BR122024008251A2 - PROCESS OF PRODUCING METHACRYLIC ACID, RECOMBINANT MICROORGANISM, FERMENTATION PROCESS, METHOD FOR PREPARING POLYMERS OR COPOLYMERS OF METHACRYLIC ACID OR METHACRYLIC ACID ESTERS - Google Patents

Abstract

PROCESS FOR PRODUCING METHACRYLIC ACID, RECOMBINANT MICROORGANISM, FERMENTATION PROCESS, METHOD FOR PREPARING POLYMERS OR COPOLYMERS OF METHACRYLIC ACID OR METHACRYLIC ACID ESTERS The invention relates to a process for producing methacrylic acid and/or its derivatives comprising the following steps: (a ) biologically convert isobutyryl-CoA into methacrylyl-CoA by the action of an oxidase; and (b) converting methacrylyl-CoA into methacrylic acid and/or its derivatives. The invention also extends to microorganisms adapted to carry out the process steps.

Description

[001] The present invention relates to a process for the biological production of methacrylic acid and its derivatives. In particular the process refers to using particular enzymatic conversions to form methacrylic acid from isobutyryl-CoA via methacrylyl-CoA, and the polymers or copolymers produced therefrom.

Fundamentals

[002] Acrylic acids and their alkyl esters, in particular methacrylic acid (MAA) and its methyl ester, methyl methacrylate (MMA), are important monomers in the chemical industry. Its main application is in the production of plastics for various applications. The most significant application of polymerization is the shaping, molding or extrusion of polymethyl methacrylate (PMMA) to produce plastics with high optical clarity. Additionally, many copolymers are used; The important copolymers are copolymers of methyl methacrylate and ethyl methacrylate with α-methyl styrene, ethyl acrylate and butyl acrylate. Furthermore, by a simple transesterification reaction, MMA can be converted to other esters such as butyl methacrylate, lauryl methacrylate, etc.

[003] Currently, MMA (and MAA) is produced by several chemical procedures, one of which is the successful 'Alpha process' whereby MMA is obtained from the ester, methyl propionate, by anhydrous reaction with formaldehyde. In the Alpha process, methyl propionate is produced by the carbonylation of ethylene. This ethylene feed stock is derived from fossil fuels. Recently, it has become desirable to also extract sustainable biomass feedstocks for the chemical industry. Consequently, an alternative biomass route for MMA rather than using the Alfa process would be advantageous.

[004] Therefore, it is an object of the present invention to address the aforementioned problem, and to provide a biological or partially biological process for the production of methacrylic acid.

[005] Surprisingly, the present inventors have discovered a way to apply a new enzyme substrate combination not previously considered for the formation of methacrylic acid at an industrially applicable level, thereby providing a new and viable biologically based pathway to key monomers such like MMA.

[006] It is known that the oxidation of isobutyryl-CoA to methacrylyl-CoA occurs naturally in pathway I of valine degradation, and the enzymes that carry out this conversion have been observed in some cells. In these systems, conversion typically uses an acyl-CoA dehydrogenase enzyme that requires a corresponding electron transport system to marry substrate oxidation with reduction of ubiquinone, which is then regenerated.

[007] WO201438216 describes a process of producing methacrylic acid from microbes and converting methacrylyl CoA to the ester using alcohol acyl transferases. The paper shows a small amount of conversion of 2-oxoisovaleric acid to isobutyryl CoA and isobutyryl CoA to methacrylyl CoA. It also discusses the theoretical production of methacrylic acid from methacrylyl-CoA in vivo, but this is not produced successfully.

[008] However, in WO201438216, the only example of in vivo production of methacrylic acid uses acyl-CoA dehydrogenases derived from Rhodococcus erythropolis recombinantly expressed in a host of the same genus; a Rhodococcus bacterium. Other examples that have attempted to heterologously express similar acyl-CoA dehydrogenases discovered in Pseudomonas aeruginosa in a different host organism have failed to produce methacrylic acid. Upregulation or expression of a heterologous acyl-CoA dehydrogenase in a host organism is difficult to achieve and has not yet been reported.

[009] Therefore, it is another object of the present invention to provide improved production of methacrylic acid.

[0010] There is no known metabolic pathway in which the production of methacrylic acid occurs, as a product or as an intermediate. Acyl-CoA thioesterase enzymes are known to catalyze the hydrolysis of structurally related substrates, however these enzymes tend to have very narrow substrate specificity, and have not been tested to do so or do not catalyze the hydrolysis of methacrylyl-CoA. Furthermore, those rarer varieties that have broader substrate specificity are likely to be a problem in a biological system, such as host cell expression, due to off-target hydrolysis of essential cellular thioesters. Again, none are known to catalyze the hydrolysis of methacrylyl-CoA. Consequently, these enzymes have thus far not been demonstrated to be viable for use in industrial applications involving the biological production of methacrylic acid.

[0011] Therefore, it is another objective of the present invention to address the aforementioned problem and to provide a viable enzymatic conversion of methacrylyl-CoA to methacrylic acid that can be used in an industrial process, and that can be used independently of any enzyme that functions for convert isobutyryl CoA to methacrylyl CoA. Declaration of Invention

[0012] According to the first aspect of the present invention, there is provided a process for producing methacrylic acid and/or its derivatives, comprising the following steps: (a) Biologically converting isobutyryl-CoA to methacrylyl-CoA by the action of an oxidase; and (b) Converting methacrylyl-CoA to methacrylic acid and/or its derivatives.

[0013] According to a second aspect of the present invention, there is provided a process for producing methacrylic acid comprising the following steps: (a) converting isobutyryl-CoA into methacrylyl-CoA; and (b) biologically convert methacrylyl-CoA into methacrylic acid by the action of a thioesterase, suitably a 4-hydroxybenzoyl-CoA thioesterase (4HBT), transferase, synthetase, and/or a phosphotransacylase and a short chain fatty acid kinase.

[0013] Preferably, in the process of the second aspect of the present invention, methacrylyl-CoA is converted to methacrylic acid by the action of a thioesterase, more preferably a 4-hydroxybenzoyl-CoA thioesterase (4HBT), suitably under group EC 3.1.2.23. Most preferably, methacrylyl-CoA is converted to methacrylic acid by the action of the acyl-CoA thioesterase 4HBT from Arthrobacter sp. SU strain.

[0014] Advantageously, the processes of the invention provide another biological route to produce the key chemical product methacrylic acid and its known derivatives reducing the industry's dependence on fossil fuels and increased sustainability.

[0015] The process allows easy conversion of renewable feed stocks to isobutyryl-CoA by microbial fermentation, and the co-expression of enzyme catalyzing steps (a) and (b) will provide a direct microbial fermentation pathway to MAA.

[0016] Furthermore, the processes use enzymes for step (a) or (b) not previously considered for the production of methacrylic acid and not found in the naturally occurring valine pathways. In particular, the enzyme for step (a) acts to convert isobutyryl CoA to methacrylyl CoA without requiring an associated electron transport system, and the enzymes for step (b) have high substrate specificity for methacrylyl CoA to avoid the problem. formation of this intermediate in host organisms. Therefore each of the enzymes in steps (a) or (b) can be used alone to partially improve chemical processes to form methacrylic acid or to improve biological processes to form methacrylic acid. Alternatively, both enzymes from steps (a) and (b) can be used together to form an autonomous biological process to manufacture methacrylic acid at an industrially applicable level, and which is functional in heterologous host organisms.

Enzymes

[0017] In the context of the present invention 'biologically' means using a biological catalyst. Preferably the biological catalysts are enzymes, but may include any catalytic structure derived from a biological source.

[0018] In the context of the present invention 'chemically' means using chemical means other than the use of a biological catalyst such as an enzyme.

[0019] In relation to the first aspect, step (b) can be conducted biologically or chemically, preferably biologically.

[0021] Regarding the second aspect, step (a) can be conducted biologically or chemically, preferably biologically.

[0020] Preferably, step (a) and step (b) are conducted enzymatically using one or more enzymes in which the enzymes are acting as biological catalysts.

[0021] Preferably the oxidase is an oxidase acting on CH-CH bonds, under EC number 1.3.x.x, more preferably an oxidase acting on CH-CH bonds using oxygen as an electron acceptor, under EC number 1, 3.3.x. Even more preferably, the oxidase is an acyl-CoA oxidase, suitably under EC number 1.3.3.6. More preferably the acyl-CoA oxidase is selected from any of the following enzymes: ACX4 from Arabidopsis thaliana, short chain acyl-CoA oxidase from Arthrobacter nicotianae, peroxisomal acyl-CoA oxidase from Vigna radiata, acyl-CoA oxidase from Candida sp. and acyl-CoA oxidase 4 from Candida tropicalis. Most preferably the acyl-CoA oxidase is ACX4 from Arabidopsis thaliana.

[0022] Alternatively, isobutyryl-CoA can be converted to methacrylyl-CoA by the action of an oxidoreductase, suitably under the EC group number 1.X.X.X. Preferably, the oxidoreductase is an oxidoreductase acting on the CH-CH group of electron donors, suitably under the EC 1.3.X.X group. More preferably, the oxidoreductase acting on the CH-CH group of donors is a FAD-dependent oxidoreductase, even more preferably the oxidoreductase is a CoA dehydrogenase under the group EC 1.3.8.X. More preferably still, the oxidoreductase is a short-chain acyl-CoA dehydrogenase, suitably under group EC 1.3.8.1, an isovaleryl-CoA dehydrogenase, suitably under group EC 1.3.8.4, an acyl-CoA dehydrogenase of 2-methyl branched chain, suitably under the group EC 1.3.8.5 or an acyl-CoA dehydrogenase, suitably under the group EC 1.3.8.-, such as an isobutyryl-CoA dehydrogenase. Most preferably the oxidoreductase is selected from any of the following enzymes: short/branched chain acyl-CoA dehydrogenase from Pseudomonas putida, isobutyryl-CoA dehydrogenase from Homo sapiens, isovaleryl-CoA dehydrogenase from Arabidopsis thaliana.

[0023] CoA dehydrogenase enzymes would generally require an electron transport system associated with the coupled oxidation of the substrate with reduction of ubiquinone, which is then regenerated. Such an electron transport system consists of an electron transfer flavoprotein (ETF), and an electron transfer flavoprotein ubiquinone oxidoreductase (ETFQO). The ETF must be compatible with both the acyl-CoA dehydrogenase enzyme and the ETFQO. Accordingly, in embodiments where an acyl-CoA dehydrogenase is used, one of the following regeneration systems is preferably utilized: In one embodiment, isobutyryl-CoA is converted to methacrylyl-CoA using a host microorganism comprising an endogenous CoA dehydrogenase, with activity on isobutyryl-CoA, and its associated electron transport system, such as is the case, for example, in Pseudomonas putida.

[0024] In a second modality, isobutyryl-CoA is converted to methacrylyl-CoA in a host organism by the action of a heterologous CoA dehydrogenase enzyme accompanied by the proteins of the electron transport system of the same organism as the heterologous CoA dehydrogenase. For example, CoA dehydrogenase and components of the electron transport system from Homo sapiens, Pseudomonas putida, Paracoccus denitrificans, or Arabidopsis thaliana are all expressed in Escherichia coli (or another host organism).

[0025] In a third embodiment, isobutyryl-CoA is converted to methacrylyl-CoA in a host organism by the action of a heterologous CoA dehydrogenase enzyme, accompanied by components of the electron transport system also from different microorganisms, whereby these components are compatible with each other and with the CoA dehydrogenase. For example, the CoA dehydrogenase of Homo sapiens is compatible with the electron transfer flavoprotein of Sus scrofa which in turn is compatible with the electron transfer flavoprotein ubiquinone oxidoreductase of Rhodobacter sphaeroides. Alternatively, since the A. thaliana ETF-ubiquinone oxidoreductase has good sequence homology to the R. sphaeroides ETF-ubiquinone oxidoreductase, isovaleryl-CoA dehydrogenase and the A. thaliana ETF would form a functional system with the R. sphaeroides ETF-ubiquinone oxidoreductase for the oxidation of isobutyryl-CoA. Finally, the ETF and ETF-ubiquinone oxidoreductase from Paracoccus denitrificans are predicted to be compatible with an isobutyryl-CoA dehydrogenase from another source, such as that from H. sapiens or homologs from different organisms, due to the similarity of the P. denitrificans ETF to human and porcine ETFs.

[0029] Preferably methacrylyl-CoA is converted to methacrylic acid by the action of a thioester hydrolase (also known as a thioesterase), suitably under group EC 3.1.2.X. Even more preferably the enzyme is an acyl CoA thioesterase, suitably under the group EC 3.1.2.20, a 3-hydroxyisobutyryl-CoA hydrolase, suitably under the group EC 3.1.2.4, an ADP-dependent acyl-CoA thioesterase, suitably under the group EC 3.1.2.18, a 4-hydroxybenzoyl-CoA thioesterase, suitably under the group EC 3.1.2.23, or a thioesterase under the group EC 3.1.2.-, such as, for example, a salicyloyl-CoA thioesterase. More preferably the thioesterase is selected from any of the following enzymes: 4HBT from Arthrobacter sp. strain SU, 4HBT from Arthrobacter globiformis, 4HBT from Pseudomonas sp. strain CBS-3, EntH from Escherichia coli, YciA from E. coli, YciA from Haemophilus influenzae, TesA from Escherichia coli or TesB from Escherichia coli, FcoT from Mycobacterium tuberculosis. Even more preferably, the thioesterase is an acyl-CoA thioesterase. Even more preferably, the thioesterase is a 4-hydroxybenzoyl-CoA thioesterase, suitably under group EC 3.1.2.23. Most preferably the acyl-CoA thioesterase is 4HBT from Arthrobacter sp. SU strain.

[0026] Thus, in one embodiment, isobutyryl-CoA can be converted to methacrylyl-CoA by the action of an oxidase and methacrylyl-CoA can be converted to methacrylic acid by the action of a 4-hydroxybenzoyl-CoA thioesterase, suitably under the group EC 3.1.2.23, more preferably the acyl-CoA thioesterase 4HBT from Arthrobacter sp. SU strain.

[0031] In one embodiment, isobutyryl-CoA can be converted to methacrylyl-CoA by the action of an acyl-CoA oxidase, suitably under EC group number 1.3.3.6, more preferably ACX4 from Arabidopsis thaliana, and methacrylyl-CoA. CoA can be converted to methacrylic acid by the action of a 4-hydroxybenzoyl-CoA thioesterase, suitably under group EC 3.1.2.23, more preferably the acyl-CoA thioesterase 4HBT from Arthrobacter sp. SU strain.

[0027] Alternatively, methacrylyl-CoA can be converted to methacrylic acid by the action of one of the following enzymatic pathways: In one embodiment, methacrylyl-CoA is converted to methacrylic acid by the action of a transferase, suitably under the group number EC 2.X.X.X. Preferably the transferase is a transferase that transfers sulfur-containing groups, suitably under group number EC 2.8.X.X. More preferably, the transferase is a CoA transferase, suitably under EC group number 2.8.3.X. More preferably still, the transferase is an acetate-dependent acyl-CoA transferase or a butyric acetoacetate-dependent CoA transferase, suitably under EC group numbers 2.8.3.8 and 2.8.3.9 respectively. Most preferably the transferase is selected from any of the following enzymes: butyryl-CoA:acetoacetate CoA transferase from Clostridium sp. SB4, butyryl-CoA:acetoacetate CoA transferase from Clostridium sticklandii, butyrate:acetoacetate CoA -transferase from Clostridium acetobutilicum ATCC824, acetate coenzyme A transferase ydiF from Escherichia coli.

[0028] As used herein, the terms ligase, synthetase, and synthase are used interchangeably as is understood in the art.

[0029] In a second embodiment, methacrylyl-CoA is converted to methacrylic acid by the action of a synthetase acting in the reverse direction, suitably under the group number EC 6.X.X.X. Preferably the synthetase is a carbon-sulfur bond forming synthetase, suitably under EC group number 6.2.X.X. More preferably the synthetase is an acid thiol ligase, suitably under group number EC 6.2.1.X. Most preferably, the synthetase is a reversible ADP- or GDP-forming acyl-CoA ligase, such as a GDP-forming succinate-CoA synthetase, suitably under group EC 6.2.1.4, an ADP-forming succinate-CoA synthetase, under group EC 6.2 .1.5, a glutarate-CoA synthetase forming ADP, under EC 6.2.1.6, a malate-CoA synthetase forming ADP, under EC 6.2.1.9, a carboxylic acid-CoA synthetase forming GDP, under EC 6.2.1.10, an acetate-CoA synthetase forming ADP, under EC 6.2.1.13 or a citrate-CoA synthetase forming ADP, under EC 6.2.1.18.

[0030] In a third embodiment, methacrylyl-CoA is converted to methacrylic acid by the combined action of a phosphotransacylase related to a phosphotransacetylase or a phosphotransbutyrylase under EC group number 2.X.X.X, more preferably EC group number 2.3.X.X, even more preferably EC 2.3.1.X, most preferably under group number EC 2.3.1.8 or 2,3,1,19, and a short chain fatty acid kinase, under group number EC 2.X.X.X, preferably EC 2.7.X.X, more preferably EC 2.7.2.X, most preferably an acetate kinase under EC 2.7.2.1, a formate kinase under EC 2.7.2.6, a butyrate kinase under EC 2.7.2.7, a fatty acid kinase branched chain under EC 2.7.2.14 or a propionate kinase under EC 2.7.2.15. Preferably the phosphotransacylase is a methacrylyl-CoA phosphotransacylase. Preferably the short chain fatty acid kinase is a reversible methacrylic acid kinase. Most preferably the phosphotransacylase is selected from any of the following enzymes: Phosphotransbutyrylase from Clostridium acetobutilicum ATCC824. Most preferably the short chain fatty acid kinase is selected from any of the following enzymes: branched chain fatty acid kinase from Spirochete MA-2, butyrate kinase from Thermotoga maritima, butyrate kinase from Clostridium butyricum.

[0031] In the context of the present invention, the term 'derivatives thereof' means any chemical product directly related to or comprising methacrylyl CoA or methacrylic acid, such as its esters, its acyl halides, its anhydrides, its amides, its nitriles, its lactones, its salts, its complexes, its isomers, its oligomers or polymers and also any substituted version of these, more preferably, the same means esters or their salts.

[0032] Preferably its methacrylic acid derivatives are methacrylic acid esters. Preferably the methacrylic acid esters are alkyl methacrylates, more preferably lower alkyl methacrylates (C1-C20), even more preferably C1C12 alkyl methacrylates, especially C1-C4 alkyl esters, such as methyl, ethyl or butyl methacrylates. , or C4-C12 alkyl esters. Most preferably, the methacrylic acid esters are butyl methacrylates, for example n-butyl methacrylate.

[0033] Methacrylic acid esters can be formed biologically from methacrylyl-CoA, preferably by the action of a transferase enzyme under EC group number EC2.X.X.X, more preferably an acyl transferase under EC group number 2.3.X.X, even more preferably an alcohol acyltransferase under EC group number EC2.3.1.84.

[0034] Preferably, when methacrylic esters are biologically formed from methacrylyl-CoA, methacrylyl-CoA is biologically formed from isobutyryl-CoA by the action of an oxidase.

[0041] Thus, according to a third aspect of the present invention, a process is provided for producing a methacrylic acid ester comprising the following steps: (a) biologically converting isobutyryl-CoA into methacrylyl-CoA by the action of an oxidase; and (b) converting methacrylyl-CoA into a methacrylic acid ester by the action of an alcohol acyltransferase.

[0035] Preferably the oxidase of the third aspect is an oxidase acting on CH-CH bonds, under number EC 1.3.X.x, more preferably an oxidase acting on CH-CH bonds using oxygen as an electron acceptor, under number EC 1.3.3.x. Even more preferably, the oxidase is an acyl-CoA oxidase, suitably under EC number 1.3.3.6. More preferably the acyl-CoA oxidase is selected from any of the following enzymes: ACX4 from Arabidopsis thaliana, short chain acyl-CoA oxidase from Arthrobacter nicotianae, peroxisomal acyl-CoA oxidase from Vigna radiata, acyl-CoA oxidase from Candida sp. and acyl-CoA oxidase 4 from Candida tropicalis. Most preferably the acyl-CoA oxidase is ACX4 from Arabidopsis thaliana.

[0036] Preferably, the methacrylic acid esters of the third aspect are alkyl methacrylates, more preferably lower alkyl methacrylates (C1-C20), even more preferably, C1-C12 alkyl methacrylates, especially C1-C4 alkyl esters, such such as methyl, ethyl or butyl methacrylates, or C4-C12 alkyl esters. Most preferably, the methacrylic acid esters are butyl methacrylates, for example n-butyl methacrylate.

