BRPI0709895A2 - pharmaceutical composition - Google Patents

Abstract

PHARMACEUTICAL COMPOSITION The invention provides pharmaceutical compositions comprising single-stranded oligonucleotides, between 8 and 26 nucleobases in length, which are complementary to human microRNAs selected from the group consisting of miR19, miR21, miRi 22a. , miRi 55 and miR375. Short oligonucleotides are particularly effective in relieving miRNA repression in vivo. Incorporation of high affinity nucleotide analogs into oligonucleotides has been found to result in highly effective anti-microRNA molecules which appear to function via the formation of nearly irreversible pairs with the miRNA target rather than cleavage-based mechanisms. RNA, such as mechanisms associated with RNaseH or RISC.

Description

Report of the Invention Patent for "PHARMACEUTICAL COMPOSITION".

FIELD OF INVENTION

The present invention relates to pharmaceutical compositions comprising LNA-containing single-stranded oligonucleotides capable of inhibiting disease-inducing microRNAs, particularly miR-19b, miR-21, miR-122A, miR-155 and miR-375 microRNAs.

BACKGROUND OF THE INVENTION

Micro-RNAs - New Gene Expression Regulators

MicroRNAs (miRNAs) are an abundant class of short endogenous RNAs that act as post-transcriptional regulators of gene expression through base pairing with their target mRNAs. Mature miRNAs are sequentially processed from transcripts. longer hairpin by Drosha (Lee et al. 2003) and Dicer RNAse III ribonucleases (Hutvagner et al. 2001, Ketting et al. 2001). To date, more than 3400 miRNAs have been noted in vertebrates, invertebrates and plants according to release 7.1 of the miRBase micro-RNA database in October 2005 (Griffith-Jones 2004, Griffi-th-Jones and others 2006) and many miRNAs that correspond to putative genes have also been identified.

Most animal miRNAs recognize their target sites located on 3'-UTRs through incomplete base pairing, resulting in translational repression of target genes (Bartel 2004). A group of research shows that animal miRNAs play key biological roles in cell growth and apoptosis (Brennecke et al. 2003), hematopoietic lineage differentiation (Chen et al. 2004), life expectancy regula- tion (Boehm and Slack 2005). , fo-torreceptor differentiation (Li and Carthew 2005), homeobox gene regulation (Yekta et al. 2004, Hornstein et al. 2005), neuronal asymmetry (hnston et al. 2004), insulin secretion (Poy et al. 2004), brain morphogenesis ( Gi-raldez et al. 2005), muscle proliferation and differentiation (Chen, Mandeie et al. 2005, Kwon et al. 2005, Sokol and Ambros 2005), cardiogenesis (Zhao et al. 2005) and embryonic development in vertebrates (Wie-nholds et al. 2005) RNAs in human diseases

miRNAs are involved in a wide variety of human diseases. One is spinal muscular atrophy (SMA), a pediatric neurodegenerative disease caused by reduced protein levels or mutations that cause loss of survival function of the motor neuron gene (NMS) (Paushkin et al 2002). Recently, it has been shown that a mutation at the miR-189 target site in the human SLITRK1 gene is associated with Tourette's syndrome (Abelson et al. 2005), while another student reported that the hepatitis C virus (HCV) RNA genome interacts with with a host-cell microRNA, the liver-specific miR-122a, to facilitate its replication in the host (Jopling et al. 2005). Other diseases in which a miRNA or its processing machinery has been implicated include Fragile X Mental Retardation (FXMR) caused by the absence of Fragile X Mental Retardation Protein (FMRP) (Nelson et al. 2003, Jin et al. 2004) and DiGeorge Syndrome ( Landthaler et al. 2004).

In addition, altered miRNA expression patterns have been reported in many human cancers. For example, the human miRNAa miR15a and miR16-1 genes are deleted or down-regulated in most cases of chronic B-cell lymphocytic leukemia (CLL), where a single signature of 13 miRNA genes has recently been shown to be associated with prognosis. progression (Calin et al. 2002, Calin et al. 2005). The role of cancer miRNAs is further supported by the fact that more than 50% of human miRNA genes are located in cancer-associated genomic regions or fragile sites (Calin et al. 2004). Recently, systematic expression analysis of a diversity of human cancers has revealed a general down-regulation of miRNAs in tumors compared with normal tissues (Lu et al. 2005). Interestingly, miRNA-based classification of poorly differentiated tumors was successful, whereas mRNA profiles were highly inaccurate when applied to the same samples. It has also been shown that miRNAs are deregulated in breast cancer (lorio et al. 2005), lung cancer (Johnson et al. 2005) and colon cancer (Michael et al. 2004), whereas the miR-17-92 cluster, the which is amplified in human B-cell lymphomas and miR-155, which is over-regulated in Burkitt's lymphoma, were reported as the first human miRNA oncogenes (Eis et al. 2005, He et al. 2005). Thus, human miRNAs would not only be highly useful as biomarkers for future cancer diagnosis, but are rapidly emerging as attractive targets for disease intervention through oligonucleotide technologies.

Inhibition of miRNAs using single-stranded oligonucleotides Several oligonucleotide approaches have been reported for several oligonucleotide approaches have been reported for demiRNA inhibition.

W003 / 029459 (TuschI) claims oligonucleotides which encode miRNAs and their complement of between 18-25 long-acting nucleotides which may comprise nucleotide analogs. LNA is suggested as a possible nucleotide analog, although no LNA-containing oligo-nucleotide is disclosed. Tuschl claims that miRNA oligonucleotides can be used in therapy.

US2005 / 0182005 discloses a 24-mer 2'OMeRNA oligoribonucleotide complementary to the longer form of miR 21, which has been found to reduce miR 21-induced repression, whereas a non-equivalent DNA-containing oligonucleotide. The term 2'OMe-RNA refers to an RNA analog where there is a substitution for methyl at position 2 '(2'OMethyl).

US2005 / 0227934 (TuschI) refers to anti-comatose molecules 50% DNA residues. He also reports that anti-RNAs containing 2'OMe RNA were used against pancreatic miRNAs, but it appears that no actual oligonucleotide structure is disclosed.

US20050261218 (ISIS) claims an oligomeric compound comprising a first region and a second region, wherein at least one region comprises a modification and a portion of the oligomeric compound is targeted to a small non-coding RNA target nucleic acid in that the non-coding RNA target nucleic acid is a miRNA. Oligomeric compounds between 17 and 25 nucleotides in length are claimed. Examples refer to fully 2 'OMe PS, 21 mer and 20 mer compounds and 2'OMe gap-mer oligonucleotides objectified against a range of pre-miRNA and miRNAmaduro targets.

Boutla et al 2003 (Nucleic Acids Research 31: 4973-4980) describe the use of complementary antisense DNA oligonucleotides in 11 different miRNAs in Drosophila, as well as their use to inactivate osmiRNAs by injecting DNA oligonucleotides into demosca embryos. Of the 11 antisense DNA oligonucleotides, only 4 structures showed severe interference with normal development, while the remaining 7 oligonucleotides did not show any phenotypes, presumably because of their inability to inhibit the miRNA in question.

An alternative approach to this has been reported by Hutvagner et al. (2004) and Leaman et al. (2005), in which 2'-O-methyl antisense oligonucleotides, complementary to mature miRNA, could be used as potent and irreversible inhibitors of Short interference RNA (siRNA) and miRNA function in vitro and in vivo in Drosophila and C. elegans thereby inducing a loss of function phenotype. A shortcoming of this method is the need for high concentrations of oligonucleotide 2'-O-methyl (100 micromolar) in transfection and injection experiments, which may be toxic to the animal. This method has recently been applied to mouse studies by conjugating complementary 2'-O-methyl antisense oligonucleotides to four different cholesterol-free miRNAs for in vivo miRNA silencing (Krützfedt et al. 2005). These so-called antagonists were administered to mice via intravenous injections. Although these experiments resulted in effective silencing of endogenous miRNAs in vivo, which was found to be specific, efficient and long-lasting, a major deficiency was the need for a high dosage (80 mg / kg) of 2'-O- antagonist. Me for efficient silencing.

Inhibition of microRNAs using LNA-modified oligonucleotides has been previously described by Chan et al. Cancer Research 2005, 65 (14) 6029-6033, Lecellier et al. Science 2005, 308, 557-560, Naguibnevae et al. Nature Cell Biology 2006 8 (3), 278-84 and 0rum and others Gene 2006, (Available online February 24, 2006). In all cases, LNA-modified anti-mir oligonucleotides were complementary to all mature omicro-RNA, ie, 20-23 nucleotides in length, which prevents efficient in vivo uptake and broad biodistribution of the molecules.

Naguibneva (Naguibneva et al. Nature Cell Biology 2006 8) describe the use of an antisense DNA-LNA-DNAmixmer antisense oligonucleotide to inhibit miR-181 micro-RNA function in vitro, which is an 8 nucleotide block of LNA located in the center of the molecule flanked by 6 DNA nucleotides at the 5 'end and 9 DNA nucleotides at the 3' end, respectively. A major antisense desedesign deficiency is low in vivo stability due to low resistance. nuclease of flanking DNA ends.

Although Chan et al. (Chan et al. Cancer Research 2005.65 (14) 6029-6033), and 0rum et al. (0rum et al. Gene 2006, (Available on February 24, 2006) do not disclose the design of the anti-mir LNA molecules. -modifieds used in their study, Lecellier et al. (Lecelliere et al. Science 2005, 308, 557-560) describe the use of an antisense gap-mer LNA-DNA-LNA antisense oligonucleotide to inhibit demicro function. -RNA, in which a 4 nucleotide block of LNA is located at the 5 'end and 3' end, respectively, with a window of 13 DNA nucleotides in the center of each molecule. A major shortcoming of this antisense design is the low in vivo uptake as well as low stability due to the 13-nucleotide DNA stretch of the anti-mir oligonucleotide.

Thus, there is a need in the field for improved oligonucleotides capable of inhibiting microRNAs.

The present invention is based on the discovery that short oligonucleotides designed to bind with high affinity to miRNA targets are highly effective for alleviating repression of pormicro-RNAs in vivo.

While not wishing to be bound by any specific theory, the evidence disclosed herein indicates that the highly efficient objectification of in vivo demiRNAs is achieved by designing oligonucleotides for the purpose of forming a highly stable pair with the target miRNA in vivo. This is achieved through the use of high affinity nucleotide analogs, such as at least one LNA unit, and suitably other high affinity denucleotide analogs, such as LNA1 2'-MOE RNA from 2'-Fluoro denucleotide analogs, in a short oligonucleotide, such as 10-17 or ΙΟ-16 nucleobases. In one aspect, the goal is to generate an oligonucleotide of a length which is unlikely to form a siRNA complex (i.e. a short oligonucleotide) and with a sufficient charge of high affinity denucleotide analogs, so that the oligonucleotide adheres almost permanently to its target miRNA, effectively forming a stable and non-functional double with the target miRNA. Such designs have been found to be considerably more efficient than prior art oligonucleotides, particularly gap-mer and bloc-mer designs and oligonucleotides which have a long length, for example 20-23 mers. The term 2'-Fluoro DNA refers to a DNA analog where there is a substitution for fluorine at the 2 '(2'F) position.

The invention provides a pharmaceutical composition comprising an oligonucleotide having a length of between 8 and 17, such as 10 and 17, such as 8-16 or 10-16 nucleobase units, a pharmaceutically acceptable diluent, carrier or adjuvant, wherein at least least one of the single strand oligonucleotide nucleobase units is a high affinity nucleotide analog, such as a single stranded nucleobase unit.

Blocked Nucleic Acid (LNA) and wherein the single-stranded oligonucleotide is complementary to a group-selected human microRNA sequence consisting of human miR-19b, miR-21, miR-122A, miR-155 and miR-375.

The invention provides a pharmaceutical composition comprising an oligonucleotide having a length of 10 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence from positions two to two. seven or from positions three to eight, starting from the 3 'end of 3' acgttt 5 '(SEQ ID NO 6, 5'tttgca3'), wherein at least one, such as one, preferably at least two, such as two or three DNA units in said sequence have been replaced by their corresponding LNA unit and optionally wherein said oligonucleotide does not comprise a region of more than 7 continuous DNA units.

The invention provides a pharmaceutical composition comprising an oligonucleotide having a length of 10 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence from positions two to two. seven or from positions three to eight, starting from the 3 'end of 3' 5 'each (SEQ ID NO 7, 5' acact 3 '), wherein at least one such as one, preferably at least two such two or three DNA units in said sequence have been replaced by their corresponding LNA unit and optionally wherein said oligonucleotide does not comprise a region of more than 7 continuous DNA units.

The invention provides a pharmaceutical composition comprising an oligonucleotide having a length of 10 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence from positions two to two. seven or from positions three to eight, starting from the 3 'end of 3' ttacga 5 '(SEQ ID NO 8, 5'agcatt3'), wherein at least one such as one, preferably at least two such as two or more three DNA units in said sequence have been replaced by their corresponding LNA unit and optionally wherein said oligonucleotide does not comprise a region of more than 7 continuous DNA units.

The invention provides a pharmaceutical composition comprising an oligonucleotide having a length of 10 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence from positions two to two. seven or from positions three to eight, starting from the 3 'end of 3' acaagc 5 '(SEQ ID NO 9, 5' cgaaca 3 '), wherein at least one such as one, preferably at least two such two or three DNA units in said sequence have been replaced by their corresponding LNA unit and optionally wherein said oligonucleotide does not comprise a region of more than 7 continuous DNA units.

The invention provides a pharmaceutical composition comprising an oligonucleotide having a length of 10 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence from positions two to two. seven or from positions three to eight, starting from the 3 'end of 3' cgaata 5 '(SEQ ID NO 10, 5' ataagc3 '), wherein at least one such as one, preferably at least two such as two or more three DNA units in said sequence have been replaced by their corresponding LNA unit and optionally wherein said oligonucleotide does not comprise a region of more than 7 continuous DNA units.

High affinity nucleotide analogs are denucleotide analogs which result in an oligonucleotide which has a higher thermal stability of the pair with a complementary RNA nucleotide than the binding affinity of an equivalent DNA nucleotide. This is typically determined by measuring Tm.

No significant non-target effects are identified when using such short high affinity oligonucleotides targeted against specific miRNAs. Indeed, the evidence provided here indicates that the effects on mRNA expression are due to the presence of a complementary sequence to the targeted miRNA (primary demRNA targets) within the mRNA or secondary effects on mRNAs which are regulated by primary mRNA targets (targeting). secondary mRNA). No toxicity effects were identified, indicating no significant adverse effects other than on the target.

The invention further provides for the use of an oligonucleotide according to the invention, such as one which may form part of the pharmaceutical composition, for the manufacture of a medicament for the treatment of a medical condition or disorder associated with the presence or over -expression (over-regulation) of microRNA.

The invention further provides a method for treating a medical disorder or disorder associated with the presence or overexpression of micro-RNA comprising the step of administering a composition (such as a pharmaceutical composition) according to the invention to a person in need of treatment. .

The invention further provides a method for reducing the effective amount of a miRNA in a cell or organism comprising administering a composition (such as a pharmaceutical composition) according to the invention or a single-stranded oligonucleotide according to the invention. to the cell or organism. Effective amount reduction, in this context, refers to the reduction of functional miRNA present in the cell or organism. It is recognized that preferred oligonucleotides according to the invention may not always significantly reduce the actual amount of miRNA in the cell or organism since they typically form very stable pairs with their target miRNAs.

The invention further provides a method for reversing the depression of a miRNA target mRNA in a cell or organism comprising administering a composition (such as the pharmaceutical composition) or a single-stranded oligonucleotide according to the invention to the cell or organism. The invention further provides for the use of a single defect oligonucleotide of from 8-16, such as from 10-16 nucleobases in length, for the manufacture of a medicament for the treatment of a medical disorder or disorder associated with the presence or overexpression of the microbe. RNA.

The invention further provides a method for treating a medical disorder or disorder associated with the presence or overexpression of microRNA comprising the step of administering a composition (such as a pharmaceutical composition) comprising a single stranded oligonucleotide of 8 to 8 -16, such as between 10-16 nucleobases in length to a person in need of treatment.

The invention further provides a method for reducing the effective amount of a target miRNA (i.e., the amount of miRNA which is available to suppress target mRNAs) in a cell or organism comprising administering a composition (such as a pharmaceutical composition) comprising a ribbon oligonucleotide. between 8-16, such as 10-16 nucleobases, to the cell or organism.

The invention further provides a method for reversing repressing a target mRNA from a miRNA into a cell or organism comprising a single-stranded oligonucleotide of 8-16, such as 10-16 nucleobases or a composition comprising said oligonucleotide. to the cell or organism.

The invention further provides a method for the synthesis of a single-stranded oligonucleotide objectified against a group-selected human microRNA consisting of human miR-19b, miR-21, miR-122A, miR-155 and miR-155 microRNAs. 375, such as a single-stranded oligonucleotide described herein, said method comprising the steps of:

The. Optionally selecting a first nucleobase, containing from the 3 'end, which is a nucleotide analog, such as an LNA nucleobase.

B. Optionally, selecting a second nucleobase from the 3 'end, which is a nucleotide analog, such as a LNA.c. Selection of an aqual single-stranded oligonucleotide region corresponds to the miRNA culture region, wherein said region is as defined herein.

d. Optionally, selection of one seventh and eighth nucleobases as defined herein.

and. Optionally selecting from 1 to 10 other nucleobases which may be selected from the group consisting of nucleotides (x) and nucleotide analogs (X), such as LNA.

f. Optionally selecting a 5 'region of the single-stranded oligonucleotide as defined herein.

g. Optionally, selecting a single strand oligonucleotide terminus as defined herein.

wherein the synthesis is performed by sequential synthesis of the regions defined in steps ag, wherein said synthesis may be performed at the 3'-5 '(a to g) or 5' - 3 '(g to a) and wherein said single strand oligonucleotide is complementary to a sequence of the target miRNA.

In one embodiment, the oligonucleotide of the invention is designed not to be recruited by RISC or to mediate target RISC-targeted cleavage. Using long oligonucleotides, that is, 21 or 22 mer are considered. Particularly RNA oligonucleotides or an "analog" RNA oligonucleotide which is complementary to the target miRNA, the oligonucleotide can compete against the target mRNA for association with the RISC complex and thereby alleviate the target mRNA miRNA repression. miRNA via the introduction of an oligonucleotide which competes as a substrate for miRNA.

However, the present invention seeks to prevent such undesirable target demRNA cleavage or translational inhibition by providing oligonucleotides capable of complementing and apparently in some cases almost irreversibly binding to mature microRNA. This may result in a form of protection against degradation or cleavage (eg by RISC or RNAseH or other endo- or exo-nucleases), which may not result in a substantial or even significant reduction in miRNA (for example, as detected by Northern Blot using LNA probes) within a cell, but ensures that the effective amount of domiRNA, as measured by repression reversal analysis, is reduced considerably. Therefore, in one aspect, the invention provides oligonucleotides which are purposely designed not to be compatible with the RISC complex, but remove miRNA by oligonucleotide detection. While not wishing to be bound by a specific theory as to why the oligonucleotides of the present invention are so effective, in analogy to RNA-based oligonucleotides (or full-length oligonucleotides), it appears that oligonucleotides according to the present invention function by non-competitive inhibition. miRNA function, as they more effectively remove available omiRNA from the cytoplasm where, according to the prior art oligonucleotides, they provide an alternative substrate to miRNA, which may act as a competitor inhibitor, the efficacy of which would be more dependent on oligonucleotide concentration. cytoplasm as well as target mRNA and miRNA concentration.

While not wishing to be bound by any specific theory, another possibility that may exist with the use of approximately similar-length oligonucleotides to target miRNAs (ie, miRNA) is that oligonucleotides could form a siRNA-like pair with the target miRNA, a situation which would reduce the effectiveness of oligonucleotide. It is also possible that oligonucleotides themselves can be used as the guide tape within the RISC complex, thereby generating the possibility of RISC-directed degradation of non-specific targets, which only happens to have sufficient complementarity to the oligonucleotide guide.

By selecting short oligonucleotides to target miRNA sequences, such problems are avoided.

Short oligonucleotides which incorporate LNA are known from the reagent area, such as LNA (see, for example, W02005 / 098029 and WO 2006/069584). However, molecules designed for diagnostic and reagent use are of a very different design from that for pharmaceutical use. For example, terminal nucleobases of the reagent oligos are typically not LNA1 but DNA, and internucleoside linkages are typically other than phosphorothioate, the preferred binding for use in the oligonucleotides of the present invention. The invention therefore provides a novel class of oligonucleotides per se.

The invention further provides an oligonucleotide (single strand) as described in the context of the pharmaceutical composition of the invention, wherein said oligonucleotide comprises:

(i) at least one phosphorothioate bond and / or

(ii) at least one 3'terminal LNA unit and / or

iii) at least one terminal 5 'LNA unit.

It is preferable for most therapeutic uses for the oligonucleotide to be completely phosphorothiolated - the exception being for therapeutic oligonucleotides for use in the CNS, such as in the brain or column where phosphorothioating may be toxic and in particular. Due to the absence of nu cleases, phosphodiester bonds can be used even between consecutive DNA units. As mentioned herein, other preferred aspects of the oligonucleotide according to the invention is that the second 3 'and / or 9' and 10 '(from the 3' end) second nucleus can also be LNA.

The inventors have found that other methods for preventing RNA cleavage (such as exo-nuclease degradation in blood serum or RISC-associated cleavage of the oligonucleotide according to the invention are possible and, as such, the invention also provides an oligonucleotide of single tape which comprises:

The. one LNA unit at position 1 and 2 counting from the 3 'end and / or

B. an LNA unit at position 9 and / or 10 also from the 3 'end and / or

ç. one or two 5 'LNA units

While the benefits of these other aspects may be seen with longer oligonucleotides, such as a nucleotide up to 26 nucleobase units in length, it is considered that these features may also be used with the shorter oligonucleotides mentioned herein, such as the oligonucleotides of between. 8-17, 8-16, 10-17 or 10-16 nucleobases described herein. It is highly preferred that oligonucleotides comprise high affinity nucleotide analogs, such as those referred to herein, more preferably LNA units.

The inventors, therefore, surprisingly found that carefully designed single-stranded oligonucleotides comprising units of blocked nucleic acid (LNA) in a particular order show significant silencing of microRNAs, resulting in reduced levels of microRNAs. Hermetic binding of said oligonucleotides to the so-called culture sequence, 2-8 or 2-7 nucleotides, counting from the 5 'end of the target microRNAs, was found to be important. Nucleotide 1 of the target microRNAs is a non-matching base and is most likely hidden in an Ag 2 protein binding pouch. While not wishing to be bound by a specific theory, the present inventors find that through Selection of culture region sequences, particularly with LNA-comprising oligonucleotides, preferably LNA units in the region which is complementary to the culture region, the pair between miRNA and oligonucleotide is particularly effective in targeting miRNAs, avoiding effects other than on the target and possibly providing another feature which prevents RISC-directed miRNA function.

The inventors have surprisingly found that microRNA silencing is further intensified when LNA-modified single-deflected oligonucleotides do not contain a nucleotide at the 3 'end corresponding to such unpaired nucleotide 1. Two LNA units at the 3 'end of α-oligonucleotides of the present invention have also been found to render said oligonucleotides highly resistant to nuclease.

Further, it has been found that oligonucleotides of the invention which have at least one nucleotide analog, such as an LNA nucleotide at positions corresponding to positions 10 and 11, counting from the 5 'end of the target micro-RNA, may prevent cleavage of the oligo-nucieotides of the invention.

Accordingly, in one aspect, the invention relates to an oligonucleotide having a length of 12 to 26 nucleotides, wherein:

(i) the first nucleotide, counting from the 3 'end, is a blocked nucleic acid (LNA) unit;

ii) the second nucleotide, counting from the 3 'end, is an LNA unit; and

iii) the ninth and / or tenth nucleotides, counting from the 3 'end, are one unit of LNA.

The invention further provides oligonucleotides as defined herein for use as a medicament.

The invention further relates to compositions comprising the oligonucleotides defined herein and a pharmaceutically acceptable carrier.

As mentioned above, microRNAs are related to a number of diseases. Accordingly, a fourth aspect of the invention relates to the use of an oligonucleotide as defined herein for the manufacture of a medicament for the treatment of a disease associated with the expression of miRNAs selected from the group consisting of spinal muscular atrophy, Tourette's syndrome. , hepatitis C virus, mental retardation X fragile, DiGeorge syndrome and cancer, such as chronic lymphocytic leukemia, breast cancer, lung cancer and colon cancer, in particular cancer.

Another aspect of the invention is a method for reducing target microRNA levels by contacting the target microRNA with an oligonucleotide as defined herein, wherein the oligonucleotide:

1. is complementary to the target microRNA,

2. does not contain a 3 'end nucleotide which corresponds to the first 5' end nucleotide of the target micro-RNA.

The invention further provides an oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 25, SEQ ID NO 28 , SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, and SEQ ID NO: 89; wherein a lower case letter identifies the nitrogenous base of a DNA unit and a capital letter identifies the nitrogenous base of an LNA unit; and wherein the LNA cytosines are optionally methylated or a conjugate thereof.

The invention further provides an oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 17 , SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO 100, and SEQ ID NO 101; where a lowercase letter identifies a nitrogenous base of a DNA unit and a capital letter identifies a nitrogenous base of a LNA unit; and wherein the LNA cytosines are optionally methylated or a conjugate thereof.

The invention further provides an oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 35. SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 102, SEQ ID NO 103, SEQ ID NO 104, and SEQ ID NO 105; wherein a lower case letter identifies the nitrogen base of a DNA unit and a upper case letter identifies the nitrogen base of an LNA unit; and wherein the LNA cytosines are optionally methylated or a conjugate thereof.

The invention further provides an oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 53. SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 106, SEQ ID NO 107, SEQ ID NO 108 and SEQ ID NO 109; wherein a lower case letter identifies the nitrogen base of a DNA unit and a upper case letter identifies the nitrogen base of an LNA unit; and wherein the LNA cytosines are optionally methylated or a conjugate thereof.

The invention further provides an oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, and SEQ ID NO 69, SEQ ID NO 38, SEQ ID NO. 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, and SEQ ID NO 46, wherein a lowercase letter identifies the nitrogenous base of a DNA unit. and a capital letter identifies the nitrogenous base of an LNA unit; and wherein the LNA cytosines are optionally methylated or a conjugate thereof.

In one embodiment, the oligonucleotide may have a nucleobase sequence of between 1-17 nucleobases, such as 8, 9, 10, 11, 12, 13,14, 15, 16 or 17 nucleobases and, as such, the oligonucleobase. in such modality it may be a continuous sub-sequence within the oligonucleotides disclosed herein.

The inventors of the present invention have surprisingly found that antisense oligonucleotides of a given length comprising a particular central DNA sequence and blocked nucleic acids (LNAs) in said central sequence exhibit superior microinhibition properties. RNA.BREVE DESCRIPTION OF DRAWINGS

Fig. 1. The effect of treatment with different LNA anti-miR oligonucleotides on target nucleic acid expression in the miR-122a cell line expressing Huh-7. DemiR-122a amounts (arbitrary units) derived from a miR-122a-specific qRT-PCR as compared to untreated cells (placebo) are shown. LNA anti-miR oligonucleotides were used at two concentrations, 1 and 100 nM, respectively. Also included is a combination control (SPC3350) to SPC3349 (also referred to here as SPC3549).

Fig. 2a. Anti-miR-122a knock-down dose response evaluation of LNA for SPC3548 and SPC3549 compared to SPC3372 inventive mouse livers using miR-122a real-time RT-PCR.

Fig. 2b. Levels of mouse miR-122 after treatment with different LNA-antimiRs. LNA-antimiR5 molecules SPC3372 and SPC3649 were administered to normal mice by three i.p. yes, no day for a period of six days at the indicated doses and were sacrificed 48 hours after the last dose. Total RNA was extracted from mouse livers and miR-122 was measured by miR-122-specific qPCR.

Fig. 3. Evaluation of plasma cholesterol levels in LNA-anti-R-122a treated mice compared to control mice receiving saline.

Fig. 4a. Evaluation of relative Bckdk mRNA levels in mice treated with antimiR-122a LNA compared to saline control mice using quantitative RT-PCR in real time.

Fig 4b. Evaluation of relative aldolase A mRNA levels in mice treated with antimiR-122a LNA compared to saline control mice using quantitative RT-PCR in real time.

Fig 4c. Evaluation of GAPDH mRNA levels in antimiR-122a LNA-treated mice (animals 4-30) compared to saline control mice (animals 1-3) using quantitative real-time RT-PCR.

Fig. 5. Evaluation of LNA-antimiR® -122a knock-down dose response in vivo in mouse livers using real-time RT-PCR from miR-122a. Six groups of animals (5 mice per group) were treated as follows. Group 1 animals were injected with 0.2 ml saline via iv on 3 successive days, Group 2 received 2.5 mg / kg SPC3372, Group 3 received 6.25 mg / kg, Group 4 received 12.5 mg / kg and Group 5 received 25 mg / kg, while Group 6 received 25 mg / kg SPC 3373 (mismatched LNA-antimiR® oligonucleotide), all in the same manner. The experiment was repeated (therefore η = 10) and the combined results are shown.

Fig. 6. Northern blot comparing SPC3649 with SPC3372. Total RNA from one mouse in each group was subjected to miR-122-specific Northern blot. mature and double miR-122 (blocked micro-RNA) formed between LNA-antimiR and miR-122 are indicated.

Fig. 7. Mice were treated with 25 mg / kg / day LNA-antimiR or saline for three consecutive days and sacrificed1, 2 or 3 weeks after the last dose. Also included are the values of animals sacrificed 24 hours after the last dose (example 11 "anti-go design"). The miR-122 levels were assessed by qPCR and normalized to the mean saline group at each individual time point. Also included are the values of animals sacrificed 24 hours after the last dose (shown as mean and SD, η = 7, 24h η = 10). Day 9, 16 or 23 sacrifice corresponds to sacrifice 1, 2 or 3 weeks after the last dose).

Fig. 8. Mice were treated with 25 mg / kg / day LNA-antimiR or saline for three consecutive days and sacrificed1, 2 or 3 weeks after the last dose. Also included are the values of animals sacrificed 24 hours after the last dose (Example 11 "anti-go design"). Plasma cholesterol was measured and normalized to the saline group at each time point (shown as mean and SD, η = 7, 24h (η = 10).

Fig. 9. Dose-dependent induction of target miR-122a by SPC3372 inhibition of miR-122a. Mice were treated with different doses of SPC3372 for three consecutive days as described above and sacrificed 24 hours after the last dose. Total RNA extracted from the liver was subjected to qPCR. Genes with a predicted miR-122 target site and observed to be over-regulated by microarray analysis were investigated for dose-dependent induction through dose escalation of SPC3372 using qPCR. Total liver RNA from 2 to 3 mice per group sacrificed 24 hours after the last dose was submitted to qPCR for the indicated genes. Figure 9 shows the mRNA levels for the saline group, η = 2-3 (2.5 - 12.5 mg / kg / day: η = 2, without SD). Also shown is mismatch control (mm, SPC3373)

Fig. 10. Transient induction of target miR-122a mRNAs after SPC3372 posttreatment. Female NMRI mice were treated with 25 mg / kg / day of SPC3372 along with a saline control for three consecutive days and sacrificed 1, 2, or 3 weeks after the last dose. RNA was extracted from the livers and predicted mRNA mRNA levels demiR Target cells, selected from microarray data, were investigated using qPCR. Three animals from each group were analyzed.

Fig. 11. Induction of Vldlr in liver by treatment with SCPC3372. The same liver RNA samples as in the previous example (Figure 10) were investigated for Vldlr induction.

