BRPI0708259A2 - methods for increasing plant yield over control plants, and for producing a transgenic plant, plants, plant parts, or plant cells, construct, uses of a construct, and a sequence of nucleic acid, transgenic plant, harvestable parts of a plant, and, products - Google Patents

Abstract

METHODS TO INCREASE PLANT YIELD IN RELATION TO CONTROL PLANTS, AND TO PRODUCE A TRANSGENIC PLANT, PLANTS, PLANT PARTS, OR PLANT CELLS, CONSTRUCT, USES OF A CONSTRUCT, AND OF A NUCLEAR, STRUCTURE, HARVEST PARTS OF A PLANT AND PRODUCTS. The present invention generally relates to the field of molecular biology and consists of a method for increasing plant yield relative to control plants. More specifically, the present invention relates to a method for increasing plant yield comprising the expression in a plant of a nucleic acid sequence encoding a MYB domain (DNA-binding) transcription factor (MYB-TF) polypeptide. In a particular embodiment, the present invention relates to a method of increasing plant yield, preferably comprising increasing the expression of a nucleic acid sequence encoding a MYB-TF polypeptide, in the endosperm of a plant seed. The present invention also concerns plants having increased expression of a nucleic acid sequence encoding a MYB-TF polypeptide, as well as plants having preferably increased expression of a nucleic acid sequence encoding a MYB-TF polypeptide in the seed endosperm, whose plants have increased yield relative to the control plants. The invention also provides constructs useful in the methods of the invention.

Description

"METHODS FOR INCREASING PLANT INCOME BETWEEN CONTROL PLANTS, AND TO PRODUCE A TRANSGENIC PLANT, PLANTS, PLANT PARTS, PLANT WALLS, CONSTRUCTION, USES OF A CONSTRUCTION, AND A SEQUENCES OF CROSS PLANT, PLANT, AND, PRODUCTS "

The present invention generally relates to the field of molecular biology and concerns a method for increasing plant yield relative to control plants. More specifically, the present invention relates to a method for increasing plant yield comprising understanding in a plant a nucleic acid sequence encoding a MYB domain transcription factor (DNA deletion) polypeptide (MYB-TF). In a particular embodiment, the present invention relates to a method of increasing plant yield preferably comprising enhancing expression of a nucleic acid sequence encoding a MYB-TF polypeptide in the endosperm of a plant seed. The present invention also relates to plants having increased expression of a MYB domain transcription factor polypeptide nucleic acid sequence, as well as to plants preferably having increased expression of a MYB domain transcription factor polypeptide encoding the endosperm of seeds, whose plants have increased yield relative to control plants. The invention also provides constructs useful in the methods of the invention.

The ever-growing world population and the diminishing supply of arable land available for agriculture feeds research into the direction of increased agricultural efficiency. Conventional means for crop and horticulture improvements use selective generation techniques to identify plants having desirable characteristics. However, selective generation techniques have several disadvantages, namely that these techniques are typically labor intensive and result in plants that often contain heterogeneous genetic components that may not always result in the desirable feature being passed from the parent plants. Advances in molecular embiology have allowed humanity to modify the plasmagerminative of animals and plants. Plant genetic engineering requires the isolation and manipulation of genetic material (typically in the form of DNA or RNA) and the subsequent introduction of that genetic material into a plant. Such technology has the ability to provide crops or plants with improved economic, agronomic or horticultural features.

One feature of particular economic interest is yield, and for many plants seed yield. Yield is usually defined as the measurable economic value yield of a crop. This can be defined in terms of quantity and / or quality. Yield is directly dependent on many factors, such as number and size of organs, plant architecture (eg number of branches), seed yield and more. Root development, nutrient uptake and stress tolerance may also be important factors in yield determination. Optimization of one of the above factors can therefore contribute to increase crop yield. Plant seeds are an important source of human and animal nutrition. Crops such as corn, rice, wheat, canola and soya beans account for more than half of total human caloric intake, either through direct consumption of the seeds themselves or through the consumption of flour products produced from processed seeds. They are also a source of sugars, oils and many types of metabolites used in industrial processes. Seed contains an embryo, from new buds and roots after germination, and an endosperm, the denutrient source for embryo growth, during germination and seedling initial growth. Seed development involves many genes, and requires the transfer of metabolites from roots, leaves and stems to all growing seeds. The endosperm, in particular, assimilates the carbohydrate, oil and protein metabolite precursors and synthesizes them into grain filling storage macromolecules. The ability to increase plant seed yield, whether through seed number, seed biomass, seed development, seed fill, or any other roughly related feature would have many agricultural applications, and many non-agricultural uses. such as biotechnological production of substances such as drugs, antibodies or vaccines.

MYB domain proteins are transcription factors with highly conserved DNA binding domain. The MYB domain was originally described in the oncogene (v-myb) of avian myeloblastosis virus (Klempnauer et al. (1982) Cell: 453-63). MYB proteins contain four imperfect direct repeats of a conserved 50-53 amino acid sequence encoding a helix-round-helix structure involved in DNA ligation (Rosinski & Atchley (1998) J Mol Evol 46: 74-83). MYB domain transcription has been identified in many higher eukaryotes, including plants (Jiang et al. (2004) GenomeBiology 5: R46). MYB domain transcription factor polypeptides constitute one of the broadest family of plant transcription factors (at least 130 in Arabidopsis thaliana), but with little conservation off-domain frequency. They have therefore been grouped into subgroups based on conserved motifs identified outside the MYB coding region (Jiang et al., Supra).

A MYB domain rice transcription factor polypeptide, OsMYB4, was cloned by hybridization using the corn MY MY Cl encoding nucleic acid molecule as a probe (Suzuki et al. (1997) Gene 198: 393-398; Protein Accession Number NCB (BAA23340) .The OsMYB4 MYB DNA binding domain is formed by two repeats, which are more similar to the second and third repeats of the three repeats (R1, R2 and R3) normally found in animal MYB DNA binding domains, and It is therefore part of the MYB family of type R2R3 depolipeptides. OsMYB4 mRNA levels were preferentially observed in developing seeds, so it was postulated that OsMYB4 plays a role in seed maturation (Suzuki et al., Supra).

WO 03/007699 describes a nucleic acid sequence of a transcription factor OsMYB4. Methods for using the polynucleotide to alter the resistance or tolerance of stress plants, to alter biological pathways, and to alter gene expression are also described.

US Patent Applications 2004/0045049 and 2004/0019927 provide nucleic acid sequences encoding an OsMYB4 transcription factor and its Arabidopsis ortholog (referred to in these applications as G211). G211 overexpression in Arabidopsis has been reported to have an effect on leaf development and inflorescence, giving small shrub plants with reduced seed yield compared to wild type controls.

Surprisingly, it has now been found that increased expression in a plane of a nucleic acid sequence encoding a MYB (DNA-binding) domain transcription factor polypeptide (MYB-TF) gives plants possessing increased yield relative to control plants. It has also been found that preferentially increased expression of the nucleic acid sequence encoding a MYB-TF polypeptide in the endosperm of a plant seed yields plants having increased yield relative to control plants.

In accordance with the present invention, there is provided a method for increasing plant yield over control plants comprising expression in a plant of a MYB-TF polypeptide encoding nucleic acid sequence. In a particular embodiment, a method is provided for increasing yield relative to control plants, preferably comprising increasing the expression of a MYB-TF polypeptide-encoding nucleic acid sequence in the endosperm of a plant seed.

The terms "polypeptide" and "protein" are used interchangeably herein and refer to amino acids in a polymeric form of any length.

The terms "polynucleotide (s)", "nucleic acid sequence (s)", "nucleotide sequence (s)" are used interchangeably herein and refer to nucleotides, whether or not deoxyribonucleotide ribonucleotides or a combination of both, in a polymeric form of either length.

The choice of a control plant is a routine part of an experimental setup and may include corresponding wild-type plants or corresponding plants without the gene of interest. A 'control plant' is typically of the same plant species or even variety as the plant to be evaluated. The control plant may also be a nullizigote of the plant to be evaluated. A "control plant" as used herein refers not only to whole plants, but also to plant parts, including seeds and seed parts.

The term "increased yield" as defined herein is taken to mean an increase in biomass (weight) of one or more parts of a plant, which may include above ground parts (which may be harvested) and / or below ground parts (which may be Particularly, such parts that can be harvested are seeds, and the performance of the methods of the invention results in plants having increased seed yield over the seedless yield of control plants.

Increased seed yield may manifest as one or more of the following: (a) an increase in seed biomass (total seed weight) which may be on an individual seed basis and / or per plant and / or per hectare or acre; b) increased number of flowers per plant; c) increased number of seeds (floods); d) increased seed filling rate, which is expressed as the ratio between the number of seeds filled divided by the total number of seeds; e) increased harvesting index, which is expressed as a ratio of the yield of harvestable parts, such as seeds, divided by the total biomass; and f) increased Thousand Kernel Weight (TKW), which is extrapolated from the number of counted full seeds and their total weight. An increased TKW may result from increased seed weight and / or seed size, and may also result from an increase in embryo size and / or sperm.

An increase in seed yield may also be manifested as an increase in seed size and / or deboning volume. In addition, an increase in seed yield may also manifest as an increase in seed area and / or demented length and / or seed width and / or seed perimeter. Increased throughput may also result in modified architecture, or may occur because of modified architecture.

Taking corn as an example, an increase in yield can be manifested as one or more of the following: increase in the number of plants per hectare or acre, increase in the number of ears per plant, an increase in the number of rows of grains, the number of grains per row, weight grain weight, thousand grain weight, ear diameter / length, increase in seed filling rate (which is the number of seedlings divided by the total number of seeds and multiplied by 100), among others. Taking rice as an example, an increased yield may manifest as an increase in one or more of the following: number of plants per hectare or acre, number of panicles per plant, number of spikelets per panicle, number of flowers (florets) per panicle ( which is expressed as a ratio of the number of full seeds to the number of primary seedlings), increase in seed fill rate (which is the number of full seeds divided by the total number of seeds multiplied by 100), increase in the weight of one thousand grains, among others.

According to a preferred feature of the present invention, performance of the methods of the invention gives plants having increased seed yield over control plants. Therefore, according to the present invention, there is provided a method for increasing the seed yield in plants relative to the seed yield of control plants, the method comprising increasing the expression in a plant of a MYB domain transcription factor encoding nucleic acid sequence . In a particular embodiment, there is provided a method for increasing the seedless yield in plants relative to the seed yield of control plants, the method preferably comprising increasing the expression of a MYB domain transcription factor polypeptide encoding nucleic acid sequence in the endosperm of a plant seed.

Since transgenic plants according to the present invention have increased yields, it is likely that these plants will exhibit an increased growth rate (over at least part of their life cycle) relative to the growth rate of corresponding wild-type plants at a corresponding stage. in your life cycle. The increased growth rate may be specific to one or more parts of a plant (including seeds), or may be considered substantially the entire plant. A plant having an increased growth rate may even exhibit early flowering. The increase in growth rate occurs at one or more stages in a plant's life cycle or substantially throughout the entire plant life cycle. Increased growth rate during the early stages of a plant's life cycle may reflect increased vigor (increased seedling vigor at emergence). Increasing growth rate can alter a plant's harvest cycle by allowing plants to be sown later and / or harvested earlier than otherwise would be possible. If the growth rate is sufficiently increased, it may allow additional sowing of seeds of the same plant species (eg sowing and harvesting rice plants followed by sowing and harvesting other rice plants within a conventional growing period). Similarly, if the growth rate is sufficiently increased, it may allow additional sowing of seeds of different plant species (eg sowing and harvesting rice plants followed by, for example, sowing and optional harvesting of soybean, potato, or any other suitable plant). Additional harvesting times of even rhizome from some harvesting plants may also be possible. Changing the crop cycle of a plant can lead to an increase in annual crop yield per square meter (due to an increase in the number (ie one year) that any particular plant can be grown and harvested). An increase in growth rate may also allow transgenic plants to be concealed over a wider geographical area than their wild-type counterparts, because the territorial limitations of growing a crop are often determined by adverse environmental conditions at planting time. (early season) or harvest season (late season). Such adverse conditions can be avoided if the crop cycle is shortened. The growth rate can be determined by deriving various parameters from the growth curves, such parameters can be: T-Medium (the time it takes for plants to reach 50% of their maximum size) and T-90 (the time it takes for plants to reach 90 % of its maximum size), among others.

Performance of the methods of the invention gives plants having an increased growth rate. Therefore, according to the present invention, there is provided a method for increasing plant growth rate, which method comprises increasing expression in a plant of a nucleic acid sequence encoding a MYB-TF polypeptide. In a particular embodiment, a method is provided. A method for increasing plant growth rate, which method preferably comprises increasing the expression of a nucleic acid sequence encoding a MYB-TF polypeptide in the endosperm of a plant seed.

An increase in yield and / or growth rate occurs if the plant is under non-stress conditions or if the plant is exposed to various stresses compared to the control plants. Plants typically respond to stress exposure by slower growth. Under severe stress conditions, the plant may even stop growing afterwards. Mild stress on the other hand is defined here as any stress to which a plant is exposed that does not result in the plant ceasing to grow without the ability to continue growing. Mild stress in the direction of the invention leads to a reduction in the growth of the stressed butternut plants by 40%, 35% or 30%, preferably less than 25%, 20% or 15%, more preferably less than 4%, 13%, 12. %, 11% or 10% or less compared to the control plant under non-stress conditions. Due to advances in agricultural practices (irrigation, fertilization, pesticide treatments) severe stresses are often not found on cultivated crop plants. As a consequence, impaired growth induced by mild stress is often an undesirable trait for agriculture. Mild stresses are the biotic and / or abiotic (environmental) stresses of each day to which a plant is exposed. Abiotic stress may be due to drought or excess water, anaerobic stress, salt stress, nutrient depletion, chemical toxicity, oxidative stress, and hot, cold or freezing temperatures. Abiotic stress can be an osmotic stress caused by water stress (particularly due to drought), salt stress, oxidative stress, or ionic stress. Stressbiotics are typically those stresses caused by pathogens, such as bacteria, viruses, fungi, and insects.

In particular, the methods of the present invention may be carried out under non-stress conditions or under mild drought conditions to give plants having increased seed yield over control plants. As reported in Wang et al. (Planta (2003) 218: 1-14), abiotic stress leads to a series of morphological, physiological, biochemical and molecular changes that adversely affect plant growth and productivity. Drought, salinity, extreme temperatures and oxidative stress are known to be interconnected and can induce growth and cellular damage through similar mechanisms. Rabbani et al. (Plant Physiol (2003) 133: 1755-1767) describe a particularly high degree of "cross talk" between drought stress and high salinity stress. For example, drought and / or salinization are manifested primarily as osmotic stress, resulting in disruption of homeostacy and ionic distribution in the cell. Oxidative stress, which often accompanies high or low temperature, salinity or drought stress, can cause denaturation of structural and functional proteins. As a consequence, these various environmental stresses often activate cell signaling pathways and similar cellular responses, such as stress protein production, antioxidant over-regulation, compatible solute accumulation, and growth arrest. The term "non-stress" conditions as used herein refers to those environmental conditions that allow optimal plant growth. Those skilled in the art are aware of normal soil conditions and normal weather conditions for a location.

Performance of the methods of the invention gives grown plants under non-stress conditions or under mild drought conditions, increased seed yield over grown control plants under comparable conditions. Therefore, according to the present invention, there is provided a method for increasing the plant yield of plants grown under non-stress conditions or under mild drought conditions, which method comprises increasing the expression in a plant of a nucleic acid sequence encoding a MYB-TF polypeptide as defined above. In a particular embodiment, the present invention concerns a method for increasing plant yield of plants grown under non-stress conditions or under mild drought conditions, preferably comprising enhancing expression of a nucleic acid sequence encoding a MYB-TF polypeptide, in the endosperm of a plant seed.

The methods of the invention are advantageously applicable to any plant.

The term "plant" as used herein includes entire plants, ancestors or progeny of plants and plant parts, including seeds, buds, stems, leaves, roots (including tubers), flowers, and tissues and organs, in which each of the foregoing above comprises the nucleic acid / gene sequence of interest. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and macrospores, again in which each of the above comprises the nucleic acid / interest gene sequence.

Plants which are particularly useful in the methods of the invention include all plants belonging to the Viridiplantae superfamily, in particular monocotyledonous and dicotyledonous plants including fodder or forage legume, ornamental plants, food crops, trees or shrubs selected from the list comprising Acer spp., Actinidia spp. Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp., Asparagusofficinalis, Avena (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa starfruit, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (egBrassica napus, Brassica rapa ssp. [canola, rapeseed, turnip]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp. Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Coriandrum sativum, Corylus spp., Crataegus spp. Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Elaeis (eg Elaeis guineensis, Elaeis oleiferaac), Eleus Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugeniauniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soy hispida or Soy max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea potatoes, Juglans spp., Lactuca sativa, Lathyrusspp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffaacutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (eg Lyeopersieon esculentum, Lycopersicon lycopersicum, Lycopersiconpyriform), Maerotyloma spp., Malus spp., Malpighia emarginate, Mammeaamericana, Mangifera indica, Manihot spp., Manilkara zapota. , Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopusspp., Oryza spp. (eg Oryza sativa, Oiyza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Parsnip sativa, Pennisetum sp., Perseaspp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleumpratense, Phoenix spp. , Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanussativus, Rheum rhabarbarum, Ribes spp. , Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Seeale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Trobolum spp., Triticosecale rimpaui, Triticum spp. (eg Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum orTriticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp. , Zizania palustris, Ziziphus spp., Among others.

According to a preferred embodiment of the present invention, the plant is a crop plant. Examples of a crop plant include soybean, sunflower, canola, alfalfa, rapeseed, cotton, tomatoes, potatoes, and potatoes. Additionally preferably, the plant is a monocot plant. Examples of monocotyledonous plants include sugar cane. More preferably the plant is a cereal. Examples of cereals include rice, corn, wheat, barley, millet, rye, triticale, sorghum and oats. The term "MYB-TF polypeptide" as defined herein refers to any polypeptide comprising from N-terminus to C-terminus (i) an R2R3 MYB domain comprising two MYB repeats; and (ii) a MYB4 domain preferably in ascending order of at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to the MYB4 domain represented by any one or more of: SEQ ID NO: 38, SEQ ID NO: 27, or SEQ ID NO: 28.

Examples of MYB-TF polypeptides as defined herein are given in Table A of Example 1.

Alternatively or additionally, a "MYB-TF polypeptide" as defined herein refers to any polypeptide sequence that when used in constructing a MYB phylogenetic tree, such as that shown in Figure 3, tends to group with the group of depolipeptide sequences comprising the polypeptide sequences represented by SEQ ID NO: 2 and SEQ ID NO: 4 (Figure 3, bold arrow; circle shows group origin over tree) instead of any other group. A preferred method for generating a phylogenetic tree is described by Kranz et al. (1998) Plant Journal 16 (2): 263-276).

One skilled in the art could readily determine if any polypeptide sequence in question falls within the definition of a "MYB-TF polypeptide" using known techniques and a computer program for preparing such a phylogenetic tree, such as the GCG, EBI or CLUSTAL package, using parameters Any sequence grouping within the group comprising polypeptide sequences as represented by SEQ ID NO: 2 and SEQID NO: 4 would be considered to fall within the above definition of a "MYB-TF polypeptide", and would be considered suitable for use in the methods of the invention.

Alternatively or additionally, a "MYB-TF polypeptide" as defined herein refers to any growing order polypeptide sequence preferably at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more identity mismatch with respect to the polypeptide sequence as represented by SEQ ID NO: 2.

Homologs of a MYB-TF polypeptide may also be used to perform the methods of the invention. "Protein homologues" include peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and / or insertions with respect to the unmodified protein in question and having similar ebiological functional activity to the unmodified protein from which they are derived.

A deletion refers to the removal of one or more amino acids from a protein.

An insertion refers to one or more amino acid residues introduced at a predetermined site in a protein. Insertions may comprise N-terminal and / or C-terminal fusions as well as intra-amino acid or multi-amino acid sequence insertions. Generally, insertions within the amino acid sequence will be smaller than N-terminal or C-terminal fusions of the order of about 1 to 10 wastes. Examples of N- or C-terminal fusion proteins or peptides include the binding domain or activation domain of a transcriptional activator as used in the yeast two-hybrid system, phage decapping proteins, label (histidine) -6, label -glutathione S-transferase, proteinA, maltose-binding protein, dihydro-folate reductase, Tag * 100 epitope, c-myc epitope, FLAG® epitope, IazC, CMP (decalmodulin linker peptide), HA epitope, protein C and VSV epitope.

A substitution refers to protein amino acid exchange for other amino acids having similar properties (such as hydrophobicity, hydrophilicity, antigenicity, propensity to form or break similar α-helical structures or similar β-leaf structures). Amino acid substitutions are typically from individual residues, but may be grouped depending on the functional restrictions placed on opolipeptide; insertions will usually be on the order of about 1 to 10 amino acid residues. Amino acid substitutions are preferably conservative amino acid substitutions. Conservative substitution tables are well known in the art (see for example Creighton (1984) Proteins. W.H. Freeman and Company and Table 1 below).