[0037] Suitably the alcohol acyltransferase acts in the presence of an alcohol or phenol, preferably a linear or branched unsubstituted C1-20 alcohol, aralkyl alcohol or phenol, and particularly preferably a C1-8 or C1-4 alkyl alcohol such as methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol, n-pentyl alcohol, isopentyl alcohol, tert-pentyl alcohol, n-hexyl alcohol, isohexyl alcohol, 2-hexyl alcohol, alcohol dimethylbutyl, ethylbutyl alcohol, heptyl alcohol, octyl alcohol, 2-ethylhexyl alcohol; a benzyl alcohol or a phenol. Preferably, the alcohol acyltransferase acts in the presence of an alcohol, more preferably a C1-C12 alcohol, more preferably a C1 to C4 or C4-C12 alcohol, even more preferably in the presence of butanol, such as n-butanol, isobutanol, sec. butanol or tert-butanol. Most preferably, the alcohol acyltransferase holds in the presence of n-butanol.

[0038] By the term alcohol here is meant a species having a hydroxyl group (-OH group) and which is capable of forming an ester group with methacrylate. Preferably, the alcohol may be a C1 to C20 alkanol, more preferably a C1 to C12 alkanol, even more preferably a C1 to C4 alkanol or a C4 to C12 alkanol, most preferably a C4 alkanol.

[0046] Preferably the alcohol acyltransferase is derived from a plant origin, more preferably the plant belongs to any order selected from the group consisting of Zingiberales, Rosales, Ericales, Cucurbitales, Brassicales and Laurales; even more preferably the plant belongs to any family selected from the group consisting of Musaceae, Rosaceae, Ericaceae, Actinidiaceae, Cucurbitaceae, Caricaceae and Lauraceae; even more preferably the plant belongs to any genus selected from the group consisting of Musa, Fragaria, Malus, Prunus, Pyrus, Vaccinium, Actinidia, Cucumis, Carica and Persea; even more preferably the plant is any one selected from the group consisting of banana, strawberry, apple, Prunus mume, Pyrus communis, blueberry, kiwi, melon, papaya and avocado. Most preferably, the alcohol acyltransferase is derived from a fruit origin such as apple, melon or tomato origin, suitably apple origin.

[0039] Biological tissue or its processed product can be used, for example, fruit, leaves, petals, stem, seed, fruit peel, sarcocarp, etc. in which alcohol acyltransferase is present. Alternatively, liquid crude enzyme extracted from these biological tissues, purified enzyme, or the like can be used. Alternatively, the gene for alcohol acyltransferase can be isolated, and introduced into a host microorganism for expression therein.

[0040] The use of an alcohol acyltransferase to convert methacrylyl CoA to methacrylic acid esters is fully described in WO2014/038214, the disclosure of which is incorporated herein by reference, in particular the alcohol acyltransferase genes and sequences thereof, and the vector plasmids comprising said sequences.

Other Process Steps

[0041] Optionally, the process of the first or second aspects of the present invention may further comprise step (c) of converting any methacrylic acid formed in step (b) into an ester of methacrylic acid.

[0042] Preferably the methacrylic acid esters are alkyl methacrylates, more preferably lower alkyl methacrylates (C1-C20), more preferably C1-C12 alkyl methacrylates, even more preferably C1-C4 or C4-C12 alkyl methacrylates. Most preferably, the methacrylic acid esters are butyl methacrylate.

[0051] The methacrylic acid esters formed in step (c) can be formed biologically or chemically, preferably they are formed biologically.

[0043] Optionally, step (c) can be chemically conducted by an esterification reaction with a suitable alcohol. The reaction conditions under which esterification is carried out can be varied considerably. The reaction proceeds very slowly at room temperature, but quite quickly at elevated temperatures. Typically one of the reactants is used in stoichiometric excess in order to drive the reaction. The other reactant is then called the limiting reactant. About 99% of the limiting reactant, for example acids, alcohols or polyols, can be converted to an ester within a few hours. Limiting reagents are typically reagents that are not present in stoichiometric excess, for example, the limiting reagents used to make polyol esters are polyols.

[0044] Because the esterification of an alcohol and an organic acid is a reversible reaction, the esterification reaction normally does not go to completion. However, conversions above 99% can be obtained by removing at least one of the esterification products, typically water. If one of the products is boiling at a lower temperature than the other, and than the reactants, this removal is typically achieved by distillation. A variety of distillation techniques are known in the art to remove produced water from the reaction zone. A method of removing water includes carrying out the reaction in a liquid medium that can form an azeotrope having a boiling point that is lower than that of one or the other or each component of the reaction. If the reactants and the resulting ester have boiling points above 100°C at atmospheric pressure, then the reaction temperature can simply be adjusted to remove water and a liquid medium capable of forming an azeotrope with water is required. Additionally, a entrainer can be used to aid in the distillation of water from the reaction mixture. Inert materials such as cyclohexane, hexane, benzene, toluene, or xylene can be used as a carrier in the production of esters. Furthermore, the reactant having the lowest boiling point can also be used as the entrainer. In the latter case, the reagent used as the entrainer is typically loaded into the reaction mixture in excess above the stoichiometric amounts required for the reaction. Esterification processes, including those utilizing water removal, may be conducted in a batch or continuous mode of operation. Various esterification processes are disclosed in Volume 9 of the Kirk-Othmer Encyclopaedia of Chemical Technology, Fourth Edition (1994), pp. 762-768, the entirety of which is hereby incorporated by reference.

[0045] A conventional batch esterification procedure includes loading all reactants into the reactor at the beginning of the reaction cycle. In catalytic esterification processes, the catalyst is typically added to the reaction mixture after the batch reaches a target temperature. The reaction mixture can then be heated further. The temperature of the reaction mixture is raised until the boiling point of the reaction mixture is reached, at which point the entrainer, if used, and the by-product water are extracted by boiling the reaction mixture. Typically, the free top vapors are condensed, the water separated from the entrainer, and the entrainer recycled to the reaction vessel. The reaction temperature, and therefore the reaction rate, is limited by the boiling point of the reaction mixture. When the reactant with the lowest boiling point is also used as the entrainer, its concentration is gradually reduced as the reaction proceeds. Also the concentrations of the reactants decrease during the reaction, which negatively affects the reaction rate. Thus the reaction temperature, and therefore the rate constant for the reaction, increases as the reaction proceeds, regardless of whether an entrainer is used or not, particularly if heat input is continued during the course of the reaction.

[0046] Preferably step (c) is biologically driven by the action of an esterase or hydrolase enzyme acting towards an ester bond under group number EC 3.1.x.x., more preferably, the enzymes are under EC 3.1.1. X and are enzymes of the hydrolase class involved in the catalysis of cleavage and formation of ester bonds. A recent review of microbial esterases is as follows: Int. J. Curr. Microbiol. App Sci (2013) 2(7): 135-146.

[0047] Preferably the process further comprises one or more additional step(s) of producing isobutyryl-CoA, more preferably producing isobutyryl-CoA from 2-ketoisovaleric acid, and/or from isobutyric acid.

[0048] In one embodiment, the process further comprises one or more additional step(s) of producing isobutyryl-CoA from 2-ketoisovaleric acid, the one or more additional step(s) being any one of the following: Preferably the process further comprises a step of converting 2-ketoisovaleric acid into isobutyryl-CoA. More preferably 2-ketoisovaleric acid is converted to isobutyryl-CoA by a branched-chain keto acid dehydrogenase enzyme complex, consisting of the alpha subunit component, the lipoamide acyltransferase component and the lipoamide dehydrogenase component. Most preferably, the dehydrogenase is selected from any of the following enzymes: branched-chain keto acid dehydrogenase (BCKD) from P. putida, BCKD from Bacillus subtilis, BCKD from P. aeuruginosa, BCKD from A. thaliana, BCKD from Streptomyces coelicolor and BCKD from Thermus thermophilus.

[0049] Alternatively, the conversion of 2-ketoisovaleric acid to isobutyryl-CoA can be catalyzed by an oxidoreductase enzyme, suitably under the EC group 1.X.X.X, preferably an oxidoreductase acting on the aldehyde or oxo donor group, suitably under the EC 1.2.X.X group, more preferably an oxidoreductase enzyme acting on the aldehyde or oxo donor group, using an iron-sulfur protein as the electron acceptor, suitably under the EC 1.2.7. preferably a 2-ketoisovalerate ferredoxin reductase (also known as ketovaline ferredoxin oxidoreductases), suitably under EC group number 1.2.7.7, which is a tetramer consisting of alpha, beta, gamma and delta subunits. Examples of such enzymes are 2-ketoisovalerate ferredoxin reductase from Pyrococcus furiosis; 2- ferredoxin reductase ketoisovalerate from Pyrococcus sp.; 2-ketoisovalerate ferredoxin reductase from Thermococcus sp; 2-ketoisovalerate ferredoxin reductase from Thermococcus littoralis; 2-ketoisovalerate ferredoxin reductase from Thermococcus profundus and 2-ketoisovalerate ferredoxin reductase from Methanobacteria thermoautotrophicum.

[0050] In a second embodiment, the process further comprises one or more additional step(s) of producing isobutyryl-CoA from isobutyric acid, the one or more additional step(s) being any one of the following: Preferably the process further comprises a step of converting isobutyric acid into isobutyryl-CoA.

[0051] Optionally, isobutyric acid is converted to isobutyryl-CoA by the action of a ligase enzyme, suitably under group number EC 6.X.X.X, preferably a ligase forming carbon-sulfur bond under group EC 6.2.X.X, more preferably an acid-thiol forming ligase under group EC 6.2.1.X, more preferably a GDP forming, ADP forming or AMP forming ligase, such as an AMP forming acetate-CoA ligase, suitably under group EC 6.2.1.1, a butyrate-CoA ligase, suitably under group EC 6.2.1.2, a carboxylic acid-CoA ligase, suitably under group EC 6.2.1.10, an ADP-forming acetate-CoA ligase, suitably under group EC 6.2.1.13, a propionate -CoA ligase, suitably under group EC 6.2.1.17 or an acid-thiol ligase in group EC 6.2.1.-. Most preferably the ligase is selected from any of the following enzymes: AcsA from Pseudomonas chlororaphis, butyryl-CoA synthetase from Paecilomyces varioti, butyryl-CoA synthetase from bovine cardiac mitochondria.

[0052] In a third embodiment, the process further comprises one or more additional step(s) of producing isobutyryl-CoA from isobutyrate, the one or more additional step(s) being any of the following: Preferably the process further comprises the step of converting isobutyrate to isobutyryl-phosphate, and the step of converting isobutyryl-phosphate to isobutyryl-CoA.

[0053] Preferably isobutyrate is converted to isobutyryl phosphate by a kinase enzyme, suitably under group number EC 2.X.X.X, preferably under EC 2.7.X.X, more preferably under group number EC 2.7.2.X, the more preferably an acetate kinase, suitably under the group EC 2.7.2.1, a formate kinase under EC 2.7.2.6, a butyrate kinase under EC 2.7.2.7, a branched-chain fatty acid kinase under EC 2.7.2.14 or a propionate kinase under EC 2.7.2.15. Most preferably the kinase is selected from any of the following enzymes: branched-chain fatty acid kinase from Spirochete MA-2, butyrate kinase from C. butyricum.

[0054] Preferably isobutyryl-phosphate is converted to isobutyryl-CoA by the action of a transferase enzyme, under group number EC 2.X.X.X, more preferably by the action of an acyltransferase under group number EC 2.3.X.X, even more preferably by the action of acyltransferase transfer groups other than amino-acyl groups under group number EC 2.3.1.X. Even more preferably a phosphate acetyltransferase or a phosphate butyryltransferase, under EC group numbers 2.3.1.8 and 2.3.1.19, respectively. More preferably the transferase is phosphate butyryltransferase from Clostridium acetobutilicum ATCC824 or phosphate acetyltransferase from Bacillus subtilis, Corynebacterium glutamicum ATCC13032, Thermotoga maritima and Clostridium kluyveri. Other sources of these enzymes include other anaerobic bacteria, especially the Clostridium species such as Clostridium pasteurianum or Clostridium beijerinckii.

[0055] Most preferably the process further comprises a step of producing isobutyryl-CoA from isobutyric acid by the action of the synthetase enzyme, preferably an isobutyryl-CoA synthetase, most preferably isobutyryl-CoA synthetase (AcsA) from P. chloraphis B23.

[0056] Optionally, any of the additional process steps as described above in relation to the first and/or second and/or third embodiments can be combined.

Microorganisms

[0057] The enzymes of the above process may be contained within one or more microorganisms, or present free from a microorganism, for example as a cell-free extract or purified enzyme in a reaction vessel, or maintained in a column.

[0058] Preferably the biological conversions of the process are conducted in one or more host microorganisms. More preferably the one or more enzymes for conducting biological conversions are contained within one or more microorganisms.

[0059] Preferably the one or more microorganisms express one or more enzymes necessary to catalyze the relevant step(s). More preferably, the relevant step(s) and any other enzymatic steps are conducted in vivo, within the one or more microorganisms.

[0072] According to a fourth aspect of the present invention, a microorganism is provided for use in the production of methacrylic acid and/or its derivatives according to the process of any of the first, second or third aspects.

[0060] The one or more microorganisms may express one or more enzymes naturally, or may be genetically engineered to express one or more enzymes, or may express a combination of both wild-type and genetically engineered enzymes. Such a genetically engineered organism can be described as a recombinant organism.

[0061] The one or more microorganisms can express one or more enzymes endogenously or heterologously, or a combination of endogenous and heterologous enzymes.

[0062] In the context of the present invention, the term ‘recombinant organism’ means a genetically modified or engineered organism comprising genetic material that has been artificially constructed and inserted into the organism. The genetic material may comprise endogenous or heterologous nucleic acids that may or may not have been further genetically modified.

[0063] In the context of the present invention, the term 'endogenous' means deriving from the same species of organism.

[0064] In the context of the present invention, the term 'heterologous' means deriving from a different species of organism.

[0065] In the context of the present invention, the term 'adapted', when used with respect to a microorganism, means a genetically modified or engineered organism, as defined above, or a mutant strain of an organism that, for example, has been selected with based on the one that expresses one or more enzymes naturally.

[0066] Microorganisms for use in any of the above processes, genetically engineered or modified as described above, may be selected from naturally occurring wild-type or recombinant non-occurring microorganism(s). ) naturally, for example, bacteria, archaea, yeast, fungi, algae or any of a variety of other microorganism(s) applicable to fermentation processes.

[0067] Therefore, according to a fifth aspect of the present invention, a recombinant microorganism is provided for use in a process of producing methacrylic acid, the microorganism being adapted to carry out the following steps: (a) Biologically converting isobutyryl-CoA into methacrylyl - CoA through the expression of an oxidase; and (b) Biologically convert methacrylyl-CoA to methacrylic acid; wherein the recombinant microorganism is Escherichia coli.

[0068] According to a sixth aspect of the present invention there is provided a microorganism, for use in a process of producing methacrylic acid, the microorganism being modified by one or more heterologous nucleic acids to conduct the following steps: (a) biologically convert isobutyryl-CoA to methacrylyl-CoA by expression of an oxidase; and (b) biologically convert methacrylyl-CoA to methacrylic acid.

[0082] According to a seventh aspect of the present invention, a microorganism adapted to carry out the following steps is provided: (a) Biologically convert isobutyryl-CoA into methacrylyl-CoA by expressing an oxidase; and (b) Biologically convert methacrylyl-CoA into methacrylic acid and/or its derivatives.

[0069] According to an eighth aspect of the present invention, a microorganism adapted to carry out the following steps is provided: (a) Biologically converting isobutyryl-CoA into methacrylyl-CoA; and (b) Biologically convert methacrylyl-CoA to methacrylic acid by expressing a thioesterase, suitably a 4-hydroxybenzoyl-CoA thioesterase (4HBT), a transferase, a synthetase, and/or a phosphotransacylase and a short-chain fatty acid kinase.

[0070] According to another aspect of the present invention there is provided a microorganism adapted to convert methacrylyl-CoA into methacrylic acid by expressing a thioesterase, suitably a 4-hydroxybenzoyl-CoA thioesterase (4HBT), a transferase, a synthetase, and /or a phosphotransacylase and a short-chain fatty acid kinase.

[0071] According to yet another aspect of the present invention, there is provided a microorganism modified by one or more recombinant nucleic acids encoding one or more enzymes that convert methacrylyl-CoA into methacrylic acid.

[0072] According to yet another aspect of the present invention, there is provided a microorganism modified by one or more recombinant nucleic acids encoding one or more enzymes that convert methacrylyl-CoA into methacrylic acid esters.

[0073] According to yet another aspect of the present invention, a process for producing methacrylic acid using one or more enzymes is provided according to additional aspects.

[0074] According to yet another aspect of the present invention, a process for producing methacrylic acid esters using one or more enzymes is provided in accordance with additional aspects.

[0075] Other preferred process traits of the first, second or third aspects may be combined in any combination with the microorganism of the fourth, fifth, sixth, seventh, eighth or additional aspects defined above.

[0076] In one embodiment the microorganism(s) express(es) at least the following enzymes: (a) (i) an acyl-CoA oxidase; and/or (11) a CoA dehydrogenase; and optionally one or more of (b) (i) an acyl-CoA thioesterase suitably a 4-hydroxybenzoyl-CoA thioesterase (4HBT); and/or (ii) an acyl-CoA transferase; and/or (iii) acyl-CoA synthetase; and/or (iv) a phosphotransacylase and a short chain fatty acid kinase; and optionally (v) an alcohol acyltransferase.

[0077] In one embodiment, the microorganism(s) express(es) at least the following enzymes: (a) (i) an acyl-CoA oxidase; and optionally one or more of (b) (i) an acyl-CoA thioesterase; and/or (ii) an acyl-CoA transferase; and/or (iii) acyl-CoA synthetase; and/or (iv) a phosphotransacylase and a short chain fatty acid kinase; and optionally (v) an alcohol acyltransferase.

[0078] In an embodiment of the fourth, fifth or eighth aspect, the microorganism(s) express(es) at least the following enzymes: (a) (i) an acyl-CoA thioesterase, suitably a 4-hydroxybenzoyl-CoA thioesterase (4HBT); and/or (ii) an acyl-CoA transferase; and/or (iii) acyl-CoA synthetase; and/or (iv) a phosphotransacylase and a short-chain fatty acid kinase; and optionally one or more of: (b) (i) an acyl-CoA oxidase; and/or (11) an acyl-CoA dehydrogenase; and optionally further (c) (i) an alcohol acyltransferase.

[0079] Preferably, when present, the CoA dehydrogenase is accompanied by a complementary electron transport system.

[0080] In a preferred embodiment, the microorganism(s) express(es) at least one of the following enzymes: (a) an acyl-CoA oxidase, such as ACX4; and (b) an acyl-CoA thioesterase, such as 4HBT.

[0081] In a more preferred embodiment, the microorganism(s) express(es) at least one of the following enzymes: (a) ACX4, suitably from A. thaliana; and (b) 4HBT, suitably from Arthrobacter sp.

[0082] In some embodiments, the microorganism is adapted to conduct the following steps: (a) biologically convert isobutyryl-CoA into methacrylyl-CoA by expressing an acyl-CoA oxidase; and (b) biologically converting methacrylyl-CoA into a C1 to C20 methacrylic acid ester, suitably a C1 to C12 methacrylic acid ester, such as a C1 to C4 methacrylic acid ester or a C4 to C12 by expression of an alcohol acyltransferase .

[0083] Preferably, the methacrylic acid ester is a C1 to C20 methacrylic acid ester, more preferably a methacrylic acid ester, even more preferably a C1 to C4 or C4 to C12 methacrylic acid ester, most preferably butyl methacrylate .

[0084] In these embodiments, the microorganism can be Escherichia coli and/or the acyl-CoA oxidase is ACX4 from Arabidopsis thaliana and/or the alcohol acyltransferase is derived from plant origin as presented here, for example from fruit such as apple and/or the microorganism is a recombinant microorganism. Preferably the microorganism can be Escherichia coli, the acyl-CoA oxidase can be ACX4 from Arabidopsis thaliana, the alcohol acyltransferase can be derived from apple, melon or tomato in origin and the microorganism can be a recombinant organism.

[0085] Preferably the microorganism(s) express(es) both of said enzymes (a) and (b) of said preferred or some embodiments.

[0086] Preferably the microorganism(s) further express one or more of the following enzymes: a branched-chain keto acid dehydrogenase enzyme or an acyl-CoA synthetase/synthase/ligase forming ADP, forming GDP, or forming AMP; or a short-chain fatty acid kinase and a phosphotransacylase.

[0087] More preferably the microorganism(s) further expresses one or more of the following enzymes: 2-ketoisovalerate dehydrogenase, an isobutyrate-CoA ligase, an acyl-CoA synthetase/synthase/ligase forming ADP, forming GDP or one forming AMP, or one short-chain fatty acid kinase and one phosphotransacylase.