Fig. 12. Stability of the miR-122a / SPC3372 double in the mouse plasmid. The stability of SPC3372 and SPC3372 / miR-122 was tested in mouse plasma at 37 ° C for 96 hours. Shown in figure 12 is a PAGE stained with SYBR-Gold.

Fig. 13. Capture of mature miR-122a by SPC3372 leads to pair formation. Shown in Figure 13 is a membrane hybridized with a miR-122a-specific probe (upper panel) and rehybridized with a Let-7-specific probe (lower panel). With the miR-122 probe, two bands could be detected, one corresponding to the mature miR-122 and one corresponding to a double between SPC3372 and miR-122.

Fig. 14. Capture of miR-122a by SPC3372 together with SPC3372 distribution assessed by in situ hybridization of liver sections. Liver cryosections of treated animals were.

Fig. 15. Gene expression in liver in LNA-anti-miR-122 treated mice. Mice treated with eLNA-antimiR saline were compared by wide-pressure profiling characterization in genome using Affymetrix Mouse Genome 4302.0 arrays. (a, 1) Shown are the number of probes that showed different expression in liver samples of LNA-antimiR-122 and saline treated mice 24 hours after treatment. (b, 2) The occurrence of miR-122 culture sequence in differentially expressed genes. The plot shows the percentage of transcripts with at least one miR-122 culture recognition sequence in their 3 'UTR. Random: Random sequences were generated and surveys were performed for miR-122 culture reknowledge sequences. Gene expression profiles in temporal livers in LNA-antimiR treated mice. Mice were treated with 25 mg / kg / day LNA-antimiR or saline for three consecutive days and sacrificed 1, 2 or 3 weeks after the last dose. Also included are the values of animals sacrificed 24 hours after the last dose. (c, 3) RNA samples from different time points were also subjected to expression profile characterization. Hierarchical cluster analysis of gene expression profiles identified as differentially expressed between LNA-antimiR treated mice and saline 24 hours, one week or three weeks post-treatment. (d, 4) Gene expression profiles identified as differentially expressed between mice treated with LNA-antimiR and saline 24 hours post-treatment were followed over time. Expression ratios and overregulated genes in LNA-antimiR-treated mice approach 1 in most of the time course, indicating a reversible effect of LNA-antimiR treatment.

Fig. 16. The effect of treatment with SPC3372 and 3595 on miR-122 levels in mouse livers.

Fig. 17. The effect of treatment with SPC3372 and 3595 on Aldolase A levels in mouse livers.

Fig. 18. The effect of treatment with SPC3372 and 3595 on Bckdk levels in mouse livers.

Fig. 19. The effect of treatment with SPC3372 and 3595 on CD320 levels in mouse livers.

Fig. 20. The effect of treatment with SPC3372 and 3595 on Ndrg3 levels in mouse livers.Fig.21. The long-term treatment effect with SPC3649 on total plasma cholesterol in abnormal hypercholesterolemic mice. Weekly blood plasma samples were obtained from saline-treated and SPPC3649-treated control mice once a week, followed by evaluation of total plasma cholesterol. Mice were treated with 5 mg / kg SPC3649, SPC3744 or saline twice weekly. Normal mice were treated in parallel.

Fig.22. The long-term effect of treatment with SPC3649 on miR-122 levels in normal and hypercholesterolemic mice.

Fig. 23. The long-term effect of SPC3649 treatment on Aldolase A levels in hypercholesterolemic and normal mice.

Fig. 24. The long-term effect of SPC3649 treatment on Bckdk levels in hypercholesterolemic and normal mice.

Fig. 25. The long-term effect of treatment with SPC3649 on AST levels in hypercholesterolemic and normal mice.

Fig. 26. The long-term effect of treatment with SPC3649 on ALT levels in normal and hypercholesterolemic mice.

Fig. 27. Modulation of HCV replication by SPC3649 in a Huh-7 cell model. Northern blot analysis of HCV RNA in Huh-7 cells after transfection with different LNA-antimiR molecules (SPC3648, SPC3649 and SPC3550) and 2 "antago-mir-122 OMe (top panel). Hybridization signal intensities were quantified and normalized for the spectrin mRNA signals in each row (bottom panel).

Fig. 28. Reversal of functional target repression of Renilluconase with target miR-19b across miR-19b blocking oligonucleotides in an endogenously miR-19b expressing cell line, HeLa. "target miR-19b" is the target miR-19b plasmid, but not co-transfected with the miR-19b blockade, and therefore represents fully miR-19b-suppressed Renilla deluciferase expression.

Fig. 29. Reversal of Renill Iuciferase functional repression with the target miR-122 through miR-122 blocking oligonucleotides in an endogenously expressing miR-122 cell line, "target miR-122" is the corresponding plasmid with target miR-122, but not transfected with the blocking oligo miR-122 and, consequently, represents fully suppressed miR-122 expression of Renilla Iuciferase.

Fig. 30. Diagram illustrating the alignment of an oligonucleotide according to the invention and a target microRNA.

DETAILED DESCRIPTION OF THE INVENTION

The oligonucleotide of the invention is typically single stranded. Therefore, it should be understood that, within the context of the invention, the term oligonucleotide may be used interchangeably with the term single stranded oligonucleotide.

In one embodiment, the invention provides pharmaceutical compositions comprising short (single-stranded) oligonucleotides, between 8 and 17 nucleobases in length, such as between 10 and 17 nucleobases in length, which are complementary to human micro-RNAs. . Short oligonucleotides are particularly effective for relieving miRNA repression in vivo. Incorporation of high affinity nucleotide analogs into oligonucleotides results in highly effective anti-micro-RNA molecules which appear to function via the formation of nearly irreversible pairs with the target miRNA rather than mechanisms based on RNA cleavage, such as mechanisms associated with RNaseH or RISC.

It is highly preferred that the single stranded oligonucleotide according to the invention comprises a continuous nucleobase sequence region which is 100% complementary to the human microRNA culture region.

It is preferred that the single stranded oligonucleotide according to the invention be complementary to the mature human microRNA sequence.

Preferred oligonucleotides according to the invention are complementary to a microRNA sequence selected from the group consisting of has-miR19b, hsa-miR21, hsa-miR 122, hsa-miR 142 a7b, hsa-miR 155, hsa-miR 375 .

In one embodiment, the oligonucleotide according to the invention does not comprise a 3 'end nucleobase that corresponds to the first nucleotide at the 5' end of the target microRNA.

In one embodiment, the first nucleobase of the single-stranded oligonucleotide according to the invention, counting from the 3 'end, is a nucleotide analog, such as an LNA moiety.

In one embodiment, the second nucleobase of the single-stranded oligonucleotide according to the invention, counting from the 3 'end, is a nucleotide analog, such as an LNA moiety.

In one embodiment, the ninth and / or tenth nucleotides of the single-stranded oligonucleotide according to the invention, counting from the 3 'end is a nucleotide analog, such as an LNA moiety.

In one embodiment, the ninth nucleobase of the single-defined oligonucleotide according to the invention, counting from the 3 'end is a nucleotide analog, such as an LNA moiety.

In one embodiment, the tenth nucleobase of the single-stranded oligonucleotide according to the invention, counting from the 3 'end, is a nucleotide analog, such as an LNA moiety.

In one embodiment, the ninth and tenth nucleobases of the single-stranded oligo-nucleotide according to the invention, calculated from the 3 'end is a nucleotide analog, such as a deLNA unit.

In one embodiment, the single-stranded oligonucleotide according to the invention does not comprise a region of more than 5 consecutive nu-cleotide DNA units. In one embodiment, the single defect oligonucleotide according to the invention does not comprise a region of more than 6 consecutive DNA nucleotide units. In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 7 consecutive DNA nucleotide units. In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 8 consecutive DNA nucleotide units. In one embodiment, the single-stranded oligonucleotide according to the invention does not comprise a region of more than 3 consecutive denucleotide DNA units. In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 2 consecutive DNA nucleotide units.

In one embodiment, the single-stranded oligonucleotide comprises at least one region consisting of at least two consecutive nucleotide analog units, such as at least two consecutive LNA units.

In one embodiment, the single-stranded oligonucleotide comprises at least one region consisting of at least three consecutive nucleotide analog units, such as at least three consecutive LNA units.

In one embodiment, the single-stranded oligonucleotide of the invention does not comprise a region of more than 7 consecutive nu-cleotide analog units, such as consecutive LNA units. In one embodiment, the single-stranded oligonucleotide of the invention does not comprise a region of more than 6 consecutive nucleotide analog units, such as consecutive LNA units. In one embodiment, the single-stranded oligonucleotide of the invention does not comprise a region of more than 6 consecutive nucleotide analog units. 5 consecutive nucleotide analog units, such as consecutive LNA units. In one embodiment, the invention single-stranded oligonucleotide does not comprise a region of more than 4 consecutive denucleotide analog units, such as consecutive LNA units. In one embodiment, the single-stranded oligonucleotide of the invention does not comprise a region of more than 3 consecutive nucleotide analog units, such as consecutive LNA units. In one embodiment, the single-stranded oligonucleotide of the invention does not comprise a region of more than 2 consecutive nucleotide analog units, such as consecutive LNA units.

In one embodiment, the first or second 3 'nucleobase of the single stranded oligonucleotide corresponds to the second 5' nucleotide of the microRNA sequence.

In one embodiment, nucleobase units 1 through 7 (inclusive) of the single-stranded oligonucleotide as measured from the 3 'end of the single-stranded oligonucleotide region are complementary to the microRNA culture region sequence. .

In one embodiment, nucleobase units 2 to 7 (inclusive) of the single-stranded oligonucleotide as measured from the 3 'end of the single-stranded oligonucleotide region are complementary to the microRNA culture region sequence. .

In one embodiment, the single-stranded oligonucleotide comprises at least one nucleotide analog unit, such as at least one LNA unit, at a position which is within the region complementary to the miRNA culture region. The single stranded oligonucleotide may, in one embodiment, comprise from 1 to 6 or from 1 to 7 nucleotide analog units, such as from 1 to 6 and 1 to 7 DNA units, at a position which is within the region complementary to the miRNA culture region.

In one embodiment, the single-stranded oligonucleotide nucleobase sequence which is complementary to the micro-RNA culture region sequence is selected from the group consisting of (X) Xxxxxx, (X) xXxxxx, (X) xxXxxx, ( X) xxxXxx, (X) xxxxXx and (X) xxxxxX, as read in a 3 '- 5' direction, where "X" denotes a nucleotide analog, (X) denotes an optional nucleotide analog, such as a LNA unit, and "x" denotes a nucleotide unit of DNA or RNA.

In one embodiment, the single-stranded oligonucleotide comprises at least two nucleotide analog units, such as at least two LNA units, at positions which are complementary to the miRNA culture region.

In one embodiment, the single-stranded oligonucleotide nucleobase sequence which is complementary to the micro-RNA culture region sequence is selected from the group consisting of (X) XXxxxx, (X) XxXxxxi (X) XxxXxx, ( (X) ) χχχΧχΧ and (Χ) χχχχΧΧ, where "Χ" denotes a nucleotide analog, such as an LNA unit, (X) denotes an optional nucleotide analog, such as an LNA unit, and "x" denotes a nucleotide unit. nucleotide of DNA or RNA.

In one embodiment, the single-stranded oligonucleotide comprises at least three nucleotide analog units, such as at least three LNA units, at positions which are complementary to the miRNA culture region.

In one embodiment, the single-stranded oligonucleotide nucleobase sequence which is complementary to the micro-RNA culture region sequence is selected from the group consisting of (X) XXXxxx, (X) xXXXxx, (X) xxXXXx, (X) xxxXXX, (X) XXxXxx, (X) XXxxXx, (X) XXxxxX, (X) xXXxXx, (X) xXXxxX, (X) xxXXxX, (X) XxXXxx, (X) XxxXXx, (X) XxxxXX, (X) xXxXXx, (X) xXxxXX, (X) xxXxXX, (X) xXxXxX and (X) XxXxXx, where "X" denotes a nucleotide analog, such as an LNA moiety, (X) denote one optional nucleotide analog, such as an LNA moiety, and "x" denotes a DNA or RNA nucleotide moiety.

In one embodiment, the single-stranded oligonucleotide comprises at least four nucleotide analog units, such as at least four LNA units, at positions which are complementary to the miRNA culture region.

In one embodiment, the single-stranded oligonucleotide nucleobase sequence which is complementary to the micro-RNA culture region sequence is selected from the group consisting of (X) xxXXX, (X) xXxXXX, (X) xXXxXX, ( X) xXXXxX, (X) xXXXXx, (X) XxxXXXX, (X) XxXxXX, (X) XxXXxX, (X) XxXXx, (X) XXxxXX, (X) XXxXxX, (X) XXxXXx, (X) XXXxxX, ( X) XXXxXx, and (X) XXXXxx, where "X" denotes a nucleotide analog, such as an LNA moiety, (X) denotes an optional nucleotide analog, such as an LNA moiety, and "x" denotes a DNA or RNA nucleotide unit. In one embodiment, the single-stranded oligonucleotide comprises at least five nucleotide analog units, such as at least five LNA1 units at positions which are complementary to the miRNA culture region.

In one embodiment, the nucleobase sequence of the single stranded oligonucleotide which is complementary to the sequence of the micro-RNA culture region is selected from the group consisting of (X) xXXXXX, (X) XxXXXX, (X) XXxXXX, (X) XXXxXX, (X) XXXXxX and (X) XXXXXx, where "X" denotes a nucleotide analog, such as an LNA1 (X) moiety, has an optional nucleotide analog, such as an LNA moiety , and "x" denotes a nucleotide unit of DNA or RNA.

In one embodiment, the single-stranded oligonucleotide comprises at least six nucleotide analog units, such as at least six LNA units, at positions which are complementary to the miRNA culture region.

In one embodiment, the single-stranded oligonucleotide nucleobase sequence which is complementary to the micro-RNA culture region sequence is selected from the group consisting of XXXXXX, XxXXXXX, XXxXXXX, XXXxXXX, XXXXxXX, XXXXXxX, and XXXXXXx. that "X" denotes a nucleotide analog, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

In one embodiment, the two nucleobase motifs at positions 7 to 8, counting from the 3 'end of the single-stranded oligonucleotide are selected from the group consisting of xx, XX, xX and Xx, where "X" denotes an analog. nucleotide, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA nucleotide unit orRNA.

In one embodiment, the two nucleobase motifs at positions 7 to 8, counting from the 3 'end of the single-stranded oligonucleotide are selected from the group consisting of XX, xX and Xx, where "X" is an analog. nucleotide, such as an LNA moiety, such as an LNA moiety, and "x" denotes a DNA or RNA nucleotide moiety. In one embodiment, the single-stranded oligonucleotide comprises at least 12 nucleobases and in which both motifs nucleobase at positions 11 to 12, counting from the 3 'end of the single defined oligonucleotide is selected from the group consisting of xx, XX, xX and Xx, where "X" denotes a nucleotide analog, such as an LNA moiety, such as one unit of LNA, and "x" denotes a nucleotide unit of DNA or RNA.

In one embodiment, the single-stranded oligonucleotide comprises at least 12 nucleobases and wherein the two nucleobase motifs in positions 11 to 12, counting from the 3 'end of the single-stranded oligonucleotide are selected from the group consisting of XX, xX and Xx, where "X" denotes a nucleotide analog, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA nucleotide unit orRNA.

In one embodiment, the single-stranded oligonucleotide comprises at least 13 nucleobases and wherein the three nucleobase motifs in positions 11 to 13, counting from the 3 'end, are selected from the group consisting of xxx, Xxx, xXx, xxX, XXx, XxX, xXX, and XXX, wherein "X" denotes a nucleotide analog, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA nucleotide unit orRNA.

In one embodiment, the three nucleobase motifs at positions 11 through 13, counting from the 3 'end of the single-stranded oligonucleotide, are selected from the group consisting of Xxx, xXx, xxX, XXx, XxX, xXX and XXX. "X" denotes a nucleotide analog, such as an LNA moiety, such as an LNA moiety, and "x" denotes a DNA or RNA nu-cleotide moiety.

In one embodiment, the single-stranded oligonucleotide comprises at least 14 nucleobases and wherein the four nucleobase motifs at positions 11 through 14, counting from the 3 'end, are selected from the group consisting of xxxx, Xxxx, xXxx, xxXx, xxxX, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, and xxx where "x" denotes a nucleotide analog, such as an LNA1 unit such as an LNA unit, and "x" denotes a nucleotide unit of DNA or RNA.

In one embodiment, the four nucleobase motifs in positions 11 through 14 of the single-stranded oligonucleotide, counting from the 3 'end, are selected from the group consisting of Xxxx1 xXxx, xxXx, xxxX, XXxx, XxXx, XxxX , xXXx, xXxX, xxXX, XXXx, XxXX, xXXX, XXxX, and XXXX, where "X" denotes a nucleotide analog, such as a LNA unit, and "x" denotes a nucleotide unit of DNA or RNA.

In one embodiment, the single-stranded 15-nucleobase oligonucleotide and the five nucleobase motifs at positions 11 through 15, counting from the 3 'end, are selected from the group consisting of Xxxxx, xXxxx, xxXxx, xxxXx, xxxxX, XXxxx , Xxxxx, xxxxx, xxxxxl xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxx, xxota "xxx" nucleotide analog, such as an LNA moiety, such as an LNA moiety, and "x" denotes a DNA or RNA nu-cleotide moiety.

In one embodiment, the 16-nucleobase single-stranded oligonucleotide and the six nucleobase motifs at positions 11 through 16, counting from the 3 'end, are selected from the group consisting of Xxxxxx, xXxxxx, xxXxxx, xxxXxx, xxxxXx, xxxxxX , Xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx , xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxx, xxxxx, xxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxx, xxxxxxxxxxxxxxxxxxxxxxxxxxxx , xXXXXX, XxXXXX, XXxXXX, XXXxXX, XXXXxX, XXXXXx, and XXXXXX where "X" denotes a nucleotide analog, such as an LNA unit, such as an LNA unit, and "x" denotes a nucleotide unit of DNA or RNA.

In one embodiment, the six nucleobase motifs at positions 11 to 16 of the single-stranded oligonucleotide, counting from the 3 'end, is xxXxxX, where "X" denotes a nucleotide analog, such as a unit of LNA1 such as an LNA1 unit and "x" denotes a DNA or RNA nucleotide unit.

In one embodiment, the three plus 5 'nucleobases are selected from the group consisting of Xxx, xXx, xxX, XXx, XxX, xXX and XXX, where "X" denotes a nucleotide analog, such as an LNA unit, such as as a unit of LNA1 and "x" denotes a nucleotide unit of DNA or RNA.

In one embodiment, x "denotes a DNA unit.

In one embodiment, the single-stranded oligonucleotide comprises a nucleotide analog unit, such as an LNA unit, at the 5 'end.

In one embodiment, the nucleotide analog units, such as X, are independently selected from the group consisting of: 2'-O-alkyl RNA unit, 2'-OMe-RNA unit, 2'-amino-DNA unit , 2'-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit.

In one embodiment, all nucleobases of the single-stranded oligonucleotide of the invention are nucleotide analog units.

In one embodiment, the nucleotide analog units, such as X, are independently selected from the group consisting of: 2'-OMe-RNAs unit, 2'-fluoro-DNAs unit, and LNA units,

In one embodiment, the single-stranded oligonucleotide comprises said at least one LNA analog unit and at least one other non-LNA nucleotide analog unit.

In one embodiment, the denam-LNA nucleotide analog unit is independently selected from 2'-OMe RNA units and 2'-fluoro DNA units.

In one embodiment, the single-stranded oligonucleotide consists of at least one XYX or YXY sequence, where X is LNA and Y is a 2'-OMe RNA unit and a 2'-fluoro DNA unit. Single-stranded oligonucleotide nucleobases consist of alternating XeY units.

In one embodiment, the single-stranded oligonucleotide comprises alternate (Xx) or (xX) LNA and DNA units.

In one embodiment, the single-stranded oligonucleotide comprises an alternate LNA motif, followed by 2 DNA units (Xxx), xXxor xxX.

In one embodiment, at least one DNA or non-LNA DNA nucleotide analog unit is replaced by an LNA nucleobase at a position selected from positions identified as LNA nucleobase units in any of the above-mentioned embodiments.

In one embodiment, "X" denotes an LNA unit.

In one embodiment, the single-stranded oligonucleotide comprises at least 2 nucleotide analog units, such as at least 3 nucleotide analog units, such as at least 4 nucleotide analog units, such as at least 5 nucleotide analog units. nu-cleotide, such as at least 6 nucleotide analog units, such as at least 7 nucleotide analog units, such as at least 8 nucleotide analog units, such as at least 9 nucleotide analog units, such as at least 10 denucleotide analog units.

In one embodiment, the single-stranded oligonucleotide comprises at least 2 LNA units, such as at least 3 LNA units, such as at least 4 LNA units, such as at least 5 LNA units, such as at least 6 LNA units, such as at least 7 LNA units, such as at least 8 LNA units, such as at least 9 LNA units, such as at least 10 LNA units.

In an embodiment wherein at least one of the nucleotide analogs, such as LNA units, is cytosine or guanine, such as between 1-10 of the nucleotide analogs, such as LNA units, is cytosine or guanine, such as 2, 3, 4, 5, 6, 7, 8, or 9 of the nucleotide analogs, such as LNA units, is cytosine or guanine.

In one embodiment at least two of the nucleotide analogs such as LNA units is cytosine or guanine. In one embodiment at least three of the nucleotide analogs such as ectosine or guanine LNA units. In one embodiment at least four of the nucleotide analogs such as LNA units is cytosine or guanine. In one embodiment at least five of the nucleotide analogs such as LNA units are cytosine or guanine. In one embodiment at least six of the nucleotide analogs such as LNA units is cytosine or guanine. In one embodiment at least seven of the nucleotide analogs such as LNA units is cytosine or guanine. In one embodiment at least eight of the nucleotide analogs such as LNA units is cytosine or guanine.

In a preferred embodiment, the nucleotide analogs have a high thermal stability of the double to a complementary RNA than to the binding affinity of a DNA nucleotide equivalent to said complementary RNA nucleotide.

In one embodiment, nucleotide analogs confer enhanced serum stability to the single-stranded oligonucleotide.

In one embodiment, the single-stranded oligonucleotide forms an A-helix conformation with a complementary single-stranded RNA molecule.

A pair between two RNA molecules typically exists in an A-shape conformation, where a pair between two DNA molecules typically exists in a B-shape conformation. A pair between a DNA and RNA molecule exists, typically in an intermediate conformation (A / B form). The use of nucleotide analogs such as beta-D-oxide LNA can be used to promote conformation similar to A-shape. Standard circular dichroisms (CD) or NMR analysis is used to determine the doubling between the inventive oligonucleotides and molecules of the invention. Complementary RNA.

Since recruitment by the RISC complex is believed to be dependent on the specific structural conformation of the target miRNA / mRNA, oligonucleotides according to the present invention may in one embodiment form a double A / B- with a complementary RNA molecule.

However, it has also been found that the use of nu-cleotide analogs which promote A-form structure may also be effective, such as the alpha-L isomer of LNA.

In one embodiment, the single stranded oligonucleotide forms an A / B-form conformation with a complementary single stranded RNA molecule.

In one embodiment, the single-stranded oligonucleotide forms an A-form conformation with a complementary single-stranded RNA molecule.

In one embodiment, the single-stranded oligonucleotide according to the invention does not mediate RNAseH-based cleavage of a complementary single-stranded RNA molecule. Typically, a portion of at least 5 (typically not effective RNAseH recruitment), more preferably at least 6, more preferably at least 7 or 8 consecutive DNA nucleobases (or alternating nucleobases which may be recruited). RNAseH, such as alpha L-amino LNA) are required so that a oligonucleotide is effective in RNAseH recruitment.

EP 1,222,309 provides in vitro methods for determining RNAseH activity which can be used to determine the ability to recruit RNAaseH. A compound is considered capable of reproducing RNAseH if, when supplied with the complementary target RNA, it elects an initial rate, as measured pmol / l / min, of at least 1%, such as at least 5%, such as at least 10%. % or less than 20% of oligonucleotide equivalent DNA, without 2 'substitutions with phosphorothioate linking groups among all nucleotides in the oligonucleotide, using the methodology provided by Example 91 - 95 of EP 1 222 309.

A compound is considered unable to recruit RNaseH when supplied with complementary target RNA, it has an initial rate, as measured pmol / l / min, of less than 1%, such as less than 5%, such as 10% or less than 20% of the initial rate determined using the equivalent DNA oligonucleotide only, without 2 'substitutions, with phosphorothioate linking groups among all nucleotides in the oligonucleotide using the methodology provided by Example 91 -. 95 of EP 1,222,309.

In a highly preferred embodiment the single deflected oligonucleotide of the invention is capable of pairing with a complementary single-stranded RNA nucleic acid molecule (typically about the same length as said single-stranded oligonucleotide) with phosphodiester internucleoside linkages. whereas the pair has a Tm of at least about 60 ° C; in fact, it is preferred that the single stranded oligonucleotide is capable of pairing with a complementary single stranded RNA nucleic acid molecule with phosphodiester-internucleoside linkages, wherein the pair has a Tm of from about 70 ° C to about 70 ° C. 95 ° C, such as a Tm of from about 70 ° C to about 90 ° C, such as about 70 ° C to about 85 ° C.

In one embodiment, the single-stranded oligonucleotide is capable of pairing with a single-stranded single-stranded DNA nucleic acid molecule with phosphodiester internucleoside linkages, wherein du-pLa has a Tm of from about 50 ° C to about 95 ° C. ° C, such as about 50 ° C to about 90 ° C, such as at least about 55 ° C, such as at least about 60 ° C or not more than about 95 ° C.

The single stranded oligonucleotide may, in one embodiment, have a length of between 14-16 nucleobases, including 15 nucleobases.

In one embodiment, the LNA unit or units are independently selected from the group consisting of oxide-LNA, thio-LNA, eamino-LNA, D-β configuration, and L-a or combinations thereof.

In a specific embodiment, the LNA units may be a β nucleobase.

In one embodiment, the LNA units are beta Doxy-LNA.

In one embodiment, the LNA units are alpha-L aminoLNA. In a preferred embodiment, the single-stranded oligonucleotide comprises between 3 and 17 LNA units.

In one embodiment, the single-stranded oligonucleotide comprises at least one internucleoside linking group which differs from phosphate.

In one embodiment, the single-stranded oligonucleotide comprises at least one phosphorothioate internucleoside linkage.

In one embodiment, the single-stranded oligonucleotide comprises phosphodiester and phosphorothioate linkages.

In one embodiment, all internucleoside bonds are phosphorothioate bonds.

In one embodiment, the single-stranded oligonucleotide comprises at least one phosphodiester internucleoside bond.

In one embodiment, all internucleoside bonds of the single-stranded oligonucleotide of the invention are phosphodiester bonds.

In one embodiment, a pharmaceutical composition according to the invention comprises a carrier, such as saline or buffered saline solution.

In one embodiment, the method for synthesizing single stranded oligonucleotide targeting a human microRNA is performed 3 'to 5' at -f.

The method for synthesizing the single stranded oligonucleotide according to the invention may be carried out using standard solid phase oligonucleotide synthesis.

Other embodiments of the invention which may be combined with the above embodiments are shown in the claims and under the heading Other Modalities ".

Definitions

The term 'nucleobase' refers to nucleotide, such as DNA eRNA, and nucleotide analogs.

The term "oligonucleotide" (or simply "oligo") refers, in the context of the present invention, to a molecule formed by covalently linking two or more nucleobases when used in the context of the single stranded oligonucleotide (also referred to as single strand oligonucleotide). ), the term "oligonucleotide" may have, in one embodiment, for example, between 8-26 nucleobases, such as between 10 and 26 nucleobases, such as between 12 and 26 nucleobases. In a preferred embodiment, as detailed herein, the oligonucleotide of the invention has a length of between 8-17 nucleobases, such as between 20 -27 nucleobases such as between 8-16 nucleobases, such as between 12-15 nucleobases.

In such an embodiment, the oligonucleotide of the invention may have a length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25 or 26 nucleobases. .

It will be appreciated that for shorter oligonucleotides it may be necessary to increase the proportion of nucleotide analogs (high affinity) such as LNA. Therefore, in one embodiment at least about 30% of the nucleobases are nucleotide analogs, such as at least about 33%, such as at least about 40%, or at least about 50% or at least about 60%, such as at least about 66%, such as at least about 70%, such as at least about 80%, or at least about 90%. It will also be apparent that the oligonucleotide may comprise a nucleobase sequence which consists solely of nucleotide analog sequences.

Here, the term "nitrogenous base" is intended to include pyrimidine purinase, such as DNA nucleobases A, C, T, and G, RNA nucleobases A, C, U, and G, as well as non-DNA / RNA nucleobases, such as 5-methylcytosine (MeC), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propynyl-6-fluoroluracil, 5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7 -propino-7-deazaadenine, 7-propino-7-deazaguanine and 2-chloro-6-aminopurine, in particular MeC. It will be understood that the actual selection of non-DNA / RNA nucleobases will depend on the corresponding nucleotide (or equivalent) present on the micro-RNA strip, which is the desired oligonucleotide to target. For example, where the corresponding nucleotide is G, it will normally be necessary to select a non-DNA / RNA nucleobase that is capable of establishing hydrogen bonds to G. In this specific case, where the corresponding nucleotide is G A typical example of a non-DNA / RNA nu-cleobase is MeC.

The term "internucleoside linking group" is intended to mean a group capable of covalent coupling together with two nucleobases, such as between DNA units, between DNA units and nu-cleotide analogs, between two non-LNA units , between a non-LNA unit and an LNA unit, and between two LNA units, etc. Preferred examples include phosphate, phosphodiester and phosphorothioate groups.

Internucleoside binding can be selected from the group consisting of: -OP (O) 2-O-, -OP (O1S) -O-, -OP (S) 2-O-, -SP (O) 2-O -, -SP (0, S) -0 -, - SP (S) 2-O-, -OP (O) 2-S-, -OP (O1S) -S-, -SP (O) 2-S -, -O-PO (Rh) -O-, O-PO (OCH3) -O-, -O-PO (NRh) -O-, -O-PO (OCH2CH2S-R) -O-, -O- PO (BH3) -O -, - O-PO (NHRh) -O-, -OP (O) 2-NRh-, -NRh-P (O) 2-O-, -NRh-CO-O-, - NRh-CO-NRh-, and / or the internucleoside bond and may be selected from the group consisting of: -O-CO-O-, -O-CO-NRh-, -NRh-CO-CH2-, -O -CH2-CO-NRh -, -O-CH2-CH2-NRh-, -CO-NRh-CH2-, -CH2-NRh-CO-, -O-CH2-CH2-S-, -S-CH2-CH2 -O-, -S-CH2-CH2-S-, -CH2-SO2-CH2-, -CH2-CO-NRh-, -O-CH2-CH2-NRh-CO-, -CH2-NCH3-O-CH2 - where Rh is selected from hydrogen and C1-4-alkyl. Suitably, in some embodiments, sulfur-containing internucleoside linkages (S) as provided above may be preferred.

The terms "corresponding to" and "corresponding to" as used in the context of oligonucleotides refer to a comparison between a nucleobase sequence of the compound of the invention and the inverse length thereof or, in one embodiment, between a nucleotide sequence. base and an equivalent (identical) nucleobase sequence which may, for example, comprise other nucleobases, but retain the same base sequence or complement thereof. Nucleotide analogs are compared directly to their corresponding equivalent or natural nucleotides. Sequences which form the reverse complement of a sequence are referred to as the complementary sequence of the sequence. When referring to the length of a nu-cleotide molecule, as referred to herein, the length corresponds to the number of monomeric units, ie nucleobases, regardless of whether these monomeric units are nucleotide or nucleotide analogs. With respect to nucleobases, the terms monomer and unit are used interchangeably herein.

It should be understood that when the term "about" is used in the context of specific values or ranges of values, the description should be read as including the specific value or related range.