Table 1: Examples of Conserved Amino Acid Substitutions

<table> table see original document page 17 </column> </row> <table>

Amino acid substitutions, deletions and / or insertions may readily be made using peptide synthesis techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulation. Methods for manipulating DNA sequences to produce substitution, insertion, or deletion variants of a protein are well known in the art. For example, techniques for preparing substitution mutations at predetermined DNA sites are well known to those skilled in the art and include M3 mutagenesis, T7-Gen in vitro mutagenesis (USB, Cleveland, OH), QuickChange Site Directed mutagenesis (Stratagene, San Diego , CA), PCR-mediated site-directed mutagenesis or other site-directed demutagenesis protocols.

Homologs (or homologous proteins) can be readily identified using routine techniques known in the art, such as sequence alignment. Methods for sequence alignment for comparison are well known in the art, such methods include GAP, BESTFIT, BLAST, FASTA and TFASTA. GAP uses Needlemane Wunsch's ((1970) J Mol Biol 48: 443453) algorithm to find the alignment of two complete sequences that maximizes the number of combinations and minimizes the number of gaps. The BLAST algorithm (Altschul et al. (1990) JMol Biol 215: 403-10) calculates the percent sequence identity and performs a statistical analysis of similarity between the two sequences. The computer program for performing BLAST analysis is publicly available through the National Center for Biotechnology Information. Counterparts can be readily identified using, for example, the ClustalW multi-sequence alignment algorithm (version 1.83) available from the GenomeNet service at Kyoto University Bioinformatics Center, with pre-established paired alignment parameters, and a percentage score method. Smaller manual editing can be performed to optimize alignment between conserved motifs, as would be apparent to a skilled artisan.

Counterparts also include orthologs and paralogues, which include evolutionary concepts used to describe degenerate ancestral relationships. Paralogues are genes within the same species that have originated through duplication of an ancestral gene and orthologs are genes from different organisms that have originated through speciation.

Orthologs and paralogues can easily be found by conducting a so-called reciprocal blast search. This can be done first by BLAST involving BLASTing of a reporting sequence (eg, SEQ ID NO: 1 or SEQ ID NO: 2) against any sequence database, such as the publicly available NCBI.BLASTN or TBLASTX database (using values can be used when part of a nucleotide sequence and BLASTP orTBLASTN (using default values) can be used when part of a protein sequence BLAST results can be optionally filtered. either filtered results or unfiltered results are then BLASTed back (according to BLAST) against sequences from the organism from which the query sequence is derived (where the inquired sequence is SEQ ID NO: 1 or SEQ IDNO: 2 the second BLAST would therefore be against the sequences. Oryza) .The results of the first and second BLASTs are then compared. A analog is identified if a position hit from the second BLAST is the same species from which the inquired sequence is derived; an ortholog is identified if a high ranking hit is not of the same kind from which the inquired frequency is derived. High position hits are those with a low E-value. The lower the E-value, the more significant the score will be (in other words the less likely the hit will be found per case). E-value computing is well known in the art. In the case of large families, ClustalW can be used, followed by neighboring junction tree, to help visualize related gene grouping and to identify orthologs and paralogues. In addition to the E-values, comparisons are also sorted by percent identity. Percent Identity refers to the number of identical nucleotides (or amino acids) between the two nucleic acid (or polypeptide) sequences compared over a particular length. Preferably, MYB-TF polypeptide homologs are in ascending order preferably at least 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97 %, 98%, 99% or more sequence identity or similarity (functional identity) with respect to an unmodified MYB-TF polypeptide as represented by SEQ IDNO: 2. Percent identity between homologous MYB-TF forced polypeptide MYB domain is reputedly low. Preferably, MYB-TF polypeptide homologs are as represented by any of the polypeptide sequences given in Table A, or any ortholog or analog of any of the SEQ LD NOs given in Table A.

The MYB-TF polypeptide may be a derivative of SEQ IDNO: 2. "Derivatives" include peptides, oligopeptides, polypeptides which may, compared to the amino acid sequence of the naturally occurring form of the protein, such as SEQ ID NO: 2, comprise amino acid substitutions for non-naturally occurring amino acid residues, or additions of non-naturally occurring amino acid residues. Derived from any of the polypeptide sequences given in Table A, or any ortholog or paralog of any of the SEQ ID NOs given in Table A are other examples which may be suitable for use in the methods of the invention. "Protein derivatives" also include peptides, oligopeptides, polypeptides which may comprise naturally occurring amino acid residues (glycosylated, acylated, ubiquinated, prized, phosphorylated, myristylated, sulfated etc.) or non-naturally occurring amino acid residues compared to amino acid sequences of amino acids. a naturally occurring form of polypeptide. A derivative may also comprise one or more non-amino acid additions or substitutions compared to the amino acid sequence from which it is derived, for example a reporter or other ligand molecule, covalently or non-covalently linked to the amino acid sequence, such as a reporter molecule that is bound to facilitate its detection, and non-naturally occurring amino acid residues in relation to the amino acid sequence of a naturally occurring protein.

The term "domain" means a set of amino acids conserved at specific positions along an alignment alignment (performed as described herein above) of evolutionarily related proteins. Although amino acids in other positions may vary among homologues, amino acids that are highly conserved at specific positions indicate amino acids that are essential in the structure, stability, or activity of a protein. Because fat can be identified by their high degree of conservation in aligned sequences from a family of protein homologs, they can be used with identifiers to determine if a common newly determined sequence polypeptide belongs to a previously identified polypeptide family.

The MYB domain (comprising MYB repeats) on a MYB-TF polypeptide can be identified using specialized databases eg SMART (Schultz et al. (1998) Proc. Natl. Acad. Sci. USA95, 58575864; Letunic et al. (2002) Nucleic Acids Res 30, 242-244; hosted by EMBL in Heidelberg, Germany), InterPro (Mulder et al., (2003) Nucl. Acids Res. 31, 315-318; hosted by European Bio-informatics Institute (EBI) in the United Kingdom) , Prosite (Bucher and Bairoch (1994), A generalized profile syntax for biomolecular sequence motifs and their function in automatic sequence interpretation. (Em) ISMB-94; Proceedings 2nd International Conference on Intelligent Systemsfor Molecular Biology. Altman R., Brutlag D., Karp P., Lathrop R., Searls D., Eds., Pp53-61, AAAIPress, Menlo Park; Hulo et al., Nucl. Acids Res. 32: D134-D137, (2004), the server ExPASy is provided as a service to the scientific community (hosted by the SwissInstitute of Bioinformatics (S IB) in Switzerland) or Pfam (Bateman et al., NucleicAcids Research 30 (1): 276-280 (2002), hosted by the Sanger Institute in the United Kingdom). The MYB domain comprises up to four perfect repeats, each forming a 53-amino acid helix-round-helix structure. MYB repeats are characterized by regularly spaced detriptophan residues.

The MYB4 domain as represented by SEQ ID NO: 38 ((D / N) (D / A) XF (S / T / P /) SFL (N / D) (Y / M) N ( E / D) as represented by SEQ ID NO: 27 ((D / N) (D / A) XF (S / T / -) SFL (N / A) SL (I / M) N (E / D), where X is any amino acid and where - is no amino acid), and / or as represented by SEQ ID NO: 28 (DDDFSSFLDSLIND), can be identified using methods for sequence alignment for comparison as described hereinabove. be adjusted to modify the stringency of the search.For example using BLAST, the statistical significance limit (called the "expected" value) for reporting combinations against database sequences can be increased to show less stringent combinations, so almost exact short combinations can be identified, including the MYB4 domain of SEQ LD NO: 38 and / or the MYB4 domain of SEQ ID NO: 27 without change, or with one or more conservative changes at any position, or with a ma, two or three nonconservative changes in any position; or with a deletion in any overlay. For example, the MYB4 domain of the Oryzasativa MYB-TF polypeptide as represented by SEQ ID NO: 2 is given in SEQ ID NO: 28 (DDDFSSFLDSLIND). Preferably, MYB-TF polypeptides useful in carrying out the methods of the invention comprise a MYB4 domain preferably in ascending order, preferably at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more of identity to domain MYB4 represented by any one or more of: SEQ ID NO: 38, SEQ ID NO: 27, or SEQ ID NO: 28.

In addition, MYB-TF polypeptides (at least in their form) typically have DNA binding activity and a reactive domain. A person skilled in the art can readily determine the presence of a domain of DNA activation and binding activity using routine procedures and techniques. Interaction of proteins with MYB-TF polypeptides (such as in transcription complexes) can be readily identified using standard techniques for a person skilled in the art.

Examples of MYB-TF polypeptide coding nucleic acid sequences include but are not limited to those represented by any of the nucleic acid sequences given in Table A, or any ortholog or coding coding nucleic acid sequence of any of the SEQ ID NOs given in Table A. Variants of MYB-TF polypeptide coding nucleic acid sequences may be suitable for use in the methods of the invention. Suitable variants include portions of MYB-TF polypeptide-encoding nucleic acid sequences and / or nucleic acid sequences capable of hybridizing to MYB-TF polypeptide-encoding nucleic acid sequences / sequences. Other variants include coding variants and allelic variants coding nucleic acid sequences of MYB-TF polypeptides.

The term "moiety" as defined herein refers to a DNA fragment encoding a polypeptide comprising from the Naté-termination to the C-terminus (i) an R2R3 MYB domain comprising two MYB repeats; and (ii) a MYB4 domain having in ascending order of preference at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more of identity to the MYB4 domain represented by any one or more of: SEQ ID NO: 38, SEQ ID NO: 27, or SEQ ID NO: 28. A portion may be prepared, for example, by performing one or more deletions in a sequence. nucleicocoding acid of a MYB-TF polypeptide. The portions may be used alone or may be fused into other coding (or non-coding) sequences for the purpose of, for example, producing a protein that combines various activities. When fused to other coding sequences, the resulting translation polypeptide may be larger than that predicted for the MYB-TF moiety. Preferably, the portion encodes a polypeptide having substantially the same biological activity as that of the MYB-TF polypeptide of SEQ ID NO: 2. .

Preferably, the moiety is a portion of a nucleic acid sequence as represented by any of the nucleic acid sequences given in Table A, or to any nucleic acid coding sequence of an ortholog or paralog of any of the SEQ ID NOs given in Table A. More preferably the portion is a portion of a nucleic acid sequence as represented by SEQ ID NO: 1.

Another variant of the MYB-TF polypeptide encoding nucleic acid sequence useful in the methods of the present invention is a nucleic acid sequence capable of hybridizing under reduced stringency conditions, preferably under stringent conditions, with a nucleic acid sequence derivative as defined herein. rather, whose hybridization sequence encodes a polypeptide comprising N-termination to C-termination (i) an R2R3 MYB domain comprising two MYB repeats; and (ii) a MYB4 domain preferably in ascending order of at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more of identity string to domain ΜΎΒ4 represented by any one or more of: SEQ ID NO: 38, SEQ ID NO: 27, or SEQ ID NO: 28.

Preferably, the hybridization sequence is one that is capable of hybridizing to a nucleic acid sequence as represented by (or probes derived from) any of the nucleic acid sequences given in Table A, or any nucleic acid sequence of an ortholog or any of the SEQ ID NOs given in Table A, or with a portion of any of the sequences mentioned above (the target sequence). More preferably the hybridization sequence is capable of hybridizing to SEQ ID NO: 1 (or derivative probes thereof). Probes are generally less than 1,000 bp in length, preferably less than 500 bp in length. Commonly, probe lengths for DNA-DNA hybridization such as Southern blotting range from 100 to 500 bp, while probe hybridization region for probe hybridizations. DNA-DNA such as PCR amplification are generally shorter than 50 but longer than 10 nucleotides.

The term "hybridization" as defined herein is a process in which substantially homologous complementary nucleotide sequences parallel each other. The hybridization process may occur entirely in solution, i.e. both complementary nucleic acid molecules are in solution. The hybridization process may also occur with one of the complementary nucleic acid molecules immobilized on a matrix such as magnetic cells, Sepharose cells or any other type of resin. The hybridization process may additionally occur with one of the complementary nucleic acid molecules immobilized on a solid support such as denitro-cellulose or nylon membrane or immobilized by eg photolithography on, for example, a silicon glass support (the latter known as microarray arrangements). nucleic acid or as nucleic acid chips). In order to allow hybridization to occur, the generally thermally or chemically denatured nucleic acid molecules are for fusion of a double strand into two single strands and / or for removal of hairpins or other secondary structures of single stranded nucleic acid molecules. .

The term "stringency" refers to the conditions under which hybridization occurs. Hybridization stringency is influenced by conditions such as temperature, salt concentration, ionic strength, and hybridization buffer composition. Generally, low stringency conditions are selected to be about 30 ° C below the thermal fusion point (Tm) for the specific sequence at an ionic strength and at a given pH. Average stringency conditions are when the temperature is 20 ° C below Tm, and high stringency conditions are when the temperature is 10 ° C below Tm. High stringency hybridization conditions are typically used for isolation of hybridization sequences that have high sequence similarity to the target nucleic acid sequence. However, nucleic acid sequences may deviate from each other and still encode a substantially identical polypeptide due to the degeneration of the genetic code. Therefore medium stringency hybridization conditions may sometimes be necessary to identify such nucleic acid molecules.

Tm is the temperature under defined pH and ionic strength, at which 50% of the target sequence hybridizes to a perfectly matched probe. Tm is dependent on the solution conditions and the base composition and length of the probe. For example, longer sequences hybridize specifically at higher temperatures. The maximum hybridization rate is obtained from about 16 ° C to up to 32 ° C below Tm. The presence of monovalent cations in the hybridization solution reduces electrostatic repulsion between two strands of nucleic acid thereby promoting hybrid formation; This effect is visible at sodium concentrations up to 0.4M (for higher concentrations, this effect can be ignored). Formamide reduces the melting temperature of DNA-DNA and DNA-RNA duplicates by 0.6 to 0.7 ° C for each percent of formamide, and addition of 50% formamide allows hybridization to be performed at 30 to 45 ° C. , although the hybridization rate is lowered. Poor base pair combinations reduce the hybridization rate and thermal stability of the duplicates. On average and for large probes, Tm decreases by about 1 ° C by% of base mismatch. Tmp can be calculated using the following equations, depending on the types of hybrids:

• DNA-DNA hybrids (Meinkoth and Wahl, Anal. Biochem., 138: 267-284, 1984):

Tm = 81.5 ° C + 16.6 χ Iog [Na +] at + 0.41 χ% [G / C] b - 500 χ [Lc] "1 -0.61 χ% formamide

• oligo-DNA or oligo-RNA hybrids:

Tm = 79.8 + 18.5 (log10 [Na +] a) + 0.58 (% G / Cb) + 11.8 (% G / Cb) 2 -820 / Lc

• DNA-RNA or RNA-RNA hybrids:

For <20 nucleotides: Tm = 2 (/ „)

For 20-35 nucleotides: Tm = 22 + 1.46 (/ „) to or to another monovalent cation, but only accurate within the range 0.01-0.4 M.

only accurate for% GC within the range of 30% to 75%.

cL = length of duplex in base pairs.

d Oligo, oligonucleotide; / „, Effective primer length = 2x (G / C no.) + (A / T no.).

Nonspecific binding can be controlled using any of a number of known techniques such as, for example, membrane blocking with protein-containing solutions, additions of SDS, DNA and RNA heterologs in the hybridization buffer, and Rnase treatment. For non-homologous probes, a series of hybridizations may be performed by varying one of (i) progressive lowering of annealing temperature (e.g. from 68 ° C to 42 ° C) or (ii) progressive lowering of formamide concentration (eg 50 % to 0%). The experienced technician is aware of various parameters that can be changed during hybridization and that they will either maintain or change stringency conditions.

In addition to hybridization conditions, specificity of hybridization typically also depends on the function of post hybridization washes. To remove residual non-specific hybridization genotype, samples are washed with dilute saline. Critical factors of such washings include the ionic strength and temperature of the final wash: the lower the salt concentration and the higher the wash temperature, the higher the stringency of the wash. Washing conditions are typically performed at or below the hybridization stringency. Positive hybridization gives a signal that is at least twice that residual dogenotype. Generally, stringent conditions suitable for nucleic acid hybridization assays or gene amplification detection procedures are as described above. More or less stringent conditions can also be selected. The experienced technician is aware of various parameters that may be changed during washing and which will either change or alter stringency conditions.

For example, high-stringency stringency hybridization conditions for DNA hybrids longer than 50 nucleotides include hybridization at 65 ° C in Ix SSC or 42 ° C in Ix SSC and 50% formamide, followed by washing at 65 ° C at 0 ° C, 3x SSC. Examples of medium stringency hybridization conditions for DNA hybrids longer than 50 nucleotides include hybridization at 50 ° C in 4x SSC or at 40 ° C in 6xSSC and 50% formamide, followed by washing at 50 ° C in 2x SSC. The length of the hybrid is the anticipated length for the hybridizing nucleic acid molecule. When known nucleic acid sequences are hybridized, the hybrid length can be determined by sequence alignment and identification of conserved conserved regions.

1xSSC is 0.15M NaCl and 15mM sodium citrate; Hybridizations and washes may additionally include 5 χDenhardt's reagent, 0.5-1.0% SDS, 100µl of shredded, denatured salmon DNA, 0.5% sodium pyrophosphate.

For purposes of defining the stringency level, reference may conveniently be made to Sambrook et al. (2001) Molecular Cloning: A laboratory manual, 3rd Edition Cold Spring Harbor Laboratory Press, CSH, New York, or Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989 and annual updates).

The MYB-TF polypeptide may be encoded by an alternative publishing variant. The term "alternative publishing variant" as used herein includes variants of a nucleic acid sequence in which selected introns and / or exons have been excised, substituted, displaced or added, or in which introns have been shortened or elongated. Such variants will be those in which the substantial biological activity of the protein is retained, which can be obtained by selective retention of protein functional segments. Such publishing variants can be found in nature or can be made by man. Methods for preparing such editing variants are well known in the art.

Preferred editing variants are editing variants of the nucleic acid sequence encoding a MYB-TF polypeptide comprising from N-terminus to C-terminus (i) an R2B3 MYB domain comprising two MYB repeats; and (ii) a MYB4 domain preferably in ascending order of at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more identity domain name MYB4 represented by any one or more of: SEQ ID NO: 38, SEQ ID NO: 27, or SEQ ID NO: 28. Other preferred deeditoring variants of the MYB-TF polypeptide encoding nucleic acid sequences comprising characteristics as defined above are publishing variants of a nucleic acid sequence encoded in Table A, or any nucleic acid sequence encoding an ortholog or a paralog of any of the SEQ ID NOs given in Table A. Most preferred is an editing variant of a nucleic acid sequence as represented by SEQ ID NO: 1.

The MYB-TF polypeptide may also be encoded by an allelic variant of a nucleic acid sequence encoding a polypeptide comprising from N-terminus to C-terminus (i) an R2R3 MYB domain comprising two MYB repeats; and (ii) a MYB4 domain preferably in ascending order of at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to the MYB4 domain represented by any one or more of: SEQ ID NO: 38, SEQ ID NO: 27, or SEQ ID NO: 28.

Preferred allelic variants of MYB-TF polypeptide nucleic acid sequences comprising characteristics defined hereinabove are allelic variants of a nucleic acid sequence as given in Table A, or any nucleic acid sequence of an ortholog or a paralog of any of SEQ ID NOs given Most preferred is an allelic variant of a nucleic acid sequence as represented by SEQ ID NO: 1. Allelic variants exist in nature, and included within the methods of the present invention is the use of these natural alleles. Allelic variants include Single Nucleotide Polymorphisms (SNPs) as well as Small Insert / Deletion Polymorphisms (INDELs). The size of INDELs is usually smaller than 100bp. SNPs and INDELs form the largest set of sequence variants in naturally occurring polymorphic strains of most organisms.

Direct evolution (gene shuffling) can also be used to generate variants of MYB-TF polypeptide coding nucleic acid sequences. This consists of DNA shuffling interactions followed by appropriate screening and / or selection of gene variants nucleic acid sequences or their MYB-TF polypeptide coding portions or homologues or portions thereof having an individual biological activity (Castle et al., (2004) Science 304 (5674): 1151-4; US Patents 5,811,238 and 6,395,547).

Site-directed mutagenesis can be used to generate variants of MYB-TF polypeptide coding nucleic acid sequences. Several methods are available for performing site-directed mutagenesis, the most common being PCR based methods (Current Protocols in Molecular Biology. Wiley Eds.).

MYB-TF polypeptide-encoding nucleic acid sequences can be derived from any natural or artificial source. Nucleic acid sequence can be modified from its native form into genomic composition and / or environment through deliberate human manipulation. In one embodiment, the MYB-TF nucleic acid sequence is of plant origin, preferably of a monocotyledonous plant, additionally preferably of the Poaceae family, more preferably Oryza genus, much more preferably the nucleic acid sequence is of Oryza sativa.

Enhanced expression of the nucleic acid sequence of a MYB-TF polypeptide can be accomplished by introducing a genetic modification, preferably at the site of a MYB-TF gene, into the plant. The location of a gene as defined herein is considered to signify a genomic region, which includes the gene of interest and the assembling or downstream IOKB of the coding region. In a particular embodiment, expression of a nucleic acid sequence encoding a MYB-TF polypeptide is preferably increased in the endosperm of a plant seed.

