BR122022015158A2 - DNA MOLECULE AND ITS USE, PLANT CELL, PLANT, PART OF PLANT, METHOD OF PRODUCTION OF PLANT MATERIAL, BIOLOGICAL SAMPLE, METHOD OF IDENTIFICATION OF THE BIOLOGICAL SAMPLE, METHOD OF PRODUCTION OF A PLANT PRODUCT, METHOD OF PRODUCTION OF A SEED, METHOD FOR ENHANCED EXPRESSION OF A POLYNUCLEOTIDE SEQUENCE - Google Patents

Abstract

An expression enhancing element comprising a 36 nucleotide DNA sequence that can be used to enhance gene expression and, in particular, to enhance expression of endogenous plant genes in plants is disclosed. Also disclosed are plants, parts of plants, and commodity plant products comprising the expression-enhancing element along with related methods of using the expression-enhancing element and plants comprising the expression-enhancing element.

Description

DNA MOLECULE AND ITS USE, PLANT CELL, PLANT, PART OF PLANT, METHOD OF PRODUCTION OF PLANT MATERIAL, BIOLOGICAL SAMPLE, METHOD OF IDENTIFICATION OF THE BIOLOGICAL SAMPLE, METHOD OF PRODUCTION OF A PLANT PRODUCT, METHOD OF PRODUCTION OF A SEED, METHOD FOR ENHANCED EXPRESSION OF A POLYNUCLEOTIDE SEQUENCE

[0001] The listing of sequences contained in the file named "10074WO1_ST25.txt", which was electronically deposited with this application, is incorporated herein by reference in its entirety.

BACKGROUND

[0002] Methods of using CRISPR technology, Zinc Finger Nuclease and nucleases with transcription activator-type effectors (TALEN) for genome editing in plants are disclosed in documents US 20150082478, US 2015/0059010A1 and Bortesi et al., 2015, Biotechnology Advances, pages 41 to 52, volume 33, no. 1. Ellis et al., 1987, EMBO J. (6):11:3203-3208, disclose a 16 base pair bacterial octopine synthase gene enhancer element that can increase exogenous gene expression in maize and tobacco protoplasts in transient expression assays. PCT patent application WO 2018/140899 discloses the insertion of expression enhancer elements with homology to the bacterial octopine synthetase gene enhancer element into the promoter region of a maize Lc gene into a maize protoplast genome to increase expression of that gene. There is a continuing need for plant-derived sequences capable of reliably enhancing the transcription of plant genes.

SUMMARY

[0003] DNA molecules comprising the polynucleotide sequence of SEQ ID NO: 3 are provided. Biological samples, plant chromosomes, plant cells, tissue cultures of regenerable cells comprising the plant cells, parts of plants and plants comprising the polynucleotide sequence of SEQ ID NO: 3 are also provided. on a plant chromosome. Also provided is the use of the aforementioned DNA molecules comprising the polynucleotide sequence of SEQ ID NO: 3 to: (i) enhance expression of one or more elements encoded by a transcription unit that is operatively linked to the promoter in a plant; (ii) conferring a useful trait to a plant comprising the recombinant DNA molecule, where the useful trait is abiotic stress, architecture, biotic stress tolerance, photosynthesis or optionally improved resource partitioning relative to a control plant lacking the recombinant DNA molecule; (iii) obtaining a plant or seed thereof exhibiting the useful trait of (ii); or (iv) growing a population of plants exhibiting the useful trait of (ii); optionally, wherein the plant of (i), (ii), (iii) or (iv) is a corn, soybean, cotton or canola plant; or optionally wherein the seed of (iii) is a corn, soybean, cotton or canola plant.

[0004] Methods of producing plant seeds, comprising crossing plants comprising the aforementioned DNA molecules comprising the polynucleotide sequence of SEQ ID NO: 3 with a second plant to produce plant seeds, and optionally harvesting the seed, are provided.

[0005] Methods of producing plant seeds, comprising self-fertilizing plants comprising the aforementioned DNA molecules comprising the polynucleotide sequence of SEQ ID NO: 3 for producing plant seeds and optionally harvesting the seed, are provided.

[0006] Methods of producing a plant, comprising a desired trait added comprising introducing a transgene, a target genetic alteration, or genetic locus that confers the desired trait in plants comprising the aforementioned DNA molecules comprising the polynucleotide sequence of SEQ ID NO: 3, are provided.

[0007] Methods of producing a commodity plant product, comprising processing a plant or seed comprising the aforementioned DNA molecules comprising the polynucleotide sequence of SEQ ID NO: 3 and recovering the commodity plant product from the processed plant or seed, are provided.

[0008] Methods of producing plant material, the method comprising growing a plant with an expression-enhancing element comprising SEQ ID NO: 3 operatively linked to a polynucleotide encoding transcripts, wherein expression of the polynucleotide encoding transcripts in said plant is increased compared to a control plant without the expression-enhancing element, are provided.

[0009] Methods of producing plant material, comprising: (a) providing a plant with an expression-enhancing element comprising SEQ ID NO: 3 operatively linked to a transcript-encoding polynucleotide, wherein expression of the transcript-encoding polynucleotide is increased in said plant compared to a control plant with no expression-enhancing element; and (b) growing the plant under conditions that allow expression of the polynucleotide that promotes the transcript are provided.

[0010] Methods of identifying biological samples, comprising a polynucleotide comprising a modified plant gene comprising the step of detecting the presence of SEQ ID NO: 3 in the biological sample, are provided.

[0011] Methods of producing a treated plant seed comprising bringing a seed comprising the aforementioned DNA molecules comprising the polynucleotide sequence of SEQ ID NO: 3 into contact with a composition comprising a biological agent, insecticide or fungicide, are provided.

[0012] Methods for enhancing the expression of an RNA molecule in a plant comprising expressing an RNA molecule encoded by a DNA molecule in the plant, wherein the DNA molecule encoding the RNA molecule is operatively linked to one or more DNA molecules comprising: (i) an expression enhancing element comprising SEQ ID NO: 3; (ii) a promoter; and optionally (iii) DNA molecules encoding a 5' untranslated region (5' UTR), an intron, an exon, a 3' UTR, a polyadenylation site, or a combination thereof; wherein the expression of the RNA is increased compared to a control plant without the expression enhancing element.

BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES

[0013] Figure 1 depicts the insertion efficiency of a dimer (SEQ ID NO: 2), trimer (SEQ ID NO: 3) or tetramer (SEQ ID NO: 4) of the 12 nucleotide core element (SEQ ID NO: 1) inserted into the ZmGln1-3 Promoter.

[0014] Figure 2 depicts the effect of a dimer (SEQ ID NO: 2), trimer (SEQ ID NO: 3) or tetramer (SEQ ID NO: 4) of the nucleotide sequence of core element 12 (SEQ ID NO: 1) inserted into the ZmGln1-3 promoter on the expression of ZmGln1-3, compared to controls.

[0015] Figure 3 depicts the expression of Lc (first panel), Gln1-3 (middle panel) and Gln1-4 (right panel) in protoplasts with insertion of the 36 bp enhancer (base pairs) (SEQ ID NO: 3) in these promoters (black bars), compared to expression in protoplasts without the 36 bp enhancer (white bars). Three biological replicas for each are shown separately.

[0016] Figure 4 depicts Gln1-3 expression (versus ZmActin1) in T0 events with the 36 bp enhancer insertion (SEQ ID NO: 3) in the Gln1-3 promoter (black bar), compared to expression in T0 events without the enhancer insertion or wild-type B104 control (white bars).

[0017] Figure 5 depicts Gln1-3 expression (relative to ZmAct1) in T1 individuals with the 36 bp enhancer insertion (SEQ ID NO: 3) in the Gln1-3 promoter compared to siblings without the enhancer insertion or wild-types, in the primary root, mesocotyl, and root.

DETAILED DESCRIPTION

[0018] The phrase “allelic variant”, as used herein, refers to a polynucleotide or polynucleotide sequence variant that occurs in a different strain, variety or isolate of a given organism.

[0019] The term “and/or”, when used in this document, shall be considered as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a sentence such as "A and/or B" in this document is intended to include "A and B", "A or B", "A" (alone) and "B" (alone). Likewise, the term “and/or”, as used in a sentence such as “A, B and/or C”, is intended to encompass each of the following: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0020] As used herein, the phrase “biological sample” refers to intact or non-intact plant tissue (eg, seed or ground plant tissue, minced plant tissue, freeze-dried tissue). It may also be an extract comprising intact or non-intact plant seeds or tissues. The biological sample may comprise flour, bran, flakes, syrup, oil, starch and cereals manufactured in whole or in part to contain by-products of crop plants. In certain embodiments, the biological sample is "non-regenerable" (i.e., incapable of being regenerated into a plant or plant part).

[0021] As used herein, the phrases "endogenous promoter", "endogenous gene", "endogenous plant transcription unit" and the like refer to the native form of a promoter, gene or plant transcription unit in its natural location in the organism or in the genome of an organism.

[0022] The term “exogenous”, as used herein in relation to a DNA molecule, nucleotide or polynucleotide inserted into a plant genome, refers to any DNA molecule, nucleotide or polynucleotide that is synthetic or that has been removed from its native location and that has been inserted into a new genomic location.

[0023] The term “isolated” as used herein means that it has been removed from its natural environment.

[0024] As used herein, the terms “include”, “includes” and “including” shall be construed as having at least the features to which they refer, while not excluding any additional unspecified features.

[0025] As used herein, the phrase "operationally linked" refers to a juxtaposition in which the components so described are in a relationship that allows them to function in the manner intended. For example, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. In another non-limiting example, an "expression-enhancing element" (e.g., a transcription-enhancer element) is operably linked to a promoter if the expression-enhancing element increases promoter activity (e.g., as measured by promoter-driven accumulation of a transcript or protein encoded by a transcript).

[0026] As used herein, the terms "orthologous" or "of orthology" are used to describe genes or proteins encoded by those genes that are from different species but that have the same function (for example, they encode enzymes that catalyze the same reactions or encode transcriptional regulators that control the expression of genes with similar functions). Orthologous genes will usually encode proteins with some degree of sequence identity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, or 95% sequence identity, conservation of sequence motifs, and/or conservation of structural features).

[0027] As used herein, the term "plant" includes a whole plant and any progeny, cell, tissue or part of a plant. The term "plant parts" includes any (any) part(s) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); a plant cutting; a plant cell; a plant cell culture; or a plant organ (eg pollen, embryos, flowers, fruits, buds, leaves, roots, stems and explants). A plant tissue or plant organ can be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A culture of plant cells or tissues may be capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating a plant having substantially the same genotype as the plant. The regenerable cells in a plant cell or tissue culture can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, grains, ears, spikes, bark or stems. In contrast, some plant cells are not capable of being regenerated to produce plants and are referred to herein as "non-regenerable" plant cells.

[0028] The term "purified", as used herein, defines an isolation of a molecule or compound in a form that is substantially free of contaminants normally associated with the molecule or compound in a native or natural environment and means having its purity increased as a result of being separated from other components of the original composition. The term "purified DNA molecule" is used herein to describe a nucleic acid sequence that has been separated from other compounds including, but not limited to, polypeptides, lipids and carbohydrates.

[0029] To the extent that any of the foregoing definitions are inconsistent with the definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the foregoing definition will be used in this document.

[0030] An expression-enhancing DNA element that can be used to enhance expression of polynucleotides encoding transcripts in plants comprising polynucleotide 5'-GTAAGCGCTTACGTAAGCGCTTACGTAAGCGCTTAC-3' (SEQ ID NO: 3) is disclosed. Also disclosed are plants, plant parts (e.g., seeds, leaves, roots, stems) and regenerable or non-regenerable plant cells comprising SEQ ID NO: 3. Biological samples including seed meal comprising polynucleotides comprising SEQ ID NO: 3 are also disclosed. Related methods of using plants, plant parts and plant cells comprising SEQ ID NO: 3 to produce plant materials including seeds or to produce commodity plant products comprising SEQ ID NO: 3 are also disclosed.