Preferred DNA analogs include DNA analogs where the 2'-H group is replaced by a substitution other than -OH (RNA), for example by substitution with -O-CH3, -O-CH2-CH2-O-CH3, -O-CH 2 -CH 2 -CH 2 -NH 2, -O-CH 2 -CH 2 -CH 2 -OH or -F.

Preferred RNA analogs include RNA analogs which have been modified to their 2'-OH group, for example by substitution by a group other than -H (DNA), for example, -O-CH3, -O- CH 2 -CH 2 -O-CH 3, -O-CH 2 -CH 2 -CH 2 -NH 2, -O-CH 2 -CH 2 -CH 2 -OH or -F.

In one embodiment, the nucleotide analog is ΈΝΑ ".

When used in the present context, the terms "LNA unit", "LNA monomer", "LNA residue", "nucleic acid blocked unit", "blocked nucleic acid monomer" or "blocked nucleic acid residue" refer to a bicyclic nucleoside analog. LNA units are described, inter alia, in WO 99/14226, WO 00/56746, WO00 / 56748, WO 01/25248, WO 02/28875, WO 03/006475 and WO 03/095467. The LNA unit may also be defined with respect to its chemical formula. Thus, an "LNA unit" as used herein has the chemical structure shown in Scheme 1 below: <table> table see original document page 41 </column> </row> <table>

on what

X is selected from the group consisting of O, S and NRh, where Rh is

H or C1-4 alkyl;

Y is (-CH 2) r, where r is an integer from 1-4; and

B is a nitrogenous base.

When referring to the replacement of a DNA unit by its corresponding LNA unit in the context of the present invention, the term "corresponding LNA unit" is intended to mean that the DNA unit has been replaced by an LNA unit containing the same base. that the DNA unit it replaces, for example, the corresponding LNA unit of a DNA unit containing basenitrogenous A also contains the nitrogenous base A. The exception is that when a DNA unit contains the base C, the corresponding LNA contains the C base or the MeC base, preferably MeC.

Here, the term "non-LNA unit" refers to a nucleoside other than one LNA unit, that is, the term "non-LNA unit" includes a DNA unit as well as an RNA unit. A preferred non-LNA unit is a DNA unit.

The terms "unit", "residue" and "monomer" are used interchangeably here.

In the present context, the term "conjugate" is intended to indicate a heterogeneous molecule formed by covalently linking an oligonucleotide as described herein to one or more non-nucleotide or non-polynucleotide moieties. Examples of non-nucleotide or non-polynucleotide moieties include macromolecular agents, such as proteins, fatty acid chains, sugar residues, glycoproteins, polymers or combinations thereof. Typically, proteins may be antibodies to a target protein. Typical polymers may be polyethylene glycol.

The term "at least one" encompasses an integer greater than or equal to 1, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18,19, 20 and so on.

The terms "one" and "one" as used above a nucleotide, an agent, an LNA moiety, etc., are intended to mean one or more.

In particular, the term "a component (such as a nucleotide, umag, an LNA moiety or the like) selected from the group consisting of ..." is intended to mean that one or more of the cited components may be selected. Thus, expressions such as "a selected component of the group consisting of A, B and C" are intended to include all combinations of A, B and C, ie A, B, C, A + B, A + C , B + C and A + B + C.

The term "thio-LNA unit" refers to an LNA unit in which X in Scheme 1 is S. A thio-LNA unit may be in D-formate and alpha-L form. Generally, the beta-D form of the thio-LNA unit is preferred. The beta-D form and the alpha-L form of a thio-LNA unit are shown in Scheme 3 as compounds 3A and 3B, respectively.

The term "amino-LNA moiety" refers to an LNA moiety wherein X in Scheme 1 is NH or NRh, where Rh is hydrogen or C1-4-alkyl. An amino-LNA moiety may be in beta-D form and alpha-L form. Generally, the beta-D form of the amino-LNA moiety is preferred. The beta-D form and the alpha-L form of an amino-LNA unit are shown in Scheme 4 as compounds 4A and 4B, respectively.

The term "LNA-oxy moiety" refers to an LNA moiety where X in Scheme 1 is O. A LNA-oxy moiety may be in D-formate and alpha-L form. Generally, the beta-D form of the LNA-oxy moiety is preferred. The beta-D form and the alpha-L form of an oxy-LNA unit are shown in Scheme 5 as compounds 5A and 5B, respectively. In the present context, the term "C1-6-alkyl" is intended to mean: - a straight or branched saturated hydrocarbon chain in which longer ascents have from one to six carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl and hexyl. A sedestin branched hydrocarbon chain means a C1-6-alkyl substituted on any carbon by a hydrocarbon chain.

In the present context, the term "C1-4-alkyl" is intended to mean a straight or branched saturated hydrocarbon chain, wherein longer ascents have from one to four carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl. A branched hydrocarbon chain is intended to mean a C1-4-alkylsubstituted on any carbon by a hydrocarbon chain.

When used herein, the term "C 1-6 alkoxy" is intended to mean C 1-6 alkyloxy, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, butoxy, pentoxy, isopentoxy, neopentoxy and hexoxy.

In the present context, the term "C 2-6 alkenyl" is intended to mean a straight or branched hydrocarbon group having from two to six carbon atoms and containing one or more double bonds. Illustrative examples of C 2-6 alkenyl groups include allyl, homo-allyl, vinyl, crotyl, butenyl, butadienyl, pentenyl, pentadienyl, hexenyl and hexadienyl. The unsaturation position (the double bond) can be at any position along the carbon chain.

In the present context, the term "C 2-6 alkynyl" is intended to mean a straight or branched hydrocarbon group containing from two to six carbon atoms and containing one or more triple bonds. Illustrative examples of C 2-6 alkynyl groups include acetylene, propynyl, butynyl, pentinyl and hexynyl. The unsaturation position (the triple bond) can be any position along the carbon chain. More than one bond may be unsaturated, so that the "C 2-6 alkynyl" is a diine or enodine, as known to those skilled in the art.

As used herein, "hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen, Inverted Hoogsteen, etc. hydrogen bonding, between complementary nucleoside or nucleotide bases. The four nucleobases commonly found in DNA are G, A, T and C, of which G pairs with C and A pairs with T. EmRNA, T is replaced by uracil (U), which then pairs with A. Osgroups Chemicals in the nucleobases that participate in the formation of double standards make up the Watson-Crick face. Hoogsteen showed years later that the purine nucleobases (G and A), in addition to their Watson-Crick face, have a Hoogsteen face that can be recognized from the exterior of the doublet used to link pyrimidine oligonucleotides via hydrogen bonding, thereby forming a triple helix structure.

In the context of the present invention, "complementary" refers to the precise pairing capability between two nucleotide sequences with one another. For example, if a nucleotide in a given position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the corresponding position of a DNA or RNA molecule, then the oligonucleotide and DNA or RNA are considered complementary to each other at that position. The DNA or RNA strand is considered complementary to each other when a sufficient number of nucleotides in the oligonucleotide can form hydrogen bonds with corresponding nucleotides in the target RNA or DNA to allow formation of a stable complex. To be stable in vitro or in vivo, the sequence of an oligonucleotide need not be 100% complementary to its target microRNA. The terms "complementary" and "specifically hybridize" thus imply that the oligonucleotide binds sufficiently strong and specific to target molecule to provide the desired interference with normal target function while leaving non-target RNA function unchanged.

In a preferred example, the oligonucleotide of the invention is 100% complementary to a human microRNA sequence, such as one of the microRNA sequences mentioned herein.

In a preferred example, the oligonucleotide of the invention comprises a continuous sequence which is 100% complementary to the culture region of the human microRNA sequence.

Micro-RNAs are short non-coding RNAs derived from endogenous degenerates that act as post-transcriptional regulators of gene expression. They are processed from longer hairpin-like precursors (approximately 70-80 nt) called pre-miRNAs via the RNAse III Dicer enzyme. Micro-RNAs assemble into ribonucleoprotein complexes called miRNPs and recognize their target sites through antisense complementarity, thereby measuring the down-regulation of their target genes. Almost perfect or perfect complementarity between the miRNA and its target site results in target domRNA cleavage, while limited complementarity between the microRNA and the target site results in translational inhibition of the target gene.

The term "micro-RNA" or "miRNA" in the context of the present invention means an RNA oligonucleotide consisting of between 18 and 25 nucleotides. In functional terms, miRNAs are typically regulatory endogenous deRNA molecules.

The terms "target microRNA" or "target miRNA" or "miR-NA target" refer to a microRNA with a biological role in human disease, for example, an overregulated oncogenic miRNA or miRNA tumor suppressor in cancer, thus being a target for therapeutic intervention of the disease in question.

The terms "target gene" or "target mRNA" refer to regulatory mRNAs targeting microRNAs, wherein said "target gene" or "target mR-NA" is post-transcriptionally regulated by almost perfect complementarity-based microRNA or perfect between the miRNA and its target site, resulting in target mRNA cleavage; or limited complementarity, often conferred on the complementarity between the so-called culture sequence (miRNA nucleotides 2-7) and the target site, resulting in translational inhibition of the target mRNA.

In the context of the present invention, the oligonucleotide is single stranded, which refers to the situation where the oligonucleotide is absent from the complementary oligonucleotide nucleotide - that is, it is not a double stranded oligonucleotide complex, such as an siRNA. In one embodiment, the composition according to the invention does not comprise another oligonucleotide which has a region of complementarity with the single strand oligonucleotide of five or more consecutive nucleobases, such as eight or more or 12 or more of the consecutive nucleobases. The other oligonucleotide is considered not to be covalently to the single strand oligonucleotide.

LNA-containing oligonucleotide of the invention

Although LNA units and non-LNA units can be combined in a number of ways to form oligonucleotides, it has surprisingly been discovered by the inventors of the present invention that a certain central DNA sequence and a certain presence of LNA units in said DNA sequence. results in a particularly high inhibition of microRNA. Such presence of LNA units in said central sequence of the oligonucleotides of the present invention makes said oligonucleotides highly nuclease resistant.

Nucleotides outside the central sequence may be LNA units and / or non-LNA units. In one embodiment, the non-LNA units outside the central sequence are DNA units.

The central sequence

In order for the antisense oligonucleotides of the present invention to inhibit their target microRNAs as efficiently as possible, there must be a certain degree of complementarity between the antisense oligonucleotides of the present invention and the corresponding target microRNAs. tooth.

It is particularly important that the oligonucleotides of the present invention are complementary to positions 3 to 8, counting from the 5 'end of the corresponding target microRNA. Nucleotide 1, containing from the 5 'end, in some of the target microRNAs, is a non-pairing base and is most likely concealed in a binding bag on the Ago 2 protein. Accordingly, the oligonucleotide of the invention may or may not. not having a nucleotide at position 1, counting from the 3 'end, corresponding to nucleotide 1, counting from the 5' end of the corresponding target microRNA. In some cases, the first two nucleotides, counting from the 5 'end of the corresponding target micro-RNA, may be left unmatched.

The central sequence of the oligonucleotides of the present invention is therefore a DNA sequence of positions one through six, two through seven overlays three through eight, counting from the 3 'end, corresponding to three over eight positions, counting from the 5' end , of the targeting microRNA.

miR-19b

A particular target micro-RNA is called miR-19b. The sequence of miR-19b from positions three to eight, counting from the 5 'end, is ugcaaa (see GenBank Ioci AJ421740 and AJ421739). The corresponding DNA sequence is acgttt. The inventors of the present invention, moreover, have found that in order to maximize inhibition of the target microRNAs, the oligonucleotides of the present invention must contain at least one LNA unit in its central sequence.

Accordingly, a first aspect of the invention relates to an oligonucleotide according to the invention, such as an oligonucleotide having a length of 12 to 26 nucleotides having the DNA sequence of positions one to six, two to seven or three to eight, preferably depositions two to seven or three to eight, counting from the 3 'end:

acgttt, (SEQ ID NO 6)

wherein at least one, such as one, preferably at least two, such as two or three DNA units in said sequence has been replaced by their corresponding LNA unit.

Complementarity with other target micro-RNA nucleotides may intensify inhibition of said target microRNA. Therefore, one embodiment is the oligonucleotide as defined above having a DNA sequence from positions one to seven, two to eight or three to nine, preferably from positions two to eight or three to nine, counting from the end. where at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by corresponding LNA unit.

In another embodiment, the oligonucleotide according to the present invention has a DNA sequence from positions one to eight, two to one or three to ten, preferably from positions two to nine or three to 10, counting from end 3. ':

acgtttag, (SEQ ID NO 71)

wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

In yet another embodiment, the oligonucleotide according to the present invention has a DNA sequence from positions one to nine, two to ten or three to eleven, preferably from positions two to ten or three to eleven, counting from the 3 'end:

where at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three, most preferably at least four, such as four or five DNA units in that sequence were replaced by their corresponding LNA unit.

miR-122a

Another interesting target micro-RNA is miR-122a. The domiR-122a sequence from positions three to eight, starting from the 5 'end, isglug (see miRBase entry HGNC: MIRN122A). The corresponding DNA sequence is ctcaca.

Accordingly, a second aspect of the present invention relates to an oligonucleotide according to the invention, such as an oligonucleotide having a length of 12 to 26 nucleotides having the DNA sequence of positions one to six, two to seven or three. to eight, preferably from positions two to seven or three to eight, starting at end 3 ':

(SEQ ID NO 7) wherein at least one, such as one, preferably at least two, such as two or three DNA units in said sequence has been replaced by their corresponding LNA unit.

One embodiment relates to the antagomir miR-122a oligonucleotide as described above having the DNA sequence from positions one, two to eight or three to nine, preferably from positions two to eight to nine, counting from the 3 'end:

wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit. .

In another embodiment, the oligonucleotide according to the present invention has a DNA sequence from positions one to eight, two to one or three to ten, preferably from positions two to nine or three to ten, counting from end 3. wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their unit of unity. Corresponding LNA.

In yet another embodiment, the oligonucleotide according to the present invention has a DNA sequence from positions one to nine, two to ten "or three to eleven, preferably from positions two to ten or three to eleven, counting from the 3 'end. : ctcacactg, (SEQ ID NO 75)

wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three, even more preferably at least four, such as four or five DNA units in said sequence have been replaced by their unit. of cor-responding LNA.miR-155

Another interesting target micro-RNA is miR-155. The domiR-155 sequence from positions three to eight, counting from the 5 'end, is a-augcu (see miRBase entry HGNC: MIRN155). The corresponding DNA sequence is ttacga.

Accordingly, a third aspect of the invention relates to an oligonucleotide according to the invention, such as an oligonucleotide having a length of 12 to 26 nucleotides having the DNA sequence of positions one to six, two to seven or three to eight, preferably two to seven or three to eight, counting from the 3 'end: ttacga, (SEQ ID NO 8)

wherein at least one, such as one, preferably at least two, such as two or three DNA units in said sequence has been replaced by their corresponding LNA unit.

In one embodiment, the antagomir miR-155 oligonucleotide as described above having a DNA sequence from positions one to seven, two to eight or three to nine, preferably from positions two to eight or three, counting from the end. 3 ':

ttacgat, (SEQ ID NO 76) wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit. .

In another embodiment, the oligonucleotide according to the present invention has a DNA sequence from positions one to eight, two to one or three to ten, preferably from positions two to nine or three to ten, counting from end 3. wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their unit of unity. Corresponding LNA.

In yet another embodiment, the oligonucleotide according to the present invention having a DNA sequence from positions one to nine, two to ten or three to eleven, preferably from positions two to ten or three to eleven, counting from the 3 'end:

ttacgatta, (SEQ ID NO 78)

wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three, even more preferably at least four, such as four or five DNA units in said sequence have been replaced by their unit. of corresponding ANA.

miR-375

Yet another interesting target micro-RNA is miR-375. The miR-375 sequence from positions three to eight, counting from the 5 'end, is uguucg (see entry on miRBase HGNC: MIRN375). The corresponding DNA sequence is caagc.

Accordingly, a fourth aspect of the invention relates to an oligonucleotide according to the invention, such as an oligonucleotide having a length of 12 to 26 nucleotides having the DNA sequence of positions one to six, two to seven or three to eight, preferably two to seven or three to eight, counting from the 3 'end:

acaagc; , (SEQ ID NO 9)

wherein at least one, such as one, preferably at least two, such as two or three DNA units in said sequence has been replaced by their corresponding LNA unit.

In one embodiment, the antagomir miR-375 oligonucleotide as described above has a DNA sequence from positions one, two to eight or three to nine, preferably from positions two to eight to nine, counting from the 3 'end:

where at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit. .

In another embodiment, the oligonucleotide according to the present invention has a DNA sequence from positions one to eight, two to one or three to ten, preferably from positions two to nine or three to ten, counting from end 3. ':

acaagcaa, (SEQ ID NO 80)

wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

In yet another embodiment, the oligonucleotide according to the present invention has a DNA sequence from positions one to nine, two to ten or three to eleven, preferably from positions two to ten or three to eleven, counting from the 3 'end:

acaagcaag, (SEQ ID NO 81)

wherein at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three, even more preferably at least four, such as four or five DNA units in said sequence have been replaced by their unit. of corresponding ANA.

Nucleotide Modification in Central Sequence

As mentioned above, in the central sequence of the oligonucleotides of the present invention at least one, such as one, preferably at least two, such as two or three DNA units in said sequence have been replaced by their corresponding LNA unit. The present inventors have further found that inhibition of the target micro-RNAs can be further increased by making sure that two LNA units in said central sequence are separated by at least one DNA unit. Accordingly, one embodiment of the invention relates to the oligonucleotide as described above, wherein at least two, such as two or three DNA units from positions one to six, two to seven to eight to eight, preferably from two to seven or three to eight, starting from the 3 'end, have been replaced by their corresponding LNA unit and wherein the LNA units are separated by at least one DNA unit.

The present inventors have also found that inhibition of demicro-RNAs can be further enhanced by making sure that two LNA units in the central sequence are separated by at most two DNA units. Accordingly, in one embodiment, the present invention relates to the oligonucleotide as described above, wherein the number of consecutive DNA units from positions one to six, two to seven or three to eight, preferably from positions two to seven or three to eight, counting from the 3 'end is a maximum of two.

Said findings apply to the central sequence per se, that is, the findings apply to the oligonucleotide positions of the present invention corresponding to the central sequence. Accordingly, another embodiment relates to the oligonucleotide as described above, wherein at least two, such as two, three or four DNA units, one to seven, two to eight or three to nine positions, preferably from two to eight or three to nine positions. , counting from the 3 'end, have been replaced by their corresponding LNA unit and wherein the LNA units are separated by at least one DNA unit. Another mode relates to the oligonucleotide as described above, wherein the number of consecutive DNA units from positions one to seven, two to eight or three to nine, preferably from positions two to eight or three to nine, with -from the 3 'end, is at most two.

Still another embodiment relates to the oligonucleotide as described above, wherein at least two, such as two, three or four DNA units from positions one to eight, two to nine or three to ten, preferably from positions two to three. nine or three to ten, counting from the 3 'end, have been replaced by their corresponding LNA unit and where the LNA units are separated by at least one DNA unit. Still another embodiment relates to the oligonucleotide as described above, wherein the number of consecutive DNA units is one to eight, two to nine or three to ten, preferably from two to nine or three to ten, from end 3. 'is at most two.

Still another embodiment relates to the oligonucleotide as described above, wherein at least two, such as two, three, four or five DNA units from positions one to nine, two to ten or three to eleven, preferably from positions two to ten. or three to eleven, counting from the 3 'end, have been replaced by their corresponding LNA unit, wherein the LNA units are separated by at least one DNA unit. Yet another embodiment relates to the oligonucleotide as described above, wherein the number of consecutive DNA units is one to nine, two to ten or three to eleven, preferably from two to ten or three to eleven, from 1 to 9. from the 3 'end is at most two.

Nucleotide modification outside central sequence

As mentioned above, nucleotides outside the central sequence may be LNA units and / or non-LNA units. In one embodiment, the invention relates to oligonucleotide as described above, wherein the number of LNA units outside the central sequence is at least one, such as one, two, three or four, and wherein said unions LNA ages are separated by at least one non-LNA unit. In another embodiment, the substitution pattern outside the central sequence is such that the number of consecutive non-LNA units outside the central sequence is a maximum of two.

Nucleotide modification at positions 3 to 8, counting from the 3 'end.

In the following embodiments which refer to the modification of nucleotides at positions 3 to 8, counting from the 3 'end, LNA moieties may be replaced by other nucleotide analogs such as those referred to herein. "X" can therefore be selected from the group consisting of 2'-0-alkyl-RNA unit, 2'-OMe-RNA unit, 2'-amino-DNA unit, 2'-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit. "x" is preferably DNA or RNA, more preferably DNA.

In an interesting embodiment of the invention, the oligonucleotides of the invention are modified at positions 3 to 8, counting from the 3 'end. The design of this sequence can be defined by the number of non-LNA units present or the number of present LNA units. In a preferred embodiment of the first, at least one such nucleotide at positions three to eight, counting from the 3 'end, is a non-LNA moiety. In another embodiment, at least two, such as two, of the nucleotides at positions 3-8, counting from the 3 'end, are non-LNA units. In yet another embodiment, at least three, such as three, of nucleotides at positions three to eight, counting from the 3 'end, are non-LNA units. In yet another embodiment at least four, such as four, of nucleotides nosions three through eight, counting from the 3 'end, are denão-LNA units. In another embodiment at least five, such as five, of osnucleotides at positions three to eight, counting from the 3 'end, are non-LNA units. In yet another embodiment, all six nucleotides at positions three through eight, counting from the 3 'end, are non-LNA units. In a preferred embodiment, said non-LNA unit is a DNA unit.

Alternatively defined, in a preferred embodiment, the oligonucleotide according to the invention comprises at least one LNA unit at positions three to eight, counting from the 3 'end. In one embodiment thereof, the oligonucleotide according to The present invention comprises an LNA unit at positions three to eight from the 3 'end. The substitution pattern for nucleotides at positions three through eight, starting from the 3 'end, can be selected from the group consisting of Xxxxxx, xXxxxx, xxXxxx, xxxXxx, xxxxXx, and xxxxxX, where "X" denotes one unit. LNA and "x" denotes a non-LNA unit.

In another embodiment, the oligonucleotide according to the present invention comprises at least two LNA units at positions three to eight, counting from the 3 'end. In one embodiment, the oligonucleotide according to the present invention comprises two units of LNA. LNA at positions three to eight, counting from the 3 'end. The substitution pattern for nucleotides at positions three to eight, starting from the 3 'end, can be selected from the group consisting of XXxxxx, XxXxxx, XxxXxx, XxxxxX, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxx, xxxxxx, xxxXXx, xxxXxX, and xxxxXX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a preferred embodiment, the substitution pattern for nucleotides at positions three to eight is counted from from the 3 'end, is selected from the group consisting of XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXxXxx, xXxxXx, xXxxxX, xxXxXx, xxXxxX, and xxxXxX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment, the substitution pattern for nucleotides at positions 3 and 8 from the 3 'end is selected from the group consisting of xXxXxx, xXxxXx, xXxxxX, xxXxXx, xxXxxX and xxxXxX, where "X" denotes a unit of one. LNA and "x" denotes a non-LNA unit. In an even more preferred fashion, the substitution pattern for nucleotides at positions three to eight, starting from the 3 'end, is selected from the group consisting of xXxXxx, xXxxXx and xxXxXx, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment, the substitution pattern for nucleotides at positions three to eight, starting from the 3 'end, is xXxXxx, where "X" denotes one LNA unit and "x" denotes one unit of LNA. non-LNA.

In yet another embodiment, the oligonucleotide according to the present invention comprises at least three LNA units at positions three to eight, counting from the 3 'end. In a damesma embodiment, the oligonucleotide according to the present invention comprises three LNA units at positions three to eight, counting from the 3 'end. The substitution pattern for nucleotides at positions three from the 3 'end can be selected from the group consisting of XXXxxx, xXXXxx, xxXXXx, xxxXXX, XXxXxx, XXxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXxX, and XxXxXx, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a preferred embodiment, the substitution pattern for nucleotides at positions three through eight, starting from the 3 'end, is selected from the group consisting of XXxXxx, XXxxXx, XXxxxX, xXXxXx, xxXXxX, XxXXxx, XxxXXx, XxxxXX , xXxXXx, xXxxXX, xxXxXX, xXxXxX, and XxXxXx, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred fashion, the substitution pattern for nucleotides at positions three to eight, starting from the 3 'end, is selected from the group consisting of xXXxXx, xXXxxX, xxXXxX, xXxXXx, xXxxXX, xxXxXX exXxXxX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment, the nucleotide substitution pattern at positions three through eight, counting from the 3 'end, is xXxXxX or XxXxXx, where "X" denotes one LNA unit and "x" denotes one unit of non-LNA. In an even more preferred embodiment, the substitution pattern for nucleotides at positions three to eight, counting from the 3 'end, is xXxXxX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit.

In another embodiment, the oligonucleotide according to the present invention comprises at least four LNA units in positions three to eight, counting from the 3 'end. In one embodiment thereof, the oligonucleotide according to the present invention comprises four LNA units at positions three to eight, counting from the 3 'end. The replacement pattern for nucleotides at positions eight through eight from the 3 'end can be selected from the group consisting of xxXXXX, xXxXXX, xXXxxX, xXXXXx, XxxXXX, XxXxXX, XxXXxX, XxXXXx, XXxxXX, XXxXxxxxxx and ΧΧΧΧχχ, where "Χ" denotes an LNA unit and "x" denotes a non-LNA unit.

In yet another embodiment, the oligonucleotide according to the present invention comprises at least five LNA units at positions three to eight, counting from the 3 'end. In one embodiment, the oligonucleotide according to the present invention comprises five LNA units at positions three to eight, starting from the 3 'end. The substitution pattern for nucleotides 3 through 8, starting at the 3 'end, may be selected from the group consisting of xXXXXX, XxXXXX, XXxXXX, XXXxXX, XXXXxX and XXXXXx, where "X" denotes a unit of one. LNA and "x" denotes a non-LNA unit.

Preferably, the oligonucleotide according to the present invention comprises one or two LNA units at three-eighth positions, counting from the 3 'end. This is considered advantageous for the stability of the A-helix formed by the double oligo: micro-RNA, a double similar to a double RNA: RNA structure.

In a preferred embodiment, said non-LNA unit is a DNA unit.

Oligonucleotide length variation

The length of the oligonucleotides of the invention need not be equivalent to the length of the target microRNAs exactly. In fact, it is considered advantageous to have a short oligonucleotide, such as between 10-17 or 10-16 nucleobases.

In one embodiment, the oligonucleotide according to the present invention has a length of 8 to 24 nucleotides, such as 10 to 24, between 12 to 24 nucleotides, such as a length of 8, 9, 10, 11, 12,13 , 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably a length of 10 - 22, such as between 12 to 22 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 nu-cleotide, more preferably a length of 10 - 20, such as between 12 to 20 nucleotide, such as a length of 10, 11, 12, 13, 14, 15, 16,17, 18, 19 or 20 nucleotides, even more preferably a length of 10 to 19, such as between 12 to 19 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotide, for example, a length of 10 to 18, such as between 12 to 18 nucleotide, such as a length of 10, 11, 12, 13, 14, 15, 16, 17 or 18 nucleotide, more preferably a length of 10 - 17, such as from 12 to 17 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16 or 17 nucleotides, more preferably a length of 10 to 16, such as between 12 to 16 nucleotides, such as a length of 10, 11, 12, 13, 14, 15 or 16 nu-cleotide.

Nucleotide modification of position 11, counting from the 3 'end to the 5' end

The substitution pattern for nucleotide from position 11, counting from the 3 'end to the 5' end may include nucleotide analog units (such as LNA) or not. In a preferred embodiment, the oligonucleotide according to the present invention comprises at least one nucleotide analog unit (such as LNA), such as a nucleotide analog unit, from position 11, counting from the 3 'end to the 5 'end. In another preferred embodiment, the oligonucleotide according to the present invention comprises at least two nucleotide analog units, such as LNA units, such as two nucleotide analog units, starting from position 11, counting from end 3 'to end 5'.

In the following embodiments which refer to nucleobase modification of nucleobases from positions 11 to the 5 'end of the oligonucleotide, LNA units may be replaced by their nucleotide analogs, such as those referred to herein. "X" may therefore -to be selected from the group consisting of 2'-0-alkyl RNA unit, 2'-OMe-RNA unit, 2'-amino-DNA unit, 2'-fluoro-DNA unit, LNA unit PNA unit, HNA unit, INA unit. "x" ions is preferably DNA or RNA, more preferably DNA. In one embodiment, the oligonucleotide according to the present invention has the following substitution pattern, which is repeated from nucleotide eleven, counting from the 3 'end to the 5' end: xXxX or XxXx1 where "X" denotes one LNA unit and "x" denotes a non-LNA unit. In another embodiment, the oligonucleotide according to the present invention has the following substitution pattern, which is repeated from nucleotide eleven, counting from the 3 'end to the 5' end: XxxXxx, xXxxXx or xxXxxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In still another embodiment, the oligonucleotide according to the present invention has the following substitution pattern, which is repeated from nucleotide eleven, counting from the 3 'end to the 5' end: XxxxXxxx, xXxxxXxx, xxXxxxXx or xxxXxxxX, "X" denotes an LNA unit and "x" denotes a non-LNA unit.

The nucleotide-specific substitution pattern from position 11, counting from the 3 'end to the 5' end depends on the nucleotide number in the oligonucleotide according to the present invention. In a preferred embodiment, the oligonucleotide according to the present invention contains 12 nucleotides and the substitution pattern for positions 11 to 12, starting from the 3 'end, is selected from the group consisting of xX and Xx, where "X" denotes a LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment of the same embodiment, the substitution pattern for positions 11 through 12 from the 3 'end is xX, where "X" denotes an LNA unit and "x" denotes a non-NNA unit. LNA. Alternatively, no LNA unit is present at positions 11 to 12, counting from the 3 'end, that is, the substitution pattern is xx.

In another preferred embodiment, the oligonucleotide according to the present invention contains 13 nucleotides and the substitution pattern for positions 11 through 13, counting from the 3 'end, is selected from the group consisting of Xxx. , xXx, xxX, XXx, XxX, xXX and XXX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment thereof, the substitution pattern for Positions 11 through 13, counted from the 3 'end, are selected from the group consisting of xXx, xxX, and xXX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment, the substitution pattern for positions 11 through 13 from the 3 'end is xxX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. Alternatively, no LNA unit is present at positions 11 through 13, counting from the 3 'end, that is, the substitution pattern is xxx.

In another preferred embodiment, the oligonucleotide according to the present invention contains 14 nucleotides and the substitution pattern for positions 11 to 14, counting from the 3 'end, is selected from the group consisting of Xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, and xxxx, where "x" denotes an lna unit and "x" denotes a non-lna unit. In a preferred embodiment thereof, the replacement pattern for positions 11 through 14, starting from the 3 'end, is selected from the group consisting of xXxx, xxXx, xxxX, xXxX exxXX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment thereof, the replacement pattern for positions 11 through 14, counting from the 3 'end, isxXxX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. LNA. Alternatively, no LNA unit is present in headings 11 through 14, counting from the 3 'end, ie the default replacement is xxxx.

In another preferred embodiment, the oligonucleotide according to the present invention contains 15 nucleotides and the substitution pattern for positions 11 to 15, counting from the 3 'end, is selected from the group consisting of Xxxxx. , xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, and xxxxx, where "x" denotes an LNA unit and "x" denotes an unna unit . In a preferred embodiment thereof, the substitution pattern for positions 11 to 15, starting from the 3 "end, is selected from the group consisting of xxXxx, XxXxx, XxxXx, xXxXx, xXxxX and xxxxX, where" X "denotes an LNA unit and" x "denotes a non-LNA unit. In a more preferred embodiment thereof, the disubstitution pattern for positions 11 to 15, counting from the 3 'end, is selected from the group consisting of xxXxx , xXxXx, xXxxX and xxXxX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit In an even more preferred embodiment thereof, the substitution pattern for positions 11 to 15, counting from 3 is selected from the group consisting of xXxxX and xxXxX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment, the substitution pattern for positions 11 through 15 , counting from end 3 \ is xxXxX, where "X" denotes a drive LNAe "x" denotes a non-LNA unit. Alternatively, no LNA units are present at positions 11 to 15, counting from the 3 'end, that is, the substitution pattern is xxxxx.