Genetic modification may be introduced, for example, by any of the following methods: T-DNA activation, TILLING, and homologous recombination, or by introduction and expression into a plant of a nucleic acid sequence encoding a MYB-TF polypeptide. Nucleic acid encoding a MYB-TF polypeptide is increased. In a particular embodiment, expression of a nucleic acid sequence encoding a MYB-TF polypeptide is preferably increased in the endosperm of a plant seed. Following introduction of genetic modification, an optional step of selecting increased expression in the plant of a MYB-TF5 polypeptide encoding nucleic acid sequence whose increased expression yields plants having increased yield relative to control plants is followed. In a particular embodiment, upon introduction of genetic modification, there follows an optional step of preferentially increased expression selection of a nucleic acid sequence encoding a plant seed MYB-TF polypeptide, whose increased expression yields plants having increased yields relative to plants. control.

T-DNA activation tagging (Hayashi et al. Science (1992) 1350-1353) involves T-DNA insertion, usually containing a promoter (may also be a translation enhancer or intron), genomic naregion of the gene of interest or 10 kb upstream or downstream of the coding region of a gene in a configuration such that the engine drives the expression of the selected gene. Typically, expression regulation of the gene selected by its natural promoter is disrupted and the gene falls under the control of the newly introduced promoter. The promoter is typically embedded in a T-DNA. This T-DNA is randomly inserted into the plant genome through Agrobacterium infection and leads to modified expression of genes near the inserted T-DNA. The resulting plantastransgenic show dominant phenotypes due to the modified expression of the genes near the introduced promoter. The promoter to be introduced can be any promoter capable of enhancing expression in a plant of the nucleic acid sequence encoding a MYB-TF polypeptide. In a particular embodiment, the promoter of choice preferably increases endosperm expression of a seed seed.

A genetic modification can also be introduced at the site of a gene encoding a MYB-TF polypeptide using the Targeted Induced Local Lesions In Genomes (TILLING) technique. This is a mutagenesis technology useful for generating and / or identifying a nucleic acid sequence encoding a MYB-TF polypeptide with modified activity and / or expression. TLLING also allows selection of plants by bringing such mutant variants. These mutant variants may exhibit modified expression, either length in localization or timing (if mutations affect the promoter for example). These mutant variants may exhibit higher MYB-TF activity than that exhibited by the gene in its formanatural. These mutant variants may exhibit TILLNG that combine high density mutagenesis with high throughput selection methods. The steps typically followed in TILLING are: (a) EMS mutagenesis (Redei GP and Koncz C (1992) In Methods in Arabidopsis Research, Koncz C, Chua NH, Schell J, eds. Singapore, World Scientific Publishing Co., pp. 16-82; Feldmann et al., (1994) In Meyerowitz EM, Somerville CR, eds, Arabidopsis. NY, pp 137-172; Lightner J and Caspar T (1998) in J Martinez-Zapater, J Salinas, eds, Methods on Molecular Biology, Vol. 82. Human Press, Totowa, NJ, pp91-104); (b) DNA preparation and collection of individuals; (c) PCR amplification of a region of interest; (d) denaturation and annealing to enable heteroduplicus formation; (e) DHPLC, where the presence of a heteroduplex in a collection is detected as an extra nocromatogram peak; (f) identification of the mutant individual; and (g) sequencing of mutant PCR product. TILLING methods are well known in the art (McCallum et al., (2000) Nat Biotechnol 18: 455-457; reviewed by Stemple (2004) Nat Rev Genet 5 (2): 145-50). Plants bearing such mutant variants have increased expression of a MYB-TF polypeptide coding acid sequence. In a particular embodiment, plants bearing such mutant variants preferably have enhanced expression of a MYB-TF polypeptide nucleic acid sequence in the endosperm of a seedling.

T-DNA Activation and TILLING are examples of technologies that allow the generation of genetic modifications comprising increased expression in a plant of a MYB-TF polypeptide encoding nucleic acid sequence, or preferably comprising expression of a MYB polypeptide encoding nucleic acid sequence -TF in the endosperm of a plant seed.

Homologous recombination allows the introduction into a genome of a selected nucleic acid sequence at a defined selected position. Homologous recombination is a standard technology routinely used in the life sciences for lower organisms such as yeast or moss Physcomitrella. Methods for performing homologous recombination in plants have been described not only for model plants (Offringa et al. (1990) EMBO J 9 (10): 3077-84) but also for harvesting plants, eg rice (Terada et al. (2002) Nat Biotech 20 (10): 1030-4; Read and Terada (2004) Curr Opin Biotech 15 (2): 132-8). The selected nucleic acid sequence is preferably the region controlling the natural expression of a nucleic acid sequence encoding a MYB-TF polypeptide in a plant. A strong constitutive promoter or alternatively a strong endosperm-specific promoter is introduced into this region, replacing it partially or substantially all of it.

A preferred method for introducing a genetic modification (which in this case need not be at the site of a MYB-TF gene) is the introduction and expression into a plant of a MYB-TF polypeptide nucleic acid sequence as defined herein above. Nucleic acid expression encoding a MYB-TF polypeptide is increased. In a particular embodiment, a preferred method for introducing a genetic modification (which in this case need not be located in a MYB-TF gene) is to introduce and preferably increase expression a nucleic acid sequence encoding a MYB-TF polypeptide as defined herein above, in the endosperm of a seed plant.

The nucleic acid sequence to be introduced into a plant may be a full length nucleic acid sequence or may be a portion or a hybridization sequence or other variant of nucleic acid as defined herein above.

The methods of the invention are based on increased expression in a plant of a MYB-TF polypeptide coding nucleic acid sequence. In a particular embodiment, the methods of the invention are preferably based upon increased expression of a nucleic acid sequence encoding a MYB-TF polypeptide in the endosperm of a plant seed. Methods of enhancing expression of degenerates or gene products are well documented in the art and include, for example, overexpression driven by appropriate promoters, the use of transcription enhancers or translation enhancers. Isolated nucleic acid sequences serving as promoter or enhancer elements may be introduced at an appropriate (typically upstream) position in a nonheterologous form of a polynucleotide so as to over-regulate the expression of a MYB-TF polypeptide nucleic acid sequence . For example, endogenous promoters may be altered in vivo by mutation, deletion and / or substitution (see, Kmiec, US Pat. No. 5,565,350; Zarling et al., PCT / US93 / 03868), or isolated promoters may be introduced. in a plant cell the appropriate orientation and distance of a gene of the present invention to control gene expression. If polypeptide expression is desired, it is generally desirable to introduce a polyadenylation region at the 3 'end of a polynucleotide coding region. The polyadenylation region may be derived from the natural gene, a variety of other plant genes, or deT-DNA. The 3 'end sequence to be added may be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene.

An intron sequence can also be added to the 5 'untranslated region (RTU) or partial coding sequence coding sequence to increase the amount of the mature message that accumulates in the cytosol. Inclusion of an editable intron in the transcriptional unit in both animal plant expression constructs has been shown to increase gene expression at both mRNA and deprotein levels by up to 1,000-fold (Buchman and Berg (1988) Mol. Cell biol. 8: 4395-4405; Callis et al (1987) Genes Dev 1: 1183-1200). Such de-intron enhancement of gene expression is typically higher when positioned near the 5 'end of the transcription unit. It is known in the art of the introns of maize introns 1, 2, and 6 Adh 1-S, the Bronze-1 intron. For general information see: The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, N.Y. (1994).

Other control sequences (in addition to motor, enhancer, silencer, intron sequences, 3'UTR and / or 5'UTR regions) may be protein and / or RNA stabilizing elements.

The invention also provides vectors and genetic constructs for facilitating the introduction and / or preferential expression of nucleic acid sequences useful in the methods according to the invention in a plant seed.

Therefore, a construct is provided comprising: (i) A nucleic acid sequence encoding a MYB-TF polypeptide as defined herein above;

(ii) One or more control sequences capable of expressing a plant, plant part or plant cell of the nucleic acid sequence of (a); and optionally

(iii) A transcription termination sequence.

Preferably, one of the control sequences is at least one of: (i) a constitutive promoter, preferably a G0S2 promoter, or (ii) an endosperm specific promoter, preferably a promotorprolamine.

Constructs useful in the methods according to the present invention may be constructed using recombinant DNA technology well known to those skilled in the art. The gene constructs may be inserted into commercially available vectors, suitable for plant transformation and suitable for dogene expression of interest in the transformed cells. The invention therefore provides use of a gene construct as defined hereinabove in the methods of the invention.

Plants are transformed with a vector comprising the sequence of interest (i.e., a nucleic acid sequence encoding a MYB-TF polypeptide). The skilled artisan is well aware of the genetic elements that must be present in the vector for the purpose of successfully transforming, selecting and propagating host cells containing the sequence of interest. The sequence of interest is operably linked in one or more control sequences (at least one promoter). The terms "regulatory element", "control sequence" and "promoter" are all used interchangeably herein and are to be taken in a broad context to refer to regulatory acidic sequences capable of effecting expression of the sequences they are linked to. Included by the aforementioned terms are transcriptional regulatory sequences derived from a classic genomic and eukaryotic gene (including the TATA box that is required for accurate transcription initiation, with or without the CCAAT box sequence) and additional regulatory elements (ie silencers, enhancers and a-reactive sequences). upstream) that alter gene expression in response to external and / or developmental stimuli, or in a specific manner arrested. Also included within the term is a transcriptional regulatory sequence of a classic prokaryotic gene, in which case it may include a sequence of box 35- and / or - box 10-transcriptional regulatory sequences. The term "regulatory element" also includes a molecule of prokaryote. synthetic fusion or derivative that confers, activates or enhances expression of a nucleic acid molecule in a cell, tissue or organ. The term "operably linked" as used herein refers to a functional link between the promoter sequence and the gene of interest, such that the promoter sequence is capable of initiating transcription of the interest gene.

The term "constitutive promoter" as used herein refers to a promoter that is transcriptionally active during most but necessarily all growth and developmental stages and under most environmental conditions in at least one cell, tissue or organ (such as the endosperm of a plant seed). Table 2 below gives examples of constitutive promoters.

A constitutive promoter is particularly useful in the methods of the invention. It should be clear that the applicability of the present invention is not restricted to the nucleic acid sequence encoding a MYB-TF polypeptide as represented by SEQ ID NO: 1, nor is the applicability of the invention restricted to the expression of a polypeptide encoding nucleic acid sequence MYB-TF, when conducted by a conductive promoter.

Table 2: Examples of constitutive promoters

<table> table see original document page 39 </column> </row> <table>

An organ-specific or tissue-specific promoter is one that is capable of preferentially initiating transcription in certain missing organs, such as leaves, roots, seed tissue, etc. For example, a "root specific promoter" is a promoter that is transcriptionally active predominantly in plant roots, substantially to the exclusion of any other parts of a plant, while still allowing any subnormal expression in these other plant parts.

An endosperm specific promoter refers to any promoter capable of preferentially driving expression of the interest gene in the endosperm of a plant seed. Reference herein to "preferably" conducting endosperm expression of a plant seed is taken to mean conduction of expression of any operably linked sequence in the endosperm substantially to the exclusion of conduction of expression elsewhere in the plant, apart from any residual expression due to expression of promotersubnormal. For example, the prolamine promoter shows strong noendosperm expression of a plant seed, with subnormality in meristem, more specifically in the bud meristem and / or center of discrimination in the system. The endosperm specific promoter may be either a quernatural or synthetic promoter.

Preferably, the endosperm-specific promoter is an isolated promoter of a prolamine gene, such as the rice promalinade RP6 promoter (Wen et al., (1993) Plant Physiol 101 (3): 1115-6) as represented by SEQ ID NO: 29 or by SEQ ID NO: 41, or a similar strength promoter and / or a promoter with a similar expression pattern as rice prolamine opromotor. Similar force pattern and / or similar expression can be analyzed, for example, by copulating promoters in a genereporter and checking reporter gene function in plant tissues. A well-known reporter gene is beta-glucuronidase and the GUScolorimetric spot is used to visualize plant woven beta-glucuronidase activity. It should be clear that the applicability of the present invention is not restricted to the nucleic acid sequence encoding a MYB-TF polypeptide represented by SEQ ID NO: 2, nor is the applicability of the invention restricted to the expression of a nucleic acid encoding a MYB-TF polypeptide when conducted. by a prolamine promoter. Examples of other endosperm specific promoters which may also be used to perform the methods of the invention are shown in Table 3 below.

Table 3: Examples of endosperm-specific promoters for use in the present invention.

<table> table see original document page 40 </column> </row> <table> <table> table see original document page 41 </column> </row> <table>

Another example of a tissue specific promoter is one which is capable of preferentially initiating transcription in young expansion tissues, such as a beta-expansin promoter. Preferably, the beta-expansin promoter is rice, more preferably substantially similar to SEQID NO: 40, much more preferably as represented by SEQ IDNO: 40. Such a promoter is also useful in carrying out the methods according to the invention.

Optionally, one or more terminator sequences (also a control sequence) may be used in the construct introduced into a plant. The term "terminator" includes a control sequence which is a DNA sequence at the end of a transcriptional unit that signals polyadenylation and 3 'processing of a primary transcript and transcription termination. Additional regulatory elements may include transcription as well as translation enhancers. Those skilled in the art are aware of the enhancer and determiner sequences that may be suitable for use in carrying out the invention. Such consequences would be known or readily obtainable by one of ordinary skill in the art.

The genetic constructs of the invention may additionally include a replication sequence origin that is required for maintenance and / or replication in a specific cell type. An example is when a gene construct is required to be kept in a bacterial cell as an episomal genetic element (e.g., plasmid or cosmid molecule). Suitable sources of replication include, but are not limited to, fl-ori and colE1. The genetic construct may optionally comprise a selectable marker gene. As used herein, the term "selectable marker gene" includes any gene that confers a phenotype to a cell in which it is expressed to facilitate the identification and / or selection of cells that are transferred or transformed with an invention nucleic acid construct. Suitable markers may be selected from markers that confer antibiotic or herbicide resistance, introduce a new metabolic condition, or allow visual selection. Examples of selectable marker genes include genes conferring antibiotic resistance (such as npt11 which phosphorylates neomycin and kanamycin, or hpt, hygromycin phosphorylation, or genes conferring resistance to, for example, bleomycin, streptomycin, tetracycline, chloramphenicol, ampicillin, gentamicin, geneticin (G418 ), spectinomycin or blasticidine), herbicides (for example bar providing resistance to Basta®; aroA or gox providing resistance to glyphosate, or genes conferring resistance to, for example, imidazolinone, phosphinothricin or sulfonyl urea), or genes providing a feature metabolic (such as manA which allows plants to hold sownmannose as the sole source of carbon or xylose isomerase for the use of xylose, or anti-nutritive markers such as 2-deoxyglucose resistance). Expression of visual marker genes results in decor formation (eg β-glucuronidase, GUS or β-galactosidase with their colored substrates, for example X-Gal), luminescence (such as luciferin / luciferase system) or fluorescence (Green Fluorescent Protein, GFP, their derivatives). This list represents only a small number of possible paths. The experienced technician is familiar with such markers. Different markers are preferred depending on the organism and method of selection.

The present invention also includes plants obtainable by the methods according to the present invention. The present invention therefore provides plants, plant parts or plant cells thereof obtainable by the method according to the present invention, wherein plants or parts or cells thereof comprise an isolated nucleic acid encoding a MYB-TF polypeptide under the control of a constructive promoter as defined herein. up here. In a particular embodiment, the present invention provides the same plants, plant parts or plant cells obtainable by the method according to the present invention, the plants or parts or cells thereof comprising a nucleic acid isolated encoding a MYB-TF polypeptide under the control of a specific endosperm promoter.

The invention also provides a method for producing transgenic plants having increased yield over control plants, comprising introducing and expressing in a plant a nucleic acid sequence encoding a MYB-TF polypeptide. In a particular embodiment, the invention provides a method for the production of transgenic plants having increased yield relative to control plants, comprising introducing and preferably expressing a nucleic acid sequence encoding a MYB-TF polypeptide in the endosperm of a plant seed.

More specifically, the present invention provides a method for producing transgenic plants having increased yield over control plants, the method of which comprises the steps of:

(i) introducing and expressing in a plant, plant part or plant cell a nucleic acid sequence encoding a MYB-TF polypeptide; and

(ii) culturing the plant cell under plant growth and growth promoting conditions and wherein expression of the nucleic acid sequence encoding a MYB-TF polypeptide is driven by a constitutive promoter, or an endosperm specific promoter.

The nucleic acid sequence can be introduced directly into a plant cell or into the plant itself (including introduction into a tissue, organ or any other part of a plant). According to a preferred feature of the present invention, the nucleic acid sequence is preferably introduced into a plant by transformation.

The term "transformation" as referred to herein includes the transfer of an exogenous polynucleotide into a host cell, regardless of the method used for the transfer. Plant tissue capable of subsequent clonal propagation, either by organogenesis or by embryogenesis, can be transformed into the genetic construct of the present invention and an entire plant can be regenerated from it. The particle tissue chosen will vary depending on the clonal propagation systems available for, and best suited for, the particular species being transformed. Exemplary tissue targets include leaf discs, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing tissue (eg, apical meristem, axillary buds, and root meristems), and induced meristem tissue (eg cotyledon meristem). hypocotyl system). The polynucleotide may be transiently or stably introduced into a host cell and may be kept unintegrated, for example, as a plasmid. Alternatively it may be integrated into the host genome. The transformed plant cell can then be used to regenerate a transformed plant in a manner known to those skilled in the art.

Transformation of plant species is now a fairly routine technique. Advantageously, any of several methods of transformation can be used to introduce the gene of interest into a suitable ancestral cell. Transformation methods include the use of deliposomes, electroporation, chemical compounds that increase free DNA uptake, DNA injection directly into the plant, bombardment with a particle gun, transformation using virus or pollination. Methods may be selected from the calcium / propylene glycol method for protoplasts (Krens, F.A. et al. (1982) Nature 296, 72-74; Negrutiu I et al. (1987) Plant Mol Biol 8: 363-373); electroporation for protoplasts (Shillito R.D. et al. (1985) Bio / Technol 3, 1099-1102); microinjection into plant material (Crossway A et al. (1986) Mol. Gen Genet202: 179-185); bombardment of DNA or RNA coated particles (KleinTM et al. (1987) Nature 327: 70) similar (non-integrative) virus infection. Transgenic rice plants with enhanced ugene expression / nucleic acid sequence encoding a MYB-TF polypeptide are preferably produced via Agrobacterium-mediated transformation using any of the well known methods for rice transformation, as described in any of the following: Patent Application European Publication EP 1198985 Al, Aldemita and Hodges (Plant 199: 612-617, 1996); Chan et al. (Plant Mol Biol 22 (3): 491-506,1993), Hiei et al. (Plant J 6 (2): 271-282, 1994), the descriptions of which are incorporated herein by reference as if fully described. In the case of maize transformation, the preferred method is as described either in Ishidaet al. (Nat. Biotechnol 14 (6): 745-50, 1996) either in Frame et al. (PlantPhysiol 129 (1): 13-22, 2002), the descriptions of which are incorporated herein by reference as if fully described.

Generally after transformation, plant cells or plant cell clusters are selected for the presence of one or more markers that are encoded by plant expressible genes co-transferred with the gene of interest, after which the transformed material is regenerated into a plant. After DNA transfer and regeneration, computationally transformed plants can be evaluated, for example using Southern analysis, for the presence of the gene of interest, copy number and / or genomic organization. Alternatively or additionally, newly introduced DNA expression levels can be monitored using Northern and / or Western analysis, or quantitative PCR, all techniques well known to those of ordinary skill in the art.

The generated transformed plants can be propagated by a variety of means, such as clonal propagation or classical generation techniques. For example, a first-generation (or TI) transformed plant may be self-fertilized to give second-homozygous (or T2) transformants, and T2-plants may be further propagated through classical generation techniques.

Generated transformed organisms can take a variety of forms. For example, they may be chimeras of transformed cells and untransformed cells; clonal transformants (e.g., all cells transformed to contain the expression cassette); Transformed and unprocessed detained grafts (e.g., in plants, a rhizomatransformed grafted onto an unprocessed implant).

The present invention clearly extends to any plant cell or plant produced by any of the methods described herein, and to all plant parts and their propagules. More specifically, the present invention provides plants, plant parts, or plant cells obtainable by the methods of the invention, wherein said plants, parts or cells thereof comprise an isolated nucleic acid encoding a MYB-TF polypeptide whose encoding nucleic acid is operatively bound to a constitutive promoter, or to a specific endosperm promoter.

The present invention further extends to include the progeny of a primary transformed primary diseased whole cell, tissue, organ or plant that has been produced by any of the methods mentioned above, and the only requirement being that the progeny exhibit the same (s) phenotypic (s) and / or genotypic trait (s) than those produced by the parent plant in the methods according to the invention.

The invention also includes host cells containing an isolated nucleic acid sequence encoding a MYB-TF polypeptide. Preferred host cells according to the invention are plant cells.

The invention also extends to harvestable parts of a plant such as, but not limited to, seeds, leaves, fruits, flowers, rhizomes, tubers and bulbs. The invention further relates to products derived, preferably directly derived, from a part capable of being harvested from such a plant, such as dried powders or pellets, oil, fat and fatty acids, starch or proteins.

The present invention also includes the use of MYB-TF polypeptide coding nucleic acid sequences and the use of MYB-TF polypeptides in increasing plant yield as defined hereinabove in the methods of the invention.