[0088] Most preferably, the microorganism(s) further expresses an isobutyryl-CoA synthetase, in particular AcsA from Pseudomonas chloraphis, in particular B23 from Pseudomonas chloraphis

[0089] With respect to the fourth, sixth, seventh, eighth and other aspects, preferably the host microorganism(s) are bacteria, examples of suitable bacteria include: enterobacteria belonging to the proteobacteria of the genera Escherichia, Enterobacter, Pantoea, Klebsiella, Serratia, Erwinia, Salmonella, Morganella, or the like, so-called coryneform bacteria belonging to the genera Brevibacterium, Corynebacterium or Microbacterium and bacteria belonging to the genera Alicyclobacillus, Bacillus, Hydrogenobacter, Methanococcus, Acetobacter, Acinetobacter, Agrobacterium, Axorhizobium, Azotobacter, Anaplasma, Bacteroides, Bartonella, Bordetella, Borrelia, Brucella, Burkholderia, Calymmatobacterium, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Coxiella, Ehrlichia, Enterococcus, Francisella, Fusobacterium, Gardnerella, Haemophilus, Helicobacter, Kelbsiella, Methanobacterium, Micrococcus, Moraxella, Mycobacterium, Mycoplasma, Neisseria, Pasteurella, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Rhizobium, Rickettsia, Rochalimaea, Rothia, Shigella, coccus, Stenotrophomonas, Streptococcus, Treponema, Vibrio, Wolbachia, Yersinia, or similar.

[0090] Exemplary bacteria include selected species of Escherichia coli, Klebsiella oxytoca, Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Mannheimia succiniciproducens, Rhizobium etli, Bacillus subtilis, Corynebacterium glutamicum, Gluconobacter oxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillus plantarum , Streptomyces coelicolor, Clostridium acetobutylicum, Pseudomonas fluorescens, Hydrogenobacter thermophilus, Methanococcus jannaschii and Pseudomonas putida.

[0091] Regarding the fourth, sixth, seventh, eighth and other aspects, preferably the bacteria is Escherichia coli.

[0092] Exemplary yeasts or fungi include those belonging to the genera Saccharomyces, Schizosaccharomyces, Candida, Kluyveromyces, Aspergillus, Pichia, Crytpococcus, or similar. Exemplary yeast or fungal species include those selected from Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces marxianus, Aspergillus terreus, Aspergillus niger, Pichia pastoris, or the like.

[0093] The one or more microorganisms of any of the fourth, sixth, seventh, eighth or other aspects may be genetically modified to enhance or reduce the activity of the above natural or genetically engineered enzymes.

[0094] Preferably the microorganism(s) are genetically engineered to enhance the production of methacrylic acid and/or its derivatives.

[0095] Enhancing the production of methacrylic acid and/or its derivatives may include making modifications to existing cellular metabolic processes, nucleic acids and/or proteins through the use of various genetic engineering techniques known in the art. Enhancing the production of methacrylic acid and/or its derivatives may also include modifying the microorganism(s) to express(es) one or more heterologous genes in the microorganism(s). These may include genes encoding enzymes of the desired pathway to methacrylic acid from carbon-based feed stocks such as those presented herein, or may include other auxiliary genes that act to promote the function and expression of enzymes in such pathways directly or indirectly. as discussed in detail below.

[0096] Consequently, the microorganism(s) can be modified to express the one or more genes for the production of methacrylic acid and/or its derivatives and preferably, the microorganism(s) ) are further modified to enhance the production of methacrylic acid and/or its derivatives.

[0097] The one or more genes that can be expressed within the microorganism(s) such that the same is/are modified to produce methacrylic acid and/or its derivatives include those encoding any of the following enzymes: ACX4 from Arabidopsis thaliana, short-chain acyl-CoA oxidase from Arthrobacter nicotianae, peroxisomal acyl-CoA oxidase from Vigna radiata, acyl-CoA oxidase 4 from Candida tropicalis, acyl-CoA oxidase from Candida sp. and related oxidases with broad substrate range, 4-hydroxybenzoyl-CoA thioesterase from Arthrobacter sp, YciA from Escherichia coli, YciA from Haemophilus influenzae, TesA from Escherichia coli, TesB from Escherichia coli, 4HBT from Arthrobacter globiformis, 4HBT from Pseudomonas sp. Strain CBS-3, EntH from Escherichia coli, butyryl-CoA acetoacetate CoA transferase from Clostridium sp. SB4, butyryl-CoA acetoacetate CoA transferase from Clostridium sticklandii, butyrate-acetoacetate CoA transferase from Clostridium acetobutilicum ATCC824, acetate coenzyme A transferase ydiF from Escherichia coli, phosphotransbutyrylase from Clostridium acetobutilicum ATCC824, branched-chain fatty acid kinase from Spirochete MA-2, butyrate kinase from Thermotoga maritima, butyrate kinase from Clostridium butyricum, branched-chain acyl-CoA dehydrogenase from Pseudomonas putida, isobutyryl-CoA dehydrogenase from Homo sapiens, isovaleryl-CoA dehydrogenase from Arabidopsis thaliana, electron transfer flavoprotein from H. sapiens, flavoprotein from electron transfer flavoprotein from Sus scrofa, electron transfer flavoprotein from Arabidopsis thaliana, electron transfer flavoprotein from Pseudomonas putida, electron transfer flavoprotein from Paracoccus denitrificans, electron transfer flavoprotein ubiquinone oxidoreductase from H. sapiens, ubiquinone oxidoreductase from electron transfer flavoprotein from Sus scrofa, ubiquinone oxidoreductase from electron transfer flavoprotein from Pseudomonas putida, ubiquinone oxidoreductase from electron transfer flavoprotein from Arabidopsis thaliana, ubiquinone oxidoreductase from electron transfer flavoprotein from Rhodobacter sphaeroides, ubiquinone oxidoreductase from electron transfer flavoprotein from electron transfer from Paracoccus denitrificans.

[0098] The one or more genes that can be expressed within the microorganism(s) such that the same(s) are modified to enhance the production of methacrylic acid and/or its derivatives include those encoding any of the following enzymes: AcsA from Pseudomonas chlororaphis; bkdA1, bkdA2, bkdB and lpdV from Bacillus subtilis; bkdA1, bkdA2, bkdB and lpdV from Pseudomonas putida; alsS of Bacillus subtilis, ilvD of Escherichia coli, ilvC of Escherichia coli, ilvB of Escherichia coli, ilvN of Escherichia coli, ilvI of Escherichia coli, ilvG of Escherichia coli, ilvM of Escherichia coli, ilvH of Escherichia coli and ilvH of Escherichia coli with mutations G14D and S17F, ilvC from Corynebacterium glutamicum R harboring the S34G, L48E and R49F mutations, ilvB and ilvN from Corynebacterium R and ilvN from Corynebacterium R harboring a G156E mutation as well as homologues from other organisms, exposing similar mutations as described above, to alleviate the inhibition of enzyme feedback and to alter cofactor dependence, where appropriate.

[0099] The present invention may further comprise modifications that reduce or eliminate the activity of an enzyme that catalyzes the synthesis of a compound other than methacrylic acid and/or its derivatives by competing for the same substrates and/or intermediates in the pathways of biosynthesis mentioned above. Examples of such enzymes include YciA, TesA, TesB of Escherichia coli, and those encoded by fadB, ilvA, panB, leuA, ygaZ, ygaH, aceF, aceE, lpdA, tpiA, pfkA, pfkB, mdh, poxB, ilvE, ldhA and lldD, in Escherichia coli, as well as homologues in other host strains as described here.

[00100] The present invention may further comprise modifications that decrease or eliminate the activity of an enzyme that metabolizes methacrylic acid and/or its derivatives or metabolizes an intermediate in the biosynthesis pathways mentioned above. Examples of such metabolism-related enzymes are enzymes from the native valine degradation pathway in E. coli, or other thioesterases that can consume thioester intermediates from the engineered pathway.

[00101] The present invention may also further comprise modifications that decrease or eliminate the activity of proteins involved in other cellular functions that remove intermediates in the above-mentioned biosynthetic pathways. Examples of such cellular functions may include storage mechanisms such as vacuolar storage (e.g. in yeast) or other intracellular bodies capable of storing metabolites (e.g. bacterial microcompartments), the bacterial periplasm, or transport mechanisms such as transmembrane pumps or porins capable of exporting metabolites.

[00102] Sources of nucleic acids for genes encoding proteins, in particular enzymes expressed in the microorganism(s) according to the present invention may include, for example, any species where the encoded gene product is capable of catalyze the aforementioned reaction. Such species include both prokaryotic and eukaryotic organisms including, but not limited to, bacteria, including archaea and eubacteria, and eukaryotes, including yeast, plant, insect, animal, and mammal, including human. Exemplary species for such sources include, for example, Escherichia coli, Homo sapiens, Propionibacterium fredenreichii, Methylobacterium extorquens, Shigella flexneri, Salmonella enterica, Yersinia frederiksenii, Propionibacterium acnes, Rattus norvegicus, Caenorhabditis elegans, Bacillus cereus, Acinetobacter calcoaceticus, Acinetobacter baylyi, Acinetobacter sp., Clostridium kluyveri, Pseudomonas sp., Thermus thermophilus, Pseudomonas aeruginosa, Pseudomonas putida, Oryctolagus cuniculus, Clostridium acetobutylicum, Leuconostoc mesenteroides, Eubacterium barkeri, Bacteroides capillosus, Anaerotruncus colihominis, Natranaerobius thermophilus, jejuni, Arabidopsis thaliana, Corynebacterium glutamicum, Sus scrofa, Bacillus subtilus, Pseudomonas fluorescens, Serratia marcescens, Streptomyces coelicolor, Methylibium petroleiphilum, Streptomyces cinnamonensis, Streptomyces avermitilis, Archaeoglobus fulgidus, Haloarcula marismortui, Pyrobaculum aerophilum, Saccharomyces cerevisiae, Clostridium cochlearium, tridium tetanomorphum, Clostridium tetani, Citrobacter amalonaticus, Ralstonia eutropha , Mus musculus, Bos taurus, Fusobacterium nucleatum, Morganella morganii, Clostridium pasteurianum, Rhodobacter sphaeroides, , Acidaminococcus fermentans, Helicobacter pylori , as well as other exemplary species disclosed herein or available as source organisms for the corresponding genes.

[00103] It should be mentioned that the one or more genes encoding enzymes that can be expressed in microorganism(s) of the invention also comprise genes encoding variants of said enzymes, for example, variant enzymes that include substitutions, deletions, insertions or additions of a or several amino acids in the polypeptide sequence, and wherein said polypeptide retains unmodified enzyme activity. Such variant enzymes also include variant enzymes that have a reduced enzymatic activity when compared to the unmodified enzyme and enzymes with modified allosteric control, for example ilvH from Escherichia coli with mutations G14D and S17F, ilvC from Corynebacterium glutamicum R harboring mutations S34G, L48E and R49F, ilvB and ilvN of Corynebacterium R and ilvN of Corynebacterium R harboring a G156E mutation.

[00104] Methods for constructing and testing the expression of a protein in a non-naturally occurring methacrylic acid-producing microorganism can be carried out, for example, by recombinant techniques and detection methods well known in the art. Such methods can be found described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1999).

[00105] Exogenous nucleic acid sequences involved in a pathway for the production of methacrylic acid and/or its derivatives or an intermediate in its formation can be stably or transiently introduced into a microorganism cell using techniques well known in the art including, but not limited to conjugation, electroporation, chemical transformation, transduction, transfection, and ultrasound transformation.

[00106] Examples of transformation methods may include treating cells of the recipient microorganism(s) with calcium chloride in order to increase DNA permeability, and preparing competent cells from cells that are in the growth phase, followed by transformation with DNA. Alternatively, a method of manufacturing DNA recipient cells within protoplasts or spheroplasts, which can readily absorb recombinant DNA, followed by introducing the recombinant DNA into the cells, which is known to be applicable to Bacillus subtilis, actinomycetes and yeast can also be used. Furthermore, the transformation of microorganisms can also be carried out by electroporation. Such methods are well known in the art.

[00107] For exogenous expression in E. coli or other prokaryotic microorganism cells, some nucleic acid sequences in the genes or cDNAs of eukaryotic nucleic acids may encode targeting signals such as an N-terminal mitochondrial or other targeting signal, which may be removed prior to transformation within prokaryotic microorganism cells, if desired. For example, removal of a mitochondrial leader sequence led to increased expression in E. coli (Hoffmeister et al., J.). Biol. Chem. 280: 4329-4338 (2005). For exogenous expression in yeast or other eukaryotic microorganism cells, genes may be expressed in the cytosol without the addition of a leader sequence, or may be targeted to mitochondria or other organelles, or targeted for secretion, by the addition of a suitable target sequence such as as a mitochondrial targeting or secretory signal suitable for the target organelle. Thus, it is understood that appropriate modifications to a nucleic acid sequence to remove or include a targeting sequence can be incorporated into an exogenous nucleic acid sequence to impart desirable properties. Furthermore, genes can be subjected to codon optimization with techniques well known in the art to obtain optimized expression of proteins within the microorganism(s).

[00108] An expression vector or vectors can be constructed to include one or more enzymes of the biosynthetic pathway encoding nucleic acids as exemplified here operably linked to functional expression control sequences in the microorganism(s). Applicable expression vectors for use in the microorganism(s) of the invention include, for example, plasmids, cosmids, phage vectors, viral vectors, episomes and artificial chromosomes, including vectors and selection sequences or markers operable for the stable integration within a host chromosome.

[00109] Additionally, expression vectors may include one or more selectable marker genes and appropriate expression control sequences. Selectable marker genes can also be included that, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media. Expression control sequences may include constitutive, inducible or repressible promoters, transcription enhancers, transcription terminators, translation signals and the like that are well known in the art. When two or more exogenous coding nucleic acid sequences are to be coexpressed, both nucleic acid sequences can be inserted, for example, into a single expression vector or into separate expression vectors. For single vector expression, the encoding nucleic acids can be operably linked to a common expression control sequence or linked to different expression control sequences, such as inducible promoters and constitutive promoters. In some embodiments, the vector may have two or more promoters for the co-expression of multiple genes or operons. In some embodiments, the genes/operons may be expressed in one or more different vectors with one or more corresponding promoters.

[00110] The vector used for transformation can be an autonomously replicable vector in a cell of the microorganism(s). Examples of bacteria-autonomously replicable vectors from Enterobacteriaceae bacteria such as E. coli may include plasmid vectors pUC19, pUC18, pBR322, RSF1010, pHSG299, pHSG298, pHSG399, pHSG398, pSTV28, pSTV29, pET20b(+), pET28b(+) ( pET vectors are available from Novagen), pLysS vectors, (pHSG and pSTV are available from Takara Bio Inc.), pMW119, pMW118, pMW219, pMW218 (pMW vectors are available from Nippon Gene Co., Ltd.) and so on. onwards, and its derivatives. Furthermore, vectors for coryneform bacteria may include pAM330 (Japanese Patent Open to the Public No. 58-67699), pHM1519 (Japanese Patent Open to the Public No. 58-77895), pSFK6 (Japanese Patent Open to the Public No. 2000-262288 ), pVK7 (USP2003-0175912A), pAJ655, pAJ611, pAJ1844 (Japanese Patent Open to the Public No. 58192900), pCG1 (Japanese Patent Open to the Public No. 57-134500), pCG2 (Japanese Patent Open to the Public No. 58- 35197), pCG4, pCG11 (Japanese Patent Open to the Public No. 57-183799), pHK4 (Japanese Patent Open to the Public No. 5-7491) and so on. Furthermore, vectors for yeast may include yeast plasmids, such as for example pD902 or pD905 for Pichia pastoris, or pD1201, pD1204, pD1205, pD1207, pD1211, pD1214, pD1215, pD1217, pD1218, pD1221, pD1224, , pD1227, pD1231 , pD1234, pD1235, pD1237 for Saccharomyces cerevisiae. Genes can also be integrated into the host chromosome using well-known methods (e.g. Datensko and Wanner (Datsenko, K. A. and Wanner, B. L. 2000, Proc. Natl. Acad. Sci. USA, 97: 6640-6645)).

[00111] Enhancing the activity of an enzyme may include enhancing the expression of a target gene by replacing an expression regulatory sequence of the target gene such as a promoter in genomic or plasmid DNA with a promoter that has an appropriate strength. For example, thr promoter, lac promoter, trp promoter, trc promoter, pL promoter, tac promoter, etc. are known as frequently used promoters. Examples of promoters with high expression activity in microorganisms such as bacteria may include promoters of the elongation factor Tu gene (EF-Tu), tuf, promoters of genes encoding the co-chaperonin GroES/EL, thioredoxin reductase, phosphoglycerate mutase , glyceraldehyde-3-phosphate dehydrogenase, and the like (WO2006/028063, EP1697525). Examples of strong promoters and methods for evaluating promoter strength are well known in the art.

[00112] Furthermore, it is also possible to replace several nucleotides in a promoter region of a gene, so that the promoter has an appropriate strength, as disclosed in WO 2000/18935. Replacement of the expression regulatory sequence can be carried out, for example, in the same way as gene replacement using a temperature-sensitive plasmid. Examples of vectors having a temperature-sensitive origin of replication that can be used for Escherichia coli or Pantoea ananatis can include, for example, the plasmid pMAN997 described in International Publication WO 1999/03988, its derivative, and so on. Furthermore, replacement of an expression regulatory sequence can also be accomplished by methods using linear DNA, such as a method called “Red-directed integration” using Red phage recombinase À. (Datsenko, K. A. and Wanner, B. L. 2000, Proc. Natl. Acad. Sci. USA, 97: 6640-6645), a method combining the method of Red-directed integration and the phage excisive system À. (Cho, E. H. et al. 2002. J. Bacteriol. 184: 52005203) (WO2005/010175), and so on. Modification of an expression regulatory sequence can be combined with increasing the gene copy number.

[00113] Furthermore, it is known that the substitution of several nucleotides in a spacer between the ribosome binding site (RBS) and the start codon, and particularly, the sequences immediately upstream of the start codon profoundly affects the translatability of the mRNA. Translation can be enhanced by modifying these sequences.

[00114] When a target gene is introduced into the aforementioned plasmid or chromosome, any promoter can be used for expression of the gene as long as a promoter that functions in the microorganism(s) used is chosen. The promoter can be the gene's native promoter, or a modified promoter. The expression of a gene can also be controlled by appropriately choosing a promoter that potently functions in the chosen microorganism(s), or by approximating the -35 and -10 regions of a promoter close to the consensus sequence.

[00115] The transformation, transduction, conjugational or chromosomal insertion of exogenous nucleic acid sequences involved in a metabolic or synthetic pathway can be confirmed using methods well known in the art. Such methods include, for example, extraction of plasmid or chromosomal DNA followed by polymerase chain amplification of specific target sequences, or restriction mapping, other nucleic acid analysis such as Northern blots, or polymerase chain reaction (PCR) amplification. of mRNA, or polyacrylamide gel electrophoresis, or measurements of enzyme activity, or immunoblotting for the expression of gene products, or other analytical methods suitable for testing the expression of an introduced nucleic acid sequence or its corresponding gene product. It is understood by those skilled in the art that exogenous nucleic acid is expressed in an amount sufficient to produce the desired gene product, and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art.

[00116] Optionally, the one or more microorganisms of the fourth, sixth, seventh, eighth or other aspects for use in any of the above processes of the invention may be further modified to reduce or eliminate the activity of an enzyme or protein participating in a cellular function that: (i) diverts material from pathways that produce methacrylic acid; and/or (ii) metabolize methacrylic acid and/or its derivatives.

[00117] In order to reduce or eliminate the activities of the aforementioned enzymes or proteins, mutations to reduce or eliminate the intracellular activities of the enzymes or proteins can be introduced into the genes of the aforementioned enzymes or proteins by conventional random or locus-directed mutagenesis or genetic engineering techniques. Examples of mutagenesis may include, for example, X-ray or ultraviolet irradiation, treatment with a mutagen such as N-methyl-N'-nitro-N-nitrosoguanidine, in vitro loco-directed or random mutagenesis by chain reaction. high-fidelity or error-prone polymerase, respectively, and so on. The site in the gene where the mutation is introduced may be in the coding region encoding the enzyme or protein or an expression control region such as a promoter. Examples of genetic engineering techniques may include genetic recombination, transduction, cell fusion, gene silencing, and so on.

[00118] A decrease or elimination of the intracellular activity of the objective enzyme or protein and the degree of decrease can be confirmed by measuring the activity of the enzyme or protein in a cell extract or a purified fraction thereof obtained from a candidate strain , and comparing it with that of a wild-type strain, or by measuring the formation of the target product by whole cells.

[00119] Examples of other methods for communicating or enhancing the ability to produce methacrylic acid and/or its derivatives and/or its intermediates may include communicating resistance to methacrylic acid or an acidic organic analogue, respiratory inhibitor or similar and communicating sensitivity to a inhibitor of cell wall synthesis. These methods may include, for example, selecting for resistant cells by culturing with increasing concentrations of the toxic substance, communicating resistance to monofluoroacetic acid, communicating resistance to adenine or thymine resistance, attenuating urease, communicating whether resistance to malonic acid, communicating resistance to benzopyrones or naphthoquinones, communicating resistance to HOQNO, communicating resistance to alpha-ketomalonic acid, communicating resistance to guanidine, communicating sensitivity to penicillin, and so on as is known in the art.