[0031] Expression of endogenous plant genes can be increased by inserting or forming SEQ ID NO: 3 into an endogenous plant gene such that SEQ ID NO: 3 is operatively linked to the endogenous promoter of the plant gene. In certain embodiments, operable binding to the endogenous promoter is achieved by inserting or forming one or more copies of SEQ ID NO: 3 into one or more of an endogenous promoter, 5' untranslated region (5' UTR), intron and/or 3' untranslated region of an endogenous plant gene. Since SEQ ID NO: 3 comprises a palindrome, the insertion or formation of the expression enhancing element into the endogenous gene is orientation independent. SEQ ID NO: 3 comprises a triplication of the 12 nucleotide palindromic repeat unit of the core element GTAAGCGCTTAC (SEQ ID NO: 1).

[0032] The nucleotide sequence of the 12-nucleotide core element of SEQ ID NO: 1 is present at multiple locations in the maize genome. For example, it can be found at various chromosomal locations in the B73 maize variety. According to the B73v4 version of the maize genomic sequences (available at https world wide web internet site maizegdb.org/genome/assembly/Zm-B73-REFERENCEGRAMENE-4.0 and hereinafter referred to as "B73v4 maize genome"), SEQ ID NO: 1 can be found at Chr3 coordinates 1,063,395..1,063,406 (intron of Zm00 001d039287), at Chr3 coordinates 12,253,969..12,253,980 (immediately downstream of Zm00001d039695), at Chr3 coordinates 12,265,615..12,265,626 (intron of Zm00001 coordinates). 12,277,428..12,277,439 (intron of Zm00001d039695), at Chr3 coordinates 147,698,750..147,698,761 (not within 2 kb of an annotated gene template), at Chr6, coordinates 107,132,183..107,132.19 4 (about 2 kb downstream of Zm00001d036949, coordinates Chr610949), 53,761,662..53,761,673 (out of 2 kb of an annotated gene template). Since SEQ ID NO: 1 is palindromic; it is also on the complementary strand of these coordinates.

[0033] The nucleotide sequence of the 12-nucleotide core element of SEQ ID NO: 1 is also present at various locations in the soybean genome. For example, it can be found at several chromosomal locations in the soybean variety W82 (Williams 82). According to the version of the soybean genome sequences (available at https world wide web internet site ncbi.nlm.nih.gov/genome entry "Glycine_max_v2.1” and hereinafter referred to as "W82 soybean genome"), SEQ ID NO: 1 can be found at chromosome 1 coordinates 44968347 to 44968358, at chromosome 3 coordinates 3983755 to 398873766, chromosome 6 coordinates 26074553 to 2607454064, and chromosome 1951 coordinates 44574064 to 44574062, 44575338 to 44575349 (overlapping the GLYMA_19G187100 gene) and 44581677 to 44 581688. Since SEQ ID NO: 1 is palindromic, it is also found on the complementary strand of these coordinates.

[0034] In certain embodiments, a polynucleotide, plant or plant gene comprising SEQ ID NO: 3 can additionally comprise at least 1, 2, 3 or more additional copies of SEQ ID NO: 1. Endogenous plant genes that are targeted for insertion or formation of SEQ ID NO: 3 can comprise a promoter that is recognized by RNA polymerase II and is operably linked to a transcription unit. In certain embodiments, such transcription units may comprise transcription unit elements including a 5' untranslated region (5' UTR), an intron, an exon, a microRNA coding region, a microRNA precursor coding region, a 3' UTR, a polyadenylation site, or a combination thereof. In certain embodiments, the polynucleotide sequence of SEQ ID NO: 3 is inserted or formed about 10, 20, 30 or 40 base pairs (bp) about 100, 240, 300, 400, 500, 1000, 2000, 3000 or 5000 bp from the transcription start site (TSS) of the transcription unit (or i.e., the 5' termination site of transcription produced by the transcription unit). In certain embodiments, the polynucleotide sequence of SEQ ID NO: 3 is inserted or formed about 40 base pairs (bp) about 100, 240, 300 or 400 bp from the transcription start site (TSS) of the transcription unit. Insertion or formation of SEQ ID NO: 3 can occur either 5' (i.e., upstream) or 3' (i.e., downstream) to the TSS of the transcription unit. When the polynucleotide sequence of SEQ ID NO: 3 is inserted or formed 5' to the TSS, the polynucleotide sequence of SEQ ID NO: 3 is thus located in non-transcribed regions of the endogenous promoter upstream of the TSS. In certain embodiments, the insertion or formation of SEQ ID NO: 3 is in the endogenous gene promoter (e.g., about 40 base pairs (bp) to about 100, 240, 300, or 400 bp 5' (i.e., upstream) of the TSS). Expression of a transgene that is integrated into the genome of the plant can also be increased by inserting or forming SEQ ID NO: 3 into the transgene so that it is operably linked to the promoter that is operably linked to the transgene. In certain embodiments, the insertion or formation of SEQ ID NO: 3 is in the endogenous gene promoter in 50 bp to about 280 bp 5' for TSS, in about 50 bp to about 240 bp 5' for TSS, in about 50 bp to about 200 bp 5' for TSS, in about 50 bp to about 180 bp 5' for TSS, in about 50 bp to about 160 bp 5' for TSS, about 50 bp to about 160 bp 5' for TSS, about 50 bp to about 140 bp 5' for TSS, about 50 bp to about 120 bp 5' for TSS, about 50 bp to about 100 bp 5' for TSS , by about 50 bp to about 80 bp 5' for TSS, about 50 bp to about 70 bp 5' for TSS, or about 50 bp to about 60 bp 5' for TSS. In certain embodiments, the insertion or formation of SEQ ID NO: 3 is in the promoter of the endogenous gene in 40 bp to about 280 bp 5' for TSS, in about 40 bp to about 240 bp 5' for TSS, in about 40 bp to about 200 bp 5' for TSS, in about 40 bp to about 180 bp 5' for TSS, in about 40 bp to about 160 bp 5' for TSS, about 40 bp to about 160 bp 5' for TSS, about 40 bp to about 140 bp 5' for TSS, about 40 bp to about 120 bp 5' for TSS, about 40 bp to about 100 bp 5' for TSS , by about 40 bp to about 80 bp 5' for TSS, about 40 bp to about 70 bp 5' for TSS, or about 40 bp to about 60 bp 5' for TSS. In certain embodiments, the insertion or formation of SEQ ID NO: 3 is in the endogenous gene promoter in 35 bp to about 280 bp 5' for TSS, in about 35 bp to about 240 bp 5' for TSS, in about 35 bp to about 200 bp 5' for TSS, in about 35 bp to about 180 bp 5' for TSS, in about 35 bp to about 160 bp 5' for TSS, about 35 bp to about 160 bp 5' for TSS, about 35 bp to about 140 bp 5' for TSS, about 35 bp to about 120 bp 5' for TSS, about 35 bp to about 100 bp 5' for TSS , by about 35 bp to about 80 bp 5' for TSS, by about 35 bp to about 70 bp 5' for TSS, or by about 35 bp to about 60 bp 5' for TSS. Expression of a transgene can also be increased by inserting or in vitro forming SEQ ID NO: 3 into the transgene so that it is operably linked to the promoter that is operably linked to the transgene, and then introducing the transgene into the genome of the plant (e.g., Agrobacterium-mediated transformation or biolistics).

[0035] The expression of transcript-encoding polynucleotides that are operatively linked to an enhancement element comprising SEQ ID NO: 3 can be increased compared to a control plant comprising the transcript-encoding polynucleotides but without the expression enhancement element. Those increases in expression that are mediated by SEQ ID NO: 3 can be measured by a variety of methods. In certain embodiments, a trait conferred by increased expression of the polynucleotide encoding transcripts is measured in plants comprising SEQ ID NO: 3 and compared to control plants lacking SEQ ID NO: 3. Examples of such traits that may be measured and compared in this manner include abiotic stress, biotic stress, architecture, photosynthesis, or improved resource partitioning. Improvements in such traits can be evaluated by comparing any measure of the trait itself (eg, water use efficiency, disease resistance, reduced stature, photosynthesis, or improved nitrogen use efficiency) or a surrogate for the trait (eg, seed yield and/or other biomass in kg/hectare) in plants comprising SEQ ID NO: 3 and compared to control plants lacking SEQ ID NO: 3. In certain embodiments, increased expression of the encoded transcript itself is measured directly by determining of transcript amounts (e.g., an mRNA or non-coding RNA) in plants comprising SEQ ID NO: 3 and compared to determining amounts of the polynucleotide encoding transcripts in control plants lacking SEQ ID NO: 3. Transcript amounts can be determined by a variety of techniques, including PCR (e.g., quantitative reverse transcriptase-PCR; qRT-PCR), hybridization, CRISPR- and/or sequencing-based techniques (Khodakov et al. , doi.org/10.1016/j.addr.2016.04.005; Gootenberg, et al. doi:10.1126/science.aaq0179). In certain embodiments, the expression of a polynucleotide encoding transcripts can also be determined by measuring the amounts of a protein encoded by a transcript in plants comprising it and compared to the amounts in control plants of protein lacking SEQ ID NO: 3. The amounts of the protein can be determined by a variety of techniques, including enzymatic assays (e.g., where the protein is an enzyme), techniques based on immunology, and mass spectroscopy (Chen et al. doi: 10.1186/s12 967-015-0537-6; Bruce et al. doi: 10.1002/0471250953.bi1321s41). The magnitude of the increase in transcript production may depend on the level of baseline expression of the polynucleotide encoding unmodified endogenous transcripts in the respective cells or tissues. By way of non-limiting example, the magnitude of the increase in expression of an endogenous gene modified by insertion or formation of SEQ ID NO: 3 above baseline expression levels of the unmodified endogenous gene will be greater when baseline expression levels are low. In certain embodiments, expression of the endogenous gene modified by the insertion or formation of SEQ ID NO: 3 can be increased by at least 1,2-, 1,5-, 2-, 3-, 4- or 5-fold over baseline expression levels of the unmodified endogenous gene. In certain embodiments, expression of the endogenous gene modified by the insertion or formation of SEQ ID NO: 3 can be increased by at least about 1.2 or 1.5 fold to about 2, 3, 4, 5, 6 fold or more over baseline expression levels of the unmodified endogenous gene.

[0036] In certain embodiments, it will be desirable to use genome editing molecules to introduce or form SEQ ID NO: 3 into a plant genome. Gene editing molecules for use in methods provided herein include molecules capable of introducing a double-stranded break ("DSB") or single-stranded break ("SSB") at a specific site or sequence in double-stranded DNA, such as in genomic DNA or in a target gene located within genomic DNA, as well as guide or chaperone RNA or other DNA template polynucleotides. Examples of such gene-editing molecules include: (a) a nuclease comprising an RNA-guided nuclease, an RNA-guided DNA endonuclease or RNA-directed DNA endonuclease (RdDe), a CRISPR class 1-like nuclease system, a Cas-type II nuclease, a Cas9, an nCas9 nicase, a Cas-V nuclease, a Cas12a nuclease, an nCas12a nicase, a Cas12d ( CasY), a Cas12e (CasX), a Cas12b (C2c1), a Cas12c (C2c3), a Cas12i, a Cas12j, a Cas14, a projected nuclease, a codon-optimized nuclease, a zinc finger nuclease (ZFN) or nicase, a nuclease with transcription activator-type effectors (TAL or TALEN effector nuclease) or nicase (TALE- nicase), an Argonaut and a meganuclease or modified meganuclease; (b) a polynucleotide encoding one or more nucleases capable of effecting site-specific alteration (including the introduction of a DSB or SSB) of a target nucleotide sequence; (c) a guide RNA (gRNA) for use with an RNA-guided nuclease, or a DNA encoding a gRNA for use with an RNA-guided nuclease; (d) donor DNA template polynucleotides suitable for insertion into a break in genomic DNA by homology-directed repair (HDR) or microhomology-mediated end joining (MMEJ); and (e) other DNA templates (eg, dsDNA, ssDNA, or combinations thereof) suitable for insertion into a break in genomic DNA (eg, by non-homologous end joining (NHEJ).