Nucleic acid sequences encoding MYB-TF polypeptides, or MYB-TF polypeptides, may find use in generation programs in which a DNA marker that can be genetically linked into a MYB-TF gene is identified. Nucleic acid genes / sequences, or MYB-TF polypeptides may be used to define a molecular marker. This DNA or protein marker may then be used in generation programs to select plants having increased yields as defined hereinabove in the methods of the invention.

Allelic variants of a MYB-TF gene / nucleic acid sequence may also find use in marker-aided generation programs. Such generation programs sometimes require the introduction of allelic variation by mutagenic treatment of plants using, for example, EMS mutagenesis; alternatively, the program may start with a collection of allelic variants of a so-called "natural" origin caused unintentionally. Identification of allelic variants then occurs, for example, by PCR. This is followed by a step for selecting higher allelic variants of the sequence in question and giving increased yield. Selection is typically performed by monitoring the growth performance of plants containing allelic variants other than the sequence in question. Growth performance can be monitored in a greenhouse or in the field. Other optional steps include plant crossing in which the upper allelar variant has been identified with another plant. This could be used, for example, to prepare a combination of phenotypic features of interest.

A nucleic acid sequence encoding a MYB-TF polypeptide can also be used as genetic probes to effectively map the genes of which they are a part, and as markers for features linked to those genes. Such information may be useful in plant generation for the purpose of developing strains with desired phenotypes. Such use of MYB-TF nucleic acid sequences requires only a nucleic acid sequence of at least 15 nucleotides in length. MYB-TF nucleic acid sequences may be used as restriction fragment length polymorphism (RFLP) markers. Southern blots (Sambrook J, Fritsch EF and Maniatis T (1989) Molecular Cloning, A Laboratory Manual) of restriction-plant genomic DNA can be probed with the MYB-TF acid sequence. The resulting band patterns can then be subjected to genetic analysis using computer programs such as MapMaker (Lander et al. (1987) Genomics 1: 174181) for the purpose of constructing a genetic map. In addition, nucleic acid sequences can be used to probe Southern blots containing restriction endonuclease-treated genomic DNAs from a set of individuals representing the parental plant and progeny of a defined genetically cross. Segregation of DNA polymorphisms is noted and used to calculate the position of the MYB-TF nucleic acid sequence in the genetic map previously obtained using this population (Botstein et al. (1980) Am. J.Hum. Genet. 32: 314-331).

The production and use of plant gene derived probes for genetic mapping are described in Bernatzky and Tanksley (1986) Plant Mol. Biol. Reporter 4: 37-41. Numerous publications describe genetic mapping of specific cDNA clones using the methodology described above or variations thereof. For example, F2 crossover populations, backcross populations, randomly combined populations, quasi-isogenic strains, and other sets of individuals can be used for mapping. Such methodologies are also well known to those skilled in the art.

Nucleic acid probes can also be used for physical mapping (ie, positioning sequences on physical maps; see Hoheisel et al. In: Non-mammalian Genomic Analysis: A PracticalGuide, Academic press 1996, pp. 319-346, and references to same).

In another embodiment, encoding nucleic acid probes may be used in direct fluorescence in situ hybridization (FISH) mapping (Trask (1991) Trends Genet. 7: 149-154). Although FISH mapping methods favor the use of large clones (several kba several hundred kb; see Laan et al. (1995) Genome Res. 5: 13-20), improvements in sensitivity may allow FISH mapping performance using shorter probes.

A variety of methods based on nucleic acid amplification for genetic and physical mapping can be performed using nucleic acid sequences. Examples include allele-specific amplification (Kazazian (1989) J. Lab. Clin. Med. 11: 95-96), PCR amplified polymorphism or fragments (CAPS; Sheffield et al. (1993) Genomics16: 325-332), allele-specific binding. (Landegren et al. (1988) Science241: 1077-1080), Nucleotide Extension Reactions (Sokolov (1990) NucleicAcid Res. 18: 3671), Radiation Hybrid Mapping (Walter et al. (1997) Nat. Genet. 7: 22-28) and Satisfactory Mapping (Dear and Cook (1989) Nucleic Acid Res. 17: 6795-6807). For these methods, the nucleic acid sequence is used to design and produce primer pairs for each amplification reaction or for primer extension reactions. The design of such initiators is well known to those skilled in the art. In methods employing PCR-based genetic mapping, it may be necessary to identify DNA sequence differences between the parental individuals of the cross-mapping in the region corresponding to the present nucleic acid sequence. This, however, is generally not required for mapping methods.

The methods according to the present invention result in plants having increased yield as described hereinabove. Increased behavior is also combined with other economically advantageous features, such as other yield enhancing features, tolerance to other abiotic and biotic stresses, features modifying various architectural and / or biochemical and / or physiological characteristics.

Description of the Figures

The present invention will now be described with reference to the following figures in which:

Fig. 1 depicts the schematic structure of a MYB-TF polypeptide comprising from the N-terminus to the C-terminus a R2R3 MYB (large circle) DNA binding domain comprising two MYB repeats (two smaller circles), a MYB4 domain (within the rectangle) . The polypeptide regions outside these domains are variable regions.

Fig. 2 represents a table of related sequences common to the MYB-TF polypeptide, as tentatively assembled by The Institutefor Genomic Research (TIRG) (TC924083). The Eucaryotic Gene Ortholog (EGO) database can be used to identify such related sequences, either by keyword research or by using the BLAST algorithm with the nucleic acid or polypeptide sequence of interest. The designer is not exhaustive, but more related sequences can be identified in the Entrez Nucleotide database at the National Center for Biotechnology Information (NCBI) using database sequence search tools.

Fig. 3 is a phylogenetic tree of plant R2R3 MYB-TF polypeptides generated by Kranz et al. (1998) Plant Journal 16 (2): 263-276. Region comprising the Glade of interest has been expanded from the original tree. SEQ ID NO: 2 (from Oryza sativa) and SEQ ID NO: 4 (from Arabidopsisthaliana) are indicated in their position on the tree prepared with a setanegra. The origin of the Glade of interest is marked with a circle.

Fig. 4 is an alignment of MYB-TF polypeptide sequences. The sequences were aligned using the AlignX Vector NTIsuite program (InforMax, Bethesda, MD). Multiple alignment was done with a gap opening penalty of 10 and a gap length of 0.01. Minor manual addition was also performed where necessary to improve placement of some conserved regions. The line shown indicates the separation of MYB-TF polypeptide sequences useful in the methods of the invention, and other MYB-TF polypeptide sequences. The two MYB repeats (R2 and R3) are heavily contained within the rectangle through all the sequences shown. The 3 propellers within these two repeats are lightly contained within rectangles. Preserved Trp (W) residues are marked with an arrow. The MYB4 domain at the C-terminus of polypeptide sequences is most heavily contained within the rectangle but only through the MYB-TF polypeptide sequences useful in carrying out the methods of the invention.

Fig. 5 shows a veto for Oryza sativa expression of an Oryza sativa nucleic acid sequence encoding a MYB-TF polypeptide under the control of a GOS2 (pG0S2) promoter or a pprol promoter or a beta-expansin promoter. (pExp).

Fig. 6 details examples of sequences useful in carrying out the methods according to the present invention.

Examples

The present invention will now be. described with reference to the following examples, which are by way of illustration only. The following examples are not intended to completely define or otherwise limit the scope of the invention.

Example 1: Identification of Sequences Related to the Nucleic Acid Sequence Used in the Methods of the Invention

Sequences (full length cDNA, ESTs, or genomic) related to the nucleic acid sequence used in the methods of the present invention were identified from those maintained in the Entrez Nucleotide Nucleotide database at the National Center forBiotechnology Information (NCBI) (http: // www. ncbi.nlm.nih.gov) using database sequence search tools, such as Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and Altschul et al (1997) Nucleic Acids Res. 25: 3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences with sequence databases and calculating the statistical significance of combinations. For example, the polypeptide encoded by the nucleic acid sequence of the present invention was used for the TBLASTN algorithm, with predefined adjustments and the filter to bypass low complexity sequence set off. The result of the analysis was viewed by paired comparison, and classified according to the probability score (E-value), where the score reflects the likelihood that a particular alignment occurs at random (the smaller the E-value, the more significant the hit). . In addition to the E-values, comparisons were also classified by percent identity. Percent identity refers to the number of identical nucleotides (or amino acids) between two nucleic acid (or polypeptide) sequences compared over a particular length. In some situations, preset parameters can be adjusted to modify the search stringency. For example, the E-value may be increased to show less stringent combinations. In this mode, almost exact short combinations can be identified.

The Table below provides a list of nucleic acid sequences related to the nucleic acid sequence used in the methods of the present invention.

Table A: Nucleic Acid Sequences Related to Nucleic Acid Sequence Used in the Methods of the Present Invention

<table> table see original document page 53 </column> </row> <table> <table> table see original document page 54 </column> </row> <table>

In some situations, related sequences have been positively assembled and publicly described by research institutions, such as The Institute for Genomic Research (TIRG). The Eucharistic Gene Ortholog (EGO) database can be used to identify such related sequences, either by keyword searching or by using the BLAST algorithm with the nucleic acid or depolipeptide sequence of interest. The result of such a search can be seen in Figure 2.

Example 2: Alignment of Relevant Polypeptide Sequences

AlignX of Vector NTI (Invitrogen) is based on the popular Clustal progressive alignment algorithm (Thompson et al. (1997) Nucleic Acids Res 25: 4876-4882; Chenna et al. (2003). Nucleic Acids Res 31: 3497-3500). A phylogenetic tree can be constructed using a neighbor join grouping algorithm. Default values are for gap gap apennial of 10, for short-span penalty of 0.1 and the selected weight matrix is Blosum 62 (if polypeptide aligned).

The result of multiple sequence alignment using the relevant polypeptides in identification of those useful in carrying out the methods of the invention is shown in Figure 4. The sequences were aligned using the AlignX Vector NTI suite program (InforMax, Bethesda, MD). Multiple sequence alignment was made. with a gap-opening penalty of 10 and a gap-extension of 0.01. Minor manual addition was also performed where necessary to improve the position of some conserved regions.

The line shown indicates the separation of MYB-TF polypeptide sequences useful in carrying out the methods of the invention, and other MYB-TF polypeptide sequences. The two MYB repeats (R2 and R3) are heavily contained in rectangle across all sequences shown. Preserved Trp (W) residues are marked with a tape. The MYB4 domain at the C-terminus of the aligned polypeptide sequences is heavily enclosed in rectangle but only for MYB-TF polypeptide sequences that are useful for carrying out the methods of the invention.

Example 3: Calculation of Global Percentage Identity Between Polypeptide Sequences Useful in Performing Invention Methods

Overall percentages of similarity and identity full-length polypeptide sequences useful in carrying out the methods of the invention were determined using one of the methods available in the art, the Matrix Global Alignment Tool (BMC Bioinformatics.2003) computer program. 4:29 MatGAT: An application that generates similarity / identity matrices using protein or DNA sequences.Campanella JJ, Bitincka L, Smalley J; program hosted by LedionBitincka). MatGAT computer program generates dissimilarity / identity matrices for protein or DNA sequences without the need for data alignment. The program performs a series of paired alignments using Myers eMiller's global alignment algorithm (with a gap opening penalty of 12, and a gap extension penalty of 2), calculating similarity and identity using for example Blosum 62 (for polypeptides), and then positions the results in a distance matrix. Sequence similarity is shown on the lower half of the dividing line and sequence identity is shown on the upper half of the diagonal dividing line.

Parameters used in the comparison were:

Score matrix: Blosum62

First Gap: 12

Extension Gap: 2

Results of computer program analysis are shown in Table B for overall identity and similarity of total length of polypeptide sequences (excluding partial polypeptide sequences). Percentage identity is given above the diagonal and percentage similarity is given below the diagonal.

The percent identity between polypeptide sequences useful in carrying out the methods of the invention ranges from 40% to 56% amino acid identity compared to SEQ ID NO: 2.

Table B: MatGAT results for overall similarity and identity over the total length of the MYB-TF polypeptide sequences useful in carrying out the methods of the invention.

<table> table see original document page 56 </column> </row> <table> <table> table see original document page 57 </column> </row> <table>

The conserved MYB4 domain as represented by SEQID NO: 28 (DDDFSSFLDSLIND) is comprised in SEQ ID NO: 2 (amino acid coordinates 231-244; see Figure 4). When percent identity is calculated between the conserved MYB4 domain of the polypeptide sequences useful in carrying out the methods of the invention and the conserved MYB4 domain as represented by SEQ ID NO: 28 (instead of between full length polypeptides), then at least 60% is achieved. amino acid identity. For example, if five amino acid residues of a conserved MYB4 domain differ when aligned with the conserved MYB4 domain as represented by SEQ ID NO: 28, then 64% amino acid identity is calculated.

Example 4: Identification of domains comprised in polypeptide sequences useful in carrying out the invention methods

The Protein Families, Domains, and Sites Integrated Resource (InterPro) database is an integrated interface for signature data banks commonly used for text and sequence-based searches. The InterPro database combines these databases, which use different methodologies and varying degrees of biological information about well-characterized proteins to derive protein signatures. Contributing databases include SWISS-PROT, PROSITE, TrEMBL, PRINTS, ProDom and Pfam, Smart. and TIRGFAMs, each database having its own search algorithms and entry access numbers. InterPro is hosted at the European Bioinformatics Institute in the United Kingdom.

InterPro scan results of the polypeptide sequence as represented by SEQ ID NO: 2 are presented in Table C and Figures 1 and 4. Table C: InterPro scan results of the polypeptide sequence as represented by SEQ ID NO: 2.

<table> table see original document page 58 </column> </row> <table>

Example 5: Cloning of nucleic acid sequence in the methods of the invention

DNA Manipulation: Unless otherwise stated, recombinant DNA techniques are performed according to standard protocols described in (Sambrook (2001) Molecular Cloning: Alaboratory Manual, 3rd Edition Cold Spring Harbor Laboratory Press, CSH, New York) or in Volumes 1 and 2 of Ausubel et al. (1994), Current Protocolsin Molecular Biology, Current Protocols. Standard molecular materials and methods for platna work are described in Plant Molecular BiologyLabhase (1993) by R.D.D. Croy, published by BIOS Scientific PublicationsLtd (UK) and Blackwell Scientific Publications (UK).

The nucleic acid sequence used in the methods of the invention was amplified by PCR using a custom Oryza sativa demented cDNA library (in pCMV Sport 6.0; Invitrogen, Paisley, UK) as a template. PCR was performed using Hifi Taq DNA polymerase under standard conditions employing 200 ng of template in a 50 μl PCR mix. The primers used were prm05233 (SEQ ID NO: 30; sense, coding bold start, AttBl site in italics: 5'-GGGGA CAA GTTTG TA CAAAAA GCA GGCTTAAA G4 ATGAAGCGGAAGCGG 3 ') and prm05234 (SEQ ID NO: 31; inverso , complementary, AttB2 site in italics: 5 'GGGGACCACTTTGTACAAGAAAGCTGGGTAATCTCCCGAAAGATTACTGT 3'), which includes AttB sites for Gateway recombination. The amplified PCR fragment was also purified using standard methods. The first step of the Gateway procedure, the BP reaction, was then performed, during which the PCR fragment recombines in vivo with pRN1 oplasmide to produce, according to Gateway terminology, an "input clone", pMYB-TF. Plasmid pDC) NR201 was purchased from Invitrogen as part of Gateway® technology.

Example 6: Expression Vector Construction

The input clone was subsequently used in an LR reaction with a destination vector used for Oryzasativa transformation. This vector contains as functional elements within T-DNA borders: a detectable plant marker; a selectable path expression cassette; and a Gateway cassette intended for in vivo LR combining with the nucleic acid sequence of interest already cloned into the input clone.

For example, a rice GOS2 promoter (pGOS2; SEQ IDNO: 39) for constitutive expression was located upstream of this Gateway.

In a second example, a rice prolamine promoter (pProl; SEQ ID NO: 29 or SEQ ID NO: 41) for endosperm specific expression was located upstream of this Gateway cassette.

In a third example, a beta-expansin promoter of rice (pExp; SEQ ID NO: 40) for expression in young expansion tissues was located upstream of this Gateway cassette.

Following the LR recombination step, the resulting expression vectors pGOS2 :: MYB-TF, pProl :: MYB-TF, and pExp :: MYB-TF (Figure 5) were independently transformed into Agrobacterium strain LBA4044 with methods well known in the art.

Example 7: Plant TransformationRice Transformation

The two Agrobacterium strains each containing an expression vector were used independently to transform Orza sativa plants. Ripe dried seeds of Nipponbare japonica rice were husked. Sterilization was performed by incubating for one minute in 70% ethanol followed by 30 minutes in 0.2% HgCl2, followed by 6 washes of 15 minutes each with sterile water. The sterile seeds were then germinated on a medium containing 2,4-D (callus induction medium). After incubation in the dark for four weeks, embryogenic stems, scutellum derivatives were excised and propagated on the same medium. After two weeks, the stems were multiplied or propagated by subculture on the same medium for another 2 weeks. Embryogenic callus pieces were subcultured in fresh medium 3 days before co-cultivation (to enhance cell division activity).

Agrobacterium strain LBA4404 containing the expression vector was used for co-cultivation. Agrobacterium was inoculated on AB medium with the appropriate antibiotics and cultured for 3 days at 28 ° C. The bacteria were then collected and suspended in liquid co-cultivation medium for a density (OD600) of about 1. The suspension was then transferred to a petri dish and the stems immersed in the suspension for 15 minutes. Callus were then dried on filter paper and transferred to co-cultivation medium, solidified and incubated 3 days in the dark at 25 ° C. Cultivated calosco were grown on medium containing 2,4-D for 4 weeks in the dark at 28 ° C in the presence of a selection agent. During this period, resistant callus islets developed rapidly growing in light, embryogenic potential was released, and shoots developed within four weeks. Sprouts were excised from the corns and incubated for 2-3 weeks in auxin-containing medium from which they were transferred to the soil. Hardened shoots were grown under high humidity and short days in a greenhouse.

Approximately 35 TOindependent rice transformants were generated per construct. Primary transformants were transferred from a culture and tissue chamber to a greenhouse.

After a quantitative PCR analysis to verify the T-DNA5 insert copy number only single copy transgenic plants that exhibited selection agent tolerance were maintained for TI seed harvest. Seeds were then harvested three to five months after transplantation. The method yielded single site transformants at a rate of over 50% (Aldemita and Hodges 1996, Chan et al. 1993, Hiei et al. 1994).

Example 8: Phenotypic Evaluation Procedure

6.1 Evaluation Configuration

Approximately 35 TOindependent rice transformants were generated. Primary transformants were transferred from a culture tissue chamber to a greenhouse for growing and harvesting TI seed. Five to seven independent events were retained, of which the T1 progeny segregated 3: 1 for the presence / absence of the transgene. For each of these events, approximately 10 T1 seedlings containing otransgene (hetero- and homozygotes) and approximately 10 missing T1 seedlings. Transgene (nullizigotes) were selected by visual marker expression monitoring. Transgenic plants and corresponding nullizygotes were grown side by side in random positions. Greenhouse conditions were short days (12 hours of light), 28 ° C in light and 22 ° C in dark, and a relative humidity of 70%.

If a T2 generation assessment was performed, the procedure was the same as for the T1 generation but with more individuals per event. From the sowing stage to the maturity stage the plants were passed seven times through a digital imaging booth. At each instant of time digital images (2048x1536 pixels, 16 million colors) were taken from each plant from at least 6 different angles. Above ground biomass was deduced from the images using an appropriate computer program.

To measure root-related parameters, plants were grown in specially designed pots with transparent backgrounds to allow root visualization. A digital camera recorded images through the bottom of the pot during plant growth. Derera characteristics such as total projected area (which can be correlated with total root volume), average root diameter and length above a certain thickness limit (coarse root length, or coarse root length) were deduced from the image using an appropriate computer program. . Changes in these parameters reflect changes in root biomass, for example, increased root area, increased root length, or increased number of thick roots are all indicative of increased soft root biomass.

6.2 Statistical analysis: F-test

A two-way ANOVA (variance analysis) was used as a statistical model for general evaluation of plant phenotypic characteristics. An F-test was performed on all measured parameters of all plants of all events transformed with the gene of the present invention. The F-test was performed to check a gene effect over all transformation effects and to verify a general gene effect, also known as a global gene effect. The threshold for significance for a true global gene effect was set at a 5% deprobability level for the F-test. A significant F-test value points to a gene effect, meaning that it is not just the mere presence or deposition of the gene that causes the differences in phenotype.

6.3 Measured Parameters

Measurement of biomass-related parameterFrom the sowing stage to the maturity stage the plants were passed several times through a digital imaging booth. At each instant of time digital images (2048x1536 pixels, 16 million decors) were taken from each plant of at least 6 different angles.

The above ground plant area (or leaf biomass) was determined by counting the total number of pixels on the digital images of the above ground plant parts broken down from the bottom. This value was averaged for figures taken at the same time from different angles and was converted to a physical surface value expressed in mm squared by calibration. Experiments show that the above ground plant area measured by this mode correlates with abiomass of above ground plant parts. The above ground area is the area measured at the instant of time at which the plant had reached its maximum biomass. The initial vigor is the above-ground plant (seedling) area three weeks after germination.