In yet another preferred embodiment, the oligonucleotide according to the present invention contains 16 nucleotides and the substitution pattern for positions 11 to 16, starting from the 3 'end, is selected from the group consisting of Xxxxxx, xXxxxx xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxxxxxxxxxxxxxxxxx , Xxxxxx, xxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, χχΧΧΧχ, χχΧΧχΧ, xxxxxx and xxxxxx, where "x" denotes a unit of nlna and "x." In a preferred embodiment thereof, the substitution pattern for positions 11 to 16, starting from the 3 'end, is selected from the group consisting of XxxXxx, xXxXxx, xXxxXx, xxXxXx, xxXxXx, xxxxxx, xxxxxx, xxxxxx, xxxxxx xxXxXX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment thereof, the substitution pattern for positions 11 to 16, counting from the 3 'end, is selected from the group consisting of xXxXxx, xXxxXx, χχΧχΧχ, χχΧχχΧ, χΧχΧχΧ, χΧχχΧΧ and χχΧχΧΧ, where "Χ" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment thereof, the substitution pattern for positions 11 to 16, counting from the 3 'end, is selected from the group consisting of χχΧχχΧ, χΧχΧχΧ, xXxxXX and xxXxXX, where "X" denotes a uni -LNA and "x" denotes a non-LNA unit. In yet another preferred embodiment thereof, the substitution pattern for positions 11 to 16 from the 3 'end is selected from the group consisting of xxXxxX and xXxXxX, where "X" denotes an LNA unit and " x "denotes a non-LNA unit. In an even more preferred embodiment, the substitution pattern for positions 11 through 16, starting from the 3 'end, is xxXxxX, where "X" denotes an LNA unit and "x" denotes a non-LNA unit. Alternatively, no LNA units are present at positions 11 to 16, counting from the 3 'end, that is, the replacement pattern is xxxxxx.

In a preferred embodiment of the invention, the oligonucleotide according to the present invention contains a 5 'end LNA unit. In another preferred embodiment, the oligonucleotide according to the present invention contains an LNA moiety at the first two positions, counting from the 5 'end.

In a particularly preferred embodiment, the oligonucleotide according to the present invention contains 13 nucleotides and the substitution pattern starting from the 3 'end is XXxXxXxxXXxxX, where "X" denotes an LNA moiety and "x" denotes a non-LNA unit. The preferred sequence for this embodiment starting from the 3 'end is CCtCaCacTGttA, where an uppercase letter denotes a nitrogenous base in a LNA unit and a lowercase letter denotes a nitrogenous base in a non-LNA unit.

In another particularly preferred embodiment, the oligonucleotide according to the present invention contains 15 nucleotides and the substitution pattern starting from the 3 'end is XXxXxxxxxxxxxX, where "X" denotes an LNA moiety and "x" denotes an LNA moiety. non-LNA unit. The preferred sequence for this embodiment, starting from the 3 'end, is CCtCaCacTGttAcCl where a capital letter denotes a nitrogenous base in a LNA unit and a lowercase letter denotes a nitrogenous base in a non-LNA unit.

Modification of Internucleoside Linkage Group

Typical internucleoside linker groups in oligonucleotides are phosphate groups, but these may be substituted by different phosphate internucleoside linker groups. In another interesting embodiment of the invention, the oligonucleotide of the invention is modified in its internucleoside linking group structure, that is, the modified oligonucleotide comprises an internucleoside linking group which differs from phosphate. Accordingly, in a preferred embodiment, the oligonucleotide according to the present invention comprises at least one.

Specific examples of internucleoside linkers which differ from phosphate (-OP (O) 2-O-) include -OP (OjS) -O-, -OP (S) 2-O-, -SP (O) 2-O -, -SP (O1S) -O-, -SP (S) 2-O-, -OP (O) 2-S-, -OP (O1S) -S-, -SP (O) 2-S-, -O-PO (Rh) -O-, O-PO (OCH3) -O-, -O-PO (NRh) -O-, -O-PO (OCH2CH2S-R) -O-, -O-PO ( BH3) -O-, -O-PO (NHRh) -O-, -OP (O) 2-NRh-, -NRh-P (O) 2-O-, -NRh-CO-O-, -NRh- CO-NRh-, -O-CO-O-, -O-CO-NRh-, -NRh-CO-CH2-, -20 O-CH2-CO-NRh-, -O-CH2-CH2-NRh-, -CO-NRh-CH2-, -CH2-NRh-CO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-SO2 -CH2-, -CH2-CO-NRh-, -O-CH2-CH2-NRh-CO-, -CH2-NCH3-O-CH2-, where Rh is hydrogen or C1-4-alkyl.

When the internucleoside linking group is modified, the internucleoside linking group is preferably a phosphorothioate (-O-P (O1S) -O-) group. In a preferred embodiment, all oligonucleotide internucleoside linking groups according to the present invention are phosphorothioate.

Specific Micro-RNA Designs

The following table provides examples of oligonucleotides according to the present invention, such as those used in pharmaceutical compositions, when compared to the prior art molecule type. <table> table see original document page 65 </column> </row> < table> <table> table see original document page 66 </column> </row> <table> <table> table see original document page 67 </column> </row> <table>

Capital letters without an superscript M or F refer to

LNA units. Lower case = DNA, except for lower case bold = RNA. LNA cytokines may be optionally methylated.) Upper case letters followed by an superscript M refer to units of 2ΌΜΕ RNA. Capital letters followed by an superscript F refer to 2'fluoro DNA units, lower case letters refer to DNA. The above oligos may, in one embodiment, be fully phosphorothioate, but other nucleobase linkages as described herein may be used. In one embodiment, the nucleobase bonds are all phosphodiester. It is considered that, for use within the spinal column / brain, it is preferable to use phosphodiester bonds, for example, for the use of miR21 targeting anti-Ri.

Oligonucleotides according to the invention may, in one embodiment, have a 5 '- 3' nucleobase sequence selected from the group consisting of:

LdLddLLddLdLdLL (New Design) LdLdLLLddLLLdLL (New Design Enhanced) LMLMMLLMMLMLMLL (New Design - 2'MOE) LMLMLLLMMLLLMLL (New Design Enhanced-2'MOE) LFLFFLLFFLFLFLL (New Design - 2 'Fluoro) LFLFdLLddLflddddd (d) (d) (L) (d) (d) (L) (d) três every three'dLddLddLdd (L) (d) (d) (L) (d) (d) (L) três every three 'ddLddLddLd (d) (L) (d) (d) (L) (d) (d) Ά every three' LMMLMMLMML (M) (M) (L) (M) (M) (L) (M) Ά every three'MMLMMLMMLMM (L) (M) (M) (L) (M) (M) (L) Ά every three'MMLMMLMMLM (M) (L) (M) (M) (L) (M) (M ) Ά every three * LFFLFFLFFL (F) (F) (L) (F) (F) (L) (F) Ά every three'FLFFLFFLFF (L) (F) (F) (L) (F) (F) (L) Ά every three'FFLFFLFFLF (F) (L) (F) (F) (L) (F) (F) Ά every three'dLdLdLdLdL (d) (L) (d) (L) (d) ( L) (d) Ά every two'LdLdLdLdL (d) (L) (d) (L) (d) (L) (d) (L) Ά every two'MLMLMLMLML (M) (L) (M) (L ) (M) (L) (M) Ά every two'LMLMLMLML (M) (L) (M) (L) (M) (L) (M) (L) Ά every two'FLFLFLFLFL (F) (L) (F) (L) (F) (L) (F) Ά every two'LFLFLFLFL (F) (L) (F) (L) (F) (L) (F) (L) dois every two '

where L = LNA unit, d = DNA units, M = 2'MOE RNA, F = 2'Fluoro and residuals in parentheses are optional.

Specific examples of the oligonucleotides according to the present invention may be selected from the group consisting of tg-CatGgaTttGcaCa (SEQ ID NO 82), tgCatGgaTttGcaC (SEQ ID NO 83), CatGgaTttGcaC (SEQ ID NO 84), tGcAtGgAtTtGcAc (SEQ ID 85), cAtG-gAtTtGcAc (SEQ ID NO 86), CatGGatTtGcAC (SEQ ID NO 87), TgCatG-GatTtGeAC (SEQ ID NO 88), TgCaTgGaTTtGeACa (SEQ ID NO 89), cCatTgtCacActCg 90 (SEQ ID NOC) ), ccAttGtcAcaCtcC (SEQ ID NO 92), cCatTgtCacActCc (SEQ ID NO 93), atTgtCacActCc (SEQ ID NO 94), ccAttGtcAcaCtcC (SEQ ID NO 95), AttGt-cAcaCtcC (SEQ IDC 96) ), AttGTca-CaCtCC (SEQ ID NO 98), CcAttGTcaCaCtCC (SEQ ID NO 99), CcaTtgTca-cAeteCa (SEQ ID NO 100), CCAttgtcacacTCCa (SEQ ID NO 101), tCaeGat-TagCatTaa (SEQ IDTta) SEQ ID NO 103), TcAc-GaTtAgCaTtAa (SEQ ID NO 104), AteAeGaTtAgCaTta (SEQ ID NO 105), gAgcCgaAcgAacAa (SEQ ID NO 107), GaceGaCaA (SEQ ID NO 107) CgAaCgAaCaA (SEQ ID NO109); where the lowercase letter identifies the nitrogenous base of a DNA unit and an uppercase letter identifies the nitrogenous base of an LNA unit, with the capital letter C referring to MeC.

It will be appreciated that the LNA / DNA nucleobase design in the specific examples above may be applied to other oligonucleotides according to the invention.

Conjugates

The invention also provides conjugates comprising the oligonucleotide according to the invention.

In one embodiment of the invention, the oligomeric compound is linked to ligands / conjugates which may be used, for example, to increase cellular uptake of antisense oligonucleotides. Such conjugation may occur at terminal positions 573'-OH, but ligands may also occur at sugars and / or bases. In particular, the growth factor to which the antisense oligonucleotide may be conjugated may comprise transferrin or folate. Transferrin - polylysine-oligonucleotide or folate - polysine - complexes or the like may be prepared for uptake by cells expressing high levels of the transferrin or folate receptor. Other examples of conjugates / linkers are cholesterol moieties, double intercalators such as acridine, poly-L-lysine, "end coat" with one or more nuclease-resistant linking groups such as phosphoromonothioate and the like. The invention also provides a conjugate comprising the compound according to the invention as described herein and at least a portion of non-nucleotide or non-polynucleotide covalently attached to said compound. Therefore, in one embodiment where the compound of the invention consists of a specified nucleic acid as disclosed herein, the compound may be

also comprising at least a portion of non-nucleotide or non-polynucleotide (e.g., not comprising one or more nucleotide or nucleotide analogs) covalently linked to said compound. The non-nucleobase moiety may, for example, be or comprise a sterol, such as cholesterol.

Therefore, it will be appreciated that the oligonucleotide of the invention, such as the oligonucleotide used in pharmaceutical (therapeutic) formulations may comprise other non-nucleobase components, such as the conjugates defined herein.

The LNA Unit

In a preferred embodiment, the LNA unit has the general chemical structure shown in Scheme 1 below:

Scheme 1

<formula> formula see original document page 70 </formula>

on what

X is selected from the group consisting of O, S and NRh, where Rh is H or C1-4-alkyl;

Y is (-CH2, where r is an integer from 1-4; eB is a nitrogenous base.

In a preferred embodiment of the invention, r is 1or 2, in particular 1, that is, a preferred LNA unit has the chemical structure shown in Scheme 2 below:

<formula> formula see original document page 71 </formula>

where XeB are as defined above.

In an interesting embodiment, the LNA units incorporated into the oligonucleotides of the invention are independently selected from the group consisting of thio-LNA units, amino-LNA units and oxy-LNA units.

Thus, the thio-LNA unit may have the chemical structure shown in Scheme 3 below:

<formula> formula see original document page 71 </formula>

where B is as defined above.

Preferably the thio-LNA moiety is in its beta-D- form, i.e. having the structure shown in 3A above.

Similarly, the amino-LNA unit may have the chemical structure shown in Scheme 4 below: <formula> formula see original document page 72 </formula>

wherein B and Rh are as defined above.

Preferably, the amino-LNA moiety is in its D-formate, i.e. having the structure shown in 4A above.

The LNA-oxide unit may have the chemical structure shown in Scheme 5 below.

Scheme 5

<formula> formula see original document page 72 </formula>

where B is as defined above.

Preferably the oxy-LNA moiety is in its beta-D- form, i.e. having the structure shown in 5A above.

As indicated above, B is a nitrogenous base which may be of natural or unnatural origin. Specific examples of nitrogenous bases include adenine (A), cytosine (C), 5-methylcytosine (MeC), isocytosine, pseudoisocytosine, guanine (G), thymine (T), uraeila (U) 15-bromouracil, 5-propynyluracil, 5-propynyl-6,5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propine-7-deazaadenine, 7-propine-7-deazaguanine and 2-chloro- 6-aminopurine.

Terminal Groups

Specific examples of terminal groups include terminal groups selected from the group consisting of hydrogen, azide, halogen, cyano, nitro, hydroxy, Prot-O-, Act-O-, Mercapto, Prot-S-, Act-S-, C1 -6-alkylthio, amino, Prot-N (RH) -, Act-N (RH) -, mono- or di (C1-6-alkyl) amino C1-6-alkoxy, optionally substituted, C-1-6- optionally substituted alkyl, optionally substituted C 2-6 alkynyl, optionally substituted C 2-6 alkenyloxy, optionally substituted C 2-6 alkynyl, optionally substituted C 2-6 alkynyloxy, monophosphate including protected monophosphate, protected monothiophosphate including protected diphosphate , dithiophosphate including protected dithiophosphate, triphosphate including protected triphosphate, trithiophosphate including protected trithiophosphate, where Prot is a protecting group for -OH, -SH and -NH (Rh), and Act is an activation group for -OH, -SH and -NH (Rh), and Rh is hydrogen or C1-6 alkyl.

Examples of phosphate protecting groups include S-acetylthioethyl (SATE) and S-pivaloylthioethyl (t-butyl-SATE).

Still other examples of terminal groups include DNA intercalators, photochemically active groups, splitting groups, reporter groups, ligands, carboxy, sulfone, hydroxymethyl, Prot-O-CH2-, Act-O-CH2-, aminomethyl, Prot-N (Rh) -CH2-, Act-N (Rhl) -CH2-, carboxymethyl, sulfonomethyl, where Prot is a protecting group -OH, -SH and -NH (Rh) ie Act is a protecting group for -OH, - SH, and -NH (Rh), and Rh is hydrogen or C1-6 alkyl.

Examples of protecting groups for -OH and -SH include substituted aryls, trityl such as 4,4'-dimethoxytrityloxy (DMT), 4-monomethoxytrityloxy (MMT); optionally substituted trityloxy 9- (9-phenyl) xanthenyloxy (pixyl), optionally substituted methoxytetrahydropyranyloxy (mthp); silyloxy, such as tri-methylsilyloxy (TMS), triisopropylsilyloxy (TIPS), tert-butyldimethylsilyloxy (TBDMS), triethylsilyloxy, phenyldimethylsilyloxy; tert-butyl ethers; acetals (including two hydroxy groups); acyloxy, such as acetyl or halogen substituted acetyls, for example chloroacetyloxy or fluoroacetyloxy, isobutyryloxy, pivoyloxy, benzoyloxy and benzoyl, methoxymethyloxy (MOM), benzyl ethers or benzylethers such as 2,6-dichlorobenzyloxy . In addition, when Z or Z * is hydroxyl, they may be protected by attachment to a solid support, optionally through a binder.

Examples of the amino protecting group include fluorenylmethoxycarbonylamino (Fmoc), tert-butyloxycarbonylamino (BOC), trifluoroacetylamino, allyloxycarbonylamino (alloc, AOC), Z-benzyloxycarbonylamino (Cbz), substituted benzyloxycarbonylamino benzylcarbonyl (2m) -CIZ), monomethoxytritylamino (MMT), dimethoxytritylamino (DMT), phthaloylamino, and 9- (9-phenyl) xanthenylamino (pixila).

The activation group preferably mediates couplings to other nucleotide residues and / or monomers and, after termination, the activation group is typically converted to an internucleoside bond. Examples of such activating groups include optionally substituted β-phosphoramidite, optionally substituted O-phosphotriester, optionally substituted O-phosphodiester, optionally substituted H-phosphonate and optionally substituted O-phosphonate. In the present context, the term "phosphoramidite" means a group of the formula -P (ORx) -N (Ry) 2, wherein Rx denotes an optionally substituted alkyl group, for example methyl, 2-cyanoethyl, or benzyl and each Ry denotes alkyl groups. optionally substituted, for example ethyl or isopropyl or the group -N (Ry) 2 forms a morpholino group (-N (CH 2 CH 2) 2 O). Rx preferably denotes 2-cyanoethyl and the two Ry are preferably identical and denote isopropyl. Accordingly, a phosphoramidite particularly is N, N-diisopropyl -O- (2-cyanoethyl) phosphoramidite.

Preferred terminal groups are hydroxy, mercapto and amino, in particular hydroxy.

Therapy and pharmaceutical compositions

As initially explained, the oligonucleotides of the invention will constitute suitable drugs with improved properties. The design of a potent and safe drug requires tuning of various parameters such as affinity / specificity, stability in biological fluids, cell uptake, mode of action, pharmacokinetic properties and toxicity.

Accordingly, in another aspect, the present invention relates to a pharmaceutical composition comprising an oligonucleotide according to the invention and a pharmaceutically acceptable diluent, vehicle or adjuvant. Preferably, said carrier is saline or buffered solution.

In yet another aspect, the present invention relates to an oligonucleotide according to the present invention for use as a medicament.

As will be understood, the dosage is dependent upon the severity and responsiveness of the disease state to be treated and the course of treatment lasting from several days to several months or until a cure is obtained or a decrease in the disease state is obtained. Optimal dosing schedules can be calculated from measurements of drug accumulation in the patient's body. Optimal dosages may vary depending on the relative potency of the individual oligonucleotides. Generally, they can be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general the dosage is 0.01 μg to 1 g per kg body weight and may be given once or more daily, weekly, monthly or yearly or even once every 2 to 10 years or by continuous infusion over hours. up to several months. Repeat dose rates may be estimated based on measured residence times and drug concentrations in body fluids or tissues. Upon successful treatment, it may be desirable for the patient to undergo maintenance therapy to prevent recurrence of the sick state.

Pharmaceutical Compositions

As indicated above, the invention also relates to a pharmaceutical composition which comprises at least one oligonucleotide of the invention as an active ingredient. It will be understood that the pharmaceutical composition according to the invention optionally comprises a pharmaceutical carrier and that the pharmaceutical composition optionally comprises other compounds, such as chemotherapeutic compounds, anti-inflammatory compounds, antiviral compounds and / or immunomodulation compounds.

The oligonucleotides of the invention may be used "as is" or in the form of a variety of pharmaceutically acceptable salts. As used herein, the term "pharmaceutically acceptable salts" refers to salts that retain the desired biological activity of the above identified oligonucleotides and exhibit minimal undesirable toxicological effects. Non-limiting examples of such salts may be formed with organic amino acid and base addition salts formed with metal cations such as zinc, calcium bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, potassium and the like. or with a cation formed from deamony, N, N-dibenzethiene diamine, D-glycosamine, tetraethylammonium or ethyl nodiamine.

In one embodiment of the invention, the oligonucleotide may be in the form of a prodrug. Oligonucleotides are negatively charged ions. Due to the lipophilic nature of cell membranes, cell uptake of oligonucleotide is reduced compared to neutral or lipophilic equivalents. This "impediment" in polarity can be avoided by using the prodrug approach (see, for example, Crooke, RM (1998) in Crooke, ST Antisense Research and Application. Springer-Verlag, Berlin, Germany, vol. 131, pages 103). -140).

Pharmaceutically acceptable binding agents and adjuvants may comprise part of the formulated drug.

Examples of dispensing methods for dispensing the therapeutic agents described herein, as well as details of pharmaceutical formulations, salts, can be described anywhere, for example, in Provisional Applications US 60 / 838,710 and 60 / 788,995, which are incorporated herein by reference and Danish Application PA 2006 00615, which is also incorporated herein by reference.

Pharmaceutical compositions of the present invention include, but are not limited to, liposome-containing solutions and formulations. These compositions may be generated from a variety of components which include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semi-solids. Drug delivery to tumor tissue can be enhanced through vehicle-mediated including, but not limited to, cationic liposomes, cyclodextrins, porphyrin derivatives, branched chain dendrimers, depolyethylenimine polymers, nanoparticles and microspheres (Dass CR. J Pharm Pharmacol2002; 54 (1): 3-27). The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional methods in the pharmaceutical industry. Such techniques include the step of maintaining the active ingredients associated with the pharmaceutical carrier (s) or excipient (s). In general, the formulations are prepared by closely and intimately associating the active ingredients with liquid carriers or finely divided solid carriers, or both, and then, if necessary, product formation. The compositions of the present invention may be formulated in any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels and suppositories. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. Suspension may also contain stabilizers. The compounds of the invention may also be conjugated to active drug substances, for example aspirin, ibuprofen, a sulfa drug, an anti-diabetic, an antibacterial or an antibiotic.

In another embodiment, the compositions of the invention may contain one or more oligonucleotide compounds targeting a first micron-RNA and one or more additional oligonucleotide compounds targeted to a second target microRNA. Two or more combined compounds may be used together or sequentially.

The compounds disclosed herein are useful for a number of therapeutic applications as indicated above. In general, therapeutic methods of the invention include administering a therapeutically effective amount of an oligonucleotide to a mammal, particularly a human. In one embodiment, the present invention provides pharmaceutical compositions containing (a) one or more compounds of the invention and (b) one or more chemotherapeutic agents. When used with the compounds of the invention, such chemotherapeutic agents may be used individually, sequentially or in combination with one or more other such chemotherapeutic agents or in combination with radiotherapy. All chemotherapeutic agents known to those skilled in the art are incorporated herein as combined compound treatments according to the invention. Other active agents, such as anti-inflammatory drugs including, but not limited to, non-steroidal anti-inflammatory drugs and corticosteroids, antiviral drugs and immunomodulating drugs, may also be combined in the inventive compositions. Two or more combined compounds may be used together or subsequently.

Examples of therapeutic indications which may be treated by the pharmaceutical compositions of the invention:

<table> table see original document page 78 </column> </row> <table>

Tropomisin 1 suppressor gene mRNA (TPM1) was indicated as a target miR-21. Myotropin mRNA (mtpn) was indicated as a target miR 375.

In yet another aspect, the present invention relates to the resting of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of a selected group disease consisting of: atherosclerosis, hypercholesterolaemia and hyperlipidaemia; cancer, glioblastoma, breast cancer, lymphoma, lung cancer; diabetes, metabolic disorders; myoblast differentiation; The present invention further relates to an oligonucleotide according to the invention for use in the treatment of a selected disease group consisting of: atherosclerosis, hypercholesterolemia and hyperlipidemia; cancer, glioblastoma, breast cancer, lymphoma, lung cancer, diabetes. , metabolic disorders; myoblast differentiation; immune disorders.

The invention provides a method of treating an individual suffering from a disease or condition selected from the group consisting of: atherosclerosis, hypercholesterolemia and hyperlipidemia; cancer, glioblastoma, breast cancer, lymphoma, lung cancer, diabetes, metabolic disorders; myoblast differentiation; immune disorders, the method comprising the step of administering an oligonucleotide or pharmaceutical composition of the invention to the individual in need thereof.

Cancer

In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for treating cancer. In another aspect, the present invention relates to a method for the treatment of cancer. treating or prophylaxis against cancer, said method comprising administering an oligonucleotide of the invention or a conjugate thereof or a pharmaceutical composition of the invention to a patient in need thereof.

Such cancers may include lympho-reticular neoplasia, leukemial lymphoblastic tumors, brain tumors, gastric tumors, plasmacitomas, myelomamultiple, leukemia, connective tissue tumors, lymphomas, and solid tumors.

In the use of a compound of the invention or a conjugate thereof for the manufacture of a cancer treatment medicament, said cancer may suitably be in the form of a solid tumor. Similarly, in the cancer treatment method disclosed herein The cancer may suitably be in the form of a solid tumor.

In addition, said cancer is also suitably a carcinoma. Carcinoma is typically selected from the group consisting of malignant melanoma, basal cell carcinoma, ovarian carcinoma, breast carcinoma, non-small cell lung cancer, renal cell carcinoma, bladder carcinoma, recurrent superficial bladder cancer, carcinoma. stomach cancer, prostatic carcinoma, pancreatic carcinoma, lung carcinoma, cervical carcinoma, cervical dysplasia, papillomatoselaringeal, colon carcinoma, colorectal carcinoma and solid tumors. Mostly, said carcinoma is selected from the group consisting of malignant melanoma, non-small cell lung cancer, breast carcinoma, colon carcinoma and renal cell carcinoma. Melanomamaligno is typically selected from the group consisting of superficially dispersing melanoma, nodular melanoma, lentigo malignant melanoma, acral mela-noma, amelanotic melanoma and desmoplastic melanoma.

Alternatively, cancer may suitably be a sarcoma. Sarcoma is typically in the form selected from the group consisting of osteosarcoma, Ewing's sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma, and Kaposi's sarcoma.

Alternatively, cancer may suitably be a glioma.

Another embodiment is directed to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a cancer treatment medicament, wherein said medicament further comprises a chemotherapeutic agent selected from the group consisting of adrenocorticosteroids. such as prednisone, dexamethasone or decadron; altretamine (Hexalen, hexamethylmelamine (HMM)); amifostine (Ethyol); aminoglutethimide (Cytadren); amsacrine (M-AMSA); anas-trozole (Arimidex); androgens, such as testosterone; asparaginase (Els-par); Calmette-Gurin bacillus; bicalutamide (Casodex); bleomycin (blenoxane); busulfan (Myleran); carboplatin (paraplatin); carmustine (BCNU, BiCNU); chlorambucil (Leukeran); chlorodeoxyadenosine (2-CDA, cladribine, leustatin); cisplatin (platinol); cytosine arabinoside (cytarabine); Dakarbazine (DTIC); dactinomycin (actinomycin-D, Cosmegen); daunorubicin (cerubidine); docetaxel (taxotamer); doxorubicin (adriamycin); epirubicin; estramustine (Emcyt); estrogens, such as diethyl stilbestrol (DES); etoposide (VP-16, VePesid, Etopophos); fludarabine (Fludara); flutamide (Eule-xin); 5-FUDR (floxuridine); 5-fluorouracil (5-FU); gemcitabine (Gemzar); go-serelin (Zodalex); herceptin (Trastuzumab); hydroxyurea (Hydrea); idarubicin (idamycin); ifosfamide; IL-2 (proleucine, aldesleucine); alpha interferon (Intron A, Roferon A); irinotecan (Camptosar); Ieuprolide (Lupron); Ievamisola (ergamisola); Iomustine (CCNU); mechloratamine (Mustargen, denitrogen mustard); melphalan (Alkeran); mercaptopurine (Purinethol, 6-MP); methotrexate (mexato); mitomycin-C (mutamucine); mitoxantrone (novantrone), octreotide (sandostatin); pentostatin (2-deoxycoformycin, Nipent); plicamycin (mitramycin, mitracin); prorocarbazine (matulane); streptozocin; ta-moxifine (Nolvadex); taxol (Paclitaxel); teniposide (Vumon, VM-26); thiotepa, topotecan (Hycamtin); tretinoin (Vesanoid, all-trans-retinoic acid); vinblastatin (Valban); vincristine (Oncovin) and vinorelbine (Navelbine). Also said treatment further comprises the administration of another chemotherapeutic agent selected from taxanes, such as Taxol1 Paclitaxel or Docetaxel.

Similarly, the invention is further directed to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for the treatment of cancer, wherein said treatment further comprises the administration of another chemotherapeutic agent selected from the group consisting of adrenocorticosteroids, such as prednisone, dexamethasone or decadron; altretamine (Hexalen, hexamethylmelamine (HMM)); amifostine (Ethyol); aminoglutethimide (Cyta-dren); amsacrine (M-AMSA); anastrozole (Arimidex); androgens, such as testosterone; asparaginase (Elspar); Calmette-Gurin bacillus; bicalutami-da (Casodex); bleomycin (blenoxane); busulfan (Myleran); carboplatin (paraplatin); carmustine (BCNU, BiCNU); chlorambucil (Leukeran); chlorodeoxy adenosine (2-CDA, cladribine, leustatin); cisplatin (platinol); cytosine arabinoside (cytarabine); dacarbazine (DTIC); dactinomycin (actinomycin-D, Cosmegen); daunorubicin (cerubidine); docetaxel (taxotamer); doxorubicin (adriamycin); epirubicin; estramustine (Emcyt); estrogens, such as diethyl stilbestrol (DES); etoposide (VP-16, VePesid, Etopophos); fludarabine (Fludara); flutamide (Eulexin); 5-FUDR (floxuridine); 5-fluorouracil (5-FU) gemcitabine (Gemzar); goserelin (Zodalex); herceptin (Trastuzumab); hydroxyurea (Hydrea); idarubicin (idamycin); ifosfamide; IL-2 (proleucine, al-desleucine); alpha interferon (Intron A, Roferon A); irinotecan (Camptosar); Ieuprolide (Lupron); Ievamisola (ergamisola); Iomustine (CCNU); mine mechratata (Mustargen, nitrogen mustard); melphalan (Alkeran); mercapto-purine (Purinethol, 6-MP); methotrexate (mexato); mitomycin-C (mutamucine); mitoxantrone (novantrone); octreotide (sandostatin); pentostatin (2-deoxycoformycin, Nipent); plicamycin (mitramycin, mitracin); prorocarbazine (matulane); streptozocin; tamoxifin (Nolvadex); taxol (Paclitaxel); tenoposid (Vumon, VM-26); thiotepa; topotecan (Hycamtin); tretinoin (Vesa-noid, all-trans retinoic acid); vinblastine (Valban); vincristine (Oncovin) evinorelbine (Navelbine). Also said treatment further comprises the administration of another chemotherapeutic agent selected from taxanes, such as Taxol, Paclitaxel or Docetaxel.

Alternatively, the invention is further directed to a method for treating cancer, said method comprising administering an oligonucleotide of the invention or a conjugate thereof or a pharmaceutical composition according to the invention to a patient in need thereof and further comprising administering a another chemotherapeutic agent. Said further administration may be such that the other chemotherapeutic agent is conjugated to the compound of the invention, is present in the pharmaceutical composition or is administered in a separate formulation.

Infectious diseases

The compounds of the invention are believed to be broadly applicable to a wide range of infectious diseases, such as commodity, tetanus, pertussis, polio, hepatitis B, hepatitis C, hemophilus influenzae, measles, mumps and rubella.

Hsa-miR122 is indicated for hepatitis C infection and as such the oligonucleotide according to the invention which aims miR-122 alvop can be used to treat hepatitis C infection.

Accordingly, in yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for treating an infectious disease as well as a method for treating an infectious disease, said method comprising administering an oligonucleotide according to the invention or a conjugate thereof or a pharmaceutical composition according to the invention to a patient in need thereof. Inflammatory diseases

The inflammatory response is an essential mechanism of defense against organism attack against infectious agents and is also implicated in the pathogenesis of many acute and chronic diseases, including autoimmune disorders. Although necessary to combat pathogens, the effects of an inflammatory outburst can be devastating. Therefore, it is often necessary to restrict the symptomatology of inflammation with the use of anti-inflammatory drugs. Inflammation is a complex process usually triggered by tissue damage that includes activation of a large set of enzymes, increased vascular permeability and blood fluid leakage, cell migration and release of chemical mediators, all aimed at destroying and repairing the injured tissue.

In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for treating an inflammatory disease, as well as a method for treating an inflammatory disease. said method comprising administering a oligonucleotide according to the invention or a conjugate thereof or a pharmaceutical composition according to the invention to a patient in need thereof.

In a preferred embodiment of the invention, inflammatory disease is a rheumatic disease and / or connective tissue disease, such as rheumatoid arthritis, systemic lupus erythematosus (SLE) or lupus, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis. ulcerative colitis, Crohn's disease, vasculitis, psoriatic arthritis, exfoliative psoriatic dermatitis, pemphigus vulgaris and Sjorgren's syndrome, in particular inflammatory bowel disease and Crohn's disease.

Alternatively, the inflammatory disease may be non-rheumatic inflammation, such as bursitis, synovitis, capsulitis, tendonitis and / or other inflammatory lesions of traumatic and / or sports origin.

Metabolic diseases

A metabolic disease is a disorder caused by the accumulation of naturally produced chemicals in the body. These illnesses are usually serious, some even life threatening. Others may decrease physical development or cause mental retardation. Most babies with these disorders at first show no obvious signs of the disease. Proper birth search can often uncover these problems. With early diagnosis and treatment, metabolic diseases can often be effectively treated.

In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for treating a metabolic disease, as well as a method for treating a metabolic disease. said method comprising administering a oligonucleotide according to the invention or a conjugate thereof or a pharmaceutical composition according to the invention to a patient in need thereof.

In a preferred embodiment of the invention, metabolic disease is selected from the group consisting of Amyloidosis, Biotinidase, OMIM (Hereditary Mendelin Online Hereditary), Crigler Najjar Syndrome, Diabetes, Fabry Support & Information Group, acid oxidation disorders. fatty acid, Galactosemia, glucose-6-phosphate dehydrogenase (G6PD) deficiency, glutaric aciduria, International Organization for Glutaric Acidemia, Glutaric Acidemia Type I, Glutaric Acidemia Type II, Glutaric Acidemia Type II, Hypophosphatemia Familial F-HYPDRR, Vitamin D-resistant Rickets, Krabbe disease, Long-chain 3-hydroxycil dedehydrogenase (LCHAD) deficiency, Groups withManosidosis, Urinary maple syrup disease, Mitochondrial disorders, Mucopolysaccharidosis syndromes: Niemann Pick1 Organic Acidemia, PKU , Pompe disease, Porphyria, metabolic syndrome, Hyperlipidemia and hereditary lipid disorders , Trimethylaminuria: the bad-odor syndrome and urea cycle disorders. Liver disorders

In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for the treatment of a liver disorder, as well as a method for the treatment of a liver disorder, said method comprising administering an oligonucleotide according to the invention or a conjugate thereof or a pharmaceutical composition according to the invention to a patient in need thereof.

In a preferred embodiment of the invention, the liver disorder is selected from the group consisting of biliary atresia, AlagillelAlfa-1 Antitrypsin syndrome, Tyrosinemia, neonatal hepatitis and Wilson's disease.

The oligonucleotides of the present invention may be used as screening reagents for diagnostic, therapeutic and pro-philatic products. In research, the oligonucleotide may be used to specifically inhibit synthesis of target genes in experimental cells and animals, thereby facilitating functional analysis of the target or an appreciation of its usefulness as a target for therapeutic intervention. In diagnosis, oligonucleotides can be used to detect and quantify target expression in cells and tissues by northern blotting, similar in situ hybridization or other techniques. For therapeutic products, an animal or human suspected of having a disease or disorder which can be treated by modulating target expression is treated by administering the oligonucleotide compounds according to the present invention. Further provided are methods of treating an animal, particularly mouse and rat, and treating a human suspected or likely to have a disease or condition associated with expression of the target by administering a therapeutically or prophylactically effective amount. of one or more of the oligonucleotide compounds or compositions of the invention.

Therapeutic use of oligonucleotide targeting miR-122a

In the examples section, it is shown that an LNA-antimiR®, such as SPC3372, targeting miR-122a, reduces noplasma cholesterol levels. Therefore, another aspect of the invention is the use of the above described oligonucleotide aiming at miR-122a as a medicament.

Still another aspect of the invention is the use of oligonucleotide

described above aiming at miR-122a for the preparation of a medicament for the treatment of increased plasma cholesterol levels. Those skilled in the art will appreciate that increased levels of noplasma cholesterol are undesirable as this increases the risk of various conditions, for example atherosclerosis.

Still another aspect of the invention is the use of the above described oligonucleotide which targets miR-122a for over-regulation of Nrdg3, Aldo A, Bckdk or CD320 demRNA levels. Other embodiments:

The following embodiments may be combined with the other embodiments of the invention as described herein.

1. An oligonucleotide having a length of 12 to 26 nu-cleotides having a central DNA sequence from positions two to seven or from positions three to eight, counting from the 3 'end: at least one such as one, preferably at least two such two or three DNA units in said sequence have been replaced by their corresponding LNA unit; or a conjugate thereof.

2. An oligonucleotide having a length of 12 to 26 nucleotides having a central DNA sequence from positions two to seven or from positions three to eight, counting from the 3 'end, each of at least one such as one. preferably at least two such two or three DNA units in said sequence have been replaced by their corresponding LNA unit; or a conjugate thereof.

3. An oligonucleotide having a length of 12 to 26 nucleotides having a central DNA sequence from positions two to seven or from positions three to eight, counting from the 3 ': ttacga end at least one such as one. preferably at least two such two or three DNA units in said sequence have been replaced by their corresponding LNA unit; or a conjugate thereof.

4. An oligonucleotide having a length of 12 to 26 nucleotides having a central DNA sequence from positions two to seven or from positions three to eight, counting from the 3 'end: at least one, such as one, of. preferably at least two such two or three DNA units in said sequence have been replaced by their corresponding LNA unit; or a conjugate thereof.

5. The oligonucleotide according to any one of embodiments 1 to 4 or a conjugate thereof, wherein at least two, such as two or three DNA units from positions one to six, two to seven or three, counting the from the 3 'end, they were replaced by their corresponding LNA unit and wherein the LNA units are separated by at least one DNA unit.

6. The oligonucleotide according to embodiment 5 or a conjugate thereof, wherein the number of consecutive DNA units is deposited one to six, two to seven or three to eight, counting from the 3 'end, is at most two.

7. The oligonucleotide according to embodiment 6 or a conjugate thereof, wherein each second nucleotide of positions one, two to seven, or three to eight, counting from the 3 'end, is a LNA unit.

8. The oligonucleotide according to embodiment 6 or a conjugate thereof, wherein each third nucleotide of positions one, two to seven or three to eight, counting from the 3 'end, is a LNA unit.

9. The oligonucleotide according to embodiment 6 or a conjugate thereof, wherein the substitution pattern for nucleotides at positions one to six, two to seven or three to eight, counting from the 3 'end, is selected from the group consisting of: Χ, χ, χ, χ, χ, Χ, χ, X, eX; where "X" denotes an LNA unit and "x" denotes a DNA unit.

10. The oligonucleotide according to embodiment 9 or a conjugate thereof, wherein the substitution pattern for nucleotides at positions one to six, two to seven or three to eight, counting from the 3 'end, is selected from the group consisting of Χ, χ, χ, X, ex; where "X" denotes one unit of LNA and "x" denotes one unit of DNA.

11.0 oligonucleotide according to embodiment 1 or a conjugate thereof having a DNA sequence of positions one to seven, two to eight or three to nine, counting from the 3 'end: acgttta, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

12. The oligonucleotide according to embodiment 2 or a conjugate thereof having a DNA sequence of positions one to seven, two to eight or three to nine, counting from the 3 'end: ctcacac, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

13. The oligonucleotide according to embodiment 3 or a conjugate thereof having a DNA sequence of positions one to seven, two to eight or three to nine, counting from the 3 'end: ttacgat, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

14. The oligonucleotide according to embodiment 4 or a conjugate thereof having a DNA sequence of positions one to seven, two to eight or three to nine, counting from the 3 'end: acaagca, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

15. The oligonucleotide according to any one of modes 11 to 14 or a conjugate thereof, wherein at least two, such as two, three or four DNA units from positions one to seven, two to eight or three to nine, counting from the 3 'end, were replaced by their corresponding LNA unit and wherein the LNA units are separated by at least one DNA unit.

16. The oligonucleotide according to embodiment 15 or a conjugate thereof, wherein the number of consecutive DNA units at positions one to seven, two to eight or three to nine, counting from the 3 'end, is no. maximum two.

17. The oligonucleotide according to embodiment 16 or a conjugate thereof, wherein each second nucleotide of one, two to eight or three to nine positions, counting from the 3 'end, is a LNA unit.

18. The oligonucleotide according to embodiment 16 or a conjugate thereof, wherein each third nucleotide of positions one, two to eight, or three to nine, counting from the 3 'end, is a LNA unit.

19. The oligonucleotide according to embodiment 16 or a conjugate thereof, wherein the substitution pattern for nucleotides at positions one through seven, two to eight or three to nine, counting from the 3 'end, is selected from the group consisting of Xx, xx, xx, xx, xx, xx, xx, xx, xx, xx, xx, and xx, where "x" denotes an LNA unit and "x" denotes a DNA unit.

20. The oligonucleotide according to embodiment 19 or a conjugate thereof, wherein the substitution pattern for nucleotides at positions one through seven, two to eight or three to nine, counting from the 3 'end, is selected from the group consisting of Xx1 xx, xX, Xx, xX, and xx, where "X" denotes one unit of LNA and "x" denotes one unit of DNA.

21. The oligonucleotide according to embodiment 11 or a conjugate thereof having a DNA sequence of positions one to eight, two to nine or three to ten, counting from the 3 'end: at least one such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

22. The oligonucleotide according to embodiment 12 or a conjugate thereof having a DNA sequence of positions one to eight, two to nine or three to ten, counting from the 3 'end: ctcacact, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

23. The oligonucleotide according to embodiment 13 or a conjugate thereof having a DNA sequence of positions one to eight, two to nine or three to ten, counting from the 3 'end: ttacgatt, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

24. The oligonucleotide according to embodiment 14 or a conjugate thereof having a DNA sequence of positions one to eight, two to nine or three to ten, counting from the 3 'end: acaagcaa, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three or four DNA units in said sequence have been replaced by their corresponding LNA unit.

25. The oligonucleotide according to any one of the 21 to 24 or a conjugate thereof, wherein at least two, such as two, three or four DNA units from positions one to eight, two to one or three to ten, counting from the 3 'end, were replaced by their corresponding LNA unit and wherein the LNA units are separated by at least one DNA unit.

26. The oligonucleotide according to embodiment 25 or a conjugate thereof, wherein the number of consecutive DNA units at positions one to eight, two to nine or three to ten, counting from the 3 'end, is no. maximum two.

27. The oligonucleotide according to embodiment 26 or a conjugate thereof, wherein each second nucleotide of positions one eighth, two to nine or three to ten, counting from the 3 'end, is a LNA unit.

28. The oligonucleotide according to embodiment 26 or a conjugate thereof, wherein each third nucleotide of positions one eighth, two to nine or three to ten, counting from the 3 'end, is a LNA unit.

29. The oligonucleotide according to embodiment 26 or a conjugate thereof, wherein the substitution pattern for nucleotides at positions one to eight, two to nine or three to ten, counting from the 3 'end, is selected from the group consisting of xxx, xxx, xxx, xxx, xxx, xxx, xxx, xxx, xxx, xxx, xxx, xxx, xxx, xxx, xxx, and xxx; where "X" denotes one unit of LNA and "x" denotes one unit of DNA.

30. The oligonucleotide according to embodiment 29 or a conjugate thereof, wherein the substitution pattern for nucleotides at positions one to eight, two to nine or three to ten, counting from the 3 'end, is selected from the group consisting of Xxx, xxX, xXx, XxX, xXx, and xxX; where "X" denotes an LNA unit and "x" denotes a DNA unit.

31. The oligonucleotide according to embodiment 21 or a conjugate thereof having a DNA sequence of positions one to one, two to ten or three to eleven, counting from the 3 'end: at least one such as one, preferably at least two, such as two, more preferably at least three, such as three, even more preferably at least four, such as four or five DNA units in said sequence have been replaced by their corresponding corresponding LNA unit. .

32. The oligonucleotide according to embodiment 22 or a conjugate thereof having a DNA sequence of positions one to one, two to ten or three to eleven, counting from the 3 'end: ctcacactg, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three, even more preferably at least four, such as four or five DNA units in said sequence have been replaced by their corresponding corresponding LNA unit. .

33. The oligonucleotide according to embodiment 23 or a conjugate thereof having a DNA sequence of positions one to one, two to ten or three to eleven, counting from the 3 'end: ttacgatta, wherein at least one such as one, preferably at least two, such as two, more preferably at least three, such as three, even more preferably at least four, such as four or five DNA units in said sequence have been replaced by their corresponding corresponding LNA unit. .

34. The oligonucleotide according to embodiment 24 or a conjugate thereof having a DNA sequence of positions one to one, two to ten or three to eleven, counting from the 3 'end: acaagca-ag, wherein at at least one, such as one, preferably at least two, such as two, more preferably at least three, such as three, even more preferably at least four, such as four or five DNA units in said sequence have been replaced by their corresponding LNA unit. .

35. The oligonucleotide according to any one of 21 or 24 or a conjugate thereof, wherein at least two, such as two, three, four or five DNA units from positions one to nine, two to ten or three at eleven, counting from the 3 'end, were replaced by their corresponding LNA unit and wherein the LNA units are separated by at least one DNA unit.

36. The oligonucleotide according to embodiment 35 or a conjugate thereof, wherein the number of consecutive DNA units at positions one to nine, two to ten, or three to eleven, counting from the 3 'end, is at least maximum two.

37. The oligonucleotide according to embodiment 36 or a conjugate thereof, wherein each second nucleotide of positions one anove, two to ten or three to eleven, counting from the 3 'end, is a LNA unit.

38. The oligonucleotide according to embodiment 36 or a conjugate thereof, wherein each third nucleotide of positions one anove, two to ten or three to eleven, counting from the 3 'end, is a LNA unit.

39. The oligonucleotide according to embodiment 36 or a conjugate thereof, wherein the substitution pattern for nucleotides at positions one to nine, two to ten or three to eleven, counting from the 3 'end, is selected from the group consisting of XxxX, XxXx, xxXx,

xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, xxxx, and xxxx; where "X" denotes one unit of LNA and "x" denotes one unit of DNA.

40. The oligonucleotide according to any one of the preceding embodiments or a conjugate thereof, wherein said nucleotide is 12 to 24 nucleotides in length, such as a length of 12 to 22 nucleotides, preferably a length of 12 to 20 nucleotides, such as a length of 12 to 19 nucleotides, more preferably a length of 12 to 18 nucleotides, such as a length of 12 to 17 nucleotides, even more preferably a length of 12 to 16 nucleotides. .

41. The oligonucleotide according to embodiment 1 tendouma sequence selected from the group consisting of Ca-tgMeCatGgaTttGcaMe, MeC tgMeCatGgaTttGca, MeCatGgaTttGcaMeC, tGcAtGgAtTtGcAc, CATG-gAtTtGcAc, MeCatGGatTtGcAMeC, TgMeCatGGatTtGcAMeC and TgMeCaTg-GaTTtGcACa; wherein the lower case letter identifies the nitrogenous base of a DNA unit and a capital letter identifies the nitrogenous base of an LNA unit; or a conjugate thereof. (SEQ IDs NO 82-89)

42. The oligonucleotide according to embodiment 2 tendouma sequence selected from the group consisting of cMeCatTgtCacActMeC-ca cMeCatTgtAacTctMeCca, ccAttGtcAcaMeCtcMeCa, cMeCatTgtMeCacActMeCc, atTgtMeCacActMeCc, ccAttGtcAcaMeCtcMeC, AttGtcAcaMeCtcMeC, aTtGtMeCa-CaMeCtMeCc, AttGTcaMeCaMeCtMeCMeC, MeCcAttGTcaMeCaMeCtMeCMeC, MeC-caTtgTcacActcMeCa and MeCMeCAttgtcacacTMeCMeCa; wherein the lower case letter identifies the nitrogenous base of a DNA unit and a capital letter identifies the nitrogenous base of an LNA unit; or a conjugate of the same. (SEQ IDs NO 90-101)

43. The oligonucleotide according to modality 3 has a sequence selected from the group consisting of tMeCacGatTagMeCat-Taa1 aTcaMeCgaTtaGcaTta, TcAcGaTtAgMeCaTtAa, atcAcGaTtAgweCaTta where a lower case nitrogen letter identifies a lower case letter nitrogen unit deLNA; or a conjugate thereof. (SEQ IDs NO 102-105).

44. The oligonucleotide according to embodiment 4 has a sequence selected from the group consisting of gAgcMeCgaAcgAacAa, gcMeCgaAcgAacAa, GaGcMeCgAaMeCgAaMeCaA, and a base letter unit that identifies a base unit of a unit of nitrogen and a base unit of a letter; deLNA; or a conjugate thereof. (SEQ IDs NO 106-109).

45. The oligonucleotide according to any of the preceding embodiments or a conjugate thereof, wherein the oligonucleotide comprises at least one internucleoside linking group which differs from phosphodiester.

46. The oligonucleotide according to embodiment 45 or a conjugate thereof, wherein said internucleoside linking group which differs from phosphodiester is phosphorothioate.

47. The oligonucleotide according to embodiment 46 or a conjugate thereof, wherein all internucleoside linking groups are phosphorothioate.

48. The oligonucleotide according to any one of the preceding embodiments or a conjugate thereof, wherein said LNA units are independently selected from the group consisting of thio-LNA units, amino-LNA units and oxide units. -LNA.

49. The oligonucleotide according to embodiment 48 or a conjugate thereof, wherein said LNA units are in D-formate.

50. The oligonucleotide according to embodiment 48 or a conjugate thereof, wherein said LNA units are beta-D oxide-LNA units.

51.0 oligonucleotide according to any of the preceding embodiments or a conjugate thereof for use as a medicament.

52. A pharmaceutical composition comprising an oligonucleotide according to any one of embodiments 1-50 or a conjugate thereof and a pharmaceutically acceptable carrier.

53. The composition according to embodiment 52, wherein said carrier is saline or buffered saline.

Use of an oligonucleotide according to any one of embodiments 1-50 or a conjugate thereof or a composition according to embodiment 52 for the manufacture of a cancer treatment medicament.

A method for treating cancer comprising the step of administering an oligonucleotide according to any one of embodiments 1-50 or a conjugate thereof or a composition according to embodiment 52.

Use of an oligonucleotide according to any one of embodiments 1-50 or a conjugate thereof or a composition according to embodiment 52 for the preparation of a medicament for treating increased plasma cholesterol levels.

57. Use of an oligonucleotide according to any one of embodiments 1-50 or a conjugate thereof or a composition according to embodiment 52 for over-regulating nrdg3, Aldo A, Bckdk or CD320 mRNA levels.

EXPERIMENTAL

Example 1: Monomer Synthesis

The monomeric building blocks of LNA and derivatives thereof were prepared following published procedures and references cited therein; see, for example, WO 03/095467 A1 and D.S. Peder-sen, C. Rosenbohm, T. Koch (2002) Preparation of LNA Phosphoramidites, Synthesis 6, 802-808.

Example 2: Oligonucleotide Synthesis

Oligonucleotides were synthesized using the phosphoramidite-like approach on an Expedite 89OO / MOSS (Multiple Oligonucleotide Synthesis System) synthesizer on a 1 pmol or 15 pmoles scale. For large-scale synthesis, an Akta Oligo Pilot (GE Healthcare) was At the end of the synthesis (DMT-on), oligonucleotides were cleaved from the solid support using aqueous ammonia for 1-2 hours at room temperature and still unprotected for 4 hours at 65 ° C. Oligonucleotides were purified by reverse phase HPLC (RP-HPLC). After removal of the DMT group, oligonucleotides were characterized by EA-HPLC, RP-HPLC and CGE and the molecular mass was further confirmed by ESI-MS. See below for more details.

Preparation of LNA Solid Support:

Preparation of LNA Succinyl Hemiester

5'-O-Dmt-3'-hydroxy-LNA monomer (500 mg), succinic anhydride (1.2 eq.) And DMAP (1.2 eq.) Were dissolved in DCM (35 mL). The reaction was stirred at room temperature overnight. After extractions with 0.1 M NaH 2 PO 4, pH 5.5 (2x) and brine (1x), the organic layer was further dried with anhydrous Na 2 SO 4, filtered and evaporated. The dehemi ester derivative was obtained in 95% yield and was used without further purification.

The above prepared hemiester derivative (90 pmoles) was dissolved in a minimum amount of DMF1 DIEA and pyBOP (90 pmoles) were added and mixed together for 1 min. This pre-activated mixture was combined with LCAA-CPG (500 Å, 80-120 mesh size, 300 mg) in a hand-shaken synthesizer. After 1.5 hours at room temperature, the support was filtered and washed with DMF, DCM and MeOH. After drying, the loading was determined to be 57 pmoles / g (see Tom Brown, Dorcas JSBrown. Modem machine- aided methods of oligo-godeoxyribonucleotide synthesis In: F. Eckstein, editor, Oligonucleotides and Analogues A Practical Approach Oxford: IRL Press, 1991: 13-14).

Oligonucleotide Elongation

Coupling of phosphoramidites (A (bz), G (ibu), 5-methyl-C (bz)) or Τ-β-cyanoethylphosphoramidite) is performed using a 0.1 M solution of protected 5'-0-DMT-daamidite in acetonitrile and DCI (4,5-dicyanoimidazole) and macetonitrile (0.25 M) as activator. Thiolation is performed using dexanthan chloride (0.01 M in acetonitrile: 10% pyridine). The rest of the reagents are those typically used for oligonucleotide synthesis. Purification by RP-HPLC:

Column: Xterra RPi8

Flow rate: 3 mL / min

Buffers: 0.1 M Ammonium Acetate, pH 8, and Acetonitrile

Abbreviations:

DMT: Dimethoxytrityl

DCI: 4,5-Dicyanoimidazole

DMAP: 4-Dimethylaminopyridine

DCM: Dichloromethane

DMF: Dimethylformamide

THF: Tetrahydrofuran

DIEA: / V, / V-diisopropylethylaminePyBOP: Benzotriazole-1-yl-oxy-tris-pyrrolidine-phosphonium hexafluorophosphate

Bz: Benzoyl

lbu: Isobutyril

Example 3: Anti-miR LNA Oligonucleotide Design and Melting Temperatures

Target Micro-RNA:

miR-122a: 5'-uggagugugacaaugguguuugu-3 'SEQ ID NO: 1miR-122a 3' to 5 ': 3'-uguuugugguaacagugugaggu-5' (SEQ IDNO: 1 reverse orientation)

Table 1: Anti-miR and Tm LNA oligonucleotide sequences:

<table> table see original document page 98 </column> </row> <table>

Lower case: DNA, upper case: LNA (all C of the LNA have been methylated), underlined: wrong combination.

Fusion temperatures were evaluated for the sequence of mature miR-122a using a phosphorothioate-linked synthetic miR-122a RNA oligonucleotide.

The anti-miR of the double LNA / miR-122a oligo was diluted to 3 μΜ in 500 μl of RNase-free H2O which was then mixed with 500 μl of 2x dimerization buffer (final oligo / double concentration of 1.5 μΜ , 2x Tm buffer: 200 mM NaCl, 0.2 mM EDTA, 20 mM NaP, pH 7.0, treated with DEPC to remove RNases). The mixture was first heated to 95 degrees for 3 minutes, then allowed to cool to room temperature (RT) for 30 minutes.

Following RT incubation, Tm was measured on a Lambda 40UV / VIS Spectrophotometer with a PeltierPTP6 temperature programmer using PE Templab software (Perkin Elmer). The temperature was raised from 20 ° C to 95 ° C and then decreased again to 20 ° C, continuously recording the absorption at 260 nm. First derivative and melting and annealing temperature maxima were used to evaluate the melting / annealing point (Tm), both providing similar / similar Tm values. For the first derivative, 91 points were used to calculate the decline.

By substituting the antimir oligonucleotide and the complementary RNA molecule, the above assay can be used to determine the Tm of other oligonucleotides, such as oligonucleotides according to the invention.

However, in one embodiment, Tm may be made with a complementary DNA molecule (phosphorothioate binding). Typically, Tm measured against a complementary DNA molecule is about 10 ° C lower than Tm with an equivalent RNA complement. The Tm measured using the DNA complement can therefore be used in cases where the doublet has a very high Tm. Melting temperature (Tm) measurements:

<table> table see original document page 100 </column> </row> <table>

It is recognized that for oligonucleotides with very high Tm, the above Tm assays may be insufficient to determine Tm. In such cases, the use of a phosphorothioated complementary DNA molecule may further decrease Tm.

The use of formamide is routine in oligonucleotide hybridization analysis (see Hutton 1977, NAR 4 (10) 3537-3555). In the above assay, inclusion of 15% formamide typically decreases Tm by about 9 ° C and 50% formamide inclusion typically decreases Tm by about 30 ° C. Using these ratios, therefore, is It is possible to determine the comparative Tm of an oligonucleotide against its complementary RNA molecule (phosphodiester), even when the Tm of the pair is, for example, greater than 95 ° C (in the absence of formamide).

For very high Tm oligonucleotides, an alternative method of determining Tm is to titrate and operate on a gel to observe single versus double strand and, through these concentrations and proportions, determine the Kd (the dissociation constant) to which it relates. -related to deltaG and also to Tm.

Example 4: LNA oligonucleotide stability in human or rat plasma

The stability of the LNA oligonucleotide was tested in human or rat plasmid (could also be mouse, monkey or dog plasma). In 45 μΙ of plasma, 5 μΙ of LNA oligonucleotide is added (at a final concentration of 20 μΜ). LNA oligonucleotides are incubated in plasma for times ranging from 0 to 96 hours at 37 ° C (plasma is tested for nuclease activity for up to 96 hours and shows no difference in nuclease cleavage pattern).

At the indicated time, the sample was frozen in liquid nitrogen. 2 µL (equal to 40 pmoles) of plasma LNA oligonucleotide was diluted by the addition of 15 µl of water and 3 µL 6x loading dye (Invitrogen). As a marker, a 10 bp Iadder (Invitrogen, USA10821-015) is used. To 1 μl of Iadder1 1 μl of 6x loading buffer and 4 μl of water are added. The samples are mixed, heated to 65 ° C for 10 min and loaded onto a pre-operation gel (16% acrylamide, 7 RE UREA, 1x TBE, pre-operated at 50 Watt for 1 h) and operated at 50-60 Watt for 2Vz hours. Subsequently, the gel is stained with 1xSyBR gold (Molecular Probes) in 1x TBE for 15 min. The bands are visualized using BioRad's Phosphoimager. Example 5: In vitro Model: Cell Culture

The effect of LNA oligonucleotides on target nucleic acid expression (amount) can be tested on any of a variety of cell types as long as target nucleic acid is present at measurable levels. The target may be expressed endogenously or by transient or stable transfection of a nucleic acid encoding said nucleic acid.

Target nucleic acid expression level can be routinely determined using, for example, Northern blot analysis (including Northern micro-RNA), Quantitative PCR (including micro-RNA qPCR), Ribonuclease protection assays. The following cell types are provided for illustrative purposes, but other cell types may be routinely used as long as the target is expressed in the chosen cell type.

Cells are grown in the appropriate medium as described below and maintained at 37 ° C in 95-98% humidity and 5% CO2. The cells were routinely passed 2-3 times a week.

15PC3: The 15PC3 human prostate cancer cell line was kindly donated by Dr. F. Baas, Neurozintuigen Laboratory, AMC, Netherlands and grown in DMEM (Sigma) + 10% fetal bovine serum (FBS) + Glutamax I + gentamicin.

PC3: The PC3 human prostate cancer cell line was purchased from ATCC and was cultured in F12 Coon with glutamine (Gibco) + 10% FBS + gentamicin.

518A2: Human melanoma cancer cell line 518A2 was kindly donated by Dr. B. Jansen, Section of Experimental Oncology, Molecular Pharmacology, Department of Clinical Pharmacology, University of Vienna and was grown in DMEM (Sigma) + 10% fetal bovine serum (FBS) + Glutamax I + gentamycin.

HeLa: HeLa cervical carcinoma cell line was cultured in MEM (Sigma) containing 10% fetal bovine serum, gentamicin at 37 ° C, 95% humidity and 5% CO2.

MPC-11: Murine myeloma cell line MPC-11 was purchased from ATCC and maintained in DMEM with 4 mM Glutamax + 10% Decavalo Serum.

DU-145: The human prostate cancer cell lineDU-145 was purchased from ATCC and maintained in RPMI with 10% Glutamax + FBS.

RCC-4 +/- VHL: RCC4 human kidney cancer cell line stably transfected with empty VHL expressing plasmid or plasmid was purchased from ECACC and maintained according to the manufacturers instructions.

786-0: Human renal carcinoma cell line 786-0 was purchased from ATCC and maintained according to the manufacturer's instructions.

HUVEC: The HUVEC human umbilical endothelial cell line was purchased from Camcrex and maintained in EGM-2 medium.

K562: Chronic human myelogenous leukemia cell line K562 was acquired from ECACC and maintained in RPMI with Glutamax + 10% FBSa.

U87MG: The U87MG human glioblastoma pedigree strain was purchased from ATCC and maintained in accordance with the manufacturer's instructions.

B16: B16 murine melanoma cell line was procured from the ATCC and maintained according to the manufacturer's instructions.

LNCap: The Human Prostate Cancer Cell Line

LNCap was purchased from ATCC and maintained in RPMI with 10% Glutamax + FBS.

Huh-7: human epithelial-like liver grown on Ea-gles MEM with 10% FBS, 2 mM Glutamax I, 1x non-essential amino acids, Gentamicin 25 pg / ml.

L428: (Deutsche Sammlung für Mikroorganismen (DSM, Braunschwieg, Germany)): Human B-cell lymphoma maintained in RPMI1640 supplemented with 10% FCS, L-glutamine and antibiotics.

L1236: (Deutsche Sammlung für Mikroorganismen (DSM, Braunschwieg, Germany)): Human B-cell lymphoma maintained in RPMI1640 supplemented with 10% FCS, L-glutamine and antibiotics.Example 6: In vitro model: antisense oligonucleotide treatment MRI of LNA

The Huh-7 cell line expressing miR-122a was transfected with LNA anti-miRs at concentrations of 1 and 100 nM according to the optimized protocol with Lipofectamine 2000 (LF2000, Invitrogen) (as follows).

Huh-7 cells were cultured in Eagles MEM with 10% FBS, 2mM Glutamax I, 1x nonessential amino acids, 25Mg / ml Gentamicin. Cells were cultured on 6-well slides (300,000 cells per well) in a total volume of 2.5 ml one day before transfection. On the day of transfection, a solution containing LF2000 diluted in Optimem (Invitrogen) was prepared (1.2 ml Optimem + 3.75 μΙ LF2000 per well, final 2.5 pg LF2000 / ml, final total volume 1.5 ml).

LNA oligonucleotides (LNA anti-miRs) were also diluted in Optimem. 285 μl Optimem + 15 μl oligonucleotide deLNA (10 μΜ oligonucleotide stock for a final concentration of 100 nM and 0.1 μΜ for a final concentration of 1 nM). Cells were washed once in Optimem, then the 1.2 ml Opti-mem / LF2000 mixture was added to each well. Cells were incubated 7min at room temperature in the LF2000 mixture where, thereafter, 300 μl of oligonucleotide / Optimem solution was added.

Cells were further incubated for four hours with oligonucleotide and Lipofectamine2000 (in a regular cell incubator of 37 ° C, 5% CO2). After these four hours, the medium / mixture was removed and regular complete medium was added. The cells were left to grow for another 20 hours. Cells were collected in Trizol (Invitrogen) 24 hours after transfection. RNA was extracted according to a standard protocol with Trizol according to the manufacturer's instructions (Invitrogen), especially to retain micro-RNA in total RNA extraction.

Example 7: In vitro and in vivo model: Analysis of miR expression oligonucleotide inhibition by micro-RNA-specific quantitative PCR

MiR-122a levels in RNA samples were evaluated on an ABI 7500 Fast real-time PCR instrument (Applied Biosys-tems, USA) using a mirVana miR-122a-specific qRT-PCR kit (Am-bion, USA). ) and miR-122a primers (Ambion, USA). The procedure was conducted according to the manufacturers protocol.

Results:

The new miR-122a-specific LNA anti-miR oligonucleotide design (i.e., SPC3349 (also referred to as SPC 3549)) was more effective at inhibiting miR-122a at 1 nM compared to previous design models, including the "" each third "and" gap-mer "(SPC3370, SPC3372, SPC3375) at 100 nM. Mismatch control has been found not to inhibit miR-122a (SPC3350). The results are shown in figure 1.

Example 8: Evaluation of anti-mirus LNA knock-down specificity by profiling characterization by miRNAA microarray expression) RNA labeling for miRNA microarray profiling characterization

Total RNA was extracted using Trizol reagent (Invitrogen) and labeled 3 'end using T4 RNA Iigase and labeled Cy3-orCy5 RNA ligand (5'-P04-rUrUrU-Cy3 / dT-3' or 5'-P04-rUrUrU- (Labeling reactions contained 2-5 pg total RNA, 15μΜ RNA ligand, 50 mM Tris-HCI (pH 7.8), 10 mM MgCl2, 10 mM DTT, Cy5 / dT-3 ') 1mM ATP, 16% polyethylene glycol and 5 units of T4 RNA Iigase (Ambion, USA) were incubated at 30 sC for 2 hours, followed by thermal inactivation T4 RNA Iigase at 80 ° C for 5 minutes.

B) Microarray hybridization and posthybridization washes

LNA-modified oligonucleotide capture probes comprising probes for all mentioned mouse (Mus musculus) and human (Homo sapiens) miRNAs in the miRBaseMicro-RNA Release 7.1 database, including a set of positive control probes and negative, were purchased from Exiqon (Exiqon, Denmark) and used to print microarray for miRNA profile characterization. Capture probes contain a 5'-terminal modified C6-amino ligand and are designed to have a Tm of 72e C against complementary target miRNAs by adjusting the LNA content and length of the capture probes. Capture probes were diluted to a final concentration of 10μΜ in 150 mM sodium phosphate buffer (pH 8.5) and placed in quadruplicate on Codelink slides (Amersham Biosciences) using BioRobotics MicroGrid Il Arrayer instrument at a humidity of 45 ° C. % e at room temperature. The slides were postprocessed as recommended by the manufacturer.

Labeled RNA was hybridized to LNA microarrays during night at 65 ° C in a hybridization mixture containing 4x SSC, 0.1% SDS, 1 pg / µl Salmon Sperm DNA and 38% formamide. Hybridized slides were washed three times in 2x SSC, 0.025% SDS at 659C, followed three times in 0.08x SSC and finally three times at 0.4x SSC at room temperature. image and data processing

The microarrays were explored using ArrayWorx Scan-ner (Applied Precision, USA) according to the manufacturer's recommendations. The explored images were imported into the TIGR Spotfinder version 3.1 (Saeed et al., 2003) for extraction of mean point intensities and median local base intensities, excluding points with intensities below the median local base + 4x standard deviations. Base-correlated intensities were normalized using the variance stabilization normalization package version 1.8.0 (Huber et al., 2002) for R (www.r-project.org). The average of repeated point intensities was calculated using Microsoft Excel. Probes showing a coefficient of variance> 100% were excluded from further data analysis.Example 9: Detection of microRNAs by in situ hybridization

Detection of microRNAs in formalin-fixed paraffin-embedded tissue sections by in situ hybridization.

A) Preparation of paraffin-embedded sections fixed in formalin for in situ hybridization

Stored paraffin-embedded samples were retrieved and divided into 5 to 10 mm sections and mounted on positively charged slides using the flotation technique. The slides are stored at 40 ° C until in situ experiments are conducted.

B) in situ hybridization

Sections on the slides are deparaffinized in xylene and then rehydrated through a series of dilutions in ethanol (from 100% to 25%). The slides are submerged in DEPC-treated water and treated with HCl and 0.2% glycine, refixed to 4% paraformaldehyde and treated with acetic anhydride / triethanolamine; slides are rinsed in several 1X PBS washes between treatments. Slides are prehybridized in hybridization solution (50% formamide, 5X SSC, 500mg / mL yeast tRNA, 1X Denhardt) at 50 sC for 30 min. Then 3pmoles of a FITC-labeled LNA probe (Exiqon, Denmark) complementary to each selected miRNA is added to the hybridization solution and hybridized for one hour at a temperature of 20-25 ° C below the predicted probe Tm (typically between 45-55 eC, depending on miRNA sequence). After washes at 0.1 X and 0.5X SCC at 65 ° C a signal amplification reaction with tiramide was performed using the Genpoint Fluo-rescein (FITC) kit (DakoCytomation, Denmark) following the recommendations of the vendor. Finally, the slides are mounted with ProlongGold solution. The fluorescence reaction is allowed to develop for 16-24 hours before documenting the expression of the selected miRNA using an epifluorescence microscope.

Micro RNA detection by in situ hybridization by whole assembly of zebrafish, Xenopus and mouse embryos

All washing and incubation steps are performed in 2 ml Eppendorf tubes. Embryos are fixed overnight at 40 ° C in paraformaldehyde at 40 ° C in PBS and subsequently transferred through a graded series (25% MeOH in PBST (PBS containing 0.1% Tween-20), 50% MeOH in PBST, 75% MeOH in PBST) to 100% methanol and stored at -20 ° C for several months. On the first day of in situ hybridization, the embryos are rehydrated by successive incubations for 5 min in 75% MeOH in PBST, 50% MeOH in PBST, 25% MeOH in PBST, and 100% PBST (4x5 min).

First, mouse and Xenopus embryos are treated with proteinase K (10 pg / ml in PBST) for 45 min at 37 ° C, refixed for 20 min in 4% paraformaldehyde in PBS and washed 3x5 min with PBST. After a short wash in water, alkaline endogenous phosphatase activity is blocked by incubating the embryos in 0.1 Me triethanolamine 2.5% acetic anhydride for 10 min, followed by a short wash in 5 washings and χ 5 min in PBST. Embryos are then transferred to hybridization buffer (50% Formamide, 5x SSC, 0.1% Twe-en, 9.2 mM citric acid, 50 µg / ml heparin, 500 µg / ml RNAde yeast) for 2-3 hours at the hybridization temperature. Hybridization is performed in preheated hybridization buffer containing 10 nM of 3-DIG-labeled Lond sondade (Roche Diagnostics) complementary to each miRNA selected. Post-hybridization washes are done at the hybridization temperature by successive incubations for 15 min in HM- (debridement buffer without heparin and yeast RNA), 75% HM / 2x 25% SSCT (SSC containing Tween-20 0.1%), 50% HM - / 2x 50% SSCT, 25% HM - / 2x 75% SSCT, 2x 100% SSCT and 2 x 30 min in 0.2x SSCT.

Subsequently, the embryos are transferred to PBST through successive incubations for 10 min in 0.2x75% SSCT / 25% PBST, 0.2x 50% SSCT / 50% PBST, 0.2x 25% SSCT / PBSTa 75 % and 100% PBST. After blocking for 1 hour in blocking buffer (2% sheep serum / 2 mg: ml BSA in PBST), embryos are incubated overnight at 40 ° C in blocking buffer containing FAB anti-DIG fragments. -AP (Roche, 1/2000). The following day, zebrafish embryos are washed 6x15 min in PBST, mouse embryos and X. tro-picalis are washed 6 χ 1 hour in TBST containing 2 mM Ievamisola and then for 2 days at 40 ° C. with regular wash buffer change.

After post-antibody washes, the embryos were washed 3x5 min in staining buffer (100 mM Tris HCl, pH 9.5, 50 mM MgCl 2, 100 mM NaCl, 0.1% Tween 20). Staining was done in buffer supplied with 4.5 μl / m I NBT (Roche, 50 mg / ml stock) and 3.5 μΙ / ml BCIP (Roche, 50 mg / ml stock). The reaction is stopped with 1 mM EDTA in PBST and the embryos are stored at 4 ° C. Embryos are mounted in Murray solution (2: 1 benzyl benzoate: benzyl alcohol) via an increasing series of methanol (25% MeOH in PBST, 50% MeOH in PBST, 75% MeOH in PBST, MeOH a 100%) before imaging.Example 10: In vitro model: Isolation and mRNA expression analysis (Total RNA isolation and cDNA synthesis for mRNA analysis)

Total RNA was isolated using RNeasy minikit (Qiagen) or using Trizol reagent (Invitrogen). For total RNA isolation using ominikit RNeasy (Qiagen), cells were washed with PBS and Cell LysisBuffer (RTL, Qiagen) supplemented with 1% mercaptoethanol added directly to the wells. After a few minutes, the samples were processed according to the manufacturer's instructions. For in vivo mRNA expression analysis, tissue samples were first homogenized using a Retsch300MM homogenizer and total RNA was isolated using Trizol reagent or RNe-asy minikit, as described by the manufacturer.

First-strand synthesis (cDNA from mRNA) was performed using the OmniScript Reverse Transcriptase or M-MLV Reverse Transcriptase kit (essentially as described by the manufacturer (Ambion)) according to the manufacturer's instructions (Qiagen). When using OmniScript Re-verse Transcriptase, 0.5 pg of each total RNA sample was adjusted to 12 μl and mixed with 0.2 μl of poly (dT) 12-ie (0.5 pg / μl) (Life Techno-logies). ), 2 μl dNTP mix (5 mM each), 2 μΙ 10x RT buffer, 0.5μl RNAguard® RNase inhibitor (33 units / ml, Amersham) and 1 μl Om-niScript Reverse Transcriptase, followed by incubation at 37 ° C for 60min and thermal inactivation at 93 ° C for 5 min.

When first strand synthesis was performed using random decamers and M-MLV Reverse Transcriptase (essentially as described by the manufacturer (Ambion)), 0.25 pg of total RNA from each sample was adjusted to 10.8 μl in H2O. 2 μΙ of decamers and 2 μl of NTP mixture (2.5 mM each) were added. The samples were heated to 70 ° C for 3 min and immediately cooled in ice water and 3.25 μΙ of a mixture containing (2 μl of 10x RT buffer; 1 μl of Trans -ase Reverse M-MLV; 0.25 μΙ inhibitor RNAase) added. cDNA is synthesized at 42 ° C for 60 min, followed by an inactivation step by heating at 95 ° C for 10 min and finally cooled to 4 ° C. CDNA can still be used for mRNA quantitation, for example, by quantitative real-time PCR.

Expression of mRNA can be evaluated in a variety of ways known in the art. For example, mRNA levels can be quantified, for example, by Northern blot analysis, competitive polymerase chain reaction (PCR), Ribonucleotide Protection Assay (RPA) or real-time PCR. Real-time quantitative PCR is presently preferred. RNA analysis can be performed on cellulartotal RNA or mRNA.

RNA isolation methods and RNA analysis, such as Northern blot analysis, are routine in the art and taught, for example, in Current Protocols in Molecular Biology, John Wiley and Sons.

Real-time quantitative PCR (PCR) can be conveniently performed using BioRAD's commercially available iQ Multicolor Real Time PCR Detection System. Real-time quantitative PCR is a method well known in the art and is taught, for example, in Heid and other Real time quantitative PCR, Genome Research (1996), 6: 986-994.

Example 11: LNA oligonucleotide uptake and efficacy in vivo

In vivo study: Six groups of animals (5 mice per group) were treated as follows. Group 1 animals were injected with 0.2 ml saline via iv on 3 successive days, Group 2 received 2.5 mg / kg SPC3372, Group 3 received 6.25 mg / kg, Group 4 received 12.5 mg / kg and Group 5 received 25 mg / kg, while Group 6 received 25 mg / kg SPC 3373 (erroneous decombination LNA-antimiR® oligonucleotide), all in the same manner. All doses were calculated from each animal's body weights on Day 0.

Prior to dosing (Day 0) and 24 hours after the last dose (Day 3), retroorbital blood was collected in tubes containing EDTA and plasma fraction collected and stored frozen at -80 ° C for analysis and cholesterol. At sacrifice, the livers were dissected and a portion was cut into 5 mm cubes and immersed in 5 volumes of cold RNAIater. A second portion was frozen in liquid nitrogen and stored for cryodi-vision.

Total RNA was extracted from liver samples as described above and analyzed for miR-122a levels by qPCRmicro-RNA-specific. Figure 5 demonstrates a clear dose response obtained with SPC3372, with an IC50 of approximately 3-5 mg / kg, whereas no inhibition of miR-122a was detected using the mismatched antagomarde combination LNA SPC 3373 for miR-122a. Example 12 : In vivo LNA-antimiR-122a dose response in C57 / BL7J female mice

In vivo study: Ten groups of animals (female C57 / BL6; 3 mice per group) were treated as follows. Group 1 animals were injected with 0.2 ml saline through i.p. on day 0, day 2 and day 4. Groups 2-10 were dosed through i.p. with three different concentrations (25 mg / kg, 5 mg / kg and 1 mg / kg) of anti-R-122a / SPC3372 (group 2-4), anti-122a / SPC3548 (group 5-7) and LNAantimir -122a / SPC3549 (group 8-10); antimir-122a LNA sequences are provided in Table 1. All three antimiR-122a LNA oligonucleotides target liver-specific miR-122a. Doses were calculated from each animal's body weights on Day 0.

Animals were sacrificed 48 hours after the last dose (Day 6), retroorbital blood was collected in EDTA-containing tubes and plasma fraction was collected and stored frozen at -80 ° C for cholesterol analysis. At sacrifice, the livers were dissected and a portion was cut into 5 mm cubes and immersed in 5 volumes of cold RNAIater. A second portion was frozen in liquid nitrogen and stored for freezing.

Total RNA was extracted from liver samples using Trizol reagent according to manufacturer's recommendations (Invitrogen, USA) and assayed for miR-122a levels by micro-RNA-specific qPCR according to manufacturer's recommendations (Ambion, USA). ). Figure 2 shows a clear dose response obtained with all three antimir-122a LNA molecules (SPC3372, SPC3548, SPC3549) .SPC3548 and SPC3549 show significantly improved efficacy in miR-122a silencing (as observed from reduced miR levels -122a) compared with SPC3372, with SPC3549 being more potent (IC50 approximately 1 mg / kg).

The above example was repeated using SPC3372 and SPC 3649 using 5 mice per group and the combined data (total of eight mice per group) are shown in Figure. Example 12a: Northern Blot

Micro-RNA-specific northern blot showed enhanced miR-122 blockade by SPC3649 compared with SPC3372 in LNA-antimiR treated mouse livers.

Oligos used in this example:

<table> table see original document page 112 </column> </row> <table>

It was decided to evaluate the effect of SPC3649 on miR-122 mR-NA levels in the livers of SPC3649-treated mice. The LNA-antimRs SPC3649 and SPC3372 were administered to mice through three i.p. every other day for a period of six days at the indicated doses, followed by sacrifice of the animals 48 hours after the last dose. Total RNA was extracted from the livers. MiR-122 levels were assessed by micro-RNA-specific northern blot (Figure 6). Treatment of normal mice with SPC3649 resulted in dramatically improved dose-dependent reduction of miR-122. Micro-RNA-specific northernblot comparing SPC3649 with SPC3372 was performed (Figure 6). SPC3649 completely blocked miR-122 at 5 and 25mg / kg, as noted by the absence of mature single-strand miR-122 and only the presence of the double band between LNA-antimiR and miR-122. Comparing the double versus mature band over Northern blot, SPC3649 appears equally effective at 1 mg / kg, as does SPC3372 at 25 mg / kg.Example 13: Evaluation of plasma cholesterol levels in anti-miR mice from LNA122

Total cholesterol level was measured in plasma using an ABX Pentra Cholesterol CP colorimetric assay. Cholesterol was measured following enzymatic hydrolysis and oxidation (2,3). 21.5 μΙ of water was added to 1.5 μΙ of plasma. 250 μΙ of reagent was added, and within 5 min, the cholesterol content measured at an onset length of 540 nM. Measurements on each animal were made in duplicate. Sensitivity and linearity were tested with diluted control compound 2 times (ABX Pentra controle control). Cholesterol level was determined by subtracting the baseline and presented in relation to noplasma cholesterol levels of saline-treated mice.

Figure 3 demonstrates a markedly decreased plasma cholesterol level in mice receiving SPC3548 andSPC3549 compared to saline control on Day 6.

Example 14: Evaluation of target miR-122a mRNA Levels in AntimiR-122a LNA-Treated Mice

Animals treated with saline control and different LNA-antimiR-122a were sacrificed 48 hours after the last dose (Day 6) and total RNA was extracted from liver samples using Trizol reagent according to manufacturer's recommendations (Invitrogen, USA). ). DemRNA levels were assessed by quantitative real-time RT-PCR for the target miR-122a, Bckdk (branched chain ketoacid dehydrogenase kinase, ENSMUSG00000030802) and aldolase A (aldoA, ENSMUSG00000030695) genes, respectively, as well as for GAPDH as control using Taqman assays according to the manufacturer's instructions (Applied biosystems, USA). Figures 4a and 4b demonstrate a clear dose-dependent over-regulation of the two target miR-122a genes, Bckdk and AldoA, respectively, as a response to treatment with all three antimiR-122a LNA molecules (SPC3372, SPC3548, SPC3549). In contrast, qPCR assays for GAPDH control did not reveal any significant differences in GAPD mRNA levels in LNA-antimiR-122a treated mice compared to control saline animals (Figure 4c). Bckdk and AIdoA mRNA levels were significantly higher in SPC3548 and SPPC3549-treated mice compared with SPC3372-treated mice (Figures 4a and 4b), thereby demonstrating their improved efficacy in vivo.

Example 15: Duration of LNA Oligonucleotide Action in vivo

In vivo study: Two groups of animals (21 mice per group) were treated as follows. Group 1 animals were injected with 0.2 ml saline via i.v on 3 successive days, Group 2 received 25 mg / kg SPC3372 in the same manner. All doses were calculated from the body weights of each animal on Day 0.

After the last dose (Day 3), 7 animals from each group were sacrificed on Day 9, Day 16 and Day 23, respectively. Prior to that, in cadad, retroorbital blood was collected in tubes containing EDTA and plasma fraction collected and stored frozen at -80 ° C for each day's cholesterol analysis. At sacrifice, the livers were dissected and a portion was cut into 5 mm cubes and immersed in 5 volumes of RNAiater ge-side. A second portion was frozen in liquid nitrogen and stored for cryodivision.

Total RNA was extracted from liver samples as described above and analyzed for miR-122a levels by qPCRmicro-RNA-specific. Figure 7 (Sacrifice on days 9, 16, or 23 corresponds to sacrifice 1, 2, or 3 weeks after the last dose) demonstrates a two-fold inhibition in mice receiving SPC3372 compared to saline control and this inhibition. could still be detected on Day 16, while on Day 23 miR-122a levels approached those of the saline group.Example 16: LNA oligonucleotide duration of action in vivo

In vivo study: Two groups of animals (21 mice per group) were treated as follows. Group 1 animals were injected with 0.2 ml saline i.v. for 3 successive days, Group 2 received 25 mg / kg SPC3372 in the same manner. All doses were calculated from the body weights of each animal on Day 0.

After the last dose (Day 3), 7 animals from each group were sacrificed on Day 9, Day 16 and Day 23, respectively. Prior to that, in cadad, retroorbital blood was collected in tubes containing EDTA and plasma fraction collected and stored frozen at -80 ° C for each day's cholesterol analysis. At sacrifice, the livers were dissected and a portion was cut into 5 mm cubes and immersed in 5 volumes of RNAiater ge-side. A second portion was frozen in liquid nitrogen and stored for cryodivision.

Total RNA was extracted from liver samples as described above and analyzed for miR-122a levels by qPCRmicro-RNA-specific. Figure 8 demonstrates a two-fold inhibition in mice receiving SPC3372 compared to the saline control and this inhibition could still be detected on Day 16, whereas on Day 23, miR-122a levels approached those in the saline group.

As per examples 17-22, the following procedures apply:

NMRI mice were administered intravenously with SPC3372 using daily doses ranging from 2.5 to 25 mg / kg for three consecutive days. The animals were sacrificed 24 hours, 1, 2 or 3 weeks after the last dose. The livers were collected, divided into pieces and submerged in RNAIater (Ambion) or frozen in pieces. RNA was extracted with Trizol reagent according to the manufacturer's instructions (Invitrogen) from RNAIater tissue, except that precipitated RNA was 80% ethanol and not vortexed. RNA was used for TaqMan mRNA qPCR according to the manufacturer (Applied bi-osystems) or Northern blot (see below). The frozen pieces were created for in situ hybridization.

Also, according to figures 9-14, SPC3372 is designated LNA-antimiR and SPC3373 (mismatch control) is designated "mm" instead of using the SPC number.

Example 17: Induction of dose-dependent target miR-122a mRNA by SCPC3372

Mice were treated with different doses of SPC3372 for three consecutive days as described above and sacrificed 24 hours after the last dose. Total RNA extracted from liver was subjected to qP-CR. Genes with predicted target miR-122 site and observed as over-regulated stands by microarray analysis were investigated for dose-dependent induction by increasing doses of SCPC3372 using qPCR. Total liver RNA from 2 to 3 mice per group sacrificed 24 hours after the last dose was subjected to qPCR for the indicated genes. Figure 9 shows the mRNA levels relative to the saline group, η = 2-3 (2.5 - 12.5 mg / kg / day: η = 2, without DS). erroneous combination control (mm, SPC3373).

Genes tested: Nrdg3 Aldo A, Bckdk, CD320 with predicted target demiR-122 site. Aldo B and Gapdh do not have a targeted miR-122a site.

A clear dose-dependent induction of target miR-122a genes was observed after treatment with different doses of SPC3372. Example 18: Transient induction of target miR-122a mRNAs after treatment with SPC3372.

NMRI female mice were treated with 25 mg / kg / day SPC3372, along with saline control for three consecutive days and sacrificed 1, 2 or 3 weeks after the last dose, respectively. RNA was extracted from the livers and the predicted target miR-122a mRNA mRNA levels, selected through microarray data, were investigated by qPCR. Three animals from each group were analyzed.

Genes tested: Nrdg3 Aldo A, Bckdk, CD320 with predicted target demiR-122 site. Gapdh does not have a predicted miR-122a target site.

A transient induction, followed by a restoration of normal expression levels in analogy to the restoration of normal demiR-122a levels was observed (Figure 10).

MRNA levels were normalized to individual GAPDH levels and to the mean of the saline treated group at each individual time point. Also included are the values of animals sacrificed 24 hours after the last dose. The mean and standard deviation, η = 3 (24h η = 3) are shown.

Example 19: Induction of Vldlr in the liver by treatment with SPC3372

The same liver RNA samples as in the previous example were investigated for Vldlr induction.

Transient over-regulation was observed following treatment with SPC3372, in accordance with the other predicted target miR-122a mRNAs (Figure 11).

Example 20: Stability of the miR-122a / SPC3372 Dual in Mouse World Plasma

The stability of SPC3372 and SPC3372 / miR-122a double was tested in mouse plasma at 37 ° C for 96 hours. Shown in Figure 12 is a PAGE stained with SYBR-Gold.

SPC3372 was completely stable for 96 hours. DualSPC3372 / miR-122a was immediately truncated (single strip demiR-122a region degradation not covered by SPC3372) but was then almost completely stable for 96 hours.

The fact that a preformed SPC3372 / miR-122 pair showed stability in serum for 96 hours along with the high thermal stability of the SPC3372 molecule pair supported our observation that inhibition of miR-122a by SPC3372 was due to the formation double stable between the two molecules, which had also been reported in cell culture (Naguibneva et al. 2006).

Example 21: Capture of mature miR-122a by SPC3372 leads to double formation

Liver RNA was also subjected to a Northern blot demicro-RNA. Shown in Figure 13 is a membrane hybridized to a miR-122a-specific probe (upper panel) and re-hybridized to aLet-7-specific probe (lower panel). With the miR-122 probe, two bands could be detected, one corresponding to mature miR-122 and one corresponding to a double between SPC3372 and miR-122.

To confirm miR-122 silencing, liver RNA samples were subjected to small RNA northern blot analysis, which showed significantly reduced levels of detectable mature miR-122 according to our real-time RT-PCR results. . By comparison, let-7a control levels were unchanged. Interestingly, a dose-dependent accumulation of a bypassed miR-122 / SPC3372 hetero-band is observed, suggesting that SPC3372 does not target miR-122 for degradation but rather binds to micro-RNA, desemodo, sterically hindering its function.

Northern analysis was performed as follows:

Membrane preparation for Northern was done as described in Sempere et al 2002, except for the following changes: Total RNA, 10 pg per row, in formamide loading buffer (formed 47.5%, 9 mM EDTA, 0.0125% Bromophenol, 0.0125% Xylene Cyanol, 0.0125% SDS) was loaded onto a 15% Novex Denaturation Urea-TBE polyacrylamide gel (Invitrogen) without RNA preheating. RNA was electrophoretically transferred to GeneScreen plus Hybridization Transfer Membrane (PerkinEImer) at 200 mA for 35 min.

The membranes were hybridized with complementary 32 P-labeled LNA-modified oligonucleotides to the mature micro-RNAs *. LNA oligonucleotides were labeled and hybridized to the membranes as described in (Válóczi et al. 2004) except for the following changes: prehybridization and hybridization assays contained 50% formamide, 0.5% SDS, 5x SSC, 5x Denhardt's solution and 20 pg / ml shear denatured salmon sperm DNA. Hybridizations were performed at 45 ° C. The blots were viewed by scanning on a Storm 860Scanner. The base membrane signal was subtracted from the radioactive signals from the miRNA bands. The miR-122 signal values were corrected for let-7a signal-based loading differences. To determine the size of the radioactive signals, the Decade Marker System (Ambion) was used according to the recommendations of the suppliers.

Example 22: Capture of miR-122a by SPC3372 together with distribution of SPPC3372 assessed by in situ hybridization of liver sections.

Liver cryosections of treated animals were subjected to in situ hybridization for deletion and localization of miR-122 and SPC3372 (Fig. 14). A miR-122 complementary probe could detect miR-122a.

A second probe was complementary to the SPC3372. An overlap is shown in figure 14; green is the distribution and evident amounts of miR-122a and SPC3372 and blue is the DAPI nuclear dye in a 10x magnification. 100x magnifications reveal the intranuclear distribution of miR-122a and SPC3372 within mouse liver cells.

Liver sections of the control animals with saline showed a strong miR-122 staining pattern throughout the liver section, while sections of SPC3372-treated mice showed a significantly reduced sparse staining pattern. In contrast, the SPC3372 molecule was readily detected in the liver treated with SPC3372, but not in the liver with untreated saline control. Higher magnification located miR-122a in the cytoplasm, where the in situ demiR-122 pattern was completely compartmentalized, while the SPC3372 molecule was evenly distributed throughout the cytoplasm.

Example 23: Microarray Analysis

We performed broad-expression profiling characterization in genome of total RNA samples from saline-treated mice, LNA-antimiR-122 and wrong combination control of LNA 24 hours after the last dose using Affymetrix Mouse Geno-me 430 2.0 arrays. Arrangement data analysis revealed 455 transams that were overregulated in the livers of anti-LNA-treated mice compared with saline-treated mice and misleading control of LNA, while 54 transcripts were down-regulated (Figure 15a). A total of 415 of the overregulated and 53 overregulated transcripts could be identified in the Ensembl database. Subsequently, we examined the 3 'untranslated regions (RTUs) of differentially expressed mRNAs with respect to the presence of the 6 nt sequence, CACTCC, corresponding to the reverse complement of the 2-7 nucleotide deculture region in mature miR-122. The number of transcripts having at least one miR-122 recognition sequence was 213 (51%) of the overregulated transcripts and 10 (19%) of the overregulated transcripts, while the frequency in a randomly-matched population was 25 %, implying that a significant reservoir of over-regulated mRNAs represents direct miR-122 targets in the liver (Figure 15b). Treatment with LNA-antimiR showed a maximum reduction in miR-122 levels within 24 hours, a 50% reduction in one week and equivalent saline controls within three weeks after the last dose of LNA (Example 12 "old design"). This coincided with a markedly small number of differentially expressed genes between the two groups of mice at later time points. Compared to 509mRNAs 24 hours after the last dose of ANL, we identified 251 genes expressed differently after one week, but only 18 genes after three weeks after treatment (Figures 15c and 15d). In general, over-regulated genes 24 hours after LNA-antimiR treatment then reverted to control levels over the next two weeks (Figure 15d).

In conclusion, a large portion of over-regulated / reversed-repressed genes following LNA-antimiR treatment were targeted miR-122, indicating a very specific effect for miR-122 blockade. Also, over-regulated / reversed repressed genes approach normal levels 3 weeks after the end of treatment, suggesting a relatively long therapeutic effect but, however, not causing a permanent change, ie the effect is reversible.

METHODS:

Gene expression characterization of LNA-antimiR treated mice

Expression profiles in livers of mice treated with saline and LNA-antimiR were compared. NMRI female mice were treated with 25 mg / kg / day LNA-antimiR, together with saline control for three consecutive days and sacrificed 24 h, 1, 2 or 3 weeks after the last dose. In addition, liver expression profiles of mice treated with wrongly matched LNA control oligonucleotide 24 h after the last dose were obtained. Three mice from each group were analyzed, yielding a total of 21 expression profiles. RNA quality and concentration were measured using an Agilent 2100 Bioanalyzer and Nanodrop ND-1000, respectively. Total RNA was processed following the instructions of the GeneChip Expression 3'-Amplification Reagents One-cycle cDNA Synthesis Kit (Affy-metrix Inc, Santa Clara, CA, USA) to produce double stranded cDNA. This was used as a template to generate biotin-labeled cRNA following the manufacturer's specifications. Fifteen micrograms of combiotin labeled cRNA were shredded into strips between 35 and 200 bases in length, of which 10 micrograms were hybridized over AffymetrixMouse Genome 430 2.0 arrays overnight in the GeneChip Hybridisation6400 oven using standard procedures. Arrangements were washed and stained in a GeneChip Fluidics Station 450. Scanning was performed using the GeneChip Scanner 3000 and image analysis was performed using Softwa-re GeneChip Operating. Normalization and statistical analysis were done using the LIMMA software package for the R27 programming environment. Probes reported as missing by the GCOS software in all hybridizations were removed from the data set. Additionally, an intensity filter was applied to the dataset to remove probes showing interference-corrected intensities below 16. Data were normalized using Quantile Normalization28. Differential expression was evaluated using a linear model method. P values were adjusted for multiple testing using Benjamini and Hochberg. Tests were considered to be significant if the adjusted values were ρ <0.05. Grouping and visualization of the Affymetrix array data were done using the MuItiExperiment Viewer29 software. Target site prediction

Transcripts with annotated 3 'UTRs were extracted from the Ensembl database (Release 41) using the EnsMart Data Mining 30 tool and screened for the presence of the CACTCC sequence, which is the reverse complement of the 2-7 culture nucleotide sequence in the miR-122 sequence. mature. As an interference control, a set of 1000 sequences with a length of 1200 nt, corresponding to the average length of the 3 'RTU of the over and under-regulated transcripts at 24 h after the last LNA-antimiR transcript, were searched for commiR-122 combinations of 6 nucleotides from culture. This was performed 500 teams and the average count was used for comparison.

Example 24: Dose-dependent inhibition of miR-122 in mouse liver by LNA-antimiR is enhanced when compared to miR-122 inhibition by antagomir

NMRI female mice were treated with the indicated doses of LNA-antimiR (SPC3372) together with a combination control (mm, SPC3373), saline and antagomir (SPC3595) for three consecutive days and sacrificed 24 hours after the last dose (as in example 11 "old design", η = 5). MiR-122 levels were analyzed by qPCR and normalized to the saline treated group. Genes with a predicted target miR-122 site and over-regulated expression profile characterization (AldoA, Nrdg3, Bckdk and CD320 ) showed reversal of dose-dependent repression by increasing doses of LNA-antimiR, measured by qPCR.

The reversal of repression was consistently higher in all target miR-122 mRNAs tested (AldoA, Bckdk1 CD320 and Nrdg3; figures17, 18, 19, 20) in LNA-antimiR-treated mice compared with antagomir-treated mice. This was also indicated when analyzing inhibition of miR-122 through miR-122-specific qPCR (Figure 16). Consequently, LNA-antimiRs provide more potent functional inhibition of miR-122 than antagonizing it at a corresponding dose.Example 25: Inhibition of miR-122 by LNA-antimiR in hypercholesterolemic mice coupled with cholesterol reduction and reversal of mRNA repression of miR-122 target

Female C57BU6J mice were fed a high fat diet for 13 weeks prior to initiation of SPC3649 treatment. This resulted in a weight increased to 30-35g compared to the weight of normal mice, which was only 20g when weighed at the beginning of LNA-antimiR treatment. High-fat diet mice had a significantly increased total plasma cholesterol level of about 130 mg / dl, thus making mice hypercholesterolemic compared to the normal level of about 70 mg / dl. Abnormal hypercholesterolemic mice were treated i.p. twice weekly with 5 mg / kg SPPC3649 and the corresponding mismatch control SPC3744 for a study period of 5 Vz weeks. Blood samples were collected weekly and total plasma cholesterol was measured throughout the course of the study. When mice were sacrificed, liver and blood samples were prepared for total RNA extraction, miRNA and mRNA quantification, evaluation of transaminase levels in blood and liver histology.

Treatment of hypercholesterolemic mice with SCPC3649 resulted in a reduction in total plasma cholesterol to about 30% compared with saline control mice after 10 days and sustained this level throughout the study (Figure 21). The effect was not as pronounced as in normal-diet mice. In contrast, mismatch control SPC3744 did not affect plasma cholesterol levels in either hypercholesterolemic or normal mice.

Quantification of miR-122 inhibition and reversal of target miR-122 gene repression (AldoA and Bckdk) after long-term treatment with SPC3649 revealed a comparable profile in normal hypercholesterolemic mice (Figures 22, 23, 24). thus demonstrating SPC3649's potency in miR-122 antagonism in both anal groups. The miR-122 qPCR assay also indicated that the mismatch control SPC3744 also had an effect on miR-122 levels in livers of treated mice, albeit to a lesser extent compared to SPC3649. This could be a reduction associated with stem-loop qPCR. Consistent with this observation, treatment of mice with the wrong combination control SPC3744 did not result in either functional repression of direct target miR-122 genes (Figures 23 and 24), nor plasma cholesterol reduction (Figure 21), implying that the SPC3649 antagonist -mediate of miR-122 is highly specific in vivo.

Liver enzymes in livers of hypercholesterolemic and normal mice were evaluated after long-term treatment with SCPC3649. No changes in alanine easpartate aminotransferase levels (ALT and AST) were detected in SPC3649-treated hypercholesterolemic mice compared with saline control mice (Figures 25 and 26). A possibly high ALT level was observed in normal mice after long-term treatment with SPC3649 (Figure 26).

Example 26: Methods for conducting the experiment and analysis of anti-FIM hypercholesterolemic LNA

Mice and Dosage

Female C57BL / 6J mice (Taconic M&B Laboratory A-nimals, Ejby, Denmark) were used. All substances were formulated in physiological saline (0.9% NaCl) to a final concentration that allowed the mice to receive an intraperitoneal injection volume of 10 ml / kg.

In the diet-induced obesity study, mice received a high-fat (60EN%) diet (D12492, Re-search Diets) for 13 weeks to increase their blood cholesterol before dosing began. The dose regimen was prolonged to 5Vz weeks of 5 mg / kg LNA-antimiR® twice weekly. Blood plasmas were collected once a week during the whole finger season. After completion of the experiment, the mice were sacrificed and RNA extracted from the livers for further analysis. The serum was also collected for liver enzyme analysis.

Total RNA Extraction

Dissected livers from sacrificed mice were immediately stored in RNA Later (Ambion). Total RNA was extracted with Trizol reagent according to the manufacturer's instructions (Invitrogen), except that the precipitated RNA pellet was washed in 80% ethanol and not subjected to swirling.

Micro-RNA-specific quantitative RT-PCR

MiRNA miR-122 and let-7a levels were quantified with TaqMan micro-RNA assay (Applied Biosystems) following the manufacturer's instructions. The RT reaction was diluted ten times in water and subsequently used for real time PCR amplification according to the manufacturer's instructions. A series of two-fold cDNA dilutions from total liver RNA from a saline-treated animal or cDNA reaction from placebo-transfected cells (using 2.5 times more total RNA than in the samples) served as a standard to ensure a linear range. (Ct versus relative number of copies) of the amplification. Applied Biosystems 7500 or 7900 real-time RT-PCR instrument was used for amplification. Quantitative RT-PCR

Quantitation of mRNA from selected genes was done using standard TaqMan assays (Applied Biosystems). The reverse transcription reaction was performed with random decamers, 0.5 pg total RNA and Ambion's M-MLV RT enzyme according to a standard protocol. The first cDNA tape was subsequently diluted 10-fold in nu-clease-free water prior to the addition of the RT-PCR reaction mixture. A series of two-fold cDNA dilutions of total liver RNA from an animal treated with saline or cDNA reaction from placebo-transfected cells (using 2.5 times more total RNA than in the samples) served as a pa to ensure a linear range (Ct versus relative number of copies) of the amplification. An Applied Biosys-tems 7500 or 7900 real-time RT-PCR instrument was used for amplification.

Metabolic measurements

Immediately prior to sacrifice, retroorbital sinus blood was collected in EDTA-coated tubes, followed by isolation of the plasma fraction. Total plasma cholesterol was analyzed using an ABX Pentra Cholesterol CP (Horiba Group, Horiba ABX Diagnostics) according to the manufacturer's instructions.

Liver Enzyme Measurement (ALT and AST) Serum from each individual mouse was prepared as follows: blood samples were stored at room temperature for 2 h before centrifugation (10 min, 3000 rpm at room temperature). After centrifugation, serum was collected and frozen at -20 ° C.

ALT and AST measurement was performed on 96 well slides using ABX Pentra ALT and AST reagents according to the manufacturer's instructions. In summary, serum samples were diluted 2.5-fold with H2O and each sample was evaluated in duplicate. After the addition of 50 μΙ of diluted or standard sample (ABX Pentra Multical) to each well, 200μ AS of AST or ALT reagent mix at 37 0C was added to each well. Kinetics measurements were performed for 5 min with an interval of 30s at 340 nm and 37 ° C using a spectrophotometer.

Example 27: Modulation of HNA replication by LNA-antimiR (SPC3649)

Oligos used in this example (capital letter: LNA, capital letter DNA, LNA Cs are methyl and LNAs are preferably B-D-oxy (subscribed after the LNA residue):

<table> table see original document page 126 </column> </row> <table>

Hepatitis C replication (HCV) has been shown to be facilitated by miR-122 and, consequently, domiR-122 antagonization has been shown to affect HCV replication in an in vitro hepatoma cell model. The efficacy of SPC3649 in reducing HCV replication in the Huh-7 cell-based model is evaluated. The different LNA-antimiR molecules, together with a 2 'OMe antisense oligonucleotide and mixed, are transfected into Huh-7 cells, HCV is allowed to replicate for 48 hours. Total RNA samples extracted from Huh-7 cells are subjected to Northern blot analysis.

Example 28: Enhanced LNA-antimiR® antisense oligonucleotide targeting miR-21

Mature miR-21 sequence from the Sanger Institute miRBase:> hsa-miR-21 MIMAT0000076 UAGCUUAUCAGUGUGUG (SEQ ID NO 4)> mmu-miR-21 MIMAT0000530UAGCUUAUCAGUGUGUGUG (SEQ ID NO 64) Compound Sequence:

SPC3521 miR-21 5'-FAM TCAgtctgataaGCTa-3 '(gap-mer design) - (SEQ ID NO 65)

SPC3870 miR-21 (mm) 5'-FAM TCCgtcttagaaGATa-3 '- (SEQ ID NO 66) SPC3825 miR-21 5'-FAM TcTgtCAgaTaCgAT-3' (new design) (SEQID NO 67)

SPC3826 miR-21 (mm) 5'-FAM TcAgtCTgaTaAgCT-31- (SEQ ID NO 68) SPC3827 miR-21 5'-FAM TcAGtCTGaTaAgCT-3 '(new intensified design) - (SEQ ID NO 69)

All compounds have a total or nearly fully thiolate major moiety and here also had a 5 'end FAM label.

MiR-21 has been shown to be overregulated in glioblastoma (Chan et al., Cancer Research 2005, 65 (14), p6029) and breast cancer (lorio et al., Cancer Research 2005, 65 (16), p7065) and therefore, it was considered a potential "oncogenic" microRNA. Chan and others also show induction of apoptosis in glioblastoma cells by antagonizing miR-21 with 2'OMe or LNA-modified antisense oligonucleotides. Consequently, miR-21 antagonizing agents have the potential to become therapeutic products for the treatment of glioblastoma and other solid tumors such as breast cancer. An LNA-enhanced oligonucleotide targeting miR-21, an LNA-antimiR®, has been shown to have surprisingly good properties for inhibiting omiR-21 suitable for the aforementioned therapeutic purposes.

Suitable therapeutic administration routes are, for example, intracranial injections of glioblastomas, intratumoral injections of Qli-oblastoma and breast cancer, as well as systemic distribution in breast cancer.

Inhibition of miR-21 in the U373e glioblastoma cell line in the MCF-7 breast cancer cell line.

The effectiveness of this LNA-antimiR® is assessed by transfection at different concentrations, along with control oligonucleotides, into the U373 and MCF-7 cell lines known to express miR-21 (or other miR-21 expressing cell lines as well). performed using a standard protocol with Lipofectami-ne2000 (Invitrogen). At 24 hours post transfection, cells are harvested and total oRNA extracted using the Trizol protocol (Invitrogen). Assessment of miR-21 levels, depending on treatment and concentration used, is performed by real-time miR-21 stem-loop RT-PCR (Ap-plied Biosystems) or alternatively by Northern blotmiR analysis. Non-radioactive specifics. The detected miR-21 levels compared to vehicle control reflect the inhibitory potential of LNA-antimiR®.

Functional inhibition of miR-21 through over-regulation evaluation of the target miR-21 gene.

The antagonistic effect of miR-21 is investigated by deconstructing the perfectly combined target miR-21 sequence behind a standard Renilla Iuciferase reporter system (between coding sequence and 3 'UTR, psiCHECK-2, Promega) - see Example 29. The reporter structure and LNA-antimiR ™ will be co-transfected into miR-21 expressing cell lines (e.g. U373, MCF-7). Cells are harvested 24 hours post-transfection in passive Iise buffer and Iuciferase activity is measured according to a standard protocol (Promega, Dual Luciferase Re-porter Assay System). Induction of Iuciferase activity is used to demonstrate the functional effect of LNA-antimiR® miR-121 antagonism.Example 29: Luciferase reporter assay for functional inhibition of micro-RNA by LNA-antimiRs and other oligos targeting RNA: Generalizing New Design and Enhanced New Design as Preferred De-Signs for Micro-RNA Function Blocking

Oligos used in this example (capital letter: LNA1 capital letter: DNA) to evaluate the reversal effect of LNA-antimiR repression on the Iuciferase reporter with the target micro-RNA sequence by blocking the respective micro-RNA :

<table> table see original document page 129 </column> </row> <table> <table> table see original document page 130 </column> </row> <table>

SEQ ID NOs as before.

A reporter plasmid (psiCheck-2 Promega) encoding the Luciferase asvariant Renilla and Firefly was engineered such that the Renilla luciferase α3'UTR included a single copy of a sequence fully complementary to the miRNA under investigation.

Cells endogenously expressing the investigated miRNAs (HuH-7 for miR-122a, HeLa for miR-19b, 518A2 for miR-155) were co-transfected with LNA-antimiRs or other amiR-binding oligonucleotides (the full length i.e. total) and the corresponding target microRNA reporter plasmid using Lipofectamine 2000 (Invitrogen).

Transfection and measurement of luciferase activity was performed according to the manufacturer's instructions (Invitrogen Lipofectamine2000 / Promega Dual-luciferase kit) using 150,000 to 300,000 cells per well in 6-well slides. To compensate for variation in cell densities and transfection efficiencies, the Renilla luciferase signal was normalized to the Firefly luciferase signal. All experiments were done in triplicate.

Surprisingly, the new design and the enhanced design were the most functional inhibitors for all three target microRNAs, miR-155, miR-19b and miR-122 (Figures 27, 28, 29). Results are summarized in table 3 below. Summary of Results:

<table> table see original document page 131 </column> </row> <table>

Table 3. Degree of reversal of repression of endogenous miR-155, miR-19b and endogenous miR-122a by various LNA-antimiR's designs.

Abelson, J.F. and others 2005. Science 310: 317-20.

Bartel, D.P. 2004. Cell 116: 281-297.

Boehm, M., Slack, F. 2005. Science. 310: 1954-7.

Brennecke1 J. et al. 2003 Cell 113: 25-36.

Calin, G.A. and others 2002. Proc. Natl. Acad. Know. USA 99: 15524-15529.

Calin, G. A. et al. 2004. Proc. Natl. Acad. Sci.U.S.A. 101: 2999-3004.

Calin, G.A. and others 2005. N. Engl. J. Med. 353: 1793-801Chan, J.A. and others 2005. Cancer Res. 65: 6029-33.

Chen, C.Z., and others 2004. Science 303: 83-86.

Chen, J.F., and others 2005. Nat Genet. Dec 25, advance publication online.

Eis, P.S. et al. 2005. Proc Natl Acad Sci U.SA 102: 3627-32.

Giraldez, A.J. et al. 2005. Science 308: 833-838.Griffiths-Jones, S. et al. 2004. Nucleic Acids Res. 32: D109-

D111.

Griffiths-Jones, S., et al. 2006. Nucleic Acids Res. 34: D140-4He, L. et al. 2005. Nature 435: 828-833.

Hornstein, E. et al. 2005. Nature 438: 671-4.

Hutvagner, G. et al. 2001. Science 293: 834-838.

Hutvagner, G. et al. 2004. PLoS Biology 2: 1-11.

Lorio, M.V. and others 2005. Cancer Res. 65: 7065-70.

Jin, P. et al. 2004. Nat Cell Biol. 6: 1048-53.

Johnson, S.M. and others 2005. Cell 120: 635-647.

Jopling, C.L. and others 2005. Science 309: 1577-81.

Ketting, R.F. et al. 2001. Genes Dev. 15: 2654-2659.Kwon, C. et al. 2005. Proc Natl Acad Sci USA. 102: 18986-91.

Landthaler, M. et al. 2004. Curr. Biol. 14: 2162-2167.Leaman, D. et al. 2005. Cell 121: 1097-108.Lee1 Y., et al. 2003. Nature 425: 415-419.Li, X. and Carthew, R.W. 2005. Cell 123: 1267-77.Lu. J. et al. 2005. Nature 435: 834-838.Michael, MZe et al. 2003. Mol. Cancer Res. 1: 882-891.Nelson, P. et al. 2003. TIBS 28: 534-540.Paushkin, S., and others 2002.Curr.Opin.Cell Biol. 14: 305-312.Poy, M.N. and others 2004. Nature 432: 226-230.Wienholds, E. et al. 2005. Science 309: 310-311.Yekta, S. et al. 2004. Science 304: 594-596.10 Zhao, Y. et al. 2005. Nature 436 : 214-220.SQUENCE LISTING

<110> Santaris A / S

<120> PHARMACEUTICAL COMPOSITION

<130> 16870PCT00

<160> 109

<170> PatentIn version 3.3

<210> 1

<211> 23

<212> RNA

<213> Homo sapiens

<400> 1uggaguguga caaugguguu ugu

<210> 2 <211> 23 <212> RNA <213> Homo sapiens

<400> 2ugugcaaauc caugcaaaac uga

<210> 3 <211> 22 <212> RNA <213> Homos sapiens

<400> 3uuaaugcuaa ucgugauagg gg

<210> 4 <211> 22 <212> RNA <213> Homo sapiens

<400> 4uagcuuauca gacugauguu ga

<210> 5 <211> 22 <212> RNA <213> homo sapiens

<400> 5uuuguucguu cggcucgcgu ga

<210> 6 <211> 6 <212> DNA <213> homo sapiens

<400> 6tttgca <210> 7

<211> 6

<212> DNA

<213> homo sapiens

<400> 7

acactc 6

<210> 8

<211> 6

<212> DNA

<213> Homo sapiens

<400> 8

agcatt 6

<210> 9

<211> 6

<212> DNA

<213> Homo sapiens

<400> 9

cgaaca 6

<210> 10

<211> 6

<212> DNA

<213> Homo sapiens

<400> 10ataagc

<210> 11

<211> 23

<212> DNA

<213> artificial

<220>

<223> Full complement gap-LNA at positions 1-4 and 20-23

<400> 11

acaaacacca ttgtcacact cca 23

<210> 12

<211> 23

<212> DNA

<213> artificial

<220>

<223> Full complement block-LNA at positions 7-14

<400> 12

acaaacacca ttgtcacact cca 23

<210> 13

<211> 23

<212> DNA

<213> artificial

<220> <223> Full complement LNA mix-amers in third position and four positions later

<400> 13acaaacacca ttgtcacact cca 23

<210> 14

<211> 15

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1, 3, 6, 7, 10, 12, 14 and 15

<400> 14ccattgtcac actcc 15

<210> 15

<211> 15

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1, 3, 5, 6, 7, 10, 11, 12, 14, 15

<400> 15ccattgtcac actcc 15

<210> 16

<211> 13

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1-5, 7-10, 12 & 13.

<400> 16attgtcacac tcc 13

<210> 17

<211> 11

<212> DNA

<213> artificial

<220>

<223> LNA LNA units at positions 1-3, 5-8, 10 & 11.

<400> 17tgtcacactc c 11

<210> 18

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME

<400> 18ccattgtcac actcc 15 <210> 19

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 as

what are 2'fluoro

<210> 20

<211> 23

<212> DNA

<213> artificial

<220>

<223> Full complement gap-LNA at positions 1-4 and 20-23

<400> 20

tcagttttgc atggatttgc aca 23

<210> 21

<211> 23

<212> DNA

<213> artificial

<220>

<223> Full complement block-LNA at positions 7-14

<210> 22

<211> 23

<212> DNA

<213> artificial

<220>

<223> Full complement LNA mixmer- LNA at third position and everythird position thereafter

<400> 22

tcagttttgc atggatttgc aca 23

<210> 23

<211> 15

<212> DNA

<213> artificial

<220>

<223> LNA units at position 1, 3, 6, 7, 10, 12, 14 and 15

<400> 19ccattgtcac actcc

15

<400> 21

tcagttttgc atggatttgc aca

23

<400> 23tgcatggatt tgcac

15

<210> 24 <211> 15 <212> DNA

<213> artificial <220>

<223> LNA units at positions 1, 3, 5, 6, 7, 10, 11, 12, 14, 15

<400> 24tgcatggatt tgcac

15

<210> 25

<211> 13

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1, 3-5, 7-10, 12 & 13.

<400> 25

catggatttg cac 13

<210> 26

<211> 11

<212> DNA

<213> artificial

<220>

<223> LNA LNA units at positions 1-3, 5-8, 10 & 11.

<210> 27

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 as

what are 2'OME

<210> 28

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 as

what are 2'OME

<400> 26tggatttgca c

11

<400> 27tgcatggatt tgcac

15

2'fluoro

<400> 28tgcatggatt tgcac

15

<210> 29 <211> 22 <212> DNA

<213> artificial

<220>

<223> Full complement gap-LNA at positions 1-4 and 20-23 <400> 29

cccctatcac gattagcatt aa

22

<210> 30

<211> 22

<212> DNA

<213> artificial

<220>

<223> Full complement block-LNA at positions 7-14

<400> 30

cccctatcac gattagcatt aa 22

<210> 31

<211> 22

<212> DNA

<213> artificial

<220>

<223> Full complement LNA mixmer- LNA at third position and everythird position thereafter

<210> 32

<211> 15

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1, 3, 6, 7, 10, 12, 14, 15

<400> 32

tcacgattag catta 15

<210> 33

<211> 15

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1, 3, 5, 6, 7, 10, 11, 12, 14, 15

<210> 34

<211> 13

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1-5, 8-11, 12 & 13.

<400> 34

acgattagca tta 13

<400> 31

cccctatcac gattagcatt aa

22

<400> 33tcacgattag catta

15

<210> 35 <211> 11 <212> Artificial DNA <213>

<220>

<223> LNA units at positions 1-3, 5-7, and 9-11 <400> 35

gattagcatt a

<210> 36

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 as

what are 2'OME

<400> 36

tcacgattag catta

<210> 37

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME2'fluoro

<400> 37

tcacgattag catta

<210> 38

<211> 22

<212> DNA

<213> artificial

<220>

<223> Full complement gap-LNA at positions 1-4 and 20-23

<400> 38

tcaacatcag tctgataagc ta

<210> 39

<211> 22

<212> DNA

<213> artificial

<220>

<223> Full complement block-LNA at positions 7-14

<400> 39

tcaacatcag tctgataagc ta

<210> 40

<211> 22

<212> DNA

<213> artificial <220>

<223> Full complement LNA mixmer- LNA at third position and everythird position thereafter

<400> 40

tcatcatcag tctgataagc tt 22

<210> 41 <211> 15 <212> Artificial DNA <213>

<220>

<223> LNA units at position 1, 3, 6, 7, 10, 12, 14 and 15 <400> 41

tcagtctgat aagct 15

<210> 42

<211> 15

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1, 3,

<400> 42tcagtctgat aagct

5, 6, 7, 10, 11, 12, 14, 15

15

<210> 43

<211> 13

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1-5, 7-10, 12 & 13. <400> 43

agtctgataa gct 13

<210> 44

<211> 15

<212> DNA

<213> artificial

<220>

<223> LNA units at positions 1-3, 5, 7-11 <400> 44

tcagtctgat aagct 15

<210> 45

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME

<400> 45tcagtctgat aagct 15

<210> 46

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME2'fluoro

<400> 46

tcagtctgat aagct 15

<210> 47

<211> 22

<212> DNA

<213> artificial

<220>

<223> Full complement gap, <400> 47

tctcgcgtgc cgttcgttct tt

LNA at positions 1-4 and 20-23

22

<210> 48

<211> 22

<212> DNA

<213> artificial

<220>

<223> Blockmer, LNA at positions 7-14 <400> 48

tctcgcgtgc cgttcgttct tt 22

<210> 49

<211> 22

<212> DNA

<213> artificial

<220>

<223> Full complement LNA mixmer- LNA at third position and everythird position thereafter

<400> 49

tctcgcgtgc cgttcgttct tt 22

<210> 50

<211> 15

<212> DNA

<213> artificial

<220>

<223> LNA at positions 1, 3, 6, 7, 10, 12, 14, 15 <400> 50

gtgccgttcg ttctt 15

<210> 51 <211> 15

<212> DNA

<213> artificial

<220>

<223> LNA at positions 1, 3, 5-7, 10-12, 14 & 15

<400> 51

gtgccgttcg ttctt 15

<210> 52

<211> 13

<212> DNA

<213> artificial

<220>

<223> LNA at positions 1-5, 7, 9-13

<400> 52

gccgttcgtt ctt 13

<210> 53

<211> 11

<212> DNA

<213> artificial

<220>

<223> LNA at positions 1-4, 6-11

<400> 53

cgttcgttct t 11

<210> 54

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME

<400> 54

gtgccgttcg ttctt 15

<210> 55

<211> 15

<212> DNA

<213> artificial

<220>

<223> All LNA residues except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME

2'fluoro

<400> 55gtgccgttcg ttctt 15

<210> 56

<211> 16

<212> DNA

<213> artificial <220>

<223> Phosphorothioate backbone, LNA at position 2 and every thirdtherafter.

<400> 56

ccattgtcac actcca 16

<210> 57

<211> 16

<212> DNA

<213> artificial

<220>

<223> Phosphorothioate backbone, LNA at position 3 and every thirdtherafter.

<400> 57

ccattgtcac actcca 16

<210> 58 <211> 16 <212> Artificial DNA <213> <220> <223> Phosphorothioate

1-3, Sc 13-15

<400> 58ccattgtcac actcca

16

<210> 59

<211> 15

<212> DNA

<213> artificial

<220>

<223> Phosphorothioate backbone, LNA at positions 1, 3, 6, 7, 10, 12,14 & 15

<400> 59

ccattgtcac actcc 15

<210> 60

<211> 15

<212> DNA

<213> artificial

<220>

<223> Phosphorothioate backbone, LNA at positions 1, 3, 6, 7, 10, 12,14 & 15, LNA cytosines are methylated

<400> 60

ccattctgac cctac 15

<210> 61

<211> 16

<212> DNA

<213> artificial

<220> <223> phosphorothioate backbone, LNA at position 3 and every thirdthereafter

<400> 61

ccattgtctc aatcca 16

<210> 62

<211> 13

<212> DNA

<213> artificial

<220>

<223> Phosphorothioate backbone, 13

<400> 62attgtcacac tcc

LNA at position 1, 4, 5, 8, 10, 12 &

13

<210> 63

<211> 15

<212> DNA

<213> artificial

<220>

<223> Fully phosphorothioate, LNA to 16, ali C LNAs are methylated.

<400> 63ccattctgac cctac

positions 1, 3, 6, 7, 10, 12, 14 & LNA is preferably Beta-D-oxy LNA.

15

<210> 64

<211> 22

<212> RNA

<213> Homo sapiens

<400> 64

uagcuuauca gacugauguu ga 22

<210> 65

<211> 16

<212> DNA

<213> artificial

<220>

<223> Gapmer design, Optional FAM label at 5 'end, LNA at positions 1-3and

13-15 <400> 65

tcagtctgat aagcta 16

<210> 66

<211> 16

<212> DNA

<213> artificial

<220>

<223> Gapmer design, Optional FAM label at 5 'end, LNA at positions 1-3and

13-15.

<400> 66tccgtcttag aagata

<210> 67

<211> 15

<212> DNA

<213> artificial

<220>

<223> Optional FAM label at 5 'end, 13 & 15

<400> 67tctgtcagat acgat

16

LNA at positions 1, 3, 6, 7, 10, 12,

<210> 68

<211> 15

<212> DNA

<213> artificial

<220>

<223> Optional FAM label at 5 'end, 13 & 15

<400> 68tcagtctgat aagct

<210> 69

<211> 15

<212> DNA

<213> artificial

<220>

<223> Optional FAM label at 5 'end, 12,

14 & 15

<400> 69tcagtctgat aagct

LNA at positions 1, 3, 6, 7, 10, 12,

15

LNA at positions 1, 3, 4 6, 7, 8, 10,

15

<210> 70

<211> 7

<212> DNA

<213> Homo sapiens

<400> 70

atttgca 7

<210> 71

<211> 8

<212> DNA

<213> Homo sapiens

<400> 71gatttgca

<210> 72

<211> 9

<212> DNA

<213> Homo sapiens

<400> 72ggctttgca

<210> 73

<211> 7

<212> DNA

<213> Homo sapiens

<400> 73cacactc

<210> 74

<211> 8

<212> DNA

<213> Homo sapiens

<400> 74tcacactc

<210> 75

<211> 9

<212> DNA

<213> Homo sapiens

<400> 75gtcacactc

<210> 76

<211> 7

<212> DNA

<213> Homo sapiens

<400> 76

tagcatt

<210> 77

<211> 8

<212> DNA

<213> Homo sapiens

<400> 77ttagcatt

<210> 78

<211> 9

<212> DNA

<213> Homo sapiens

<400> 78attagcatt

<210> 79

<211> 7

<212> DNA

<213> Homo sapiens

<400> 79acgaaca

<210> 80 <211> 8

<212> DNA

<213> Homo sapiens

<400> 80

aacgaaca 8

<210> 81

<211> 9

<212> DNA

<213> Homo sapiens

<400> 81

gaacgaaca 9

<210> 82

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 3 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 82

tgcatggatt tgcaca 16

<210> 83

<211> 15

<212> DNA

<213> Artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 3 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 83

tgcatggatt tgcac 15

<210> 84

<211> 13

<212> DNA

<213> Artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 84

catggatttg cac 13

<210> 85

<211> 15

<212> DNA

<213> Artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 2 and every other basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated. <400> 85tgcatggatt tgcac 15

<210> 86

<211> 13

<212> DNA

<213> Artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 2 and every other basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 86

catggatttg cac 13

<210> 87

<211> 13

<212> DNA

<213> Artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1, 4, 5, 8, 10, 12 & 13.Preferably phosphorothioate, preferably oxy-LNA. Preferably LNACs are methylated.

<400> 87catggatttg cac 13

<210> 88

<211> 15

<212> DNA

<213> Artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1, 3, 6, 7, 10, 12, 14 & 15. Preferably phosphorothioate, preferably oxy-LNA. PreferablyLNA Cs are methylated.

<400> 88

tgcatggatt tgcac 15

<210> 89

<211> 16

<212> DNA

<213> Artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1, 3, 5, 7, 9, 10, 14 & 15. Preferably phosphorothioate, preferably oxy-LNA. PreferablyLNA Cs are methylated.

<400> 89

tgcatggatt tgcaca 16

<210> 90

<211> 16

<212> DNA

<213> artificial <220>

<223> DNA / LNA oligonucleotide, LNA at position 2 and every other basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 90

ccattgtcac actcca 16

<210> 91

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 2 and every thris basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 91

ccattgtaac tctcca 16

<210> 92

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 3 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 92

ccattgtcac actcca 16

<210> 93

<211> 15

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 2 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 93

ccattgtcac actcc 15

<210><211><212> <213>

9413DNA

artificial

<220> <223>

DNA / LNA oligonucleotide, LNA at position 3 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 94attgtcacac tcc

13

<210> 95 <211> 15 <212> Artificial DNA <213>

<220> <223>

DNA / LNA oligonucleotide, LNA at position 3 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 95ccattgtcac actcc

<210> 96 <211> 13 <212> Artificial DNA <213>

<220> <223> DNA / LNA oligonucleotide, LNA at position 1 and every third base thereafter. Preferably phosphorothioate, preferably oxy-LNA. Preferably LNA Cs are methylated.

<400> 96attgtcacac tcc

<210> 97 <211> 13

<212> artificial <213> DNA

<220> <223> DNA / LNA oligonucleotide, LNA at position 2 and every other basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 97attgtcacac tcc

<210> 98 <211> 13

<212> DNA

<213> artificial

<220> <223> DNA / LNA oligonucleotide, LNA at position 1, 4, 5, 8, 10, 12 & 13.Preferably phosphorothioate, preferably oxy-LNA. Preferably LNACs are methylated.