[00134] Examples of such resistant bacteria may include the following strains: Brevibacterium flavum AJ3949 FERM BP-2632; Corynebacterium glutamicum AJ11628 FERM P-5736; Brevibacterium flavum AJ11355 FERM P-5007; Corynebacterium glutamicum AJ11368 FERM P-5020; Brevibacterium flavum AJ11217 FERM P-4318; Corynebacterium glutamicum AJ11218 FERM P-4319; Brevibacterium flavum AJ11564 FERM P-5472; Brevibacterium flavum AJ11439 FERM P- 5136; Corynebacterium glutamicum H7684 FERM BP-3004; Brevibacterium lactofermentum AJ11426 FERM P-5123; Corynebacterium glutamicum AJ11440 FERM P-5137; and Brevibacterium lactofermentum AJ11796 FERM P-6402.

[00120] Other methods for communicating or enhancing the ability to produce methacrylic acid and/or its derivatives and/or its intermediates may include communicating resistance to down-regulators/inhibitors, communicating sensitivity to up-regulators/activators or alleviating the need for allosteric activation of enzymes by other compounds. For example, reducing the need for allosteric activation of the branched-chain keto acid dehydrogenase of Pseudomonas putida by valine, or alleviating the allosteric inhibition of acetolactate synthase of Escherichia coli. Fermentation

[00121] Accordingly, the above-mentioned processes of the invention may be conducted by culturing microorganism(s) of the fourth, sixth, seventh, eighth or other aspects of the invention that are capable of producing the intermediate methacrylyl-CoA and/or methacrylic acid and/or their derivatives such as methacrylic acid esters, suitably in a medium.

[00122] Suitably therefore, the processes of the first, second or third aspects of the invention may further comprise the step of cultivating one or more microorganisms to produce methacrylic acid and/or its derivatives such as methacrylic acid esters.

[00123] Preferably said cultivation takes place in a fermentation medium.

[00124] Therefore, according to a ninth aspect of the present invention, there is provided a fermentation process comprising cultivating one or more microorganisms of the fourth, fifth, sixth, seventh, eighth or other aspects in a fermentation medium to produce methacrylic acid and /or its derivatives such as methacrylic acid esters.

[00125] Methacrylic acid and/or its derivative may be present in the fermentation medium or within the cells of the microorganism(s).

[00126] Suitably, therefore, the processes of the first, second or third aspects of the invention may further comprise the step of collecting methacrylic acid and/or an intermediate in the formation thereof and/or a derivative thereof such as an ester of the acid methacrylic acid from the fermentation medium or cells of the microorganism(s).

[00127] Methacrylic acid and/or a derivative thereof such as an ester of methacrylic acid may be present in the fermentation medium by the microorganism(s) secreting methacrylic acid and/or a derivative thereof such as an ester of methacrylic acid. methacrylic acid as described above.

[00128] Methacrylic acid and/or a derivative thereof such as an ester of methacrylic acid may be present in the cells of the microorganism(s) by the microorganism accumulating methacrylic acid and/or its derivatives such as an ester of methacrylic acid as described above.

[00129] Suitably therefore the cells are removed from the fermentation medium by any means known in the art, such as filtration, centrifugation, etc., and methacrylic acid or salt thereof and/or methacrylic acid ester is collected from the fermentation medium by any means known in the art, such as: distillation, liquid-liquid extraction, etc. Suitably therefore, the processes of the invention may comprise an additional step of collecting the methacrylic acid and/or derivative thereof such as a methacrylic acid ester from the surrounding medium, this may be implemented by first removing the cells from the medium by filtration or centrifugation. and then extracting the methacrylic acid and/or derivative thereof from the clarified medium by distillation or liquid-liquid extraction.

[00130] Optionally, collecting the methacrylic acid and/or derivative thereof such as a methacrylic acid ester may further comprise a step of releasing the methacrylic acid and/or derivative thereof such as a methacrylic acid ester from the cell which may be carried out by any means known in the art, preferably wherein the cell is lysed to release the desired product, such as: by sonication, homogenization, enzymatic treatment, bead milling, osmotic shock, freeze-thaw, acid/base treatment, phage lysis, etc. followed by a similar collection method of the fermentation medium as detailed above. Suitably therefore, the processes of the invention may comprise the additional steps of collecting the methacrylic acid and/or derivative thereof such as a methacrylic acid ester from the cells, this may be implemented by lysing the cells, and subsequent filtration of cell fragments followed by extraction of methacrylic acid and/or derivative thereof such as a methacrylic acid ester.

[00131] Suitably, cultivation or cultivation of a microorganism requires a carbon-based food supply in which the microorganism can produce energy and growth. Preferably, therefore, the microorganism(s) are cultivated in a carbon-based feed stock, and the processes of the first or second aspects of the invention may further comprise the step of cultivating the one or more microorganisms that are capable of produce methacrylic acid and/or its derivatives from a carbon-based feed stock.

[00147] Preferably the cultivation or cultivation takes place in a fermentation medium, suitably a surrounding medium that surrounds the microorganism(s), preferably the carbon-based feed stock is present in the medium, optionally dissolved or placed in suspension in the medium, bubbled into the medium and/or mixed with the medium. Preferably therefore the medium comprises the microorganism(s) and the carbon-based feed stock together with any buffers and salts.

[00132] Therefore, according to a tenth aspect of the present invention there is provided a fermentation medium comprising one or more microorganisms of the fourth, fifth, sixth, seventh, eighth or other aspects.

[00149] Preferably the fermentation medium further comprises methacrylic acid and/or its derivatives such as methacrylic acid esters.

[00150] Preferably the microorganism(s) produce methacrylic acid and/or its derivatives such as methacrylic acid esters at an increased rate above that of the basal rate as explained above, such that preferably the concentration of methacrylic acid and/or its derivatives such as methacrylic acid esters present in the secretion or cell lysing medium is at a high titre.

[00133] Preferably the titre of methacrylic acid and/or its derivatives such as methacrylic acid esters present in the fermentation medium is at least 5 mg/L. For example, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95, 105, 115, 125, 135, 145, 155 mg/L, preferably at least greater than 130 mg/L.

[00134] Preferably, in an embodiment where methacrylic acid and/or its derivatives such as methacrylic acid esters accumulate within the microorganism(s), the concentration of methacrylic acid and/or an intermediate thereof and/or its derivatives such as methacrylic acid esters present in the cell is at least 0.05 mM, more preferably at least 0.1 mM, more preferably at least 1 mM, more preferably at least 2 mM, more preferably at least 5 mM, more preferably at least 10 mM. Preferably the concentration of methacrylic acid or an intermediate thereof and/or its derivatives such as methacrylic acid esters in the cell ranges from 10 mM to about 300 mM, more preferably from about 20 mM to about 200 mM, even more preferably from about 30 mM to about 100 mM, most preferably from about 40 mM to about 70 mM.

[00135] The microorganism(s) of the invention can be cultivated or worked as a batch, a repeated batch, a fed batch, a repeated fed batch or a continuous cultivation process.

[00136] Suitably, the cultivation process takes place in a culture medium, otherwise known herein as the surrounding medium or fermentation medium. Preferably a fed-batch or repeated fed-batch process is applied, in which the carbon source and/or nitrogen source and/or additional compounds are fed to the cultivation process. More preferably, the carbon and/or nitrogen sources are fed into the cultivation process.

[00137] The fermentation medium in which the microorganism(s) of the present invention is/are cultivated may be any commercially available medium suitable for the needs of the organism in question, provided that the relevant nutrients required by said organism are limiting . The culture can be aerobic or anaerobic, however in the context of the invention where the oxidase enzyme is used, the culture is preferably aerobic.

[00156] The fermentation medium suitably contains a carbon-based feed stock as described above, and a source of nitrogen, as well as additional compounds required for the growth of the microorganism(s) and/or the formation of acid methacrylic acid and/or methacrylic acid ester.

[00138] Examples of suitable carbon-based feedstocks known in the art include glucose, maltose, maltodextrins, sucrose, hydrolyzed starch, starch, lignin, aromatics, synthesis gas or its components, methane, ethane, propane, butane, molasses, and oils. Preferably the carbon-based feedstock is derived from biomass. Mixtures may also be used, as well as residues such as municipal waste, food waste, and lignocellulosic residues from food processing, forestry, or agriculture.

[00139] Examples of suitable nitrogen sources known in the art include soybean flour, corn steep liquor, yeast extract, ammonia, ammonium salts, nitrate salts, urea, nitrogen gas, or other nitrogenous sources.

[00140] Examples of additional compounds required for the cultivation of the microorganism(s) include antibiotics, antifungals, antioxidants, buffers, phosphate, sulfate, magnesium salts, trace elements and/or vitamins.

[00141] The total amount of carbon-based feed stock and nitrogen source to be added to the medium may vary depending on the needs of the microorganism(s) and/or the duration of the cultivation process.

[00142] The ratio between the carbon-based feed stock and the nitrogen source in the culture medium can vary considerably.

[00143] Additional compounds required for the growth of the microorganism(s) and/or for the production of methacrylic acid and/or its derivatives such as methacrylic acid esters, such as phosphate, sulfate or trace elements, may be added in amounts that may vary among different classes of microorganisms, i.e., among fungi, yeasts and bacteria. Furthermore, the amount of additional compound to be added may be determined by whether methacrylic acid and/or its derivatives such as methacrylic acid esters are formed and which pathways are used to form them.

[00144] Typically, the amount of each fermentation medium component required for the growth of a microorganism is determined by measuring the growth yield on the nutrient and further evaluated against the amount of carbon-based feed stock used in the process. of cultivation or cultivation, as the amount of biomass formed will be primarily determined by the amount of carbon-based feed stock used, and the nutrient limitations imposed during any feeding regime.

[00145] The cultivation or cultivation process according to the invention is preferably carried out on an industrial scale. An industrial scale process is understood to encompass a process of cultivation or cultivation in one or more fermenters of a scale in volume that is > 0.01 m3, preferably > 0.1 m3, preferably > 0.5 m3, preferably > 5 m3 , preferably > 10 m3, more preferably > 25 m3, more preferably > 50 m3, more preferably > 100 m3, most preferably > 200 m3.

[00146] Preferably, the cultivation or cultivation of the microorganism(s) of the invention is generally carried out in a bioreactor. A ‘Bioreactor’ is generally understood to mean a vessel in which microorganisms are industrially grown. Bioreactors can be of any size, number and shape, and can include inputs to provide nutrients, additional compounds for growth, fresh media, carbon-based feed stocks, gas additives such as, but not limited to, air, nitrogen, oxygen or carbon dioxide. Bioreactors may also comprise outlets for removing volumes of the culture medium to collect methacrylic acid and/or methacrylic acid ester from the fermentation medium itself or from within the microorganism(s). The bioreactor preferably also has an outlet for sampling the culture. The bioreactor can generally be configured to mix the fermentation medium, for example, by stirring, oscillating, shaking, inverting, bubbling gas through the culture, etc. Alternatively, some continuous cultures do not require mixing, for example microreactor systems using a plug flow system. Bioreactors are common and well known in the art and examples can be found in standard texts such as 'Biotechnology: A Textbook of Industrial Microbiology, Second Edition' (1989) Authors: Wulf Cruegar and Annelise Crueger, translated by Thomas D. Brock Sinauer Associates , Inc., Ssobland, MA.

[00147] Therefore, according to an eleventh aspect of the invention, there is provided a bioreactor comprising one or more microorganisms of the fourth, fifth, sixth, seventh, eighth or other aspects and/or the fermentation medium of the tenth aspect.

[00148] Optionally, the bioreactor may comprise a plurality of microorganism(s) different from the present invention.

[00149] Preferably, the bioreactor comprises only microorganism(s) capable of carrying out the process of the invention.

[00150] Most preferably the bioreactor comprises only microorganism(s) of the same species such that the same culture conditions can be used throughout.

Biomass Feed Stock

[00151] Preferably the biomass used comprises a high amount of carbohydrates, particularly preferable are carbohydrates that are sources of C5 or C6 sugars, carbon-based gases, or aromatics, preferably C5 or C6 sugars, more preferably glucose, such as, but not limited to starch, lignin, cellulose, glycogen, arabinoxylan, chitin, or pectin.

[00152] Alternatively, the biomass used comprises a high amount of fats, particularly preferable are fats or oils that are sources of glycerol and fatty acids, specifically triglycerides. Suitable triglycerides include any oil or fat that is readily available from a plant or animal source. Examples of such oils and fats include: palm oil, linseed oil, rapeseed oil, lard, butter, herring oil, coconut oil, vegetable oil, sunflower oil, castor oil, soybean oil, olive, cocoa butter, ghee, whale fat, etc.

[00153] Biomass can be composed of one or more different biomass sources. Examples of suitable biomass sources are as follows; virgin wood, energy crops, agricultural waste, food waste, municipal waste and industrial waste or co-products.

[00154] Sources of virgin wood biomass may include but are not limited to; wood chips; shells; fragments; firewood; sawdust; wood pellets or briquettes.

[00155] Energy crop biomass sources may include but are not limited to; forests or short rotation forestry; non-woody grasses such as miscanthus, hemp switchgrass, reeds or rye; agricultural crops such as sugar, starch or oil crops; or aquatic plants such as micro or macro algae and weeds.

[00156] Agricultural waste may include but is not limited to; shells; straw; corn fodder; flour; grains; poultry litter; manure; slurry; synthesis gas; or silage.

[00157] Food waste may include but is not limited to; bark/skin; shells; seed hulls; pulps; seeds/pits; inedible parts of animals or fish; pulp from juice and oil extraction; spent grains or hops from beer fermentation; household kitchen waste; lard or oils or fats.

[00158] Industrial waste may include but is not limited to; untreated wood including pallets, treated wood, shale gases, wood composites including MDF/OSD, wood laminates, pulp/shavings/waste paper; textile products including fiber/thread/effluent; or sewage sludge.

Other products

[00159] Furthermore, the production of other useful organic compounds, for example derivatives of methacrylic acid such as various of its esters is also contemplated. Accordingly, the methacrylic acid product may be esterified to produce an ester thereof. Potential esters may be selected from C1-C20 alkyl or C2-C12 hydroxyalkyl, glycidyl, isobornyl, dimethylaminoethyl, tripropylene glycol esters. Most preferably the alcohols or alkenes used to form the esters may be derived from biological sources, for example biomethanol, bioethanol, biobutanol. Preferred esters are ethyl, n-butyl, i-butyl, hydroxymethyl, hydroxypropyl or methyl methacrylate, most preferably methyl methacrylate or butyl methacrylate.

[00160] Preferably methacrylic acid is converted to alkyl or hydroxyalkyl methacrylate by an esterification reaction. Suitable reaction conditions for such a conversion are well known in the art and are described in conjunction with the production of methacrylic acid in WO/2012/069813.

[00161] According to a twelfth aspect of the present invention there is provided a method of preparing polymers or copolymers of methacrylic acid or methacrylic acid esters, comprising the steps of: (i) preparing methacrylic acid and/or its derivatives in accordance with with the first, second or third aspects or other aspects of the invention; (ii) optionally esterifying the methacrylic acid prepared in (i) to produce the methacrylic acid ester; (iii) polymerization of methacrylic acid and/or its derivatives prepared in (i) and/or, if present, the ester prepared in (ii), optionally with one or more comonomers, to produce polymers or copolymers thereof.

[00162] Step (i) may comprise any of the other features outlined in relation to the first, second and third aspects above in combination with those of the twelfth aspect.

[00163] Preferably, the methacrylic acid ester of (ii) above is selected from C1-C20 alkyl or C2-C12 hydroxyalkyl, glycidyl, isobornyl, dimethylaminoethyl, tripropylene glycol esters, more preferably, ethyl methacrylate, n-butyl, i-butyl, hydroxymethyl, hydroxypropyl or methyl, most preferably, methyl methacrylate, ethyl methacrylate, butyl methacrylate or butyl methacrylate.

[00164] Thus, according to another aspect of the present invention there is provided a method of preparing polymers or copolymers of methacrylic acid esters, comprising the steps of: preparing methacrylic acid esters according to the third aspect or other aspects of the invention; polymerization of methacrylic acid and/or its derivatives prepared in (i), optionally with one or more comonomers, to produce polymers or copolymers thereof.

[00165] Step (i) may comprise any of the other features outlined in relation to the third aspect above in combination with those of the twelfth aspect.

[00166] Advantageously, such polymers will have an appreciable portion if not all of the monomeric residues derived from a source other than fossil fuels.

[00167] In any case, preferred comonomers include, for example, monoethylenically unsaturated carboxylic acids and dicarboxylic acids and their derivatives, such as esters, amides and anhydrides.

[00168] Particularly preferred comonomers are acrylic acid, methyl acrylate, ethyl acrylate, propyl acrylate, n-butyl acrylate, iso-butyl acrylate, t-butyl acrylate, 2-ethylhexyl acrylate, hydroxyethyl acrylate , iso-bornyl acrylate, methacrylic acid, methyl methacrylate, ethyl methacrylate, propyl methacrylate, n-butyl methacrylate, iso-butyl methacrylate, t-butyl methacrylate, 2-ethylhexyl methacrylate, hydroxyethyl methacrylate, lauryl methacrylate, glycidyl methacrylate, hydroxypropyl methacrylate, iso-bornyl methacrylate, dimethylaminoethyl methacrylate, tripropylene glycol diacrylate, styrene, a-methyl styrene, vinyl acetate, isocyanates including toluene diisocyanate and p,p' diisocyanate -methylene diphenyl, acrylonitrile, butadiene, butadiene and styrene (MBS) and ABS subjected to any of the above comonomers other than the selected monomer of methacrylic acid or an ester of methacrylic acid in (i) or (ii) above in any given copolymerization of said acid or ester monomer in (i) or a said ester monomer in (ii) with one or more of the comonomers.

[00169] Of course, it is also possible to use mixtures of different comonomers. The comonomers themselves may or may not be prepared by the same process as the monomers of (i) or (ii) above.

[00170] According to a twelfth aspect of the present invention there is provided polymethacrylic acid, homopolymers or copolymers of polymethyl methacrylate (PMMA) and polybutyl methacrylate formed from the method of the eleventh aspect of the invention here.

Examples

[00171] The invention will now be illustrated with reference to the following non-limiting examples and figures in which: Figure 1 shows a Lineweaver-Burke plot for the kinetic characterization of 4-hydroxybenzoyl-CoA thioesterase labeled by hexahistidine at the carboxy terminus (75 μg .ml-1) of Arthrobacter sp. SU with methacrylyl-CoA as a substrate.

[00172] Figure 2 shows a Lineweaver-Burke plot for the kinetic characterization of 4-hydroxybenzoyl-CoA thioesterase labeled with hexahistidine at the carboxy terminus (1 mg.ml-1) from Arthrobacter sp. SU with isobutyryl-CoA as a substrate.

[00173] Figure 3 shows superimposed HPLC traces of isobutyryl-CoA standards (major peak at 32.2 min and minor peak at 32.9 min), methacrylyl-CoA (major peak at 30.8 min and minor peak at 31.6 min), methacrylic acid (peak at 13.5 min) and coenzyme A (major peak at 11 min and minor peak at 12 min) using the HPLC method to determine the in vitro activity of chain acyl-CoA oxidase short (ACX4) from Arabidopsis thaliana for the oxidation of isobutyryl-CoA to methacrylyl-CoA. Flavin adenine dinucleotide eluted at 27.8 min, and was used as an internal standard for isobutyryl-CoA and methacrylyl-CoA.

[00174] Figure 4 shows the HPLC trace of the assay mixture containing ACX4 cell-free extract, 4HBT labeled with purified carboxy-terminal hexahistidine and flavin adenine dinucleotide in HEPES assay buffer, without any added substrate, as a negative control.

[00175] Figure 5 shows the HPLC analysis of an assay mixture after 30 min incubation of ACX4 cell-free extract with isobutyryl-CoA in HEPES assay buffer containing flavin adenine dinucleotide.

[00176] Figure 6 shows HPLC analysis of an assay mixture after 30 min incubation of ACX4 cell-free extract with isobutyryl-CoA in HEPES assay buffer containing flavin adenine dinucleotide that was boosted with more isobutyryl-CoA. CoA after the reaction mixture was stopped by acidification.

[00177] Figure 7 shows the HPLC analysis of the reaction for the conversion of isobutyryl-CoA to methacrylic acid and coenzyme A by the cell-free extract of ACX4 and the purified His-labeled 4HBT at the carboxy terminus.

[00178] Figure 8 shows the pET20b(+)::4HBT-ACX- AcsA plasmid, a pET20b(+) plasmid containing the 4HBT gene, the ACX4 gene and the AcsA gene all under the control of a single T7 promoter.

[00179] Figure 9 shows an SDS-PAGE co-expression analysis of 4HBT, ACX4 and AcsA by E. coli BL21 (DE3) pLysS pET20b(+)::4HBT- ACX4-AcsA.

[00180] Figure 10 shows the HPLC traces performed for the analysis of the biotransformation of isobutyric acid to methacrylic acid and all relevant controls, 20.5 h after induction, whereby Figure 10A shows traces carried out for the culture of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA in which no isobutyric acid was added; Figure 10B shows the culture of E. coli BL21 (DE3) pLysS pET20b(+) in which no isobutyric acid was added; Figure 10C shows the HPLC trace of a 5 mM isobutyric acid standard; Figure 10D shows the HPLC trace of an E. coli BL21 (DE3) pLysS pET20b(+) culture that was supplemented with isobutyric acid (5 mM) 1 h after induction of recombinant protein expression, Figure 10E shows the HPLC trace of a cocktail of isobutyric acid (5 mM) and methacrylic acid (200 μM) standards and Figure 10F shows the HPLC trace of the E. coli BL21 (DE3) pLysS pET20b(+)::4HBT- culture ACX4-AcsA to which isobutyric acid (5 mM) was added 1 h after induction of recombinant protein expression.