In addition, another parameter was deduced from the above-ground dabiomass images before flowering: the greenness index, which is ownership (expressed as%) of dark green and green pixels in the last image before flowering.

Increase in root biomass is expressed as an increase in total root biomass (measured as the maximum root biomass observed over the life of a plant); or as an increase in the shoot / root index (measured as the ratio of root to shoot mass in the period of active root and shoot growth); or as an increase in thick roots; or as an increase in thin roots.

Seed related parameter measurements

The mature primary panicles were harvested, counted, bagged, bar-coded and then dried for three days in an oven at 37 ° C. The panicles were then threshed and all seeds were collected and counted. The full shells were separated from the empty shells using an air blowing device. The empty shells were discarded and the remaining fraction was counted again. The full shells were weighed on an analytical scale. The number of full seeds was determined by counting the number of full shells remaining after the separation step. Total seed weight per plant was measured by weighing all bark harvested from a plant. The total number of seeds per plant was measured by counting the number of bark harvested from a plant. Thousand Kernel Weight (TKW) is extrapolated from the number of full seeds and their total weight. The Harvest Index (HI) in the present invention is defined as the ratio between the total seed weight per plant and the area (mm2) above ground multiplied by a factor 10. The total number of flowers per panicle as defined in the present invention is the ratio between the total number of seeds and the number of mature primary panicles. The seed filling rate as defined in the present invention is proportion (expressed as a%) of the number of seeds. floods over the total number of seeds (or florets).

Example 9: Results of Phenotypic Evaluation of Rice Plantastransgenics comprising the Nucleic Acid Sequence of a MYB-TF Polypeptide Under the Control of a Constitutive Engine

As shown in Table D, seedling vigor in emergence, number of thick roots, greenness index (before flowering), seed filling rate, total seed weight per plant, number of full seeds, and harvesting index are increased in plants. transgenic cells expressively expressing a nucleic acid sequence encoding a MYB-TF polypeptide compared to control plants, T1-weighted.

Table D shows the average percentage increase in emergent vigor, number of coarse roots, greenness index (before flowering), seed filling rate, total seed weight per plant, number of full seeds, and mowing index of the two. better independent transgenic events compared to control plants, IT nageration.

<table> table see original document page 65 </column> </row> <table>

Example 10: Results of phenotypic evaluation of transgenic rice plants comprising the nucleic acid sequence encoding a MYB-TF polypeptide under the control of an endosperm specific promoter.

As shown in Table Ε, total seed weight per seedling, number of full seeds and harvesting index are increased in transgenic plants with preferentially increased expression of a nucleic acid sequence encoding a noendosperma MYB-TF polypeptide compared to control plants, both in generation T1 quantone generation T2.

Table E shows the average percentage increase in yield (total seed weight per plant), in the number of full seeds, and in the harvest index, of independent transgenic events compared to control complants in the T1 and T2 generations.

<table> table see original document page 65 </column> </row> <table>

Total seed number, filling rate and emergent vigor are also increased in transgenic plants, preferably having increased expression of a MYB-TF polypeptide coding sequence in the endosperm (from a plant-only) compared to plants. of control.

Example 11: Results of phenotypic evaluation of transgenic rice plants comprising the nucleic acid sequence encoding a MYB-TF polypeptide under the control of a promoter for expression in young expansion tissues.

Transgenic plants expressing a nucleic acid sequence encoding a MYB-TF polypeptide under beta-expansin motor control for expression in young expansion tissues show increased harvesting rate compared to control plants, Tl nageration (see Table F).

Table F shows the mean percentage increase in the deceif index of independent transgenic events compared to control plants in the Tl generation.

<table> table see original document page 66 </column> </row> <table>

Example 12: Examples of Transforming Other Harvest

Corn Processing

Corn transformation (Zea mays) is performed with a modification of the method described by Ishida et al. (1996) Nature Biotech 14 (6): 745-50. Transformation is genotype dependent in maize and only specific genotypes are susceptible to transformation and regeneration. Al88 natural alignment (University of Minnesota) or Al 88 hybrids as a parent plant are good sources of donor material for transformation, but other genotypes can also be used successfully. Ears are harvested from the corn plant approximately 11 days after apollination (DAP) when The length of the mature embryo is about 1 to 1.2 mm. Immature embryos are co-cultured with Agrobacteriumtumefaciens containing the expression vector, and transgenic plants are recovered through organogenesis. Excised embryos are grown over callus induction, then maize regeneration medium, containing selection agent (eg imidazolinone but various deletion markers may be used). Petri dishes are incubated in light at 25 ° C for 2-3 weeks, or until buds develop. Green shoots are transferred from each embryo to maize rooting medium and incubated at 25 ° C for 2-3 weeks until root development. Rooted shoots are transplanted to soil in the greenhouse. T1 seeds are produced from plants that exhibit tolerance to the selection agent and contain a single copy of the T-DNA insert.

Wheat processing

Wheat processing is performed with the method described by Ishida et al. (1996) Nature Biotech 14 (6): 745-50. The cultivar Bobwhite (available from CEMMYT, Mexico) is commonly used in transformation. Immature embryos are co-cultured with Agrobacterium, embryos are grown in vitro on callus-inducing medium, then on deregenerating medium, containing the selection agent (eg imidazolinone but several selection markers may be used). Petri dishes are incubated in light at 25 ° C for 2-3 weeks, or until buds develop. Green shoots are transferred from each embryo to rooting medium and incubated at 25 ° C for 2-3 weeks until root development. Rooted shoots are transplanted to soil in the greenhouse. T1 seeds are produced from plants that exhibit tolerance to the selection agent and contain a single copy of the T-DNA insert.

Soybean Processing

Soybean is processed according to a modification of the method described in Texas A&M US Patent 5,164,310. Several commercial varieties of soybean are susceptible to processing by this method. Hiding Jack (available from the Illinois Seed Foundation) is commonly used for transformation. Soybean seeds are sterilized for in vitro sowing. The hypocotyl, radicle and cotyledon are excised from seven-day-old young seedlings. The epicotyl and remaining cotyledon are further grown to develop axillary nodes. Axillary nodes are excised and incubated with Agrobacterium tumefaciens containing the expression vector. After co-cultivation treatment, the explants are washed and transferred to selection medium. Regenerated shoots are excised and placed on a shoot lengthening means. Sprouts no longer than 1 cm are placed on rooting media until roots develop. Rooted shoots are transplanted to greenhouse soil. T1 seeds are produced from plants that exhibit selection agent tolerance and contain a single copy of the T-DNA insert.

Rapeseed / canola transformation

Hypocotyls and cotyledonary petioles from 5-6 day old seedlings are used as explants for tissue culture and transformed according to Babic et al. (1998, Plant Cell Rep 17: 183-188). The commercial cultivar Westar (Agriculture Canada) is the standard variety used for processing, but other varieties can also be used. Canola seeds are surface sterilized for in vitro sowing. Cotyledon petiole implants with the attached cotyledon are excised from the seedlings in vitro, and inoculated with Agrobacterium (containing the expression vector) by immersion of the cut end of the petiole explant in bacterial suspension. The explants are then cultured for 2 days in MSBAP-3 medium containing 3 mg / l BAP, 3% sucrose, 0.7% Phytagar at 23 ° C, 16 h light. After two days of co-culture with Agrobacterium, petiole explants are transferred to MSBAP-3 medium containing 3 mg / l deBAP, cefotaxime, carbenicillin, or timentin (300 mg / l) for 7 days, and then cultured on MSBAP-3 medium. with cefotaxime, carbenicillin, or timentinae selection agent until root regeneration. When the shoots are 5-100mm long, they are cut and transferred to shoot-extension medium (MSBAP-0.5, containing 0.5 mg / l BAP). Sprouts about 2 cm long are transferred to rooting medium (MSO) for root induction. Rooted shoots are transplanted to the greenhouse. T1 seeds are produced from plants that exhibit selection agent tolerance and contain a single copy of the T-DNA insert.

Alfalfa Transformation

An alfalfa regeneration clone (Medicago sativa) is transformed using the method of (McKersie et al., 1999 Plant Physiol 119: 839-847). Alfalfa regeneration and transformation are degenotype dependent and therefore a regeneration plant is required. Methods for obtaining regeneration plants have been described. For example, they may be selected from the cultivar Rangelander (Agriculture Canada) or any other commercial alfalfa variety as described by Brovm DCW and AAtanassov (1985. Plant Cell Tissue Organ Culture 4: 111-112). Alternatively, the variety RA3 (University of Wisconsin) has been selected for use in tissue culture (Walker et al., 1978 Am J Bot65: 654-659). Petiole explants are co-cultured with an Agrobacterium tumefaciens C58C1 pMP90 night culture (McKersie et al, 1999 PlantPhysiol 119: 839-847) or LBA4404 containing the expression vector. Osteplants are co-cultured for 3 d in the dark on SH induction medium containing 288 mg / l Pro, 53 mg / l thioproline, 4.35 g / l K2SO4, and 100μm [sic] of acetosiringinone. The explants are washed in half-strength Murashige-Skoog medium (Murashige and Skoog, 1962) and plated on the same SH induction medium without acetosiringinone but with a suitable selection agent and appropriate antibiotic to inhibit growth of Agrobacterium. After several weeks, somatic embryos are transferred to BOY2 development medium containing no growth regulators, no antibiotics, and 50 g / L sucrose. Somatic embryos are subsequently germinated up to half-strength Murashige-Skoog. Rooted seedlings were transplanted into pots in a greenhouse. T1 seeds are produced from plants that exhibit selection agent tolerance and contain a single copy of the T-DNA insert. SEQUENCE LISTING

<110> CropDesign N.V.

<120> "PLANTS WITH INCREASED INCOME AND A METHOD TO PREPARE THE SAME"

<130> PF58329 <160> 41

<170> PatentIn version 3.3

<210> 1

<211> 828

<212> DNA

<213> Oryza sativa

<400> 1

atgaagcgga agcggccggc ggcgctgcgc ggcggggagg aggcggcggc ggcggcgctg 60

aagcgtgggc catggacgcc cgaggaggac gaggtgctgg cgcggttcgt ggcgcgggag 120

gggtgcgacc ggtggcgcac gctgccgcgg cgcgcgggcc tgctgcgctg cggcaagagc 180

tgccgcctcc ggtggatgaa ctacctccgc cccgacatca agcgctgccc catcgccgac 240

gacgaggagg acctcatcct ccgcctccac cgcctcctcg gcaaccggtg gtcgctgatc 300

gccgggaggt tgccggggcg cacggacaac gagatcaaga actactggaa ctcgcatctc 360

agcaagaagc tcatcgcgca gggcatcgac ccgcggacgc acaagccgct gacggccgcc 420

gccgatcact ccaacgccgc cgctgccgtc gccgccactt cttacaagaa ggcggtgccg 480

gccaagccgc cgaggacggc atcctcgccg gccgctggca ttgagtgcag cgacgatcgt 540

gcccgaccgg ccgacggtgg cggtgacttc gcagcgatgg tgagcgccgc cgatgccgag 600

ggattcgaag gaggatttgg cgatcagttc tgtgccgagg atgcagttca tggtggcttc 660

gacatgggtt ctgcttccgc catggtgggt gacgacgact tctcctcgtt tcttgattct 720

ctgatcaacg acgagcagtt aggcgatctc ttcgtcgtcg agggcaacga tcacgagcat 780

ggcaatggtg agattggtca tggagacgtc atggaatcca aacagtaa 828

<210> 2

<211> 275

<212> PRT

<213> Oryza sativa

<400> 2

Met Lys Arg Lys Arg Pro Wing Wing Read Arg Wing Gly Gly Glu Glu Wing Wing15 10 15

Wing Wing Wing Wing Read Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp Glu Val

20 25 30

Leu Wing Arg Phe Val Wing Arg Glu Gly Cys Asp Arg Trp Arg Thr Leu

35 40 45

Pro Arg Arg Wing Gly Leu Read Arg Cys Gly Lys Ser Cys Arg Read Le Arg

50 55 60

Trp Met Asn Tyr Leu Arg Pro Asp Ile Lys Arg Cys Pro Ile Wing Asp65

Asp Glu Glu Asp Leu Ile Leu Arg Leu His His Leu Leu Gly Asn Arg

85 90 95

Trp Ser Leu Ile Wing Gly Arg Leu Pro Gly Arg Thr Asp Asn Glu Ile

100 105 110

Lys Asn Tyr Trp Asn To Be His Read To Be Lys Lys To Read Ile Wing Gln Gly

115 120 125

Ile Asp Pro Arg Thr His Lys Pro Read Thr .Ala Wing Wing Asp His Ser

130 135 140

Asn Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Asp Phe 190 Wing AlaMet Val Ser 195 Wing Asp Wing Glu 200 Gly Phe Glu Gly 205 Phe Gly AspGln Phe 210 Cys Glu Wing Asp Wing 215 Val His Gly Gly Phe 220 Asp Met Gly SerAla Ser Wing Met Val Gly Asp Asp Phe Be Ser Phe Leu Asp Ser225 230 235 240Leu Ile Asn Asp Glu 245 Gln Leu Gly Asp Leu 250 Phe Val Val Glu Gly 255 AsnAsp His Glu His 260 Gly Asn Gly Glu Ile 265 Gly His Gly Asp Val 270 Met Glu

Ser Lys Gln275

<210> 3

<211> 750

<212> DNA

<213> Arabidopsis thaliana

<400> 3

atgatgtcat gtggtgggaa gaagccagtg tctaagaaaa caacgccgtg ttgcacgaag 60

atggggatga agagaggacc atggacggtg gaggaagacg agattcttgt gagcttcatt 120

aagaaagaag gtgaaggacg gtggcgatcg cttcctaaga gagctggttt actcagatgt 180

ggaaagagct gtcgtctacg gtggatgaac tatctccgac cctcggttaa acgtggagga 240

attacgtcgg acgaggaaga tctcatcctc cgtcttcacc gcctcctcgg caacaggtgg 300

tcattgatcg cgggaaggat accgggaagg actgataatg aaattaagaa ctattggaac 360

actcatcttc gtaagaaact tttaaggcaa ggaattgatc ctcaaaccca caagcctctt 42 0

gatgcaaaca acatccataa accagaagaa gaagtttccg gtggacaaaa gtaccctcta 480

gagcctattt ctagttctca tactgatgat accactgtta atggcgggga tggagatagc 540

aagaacagta tcaatgtctt tggtggtgaa cacggctacg aagactttgg tttctgctac 600

gacgacaagt tctcatcgtt tcttaattcg ctcatcaacg atgttggtga tccttttggt 660

aatattatcc caatatctca acctttgcag atggatgatt gtaaggatgg gattgttgga 720

gcgtcgtctt ctagcttagg acatgactag 750

<210> 4

<211> 249

<212> PRT

<213> Arabidopsis thaliana

<400> 4

Met Met Be Cys Gly Gly Lys Lys Pro Val Ser Lys Lys Thr Thr Pro1 5 10 15 Cys Cys Thr Lys 20 Met Gly Met Lys Arg 25 Gly Lys Trp Val 30 Glu GluAsp Glu Ile 35 Leu Val Ser Phe Ile 40 Lys Lys Glu Gly Glu 45 Gly Arg TrpArg Be 50 Leu Pro Lys Arg Wing 55 Gly Leu Read Le Arg Cys 60 Gly Lys Be CysArg Leu Arg Trp Met Asn Tyr Leu Arg Pro Be Val Lys Arg Gly65 70 75 80Ile Thr Be Asp Glu 85 Glu Asp Leu Ile Leu 90 Arg Leu His Arg Leu 95 LeuGly Asn Arg Trp 100 Ser Leu Ile Wing Gly 105 Arg Ile Pro Gly Arg 110 Thr AspAsn Glu Ile 115 Lys Asn Tyr Trp Asn 120 Thr His Leu Arg Lys 125 Lys Leu LeuArg

Ile145Glu

Asp

Tyr

Asn

Ile225Ala

Gln Gly130

His lys

To Ile

Gly asp

Glu Asp195Ser Leu210

Be GlnSer Be

Ile asp

Pro glu

Ser Ser165Ser Lys180

Phe Gly

Ile asn

Pro leu

Ser Ser245

Pro Gln Thr

135Glu Glu Val150

To be his thr

Asn ser ile

Phe Cys Tyr200

Asp Val Gly

215Gln Met Asp230

Read gly his

His lys

Be gly

Asp Asp170Asn Val185

Asp AspAsp ProAsp CysAsp

Pro Leu Asp140

Gly Gln Lys155

Thr thr val

Phe Gly Gly

Lys Phe Ser205

Phe Gly Asn220Lys Asp Gly235

Wing Asn Asn

Tyr Pro Leu160

Asn Gly Gly175

Glu His Gly190

Ser Phe Leu

Ile Ile Pro

Ile Val Gly240

<210> 5

<211> 744

<212> DNA

<213> Gossypium hirsutum

<400> 5

atgagaaacc

gtagggttga

aacaaagaag

ggaaaaagct

attgctcccg

tcactaatag

actcacctga

aaccctcaac

tccatggcga

aagcaaaatt

gaccattatc

ataaatgaag

actcccttcg

ctacgaaaaaaaagagggccgcgaaggacggtcgtctccgatgaagaagactggaagaatgtaagaaattaactctcaccaaccaaacaaattatgacgaagcaacaacaat atgatgatgcatcaaccaaa

agacaacgttatggacgccggtggcggactatggatgaattctcatcctcaccagggcgtgataagtcaaatcaccaccatcctccttcctgggagcaatagatcatgatattggtttcgatga

ggaaccaagagaagaagacgttacctaaactatctccgaccgccttcaccacagataacggggatcgatctcactcaaaccctcttcctggaagaccatcgatgtgttctaatttgggac

cgacgccgtg ttgcagcaaa 60agttattatc taattacatc 120gggctggtct tctccgatgc 180cttctgttaa acgtggccag 240gccttttagg gaatcggtgg 300aaataaagaa ctactggaat 360ctcgaacgca caagccttta 420cttcaccttc ttcatcatca 480ttcatgtcgt caacgctaac 540aagggatgat catgaacaat 600cttcttttct gaattcattg 660tctcacaagg atgggaatct 720 744

<210> 6

<211> 247

<212> PRT

<213> Gossypium hirsutum

<400> 6 Met Arg Asn Pro Lys Thr Asp Lys Asp Val Gly Thr Lys Thr Thr Pro1 5 10 15 Cys Cys Ser Lys 20 Val Gly Leu Lys Arg 25 Gly Pro Trp Thr 30 Glu GluAsp Glu Leu 35 Leu Ser Asn Tyr Ile 40 Asn Lys Glu Gly Glu 45 Gly Arg TrpArg Thr 50 Leu Pro Lys Arg Wing 55 Gly Leu Leu Arg Cys 60 Gly Lys Be CysArg Leu Arg Trp Met Asn Tyr Leu Arg Pro Be Val Lys Arg Gly Gln65 70 75 80Ile Ala Pro Asp Glu 85 Glu Asp Leu Ile Leu 90 Arg Leu His Arg Leu 95 LeuGly Asn Arg Trp 100 Ser Leu Ile Wing Gly 105 Arg Ile Pro Gly Arg 110 Thr AspAsn Glu Ile 115 Lys Asn Tyr Trp Asn 120 Thr His Leu Ser Lys 125 Lys Leu IleSer Gln 130 Gly Ile Asp Pro Arg 135 Thr His Lys Pro Leu 140 Asn Pro Gln GlnLeu Ser Pro Pro Be Leu Lys Pro Ser Ser Be Ser145 150 155 160Ser Met Alys Lys Pro 165 Asn Pro As 170 Pro Leu Pro Val His 175 ValVal Asn Wing Asn 180 Lys Gln Asn Tyr Tyr 185 Asp Asp Gly Ser Asn 190 Glu AspHis Gln Gly 195 Met Ile Met Asn 200 Asp His Tyr Gln Gln 205 Gln Gln AspHis Asp 210 Asp Val Phe Ser Ser 215 Phe Leu Asn Ser Leu 220 Ile Asn Glu AspAsp Asp Wing Leu Val Ser Asn Leu Gly Leu Ser Gln Gly Trp Glu Ser225 230 235 240Thr Pro Phe Asp Gln 245 Pro Lys

<210> 7 <211> 993 <212> DNA

<213> Lotus corniculatus <400> 7

atgaggaacc cgatagcatc atcatcaacg aacaagaaga agagcagtac tacaactggt 60

aatgaaaatg gcacgactgt tactactact ccgtgctgca gcaaagttgg gttgaagaga 120

gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180

ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 24 0

ctccgctgga tgaactacct ccgcccctct gtcaaacgcg gccagatcgc ccccgacgaa 300

gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360

agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420

aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480

attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540

acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600

aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660

gcatatatgg tagctaatga tattcctgat gatgatgttc cttccatggg tcatctactt 720

gccaacaaca acaacaacca ggactacaat gatatcaatt attgttctga tgatatcttt 780

tcttccttcc tcaattctct gatcaatgag gatgctttct ctgcccagcg ccacctgcaa 84 0

tcggagcatc atgatgacct tgcacaggat cctgtaactt catcaacacc acaaggttat 900

aatggcattg gtgttgcatg ggaattgccc ctcatgcctg ctaatttcag ccaaaatgaa 960

cacagccatg aggttgatga tcatcacaaa tag 993

<210> 8

<211> 330

<212> PRT

<213> Lotus corniculatus

<400> Argϊ Met Arg Asn Pro Ile Ala Ser Be Ser Thr Asn Lys Lys Ser Ser1 5 10 15 Thr Thr Gly 20 Asn Glu Asn Gly Thr 25 Thr Val Thr Thr 30 Pro CysCys Ser Lys 35 Val Gly Leu Lys Arg 40 Gly Pro Trp Thr Pro 45 Glu Glu AspGlu Val 50 Leu Wing Ser Phe Ile 55 Arg Lys Glu Gly Glu 60 Gly Arg Trp ArgThr Leu Pro Lys Arg Wing Gly Leu Read Arg Cys Gly Lys Ser Cys Arg65 70 75 80Leu Arg Trp Met Asn Tyr Leu Arg Pro To Be Val Lys Arg Gly Gln Ile

85 90 95Ala Pro Asp Glu Glu

Ile leu

His arg

100 105 110 Asn Arg Trp 115 Ser Leu Ile Ala Gly 120 Arg Ile Pro Gly Arg 125 Thr Asp AsnGlu Ile 130 Lys Asn Phe Trp Asn 135 Thr Leu Ile SerGln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser145 150 155 160Ile Pro Ser Ser 165 165 Thr Thr Pro Pro 170 Pro Pro Lys 175 ProLeu Pro Val Ile 180 Thr Asn His Gln Thr 185 Leu His Glu Thr Thr 190 HisHis His Leu 195 Asn Ile Ala Ser Val 200 Asn Gln Glu Cys Asp 205 Glu Gly GlnTyr Gln 210 Tyr Gln Pro Gln 215 Wing Val Wing Wing Wing Wing 220 Wing Tyr Met ValAla Asn Asp Ile Pro Asp Asp Val Pro Ser Met Gly His Leu Leu225 230 235 240Ala Asn Asn Asn Asn 245 Asn Gln Asp Tyr Asn 250 Asp Ile Asn Tyr Cys 255 SerAsp Asp Ile Phe 260 Ser Ser Phe Leu Asn 265 Ser Leu Ile Asn Glu 270 Asp AlaPhe Ser Ala 275 Gln Arg His Leu Gln 280 Ser Glu His His Asp 285 Asp Leu AlaGln Asp 290 Pro Val Thr Be Ser 295 Thr Pro Gln Gly Tyr 300 Asn Gly Ile GlyVal Wing Trp Glu Leu Pro Leu Met Pro Wing Asn Phe Be Gln Asn Glu305 310 315 320His Be His Glu Val 325 Asp Asp His His Lys 330

<210> 9

<211> 915

<212> DNA

<213> Medicago truncatula

<4 00> 9

atgatgaatc

aattcaaatc

gggttgaaga

aaagaaggtg

aaaagctgtc

gctcctgatg

ttgatagctg

catctcagca

aacccatctt

tttgcaccat

ccctctcaaa

gataatcatc

aacaattacg

gcatttgctg

ctgtgggaat

gggaaagctt

tatcttcatccaaacaaaaagaggaccgtgaaggtcgttggtctccgttgaagaagatctggagaattccagaaacttatcttcttcttccttcttctgacacaacaagcatgtgcttacgggtgatgacacacagatccgccgccactcttag

aacagatcaaacagaagacagactgtagaagagaactcttgatgaattatcatcctccgcaggaagaacctaaccaagggaataatcccatcatcatcattcagggttgtcaacaacaactgtgtttactagagaatgatcatgatgaca

gacaaatcagacaacaactagaagatgaagcccaaacgagcttcgtccatctccaccgtcgataatgagaattgatcccaaatactaatcccaattactaggtaacttggagaggggatttcatttctggcctttgatcttctactcata

aaacaacaaacaccttgttgttttatcagactggtcttctccgtcaaacgttctcggcaattaaaaattagaactcacaaaccaaacaagtcactaacaattaatgatgtatggagacgaattcattgattatctgctgcatttcaccca

ttcaaattcacagtaaagtaatacatcaaaccgttgcggccggtcagatccaggtggtcattggaacacagcctcttaattactcctttttgaacctgatttctgcaatgcaatggtaatcaacgacgataccaccagctaaaccaagac

60120180240300360420480540600660720780840900915

<210> 10

<211> 304

<212> PRT

<213> Medicago truncatula <400> 10 Met Met Asn Read Be Ser As Thr Asp Gln Asp Lys Be Glu Thr Thr1 5 10 15 Asn Be Asn Be Asn Be Asn Pro Asn Lys Lys Gln Thr Thr 20 20 30 30 Thr Thr Pro Cys Cys Be Lys Val Gly Leu Lys Arg Gly Pro Trp Thr 35 40 45 Val Glu Glu Asp Glu Val Leu Be Glu Tyr Ile Lys Glu Gly Glu 50 55 60 Gly Arg Trp Arg Thr Leu Pro Wing Gly Leu Arg Cys Gly65 70 75 80Lys Be Cys Arg Leu Arg Trp Met Asn Tyr Leu Arg Pro Be Val Lys 85 90 95 Arg Gly Gln Ile Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His 100 105 110 Arg Leu Leu Gly Asn Arg Trp Be Leu Ile Wing Gly Arg Ile Pro Gly 115 120 125 Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Leu Ser Lys 130 135 140 Lys Leu Ile Asn Gln Gly Ile Asp Pro Arg Thr His Lys Pro Read Asn145 150 155 160Asn Pro Ser Being Being Being Being Ile Ile Pro Asn Thr ro Phe Phe Ala Pro To Be Ser As His His His Pro Ile 180 185 190 Thr Ile Thr Asn Asu Glu Pro Asp Pro To Be Gln Thr Gln Ala Gln 195 200 205 Gly Cys Gly Asn Leu Val Asn Val Asp Val Ser Ala Met Asp Asn His His 210 215 220 Val Leu Thr Asn Asn Asn Arg Gly Asp Asp Tyr Gly Asp Asn Asp Gly Asn225 230 235 240Asn Asn Tyr Gly Asp Asp Val Phe Thr Be Ashe Asp Ser Leu 245 250 255 Ile Asn Asp Asp Asa Ala Phe Ala Ala His Arg Be Glu Asn Asp Pro Leu 260 265 270 Ile Leu Be Wing Ala Pro Pro Wing Leu Trp Glu Be Pro Leu Met 275 280 285 Met Thr Be Thr His Asn Phe Thr Gln Asn Gln Asp Gly Lys Ala Ser 290 295 300

<210> 11 <211> 846 <212> DNA

<213> Petunia hybrida <400> 11

atgagaaccc catcatcatc atcaacaaca agcaacaaag taacaccatg ttgtagcaag 60

gtagggttaa aaagaggtcc atggacacca gaagaagatg aaatattgac aaattatata 120

aataaagaag gagaaggacg gtggcgaacg ttgccaaaga aggcggggct cctccgttgt 180

ggaaaaagct gccgccttcg gtggatgaat tacctccgtc cttcagttaa acgtggccat 240

attgcacctg atgaagaaga tctcattctt cgcctccatc gtctccttgg caacaggtgg 300

tccttgatag ctgggagaat tccagggaga acagataatg agataaagaa ttattggaac 360

actcacctta gcaagaagtt aatcagtcac ggaatagatc ctagaactca caagccattg 420

aaaaactcta attcctcaag tgatgatatt accaacaaat tagcttcttc ttctcctcct 480

tcatcttcaa aagcaaatga tctcaatcca attctaagcc ccacttacat ttctagtttt 540

caaatggaag aaccattagg aaaaatcaat actcacccgg gagaaattac tagtcttgat 600

gatcaatatc aaagtaacgc gattcttgcc gagtatggtg atgatctgaa tattgcggtt 660

actattgagg aagatgttga aatgaattgt tgcacggatg atgttttctc ctctttcttg 720

aattctttga tcaatgaaga tatgttcgct tgccaaaacc aacaaaccaa cgggacgttc 780caagattttg atcctttcat ggcttcatca tctacacctt catctgatca atataatccc 840agttag 846

<210> 12 <211> 281 <212> PRT

<213> Petunia hybrida <400> 12 Met Arg Thr Pro Be Ser Be Ser Thr Thr Be Asn Lys Val Thr Pro1 5 10 15 Cys Cys Be Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu 20 25 30 Asp Glu Ile Leu Thr Asn Tyr Ile Asn Lys Glu Gly Glu Gly Arg Trp 35 40 45 Arg Leu Thr Pro Lys Lys Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys 50 55 60 Arg Leu Arg Trp Met Asn Tyr Leu Arg Pro Be Val Lys Arg Gly His65 70 75 80Ile Pro Wing Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu 85 90 95 Gly Asn Arg Trp Being Leu Ile Gly Arg Ile Pro Gly Arg Thr Asp 100 105 110 Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Leu Be Lys Lys Leu Ile 115 120 125 Be His Gly Ile Asp Pro Arg Thr Lys Wing Asn Asp Read Asn Pro Ile Read Ser Pro Thr Ile Be Ser Phe Gln Met Glu Glu Pro Read Gly Lys Ile Asn Thr His 180 185 190 Pro Gly Glu Ile Thr Be Read Asp Asp Gln Tyr Gln Be Asn Ala Ile 195 200 205 Leu Wing Glu Tyr Gly Asp Leu Asn Ile Ala Val Thr Ile Glu Glu 210 215 220 Asp Val Glu Met Asn Cys Cys Thr Asp Asp Val Phe Be Ser Phe Leu225 230 235 240Asn Be Leu Ile Asn Glu Asp Met Phe Ala Cys Gln Asn Gln Thr 245 250 255 Asn Gly Thr Phe Gln Asp Phe Asp Pro Phe Met Ala Ser Be Ser Thr 260 265 270 Pro Ser Be Asp Gln Tyr Asn Pro Ser

275 280

<210> 13

<211> 951

<212> DNA

<213> Populus tremuloides

<400> 13

atgagaaagc caacttcagc tacaacagcaatcaaggtag ggttaaagag aggaccgtggtatcaaga aagaaggtga aggccggtggcgctgtggca agagctgccg tctccgctggggccagatcagggggtaggggggtag

gaatcagcag caaagaccac cccatgctgc 60

acaccagaag aagatgaact ccttgttaac 120

cgaactttac ccaagaaagc cggtctcctc 180

atgaactacc tccgcccttc tgttaaacgt 240

attctccgcc tccatcgact cctaggcaat 300

gggcgtacag ataatgaaat aaagaattac 360

agccaaggaa ttgatccaag aacccataag 420cctctcaatc ctcaatcttt tgatcaatca aaaccttctt tgccgaaggc gaatctgcac 480

caagaacgcc taaaagaacc tattaagaat attgtttctt ctggtttgga agaaactact 540

agtggcagta ctcgcataat caacagagag aatgagtatt ttcaaaacaa cattaatgcc 600

cacctggatg aacagtatca cgcagaccat tttattgcaa gtcatggcta tacaagtttg 660

ctgaattatg atggtacttc tgggatggat ttgagaggcg atcaaagtct tggtattgga 720

gaagctgatc aagatatcaa ttccggcacc gacgatgtgt tttcgttcct caattcgctc 780

ataaatgagg aggctttgca acaacatcaa atccttaatg tgcctaatgt gaattgtgca 840

ccacccagtt cagatccttt tgtttcaatt gctgccacaa catttggact cggaactggc 900

tgggaatcta ctctcatgtc ttctgctttt aacaaaaatg attccaaata g 951

<210> 14 <211> 316 <212> PRT

<213> Populus tremuloides <400> 14

Met Arg Lys Pro Thr Be Wing Thr Thr Wing Glu Be Wing Wing Lys Thr1 5 10 15

Thr Cys Cys Cle Ile Lys Val Gly Read Lys Arg Gly Pro Trp Thr Pro

20 25 30

Glu Glu Asp Glu Leu Leu Val Asn Tyr Ile Lys Lys Lys Glu Gly Glu Gly

35 40 45

Arg Trp Arg Thr Read Lys Pro Lys Gly Wing Read Leu Read Arg Cys Gly Lys

50 55 60

Ser Cys Arg Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg65 70 75 80

Gly Gln Ile Wing Asp Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg

85 90 95

Leu Leu Gly Asn Arg Trp Being Leu Ile Wing Gly Arg Ile Pro Gly Arg

100 105 110

Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Leu Being Lys Lys

115 120 125

Read Ile Be Gln Gly Ile Asp Pro Arg Thr His Lys Pro Read Asn Pro

130 135 140

Gln Be Phe Asp Gln Be Lys Pro Be Read Pro Lys Wing Asn Read His145 150 155 160

Gln Glu Arg Leu Lys Glu Pro Ile Lys Asn Ile Val Ser Ser Gly Leu

165 170 175

Glu Glu Thr Thr Be Gly Be Thr Arg Ile Ile Asn Arg Glu Asn Glu

180 185 190

Tyr Phe Gln Asn Asn Ile Asn Ala His Leu Asp Glu Gln Tyr His Ala

195 200 205

Asp His Phe Ile Wing Be His Gly Tyr Thr Be Read Leu Asn Tyr Asp

210 215 220

Gly Thr Be Gly Met Asp Read Arg Gly Asp Gln Be Read Gly Ile Gly225 230 235 240

Glu Wing Asp Gln Asp Ile Asn Be Gly Thr Asp Asp Val Phe Be Phe

245 250 255

Leu Asn Ser Leu Ile Asn Glu Glu Wing Leu Gln Gln His Gln Ile Leu

260 265 270

Asn Val Pro Asn Val Asn Cys Pro Wing Be Ser Asp Pro Phe Val

275 280 285

Ser Ile Wing Wing Thr Thr Phe Gly Leu Gly Thr Gly Trp Glu

290 295 300

Read Met Ser Sera Phe Asn Lys Asn Asp Ser Lys305 310 315

<210> 15 <211> 936 <212> DNA

<213> Vitis vinifera

<400> 15

atgaggaatg catcctcagc atcagctcca ccttcatctt cttcaaaaac accatgctgc 60

atcaaggttg gattgaagag ggggccatgg acgccggagg aagacgaggt tctggccaat 120

tacatcaaga aagaaggaga aggccggtgg cgcaccctcc cgaagcgcgc cggtctcctc 180

cgctgcggca agagctgtcg cctccgctgg atgaactacc tccgcccttc cgtcaagcgc 240

ggccagatcg cccccgatga agaggatctc attctccgcc tccaccgact tctcggcaac 300

aggtgggctt tgattgccgg aagaattccg ggccggacgg ataatgagat aaaaaactac 360

tggaacacac acctgagcaa gaagctgatc agccagggaa tagatccgag aacccataag 420

ccattgaacc ctaattcatc atctgttgat gtgaaagctt cttcttcaaa ggcaaaagct 480

gttatgaacc ctaaccctaa ccctaatcct tctccttcag aaaaagcagc agccaacaag 540

gaagctggga acttcaagag tgacaatcag tatcagattg gggcagctgg caatgatggc 600

agtgccaata tccagaattc ggatggttcc gggaccggat tgaggagcag caacaacgaa 660

gaagacgatg accttaactg tggcaccgat gatgtcttct cttcattttt gaactcattg 720

atcaatgagg atgtgtttcc tggacagcac catctccaac aacagcacca tggtggtctc 780

attgcaccgg gctccgatgc tttgatctct acttcttcag tccagtcgtt cgggttcggt 840

accagctggg aggctgcagc catgacttcc acgtctgttt ttagccaaat cgatcactcc 900

aagaggttta acgatcaacc tgataagcgg ttctga 936

<210> 1.6 <211> 311 <212> PRT

<213> Vitis vinifera <400> L 6 Met Arg Asn Ala Ser Be Ala Ser Ala Pro Ala Pro Ser Be Ser Lys1 5 10 15 Thr Cys Cys Ile Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro 20 25 30 Glu Glu Asp Glu Val Leu Wing Asn Tyr Ile Lys Lys Lys Glu Gly Glu Gly 35 40 45 Arg Trp Arg Thr Leu Pro Lys Arg Wing Gly Leu Leu Arg Cys Gly Lys 50 55 60 Ser Cys Arg Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg65 70 75 80Gly Gln Ile Pro Wing Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg 85 90 95 Leu Leu Gly Asn Arg Trp Wing Leu Ile Ally Gly Arg Ile Pro Gly Arg 100 105 110 Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Leu Be Lys Lys 115 120 125 Leu Ile Be Gln Gly Ile Asp Pro Arg His His Lys Pro Read Asn Pro 130 135 140 Asn Be Ser Be Val Asp Val Lys Ala Be Be Lys Ala Lys Ala145 150 155 160Val Met Asn Pro Asn Pro Asn Pro Asn Pro Ser Pro Ser Glu Lys Wing 165 170 17 5 Wing Wing Asn Lys Glu Wing Gly Asn Phe Lys Being Asp Asn Gln Tyr Gln 180 185 190 Ile Gly Wing Wing Gly Asn Asp Gly Being Wing Asn Ile Gln Asn Being 195 195 205 Gly Being Gly Thr Gly Leu Arg Being Being Asn Asn Glu Glu Asp Asp Asp 210 215 220 Leu Asn Cys Gly Thr Asp Asp Val Phe Being Ser Phe Leu Asn Being Leu225 230 235 240Ile Asn Glu Asp Val Phe Pro Gly His His Leu Gln Gln Gln His 245 250 255His Gly Gly Leu Ile Ala Pro Gly Ser Asp Wing Read Ile Ser Thr

260 265 270

Be Val Gln Be Phe Gly Phe Gly Thr Be Trp Glu Wing Ala Wing Met

275 280 285

Thr Be Thr Be Val Phe Be Gln Ile Asp His Be Lys Arg Phe Asn

290 295 300

Asp Pro Gln Asp Lys Arg Phe305 310

<210> 17

<211> 813

<212> DNA

<213> Zea mays

<400> 17

atgatgatgc ggaagccggc ggtgcagcag cgtggcgcgg gggcgataag gacgctcaag 60

cggggtgcgt ggacgccgga ggaggacgag ctgctggcgc ggcccgtggc gaaggacggg 120

gaggggcggt ggcgcacgct gccgcggcgg gcggggctgc ttcgctgcgg caagagctgc 180

aggctccgct ggatgaacta cctcaggccg gacatcaagc gcgggcctat cgccgccgac 240

gaggaggacc tcatcctccg cctccaccgc ctgctcggaa acaggtggtc gctgatcgct 300

gggcgtctgc ctggccgcac ggacaacgag gtcaagaact actggaactc gcacctcagc 360

aagaagctcg tcgcgcgggg catcgacccg cgcacgcaca cgcctctgcc cgcagcagct 420

gcgagcctgc actcgcactc ccaccgcgcc gacgacgact caccagcagg agccgccggt 480

tcgtctgccg acaagacgcc gccgccactg gtggaagtcg agccatcggt tgcgccgccg 540

ccagcgcagc cgaactcatc tttcggcgac ggaagcagcg gcgacttcgc ggggggcatg 600

atgggtctag gctccgaggg cttcgatgga gtcggtgatc cgttctgtgc accagctcct 660

ggcggcttcc acttgggctg ccccgtcgtg gacgacgcca ccttctcctc gttcctcgac 720

tcgctgatga acgaggagcg catgcgcatc gccgattaca ttggagatca cagggatgct 780

gatggtggga acgaccaggg tggagcttat tag 813

<210> 18

<211> 270

<212> PRT

<213> Zea mays

<400> 18 Met Met Met Arg Lys Pro Wing Val Gln Gln Arg Gly Wing Gly Wing Ile1 5 10 15 Arg Thr Leu Lys 20 Arg Gly Wing Trp Thr 25 Pro Glu Glu Asp Glu 30 Leu LeuAla Arg Pro 35 Val Wing Lys Asp Gly 40 Glu Gly Arg Trp Arg 45 Thr Read ProArg Arg 50 Wing Gly Read Leu Read Arg 55 Arg Leu Arg TrpMet Asn Tyr Leu Arg Pro Asp Ile Lys Arg Gly Pro Ile Wing Asp65 70 75 80Glu Glu Asp Leu Ile 85 Leu Arg Leu His Arg 90 Leu Read Gly Asn Arg 95 TrpSer Leu Ile Wing 100 Gly Arg Leu Pro Gly 105 Arg Thr Asp Asn Glu 110 Val LysAsn Tyr Trp 115 Asn Be His Leu Be 120 Lys Lys Leu Val Wing 125 Arg Gly IleAsp Pro 130 Arg Thr His Thr Pro 135 Leu Pro Wing Ala 140 Wing Be Read HisSer His Be His Arg Wing Asp Asp Asp Ser Pro Wing Gly Wing Wing Gly145 150 155 160Ser Ser Wing Asp Lys 165 Thr Pro Pro Wing Read 170 Val Glu Val Glu Pro 175 SerVal Wing Pro Pro Wing Gln Pro Wing Asn Ser Ser Phe Gly Asp Gly Ser180 185 190