<400> 98attgtcacac tcc

<210> 99 <211> 15 <212> Artificial DNA <213>

<220> <223> DNA / LNA oligonucleotide, LNA to position 1, 3, 6, 7, 10, 12, 14 & 15. Preferably phosphorothioate, preferably oxy-LNA. PreferablyLNA Cs are methylated.

<400> 99ccattgtcac actcc <210> 100

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1, 4, 7, 11, 15.

Preferably phosphorothioate, preferably oxy-LNA. Preferably LNACs are methylated.

<400> 100

ccattgtcac actcca 16

<210> 101

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA gapmer oligonucleotide, LNA at position 1-3, & 13-15,

Preferably phosphorothioate, preferably oxy-LNA. Preferably LNACs are methylated.

<400> 101

ccattgtcac actcca 16

<210> 102

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 2 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 102

tcacgattag cattaa 16

<210> 103

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 3 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 103

atcacgatta gcatta 16

<210> 104

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1 and every other basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated. <400> 104

tcacgattag cattaa 16

<210> 105

<211> 16

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1, 4, 6, 8, 10, 12, 14 & 16. Preferably phosphorothioate, preferably oxy-LNA. PreferablyLNA Cs are methylated.

<400> 105

atcacgatta gcatta 16

<210> 106

<211> 15

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 2 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 106

gagccgaacg aacaa 15

<210> 107

<211> 13

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 3 and every third basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 107

gccgaacgaa caa 13

<210> 108

<211> 15

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1 and every other basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 108

gagccgaacg aacaa 15

<210> 109

<211> 13

<212> DNA

<213> artificial

<220>

<223> DNA / LNA oligonucleotide, LNA at position 1 and every other basethereafter. Preferably phosphorothioate, preferably oxy-LNA.Preferably LNA Cs are methylated.

<400> 109gccgaacgaa caa

Claims (113)

A pharmaceutical composition comprising a single stranded oligonucleotide or conjugate thereof having a length of 8 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence of the positions two to seven or positions three to eight, from the 3 'end of 3' acgttt 5 '(SEQ ID NO 6) wherein at least one, such as one, preferably at least two, such as two or three, DNA units in that sequence were replaced by their corresponding LNA unit. A pharmaceutical composition comprising a single stranded oligonucleotide or conjugate thereof having a length of 8 to 26 nucleobase units and a diluent. A pharmaceutically acceptable carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence of positions two to seven or positions three to eight, from the 3 'end of 3' to 5 '(SEQ ID NO 7) wherein at least one, such as one, preferably at least two, such as two or three, DNA units in said sequence have been replaced by their corresponding LNA unit. A pharmaceutical composition comprising a single stranded oligonucleotide or conjugate thereof having a length of 8 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence. from positions two to seven or from positions three to eight, from the 3 'end of 3' ttacga 5 '(SEQ ID NO 8) wherein at least one such as one, preferably at least two such as two or three, DNA units in that sequence were replaced by their corresponding LNA unit. A pharmaceutical composition comprising a single stranded oligonucleotide or conjugate thereof having a length of 8 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence. from positions two to seven or from positions three to eight, starting from the 3 'end of 3' acaagc 5 '(SEQ ID NO 9) wherein at least one such as one, preferably at least two such as two or three, DNA units in that sequence were replaced by their corresponding LNA unit. A pharmaceutical composition comprising a single stranded oligonucleotide or conjugate thereof having a length of 8 to 26 nucleobase units and a pharmaceutically acceptable diluent, carrier or adjuvant, wherein the oligonucleotide comprises a central DNA sequence. from positions two to seven or from positions three to eight, from the 3 'end of 3' cgaata 5 '(SEQ ID NO 10) wherein at least one, such as one, preferably at least two, such as two or three DNA units in said sequence have been replaced by their corresponding LNA unit and wherein said oligonucleotide does not comprise a region of more than 7 continuous DNA units. A pharmaceutical composition according to any one of claims 1 - 5, wherein the oligonucleotide nucleobase sequence is complementary to a nucleotide sequence present in a human microRNA sequence selected from the group consisting of (miR 19b) UGUGCAAAUCCAUGCAAAACUGA ( SEQ ID 1) (miR 122a) UGGAGUGUGACAAUGGUGUUUGU (SEQ ID 2) (miR 155) UUAAUGCUAAUCGUGAUAGGGG (SEQ ID 3) (miR 375) UUUGUUCGUUCGGUCUCGUGA (SEQ ID 4) (miR 21) UAGUUGAUG Pharmaceutical composition according to any one of claims 1 - 6, wherein the oligonucleotide has a length of between 10 - 17 nucleobases. Pharmaceutical composition according to any one of claims 1 - 6, wherein the oligonucleotide has a length of between 10 - 16 nucleobases. Pharmaceutical composition according to any one of claims 1 - 6, wherein the oligonucleotide has a length of between 12 - 26 nucleobases. Pharmaceutical composition according to any one of claims 1 to 9, wherein at least two DNA units from oligonucleotide positions one to six, two to seven or three to eight, starting from the 3 'end, have been replaced. corresponding LNA unit and wherein the LNA units are separated by at least one DNA unit. Pharmaceutical composition according to any one of claims 1 to 10, wherein at least three DNA units from oligonucleotide positions one to six, two to seven or three to eight, starting from the 3 'end, have been replaced. corresponding LNA unit and wherein the LNA units are separated by at least one DNA unit. The pharmaceutical composition of claim 10 or 11, wherein the number of consecutive DNA units at oligonucleotide positions one six, two to seven or three to eight, counting from the 3 'end, is at most two. The pharmaceutical composition of claim 12 wherein each second nucleotide of positions one to six, two to seven to eight to eight of the oligonucleotide, counting from the 3 'end, is an LNA unit. The pharmaceutical composition of claim 12, wherein each three nucleotide at oligonucleotide positions one to six, two to seven, or three, counting from the 3 'end, is a LNA moiety. Pharmaceutical composition according to any one of claims 1-14, wherein the total number of LNA units from oligonucleotide positions one to six, two to seven or three to eight, from the 3 'end is between 2 and 6 LNA units. Pharmaceutical composition according to any one of claims 1 - 15, wherein the first nucleobase of the oligonucleotide, counting from the 3 'end, is a nucleotide analog, such as an LNA unit. A pharmaceutical composition according to any one of claims 1 - 16, wherein the second nucleobase of the oligonucleotide, counting from the 3 'end, is a nucleotide analog, such as an LNA unit. A pharmaceutical composition according to any one of claims 1-17, wherein the substitution pattern for nucleobases at positions one to six, two to seven or three to eight of the oligonucleotide, from the 3 'end, is selected from the group consisting ofxxXxxX, xxXxXx, χΧχχΧχ, χΧχΧχχ, XxxXxx, xXxXxX, XxXxXx, XxxXxX andXxXxxX; xxXxxX, xXxxXx, XxxXxx, xXxXxX, and XxXxXx; wherein "X" denotes a nucleotide analog such as an LNA moiety and "x" denotes a DNA moiety. A pharmaceutical composition according to any one of claims 1 - 18, wherein the substitution pattern for nucleobases at positions one to seven, two to eight or three to nine of the oligonucleotide, from the 3 'end, is selected from the group consisting of xxxxxxxx, xxxxxxx, xxxxxxx, xxxxxxx, xxxxxxx, xxxxxxx, xxxxxxx, xxxxxxx, xxxxxxx, xxxxxxx, xxxxxxxx, xxxxxxx, xxxxxx, xxxxxx wherein "X" denotes a denucleotide analog such as an LNA moiety and "x" denotes a DNA moiety. A pharmaceutical composition according to any one of claims 1-19, wherein the substitution pattern for nucleobases at positions one to eight, two to nine or three to ten, from the 3 'end, is selected from the group consisting of xxxxxxxxx, xxxxxxxx, xxxxxxxx, xxxxxxxx, xxxxxxxx, xxxxxxxx, xxxxxxxx, xxxxxxx, xxxxxxxx, xxxxxxxxxxxxxxxxxxxxxxxxxxx xxXxxXxx, xXxxXxxX, XxxXxxXx, xXxXxXxX, XxXxXxXx, and XxXxXxxX; wherein "X" denotes a nucleotide analog such as an LNA moiety and "x" denotes a DNA moiety. Pharmaceutical composition according to any one of claims 1 - 20, wherein the substitution pattern for nucleobases at positions one to nine, two to ten or three to eleven, from the 3 'end, is selected from the group consisting emxxXxxXxxX, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx, xxxxxxxxx is xXXXXXXXX; wherein "X" denotes a nucleotide analog such as an LNA moiety and "x" denotes a DNA moiety. A pharmaceutical composition according to any one of claims 1-21, wherein the oligonucleotide comprises a continuous nucleobase sequence region which is 100% complementary to the human micro-RNA cultured region. A pharmaceutical composition according to any one of claims 1-22, wherein the ninth and / or tenth nucleotide of the oligonucleotide, counting from the 3 'end, is a nucleotide analog, such as an LNA moiety. A pharmaceutical composition according to any one of claims 1 - 23, wherein the oligonucleotide does not comprise a region of more than 5 consecutive DNA nucleotide units. A pharmaceutical composition according to any one of claims 1-24, wherein the oligonucleotide comprises at least one region consisting of at least two consecutive nucleotide analog units, such as at least two consecutive LNA units. A pharmaceutical composition according to any one of claims 1 - 25, wherein the oligonucleotide does not comprise a region of more than 7 consecutive nucleotide analog units, such as LNA communities. The pharmaceutical composition of claim 26, wherein the oligonucleotide does not comprise a region of more than 3 consecutive nucleotide analog units, such as LNA units. A pharmaceutical composition according to claims 1-27, wherein the oligonucleotide nucleobase sequence which is complementary to the micro-RNA culture region sequence is selected from the group consisting of (X) Xxxxxx, ( X) xXxxxx, (X) xxXxxx, (X) xxxXxx, (X) xxxxXx, and (X) xxxxxX, as read in a direction S1-S11 where "X" notes a nucleotide analog, (X) denotes a optional nucleotide analog, such as an LNA1 unit, and "x" denotes a nucleotide unit of DNA or RNA. A pharmaceutical composition according to any one of claims 1-28, wherein the oligonucleotide comprises at least two nucleotide analog units, such as at least two LNA units, at positions which are complementary to the demiRNA culture region. A pharmaceutical composition according to claim 29, wherein the oligonucleotide nucleobase sequence which is complementary to the sequence of the microRNA culture region is selected from the group consisting of (X) XXxxxx, (X) XxXxxx , (X) XxxXxx, (X) XxxxXx, (X) XxxxxX, (X) xXXxxx, (X) xXxXxx, (X) xXxxXx, (X) xXxxxX, (X) xxXXxx, (X) xxXxXx, (X) xxXxxX , (X) xxxXXx, (X) xxxXxX, and (X) xxxxXX, where "X" denotes a nucleotide analog, such as an LNA moiety, (X) denotes an optional nucleotide analog, such as a moiety. LNA and "x" denotes a nucleotide unit of DNA or RNA. A pharmaceutical composition according to any one of claims 1-28, wherein the oligonucleotide comprises at least three nucleotide analog units, such as at least three LNA units, at positions which are complementary to the demiRNA culture region. The pharmaceutical composition of claim 31, wherein the oligonucleotide nucleobase sequence which is complementary to the sequence of the micro-RNA culture region is selected from the group consisting of (X) XXXxxx, (X) xXXXxx , (X) xxXXXx, (X) xxxXXX, (X) XXxXxx, (X) XXxxXx, (X) XXxxxX, (X) xXXxXx, (X) xXXxxX, (X) xxXXxX, (X) XxXXxx, (X) XxxXXx , (X) XxxxXX, (X) xXxXXx, (X) xXxxXX, (X) xxXxXX, (X) xXxXxX, and (X) XxXxXx, where "X" denotes a nucleotide analog, such as an LNA moiety, (X ) denotes an optional nucleotide analog such as an LNA unit and "x" denotes a DNA or RNA nucleotide unit. A pharmaceutical composition according to any one of claims 1-28, wherein the single-stranded oligonucleotide comprises at least four analogous nucleotide units, such as at least four LNA units, at positions which are complementary to the cell culture region. miRNA. The pharmaceutical composition of claim 33, wherein the oligonucleotide nucleobase sequence which is complementary to the sequence of the micro-RNA culture region is selected from the group consisting of (X) xxXXX, (X) xXxXXX , (X) xXXxXX, (X) xXXXxX, (X) xXXXXx, (X) XxxXXXX, (X) XxXxXX, (X) XxXXxX, (X) XxXXx, (X) XXxxXX, (X) XXxXxX, (X) XXxXXx , (X) XXXxxX, (X) XXXxXx, and (X) XXXXxx, where "X" denotes a nucleotide analog, such as an LNA moiety, (X) has an optional nucleotide analog, such as a moiety. of LNA and "x" denotes a nucleotide unit of DNA or RNA. A pharmaceutical composition according to any one of claims 1-28, wherein the oligonucleotide comprises at least five nucleotide analog units, such as at least five LNA units, at positions which are complementary to the miRNA culture region. The pharmaceutical composition of claim 35, wherein the oligonucleotide nucleobase sequence which is complementary to the sequence of the micro-RNA culture region is selected from the group consisting of (X) xXXXXX, (X) XxXXXX , (X) XXxXXX, (X) XXXxXX, (X) XXXXxX, and (X) XXXXXx, where "X" denotes a nucleotide analog, such as an LNA moiety, (X) denotes an optional nucleotide analog such as an LNA unit and "x" denotes a DNA or RNA nucleotide unit. A pharmaceutical composition according to any one of claims 1-28, wherein the oligonucleotide comprises six or seven nucleotide analog units, such as six or seven LNA1 units at positions which are complementary to the miRNA culture region. The pharmaceutical composition of claim 37, wherein the oligonucleotide nucleobase sequence which is complementary to the microRNA culture region sequence is selected from the group consisting of XXXXXX, XxXXXXX, XXxXXXX, XXXxXXX, XXXXxXX , XXXXXxX and XXXXXXx, wherein "X" denotes a nucleotide analog, such as an LNA unit, such as an LNA unit and "x" denotes a DNA or RNA nucleotide unit. Pharmaceutical composition according to any one of claims 1 - 38, wherein the two nucleobase motifs at positions 7 to 8, counting from the 3 'end of the single-stranded oligonucleotide are selected from the group consisting of xx, XX, xX and Xx. wherein "X" denotes a nucleotide analog such as an LNA unit such as an LNA unit and "x" denotes a DNA or RNA nucleotide unit. A pharmaceutical composition according to any one of claims 1 - 39, wherein the oligonucleotide comprises at least 12 nucleobases and wherein the two nucleobase motifs at positions 11 to 12, counting from the 3 'end of the single strand oligonucleotide are: selected from the group consisting of xx, XX, xx and xx1 wherein "X" denotes a nucleotide analog, such as an LNA moiety, such as an LNA moiety, and "x" denotes a DNA nucleotide moiety or RNA. A pharmaceutical composition according to any one of claims 1-40, wherein the oligonucleotide comprises at least 13 nucleobases and wherein the three nucleobase motifs at positions 11 to 13, counting from the 3 'end, are selected from the group consisting of xxx , Xxx, xXx, xxX, XXx, XxX, xXX, and XXX, wherein "X" denotes a nucleotide go-analog, such as an LNA moiety, such as an LNA moiety, and "x" denotes a nucleotide moiety. DNA or RNA. A pharmaceutical composition according to any one of claims 1-41, wherein the oligonucleotide comprises at least 14 nucleobases and wherein the four nucleobase motifs at positions 11a-14, counting from the 3 'end, are selected from the group consisting of having xxxx, xxxx1 xxxx, xxxx, xxxx, xxxx1 xxxx1 xxxx1 xxxx, xxxx, xxxx, xxxx, xxxx1 xxxx, xxxx, and xxx where "x" denotes a nucleotide analog such as a unit of LNA1 such as a unit of LNA and "x" denotes a nucleotide unit of DNA or RNA. A pharmaceutical composition according to any one of claims 1-42, wherein said oligonucleotide comprises 15 nucleobases and the five nucleobase motifs at positions 11 to 15, starting from the 3 'end, are selected from the group consisting of Xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxxx, xxxx, xxxxx, xxxxx, xxxx, xxxx, xxxxx, xxxxx, xxx1xxxxxx "X" denotes a nucleotide analog, such as an LNA1 unit such as an LNA unit and "x" denotes a DNA or RNA nucleotide unit. A pharmaceutical composition according to any one of claims 1 - 43, wherein the oligonucleotide comprises 16 nucleobases and the six nucleobase motifs at positions 11 to 16, counting from the 3 'end, are selected from the group consisting of Xxxxxx. , xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxx, xxxxxxxxxxxxxxxxxxxxxxxxxxx , , xXXXxX, XxXXXx, xXXXXx, xXXXXX, XxXXXX1XXxXXX, XXXxXX, XXXXxX, XXXXXx, and XXXXXX where "X" denotes a nucleotide analog, such as an LNA unit, and "x" denotes a unit of nucleotide DNA or RNA. The pharmaceutical composition of claim 44, wherein the oligonucleotide consists of between 17 and 26 nucleobases, and nucleobases 17-26, counting from the 3 'end are each independently selected from the group consisting of X and x. wherein "X" denotes a nucleotide analog, such as an LNA unit, such as an LNA unit and "x" denotes a DNA or RNA nucleotide unit. A pharmaceutical composition according to any one of claims 1 - 45 wherein the nucleobase motif for the three nucleobases plus 5 'of the oligonucleotide is selected from the group consisting of Xxx, xXx, xxX, XXx, XxX, xXX and XXX. wherein "X" denotes a nucleotide analog, such as an LNA unit, such as an LNA unit and "x" denotes a DNA or RNA nucleotide unit. Pharmaceutical composition according to any one of claims 18 - 46, wherein "x" denotes a DNA unit. A pharmaceutical composition according to any one of claims 1-47, wherein the single-stranded oligonucleotide comprises a nucleotide analog unit, such as an LNA unit, at the 5 'end. A pharmaceutical composition according to any one of claims 16-48, wherein the nucleotide analog units, such as X, are independently selected from the group consisting of: 2'-O-alkyl-RNA unit, 2'-OMe unit. -RNA, 2'-amino-DNA unit, 2'-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit. The pharmaceutical composition of claim 49, wherein all nucleobases are nucleotide analog units. The pharmaceutical composition according to claim 49 or 50, wherein the nucleotide analog units, such as X, are independently selected from the group consisting of: 2'-OMe-RNA units, 2'-fluoro-units. DNA and LNA units. A pharmaceutical composition according to any one of claims 49 - 51, wherein the oligonucleotide comprises at least one LNA analog unit and at least one other nucleotide analog unit other than LNA. The pharmaceutical composition of claim 52, wherein the non-LNA nucleotide analog unit or units are independently selected from 2'-OMe RNA units and 2'-fluoro-DNA units. The pharmaceutical composition of claim 53, wherein the single-stranded oligonucleotide consists of at least one XYX or YXY sequence, wherein X is LNA and Y is a 2'-0Me RNA unit and a 2'-unit. '-fluoro-DNA. The pharmaceutical composition of claim 54, wherein the nucleobase sequence of the single strand oligonucleotide consists of alternate XeY units. A pharmaceutical composition according to any one of claims 1-49, wherein the single-stranded oligonucleotide comprises alternating LNA and DNA (Xx) or (xX) units. A pharmaceutical composition according to any one of claims 1-49, wherein the single-stranded oligonucleotide comprises an alternate LNA motif followed by 2 DNA units (Xxx), xXx or xxx. A pharmaceutical composition according to any one of claims 54 - 57, wherein at least one of the DNA or non-LNA DNA nucleotide analog units is replaced by an LNA nucleobase at a position selected from the positions identified as LNA nucleobase units in any one of the following. preceding claims. Pharmaceutical composition according to any one of claims 18-58, wherein "X" denotes an LNA unit. A pharmaceutical composition according to any one of claims 1 - 59, wherein the single-stranded oligonucleotide comprises at least 5 LNA units. The pharmaceutical composition of claim 60, wherein the single strand oligonucleotide comprises at least 7 LNA units. Pharmaceutical composition according to any one of claims 1 - 61, wherein at least one of the nucleobases of LCA is ecytosine or guanine. The pharmaceutical composition of claim 62, wherein at least three of the LNA nucleobases are independently selected from cytosine or guanine. A pharmaceutical composition according to any one of claims 16-63, wherein the nucleotide analogs have a higher thermal duplex stability by a complementary RNA nucleotide than the thermal duplex duplex of a DNA nucleotide equivalent to said complementary RNA nucleotide. . A pharmaceutical composition according to any one of claims 16-64, wherein the nucleotide analogs confer enhanced stability in oligonucleotide serum. A pharmaceutical composition according to any one of claims 1 - 65 wherein the oligonucleotide does not mediate RNAseH-based cleavage of a complementary single stranded RNA molecule. A pharmaceutical composition according to any one of claims 1 - 66 wherein the oligonucleotide is capable of forming a duplex with a complementary single stranded RNA nucleic acid molecule with phosphodiester internucleoside linkages, wherein the duplex has a Tm of at least about 60 ° C. The pharmaceutical composition of claim 67, wherein the oligonucleotide is capable of forming a duplex with a complementary single stranded phosphodiester-linked nucleic acid RNA molecule, wherein the duplex has a Tm of between about from -70 ° C to about 95 ° C. The pharmaceutical composition of claim 68, wherein the oligonucleotide is capable of duplexing a complementary single stranded RNA nucleic acid molecule with phosphodiester internucleo-solid linkages, wherein the pair has a Tm of from about About 90 ° C, such as between about 70 ° C and about 85 ° C. A pharmaceutical composition according to any one of claims 1 - 69, wherein the oligonucleotide is capable of forming a duplex with a single stranded RNA nucleic acid molecule complementing phosphodiester internucleoside linkages, wherein the duplex has a Tm of from about 50 ° C to about 90 ° C. A pharmaceutical composition according to any one of claims 1-70, wherein the single-stranded oligonucleotide has a length of 10 to 16, such as a length of 10, 11, 12, 13,14,15 or 16. nucleobases. The pharmaceutical composition of claim 71, wherein the single strand oligonucleotide is 15 or 16 nucleobases in length. Pharmaceutical composition according to any one of claims 1 - 72, wherein the LNA unit or units are independently selected from the group consisting of oxy-LNA, thio-LNA and amin-no-LNA, in D-β configurations. and L-α or combinations thereof. The pharmaceutical composition of claim 73, wherein the LNA moiety or units is beta Doxy-LNA. The pharmaceutical composition of claim 73, wherein the LNA units are alpha-L amino LNA. A pharmaceutical composition according to any one of claims 1 - 75, wherein the single-stranded oligonucleotide comprises between 3 and 17 LNA units. A pharmaceutical composition according to any one of claims 1-76, wherein the oligonucleotide comprises at least one internucleoside linking group which differs from phosphate. The pharmaceutical composition of claim 77, wherein the oligonucleotide comprises at least one phosphorothioate internucleoside bond. The pharmaceutical composition of claim 78, wherein the oligonucleotide comprises phosphodiester and phosphorothioate linkages. The pharmaceutical composition of claim 77, wherein all internucleoside bonds are phosphorothioate bonds. A pharmaceutical composition according to any one of claims 1-79, wherein the oligonucleotide comprises at least one phosphodiester internucleoside bond. The pharmaceutical composition of claim 81, wherein all internucleoside bonds are phosphodiester bonds. Pharmaceutical composition according to any one of claims 1 - 82, wherein said carrier is saline or buffered saline solution. An oligonucleotide according to any one of claims 1-75, wherein said single-stranded oligonucleotide comprises at least one phosphorothioate linkage and / or at least the first 5 'and / or the last 5' nucleobase. 'is an LNA nucleobase. 85. Oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO-28 , SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88 and SEQ ID NO: 89; where a lowercase letter identifies the nitrogenous base of a DNA unit and a capital letter identifies the nitrogenous base of a LNA unit; and wherein the LNA cytosines are optionally methylated or a conjugate thereof. 86. Oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO-17 , SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO 100 and SEQ ID NO-101; wherein a lower case letter identifies the nitrogenous base of a DNA unit and a capital letter identifies the nitrogenous base of an LNA unit; and wherein the LNA cytosines are optionally methylated or a conjugate thereof. 87. Oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO-35. SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 102, SEQ ID NO 103, SEQID NO 104 and SEQ ID NO 105; wherein a lower case letter identifies the basenitrogenous one unit of DNA and an uppercase letter identifies the basenitrogenous one unit of LNA; and wherein the LNA cytosines are optionally methylated or a conjugate thereof. 88. Oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO-53 SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 106, SEQ ID NO 107, SEQID NO 108 and SEQ ID NO 109; wherein a lower case letter identifies the basenitrogenous one unit of DNA and an uppercase letter identifies the basenitrogenous one unit of LNA; and wherein the LNA cytosines are optionally methylated or a conjugate thereof. 89. Oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68 and SEQ ID NO 69, SEQ ID NO 38, SEQ ID NO-39 , SEQ ID NO. 40, SEQ ID NO. 41, SEQ ID NO. 42, SEQ ID NO. 43, SEQ ID NO. 44, SEQ ID NO. 45 and SEQ ID NO. 46, wherein a lowercase letter identifies the nitrogen base of a unit of DNA and an uppercase letter identify the nitrogenous base of an LNA unit; and wherein the LNA cytosines are optionally methylated or a conjugate thereof. An oligonucleotide according to any one of claims 84 - 89, wherein the internucleobase bonds are as defined in any one of claims 77 - 82. An oligonucleotide according to any one of claims 84 - 90, wherein the nucleobase sequences of the oligonucleotide consist of said nucleobase sequence. A conjugate comprising the oligonucleotide as defined in any one of claims 84-91 and at least one non-nucleobase entity covalently attached thereto. A conjugate according to claim 92, wherein the non-nucleobase entity consists of or comprises a sterol, such as cholesterol. A pharmaceutical composition comprising the oligonucleotide or conjugate as defined in any one of claims 84-93 and a pharmaceutically acceptable diluent, carrier or adjuvant. Use of a single stranded or conjugated oligonucleotide as defined in any one of claims 1-93 for the manufacture of a medicament for the treatment of a disease or medical disorder associated with the presence or overexpression of micro-RNA, such as a selected disease. of the group consisting of increased levels of noplasma cholesterol, atherosclerosis, hypercholesterolemia or hyperlipidemia, hepatitis C, cancer and a metabolic disorder such as diabetes. A method for treating a medical disease or disorder associated with the presence or overexpression of microRNA, comprising the step of administering a composition as defined in any one of claims 1-93 to a person in need of treatment, such as a a person suffering from a disease selected from the group consisting of increased plasma cholesterol levels, atherosclerosis, hypercholesterolemia or hyperlipidemia, hepatitis C, cancer, and a metabolic disorder such as diabetes. A method for reducing the effective amount of a demiRNA target in a cell or organism comprising administering a composition or a single-stranded oligonucleotide as defined in any one of claims 1-93 to the cell or organism. 98. The method of claim 97, wherein reducing the effective amount of the miRNA target occurs via antagonism in vivo. A method for reversing repression of a target mRNA from a miRNA in a cell or organism comprising administering a composition or a single-stranded oligonucleotide as defined in any one of claims 1-93 to the cell or organism. A method for the synthesis of a single-stranded oligonucleotide as defined in any one of claims 1-93, said method comprising the steps of: a. Selection of a first nucleobase, counting from the 3 'end, which is a LNA.b nucleobase. Optionally selecting a second nucleobase, counting from the 3 'end, which is an LNA.c. Selection of an aqual single-stranded oligonucleotide region corresponds to either of the regions identified in claims 1-5 or the miRNA.d culture region. Optionally selecting two further nucleobases which are the seventh and eighth nucleobases as claimed in claim 39. Optionally selecting a 5 'region of the single-stranded oligonucleotide as defined in any one of claims 40 - 45.f. Optionally selection from 1 to 10 other nucleic bases which may be selected from the group consisting of nucleotides and nucleotide analogs, such as LNA.g. Optionally selecting a 5 'end end of the single stranded oligonucleotide as defined in claim 46, wherein the synthesis is performed by sequential synthesis of the regions defined in steps a-f, wherein said synthesis may be performed in the 3'-5' direction. (aa f) or 5 '- 3' (faa) and wherein said single-stranded oligonucleotide is complementary to a sequence found within a selected sequence of the group consisting of: SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQ ID NO 5. 101. The method of claim 100, wherein the synthesis is performed in the 3 'to 5' direction a-f. 102. Use of an 8-16 nucleobase-length oligonucleotide for the manufacture of a medicament for the treatment of a disease or medical disorder associated with the presence or overexpression of micro-RNA, wherein the oligonucleotide is complementary to a corresponding sequence present in a selected sequence. of the group consisting of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQID NO 5. Use according to claim 102, wherein the disease is selected from the group consisting of increased levels of noplasma cholesterol, atherosclerosis, hypercholesterolemia or hyperlipidemia, hepatitis C, cancer and a metabolic disorder such as diabetes. A method for treating a medical disease or disorder associated with the presence or overexpression of microRNA, comprising the step of administering an oligonucleotide as defined in any one of claims 1 - 100 or a conjugate thereof, to any one. person who needs treatment. 105. The method of claim 104, wherein the person is suffering from a disease selected from the group consisting of increased plasma cholesterol levels, atherosclerosis, hypercholesterolemia or hyperlipidemia, hepatitis C, cancer and a metabolic disorder such as comodiabetes. Use of an oligonucleotide as defined in any one of claims 1-93 or a conjugate thereof for over-regulating Nrdg3, Aldo A, Bckdk or CD320 mRNA levels. A method for reducing the effective amount of a demiRNA target in a cell or organism comprising administering a composition or an oligonucleotide as defined in any one of claims 1 - 93 or a conjugate thereof to the cell or organism. A method for reversing repression of a target mRNα from a miRNA in a cell or organism comprising administering a composition or oligonucleotide as defined in any one of claims 1-93 or a conjugate thereof to the cell or organism. 109. Treatment of a medical disease or disorder associated with the presence or overexpression of micro-RNA comprising the step of administering a composition (such as a pharmaceutical composition) comprising a single-stranded oligonucleotide of between 8-16 nucleobases in length to a person which requires treatment, wherein the oligonucleotide is complementary to a corresponding sequence present in a sequence selected from the group consisting of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQ ID NO 5. 110. A method for reducing the effective amount of a demiRNA target in a cell or organism comprising administering a composition (such as a pharmaceutical composition) comprises a single-stranded oligonucleotide of between 8-16 nucleobases to the cell or organism, wherein the oligonucleotide is. complementary to a corresponding sequence present in a selected sequence from the group consisting of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQID NO 5. 111. A method for reversing repression of a target mRNA from a miRNA in a cell or organism comprising a single-stranded oligonucleotide of 8-16 nucleobases or (or a composition comprising said oligonucleotide) to the cell or organism, wherein the oligonucleotide is complementary to a corresponding sequence present in a sequence selected from the group consisting of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQ ID NO 5. 112. A pharmaceutical composition comprising a single-stranded oligonucleotide of a length of between 8 and 16 nucleobase units, a pharmaceutically acceptable diluent, carrier or adjuvant, wherein at least one of the single-defined oligonucleotide nucleobase units is an analog. where the single stranded oligonucleotide is complementary to a human microRNA sequence, wherein the oligonucleotide is complementary to a corresponding sequence present in a sequence selected from the group consisting of SEQ ID NO 1, SEQID NO 2, SEQ ID NO 3 , SEQ ID NO 4 and SEQ ID NO 5. A pharmaceutical composition according to claim 112, wherein the composition is for the treatment of a selected group disease consisting of increased plasma cholesterol levels, atherosclerosis, hypercholesterolemia or hyperlipidemia, hepatitis C, cancer and a metabolic disorder such as like diabetes.