[00181] Figure 11 shows the change in methacrylic acid concentration over time (bottom line) in the culture of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA that was supplemented with isobutyric acid , as well as the change in culture ln(OD600) with time (top line) since the addition of isobutyric acid to the culture.

[00182] Figure 12 shows the plasmid pET20b(+)::4HBT-ACX4- ppBCKD, the plasmid pET20b(+) with the genes encoded in the codon encoding 4HBT of Arthrobacter sp. strain SU, ACX4 from Arabidopsis thaliana as well as the bkdA1, bkdA2, bkdB and lpdV genes from Pseudomonas putida KT2440, all under the control of a single T7 promoter.

[00183] Figure 13 shows the HPLC analysis of a cocktail of 2-ketoisovaleric acid (5 mM), isobutyric acid (5 mM) and methacrylic acid (200 μM) standards, whereby the components were separated by elution isocratic, using 14% acetonitrile in 50 mM KH2PO4 that was acidified to pH 2.5 with HCl, at a flow rate of 1 ml.min-1.

[00184] Figure 14 shows the HPLC analysis of the culture of the negative control strain of E. coli BL21 (DE3) pLysS pET20b(+), whereby the components were separated by isocratic elution, using 14% acetonitrile in 50 mM KH2PO4 that was acidified to pH 2.5 with HCl, at a flow rate of 1 ml.min-1.

[00185] Figure 15 shows the HPLC analysis of the E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD culture, whereby the components were separated by isocratic elution, using 14% acetonitrile in 50 mM KH2PO4 that was acidified to pH 2.5 with HCl, at a flow rate of 1 ml.min-1, demonstrating the production of methacrylic acid from glucose.

[00186] Figure 16 shows the HPLC analysis of a sample from the E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD culture, which was boosted with an additional 0.24 mM acid authentic methacrylic acid, whereby the components were separated by isocratic elution, using 14% acetonitrile in 50 mM KH2PO4 which was acidified to pH 2.5 with HCl, at a flow rate of 1 ml.min-1.

[00187] Figure 17 shows the HPLC analysis of the culture of the negative control strain E. coli BL21 (DE3) pLysS pET20b(+) that was supplemented with 2-ketoisovaleric acid, whereby the components were separated by isocratic elution , using 14% acetonitrile in 50 mM KH2PO4 that was acidified to pH 2.5 with HCl, at a flow rate of 1 ml.min-1.

[00188] Figure 18 shows the HPLC analysis of the E. Coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD culture that was supplemented with 2-ketoisovaleric acid (5 mM), whereby the components were separated by isocratic elution, using 14% acetonitrile in 50 mM KH2PO4 which was acidified to pH 2.5 with HCl, at a flow rate of 1 ml.min-1, demonstrating that supplementation of the culture with acid 2 -ketoisovaleric reinforces the production of methacrylic acid by this strain.

[00189] Figure 19 shows the HPLC analysis of a sample from the E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD culture that was supplemented with 2-ketoisovaleric acid (5 mM), which was boosted with an additional 0.24 mM of authentic methacrylic acid, whereby the components were separated by isocratic elution, using 14% acetonitrile in 50 mM KH2PO4 which was acidified to pH 2.5 with HCl, at a rate flow rate of 1 ml.min-1.

[00190] Figure 20 shows the structure of the plasmid pMMA121 for the expression of the Arabidopsis thaliana ACX4 protein in E. coli.

[00191] Figure 21 shows the production of methacrylyl-CoA from isobutyryl-CoA using the Arabidopsis thaliana ACX4 protein produced from the recombinant E.coli of Example 5.

[00192] Figure 22 shows the SDS-PAGE analysis of the recombinant E. coli fractions from example 5 containing the Arabidopsis thaliana ACX4 protein.

[00193] Figure 23 shows the structure of plasmids pWA008, pMMA133 and pMMA134 for the expression of apple AAT (MpAAT1), Arabidopsis ACX4, and the complex genes bkdA1, bkdA2, bkdB and lpdV: BCKAD of Pseudomonas aeruginosa strain PA01 in Recombinant E. coli.

[00214] Figure 24 shows the production of butyl methacrylate from 2-ketoisovalerate and butanol by HPLC analysis of a culture sample from the production of recombinant E. coli expressing the plasmid pMMA134.

[00194] Example 1: Selective hydrolysis of methacrylyl-CoA

[00195] Example 2: The oxidation of isobutyryl-CoA to methacrylyl-CoA and the in vitro conversion of isobutyryl-CoA to methacrylic acid and coenzyme A in an enzyme-linked reaction.

[00196] Example 3: The whole cell biotransformation of isobutyric acid to methacrylic acid.

[00197] Example 4: Whole-cell production of methacrylic acid from glucose via a 2-ketoisovalerate intermediate.

[00198] Example 5: Whole-cell production of butyl methacrylate from 2-ketoisovalerate by recombinant Escherichia coli 1.1 Materials for examples 1 to 4

[00199] The bacterial strains used from beginning to end of examples one to four are listed, as are the culture medium and agar plates used from beginning to end of the experiments. A primer table lists all primers used in this study, and a plasmid table lists all plasmids used and constructed during this study. 1.1.1 Bacterial strains

[00200] E. coli JM107 was used as a plasmid cloning host while E. coli BL21 (DE3) pLysS was used as a gene expression host. 1.1.2 Bacterial culture medium and nutrient agar plates 1.1.2.1 Luria Bertani broth (LB medium)

[00201] Luria Bertani (Melford) high salt medium (25 g.L-1) was used whenever LB medium is alluded to, whereby 25 g of LB high salt medium in 1 liter consists of peptone digestion of casein (10 g.L-1), yeast extract (5 g.L-1) and sodium chloride (10 g.L-1). The LB medium was frequently supplemented with carbenicillin (50 μg.ml-1), chloramphenicol (34 μg.ml-1) and/or glucose (1% w/v). The LB medium was sterilized by autoclave, while stock solutions of glucose (20% w/v) in water, carbenicillin (100 mg.ml-1) in water and chloramphenicol (34 mg.ml-1) in ethanol were sterilized in a filter and added separately. 1.1.2.2 MSX Minimum Medium

[00202] MSX medium was prepared by combining MSA medium (760 ml.L-1), MSB medium (200 ml.L-1) and a 12.5% (w/v) glucose stock solution ( 40 ml.L-1) at room temperature. The MSB medium was composed of NH4Cl (15 g.L-1) and MgSO4.7H2O (2.0 g.L-1) and was sterilized by autoclave. MSA medium was composed of KH2PO4 (7.89 g.L-1), Vishniac trace elements (2.63 ml.L-1) and KOH solution was added until the pH reached 7.0 before MSA was sterilized by autoclave. Vishniac trace elements were prepared as previously described (Vishniac W, Santer M. THE THIOBACILLI, Bacteriological Reviews 1957; 21(3): 195-213.) but using only 3.9 g.L-1 of ZnSO4.7H2O. Glucose was filter sterilized using a 0.22 μm sterile filter. The MSX medium was sometimes supplemented with riboflavin (1 mg.L-1) and this was obtained by first dissolving the riboflavin in MSB medium (5 mg.L-1). This solution was then filter sterilized and the MSB+Riboflavin solution was then mixed with MSA and glucose in the same volumetric volume as for the MSX medium alone, to form MSX supplemented with riboflavin. Both MSX and MSX supplemented with riboflavin were always supplemented with carbenicillin (50 μg.ml-1) and chloramphenicol (34 μg.ml-1), prepared as previously described for LB medium. 1.1.2.3 Luria Bertani agar plates

[00203] Luria Bertani agar plates were prepared using Luria Bertani (Melford) high salt medium (25 g.L-1) and agar (20 g.L-1). The LB and agar mixture was sterilized by autoclaving and allowed to cool for 1 hour in a 50°C water bath before pouring. LB agar plates were frequently supplemented with carbenicillin (50 μg.ml-1), chloramphenicol (34 μg.ml-1) and/or glucose (1% w/v). Stock solutions of carbencillin, chloramphenicol and glucose were prepared as previously described for liquid Luria Bertani broth and added to the LB agar solution just before pouring. The glucose stock solution was preheated in a 50°C water bath for 1 h before its addition to LB agar. 1.1.3 Primer Table and Sequence List

8 .B.F GTGACTAACAGGAGATATAGATATGGCAGTTCTGAGCAGC 9 OE.B.R CTCGAGATATTATAGCTAGCTTACAGACGGCTACGGGTTG 10 BCKAD.F GGCCTGTCATGAGTGATTACGAGCCG 16 BCKAD.R CGGCCCTGCAGGTTCGCGGGAATCAGATGTGC 17 AAT.F AGGAGATACCATGAAAAGCTTTTCTGTACTC 18 AAT.R AGCAGCCGGATCCCCTGCAGGACTAGTTTACTGGCTGGTGCTAC 19 ACX4.F CACCAGCCAGTAAGCTAGCAAGGAGATATACCATGGCTG 20 ACX4.R GAACGGGTAG 21 SEQ ID NO. 1 - codon-optimized gene sequence for 4-Hydroxybenzoyl-CoA Thioesterase (4HBT) from Arthobacter sp. SU strain for expression in Escherichia coli.

[00205] SEQ ID NO. 4 - The product of the polymerase chain reaction performed to modify the 4HBT gene such that subcloning of the PCR product into plasmid pET20b(+) to form plasmid pET20b(+)::CtHis-4HBT.

[00206] SEQ ID NO. 5 - The gene encoding the 4HBT enzyme labeled with histidine at the carboxy terminus in plasmid pET20b(+)::CtHis-4HBT.

[00207] SEQ ID NO. 6 - codon-optimized gene encoding short-chain acyl-CoA oxidase (ACX4) from Arabidopsis thaliana for expression in Escherichia coli.

[00208] SEQ ID NO. 11 - The product of the overlap extension polymerase chain reaction to concatenate 4HBT and ACX4 into a polynucleotide.

[00209] SEQ ID NO. 12 - codon-optimized gene encoding acyl-CoA synthetase (AcsA) from Pseudomonas chlororaphis B23 for expression in Escherichia coli.

[00210] SEQ ID NO. 13 - The sequence between, and inclusive of, the NdeI and XhoI restriction sites in pET20b(+)::4HBT-ACX4-AcsA.

[00211] SEQ ID NO. 14 - The ‘ppBCKD’ polynucleotide synthesized by Biomatik containing the four genes encoding the subunits of the branched-chain keto acid dehydrogenase KT2440 from Pseudomonas putida, released on the plasmid pBSK::ppBCKD.

[00212] SEQ ID NO. 15 - The sequence between, and inclusive of, the NdeI and XhoI restriction sites in plasmid pET20b(+)::4HBT-ACX4-ppBCKD.

[00213] SEQ ID NO. 22 - The sequence of the pET16b (Sse) expression vector containing a modified Sse8387I expression site.

[00214] SEQ ID NO. 23 - codon-optimized gene encoding short-chain acyl-CoA oxidase (ACX4) from Arabidopsis thaliana for expression in the expression vector pET16b (Sse).

[00215] SEQ ID NO. 24 - gene optimized in the codon encoding Apple's alcohol acyl transferase (AAT) for expression in the pET16b (Sse) expression vector. 1.1.4 Plasmid table

PLASMID REFERENCE SOURCE DESCRIPTION

[00216] pBMH::4HBT Biomatik Corporation A cloning vector conferring resistance to ampicillin containing a codon-optimized gene encoding 4HBT flanked by NdeI and NotI restriction sites.

[00217] pBMH::AcsA Biomatik Corporation A cloning vector conferring ampicillin resistance containing a codon-optimized gene encoding AcsA flanked by a 3' XhoI restriction site and a 5' sequence containing a NheI restriction site, a ribosome binding site, a spacer sequence and a NdeI restriction site.

[00218] pBSK::ppBCKD Biomatik Corporation A cloning vector with the four genes encoding the branched-chain keto acid dehydrogenase complex of Pseudomonas putida KT2440, flanked by a 3' XhoI restriction site and a 5' sequence composed of a XbaI restriction site, a spacer sequence, an NheI restriction site, a ribosome binding site and a second spacer sequence.

[00219] pMA-RQ::ACX4 Life Technologies A cloning plasmid conferring resistance to ampicillin, and containing a gene optimized in the codon encoding ACX4 of Arabidopsis thaliana, flanked by a 5' NdeI and a 3' XhoI restriction site.

[00220] pJET1.2 Thermo Scientific The linearized blunt end cloning vector pJET1.2 by Thermo Scientific.

[00221] pJET1.2::CtHIS- 4HBT This work The cloning vector pJET1.2 containing the product of a polymerase chain reaction to replace the stop codon of 4HBT with a 5’-GGA-3’ sequence followed by an XhoI site, such that upon subcloning the insert into pET20b(+), the gene formed encodes 4HBT with a C-terminal His tag attached to the end, with a tripeptide linker between them.

[00222] pJET1.2::4HBT- ACX4 This work The pJET1.2 cloning vector containing the product of an overlap extension polymerase chain reaction that linked the 4HBT and ACX4 genes into a single polynucleotide with a new ribosome binding between the two genes.

[00223] pET20b(+) Novagen The pET20b(+) expression vector by Novagen.

[00224] pET20b(+)::4HBT This work The pET20b(+) expression vector containing the optimized gene at the codon encoding 4HBT from Arthrobacter sp. SU strain between the NdeI and NotI restriction sites.

[00225] pET20b(+)::CtHIS- 4HBT This work The pET20b(+) expression vector with the pJET1.2::CtHIS-4HBT insert subcloned between the NdeI and XhoI restriction sites, for the expression of 4HBT with a Gly-Leu-Glu-His-His-His-His-His-His peptide attached to the carboxy terminus of each subunit.

[00226] pET20b(+)::ACX4 This work The expression vector pET20b(+) containing the gene optimized in the codon encoding short-chain acyl-CoA oxidase from Arabidopsis thaliana, cloned between the NdeI and XhoI restriction sites.

[00227] pET20b(+)::AcsA This work The expression vector pET20b(+) containing the optimized gene in the codon encoding AcsA, cloned between the NdeI and XhoI restriction sites.

[00228] pET20b(+)::4HBT- ACX4 This work The expression vector pET20b(+) containing the 4HBT and ACX4 genes subcloned as a single polynucleotide from plasmid pJET1.2::4HBT-ACX4 into plasmid pET20b(+) between the NdeI and XhoI restriction sites, such that an expression unit is formed for the co-expression of both 4HBT and ACX4, and capable of accepting a second insert between the newly introduced NheI site and the XhoI site.

[00229] pET20b(+)::4HBT- ACX4-AcsA This work The expression vector pET20b(+)::4HBT-ACX4 containing the AcsA gene subcloned from the plasmid pBMH::AcsA between its NheI and XhoI sites.

[00230] pET20b(+)::ppBCKD This work The expression vector pET20b(+) containing the four genes encoding the ppBCKD complex, subcloned from the plasmid pBSK::ppBCKD between the XbaI and XhoI restriction sites.

[00231] pET20b(+)::4HBT- ACX4-ppBCKD This work The expression vector pET20b(+)::4HBT-ACX4 containing the four genes encoding the ppBCKD complex, subcloned from the plasmid pBSK::ppBCKD within it among its NheI and XhoI restriction sites.

[00232] pET16b (Sse) This work The pET16b expression vector with a modified Sse8387I restriction site.

[00233] pMMA121 This work The pET16b (Sse) expression vector containing the A. thaliana ACX4 gene optimized for expression in pET16b (Sse) between its XbaI and Sse8387I restriction sites.

[00234] pWA008 This work The pET16b(Sse) expression vector containing the operon encoding the BCKAD complex of P. aeruginosa strain PA01 inserted between its NcoI and Sse8387I restriction sites.

[00235] pAAT212 This work The pET(Sse) expression vector containing the Apple AAT gene optimized for expression in pET16b (Sse) inserted between its NcoI and Sse8387I restriction sites pMMA133 This work The pAAT212 plasmid also containing the ACX4 gene of A.

[00236] thaliana optimized for expression in the pET16b (Sse) vector inserted between the SpeI restriction site and the AAT gene.

[00237] pMMA134 This work Plasmids pMMA133 and pWA008 linked together and containing the A. thaliana ACX4 gene optimized for expression in the pET16b (Sse) vector, the Apple AAT gene optimized for expression in the pET16b (Sse) vector, and the BCKAD complex from P. aeruginosa strain PA01 inserted between the XbaI and Sse8387I restriction sites. 1.2 General methods for examples 1 to 4 1.2.1 Transformation of plasmids into the E. coli JM107 cloning host.

[00238] Plasmids (1 ng) were transformed into E.coli JM107 (50 μl) that was made competent using the Fermentas TransformAid® bacterial transformation kit. Freshly transformed cells were incubated on ice for 5 min, then plated onto pre-warmed LB agar plates supplemented with carbenicillin (50 ng.μl-1). Plates were incubated at 37°C for 16 h. 1.2.2 Restriction digestions of plasmids

[00239] To isolate the gene or polynucleotide inserts from the plasmids, restriction digests of plasmids were performed using the Fermentas FastDigest® series of restriction endonucleases, according to the instructions provided. All restriction digestion reactions were performed in a water bath at 37°C for 3 h. 1.2.3 Linear expression vector preparation

[00240] The plasmids were linearized in restriction digestion reactions (100 μl) containing plasmid DNA (100 ng.μl-1), Fermentas FastDigest® Green buffer (1X) and Fermentas FastDigest® restriction endonucleases, as described above. The linearized vectors were purified by agarose gel electrophoresis and gel extraction without first heat inactivating the restriction endonucleases. The 5' phosphates of the linearized vectors were then hydrolyzed by Antarctic phosphatase (New England Biolabs) according to the instructions provided. The dephosphorylated vector was concentrated by ethanol precipitation, which required the addition of 3 M sodium acetate, pH 5.2, to the sample (added volume: 1/10th of the original sample volume) followed by the addition of absolute ethanol (added volume: : 2X the new sample volume). The precipitation mixture was incubated overnight at -20°C. The precipitated DNA was then centrifuged in an Eppendorf miniSpin F-45-12-11 rotor at 13400 rpm for 30 min. The supernatant was discarded and the cell pellet was washed with 70% (v/v) ethanol. The DNA pellet was then centrifuged in the same rotor and at the same speed as before for an additional 10 min. The supernatant was removed and the DNA pellet was air-dried in a fume hood for 20 min before being resuspended in nuclease-free water (50 μl). The concentration of the linearized vector was determined by analytical agarose gel electrophoresis. 1.2.4 Agarose gel electrophoresis and gel extraction

[00241] Linear DNA fragments from plasmid digestion or PCR amplification were purified by agarose gel electrophoresis. The digests or PCR products were loaded onto an agarose gel consisting of agarose (1% (w/v)), ethidium bromide (1.78 μM), Tris acetate (4 mM), and ethylenediaminetetraacetic acid (EDTA) (1 mm). A potential difference of 7V per centimeter of gel length was applied across the gel to resolve the polynucleotides. DNA was visualized in the gel with a transluminator, and a slice of gel containing the polynucleotide of interest was excised with a scalpel. The polynucleotide was purified from the gel slice with the QIAquick® gel extraction kit. Polynucleotide concentration was determined by analytical agarose gel electrophoresis. 1.2.5 Ligation of inserts within linearized plasmids

[00242] Gene inserts were ligated into the linearized plasmid in a ligation reaction (20 μl). Ligation reactions consisted of gene insert and linear vector (50 ng) in a 3:1 molar ratio for gene inserts less than 3 kb in length, or a 1:1 molar ratio for gene inserts greater than 3 kb in length, along with T4 DNA ligase (1 unit) and Fermentas T4 DNA ligase buffer (1X). Ligations were carried out at room temperature for 20 min and the ligation mixture (2.5 μl) was used as the source of plasmid for transformation into E. coli JM107, which was performed using the Fermentas TransformAid bacterial transformation kit as before. Transformed cells were plated on pre-warmed LB agar plates supplemented with carbenicillin and incubated at 37°C for 16 h. 1.2.6 Subcloning of a polynucleotide into an expression vector

[00243] To subclone a polynucleotide into a new vector, the source vector was first amplified by transforming it (1 ng) into E. coli JM107 using the Fermentas TransformAid® bacterial transformation kit and then preparing an LB culture (5 ml) supplemented with carbenicillin to each of the 5 single colonies on the agar plate. 5 x 5 ml LB+Carbenicillin cultures were incubated at 37°C with shaking at 250 rpm for 16 h and plasmids were purified from the culture using the QIAGEN QIAprep® Spin miniprep kit as described in the manual. The polynucleotides of interest were digested from each plasmid preparation in restriction digestion reactions (20 μl) using 1 μl of the required restriction endonuclease for each of the desired 5' and 3' cloning sites. The restriction digests were pooled together and the polynucleotide to be subcloned into the new vector was purified from the rest of the source vector by agarose gel electrophoresis and gel extraction. A ligation reaction was set up to ligate the polynucleotide insert into a previously prepared linearized expression vector with cohesive ends complementary to the insert. The ligation reaction (2.5 μl) was used as the plasmid source for transformation into E. coli JM107, as previously described. The expression plasmid was amplified by inoculating a LB+Carbenicillin culture (100 ml) with a single colony from the transformant plate, incubating the culture at 37°C with shaking at 200 rpm for 16 h, and purifying the plasmid from the culture. using the QIAGEN Plasmid MidiPrep kit. 1.2.7 Transformation of E. coli BL21 (DE3) pLysS with expression vector