Be Gly Asp Phe Wing Gly Gly Met Met Gly Leu Gly Be Glu Gly Phe

195 200 205

Gly Asp Val Gly Asp Pro Phe Cys Pro Wing Gly Phe His Pro Wing

210 215 220

Gly Cys Pro Val Val Val Asp Asp Wing Thr Thr Be Ser Phe Leu Asp225 230 235 240

Be Met Le Asn Glu Glu Arg Met Arg Ile Wing Asp Tyr Ile Gly Asp

245 250 255

His Arg Asp Wing Asp Gly Gly Asn Asp Gln Gly Gly Wing Tyr260 265 270

<210> 19

<211> 720

<212> DNA

<213> Antirrhinum majus

<400> 19

gggccatgga cggcggagga ggacgggctt ttagcggagt acgtaaagga gggaggtgag 60

gggaagtggc gcacgctgcc gaaggaggcg gggctgctac ggtgcggcaa gagctgccgc 120

ctccggtgga tgaactacct ccgtccctcc gtcaagcgcg gccacatcac tcctgacgag 180

gaggatctca tcctccgcct ccaccgcctc ctcggaaaca ggtggtcttt aatagcggga 240

agaatacctg ggcggacaga taacgagata aagaactact ggaacactca cctcaccaaa 300

aaactcataa gccaaggaat cgatcccaaa acacacaagc cattgaatcc acttaacccc 360

agcagcatca aacattactc tccctcagaa aaatcagttg atgttccaat ttcctcagta 420

aacaatatcc aaattataga atatccagct gaaaacatca tgatcggtgc agagtccaag 480

aaattagagt tgagaataag tagtactaat gaggggacca tattgggtag tgatgatgaa 540

gataatgaca tgatcatcag cagttgtttc cctgataatg atgccttttc atccttcttg 600

aattcactca ttaacgatga tatgttcatt aataacaacc aaccccacga tgatcatcag 660

gaacaacaac aagaggaggg gagacgccga ccggctgctg cagatgtaat aaagtggtga 720

<210> 20

<211> 239

<212> PRT

<213> Antirrhinum majus

<400> 20 Gly Pro Trp Thr Wing Glu Glu Asp Gly Leu Leu Wing Glu Tyr Val Lys1 5 10 15 Glu Gly Gly Glu 20 Gly Lys Trp Arg Thr 25 Leu Pro Lys Glu Wing 30 Gly LeuLeu Arg Cys 35 Gly Lys Ser Cys Arg 40 Leu Arg Trp Met Asn 45 Tyr Leu ArgPro Ser 50 Val Lys Arg Gly His 55 Ile Thr Pro Asp Glu 60 Glu Asp Leu IleLeu Arg Leu His Arg Leu Leu Gly Asn Arg Trp Ser Leu Ile Ala Gly65 70 75 80Arg Ile Pro Gly Arg 85 Thr Asp Asn Glu Ile 90 Lys Asn Tyr Trp Asn 95 ThrHis Leu Thr Lys 100 Lys Leu Ile Ser Gln 105 Gly Ile Asp Pro Lys 110 Thr HisLys Pro Leu 115 Asn Pro Read Asn Pro 120 Ser Ser Ile Lys His 125 Tyr Ser ProSer Glu 130 Lys Be Val Asp Val 135 Pro Ile Be Ser Val 140 Asn Asn Ile GlnIle Ile Glu Tyr Pro Wing Glu Asn Ile Met Ile Gly Wing Glu Be Lys145 150 155 160Lys Leu Glu Leu Arg Ile Be Ser Thr Asn Glu Gly Thr Ile Leu Gly

165 170 175Ser Asp Asp Glu Asp Asn Asp Met Ile Ile Ser Ser Cys Phe Pro Asp

180 185 190

Asn Asp Ala Phe Be Be Phe Read Asn Be Read Ile Asn Asp Asp Met

195 200 205

Phe Ile Asn Asn Asn Gln Pro His Asp Asp His Gln Glu Gln Gln Gln

210 215 220

Glu Glu Gly Arg Arg Arg Pro Pro Wing Wing Wing Asp Val Ile Lys Trp225 230 235

<210> 21

<211> 476

<212> DNA

<213> Lycopersicon esculentum <220>

<221> misc_feature

<222> (11) .. (11)

<223> η is a, c, g, t

<220>

<221> misc_feature

<222> (19) .. (19)

<223> η is a, c, g, or t

<400> 21

tggtcattga nagcagggng aattcccgga agaacggata acgagataaa gaattattgg 60

aatacccacc ttagcaagaa attaatcaac caaggaatag atccaagaac acacaaacca 120

ttaatattaa acaaccctaa ttcctctaat agtgatgata atcacattat tacaaacaaa 180

gctaattctt cttctccttc ttcatcctca aaactagcaa ataattataa tctcaacaca 240

attaatattc caaaccccat ttacactcct aatttccaaa tgaaagaacc cttaagaagt 300

agcatcaaca ataataactg tcctggagaa actacgagtc ctgatgatga ttatcagtat 360

cagagcagta atgtgatgct tgccaattat cgcgatgatg atatgaatat tgtggttcat 42 0

gatgagggag atgatgaaat gaattgttgc gcggacgatg tcttctcctc cttctt 47 6

<210> 22

<211> 159

<212> PRT

<213> Lycopersicon esculentum

<220>

<221> misc_feature

<222> (4) .. (4)

<223> Xaa can be any naturally occurring amino acid

<220>

<221> misc_feature

<222> (7) .. (7)

<223> Xaa can be any naturally occurring amino acid

<400> 22

Trp Ser Leu Xaa Wing Gly Xaa Ile Pro Gly Arg Thr Asp Asn Glu Ile1 5 10 15

Lys Asn Tyr Trp Asn Thr His Leu Being Lys Lys Leu Ile Asn Gln Gly

20 25 30

Ile Asp Pro Arg Thr His Lys Pro Ile Ile Leu Asn Asn Pro Asn Ser

35 40 45

Be Asn Be Asp Asp Asn His Ile Ile Thr Asn Lys Wing Asn Be

50 55 60

Be Pro Be Ser Be Ser Lys Leu Wing Asn Asn Tyr Asn Leu Asn Thr65 70 75 80

Ile Asn Ile Pro Asn Pro Ile Tyr Thr Asn Phe Gln Met Lys Glu

85 90 95

Pro Read Arg Be Ser Ile Asn Asn Asn Asn Cys Pro Gly Glu Thr Thr

100 105 110

Be Pro Asp Asp Asp Tyr Gln Tyr Gln Ser As Asn Val Met Leu Wing

115 120 125

Asn Tyr Arg Asp Asp Asp Met Asn Ile Val Val His Asp Glu Gly Asp

130 135 140

Asp Glu Met Asn Cys Cys Wing Asp Asp Val Phe Ser Ser Phe Leu145 150 155

<210> 23 <211> 618 <212> DNA

<213> Solanum chacoense <400> 23

cacgaggatc tcatcctccg cctccatcgc ctcctaggga acaggtggtc attgatagca 60

ggcagaattc caggaagaac agacaacgag ataaagaatt attggaatac tcaccttagc 120

aagaaattaa tctgccaagg aatagatcca agaacacaca aaccattaat attaaacagc 180

cctaattcct ctagtgatga taatcatatt attacaaaca aagctaattc ttcttctcct 240

tcttcatcct caaaactagc aaatgattat gatctcaaca caattaatac tccaaacccc 300

atttacaatc ctaatttcca aatgaaagaa cccttaggaa gtagcatcaa caataataac 360

cgtcctggag aaattacgag tcttgatgat gattatcagt atcagagcag taatgtgatg 420

cttgccaatt atcgcgatga tgatatgaac attgtggttc atgatgaggg agacgatgga 480

atgaattgtt gcgcggacga tgtcttctcc tccttcttga attctttgat caatgaagac 540

atgttcatga attgccaaaa tcaacaaatc aatggtacat tgcaagattt tgaccatttt 600

atggcttcat ctatatga 618

<210> 24 <211> 205 <212> PRT

<213> Solanum chacoense <400> 24

His Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly Asn Arg Trp1 5 10 15

Be Leu Ile Wing Gly Arg Ile Pro Gly Arg Thr Asp Asn Glu Ile Lys

20 25 30

Asn Tyr Trp Asn Thr His Read Ser Lys Lys Read Ile Cys Gln Gly Ile

35 40 45

Asp Pro Arg Thr His Lys Pro Read Ile Read Asn Be Pro Asn Be Ser

50 55 60

Ser Asp Asp Asn His Ile Ile Thr Asn Lys Wing Asn Ser Ser Ser Pro65 70 75 80

Being Being Being Being Lys Leu Wing Asn Asp Tyr Asp Leu Asn Thr Ile Asn

85 90 95

Thr Pro Asn Pro Ile Tyr Asn Pro Asn Phe Gln Met Lys Glu Pro Leu

100 105 110

Gly Be Ser Ile Asn Asn Asn Asn Arg Pro Gly Glu Ile Thr Be Leu

115 120 125

Asp Asp Asp Tyr Gln Tyr Gln Being Asn Val Met Leu Wing Asn Tyr

130 135 140

Arg Asp Asp Asp Met Asn Ile Val Val His Asp Glu Gly Asp Asp Gly145 150 155 160

Met Asn Cys Cys Asp Wing Asp Val Phe Be Ser Phe Leu Asn Ser Leu

165 170 175

Ile Asn Glu Asp Met Phe Met Asn Cys Gln Asn Gln Gln Ile Asn Gly180 185 190

Thr Read Gln Asp Phe Asp His Phe Met Wing Ser Ser Ile195 200 205

<210> 25

<211> 732

<212> DNA

<213> Triticum aestivum

<220>

<221> misc_feature

<222> (502) .. (502)

<223> η is a, c, g, or t

<400> 25

acggcgccgc

ttcgtggcgc

cgctgcggca

ggccccatcg

cggtggtcgc

tggaactcgc

ccgctcgccg

acggtcagac

ctggaactga

gcgatgagcg

gctgcttccc

ttcacctcgt

ggcgctatct

cgctgaagcggggagggggaagagctgccgccgaggacgatgatcgccggacctcagcaactgctcccggcgccgcacctcgcgacggcctcgacgcccagcggagtctttcctcgattcag

ggggccgtggggggcggtggcctgcggtggggaggacctcgggagagttccccagggcggcactgcccccgcgngacagccctgacttcgaacaacgacgtgcttgatgaat

acggcggaggcgcacgctgcatgaactaccatcctccgccgggcgcacggggccccagggccgctcctaccgcagcgcttgtaggcgacggggtttgggtgtcgagcgccagt

aggacgaggtcacggcgggctccggccggatccaccgcgtacaacgagattcgacccgcgacaagacgacgctgccgaccggcatgacgaatcagcttctcaatggtggatggctgctga

gctggcgcgggggcctgctgcatcaagcgccctcggcaaccaagaactacgacgcacatggtgggcgccgtcgtctgccgcctcgccgcgcgccgactaccgacgacacctcacaaggtt

60120180240300360420480540600660720732

<210> 26

<211> 243

<212> PRT

<213> Triticum aestivum

<220>

<221> misc_feature

<222> (168) .. (168)

<223> Xaa can be any naturally occurring amino acid

<400> '26

Thr Wing Pro Pro Leu Lys Arg Gly Pro Trp Thr Wing Glu Glu Asp Glu1 5 10 15 Val Leu Arg Wing Phe Val Wing Arg Glu Gly Glu Arg Trp Arg Thr 25 25 30 Leu Pro Arg Wing Gly Leu Arg Le Cys Gly Lys Ser Cys Arg Leu 35 40 45 Arg Trp Met Asn Tyr Leu Arg Pro Asp Ile Lys Arg Gly Pro Ile Wing 50 55 60 Glu Asp Glu Asp Leu Ile Leu Arg Leu His Val Val Gly Asn65 70 75 80Arg Trp Ser Leu Ile Ala Gly Arg Leu Pro Gly Arg Thr Asp Asn Glu 85 90 95 Ile Lys Asn Tyr Trp Asn Be His Leu Be Lys Lys Leu Ile Wing Gln 100 105 110 Gly Leu Asp Pro Arg Thr His Met Pro Wing Ala Pro Wing Gly Arg 115 120 120 125 Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Lion Wing Wing Arg Arg Arg Arg His 175 AspAsp Read Wing Ala 180 Wing Met Ser Val Asp 185 Gly PheGly Asp Gln 195 Read Leu Wing Asp Tyr 200 Wing Wing Be Arg Gly 205 Val Phe AsnAsp Val 210 Met Gly Cys Pro Met 215 Val Asp Asp Thr 220 Phe Thr Be PheLeu Asp Be Read Met Asn Glu Arg Gln His Lys Val225 230 235 240Gly Wing Ile

<210> 27

<211> 14

<212> PRT

<213> Sequence

artificial

<220>

<223> MYB4 domain

<220>

<221> VARIANT

<222> (1). . (1)

<223> / replace = "Asn"

<220>

<221> VARIANT

<222> (2) .. (2)

<223> / replace = "Wing"

<220>

<221> DUBY

<222> (3) .. (3)

<223> Xaa can be any naturally occurring amino acid

<220>

<221> VARIANT

<222> (5) .. (5)

<223> / replace = "Thr" / replace = ""

<220>

<221> VARIANT

<222> (9) .. (9)

<223> / replace = "Asp"

<220>

<221> VARIANT

<222> (12) .. (12)

<223> / replace = nMet "

<220>

<221> VARIANT

<222> (14) .. (14)

<223> / replace = "Asp"

<400> 27

Asp Asp Xaa Phe Be Ser Phe Leu Asn Ser Leu Ile Asn Glu <210> 28

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Oryza sativa MYB4 domain as in SEQ ID NO: 2

<400> 28

Asp Asp Asp Phe Be Be Phe Read Asp Be Read Ile Asn Asp Asp1 5 10

<210> 29

<211> 654

<212> DNA

<213> Oryza sativa

<400> 29

cttctacatc

ttattttaca

ttattgtaaa

aaacaagagt

attgaaatta

gcattaccaa

ccttatcaca

atcatgtata

gtgcacctaa

aaaactaaca

aatcctcatc

ggcttaggtgaaaatataaagttctacaaagtcaatggaatataattcaaaatatatatattgacacatatgatagcccagaatatccctctaaagcaatccttcacc

tagcaacacgatagatcagtgctaatttaacaatgaaaacagagaataaagcttacaaaaaaagtgagtgaacaaagttacaaataatatgaccgatgggaacaattcaaa

actttattatccctcaccacaagttattgccatatgacattccacatagccatgacaagctgagtcataatttgatgatgactcacttagaagcatctattattatagtt

tattattatt attattatta 60aagtagagca agttggtgag 120attaacttat ttcatattac 180actataattt tgtttttatt 240cgtaaagttc tacatgtggt 300ttagtttgaa aaattgcaat 360tattattttc tttgctaccc 420atatcaaaga acatttaggagagaatatagagagagata 600a

<210> 30

<211> 50

<212> PRT

<213> Artificial sequence <220>

<223> initiator: prm5233

<400> 30

Gly Gly Gly Gly Cly Wing Cys Wing Gly Thr Thr Wing Gly Thr Wing Cys1 5 10 15 Wing Wing Wing Wing 20 Wing Wing Gly Cys Wing 25 Gly Gly Cys Thr Thr 30 Wing Wing Cys Wing 35 Wing Thr Gly Wing 40 Gly Cys Gly Gly Wing 45 Wing Gly Cys

Gly Gly50

<210> 31

<211> 50

<212> PRT

<213> Artificial sequence <220>

<223> initiator: prm5234

<400> 31Gly Gly Gly Gly Gly Cys Wing Cys Gly Thr Thr Gly Gly Thr Cys1 5 10 15

Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing Wing 25

Cys Thr Cys Cys Cys Gly Wing Gly Wing Gly Wing Thr Thr Wing Cys Thr35 40 45

Gly thr50

<210> 32 <211> 756 <212> DNA

<213> Brassica napus <400> 32

atgacgtcat ctggaggaaa gaagcaggtc gtgaagaaga tgatcccgtg ctgcatgaag 60

atggggatga agagaggacc atggacggcg gaggaggatg agattcttgt tagcttcatc 120aagaaagaag gcgaaggaag gtggagatcg cttcccaaga gagctggttt actccgatgt 180ggaaagagct gccgcctacg gtggatgaac tatctccggc cgtctgtaaa acgcggcggt 240atcactcccg acgaggaaga tctcatcctc cgccttcatc gcctccttgg caaccggtgg 300tcactgatcg cgggaaggat accgggaagg actgataatg agattaagaa ctattggaac 360actcatcttc gtaagaaact cttaagtgaa ggcattgatc ctcgaaccca caagcctctt 420gatgcaaaca atgctcatca taaacccgga gaagaagttt ccggtggaca gaatcttcta 480gagcctaatt ctagttctca cactgatgac accaccgtta atagcggaaa tgaagctacc 540aagatcactt tcagtgtctt tggtggtgaa gacaacgaag actttggttt ctgttacgat 600gataagtttt cttcgtttct aaatgcgctt attaatgatg atccttttga tagtaatatt 660ccattgtccc agccgttacg gacgcaagat tgtactggtg aggaggaggaggaggaggaggaggaggaggaggg

<210> 33

<211> 251

<212> PRT

<213> Brassica napus

<400> 33 Met Thr Be Ser Gly Gly Lys Lys Gln Val Val Lys Lys Met Ile Pro1 5 10 15 Cys Cys Met Lys 20 Met Gly Met Lys Arg 25 Gly Pro Trp Wing 30 Glu GluAsp Glu Ile 35 Leu Val Ser Phe Ile 40 Lys Lys Glu Gly Glu 45 Gly Arg TrpArg Ser 50 Leu Pro Lys Arg Wing 55 Gly Leu Leu Arg Cys 60 Gly Lys Be CysArg Leu Arg Trp Met Asn Tyr Leu Arg Pro Be Val Lys Arg Gly65 70 75 80Ile Thr Pro Asp Glu 85 Glu Asp Leu Ile Leu 90 Arg Leu His Arg Leu 95 LeuGly Asn Arg Trp 100 Ser Leu Ile Wing Gly 105 Arg Ile Pro Gly Arg 110 Thr AspAsn Glu Ile 115 Lys Asn Tyr Trp Asn 120 Thr His Leu Arg Lys 125 Lys Leu LeuSer Glu 130 Gly Asle Asp Pro Arg 135 Thr His Lys Pro Leu 140 Asp Wing Asn AsnAla His His Lys Pro Gly Glu Glu Val Ser Asn Ser 175 GlyAsn Glu Wing Thr 180 Lys Ile Thr Phe Ser 185 Val Phe Gly Gly Glu 190 Asp AsnGlu Asp Phe 195 Gly Phe Cys Tyr Asp 200 Asp Lys Phe S er Ser 205 Phe Leu AsnAla Leu 210 Ile Asn Asp Asp Pro 215 Phe Asp Le Asn Ile 220 Pro Leu Ser GlnPro Leu Arg Thr Gln Asp Cys Thr Gly Glu Ile Val Gly Thr Ser225 230 235 240Ser Leu Glu His Gly 245 Gln Arg Ile Glu Asp 250 Ile

<210> 34

<211> 900

<212> DNA

<213> Eucalyptus grandis

<400> 34

atgaggaatc cgtcgtcgtc gtcgggaggg acgaagaccc cgtgctgcag caaggtgggg 60

ctgaagaggg ggccctggac gccggaggag gacgagctcc tcgccggcta catcaaccgc 120

gagggcgagg gccggtggcg gaccctcccc aagcgggccg gcctcctccg ctgcggcaag 180

agctgccgcc tccgctggat gaactacctc cgcccctccg tcaagcgcgg ccagatcgcc 240

cccgacgagg aggacctcat cctccgcctc caccgcctcc tcggcaaccg gtggtctttg 300

atagctggga gaatcccagg acggactgac aatgagatca agaactactg gaacactcac 360

cttagcaaga agctcatcag tcaaggaatt gatccgagga cgcacaagcc gctcaatcca 420

gaaacccaga actccagcag caatcctcca gcgaaacctc ctccttccaa agcggcacct 480

cgccctcgaa gccctaaccc tagccccatc tcttctggcc tcgaggaaac cagcagtggc 54 0

agcccagcca tcctcaaaga aaatgatcag atccaaagtg ccgataatac ggaggctgtg 600

tatcaaaatg ggactgcgac agctcacggt ggtgaagcca gttatttgcc gggtacccag 660

cattaccatg tgatgggctt gagaagcagc cacggactgt ctaatgagga ggaggaggac 720

ctcaactgct gcggggacga cgtcttctca tcgttcctga actccctgat caacgaggaa 780

gcattcccaa tccagcacca gctacaacaa caggccgtcg gctcctcgcc ggattcggat 840

tctctgattc ccatggctgc agcacctgca ttcgggatag ccgctggctg ggactcttag 900

<210> 35

<211> 299

<212> PRT

<213> Eucalyptus grandis

<400> 35

Met Arg Asn Pro Be Ser Be Ser Gly Gly Thr Lys Thr Pro Cys Cys1 5 10 15

Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp Glu

20 25 30

Leu Leu Wing Gly Tyr Ile Asn Arg Glu Gly Glu Gly Arg Trp Arg Thr

35 40 45

Leu Pro Lys Arg Gly Wing Leu Read Le Arg Cys Gly Lys Ser Cys Arg Leu

50 55 60

Arg Trp Met Asn Tyr Leu Arg Pro Be Val Lys Arg Gly Gln Ile Ala65 70 75 80

Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Leu Leu Leu Gly Asn

85 90 95

Arg Trp Being Read Ile Gly Wing Arg Ile Pro Gly Arg Thr Asp Asn Glu

100 105 110

Ile Lys Asn Tyr Trp Asn Thr His Read Ser Lys Lys Read Ile Ser Gln

115 120 125

Gly Ile Asp Pro Arg Thr His Lys Pro Read Asn Pro Glu Thr Gln Asn

130 135 140

Ser Ser Ser Asn Pro Pro Lys Pro Pro Pro Lys Pro Pro Pro Lys Pro Pro Wing Pro145 150 155 160