[0037] CRISPR technology for eukaryotic gene editing is disclosed in US Patent Application Publication 2016/0138008A1 and US2015/0344912A1, and US Patent Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,9 93,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965 and 8,906,616. Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016/0208243 A1. Plant RNA promoters for expressing plant codon-optimized CRISPR guide RNA and Cas9 CRISPR endonuclease are disclosed in International Patent Application No. PCT/US2015/018104 (published as WO 2015/131101 and claiming priority to US Provisional Patent Application 61/945,700). Methods of using CRISPR technology for genome editing in plants are disclosed in US Patent Application Publications US 2015/0082478A1 and US 2015/0059010A1 and International Patent Application PCT/US2015/038767 A1 (published as WO 2016/007347 and claiming priority to US Provisional Patent Application 62/ 023,246). In certain embodiments, an RNA-guided endonuclease is used that leaves a blunt end after cleavage of the target site. Blind-ended RNA-guided endonucleases include Cas9, Cas12c, Cas12i, and Cas 12h (Yan et al., 2019). In certain embodiments, an RNA-guided endonuclease is used that leaves a staggered single-stranded DNA overhang after cleavage of the target site used. Staggered end-cutting RNA-guided endonucleases include Cas12a, Cas12b, and Cas12e. All patent publications referenced in this paragraph are incorporated herein by reference in their entirety.

[0038] CRISPR-like genome editing can be adapted for use in the plant cells and methods provided herein in several ways. CRISPR elements, for example, gene editing molecules comprising CRISPR endonucleases and CRISPR guide RNAs including single guide RNAs or guide RNAs in combination with tracrRNAs or scoutRNA, or polynucleotides encoding the same, are useful in performing genome editing without remnants of CRISPR elements or selective genetic markers occurring in progeny. In certain embodiments, CRISPR elements are delivered directly to eukaryotic cell (e.g., plant cells), systems, methods, and compositions as isolated molecules, as isolated or semipurified products of a cell-free synthetic process (e.g., in vitro translation), or as isolated or semipurified products of a cell-based synthetic process (e.g., as in a bacterial or other cell lysate). In certain embodiments, the plants or plant cells used in the systems, methods, and compositions provided herein can comprise a transgene that expresses a CRISPR endonuclease (e.g., a Cas9, a Cpf1-like CRISPR endonuclease, or another CRISPR endonuclease). In certain embodiments, one or more CRISPR endonucleases with unique PAM recognition sites can be used. guide RNAs (sgRNAs or crRNAs and a tracrRNA) to form an RNA-guided endonuclease/guide RNA complex that can specifically bind sequences in the gDNA target site that are adjacent to a protospacer adjacent motif (PAM) sequence. The type of RNA-guided endonuclease typically informs the location of suitable PAM sites and the design of crRNAs or sgRNAs. G-rich PAM sites, eg 5'-NGG are normally targeted for designing crRNAs or sgRNAs used with Cas9 proteins. Examples of PAM sequences include 5'-NGG (Streptococcus pyogenes), 5'-NNAGAA (Streptococcus thermophilus CRISPR1), 5'-NGGNG (Streptococcus thermophilus CRISPR3), 5'-NNGRRT or 5'-NNGRR (Staphylococcus aureus Cas9, SaCas9) and 5'-NNNGATT (Neisseria meningitidis). T-rich PAM sites (eg, 5'-TTN or 5'-TTTV, where "V" is A, C, or G) are typically targeted for designing crRNAs or sgRNAs used with Cas12a proteins. In some cases, Cas12a can also recognize a 5'-CTA PAM motif. Other examples of potential Cas12a PAM sequences include TTN, CTN, TCN, CCN, TTTN, TCTN, TTCN, CTTN, ATTN, TCCN, TTGN, GTTN, CCCN, CCTN, TTAN, TCGN, CTCN, ACTN, GCTN, TCAN, GCCN, and CCGN (where N is defined as any nucleotide). Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016/0208243 A1, which is incorporated herein by reference for its disclosure of DNA encoding Cpf1 endonucleases and guide RNAs and PAM sites.

[0039] In certain embodiments, zinc finger nucleases or zinc finger nicases may also be used in the methods provided herein. Zinc finger nucleases are site-specific endonucleases comprising two protein domains: a DNA binding domain comprising a plurality of individual zinc finger repeats that recognize between 9 and 18 base pairs, and a DNA cleavage domain comprising a nuclease domain (usually Fokl). The cleavage domain dimerizes in order to cleave the DNA; therefore, a pair of ZFNs is required to target non-palindromic target polynucleotides. In certain embodiments, zinc finger nuclease and zinc finger nicase design methods that have been described (Urnov et al. (2010) Nature Rev. Genet., 11: 636 - 646; Mohanta et al. (2017) Genes vol. 8,12: 399; Ramirez et al. Nucleic Acids Res. (2012); 40(12): 55 60–5568; Liu et al (2013) Nature Communications, 4: 2565) can be adapted for use in the methods set forth herein. The zinc finger nuclease or zinc finger nicase binding domains provide specificity and can be designed to specifically recognize any desired target DNA sequence. Zinc finger DNA binding domains are derived from the DNA binding domain of a large class of eukaryotic transcription factors called zinc finger proteins (ZFPs). The DNA binding domain of ZFPs normally contains a tandem array of at least three zinc "fingers", each recognizing a specific DNA triplet. A number of strategies can be used to engineer the binding specificity of the zinc finger binding domain. One approach, called “modular assembly,” relies on the functional autonomy of individual zinc fingers with DNA. In this approach, a given sequence is targeted by identifying the zinc fingers for each component triplet in the sequence and linking them into a multifinger peptide. Several alternative strategies for designing zinc finger DNA binding domains have also been developed. These methods are designed to accommodate the ability of zinc fingers to come into contact with neighboring fingers, as well as nucleotide bases outside their target triplet. Typically, the engineered zinc finger DNA binding domain has a novel binding specificity compared to a naturally occurring zinc finger protein. Engineering methods include, for example, rational design and various types of selection. Rational design includes, for example, the use of databases of triplet (or quadruplet) nucleotide sequences and individual zinc-finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more zinc-finger amino acid sequences that bind to the particular triplet or quadruplet sequence. See, for example, US Patent Nos. 6,453,242 and 6,534,261, both of which are incorporated herein by reference in their entirety. Exemplary selection methods (eg, phage display and two-hybrid yeast systems) can be adapted for use in the methods described herein. Furthermore, enhancement of binding specificity for zinc finger binding domains has been described in US Patent No. 6,794,136, incorporated herein by reference in its entirety. Furthermore, the individual zinc finger domains can be linked together using any suitable linker sequences. Examples of linker sequences are publicly known, for example, see US Patent Nos. 6,479,626; 6,903,185; and 7,153,949, incorporated herein by reference in their entirety. The nucleic acid cleavage domain is non-specific and is typically a restriction endonuclease such as Fokl. This endonuclease must dimerize to cleave the DNA. Thus, cleavage by Fokl as part of a ZFN requires two adjacent and independent binding events, which must occur in the correct orientation and with proper spacing to allow dimer formation. The requirement for two DNA binding events allows for more specific targeting of long and potentially unique recognition sites. Fokl variants with enhanced activities have been described and can be adapted for use in the methods described herein; see, for example, Guo et al. (2010) J. Mol. Biol., 400:96-107.

[0040] Transcription activator-type effectors (TALEs) are proteins secreted by certain species of Xanthomonas to modulate gene expression in host plants and to facilitate colonization and survival of the bacteria. TALEs act as transcription factors and modulate the expression of resistance genes in plants. Recent studies of TALEs have revealed the code that links the repetitive region of TALEs with their target DNA binding sites. TALEs comprise a highly conserved and repetitive region consisting of tandem repeats of 33 or 34 amino acid segments. The repeat monomers differ from each other mainly at amino acid positions 12 and 13. A strong correlation was found between unique pairs of amino acids at positions 12 and 13 and the corresponding nucleotide at the TALE binding site. The simple relationship between the amino acid sequence and DNA recognition of the TALE binding domain allows the design of DNA binding domains of any desired specificity. TALs can be ligated to a non-specific DNA cleavage domain to prepare genome-editing proteins, referred to as TAL effector nucleases or TALENs. As in the case of ZFNs, a restriction endonuclease such as Fokl can conveniently be used. Methods for using TALENs in plants have been described and can be adapted for use in the methods described herein, see, Mahfouz et al. (2011) Proc. Natl. academic Sci. USA, 108:2623 - 2628; Mahfouz (2011) GM Crops, 2:99 – 103; and Mohanta et al. (2017) Genes vol. 8.12:399). TALE nicases have also been described and can be adapted for use in methods described herein (Wu et al.; Biochem Biophys Res Commun. (2014);446(1):261-6; Luo et al; Scientific Reports 6, article number: 20657 (2016)).

[0041] In certain modalities where ID na: 3 is inserted into the genome in a double ribbon break into the plant genome introduced by one or more nucleases or nicases (for example, a crispr/rna complex with endonuclease or nicase sytiosepecific or, a nuclease or nicase azf and a nuclease or nicase tale) In the donor or another DNA model comprises the seq ID no: 3. In certain modalities where SEQ ID no: 3 is formed in the genome in a double tape breaker in the plant genome introduced by a nuclease, the donor DNA model or another DNA model can understand less than the complete set of 36 nucleotides or pairs of sequence base sequence in: 3 and the genomic DNA in the site of integration can contribute Uir with nucleotides or pairs of bases of seq id no: 3 that are absent from the donor DNA model or another DNA model. In certain embodiments where SEQ ID NO: 3 is formed in genomic DNA, the donor DNA template or other DNA template may comprise 24 to 35 contiguous nucleotides or base pairs of SEQ ID NO: 3, the genomic DNA at the site of integration may contribute 1 to 12 nucleotides or base pairs of the SEQ ID NO: 3 sequence that are absent from the donor DNA template or other DNA template, and the complete sequence of 36 base pairs of SEQ ID NO: 3 is formed at the site of integration in the genome. Donor DNA template molecules used in the methods provided herein include DNA molecules comprising, from 5' to 3', a first homology arm, a replacement DNA, and a second homology arm, wherein the sequences containing homology arms are partially or completely homologous to genomic DNA (gDNA) sequences that flank a target site-specific endonuclease cleavage site on the gDNA. In certain embodiments, the replacement DNA can comprise an insertion, deletion or substitution of 1 or more base pairs of DNA with respect to the target gDNA. In one embodiment, the donor DNA template molecule is double-stranded and perfectly base-paired for all or most of its length, with the possible exception of any mismatched nucleotides at either or both ends. In another embodiment, the donor DNA template molecule is double-stranded and includes one or more non-terminal mismatches or non-terminal unpaired nucleotides within the otherwise double-stranded duplex. In one embodiment, the donor DNA template molecule that is integrated into the site of at least one double-stranded break (DSB) includes between 2-20 nucleotides on one strand (if single-stranded) or on both strands (if double-stranded), e.g. 18, 19, or 20 nucleotides on one or both strands, each of which can be base-paired to a nucleotide on the opposite strand of the target integration site (in the case of a perfectly base-paired double-stranded polynucleotide molecule). Such donor DNA templates can be integrated into genomic DNA containing blunt and/or staggered double-stranded DNA breaks by homology-directed repair (HDR) or microhomology-mediated end joining (MMEJ). In certain embodiments, a donor DNA template homology arm can be from about 20, 50, 100, 200, 400 or 600 to about 800 or 1000 base pairs in length. In certain embodiments, a donor DNA template molecule can be provided to a plant cell in a circular form (e.g., a plasmid or a viral vector including a geminivirus vector) or a linear DNA molecule. In certain embodiments, a circular or linear DNA molecule that is used can comprise a modified donor DNA template molecule comprising, from 5' to 3', a first copy of the target sequence-specific endonuclease cleavage site sequence, the first homology arm, the replacement DNA, the second homology arm, and a second copy of the target sequence-specific endonuclease cleavage site sequence. In other embodiments, DNA templates suitable for NHEJ insertion will not have homology arms that are partially or completely homologous to genomic DNA (gDNA) sequences that flank a target site-specific endonuclease cleavage site on the gDNA. In certain embodiments, template DNA comprising all of SEQ ID NO: 3 (e.g., dsDNA, ssDNA, or combinations thereof) may be inserted into a double-stranded break in gDNA by non-homologous end joining (NHEJ). In certain embodiments, DNA template comprising less than the complete set of 36 nucleotides or base pairs of sequence SEQ ID NO: 3 (e.g., dsDNA, ssDNA, or combinations thereof) can be inserted into a double-stranded break in gDNA by non-homologous end joining (NHEJ), the gDNA at the insertion site can contribute the nucleotides or base pairs of SEQ ID NO: 3 that are absent from the DNA template, and the SEQ ID NO: 3 can be formed at the site of a double-stranded break in gDNA.

[0042] In some embodiments, the enhancer of SEQ ID NO: 3 replaces or largely replaces a corresponding sequence in a plant gene, such as in a promoter. Consequently, a replacement rather than an insertion leaves the placement of other elements unchanged. A replacement target site can be chosen by similarity to SEQ ID NO: 3. A replacement template can be used in an HDR process, and/or DNA base editing and/or genome editing can be used to produce the desired replacement region that corresponds to SEQ ID NO: 3. Base editors include, for example, a site-specific base edit mediated by deaminase base editing enzymes C*G to Τ·Α or Α·Τ to G*C (Gaudelli et al., “Programmable base editing of Α·Τ to G*C in genomic DNA without DNA cleavage”. Nature (2017); Nishida et al. “Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems”. Science 353 (6305) (2016); Komor et al. “Programmable editing of a target base in genomic DNA without doublestranded DNA cleavage”. Nature 533 (7603)(2016):420-4 Catalytically killed dCas9 fused to a cytidine deaminase or a protein adenine deaminase becomes a specific base editor that can alter DNA bases without inducing a DNA break. Base editors convert C->T (or G->A on the opposite strand) or an adenine base editor can convert adenine to inosine, resulting in an A->G change within an edit window specified by the gRNA.

[0043] Various treatments can be used for applying gene editing molecules and/or other molecules to a plant cell. In certain embodiments, one or more treatments are employed to apply gene editing or other molecules (e.g., comprising a polynucleotide, polypeptide, or combination thereof) to a eukaryotic or plant cell, e.g., across barriers such as a cell wall, plasma membrane, nuclear envelope, and/or other lipid bilayer. In certain embodiments, a polynucleotide, polypeptide, or RNP (ribonucleoprotein)-containing composition comprising the molecules is delivered directly, for example, by direct contact of the composition with a plant cell. The aforementioned compositions may be provided in the form of a liquid, a solution, a suspension, an emulsion, a reverse emulsion, a colloid, a dispersion, a gel, liposomes, micelles, an injectable material, an aerosol, a solid, a powder, a particulate, a nanoparticle or a combination thereof may be delivered directly to a plant, plant part, plant cell or plant explant (e.g., by abrasion or drilling or otherwise by disrupting the cell wall or cell membrane, by spraying or dipping or dipping or otherwise in direct contact, by microinjection). For example, a plant cell or plant protoplast is immersed in a liquid genome-editing molecule-containing composition, wherein the agent is delivered to the plant cell. In certain embodiments, the agent-containing composition is delivered using negative or positive pressure, for example, using vacuum infiltration or application of hydrodynamic or fluid pressure. In certain embodiments, the agent-containing composition is introduced into a plant cell or plant protoplast, for example, by microinjection, or by disrupting or deforming the cell wall or cell membrane, for example, by physical treatments, such as by applying negative or positive pressure, shear forces, or treatment with a chemical or physical delivery agent, such as surfactants, liposomes, or nanoparticles; see, for example, application of materials to cells employing microfluidic flow through a cell strain constriction, as described in Published US Patent Application 2014/0287509, incorporated by reference in its entirety herein. Other techniques useful for delivering the agent-containing composition to a eukaryotic cell, plant cell, or plant protoplast include: ultrasound or sonication; vibration, friction, shear stress, vortexing, cavitation; centrifugation or application of mechanical force; deformation or breakdown of the mechanical cell wall or cell membrane; breakdown or permeabilization of the enzymatic cell wall or cell membrane; mechanical abrasion or scarification (for example, abrasion with carborundum or other particulate abrasive or scarification with a file or sandpaper) or chemical scarification (for example, treatment with an acid or caustic agent); and electroporation. In certain embodiments, the agent-containing composition is provided by bacterial (e.g., Agrobacterium sp., Rhizobium sp., Sinorhizobium sp., Mesorhizobium sp., Bradyrhizobium sp., Azobacter sp., Phyllobacterium sp.) transfection of the plant cell or plant protoplast with a polynucleotide encoding genome-editing molecules (e.g., RNA-dependent DNA endonuclease, RNA-binding protein). RNA-dependent DNA, RNA-dependent nicase, ABE or CBE and/or guide RNA); see, for example, Broothaerts et al. (2005) Nature, 433:629-633). Any one of these techniques or a combination thereof are alternatively used on the plant explant, plant part or tissue or intact plant (or seed) from which a plant cell is optionally subsequently obtained or isolated; in certain embodiments, the agent-containing composition is provided in a separate step after the plant cell has been isolated.

[0044] Techniques for performing genome editing in crop plants (for example, maize) include the use of morphogenic factors, such as Wuschel (WUS), Ovule Development Protein (ODP) and/or Babyboom (BBM), which can improve the efficiency of plant recovery with genome edits. In some aspects, the morphogenic factor comprises WUS1, WUS2, WUS3, WOX2A, WOX4, WOX5, WOX9, BBM2, BMN2, BMN3 and/or ODP2. In certain embodiments, compositions and methods for using WUS, BBM and/or ODP, as well as other techniques that can be adapted to effect genome edits in plants and other germplasm, are disclosed in US 20030082813, US 20080134353, US 20090328252, US 20100100981, US 20110165679, US 2 0140157453, US 20140173775 and US 20170240911, which are each incorporated by reference in their entirety. In certain embodiments, genome edits can be performed on regenerable plant parts (e.g.; plant embryos) of crop plants by transiently supplying gene editing molecules or polynucleotides encoding the same and not necessarily requiring incorporation of a selectable marker gene into the plant genome (e.g., US 20160208271 and US 20180273960, both incorporated herein by reference in their entirety; Svitashev et al.Nat Commun.2016;7:13274).

[0045] An expression enhancing element comprising SEQ ID NO: 3 can be operatively linked to an exogenous (i.e. encoded transgene) or genes encoding endogenous transcripts that include those that confer characteristics, such as improved yield, improved food and/or food characteristics (e.g., improved oil, starch, protein or amino acid quality or quantity), improved nitrogen use efficiency, (e.g., a glutamine synthetase gene), biofuel use characteristics improved ethanol production (e.g. improved ethanol production), delayed flowering, no flowering, increased resistance to biotic stress (e.g. resistance to damage by insects, nematodes, bacteria or fungi), increased abiotic stress resistance (e.g. resistance to drought, cold, heat, metal or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased number of flowers, architecture for improved high-density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased cell division rate, improved metabolic efficiency, and/or increased meristem size) compared to a control plant without the target genetic change. Polynucleotides comprising SEQ ID NO: 3 can be operatively linked to such genes by polynucleotide insertions into the plant genome that result in the insertion or formation of SEQ ID NO: 3 into an endogenous plant gene. Sites on endogenous plant genes suitable for insertion or formation of SEQ ID NO: 3 include promoter, coding and non-coding regions (e.g., 5' UTRs, introns and 3' UTRs). Suitable target plants for insertion or formation of SEQ ID NO: 3 include plants and plant cells of any species of interest, including dicots and monocots. Plants of interest include row crop plants, fruit and vegetable producing plants and trees, trees and ornamental plants including ornamental flowers, shrubs, trees, ground covers and lawns. Examples of commercially important crops, trees and cultivated plants include: alfalfa (Medicago sativa), almonds (Prunus dulcis), apples (Malus x domestica), apricots (Prunus armeniaca, P. brigantine, P. mandshurica, P. mume, P. sibirica), asparagus (Asparagus officinalis), bananas (Musa spp.), barley (Hordeum vulgare), bean (Phaseolus spp.), blueberries and cranberries (Vaccinium spp.), cocoa (Theobroma cacao), canola and rapeseed or oilseed rape (Brassica napus), cloves (Dianthus caryophyllus), carrots (Daucus carota sativus), cassava (Manihot esculentum), cherries (Prunus avium), chickpeas (Cider arietinum), chicory (Cichorium intybus), peppers and other peppers s capsicum (Capsicum annuum, C. frutescens, C. chinense, C. pubescens, C. baccatum), chrysanthemums (Chrysanthemum spp.), Coconut (Cocos nucifera), coffee (Coffea spp. including Coffea arabica and Coffea canephora), cotton (Gossypium hirsutum L.), cowpea (Vigna unguiculata), cucumber (Cucumis sativ us), currants and currants (Ribes spp.), eggplant or aubergine (Solanum melongena), eucalyptus (Eucalyptus spp.), flax (Linum usitatissumum L.), geraniums (Pelargonium spp.), grapefruit (Citrus x paradisi), grapes (Vitus spp.) including wine grapes (Vitus vinifera), guava (Psidium guajava), hops (Humulus lupulus), hemp and cannabis (Cannabis sativa and Cannabis spp.), irises (Iris spp.), lemon (Citrus limon), lettuce (Lactuca sativa), lemon (Citrus spp.), maize (Zea mays L.), mango (Mangifera indica), mangosteen (Garcinia mangostana), melon (Cucumis melo), millet (Setaria spp, Echin ochloa spp, Eleusine spp, Panicum spp., Pennisetum spp.), oats (Avena sativa), palm oil (Ellis quineensis), olives (Olea europaea), onions (Allium cepa), oranges (Citrus sinensis), papayas (Carica papaya), peaches and nectarines (Prunus persica), pears (Pyrus spp.), peas (Pisa sativum), peanuts (Arachis hypoga ea), peonies (Paeonia spp.), Petunias (Petunia spp.), Pineapple (Ananas comosus), banana (Musa spp.), Plum (Prunus dom estica), poinsettia (Euphorbia pulcherrima), Polish canola (Brassica rapa), poplar (Populus spp.), potato (Solanum tuberosum), pumpkin (Cucurbita pepo), rice (Oryza sativa L.), rose s (Rosa spp.), rubber (Hevea brasiliensis), rye (Secale cereale), safflower (Carthamus tinctorius L), sesame seed (Indian sesame), sorghum (Sorghum bicolor), soybean (Glycine max L.), pumpkin (Cucurbita pepo), strawberry (Fragaria spp., Fragaria x ananassa), sugar beet (Beta vulgaris), sugar cane (S accharum spp.), Sunflower (Helianthus annus), sweet potato (Ipomoea batatas), tangerine (Citrus tangerina), tea (Camellia sinensis), tobacco (Nicotiana tabacum L.), tomato (Lycopersicon esculentum), tulips (Tulipa spp.), Turnip (Brassica rapa rapa), walnuts (Juglans spp. L.), watermelon (Citrulus lanatus), wheat (Tritium aestivum) and yam (Discorea spp.).

[0046] General categories of genes of interest include, but are not limited to, genes involved in information, such as transcription factors, including zinc finger-containing transcription factors, those involved in communication, such as kinases and/or other signal transduction factors, and those involved in housekeeping, such as heat shock proteins. More specific categories, for example, include, but are not limited to, genes that encode traits important to agronomy (e.g., increased yield, improved nitrogen use efficiency), abiotic stress tolerance (e.g., water use efficiency, increased heat, cold, and drought tolerance), abiotic stress tolerance (e.g., insect resistance, fungal or bacterial disease resistance, and nematode resistance), herbicide resistance, sterility, grain or seed traits, and commercial products. Genes of interest generally include those involved in the metabolism of oil, starch, carbohydrates or nutrients, as well as those that affect seed size, plant development, regulation of plant growth and yield improvement. Plant development and growth regulation also refers to the regulation of development and growth of various parts of a plant, such as the flower, seed, root, leaf, and shoot.

[0047] Disease and/or insect resistance genes can encode resistance to pests that have high resistance to drag, such as northern corn leaf blight, rust, anthracnose, soybean mosaic virus, soybean cyst nematode, root knot nematode, brown leaf spot, Downy mildew, purple seed spot, seed rot, and seedling diseases commonly caused by fungi - Pythium sp., Phytophthora sp., Rhizoctonia sp., Diaporthe sp.. Bacterial plague caused by the bacterium Pseudomonas syringae pv. Glycinea. Genes that confer insect resistance include, for example, genes for toxic proteins from Bacillus thuringiensis (U.S. Patent Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; and Geiser et al (1986) Gene 48:109); lectins (Van Damme et al. (1994) Plant Mol. Biol. 24:825); and the like.

[0048] Herbicide resistance traits may include genes that encode resistance to herbicides that act to inhibit the action of acetolactate synthase (ALS), in particular, sulfonylurea-type herbicides (e.g., the ALS gene for acetolactate synthase containing mutations that lead to such resistance, in particular the S4 and/or HRA mutations). Mutants of the ALS gene encode resistance to the herbicide chlorsulfuron. Glyphosate acetyl transferase (GAT) is an N-acetyl transferase from Bacillus licheniformis that has been optimized by gene shuffling for acetylation of the broad-spectrum herbicide glyphosate, forming the basis of a novel mechanism of glyphosate tolerance in transgenic plants ( Castle et al. (2004) Science 304, 1 151 -1 154 ).

[0049] Genes involved in plant growth and development have been identified in plants. One such gene, which is involved in cytokinin biosynthesis, is isopentenyl transferase (IPT). Cytokinin plays a critical role in plant growth and development by stimulating cell division and cell differentiation ( Sun et al. (2003), Plant Physiol. 131: 167-176 ).

[0050] In certain embodiments, the present disclosure contemplates inserting the enhancer sequence into a recipient cell at more than one advantageous locus.

[0051] Commodity plant products obtained from plants or parts of plants comprising SEQ ID NO: 3, as well as methods for making such products are provided. In certain embodiments, commodities are processed products made from the plant or its seeds, including: (a) corn, soybean, cotton or canola seed meal (defatted or non-defatted); (b) extracted proteins, oils, sugars, syrups and starches; (c) fermentation products; (d) animal feed or human food products (for example, feed and food comprising corn meal, soybean, cottonseed or canola seed (defatted or non-defatted) and other ingredients (e.g. other cereal grains, other seed meal, other protein meal, other oil, other starch, other sugar, a binder, a preservative, a humectant, a vitamin and/or mineral); (e) a pharmaceutical product; (f) raw or processed biomass (e.g. material cellulosic and/or lignocellulosic; silage); and (g) various industrial products.

[0052] Also provided herein are methods for detecting SEQ ID NO: 3 in any of the biological samples and commodities mentioned above. Detection of DNA molecules comprising SEQ ID NO: 3 can be achieved by any combination of nucleic acid amplification (e.g., PCR amplification), hybridization, sequencing, and/or techniques based on mass spectrometry. The established methods for detecting foreign nucleic acids at transgenic loci set forth in US 20190136331 and US 9,738,904, both incorporated herein by reference in their entirety, may be adapted for use in detecting the nucleic acids provided herein. In certain embodiments, such detection is achieved by amplification and/or hybridization-based detection methods using a method (e.g., selective amplification primers) and/or probe (e.g., capable of hybridization or selective generation of a specific primer extension product) that specifically recognizes the target DNA molecule (e.g., transgene locus excision site), but does not recognize DNA from an unmodified transgenic locus. In certain embodiments, hybridization probes (e.g., polynucleotides comprising at least 15 to 36 nucleotides from SEQ ID NO: 3) can comprise detectable labels (e.g., fluorescent, radioactive, epitope, and chemiluminescent tags). In certain embodiments, a single nucleotide polymorphism detection assay can be adapted for detection of the target DNA molecule (e.g., a site of insertion or formation of SEQ ID NO: 3 in a plant genome).

[0053] Inbred and hybrid plants and seeds comprising SEQ ID NO: 3 operatively linked to a polynucleotide encoding transcripts are provided herein along with methods for making and using such hybrid and inbred seeds. Methods for producing inbred seeds include selfing of inbred plants and restricting cross-pollination by any plant other than the inbred plant. Methods for producing such hybrid seed can comprise crossing elite crop plant lines in which at least one of the pollen donor or recipient comprises SEQ ID NO: 3 operably linked to a polynucleotide encoding transcripts. In certain embodiments, the pollen donor and recipient will comprise germplasm from distinct heterotic groups and will provide hybrid seeds and plants that exhibit heterosis. In certain embodiments, the inbred plant, hybrid plant, pollen donor, and/or pollen acceptor may each comprise a distinct transgenic locus that confers a distinct trait (e.g., herbicide tolerance or insect resistance), a different type of trait (e.g., tolerance to distinct herbicides or to distinct insects such as coleopteran or lepidopteran insects), or a different mode of action for the same trait (e.g., resistance to coleopteran insects for two distinct modes of action or resistance to lepidopteran insects by two distinct modes of action). Transgenes that can be introduced into plant lines comprising SEQ ID NO: 3 operatively linked to a polynucleotide encoding transcripts by breeding or direct transformation include: (i) transgenes that confer insect resistance (e.g., transgenes that produce Bacillus thuringiensis proteins including Cry1Ab, Cry1Ac, Cry1F, Cry2Ab, Cry2Ae, Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A and variants thereof; transgenes that induce insect inhibitory RNAi responses, including dvsnf7); and (ii) transgenes that confer herbicide tolerance (eg, CP4-EPSPS or other EPSPS genes that confer glyphosate tolerance; PAT or BAR genes that confer resistance to the herbicide glufosinate; aad-1 genes that confer resistance to the herbicides 2,4-D and aryloxy phenoxy propionate; DMO genes that confer resistance to the herbicide dicamba). Examples of selected events of transgenic corn, soybean, cotton and canola plants that contain transgenes that confer traits such as herbicide tolerance and/or pest tolerance are disclosed in US Patent Nos. 7323556, 8575434, 6040497, 10316330; 8618358, 8212113, 9428765, 8455720, 7897748, 8273959, 8093453, 8901378, 8466346, RE44962, 9540655, 9738904, 8680363, 804907 1, 9447428, 9944945, 8592650, 10184134, 7179965, 7371940, 9133473, 8735661, 7381861, 8048632 and 9738903, incorporated herein by reference in their entirety. Transgenes that can be used to confer insect resistance in maize include those disclosed in U.S. Patent Application Publications Nos. 20150361446 and 20200190533, incorporated herein by reference in their entirety, as well as those disclosed in U.S. Patent Nos. 6342660, 6852915, 7323556, 7695914, 77 05216, 7897748, 8212113, 8455720, 8466346, 8575434, 8901378, 9428765 and 10316330, incorporated herein by reference in their entirety. Transgenes that can be used to confer herbicide tolerance in maize include those disclosed in U.S. Patent Application Publications Nos. 20120244533 and 20200190533, incorporated herein by reference in their entirety, as well as those disclosed in U.S. Patent Nos. 6,040,497, 6,852,915, 8,273,959, 8,6 18,358, 8,759,618 and 9,994,863, incorporated herein by reference in their entirety. In certain embodiments, the pollen recipient will be rendered male sterile or conditionally male sterile. Methods for inducing male sterility or conditional male sterility include emasculation (eg, detasseling), cytoplasmic male sterility, chemical hybridization agents or systems, transgenes or transgene systems, and/or mutation(s) in one or more endogenous plant genes. Descriptions of various male sterility systems that can be adapted for use with the crop plants provided herein are described in Wan et al. Molecular Plant; 12, 3, (2019):321-342 as well as US 8,618,358; US 20130031674; and US 2003188347.

[0054] In certain embodiments, plants provided herein comprising SEQ ID NO: 3 may additionally comprise one or more target genetic alterations introduced by one or more molecules or gene editing systems. These target genetic alterations include those that confer traits such as improved yield, improved food and/or feed characteristics (e.g., improved oil, starch, protein, or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use traits (e.g., improved ethanol production), conditional male sterility/male sterility systems (e.g., targeting endogenous MS26, MS45, and MSCA1 genes), herbicide tolerance (e.g., having targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), delayed flowering, no flowering, increased resistance to biotic stress (e.g., resistance to damage by insects, nematodes, bacteria, or fungi), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, senescence delayed, increased flower number, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased cell division rate, improved metabolic efficiency, and increased meristem size compared to a control plant without the desired genetic change. The types of targeted genetic alterations that can be introduced include insertions, deletions and substitutions of one or more nucleotides in the crop plant's genome. Sites in endogenous plant genes for targeted genetic changes include promoter, coding, and non-coding regions (eg, 5' UTRs, introns, splice donor and acceptor sites, and 3' UTRs). In certain embodiments, the targeted genetic alteration comprises an insertion of a regulatory DNA sequence or other DNA sequence into an endogenous plant gene. Non-limiting examples of regulatory sequences that can be inserted into endogenous plant genes with gene editing molecules to effect targeted genetic alterations that confer useful phenotypes include those set forth in US Patent Application Publication 20190352655, which is incorporated herein by reference in its entirety, such as: (a) auxin response element (AuxRE) sequence; (b) at least one D1-4 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971), (c) at least one DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (d) at least one m5-DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (e) at least one P3 sequence; (f) a small RNA recognition site sequence joined by a corresponding small RNA (e.g., a siRNA, a microRNA (miRNA), a trans-acting siRNA as described in U.S. Patent No. 8,030,473, or a phased sRNA as described in U.S. Patent No. 8,404,928; both cited patents are incorporated herein by reference); (g) a microRNA (miRNA) recognition site sequence; (h) a microRNA (miRNA) recognition sequence for an engineered miRNA wherein the specific binding agent is the corresponding mature miRNA; (i) a transposon recognition sequence; (j) a sequence recognized by an associated amphiphilic repression motif (EAR) to the ethylene responsive element binding factor; (k) a splice site sequence (e.g., a donor site, a branch site, or a recipient site; see, for example, the splice sites and splice signals shown on the website lemur[dot]amu[dot]edu[dot]pl/share/ERISdb/home.html); (l) a recombinase recognition site sequence that is recognized by a site-specific recombinase; (m) a sequence encoding an amino acid RNA or aptamer or a riboswitch RNA, the specific binding agent is the corresponding ligand, and the change in expression is upregulation or downregulation; (n) a hormone-responsive element recognized by a nuclear receptor or a hormone-binding domain thereof; (o) a transcription factor binding sequence; and (p) a polycomb response element (see, Xiao et al. (2017) Nature Genetics, 49:1546-1552, doi: 10.1038/ng.3937). Non-limiting examples of target maize genes that can undergo target gene edits to confer useful traits include: (a) ZmIPK1 (herbicide tolerant and phytate reduced maize; Shukla et al., Nature. 2009;459:437–41); (b) ZmGL2 (reduced epicuticular wax in leaves; Char et al. Plant Biotechnol J. 2015;13:1002); (c) ZmMTL (induction of haploid plants; Kelliher et al. Nature. 2017;542:105); (d) Wx1 (high amylopectin; US 20190032070; incorporated herein by reference in its entirety); (e) TMS5 (thermosensitive male sterile; Li et al. J Genet Genomics. 2017;44:465–8); (f) ALS (herbicide tolerance; Svitashev et al.; Plant Physiol. 2015;169:931–45); and (g) ARGOS8 (drought stress tolerance; Shi et al., Plant Biotechnol J. 2017;15:207–16). Non-limiting examples of target soybean genes that can undergo target gene edits to confer useful traits include: (a) FAD2-1A, FAD2-1B (increased oleic acid content; Haun et al.; Plant Biotechnol J. 2014;12:934–40); (b) FAD2-1A, FAD2-1B, FAD3A (increased oleic acid and decreased linolenic content; Demorest et al., BMC Plant Biol. 2016;16: 225); and (c) ALS (herbicide tolerance; Svitashev et al.; Plant Physiol. 2015;169:931–45). A non-limiting example of target Brassica genes that can undergo target gene edits to confer useful traits include: (a) the FRIGIDA gene to confer early flowering ( Sun Z, et al. J Integr Plant Biol. 2013;55:1092–103 ); and (b) ALS (herbicide tolerance; document US 20160138040, incorporated herein by reference in its entirety). Non-limiting examples of target genes in crop plants, including corn and soybeans, that can undergo target genetic alterations that confer useful phenotypes, include those set forth in US Patent Application Nos. 20190352655, 20200199609, 20200157554, and 20200231982, which are incorporated herein in their entirety; and Zhang et al. (Genome Biol. 2018; 19: 210). In certain embodiments, such target genetic alterations can be combined with plants comprising SEQ ID NO: 3 by breeding techniques. These breeding techniques include outcrossing and/or introgression by backcrossing with a recurrent parent. In such crosses, the plant comprising SEQ ID NO: 3 can be a pollen donor or acceptor. In certain embodiments, plants comprising SEQ ID NO: 3 can be used as the recurrent parent in such backcrosses to introgress the target genetic alteration into plant germplasm comprising SEQ ID NO: 3. In certain embodiments, plants comprising the target genetic alteration(s) can be used as the recurrent parent in such backcrosses to introgress the genomic region comprising SEQ ID NO: 3 into germplasm from plant comprising the target genetic alteration(s).

[0055] In certain embodiments, plants provided herein comprising SEQ ID NO: 3 may additionally comprise one or more genetic loci that confer traits, such as improved yield, improved food and/or feed characteristics (e.g., improved oil, starch, protein, or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use characteristics (e.g., improved ethanol production), conditional male sterility/male sterility systems (e.g., e.g., targeting endogenous MS26, MS45, and MSCA1 genes), herbicide tolerance (e.g., targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), delayed flowering, no flowering, increased resistance to biotic stress (e.g., resistance to damage by insects, nematodes, bacteria, or fungi), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, rate of enhanced growth, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased number of flowers, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased rate of cell division, improved metabolic efficiency, and increased meristem size compared to a control plant without the desired genetic change. Sources of such genetic loci include elite cultivars, sexually compatible wild relatives (eg, Soybean Glycine), plant germplasm that has been subjected to random mutagenesis (eg, with a chemical mutagen such as EMS or with gamma-ray mutagenesis), and the like. In certain embodiments, such genetic loci can be combined with plants comprising SEQ ID NO: 3 by breeding techniques. These breeding techniques include outcrossing and/or introgression by backcrossing with a recurrent parent. In such crosses, the plant comprising SEQ ID NO: 3 can be a pollen donor or acceptor. In certain embodiments, plants comprising SEQ ID NO: 3 can be used as the recurrent parent in such backcrosses to introgress the genetic locus into plant germplasm comprising SEQ ID NO: 3. In certain embodiments, plants comprising the genetic locus or loci can be used as the recurrent parent in such backcrosses to introgress the genomic region comprising SEQ ID NO: 3 into plant germplasm comprising locus or genetic loci.

[0056] Also provided herein are methods for producing a commodity plant product or plant material comprising growing any of the aforementioned plants comprising SEQ ID NO: 3 or growing the plants from seeds comprising SEQ ID NO: 3. In certain embodiments, such plants and/or seeds are irrigated, fertilized, and/or treated with a biological agent (e.g., a plant beneficial microorganism, including Bacillus sp., Rhizobium sp., and the like), nematicide (eg, a carbamate or organophosphate insecticide), insecticide (eg, a neonicotinoid, pyrethroid, carbamate, or organophosphate insecticide), and/or fungicide (eg, a benzimidazole, imidazole, or strobilurin fungicide). Plants can be treated with such fertilizers, biological agents, nematicides, insecticides and fungicides by methods including spraying, fumigating and/or soaking the soil. Seeds can be treated with such fertilizers, biological agents, nematicides, insecticides and fungicides by methods including furrow or coating applications (e.g., with a drum coater, tumble coater, tumbler tumbler, fluidized bed and/or spouted bed apparatus). Methods and compositions, including various binders, fillers, film coatings and active ingredients such as fertilizers, surfactants, plant growth regulators, crop desiccants, fungicides, bactericides, bacteriostats, insecticides and insect repellents for coating seeds that can be adapted for use with seeds provided herein are disclosed in U.S. Patent No. 10745578, which is incorporated herein by reference in its entirety.

MODALITIES

[0057] Various embodiments of the DNA molecules, plants, plant parts, genomes, chromosomes, methods, biological samples and other compositions described herein are presented in the following set of numbered embodiments.

[0058] 1. A DNA molecule comprising the polynucleotide sequence of SEQ ID NO: 3.

[0059] 2. The DNA molecule according to Embodiment 1, wherein the DNA molecule is an isolated, synthetic and/or recombinant DNA molecule.

[0060] 3. The DNA molecule according to Embodiment 1 or 2, wherein the polynucleotide sequence of SEQ ID NO: 3 is operatively linked to a polynucleotide sequence comprising a promoter, optionally wherein the promoter is an endogenous promoter, and optionally wherein the endogenous promoter is located on a plant chromosome.

[0061] 4. The DNA molecule according to embodiment 1, 2 or 3, wherein the polynucleotide sequence of SEQ ID NO: 3 and the promoter are operatively linked to a transcription unit and increase the expression of a transcript or protein encoded by the transcription unit in a plant cell relative to a control plant cell comprising the promoter in the absence of the polynucleotide sequence of SEQ ID NO: 3.

[0062] 5. The DNA molecule according to any one of embodiments 1 to 4, wherein the polynucleotide sequence of SEQ ID NO: 3 is located about 10, 10, 20, 30, 40 or 50 base pairs (bp) from about 70, 80, 100, 120, 140, 160, 180, 200, 2 40, 300, 400, 500, 1000, 2000, 3000 or 5000 bp from the transcription start site of the transcription unit and, optionally, where the polynucleotide sequence of SEQ ID NO: 3 is located 5' to the TSS.

[0063] 6. The DNA molecule according to any one of embodiments 1 to 5, wherein the promoter is an endogenous plant promoter and the transcription unit is an endogenous plant transcription unit, wherein the promoter and the transcription unit are located on a plant chromosome, and optionally wherein the endogenous plant promoter and the endogenous plant transcription unit element are a maize, soybean, cotton or canola plant promoter and a transcription unit.

[0064] 7. A biological sample comprising the DNA molecule according to any one of embodiments 1 to 6.

[0065] 8. The biological sample according to embodiment 7, wherein the sample comprises: (i) flour, syrup, oil or starch; or (ii) bran or flakes from corn, soy, cotton or canola seeds.

[0066] 9. A plant chromosome comprising the DNA molecule according to any one of embodiments 1 to 6, optionally wherein the plant chromosome is a corn, soybean, cotton or canola plant chromosome.

[0067] 10. The plant chromosome, according to embodiment 9, wherein the plant chromosome is a maize plant chromosome.

[0068] 11. The plant chromosome according to embodiment 9 or 10, wherein one or more nucleotides of SEQ ID NO: 3 are endogenous nucleotides of the plant chromosome, optionally wherein at least 24 nucleotides of SEQ ID NO: 3 are exogenous nucleotides inserted into the plant chromosome.

[0069] 12. A plant cell comprising the DNA molecule according to any one of embodiments 1 to 6, optionally wherein the plant cell is a corn, soybean, cotton or canola plant cell.

[0070] 13. The plant cell of embodiment 12, wherein the polynucleotide sequence of SEQ ID NO: 3 is operably linked to a polynucleotide sequence comprising a promoter, wherein the promoter is an endogenous promoter, and wherein the endogenous promoter is located on a plant chromosome.

[0071] 14. The plant cell according to embodiment 12 or 13, wherein the plant cell is a maize plant cell.

[0072] 15. A tissue culture of regenerable cells comprising the plant cell according to embodiment 12.

[0073] 16. A plant comprising the DNA molecule according to any one of embodiments 1 to 6, optionally wherein the plant is a corn, soybean, cotton or canola plant.

[0074] 17. The plant according to embodiment 16, wherein the plant is a corn, soybean, cotton or canola plant.

[0075] 18. The plant according to embodiment 16 or 17, wherein the polynucleotide sequence of SEQ ID NO: 3 is operatively linked to a polynucleotide sequence comprising a promoter, wherein the promoter is an endogenous promoter, and wherein the endogenous promoter is located on a chromosome of the plant.

[0076] 19. A plant part comprising the DNA molecule according to any one of embodiments 1 to 6, optionally wherein the plant part is a corn, soybean, cotton or canola plant part.

[0077] 20. The plant part according to embodiment 19, wherein the plant part is a corn plant part.

[0078] 21. The plant part of embodiment 19 or 20, wherein the plant part is a seed, optionally wherein the seed is a corn seed.

[0079] 22. The plant part according to embodiment 19, 20 or 21, wherein the seed is a hybrid seed, optionally wherein the hybrid seed is an F1 hybrid seed, and optionally wherein the F1 hybrid seed exhibits heterosis.

[0080] 23. The plant part according to any one of embodiments 19 to 22, wherein the seed is an inbred seed.

[0081] 24. A method of producing plant seeds, said method comprising crossing the plant according to any one of embodiments 16 to 18 with a second plant to produce plant seeds and optionally harvesting the seed.

[0082] 25. The method according to embodiment 24, wherein the genotype of the plant and the genotype of the second plant are of different genotypes and the seed is hybrid seed.

[0083] 26. The method according to embodiment 24 or 25, wherein the plant or second plant further comprises a transgene, target genetic alteration or genetic locus that confers a desired trait and the harvested seed comprises the transgene, target genetic alteration or genetic locus.

[0084] 27. A method of producing plant seeds, said method comprising self-fertilizing the plant according to any one of embodiments 16 to 18 to produce plant seeds and optionally harvesting the seed.

[0085] 28. The method according to embodiment 27, in which the plant and the seed are inbred.

[0086] 29. A method of producing a plant comprising an added desired trait, said method comprising introducing a transgene, a target genetic alteration or genetic locus that confers the desired trait on the plant as per embodiment 16, 17 or 18.

[0087] 30. A method of producing a commodity plant product, said method comprising processing a plant or seed comprising the DNA molecule according to any one of Embodiments 1 to 6 and recovering the commodity plant product from the processed plant or seed.

[0088] 31. The method according to embodiment 30, wherein the commodity plant product is seed bran, starch, syrup, silage, oil or protein.

[0089] 32. The method according to embodiment 30 or 31, wherein the commodity plant product comprises a detectable amount of the DNA molecule.

[0090] 33. A method of producing plant material, the method comprising growing a plant with an expression enhancing element comprising SEQ ID NO: 3 operatively linked to a polynucleotide encoding transcripts, wherein expression of the polynucleotide encoding transcripts in said plant is increased compared to a control plant without the expression enhancing element.

[0091] 34. The method according to embodiment 33, wherein growing comprises at least one of sowing a seed that germinates and forms the plant, irrigating the seed or plant, and/or treating the plant or seed with a biological agent, herbicide, insecticide, or fungicide.

• (a) fornecer uma planta com um elemento de aumento de expressão compreendendo a SEQ ID NO: 3 operacionalmente ligada a um polinucleotídeo que codifica transcritos, em que a expressão do polinucleotídeo que codifica transcritos é aumentada na referida planta em comparação com uma planta de controle sem elemento de aumento de expressão; e
• (b) cultivar a planta sob condições que permitem a expressão do polinucleotídeo que promove o transcrito.

[0092] 35. A method of producing plant material, the method comprising:

• (a) providing a plant with an expression enhancing element comprising SEQ ID NO: 3 operatively linked to a polynucleotide encoding transcripts, wherein expression of the polynucleotide encoding transcripts is increased in said plant compared to a control plant without an expression enhancing element; It is
• (b) growing the plant under conditions that allow expression of the polynucleotide that promotes the transcript.