[00244] The expression vector (1 ng) was transformed into the E. coli BL21 (DE3) pLysS expression host. Competent cells were purchased from Novagen, and ice-cold circular plasmid (1 ng) was added to ice-cold competent cells (20 μl). The transformation mixture was incubated on ice for 5 min before a 30 s heat shock at 42°C. After heat shock, cells were incubated on ice for an additional 2 min. SOC medium (Novagen) (80 μl) was added to the transformed cells and cells were incubated at 37°C with shaking at 250 rpm for 60 min before plating on LB agar plates supplemented with carbenicillin (50 μg.ml-1). , chloramphenicol (34 μg.ml-1) and glucose (1%, w/v). Plates were incubated at 37°C for 16 h. 1.2.8 Analytical agarose gel electrophoresis

[00245] The homogeneity and concentration of linear DNA was determined by analytical agarose gel electrophoresis. Agarose gels consisted of agarose (1% (w/v)), ethidium bromide (1.78 μM), Tris acetate (4 mM), and EDTA (1 mM). A fixed volume (5 μl) of DNA sample was loaded onto the gel alongside GeneRuler® 1 kb Plus DNA ladder (Thermo Scientific) (5 μl). To estimate sample concentration, the intensity of the sample band was visually compared to the intensities of bands of similar size and known mass on the ladder, as described in the manual for the geneRuler® 1kb Plus DNA ladder. 1.2.9 Sodium dodecyl sulfate polyacrylamide gel electrophoresis

[00246] Samples (1.5 ml) were collected from cell culture and cells were pelleted by centrifugation at 5000g for 10 min. The cell pellets were resuspended in cell lysis buffer, using 100 μl for each OD600 unit the cell culture was in when the samples were collected. Cell lysis buffer contained potassium phosphate buffer (100 mM, pH 7.5), BugBuster cell lysis detergent (Merck-Millipore) (1X), Benzonase nuclease (Sigma Aldrich) (0.01%, v /v) and protease inhibitor cocktail (Roche). The resuspended cells were incubated for 20 min with shaking at 250 rpm and centrifuged at 18,000g for 20 min at 4°C. The insoluble fraction was resuspended in potassium phosphate buffer (100 mM, pH 7.5) using the same volume as was used to resuspend the cell pellet. The soluble and insoluble fractions were mixed in a 1:1 ratio with 2X Laemmli sample buffer (Bio-Rad), containing β-mercaptoethanol (5%, v/v). Samples were boiled at 100°C for 5 min and loaded onto a precast Bio-Rad AnyKD TGX gel. Electrophoresis was performed at 200V in Tris/Glycine/DS conduction buffer (Bio-Rad). The gels were washed by soaking them in double distilled water at room temperature with gentle agitation (50 rpm) for 5 min. The water was removed and the washing procedure was repeated four more times. The gels were then dyed by soaking overnight (16 h) in EZBlue® Gel Dyeing Reagent (Sigma-Aldrich) at room temperature with gentle agitation for 16 h. 1.3 Example 1 - Production of methacrylic acid from methacrylyl-CoA:

[00247] The enzyme 4-hydroxybenzoyl-CoA thioesterase (4HBT) from Arthrobacter sp. strain SU (Genbank accession number AAC80224.1, Uniprot accession number Q04416, EC number 3.1.2.23) was identified as a candidate thioesterase for the hydrolysis of methacrylyl-CoA after a database and literature search for thioesterases with known activity on substrates that are structurally related to methacrylyl-CoA.

[00248] A gene encoding the amino acid sequence for 4HBT was codon optimized for expression in E. coli and synthesized by Biomatik Corporation with an NdeI restriction site integrated at the 5' end and a NotI restriction site attached to the 3' end .

[00249] The synthesized polynucleotide (SEQ. ID 1) was released into the pBMH::4HBT cloning vector and the 4HBT gene insert was subcloned into a previously linearized ET20b(+) expression vector, at the NdeI and NotI restriction sites, to form pET20b(+)::4HBT. The newly constructed plasmid pET20b(+)::4HBT was then transformed into E. coli BL21 (DE3) pLysS to form E. coli BL21 (DE3) pLysS pET20b(+)::4HBT.

[00250] To express the enzyme 4-hydroxybenzoyl-CoA thioesterase, a starter culture (20 ml) of LB medium supplemented with glucose, carbencillin and chloramphenicol was first inoculated with a single colony of E. coli BL21 (DE3) pLysS pET20b(+ )::4HBT from an LB agar plate supplemented with glucose, chloramphenicol and carbenicillin. The starter culture was incubated at 37°C with shaking at 200 rpm until the culture reached an OD600 of 1.0. The cells were then harvested by centrifugation at 5000g for 15 min at 4°C and used to inoculate an intermediate culture (100 ml) of LB medium, also supplemented with glucose, carbenicillin and chloramphenicol. The intermediate culture was also incubated at 37°C with shaking at 200 rpm until an OD600 of 1.0. Cells in the intermediate culture were then harvested by centrifugation at 5000g for 15 min at 4°C before being resuspended in fresh LB medium (1L), once again supplemented with glucose, carbenicillin and chloramphenicol, in a shake flask. 2.5 L with deflector. This culture was incubated at 37°C with shaking at 200 rpm to an OD600 of 1.0 and 4HBT expression was then induced by the addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.4 mM. . The culture was incubated for an additional 5.5 h under the same conditions. The culture was divided evenly into three centrifuge tubes and the cells were then harvested by centrifugation at 5000g for 20 min at 4°C. A sample of the culture collected before the cells were harvested was analyzed by SDS-PAGE which showed that the protein was highly soluble and well expressed. The cell pellets in each centrifuge tube were washed three times in assay buffer (50 ml), which comprised 2-([4-(2-hydroxyethyl)piperazin-1-yl])ethanesulfonic acid (HEPES) (50 mM), which was adjusted to pH 7.5 with potassium hydroxide. Cell pellets were frozen at −80°C until lysed. This process was repeated for E. coli BL21 (DE3) pLysS pET20b(+), an empty pET20b(+) vector negative control strain.

[00251] To prepare a cell-free extract of the 4HBT enzyme, one of the E. coli BL21(DE3) pLysS pET20b(+)::4HBT cell pellets that was prepared previously was resuspended in HEPES assay buffer (50 mM, pH 7.5) and lysed in a Constant Systems One Shot cell disruptor. The cell lysate was centrifuged at 18,000g for 15 min at 4°C, and the supernatant from this was centrifuged at 57,750g for an additional 60 min at 4°C. This supernatant was washed using a VivaSpin Viva6 10,000 Molecular Weight Cut-Off centrifugal concentrator, centrifuged at 10,000g at 18°C until a six-fold volume reduction, followed by a six-fold redilution in HEPES assay buffer and an additional six-fold volume reduction in the centrifugal concentrator. Total protein concentration of cell-free extract from E. coli BL21(DE3) pLysS pET20b(+)::4HBT overexpression cultures was performed using the BioRad DC assay kit, using bovine serum albumin as the protein standard. The same procedure was followed to prepare cell-free extract from a cell pellet of E. coli BL21(DE3) pLysS pET20b(+), the negative control strain.

[00252] In order to test the 4HBT enzyme for activity on methacrylyl-CoA, methacrylyl-CoA was first prepared. The synthesis of methacrylyl-CoA was carried out by reacting coenzyme A with methacrylic anhydride. The reaction consisted of coenzyme A (20 mM) and methacrylic anhydride (40 mM) in sodium phosphate buffer (100 mM, pH 8.5). The reaction was incubated on ice and vortexed every 2 min for 30 min, and the final reaction mixture was acidified to pH 3.5 with hydrochloric acid. The by-product methacrylic acid and unreacted methacrylic anhydride were removed by extraction with 4 x 10 ml of diethyl ether saturated with water. Methacrylyl-CoA was purified by reversed-phase high-performance liquid chromatography (RP-HPLC) on an analytical scale column (Agilent Zorbax Eclipse XDB C18 column, 4.6 mm x 150 mm). The sample (75 μl) was injected into the C18 column, and eluted in 40 min by a linear gradient of acetonitrile (1.8% to 13.5%) in 0.1% trifluoroacetic acid (TFA), at a rate of flow of 1 ml.min-1. The main peak was the peak containing methacrylyl-CoA, and the fractions containing methacrylyl-CoA were collected and pooled. Acetonitrile was removed by rotary evaporation (21°C, 3kPa), leaving behind an aqueous solution of methacrylyl-CoA and trifluoroacetic acid. This solution of methacrylyl-CoA and trifluoroacetic acid was brought to pH 7 by sodium hydroxide and flash frozen with liquid nitrogen before freeze-drying. TFA was removed by redissolving the freeze-dried sample in nuclease-free water (10 ml), and repeating the freeze-drying-redissolution cycle twice more, once in 5 ml, and finally in 1 ml of free water. of nuclease. The concentration of methacrylyl-CoA was determined by absorbance at 260 nm with a molar extinction coefficient of 16800 M-1.cm-1.

[00253] Crude 4HBT enzymatic assays were performed in cuvettes (1 ml) containing cell-free protein extract (1 mg.ml-1), methacrylyl-CoA (approximately 100 μM), 5'5-dithiobis-acid ( 2- nitrobenzoic acid) (DTNB) (500 μM). Reactions were initiated by the addition of substrate and were monitored at 412 nm. Enzymatic assays were repeated for cell-free extract of E. coli BL21 (DE3) pLysS pET20b(+). Enzymatic assays for cell-free extract from both the 4HBT-overexpressing strain and the empty vector control strain were repeated for isobutyryl-CoA also as a substrate.

[00254] Crude enzyme assays of 4HBT demonstrated that 4HBT catalyzed the hydrolysis of methacrylyl-CoA, and exhibited a selectivity for methacrylyl-CoA over isobutyryl-CoA as a substrate.

[00255] In order to better characterize 4-hydroxybenzoyl-CoA thioesterase, the enzyme was labeled with His so that it would be assayed as a pure enzyme as opposed to as a part of a cell-free extract. By His tagging the enzyme, a polymerase chain reaction was established. Forward and reverse primers for labeling with His 4HBT, HHT.F (SEQ. ID 2) and HHT.R (SEQ. ID 3), were designed to replace the stop codon (5'-TAA-3') of the gene that encodes 4HBT with a sequence (5'-GGA-3') and to introduce a 3' XhoI restriction site immediately afterwards. Thus, upon cloning, the PCR product returns to pET20b(+) between the NdeI and XhoI restriction sites, an open reading frame encoding 4HBT with a glycine-leucine-glutamate spacer sequence and a carboxy-terminal hexahistidine (His) tag. was raised.

[00256] The polymerase chain reaction mixtures contained the plasmid pET20b(+)::4HBT as standard DNA (50 pg.μl-1), KOD DNA polymerase (1 unit), HHT.F primer (0.4 μM ), primer HHT.R (0.4 μM), deoxyadenosinetriphosphate (dATP) (0.2 mM), deoxythymidine triphosphate (dTTP) (0.2 mM), deoxycytidinetriphosphate (dCTP) (0.2 mM), deoxyguanosinetriphosphate (dGTP ) (0.2 mM), MgCl2 (1 mM) and Novagen #1 buffer for KOD DNA polymerase (1X). PCR mixtures were loaded into a thermocycler programmed to start at 94°C for 3 min, then cycle through 30 iterations of 30 s melting at 94°C, 30 s annealing at 55°C, 80 s stretching at 72° C, before finishing with 5 min at 72°C.

[00257] The PCR product (SEQ. ID 4) was purified by agarose gel electrophoresis followed by gel extraction, and was blunt-end ligated into the pJET1.2 cloning vector to form pJET1.2::CtHis-4HBT . The insert was then subcloned from pJET1.2::CtHis-4HBT into pET20b(+) between the NdeI and XhoI restriction sites to form pET20b(+)::CtHis-4HBT. The E. coli BL21 (DE3) pLysS expression host was then transformed with pET20b(+)::CtHis-4HBT to form the C-terminal hexahistidine-labeled 4HBT expression host, E. coli BL21 (DE3) pLysS pET20b(+ )::CtHis-4HBT.

[00258] The pure carboxy-terminal His-labeled 4HBT enzyme was then prepared by first growing cultures of E. coli BL21 (DE3) pLysS pET20b(+)::CtHis-4HBT and inducing expression in exactly the same way as was performed for E. coli BL21 (DE3) pLysS pET20b(+)::4HBT. A culture sample taken 5.5 h after expression showed that the carboxy-terminal His-labeled 4HBT enzyme was also very soluble and was expressed at high levels. Cells were harvested by dividing the cell culture into three centrifuge tubes and centrifuging at 5000g for 20 min at 4°C. However the cell pellets were not washed, and were instead directly stored at -80°C. A cell-free extract of 4HBT labeled with carboxy-terminal hexahistidine was prepared by resuspending one of the E. coli BL21 (DE3) pLysS pET20b(+)::CtHis-4HBT cell pellets in binding buffer (6 ml ) to a Nickel-sepharose FPLC column. The binding buffer consisted of NaH2PO4 (10 mM), Na2HPO4 (10 mM), NaCl (500 mM), imidazole (30 mM) and was adjusted to pH 7.4 with HCl. Benzonase® nuclease (0.6 μl) was added to the resuspended cells before they were lysed in the Constant Systems One Shot cell disruptor. The cell lysate was then clarified by centrifugation at 18,000g for 15 min at 4°C, followed by centrifugation of the supernatant at 57,750g for 60 min at 4°C. This supernatant was then loaded onto a GE Healthcare HisTrap® FF Crude column (1 ml) that was equilibrated with binding buffer. Unbound proteins were washed from the column with five column volumes of binding buffer, and His-labeled proteins were eluted with a linear imidazole concentration gradient from 30 mM to 500 mM in 20 column volumes. Protein elution was monitored at 280 nm and fractions were checked for the presence and purity of carboxy-terminal His-labeled 4HBT by SDS-PAGE. Fractions containing pure CtHis-4HBT protein were pooled and a buffer exchange to replace the elution buffer with potassium phosphate assay buffer (100 mM, pH 7.5) was performed in a VivaSpin Viva6 10,000 Molecular Weight centrifugal concentrator. Cut Off. To perform the buffer exchange, the pooled fractions were centrifuged through the ultrafiltration membrane of the centrifugal concentrator at 10,000g at 18°C until the volume of the fractions was reduced to 1 ml. The remaining protein fraction was diluted sixfold in potassium phosphate assay buffer and the samples concentrated by further centrifugation through the ultrafiltration membrane under the same conditions until a sixfold volume reduction was obtained. The final dilution in potassium phosphate assay buffer and reconcentration was performed once more and the CtHIS-4HBT protein concentration was determined by UV280 absorbance on a NanoDrop ND1000 spectrophotometer, using a molar extinction coefficient of 20970 M-1. cm-1 and a molecular weight of 17516.5 mg.mmol-1 for the 4HBT enzyme labeled with His at the carboxy terminus. Values for molar extinction coefficient and molecular weight were determined using the Expasy ProtParam tool, using the amino acid translation of the gene sequence encoding the 4HBT enzyme labeled with his at the carboxy terminus (SEQ. ID 5) in plasmid pET20b(+ )::CtHis-4HBT.

[00259] The kinetic characterization of the purified carboxy-terminal hexahistidine-labeled 4HBT enzyme was carried out for methacrylyl-CoA that was previously prepared, and for isobutyryl-CoA (purchased from Sigma Aldrich as lithium salt of isobutyryl-CoA).

[00260] Methacrylyl-CoA hydrolysis reactions (200 μl) were performed in Nunc 96-well plates using purified CtHis-4HBT protein (0.075 mg.ml-1) and DTNB (0.5 mM) to monitor the reaction . Initial rates were determined for methacrylyl-CoA starting concentrations of 0.375 mM, 0.3 mM, 0.225 mM, 0.15 mM, and 0.075 mM. The reactions were initiated by the addition of enzyme.

[00261] Isobutyryl-CoA hydrolysis reactions (200 μl) were also carried out in Nunc 96-well plates, using purified CtHIS-4HBT protein (1 mg.ml-1) and DTNB (0.5 mM) to monitor the reaction. Initial rates were determined for starting isobutyryl-CoA concentrations of 0.5 mM, 0.4 mM, 0.3 mM, 0.2 mM, and 0.1 mM. Reactions were once again initiated by the addition of enzyme.

[00262] Lineweaver-Burke plots were plotted for the kinetic characterization of both methacrylyl-CoA (Fig. 1) and isobutyryl-CoA (Fig. 2). The kinetic constants for 4HBT labeled with hexahistidine at the carboxy terminus for methacrylyl-CoA had a KM of 1.6 mM and a Vmax of 470 nmols.mg-1.min-1, whereas for isobutyryl-CoA, they had a Km of 3 mM and a Vmax of 16.7 nmols.mg-1.min-1.

[00263] Thus, it was demonstrated that 4HBT catalyzes the hydrolysis of methacrylyl CoA and can be used to produce methacrylic acid. Since 4HBT hydrolyzes methacrylyl-CoA with lower KM values and higher Vmax values than for isobutyryl-CoA, the hydrolysis of methacrylyl-CoA by 4HBT is advantageously highly selective. 1.4 Example 2 - Formation of methacrylyl-CoA and methacrylic acid from isobutyryl-CoA

[00264] The enzyme short-chain acyl-CoA oxidase (ACX4) from Arabidopsis thaliana (Genbank accession number AB017643.1, Uniprot accession number Q96329, EC number 1.3.3.6) was identified through a literature search as an acyl-CoA oxidase enzyme with detectable activity on isobutyryl-CoA as a substrate when expressed in insect cell lines.

[00265] To determine whether this oxidase would be functionally expressed in Escherichia coli with useful levels of activity on isobutyryl-CoA as a substrate for its integration into a metabolic pathway, a gene encoding the amino acid sequence for ACX4 was codon-optimized for expression in E. coli by Life Technologies with an NdeI restriction site integrated at the 5' end and an XhoI restriction site at the 3' end.

[00266] The synthesized polynucleotide (SEQ. ID 6) was released into the plasmid pMA-RQ::ACX4 and the gene insert was subcloned into a previously linearized pET20b(+) vector, at the NdeI and XhoI restriction sites, to form pET20b(+)::ACX4. The newly constructed pET20b(+)::ACX4 was then transformed into E. coli BL21(DE3) pLysS to form E. coli BL21(DE3) pLysS pET20b(+)::ACX4.

[00267] In order to test the expression of ACX4, an MSX starter culture supplemented with carbenicillin and chloramphenicol was inoculated with a single colony of E. coli BL21 (DE3) pLysS pET20b(+)::ACX4 from an LB plate agar that was supplemented with glucose, chloramphenicol and carbenicillin. The starter culture (20 ml) was incubated at 37°C with shaking at 200 rpm for 16 h. Cells were harvested from the starter culture by centrifugation at 5000g for 15 min at 4°C and then resuspended in an intermediate culture of fresh MSX medium (100 ml) that was also supplemented with chloramphenicol and carbenicillin. The intermediate culture was incubated at 37°C with shaking at 200 rpm until an OD600 of 1.0. The cells were then harvested from the intermediate culture by centrifugation at 5000g for 15 min at 4°C and resuspended in a culture in fresh MSX (1L) supplemented with chloramphenicol, carbenicillin and also riboflavin, in a 2.2L shake flask. 5 L with deflector. The culture was incubated at 37°C with shaking at 200 rpm to an OD600 of 0.7 and expression was then induced by the addition of IPTG to a final concentration of 0.4 mM. The culture was incubated for an additional 7 h under the same conditions before the cells were divided into three centrifuge tubes and harvested by centrifugation at 5000g for 20 min at 4°C. A sample of the culture was taken before the cells were harvested and was analyzed by SDS-PAGE, which showed that the ACX4 protein was well expressed and that approximately one-third of the ACX4 protein was in the soluble fraction and two-thirds in the insoluble fraction. The cell pellets were washed three times in HEPES buffer (50 mM) which was adjusted to pH 7.5 with KOH. Cell pellets were frozen at −80°C until lysed. The process was repeated for the negative control strain E. coli BL21 (DE3) pLysS pET20b(+).