Arg Pro Arg Be Pro Asn Pro Be Pro Ile Be Be Gly Leu Glu Glu165 170 175Thr Be Be Gly 180 Be Pro Wing Ile Leu 185 Lys Glu Asn Asp Gln 190 Ile GlnSer Wing Asp 195 Asn Thr Glu Wing Val 200 Tyr Asn Gly Thr 205 Ala Thr AlaHis Gly 210 Gly Glu Wing Ser Tyr 215 Leu Pro Gly Thr Gln 220 His Tyr His ValMet Gly Leu Arg Be His His Gly Leu Be Asn Glu Glu Glu Asp225 230 235 240Leu Asn Cys Cys Gly 245 Asp Asp Val Phe Ser 250 Ser Phe Leu Asn Ser 255 LeuIle Asn Glu Glu 260 Wing Phe Pro Ile Gln 265 His Gln Leu Gln Gln 270 Gln AlaVal Gly Ser 275 Ser Pro Asp Ser Asp 280 Ser Leu Ile Pro Met 285 Wing Ala AlaPro Wing 290 Phe Gly Ile Ala Wing 295 Gly Trp Asp Ser

<210> 36 <211> 1125 <212> DNA

<213> Domestic Malus <400> 36

atgaggaacc cgtcgtcttc gtcgaaagca acagcagcag caagtgctac gatgacaaca 60

gcatcgccgt cgtcgagcaa ggcggggatt gccggaggga gtaagacgcc gtgttgcgta 120

aaggtgggtt tgaagagggg gccgtggact cccgaagagg acgagctgct agccaattac 180

atcaagaaag aaggtgaagg acggtggcgg accctcccca agcaggctgg gttgctccgc 240

tgcggaaaaa gctgtcgcct ccgctggatg aactacctcc gcccttccgt taagcgcggc 300

cagatcgccc ccgatgaaga agatctcatt ctccgcctcc atcgcctcct cggcaatcgg 360

tggtctttga tagctgggag gattccaggt cgtacggaca atgagataaa gaactactgg 420

aacacacacc tgagcaagaa gctgataagc caaggcatag atcccagaac ccacaagcct 480

ctcaatccag atcatcactc tgctgctgcc gatgctgatg tgggcaacac aaataaatca 540

gctgctgctg ctgcttcttc caaagccaat aaccgattct caaaccctaa tcctagtcct 600

cctccttctg atcgtcttgt ccatcaagga gcggatccca gtatcaacgg taatgatgga 660

aacatcgcaa ttgatgatca tgatctgggc actatagtcc atagctgtgc aaacatgacc 720

acgtccatta acaatcccga tgcttcttct tcggccgcag caatgggcac tttgagttta 780

aggaccaaca acaatagcca cgctggagta ctacttgggg gaggaggaaa tgaagaggac 840

gaggacatca actgttgtgc ggacgatgtc ttctcttcgt ttctgaattc gttgatcaac 900

gaggatccat tttctgtaca acaccaattg caacaacagg tactgcacaa tgggaatgtt 960

agtacacacg cagctggtgc tggttccgac cacgttcctt tgatttctat gactagtgct 1020

agtactatgg cgccgtcaac atttggctgg gactctgctg tgctcatgtc ttctgctttc 1080

aaccaaaatg atcaccagag ggttactgat caaacggagc agtag 1125

<210> 37 <211> 374 <212> PRT

<213> Malus domestic <400> 37

Met Arg Asn Pro Be Ser Be Ser Lys Wing Thr Wing Wing Wing Be Wing1 5 10 15

Thr Met Thr Thr Wing Be Pro Be Be Lys Wing Gly Ile Wing Gly

20 25 30

Gly Ser Lys Pro Thr Cys Cys Val Lys Val Gly Read Lys Arg Gly Pro

35 40 45

Trp Thr Pro Glu Glu Asp Glu Read Leu Wing Asn Tyr Ile Lys Lys Glu

50 55 60

Gly Glu Gly Arg Trp Arg Thr Leu Pro Lys Gln Wing Gly Leu Leu Arg65 70 75 80Cys Gly Lys Be Cys Arg Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser

85 90 95

Val Lys Arg Gly Gln Ile Pro Wing Asp Glu Glu Asp Leu Ile Leu Arg

100 105 110

Read His Arg Read Le Gly Asn Arg Trp Be Read Ile Wing Gly Arg Ile

115 120 125

Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Leu

130 135 140

Be Lys Lys Leu Ile Be Gln Gly Ile Asp Pro Arg Thr His Lys Pro145 150 155 160

Leu Asn Pro Asp His His Be Wing Wing Wing Wing Asp Wing Wing Val Gly Asn

165 170 175

Thr Asn Lys Be Wing Wing Wing Wing Wing Be Wing Lys Wing Asn Asn Arg

180 185 190

Phe Ser Asn Pro Asn Pro Ser Pro Pro As As Arg Arg Read Val His

195 200 205

Gln Gly Asp Pro Wing Ile Asn Gly Asn Asp Gly Asn Ile Wing Ile

210 215 220

Asp Asp His Asp Read Gly Thr Ile Val His Ser Cys Wing Asn Met Thr225 230 235 240

Thr Be Ile Asn Asn Pro Asp Wing Ser Be Ser Wing Ala Wing Met Gly

245 250 255

Thr Leu Be Leu Arg Thr Asn Asn Asn Be His Wing Gly Val Leu Leu

260 265 270

Gly Gly Gly Gly Asn Glu Asu Glu Asp Glu Asp Ile Asn Cys Cys Wing Asp

275 280 285

Asp Val Phe Be Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Pro Phe

290 295 300

Ser Val Gln His Gln Leu Gln Gln Gln Val Leu His Asn Gly Asn Val305 310 315 320

Be Thr His Wing Gly Wing Gly Wing Asp His Val Pro Leu Ile Ser

325 330 335

Met Thr Be Wing Be Thr Met Wing Wing Be Thr Phe Gly Trp Asp Be

340 345 350

Val Wing Read Met Being Ser Phe Wing Asn Gln Asn Asp His Gln Arg Val

355 360 365

Thr Asp Gln Thr Glu Gln370

<210> 38

<211> 14

<212> PRT

<213> Artificial sequence <220>

<223> MYB4 domain

<220>

<221> VARIANT

<222> (1) .. (1)

<223> / replace = "Asn"

<220>

<221> VARIANT

<222> (2) .. (2)

<223> / replace = "Wing"

<220> <221>

Doubt <222> (3) .. (3) <220>

<221> VARIANT

<222> (5) .. (5)

<223> / replace = "Thr" / replace = "Pro" / replace = ""

<220>

<221> VARIANT

<222> (9) .. (9)

<223> / replace = "Asp"

<220>

<221> VARIANT

<222> (12). . (12)

<223> / replace = "Met"

<220>

<221> VARIANT

<222> (14) .. (14)

<223> / replace = "Asp"

<400> 38

Asp Asp Xaa Phe Be Ser Phe Leu Asn Ser Leu Ile Asn Glu1 5 10

<210> 39

<211> 2194

<212> DNA

<213> Oryza sativa

<400> 39

aatccgaaaa gtttctgcac cgttttcacc ccctaactaa caatataggg aacgtgtgct 60

aaatataaaa tgagacctta tatatgtagc gctgataact agaactatgc aagaaaaact 120

catccaccta ctttagtggc aatcgggcta aataaaaaag agtcgctaca ctagtttcgt 180

tttccttagt aattaagtgg gaaaatgaaa tcattattgc ttagaatata cgttcacatc 24 0

tctgtcatga agttaaatta ttcgaggtag ccataattgt catcaaactc ttcttgaata 300

aaaaaatctt tctagctgaa ctcaatgggt aaagagagag atttttttta aaaaaataga 360

atgaagatat tctgaacgta ttggcaaaga tttaaacata taattatata attttatagt 42 0

ttgtgcattc gtcatatcgc acatcattaa ggacatgtct tactccatcc caatttttat 480

ttagtaatta aagacaattg acttattttt attatttatc ttttttcgat tagatgcaag 540

gtacttacgc acacactttg tgctcatgtg catgtgtgag tgcacctcct caatacacgt 600

tcaactagca acacatctct aatatcactc gcctatttaa tacatttagg tagcaatatc 660

tgaattcaag cactccacca tcaccagacc acttttaata atatctaaaa tacaaaaaat 72 0

aattttacag aatagcatga aaagtatgaa acgaactatt taggtttttc acatacaaaa 780

aaaaaaagaa ttttgctcgt gcgcgagcgc caatctccca tattgggcac acaggcaaca 840

acagagtggc tgcccacaga acaacccaca aaaaacgatg atctaacgga ggacagcaag 900

tccgcaacaa ccttttaaca gcaggctttg cggccaggag agaggaggag aggcaaagaa 960

aaccaagcat cctccttctc ccatctataa attcctcccc ccttttcccc tctctatata 1020

ggaggcatcc aagccaagaa gagggagagc accaaggaca cgcgactagc agaagccgag 1080

cgaccgcctt ctcgatccat atcttccggt cgagttcttg gtcgatctct tccctcctcc 1140

acctcctcct cacagggtat gtgcctccct tcggttgttc ttggatttat tgttctaggt 1200

tgtgtagtac gggcgttgat gttaggaaag gggatctgta tctgtgatga ttcctgttct 1260

tggatttggg atagaggggt tcttgatgtt gcatgttatc ggttcggttt gattagtagt 1320

atggttttca atcgtctgga gagctctatg gaaatgaaat ggtttaggga tcggaatctt 1380

gcgattttgt gagtaccttt tgtttgaggt aaaatcagag caccggtgat tttgcttggt 1440

gtaataaagt acggttgttt ggtcctcgat tctggtagtg atgcttctcg atttgacgaa 1500

gctatccttt gtttattccc tattgaacaa aaataatcca actttgaaga cggtcccgtt 1560

gatgagattg aatgattgat tcttaagcct gtccaaaatt tcgcagctgg cttgtttaga 1620tacagtagtc cccatcacga aattcatgga aacagttata atcctcagga acaggggatt 1680

ccctgttctt ccgatttgct ttagtcccag aatttttttt cccaaatatc ttaaaaagtc 1740

actttctggt tcagttcaat gaattgattg ctacaaataa tgcttttata gcgttatcct 1800

agctgtagtt cagttaatag gtaatacccc tatagtttag tcaggagaag aacttatccg 1860

atttctgatc tccattttta attatatgaa atgaactgta gcataagcag tattcatttg 1920

gattattttt tttattagct ctcacccctt cattattctg agctgaaagt ctggcatgaa 1980

ctgtcctcaa ttttgttttc aaattcacat cgattatcta tgcattatcc tcttgtatct 2040

acctgtagaa gtttcttttt ggttattcct tgactgcttg attacagaaa gaaatttatg 2100

aagctgtaat cgggatagtt atactgcttg ttcttatgat tcatttcctt tgtgcagttc 2160

ttggtgtagc ttgccacttt caccagcaaa gttc 2194

<210> 40

<211> 1244

<212> DNA

<213> Oryza sativa

<400> 40

aaaaccaccg agggacctga tctgcaccgg ttttgatagt tgagggaccc gttgtgtctg 60

gttttccgat cgagggacga aaatcggatt cggtgtaaag ttaagggacc tcagatgaac 120

ttattccgga gcatgattgg gaagggagga cataaggccc atgtcgcatg tgtttggacg 180

gtccagatct ccagatcact cagcaggatc ggccgcgttc gcgtagcacc cgcggtttga 24 0

ttcggcttcc cgcaaggcgg cggccggtgg ccgtgccgcc gtagcttccg ccggaagcga 300

gcacgccgcc gccgccgacc cggctctgcg tttgcaccgc cttgcacgcg atacatcggg 360

atagatagct actactctct ccgtttcaca atgtaaatca ttctactatt ttccacattc 420

atattgatgt taatgaatat agacatatat atctatttag attcattaac atcaatatga 480

atgtaggaaa tgctagaatg acttacattg tgaattgtga aatggacgaa gtacctacga 54 0

tggatggatg caggatcatg aaagaattaa tgcaagatcg tatctgccgc atgcaaaatc 600

ttactaattg cgctgcatat atgcatgaca gcctgcatgc gggcgtgtaa gcgtgttcat 660

ccattaggaa gtaaccttgt cattacttat accagtacta catactatat agtattgatt 720

tcatgagcaa atctacaaaa ctggaaagca ataagaaata cgggactgga aaagactcaa 780

cattaatcac caaatatttc gccttctcca gcagaatata tatctctcca tcttgatcac 840

tgtacacact gacagtgtac gcataaacgc agcagccagc ttaactgtcg tctcaccgtc 900

gcacactggc cttccatctc aggctagctt tctcagccac ccatcgtaca tgtcaactcg 960

gcgcgcgcac aggcacaaat tacgtacaaa acgcatgacc aaatcaaaac caccggagaa 1020

gaatcgctcc cgcgcgcggc ggcgacgcgc acgtacgaac gcacgcacgc acgcccaacc 1080

ccacgacacg atcgcgcgcg acgccggcga caccggccgt ccacccgcgc cctcacctcg 1140

ccgactataa atacgtaggc atctgcttga tcttgtcatc catctcacca ccaaaaaaaa 1200

aaggaaaaaa aaacaaaaca caccaagcca aataaaagcg acaa 1244

<210> 41

<211> 654

<212> DNA

<213> Oryza sativa

<400> 41

cttctacatc ggcttaggtg tagcaacacg actttattat tattattatt attattatta 60

ttattttaca aaaatataaa atagatcagt ccctcaccac aagtagagca agttggtgag 120

ttattgtaaa gttctacaaa gctaatttaa aagttattgc attaacttat ttcatattac 180

aaacaagagt gtcaatggaa caatgaaaac catatgacat actataattt tgtttttatt 24 0

attgaaatta tataattcaa agagaataaa tccacatagc cgtaaagttc tacatgtggt 300

gcattaccaa aatatatata gcttacaaaa catgacaagc ttagtttgaa aaattgcaat 360

ccttatcaca ttgacacata aagtgagtga tgagtcataa tattattttt cttgctaccc 420

atcatgtata tatgatagcc acaaagttac tttgatgatg atatcaaaga acatttttag 480

gtgcacctaa cagaatatcc aaataatatg actcacttag atcataatag agcatcaagt 54 0

aaaactaaca ctctaaagca accgatggga aagcatctat aaatagacaa gcacaatgaa 600

aatcctcatc atccttcacc acaattcaaa tattatagtt gaagcatagt agta 654

Claims (31)

1. Method for increasing plant yield over control plants, characterized in that it comprises increasing a plant's expression of a nucleic acid sequence encoding a MYB domain transcription factor (MYB-TF) polypeptide, and optionally selecting plants possessing yield. increased. Method according to claim 1, characterized in that the expression is preferably increased in the endosperm of a plant seed. Method according to claim 1 or 2, characterized in that said MYB-TF polypeptide is any polypeptide comprising from the N-terminus to the C-terminus (i) an R2R3 MYB domain comprising two MYB repeats; and (ii) a MYB4 domain preferably in ascending order of at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more of identity. string to the MYB4 domain represented by any one or more of: SEQ ID NO: 38, SEQ ID NO: 27, or SEQ ID NO: 28. Method according to any of the preceding claims, characterized in that said MYB-TF polypeptide is any polypeptide sequence which, when used in the construction of a MYB phylogenetic tree such as that shown in Figure 3, tends to group with the group. of polypeptide sequences comprising sequences represented by SEQ ID NO: 2 and SEQ ID NO: 4, rather than any other group, as shown in Figure 3. Method according to any of the preceding claims, characterized in that said MYB-TF polypeptide is any sequence of polypeptides with increasing order of preference at least 35%, 40%, 45%, 50%, 55%, 60% , 65%, 70%, 75%, 80%, 85%, - 90%, 95%, 98%, 99% or more of sequence identity with respect to polypeptide sequence as represented by SEQ ID NO: 2. Method according to claim 1 or 2, characterized in that said increased expression is effected by the introduction of a genetic modification, preferably at the site of a MYB-TF polypeptide genecoder, in a plant. Method according to claim 6, characterized in that said genetic modification is effected by any one or more of: T-DNA activation, TILLING and homologous recombination. 8. Method for increasing plant yield over control plants, characterized in that it comprises introducing and expressing into a plant a nucleic acid sequence encoding a MYB-TF polypeptide. A method according to claim 8, characterized in that the said nucleic acid sequence is operably linked to a constitutive promoter, preferably to a GOS2 promoter. Method according to any one of claims 1, 6, or 8, characterized in that said plant yield is one or more of: (i) increased seedling vigor in emergence; (ii) rooted biomass; (iii) increased greenness index (before flowering); (iv) increased seed fill rate (v) total seed weight per plant increased; (vi) increased number of full seeds; or (vii) increased deceiving index. A method for increasing plant yield relative to control plants, characterized in that it comprises introducing and preferably increasing the expression of a MYB-TF polypeptide nucleic acid sequence in the endosperm of a plant seed. A method according to claim 11, characterized in that said nucleic acid sequence is operably linked to an endosperm-specific promoter, preferably to a prolamine promoter. A method according to any one of claims 2, 6, or 11, characterized in that said plant yield is one or more of: (i) increased total seed weight per plant; (ii) increased number of full seeds; or (iii) increased harvesting index. A method according to any one of the preceding claims, characterized in that said nucleic acid sequence is a portion or an allelic variant or an editing variant or a sequence capable of hybridizing to a nucleic acid sequence as given in Table A, in which portion, allelic variant, editing variant, or hybridization sequence encodes a MYB-TF polypeptide. A method according to claim 14, characterized in that said portion, allelic variant, editing variant, or hybridization sequence encodes an ortholog or paralog of a MYB-TF polypeptide. A method according to any one of the preceding claims, characterized in that said nucleic acid sequence encoding a MYB-TF polypeptide is of a plant origin, preferably from a monocotyledonous plant, preferably from the Poaceae family, more preferably from the genus Oryza. , much more preferably from Oryza sativa. Plants, plant parts, or plant cells obtainable by the method as defined in any one of the preceding claims, characterized in that said plants, or parts or cells thereof, comprise an isolated nucleic acid encoding a MYB-TF polypeptide; whose isolated nucleic acid is operably linked in a constitutive promoter or endosperm specific promoter. 18. Construct, characterized by understanding: a. A nucleic acid sequence encoding a MYB-TF polypeptide b. One or more control sequences capable of expressing a plant, plant part or plant cell of the nucleic acid sequence of (a); and optionallyec. A transcription termination sequence. Construct according to claim 18, characterized in that one of said control sequences is one of: (i) a constitutive promoter, preferably a GOS2 promoter; or (ii) an endosperm specific promoter, preferably a prolamine promoter. Use of a construct as defined in claim 18 or 19, characterized in that it is for increasing plant yield. 21. Plant, plant part or plant cell, characterized in that it is transformed with a construct as defined in claim 19 or 20. 22. A method of producing a transgenic plant having increased mismatch relative to control plants, characterized by the following: (i) introducing and expressing in a plant, plant part or plant cell a nucleic acid sequence encoding a MYB-TF polypeptide wherein the expression of said nucleic acid sequence is driven by a constitutive promoter or an endosperm specific promoter; and (ii) cultivating the plant part or plant cell under conditions conducive to plant growth and development. 23. Transgenic plant, characterized by the fact that it has increased yield compared to control plants, said increased yield resulting from the increased expression in a nucleic acid transgene plant encoding a MYB-TF polypeptide. Transgenic plant according to claim 23, characterized in that said expression is preferably increased in the endosperm of a plant seed. Transgenic plant according to any one of claims 17, 21, 23, or 24, characterized in that said plant is a crop plant or a monocot plant or a cereal, such as rice, corn, wheat, barley, millet, rye, triticale, sorghum and oats. Harvestable parts of a plant as defined in any one of claims 17, 21, 23, 24, or 25, wherein said harvestable parts are seeds. Products, characterized in that they are derived from a plant as defined in claim 25 and / or harvestable parts of the plant as defined in claim 26. 28. Use of a nucleic acid sequence encoding a MYB-TF polypeptide, whose nucleic acid sequence is operably linked in a constitutive promoter, characterized by the fact that it is in increasing plant yield compared to a control plant. Use according to claim 28, characterized in that said plant yield is one or more of: (i) emergence of increased seedling vigor; (ii) increased number of thick roots; (iii) increased greenness index (before flowering); (iv) increased spike rate (v) increased seed weight per plant increased; (vi) increased number of full seeds; or (vii) increased harvesting index. Use of a nucleic acid sequence encoding a MYB-TF polypeptide, whose nucleic acid sequence is operably linked in an endosperm specific promoter, characterized in that it is in increasing plant yield compared with a control plant. Use according to claim 30, characterized in that the said increased plant yield is one or more of: (i) increased total seed weight per plant (ii) increased number of full seeds; or (iii) increased harvesting index.