[0093] 36. The method according to any one of embodiments 33 to 35, wherein the plant material comprises a seed, optionally wherein the method further comprises harvesting the seed from the plant.

[0094] 37. The method according to any one of embodiments 33 to 36, wherein the expression-enhancing element is in an endogenous promoter that is operably linked to the polynucleotide encoding transcripts or in a 5' UTR, intron or 3' UTR of the transcript encoding the polynucleotide and wherein said endogenous promoter, 5' UTR, intron or 3' UTR is located in a plant chromosome.

[0095] 38. The method according to any one of embodiments 33 to 37, wherein the polynucleotide sequence of SEQ ID NO: 3 is located about 10, 20, 30, 40 or 50 base pairs (bp) from about 70, 80, 100, 120, 140, 160, 180, 200, 240, 300, 400, 500, 1000, 2000, 3000 or 5000 bp from the transcription start site of the transcription unit and, optionally, where the polynucleotide sequence of SEQ ID NO: 3 is located 5' to the TSS.

[0096] 39. The method according to any one of embodiments 33 to 38, wherein the polynucleotide encoding transcripts is an endogenous plant transcription unit, wherein the promoter and transcription unit are located in a plant chromosome, optionally wherein the polynucleotide encoding transcripts is a corn, soybean, cotton or canola plant transcript encoding polynucleotide.

[0097] 40. The method according to any one of embodiments 33 to 39, wherein the plant is a maize plant and/or wherein the seed is a maize plant seed.

[0098] 41. The method of identifying a biological sample comprising a polynucleotide comprising a modified plant gene, comprising the step of detecting the presence of SEQ ID NO: 3 in the biological sample.

[0099] 42. The method according to embodiment 41, wherein the biological sample is obtained from a plant cell, plant or plant part, optionally wherein the plant part is a seed and/or optionally wherein the plant is a corn, soybean, cotton or canola plant.

[0100] 43. A method for producing nucleic acids comprising the polynucleotide sequence of SEQ ID NO: 3, the method comprising isolating nucleic acids from the plant according to embodiment 16, 17 or 18 or from the plant part according to any of embodiments 19 to 23.

[0101] 44. A method of producing a treated plant seed comprising contacting a seed comprising the DNA molecule according to any one of Embodiments 1 to 6 with a composition comprising a biological agent, nematicide, insecticide or fungicide.

[0102] 45. The method according to embodiment 44, wherein the seed is a corn, soybean, cotton or canola plant seed.

[0103] 46. A method for increasing the expression of a polynucleotide sequence in a plant, the method comprising expressing a polynucleotide sequence that is operatively linked to an expression enhancing element comprising SEQ ID NO: 3 and to a promoter, wherein the expression of the polynucleotide is increased compared to a control plant without the expression enhancing element.

[0104] 47. The method according to embodiment 46, wherein the plant is a corn, soybean, cotton or canola plant, optionally, wherein the polynucleotide sequence comprises a gene that confers improved yield, improved food and/or food characteristics (for example, improved quality or quantity of oil, starch, protein or amino acid), improved nitrogen use efficiency, improved biofuel use characteristics (for example, improved ethanol production), delayed flowering, no flowering, increased resistance to biotic stress (e.g. resistance to damage by insects, nematodes, bacteria or fungi), resistance to abiotic stress increased (e.g. resistance to drought, cold, heat, metal or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased number of flowers, improved architecture for high density planting, improved photosynthesis, plant mass increased root, increased cell number, improved seedling vigor, improved seedling size, increased cell division rate, improved metabolic efficiency, and/or increased meristem size.

[0105] 48. The method according to embodiment 46 or 47, wherein the expression is increased in a plant part, optionally wherein the part is a seed, leaf, stem, flower, root, stem or cell.

[0106] 49. Use of the DNA molecule according to any one of embodiments 1 to 6 for: (i) increasing the expression of one or more elements encoded by a transcription unit that is operatively linked to the promoter in a plant; (ii) conferring a useful trait on a plant comprising the DNA molecule or recombinant DNA molecule, wherein the useful trait is optionally improved yield, improved food and/or feed characteristics (e.g. improved quality or quantity of oil, starch, protein or amino acid), improved nitrogen use efficiency, improved biofuel use characteristics (e.g. improved ethanol production), delayed flowering, no flowering, increased resistance to biotic stress (e.g. resistance to insect damage, nematodes, bacteria or fungi), increased abiotic stress resistance (e.g., resistance to drought, cold, heat, metal or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased number of flowers, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seeding vigor, improved seed size, division rate increased cellular, improved metabolic efficiency and/or increased meristem size relative to a control plant without the recombinant DNA molecule; (iii) obtaining a plant or seed thereof exhibiting the useful trait of (ii); or (iv) to grow a population of plants exhibiting the useful trait of (ii); optionally, wherein the plant of (i), (ii), (iii) or (iv) is a corn, soybean, cotton or canola plant; or optionally wherein the seed of (iii) is a corn, soybean, cotton or canola plant.

EXAMPLES Example 1.

[0107] Single-target insertion of the transcription-enhancing element into maize protoplasts by NHEJ is illustrated in this example. Corn protoplasts were prepared using established methods (see, US20190352655, which is incorporated herein by reference in its entirety).

[0108] Maize protoplasts were isolated from leaf material of B104 seedlings and transfected with double-stranded oligos and RNPs consisting of Cas9 protein complexed with a tracrRNA:crRNA duplex targeting the ZmGln1-3 promoter (crRNA sequence: UACACGUACGAUUACAACCAGUUUUAGAGCUAUGCU; SEQ ID NO: 5) and the double-stranded oligos described below. The Cas9/tracrRNA/crRNA complex results in a double-strand break in the DNA 66 bp upstream of the ZmGln1-3 transcription start site (ie, the Zm00001d017958 gene according to the B73v4 maize genome that encodes the polypeptide of SEQ ID NO: 6). Three types of double-stranded oligos were tested: a 24 nt configuration containing two repeats of the enhancer sequence, a 36 bp configuration containing three repeats of the enhancer sequence, and a 48 nt configuration containing four repeats of the enhancer sequence. The oligos were 5' phosphorylated and contained two phosphorothioate linkages at both ends. As a control, the protoplasts were transfected only with RNPs, that is, without added oligos. Each transfection was performed in triplicate. After transfection, cells were washed and incubated for 48 hours. At the end of the incubation period, cells were harvested for gDNA and RNA preparation.

[0109] To analyze insertion sites, gDNA was used as a template in which PCR was performed with primers flanking the insertion site. After cleaning the bead, the resulting amplicons were sequenced by next generation sequencing. Reads were aligned to the target locus, and the percentage of reads containing the enhancer sequence was used as a proxy for the fraction of cells that integrated the enhancer. The data are summarized in Figure 1. For transfections with the dual enhancer, it was estimated that 7% of cells integrated the enhancer element into the Gln1-3 target locus. For cells transfected with the triple or quad enhancer, 44% and 41% respectively of the cells integrated the enhancer element into the target locus. All numbers are averaged over 3 biological replicates. These data show that the triple element has the best performance in terms of insertion efficiency.

[0110] To assess the effect of the inserted enhancer sequence on the expression level of Gln1-3, bulk RNA was extracted from harvested protoplasts and converted into cDNA. Using qRT-PCR, the expression level of ZmGln1-3 was measured relative to that of ZmAct1, a well-known reference gene; data are summarized in Figure 2. In cells transfected with the dual enhancer, the level of ZmGln1-3 expression was indistinguishable from control cells transfected with RNP alone. However, in cells transfected with the triple enhancer, the expression level of ZmGln1-3 was about 4.5 times higher compared to controls. For cells transfected with the quadruple enhancer, it increased only 2.7-fold. These data indicate that both the triple and quad enhancer increase target gene expression when integrated into the promoter, but the triple enhancer does so more efficiently.

Example 2.

[0111] Improved transcription in maize protoplasts on multi-gene targets with the 36 bp enhancer is illustrated in this example. Maize protoplasts were isolated from leaf material of B104 seedlings and transfected with RNPs consisting of Cas9 complexed with a tracrRNA:crRNA duplex, with or without double-stranded 5' phosphorylated 36 nucleotide enhancer oligos (SEQ ID NO: 3) with two phosphorothioate linkages at both ends with the 36 nucleotide enhancer sequence (SEQ ID NO: 3). Three crRNAs were used in this experiment. The first crRNA (UACACGUACGAUUACAACCAGUUUUAGAGCUAUGCU; SEQ ID NO: 5 targets the ZmGln1-3 promoter (ie, the promoter of the Zm00001d017958 gene according to the maize genome of B73v4 that encodes the polypeptide of SEQ ID NO:6). The second crRNA (UGUAUCCGUAUUUAUACGUGGUUUUAGAGCUAUGCU) ; SEQ ID NO: 7) targets the ZmGln1-4 promoter (ie, the promoter of the Zm00001d051804 gene according to the B73v4 maize genome encoding the polypeptide of SEQ ID NO:8). The third crRNA (CUCCAAGUGACCGAGCAAGAGUUUUAGAGCUAUGCU; SEQ ID NO: 9) targets the ZmLc promoter (ie, the gene Zm00001d026147 according to the maize genome of B73v4 encoding the polypeptide of SEQ ID NO: 10. Each transfection was performed in triplicate. After transfection, cells were washed and incubated for 48 hours. At the end of the incubation period, cells were harvested for gDNA and RNA preparation.

[0112] To analyze the insertion sites, gDNA was used as a template and PCR was performed with primers flanking the insertion site and, after cleaning the bead, the resulting amplicons were sequenced by next-generation sequencing. Reads were aligned to the target locus, and the percentage of reads containing the enhancer sequence was used as a proxy for the fraction of cells that integrated the enhancer. In reads without the enhancer sequence, the number of reads with indels (insertions and deletions) due to NHEJ was determined. The insertion efficiency was in all three cases about half of the total editing efficiency (combining reads with indels only and reads with the inserted oligonucleotide), but the absolute insertion efficiency differed between targets and was 31% for ZmGln1-3, 9% for Gln1-4 and 12% for Lc.

[0113] To evaluate the effect of the inserted enhancer sequence SEQ ID NO: 3 on the expression level of Gln1-3, bulk RNA was extracted from harvested protoplasts and converted into cDNA. Using qRTPCR, the expression level of the target gene (ZmGln1-3, ZmGln1-4 or ZmLc) was measured relative to that of ZmAct1, a well-known reference gene. These results are summarized in Figure 3, showing a >400-fold increase in Lc expression, 2.3-fold increase in Gln1-3, and 1.9-fold increase in Gln1-4 due to the insertion of the maize enhancer sequence into the promoters of these genes. Considering that only a fraction of cells integrated the enhancer sequence, as discussed above, the increase in gene expression in cells with the enhancer is even greater, indicating that the enhancer works well to increase the expression level of multiple targets.

Example 3.

[0114] Maize genome editing and transformation is illustrated in this example. Immature embryos of a maize line that ubiquitously expresses a CRISPR/Cas nuclease in the B104 background were bombarded with gold particles coated with a guide RNA targeting the Gln1-3 promoter in the Gln1.3 gene (i.e., the promoter of the Zm00001d017958 gene according to the B73v4 maize genome encoding the polypeptide of SEQ ID NO:6) and oligonucleotide s phosphorylated 5' double-stranded with 2 phosphorothioate linkages at both ends with the 36 nucleotide enhancer sequence (SEQ ID NO: 3) and a plasmid encoding the pat resistance gene and a fluorescent protein. Using standard tissue culture practices, with selection for pat and fluorescence resistance, plants were regenerated containing either the full or partial 36 bp enhancer element (SEQ ID NO: 3). Leaf tissue was taken from regenerated plants for gDNA extraction to verify the presence of the insert using primers that flank the gRNA target site. An increase in amplicon size allowed selection of events with the present insert. Amplicon sequencing confirmed that oligo insertion happened at the predicted target sites, which for Gln1-3 was 66 bp upstream of the transcription start site (TSS), with efficiencies ranging from 0.4% to 1.1%, as shown in Table 1.

[0115] RNA was prepared from leaf samples taken from young regenerators of a single bombardment experiment with the aim of inserting the maize enhancer element into the Gln1-3 promoter and converted into cDNA. Using SYBR-based qRT-PCR, the expression level of Gln1-3 and control of ZmAct1 were measured. The same plants were also genotyped for the presence of the enhancer. The results are summarized in Figure 4, showing that event plants that did not have the enhancer inserted had low levels of Gln1-3, similar to the untransformed B104 control, while event plants with the 36 bp enhancer element (SEQ ID NO: 3) present had levels that were 4 to 10 times higher than controls.

[0116] Plants containing the insert were grown to maturity and crossed with wild-type B104 plants. A population of T1BC1 generated in this way from a plant heterozygous for the full-length 36 bp enhancer insert was then cultured for further analysis. From these plants, leaf tissue was sampled for genotyping for PCR insertion, and leaf, mesocotyl, and primary root tissue were harvested for RNA extraction, cDNA synthesis, and qRT-PCR for Gln1-3 and ZmAct1. The results of these experiments are shown in Figure 5. Individuals with the insert were compared to siblings who did not inherit the enhancer insert allele, and wild-type B104 plants were grown alongside the T1BC1 plants. In the roots and mesocotyl there was a 2-fold and significant (p<0.05, two-tailed Student's t-test) increase in Gln1-3 expression in plants with the insert compared to siblings without the insert and with B104 plants. In leaves, no difference in expression could be detected, possibly linked to the fact that Gln1-3 expression is already very high in the leaf compared to the root and mesocotyl.

Example 4.

[0117] This example illustrates the potentiation of transcript expression in soybean cells. Soybean protoplasts were prepared using established methods (see US20190352655).

[0118] Two plasmids were prepared for protoplast transfection. A control plasmid had an expression cassette with the soybean Tlf1b gene promoter, 5' UTR and initiator codon (SEQ ID NO: 11) driving expression of a GFP fluorescent marker. A test plasmid differs from the control plasmid only by the insertion of the 36 bp enhancer element of SEQ ID NO: 3, the insertion being 484 nucleotides from the start codon for the Tfl1b protein (SEQ ID NO: 12).

[0119] Increased expression of the GFP marker gene was observed in soybean protoplasts transfected with the test plasmid comprising the insertion of the 36 bp enhancer element of SEQ ID NO: 3 into the soybean Tlf1b gene promoter relative to controls transfected with the plasmid comprising the soybean Tlf1b gene promoter at 16 hours, 24 hours and 40 hours after transfection.

[0120] The breadth and scope of the present disclosure should not be limited by any of the exemplary embodiments described above, but should be defined only in accordance with the following claims and their equivalents.

Claims (39)

DNA molecule, characterized in that it comprises the polynucleotide sequence of SEQ ID NO: 3. DNA molecule, according to claim 1, characterized in that the DNA molecule is an isolated, synthetic and/or recombinant DNA molecule. DNA molecule according to claim 1, characterized by the fact that the polynucleotide sequence of SEQ ID NO: 3 is located in a polynucleotide sequence comprising a promoter. DNA molecule according to claim 3, characterized in that the polynucleotide sequence of SEQ ID NO: 3 and the promoter are operatively linked to a transcription unit and increase the expression of a transcript or protein encoded by the transcription unit in a plant cell relative to a control plant cell comprising the promoter in the absence of the polynucleotide sequence of SEQ ID NO: 3. DNA molecule according to claim 4, characterized in that the polynucleotide sequence of SEQ ID NO: 3 is located at about 10, 20, 30 or 40 base pairs (bp) at about 100, 240, 300, 400, 500, 1000, 2000, 3000 or 5000 bp from the transcription start site of the transcription unit. DNA molecule according to claim 4, characterized in that the promoter is a plant promoter and the transcription unit is a plant transcription unit and, optionally, wherein the endogenous plant promoter and the endogenous plant transcription unit element are a maize or soybean plant promoter and transcription unit. Plant cell characterized in that it comprises the DNA molecule as defined in claim 3, wherein the plant cell is, optionally, a non-regenerable plant cell that is not capable of being regenerated to produce a plant. Plant cell according to claim 7, characterized in that the polynucleotide sequence of SEQ ID NO: 3 is located in a polynucleotide sequence comprising a promoter, wherein the promoter is an endogenous promoter, and wherein the endogenous promoter is located in its natural location in the plant genome. Plant cell, according to claim 7, characterized in that the plant cell is a corn or soybean plant cell. Plant characterized by the fact that it comprises the DNA molecule, as defined in claim 3. Plant according to claim 10, characterized in that the polynucleotide sequence of SEQ ID NO: 3 is located in a polynucleotide sequence comprising a promoter, wherein the promoter is an endogenous promoter and wherein the endogenous promoter is located in its natural location in the genome of the plant. Plant part characterized by the fact that it comprises the DNA molecule, as defined in claim 3. Plant part according to claim 12, characterized in that the plant part is a seed. Method of producing plant material, the method characterized in that it comprises cultivating a plant with an expression enhancing element comprising SEQ ID NO: 3 located in a promoter, wherein the expression enhancing element of SEQ ID NO: 3 and the promoter are operably linked to a polynucleotide encoding transcripts, and wherein the expression of the polynucleotide encoding transcripts in said plant is increased compared to a control plant without the expression enhancing element. Method according to claim 14, characterized in that the growth comprises at least one of sowing a seed that germinates and forms the plant, irrigating the seed or plant and/or treating the plant or seed with a biological agent, herbicide, insecticide or fungicide. Method according to claim 14, characterized in that the plant material comprises a seed and wherein the method further comprises harvesting the seed from the plant. Method according to claim 14, characterized in that the expression-enhancing element is in an endogenous promoter that is operatively linked to the polynucleotide encoding endogenous transcripts, and in which said endogenous promoter and the polynucleotide encoding endogenous transcripts are located in their natural location in the plant genome. Method, according to claim 14, characterized in that the polynucleotide sequence of SEQ ID NO: 3 is located at about 10, 20, 30 or 40 base pairs (bp) at about 100, 240, 300, 400, 500, 1000, 2000, 3000 or 5000 bp from the transcription start site of the transcript. Method according to claim 17, characterized in that the plant is a corn or soybean plant, and in which the endogenous promoter and the endogenous transcription unit are an endogenous promoter from a corn or soybean plant and a polynucleotide encoding endogenous transcripts located in their natural location in the genome of the corn or soybean plant. Method according to claim 14, characterized in that the plant is a corn or soybean plant. Method of producing plant material, the method characterized in that it comprises inserting a transcription-enhancing element of SEQ ID NO: 3 into a promoter of a plant and growing the plant to produce plant material, wherein the expression-enhancing element and the promoter are operably linked to a polynucleotide encoding transcripts, and wherein expression of the polynucleotide encoding transcripts in said plant is increased compared to a control plant without the expression-enhancing element. Method according to claim 21, characterized in that the growth comprises at least one of sowing a seed that germinates and forms the plant, irrigating the seed or plant and/or treating the plant or seed with a biological agent, herbicide, insecticide or fungicide. Method according to claim 21, characterized in that the plant material comprises a seed and wherein the method further comprises harvesting the seed from the plant. Method according to claim 21, characterized in that the expression enhancing element is located in an endogenous promoter that is operatively linked to the polynucleotide that encodes endogenous transcripts and in which said endogenous promoter and the polynucleotide that encodes endogenous transcripts are located in their natural location in the plant genome. Method according to claim 21, characterized in that the polynucleotide sequence of SEQ ID NO: 3 is located at about 10, 20, 30, 40 or 50 base pairs (bp) at about 70, 80, 100, 120, 140, 160, 180, 200, 240, 300, 400, 50 0, 1000, 2000, 3000 or 5000 bp from the transcription start site of the transcription unit and, optionally, where the polynucleotide sequence of SEQ ID NO: 3 is located 5' to the TSS. Method according to claim 21, characterized in that the plant is a corn or soybean plant, wherein the expression-enhancing element is located in an endogenous corn or soybean promoter that is operatively linked to the polynucleotide encoding endogenous transcripts, and wherein said endogenous promoter and polynucleotide encoding endogenous transcripts are located in their natural location in the genome of the corn or soybean plant. Biological sample characterized by the fact that it comprises the DNA molecule, as defined in claim 1, in which the biological sample is, optionally, "non-regenerable" and incapable of being regenerated in a plant or plant part. Biological sample, according to claim 27, characterized in that the sample comprises corn, soybean, cotton or canola seed bran. Method for identifying the biological sample, as defined in claim 27, characterized in that it comprises a polynucleotide comprising a modified plant gene, in which the polynucleotide sequence of SEQ ID NO: 3 is located in a polynucleotide sequence comprising a promoter, comprising the step of detecting the presence of SEQ ID NO: 3 in the biological sample. Method, according to claim 29, characterized in that the biological sample is obtained from a plant cell, plant or plant part, optionally in which the plant part is a seed and/or, optionally, in which the plant is a corn, soybean, cotton or canola plant. Method of producing a commodity plant product, said method characterized in that it comprises processing a plant or seed comprising the DNA molecule, as defined in any one of claims 1 to 6, and recovering the commodity plant product from the processed plant or seed. Method according to claim 31, characterized in that the commodity plant product is seed bran, starch, syrup, silage, oil or protein. Method for producing nucleic acids, characterized in that it comprises the polynucleotide sequence of SEQ ID NO: 3, the method characterized in that it comprises isolating nucleic acids from the plant part, as defined in claim 12. Method of producing a treated plant seed, characterized in that it comprises placing a seed comprising the DNA molecule, as defined in any one of claims 1 to 6, in contact with a composition comprising a biological agent, nematicide, insecticide or fungicide. Method, according to claim 34, characterized in that the seed is a seed of a corn, soybean, cotton or canola plant. Method for increasing the expression of a polynucleotide sequence in a plant, the method characterized in that it comprises expressing a polynucleotide sequence that is operatively linked to an expression enhancing element comprising SEQ ID NO: 3 and to a promoter, wherein the expression of the polynucleotide is increased compared to a control plant without the expression enhancing element. Method according to claim 36, characterized in that the plant is a corn, soybean, cotton or canola plant, optionally wherein the polynucleotide sequence comprises a gene that confers improved yield, improved food and/or feed characteristics (e.g. improved quality or quantity of oil, starch, protein or amino acid), improved nitrogen use efficiency, improved biofuel use characteristics (e.g. improved ethanol production), delayed flowering, no flowering, increased stress resistance biotic (e.g. resistance to insect, nematode, bacterial or fungal damage), increased resistance to abiotic stress (e.g. resistance to drought, cold, heat, metal or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased number of flowers, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number , improved seedling vigor, improved seedling size, increased rate of cell division, improved metabolic efficiency, and/or increased meristem size. Method according to any one of claims 36 or 37, characterized in that the expression is increased in a part of the plant, optionally where the part is a seed, leaf, stem, flower, root, stem or cell. Use of the DNA molecule, as defined in any one of claims 1 to 6, characterized in that it is for: (i) increasing the expression of one or more elements encoded by a transcription unit that is operatively linked to the promoter in a plant; (ii) conferring a useful trait on a plant comprising the DNA molecule or recombinant DNA molecule, wherein the useful trait is, optionally, improved yield, improved food and/or feed characteristics (e.g., improved oil, starch, protein or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use characteristics (e.g., improved ethanol production), delayed flowering, non-flowering, increased resistance to biotic stress (e.g., resistance to insect damage, nematode ides, bacteria, or fungi), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased number of flowers, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, division rate increased cellular, improved metabolic efficiency and/or increased meristem size relative to a control plant without the recombinant DNA molecule; (iii) obtaining a plant or seed thereof exhibiting the useful trait of (ii); or (iv) growing a population of plants exhibiting the useful trait of (ii); optionally, wherein the plant of (i), (ii), (iii) or (iv) is a corn, soybean, cotton or canola plant; or, optionally, wherein the seed of (iii) is a corn, soybean, cotton or canola plant.

Images