[00268] To prepare a cell-free extract of the ACX4 enzyme, one of the cell pellets that was previously prepared was resuspended in HEPES buffer (50 mM, pH 7.5) (6 ml) that was supplemented with flavin adenine dinucleotide (FAD) at a final concentration of 10 μM. The resuspended cells were then lysed in a Constant Systems One Shot cell disruptor. The lysate was centrifuged at 18,000g for 15 min at 4°C and the supernatant was further centrifuged at 57,750 rpm for 60 min at 4°C. The supernatant was concentrated in a VivaSpin Viva6 10,000 Molecular Weight Cut-Off Centrifugal Concentrator, centrifuging at 10,000g at 18°C until a six-fold volume reduction of the retentate. The retentate was washed once by a six-fold redilution in HEPES buffer (50 mM, pH 7.5) which was once again supplemented with FAD (10 μM), followed by a second concentration step in the centrifugal concentrator through a six-fold volume reduction. Total protein concentration in the retentate was determined using the BioRad DC portein assay kit, using bovine serum albumin as the protein standard.

[00269] An analytical HPLC method was developed to resolve isobutyryl-CoA (IB-CoA), methacrylyl-CoA (MAA-CoA), flavin adenine dinucleotide (FAD), methacrylic acid (MAA) and coenzyme A (CoA-SH) . Coenzyme A, methacrylyl-CoA and isobutyryl-CoA eluted at 11.0 min, 30.8 min and 32.2 min respectively. Coenzyme A, methacrylyl-CoA, and isobutyryl-CoA each had a small (minor) tail peak associated with the main peak at 12 min, 31.6 min, and 32.9 min, respectively ( Fig. 3 ). Methacrylic acid eluted at 13.5 min, and FAD, used in the ACX4 crude assays and as an internal standard for the isobutyryl-CoA and methacrylyl-Coa standards, eluted at 27.8 min.

[00270] To ensure that coenzyme A, methacrylic acid, isobutyryl-CoA and methacrylyl-CoA were not confused with the cell-free extract peaks, a substrate-free control was performed using cell-free extract of ACX4 (0.8 mg.ml-1), purified CtHis-4HBT (0.6 mg.ml-1) and FAD (10 μM) in HEPES buffer. No peaks were observed eluting at the elution times of coenzyme A, methacrylic acid, methacrylyl-CoA, or isobutyryl-CoA (Fig. 4).

[00271] The ACX4 activity test was performed in 1.5 ml microcentrifuge tubes. The crude enzyme reactions consisted of cell-free ACX4 protein extract (0.8 mg.ml-1), isobutyryl-CoA (500μM) and flavin adenine dinucleotide (10 μM) in HEPES buffer (50 mM, pH 7, 5). The reaction was incubated at 30°C in the 1.5 ml microcentrifuge tube with shaking at 250 rpm for 30 min and the final reaction product was analyzed by analytical HPLC (Fig. 5). Methacrylyl-CoA was the main product, with a peak at 30.7 min. The concentration of methacrylic acid formed during the crude enzyme assay was 74 μM.

[00272] In order to confirm that the methacrylyl-CoA peak was genuine, and that it was not an isobutyryl-CoA peak with an altered elution time, the sample was boosted with isobutyryl-CoA and analyzed by HPLC one more time. turn. ACX4 was inactivated when the sample was acidified and this ensured that any additional isobutyryl-CoA was not converted to methacrylyl-CoA. Indeed, the sample reinforced with isobutyryl-CoA showed not only the original methacrylyl-CoA peak but also an additional peak at 32 min with the characteristic tail peak of isobutyryl-CoA (Fig. 6).

[00273] To determine whether methacrylic acid would be produced from isobutyric acid in an enzyme binding reaction, an experiment was established whereby crude ACX4 was incubated with purified CtHis-4HBT enzyme. The same cell-free extract of ACX4 was used as the protein source for ACX4, although pure CtHis-4HBT was prepared again in the same manner as for its kinetic characterization in example 1, but performing a buffer exchange to HEPES buffer (50 mM, pH 7.5) at the end, instead of the previously used phosphate buffer. Thus, crude ACX4 (0.8 mg.ml-1) was coincubated with pure CtHis-4HBT (0.6 mg.ml-1) together with FAD (10 μM) and isobutyryl-CoA (500 μM) in HEPES buffer . The sample was incubated at 30°C with shaking at 250 rpm for 30 min, and analyzed by HPLC. Methacrylic acid and coenzyme A were the main products. The methacrylic acid peak was observed at 13.45 min while the major and minor coenzyme A peaks were observed at 11.1 min and 12.1 min, respectively. The concentration of methacrylic acid generated during the enzyme-bound reaction (Fig. 7) was 345 μM, 4.7 times higher than that during the crude ACX4 assay alone.

[00274] This confirms that ACX4 oxidizes isobutyryl-CoA. It was also demonstrated that the combination of ACX4 with 4HBT in vitro allows the conversion of isobutyryl-CoA to methacrylic acid at industrially applicable levels. 1.5 Example 3 - A whole cell biotransformation of isobutyric acid to methacrylic acid.

[00275] Another biotransformation of isobutyric acid to methacrylic acid using an acyl-CoA synthetase to activate isobutyric acid with coenzyme A to form isobutyryl-CoA is shown in the present example, and for the Arabidopsis thaliana acyl-CoA oxidase ACX4 to oxidize the isobutyryl-CoA for methacrylyl-CoA as well as for the acyl-CoA thioesterase 4HBT from Arthrobacter sp. SU strain to hydrolyze methacrylyl-CoA to methacrylic acid and coenzyme A is also shown.

[00276] The acyl-CoA synthetase AcsA from Pseudomonas chlororaphis B23 (Genbank accession number: BAD90933.1, Uniprot accession number: Q5CD72) was identified from a database and literature search as an acyl-CoA synthetase that forms AMP capable of activating isobutyric acid to isobutyryl-CoA, with a published Michaelis constant (Km) of 0.14 mM, and turnover number (kcat) of 10.6 s-1.

[00277] In this example, we demonstrate the construction of a vector based on pET20b(+), pET20b(+)::4HBT-ACX4-AcsA, for the co-expression of genes encoding 4HBT, ACX4 and AcsA from a single operon under the control of the T7 promoter of pET20b(+), and its use to encode the metabolic pathway for the whole cell biotransformation of isobutyric acid to methacrylic acid.

[00278] Construction of the operon was carried out in two stages. The first stage comprised the construction of a vector based on pET20b(+), pET20b(+)::4HBT-ACX4, for the co-expression of the genes encoding only 4HBT and ACX4, while the second stage involved the subcloning of the gene encoding AcsA into the pET20b(+)::4HBT-ACX4 vector, with its own ribosome binding site in place, in order to construct the final pET20b(+)::4HBT-ACX4-AcsA plasmid.

[00279] In order to construct the pET20b(+)::4HBT-ACX4 vector, the genes encoding 4HBT and ACX4 were first joined into a single polynucleotide, with a new ribosome binding site between the gene encoding 4HBT and the one encoding ACX4 , in order to guarantee the efficient translation of the latter. To join the two genes together, an overlap extension polymerase chain reaction was performed. The overlap extension polymerase chain reaction was itself performed in two steps. First, the genes encoding 4HBT and ACX4 were amplified from their respective expression vectors, pET20b(+)::4HBT and pET20b(+)::ACX4, in two separate polymerase chain reactions, reactions 'A' and 'B' .

[00280] The primers used for the overlap extension polymerase chain reaction were primer OE.A.F (SEQ. ID 7), the forward primer for the overlap extension polymerase chain reaction A; primer OE.A.R (SEQ. ID 8), the reverse primer for the polymerase A chain reaction; primer OE.B.F (SEQ. ID 9), the forward primer for the overlap extension polymerase chain reaction B and finally, OE.B.R (SEQ. ID 10), the reverse primer for the overlap polymerase chain reaction of overlap extension B. The overhang of the OE.A.F primer was designed to maintain an NdeI restriction site at the 5' end of the new polynucleotides. The projections of the OE.A.R and OE.B.F primers were planned to contain sequences complementary to each other in order to allow the concatenation of the two PCR products from reactions A and B. The complementary sequence was planned such that in the concatenation of the two products of PCR, an intergenic sequence between the 4HBT gene and the ACX4 gene would be introduced, containing a new ribosome binding site for the latter gene. Finally, the OE.B.R primer design was designed to contain two restriction sites, an NheI restriction site and an XhoI restriction site. this took into account the concatenated polynucleotide containing the 4HBT and ACX4 genes to be cloned into the plasmid pET20b(+) at their NdeI and XhoI restriction sites to form pET20b(+)::4HBT-ACX4 and for the AcsA gene to be cloned into the plasmid pET20b(+)::4HBT-ACX4 between the NheI and XhoI restriction sites to form plasmid pET20b(+)::4HBT-ACX4-AcsA. An adenine- and thymine-rich spacer sequence was included between the NheI and at adjacent NheI and XhoI restriction sites.

[00281] The polymerase A chain reaction (50 μl) contained pET20b(+)::4HBT (10 pg.μl-1) as the standard DNA, KOD DNA polymerase (1 unit), primer OE.A.F (0, 4 μM), OE.A.R primer (0.4 μM), deoxyadenosinetriphosphate (dATP) (0.2 mM), deoxythymidine triphosphate (dTTP) (0.2 mM), deoxycytidine triphosphate (dCTP) (0.2 mM), deoxyguanosine - triphosphate (dGTP) (0.2 mM), MgCl2 (1 mM) and Novagen buffer for KOD DNA polymerase (1X).

[00282] The polymerase B chain reaction (50 μl) was composed of pET20b(+)::ACX4 (20 pg.μl-1) as standard DNA, KOD DNA polymerase (1 unit), primer OE.B.F (0 .4 μM), OE.B.R primer (0.4 μM), dATP (0.2 mM), dTTP (0.2 mM), dCTP (0.2 mM), dGTP (0.2 mM), MgCl2 ( 1 mM) and Novagen buffer for KOD DNA polymerase (1X).

[00283] Both PCR reactions were carried out in parallel and under the same conditions, starting with an initial denaturation step at 95°C for 3 min, followed by 25 cycles consisting of a 15 s denaturation step at 98°C, an annealing step of 2 s at 50°C and an extension step of 20 s at 72°C. These 25 cycles were followed by another 5 min extension step at 72°C. The two double-stranded PCR products, product A and product B, were purified by agarose gel electrophoresis and gel extraction, and their concentrations determined by analytical agarose gel electrophoresis.

[00284] PCR products A and B were then concatenated in a second polymerase chain reaction consisting of PCR product A (15 nM), PCR product B (15 nM), dATP (0.2 mM), dTTP (0.2 mM), dCTP (0.2 mM), dGTP (0.2 mM), MgCl2 (1 mM), Novagen Buffer #1 for KOD DNA polymerase (1X), dimethyl sulfoxide (5% (v /v)) and KOD DNA polymerase (8 nl/μl). The reaction was carried out in a thermocycler programmed to start at 95°C for 3 min and continued with 15 cycles of a 15 s denaturation step at 98°C, a 2 s annealing step at 50°C, and an extension step of 20 s at 72°C, and finally finish with an additional extension step lasting 5 min at 72°C.

[00285] After this PCR program, the outer forward primer and outer reverse primer used in the amplification of A and B, respectively, were added directly from a concentrated stock (50 μM) to a final concentration of 0.5 μM. The modified PCR reaction mixture was then subjected to another PCR, with the thermal cycler programmed to begin with an initial melting step of 3 min at 95°C, and continue with 15 cycles consisting of a melting step lasting 15 s at 98°C, an annealing step lasting 2 s at 55°C, and an extension step lasting 20 s at 72°C, before ending with an additional extension step lasting 5 min at 72°C.

[00286] The product of this concatenation step (SEQ. ID 11) was purified by agarose gel electrophoresis and gel extraction, and was blunt-end ligated into the pJET1.2 cloning vector to form pJET1.2::4HBT-ACX4. The polynucleotide containing the concatenated 4HBT and ACX4 genes was then subcloned into pET20b(+), forming pET20b(+)::4HBT-ACX4. The plasmid pET20b(+)::4HBT-ACX4 was then linearized by digestion at the NheI and XhoI restriction sites.

[00287] For the next phase in the construction of the pET20b(+)::4HBT-ACX4-AcsA plasmid, a gene encoding the AcsA amino acid sequence was codon optimized for expression in E. coli and synthesized by Biomatik Corporation with a site XhoI restriction sequence attached to the 3' end, and a short sequence attached to the 5' end. This sequence contained an NheI restriction site, a ribosome binding site, and a spacer sequence ending in a cytosine-adenine-thymine trinucleotide, which together with the AcsA start codon encoded an NdeI restriction site.

[00288] The AcsA polynucleotide optimized at the synthesized codon (SEQ. ID 12) was released into the cloning plasmid pBMH::AcsA and the AcsA gene was subcloned together with its 5' ribosome binding site into the pET20b(+) vector: :4HBT-ACX4 linearized, between the NheI and XhoI restriction sites, forming the plasmid pET20b(+)::4HBT-ACX4-AcsA (Fig. 8). This plasmid was then transformed into E. coli BL21 (DE3) pLysS, forming E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA. The sequence between and inclusive of the NdeI and XhoI restriction sites in plasmid pET20b(+)::4HBT-ACX4-AcsA is shown in SEQ ID NO 13.

[00289] In order to construct a strain for expression of only the AcsA gene, the AcsA gene alone was subcloned out of the pBMH::AcsA cloning vector and into the pET20b(+) plasmid, between the NdeI and XhoI restriction sites, forming pET20b(+)::AcsA. The pET20b(+)::AcsA plasmid was then transformed into E. coli BL21(DE3) pLysS, forming E. coli BL21(DE3) pLysS pET20b(+)::AcsA.

[00290] The co-expression of 4HBT, ACX4 and AcsA by E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA was confirmed by incubating cultures (100 ml) of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4- AcsA in MSX medium supplemented with riboflavin (1 mg.L-1) at two different test temperatures, 37°C and 28°C. Cultures were grown to an OD600 of 0.5 and expression was induced with the addition of IPTG (0.4 mM). Samples were collected exactly before induction of expression, as well as 1 h, 3 h, 5 h and 20 h after induction. The control strains of E. coli BL21 (DE3) pLysS pET20b(+)::ACX4, as prepared in example 2, and E. coli BL21 (DE3) pLysS pET20b(+)::AcsA were also grown under the same conditions . Samples collected during co-expression of 4HBT, ACX4 and AcsA in E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4- AcsA, as well as those collected during expression of ACX4 alone in E. coli BL21 (DE3 ) pLysS pET20b(+)::ACX4 and AcsA in E. coli BL21 (DE3) pLysS pET20b(+)::AcsA were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

[00291] Analysis by SDS-PAGE (Fig. 9) showed that when expression was performed at 37°C, 5 h after induction, high levels of soluble 4HBT (bottom band on the left) and good levels of ACX4 (top left lane) were detected with very little insoluble protein detected, although high levels of insoluble AcsA (top right lane) were detected with no visible AcsA protein in the soluble fractions. Line 1) Empty pET20b(+) vector negative control. 2) BR protein ladder spectra. 3) expression of 0 h soluble pET20b(+)::4HBT-ACX4-AcsA. 3) 3 h soluble. 4) 5 h soluble. 5) 0 h insoluble. 6) expression of 5 h soluble pET20b(+)::AcsA. 7) soluble pET20b(+)::ACX4. 8) soluble pET20b(+)::4HBT. 9) pET20b(+):4HBT-ACX4-AcsA 0 h insoluble. 10) pET20b(+):4HBT-ACX4- AcsA 3 h insoluble. 11) pET20b(+):4HBT-ACX4-AcsA 5 h insoluble. 12) pET20b(+)::AcsA 5 h insoluble.

[00292] To test the ability of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA to convert isobutyric acid to methacrylic acid, an MSX pre-culture (20 ml), supplemented with carbenicillin and chloramphenicol , was inoculated from a single colony of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA on an LB agar plate supplemented with glucose, carbenicillin and chloramphenicol, and was incubated at 37°C with stirring at 200 rpm for 16 h. The cells were harvested by centrifugation at 5000g for 15 min at 4°C, and the cells were resuspended in MSX medium (100 ml) supplemented with carbenicillin, chloramphenicol and riboflavin, in a 250 ml shake flask and this culture was incubated at 37°C with stirring at 200 rpm. Gene coexpression was induced with the addition of IPTG (0.4 mM) at an OD600 of 0.5. The culture was incubated for an additional 1 h before adding potassium isobutyrate (pH 7.0) from a concentrated stock concentration of 500 mM to a final concentration of 5 mM in the culture medium. Samples were collected immediately after the addition of isobutyric acid (0 h sample) and then at 1 h, 2 h, 4 h, 6 h, 8 h and 19.5 h thereafter.

[00293] Samples collected during the biotransformation of isobutyric acid to methacrylic acid were centrifuged in an Eppendorf miniSpin F-45-12-11 rotor for 5 min at 6000 rpm. Supernatants were filtered through 0.2 μm Sartorius RC 4 mM filters and then acidified to pH 2.5 with 5 M HCl. The acidified supernatant was injected onto an Agilent Zorbax Eclipse XDB C18 column (4.6 mm x 150 mm). HPLC was performed at 0.4 ml.min-1 and methacrylic acid was resolved from isobutyric acid by an isocratic elution with 14% acetonitrile in KH2PO4 that was adjusted to pH 2.5 with HCl. The column was washed between runs by increasing the flow rate to 1 ml.min-1 and the acetonitrile concentration to 75% for 15 min before conditions were returned to a flow rate of 0.4 ml.min-1 and 14% acetonitrile for the next sample. The column was allowed to equilibrate for 20 min before injection of the next sample.

[00294] Three negative controls were also performed and analyzed. The first control was the negative control strain, E. coli BL21 (DE3) pLysS pET20b(+), which did not contain the 4HBT-ACX4-AcsA coexpression operon and was grown without any isobutyric acid added to the medium after IPTG was added to the culture medium. The second control used the same strain as that used in the first control, but isobutyric acid (5 mM) was added 1 h after the addition of IPTG to the culture medium. The third control used the same E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA as used in the main biotransformation culture, but no isobutyric acid was added to the culture medium after coexpression of 4HBT, ACX4 and AcsA was induced.

[00295] A summary of the HPLC traces observed in figure 10, which are traces of samples collected at 20.5 hours after induction, from all four cultures that were tested (19.5 h biotransformation time). Figure 10C is a standard of isobutyric acid (5 mM) and Figure 10E is a standard of isobutyric acid (5 mM) mixed with a standard of methacrylic acid (200 μM). Figures 10A, 10B and 10D show that no methacrylic acid was formed in any of the controls and figure 10F shows that methacrylic acid was in fact formed during biotransformation.

[00278] Figure 11 summarizes the production of methacrylic acid over time as well as the growth of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT- ACX4-AcsA during biotransformation where the final concentration of the desired product of methacrylic acid is around 0.25 mM.

[00296] In this example, a whole cell process for converting feed stock from isobutyric acid to methacrylic acid at industrially applicable levels was demonstrated, by co-expressing 4HBT, ACX4 and AcsA in vitro in recombinant E. coli. 1.6 Example 4 - Formation of methacrylic acid from glucose

[00297] The branched-chain keto acid dehydrogenase complex from Pseudomonas putida KT2440 was previously shown to catalyze the oxidative decarboxylation of 2-ketoisovaleric acid to isobutyryl-CoA in a recombinant metabolic pathway for the production of isobutyric acid in E. coli (Zhang, K., Xiong, M. and Woodruff, A. P. 2012, Cells and methods for producing isobutyric acid, International Patent Number WO 2012/109534 A2). The genes encoding the branched-chain keto acid dehydrogenase alpha subunit (bkdA1), the branched-chain keto acid dehydrogenase beta subunit (bkdA2), the lipoamide acyltransferase component (bkdB), and the lipoamide dehydrogenase component (lpdV) of the complex of branched-chain keto acid dehydrogenase are clustered adjacent to each other and are all found under the control of a single promoter in the genomic DNA of Pseudomonas putida KT2440 (Genbank accession number AE015451.1).

[00298] The entire wild-type sequence encoding the bkdA1, bkdA2, bkdV and lpdV genes, as they appeared in the genomic DNA of Pseudomonas putida KT2440 between nucleotides 4992042 and 4996988, was synthesized by Biomatik Corporation as a single polynucleotide, ppBCKD (SEQ . ID 14). The ppBCKD polynucleotide contained an XhoI restriction site at the 3' end, and a short sequence at the 5' end, immediately before the start codon of the bkdA1 gene. This 5' appended sequence contained an XbaI restriction site, a spacer sequence, an NheI restriction site, a ribosome binding site, and a second spacer sequence. The XbaI site was included to allow the insertion of the ppBCKD polynucleotide into the pET20b(+) plasmid for the construction of pET20b(+)::ppBCKD, capable of expressing only the four branched-chain keto acid dehydrogenase genes from Pseudomonas putida KT2550. The first spacer sequence was included in order to maintain the same number of base pairs between the T7 promoter and the ribosome binding site in the pET20b(+)::ppBCKD plasmid as exists in the pET20b(+) plasmid, and with the exception Of the six nucleotides encoding the NheI site just before the ribosome binding site, the spacer sequence is identical to that between the XbaI site and the ribosome binding site in plasmid pET20b(+). The NheI restriction site was included to allow insertion of the ppBCKD polynucleotide into the pET20b(+)::4HBT-ACX4 plasmid to construct the pET20b(+)::4HBT-ACX4-ppBCKD plasmid. The ribosome binding site and spacer sequence were identical to those used exactly before the bkdA1 gene when the BCKD genes were expressed for isobutyric acid production which was previously reported (Zhang, K., Xiong, M. and Woodruff, A. P. 2012 , Cells and methods for producing isobutyric acid, International Patent Number WO 2012/109534 A2).

[00299] The single polynucleotide containing the four branched-chain keto acid dehydrogenase genes from Pseudomonas putida KT2440 was delivered in plasmid pBSK (pBSK::ppBCKD). The four genes were subcloned from plasmid pBSK::ppBCKD and into plasmid pET20b(+)::4HBT-ACX4 of Example 2, between the NheI and XhoI restriction sites, to form pET20b(+)::4HBT-ACX4-ppBCKD (Fig. 12). Sequence ID 15 shows the sequence between the NdeI and XhoI restriction sites in plasmid pET20b(+)::4HBT-ACX4-ppBCKD. Plasmid pET20b(+)::4HBT-ACX4-ppBCKD was transformed into E. coli BL21(DE3) pLysS to form E. coli BL21(DE3) pLysS pET20b(+)::4HBT-ACX4- ppBCKD. Similarly, the four genes were also subcloned into plasmid pET20b(+) between NheI and XhoI restriction sites to form pET20b(+)::ppBCKD, and this plasmid was transformed into E. coli BL21(DE3) pLysS to form E. coli BL21(DE3) pLysS pET20b(+)::ppBCKD. This latter strain was used to help identify bands on an SDS-PAGE gel corresponding to the bkdA1, bkdA2, bkdB, and lpdV genes during expression studies (not shown).

[00300] An MSX preculture (10 ml) supplemented with carbenicillin and chloramphenicol was inoculated with E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD from a single colony on an LB agar plate supplemented with glucose, carbenicillin and chloramphenicol. Cultures were incubated at 37°C with shaking at 250 rpm for 16 h. Cells were harvested by centrifugation at 5000g for 15 min at 4°C and then resuspended in fresh MSX medium (100 ml) that was supplemented with riboflavin as well as carbenicillin and chloramphenicol, in a 500 ml shake flask. Fresh cultures were incubated at 37°C with shaking at 250 rpm and expression was induced in each culture at an OD600 of 0.5 by the addition of IPTG (0.4 mM). Cultures were incubated for an additional 17 h before samples were collected for analysis by reversed-phase high-performance liquid chromatography (RP-HPLC). A repeat culture was performed for the negative control culture E. coli BL21 (DE3) pLysS pET20b(+).

[00301] The samples were centrifuged in an Eppendorf miniSpin F-45-12-11 rotor for 5 min at 6000 rpm. Supernatants were filtered through 4 mM Sartorius RC 0.2 micron filters and then acidified to pH 2.5 with 5 M HCl. The acidified supernatant was injected onto an Agilent Zorbax Eclipse XDB C18 column (4.6 mm x 250 mm). HPLC was performed at 1 ml.min-1 and the analytes were eluted by isocratic elution with 14% acetonitrile in 50 mM KH2PO4 which was adjusted to pH 2.5 with HCl. The column was washed between runs by increasing the acetonitrile concentration to 75% for 15 min before being returned to 14% acetonitrile for a 20 min re-equilibration step.

[00302] The standards of methacrylic acid (0.2 mM), isobutyric acid (5 mM) and 2-ketoisovaleric acid (5 mM) eluted at 3.6 min, 8.3 min and 8.6 min, and with areas peak values 5980 mAU.min, 330 mAU.min and 1580 mAU.min, respectively. HPLC analysis of a cocktail of 2-ketoisovaleric acid (5 mM), isobutyric acid (5 mM) and methacrylic acid (200 μM) is shown in figure 13.

[00303] HPLC analysis of the sample collected from the negative control culture E. coli BL21 (DE3) pLysS pET20b(+), shown in figure 14, did not show any peak in the region expected for methacrylic acid, while analysis of the sample collected from culture of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD showed a peak at 8.6 min with a peak area of 0.88 AU.min, corresponding to a methacrylic acid concentration of 0. 11 mM (Fig. 15).

[00304] To confirm that the peak was indeed representative of methacrylic acid, the sample was boosted with an additional 0.24 mM of methacrylic acid from a 10 mM stock solution, and this boosted sample was also analyzed by HPLC, shown in figure 16. A single peak with an area of 2.7 AU.min, corresponding to a methacrylic acid concentration of 0.34 mM was observed at 8.5 min, corroborating that the E. coli BL21 (DE3) strain pLysS pET20b(+)::4HBT-ACX4-ppBCKD produces methacrylic acid directly from glucose.

[00305] To determine whether supplementing cultures with 2-ketoisovaleric acid would enhance methacrylic acid production, two pre-cultures of MSX (10 ml) supplemented with carbenicillin and chloramphenicol were once again prepared by inoculating one with E. coli BL21 ( DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD and the others with E. coli BL21 (DE3) pLysS pET20b(+) as before. Pre-cultures were incubated at 37°C with shaking at 250 rpm for 16 h before the cells were pelleted and resuspended in fresh MSX medium (100 ml) supplemented with riboflavin, chloramphenicol and carbenicillin in a shake flask. 500 ml. Expression was induced in each culture at an OD600 of 0.5 by the addition of IPTG (0.4 mM), and the cultures were incubated for an additional 3 h before the addition of 2-ketoisovalerate (pH 7.0) until a final concentration of 5 mM in each culture. Cultures were incubated for an additional 14 h. Culture samples were collected and analyzed by high-performance liquid chromatography with isocratic elution as described for cultures that were not supplemented with 2-ketoisovaleric acid.

[00306] HPLC analysis of the sample collected 14 h after 2-ketoisovalerate was added to the negative control culture of empty E. coli BL21 (DE3) pLysS pET20b(+), shown in figure 17, showed no peak in region where methacrylic acid is usually observed, as expected. It did, however, show some background consumption of 2-ketoisovaleric acid (Fig. 6), with the peak area for this 2-ketoisovaleric acid in this culture being 3353 mAU.min, corresponding to 2.8 mM of 2-ketoisovaleric acid. -Ketoisovaleric remaining in the culture as opposed to the original 5 mM.

[00307] When the sample collected 14 h after 2-ketoisovalerate was added to the culture expressing the genes for the conversion of 2-ketoisovaleric acid to methacrylic acid, the culture of E. coli BL21 (DE3) pLysS pET20b(+) ::4HBT-ACX4-ppBCKD, a peak at 8.4 min with a peak area of 1890 mAU.min appeared in the HPLC trace (Fig. 18), indicating that methacrylic acid was produced at a concentration of 0.24 mM . No 2-ketoisovaleric acid was detected in this sample, indicating that it was completely consumed during the conversion of 2-ketoisovaleric acid to methacrylic acid.

[00308] The sample was reinforced with an additional 0.24 mM methacrylic acid and analysis of the reinforced sample (Fig. 19) showed a peak with a peak area of 3.4 AU.min, corresponding to the concentration of methacrylic acid of 0.44 mM, therefore the original methacrylic acid peak was genuine.

[00309] In this example, the branched-chain keto acid dehydrogenase, namely BCKD from Pseudomonas putida KT2440, was co-expressed with an acyl-CoA oxidase, namely ACX4 from Arabidopsis thaliana, and a thioesterase enzyme, namely 4HBT from Arthrobacter sp. SU strain in a cellular system. It has been demonstrated that the production of methacrylic acid from a key feed stock such as glucose which is readily available from biomass using recombinant E.coli is possible, and further that the production of said methacrylic acid can be enhanced by supplementation of growth medium with 2-ketoisovaleric acid. 1.7 Example 5: Whole-cell production of butyl methacrylate from 2-ketoisovalerate by recombinant Escherichia coli

[00310] The A. thaliana ACX4 gene was codon optimized for E. coli, synthesized and cloned into the pET16b (Sse) vector. The gene was digested with NheI/Sse8387I and ligated into pET16b (Sse) digested with XbaI/Sse8387I. The resulting plasmid, pMMA121 (see Fig. 20), was introduced into E. coli BL21(DE3), and recombinant E. coli (BL21(DE3)/pMMA121) was grown as follows; BL21(DE3)/pET16b (vector control) or BL21(DE3)/ pMMA121 was inoculated into LB medium supplemented with ampicillin (0.1 mg/ml) and cultured overnight in a test tube at 37°C. An aliquot of an overnight culture was transferred to the 100 ml of the same medium in a flask and shaken at 37°C for 2 to 3 hours. IPTG (1 mM final) was added to the flask and the culture was incubated with shaking at 20°C overnight.

[00311] The cells were harvested by centrifuge and placed in suspension in 0.1 M sodium phosphate buffer (pH 7.0), then disrupted by sonication. Disrupted E. coli cells were centrifuged for supernatant and pellet fractions, and both vector control and pMMA121-containing cells were analyzed for ACO (acyl-CoA oxidase) activity (see Fig. 21) and ACX4 protein expression by SDS-PAGE (see Fig. 22). Figure 21 shows the presence of only IBA-CoA in the buffer, the presence of IBA-CoA and a small amount of CoA in the sample containing cells comprising only the unchanged pET16b plasmid, and the presence of MAA-CoA, much less IBA-CoA and an unknown compound in the sample containing cells comprising the plasmid pMMA121. Therefore, a high ACO activity was detected in the supernatant fraction of BL21/pMMA121 indicated by the production of methacrylyl CoA, showing that the 40 kDa protein detected by SDS-PAGE in Figure 22 is the ACX4 protein. SDS-PAGE shows in line 1 - BL21/pET16b (vector) SF (soluble fraction); line 2 - BL21/pMMA121 SF; line 3 - BL21/pET16b SE (insoluble fraction); line 4 - BL21/pMMA121 SE; and line 5 - molecular weight marker. Around 40 kDa, a band (highlighted by black boxes) was observed only in the BL21/pMMA121 lines but not in the BL21/pET16b (vector) lines.

[00312] The BCKAD complex gene was cloned from Pseudomonas aeruginosa strain PA01 as follows. The DNA fragment containing an entire gene operon encoding the BCKAD complex gene was obtained by the PCR method with primers BCKAD.F and BCKAD.R (table in 1.1.3) using genomic DNA as a template. The fragment obtained was digested with restriction enzymes BspHI and Sse8387I, and inserted into the vector pET16b(Sse) between NcoI/Sse8387I (BamH site of pET16b was converted to Sse8387I site). The resulting plasmid was named pWA008 (see Fig. 23).

[00296] A plasmid for expressing Apple AAT and ACX4 from A. thaliana was constructed as follows. The DNA fragments containing the AAT or ACX4 gene were amplified by the PCR method with primers AAT.F and AAT.R or ACX4.F and ACX4.R (table in 1.1.3), using a plasmid containing the AAT gene optimized in codon or pMMA121 as a standard, respectively. The pET(Sse) vector was digested with restriction enzymes NcoI and Sse8387I and joined with the DNA fragment containing the AAT gene, using the In-Fusion HD Cloning Kit (Takara Bio). The resulting plasmid, pAAT212, was digested with the SpeI restriction enzyme and joined with the DNA fragment containing the ACX4 gene, using the In-Fusion HD Cloning Kit. The resulting plasmid, pMMA133, contained the AAT and ACX4 genes with control from the T7 promoter (see Fig. 23).

[00313] A plasmid for expressing BCKAD, AAT and ACX4 was constructed as follows. Plasmid pMMA133 was digested with restriction enzymes SpeI and Sse8387I, and the linearized DNA fragment was obtained. Plasmid pWA008 was digested with XbaI and Sse8387I restriction enzymes and the 5.0 kb fragment containing the BCKAD complex gene was isolated. Both fragments were ligated using the ‘Mighty Mix’ DNA Ligation Kit (manufactured by Takara Bio Inc.). The resulting plasmid pMMA134 (see Fig. 23) was introduced into E. coli BL21(DE3) for butyl methacrylate production experiments.

[00314] E. coli BL21(DE3)/pMMA134 was cultured in essentially the same manner as described above regarding ACX4 expression. Cells were harvested by centrifuge, washed with 0.1 M sodium phosphate buffer (pH 7.0) and suspended in the same buffer to obtain cell suspension. Using the cell suspension, about 1 ml of a resting cell reaction solution was prepared in each vial, which contained 40 mM 2-ketoisovalerate (2-oxoisovalerate), 60 mM butanol, 0.05 M of sodium phosphate buffer (pH 7.0) and cells (OD650 = 12.5). Reactions were carried out at 30°C, 180 rpm for 3 to 44 hours, and 1 ml of acetonitrile was added to the vials and mixed well to stop the reaction. After filtration using a DISMIC syringe filter/bore diameter 0.45 micron (manufactured by ADVANTEC), analysis was done by HPLC on the ODS column. HPLC conditions were as follows: Apparatus: Waters 2695, Column: CAPCELL PAK C18 UG120, 2.0 mm I.D. x 250 mm, Mobile phase: 0.1% phosphoric acid / 65% methanol, Flow amount: 0.25 ml/min, Conduction time: 12 min, Column temperature: 35°C and Detection: UV 210 nm. Figure 24 shows the concentration of the following chemicals with fermentation time: ■, 2-ketoisovalerate (2- OIV); ▲, Isobutyric acid (IBA); ♦, Butyl methacrylate (BMA): and x, Methacrylic acid (MAA). As the concentration of the 2-ketoisovalerate (2-oxoisovalerate) feedstock falls, production of the intermediate in the isobutyric acid pathway increases, as does production of the final ester product butyl methacrylate.

[00315] This example demonstrates the viable in vivo production of a methacrylic acid derivative, butyl methacrylate methacrylate ester, from the biochemical intermediate 2-ketoisovalerate (2-oxoisovalerate) which is produced directly from glucose, and the reagent butanol which is a common industrial feed stock. Production of butyl methacrylate is demonstrated at industrially applicable levels from cell culture of recombinant E. coli expressing the BCKAD operon to convert 2-ketoisovalerate to isobutyryl CoA, ACX4 oxidase to convert isobutyryl CoA to methacrylyl CoA, and AAT to convert methacrylyl CoA to butyl methacrylate by reaction with butanol.

[00316] Attention is directed to all papers and documents which are filed concurrently with or prior to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

[00317] All features disclosed in this specification (including any claims, summary and attached drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such traits and/or stages are mutually exclusive.

[00318] Each feature disclosed in this specification (including any claims, summary and attached drawings) may be replaced by alternative features serving an identical, equivalent or similar purpose, unless expressly otherwise provided. Thus, unless expressly from another mod. established, each disclosed trait is just one example of a generic series of equivalent or similar traits.

[00319] The invention is not restricted to the details of the preceding embodiment(s). The invention extends to any new detail, or any new combination, of the features disclosed in this specification (including any attached claims, abstract and drawings), or to any new, or any new combination, of the steps of any method or process so disclosed.

Claims (13)

1. Process of producing methacrylic acid and/or methacrylic acid esters, the process characterized by the fact that it comprises the following steps: (a) biologically converting isobutyryl-CoA into methacrylyl-CoA by the action of ACX4 from Arabidopsis thaliana, acyl-CoA short-chain oxidase from Arthrobacter nicotianae, and/or a peroxisomal acyl-CoA oxidase from Vigna radiata; and (b) converting methacrylyl-CoA into methacrylic acid and/or methacrylic acid esters, wherein step (b) may be biologically driven by the action of a 4-hydroxybenzoyl-CoA thioesterase (4HBT) and/or an alcohol acyltransferase; and/or wherein the methacrylic acid esters are C1 to C20 alkyl esters, most preferably C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters, such as butyl methacrylates, for example n methacrylate. -butyl. 2. Process according to claim 1, characterized by the fact that methacrylyl-CoA is converted into methacrylic acid esters biologically by the action of alcohol acyltransferase, suitably under group number EC 2.3.1.84, preferably in which the alcohol acyltransferase is derived from a fruit origin such as apple, melon or tomato origin; and/or preferably wherein the alcohol acyltransferase acts in the presence of an alcohol, for example a C1 to C12 alcohol, such as a C1 to C4 alcohol or a C4 to C12 alcohol to form the corresponding alkyl ester, such as butanol. 3. Process according to claim 1, characterized in that the process comprises an additional step (c) of converting methacrylic acid formed in step (b) into an ester of methacrylic acid, wherein step (c) can be biologically or chemically driven, preferably in which step (c) is biologically driven by the action of an esterase or hydrolase. 4. Process according to any one of claims 1 to 3, characterized by the fact that methacrylyl-CoA is converted into methacrylic acid biologically by the action of 4-hydroxybenzoyl-CoA thioesterase (4HBT), suitably under group EC 3.1.2.23 , and wherein, in any case, the 4-hydroxybenzoyl-CoA thioesterase (4HBT) is selected from any of the following enzymes: acyl-CoA thioesterase 4HBT from Arthrobacter sp., acyl-CoA thioesterase 4HBT from Arthrobacter globiformis, 4HBT from Pseudomonas sp. strain CBS-3, more preferably, the 4-hydroxybenzoyl-CoA thioesterase (4HBT) is the acyl-CoA thioesterase 4HBT from Arthrobacter sp. SU strain. 5. Recombinant microorganism, characterized by the fact that it is adapted to carry out the following steps: (a) biologically convert isobutyryl-CoA into methacrylyl-CoA by expressing ACX4 from Arabidopsis thaliana, short-chain acyl-CoA oxidase from Arthrobacter nicotianae, and/ or a peroxisomal acyl-CoA oxidase from Vigna radiata; and (b) biologically convert methacrylyl-CoA into methacrylic acid and/or methacrylic acid esters by expressing a 4-hydroxybenzoyl-CoA thioesterase (4HBT) and/or an alcohol acyltransferase; wherein the microorganism is genetically engineered to express ACX4 from Arabidopsis thaliana, short-chain acyl-CoA oxidase from Arthrobacter nicotianae, and/or a peroxisomal acyl-CoA oxidase from Vigna radiata, and wherein the microorganism is genetically engineered to express 4- hydroxybenzoyl-CoA thioesterase (4HBT) and/or alcohol acyltransferase, wherein the microorganism is a bacterium, such as Escherichia coli. 6. Recombinant microorganism according to claim 5, characterized in that the microorganism is genetically engineered by one or more heterologous nucleic acids to express ACX4 from Arabidopsis thaliana, a peroxisomal acyl-CoA oxidase from Vigna radiata and/or acyl-CoA oxidase from short chain of Arthrobacter nicotianae and/or wherein the microorganism is genetically engineered by one or more heterologous nucleic acids to express a 4-hydroxybenzoyl-CoA thioesterase (4HBT) and/or an alcohol acyltransferase. 7. Process of producing methacrylic acid and/or acrylic acid esters according to claim 1, 3 or 4, characterized in that the process uses the microorganism as defined in any one of claims 5 to 6. 8. Recombinant microorganism according to claim 5 or 6, characterized in that the microorganism expresses the following enzymes: (a) (i) ACX4 from Arabidopsis thaliana, and one or more of: (b) (i) a 4HBT , suitably from Arthrobacter sp.; (c) ) an alcohol acyltransferase. 9. Recombinant microorganism according to claim 5, 6 or 8, characterized in that the methacrylic acid esters are C1 to C20 methacrylic acid esters, suitably a C1 to C12 methacrylic acid ester, such as a C1 to C4 or C4 to C12 methacrylic acid ester; and wherein the microorganism is capable of converting methacrylyl-CoA to a C1 to C20 methacrylic acid ester, suitably a C1 to C12 methacrylic acid ester, such as a C1 to C4 or C4 to C12 methacrylic acid ester by expression of alcohol acyl transferase, preferably wherein the alcohol acyl transferase is of a fruit origin such as apple, melon or tomato origin. 10. Fermentation process, characterized by the fact that it comprises cultivating one or more microorganisms, as defined in any one of claims 5, 6, 8 or 9, in a fermentation medium to produce methacrylic acid and/or methacrylic acid esters , wherein the methacrylic acid esters may be C1 to C20 alkyl esters, more preferably, C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters. 11. Recombinant microorganism according to any one of claims 5, 6, 8 or 9, characterized by the fact that the recombinant microorganism is present in a fermentation medium, which further preferably comprises methacrylic acid and/or methacrylic acid esters, wherein the methacrylic acid esters may be C1 to C20 alkyl esters, most preferably, C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters. 12. Recombinant microorganism according to any one of claims 5, 6, 8, 9 or 11 characterized by the fact that the recombinant microorganism is present in a bioreactor. 13. Method for preparing polymers or copolymers of methacrylic acid or methacrylic acid esters, the method characterized by the fact that it comprises the steps of: (i) preparing methacrylic acid and/or methacrylic acid esters as defined in any of the claims of 1 to 4; (ii) optionally esterifying the methacrylic acid prepared in (i) to produce the methacrylic acid ester; (iii) polymerizing methacrylic acid and/or methacrylic acid esters prepared in (i) and/or, if present, the ester prepared in (ii), optionally with one or more comonomers, to produce polymers or copolymers thereof, wherein methacrylic acid esters may be C1 to C20 alkyl esters, more preferably C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters.