BR122022002011B1 - PARENT POLYPEPTIDE GH61 VARIANT, POLYNUCLEOTIDE ISOLATED, RECOMBINANT MICROBIAL HOST CELL, METHODS FOR PRODUCING A GH61 POLYPEPTIDE VARIANT, PROCESSES FOR DEGRADING OR CONVERTING A CELLULOSIC MATERIAL, FOR PRODUCING A FERMENTATION PRODUCT AND FOR FERMENTATING A MATERIAL CELLULOSIC IAL, COMPOSITION OF ENZYMES, DETERGENT COMPOSITION, AND METHOD FOR CLEANING OR WASHING A HARD SURFACE OR CLOTHING - Google Patents

Abstract

The present invention relates to variants of the GH61 polypeptide. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

Description

Divided from BR112014026625-5 of 04/26/2013 Reference to a Sequence Listing

[001] This application contains a Sequence Listing in machine-readable form, which is incorporated herein by reference.

Background of the Invention Area of Invention

[002] The present invention relates to variants of the GH61 polypeptide, polynucleotides encoding the variants, methods of producing the variants, and methods of using the variants.

Description of the Related Technique

[003] Cellulose is a polymer of the simple sugar glucose covalently linked by beta-1,4 bonds. Many microorganisms produce enzymes that hydrolyze beta-linked glucans. These enzymes include endoglucanases, cellobiohydrolases, and beta-glucosidases. Endoglucanases digest the cellulose polymer at random positions, opening it up to attack by cellobiohydrolases. Cellobiohydrolases sequentially release cellobiose molecules from the ends of the cellulose polymer. Cellobiose is a water-soluble beta-1,4-linked glucose dimer. Beta-glucosidases hydrolyze cellobiose to glucose.

[004] The conversion of lignocellulosic feedstocks to ethanol has the advantages of ready availability of large amounts of feedstock, the desirability of avoiding burning or dumping the materials in landfills, and the cleanliness of the ethanol fuel. Wood, agricultural waste, herbaceous crops, and municipal solid waste have been considered feedstocks for ethanol production. These materials consist primarily of cellulose, hemicellulose, and lignin. Once the lignocellulose is converted into fermentable sugars, eg glucose, the fermentable sugars can easily be fermented by yeast into ethanol.

[005] WO 2005/074647, WO 2008/148131, and WO 2011/035027 disclose isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Thielavia terrestris. WO 2005/074656 and WO 2010/065830 disclose isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Thermoascus aurantiacus. WO 2007/089290 and WO 2012/149344 disclose isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Trichoderma reesei. WO 2009/085935, WO 2009/085859, WO 2009/085864, and WO 2009/085868 disclose isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Myceliophthora thermophila. WO 2010/138754 discloses an isolated GH61 polypeptide having enhancing cellulolytic activity and its polynucleotide from Aspergillus fumigatus. WO 2011/005867 discloses an isolated GH61 polypeptide having enhancing cellulolytic activity and its polynucleotide from Penicillium pinophilum. WO 2011/039319 discloses an isolated GH61 polypeptide having enhancing cellulolytic activity and its polynucleotide from Thermoascus sp. WO 2011/041397 discloses an isolated GH61 polypeptide having enhancing cellulolytic activity and its polynucleotide from Penicillium sp. WO 2011/041504 discloses isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Thermoascus crustaceus. WO 2012/030799 discloses isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Aspergillus aculeatus. WO 2012/113340 discloses isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Thermomyces lanuginosus. WO 2012/122477 discloses isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Aurantiporus alborubescens, Trichophaea saccata, and Penicillium thomii. WO 2012/135659 discloses an isolated GH61 polypeptide having enhancing cellulolytic activity and its polynucleotide from Talaromyces stipitatus. WO 2012/146171 discloses isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Humicola insolens. WO 2012/101206 discloses isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Malbranchea cinnamomea, Talaromyces leycettanus, and Chaetomium thermophilum. WO 2013/043910 discloses isolated GH61 polypeptides having enhancing cellulolytic activity and their polynucleotides from Acrophialophora fusispora and Corynascus sepedonium.

[006] WO 2012/044835 and WO 2012/044836 disclose GH61 polypeptide variants having enhancing cellulolytic activity with improved thermal activity and thermostability.

[007] There is a need in the art for GH61 polypeptides having enhancing cellulolytic activity with increased thermostability as a component of enzyme compositions for use in degrading lignocellulose at elevated temperatures.

[008] The present invention provides variants of the GH61 polypeptide with increased thermostability.

Summary of the Invention

[009] The present invention relates to variants of the GH61 polypeptide, comprising a substitution at one or more (e.g., several) positions corresponding to positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102 , 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250 of the mature polypeptide of SEQ ID NO: 30, wherein the variants have enhancing cellulolytic activity.

[0010] The present invention also relates to isolated polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and production methods of the variants.

[0011] The present invention also relates to processes for degrading or converting a cellulosic material, comprising: treating the cellulosic material with an enzyme composition in the presence of a GH61 polypeptide variant of the present invention. In one aspect, the processes further comprise recovery of degraded or converted cellulosic material.

[0012] The present invention also relates to processes for producing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzyme composition in the presence of a GH16 polypeptide variant of the present invention; (b) fermenting the saccharified cellulosic material with one or more (e.g., several) fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.

[0013] The present invention also relates to processes for fermenting a cellulosic material, comprising: fermenting the cellulosic material with one or more (e.g., several) fermenting microorganisms, wherein the cellulosic material is saccharified with a composition of enzymes in the presence of a GH61 polypeptide variant of the present invention. In one aspect, fermentation of cellulosic material produces a fermentation product. In another aspect, the processes further comprise recovery of fermentation product from fermentation.

Brief Description of Figures

[0014] Figure 1 shows the genomic DNA sequence (SEQ ID NO: 29) and the deduced amino acid sequence (SEQ ID NO: 30) of an Aspergillus fumigatus gene encoding a GH61B polypeptide having enhancing cellulolytic activity.

[0015] Figure 2 shows a restriction map of pMMar44.

[0016] Figure 3 shows a restriction map of pMMar49.

[0017] Figure 4 shows a restriction map of pMMar45.

[0018] Figure 5 shows a restriction map of pDFng113.

[0019] Figure 6 shows a restriction map of pDFng153-4.

[0020] Figure 7 shows a restriction map of pDFng154-17.

[0021] Figure 8 shows a restriction map of pDFng155-33.

[0022] Figure 9 shows a restriction map of pDFng156-37.

[0023] Figure 10 shows a restriction map of pDFng157-51.

[0024] Figure 11 shows a restriction map of pBGMH16.

Definitions

[0025] Acetylxylan esterase: The term "acetylxylan esterase" means a carboxylesterase (EC 3.1.1.72) which catalyzes the hydrolysis of acetyl groups of polymeric xylan, acetylated xylose, acetylated glucose, alpha-naphthyl acetate, and p-nitrophenyl acetate . For purposes of the present invention, acetylxylan esterase activity is determined using 0.5 mM p-nitrophenyl acetate as substrate in 50 mM sodium acetate pH 5.0 containing 0.01% TWEEN™ 20 (polyoxyethylene monolaurate sorbitan). One unit of acetylxylan esterase is defined as the amount of enzyme capable of releasing 1 μmole of p-nitrophenolate anion per minute at pH 5, 25 °C.

[0026] Allelic variant: The term "allelic variant" means any one of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and can result in polymorphism within populations. Genetic mutations can be silent (no change in the encoded polypeptide) or they can encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

[0027] Alpha-L-arabinofuranosidase: The term “alpha-L-arabinofuranosidase” means an alpha-L-arabinofuranoside arabinofuranohydrolase (EC 3.2.1.55) that catalyzes the hydrolysis of terminal non-reducing residues of alpha-L-arabinofuranoside to alpha- L-arabinosides. The enzyme acts on alpha-L-arabinofuranosides, alpha-L-arabinans containing (1,3) and/or (1,5) linkages, arabinoxylans, and arabinogalactans. Alpha-L-arabinofuranosidase is also known as arabinosidase, alpha-arabinosidase, alpha-L-arabinosidase, alpha-arabinofuranosidase, polysaccharide alpha-L-arabinofuranosidase, alpha-L-arabinofuranoside hydrolase, L-arabinosidase, or alpha-L-arabinanase . For purposes of the present invention, alpha-L-arabinofuranosidase activity is determined using 5 mg of medium viscosity wheat arabinoxylan (Megazyme International Ireland, Ltd., Bray, Co. Wicklow, Ireland) per mL of sodium acetate at 100 mM pH 5 in a total volume of 200 µL for 30 minutes at 40°C, followed by arabinose analysis by AMINEX® HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

[0028] Alpha-glucuronidase: The term "alpha-glucuronidase" means an alpha-D-glucosiduronate glucuronohydrolase (EC 3.2.1.139) which catalyzes the hydrolysis of an alpha-D-glucuronoside to D-glucuronate and an alcohol. For purposes of the present invention, alpha-glucuronidase activity is determined according to de Vries, 1998, J. Bacteriol. 180: 243-249. One unit of alpha-glucuronidase equals the amount of enzyme capable of liberating 1 μmole of glucuronic acid or 4-O-methylglucuronic acid per minute at pH 5, 40 °C.

[0029] Beta-glucosidase: The term “beta-glucosidase” means a beta-D-glucoside glucohydrolase (E.C. 3.2.1.21) that catalyzes the hydrolysis of terminal non-reducing beta-D-glucose residues with the release of beta-D-glucose . For purposes of the present invention, betaglucosidase activity is determined using p-nitrophenyl-beta-D-glucopyranoside as substrate according to the procedure of Venturi et al., 2002, J. Basic Microbiol. 42: 55-66. One unit of beta-glucosidase is defined as 1.0 µmole of p-nitrophenolate anion produced per minute at 25 °C, pH 4.8 from 1 mM p-nitrophenyl-beta-D-glucopyranoside as a substrate in sodium citrate. 50 mM sodium containing 0.01% TWEEN® 20.

[0030] Beta-xylosidase: The term “beta-xylosidase” means a beta-D-xyloside xylohydrolase (E.C. 3.2.1.37) that catalyzes the exohydrolysis of small beta (1^4)-xylooligosaccharides to remove D- xylose successive non-reducing terminals. For purposes of the present invention, beta-xylosidase activity is preferably determined using 1 mM p-nitrophenyl-beta-D-xyloside as substrate in 100 mM sodium citrate containing 0.01% TWEEN® 20 at pH 5, 40°C. One unit of beta-xylosidase is defined as 1.0 µmole of p-nitrophenolate anion produced per minute at 40 °C, pH 5 from 1 mM p-nitrophenyl-beta-D-xyloside as substrate in sodium citrate at 100 mM containing 0.01% TWEEN® 20.

[0031] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription of a mature, processed mRNA molecule obtained from a eukaryotic or prokaryotic cell. The cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor mRNA that is processed through a series of steps, including splicing, before appearing as processed mature mRNA.

[0032] Cellobiohydrolase: The term "cellobiohydrolase" means a 1,4-beta-D-glucan cellobiohydrolase (E.C. 3.2.1.91 and E.C. 3.2.1.176) that catalyzes the hydrolysis of 1,4-beta-D-glucosidic bonds in cellulose , cellooligosaccharides, or any polymer containing glucose linked to beta-1,4, releasing cellobiose from the reducing end (cellobiohydrolase I) or non-reducing end (cellobiohydrolase II) of the chain (Teeri, 1997, Trends in Biotechnology 15: 160-167; Teeri et al., 1998, Biochem.Soc.Trans.26:173-178). Cellobiohydrolase activity is preferably determined according to the procedures described by Lever et al., 1972, Anal. Biochem. 47: 273-279; van Tilbeurgh et al., 1982, FEBS Letters, 149: 152-156; van Tilbeurgh and Claeyssens, 1985, FEBS Letters, 187: 283-288; and Tomme et al., 1988, Eur. J. Biochem. 170: 575-581.

[0033] Cellulolytic enzyme or cellulase: The term “cellulolytic enzyme” or “cellulase” means one or more (eg, several) enzymes that hydrolyze a cellulosic material. Such enzymes include endoglucanase(s), cellobiohydrolase(s), beta-glucosidase(s), or combinations thereof. The two basic approaches to measuring cellulolytic enzyme activity include: (1) measuring total cellulolytic enzyme activity, and (2) measuring the activities of individual cellulolytic enzymes (endoglucanases, cellobiohydrolases, and beta-glucosidases) as reviewed in Zhang et al. al., 2006, Biotechnology Advances 24: 452-481. Total cellulolytic activity is usually measured using insoluble substrates, including Whatman No. 1 filter paper, microcrystalline cellulose, bacterial cellulose, algal cellulose, cotton, pre-treated lignocellulose, etc. The most common assay for total cellulolytic activity is the filter paper assay using Whatman No. 1 filter paper as the substrate. The assay was established by the International Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Pure Appl. Chem. 59: 257-68).

[0034] For purposes of the present invention, the activity of cellulolytic enzymes is determined by measuring the increase in hydrolysis of a cellulosic material by cellulolytic enzyme(s) under the following conditions: 1-50 mg of cellulolytic enzyme protein/ g of cellulose in PCS (or other pre-treated cellulosic material) for 3-7 days at a suitable temperature such as 40°C-80°C, e.g. 50°C, 55°C, 60°C, 65°C, or 70°C, and a suitable pH such as 4-9, e.g., 5.0, 5.5, 6.0, 6.5, or 7.0, compared to a hydrolysis control without addition of cellulolytic enzyme protein. Typical conditions are 1 mL reactions, washed or unwashed pretreated corn stover (PCS), 5% insoluble solids, 50 mM sodium acetate pH 5, 1 mM MnSO4, 50 °C, 55 °C, or 60 °C, 72 hours, analysis of sugars by AMINEX® HPX-87H column (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

[0035] Cellulosic material: The term “cellulosic material” means any material containing cellulose. The predominant polysaccharide in the primary cell wall of biomass is cellulose, the second most abundant is hemicellulose, and the third is pectin. The secondary cell wall, produced after the cell has stopped growing, also contains polysaccharides and is reinforced by polymeric lignin covalently crosslinked to hemicellulose. Cellulose is a homopolymer of anhydrocellobiose and thus a linear beta-(1-4)-D-glucan, while hemicelluloses include a variety of compounds, such as xylans, xyloglucans, arabinoxylans, and mannans in complex branched structures with a spectrum of substituents. . Although generally polymorphous, cellulose is found in plant tissue primarily as an insoluble crystalline matrix of parallel glucan chains. Hemicelluloses are usually hydrogen-bonded to cellulose, as well as other hemicelluloses, which help to stabilize the cell wall matrix.

[0036] Cellulose is generally found, for example, in the stems, leaves, skins, bark, and husks of plants or leaves, branches, and wood of trees. Cellulosic material can be, but is not limited to, agricultural waste, herbaceous material (including energy crops), municipal solid waste, pulp and paper mill waste, paper waste, and wood (including forestry waste) (see , for example, Wiselogel et al., 1995, in Handbook on Bioethanol (Charles E. Wyman, editor), pp. 105-118, Taylor & Francis, Washington D.C.; Wyman, 1994, Bioresource Technology 50: 3-16; Lynd , 1990, Applied Biochemistry and Biotechnology 24/25: 695-719; Mosier et al., 1999, Recent Progress in Bioconversion of Lignocellulosics, in Advances in Biochemical Engineering/Biotechnology, T. Scheper, Executive Editor, Volume 65, pages 23- 40, Springer-Verlag, New York). It is understood herein that the cellulose can be in the form of lignocellulose, a plant cell wall material containing lignin, cellulose, and hemicellulose in a mixed matrix. In a preferred aspect, the cellulosic material is any biomass material. In another preferred aspect, the cellulosic material is lignocellulose, which comprises cellulose, hemicelluloses, and lignin.

[0037] In one aspect, the cellulosic material is agricultural waste. In another aspect, the cellulosic material is herbaceous material (including energy crops). In another aspect, the cellulosic material is municipal solid waste. In another aspect, the cellulosic material is waste from pulp and paper mills. In another aspect, the cellulosic material is waste paper. In another aspect, the cellulosic material is wood (including forestry waste).

[0038] In another aspect, the cellulosic material is sugarcane. In another aspect, the cellulosic material is bagasse. In another aspect, the cellulosic material is bamboo. In another aspect, the cellulosic material is corn cob. In another aspect, the cellulosic material is corn fiber. In another aspect, the cellulosic material is corn stover. In another aspect, the cellulosic material is miscanto. In another aspect, the cellulosic material is orange peel. In another aspect, the cellulosic material is rice straw. In another aspect, the cellulosic material is elephant grass. In another aspect, the cellulosic material is wheat straw.

[0039] In another aspect, the cellulosic material is poplar. In another aspect, the cellulosic material is eucalyptus. In another aspect, the cellulosic material is spruce. In another aspect, the cellulosic material is pine. In another aspect, the cellulosic material is poplar. In another aspect, the cellulosic material is spruce. In another aspect, the cellulosic material is willow.

[0040] In another aspect, the cellulosic material is seaweed cellulose. In another aspect, the cellulosic material is bacterial cellulose. In another aspect, the cellulosic material is cotton linter. In another aspect, the cellulosic material is filter paper. In another aspect, the cellulosic material is microcrystalline cellulose. In another aspect, the cellulosic material is phosphoric acid-treated cellulose.

[0041] In another aspect, the cellulosic material is an aquatic biomass. As used herein, the term "aquatic biomass" means biomass produced in an aquatic environment by a process of photosynthesis. Aquatic biomass can be algae, emergent plants, floating leaf plants, or submerged plants.

[0042] The cellulosic material may be used as such or may be pre-treated using conventional methods known in the art, as described herein. In a preferred aspect, the cellulosic material is pre-treated.

[0043] Coding sequence: The term “coding sequence” means a polynucleotide, which directly specifies the amino acid sequence of a variant. Coding sequence boundaries are generally determined by an open reading frame, which begins with an initiation codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0044] Control sequences: The term "control sequences" means nucleic acid sequences necessary for expression of a polynucleotide encoding a variant of the present invention. Each control sequence can be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the variant or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, control sequences include a promoter, and transcriptional and translational termination signals. Control sequences may be provided with linkers for the purpose of introducing specific restriction sites by facilitating the linkage of the control sequences to the coding region of the polynucleotide encoding a variant.

[0045] Endoglucanase: The term “endoglucanase” means an endo-1,4-(1,3;1,4)-beta-D-glucan 4-glucanohydrolase (E.C. 3.2.1.4) that catalyzes the endohydrolysis of 1, 4-beta-D-glycosides in cellulose, cellulose derivatives (such as carboxymethyl cellulose and hydroxyethyl cellulose), lichenine, beta-1,4 linkages in mixed beta-1,3 glucans such as beta-D-glucans or xyloglucans cereals, and other plant material containing cellulosic components. Endoglucanase activity can be determined by measuring the reduction in substrate viscosity or increase in reducing ends determined by a reducing sugar assay ( Zhang et al., 2006, Biotechnology Advances 24: 452-481 ). For purposes of the present invention, endoglucanase activity is determined using carboxymethyl cellulose (CMC) as substrate according to the procedure of Ghose, 1987, Pure and Appl. chem. 59: 257-268, at pH 5, 40°C.

[0046] Expression: The term "expression" includes any step involved in producing a variant including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0047] Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a variant and is operably linked to control sequences that provide for its expression.

[0048] Family 61 glycoside hydrolase: The term "Family 61 glycoside hydrolase" or "GH61 Family" or "GH61" means a polypeptide of Family 61 glycoside hydrolases according to Henrissat, 1991, Biochem. J. 280: 309-316, and Henrissat, and Bairoch, 1996, Biochem. J. 316: 695-696. Enzymes in this family were originally classified as a family of glycoside hydrolases based on measurement of very weak endo-1,4-beta-D-glucanase activity in one member of the family. GH61s have recently been classified as lytic polysaccharide monooxygenases ( Quinlan et al., 2011, Proc. Natl. Acad. Sci. USA 208: 15079-15084 ; Phillips et al., 2011, ACS Chem. Biol. 6: 1399-1406 ; Lin et al., 2012, Structure 20: 1051-1061).

[0049] Feruloyl esterase: The term “feruloyl esterase” means a 4-hydroxy-3-methoxycinnamoyl sugar hydrolase (EC 3.1.1.73) that catalyzes the hydrolysis of 4-hydroxy-3-methoxycinnamoyl (feruloyl) groups of esterified sugar, which is usually arabinose on natural biomass substrates to produce ferulat (4-hydroxy-3-methoxycinnamate). Feruloyl esterase (FAE) is also known as ferulic acid esterase, hydroxycinnamoyl esterase, FAE-III, cinnamoyl ester hydrolase, FAEA, cinAE, FAE-I, or FAE-II. For purposes of the present invention, feruloyl esterase activity is determined using 0.5 mM p-nitrophenylferulate as a substrate in 50 mM sodium acetate pH 5.0. One unit of feruloyl esterase equals the amount of enzyme capable of liberating 1 μmole of p-nitrophenolate anion per minute at pH 5, 25 °C.

[0050] Fragment: The term "fragment" means a polypeptide having one or more (eg, several) amino acids missing from the amino and/or carboxyl terminus of its mature polypeptide, wherein the fragment has enhancing cellulolytic activity. In one aspect, a fragment contains at least 85% of the amino acid residues, e.g., at least 90% of the amino acid residues or at least 95% of the amino acid residues of the mature polypeptide of a GH61 polypeptide.

[0051] Hemicellulolytic enzyme or hemicellulase: The term “hemicellulolytic enzyme” or “hemicellulase” means one or more (eg, several) enzymes that hydrolyze a hemicellulosic material. See, for example, Shallom and Shoham, Current Opinion In Microbiology, 2003, 6(3): 219-228. Hemicellulases are key components in the degradation of plant biomass. Examples of hemicellulases include, but are not limited to, an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, a mannosidase, a xylanase, and a xylosidase. The substrates for these enzymes, hemicelluloses, are a heterogeneous group of branched and linear polysaccharides that are hydrogen bonded to the cellulose microfibrils in the cell wall of plants, cross-linking them into a robust network. Hemicelluloses are also covalently linked to lignin, forming together with cellulose a highly complex structure. The variable structure and organization of hemicelluloses require the concerted action of many enzymes for their complete degradation. The catalytic modules of hemicellulases are either glycoside hydrolases (GHs) that hydrolyze glycosidic bonds, or carbohydrate esterases (CEs), which hydrolyze ester bonds of acetate or ferulic acid side groups. These catalytic modules, based on their primary sequence homology, can be assigned to the GH and CE families. Some families, with a similar global fold, may be further grouped into clans, labeled alphabetically (eg, GH-A). A very informative and up-to-date classification of these and other carbohydrate-active enzymes is available in the Carbohydrate-Active Enzymes (CAZy) database. Activities of hemicellulolytic enzymes can be measured according to Ghose and Bisaria, 1987, Pure & Appl. chem. 59: 1739-1752, at a suitable temperature such as 40 °C-80 °C, e.g. 50 °C, 55 °C, 60 °C, 65 °C, or 70 °C, and a suitable pH such as 4-9, e.g., 5.0, 5.5, 6.0, 6.5, or 7.0.

[0052] High stringency conditions: The term “high stringency conditions” means, for probes at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms µg/ml denatured, sheared salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 65°C.

[0053] Host cell: The term "host cell" means any type of cell that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0054] Enhanced Property: The term "enhanced property" means a characteristic associated with a variant that is improved compared to the parent. Such an improved property includes, but is not limited to, increased thermostability.

[0055] Enhanced thermostability: The term "enhanced thermostability" means an increased retention of enhancing cellulolytic activity of a GH61 polypeptide variant after a period of incubation at a temperature relative to the parent. The increased thermostability of the variant relative to the parent can be evaluated, for example, under conditions of one or more (eg, several) temperatures. For example, the one or more (e.g. multiple) temperatures can be any temperature or temperatures in the range 45°C to 95°C, e.g. 45, 50, 55, 60, 65, 70, 75, 80, 85, or 95°C (or between, e.g., 62°C, 68°C, 72°C, etc.) at one or more (e.g., multiple) pHs in the range of 3 to 9, eg 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8 ,0, 8.5, or 9.0 (or between) for a suitable period (time) of incubation, e.g., 1 minute, 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes , 45 minutes, or 60 minutes (or between, eg, 23 minutes, 37 minutes, etc.), such that the variant retains residual activity. However, longer incubation periods can also be used. The term "enhanced thermostability" may be used interchangeably with "enhanced thermostability".

[0056] The increased thermostability of the variant relative to the parent can be determined by differential scanning calorimetry (DSC) using methods standard in the art (see, for example, Sturtevant, 1987, Annual Review of Physical Chemistry 38: 463-488; Example 9). The increased thermostability of the variant relative to the parent can also be determined using protein thermal unfolding analysis (see, for example, Example 10 here). The increased thermostability of the variant relative to the parent can also be determined using any enzyme assay known in the art for GH61 polypeptides having enhancing cellulolytic activity to measure residual activity after a temperature treatment. See, for example, WO 2005/074647, WO 2008/148131, WO 2005/074656, WO 2010/065830, WO 2007/089290, WO 2009/085935, WO 2009/085859, WO 2009/085864, WO 2009 /085868, and WO 2008/151043, which are incorporated herein by reference. Alternatively, the increased thermostability of the variant relative to the parent can be determined using any application test for the variant where the performance of the variant is compared to the parent. For example, the application tests described in Example 5 can be used.

[0057] Isolated: The term “isolated” means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed of one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by man from that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a promoter stronger than the promoter naturally associated with the gene encoding the substance).

[0058] Low stringency conditions: The term “low stringency conditions” means, for probes at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms µg/ml denatured, sheared salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 50°C.

[0059] Mature Polypeptide: The term "mature polypeptide" means a polypeptide in its final form after translation and any post-translational modifications such as N-terminal splicing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is amino acids 20 to 326 of SEQ ID NO: 2 based on the SignalP 3.0 program (Bendtsen et al., 2004, J. Mol. Biol. 340: 783-795) which predicts that amino acids 1 to 19 of SEQ ID NO: 2 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 239 of SEQ ID NO: 4 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 4 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 258 of SEQ ID NO: 6 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 6 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 226 of SEQ ID NO: 8 based on the SignalP program which predicts that amino acids 1 to 18 of SEQ ID NO: 8 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 304 of SEQ ID NO: 10 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 10 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 317 of SEQ ID NO: 12 based on the SignalP program which predicts that amino acids 1 to 15 of SEQ ID NO: 12 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 249 of SEQ ID NO: 14 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 14 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 249 of SEQ ID NO: 16 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 16 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 232 of SEQ ID NO: 18 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 18 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 235 of SEQ ID NO: 20 based on the SignalP program which predicts that amino acids 1 to 15 of SEQ ID NO: 20 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 323 of SEQ ID NO: 22 based on the SignalP program which predicts that amino acids 1 to 18 of SEQ ID NO: 22 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 310 of SEQ ID NO: 24 based on the SignalP program which predicts that amino acids 1 to 15 of SEQ ID NO: 24 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 246 of SEQ ID NO: 26 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 26 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 354 of SEQ ID NO: 28 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 28 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 250 of SEQ ID NO: 30 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 30 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 322 of SEQ ID NO: 32 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 32 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 444 of SEQ ID NO: 34 based on the SignalP program which predicts that amino acids 1 to 23 of SEQ ID NO: 34 are a signal peptide. In another aspect, the mature polypeptide is amino acids 26 to 253 of SEQ ID NO: 36 based on the SignalP program which predicts that amino acids 1 to 25 of SEQ ID NO: 36 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 246 of SEQ ID NO: 38 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 38 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 334 of SEQ ID NO: 40 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 40 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 227 of SEQ ID NO: 42 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 42 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 223 of SEQ ID NO: 44 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 44 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 368 of SEQ ID NO: 46 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 46 are a signal peptide. In another aspect, the mature polypeptide is amino acids 25 to 330 of SEQ ID NO: 48 based on the SignalP program which predicts that amino acids 1 to 24 of SEQ ID NO: 48 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 236 of SEQ ID NO: 50 based on the SignalP program which predicts that amino acids 1 to 16 of SEQ ID NO: 50 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 250 of SEQ ID NO: 52 based on the SignalP program which predicts that amino acids 1 to 18 of SEQ ID NO: 52 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 478 of SEQ ID NO: 54 based on the SignalP program which predicts that amino acids 1 to 22 of SEQ ID NO: 54 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 230 of SEQ ID NO: 56 based on the SignalP program which predicts that amino acids 1 to 16 of SEQ ID NO: 56 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 257 of SEQ ID NO: 58 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 58 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 251 of SEQ ID NO: 60 based on the SignalP program which predicts that amino acids 1 to 22 of SEQ ID NO: 60 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 349 of SEQ ID NO: 62 based on the SignalP program which predicts that amino acids 1 to 18 of SEQ ID NO: 62 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 436 of SEQ ID NO: 64 based on the SignalP program which predicts that amino acids 1 to 23 of SEQ ID NO: 64 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 344 of SEQ ID NO: 66 based on the SignalP program which predicts that amino acids 1 to 23 of SEQ ID NO: 66 are a signal peptide. In another aspect, the mature polypeptide is amino acids 26 to 400 of SEQ ID NO: 68 based on the SignalP program which predicts that amino acids 1 to 25 of SEQ ID NO: 68 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 389 of SEQ ID NO: 70 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 70 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 406 of SEQ ID NO: 72 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 72 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 427 of SEQ ID NO: 74 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 74 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 267 of SEQ ID NO: 76 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 76 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 273 of SEQ ID NO: 78 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 78 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 322 of SEQ ID NO: 80 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 80 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 234 of SEQ ID NO: 82 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 82 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 233 of SEQ ID NO: 84 based on the SignalP program which predicts that amino acids 1 to 23 of SEQ ID NO: 84 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 237 of SEQ ID NO: 86 based on the SignalP program which predicts that amino acids 1 to 16 of SEQ ID NO: 86 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 484 of SEQ ID NO: 88 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 88 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 320 of SEQ ID NO: 90 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 90 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 272 of SEQ ID NO: 92 based on the SignalP program which predicts that amino acids 1 to 22 of SEQ ID NO: 92 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 327 of SEQ ID NO: 94 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 94 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 274 of SEQ ID NO: 96 based on the SignalP program which predicts that amino acids 1 to 22 of SEQ ID NO: 96 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 227 of SEQ ID NO: 98 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 98 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 257 of SEQ ID NO: 100 based on the SignalP program which predicts that amino acids 1 to 16 of SEQ ID NO: 100 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 246 of SEQ ID NO: 102 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 102 are a signal peptide. In another aspect, the mature polypeptide is amino acids 28 to 265 of SEQ ID NO: 104 based on the SignalP program which predicts that amino acids 1 to 27 of SEQ ID NO: 104 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 310 of SEQ ID NO: 106 based on the SignalP program which predicts that amino acids 1 to 15 of SEQ ID NO: 106 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 354 of SEQ ID NO: 108 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 108 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 267 of SEQ ID NO: 110 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 110 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 237 of SEQ ID NO: 112 based on the SignalP program which predicts that amino acids 1 to 15 of SEQ ID NO: 112 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 234 of SEQ ID NO: 114 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 114 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 226 of SEQ ID NO: 116 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 116 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 231 of SEQ ID NO: 118 based on the SignalP program which predicts that amino acids 1 to 16 of SEQ ID NO: 118 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 248 of SEQ ID NO: 120 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 120 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 233 of SEQ ID NO: 122 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 122 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 243 of SEQ ID NO: 124 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 124 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 363 of SEQ ID NO: 126 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 126 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 296 of SEQ ID NO: 128 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 128 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 318 of SEQ ID NO: 130 based on the SignalP program which predicts that amino acids 1 to 15 of SEQ ID NO: 130 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 259 of SEQ ID NO: 132 based on the SignalP program which predicts that amino acids 1 to 18 of SEQ ID NO: 132 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 325 of SEQ ID NO: 134 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 134 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 298 of SEQ ID NO: 136 based on the SignalP program which predicts that amino acids 1 to 18 of SEQ ID NO: 136 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 298 of SEQ ID NO: 138 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 138 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 344 of SEQ ID NO: 140 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 140 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 330 of SEQ ID NO: 142 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 142 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 216 of SEQ ID NO: 144 based on the SignalP program which predicts that amino acids 1 to 18 of SEQ ID NO: 144 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 490 of SEQ ID NO: 146 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 146 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 306 of SEQ ID NO: 148 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 148 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 339 of SEQ ID NO: 150 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 150 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 334 of SEQ ID NO: 152 based on the SignalP program which predicts that amino acids 1 to 22 of SEQ ID NO: 152 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 366 of SEQ ID NO: 154 based on the SignalP program which predicts that amino acids 1 to 23 of SEQ ID NO: 154 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 364 of SEQ ID NO: 156 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 156 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 344 of SEQ ID NO: 158 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 158 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 252 of SEQ ID NO: 160 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 160 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 344 of SEQ ID NO: 162 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 162 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 347 of SEQ ID NO: 164 based on the SignalP program which predicts that amino acids 1 to 21 of SEQ ID NO: 164 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 342 of SEQ ID NO: 166 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 166 are a signal peptide. In another aspect, the mature polypeptide is amino acids 27 to 254 of SEQ ID NO: 168 based on the SignalP program which predicts that amino acids 1 to 26 of SEQ ID NO: 168 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 272 of SEQ ID NO: 409 based on the SignalP program which predicts that amino acids 1 to 22 of SEQ ID NO: 409 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 272 of SEQ ID NO: 411 based on the SignalP program which predicts that amino acids 1 to 22 of SEQ ID NO: 411 are a signal peptide. host may produce a mixture of two or more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide.

[0060] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide encoding a mature polypeptide having enhancing cellulolytic activity. In one aspect, the coding sequence of the mature polypeptide is nucleotides 388 to 1332 of SEQ ID NO: 1 based on the SignalP 3.0 program (Bendtsen et al., 2004, supra) which predicts that nucleotides 330 to 387 of SEQ ID NO : 1 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 98 to 821 of SEQ ID NO: 3 based on the SignalP program which predicts that nucleotides 47 to 97 of SEQ ID NO: 3 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 126 to 978 of SEQ ID NO: 5 based on the SignalP program which predicts that nucleotides 69 to 125 of SEQ ID NO: 5 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 55 to 678 of SEQ ID NO: 7 or its genomic DNA sequence based on the SignalP program which predicts that nucleotides 1 to 54 of SEQ ID NO: 7 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 912 of SEQ ID NO: 9 or its genomic DNA sequence based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 9 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 46 to 951 of SEQ ID NO: 11 or its genomic DNA sequence based on the SignalP program which predicts that nucleotides 1 to 45 of SEQ ID NO: 11 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 796 of SEQ ID NO: 13 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 13 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 77 to 766 of SEQ ID NO: 15 based on the SignalP program which predicts that nucleotides 20 to 76 of SEQ ID NO: 15 or its genomic DNA sequence encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 921 of SEQ ID NO: 17 based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 17 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 46 to 851 of SEQ ID NO: 19 based on the SignalP program which predicts that nucleotides 1 to 45 of SEQ ID NO: 19 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 55 to 1239 of SEQ ID NO: 21 based on the SignalP program which predicts that nucleotides 1 to 54 of SEQ ID NO: 21 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 46 to 1250 of SEQ ID NO: 23 based on the SignalP program which predicts that nucleotides 1 to 45 of SEQ ID NO: 23 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 811 of SEQ ID NO: 25 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 25 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1112 of SEQ ID NO: 27 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 27 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 859 of SEQ ID NO: 29 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 29 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1018 of SEQ ID NO: 31 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 31 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 70 to 1483 of SEQ ID NO: 33 based on the SignalP program which predicts that nucleotides 1 to 69 of SEQ ID NO: 33 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 76 to 832 of SEQ ID NO: 35 based on the SignalP program which predicts that nucleotides 1 to 75 of SEQ ID NO: 35 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 875 of SEQ ID NO: 37 based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 37 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1250 of SEQ ID NO: 39 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 39 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 795 of SEQ ID NO: 41 based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 41 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 974 of SEQ ID NO: 43 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 43 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1104 of SEQ ID NO: 45 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 45 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 73 to 990 of SEQ ID NO: 47 based on the SignalP program which predicts that nucleotides 1 to 72 of SEQ ID NO: 47 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 49 to 1218 of SEQ ID NO: 49 based on the SignalP program which predicts that nucleotides 1 to 48 of SEQ ID NO: 49 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 55 to 930 of SEQ ID NO: 51 based on the SignalP program which predicts that nucleotides 1 to 54 of SEQ ID NO: 51 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 67 to 1581 of SEQ ID NO: 53 based on the SignalP program which predicts that nucleotides 1 to 66 of SEQ ID NO: 53 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 49 to 865 of SEQ ID NO: 55 based on the SignalP program which predicts that nucleotides 1 to 48 of SEQ ID NO: 55 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1065 of SEQ ID NO: 57 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 57 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 67 to 868 of SEQ ID NO: 59 based on the SignalP program which predicts that nucleotides 1 to 66 of SEQ ID NO: 59 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 55 to 1099 of SEQ ID NO: 61 based on the SignalP program which predicts that nucleotides 1 to 54 of SEQ ID NO: 61 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 70 to 1483 of SEQ ID NO: 63 based on the SignalP program which predicts that nucleotides 1 to 69 of SEQ ID NO: 63 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 1032 of SEQ ID NO: 65 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 65 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 76 to 1200 of SEQ ID NO: 67 based on the SignalP program which predicts that nucleotides 1 to 75 of SEQ ID NO: 67 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 1167 of SEQ ID NO: 69 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 69 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1218 of SEQ ID NO: 71 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 71 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1281 of SEQ ID NO: 73 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 73 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 801 of SEQ ID NO: 75 based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 75 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 819 of SEQ ID NO: 77 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 77 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 966 of SEQ ID NO: 79 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 79 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 702 of SEQ ID NO: 81 or its genomic DNA sequence based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 81 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 70 to 699 of SEQ ID NO: 83 or its genomic DNA sequence based on the SignalP program which predicts that nucleotides 1 to 69 of SEQ ID NO: 83 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 49 to 711 of SEQ ID NO: 85 or its genomic DNA sequence based on the SignalP program which predicts that nucleotides 1 to 48 of SEQ ID NO: 85 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 76 to 1452 of SEQ ID NO: 87 based on the SignalP program which predicts that nucleotides 1 to 75 of SEQ ID NO: 87 encode a signal peptide. or In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1018 of SEQ ID NO: 89 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 89 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 67 to 869 of SEQ ID NO: 91 based on the SignalP program which predicts that nucleotides 1 to 66 of SEQ ID NO: 91 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1036 of SEQ ID NO: 93 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 93 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 67 to 878 of SEQ ID NO: 95 based on the SignalP program which predicts that nucleotides 1 to 66 of SEQ ID NO: 95 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 818 of SEQ ID NO: 97 based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 97 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 49 to 1117 of SEQ ID NO: 99 based on the SignalP program which predicts that nucleotides 1 to 48 of SEQ ID NO: 99 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 875 of SEQ ID NO: 101 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 101 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 82 to 1064 of SEQ ID NO: 103 based on the SignalP program which predicts that nucleotides 1 to 81 of SEQ ID NO: 103 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 46 to 1032 of SEQ ID NO: 105 based on the SignalP program which predicts that nucleotides 1 to 45 of SEQ ID NO: 105 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 1062 of SEQ ID NO: 107 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 107 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 801 of SEQ ID NO: 109 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 109 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 46 to 840 of SEQ ID NO: 111 based on the SignalP program which predicts that nucleotides 1 to 45 of SEQ ID NO: 111 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 702 of SEQ ID NO: 113 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 113 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 750 of SEQ ID NO: 115 based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 115 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 49 to 851 of SEQ ID NO: 117 based on the SignalP program which predicts that nucleotides 1 to 48 of SEQ ID NO: 117 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 860 of SEQ ID NO: 119 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 119 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 830 of SEQ ID NO: 121 based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 121 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 925 of SEQ ID NO: 123 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 123 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 1089 of SEQ ID NO: 125 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 125 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1083 of SEQ ID NO: 127 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 127 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 46 to 1029 of SEQ ID NO: 129 based on the SignalP program which predicts that nucleotides 1 to 45 of SEQ ID NO: 129 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 55 to 1110 of SEQ ID NO: 131 based on the SignalP program which predicts that nucleotides 1 to 54 of SEQ ID NO: 131 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1100 of SEQ ID NO: 133 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 133 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 55 to 1036 of SEQ ID NO: 135 based on the SignalP program which predicts that nucleotides 1 to 54 of SEQ ID NO: 135 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1022 of SEQ ID NO: 137 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 137 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1032 of SEQ ID NO: 139 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 139 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1054 of SEQ ID NO: 141 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 141 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 55 to 769 of SEQ ID NO: 143 based on the SignalP program which predicts that nucleotides 1 to 54 of SEQ ID NO: 143 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 52 to 1533 of SEQ ID NO: 145 based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 145 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 918 of SEQ ID NO: 147 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 147 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1089 of SEQ ID NO: 149 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 149 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 67 to 1002 of SEQ ID NO: 151 based on the SignalP program which predicts that nucleotides 1 to 66 of SEQ ID NO: 151 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 70 to 1098 of SEQ ID NO: 153 based on the SignalP program which predicts that nucleotides 1 to 69 of SEQ ID NO: 153 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 61 to 1088 of SEQ ID NO: 155 based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 155 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1086 of SEQ ID NO: 157 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 157 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 756 of SEQ ID NO: 159 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 159 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1032 of SEQ ID NO: 161 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 161 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 64 to 1041 of SEQ ID NO: 163 based on the SignalP program which predicts that nucleotides 1 to 63 of SEQ ID NO: 163 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 58 to 1026 of SEQ ID NO: 165 based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 165 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 79 to 762 of SEQ ID NO: 167 based on the SignalP program which predicts that nucleotides 1 to 78 of SEQ ID NO: 167 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 67 to 881 of SEQ ID NO: 408 based on the SignalP program which predicts that nucleotides 1 to 66 of SEQ ID NO: 408 encode a signal peptide. In another aspect, the coding sequence of the mature polypeptide is nucleotides 67 to 882 of SEQ ID NO: 410 based on the SignalP program which predicts that nucleotides 1 to 66 of SEQ ID NO: 410 encode a signal peptide. mature polypeptide coding" herein shall be understood to include the cDNA sequence of the genomic DNA sequence or the genomic DNA sequence of the cDNA sequence.

[0061] Medium stringency conditions: The term “medium stringency conditions” means, for probes at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms µg/ml denatured, sheared salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 55°C.

[0062] Medium-high stringency conditions: The term “medium-high stringency conditions” means, for probes at least 100 nucleotides in length, prehybridization and hybridization at 42 °C in 5X SSPE, 0.3 SDS %, 200 micrograms/mL denatured, sheared salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 60°C.

[0063] Mutant: The term "mutant" means a polynucleotide encoding a variant.

[0064] Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, whether single-stranded or double-stranded, that is isolated from a naturally occurring gene or is modified to contain nucleic acid segments in a manner that would not otherwise exist in nature or that is synthetic, comprising one or more control sequences.

[0065] Operably Linked: The term "operably linked" means a configuration in which a control sequence is placed in an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

[0066] Parent or Parent GH61 Polypeptide: The term "parent" or "parent GH61 polypeptide" means a GH61 polypeptide to which an alteration, i.e., a substitution, insertion, and/or deletion, is made in one or more (e.g. (e.g., multiple) positions, to produce the GH61 polypeptide variants of the present invention. The parent may be a naturally occurring (wild-type) polypeptide or a variant or fragment thereof.

[0067] Polypeptide having enhancing cellulolytic activity: The term "polypeptide having enhancing cellulolytic activity" means a GH61 polypeptide or variant thereof which catalyzes enhancement of hydrolysis of a cellulosic material by enzyme having cellulolytic activity, i.e., a cellulase. For purposes of the present invention, enhancing cellulolytic activity is determined by measuring the increase in reducing sugars or the increase in total cellobiose and glucose from hydrolysis of a cellulosic material by cellulolytic enzyme under the following conditions: 1-50 mg total protein/ g of pretreated corn stover cellulose (PCS), where the total protein is comprised of cellulolytic enzyme protein at 50-99.5% w/w and protein of a GH61 polypeptide or its variant at 0.5-50% w/w for 17 days at a suitable temperature, such as 40°C-80°C, e.g. 50°C, 55°C, 60°C, 65°C, or 70°C, and a pH suitable, such as 4-9, e.g. 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, or 8.5, compared to a control hydrolysis with equal total protein load without enhancing cellulolytic activity (1-50 mg cellulolytic protein/g cellulose in PCS). In one aspect, the enhancing activity of the GH61 polypeptide is determined using a mixture of CELLUCLAST® 1.5L (Novozymes A/S, Bagsv^rd, Denmark) in the presence of 2-3% Aspergillus oryzae beta-glucosidase by weight of protein total (recombinantly produced in Aspergillus oryzae according to WO 02/095014) or 2-3 % Aspergillus fumigatus beta-glucosidase of total protein weight (recombinantly produced in Aspergillus oryzae as described in WO 02/095014) protein load cellulase is used as the source of cellulolytic activity.

[0068] Another assay for determining the enhancing cellulolytic activity of a GH61 polypeptide or its variant is to incubate the GH61 polypeptide or its variant with 0.5% phosphoric acid-swollen cellulose (PASC), 100 mM sodium acetate pH 5, 1 mM MnSO4, 0.1% gallic acid, 0.025 mg/mL Aspergillus fumigatus beta-glucosidase, and 0.01% TRITON® X100 for 24-96 hours at 40°C followed by determination of glucose released from PASC .

[0069] GH61 polypeptides or variants thereof having enhancing cellulolytic activity enhance enzyme-catalyzed hydrolysis of a cellulosic material having cellulolytic activity by reducing the amount of cellulolytic enzyme required to achieve the same degree of hydrolysis preferably at least 1.01 times, p .eg, at least 1.05 times, at least 1.10 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times times, at least 10 times, or at least 20 times.

[0070] Pre-treated corn straw: The term “PCS” or “Pre-treated Corn Straw” means a cellulosic material derived from corn straw by heat treatment and dilute sulfuric acid, alkaline pre-treatment, pre-treatment neutral, or any pretreatment known in the art.

[0071] Sequence identity: The relationship between two amino acid sequences or between two nucleotide sequences is described by the "sequence identity" parameter.

[0072] For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the program Needle from the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or higher. The parameters used are open gap penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 substitution matrix (EMBOSS version of BLOSUM62). The Needle result marked "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:

[0073] (Identical Residuals x 100)/(Alignment Length - Total Number of Alignment Intervals)

[0074] For purposes of the present invention, sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or higher. The parameters used are open gap penalty of 10, gap extension penalty of 0.5, and EDNAFULL substitution matrix (EMBOSS version of NCBI NUC4.4). The Needle result marked "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:

[0075] (Identical Deoxyribonucleotides x 100)/(Alignment Length - Total Number of Alignment Gaps)

[0076] Subsequence: The term "subsequence" means a polynucleotide having one or more (e.g., multiple) nucleotides missing from the 5' and/or 3' end of a mature polypeptide coding sequence, wherein the subsequence encodes a fragment having enhancing cellulolytic activity. In one aspect, the subsequence contains at least 85% of the nucleotides, e.g., at least 90% of the nucleotides or at least 95% of the nucleotides of the mature polypeptide coding sequence of a GH61 polypeptide.

[0077] Variant: The term "variant" means a polypeptide having enhancing cellulolytic activity comprising an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions. A substitution means replacing the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means the addition of an amino acid adjacent to and immediately following the amino acid occupying a position. Variants of the present invention have at least 20%, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% , or at least 100% of the enhancing cellulolytic activity of its parent GH61 polypeptides.

[0078] Very high stringency conditions: The term “very high stringency conditions” means, for probes at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/mL of denatured, sheared salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 70°C.

[0079] Very low stringency conditions: The term “very low stringency conditions” means, for probes at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml denatured, sheared salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 45°C.

[0080] Wild-Type GH61 Polypeptide: The term "wild-type" GH61 polypeptide means a GH61 polypeptide naturally produced by a microorganism, such as a bacterium, yeast, or filamentous fungus found in nature.

[0081] Xylan-containing material: The term "xylan-containing material" means any material comprising a plant cell wall polysaccharide containing a backbone of beta-(1-4)-linked xylose residues. Land plant xylans are heteropolymers having a beta-(1-4)-D-xylopyranose backbone, which is branched by short carbohydrate chains. They comprise D-glucuronic acid or its 4-O-methyl ether, L-arabinose, and/or various oligosaccharides, composed of D-xylose, L-arabinose, D- or L-galactose, and D-glucose. Xylan-type polysaccharides can be divided into homoxylans and heteroxylans, which include glucuronoxylans, (arabino)glucuronoxylans, (glucurono)arabinoxylans, arabinoxylans, and complex heteroxylans. See, for example, Ebringerova et al., 2005, Adv. Polym. Sci. 186: 1-67.

[0082] In the processes of the present invention, any material containing xylan can be used. In a preferred aspect, the xylan-containing material is lignocellulose.

[0083] Xylan degradation activity or xylanolytic activity: The term “xylan degradation activity” or “xylanolytic activity” means a biological activity that hydrolyzes material containing xylan. The two basic approaches to measuring xylanolytic activity include: (1) measuring total xylanolytic activity, and (2) measuring individual xylanolytic activities (eg, endoxylanases, beta-xylosidases, arabinofuranosidases, alpha-glucuronidases, acetylxylan esterases, feruloyl esterases, and alpha-glucuronyl esterases). Recent progress in xylanolytic enzyme assays has been summarized in several publications, including Biely and Puchard, 2006, Journal of the Science of Food and Agriculture 86(11): 1636-1647; Spanikova and Biely, 2006, FEBS Letters 580(19): 4597-4601; Herrmann et al., 1997, Biochemical Journal 321: 375-381.

[0084] The total degradation activity of xylan can be measured by determining the reducing sugars formed from various types of xylan, including, for example, xylans from oat spelled, beech wood, and larch wood, or by determining photometry of stained xylan fragments released from various covalently stained xylans. The most common assay of total xylanolytic activity is based on the production of reducing sugars from polymeric 4-O-methyl glucuronoxylan as described in Bailey, Biely, Poutanen, 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology 23 (3): 257-270. Xylanase activity can also be determined with 0.2% AZCL-arabinoxylan as substrate in 0.01% TRITON® X-100 (4-(1,1,3,3-tetramethylbutyl)phenyl-polyethylene glycol) and 200 mM sodium phosphate pH 6 at 37 °C. One unit of xylanase activity is defined as 1.0 µmole of azurin produced per minute at 37°C, pH 6 from 0.2% AZCL-arabinoxylan as substrate in 200 mM sodium phosphate pH 6.

[0085] For purposes of the present invention, xylan degradation activity is determined by measuring the increase in hydrolysis of birch wood xylan (Sigma Chemical Co., Inc., St. Louis, MO, USA) by enzyme(s) of xylan degradation under the following typical conditions: 1 mL reactions, 5 mg/mL substrate (total solids), 5 mg xylanolytic protein/g substrate, 50 mM sodium acetate pH 5, 50 °C, 24 hours, analysis of sugars using p-hydroxybenzoic acid hydrazide (PHBAH) assay as described by Lever, 1972, Anal. Biochem 47: 273-279.

[0086] Xylanase: The term "xylanase" means a 1,4-beta-D-xylan-xylohydrolase (E.C. 3.2.1.8) which catalyzes the endohydrolysis of 1,4-beta-D-xylosidic bonds in xylans. For purposes of the present invention, xylanase activity is determined with 0.2% AZCL-arabinoxylan as substrate in 0.01% TRITON® X-100 and 200 mM sodium phosphate pH 6 at 37 °C. One unit of xylanase activity is defined as 1.0 µmole of azurin produced per minute at 37°C, pH 6 from 0.2% AZCL-arabinoxylan as substrate in 200 mM sodium phosphate pH 6.

Variant Designation Conventions

[0087] For purposes of the present invention, the mature polypeptide disclosed in SEQ ID NO: 30 is used to determine the corresponding amino acid residue in another GH61 polypeptide. The amino acid sequence of another GH61 polypeptide is aligned with the mature polypeptide disclosed in SEQ ID NO: 30 and, based on the alignment, the amino acid position number corresponding to any amino acid residue in the mature polypeptide disclosed in SEQ ID NO: 30 is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or higher. The parameters used are an open gap penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 substitution matrix (EMBOSS version of BLOSUM62). Numbering of amino acid positions is based on the full-length polypeptide (e.g., including the signal peptide) of SEQ ID NO: 30 where position 1 is the first amino acid of the signal peptide (i.e., Met) and position 22 is His of SEQ ID NO: 30.

[0088] For example, the position corresponding to position 105 of the GH61 polypeptide from Aspergillus fumigatus (SEQ ID NO: 30) is position 109 in the GH61 polypeptide from Penicillium emersonii (SEQ ID NO: 36), position 105 in the GH61 polypeptide from Thermoascus aurantiacus (SEQ ID NO: 14), and position 103 in the GH61 polypeptide from Aspergillus aculeatus (SEQ ID NO: 68); the position corresponding to position 188 of the GH61 polypeptide of Aspergillus fumigatus is position 192 of the GH61 polypeptide of Penicillium emersonii, position 188 of the GH61 polypeptide of Thermoascus aurantiacus, and position 186 of the GH61 polypeptide of Aspergillus aculeatus; the position corresponding to position 154 of the Aspergillus fumigatus GH61 polypeptide is position 152 in the Aspergillus aculeatus GH61 polypeptide; and the position corresponding to position 189 of the GH61 polypeptide of Aspergillus fumigatus is position 193 of the GH61 polypeptide of Penicillium emersonii and position 187 of the GH61 polypeptide of Aspergillus aculeatus.

[0089] Identification of the corresponding amino acid residue in another GH61 polypeptide can be determined by an alignment of multiple polypeptide sequences using various computer programs including, but not limited to, MUSCLE (Multiple Sequence Comparison by Log Expectation; Version 3.5 or higher; Edgar, 2004, Nucleic Acids Research 32: 1792-1797); MAFFT (version 6.857 or greater; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374 ; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS EMMA employing ClustalW (1.83 or greater; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), using their respective definition parameters.

[0090] When another GH61 polypeptide diverged from the mature polypeptide of SEQ ID NO: 30 such that traditional sequence-based comparison fails to detect their relationship (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615) , other pairwise sequence comparison algorithms can be used. Greater sensitivity in sequence-based searching can be achieved by using search programs that use probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and is capable of detecting remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has one or more representatives in protein structure databases. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) utilize information from a variety of sources (PSI-BLAST, secondary structure prediction , structural alignment profiles, and solvation potentials) as input to a neural network that predicts structural folding for a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919, can be used to align a sequence of unknown structure with superfamily models present in the SCOP database. These alignments can in turn be used to generate homology models for the polypeptide, and such models can be evaluated for accuracy using a variety of tools developed for that purpose.

[0091] For proteins of known structure, several tools and resources are available to retrieve and generate structural alignments. For example, the superfamilies of SCOP proteins have been structurally aligned, and these alignments are accessible and downloadable. Two or more protein structures can be aligned using a variety of algorithms such as the distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747), and further implementations of these algorithms can be used to query databases of structures with a structure of interest in order to discover possible structural homologs (eg, Holm and Park, 2000, Bioinformatics 16: 566-567 ).

[0092] In describing the GH61 polypeptide variants of the present invention, the nomenclature described below is adapted for ease of reference. The accepted IUPAC three-letter or single-letter amino acid abbreviation is used.

[0093] Substitutions. For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, the replacement of threonine at position 226 by alanine is designated as "Thr226Ala" or "T226A". Multiple mutations are separated by plus signs (“+”), eg, “Gly205Arg + Ser411Phe” or “G205R + S411F”, representing substitutions at positions 205 and 411 of glycine (G) for arginine (R) and serine (S) by phenylalanine (F), respectively.

[0094] Deletions. For an amino acid deletion, the following nomenclature is used: Original amino acid, position*. Accordingly, the deletion of glycine at position 195 is designated as "Gly195*" or "G195*". Multiple deletions are separated by plus signs (“+”), eg, “Gly195* + Ser411*” or “G195* + S411*”.

[0095] Inserts. For an amino acid insertion, the following nomenclature is used: Original amino acid, position, original amino acid, inserted amino acid. Accordingly, the insertion of lysine after glycine at position 195 is designated "Gly195GlyLys" or "G195GK". A multiple amino acid insert is designated [Original amino acid, position, original amino acid, inserted amino acid #1, inserted amino acid #2; etc.]. For example, the insertion of lysine and alanine after glycine at position 195 is indicated as "Gly195GlyLysAla" or "G195GKA".

[0096] In such cases, the inserted amino acid residue(s) are numbered by adding lowercase letters to the position number of the amino acid residue preceding the amino acid residue(s)( inserted. In the example above, the sequence would then be:

[0097] Multiple replacements. Variants comprising multiple substitutions are separated by plus signs (“+”), e.g., “Arg170Tyr+Gly195Glu” or “R170Y+G195E” representing a substitution of arginine and glycine at positions 170 and 195 by tyrosine and glutamic acid, respectively.

[0098] Different replacements. Where different substitutions may be introduced at one position, the different substitutions are separated by a comma, eg, “Arg170Tyr,Glu” represents a replacement of arginine at position 170 with tyrosine or glutamic acid. Thus, “Tyr167Gly,Ala + Arg170Gly,Ala” designates the following variants: “Tyr167Gly+Arg170Gly”, “Tyr167Gly+Arg170Ala”, “Tyr167Ala+Arg170Gly”, and “Tyr167Ala+Arg170Ala”.

Detailed Description of the Invention

[0099] The present invention relates to variants of the GH61 polypeptide, comprising a substitution at one or more (e.g., several) positions corresponding to positions 26, 32, 34, 40, 41, 42, 47, 56, 72 , 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250 of the mature polypeptide of SEQ ID NO: 30 in that the variants have enhancing cellulolytic activity.

Variants

[00100] In one embodiment, the variant has a sequence identity of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99% but less than 100%, with amino acid sequence of the parent GH61 polypeptide.

[00101] In another embodiment, the variant has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82 %, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92 %, at least 93%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99%, but less than 100% sequence identity with the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48 , 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 ,100,102,104,106,108,110,112,114,116,118,120,122,124,126,128,130,132,134,136,138,140,142,144,146, 148 , 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411.

[00102] In one aspect, the number of substitutions in the variants of the present invention is 1-28, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, and 28 replacements.

[00103] In another aspect, a variant comprises a substitution in one or more (e.g., multiple) positions corresponding to positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a two position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a three position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a four position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a five position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a six position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a seven position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises an eight position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a nine position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a ten position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises an eleven-position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a twelve position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a substitution at thirteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a fourteen position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a substitution at fifteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a sixteen position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a seventeen-position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises an eighteen position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a substitution at nineteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a twenty position substitution corresponding to any one of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222 , 234, 246, 249, and 250. In another aspect, a variant comprises a substitution at twenty-one positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a twenty-two substitution positions corresponding to any of the positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213 , 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a substitution at twenty-three positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a substitution in twenty-four positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200 , 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a twenty-five position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. variant comprises a substitution at twenty-six positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169 , 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250. In another aspect, a variant comprises a substitution at twenty-seven positions corresponding to any one of positions 26, 32, 34, 40, In In another aspect, a variant comprises a substitution at each position corresponding to positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00104] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 26. In another aspect, the amino acid at a position corresponding to position 26 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Ile. In another aspect, the variant comprises or consists of the S26I substitution of the mature polypeptide of SEQ ID NO: 30.

[00105] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 32. In another aspect, the amino acid at a position corresponding to position 32 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Glu or Ser. In another aspect, the variant comprises or consists of the G32E or G32S substitution of the mature polypeptide of SEQ ID NO: 30.

[00106] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 34. In another aspect, the amino acid at a position corresponding to position 34 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Phe. In another aspect, the variant comprises or consists of the Y34F substitution of the mature polypeptide of SEQ ID NO: 30.

[00107] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 40. In another aspect, the amino acid at a position corresponding to position 40 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Ala. In another aspect, the variant comprises or consists of the V40A substitution of the mature polypeptide of SEQ ID NO: 30.

[00108] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 41. In another aspect, the amino acid at a position corresponding to position 41 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Thr. In another aspect, the variant comprises or consists of the N41T substitution of the mature polypeptide of SEQ ID NO: 30.

[00109] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 42. In another aspect, the amino acid at a position corresponding to position 42 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Ile, Glu, or Val. In another aspect, the variant comprises or consists of the Q42I, Q42E, or Q42V substitution of the mature polypeptide of SEQ ID NO: 30.

[00110] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 47. In another aspect, the amino acid at a position corresponding to position 47 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Glu, Leu, or Arg. In another aspect, the variant comprises or consists of the S47E, S47L, or S47R substitution of the mature polypeptide of SEQ ID NO: 30.

[00111] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 56. In another aspect, the amino acid at a position corresponding to position 56 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Cys, Glu, or Thr. In another aspect, the variant comprises or consists of the S56C, S56E, or S56T substitution of the mature polypeptide of SEQ ID NO: 30.

[00112] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 72. In another aspect, the amino acid at a position corresponding to position 72 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Gln or Thr. In another aspect, the variant comprises or consists of the S72Q or S72T substitution of the mature polypeptide of SEQ ID NO: 30.

[00113] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 102. In another aspect, the amino acid at a position corresponding to position 102 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Lys or Pro. In another aspect, the variant comprises or consists of the T102K or T102P substitution of the mature polypeptide of SEQ ID NO: 30.

[00114] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 123. In another aspect, the amino acid at a position corresponding to position 123 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Arg. In another aspect, the variant comprises or consists of the A123R substitution of the mature polypeptide of SEQ ID NO: 30.

[00115] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 138. In another aspect, the amino acid at a position corresponding to position 138 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Cys, Glu, Gly, Lys, Leu, or Met. In another aspect, the variant comprises or consists of the Q138C, Q138E, Q138G, Q138K, Q138L, or Q138M substitution of the mature polypeptide of SEQ ID NO: 30.

[00116] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 149. In another aspect, the amino acid at a position corresponding to position 149 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Ile. In another aspect, the variant comprises or consists of the V149I substitution of the mature polypeptide of SEQ ID NO: 30.

[00117] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 152. In another aspect, the amino acid at a position corresponding to position 152 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Ser. In another aspect, the variant comprises or consists of the D152S substitution of the mature polypeptide of SEQ ID NO: 30.

[00118] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 163. In another aspect, the amino acid at a position corresponding to position 163 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Glu, Phe, or Val. In another aspect, the variant comprises or consists of the T163E, T163F, or T163V substitution of the mature polypeptide of SEQ ID NO: 30.

[00119] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 164. In another aspect, the amino acid at a position corresponding to position 164 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Cys or Leu. In another aspect, the variant comprises or consists of the V164C or V164L substitution of the mature polypeptide of SEQ ID NO: 30.

[00120] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 166. In another aspect, the amino acid at a position corresponding to position 166 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Leu. In another aspect, the variant comprises or consists of the I166L substitution of the mature polypeptide of SEQ ID NO: 30.

[00121] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 169. In another aspect, the amino acid at a position corresponding to position 169 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Arg or Cys. In another aspect, the variant comprises or consists of the S169R or S169C substitution of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the S173C substitution of the mature polypeptide of SEQ ID NO: 36. in the mature GH61 polypeptide from Penicillium sp. (emersonii) corresponding to position 169 in the mature GH61 polypeptide from A. fumigatus is position 173.

[00122] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 186. In another aspect, the amino acid at a position corresponding to position 186 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Phe, Lys, Thr, or Tyr. In another aspect, the variant comprises or consists of the S186F, S186K, S186T, or S186Y substitution of the mature polypeptide of SEQ ID NO: 30.

[00123] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 200. In another aspect, the amino acid at a position corresponding to position 200 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Ile or Val. In another aspect, the variant comprises or consists of the F200I or F200V substitution of the mature polypeptide of SEQ ID NO: 30.

[00124] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 207. In another aspect, the amino acid at a position corresponding to position 207 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Pro. In another aspect, the variant comprises or consists of the G207P substitution of the mature polypeptide of SEQ ID NO: 30.

[00125] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 213. In another aspect, the amino acid at a position corresponding to position 213 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Glu. In another aspect, the variant comprises or consists of the S213E substitution of the mature polypeptide of SEQ ID NO: 30.

[00126] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 219. In another aspect, the amino acid at a position corresponding to position 219 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Glu, Met, Gln, or Cys. In another aspect, the variant comprises or consists of the S219E, S219M, S219Q, or S219C substitution of the mature polypeptide of SEQ ID NO: 30.

[00127] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 222. In another aspect, the amino acid at a position corresponding to position 222 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Arg. In another aspect, the variant comprises or consists of the K222R substitution of the mature polypeptide of SEQ ID NO: 30.

[00128] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 234. In another aspect, the amino acid at a position corresponding to position 234 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Gly or Lys. In another aspect, the variant comprises or consists of the S234G or S234K substitution of the mature polypeptide of SEQ ID NO: 30.

[00129] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 246. In another aspect, the amino acid at a position corresponding to position 246 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Pro. In another aspect, the variant comprises or consists of the A246P substitution of the mature polypeptide of SEQ ID NO: 30.

[00130] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 249. In another aspect, the amino acid at a position corresponding to position 249 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Gln, Arg, or Cys. In another aspect, the variant comprises or consists of the N249Q, N249R, or N249C substitution of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the F253C substitution of the mature polypeptide of SEQ ID NO: 36 The position in the mature GH61 polypeptide from Penicillium sp. (emersonii) corresponding to position 249 in the mature GH61 polypeptide from A. fumigatus is position 253.

[00131] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 250. In another aspect, the amino acid at a position corresponding to position 250 is replaced by Ala, Arg, Asn, Asp, Cys, Gln , Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Cys. In another aspect, the variant comprises or consists of the A250C substitution of the mature polypeptide of SEQ ID NO: 30.

[00132] In another aspect, the variant comprises or consists of one or more (e.g., multiple) substitutions selected from the group consisting of S26I; G32E,S; Y34F; V40A; N41T; Q42I,E,V; S47E,L,R; S56C,E,T; S72Q,T; T102K,P; A123R; Q138C,E,G,K,L,M; V149I; D152S; T163E,F,V; V164C,L; I166L; S169R,C; S186F,K,T,Y; F200I,V; G207P; S213E; S219E,M,Q,C; K222R; S234G,K; A246P; N249Q,R,C; and A250C; or to one or more (eg, multiple) substitutions selected from the group consisting of S26I; G32E,S; Y34F; V40A; N41T; Q42I,E,V; S47E,L,R; S56C,E,T; S72Q,T; T102K,P; A123R; Q138C,E,G,K,L,M; V149I; D152S; T163E,F,V; V164C,L; I166L; S169R,C; S186F,K,T,Y; F200I,V; G207P; S213E; S219E,M,Q,C; K222R; S234G,K; A246P; N249Q,R,C; and A250C at positions corresponding to the mature polypeptide of SEQ ID NO: 30 in other GH61 polypeptides described herein.

[00133] In each of the aspects below, the variant comprises or consists of one or more (e.g., multiple) substitutions described below at positions corresponding to SEQ ID NO: 30 in other GH61 polypeptides described herein.

[00134] In another aspect, the variant comprises or consists of the substitutions S173C + F253C of the mature polypeptide of SEQ ID NO: 36. In another aspect, the variant comprises or consists of the substitutions L111V + D152S + M155L + A162W + Q138K + K229W of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the substitutions L111V + D152S + M155L + A162W + Q138K + K229W of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the substitutions L111V + D152S + M155L + A162W + S56A + K229W of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the substitutions L111V + D152S + M155L + A162W + T102K + K229W of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the substitutions L111V + D152S + M155L + A162W + S186T + K229W of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises as or consists of the L111V + D152S + M155L + A162W + K229W + S234G substitutions of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises as or consists of the substitutions L111V + D152S + M155L + A162W + T102K + E105K + K229W from the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the substitutions L111V + D152S + M155L + A162W + Q138K + G188F + K229W from the mature polypeptide of SEQ ID NO: 30. the variant comprises or consists of the L111V + D152S + M155L + A162W + Q138K + V149I + G188F + K229W substitutions of the mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the substitutions L111V + D152S + M155L + A162W + S169C + G188F + K229W + A250C of the mature polypeptide of SEQ ID NO: 30. mature polypeptide of SEQ ID NO: 30. In another aspect, the variant comprises or consists of the L111V + D152S + M155L + A162W + Q138K + V149I + G188F + G207P + K229W substitutions of the mature polypeptide of SEQ ID NO: 30.

[00135] Variants may additionally comprise one or more alterations, eg, substitutions, insertions, or deletions at one or more (eg, several) other positions.

[00136] The amino acid changes may be of a minor nature, ie, conservative amino acid substitutions or insertions that do not significantly affect protein folding and/or activity; small deletions, typically 1-30 amino acids; small extensions of the amino- or carboxyl-terminus, such as an amino-terminal methionine residue; a small peptide linker of up to 20-25 residues; or a small extension that facilitates purification by changing the total charge or another function, such as a polyhistidine tract, an antigenic epitope, or a binding domain.

[00137] Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine) and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. Common substitutions are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg , Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.

[00138] Alternatively, the amino acid changes are of such a nature that the physicochemical properties of the polypeptides are altered. For example, amino acid changes can improve the thermal stability of the polypeptide, alter substrate specificity, change the pH optimum, and the like.

[00139] The variants of the present invention may additionally or further comprise a substitution at one or more (e.g., multiple) positions corresponding to positions 111, 152, 155, and 162 of the mature polypeptide of SEQ ID NO: 30, wherein the variants have enhancing cellulolytic activity (WO 2012/044835).

[00140] In one aspect, the number of additional substitutions above in the variants of the present invention is 1-4, such as 1, 2, 3, or 4 substitutions.

[00141] In another aspect, a variant further or further comprises a substitution at one or more (e.g., multiple) positions corresponding to positions 111, 152, 155, and 162. In another aspect, the variant further comprises or still further a two position substitution corresponding to any one of positions 111, 152, 155, and 162. In another aspect, the variant further or further comprises a three position substitution corresponding to any one of positions 111, 152, 155, and 162. In another aspect, the variant further or further comprises a substitution at each position corresponding to positions 111, 152, 155, and 162.

[00142] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 111. In another aspect, the amino acid at a position corresponding to position 111 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Val. In another aspect, the variant additionally or further comprises the L111V substitution of the mature polypeptide of SEQ ID NO: 30.

[00143] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 152. In another aspect, the amino acid at a position corresponding to position 152 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Ser. In another aspect, the variant additionally or further comprises the D152S substitution of the mature polypeptide of SEQ ID NO: 30.

[00144] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 155. In another aspect, the amino acid at a position corresponding to position 155 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Leu. In another aspect, the variant additionally or further comprises the M155L substitution of the mature polypeptide of SEQ ID NO: 30.

[00145] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 162. In another aspect, the amino acid at a position corresponding to position 162 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Trp. In another aspect, the variant additionally or further comprises the A162W substitution of the mature polypeptide of SEQ ID NO: 30.

[00146] In another aspect, the variant additionally or further comprises one or more (e.g., multiple) substitutions selected from the group consisting of L111V, D152S, M155L, and A162W of the mature polypeptide of SEQ ID NO: 30, or to one or more (e.g., multiple) substitutions selected from the group consisting of L111V, D152S, M155L, and A162W at positions corresponding to the mature polypeptide of SEQ ID NO: 30 in other GH61 polypeptides described herein.

[00147] The variants of the present invention may additionally or further comprise a substitution at one or more (e.g., multiple) positions corresponding to positions 96, 98, 200, 202, and 204 of the mature polypeptide of SEQ ID NO: 30, where the variants have enhancing cellulolytic activity (WO 2012/044836).

[00148] In one aspect, the number of additional substitutions above in the variants of the present invention is 1-5, such as 1, 2, 3, 4, or 5 substitutions.

[00149] In another aspect, a variant additionally or furthermore comprises a substitution at one or more (e.g., multiple) positions corresponding to positions 96, 98, 200, 202, and 204. In another aspect, the variant comprises additionally or furthermore a two position substitution corresponding to any one of positions 96, 98, 200, 202, and 204. In another aspect, the variant additionally or further comprises a three position substitution corresponding to any one of positions 96, 98, 200, 202, and 204. In another aspect, the variant further or further comprises a four position substitution corresponding to any one of positions 96, 98, 200, 202, and 204. In another aspect, the variant further comprises or still additionally a substitution at each position corresponding to positions 96, 98, 200, 202, and 204.

[00150] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 96. In another aspect, the amino acid at a position corresponding to position 96 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Val. In another aspect, the variant additionally or further comprises the I96V substitution of the mature polypeptide of SEQ ID NO: 30.

[00151] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 98. In another aspect, the amino acid at a position corresponding to position 98 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Leu. In another aspect, the variant additionally or further comprises the F98L substitution of the mature polypeptide of SEQ ID NO: 30.

[00152] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 200. In another aspect, the amino acid at a position corresponding to position 200 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Ile. In another aspect, the variant additionally or further comprises the F200I substitution of the mature polypeptide of SEQ ID NO: 30.

[00153] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 202. In another aspect, the amino acid at a position corresponding to position 202 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Leu. In another aspect, the variant additionally or further comprises the I202L substitution of the mature polypeptide of SEQ ID NO: 30.

[00154] In another aspect, the variant additionally or further comprises a substitution at a position corresponding to position 204. In another aspect, the amino acid at a position corresponding to position 204 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Val. In another aspect, the variant additionally or further comprises the I204V substitution of the mature polypeptide of SEQ ID NO: 30.

[00155] In another aspect, the variant additionally or further comprises one or more (e.g., several) substitutions selected from the group consisting of I96V, F98L, F200I, I202L, and I204V, or to one or more (p. g., various) substitutions selected from the group consisting of I96V, F98L, F200I, I202L, and I204V at positions corresponding to SEQ ID NO: 30 in other GH61 polypeptides described herein.

[00156] The variants of the present invention may additionally or further comprise a substitution at one or more (e.g., several) positions corresponding to positions 105, 154, 188, 189, 216, and 229 of the mature polypeptide of SEQ ID NO: 30, where the variants have enhancing cellulolytic activity.

[00157] In one aspect, the number of additional substitutions above in the variants of the present invention is 1-6, e.g., 1, 2, 3, 4, 5, or 6 substitutions.

[00158] In another aspect, a variant further or further comprises a substitution at one or more (e.g., multiple) positions corresponding to positions 105, 154, 188, 189, 216, and 229. In another aspect, a variant further or further comprises a two position substitution corresponding to any one of positions 105, 154, 188, 189, 216, and 229. In another aspect, a variant further or further comprises a three position substitution corresponding to any one of positions 105, 154, 188, 189, 216, and 229. In another aspect, a variant further or further comprises a four position substitution corresponding to any one of positions 105, 154, 188, 189, 216, and 229. In another aspect, a variant further or further comprises a substitution at five positions corresponding to any one of positions 105, 154, 188, 189, 216, and 229. In another aspect, a variant further or further comprises a substitution at each position corresponding to positions 105, 154, 188, 189, 216, and 229.

[00159] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 105. In another aspect, the amino acid at a position corresponding to position 105 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Pro or Lys. In another aspect, the variant additionally or further comprises the E105P or E105K substitution of the mature polypeptide of SEQ ID NO: 30.

[00160] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 154. In another aspect, the amino acid at a position corresponding to position 154 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Leu. In another aspect, the variant additionally or further comprises the E154L substitution of the mature polypeptide of SEQ ID NO: 30.

[00161] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 188. In another aspect, the amino acid at a position corresponding to position 188 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Ala or Trp. In another aspect, the variant additionally or further comprises the G188A or G188W substitution of the mature polypeptide of SEQ ID NO: 30.

[00162] In another aspect, the variant additionally or further comprises a substitution at a position corresponding to position 189. In another aspect, the amino acid at a position corresponding to position 189 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Lys. In another aspect, the variant additionally or further comprises the N189K substitution of the mature polypeptide of SEQ ID NO: 30.

[00163] In another aspect, the variant additionally comprises a substitution at a position corresponding to position 216. In another aspect, the amino acid at a position corresponding to position 216 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Leu or Tyr. In another aspect, the variant additionally or further comprises the A216L or A216Y substitution of the mature polypeptide of SEQ ID NO: 30.

[00164] In another aspect, the variant additionally or further comprises a substitution at a position corresponding to position 229. In another aspect, the amino acid at a position corresponding to position 229 is replaced by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Trp, His, Ile, or Tyr. In another aspect, the variant additionally or further comprises the A229W, A229H, A229I, or A229Y substitution of the mature polypeptide of SEQ ID NO: 30.

[00165] In another aspect, the variant additionally or further comprises one or more (e.g., several) substitutions selected from the group consisting of E105P,K; E154L; G188A,W; N189K; A216L,Y; and A229W,H,I,Y, from the mature polypeptide of SEQ ID NO: 30, or to one or more (eg, multiple) substitutions selected from the group consisting of E105P,K; E154L; G188A,W; N189K; A216L,Y; and A229W,H,I,Y at positions corresponding to the mature polypeptide of SEQ ID NO: 30 in other GH61 polypeptides described herein.

[00166] Variants may consist of at least 85% of the amino acid residues, e.g., at least 90% of the amino acid residues or at least 95% of the amino acid residues of the mature polypeptides of the corresponding parent GH61 polypeptides.

[00167] Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In this latter technique, single alanine mutations are introduced at all residues of the molecule, and the resulting mutant molecules are tested for enhancing cellulolytic activity to identify amino acid residues that are critical to the molecule's activity. See also, Hilton et al., 1996, J. Biol. chem. 271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of the structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutated amino acid contact sites. putative. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. The identity of essential amino acids can also be inferred from an alignment with a related polypeptide. Essential amino acids in GH61 polypeptides correspond to positions 22, 107, 194, and/or 196 of the mature polypeptide of SEQ ID NO: 30.

[00168] In one embodiment, the variants have increased thermostability compared to their parent GH61 polypeptides.

[00169] In one aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.0 and 95°C.

[00170] In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 55 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 3.5 and 95°C.

[00171] In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.0 and 95°C.

[00172] In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 4.5 and 95°C.

[00173] In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.0 and 95°C.

[00174] In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 5.5 and 95°C.

[00175] In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.0 and 95°C.

[00176] In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 68 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 6.5 and 95°C.

[00177] In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.0 and 95°C.

[00178] In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 7.5 and 95°C.

[00179] In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.0 and 95°C.

[00180] In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 8.5 and 95°C.

[00181] In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 45 °C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 50°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 55°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 60°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 62°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 65°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 68°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 70°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 72°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 75°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 80°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 85°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 90°C. In another aspect, the thermostability of the variant relative to the parent is determined at pH 9.0 and 95°C.

[00182] In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 1 minute. In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 5 minutes. In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 10 minutes. In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 15 minutes. In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 20 minutes. In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 25 minutes. In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 30 minutes. In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 45 minutes. In each of the above aspects, the thermostability of the variant relative to the parent can be determined by incubating the variant and the parent for 60 minutes. A time period longer than 60 minutes can also be used.

[00183] In one aspect, the thermostability of the variant having enhancing cellulolytic activity is increased at least 1.01 times, e.g., at least 1.05 times, at least 1.1 times, at least 1.2 times, at least 1.3 times at least 1.4 times at least 1.5 times at least 1.8 times at least 2 times at least 5 times at least 10 times at least 15 times at least 20 times, at least 25 times, at least 30 times, at least 50 times, at least 75 times, or at least 100 times compared to more thermostable than the parent.

Parent GH61 Polypeptides

[00184] The parent GH61 polypeptide may be any GH61 polypeptide having enhancing cellulolytic activity.

[00185] The parent GH61 polypeptide may be (a) a polypeptide having at least 60% sequence identity with the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 16 8, 409, or 411; (b) a polypeptide encoded by a polynucleotide that hybridizes under conditions of at least low stringency to (i) the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 , 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67 , 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117 . 67, 408, or 410, or (ii) the full length complement of (i); or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity with the coding sequence of the mature polypeptide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 , 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69 , 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119 ,121,123,125,127,129,131,133,135,137,139,141,143,145,147,149,151,153,155,157,159,161,163,165,167, 408 , or 410.

[00186] In one aspect, the parent has a sequence identity with the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 , 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78 ,80,82,84,86,88,90,92,94,96,98,100,102,104,106,108,110,112,114,116,118,120,122,124,126,128 , 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411 of at least 60% , e.g. at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85% at least 86% at least 87% at least 88% at least 89% at least 90% at least 91% at least 92% at least 93% at least 94% at least 95% at least 96%, at least 97%, at least 98%, at least 99%, or 100% having cellulolytic-enhancing activity.

[00187] In one embodiment, the amino acid sequence differs from the parent by up to 10 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 14 6, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411.

[00188] In another embodiment, the parent comprises or consists of the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14,16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411.

[00189] In another embodiment, the parent comprises or consists of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 , 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78 ,80,82,84,86,88,90,92,94,96,98,100,102,104,106,108,110,112,114,116,118,120,122,124,126,128 , 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411.

[00190] In another embodiment, the parent is a fragment containing at least 85% of the amino acid residues, e.g., at least 90% of the amino acid residues or at least 95% of the amino acid residues of the mature polypeptide of a GH61 polypeptide.

[00191] In another embodiment, the parent is an allelic variant of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 , 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78 ,80,82,84,86,88,90,92,94,96,98,100,102,104,106,108,110,112,114,116,118,120,122,124,126,128 , 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411.

[00192] In another aspect, the parent is encoded by a polynucleotide that hybridizes under very low stringency conditions, low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions stringency with (i) the coding sequence for the mature polypeptide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 408, or 410, or their full-length complements (Sambrook et al. ., 1989, Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor, New York).

[00193] The polynucleotide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 408, or 410, or subsequences thereof, as well as the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 1 54, 56, 158, 160, 162, 164, 166, 168, 409, or 411, or fragments thereof, can be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species of according to methods well known in the art. In particular, such probes can be used for hybridization with genomic DNA or cDNA from a cell of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene present therein. Such probes can be considerably shorter than the entire sequence, but must be at least 15, e.g., at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. Probes are typically labeled to detect the corresponding gene (eg, with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention.

[00194] A library of genomic DNA or cDNA prepared from such other strains can be screened for DNA that hybridizes to the probes described above and encodes a parent. Genomic or other DNA from such other strains can be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA can be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that hybridizes to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 , 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85 ,87,89,91,93,95,97,99,101,103,105,107,109,111,113,115,117,119,121,123,125,127,129,131,133,135 , 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 408, or 410, or their subsequences, the carrier material is used in a transfer from Southern.

[00195] For purposes of the present invention, hybridization indicates that the polynucleotides hybridize with a labeled nucleic acid probe corresponding to (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 , 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69 , 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119 ,121,123,125,127,129,131,133,135,137,139,141,143,145,147,149,151,153,155,157,159,161,163,165,167, 408 , or 410; (ii) its mature polypeptide coding sequence; (iii) its full length complement; or (iv) a subsequence thereof; under conditions of very low to very high stringency. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film or any other detection means known in the art.

[00196] In one aspect, the nucleic acid probe is the coding sequence of the mature polypeptide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 408, or 410.

[00197] In another embodiment, the nucleic acid probe is a polynucleotide encoding the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411; its mature polypeptide; or a fragment thereof.

[00198] In another embodiment, the nucleic acid probe is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81 ,83,85,87,89,91,93,95,97,99,101,103,105,107,109,111,113,115,117,119,121,123,125,127,129,131 , 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 408, or 410.

[00199] In another aspect, the parent is encoded by a polynucleotide having a sequence identity with the coding sequence of the mature polypeptide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 , 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69 , 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119 ,121,123,125,127,129,131,133,135,137,139,141,143,145,147,149,151,153,155,157,159,161,163,165,167, 408 , or 410 of at least 60%, e.g. at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.

[00200] The parent may be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or C-terminus of a region of another polypeptide.

[00201] A parent may be a fusion polypeptide or cleavable fusion polypeptide to which another polypeptide is fused at the N-terminus or C-terminus of the polypeptide of the present invention. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention. Techniques for producing fusion polypeptides are known in the art, and include linking the coding sequences encoding the polypeptides such that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. . Fusion polypeptides can also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776- 779).

[00202] A fusion polypeptide may additionally comprise a cleavage site between the two polypeptides. After secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.

[00203] The parent can be obtained from microorganisms of any genus. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the parent encoded by a polynucleotide is produced by the source or by a strain into which the source polynucleotide has been inserted. In one embodiment, the parent is secreted extracellularly.

[00204] The parent may be a bacterial GH61 polypeptide. For example, the parent can be a Gram-positive bacterial polypeptide such as a GH61 polypeptide from Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, or Streptomyces, or a Gram-negative bacterial polypeptide such as a GH61 polypeptide from Campylobacter, E. coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella, or Ureaplasma.

[00205] In one embodiment, the parent is a GH61 polypeptide from Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis.

[00206] The parent may be a fungal GH61 polypeptide. For example, the parent can be a GH61 polypeptide from yeast such as a GH61 polypeptide from Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia; or a filamentous fungal GH61 polypeptide such as a GH61 polypeptide from Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Coptotermes, Corynascus, Cryphonectria, Cryptococcus, Diplodia, Exidia, Fil ibasidium, Fusarium, Gibberella, Holomastigotoides, Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces, Poitrasia, Pseudoplectania, Pseudotrichonympha, Rhizomucor, Schizophyllum, S cytalidium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella, or Xylaria.

[00207] In another embodiment, the parent is a GH61 polypeptide from Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, or Saccharomyces oviformis.

[00208] In another embodiment, the parent is a GH61 polypeptide from Acremonium cellulolyticus, Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus lentulus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Aspergillus terreus , Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium shitrium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Fennellia nivea, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fu sarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora thermophil a, Neurospora crassa , Penicillium emersonii, Penicillium funiculosum, Penicillium pinophilum, Penicillium purpurogenum, Phanerochaete chrysosporium, Talaromyces leycettanus, Thermoascus aurantiacus, Thielavia achromatica, Thielavia albomyces, Thielavia albopilosa, Thielavia australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia o vispora, Thielavia peruviana, Thielavia setosa, Thielavia spededonium, Thielavia subthermophila, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.

[00209] It will be understood that for the aforementioned species the invention encompasses both perfect and imperfect states, and other taxonomic equivalents, eg anamorphs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents.

[00210] Strains of these species are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

[00211] The parent can be identified and obtained from other sources, including microorganisms isolated from nature (eg, soil, compounds, water, etc.) or DNA samples obtained directly from natural materials (eg, soil , compounds, water, etc.) using the aforementioned probes. Techniques for isolating microorganisms and DNA directly from natural habitats are well known in the art. A polynucleotide encoding the parent can then be obtained by similar screening of a genomic DNA or cDNA library from another microorganism or mixed DNA sample. Once a polynucleotide encoding a parent is detected with the probe(s), the polynucleotide can be isolated or cloned using techniques that are known to those of ordinary skill in the art (see, e.g., Sambrook et al. , 1989, supra).

Preparation of Variants

[00212] The present invention also relates to methods for obtaining a variant of the GH61 polypeptide having enhancing cellulolytic activity, comprising: (a) introducing into a parent GH61 polypeptide a substitution in one or more (e.g., several) positions corresponding to positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250 of the mature polypeptide of SEQ ID NO: 30, wherein the variant has enhancing cellulolytic activity; and optionally (b) recovering the variant. In one aspect, the method further comprises introducing into the parent GH61 polypeptide a substitution at one or more (e.g., multiple) positions corresponding to positions 111, 152, 155, and 162 of the mature polypeptide of SEQ ID NO : 30, where the variant has enhancing cellulolytic activity. In another aspect, the method further comprises introducing into the parent GH61 polypeptide a substitution at one or more (e.g., multiple) positions corresponding to positions 96, 98, 200, 202 and 204 of the mature polypeptide of SEQ ID NO: 30, where the variant has enhancing cellulolytic activity. In another aspect, the method further comprises introducing into the parent GH61 polypeptide a substitution at one or more (e.g., multiple) positions corresponding to positions 105, 154, 188, 189, 216 and 229 of the mature GH61 polypeptide. SEQ ID NO: 30, wherein the variant has enhancing cellulolytic activity.

[00213] Variants can be prepared using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.

[00214] Site-directed mutagenesis is a technique in which one or more (eg, several) mutations are introduced at one or more defined sites in a polynucleotide encoding the parent. Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepare variants.

[00215] Site-directed mutagenesis can be achieved in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving cleavage by a restriction enzyme at a site on the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually, the restriction enzyme that digests the plasmid and the oligonucleotide is the same, allowing the sticky ends of the plasmid and the insert to bind together. See, eg, Scherer and Davis, 1979, Proc. Natl. academic Sci. USA 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.

[00216] Site-directed mutagenesis can also be achieved in vivo by methods known in the art. See, eg, US Patent Application Publication. At the. 2004/0171154; Storici et al., 2001, Nature Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16.

[00217] Site-directed mutagenesis systematically replaces a polypeptide coding sequence with sequences encoding all 19 amino acids at one or more (eg, several) specific positions (Parikh and Matsumura, 2005, J. Mol. Biol. 352 : 621-628).

[00218] Synthetic gene construction entails in vitro synthesis of a polynucleotide molecule designed to encode a polypeptide of interest. Gene synthesis can be performed using a number of techniques, such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies in which oligonucleotides are synthesized and assembled into photoprogrammable microfluidic chips.

[00219] Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. academic Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (eg, Lowman et al., 1991, Biochemistry 30: 10832-10837; US Patent No. 5,223,409; WO 92/06204), and targeted mutagenesis for region (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).

[00220] High-throughput mutagenesis/scrambling methods can be combined with automated screening methods to detect the activity of mutagenized, cloned polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules encoding active polypeptides can be recovered from host cells and rapidly sequenced using methods standard in the art. These methods allow rapid determination of the importance of individual amino acid residues in a polypeptide.

[00221] Semi-synthetic gene construction is achieved by combining aspects of synthetic gene construction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or scrambling. The semisynthetic construct is typified by a process using fragments of polynucleotides that are synthesized, in combination with PCR techniques. Defined regions of genes can thus be synthesized de novo, while other regions can be amplified using site-specific mutagenic primers, while still other regions can be subject to amplification by error-prone or error-prone PCR. Polynucleotide subsequences can then be shuffled.

polynucleotides

[00222] The present invention also relates to isolated polynucleotides encoding variants of the GH61 polypeptide of the present invention.

Nucleic Acid Constructs

[00223] The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the GH61 polypeptide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under compatible conditions with the control sequences.

[00224] The polynucleotide can be manipulated in a variety of ways to provide expression of a GH61 polypeptide variant. Manipulation of the polynucleotide before insertion into a vector may be desirable or necessary depending on the expression vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[00225] The control sequence may be a promoter, a polynucleotide recognized by a host cell for expression of a polynucleotide encoding a variant of the present invention. The promoter contains transcriptional control sequences that mediate expression of the GH61 polypeptide variant. The promoter can be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides homologous or heterologous to the host cell.

[00226] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a bacterial host cell are the promoters obtained from the alpha-amylase gene (amyQ) of Bacillus amyloliquefaciens, alpha-amylase gene (amyL) of Bacillus licheniformis, penicillinase (penP) gene from Bacillus licheniformis, maltogenic amylase (amyM) gene from Bacillus stearothermophilus, levansucrase (sacB) gene from Bacillus subtilis, xylA and xylB genes from Bacillus subtilis, cryIIIA gene from Bacillus thuringiensis (Agaisse and Lereclus, 1994, Molecular Microbiology 13: 97-107), E. coli lac operon, E. coli trc promoter (Egon et al., 1988, Gene 69: 301-315), Streptomyces agarase (dagA) gene coelicolor, and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. USA 80: 21-25). Additional promoters are described in "Useful proteins from recombinant bacteria" in Gilbert et al., 1980, Scientific American 242: 74-94; and in Sambrook et al., 1989, supra. Examples of tandem promoters are disclosed in WO 99/43835.

[00227] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are the promoters obtained from the genes of Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, stable acid alpha-amylase from Aspergillus niger, glucoamylase (glaA) from Aspergillus niger or Aspergillus awamori, TAKA amylase from Aspergillus oryzae, alkaline protease from Aspergillus oryzae, triose phosphate isomerase from Aspergillus oryzae, trypsin-like protease from Fusarium oxysporum (WO 96/00787), amyloglucosidase from Fusarium venenatum (WO 00/56900), Daria from Fusarium venenatum (WO 00/56900), Quinn from Fusarium venenatum (WO 00/56900), lipase from Rhizomucor miehei, aspartic proteinase from Rhizomucor miehei, beta-glucosidase from Trichoderma reesei, cellobiohydrolase Trichoderma reesei I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III Trichoderma reesei, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor, as well as the NA2-tpi promoter (a modified promoter of a neutral Aspergillus alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from a neutral alpha-amylase gene from Aspergillus niger in which the untranslated leader has been replaced by an untranslated leader from a triose phosphate isomerase gene from Aspergillus nidulans or Aspergillus oryzae); and their mutant, truncated, and hybrid promoters. Other promoters are described in U.S. Pat. At the. 6,011,147.

[00228] In a yeast host, useful promoters are obtained from the genes for enolase (ENO-1) from Saccharomyces cerevisiae, galactokinase (GAL1) from Saccharomyces cerevisiae, alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP) from Saccharomyces cerevisiae, triose phosphate isomerase (TPI) from Saccharomyces cerevisiae, metallothionein (CUP1) from Saccharomyces cerevisiae, and 3-phosphoglycerate kinase from Saccharomyces cerevisiae. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.

[00229] The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operatively linked to the 3' end of the polynucleotide encoding the GH61 polypeptide variant. Any terminator that is functional in the host cell can be used.

[00230] Preferential terminators for bacterial host cells are obtained from the genes for alkaline phosphatase (aprH) from Bacillus clausii, alpha-amylase (amyL) from Bacillus licheniformis, and ribosomal RNA (rrnB) from Escherichia coli.

[00231] Preferred terminators for filamentous fungal host cells are obtained from the genes of Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium trypsin-like protease oxysporum, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trigluchoderma xylanase I reesei , Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor.

[00232] Preferred terminators for yeast host cells are obtained from the genes of Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.

[00233] The control sequence can also be a stabilizing region of mRNA downstream of a promoter and upstream of the coding sequence of a gene that increases gene expression.

[00234] Examples of suitable mRNA stabilizing regions are obtained from a Bacillus thuringiensis cryIIIA gene (WO 94/25612) and a Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177: 3465-3471) .

[00235] The control sequence can also be a leader, an untranslated region of an mRNA that is important for translation by the host cell. The leader is operatively linked to the 5' terminus of the polynucleotide encoding the GH61 polypeptide variant. Any leader that is functional in the host cell can be used.

[00236] Preferred leaders for filamentous fungal host cells are obtained from the genes of TAKA amylase from Aspergillus oryzae and triose phosphate isomerase from Aspergillus nidulans.

[00237] Leaders suitable for yeast host cells are obtained from the genes for enolase (ENO-1) from Saccharomyces cerevisiae, 3-phosphoglycerate kinase from Saccharomyces cerevisiae, alpha factor from Saccharomyces cerevisiae and alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2) /GAP) from Saccharomyces cerevisiae.

[00238] The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the coding sequence of the GH61 polypeptide variant and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the host cell can be used.

[00239] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes of anthranilate synthase from Aspergillus nidulans, glucoamylase from Aspergillus niger, alpha-glucosidase from Aspergillus niger, TAKA amylase from Aspergillus oryzae and trypsin-like protease from Fusarium oxysporum .

[00240] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.

[00241] The control sequence may also be a signal peptide coding region that encodes a signal peptide attached to the N-terminus of a GH61 polypeptide variant and directs the variant to the secretory pathway of the cell. The 5' end of the polynucleotide coding sequence may inherently contain a signal peptide coding sequence naturally linked in translational reading frame to the coding sequence segment encoding the variant. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign signal peptide coding sequence can simply be substituted for the natural signal peptide coding sequence in order to enhance secretion of the variant. However, any signal peptide coding sequence that directs the expressed variant to the secretory pathway of a host cell may be used.

[00242] Effective signal peptide coding sequences for bacterial host cells are the signal peptide coding sequences obtained from the genes of maltogenic amylase from Bacillus NCIB 11837, subtilisin from Bacillus licheniformis, beta-lactamase from Bacillus licheniformis, alpha-amylase from Bacillus stearothermophilus, neutral proteases (nprT, nprS, nprM) from Bacillus stearothermophilus, and prsA from Bacillus subtilis. Additional signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

[00243] Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes of neutral amylase from Aspergillus niger, glucoamylase from Aspergillus niger, TAKA amylase from Aspergillus oryzae, cellulase from Humicola insolens, endoglucanase V from Humicola insolens, lipase from Humicola lanuginosa, and aspartic proteinase from Rhizomucor miehei.

[00244] Useful signal peptides for yeast host cells are obtained from the Saccharomyces cerevisiae alpha factor and Saccharomyces cerevisiae invertase genes. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.

[00245] The control sequence may also be a propeptide coding sequence encoding a propeptide positioned at the N-terminus of a polypeptide variant. The resulting polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A pro-polypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the pro-peptide from the pro-polypeptide. The propeptide coding sequence can be obtained from the genes for alkaline protease (aprE) from Bacillus subtilis, neutral protease (nprT) from Bacillus subtilis, laccase from Myceliophthora thermophila (WO 95/33836), aspartic proteinase from Rhizomucor miehei, and factor alpha from Saccharomyces cerevisiae.

[00246] Where signal peptide and propeptide sequences are present, the propeptide region is positioned near the N-terminus of the GH61 polypeptide variant and the signal peptide sequence is positioned near the N-terminus of the pro-peptide sequence. peptide.

[00247] It may also be desirable to add regulatory sequences that regulate expression of the GH61 polypeptide variant in relation to host cell growth. Examples of regulatory sequences are those that cause gene expression to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory sequences in prokaryotic systems include the lac, tac, and trp operator systems. In yeast, either the ADH2 system or the GAL1 system can be used. In filamentous fungi, the glucomylase promoter from Aspergillus niger, the TAKA alpha-amylase promoter from Aspergillus oryzae, and the glucoamylase promoter from Aspergillus oryzae, cellobiohydrolase I promoter from Trichoderma reesei, and cellobiohydrolase II promoter from Trichoderma reesei. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the variant would be operably linked to the regulatory sequence.

Expression Vectors

[00248] The present invention also relates to recombinant expression vectors comprising a polynucleotide encoding a variant of the GH61 polypeptide of the present invention, a promoter, and transcriptional and translational termination signals. The various nucleotide and control sequences can be joined together to produce a recombinant expression vector that can include one or more convenient restriction sites to allow insertion or substitution of the polynucleotide encoding the variant at such sites. Alternatively, the polynucleotide can be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. When creating the expression vector, the coding sequence is located in the vector such that the coding sequence is operatively linked to the appropriate control sequences for expression.

[00249] The recombinant expression vector can be any vector (eg, a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[00250] The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or a artificial chromosome. The vector can contain any means to ensure self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated along with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, can be used.

[00251] The vector preferably contains one or more selectable markers that allow easy selection of transformed, transfected, transduced, or similar cells. A selectable marker is a gene whose product provides biocidal or viral resistance, heavy metal resistance, auxotroph prototrophy, and the like.

[00252] Examples of bacterial selectable markers are dal genes from Bacillus licheniformis or Bacillus subtilis, or markers that confer antibiotic resistance such as resistance to ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline. Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Markers selectable for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl-aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase) , hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as their equivalents. Preferred for use in an Aspergillus cell are amdS and pyrG genes from Aspergillus nidulans or Aspergillus oryzae and a bar gene from Streptomyces hygroscopicus. Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.

[00253] The selectable marker may be a dual selectable marker system as described in WO 2010/039889. In one aspect, the dual selectable marker is a hph-tk dual selectable marker system. The vector preferably contains an element(s) that allows for integration of the vector into the genome of the host cell or autonomous replication of the vector in the cell independent of the genome.

[00254] For integration into the host cell genome, the vector may be based on the polynucleotide sequence encoding the GH61 polypeptide variant or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the host cell genome at a precise location(s) on the chromosome(s). To increase the likelihood of integration at a precise location, the integration elements should contain a sufficient number of nucleic acids, such as 100 to 10000 base pairs, 400 to 10000 base pairs, and 800 to 10000 base pairs, which have a high degree of sequence identity with the corresponding target sequence to enhance the likelihood of homologous recombination. Integrating elements can be any sequence that is homologous to the target sequence in the host cell genome. Furthermore, integrating elements can be non-coding or coding polynucleotides. On the other hand, the vector can be integrated into the host cell genome by non-homologous recombination.

[00255] For autonomous replication, the vector may additionally comprise an origin of replication allowing the vector to replicate autonomously in the host cell in question. The origin of replication can be any plasmid replicator mediating autonomous replication that functions within a cell. The term "origin of replication" or "plasmid replicator" means a polynucleotide that enables a plasmid or vector to replicate in vivo.

[00256] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177 and pACYC184 allowing replication in E. coli, and pUB110, pE194, pTA1060 and pAMβl allowing replication in Bacillus.

[00257] Examples of origins of replication for use in a yeast host cell are 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

[00258] Examples of useful origins of replication in a filamentous fungal cell are AMA1 and ANS1 (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be achieved according to the methods disclosed in WO 00/24883.

[00259] More than one copy of a polynucleotide of the present invention can be inserted into a host cell to increase production of a GH61 polypeptide variant. An increase in the number of copies of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby so additional copies of the polynucleotide can be selected for by culturing the cells in the presence of the appropriate selectable agent.

[00260] The procedures used to link the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).

[00261] Host Cells

[00262] The present invention also relates to recombinant host cells, comprising a GH61 polynucleotide variant of the present invention operably linked to one or more control sequences that direct the production of a variant of the present invention. A construct or vector comprising a polynucleotide is introduced into a host cell such that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector as described above. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will largely depend on the gene encoding the variant and its source.

[00263] The host cell can be any cell useful in the recombinant production of a GH61 polypeptide variant, e.g., a prokaryote or a eukaryote.

[00264] The prokaryotic host cell may be any Gram-positive or Gram-negative bacteria. Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces. Gram-negative bacteria include, but are not limited to, Campylobacter, E. coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma.

[00265] The bacterial host cell may be any Bacillus cell including, but not limited to, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.

[00266] The bacterial host cell may also be any Streptococcus cell, including, but not limited to, Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis and Streptococcus equi subsp. Zooepidemicus.

[00267] The bacterial host cell may also be any Streptomyces cell, including, but not limited to, Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[00268] The introduction of DNA into a Bacillus cell can be performed by transformation with protoplasts (see, eg, Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115), transformation with competent cells (see, e.g., Young and Spizizen, 1961, J. Bacteriol. 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, J. Mol. Biol. 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, J. Bacteriol. 169: 52715278). Introduction of DNA into an E. coli cell can be accomplished by protoplast transformation (see, eg, Hanahan, 1983, J. Mol. Biol. 166: 557-580) or electroporation (see, e.g. ., Dower et al., 1988, Nucleic Acids Res. 16: 6127-6145). Introduction of DNA into a Streptomyces cell can be accomplished by protoplast transformation, electroporation (see, eg, Gong et al., 2004, Folia Microbiol. (Praha) 49: 399-405), conjugation (see, eg, Mazodier et al., 1989, J. Bacteriol. 171: 3583-3585), or transduction (see, eg, Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98 : 6289-6294). Introduction of DNA into a Pseudomonas cell can be accomplished by electroporation (see, eg, Choi et al., 2006, J. Microbiol. Methods 64: 391397), or conjugation (see, eg, Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71: 51-57 ). Introduction of DNA into a Streptococcus cell can be accomplished by natural competence (see, e.g., Perry and Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), transformation with protoplasts (see, e.g. , Catt and Jollick, 1991, Microbios 68: 189-207), electroporation (see, e.g., Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804) or conjugation (see, p. , Clewell, 1981, Microbiol Rev. 45: 409-436). However, any method known in the art for introducing DNA into a host cell can be used.

[00269] The host cell can also be a eukaryote, such as a mammalian, insect, plant, or fungal cell.

[00270] The host cell may be a fungal cell. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).

[00271] The fungal host cell may be a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for purposes of this invention, yeast should be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[00272] The yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowia cell such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces klu cell yveri, Saccharomyces norbensis, Saccharomyces oviformis or Yarrowia lipolytica.

[00273] The fungal host cell may be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by elongation of hyphae and carbon catabolism is obligatorily aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by flowering from a single-celled thallus and carbon catabolism can be fermentative.

[00274] The filamentous fungal host cell may be a cell of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium , Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma.

[00275] For example, the filamentous fungal host cell may be a cell of Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilves cens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium shitarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens , Humicola lanuginosa , Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma re esei, or Trichoderma viride.

[00276] Fungal cells can be transformed by a process involving protoplast formation, protoplast transformations, and cell wall regeneration in a manner known per se. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. academic Sci. USA 81: 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast can be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp. 182-187, Academic Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153: 163; and Hinnen et al., 1978, Proc. Natl. academic Sci. USA 75: 1920.

Production Methods

[00277] The present invention also relates to methods of producing a variant of the GH61 polypeptide, comprising: (a) culturing a recombinant host cell of the present invention under conditions conducive to production of the variant; and optionally (b) recovering the variant.

[00278] The host cells are cultured in a suitable nutrient medium for production of the GH61 polypeptide variant using methods known in the art. For example, cells can be cultured by multiwell plates such as 24-, 48-, or 96-well plates, shake-flask cultivation, or small-scale or large-scale fermentations (including continuous, batch, fed-batch, or in-state fermentations). solid) in laboratory or industrial fermenters in a suitable medium and under conditions allowing the variant to be expressed and/or isolated. Cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or can be prepared according to published compositions (eg, in American Type Culture Collection catalogs). If the variant is secreted into the nutrient medium, the variant can be recovered directly from the medium. If the variant is not secreted, it can be recovered from cell lysates.

[00279] The GH61 polypeptide variant can be detected using methods known in the art that are variant specific. These detection methods include, but are not limited to, the use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine variant activity. A specific assay for GH61 proteins is to incubate GH61 polypeptide variants with 0.5% phosphoric acid-swollen cellulose (PASC), 100 mM sodium acetate pH 5, 1 mM MnSO4, 0.1% gallic acid, 0.025 mg/mL Aspergillus fumigatus beta-glucosidase, and 0.01% TRITON® X100 for 24-96 hours at 40°C followed by an assay of this reaction to determine the glucose released from the PASC. See the assay described in Example 5.

[00280] GH61 polypeptide variants can be recovered using methods known in the art. For example, the variant can be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. In one aspect, an entire fermentation broth comprising an embodiment of the present invention is recovered.

[00281] GH61 polypeptide variants can be purified by a variety of procedures known in the art, including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (eg, preparative isoelectric focusing), differential solubility (eg, ammonium sulfate precipitation), SDS-PAGE, or extraction (see, eg, Protein Purification, Janson and Ryden, editors , VCH Publishers, New York, 1989) to obtain substantially pure variants.

[00282] In an alternative aspect, the GH61 polypeptide variant is not rescued, but instead a host cell of the present invention expressing the variant is used as a source of the variant.

Cellular Formulations or Compositions of Fermentation Broth

[00283] The present invention also relates to a formulation or cell composition of fermentation broth comprising a variant of the present invention. The fermentation broth product further comprises additional ingredients used in the fermentation process, such as, for example, cells (including host cells containing the gene encoding the variant of the present invention which are used to produce the variant), cell debris, biomass , fermentation media and/or fermentation products. In some embodiments, the composition is a whole broth of dead cells containing organic acid(s), dead cells and/or cell debris, and culture medium.

[00284] The term "fermentation broth" as used herein refers to a preparation produced by cellular fermentation that undergoes zero or minimal recovery and/or purification. For example, fermentation broths are produced when microbial cultures are grown to saturation, incubated under carbon limiting conditions to allow synthesis (eg, expression of enzymes by host cells) and secretion of proteins into the culture medium. cells. The fermentation broth may comprise unfractionated or fractionated contents of fermentation materials derived at the end of fermentation. Typically, the fermentation broth is unfractionated and comprises the spent culture medium and cellular debris present after the microbial cells (eg, filamentous fungal cells) are removed, eg, by centrifugation. In some embodiments, the fermentation broth contains spent cell culture medium, extracellular enzymes, and viable and/or non-viable microbial cells.

[00285] In one embodiment, the fermentation broth formulation and cell compositions comprise a first organic acid component comprising at least one organic acid having 1-5 carbons and/or a salt thereof and a second organic acid component comprising at least one organic acid with 6 or more carbons and/or a salt thereof. In a specific embodiment, the first organic acid component is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the foregoing and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylvaleric acid, phenylacetic acid, a salt thereof, or a mixture of two or more of the foregoing.

[00286] In one aspect, the composition contains an organic acid(s), and optionally additionally contains dead cells and/or cell debris. In one embodiment, dead cells and/or cell debris are removed from a whole broth of dead cells to provide a composition that is free of these components.

[00287] Fermentation broth formulations or cell compositions may additionally comprise a preservative and/or antimicrobial agent (e.g., bacteriostatic), including, but not limited to, sorbitol, sodium chloride, potassium sorbate, and others known in the art.

[00288] Fermentation broth formulations or cellular compositions may additionally comprise multiple enzymatic activities, such as one or more (e.g., several) enzymes selected from the group consisting of a cellulase, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swolenin. Fermentation broth formulations or cellular compositions may also comprise one or more (e.g., several) enzymes selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase, or a transferase, e.g. e.g., an alpha-galactosidase, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase , glucoamylase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.

[00289] The whole broth or dead cell composition may contain the unfractionated contents of fermentation materials derived at the end of fermentation. Typically, the whole broth or dead cell composition contains the spent culture medium and cell debris present after the microbial cells (e.g., filamentous fungal cells) are grown to saturation, incubated under carbon limiting conditions to allow the synthesis of proteins (eg, expression of cellulase and/or glucosidase enzyme(s). In some embodiments, the entire broth or dead cell composition contains the spent cell culture medium, extracellular enzymes, and dead filamentous fungal cells. In some embodiments, microbial cells present in the whole broth or dead cell composition can be permeabilized and/or lysed using methods known in the art.

[00290] A whole broth or cell composition as described herein is typically a liquid, but may contain insoluble components such as dead cells, cell debris, culture media components, and/or insoluble enzyme(s). In some embodiments, insoluble components can be removed to provide a clarified liquid composition.

[00291] Whole broth cellular formulations and compositions of the present invention can be produced by a method described in WO 90/15861 or WO 2010/096673.

[00292] Examples of preferred uses of the compositions of the present invention are given below. The dosage of the composition and other conditions under which the composition is used can be determined based on methods known in the art.

Enzyme Compositions

[00293] The present invention also relates to compositions comprising a variant of the present invention. Preferably, the compositions are enriched in such a variant. The term "enriched" indicates that the enhancing cellulolytic activity of the composition has been increased, e.g., with an enrichment factor of at least 1.1.

[00294] The compositions may comprise a variant of the present invention as the main enzyme component, e.g., a monocomponent composition. Alternatively, the compositions can comprise multiple enzymatic activities, such as one or more (e.g., several) enzymes selected from the group consisting of a cellulase, a hemicellulase, a GH61 polypeptide, an esterase, an expansin, a laccase, a ligninolytic, a pectinase, a peroxidase, a protease, and a swolenin. Compositions may also comprise one or more (e.g., several) enzymes selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase, or a transferase, e.g., an alpha-galactosidase , alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.

[00295] The compositions may be prepared according to methods known in the art and may be in the form of a liquid or dry composition. The compositions can be stabilized according to methods known in the art.

[00296] Examples of preferred uses of the compositions of the present invention are given below. The dosage of the composition and other conditions under which the composition is used can be determined based on methods known in the art.

[00297] Uses

[00298] The present invention is also directed to the following processes for using the GH61 polypeptide variants having enhancing cellulolytic activity, or compositions thereof.

[00299] The present invention also relates to processes for degrading or converting a cellulosic material, comprising: treating the cellulosic material with an enzyme composition in the presence of a GH61 polypeptide variant of the present invention. In one aspect, the processes further comprise recovery of degraded or converted cellulosic material. Soluble products of degradation or conversion of cellulosic material can be separated from insoluble cellulosic material using a method known in the art, such as, for example, centrifugation, filtration, or gravity settling.

[00300] The present invention also relates to processes for producing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzyme composition in the presence of a GH16 polypeptide variant of the present invention; (b) fermenting the saccharified cellulosic material with one or more (e.g., several) fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.

[00301] The present invention also relates to fermentation processes of a cellulosic material, comprising: fermentation of the cellulosic material with one or more (e.g., several) fermenting microorganisms, in which the cellulosic material is saccharified with a composition of enzymes in the presence of a GH61 polypeptide variant of the present invention. In one aspect, fermentation of cellulosic material produces a fermentation product. In another aspect, the processes further comprise recovery of fermentation product from fermentation.

[00302] The processes of the present invention can be used to saccharify cellulosic material into fermentable sugars and to convert fermentable sugars into many useful fermentation products, e.g., fuel (ethanol, n-butanol, isobutanol, biodiesel, fuel aviation) and/or platform chemicals (eg, acids, alcohols, ketones, gases, and the like). Producing a desired fermentation product from cellulosic material typically involves pretreatment, enzymatic hydrolysis (saccharification), and fermentation.

[00303] The processing of cellulosic material according to the present invention can be achieved using methods conventional in the art. Furthermore, the processes of the present invention can be implemented using any conventional biomass processing device configured to operate in accordance with the invention.

[00304] Hydrolysis (saccharification) and fermentation, separate or simultaneous, include, but are not limited to, separate hydrolysis and fermentation (SHF); simultaneous saccharification and fermentation (SSF); simultaneous saccharification and co-fermentation (SSCF); hybrid hydrolysis and fermentation (HHF); separate hydrolysis and co-fermentation (SHCF); hybrid hydrolysis and cofermentation (HHCF); and direct microbial conversion (DMC), also sometimes called consolidated bioprocessing (CBP). SHF uses separate process steps to first enzymatically hydrolyze cellulosic material to fermentable sugars, eg, glucose, cellobiose, and pentose monomers, and then ferment the fermentable sugars to ethanol. In SSF, enzymatic hydrolysis of cellulosic material and fermentation of sugars into ethanol are combined in one step (Philippidis, G.P., 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, C.E., editor, Taylor & Francis , Washington, DC, 179-212). SSCF involves the co-fermentation of multiple sugars (Sheehan and Himmel, 1999, Biotechnol. Prog. 15: 817-827). HHF involves a separate hydrolysis step, and additionally a simultaneous saccharification and hydrolysis step, which can be carried out in the same reactor. The steps in an HHF process can be carried out at different temperatures, i.e., enzymatic saccharification at elevated temperature followed by SSF at a lower temperature than the fermentation strain can tolerate. DMC combines all three processes (enzyme production, hydrolysis, and fermentation) in one or more (eg, several) steps where the same organism is used to produce the enzymes for converting cellulosic material into fermentable sugars and for converting the fermentable sugars in a final product (Lynd et al., 2002, Microbiol. Mol. Biol. Reviews 66: 506-577). It is understood herein that any method known in the art comprising pretreatment, enzymatic hydrolysis (saccharification), fermentation, or a combination thereof, can be used in practicing the processes of the present invention.

[00305] A conventional device may include a fed batch stirred reactor, a continuous stirred reactor, a continuous flow stirred reactor with ultrafiltration, and/or a continuous plug flow column reactor (de Castilhos Corazza et al., 2003, Acta Scientiarum. Technology 25: 33-38; Gusakov and Sinitsyn, 1985, Enz. Microb. Technol. 7: 346-352), an attrition reactor (Ryu and Lee, 1983, Biotechnol. Bioeng. 25: 53-65) . Additional reactor types include fluidized bed, sludge blanket, immobilized, and extruder-type reactors for hydrolysis and/or fermentation.

[00306] Pre-treatment. In practicing the processes of the present invention, any pretreatment process known in the art can be used to disaggregate plant cell wall components from cellulosic material ( Chandra et al., 2007, Adv. Biochem. Engin./Biotechnol. 108: 6793; Galbe and Zacchi, 2007, Adv. Biochem. Engin./Biotechnol. 108: 41-65; Hendriks and Zeeman, 2009, Bioresource Technol. 100: 10-18; Mosier et al., 2005, Bioresource Technol. 96: 673-686; Taherzadeh and Karimi, 2008, Int. J. Mol. Sci. 9: 1621-1651; Yang and Wyman, 2008, Biofuels Bioproducts and Biorefining-Biofpr. 2: 26-40).

[00307] The cellulosic material may also be subjected to particle size reduction, screening, pre-soaking, wetting, washing, and/or conditioning prior to pre-treatment using methods known in the art.

[00308] Conventional pretreatments include, but are not limited to, steam pretreatment (with or without explosion), dilute acid pretreatment, hot water pretreatment, alkaline pretreatment, pretreatment with lime, wet oxidation, wet blasting, ammonia fiber blasting, organic solvent pretreatment, and biological pretreatment. Additional pretreatments include ammonia percolation pretreatments, sonication, electroporation, microwaves, supercritical CO2, supercritical H2O, ozone, ionic liquid, and gamma irradiation.

[00309] The cellulosic material can be pre-treated before hydrolysis and/or fermentation. Pretreatment is preferably carried out before hydrolysis. Alternatively, the pretreatment can be carried out simultaneously with hydrolysis by enzymes to liberate fermentable sugars, such as glucose, xylose, and/or cellobiose. In most cases, the pretreatment step itself results in some conversion of biomass to fermentable sugars (even in the absence of enzymes).

[00310] Steam pre-treatment. In steam pretreatment, cellulosic material is heated to break down plant cell wall components, including lignin, hemicellulose, and cellulose to make the cellulose and other fractions, eg, hemicellulose, accessible to enzymes. The cellulosic material is passed through or through a reaction vessel where steam is injected to raise the temperature to the required temperature and pressure and is retained therein for the desired reaction time. The steam pretreatment is preferably carried out at 140-250 °C, eg 160-200 °C or 170-190 °C, where the optimum temperature range depends on the optional addition of a chemical catalyst. The residence time for steam pretreatment is preferably 1-60 minutes, e.g. 1-30 minutes, 1-20 minutes, 3-12 minutes, or 4-10 minutes, where the optimum residence time depends on temperature and the optional addition of a chemical catalyst. Steam pretreatment allows for relatively high solids loadings, such that cellulosic material is generally only wetted during pretreatment. Steam pretreatment is often combined with an explosive discharge of material after pretreatment, which is known as a steam explosion, i.e. rapid expansion to atmospheric pressure and turbulent flow of material to increase the surface area accessible by fragmentation (Duff and Murray, 1996, Bioresource Technology 855: 1-33; Galbe and Zacchi, 2002, Appl. Microbiol. Biotechnol. 59: 618-628; U.S. Patent Application No. 2002/0164730). During steam pretreatment, the acetyl groups of hemicellulose are cleaved and the resulting acid autocatalyzes the partial hydrolysis of hemicellulose to monosaccharides and oligosaccharides. Lignin is removed only to a limited extent.

[00311] Chemical Pretreatment: The term “chemical treatment” refers to any chemical pretreatment that promotes the separation and/or release of cellulose, hemicellulose, and/or lignin. Such a pretreatment can convert crystalline cellulose to amorphous cellulose. Examples of suitable chemical pretreatment processes include, for example, dilute acid pretreatment, lime pretreatment, wet oxidation, ammonia freeze/fiber expansion (AFEX), ammonia percolation (APR), liquid ionic acid, and pre-treatments with organosolv.

[00312] A chemical catalyst such as H2SO4 or SO2 (typically 0.3 to 5% w/w) is sometimes added before steam pretreatment, which decreases time and temperature, increases recovery, and improves the enzymatic hydrolysis (Ballesteros et al., 2006, Appl. Biochem. Biotechnol. 129-132: 496-508; Varga et al., 2004, Appl. Biochem. Biotechnol. 113-116: 509-523; Sassner et al., 2006, Enzyme Microb Technol 39: 756-762). In dilute acid pretreatment, the cellulosic material is mixed with dilute acid, typically H2SO4, and water to form a slurry, heated by steam to the desired temperature, and after a residence time expanded to atmospheric pressure. Dilute acid pretreatment can be performed with a number of reactor designs, eg, plug flow reactors, countercurrent reactors, or continuous bed shrinkage countercurrent reactors (Duff and Murray, 1996, supra; Schell et al., 2004, Bioresource Technol.179-188;Lee et al., 1999, Adv.Biochem.Eng.Biotechnol.65:93-115).

[00313] Various pretreatment methods can also be used under alkaline conditions. These alkaline pretreatments include, but are not limited to, sodium hydroxide pretreatment, lime, wet oxidation, ammonia percolation (APR), and ammonia freeze/fiber expansion (AFEX).

[00314] Lime pretreatment is performed with calcium oxide or calcium hydroxide at temperatures of 85-150 °C and residence times from 1 hour to several days (Wyman et al., 2005, Bioresource Technol. 96: 1959-1966, Mosier et al., 2005, Bioresource Technol.96: 673-686). WO 2006/110891, WO 2006/110899, WO 2006/110900, and WO 2006/110901 disclose pretreatment methods using ammonia.

[00315] Wet oxidation is a thermal pretreatment typically performed at 180-200 °C for 5-15 minutes with the addition of an oxidizing agent such as hydrogen peroxide or oxygen overpressure (Schmidt and Thomsen, 1998, Bioresource Technol. 64: 139-151; Palonen et al., 2004, Appl. Biochem. Biotechnol. 117: 1-17; Varga et al., 2004, Biotechnol. Bioeng. 88: 567-574; Martin et al., 2006, J Chem Technol Biotechnol 81: 1669-1677). The pretreatment is preferably carried out at 1-40% dry matter, e.g. 2-30% dry matter or 5-20% dry matter, and often the initial pH is increased by adding alkali such as sodium carbonate.

[00316] A modification of the wet oxidation pretreatment method, known as wet blasting (combination of wet oxidation and steam explosion), can handle dry matter up to 30%. In wet blasting, the oxidizing agent is introduced during pretreatment after a certain residence time. The pre-treatment is then completed by expansion to atmospheric pressure (WO 2006/032282).

[00317] The expansion of fibers with ammonia (AFEX) involves treating the cellulosic material with liquid or gaseous ammonia at moderate temperatures such as 90-150 °C and high pressure such as 17-20 bar for 5-10 minutes, where the content of dry matter can be as high as 60% (Gollapalli et al., 2002, Appl. Biochem. Biotechnol. 98: 23-35; Chundawat et al., 2007, Biotechnol. Bioeng. 96: 219-231; Alizadeh et al. ., 2005, Appl.Biochem.Biotechnol.121:1133-1141; Teymouri et al., 2005, Bioresource Technology 96:2014-2018). During AFEX pretreatment, the cellulose and hemicelluloses remain relatively intact. The lignin-carbohydrate complexes are cleaved.

[00318] Pretreatment with organosolv delignifies the cellulosic material by extraction using aqueous ethanol (40-60% ethanol) at 160-200 °C for 30-60 minutes (Pan et al., 2005, Biotechnol. Bioeng. 90 :473-481; Pan et al., 2006, Biotechnol.Bioeng.94:851-861; Kurabi et al., 2005, Appl.Biochem.Biotechnol.121:219-230). Sulfuric acid is usually added as a catalyst. In pretreatment with organosolv, most of the hemicellulose and lignin is removed.

[00319] Other examples of suitable pretreatment methods are described by Schell et al., 2003, Appl. Biochem. Biotechnol. 105-108: 69-85, and Mosier et al., 2005, Bioresource Technology 96: 673-686, and U.S. Published Application 2002/0164730.

[00320] In one aspect, the chemical pretreatment is preferably carried out in the form of a dilute acid treatment, and more preferably in the form of a continuous dilute acid treatment. The acid is typically sulfuric acid, but other acids such as acetic acid, citric acid, nitric acid, phosphoric acid, tartaric acid, succinic acid, hydrogen chloride, or mixtures thereof may also be used. The weak acid treatment is conducted in the pH range of preferably 1-5, e.g. 1-4 or 1-2.5. In one aspect, the acid concentration is in the range of preferably 0.01 to 10% by weight of acid, e.g. 0.05 to 5% by weight of acid or 0.1 to 2% by weight of acid . The acid is contacted with the cellulosic material and maintained at a temperature in the range of preferably 140-200°C, e.g. 165-190°C, for periods ranging from 1 to 60 minutes.

[00321] In another aspect, the pretreatment takes place in an aqueous slurry. In preferred aspects, the cellulosic material is present during the pretreatment in amounts preferably between 10-80% by weight, e.g. 20-70% by weight or 30-60% by weight, such as around 40 % by weight. The pre-treated cellulosic material can either be left unwashed or washed using any method known in the art, e.g., water washed.

[00322] Mechanical Pretreatment or Physical Pretreatment: The term "mechanical pretreatment" or "physical pretreatment" refers to any pretreatment that promotes the reduction of particle size. For example, such pretreatment may involve various types of grinding or grinding (eg, dry grinding, wet grinding, or vibrating ball grinding).

[00323] The cellulosic material can be physically (mechanically) and chemically pre-treated. Mechanical or physical pre-treatment can be coupled with steam/steam explosion treatment, hydrothermolysis, dilute or weak acid treatment, high temperature treatment, high pressure treatment, irradiation (e.g. microwave irradiation), or their combinations. In one aspect, high pressure means pressure in the range of preferably about 100 to about 400 psi, e.g., about 150 to about 250 psi. In another aspect, high temperature means temperatures in the range of about 100 to about 300°C, e.g., about 140 to about 200°C. In a preferred aspect, the mechanical or physical pre-treatment is carried out in a batch process using a steam gun hydrolyzer system using high pressure and high temperature as defined above, e.g. a Sunds Hydrolyzer available from Sunds Defibrator AB , Sweden. The physical and chemical pretreatments can be carried out sequentially or simultaneously, as desired.

[00324] Accordingly, in a preferred aspect, the cellulosic material is subjected to physical (mechanical) or chemical pretreatment, or any combination thereof, to promote the separation and/or release of cellulose, hemicellulose, and/or lignin.

[00325] Biological pretreatment: The term “biological pretreatment” refers to any biological pretreatment that promotes the separation and/or release of cellulose, hemicellulose, and/or lignin from cellulosic material. Biological pretreatment techniques may involve application of microorganisms and/or lignin-solubilizing enzymes (see, for example, Hsu, T.-A., 1996, Pretreatment of biomass, in Handbook on Bioethanol: Production and Utilization, Wyman, C. E. , ed., Taylor & Francis, Washington, DC, 179-212; Ghosh and Singh, 1993, Adv. Appl. Microbiol. 39: 295-333; McMillan, J.D., 1994, Pretreating lignocellulosic biomass: a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel, M.E., Baker, J.O., and Overend, R.P., editors, ACS Symposium Series 566, American Chemical Society, Washington, DC, chapter 15; Gong, C.S., Cao, N.J., Du, J., and Tsao, G. T., 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T., editor, Springer-Verlag Berlin Heidelberg, Germany, 65: 207-241; Olsson and Hahn-Hagerdal, 1996, Enz. Microb. Tech. 18: 312-331, and Vallander and Eriksson, 1990, Adv. Biochem. Eng./Biotechnol. 42: 63-95).

[00326] Saccharification. In the hydrolysis step, also known as saccharification, the cellulosic material, eg pre-treated, is hydrolyzed to degrade the cellulose and/or hemicellulose into fermentable sugars such as glucose, cellobiose, xylose, xylulose, arabinose, mannose, galactose, and/or soluble oligosaccharides. The hydrolysis is carried out enzymatically by an enzyme composition in the presence of a GH61 polypeptide variant of the present invention. The enzymes of the compositions can be added simultaneously or sequentially.

[00327] The enzymatic hydrolysis is preferably carried out in a suitable aqueous environment under conditions that can be readily determined by one skilled in the art. In one aspect, the hydrolysis is carried out under conditions suitable for the activity of the enzyme(s), i.e., optimal for the enzyme(s). The hydrolysis can be carried out as a fed-batch or continuous process where the cellulosic material is gradually fed into, for example, an enzyme-containing hydrolysis solution.

[00328] Saccharification is generally carried out in stirred tank reactors or fermenters under controlled conditions of pH, temperature, and mixing. Proper conditions of process time, temperature and pH can be readily determined by one skilled in the art. For example, saccharification can last for up to 200 hours, but typically is preferably carried out for about 12 to about 120 hours, e.g., about 16 to about 72 hours or about 24 to about 48 hours. The temperature is in the range of preferably about 25°C to about 70°C, e.g., about 30°C to about 65°C, about 40°C to about 60°C, or about 50°C to about 55°C. The pH preferably ranges from about 3 to about 8, e.g., about 3.5 to about 7, about 4 to about 6, or about 5 to about 5.5. The dry solids content is in the range of preferably about 5 to about 50% by weight, e.g., about 10 to about 40% by weight or about 20 to about 30% by weight.

[00329] Enzyme compositions may comprise any protein useful in degrading cellulosic material.

[00330] In one aspect, the enzyme composition comprises or further comprises one or more (e.g., several) proteins selected from the group consisting of a cellulase, a GH61 polypeptide having cellulolytic-enhancing activity, a hemicellulase, an esterase, a expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swolenin. In another aspect, the cellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase. In another aspect, the hemicellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase , a glucuronidase, a glucuronoyl esterase, a mannanase, a mannosidase, a xylanase, and a xylosidase. In another aspect, the oxidoreductase is preferably one or more (e.g., several) enzymes selected from the group consisting of a catalase, a laccase, and a peroxidase.

[00331] In another aspect, the enzyme composition comprises one or more (e.g., multiple) cellulolytic enzymes. In another aspect, the enzyme composition comprises or additionally comprises one or more (e.g., several) hemicellulolytic enzymes. In another aspect, the enzyme composition comprises one or more (e.g., several) cellulolytic enzymes and one or more (e.g., several) hemicellulolytic enzymes. In another aspect, the enzyme composition comprises one or more (e.g., several) enzymes selected from the group of cellulolytic enzymes and hemicellulolytic enzymes. In another aspect, the enzyme composition comprises an endoglucanase. In another aspect, the enzyme composition comprises a cellobiohydrolase. In another aspect, the enzyme composition comprises a beta-glucosidase. In another aspect, the enzyme composition comprises a GH61 polypeptide having enhancing cellulolytic activity. In another aspect, the enzyme composition comprises an endoglucanase and a GH61 polypeptide having enhancing cellulolytic activity. In another aspect, the enzyme composition comprises a cellobiohydrolase and a GH61 polypeptide having enhancing cellulolytic activity. In another aspect, the enzyme composition comprises a beta-glucosidase and a GH61 polypeptide having enhancing cellulolytic activity. In another aspect, the enzyme composition comprises an endoglucanase and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase and a beta-glucosidase. In another aspect, the enzyme composition comprises a beta-glucosidase and a cellobiohydrolase. In another aspect, the enzyme composition comprises a beta-glucosidase and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a GH61 polypeptide having enhancing cellulolytic activity, and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase, a GH61 polypeptide having enhancing cellulolytic activity, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, and a GH61 polypeptide having enhancing cellulolytic activity. In another aspect, the enzyme composition comprises a beta-glucosidase, a GH61 polypeptide having enhancing cellulolytic activity, and a cellobiohydrolase. In another aspect, the enzyme composition comprises a beta-glucosidase, a GH61 polypeptide having enhancing cellulolytic activity, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a cellobiohydrolase, a beta-glucosidase, and a GH61 polypeptide having enhancing cellulolytic activity. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, a GH61 polypeptide having enhancing cellulolytic activity, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II.

[00332] In another aspect, the enzyme composition comprises an acetylmannan esterase. In another aspect, the enzyme composition comprises an acetylxylan esterase. In another aspect, the enzyme composition comprises an arabinanase (e.g., alpha-L-arabinanase). In another aspect, the enzyme composition comprises an arabinofuranosidase (e.g., alpha-L-arabinofuranosidase). In another aspect, the enzyme composition comprises a coumaric acid esterase. In another aspect, the enzyme composition comprises a feruloyl esterase. In another aspect, the enzyme composition comprises a galactosidase (e.g., alpha-galactosidase and/or beta-galactosidase). In another aspect, the enzyme composition comprises a glucuronidase (e.g., alpha-D-glucuronidase). In another aspect, the enzyme composition comprises a glucuronoyl esterase. In another aspect, the enzyme composition comprises a mannanase. In another aspect, the enzyme composition comprises a mannosidase (e.g., beta-mannosidase). In another aspect, the enzyme composition comprises a xylanase. In a preferred aspect, the xylanase is a Family 10 xylanase. In another preferred aspect, the xylanase is a Family 11 xylanase. In another aspect, the enzyme composition comprises a xylosidase (e.g., beta-xylosidase).

[00333] In another aspect, the enzyme composition comprises an esterase. In another aspect, the enzyme composition comprises an expansin. In another aspect, the enzyme composition comprises a ligninolytic enzyme. In a preferred aspect, the ligninolytic enzyme is a manganese peroxidase. In another preferred aspect, the ligninolytic enzyme is a lignin peroxidase. In another preferred aspect, the ligninolytic enzyme is an H2O2 producing enzyme. In another aspect, the enzyme composition comprises a pectinase. In another aspect, the enzyme composition comprises an oxidoreductase. In another preferred aspect, the oxidoreductase is a catalase. In another preferred aspect, the oxidoreductase is a laccase. In another preferred aspect, the oxidoreductase is a peroxidase. In another aspect, the enzyme composition comprises a protease. In another aspect, the enzyme composition comprises a swolenin.

[00334] In the processes of the present invention, the enzyme(s) may be added before or during saccharification, saccharification and fermentation, or fermentation.

[00335] One or more (eg, several) components of the enzyme composition can be native proteins, recombinant proteins, or a combination of native proteins and recombinant proteins. For example, one or more (e.g., several) components can be proteins native to a cell, which is used as a host cell to recombinantly express one or more (e.g., several) other components of the enzyme composition. It is understood herein that recombinant proteins can be heterologous (e.g., foreign) and native to the host cell. One or more (eg, several) components of the enzyme composition can be produced as monocomponents, which are then combined to form the enzyme composition. The enzyme composition can be a combination of multicomponent and monocomponent protein preparations.

[00336] The enzymes used in the processes of the present invention may be in any form suitable for use, such as, for example, a fermentation broth formulation or cell composition, a cell lysate with or without cell debris, an enzyme preparation semipurified or purified, or a host cell as a source of the enzymes. The enzyme composition can be a dry powder or granule, a non-dustable granule, a liquid, a stabilized liquid, or a stabilized protected enzyme. Liquid enzyme preparations can, for example, be stabilized by the addition of stabilizers such as a sugar, a sugar alcohol or other polyol, and/or lactic acid or other organic acid in accordance with established procedures.

[00337] The optimal amounts of enzymes and variants of the GH61 polypeptide depend on several factors, including, but not limited to, the mixture of cellulolytic enzymes and/or hemicellulolytic enzymes, the cellulosic material, the concentration of the cellulosic material, the(s) ) pretreatment(s) of cellulosic material, temperature, time, pH, and inclusion of a fermenting organism (eg, for Simultaneous Saccharification and Fermentation).

[00338] In one aspect, an effective amount of cellulolytic or hemicellulolytic enzyme relative to cellulosic material is about 0.5 to about 50 mg, e.g., about 0.5 to about 40 mg, about 0.5 to about 25 mg, about 0.75 to about 20 mg, about 0.75 to about 15 mg, about 0.5 to about 10 mg, or about 2.5 to about of 10 mg per g of cellulosic material.

[00339] In another aspect, an effective amount of a GH61 polypeptide variant relative to cellulosic material is about 0.01 to about 50.0 mg, e.g., about 0.01 to about 40 mg , about 0.01 to about 30 mg, about 0.01 to about 20 mg, about 0.01 to about 10 mg, about 0.01 to about 5 mg, about 0.025 to about from 1.5 mg, about 0.05 to about 1.25 mg, about 0.075 to about 1.25 mg, about 0.1 to about 1.25 mg, about 0.15 to about from 1.25 mg, or about 0.25 to about 1.0 mg per g of cellulosic material.

[00340] In another aspect, an effective amount of a GH61 polypeptide variant relative to cellulolytic or hemicellulolytic enzyme is about 0.005 to about 1.0 g, e.g., about 0.01 to about 1. 0 g, about 0.15 to about 0.75 g, about 0.15 to about 0.5 g, about 0.1 to about 0.5 g, about 0.1 to about 0.25 g, or about 0.05 g to about 0.2 g per g cellulolytic or hemicellulolytic enzyme.

[00341] Polypeptides having cellulolytic enzyme activity or hemicellulolytic enzyme activity as well as other proteins/polypeptides useful in the degradation of cellulosic material (collectively hereinafter referred to as "polypeptides having enzyme activity") may be derived or obtained from any suitable source, including archaeobacterial, bacterial, fungal, yeast, plant, or mammalian origin. The term "obtained" here also means that the enzyme may have been produced recombinantly in a host organism employing methods described herein, wherein the recombinantly produced enzyme is native to or foreign to the host organism or has a modified amino acid sequence, e.g. ., having one or more (e.g., several) amino acids that are deleted, inserted and/or substituted, i.e., a recombinantly produced enzyme that is a mutant and/or a fragment of a native amino acid sequence, or an enzyme produced by nucleic acid scrambling procedures known in the art. Encompassed within the meaning of a native enzyme are natural variants and within the meaning of a foreign enzyme are variants obtained by, for example, site-directed mutagenesis or scrambling.

[00342] A polypeptide having enzyme activity may be a bacterial polypeptide. For example, the polypeptide may be a Gram-positive bacterial polypeptide such as a polypeptide having enzyme activity from Bacillus, Streptococcus, Streptomyces, Staphylococcus, Enterococcus, Lactobacillus, Lactococcus, Clostridium, Geobacillus, Caldicellulosiruptor, Acidothermus, Thermobifidia, or Oceanobacillus, or a Gram-negative bacterial polypeptide such as a polypeptide having enzyme activity from E. coli, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium, Fusobacterium, Ilyobacter, Neisseria, or Ureaplasma.

[00343] The polypeptide having enzyme activity may also be a fungal polypeptide, and more preferably a yeast polypeptide such as a polypeptide having enzyme activity from Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia; or more preferably a filamentous fungal polypeptide such as a polypeptide having enzyme activity from Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Coptotermes, Corynascus, Cryphonectria, Cryptococcus, Diplodia, Exidia, Filibasidium, Fusarium, Gibberella, Holomastigotoides, Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces, Poitrasia, Pseudoplectania, Pseudotrichonympha, Rhizomu color, Schizophyllum, Scytalidium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella, or Xylaria.

[00344] In one aspect, the polypeptide is a polypeptide having enzyme activity from Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, or Saccharomyces oviformis.

[00345] In another aspect, the polypeptide is a polypeptide having enzyme activity from Acremonium cellulolyticus, Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium keratinophilum, Chrysosporium luck nowense, Chrysosporium tropicum, Chrysosporium shitrium, Chrysosporium inops, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium zonatum, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fu sarium reticulatum, Fusarium roseum , Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium funiculosum, Pen icillium purpurogenum, Phanerochaete chrysosporium, Thielavia achromatica, Thielavia albomyces, Thielavia albopilosa, Thielavia australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia ovispora, Thielavia peruviana, Thielavia spededonium, Thielavia setosa, Thielavia subthermophila, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma long ibrachiatum, Trichoderma reesei, Trichoderma viride, or Trichophaea saccata.

[00346] Chemically modified or protein-engineered mutants of polypeptides having enzyme activity can be used.

[00347] One or more (e.g., several) components of the enzyme composition may be a recombinant component, i.e., produced by cloning a DNA sequence encoding the unique component and subsequently transformed in the cell with the DNA sequence and expressed in a host (see, for example, WO 91/17243 and WO 91/17244). The host is preferably a heterologous host (the enzyme is foreign to the host), but the host may under certain conditions also be a homologous host (the enzyme is native to the host). Monocomponent cellulolytic proteins can also be prepared by purifying such a protein from a fermentation broth.

[00348] In one aspect, the one or more (e.g., several) cellulolytic enzymes comprises a commercial preparation of cellulolytic enzymes. Examples of commercial preparations of cellulolytic enzymes suitable for use in the present invention include, for example, CELLIC® CTec (Novozymes A/S), CELLIC® CTec2 (Novozymes A/S), CELLIC® CTec3 (Novozymes A/S), CELLUCLAST™ (Novozymes A/S), NOVOZYM™ 188 (Novozymes A/S), SPEZYME™ CP (Genencor Int.), ACCELERASE™ TRIO (DuPont), FILTRASE® NL (DSM); METHAPLUS® S/L 100 (DSM), ROHAMENT™ 7069 W (Rohm GmbH), or ALTERNAFUEL® CMAX3™ (Dyadic International, Inc.). Cellulase enzymes are added in effective amounts of from about 0.001 to about 5.0% by weight solids, e.g., about 0.025 to about 4.0% by weight solids or about 0.005 to about 2.0% by weight solids.

[00349] Examples of bacterial endoglucanases that can be used in the processes of the present invention include, but are not limited to, endoglucanase from Acidothermus cellulolyticus (WO 91/05039; WO 93/15186; US Patent No. 5,275,944; WO 96/02551 ;U.S. Patent No. 5,536,655; WO 00/70031; WO 05/093050); endoglucanase from Erwinia carotovara (Saarilahti et al., 1990, Gene 90: 9-14), endoglucanase III from Thermobifida fusca (WO 05/093050), and endoglucanase V from Thermobifida fusca (WO 05/093050).

[00350] Examples of fungal endoglucanases that can be used in the present invention include, but are not limited to, endoglucanase I from Trichoderma reesei (Penttila et al., 1986, Gene 45: 253-263), endoglucanase I from Trichoderma reesei Cel7B ( GenBank:M15665), endoglucanase II from Trichoderma reesei (Saloheimo, et al., 1988, Gene 63:11-22), endoglucanase II from Trichoderma reesei Cel5A (GemBank:M19373), endoglucanase III from Trichoderma reesei (Okada et al., 1988, Appl. Environ. Microbiol. 64: 555-563, GenBank:AB003694), endoglucanase V from Trichoderma reesei ( Saloheimo et al., 1994, Molecular Microbiology 13: 219-228, GenBank: Z33381), endoglucanase from Aspergillus aculeatus ( Ooi et al., 1990, Nucleic Acids Research 18: 5884), endoglucanase from Aspergillus kawachii (Sakamoto et al., 1995, Current Genetics 27: 435-439), endoglucanase from Fusarium oxysporum (GenBank:L29381), endoglucanase from Humicola grisea var. thermoidea (GenBank:AB003107), endoglucanase from Melanocarpus albomyces (GenBank:MAL515703), endoglucanase from Neurospora crassa (GenBank:XM_324477), endoglucanase V from Humicola insolens, endoglucanase from Myceliophthora thermophila CBS 117.65, endoglucanase I from Thermoascus a urantiacus (GenBank:AF487830) , and endoglucanase from Trichoderma reesei strain No. VTT-D-80133 (GenBank:M15665).

[00351] Examples of cellobiohydrolases useful in the present invention include, but are not limited to, cellobiohydrolase II from Aspergillus aculeatus (WO 2011/059740), cellobiohydrolase I from Chaetomium thermophilum, cellobiohydrolase II from Chaetomium thermophilum, cellobiohydrolase I from Humicola insolens, cellobiohydrolase II from Myceliophthora thermophila (WO 2009/042871), cellobiohydrolase I from Penicillium occitanis (GenBank: AY690482), cellobiohydrolase I from Talaromyces emersonii (GenBank:AF439936), cellobiohydrolase II from Thielavia hyrcanie (WO 2010/141325), cellobiohydrolase II of Thielavia terrestris ( CEL6A, WO 2006/074435), cellobiohydrolase I from Trichoderma reesei, cellobiohydrolase II from Trichoderma reesei, and cellobiohydrolase II from Trichophaea saccata ( WO 2010/057086 ).

[00352] Examples of beta-glucosidases useful in the present invention include, but are not limited to, beta-glucosidases from Aspergillus aculeatus (Kawaguchi et al., 1996, Gene 173: 287-288), Aspergillus fumigatus (WO 2005/047499) , Aspergillus niger (Dan et al., 2000, J. Biol. Chem. 275: 4973-4980), Aspergillus oryzae (WO 02/095014), Penicillium brasilianum IBT 20888 (WO 2007/019442 and WO 2010/088387), Thielavia terrestris (WO 2011/035029), and Trichophaea saccata (WO 2007/019442).

[00353] Beta-glucosidase can be a fusion protein. In one aspect, the beta-glucosidase is an Aspergillus oryzae beta-glucosidase variant BG fusion protein (WO 2008/057637) or an Aspergillus oryzae beta-glucosidase fusion protein (WO 2008/057637).

[00354] Other useful endoglucanases, cellobiohydrolases, and beta-glucosidases are disclosed in numerous families of Glycosyl Hydrolases using classification according to Henrissat, 1991, Biochem. J. 280: 309-316, and Henrissat and Bairoch, 1996, Biochem. J. 316: 695-696.

[00355] Other cellulolytic enzymes that can be used in the present invention are described in WO 98/13465, WO 98/015619, WO 98/015633, WO 99/06574, WO 99/10481, WO 99/025847, WO 99/031255 , WO 2002/101078, WO 2003/027306, WO 2003/052054, WO 2003/052055, WO 2003/052056, WO 2003/052057, WO 2003/052118, WO 2004/016760, WO 2004/0 43980, WO 2004/048592 , WO 2005/001065, WO 2005/028636, WO 2005/093050, WO 2005/093073, WO 2006/074005, WO 2006/117432, WO 2007/071818, WO 2007/071820, WO 2008/0 08070, WO 2008/008793 , US patent At the. 5,457,046, U.S. Patent At the. 5,648,263, and U.S. Pat. At the. 5,686,593.

[00356] In the processes of the present invention, any GH61 polypeptide having enhancing cellulolytic activity can be used as a component of the enzyme composition.

[00357] Examples of GH61 polypeptides useful in the processes of the present invention include, but are not limited to, GH61 polypeptides from Thielavia terrestris (WO 2005/074647, WO 2008/148131, and WO 2011/035027), Thermoascus aurantiacus (WO 2005/ 074656 and WO 2010/065830), Trichoderma reesei (WO 2007/089290), Myceliophthora thermophila (WO 2009/085935, WO 2009/085859, WO 2009/085864, and WO 2009/085868), Aspergillus fumigatus (W 2010/138754) , Penicillium pinophilum ( WO 2011/005867 ), Thermoascus sp. (WO 2011/039319), Penicillium sp. (WO 2011/041397), Thermoascus crustaceus (WO 2011/041504), Aspergillus aculeatus (WO 2012/125925), Thermomyces lanuginosus (WO 2012/113340, WO 12/129699, and WO 2012/130964), Aurantiporus al borubescens (WO 2012 /122477), Trichophaea saccata (WO 2012/122477), Penicillium thomii (WO 2012/122477), Talaromyces stipitatus (WO 2012/135659), Humicola insolens (WO 2012/146171), Malbranchea cinnamomea (WO 2012/101 206), Talaromyces leycettanus (WO 2012/101206), and Chaetomium thermophilum (WO 2012/101206).

[00358] In one aspect, the GH61 polypeptide variant and the GH61 polypeptide having enhancing cellulolytic activity are used in the presence of a soluble activating divalent metal cation according to WO 2008/151043, e.g., manganese or copper.

[00359] In another aspect, the GH61 polypeptide variant and the GH61 polypeptide having enhancing cellulolytic activity are used in the presence of a dioxy compound, a bicyclic compound, a heterocyclic compound, a nitrogen-containing compound, a quinone compound, a compound containing sulphur, or a liquor obtained from a pre-treated cellulosic material such as pre-treated corn stover (WO 2012/021394, WO 2012/021395, WO 2012/021396, WO 2012/021399, WO 2012/021400, WO 2012/ 021401, WO 2012/021408, and WO 2012/021410).

[00360] In one aspect, such a compound is added at a molar ratio of compound to cellulose glucosyl units of about 10-6 to about 10, e.g., about 10-6 to about 7 .5, about 10-6 to about 5, about 10-6 to about 2.5, about 10-6 to about 1, about 10-5 to about 1, about 10-5 to about 10-1, about 10-4 to about 10-1, about 10-3 to about 10-1, or about 10-3 to about 10-2. In another aspect, an effective amount of such a compound is about 0.1 µM to about 1 M, e.g., about 0.5 µM to about 0.75 M, about 0.75 µM to about 0.5 M, about 1 µM to about 0.25 M, about 1 µM to about 0.1 M, about 5 µM to about 50 mM, about 10 µM to about 25 mM , about 50 µM to about 25 mM, about 10 µM to about 10 mM, about 5 µM to about 5 mM, or about 0.1 mM to about 1 mM.

[00361] The term "liquor" means the solution phase, aqueous, organic, or a combination thereof, originating from the treatment of a lignocellulose and/or hemicellulose material into a paste, or its monosaccharides, e.g., xylose , arabinose, mannose, etc., under conditions as described herein, and their soluble contents. A liquor for cellulolytic enrichment of a GH61 polypeptide can be produced by treating a lignocellulose or hemicellulose material (or feedstock) by applying heat and/or pressure, optionally in the presence of a catalyst, e.g., acid, optionally in the presence of an organic solvent, and optionally in combination with physically disaggregating the material, and then separating the solution from residual solids. Such conditions determine the degree of cellulolytic enrichment obtainable by combining liquor and a GH61 polypeptide during hydrolysis of a cellulosic substrate by a cellulase preparation. The liquor can be separated from the treated material using a method standard in the art, such as filtration, sedimentation, or centrifugation.

[00362] In one aspect, an effective amount of the liquor relative to the cellulose is about 10 -6 to about 10 g per g of cellulose, e.g. about 10 -6 to about 7.5 g, about 10 -6 to about 5 g, about 10 -6 to about 2.5 g, about 10 -6 to about 1 g, about 10 -5 to about 1 g, about 10 - 5 to about 10 -1 g, about 10 -4 to about 10 -1 g, about 10 -3 to about 10 -1 g, or about 10 -3 to about 10 -2 g per g of cellulose.

[00363] In one aspect, the one or more (e.g., several) hemicellulolytic enzymes comprises a commercial preparation of hemicellulolytic enzymes. Examples of commercial preparations of hemicellulolytic enzymes suitable for use in the present invention include, for example, SHEARZYME™ (Novozymes A/S), CELLIC® HTec (Novozymes A/S), CELLIC® HTec2 (Novozymes A/S), CELLIC® HTec3 (Novozymes A/S), VISCOZYME® (Novozymes A/S), ULTRAFLO® (Novozymes A/S), PULPZYME® HC (Novozymes A/S), MULTIFECT® Xylanase (Genencor), ACCELLERASE® XY (Genencor), ACCELLERASE ® XC (Genencor), ECOPULP® TX-200A (AB Enzymes), HSP 6000 Xylanase (DSM), DEPOL™ 333P (Biocatalysts Limit, Wales, UK), DEPOL™ 740L. (Biocatalysts Limit, Wales, UK), and DEPOL™ 762P (Biocatalysts Limit, Wales, UK), ALTERNA FUEL 100P (Dyadic), and ALTERNA FUEL 200P (Dyadic).

[00364] Examples of xylanases useful in the processes of the present invention include, but are not limited to, xylanases from Aspergillus aculeatus (GeneSeqP:AAR63790; WO 94/21785), Aspergillus fumigatus (WO 2006/078256), Penicillium pinophilum (WO 2011/ 041405), Penicillium sp. (WO 2010/126772), Talaromyces lanuginosus GH11 (WO 2012/130965), Talaromyces thermophilus GH11 (WO 2012/13095), Thielavia terrestris NRRL 8126 (WO 2009/079210), and Trichophaea saccata GH10 (WO 201 1/057083).

[00365] Examples of beta-xylosidases useful in the processes of the present invention include, but are not limited to, beta-xylosidases from Neurospora crassa (SwissProt:Q7SOW4), Trichoderma reesei (UniProtKB/TrEMBL:Q92458), Talaromyces emersonii (SwissProt:Q8X212 ), and Talaromyces thermophilus GH11 (WO 2012/13095).

[00366] Examples of acetylxylan esterases useful in the processes of the present invention include, but are not limited to, acetylxylan esterases from Aspergillus aculeatus (WO 2010/108918), Chaetomium globosum (UniProt:Q2GWX4), Chaetomium gracile (GeneSeqP:AAB82124), Humicola insolens DSM 1800 (WO 2009/073709), Hypocrea jecorina (WO 2005/001036), Myceliophtera thermophila (WO 2010/014880), Neurospora crassa (UniProt:q7s259), Phaeosphaeria nodorum (UniProt:Q0UHJ1), and Thielavia terrestris NRRL 8126 ( WO 2009/042846).

[00367] Examples of feruloyl esterases (ferulic acid esterases) useful in the processes of the present invention include, but are not limited to, feruloyl esterases from Humicola insolens DSM 1800 (WO 2009/076122), Neosartorya fischeri (UniProt:A1D9T4), Neurospora crassa (UniProt:Q9HGR3), Penicillium aurantiogriseum (WO 2009/127729), and Thielavia terrestris (WO 2010/053838 and WO 2010/065448).

[00368] Examples of arabinofuranosidases useful in the processes of the present invention include, but are not limited to, arabinofuranosidases from Aspergillus niger (GeneSeqP:AAR94170), Humicola insolens DSM 1800 (WO 2006/114094 and WO 2009/073383), and M. giganteus (WO 2006/114094).

[00369] Examples of alpha-glucuronidases useful in the processes of the present invention include, but are not limited to, alpha-glucuronidases from Aspergillus clavatus (UniProt:alcc12), Aspergillus fumigatus (SwissProt:Q4WW45), Aspergillus niger (UniProt:Q96WX9), Aspergillus terreus (SwissProt:Q0CJP9), Humicola insolens (WO 2010/014706), Penicillium aurantiogriseum (WO 2009/068565), Talaromyces emersonii (UniProt:Q8X211), and Trichoderma reesei (UniProt:Q99024).

[00370] Examples of oxidoreductases useful in the processes of the present invention include, but are not limited to, Aspergillus fumigatus catalase, Aspergillus lentilus catalase, Aspergillus niger catalase, Aspergillus oryzae catalase, Humicola insolens catalase, Neurospora crassa catalase, catalase from Penicillium emersonii, catalase from Scytalidium thermophilum, catalase from Talaromyces stipitatus, catalase from Thermoascus aurantiacus, laccase from Coprinus cinereus, laccase from Myceliophthora thermophila, laccase from Polyporus pinsitus, laccase from Pycnoporus cinnabarinus, laccase from Rhizoctonia solani, laccase from Streptomyces co elicolor, Coprinus cinereus peroxidase, Soybean peroxidase, and King palm peroxidase.

[00371] The polypeptides having enzyme activity used in the processes of the present invention can be produced by fermentation of the above-noted microbial strains in a nutrient medium containing adequate sources of carbon and hydrogen and inorganic salts, using procedures known in the art (see, p. g., Bennett, J.W. and LaSure, L. (eds.), More Gene Manipulations in Fungi, Academic Press, CA, 1991). Suitable media are available from commercial suppliers or can be prepared according to published compositions (eg, in American Type Culture Collection catalogs). Temperature ranges and other conditions suitable for growth and enzyme production are known in the art (see, e.g., Bailey, J.E., and Ollis, D.F., Biochemical Engineering Fundamentals, McGraw-Hill Book Company, NY, 1986).

[00372] Fermentation can be any method of culturing a cell resulting in the expression or isolation of an enzyme or protein. Fermentation can therefore be understood to comprise shake flask cultivation, or small- or large-scale fermentation (including continuous, batch, fed-batch, or solid-state fermentations) in laboratory or industrial fermenters, carried out in a suitable medium and under conditions allowing the enzyme to be expressed or isolated. The resulting enzymes produced by the methods described above can be recovered from the fermentation medium and purified by conventional procedures.

[00373] Fermentation. The fermentable sugars obtained from the hydrolyzed cellulosic material can be fermented by one or more (eg, multiple) fermenting microorganisms capable of fermenting the sugars directly or indirectly into a desired fermentation product. "Fermentation" or "fermentation process" refers to any fermentation process or any process comprising a fermentation step. Fermentation processes also include fermentation processes used in the consumer alcohol industry (eg, beer and wine), the dairy industry (eg, fermented milk products), the leather industry, and the tobacco industry. Fermentation conditions depend on the desired fermentation product and fermenting organism and can easily be determined by one skilled in the art.

[00374] In the fermentation step, sugars, released from the cellulosic material as a result of the pretreatment and enzymatic hydrolysis steps, are fermented into a product, eg, ethanol, by a fermenting organism, such as yeast. Hydrolysis (saccharification) and fermentation can be separate or simultaneous.

[00375] Any suitable hydrolyzed cellulosic material can be used in the fermentation step in the practice of the present invention. Material is generally selected on the basis of economics, i.e., costs per potential sugar equivalent, and recalcitrance to enzymatic conversion.

[00376] The term “fermentation medium” is understood here as referring to a medium before the fermenting microorganism(s) is added, such as a medium resulting from a process of saccharification, as well as a medium used in a simultaneous saccharification and fermentation (SSF) process.

[00377] “Fermenting microorganism” refers to any microorganism, including bacterial and fungal organisms, suitable for use in a desired fermentation process to produce a fermentation product. The fermenting organism can be hexose and/or pentose fermenting organisms, or a combination thereof. Hexose and pentose fermenting organisms are well known in the art. Suitable fermentative microorganisms are capable of fermenting, i.e., converting, sugars, such as glucose, xylose, xylulose, arabinose, maltose, mannose, galactose, and/or oligosaccharides, directly or indirectly, into the desired fermentation product. Examples of ethanol-producing bacterial and fungal fermenting organisms are described by Lin et al., 2006, Appl. Microbiol. Biotechnol. 69: 627-642.

[00378] Examples of fermenting microorganisms that can ferment hexose sugars include bacterial and fungal organisms such as yeast. Yeasts include strains of Candida, Kluyveromyces, and Saccharomyces, eg, Candida sonorensis, Kluyveromyces marxianus, and Saccharomyces cerevisiae.

[00379] Examples of fermenting organisms that can ferment pentose sugars in their native state include bacterial and fungal organisms, such as some yeasts. Xylose fermenting yeasts include Candida strains, preferably C. sheatae or C. sonorensis; and strains of Pichia, e.g. P. stipitis, such as P. stipitis CBS 5773. Pentose fermenting yeasts include Pachysolen strains, preferably P. tannophilus. Organisms not capable of fermenting pentose sugars, such as xylose and arabinose, can be genetically engineered to do so by methods known in the art.

[00380] Examples of bacteria that can effectively ferment hexose and pentose to ethanol include, for example, Bacillus coagulans, Clostridium acetobutylicum, Clostridium thermocellum, Clostridium phytofermentans, Geobacillus sp., Thermoanaerobacter saccharolyticum, and Zymomonas mobilis (Philippidis, 1996, supra).

[00381] Other fermenting organisms include Bacillus strains such as Bacillus coagulans; Candida, such as C. sonorensis, C. methanosorbosa, C. diddensiae, C. parapsilosis, C. naedodendra, C. blankii, C. entomophilia, C. brassicae, C. pseudotropicalis, C. boidinii, C. utilis, and C. .scehatae; Clostridium, such as C. acetobutylicum, C. thermocellum, and C. phytofermentans; E. coli, especially E. coli strains that have been genetically engineered to improve ethanol yields; Geobacillus sp.; Hansenula, such as Hansenula anomala; Klebsiella, such as K. oxytoca; Kluyveromyces, such as K. marxianus, K. lactis, K. thermotolerans, and K. fragilis; Schizosaccharomyces, such as S. pombe; Thermoanaerobacter, such as Thermoanaerobacter saccharolyticum; and Zymomonas, such as Zymomonas mobilis.

[00382] Commercially available yeasts suitable for ethanol production include, e.g., BIOFERM™ AFT and XR (NABC - North American Bioproducts Corporation, GA, USA), ETHANOL RED™ yeast (Fermentis/Lesaffre, USA), FALI ™ (Fleischmann's Yeast, USA), FERMIOL™ (DSM Specialties), GERT STRAND™ (Gert Strand AB, Sweden), and SUPERSTART™ and THERMOSACC™ fresh yeast (Ethanol Technology, WI, USA).

[00383] In one aspect, the fermenter microorganism has been genetically modified to provide the ability to ferment pentose sugars, such as microorganisms using xylose, using arabinose, and co-using xylose and arabinose.

[00384] The cloning of heterologous genes in various fermenting microorganisms led to the construction of organisms capable of converting hexoses and pentoses into ethanol (cofermentation) (Chen and Ho, 1993, Appl. Biochem. Biotechnol. 39-40: 135-147; Ho et al., 1998, Appl. Environ. Microbiol. 64: 1852-1859; Kotter and Ciriacy, 1993, Appl. Microbiol. Biotechnol. 38: 776-783; Walfridsson et al., 1995, Appl. Environ. Microbiol. 61 : 4184-4190; Kuyper et al., 2004, FEMS Yeast Research 4: 655-664; Beall et al., 1991, Biotech.Bioeng.38:296-303; Ingram et al., 1998, Biotechnol.Bioeng.58 :204-214;Zhang et al., 1995, Science 267:240-243;Deanda et al., 1996, Appl.Environ.Microbiol.62:4465-4470;WO 03/062430).

[00385] It is well known in the art that the organisms described above can also be used to produce other substances as described herein.

[00386] The fermenting microorganism is typically added to the degraded cellulosic material or hydrolyzate and fermentation is carried out for about 8 to about 96 hours, e.g., about 24 to about 60 hours. The temperature is typically between about 26°C and about 60°C, e.g., about 32°C or 50°C, and about pH 3 to about pH 8, e.g., pH 4 -5, 6, or 7.

[00387] In one aspect, the yeast and/or other microorganism is applied to the degraded cellulosic material and the fermentation is carried out for about 12 to about 96 hours, such as typically 24-60 hours. In another aspect, the temperature is preferably between about 20°C and about 60°C, e.g., about 25°C to about 50°C, about 32°C to about 50°C, or about 32°C to about 50°C, and the pH is generally from about pH 3 to about pH 7, e.g., about pH 4 to about pH 7. However, some fermenting organisms , eg bacteria, have higher optimal fermentation temperatures. The yeast or other microorganism is preferably applied in amounts of approximately 105 to 1012, preferably approximately 107 to 1010, especially approximately 2 x 108 viable cell counts per ml of fermentation broth. Additional guidance concerning the use of yeast for fermentation can be found in, e.g., “The Alcohol Textbook” (Editors K. Jacques, T.P. Lyons and D.R. Kelsall, Nottingham University Press, UK 1999), which is hereby incorporated by reference.

[00388] A fermentation enhancer can be used in combination with any of the processes described herein to further improve the fermentation process, and in particular, the performance of the fermenting microorganism, such as enhancement of the rate and yield of ethanol. A "fermentation enhancer" refers to enhancers of the growth of fermenting microorganisms, in particular, yeast. Preferred fermentation stimulators for growth include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenate, nicotinic acid, meso-inositol, thiamine, pyridoxine, para-aminobenzoic acid, folic acid, riboflavin, and Vitamins A, B, C, D, and E. See, for example, Alfenore et al., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), which is incorporated herein by reference. Examples of minerals include minerals and mineral salts that can provide nutrients comprising P, K, Mg, S, Ca, Fe, Zn, Mn, and Cu.

[00389] Fermentation products: A fermentation product can be any substance derived from fermentation. The fermentation product can be, without limitation, an alcohol (e.g., arabinitol, n-butanol, isobutanol, ethanol, glycerol, methanol, ethylene glycol, 1,3-propanediol [propylene glycol], butanediol, glycerin, sorbitol , and xylitol); an alkane (eg, pentane, hexane, heptane, octane, nonane, decane, undecane, and dodecane), a cycloalkane (eg, cyclopentane, cyclohexane, cycloheptane, and cyclooctane), an alkene (eg, ., pentene, hexene, heptene, and octene); an amino acid (eg, aspartic acid, glutamic acid, glycine, lysine, serine, and threonine); a gas (eg, methane, hydrogen (H2), carbon dioxide (CO2), and carbon monoxide (CO)); isoprene; a ketone (e.g., acetone); an organic acid (eg, acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diket-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid, and xylonic acid); and polyketide. The fermentation product can also be protein as a high value product.

[00390] In a preferred aspect, the fermentation product is an alcohol. It will be understood that the term "alcohol" encompasses a substance that contains one or more hydroxyl moieties. The alcohol can be, but is not limited to, n-butanol, isobutanol, ethanol, methanol, arabinitol, butanediol, ethylene glycol, glycerin, glycerol, 1,3-propanediol, sorbitol, xylitol. See, for example, Gong et al., 1999, "Ethanol production from renewable resources", in Advances in Biochemical Engineering/Biotechnology, Scheper, T., editor, Springer-Verlag Berlin Heidelberg, Germany, 65: 207-241; Silveira and Jonas, 2002, Appl. Microbiol. Biotechnol. 59: 400-408; Nigam and Singh, 1995, Process Biochemistry 30(2): 117-124; Ezeji et al., 2003, World Journal of Microbiology and Biotechnology 19(6): 595-603.

[00391] In another preferred aspect, the fermentation product is an alkane. The alkane can be an unbranched or a branched alkane. The alkane can be, but is not limited to, pentane, hexane, heptane, octane, nonane, decane, undecane, or dodecane.

[00392] In another preferred aspect, the fermentation product is a cycloalkane. The cycloalkane can be, but is not limited to, cyclopentane, cyclohexane, cycloheptane, or cyclooctane.

[00393] In another preferred aspect, the fermentation product is an alkene. The alkene can be an unbranched or a branched alkene. The alkene can be, but is not limited to, pentene, hexene, heptene, or octene.

[00394] In another preferred aspect, the fermentation product is an amino acid. The organic acid can be, but is not limited to, aspartic acid, glutamic acid, glycine, lysine, serine, or threonine. See, for example, Richard and Margaritis, 2004, Biotechnology and Bioengineering 87(4): 501-515.

[00395] In another preferred aspect, the fermentation product is a gas. The gas can be, but is not limited to, methane, H2, CO2, or CO. See, for example, Kataoka et al., 1997, Water Science and Technology 36(6-7): 41-47; and Gunaseelan, 1997, Biomass and Bioenergy 13(1-2): 83-114.

[00396] In another preferred aspect, the fermentation product is isoprene.

[00397] In another preferred aspect, the fermentation product is a ketone. It will be understood that the term "ketone" encompasses a substance that contains one or more ketone moieties. The ketone can be, but is not limited to, acetone.

[00398] In another preferred aspect, the fermentation product is an organic acid. The organic acid can be, but is not limited to, acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diket-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, propionic acid, succinic acid, or xylonic acid. See, for example, Chen and Lee, 1997, Appl. Biochem. Biotechnol. 63-65: 435-448.

[00399] In another preferred aspect, the fermentation product is polyketide.

[00400] Recovery. The fermentation product(s) may optionally be recovered from the fermentation medium using any method known in the art, including, but not limited to, chromatography, electrophoretic procedures, differential solubility, distillation, or extraction. For example, alcohol is separated from fermented cellulosic material and purified by conventional distillation methods. Ethanol with a purity of up to about 96% by volume can be obtained, which can be used as, for example, fuel ethanol, potable ethanol, i.e., potable neutral alcoholic beverages, or industrial ethanol.

Detergent Compositions

[00401] The present invention also relates to detergent compositions comprising a variant of the GH61 polypeptide of the present invention and a surfactant. A variant of the GH61 polypeptide of the present invention can be added to and thereby become a component of a detergent composition.

[00402] The detergent composition of the present invention can be formulated, for example, as a hand or machine laundry detergent composition, including a laundry additive composition suitable for pre-treating stained fabrics and a fabric softener composition fabrics added for rinsing, or formulated as a detergent composition for use in general household hard surface cleaning operations, or formulated for hand or machine dishwashing operations. In one aspect, the present invention also relates to methods for cleaning or laundering a hard surface or clothing, the method comprising contacting the hard surface or clothing with a detergent composition of the present invention.

[00403] In a specific aspect, the present invention provides a detergent additive comprising a variant of the GH61 polypeptide of the present invention. The detergent additive as well as the detergent composition may comprise one or more (e.g. enzymes) selected from the group consisting of amylase, arabinase, cutinase, carbohydrase, cellulase, galactanase, laccase, lipase, mannanase, oxidase, pectinase, peroxidase , protease, and xylanase.

[00404] In general, the properties of the selected enzyme(s) must be compatible with the selected detergent (i.e., optimal pH, compatibility with other enzymatic and non-enzymatic ingredients, etc.) and the (s) enzyme(s) must be present in effective amounts.

[00405] Cellulases: Suitable cellulases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Suitable cellulases include cellulases from the genera Bacillus, Pseudomonas, Humicola, Fusarium, Thielavia, Acremonium, e.g., the fungal cellulases produced from Humicola insolens, Myceliophthora thermophila and Fusarium oxysporum disclosed in US 4,435,307, US 5,648,263, US 5,691,178, US 5,77 6.757 and WO 89/09259.

[00406] Especially suitable cellulases are alkaline or neutral cellulases having color care benefits. Examples of such cellulases are cellulases described in EP 0 495 257, EP 0 531 372, WO 96/11262, WO 96/29397, WO 98/08940. Other examples are cellulase variants such as those described in WO 94/07998, EP 0 531 315, US 5,457,046, US 5,686,593, US 5,763,254, WO 95/24471, WO 98/12307 and PCT/DK98/00299.

[00407] Commercially available cellulases include Celluzyme™, and Carezyme™ (Novozymes A/S), Clazinase™, and Puradax HA™ (Genencor International Inc.), and KAC-500(B)™ (Kao Corporation).

[00408] Proteases: Suitable proteases include those of animal, vegetable or microbial origin. Microbial origin is preferred. Chemically modified or protein engineered mutants are included. The protease may be a serine protease or a metalloprotease, preferably an alkaline microbial protease or a trypsin-like protease. Examples of alkaline proteases are subtilisins, especially those derived from Bacillus, eg subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06279). Examples of trypsin-like proteases are trypsin (eg, of porcine or bovine origin) and the Fusarium protease described in WO 89/06270 and WO 94/25583.

[00409] Examples of useful proteases are the variants described in WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially variants with substitutions at one or more of the following positions: 27, 36, 57, 76, 87, 97, 101, 104, 120, 123, 167, 170, 194, 206, 218, 222, 224, 235, and 274.

[00410] Preferred commercially available protease enzymes include ALCALASE™, SAVINASE™, PRIMASE™, DURALASE™, ESPERASE™, and KANNASE™ (Novozymes A/S), MAXATASE™, MAXACAL™, MAXAPEM™, PROPERASE™, PURAFECT™, PURAFECT OXP™, FN2™, and FN3™ (Genencor International Inc.).

[00411] Lipases: Suitable lipases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful lipases include lipases from Humicola (synonym Thermomyces), e.g. from H. lanuginosa (T. lanuginosus) as described in EP 258 068 and EP 305 216 or from H. insolens as described in WO 96/13580, a lipase from Pseudomonas, e.g. from P. alcaligenes or P. pseudoalcaligenes (EP 218 272), P. cepacia (EP 331 376), P. stutzeri (GB 1,372,034), P. fluorescens, strain Pseudomonas sp. SD 705 (WO 95/06720 and WO 96/27002), P. wisconsinensis (WO 96/12012), a lipase from Bacillus, e.g., from B. subtilis ( Dartois et al., 1993, Biochemica et Biophysica Acta , 1131: 253-360), B. stearothermophilus (JP 64/744992) or B. pumilus (WO 91/16422).

[00412] Other examples are lipase variants such as those described in WO 92/05249, WO 94/01541, EP 407 225, EP 260 105, WO 95/35381, WO 96/00292, WO 95/30744, WO 94/ 25578, WO 95/14783, WO 95/22615, WO 97/04079 and WO 97/07202.

[00413] Preferred commercially available lipase enzymes include LIPOLASETM and LIPOLASE ULTRATM (Novozymes A/S).

[00414] Amylases: Suitable amylases (α and/or β) include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Amylases include, for example, α-amylases obtained from Bacillus, eg a special strain of Bacillus licheniformis, described in more detail in GB 1,296,839.

[00415] Examples of useful amylases are the variants described in WO 94/02597, WO 94/18314, WO 96/23873, and WO 97/43424, especially variants with substitutions at one or more of the following positions: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181, 188, 190, 197, 202, 208, 209, 243, 264, 304, 305, 391, 408 and 444.

[00416] Commercially available amylases are DURAMYLTM, TERMAMYLTM, FUNGAMYLTM and BANTM (Novozymes A/S), RAPIDASETM and PURASTARTM (from Genencor International Inc.).

[00417] Peroxidases/Oxidases: Suitable peroxidases/oxidases include those of plant, bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful peroxidases include peroxidases from Coprinus, e.g., from C. cinereus, and variants thereof such as those described in WO 93/24618, WO 95/10602 and WO 98/15257.

[00418] Commercially available peroxidases include GUARDZYME™ (Novozymes A/S).

[00419] The detergent enzyme(s) may be included in a detergent composition by adding separate additives containing one or more (e.g., several) enzymes, or by adding a combined additive comprising all these enzymes. A detergent additive of the invention, i.e., a separate additive or a combined additive, can be formulated, for example, as a granulate, liquid, paste, etc. Preferred detergent additive formulations are granules, in particular non-dusting granules, liquids, in particular stabilized liquids, or pastes.

[00420] Dust-free granulates, eg, as disclosed in US 4,106,991 and 4,661,452 can be produced and optionally coated by methods known in the art. Examples of waxy coating materials are poly(ethylene oxide) products (polyethylene glycol, PEG) with average molar weights from 1000 to 20,000; ethoxylated nonolphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluidized bed techniques are given in GB 1483591. Liquid enzyme preparations can, for example, be stabilized by the addition of a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid according to established methods. Protected enzymes can be prepared according to the method disclosed in EP 238,216.

[00421] The detergent composition of the invention can be in any convenient form, e.g., a bar, a tablet, a powder, a granule, a paste, or a liquid. A liquid detergent can be aqueous, typically containing 70% water and 0-30% organic solvent, or non-aqueous.

[00422] The detergent composition comprises one or more (eg, several) surfactants, which can be non-ionic including semipolar and/or anionic and/or cationic and/or zwitterionic. Surfactants are typically present at a level of 0.1% to 60% by weight.

[00423] When included therein, the detergent will usually contain from about 1% to about 40% of an anionic surfactant such as linear alkylbenzenesulfonate, alpha-olefinsulfonate, alkyl sulfate (fatty acid sulfate), alcohol ethoxysulfate, alkanesulfonate secondary, alpha-sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid, or soap.

[00424] When included therein, the detergent will usually contain from about 0.2% to about 40% of a nonionic surfactant such as alcohol ethoxylate, nonylphenol ethoxylate, alkyl polyglycoside, alkyldimethylaminooxide, ethoxylated fatty acid monoethanolamide, monoethanolamide of fatty acid, polyhydroxy alkyl fatty acid amide, or N-acyl and N-alkyl derivatives of glucosamine ("glucamides").

[00425] The detergent may contain 0-65% of a detergent builder or complexing agent such as zeolite, diphosphate, triphosphate, phosphonate, carbonate, citrate, nitrilotriacetic acid, ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic acid, alkylor alkenylsuccinic acid, soluble silicates, or layered silicates (eg SKS-6 from Hoechst).

[00426] The detergent may comprise one or more (eg several) polymers. Examples are carboxymethylcellulose, poly(vinylpyrrolidone), poly(ethylene glycol), poly(vinyl alcohol), poly(vinylpyridine-N-oxide), poly(vinylimidazole), polycarboxylates such as polyacrylates, maleic/acrylic acid copolymers, and of lauryl methacrylate/acrylic acid.

[00427] The detergent may contain a bleach system which may comprise a source of H2O2 such as perborate or percarbonate which may be combined with a bleach activator formed of peracid such as tetraacetylethylenediamine or nonanoyloxybenzenesulfonate. Alternatively, the bleach system may comprise peroxyacids, for example of the amide, imide, or sulfone type.

[00428] The enzyme(s) of the detergent composition of the invention may be stabilized using conventional stabilizing agents, e.g., a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol , lactic acid, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid, and the composition may be formulated as described in, for example WO92/19709 and WO92/19708.

[00429] The detergent may also contain other conventional detergent ingredients such as, e.g., fabric conditioners including clays, foam boosters, soap suppressants, anti-corrosion agent, soil suspending agents, soil redeposition agents , dyes, bactericides, optical brighteners, hydrotopes, stain inhibitors, or perfumes.

[00430] In detergent compositions, any enzyme can be added in an amount corresponding to 0.01-100 mg of enzyme protein per liter of washing liquor, preferably 0.05-5 mg of enzyme protein per liter of washing liquor wash, in particular 0.1-1 mg of enzyme protein per liter of wash liquor.

[00431] In the detergent compositions, the GH61 polypeptide variant of the present invention having enhancing cellulolytic activity can be added in an amount corresponding to 0.001-100 mg of protein, preferably 0.005-50 mg of protein, more preferably 0.01-25 mg of protein, even more preferably 0.05-10 mg protein, most preferably 0.05-5 mg protein, and most preferably 0.01-1 mg protein per liter of wash liquor.

[00432] A GH61 polypeptide variant having enhancing cellulolytic activity of the present invention can also be incorporated into the detergent formulations disclosed in WO97/07202 which is incorporated herein by reference.

Plants

[00433] The present invention also relates to isolated plants, e.g., a plant, plant part, or transgenic plant cell, comprising a polynucleotide of the present invention in order to express and produce a variant of the GH61 polypeptide in amounts recoverable. The variant can be recovered from the plant or plant part. Alternatively, the plant or plant part containing the variant can be used as such to improve the quality of a food or feed, e.g., improve nutritional value, palatability, and rheological properties, or to destroy an antinutritive factor.

[00434] The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot). Examples of monocot plants are grasses such as meadow grasses (Poaceae, Poa), forage grasses such as Festuca, Lolium, temperate grasses such as Agrostis, and cereals, e.g. wheat, oats, rye, barley, rice , sorghum, and corn.

[00435] Examples of dicot plants are tobacco, legumes such as lupines, potatoes, sugar beets, peas, beans, and soybeans, and cruciferous plants (family Brassicaceae) such as cauliflower, rapeseed, and the related model organism of near Arabidopsis thaliana.

[00436] Examples of plant parts are stem, callus, leaves, root, fruit, seeds, and tubers, as well as the individual tissues comprising these parts, eg, epidermis, mesophyll, parenchyma, vascular tissues, meristems. Specific compartments of plant cells, such as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes, and cytoplasm, are also considered a plant part. Furthermore, any plant cell, regardless of tissue origin, is considered to be a plant part. Likewise, plant parts such as specific tissues and cells isolated to facilitate the use of the invention are also considered plant parts, e.g., embryos, endosperms, aleurone and seed pellets.

[00437] Also included within the scope of the present invention is the progeny of such plants, plant parts, and plant cells.

[00438] The transgenic plant or plant cell expressing the variant can be constructed according to methods known in the art. Briefly, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a variant into the host plant genome or chloroplast genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell. .

[00439] The expression construct is conveniently a nucleic acid construct comprising a polynucleotide encoding a variant operably linked to appropriate regulatory sequences required for expression of the polynucleotide in the plant or plant part of choice. Furthermore, the expression construct may comprise a selectable marker useful for identifying plant cells into which the expression construct has been integrated and DNA sequences necessary for introducing the construct into the plant in question (these latter depend on the method of introducing the expression construct). DNA to be used).

[00440] The choice of regulatory sequences, such as promoter and terminator sequences and optionally signal or transit sequences (Sticklen, 2008, Nature Reviews 9: 433-443), is determined, for example, on the basis of when, where, and how you want the variant to be expressed. For example, expression of the gene encoding a variant can be constitutive or inducible, or it can be developmental, stage or tissue specific, and the gene product can be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86: 506.

[00441] For constitutive expression, the 35S-CaMV promoter, maize ubiquitin 1, or rice actin 1 can be used (Franck et al., 1980, Cell 21: 285-294; Christensen et al., 1992, Plant Mol. Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165). Organ-specific promoters can be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits ( Edwards and Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303 ), or of metabolic sink tissues such as meristems (Ito et al., 1994, Plant Mol. Biol. 24: 863-878), a seed-specific promoter such as the glutelin, prolamine, globulin, or rice albumin promoter ( Wu et al., 1998, Plant Cell Physiol. 39: 885889 ), a Vicia faba promoter from legumin B4, and the Vicia faba unknown seed protein gene ( Conrad et al., 1998, J. Plant Physiol. 152: 708-711), a seed oil body protein promoter (Chen et al., 1998, Plant Cell Physiol. 39: 935-941), the Brassica napus napA reserve protein promoter, or any other specific promoter for seeds known in the art, e.g. as described in WO 91/14772. Furthermore, the promoter may be a leaf-specific promoter such as the rice or tomato rbcs promoter (Kyozuka et al., 1993, Plant Physiol. 102: 991-1000), the virus adenine methyltransferase gene promoter Chlorella (Mitra and Higgins, 1994, Plant Mol. Biol. 26: 85-93), the rice aldP gene promoter (Kagaya et al., 1995, Mol. Gen. Genet. 248: 668-674), or a wound-inducible promoter such as the potato pin2 promoter ( Xu et al., 1993, Plant Mol. Biol. 22: 573-588 ). Likewise, the promoter can be induced by abiotic treatments such as temperature, drought, or changes in salinity or induced by exogenously applied substances that activate the promoter, e.g., ethanol, estrogens, plant hormones such as ethylene, acid abscisic acid, and gibberellic acid, and heavy metals.

[00442] A promoter-enhancer element can also be used to achieve higher expression of a variant in the plant. For example, the promoter enhancer element can be an intron that is placed between the promoter and the polynucleotide encoding a variant. For example, Xu et al., 1993, supra, disclose the use of the first intron of the rice actin 1 gene to enhance expression.

[00443] The selectable marker gene and any other parts of the expression construct can be chosen from those available in the art.

[00444] The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biolistic transformation, and electroporation (Gasser et al. , 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).

[00445] Agrobacterium tumefaciens-mediated gene transfer is a method for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Mol. Biol. 19: 15-38) and for transforming monocots, although other methods processing plants can be used for these plants. One method for generating transgenic monocots is particle bombardment (microscopic particles of gold or tungsten coated with the transforming DNA) of embryonic calli or developing embryos (Christou, 1992, Plant J. 2: 275-281; Shimamoto, 1994, Curr Opin.Biotechnol.5:158-162; Vasil et al., 1992, Bio/Technology 10:667-674). An alternative method for transforming monocots is based on protoplast transformation as described by Omirulleh et al., 1993, Plant Mol. Biol. 21: 415-428. Additional transformation methods include those described in U.S. Pat. Us. 6,395,966 and 7,151,204 (both of which are incorporated herein by reference in their entirety).

[00446] After transformation, transformants having incorporated the expression construct are selected and regenerated into whole plants according to methods well known in the art. Often, the transformation procedure is designed for the selective elimination of selection genes during regeneration or in subsequent generations by use, for example, of cotransformation with two separate T-DNA constructs or site-specific excision of the selection gene by one specific recombinase.

[00447] In addition to directly transforming a particular plant genotype with a construct of the present invention, transgenic plants can be made by crossing a plant having the construct with a second plant lacking the construct. For example, a construct encoding a variant can be introduced into a particular plant variety by crossing, without the need for direct transformation of a plant of that given variety. Therefore, the present invention encompasses not only a plant directly regenerated from cells that have been transformed according to the present invention, but also the progeny of such plants. As used herein, progeny can refer to the progeny of any generation from a parent plant prepared in accordance with the present invention. Such progeny may include a DNA construct prepared in accordance with the present invention. Crossing results in introduction of a transgene into a plant line by cross-pollination of a parent line with a donor plant line. Non-limiting examples of such steps are described in U.S. Pat. At the. 7,151,204.

[00448] Plants can be generated through a process of retroconversion. For example, plants include plants referred to as a genotype, strain, inbred plant, or retroconverted hybrid.

[00449] Genetic markers can be used to aid the ingression of one or more transgenes of the invention from one genetic background to another. Marker-assisted selection offers advantages over conventional breeding in that it can be used to avoid errors caused by phenotypic variations. Additionally, genetic markers can provide data regarding the relative degree of elite germplasm in the individual progeny of a particular cross. For example, when a plant with a desired trait that otherwise has an agronomically undesirable genetic background is crossed with an elite parent, genetic markers can be used to select offspring that not only possess the trait of interest, but also have a relatively large proportion of the desired germplasm. In this way, the number of generations required to enter one or more traits into a particular gene pool is minimized.

[00450] The present invention also relates to methods of producing a variant of the present invention comprising: (a) culturing a transgenic plant or plant cell comprising a polynucleotide encoding the variant under conditions conducive to production of the variant; and optionally (b) recovering the variant.

[00451] The present invention is further described by the following examples which should not be considered as limiting the scope of the invention.

Examples Strains

[00452] Aspergillus oryzae strain PFJo218 (amy-, alp-, Npl-, CPA-, KA-, pyrG-, ku70- ; US Patent Application 20100221783) was used as an expression host for polypeptide variants GH61.

[00453] Aspergillus oryzae strain COLs1300 was also used as an expression host for variants of the GH61 polypeptide. A. niger COLs1300 (amyA, amyB, amyC, alpA, nprA, kusA, niaD, niiA, amdS+) was created from A. oryzae PFJ0220 (EP 2 147 107 B1) by deleting the promoter and the 5' part of the gene of the nitrite reductase (niiA) and the nitrate reductase (niaD) gene.

Media and Reagents

[00454] The AMG trace metal solution was composed of 14.3 g of ZnSOΔl F('), 2.5 g of CiiSCFol F(), 0.5 g of NiCFΔIF('), 13.8 g of FeSOc? H2O, 8.5 g MnSO4^H2O4, 3 g citric acid, and deionized water to 1 liter.

[00455] ) C)Ls1300 protoplast culture medium was composed of 100 mL of sucrose medium and 1 mL of 1 M urea.

[00456] The C)Ls1300 protoplast solution was composed of 80 mg of GLUCANEX® (Novozymes A/S, Bagsvaerd, Denmark), 0.5 mg/mL of chitinase (Sigma Chemical Co., Inc., St. Louis , M), USA), 10 mL of 1.2 M MgSO4, and 100 µL of 1 M NaH2PO4 pH 5.8.

[00457] The C)VE-N-Gly plates were composed of 50 mL of C)VE salt solution, 218 g of sorbitol, 10 g of glycerol, 2.02 g of KN)3, 25 g of Noble Agar, and deionized water up to 1 liter.

[00458] The C)VE-N-Gly plates with 10 mM uridine were composed of 50 mL of C)VE salt solution, 218 g of sorbitol, 10 g of glycerol, 2.02 g of KN)3, 25 g of Noble Agar, and deionized water to 1 liter; uridine was then added at a concentration of 10 mM to individual plates.

[00459] The solution of C)VE salts was composed of 26 g of KCl, 26 g of MgSOr7H2C), 76 g of KH2PO4, 50 mL of solution of trace elements C)VE, and deionized water up to 1 liter.

[00460] The solution of trace elements C)VE was composed of 40 mg of Na;B:O-WH2O, 0.4 g of CuSCFolH), 1.2 g of FeS(')/7l F('), 0 .7 g MnSOHFO, 0.8 g Na.ΔloOΔI F(), 10 g ZnS(')/7l F('), and deionized water to 1 liter.

[00461] ) LB agar was composed of 5 g of starch (Merck, Whitehouse Station, NJ, USA), 37 g of LB agar (Sigma Chemical Co., Inc., St. Louis, M.), USA), and water deionized to 1 liter.

[00462] LB+Amp agar plates were composed of LB agar supplemented with 150 μg of ampicillin per mL.

[00463] The M400 medium was composed of 50 g of maltodextrin, 2 g of MgSO^7H2O, 2 g of KH2PO4, 4 g of citric acid, 8 g of yeast extract, 2 g of urea, 0.5 mL of solution of AMG trace metals, 0.5 g of CaCl2, and deionized water to 1 liter; adjusted with NaOH to pH 6. After adjusting the pH, 0.7 mL of antifoam was added.

[00464] The Magnificent Broth was composed of 50 g of Magnificent Broth powder (MacConnell Research Corp. San Diego, CA, USA) and deionized water up to 1 liter.

[00465] The MaltV1 medium was composed of 20 g of maltose, 10 g of Peptone Bacto, 1 g of yeast extract, 1.45 g of (NH4)2SO4, 2.08 g of KH2PO4, 0.28 g of CaCl2 , 0.42 g MgSO4 71 I2O, 0.42 mL Trichoderma Trace Metals Solution, 0.48 g citric acid, 19.52 g 2-(N-morpholino)ethanesulfonic acid (MES), and water deionized 1 liter; adjusted with Na)H to pH 5.5.

[00466] ) MDU2BP medium (pH 5.0) was composed of 135 g of maltose, 3 g of MgSO^7l I2O, 3 g of NaCl, 6 g of K2SO4, 36 g of KH2PO4, 21 g of yeast extract, 6 g of urea, 1.5 mL of AMG Trace Metals Solution, and deionized water to 1 liter.

[00467] The PEG solution was composed of 6 g of polyethylene glycol 4000 (PEG 4000), 100 μL of 1 M Tris pI 7.5, 100 μL of 1 M CaCl2, and deionized water up to 10 mL.

[00468] ) protoplast culture medium was composed of 92 mL of sucrose transformation medium, 2 mL of 1 M uridine, 1 mL of 1 M NaN)3, and 10 mL of YP medium.

[00469] The protoplast solution consisted of 15 mL of 1.2 M MgS)4, 150 μL of 1 M NaI2P)4 (pI 5.8), 100 mg of GLUCANEX® (Novozymes A/S, Bagsvaerd , Denmark), and 10 mg of chitinase (Sigma Chemical Co., Inc., St. Louis, M.), USA).

[00470] The ST solution was composed of 1.5 mL of 2 M sorbitol, 500 μL of 1 M Tris pH 7.5, and deionized water up to 5 mL.

[00471] The STC solution was composed of 60 mL of 2 M sorbitol, 500 μL of 1 M Tris pH 7.5, 1 mL of 1 M CaCl2, and deionized water up to 100 mL.

[00472] The sucrose medium was composed of 20 mL of COVE salts solution, 342 g of sucrose, and deionized water up to 1 liter.

[00473] The sucrose agar plates were composed of 20 mL of Trichoderma trace elements solution, 20 g of Noble agar, 342 g of sucrose, and deionized water up to 1 liter.

[00474] The TAE buffer was composed of 40 mM 2-amino-2-hydroxymethylpropane-1,3-diol, 20 mM glacial acetic acid, and 2 mM ethylenediaminetetraacetic acid at pH 8.0.

[00475] The TBE buffer was composed of 10.8 g of Tris base, 5.5 g of boric acid, 0.74 g of EDTA (pH 8) in deionized water to 1 liter.

[00476] The TE buffer was composed of 10 mM Tris-0.1 mM EDTA pH 8.

[00477] The top agar was composed of 500 mL of sucrose medium, 5 g of low melting agarose, and 10 mL of 20 mM Tris pH 7.5.

[00478] The sucrose transformation medium was composed of 70 mL of 1 M sucrose and 20 mL of COVE salt solution.

[00479] The Trichoderma trace metal solution was composed of 216 g of FeCk6l I2O, 58 g of /nSO/7112O, 27 g of MiiSOH I2O, 10 g of CiiSOr5H2C), 2.4 g of H3BO3, 336 g of citric acid , and deionized water up to 1 liter.

[00480] The 2XYT agar plates were composed of 16 g of tryptone, 10 g of yeast extract, 5 g of NaCl, 15 g of Bacto agar, and deionized water up to 1 liter.

[00481] The 2XYT+Amp agar plates were composed of 2XYT agar supplemented with 100 μg of ampicillin per mL.

[00482] The YP medium was composed of 10 g of Bacto yeast extract, 20 g of Bacto peptone, and deionized water up to 1 liter.

Example 1: Construction of expression vectors pMMar44, pMMar49, pMMar45, and pDFng113

[00483] Plasmid pMMar44 was constructed as described below for expression of Aspergillus fumigatus GH61B polypeptide, and generation of mutant gene libraries. Additionally, plasmids pMMar49, pMMar45, and pDFng113 were constructed as described below for expression of Aspergillus fumigatus GH61B polypeptide variants (WO 2012/044835), Penicillium sp. (emersonii) (hereinafter GH61A polypeptide from Penicillium emersonii), and GH61A polypeptide from Thermoascus aurantiacus, respectively, and generation of variants.

[00484] Plasmid pENI2376 (US Patent Application 20060234340) containing the AMA sequence for autonomous maintenance in Aspergillus was digested with Bam HI and Not I to linearize the plasmid and remove an 8 bp fragment. The digested plasmid was purified using a PCR Purification Kit (QIAGEN Inc., Valencia, CA, USA).

[00485] The coding sequence of the GH61B polypeptide of Aspergillus fumigatus (Figure 1; SEQ ID NO: 29 [genomic DNA sequence] and SEQ ID NO: 30 [deduced amino acid sequence]), the coding sequence of the GH61B polypeptide of Aspergillus fumigatus (WO 2012/044835), the coding sequence for the GH61A polypeptide from Penicillium emersonii (SEQ ID NO: 35 [genomic DNA sequence] and SEQ ID NO: 36 [deduced amino acid sequence]), and the coding sequence for the GH61A polypeptide of Thermoascus aurantiacus (SEQ ID NO: 13 [genomic DNA sequence] and SEQ ID NO: 14 [deduced amino acid sequence]) were amplified from the source plasmids described below using the primers shown in Table 1. Bold letters represent the coding sequence. The remaining sequences are homologous with pENI2376 insertion sites for expression of the GH61 polypeptide coding sequences.Table 1

[00486] The construction of the pMMar44 plasmid containing the coding sequence of the Aspergillus fumigatus GH61B polypeptide is described below. The coding sequence of the Aspergillus fumigatus GH61B polypeptide was amplified from plasmid pAG43 (WO 2010/138754) using the primers shown in Table 1 with overhangs designed for cloning into plasmid pENI2376.

[00487] Fifty picomoles of each of the primers listed in Table 1 were used in a PCR consisting of 90 ng of pAG43, 1X ADVANTAGE® 2 PCR Buffer (Clontech Laboratories, Inc., Mountain View, CA, USA), 1 µL of a combination of dATP, dTTP, dGTP, and dCTP, each at 10 mM, and 1X ADVANTAGE® 2 DNA Polymerase Mixture (Clontech Laboratories, Inc., Mountain View, CA, USA) in a final volume of 50 µL. was performed using an EPPENDORF® MASTERCYCLER® 5333 (Eppendorf Scientific, Inc., Westbury, NY, USA) programmed for 1 cycle at 95 °C for 1 minute; 30 cycles each at 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute; and a final elongation at 72°C for 10 minutes. The heat block then went to a soak cycle at 4°C.

[00488] The reaction product was isolated by 1.0% agarose gel electrophoresis using TBE buffer where a PCR product band of approximately 862 bp was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit ( QIAGEN Inc., Valencia, CA, USA).

The homologous ends of the 862 bp PCR product and the digested pENI2376 were joined using an IN-FUSION™ ADVANTAGE® PCR Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA). A total of 63 ng of the 862 bp PCR product and 200 ng of pENI2376 digested by Bam HI/Not I were used in a reaction comprising 4 µL of 5X IN-FUSION™ reaction time (Clontech Laboratories, Inc., Mountain View, CA, USA) and 2 µL of IN-FUSION™ enzyme (Clontech Laboratories, Inc., Mountain View, CA, USA) in a final volume of 20 µL. The reaction was incubated for 15 minutes at 37°C, followed by 15 minutes at 50°C, and then placed on ice. The reaction volume was increased to 100 µL with TE buffer and 2 µL of the reaction was transformed into E. coli XL10-GOLD® Super Competent Cells (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600 (QIAGEN Inc., Valencia, CA, USA). Insertion of the Aspergillus fumigatus GH61B polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer (Applied Biosystems®, Life Technologies, Grand Island, NY, USA) and dye terminator chemistry from a Cycle Sequencing Kit BigDye® Terminator v3.1 (Applied Biosystems®, Life Technologies). Sequencing primers used for gene and sequence insertion verification are shown below. Primer 996271: ACTCAATTTACCTCTATCCACACTT (SEQ ID NO: 179) pALLO2 3' Primer: GAATTGTGAGGCGGATAACAATTTCA (SEQ ID NO: 180)

[00490] A plasmid containing the correct A. fumigatus GH61B polypeptide coding sequence was selected and designated pMMar44 (Figure 2).

[00491] Construction of plasmid pMMar49 containing eight base pair changes resulted in four amino acid mutations of the GH61B polypeptide from Aspergillus fumigatus (WO 2012/044835) is described below. The coding sequence of the mutated Aspergillus fumigatus GH61B polypeptide (WO 2012/044835) was amplified from plasmid pTH230 using the primers shown in Table 1 with overhangs designed for cloning into plasmid pENI2376.

[00492] Fifty picomoles of each of the primers listed in Table 1 were used in a PCR consisting of 100 ng of pTH230, 1X ADVANTAGE® 2 PCR Buffer (Clontech Laboratories, Inc., Mountain View, CA, USA), 1 µL of a combination of dATP, dTTP, dGTP, and dCTP, each at 10 mM, and 1X ADVANTAGE® 2 DNA Polymerase Mixture (Clontech Laboratories, Inc., Mountain View, CA, USA) in a final volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 1 minute; 30 cycles each at 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute; and a final elongation at 72°C for 7 minutes. The heat block then went to a soak cycle at 4°C.

[00493] The reaction product was isolated by 1.0% agarose gel electrophoresis using TBE buffer where a PCR product band of approximately 862 bp was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.

[00494] The homologous ends of the 862 bp PCR product and the digested pENI2376 were joined using an IN-FUSION™ ADVANTAGE® PCR Cloning Kit. A total of 90 ng of the 862 bp PCR product and 220 ng of pENI2376 digested by Bam HI/Not I were used in a reaction comprising 4 µL of 5X IN-FUSION™ reaction time and 2 µL of IN-FUSION enzyme ™ in a final volume of 20 µL. The reaction was incubated for 15 minutes at 37°C, followed by 15 minutes at 50°C, and then placed on ice. The reaction volume was increased to 100 µL with TE buffer and 2 µL of the reaction was transformed into E. coli XL10-GOLD® Super Competent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. The mutated insert of the Aspergillus fumigatus GH61B polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry of a BigDye® Terminator v3.1 Cycle Sequencing Kit. Sequencing primers 996271 and pALLO2 3' were used for gene and sequence insertion verification.

[00495] A plasmid containing the correct mutated A. fumigatus GH61B polypeptide coding sequence was selected and designated pMMar49 (Figure 3).

[00496] The construction of the plasmid pMMar45 containing the coding sequence of the Penicillium emersonii GH61A polypeptide is described below. The Penicillium emersonii GH61A polypeptide coding sequence was amplified from plasmid pDM286 containing the Penicillium emersonii GH61A polypeptide coding sequence using the primers shown in Table 1 with overhangs designed for cloning into plasmid pENI2376.

[00497] Plasmid pDM286 was constructed according to the following protocol. The P. emersonii GH61A polypeptide gene was amplified from plasmid pGH61D23Y4 (WO 2011/041397) using PHUSION™ High-Fidelity Hot Start DNA Polymerase (Finnzymes Oy, Espoo, Finland) and gene-specific forward and reverse primers shown below. The italicized region represents vector homology with the insertion site. Forward Primer: 5'-CGGACTGCGCACCATGCTGTCTTCGACGACTCGCAC-3' (SEQ ID NO: 181) Reverse Primer: 5'-TCGCCACGGAGCTTATCGACTTCTTCTAGAACGTC-3' (SEQ ID NO: 182)

[00498] The amplification reaction contained 30 ng of plasmid pGH61D23Y4, 50 pmoles of each of the primers listed above, 1 µL of a 10 mM combination of dATP, dTTP, dGTP, and dCTP, 1X PHUSION™ High-Fidelity Hot Buffer Start DNA Polymerase (Finnzymes Oy, Espoo, Finland) and 1 unit of PHUSION™ High-Fidelity Hot Start DNA Polymerase buffer in a final volume of 50 µL.

[00499] The amplification reaction was incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S (Eppendorf Scientific, Inc., Westbury, NY, USA) programmed for 1 cycle at 98 °C for 30 seconds; 35 cycles each at 98°C for 10 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, and one cycle at 72°C for 10 minutes.

[00500] The PCR products were separated by 1% agarose gel electrophoresis using TAE buffer. A 0.87 kb fragment was excised from the gel and extracted using a NUCLEOSPIN® Extract II Kit (Macherey-Nagel, Inc., Bethlehem, PA, USA).

[00501] The plasmid pMJ09 (US 2005/0214920 A1) was digested with Nco I and Pac I, and, after digestion, the digested vector was isolated by electrophoresis in a 1.0% agarose gel using TBE buffer where a fragment of approximately 7.1 kb was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 0.87 kb PCR product was inserted into Nco I/Pac I digested pMJ09 using an IN-FUSION™ ADVANTAGE® PCR Cloning Kit according to the manufacturer's protocol. The IN-FUSION™ reaction was composed of 1X IN-FUSION™ Reaction Buffer, 180 ng of Not I/Pac I-digested plasmid pMK09, 108 ng of the 0.87 kb PCR product, and 1 µL of IN-FUSION™ Enzyme. FUSION™ in a reaction volume of 10 µL. The reaction was incubated for 15 minutes at 37°C and then for 15 minutes at 50°C. To the reaction, 40 μL of TE was added and 2 μL were used to transform competent ONE SHOT® TOP10 cells (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry from a BigDye® Terminator Cycle Sequencing Kit v3.1. A clone containing the insert without any PCR errors was identified and designated plasmid pDM286. Plasmid pDM286 can be digested with Pme I to generate an approximately 5.4 kb fragment for transformation of T. reesei. This 5.4 kb fragment contains the expression cassette [T. reesei Cel7A cellobiohydrolase promoter (CBHI), P. emersonii glycosyl hydrolase 61A (GH61A) gene, T. reesei Cel7A cellobiohydrolase terminator (CBHI)] , and Aspergillus nidulans acetamidase (amdS) gene.

[00502] For the construction of pMMar45, 50 picomoles of each of the primers listed in Table 1 were used in a PCR composed of 120 ng of pDM286, 1X EXPAND® PCR Buffer (Roche Diagnostics, Inc., Indianapolis, IN, USA) , 1 µL of a combination of dATP, dTTP, dGTP, and dCTP, each at 10 mM, and 1X EXPAND® DNA Polymerase Mixture (Roche Diagnostics, Inc., Indianapolis, IN, USA), in a final volume of 50 µL . Amplification was performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 1 minute; 30 cycles each at 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute; and a final elongation at 72°C for 10 minutes. The heat block then went to a soak cycle at 4°C.

[00503] The reaction product was isolated by 1.0% agarose gel electrophoresis using TBE buffer where a PCR product band of approximately 762 bp was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.

The homologous ends of the 762 bp PCR product and the Bam HI/Not I by digested pENI2376 were joined using an IN-FUSION™ ADVANTAGE® PCR Cloning Kit. A total of 90 ng of the 762 bp PCR product and 200 ng of digested pENI2376 was used in a reaction composed of 4 µL of 5X IN-FUSION™ reaction time and 2 µL of IN-FUSION™ enzyme, in a final volume of 20 µL. The reaction was incubated for 15 minutes at 37°C, followed by 15 minutes at 50°C, and then placed on ice. The reaction volume was increased to 100 µL with TE buffer and 2 µL of the reaction was transformed into E. coli XL10-GOLD® Super Competent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion of the P. emersonii GH61A polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry of a BigDye® Terminator v3.1 Cycle Sequencing Kit. Sequencing primers 996271 and pALLO2 3' were used for gene and sequence insertion verification.

[00505] A plasmid containing the correct P. emersonii GH61A polypeptide coding sequence was selected and designated pMMar45 (Figure 4).

[00506] The construction of plasmid pDFng113 containing the coding sequence of the GH61A polypeptide from Thermoascus aurantiacus is described below. The Thermoascus aurantiacus GH61A polypeptide coding sequence was amplified from plasmid pDZA2 (WO 2005/074656) using the primers shown in Table 1 with overhangs designed for cloning into plasmid pENI2376.

[00507] Fifty picomoles of each of the primers listed in Table 1 were used in a PCR consisting of 100 ng of pDZA2, 1X EXPAND® PCR Buffer, 1 μL of a combination of dATP, dTTP, dGTP, and dCTP, each to 10 mM, and 1X EXPAND® DNA Polymerase Mixture in a final volume of 50 µL. The amplification reaction was performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 94 °C for 2 minutes; 30 cycles each at 94°C for 15 seconds, 59.9°C for 30 seconds, and 72°C for 1 minute; and a final elongation at 72°C for 7 minutes. The heat block then went to a soak cycle at 4°C.

[00508] The reaction product was isolated by 1.0% agarose gel electrophoresis using TBE buffer where a PCR product band of approximately 822 bp was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.

The homologous ends of the 822 bp PCR product and the Bam HI/Not I by digested pENI2376 were joined using an IN-FUSION™ ADVANTAGE® PCR Cloning Kit. A total of 37 ng of the 799 bp PCR product and 200 ng of digested pENI2376 was used in a reaction composed of 4 µL of 5X IN-FUSION™ reaction time and 2 µL of IN-FUSION™ enzyme, in a final volume of 20 µL. The reaction was incubated for 15 minutes at 37°C, followed by 15 minutes at 50°C, and then placed on ice. The reaction volume was increased to 50 µL with TE buffer and 2 µL of the reaction was transformed into E. coli XL10-GOLD® Ultracompetent Cells (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion of the T. aurantiacus GH61A polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry of a BigDye® Terminator v3.1 Cycle Sequencing Kit. Sequencing primers 996271 and pALLO2 3' were used for gene and sequence insertion verification.

[00510] A plasmid containing the correct T. aurantiacus GH61A polypeptide coding sequence was selected and designated pDFng113 (Figure 5).

Example 2: Construction of a site saturation library of the GH61B polypeptide from Aspergillus fumigatus

[00511] A site-saturation library of the coding sequence of the GH61B polypeptide from Aspergillus fumigatus was synthesized by GeneArt AG (Regensburg, Germany). An average of 16.8 mutations per position were synthesized for a total of 165 residues, excluding the most conserved residues, resulting in a total of 2768 mutants. E. coli DH10B strains (Invitrogen, Carlsbad, CA, USA) containing mutant plasmids with known mutations were plated in 96-well plates as 50 µl glycerol stocks, and stored at -80°C.

[00512] DNA was generated from a thawed GeneArt plate by using a sterile 96-well replicator to stamp the GeneArt plate onto a 2XYT agar plate containing 100 µg/ml ampicillin. The agar plate was incubated overnight at 37°C. Colonies resulting from the agar plate were used to inoculate a block of 96 deep wells with each well containing 1 mL of Magnificent Broth supplemented with 400 µg ampicillin per mL. The block was covered with a breathable lid with air pores and then incubated in a humidified box at 37 °C overnight at 350 rpm. The block was centrifuged at 1100 x g for 10 minutes and the supernatant discarded. Plasmids were extracted from cell pellets using a BIOROBOT® 9600.

Example 3: Expression of wild-type and variants of A. fumigatus GH61B polypeptide and P. emersonii GH61A polypeptide in Aspergillus oryzae PFJO218

[00513] Aspergillus oryzae PFJO218 was incubated on a COVE-N-Gly plate with 10 mM uridine and incubated at 34 °C until confluence. Spores were collected from the plate by washing with 8 mL of 0.01% TWEEN® 20. One mL of the spore suspension was used to inoculate 103 mL of Protoplast Culture Medium into a 500 mL polycarbonate shake flask. The shake flask was incubated at 30°C with shaking at 180 rpm for 17-20 hours. The mycelia were filtered through a funnel lined with MIRACLOTH® (Calbiochem, La Jolla, CA, USA) and washed with 200 mL of 0.6 M MgSO4. The washed mycelia were resuspended in 15 mL of Protoplast Solution in a vial 125 ml sterile polycarbonate shaker and incubated on ice for 5 minutes. One mL of a solution of 12 mg bovine serum albumin per mL of deionized water was added to the shake flask and the shake flask was then incubated at 37°C with mixing at 70 rpm for 1-3 hours until formation of protoplasts are complete. The mycelia/protoplast mixture was filtered through a funnel lined with MIRACLOTH® into a 50 mL conical tube and overlaid with 5 mL of ST solution. The 50 mL conical tube was centrifuged at 1050 x g for 15 minutes with low acceleration/deceleration. After centrifugation, the liquid was separated into 3 phases. The interphase containing the protoplasts was transferred to a new 50 ml conical tube. Two volumes of STC solution were added to the protoplasts followed by a brief centrifugation at 1050 x g for 5 minutes. The supernatant was discarded. The protoplasts were washed twice with 20 ml of STC with resuspension of the protoplast pellet, centrifugation at 1050 x g for 10 minutes, and decanting the supernatant each time. After the final decantation, the protoplast pellet was resuspended in STC at a concentration of 1 x 108/ml. Protoplasts were frozen at -80°C until transformation.

[00514] A volume of 1.3 μL of each mutant plasmid was used to transform 3.5 μL of A. oryzae PFJO218 protoplasts with 3.5 μL of PEG solution per well in a 24-well plate. Plasmid pMMar44 or pMMar45 (Table 1) was also transformed as above into A. oryzae PFJO218 protoplasts to provide broth comprising wild-type GH61 polypeptides from A. fumigatus or P. emersonii. The 24-well plate was incubated at 37°C stationary for 30 minutes followed by addition of 28.6 µL of Sucrose Transformation Medium containing 10 mM NaNO3 and 14.3 µL of STC. The 24-well plate was then placed in a stationary 37°C humidified box for 7 days. On day 7, 1 ml of MaltV1 medium was added to each well. The plate was returned to the stationary 39°C humidified box and incubated for an additional 5 days. At least 550 µL of broth for each variant or wild-type GH61 polypeptide from A. fumigatus or P. emersonii was collected using a pipette to remove the mycelia mat and aspirate the liquid, for assay using PASC as a substrate. Mutant plasmids resulting in variants with improved thermostability using a PASC assay (Example 5) were transformed back and retested using the protocols described above.

[00515] Some of the variants were spore purified for further characterization. After a 7-day incubation of the transformation and prior to the addition of 1 ml of MaltV1 expression medium, a loop was passed over the initial growth of the transformation to collect spores in the well. The spores were then seeded onto a COVE-N-Gly plate and incubated at 37°C for approximately 36 hours. Single individual transformants were excised from the plate and transferred onto fresh COVE-N-Gly plates. Plates were stored at 34°C until confluence. Once confluent, a loop dipped in 0.01% TWEEN® 20 was passed over the spores which were then used to inoculate a 24-well plate with each well containing 1 ml of MaltV1 expression medium. The 24-well plate was placed in a humidified chamber at 39 °C. Samples were collected on the fifth day by removing the mycelia mat and pipetting the broth.

Example 4: Preparation of beta-glucosidase from Aspergillus fumigatus.

[00516] Beta-glucosidase from Aspergillus fumigatus NN055679 Cel3A (SEQ ID NO: 169 [DNA sequence] and SEQ ID NO: 170 [deduced amino acid sequence]) was recombinantly prepared according to WO 2005/047499 using Aspergillus oryzae as a host.

[00517] The filtered broth was adjusted to pH 8.0 with 20% sodium acetate, which made the solution turbid. To remove turbidity, the solution was centrifuged (20,000 x g for 20 minutes), and the supernatant was filtered through a 0.2 µm filtration unit (Nalgene, Rochester, NY, USA). The filtrate was diluted with deionized water to achieve the same conductivity as 50 mM Tris/HCl, pH 8.0. The adjusted enzyme solution was applied to a Q SEPHAROSE® Fast Flow column (GE Healthcare, Piscataway, NJ, USA) equilibrated in 50 mM Tris-HCl, pH 8.0 and eluted with a linear gradient of sodium chloride from 0 to 500 mM. Fractions were pooled and treated with 1% (w/v) activated charcoal to remove the color from the beta-glucosidase pool. Charcoal was removed by filtering the suspension through a 0.2 µm filter unit (Nalgene, Rochester, NY, USA). The filtrate was adjusted to pH 5.0 with 20% acetic acid and diluted 10 times with deionized water. The adjusted filtrate was applied to an SP SEPHAROSE® Fast Flow column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 10 mM succinic acid pH 5.0 and eluted with a linear gradient of sodium chloride from 0 to 500 mM. Protein concentration was determined using a Microplate BCA™ Protein Assay Kit (Thermo Fischer Scientific, Waltham, MA, USA) in which bovine serum albumin was used as a protein standard.

Example 5: Screening libraries of polypeptide variants GH61B from Aspergillus fumigatus and GH61A from Penicillium emersonii

[00518] Using a BIOMEK® FX Laboratory Automation Workstation (Beckman Coulter, Fullerton, CA, USA) with a DYAD® Thermal Cycler (Bio-Rad Laboratories, Inc., Richmond, CA, USA), 80 μL of each sample of broth from library plates of Aspergillus fumigatus GH61B variants and parent (wild-type) polypeptide grown in MaltV1 medium (Example 3) were mixed with 20 µL of 1 M sodium acetate buffer-10 mM MnSO4 pH 5.0 . Depending on the library, samples were then heat challenged at 62°C, 65°C, 68°C, 72°C, or 75°C for 20 minutes and compared to room temperature controls. After the heat challenge, broth samples were diluted 1.25, 2.5, 6.25, and 15.625 times in 2 mM MnSO4-200 mM sodium acetate pH 5 and 12.5 µL of dilutions were then transferred to 384-well polypropylene assay plates containing 25 µL of 1% phosphoric acid-swollen cellulose (PASC) and 12.5 µL of a cofactor solution (400 mM sodium acetate pH 5, 4 mM MnSO4, 0.4% gallic acid, 0.1 mg/mL Aspergillus fumigatus beta glucosidase, and 0.04% TRITON® X100. Plates were heat sealed using an ALPS-300™ (Abgene, Epsom, UK) with a plastic sheet and incubated at 40°C for 4 days.

[00519] The background glucose concentration of buffer-treated broth samples was determined prior to incubation by performing a glucose assay using the following reagents per liter: 0.9951 g ATP, 0.5176 g NAD, 0 .5511 g MgSO4 HO, 20.9 g MOPS, 1000 units hexokinase, 1000 units glucose-6-phosphate dehydrogenase, and 0.01% TRITON® X-100, pH 7.5. The BIOMEK® FX Laboratory Automation Workstation was used for this assay. Four serial 2-fold dilutions were performed in 384-well polystyrene plates using water as the diluent. Five µL of the dilutions were added to a new 384-well polystyrene plate, followed by addition of 60 µL of the above reagents. The plate was incubated at room temperature (22°C+2°C) for 30 to 45 minutes. Relative fluorescence units (RFU) were determined using a DTX 880 plate reader (Beckman Coulter, Fullerton, CA, USA) with excitation at 360 nm and emission at 465 nm and compared to glucose standards (1 mg/mL and 0.125 mg/mL) diluted in the same plate as the samples. At the end of four days, PASC plates incubated at 40°C were analyzed for glucose concentration using the glucose assay described above. Any background glucose was subtracted from the appropriate samples and then residual activity was calculated by comparing the glucose released in the PASC assay from the ambient sample treatment with the glucose released in the PASC assay from the heat challenged sample treatment. Only data that fit the linear part of the curve (defined as less than or equal to 1 mg/mL of glucose produced in an assay containing 5 mg/mL of PASC) were used in the calculation. The formula for calculating residual activity from the heat treatment was as follows: (mg/mL of glucose produced for the heat-treated sample / mg/mL of glucose produced for the ambient-treated sample) x 100%. Improved variants were those having a higher % residual activity compared to wild-type A. fumigatus GH61A polypeptide broth from MaltV1 medium in at least one heat treatment condition. MICROSOFT® EXCEL® (Microsoft Corporation, Redmond, WA, USA) was used for all calculations.

Example 6: Thermostability of GH61B variants from Aspergillus fumigatus measured by residual activity after heat treatment

[00520] Based on the residual activity ratios as described in Example 5, screening of libraries constructed in the previous Examples generated the results listed in Table 2.

[00521] Table 2 shows the average Residual Activity % (from 3-5 samples of each variant and the wild-type control) after treatment at 62, 65, or 68 °C. The GH61B polypeptide from Aspergillus fumigatus genitor showed decreased residual activity of 56%, 35%, and 12% when the temperature was increased from 62°C to 65°C to 68°C, respectively. The increase in thermostability of GH61B polypeptide variants from Aspergillus fumigatus ranged from a 1.02- to 1.3-fold increase when treated at 62 °C, a 1.06 to 1.7-fold increase when treated at 65 °C, and a 1.3 to 3.8-fold when treated at 68°C compared to wild-type A. fumigatus polypeptide GH61. The results showed that the improvements were most significant when treated at 68 °C. Table 2. Variants with improved thermostability with treatment at 62, 65, or 68 °C

Example 7: Thermostability of combinatorial variants of the GH61B polypeptide from Aspergillus fumigatus

[00522] The plasmid pLSBF09-3 was constructed as a template for subsequent combinatorial variants of GH61B from Aspergillus fumigatus. This plasmid was constructed by performing a single site-directed mutagenesis reaction on pMMar49 (Example 1) using a Site Mutagenesis Kit -Directed QUIKCHANGE® II XL (Stratagene, La Jolla, CA, USA). Two mutagenic primers were designed to insert the desired mutation. The PCR consisted of 125 ng of each primer, approximately 25 ng of plasmid template, 1X QUIKCHANGE® reaction buffer (Stratagene, La Jolla, CA, USA), 3 µL of QUIKSOLUTION® (Stratagene, La Jolla, CA, USA) , 1 µL of XL dNTP mix, and 1 µL of 2.5 U/μL Pfu ULTRA™ enzyme (Stratagene, La Jolla, CA, USA) in a final volume of 50 µL. The amplification reaction was performed using an EPPENDORF® MASTERCYCLER® thermal cycler programmed for hot start at 95 °C; 1 cycle at 95°C for 1 minute; 18 cycles each at 95°C for 50 seconds, 60°C for 50 seconds, and 68°C for 10 minutes; and a maintenance at 4 °C. One microliter of Dpn I was directly added to the amplification reaction and incubated at 37 °C for 1 hour. A 2 µL volume of the DpnI-digested reaction was used to transform E. coli XL10-GOLD® Ultracompetent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. One of the clones with the desired mutation was designated pLSBF09-3. Using pLSBF09-3 as a template, two additional combinatorial plasmids were constructed. Plasmids pDFng146 and pDFng148 were each mutagenized as described above. The primers used in these reactions are shown in Table 3.Table 3

[00523] Seven variants (pLSBF15, 17, 18, 20, 22, 53, and pDFNG145) of the GH61B polypeptide from Aspergillus fumigatus were constructed by adding a single amino acid mutation on top of pLSBF09-3 or pDFng148 using a Mutagenesis Kit Site-Directed QUIKCHANGE® II XL. The site-directed mutagenesis method described above was used in the construction of these mutants as well. The primers used in these reactions are shown in Table 4.

[00524] Four additional variants (pLSBF47, 48, 49, and 54) of GH61B from Aspergillus fumigatus were constructed through multiple site-directed mutagenesis of pDFng146 or pDFng148 using a QUIKCHANGE® Lightning Multiple Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). A mutagenic primer was designed for each desired mutation. One hundred ng of each primer (Table 4) were used in a PCR containing approximately 100 ng of template plasmid, 1X QUIKCHANGE® Lightning Multiple Buffer (Stratagene, La Jolla, CA, USA), 0.5 µL of QUIKSOLUTION® (Stratagene, La Jolla, CA, USA), 1 µL of dNTP mix, and 1 µL of QUIKCHANGE® Lightning multiple enzyme combination (Stratagene, La Jolla, CA, USA) in a final volume of 25 µL. The amplification reaction was performed using an EPPENDORF® MASTERCYCLER® thermal cycler programmed for hot start at 95 °C; 1 cycle at 95°C for 2 minutes; 30 cycles each at 95°C for 20 seconds, 55°C for 30 seconds, and 65°C for 5 minutes; 1 cycle at 65 °C for 5 minutes, and a maintenance at 4 °C. One microliter of Dpn I was directly added to the amplification reaction and incubated at 37 °C for 5 minutes. A 1.5 µL volume of the DpnI-digested reaction was transformed into E. coli XL10-GOLD® Ultracompetent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry from a BigDye® Terminator Cycle Sequencing Kit v3.1. One of the clones with the desired mutations was designated as each plasmid listed below. A. fumigatus GH61A polypeptide variants were expressed using Aspergillus oryzae PFJO218 as a host according to the procedure described in Example 3.

[00525] Based on the residual activity ratios determined according to Example 5, screening of libraries constructed in the previous Examples generated the results listed in Table 5. Table 5 shows an average Residual Activity % (2-199 samples for each one of the combinatorial variants and 34-179 samples for wild-type GH61 polypeptide) after treatment at any of 65°C, 68°C, 72°C, or 75°C.

[00526] Parent wild-type A. fumigatus polypeptide GH61 showed decreased residual activity of 40%, 24%, 0%, and 0% when the treatment temperature was increased from 65°C to 68°C to 72°C to 75 °C, respectively. The thermostability of combinatorial variants of GH61B polypeptide from Aspergillus fumigatus ranged from 0.8-fold (decreased) to 1.4-fold increase at 65°C, no increase to 2-fold increase at 68°C compared to GH61 polypeptide from Aspergillus fumigatus. Wild-type A. fumigatus. Since wild-type GH61 polypeptide has no residual activity at 72°C, the other variant (L111V, D152S, M155L, A162W) was used for comparison at 72°C and 75°C. In these cases, the variants ranged from no increase to 4.4-fold increase at 72°C, and from 4-fold to 33-fold increase at 75°C. The results showed that the improvements were most significant with treatment at 75°C for those measured at 75°C, otherwise they were most significant at 72°C where wild type had no measurable residual activity. Table 5. Aspergillus fumigatus GH61B polypeptide variants with improved thermostability with treatment at 65°C, 68°C, 72°C or 75°C

Example 8: Purification of GH61B polypeptide variants from Aspergillus fumigatus and GH61 from Penicillium emersonii

[00527] Expression and purification of GH61B polypeptide from wild-type Aspergillus fumigatus and GH61 from Penicillium emersonii were conducted as previously described in WO 2012/044835.

[00528] Strains expressing polypeptide variants GH61B from Aspergillus fumigatus and GH61 from Penicillium emersonii, generated as described in Examples 7 and 11, were grown in shake flasks to generate material as described below for purification. After isolation of single colonies, Aspergillus oryzae PFJO218 transformants were cultured for 4 days at 34°C on COVE-N-Gly plates in preparation for larger scale fermentation. Spores were recovered from each plate using 0.01% TWEEN® 20. Each spore suspension (500 µL) was inoculated into 25 mL of M400 medium in 125 mL plastic shake flasks. Transformants were fermented for 3 days at 39 °C with agitation at 150 rpm and the broths were collected and filtered using 0.22 µm filters. The filtered culture broths were then concentrated by centrifugal ultrafiltration using VIVACELL® 100 5 kDa MWCO centrifuge concentration devices (Sartorius Stedim, Goettingen, Germany) and then buffer changed into 20 mM Tris-HCl pH 8.0.

[00529] Concentrated and buffer-changed variants of polypeptide GH61B from Aspergillus fumigatus and GH61 from Penicillium emersonii were further purified by one of two chromatographic methods. In one method, the concentrated and buffer-changed broths were then each applied to a MONO Q® HR 16/10 column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 20 mM Tris-HCl pH 8.0. Bound proteins were eluted with a linear gradient of 0-500 mM sodium chloride in 20 mM Tris-HCl pH 8.0. Fractions were analyzed by SDS-PAGE using a CRITERION® Stain-Free Tris-HCl 8-16% SDS-PAGE gel (Bio-Rad Laboratories, Inc., Hercules, CA, USA), grouped based on the abundance of a approximately 25 kDa band, and concentrated using VIVASPIN® 5 kDa MWCO centrifugal concentration devices (GE Healthcare, Buckinghamshire, UK). Alternatively, the concentrated and desalted broths were then each applied to a HILOAD® 26/60 SUPERDEX® 75 size exclusion column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 20 mM Tris-HCl pH 8.0 and 150 mM NaCl. The applied proteins were isocratically eluted using 20 mM Tris-HCl pH 8.0 and 150 mM NaCl as the mobile phase. Fractions were analyzed by SDS-PAGE using a CRITERION® Stain-Free Tris-HCl 8-16% SDS-PAGE gel, pooled based on the abundance of a band of approximately 25 kDa, and concentrated using VIVASPIN® centrifugal concentration devices 5 kDa MWCO and then buffer exchanged in 20 mM MES pH 6.0.

[00530] Protein concentrations were determined using a Microplate BCA™ Protein Assay Kit in which bovine serum albumin was used as a protein standard.

Example 9: Determination of the Tm (melting temperature) of Aspergillus fumigatus wild-type GH61B polypeptide and Aspergillus fumigatus polypeptide GH61B variants by Differential Scanning Calorimetry

[00531] The thermostability of wild-type GH61B polypeptide from A. fumigatus and GH61B polypeptide variants from Aspergillus fumigatus, which were purified as described in Example 8, were determined by Differential Scanning Calorimetry (DSC) using a Differential Scanning Calorimeter VP (MicroCal Inc., GE Healthcare, Piscataway, NJ, USA). The melting temperature, Tm (°C), was taken as the top of the denaturation peak (main endothermic peak) in thermograms (Cp vs. T) obtained after heating 1 mg of protein per mL of enzyme solution in acetate 50 mM sodium pH 5.0, 100 µM CuSO4, or 1 mg of protein per mL of enzyme solution in 50 mM sodium acetate pH 5.0, 10 mM EDTA pH 5.0, at a rate of constant programmed heating. One mL of the sample and reference solutions was degassed at 25 °C using a ThermoVac (MicroCal Inc., GE Healthcare, Piscataway, NJ, USA) before loading the sample and reference cells into the calorimeter. Sample and reference solutions (reference: degassed water) were manually loaded into the DSC and thermally pre-equilibrated to 25°C before the DSC scan was performed from 25°C to 95°C at a scan rate of 90 K/hour. Denaturation temperatures were determined with an accuracy of approximately +/-1 °C. The results of thermostability determinations of A. fumigatus GH61B polypeptide variants are shown in Table 6. Table 6. Melting temperatures (°C) of A. fumigatus GH61B polypeptide and A. fumigatus GH61B polypeptide variants, as determined by differential scanning calorimetry

Example 10: Determination of the Tm (melting temperature) of Aspergillus fumigatus wild-type GH61B polypeptide and Aspergillus fumigatus GH61B polypeptide variants by thermal unfolding protein analysis

[00532] Thermal protein unfolding of Aspergillus fumigatus GH61B polypeptide variants was monitored using SYPRO® Orange Protein Stain (Invitrogen, Naerum, Denmark) using a StepOnePlus™ Real Time PCR System (Applied Biosystems Inc., Foster City, CA, USA). In a 96-well white PCR plate, 15 µL of a protein sample (prepared as described in Example 8) in 100 mM sodium acetate pH 5.0 was mixed (1:1) with Sypro Orange (resulting concentration = 10X; stock solution = 5000X in DMSO) in 20 mM EDTA. The plate was sealed with an optical PCR seal. The PCR instrument was set at a tracking rate of 76 °C per hour, starting at 25 °C and ending at 96 °C. Fluorescence was monitored every 20 seconds using a built-in blue LED light for excitation and ROX-filter (610 nm, emission). Tm values were calculated as the maximum value of the first derivative (dF/dK) ( Gregory et al., 2009, J. Biomol. Screen. 14: 700 ). The results of the thermostability determinations are shown in Table 7. Table 7. Melting temperatures (°C) of GH61B polypeptide and A. fumigatus variants determined by thermal unfolding analysis of proteins

Example 11: Construction of GH61A polypeptide variants from Penicillium emersonii

[00533] The variant plasmid pLSBF10 was constructed by two sequential single site-directed mutagenesis reactions in pMMar45 (Example 1) using a QUIKCHANGE® II XL Site-Directed Mutagenesis Kit. Two mutagenic primers were designed to insert each desired mutation. A total of 125 ng of each primer was used in a PCR containing approximately 25 ng plasmid template, 1X QUIKCHANGE® reaction buffer, 3 µL QUIKSOLUTION®, 1 µL XL dNTP mix (provided in the QUIKCHANGE Site-Directed Mutagenesis Kit ® II XL), and 1 μL of Pfu Ultra Enzyme at 2.5 U/μL in a final volume of 50 μL. PCR was performed using an EPPENDORF® MASTERCYCLER® thermal cycler programmed for hot start at 95 °C; 1 cycle at 95°C for 1 minute; 18 cycles each at 95°C for 50 seconds, 60°C for 50 seconds, and 68°C for 10 minutes; and a maintenance at 4 °C. One microliter of Dpn I was directly added to the amplification reaction and incubated at 37 °C for 1 hour. A 2 µL volume of the DpnI-digested reaction was used to transform E. coli XL10-GOLD® Ultracompetent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry from a BigDye® Terminator Cycle Sequencing Kit v3.1. One of the clones with the 2 desired mutations was designated as pLSBF10. The primers used in this reaction can be found below in Table 8.

[00534] A summary of the primers used for the site-directed mutagenesis reactions and the variant (S173C, F253C) obtained is shown in Table 8.

[00535] The resulting mutant plasmid DNA was prepared using a BIOROBOT® 9600. Each mutant plasmid was sequenced using a 3130xl Genetic Analyzer to verify substitutions. Sequencing primers 996271 and pALLO2 3' were used for verification.Table 8

[00536] GH61A polypeptide variants from P. emersonii were expressed using Aspergillus oryzae PFJO218 as host was carried out according to the procedure described in Example 3.

Example 12: Thermostability of wild-type P. emersonii variant GH61A polypeptide and P. emersonii variant GH61A polypeptide

[00537] Based on the residual activity ratios determined according to Example 5, the screening of libraries constructed in the previous Examples generated the results listed in Table 9. Table 9 shows an average Residual Activity % (from 2-14 samples each for the combinatorial variants and 14 wild-type samples) after treatment at either 65°C, 68°C, 72°C, or 75°C.

[00538] The parent wild-type P. emersonii polypeptide GH61A showed decreased residual activity of 45%, 18% and 1% when the treatment temperature was increased from 65 °C to 72 °C to 75 °C, respectively (68 °C has not been tested). The thermostability of the combinatorial variant P. emersonii GH61A polypeptide ranged from 0.8-fold (decreased) to 2.2-fold increase at 72 °C, and 30-fold compared to wild-type P. emersonii GH61A polypeptide at 75 °C.Table 9. GH61A polypeptide variants from Penicillium emersonii with improved thermostability with treatment at 65 °C, 68 °C, 72 °C or 75 °C

Example 13: Determination of the Tm (melting temperature) of P. emersonii wild-type GH61A polypeptide and variant P. emersonii GH61A polypeptide by Differential Scanning Calorimetry

[00539] The thermostability of wild-type P. emersonii GH61A polypeptide and variant P. emersonii GH61A polypeptide (S173C, F253C), purified as described in Example 8, were determined by Differential Scanning Calorimetry (DSC) using a VP Differential Scanning Calorimeter as described in Example 9. The results of determining the thermostability of the variant GH61A polypeptide from P. emersonii are shown in Table 10. Table 10. Melting temperatures (°C) of the GH61A polypeptide from P. emersonii wild-type and P. emersonii GH61A polypeptide and variant P. emersonii GH61A polypeptide, as determined by differential scanning calorimetry

[00540] Example 14: Determination of the Tm (melting temperature) of P. emersonii wild-type GH61A polypeptide and P. emersonii variant GH61A polypeptide by thermal unfolding protein analysis

[00541] Thermal unfolding of proteins of the GH61A polypeptide variant of Penicillium emersonii (S173C, F253C) was monitored using SYPRO® Orange Protein Stain and was performed using a StepOnePlus™ Real Time PCR System as described in Example 10. cultures of wild-type P. emersonii GH61A polypeptide and variant P. emersonii GH61A polypeptide were prepared as described in Example 11. The results of the thermostability determination are shown in Table 11. Table 11. Melting temperature (° C) of Penicillium emersonii GH61A polypeptide variants by thermal protein unfolding analysis

Example 15: Construction of expression vectors pDFng153-4, pDFng154-17, pDFng155-33, pDFng156-37, and pDFng157-51

[00542] The plasmids pDFng153-4 (Figure 6), pDFng154-17 (Figure 7), pDFng155-33 (Figure 8), and pDFng156-37 (Figure 9), and pDFng157-51 (Figure 10) were constructed as described below for expression of Thermoascus aurantiacus GH61A polypeptide, Penicillium emersonii GH61A polypeptide, Aspergillus aculeatus GH61 polypeptide, Penicillium pinophilum GH61 polypeptide, and Thielavia terrestris GH61 polypeptide, respectively, and the generation of the variants listed in Table 12. The plasmids were constructed using plasmid pBGMH16 (Figure 11).

[00543] Plasmid pBGMH16 was constructed according to the protocol described below. A Nb.BtsI recognition site in pUC19 was removed by PCR using the BGMH24 and BGMH25 primer pair shown below followed by cloning based on USERTM uracil-specific excision reagents (New England BioLabs, Ipswich, MA, USA) . Plasmid pUC19 is described in Yanisch-Perron et al., 1985, Gene 33(1): 103-19. BGMH24 primer: ATGCAGCGCUGCCATAACCATGAGTGA (SEQ ID NO: 217) BGMH25 primer: AGCGCTGCAUAATTCTCTTACTGTCATG (SEQ ID NO: 218)

[00544] The underlined sequence is used in the USER™ assisted fusion of the PCR fragment creating pBGMH13. The USER™ enzyme (Uracil Specific Excision Reagent) (New England Biolabs, Ipswich, MA, USA) generates a single nucleotide gap at the location of a uracil. The USER™ enzyme is a mixture of Uracil DNA glycosylase (UDG) and the DNA glycosylase-lyase endonuclease VIII. UDG catalyzes the excision of a uracil base, forming an abasic (apyrimidine) site while leaving the phosphodiester backbone intact. The lyase activity of endonuclease VIII cleaves the phosphodiester backbone at the 3' and 5' sides of the basic site such that the base-free deoxyribose is released.

[00545] The amplification reaction consisted of 100 ng of each primer, 10 ng of pUC19, 1X PfuTurbo® Cx Reaction Buffer (Stratagene, La Jolla, CA, USA), 2.5 μl of a combination of dATP, dTTP , dGTP, and dCTP, each at 10 mM, and 2.5 units of PfuTurbo® Cx Hot Start DNA Polymerase (Stratagene, La Jolla, CA, USA) in a final volume of 50 µL. The reaction was carried out using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 2 minutes; 32 cycles each at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 3 minutes; and a final elongation at 72°C for 7 minutes. Five µl of 10X NEBuffer 4 (New England Biolabs, Inc., Ipswich, MA, USA) and 20 units of Dpn I were added and incubated at 37°C for 1 hour. Dpn I was inactivated at 80 °C for 20 minutes. A total of 100 ng of PCR product and 1 unit of USER™ enzyme in a total volume of 10 µL were incubated 20 minutes at 37°C followed by 20 minutes at 25°C. Ten µL were transformed into competent ONE SHOT® TOP10 cells. E. coli transformants were selected on LB+Amp agar plates and plasmid DNA was prepared using QIAPREP® Spin Miniprep Kit (QIAGEN Inc., Valencia, CA, USA). The resulting plasmid pBGMH13 was confirmed by sequencing using an Applied Biosystems Model 3730XL Automated DNA Sequencer using Terminator Chemistry 3.1 BIG-DYE™ version 3.1 (Applied Biosystems, Inc., Foster City, CA, USA).

[00546] Plasmid pBGMH14 contains part of pBGMH13 as the backbone of the vector and a Pac I/Nt.BbvCI USER™ cassette (Hansen et al., 2011, Appl. Environ. Microbiol. 77(9): 3044-51) that it is flanked by part of the A. oryzae niaD gene on one side and part of the A. oryzae niiA gene on the other side. The Pac I/Nt.BbvCI USER™ cassette can be linearized with Pac I and Nt.BbvCI and a PCR product with matching overhangs can be cloned into this location (New England Biolabs, Ipswich, MA, USA).

[00547] A niiA fragment from Aspergillus oryzae was generated using primers BGMH27 and BGMH29 shown below. The primer pair BGMH28 and BGMH32 shown below was used to amplify the Aspergillus oryzae niaD gene region and the primer pair BGMH30 and BGMH31 shown below was used to amplify the plasmid backbone region. BGMH Primer 27: AATTAAGUCCTCAGCGTGATTTAAAACGCCATTGCT (SEQ ID NO: 219) BGMH Primer 28: ACTTAATUAAACCCTCAGCGCAGTTAGGTTGGTGTTCTTCT (SEQ ID NO: 220) BGMH Primer 29: AGCTCAAGGAUACCTACAGGMTTATTCGAAA (SEQ ID NO: 221) BGMH Primer 30: ATCCTTGAGCUGTTTCCTGTGTGAAATTGTTATCC (SEQ ID NO: 222) BGMH Primer 31: ATCTCCTCUGCTGGTCTGGTTAAGCCAGCCCCGACAC (SEQ ID NO: 223) BGMH Primer 32: AGAGGAGAUAATACTCTGCGCTCCGCC (SEQ ID NO: 224)

[00548] The underlined sequence was used in the USER™ assisted fusion of the three fragments. The sequence marked in bold was used to insert a PacI/Nt.BbvCI USER™ cassette (Hansen et al., 2011, supra) between the niiA and niaD fragments.

[00549] Genomic DNA from A. oryzae BECH2 (WO 00/39322) was purified using a FASTDNA™ 2 ml SPIN Soil Kit (MP Biomedicals, Santa Ana, California, USA).

[00550] Each PCR consisted of 100 ng of each primer, template DNA (pBGMH13 or A. oryzae BECH2 genomic DNA), 1X PfuTurbo® Cx Reaction Buffer, 2.5 μL of a combination of dATP, dTTP, dGTP, and dCTP, each at 10 mM, and 2.5 units of PfuTurbo® Cx Hot Start DNA Polymerase in a final volume of 50 µL. PCRs were performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 2 minutes; 32 cycles each at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 4 minutes; and a final elongation at 72°C for 10 minutes. Where the template DNA was a plasmid, 5 µl of 10X NEBuffer 4 and 20 units of Dpn I were added and incubated at 37°C for 1 hour. Dpn I was inactivated at 80 °C for 20 minutes. Fifty ng of each of the PCR products and 1 unit of USER™ enzyme in a total volume of 10 µL were incubated for 20 minutes at 37°C followed by 20 minutes at 25°C. Then, 10 µL were transformed into competent ONE SHOT® TOP10 cells. The three fragments were fused by uracil-specific splicing reagent-based cloning (Nour-Eldin et al., 2010, Methods Mol. Biol. 643: 185-200). E. coli transformants were selected on LB+Amp agar plates and plasmid DNA was prepared using QIAPREP® Spin Miniprep Kit. Plasmid pBGMH14 was confirmed by sequencing using Applied Biosystems Model 3730XL Automated DNA Sequencer using terminator chemistry 3.1 BIG-DYE™ version 3.1. The P13amy promoter is a derivative of the NA2-tpi promoter from pJaL676 (WO 2003/008575). The A. niger AMG terminator used is described by Christensen et al., 1988, Nature Biotechnology 6: 141-1422. The P13amy promoter and AMG terminator were cloned into the Pac I/Nt.BbvCI USER™ cassette in pBGMH14. The primers shown below were designed such that an Asi SI/Nb.BtsI USER™ cassette (Hansen et al., 2011, supra) was inserted between the promoter and terminator. BGMH Primer 49: GGGTTTAAUCCTCACACAGGAAACAGCTATGA (SEQ ID NO: 225) BGMH Primer 50: AGTGTCTGGCGAUCGCTCTCACTGCCCCCAGTTGTGTATATAGAG GA (SEQ ID NO: 226) BGMH Primer 51: ATCGCAGACACUGCTGGCGGTAGACAATCAATCCAT (SEQ ID NO: 227) Primer B GMH 52: GGACTTAAUGGATTCTAAGATGAGCTCATGGCT (SEQ ID NO: 228)

[00551] The underlined sequence was used in the USER™ assisted fusion of the two PCR fragments into a Pac I/Nt.BbvCI digested pBGMH14. The sequence marked in bold was used to introduce an AsiSI/Nb.BtsI USER™ cassette (Hansen et al., 2011, supra) between the promoter and terminator.

[00552] The pair of primers BGMH49 and BGMH50 was used to amplify the P13amy promoter and the pair of primers BGMH51 and BGMH52 was used to amplify the AMG terminator. The PCR comprised 100 ng of each primer, template DNA, 1X PfuTurbo® Cx Reaction Buffer, 2.5 µL of a combination of dATP, dTTP, dGTP, and dCTP, each at 10 mM, and 2.5 units of PfuTurbo® Cx Hot Start DNA Polymerase in a final volume of 50 µL. The reaction was carried out using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 2 minutes; 32 cycles each at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 45 seconds; and a final elongation at 72°C for 3 minutes. Then, 5 µl of 10X NEBuffer 4 and 20 units of Dpn I were added and incubated at 37°C for 1 hour. Dpn I was inactivated at 80 °C for 20 minutes.

[00553] The two fragments were fused in pBGMH14 digested by Pac I/Nt.BbvCI by USERTM-based cloning method in a reaction composed of 10 ng of pBGMH14 digested by Pac I/Nt.BbvCI, 50 ng of each of two PCR products, and 1 unit of USER™ enzyme in a total volume of 10 µL. The reaction was incubated at 37°C for 20 minutes followed by 20 minutes at 25°C. Then, 10 µL were transformed into competent ONE SHOT® TOP10 cells. E. coli transformants were selected on LB+Amp agar plates and plasmid DNA was prepared using QIAPREP® Spin Miniprep Kit. Plasmid pBGMH16 was confirmed by sequencing.

[00554] The DNA sequence was confirmed by Sanger sequencing with an Applied Biosystems Model 3730XL Automated DNA Sequencer using terminator chemistry 3.1 BIG-DYE™ version 3.1. Sequencing primers used for sequence verification of niiA, niaD, the P13amy promoter, AsiSI/Nb.BtsI USER™ cassette, and AMG terminator in BGNH16 are shown below.

[00555] Plasmid pBGMH16 contains flanking regions designed to repair the niiA gene and the niaD gene in Aspergillus oryzae COLs1300. Plasmid pBGMH16 was digested with Asi Si and Nb. Bts I to linearize the plasmid and create single-stranded overhangs such that a PCR product with compatible overhangs can be cloned into this site by USER™ cloning (New England Biolabs, Inc., Ipswich, MA, USA). The digested plasmid was purified using a DNA Purification Kit (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer's instructions.

[00556] The coding sequence of the T. aurantiacus GH61A polypeptide (SEQ ID NO: 13 [genomic DNA sequence] and SEQ ID NO: 14 [deduced amino acid sequence]), the coding sequence of the P. emersonii GH61A polypeptide ( SEQ ID NO: 35 [genomic DNA sequence] and SEQ ID NO: 36 [deduced amino acid sequence]), the A. aculeatus GH61 polypeptide coding sequence (SEQ ID NO: 67 [genomic DNA sequence] and SEQ ID NO: 68 [deduced amino acid sequence]), the coding sequence of the P. pinophilum GH61 polypeptide (SEQ ID NO: 31 [genomic DNA sequence] and SEQ ID NO: 32 [deduced amino acid sequence]), and the sequence coding for the T. terrestris GH6 polypeptide (SEQ ID NO: 45 [genomic DNA sequence; cDNA was used here] and SEQ ID NO: 46 [deduced amino acid sequence]) were amplified from the source plasmids described below using the primers shown in Table 12. Bold letters represent the coding sequence. The only deoxyuridine (U) residue inserted in each primer is the U that is excised from the PCR products using the USERTM enzyme (New England Biolabs, Inc., Ipswich, MA, USA) to obtain overhangs for the insertion site. The underlined letters represent a His tag. The remaining sequences are homologous with pBGMH16 insertion sites for expression of GH61 polypeptides. Table 12

[00557] The construction of the plasmid pDFng153-4 containing the coding sequence for the Thermoascus aurantiacus GH61A polypeptide is described below. The T. aurantiacus GH61A polypeptide coding sequence was amplified from plasmid pDFng113 using the primers shown in Table 12 with overhangs designed for cloning into plasmid pBGMH16. The amplification consisted of 100 ng of each primer listed in Table 12, 30 ng of pDFng113, 1X PfuTurbo® Cx Reaction Buffer, 2.5 µl of a combination of dATP, dTTP, dGTP, and dCTP, each at 10 mM , and 2.5 units of PfuTurbo® Cx Hot Start DNA Polymerase in a final volume of 50 µL. PCR was performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 2 minutes; 30 cycles each at 95°C for 30 seconds, 57.7°C for 30 seconds, and 72°C for 1.5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a soak cycle at 10°C.

[00558] The PCR solution was analyzed by 0.7% agarose gel electrophoresis using TBE buffer where a PCR product band of approximately 894 bp was observed. The PCR solution was then digested with 1 µL of Dpn I and 4.5 µL of NEBuffer 4 at 37°C overnight and purified using a QIAGEN® Purification Kit according to the manufacturer's instructions.

[00559] The homologous ends of the 894 bp PCR product and pBGMH16 digested by Asi SI and Nb.BtsI were joined in a reaction consisting of 10 μL of PCR containing the 894 bp PCR product, 1 μL of digested plasmid pBGMH16 by Asi SI and Nb.BtsI, and 1 µL of USER™ enzyme. The reaction was incubated for 15 minutes at 37°C, followed by 15 minutes at 25°C. Ten μL of the reaction was transformed into E. coli XL10-GOLD® Super Competent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion of the T. aurantiacus GH61A polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry of a BigDye® Terminator v3.1 Cycle Sequencing Kit. The sequencing primers shown below were used for gene and sequence insertion verification. Primer TaGH61seqF: CCCAGTTATCAACTACCTTG (SEQ ID NO: 259) Primer pBGMH16seqF: CTCAATTTACCTCTTATCCAC (SEQ ID NO: 260) Primer pBGMH16seqR: TATAACCAATTGCCCTCATC (SEQ ID NO: 261) A plasmid containing the coding sequence for the T. aurant GH61A polypeptide correct iacus was selected and designated pDFng153-4.

[00560] The construction of the plasmid pDFng154-17 containing the coding sequence for the Penicillium emersonii GH61A polypeptide is described below. The P. emersonii GH61A polypeptide coding sequence was amplified from plasmid pMMar45 using the primers shown in Table 12 with overhangs designed for cloning into plasmid pBGMH16. The amplification consisted of 100 ng of each primer listed in Table 12, 30 ng of pMMar45, 1X PfuTurbo® Cx Reaction Buffer, 2.5 µl of a combination of dATP, dTTP, dGTP, and dCTP, each at 10 mM , and 2.5 units of PfuTurbo® Cx Hot Start DNA Polymerase in a final volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 2 minutes; 30 cycles each at 95°C for 30 seconds, 64.1°C for 30 seconds, and 72°C for 1.5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a soak cycle at 10°C.

[00561] The PCR solution was analyzed by electrophoresis on a 0.7% agarose gel using TBE buffer where a PCR product band of approximately 930 bp was observed. The PCR solution was then digested with 1 µL of Dpn I and 4.5 µL of NEBuffer 4 at 37°C overnight and purified using a QIAGEN® Purification Kit according to the manufacturer's instructions.

[00562] The homologous ends of the 930 bp PCR product and the pBGMH16 digested by Asi SI and Nb.BtsI were joined in a reaction consisting of 10 μL of the PCR solution containing the 930 bp PCR product, 1 μL of pBGMH16 digested by Asi SI and Nb.BtsI, and 1 µL of USERTM enzyme. The reaction was incubated for 15 minutes at 37°C, followed by 15 minutes at 25°C. Ten μL of the reaction was transformed into E. coli XL10-GOLD® Super Competent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion of the P. emersonii GH61A polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry of a BigDye® Terminator v3.1 Cycle Sequencing Kit. The sequencing primers pBGMH16seqF and pBGMH16seqR and the PeGH61seqF primer shown below were used for gene and sequence insertion verification.PeGH61seqF: GCACCGTCGAGCTGCAGTGG (SEQ ID NO: 261)

[00563] A plasmid containing the correct P. emersonii GH61A polypeptide coding sequence was selected and designated pDFng154-17.

[00564] The construction of the plasmid pDFng155-33 containing the coding sequence of the GH61A polypeptide from Aspergillus aculeatus is described below. The A. aculeatus GH61A polypeptide coding sequence was amplified from plasmid Xyz1566 (Example 3 of WO 2012/030799) using the primers shown in Table 12 with overhangs designed for cloning into plasmid pBGMH16. The amplification reaction was composed of 100 ng of each primer listed in Table 12, 30 ng of plasmid Xyz1566, 1X PfuTurbo® Cx Reaction Buffer, 2.5 µl of a combination of dATP, dTTP, dGTP, and dCTP, each to 10 mM, and 2.5 units of PfuTurbo® Cx Hot Start DNA Polymerase in a final volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 2 minutes; 30 cycles each at 95°C for 30 seconds, 63.4°C for 30 seconds, and 72°C for 1.5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a soak cycle at 10°C.

[00565] The PCR product was analyzed by 0.7% agarose gel electrophoresis using TBE buffer where a PCR product band of approximately 1.3 kb was observed. The PCR product solution was then digested with 1 µL of Dpn I and 4.5 µL of NEBuffer 4 at 37°C overnight and purified using a QIAGEN® Purification Kit according to the manufacturer's instructions.

[00566] The homologous ends of the 1.3 kb PCR product and the digested pBGMH16 were joined in a reaction consisting of 10 μL of the PCR containing the 1.3 kb PCR product, 1 μL of the digested pBGMH16, and 1 μL of USERTM enzyme. The reaction was incubated for 15 minutes at 37°C, followed by 15 minutes at 25°C. Ten μL of the reaction was transformed into E. coli XL10-GOLD® Super Competent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion of the A. aculeatus GH61A polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry of a BigDye® Terminator v3.1 Cycle Sequencing Kit. The sequencing primers pBGMH16seqF and pBGMH16seqR and the AaGH61seqF primer shown below were used for gene and sequence insertion verification.AaGH61seqF primer: CCTTGCCAACTGCAATGGTG (SEQ ID NO: 263)

[00567] A plasmid containing the correct A. aculeatus GH61A polypeptide coding sequence was selected and designated pDFng155-33.

[00568] Plasmid pSMai215 was used to provide the DNA template of the Penicillium pinophilum GH61A gene for construction of pDFng156-37. Plasmid pSMai215 was constructed as described below. Two synthetic oligonucleotide primers shown below were designed to PCR amplify the Penicillium pinophilum GH61A polypeptide gene. An IN-FUSION™ PCR Cloning Kit was used to clone the fragment directly into the pMJ09 expression vector (WO 2005/047499). Bold letters represent the coding sequence. The remaining sequence is homologous to the pMJ09 insertion sites. Forward Primer: 5'-GGACTGCGCCACATGCCTTCTACTAAAG-3' (SEQ ID NO: 264) Reverse Primer: 5'-GCCACGGAGCTTAATTAATCAAAGGACAGTAGTG-3' (SEQ ID NO: 265)

[00569] Fifty picomoles of each of the above primers were used in a PCR consisting of 10 ng of pPin7, 1X EXPAND® High Fidelity PCR buffer with MgCl2 (Roche Diagnostics Corporation, Indianapolis, IN, USA), 0.25 mM each of dATP, dTTP, dGTP, and dCTP, and 2.6 units of EXPAND® High Fidelity Enzyme Blend (Roche Diagnostics Corporation, Indianapolis, IN, USA), in a final volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 98°C for 3 minutes; 30 cycles each at 98°C for 30 seconds, 59°C for 30 seconds, and 72°C for 1 minute; and a final elongation at 72°C for 15 minutes. The heat block then went to a soak cycle at 4°C. The reaction products were isolated by electrophoresis on a 1% agarose gel in TAE buffer where a PCR product band of approximately 1.05 kb was observed on the gel. The PCR product solution was purified using a MINELUTE® Gel Extraction Kit.

[00570] Plasmid pMJ09 (WO 2005/047499) was digested with Nco I and Pac I, isolated by 1.0% agarose gel electrophoresis in TAE buffer, excised from the gel, and extracted using a Gel Extraction Kit QIAQUICK® (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer's instructions.

[00571] The 1.05 kb gene fragment and the digested vector were ligated together using an INFUSION™ PCR Cloning Kit (Clontech Laboratories Inc., Mountain View, CA, USA) resulting in pSMai215. The ligation reaction (20 µL) was composed of 1X IN-FUSION™ Buffer, 1X BSA, 1 µL of IN-FUSION™ enzyme (diluted 1:10), 100 ng of pMJ09 digested with Nco I/Pac I, and 42 ng of the purified 1.05 kb PCR product. The reaction was incubated at 37°C for 15 minutes followed by 50°C for 15 minutes. After dilution of the reaction mixture with 50 μL of TE buffer (pH 8), 2.5 μL of the reaction was transformed into Supercompetent XL10 SOLOPACK® Gold E. coli cells. Transformation reactions in E. coli were streaked onto 2XYTamp agar plates. An E. coli transformant containing pSMai215 was detected by restriction digestion and plasmid DNA was prepared using a BIOROBOT® 9600. Insertion of GH61A from Penicillium pinophilum into pSMai215 was confirmed by DNA sequencing.

[00572] The construction of the plasmid pDFng156-37 containing the coding sequence for the Penicillium pinophilum GH61A polypeptide is described below. The P. pinophilum GH61A polypeptide coding sequence was amplified from plasmid pSMai215 using the primers shown in Table 12 with overhangs designed for cloning into plasmid pBGMH16. The amplification reaction was composed of 100 ng of each primer listed in Table 12, 30 ng of plasmid pSMai215, 1X PfuTurbo® Cx Reaction Buffer, 2.5 µl of a combination of dATP, dTTP, dGTP, and dCTP, each to 10 mM, and 2.5 units of PfuTurbo® Cx Hot Start DNA Polymerase in a final volume of 50 µL. PCR was performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 2 minutes; 30 cycles each at 95°C for 30 seconds, 61.2°C for 30 seconds, and 72°C for 1.5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a soak cycle at 10°C.

[00573] The PCR product was analyzed by 0.7% agarose gel electrophoresis using TBE buffer where a PCR product band of approximately 1.1 kb was observed. The PCR product solution was then digested with 1 µL of Dpn I and 4.5 µL of NEB4 Buffer at 37°C overnight and purified using a QIAGEN® Purification Kit.

[00574] The homologous ends of the 1.1 kb PCR product and the digested pBGMH16 were joined in a reaction consisting of 10 μL of the PCR containing the 1.1 kb PCR product, 1 μL of the digested pBGMH16, and 1 μL of USER™ enzyme. The reaction was incubated at 37°C for 15 minutes, followed by 15 minutes at 25°C. Ten μL of the reaction was transformed into E. coli XL10-GOLD® Super Competent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion of the P. pinophilum GH61A polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry of a BigDye® Terminator v3.1 Cycle Sequencing Kit. Sequencing primers pBGMH16seqF and pBGMH16seqR and primer PpGH61seqF shown below were used to verify gene and sequence insertion.Primer PpGH61seqF:CAATGGCAATTGTTCTACCG (SEQ ID NO: 266) A plasmid containing the correct P. pinophilum GH61A polypeptide coding sequence was selected and designated pDFng156-37.

[00575] The construction of the plasmid pDFng157-51 containing the coding sequence of the Thielavia terrestris GH61 polypeptide is described below. The T. terrestris GH61 polypeptide coding sequence was amplified from plasmid pAG68 using the primers shown in Table 12 with overhangs designed for cloning into plasmid pBGMH16. The amplification reaction was composed of 100 ng of each primer listed in Table 12, 30 ng of plasmid pAG68, 1X PfuTurbo® Cx Reaction Buffer, 2.5 µl of a combination of dATP, dTTP, dGTP, and dCTP, each to 10 mM, and 2.5 units of PfuTurbo® Cx Hot Start DNA Polymerase in a final volume of 50 µL. PCR was performed using an EPPENDORF® MASTERCYCLER® 5333 programmed for 1 cycle at 95 °C for 2 minutes; 30 cycles each at 95°C for 30 seconds, 61.2°C for 30 seconds, and 72°C for 1.5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a soak cycle at 10°C.

[00576] The PCR product was analyzed by 0.7% agarose gel electrophoresis using TBE buffer where a PCR product band of approximately 1.2 kb was observed. The PCR product solution was then digested with 1 µL of Dpn I and 4.5 µL of NEB4 buffer at 37°C overnight and purified using a QIAGEN® Purification Kit according to the manufacturer's instructions.

[00577] The homologous ends of the 1.2 kb PCR product and the digested pBGMH16 were joined in a reaction consisting of 10 μL of the PCR containing the 1.1 kb PCR product, 1 μL of the digested pBGMH16, and 1 μL of USERTM enzyme. The reaction was incubated at 37°C for 15 minutes, followed by 15 minutes at 25°C. Ten μL of the reaction was transformed into E. coli XL10-GOLD® Super Competent Cells according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600. Insertion of the T. terrestris GH61A polypeptide coding sequence was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer and dye terminator chemistry of a BigDye® Terminator v3.1 Cycle Sequencing Kit. Sequencing primers pBGMH16seqF and pBGMH16seqR and primer TtGH61seqF shown below were used for gene and sequence insertion verification. Primer TtGH61seqF: CGACGGGCAGCTCGGCGCCCG (SEQ ID NO: 267)

[00578] A plasmid containing the correct T. terrestris GH61 polypeptide coding sequence was selected and designated pDFng157-51.

Example 16: Construction of GH61 polypeptide variants from Thermoascus aurantiacus

[00579] Thermoascus aurantiacus GH61 polypeptide variants were constructed by SOE-PCR (Protrusion Extension Polymerase Chain Reaction Processing) with the plasmid pDFng153-4. Briefly, the first PCR used the forward primer EbZn NiaD Dir and a mutation-specific reverse primer (Table 13). The second PCR used the reverse primer EbZn NiiA Rev and a mutation-specific reverse primer (Table 13) containing the sequence encoding the altered amino acid. The mutation-specific forward and reverse primers contained 15-20 overlapping nucleotides. The third PCR used the overlapping nucleotides to process together the fragments produced in the first and second reactions. Finally, using a nested forward primer BGMH110V2F and a nested reverse primer BGMH109V2R, the processed fragment was amplified by PCR. EbZn NiaD Primer Dir: 5'-GCATTTTATCAGGGTTATTGTCTCATGAGCGG-3' (SEQ ID NO: 268) EbZn NiiA Primer Rev: 5'-GCTGATAAACTCTGGAGCCGGTGAGCG-3' (SEQ ID NO: 269) BGMH110V2F Primer: 5'-CCAGACCAGCAGAGGAGATAATACTCTGCG-3' ( SEQ ID NO: 270) Primer BGMH109V2R: 5'-CAAGGATACCTACAGTTATTCGAAACCTCCTG-3' (SEQ ID NO: 271)

[00580] The first PCRs for T. aurantiacus GH61 polypeptide variants contained 0.2 picomoles of the EbZn NiaD Dir primer, 0.2 picomoles of the reverse primer listed in Table 13, 10 ng of template (pDFng153-4), 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High-Fidelity Buffer, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient (Eppendorf Scientific, Inc., Westbury, NY, USA) programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 25 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00581] The second SOE-PCRs for T. aurantiacus GH61 variants contained 0.2 picomoles of the forward primer listed in Table 13, 0.2 picomoles of the EbZn NiiA Rev primer, 10 ng template (pDFng153-4), 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High-Fidelity Buffer, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 25 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00582] Each PCR product was analyzed by 1.0% agarose gel electrophoresis using TAE buffer where a PCR product band of 4.1 to 5.3 kb was observed (as specified in Table 13) indicating amplification appropriate. The remaining 45 microliters were then blotted with 10 units of Dpn I and 1X NEB4 to remove remaining wild-type template. The reaction was purified for 4 hours at 37 °C and then purified using a MINELUTE® 96 UF Purification Kit (QIAGEN Inc., Valencia, CA, USA). Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000 (Thermo Scientific, Wilmington, DE, USA).

[00583] The third SOE-PCR for T. aurantiacus GH61 variants contained 50 to 100 ng of each fragment produced in the first and second PCRs, 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High Buffer -Fidelity, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 15 seconds, 68°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step. Primer Primer BGMH110V2F (0.2 picomoles) and primer BGMH109V2R (0.2 picomoles) were added during the annealing/extension step of the fifth cycle to allow overlapping nucleotides to be processed before amplification.

[00584] The wild-type fragment was produced using conditions similar to the third PCR. The reaction was composed of 10 ng of template (pDFng153-4), 0.2 picomoles of BGMH110V2F primer, 0.2 picomoles of BGMH109V2R primer, 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High- Fidelity, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 15 seconds, 68°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00585] Each SOE-PCR product was analyzed by electrophoresis on a 1.0% agarose gel using TAE buffer where a PCR product band of approximately 8 kb was observed indicating proper amplification. The remaining 45 µL of each SOE-PCR product was then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000. The entire volume was then transformed into the Aspergillus oryzae strain COLs1300 as described in Example 21.

[00586] Example 17: Construction of GH61 polypeptide variants from Penicillium emersonii

[00587] Penicillium emersonii GH61 polypeptide variants were constructed by SOE-PCR (Protrusion Extension Polymerase Chain Reaction Processing) with plasmid pDFng154-17. Briefly, the first PCR used the forward primer EbZn NiaD Dir and a mutation-specific reverse primer (Table 14). The second PCR used the reverse primer EbZn NiiA Rev and a mutation-specific reverse primer (Table 14) containing the sequence encoding the altered amino acid. The mutation-specific forward and reverse primers contained 15-20 overlapping nucleotides. The third PCR used the overlapping nucleotides to process together the fragments produced in the first and second reactions. Finally, using a nested forward primer BGMH110V2F and a nested reverse primer BGMH109V2R, the processed fragment was amplified by PCR.

[00588] The first PCRs for variants of the P. emersonii GH61 polypeptide contained 0.2 picomoles of the EbZn NiaD Dir primer, 0.2 picomoles of the reverse primer listed in Table 14, 10 ng of template (pDFng154-17), 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High-Fidelity Buffer, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 25 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00589] The second PCRs for P. emersonii GH61 variants contained 0.2 picomoles of the forward primer listed in Table 14, 0.2 picomoles of the EbZn NiiA Rev primer, 10 ng template (pDFng154-17), 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High-Fidelity Buffer, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 25 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00590] Each PCR product was analyzed by electrophoresis on a 1.0% agarose gel using TAE buffer where a PCR product band of 4.2 to 5.2 kb was observed (as specified in Table 14) indicating amplification appropriate. The remaining 45 microliters were then blotted with 10 units of Dpn I and 1X NEB4 to remove remaining wild-type template. The reaction was purified for 4 hours at 37 °C and then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000.

[00591] The third SOE-PCR for P. emersonii GH61 variants contained 50 to 100 ng of each fragment produced in the first and second PCRs, 4 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X ADVANTAGE® GC Buffer -Melt (Clontech Laboratories, Inc., Mountain View, CA, USA), and 2.5 units of ADVANTAGE® GC Genomic LA Polymerase (Clontech Laboratories, Inc., Mountain View, CA, USA) in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 94°C for 1 minute; 35 cycles each at 94°C for 30 seconds, 66°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step. Primer Primer BGMH110V2F (0.4 picomoles) and primer BGMH109V2R (0.4 picomoles) were added during the annealing/elongation step of the fifth cycle to allow overlapping nucleotides to be processed before amplification.

[00592] The wild-type fragment was produced using conditions similar to the third PCR. The reaction was composed of 10 ng of template (pDFng154-17), 0.4 picomoles of BGMH110V2F primer, 0.4 picomoles of BGMH109V2R primer, 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X ADVANTAGE® GC- Melt, and 2.5 units of ADVANTAGE® GC Genomic LA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 94°C for 1 minute; 35 cycles each at 94°C for 30 seconds, 66°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00593] Each SOE-PCR product was analyzed by electrophoresis on a 1.0% agarose gel using TAE buffer where a PCR product band of approximately 8 kb was observed indicating proper amplification. The remaining 45 µL of each SOE-PCR product was then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000. The entire volume was then transformed into the Aspergillus oryzae strain COLs1300 as described in Example 21.Table 14

Example 18: Construction of GH61 polypeptide variants from Aspergillus aculeatus

[00594] Aspergillus aculeatus GH61 polypeptide variants were constructed by SOE-PCR (Protrusion Extension Polymerase Chain Reaction Processing) with the plasmid pDFng155-33. Briefly, the first PCR used the forward primer EbZn NiaD Dir and a mutation-specific reverse primer (Table 15). The second PCR used the reverse primer EbZn NiiA Rev and a mutation-specific reverse primer (Table 15) containing the sequence encoding the altered amino acid. The mutation-specific forward and reverse primers contained 15-20 overlapping nucleotides. The third PCR used the overlapping nucleotides to process together the fragments produced in the first and second reactions. Finally, using a nested forward primer BGMH110V2F and a nested reverse primer BGMH109V2R, the processed fragment was amplified by PCR.

[00595] The first PCRs for GH61 polypeptide variants from A. aculeatus contained 0.2 picomoles of the EbZn NiaD Dir primer, 0.2 picomoles of the reverse primer listed in Table 15, 10 ng of template (pDFng155-33), 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High-Fidelity Buffer, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 25 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00596] The second PCRs for A. aculeatus GH61 variants contained 0.2 picomoles of the forward primer listed in Table 15, 0.2 picomoles of the EbZn NiiA Rev primer, 10 ng template (pDFng155-33), 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High-Fidelity Buffer, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 25 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00597] Each PCR product was analyzed by electrophoresis on a 1.0% agarose gel using TAE buffer where a PCR product band of 4.6 to 5.1 kb was observed (as specified in Table 15) indicating amplification appropriate. The remaining 45 microliters were then blotted with 10 units of Dpn I and 1X NEB4 to remove remaining wild-type template. The reaction was purified for 4 hours at 37 °C and then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000.

[00598] The third SOE-PCR for the GH61 variants of A. aculeatus contained 50 to 100 ng of each fragment produced in the first and second PCRs, 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High Buffer -Fidelity, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 15 seconds, 68°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step. Primer Primer BGMH110V2F (0.2 picomoles) and primer BGMH109V2R (0.2 picomoles) were added during the annealing/extension step of the fifth cycle to allow overlapping nucleotides to be processed before amplification.

[00599] The wild-type fragment was produced using conditions similar to the third PCR. The reaction was composed of 10 ng of template (pDFng155-33), 0.2 picomoles of BGMH110V2F primer, 0.2 picomoles of BGMH109V2R primer, 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High- Fidelity, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 15 seconds, 68°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00600] Each SOE-PCR product was analyzed by 1.0% agarose gel electrophoresis using TAE buffer where a PCR product band of approximately 8 kb was observed indicating proper amplification. The remaining 45 µL of each SOE-PCR product was then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000. The entire volume was then transformed into the Aspergillus oryzae strain COLs1300 as described in Example 21. Table 15

Example 19: Construction of GH61 polypeptide variants from Penicillium pinophilum

[00601] GH61 polypeptide variants from Penicillium pinophilum were constructed by SOE-PCR (Protrusion Extension Polymerase Chain Reaction Processing) with plasmid pDFng156-37. Briefly, the first PCR used the forward primer EbZn NiaD Dir and a mutation-specific reverse primer (Table 16). The second PCR used the reverse primer EbZn NiiA Rev and a mutation-specific reverse primer (Table 16) containing the sequence encoding the altered amino acid. The mutation-specific forward and reverse primers contained 15-20 overlapping nucleotides. The third PCR used the overlapping nucleotides to process together the fragments produced in the first and second reactions. Finally, using a nested forward primer BGMH110V2F and a nested reverse primer BGMH109V2R, the processed fragment was amplified by PCR.

[00602] The first PCRs for variants of the P. pinophilum GH61 polypeptide contained 0.2 picomoles of the EbZn NiaD Dir primer, 0.2 picomoles of the reverse primer listed in Table 16, 10 ng of template (pDFng156-37), 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High-Fidelity Buffer, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 25 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00603] The second PCRs for P. pinophilum GH61 variants contained 0.2 picomoles of the forward primer listed in Table 16, 0.2 picomoles of the EbZn NiiA Rev primer, 10 ng template (pDFng156-37), 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High-Fidelity Buffer, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 25 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00604] Each PCR product was analyzed by electrophoresis on a 1.0% agarose gel using TAE buffer where a PCR product band of 4.1 to 5.5 kb was observed (as specified in Table 16) indicating amplification appropriate. The remaining 45 microliters were then blotted with 10 units of Dpn I and 1X NEB4 to remove remaining wild-type template. The reaction was purified for 4 hours at 37 °C and then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000.

[00605] The third SOE-PCR for the GH61 variants of P. pinophilum contained 50 to 100 ng of each fragment produced in the first and second PCRs, 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High Buffer -Fidelity, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 15 seconds, 68°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step. Primer Primer BGMH110V2F (0.2 picomoles) and primer BGMH109V2R (0.2 picomoles) were added during the annealing/extension step of the fifth cycle to allow overlapping nucleotides to be processed before amplification.

[00606] The wild-type fragment was produced using conditions similar to the third PCR. The reaction was composed of 10 ng of template (pDFng156-37), 0.2 picomoles of BGMH110V2F primer, 0.2 picomoles of BGMH109V2R primer, 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X PHUSION® High- Fidelity, and 0.7 units of PHUSION® High-Fidelity DNA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 98°C for 2 minutes; 35 cycles each at 98°C for 15 seconds, 68°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00607] Each SOE-PCR product was analyzed by 1.0% agarose gel electrophoresis using TAE buffer where a PCR product band of approximately 8 kb was observed indicating proper amplification. The remaining 45 µL of each SOE-PCR product was then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000. The entire volume was then transformed into the Aspergillus oryzae strain COLs1300 as described in Example 21. Table 16

[00608] Example 20: Construction of GH61 polypeptide variants from Thielavia terrestris

[00609] GH61 polypeptide variants from Thielavia terrestris were constructed by SOE-PCR (Protrusion Extension Polymerase Chain Reaction Processing) with plasmid pDFng157-51. Briefly, the first PCR used the forward primer EbZn NiaD Dir and a mutation-specific reverse primer (Table 17). The second PCR used the reverse primer EbZn NiiA Rev and a mutation-specific reverse primer (Table 17) containing the sequence encoding the altered amino acid. The mutation-specific forward and reverse primers contained 15-20 overlapping nucleotides. The third PCR used the overlapping nucleotides to process together the fragments produced in the first and second reactions. Finally, using a nested forward primer BGMH110V2F and a nested reverse primer BGMH109V2R, the processed fragment was amplified by PCR.

[00610] The first PCRs for T. terrestris variants of the GH61 polypeptide contained 0.2 picomoles of the EbZn NiaD Dir primer, 0.4 picomoles of the reverse primer listed in Table 17, 10 ng of template (pDFng157-51), 4 nanomoles each of dATP, dTTP, dGTP, and dCTP, 1X ADVANTAGE® GC-Melt Buffer, and 2.5 units of ADVANTAGE® GC Genomic LA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 94°C for 1 minute; 35 cycles each at 94°C for 30 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00611] The second PCRs for the T. terrestris GH61 variants contained 0.2 picomoles of the forward primer listed in Table 17, 4 picomoles of the EbZn NiiA Rev primer, 10 ng of template (pDFng157-51), 4 nanomoles each of dATP, dTTP, dGTP, and dCTP, 1X Advantage® GC-Melt Buffer, and 2.5 units of Advantage® GC Genomic LA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 94°C for 1 minute; 35 cycles each at 94°C for 30 seconds, 66°C for 30 seconds, and 72°C for 5 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00612] Each PCR product was analyzed by electrophoresis on a 1.0% agarose gel using TAE buffer where a PCR product band of 4.1 to 5.6 kb was observed (as specified in Table 17) indicating amplification appropriate. The remaining 45 microliters were then blotted with 10 units of Dpn I and 1X NEB4 to remove remaining wild-type template. The reaction was purified for 4 hours at 37 °C and then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000.

[00613] The third SOE-PCR for T. terrestris GH61 variants contained 50 to 100 ng of each fragment produced in the first and second PCRs, 4 nanomoles each of dATP, dTTP, dGTP, and dCTP, 1X Advantage® GC Buffer -Melt, and 2.5 units of Advantage® GC Genomic LA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 94°C for 1 minute; 35 cycles each at 94°C for 30 seconds, 66°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step. Primer Primer BGMH110V2F (0.4 picomoles) and primer BGMH109V2R (0.4 picomoles) were added during the annealing/elongation step of the fifth cycle to allow overlapping nucleotides to be processed before amplification.

[00614] The wild-type fragment was produced using conditions similar to the third PCR. The reaction was composed of 10 ng of template (pDFng157-51), 0.4 picomoles of BGMH110V2F primer, 0.4 picomoles of BGMH109V2R primer, 1 nanomole each of dATP, dTTP, dGTP, and dCTP, 1X Advantage® GC- Melt, and 2.5 units of Advantage® GC Genomic LA Polymerase in a final reaction volume of 50 µL. Amplification was performed using an EPPENDORF® MASTERCYCLER® Gradient programmed for 1 cycle at 94°C for 1 minute; 35 cycles each at 94°C for 30 seconds, 66°C for 30 seconds, and 72°C for 10 minutes; and a final elongation at 72°C for 10 minutes. The heat block then went to a 10°C hold step.

[00615] Each SOE-PCR product solution was analyzed by 1.0% agarose gel electrophoresis using TAE buffer where an approximately 8 kb PCR product band was observed indicating proper amplification. The remaining 45 µL of each SOE-PCR product was then purified using a MINELUTE® 96 UF Purification Kit. Purified PCR products were resuspended in deionized water to a final volume of 20 µL. The concentration of each fragment was measured using a NanoDrop 2000. The entire volume was then transformed into the Aspergillus oryzae strain COLs1300 as described in Example 21.Table 17

Example 21: Expression of polypeptide variants GH61A from T. aurantiacus, GH61A from P. emersonii, GH61 from A. aculeatus, GH61 from Penicillium pinophilum and GH61 from Thielavia terrestris in Aspergillus oryzae COLs1300

[00616] Aspergillus oryzae COLs1300 was inoculated onto a COVE-N-Gly plate containing 10 mM urea and incubated at 34 °C until confluence. Spores were collected from the plate by washing with 10 ml of YP medium. The entire spore suspension was used to inoculate 100 ml of COL1300 protoplast culture medium into a 500 ml polycarbonate shake flask. The shake flask was incubated at 30°C with shaking at 200 rpm for 16-20 hours. The mycelia were filtered through a funnel lined with MIRACLOTH® and washed with 200 mL of 0.6 M MgSO4. The washed mycelia were resuspended in 20 mL of COLs1300 protoplast solution in a sterile 125 mL polycarbonate shake flask and incubated at room temperature for 3 minutes. One ml of a solution of 12 mg BSA per ml deionized water was added to the shake flask and the shake flask was then incubated at 37°C with mixing at 65 rpm for 100-150 minutes until protoplast formation was complete . The mycelia/protoplast mixture was filtered through a funnel lined with MIRACLOTH® into a 50 mL conical tube and overlaid with 5 mL of ST solution. The 50 mL conical tube was centrifuged at 1050 x g for 15 minutes with low acceleration/deceleration. After centrifugation, the liquid was separated into 3 phases. The interphase containing the protoplasts was transferred to a new 50 ml conical tube. Two volumes of STC solution were added to the protoplasts followed by centrifugation at 1050 x g for 5 minutes. The supernatant was discarded and the protoplasts were washed twice with 5 mL of STC solution with resuspension of the protoplast pellet, centrifugation at 1050 x g for 5 minutes, and decanting the supernatant each time. After the final decantation, the protoplast pellet was resuspended in STC solution at a concentration of 5 x 107/mL. Protoplasts were frozen at -80°C until transformation.

[00617] A 15 μL volume of each mutant fragment, as described in Examples 16-20, was used to transform 100 μL of A. oryzae COLs1300 protoplasts in a 15 mL round bottom tube. After an initial incubation at room temperature for 15 minutes, 300 µL of PEG solution was added to the 15 mL round bottom tube containing the transformation mixture. The reaction was incubated for an additional 15 minutes at room temperature. Six mL of molten top agar was added to the reaction and the entire mixture was evenly poured onto a sucrose agar plate supplemented with 10 mM NaNO 3 and left at room temperature until the top agar had settled. Plates were incubated at 37°C for 4-6 days. Resulting transformants were collected using sterile inoculation loops and transferred to plates containing COVE-B-gly medium and incubated at 34°C for approximately 4 days (until sporulation). Spores were inoculated into a deep 48-well plate containing 0.5 ml of MDU2BP medium incubated at 34°C for 3 days, stationary in a humidified box. Samples were collected on the third day by removing the mycelia mat.

[00618] Example 22: Determination of the Tm (melting temperature) of the variants of GH61A from T. aurantiacus, GH61A from P. emersonii, GH61 from A. aculeatus, GH61 from Penicillium pinophilum and GH61 from Thielavia terrestris by analyzing the thermal unfolding of the proteins

[00619] The thermal unfolding of proteins of variants of GH61A from Thermoascus aurantiacus, GH61A from Penicillium emersonii, GH61 from Aspergillus aculeatus, GH61 from Penicillium pinophilum, GH61 from Thielavia terrestris was determined by analyzing the thermal unfolding of proteins according to Example 10 The broths of the variants, and their wild-type polypeptides, were prepared as described in Example 21. The average reading of triplicate broths of one to five transformants for each variant was determined, and the increase in Tm for each variant is shown in the Table 18. Table 18. Increased melting temperatures (°C) of polypeptide variants GH61A from T. aurantiacus, GH61A from P. emersonii, GH61 from A. aculeatus, GH61 from P. pinophilum, and GH61 from T. terrestris as determined by thermal unfolding analysis of proteins

[00620] The present invention is further described by the following numbered paragraphs: [1] A variant of the GH61 polypeptide, comprising a substitution at one or more positions corresponding to positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250 of the mature polypeptide of SEQ ID NO: 30, wherein the variant has cellulolytic enhancing activity and wherein the variant has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least at least 97%, at least 98%, at least 99%, or at least 99%, but less than 100% sequence identity with the amino acid sequence of a parent GH61 polypeptide.

[00621] [2] The variant of paragraph 1, wherein the parent GH61 polypeptide is selected from the group consisting of: (a) a polypeptide having at least 60% sequence identity with the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 1 52, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411; (b) a polypeptide encoded by a polynucleotide that hybridizes under conditions of at least low stringency to (i) the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 , 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67 , 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117 ,119,121,123,125,127,129,131,133,135,137,139,141,143,145,147,149,151,153,155,157,159,161,163,165, 167 , 408, or 410, or (ii) the full length complement of (i); (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity with the coding sequence of the mature polypeptide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121 123 125 127 129 131 133 135 137 139 141 143 145 147 149 151 153 155 157 159 161 163 165 167 4 08, or 410; and (d) a fragment of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411, which has enhancing cellulolytic activity.

[00622] [3] The variant of paragraph 2, wherein the parent GH61 polypeptide has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 , 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64 , 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114 ,116,118,120,122,124,126,128,130,132,134,136,138,140,142,144,146,148,150,152,154,56,158,160,162, 164 , 166, 168, 409, or 411.

[00623] [4] The variant of paragraph 2, wherein the parent GH61 polypeptide is encoded by a polynucleotide that hybridizes under conditions of low stringency, conditions of medium stringency, conditions of medium-high stringency, conditions of high stringency, or conditions of very high stringency with (i) the coding sequence of the mature polypeptide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81 ,83,85,87,89,91,93,95,97,99,101,103,105,107,109,111,113,115,117,119,121,123,125,127,129,131 , 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 408, or 410; or (ii) the full length complement of (i).

[00624] [5] The variant of paragraph 2, wherein the parent GH61 polypeptide is encoded by a polynucleotide having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with the coding sequence of the mature polypeptide of SEQ ID NO: 1, 3, 5 , 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55 , 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105 ,107,109,111,113,115,117,119,121,123,125,127,129,131,133,135,137,139,141,143,145,147,149,151,153, 155 , 157, 159, 161, 163, 165, 167, 408, or 410.

[00625] [6] The variant of paragraph 2, wherein the parent GH61 polypeptide comprises or consists of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409 , or 411 .

[00626] [7] The variant of paragraph 2, wherein the parent GH61 polypeptide is a fragment of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 , 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72 , 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122 , 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 409, or 411, in which the fragment has enhancing cellulolytic activity.

[00627] [8] The variant of any one of paragraphs 1-7, which has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least at least 96%, at least 97%, at least 98%, at least 99%, or at least 99%, but less than 100% sequence identity with the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108,110,112,114,116,118,120,122,124,126,128,130,132,134,136,138,140,142,144,146,148,150,152,154,5 6, 158, 160, 162, 164, 166, 168, 409, or 411.

[00628] [9] The variant of any one of paragraphs 2-8, wherein the fragment of the variant consists of at least 85% of amino acid residues, e.g. at least 90% of amino acid residues or at least 95% of the mature polypeptide amino acid residues from the parent GH61 polypeptide.

[00629] [10] The variant of any one of paragraphs 1-9, wherein the number of substitutions in the variants of the present invention is 1-29, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, and 28 replacements.

[00630] [11] The variant of any one of paragraphs 1-10, which comprises a substitution in a position corresponding to position 26.

[00631] [12] The variant of paragraph 11, where the replacement is Ile.

[00632] [13] The variant of any one of paragraphs 1-12, which comprises a substitution in a position corresponding to position 32.

[00633] [14] The variant of paragraph 13, where the replacement is Glu or Ser.

[00634] [15] The variant of any one of paragraphs 1-14, which comprises a substitution in a position corresponding to position 34.

[00635] [16] The variant of paragraph 15, where the replacement is Phe.

[00636] [17] The variant of any one of paragraphs 1-16, which comprises a substitution in a position corresponding to position 40.

[00637] [18] The variant of paragraph 17, where the replacement is Ala.

[00638] [19] The variant of any one of paragraphs 1-18, which comprises a substitution in a position corresponding to position 41.

[00639] [20] The variant of paragraph 19, where the replacement is Thr.

[00640] [21] The variant of any one of paragraphs 1-20, which comprises a substitution in a position corresponding to position 42.

[00641] [22] The variant of paragraph 21, where the replacement is Ile, Glu, or Val.

[00642] [23] The variant of any one of paragraphs 1-22, which comprises a substitution in a position corresponding to position 47.

[00643] [24] The variant of paragraph 23 where the replacement is Glu, Leu, or Arg.

[00644] [25] The variant of any one of paragraphs 1-24, which comprises a substitution in a position corresponding to position 56.

[00645] [26] The variant of paragraph 25, where the substitution is Cys,Glu, or Thr.

[00646] [27] The variant of any one of paragraphs 1-26, which comprises a substitution in a position corresponding to position 72.

[00647] [28] The variant of paragraph 27, where the replacement is Gln or Thr.

[00648] [29] The variant of any one of paragraphs 1-28, which comprises a substitution in a position corresponding to position 102.

[00649] [30] The variant of paragraph 29, where the replacement is Lys or Pro.

[00650] [31] The variant of any one of paragraphs 1-30, which comprises a substitution in a position corresponding to position 123.

[00651] [32] The variant of paragraph 31, where the replacement is Arg.

[00652] [33] The variant of any one of paragraphs 1-32, which comprises a substitution in a position corresponding to position 138.

[00653] [34] The variant of paragraph 33, where the replacement is Cys, Glu, Gly, Lys, Leu, or Met.

[00654] [35] The variant of any one of paragraphs 1-34, which comprises a substitution in a position corresponding to position 149.

[00655] [36] The variant of paragraph 35, where the replacement is Ile.

[00656] [37] The variant of any one of paragraphs 1-36, which comprises a substitution in a position corresponding to position 152.

[00657] [38] The variant of paragraph 37, where the replacement is Ser.

[00658] [39] The variant of any one of paragraphs 1-38, which comprises a substitution in a position corresponding to position 163.

[00659] [40] The variant of paragraph 39, where the replacement is Glu,Phe, or Val.

[00660] [41] The variant of any one of paragraphs 1-40, which comprises a substitution in a position corresponding to position 164.

[00661] [42] The variant of paragraph 41, where the replacement is Cys or Leu.

[00662] [43] The variant of any one of paragraphs 1-42, which comprises a substitution in a position corresponding to position 166.

[00663] [44] The variant of paragraph 43, where the replacement is Leu.

[00664] [45] The variant of any one of paragraphs 1-44, which comprises a substitution in a position corresponding to position 169.

[00665] [46] The variant of paragraph 45, where the replacement is Arg or Cys.

[00666] [47] The variant of any one of paragraphs 1-46, which comprises a substitution in a position corresponding to position 173.

[00667] [48] The variant of paragraph 47, where the replacement is Cys.

[00668] [49] The variant of any one of paragraphs 1-48, which comprises a substitution in a position corresponding to position 186.

[00669] [50] The variant of paragraph 49, where the substitution is Phe, Lys, Thr, or Tyr.

[00670] [51] The variant of any one of paragraphs 1-50, which comprises a substitution in a position corresponding to position 200.

[00671] [52] The variant of paragraph 51, where the replacement is Ile or Val.

[00672] [53] The variant of any one of paragraphs 1-52, which comprises a substitution in a position corresponding to position 207.

[00673] [54] The variant of paragraph 53, where the replacement is Pro.

[00674] [55] The variant of any one of paragraphs 1-54, which comprises a substitution in a position corresponding to position 213.

[00675] [56] The variant of paragraph 55, where the replacement is Glu.

[00676] [57] The variant of any one of paragraphs 1-56, which comprises a substitution in a position corresponding to position 219.

[00677] [58] The variant of paragraph 57, where the replacement is Glu, Met, Gln, or Cys.

[00678] [59] The variant of any one of paragraphs 1-58, which comprises a substitution in a position corresponding to position 222.

[00679] [60] The variant of paragraph 59, where the replacement is Arg.

[00680] [61] The variant of any one of paragraphs 1-60, which comprises a substitution in a position corresponding to position 234.

[00681] [62] The variant of paragraph 61, where the replacement is Gly or Lys.

[00682] [63] The variant of any one of paragraphs 1-62, which comprises a substitution in a position corresponding to position 246.

[00683] [64] The variant of paragraph 63, where the replacement is Pro.

[00684] [65] The variant of any one of paragraphs 1-64, which comprises a substitution in a position corresponding to position 249.

[00685] [66] The variant of paragraph 65, where the replacement is Gln, Arg, or Cys. [67] The variant of any one of paragraphs 1-66, which comprises a substitution in a position corresponding to position 250.

[00686] [68] The variant of paragraph 67, where the replacement is Cys.

[00687] [69] The variant of any one of paragraphs 1-68, which comprises a substitution in two positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00688] [70] The variant of any one of paragraphs 1-68, which comprises a substitution in three positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00689] [71] The variant of any one of paragraphs 1-68, which comprises a four-position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00690] [72] The variant of any one of paragraphs 1-68, which comprises a substitution in five positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00691] [73] The variant of any one of paragraphs 1-68, which comprises a substitution in six positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00692] [74] The variant of any one of paragraphs 1-68, which comprises a substitution in seven positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00693] [75] The variant of any one of paragraphs 1-68, which comprises an eight-position substitution corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00694] [76] The variant of any one of paragraphs 1-68, which comprises a substitution in nine positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00695] [77] The variant of any one of paragraphs 1-68, which comprises a substitution in ten positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00696] [78] The variant of any one of paragraphs 1-68, which comprises a substitution in eleven positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00697] [79] The variant of any one of paragraphs 1-68, which comprises a substitution in twelve positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00698] [80] The variant of any one of paragraphs 1-68, which comprises a substitution in thirteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00699] [81] The variant of any one of paragraphs 1-68, which comprises a substitution in fourteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00700] [82] The variant of any one of paragraphs 1-68, which comprises a substitution in fifteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00701] [83] The variant of any one of paragraphs 1-68, which comprises a substitution in sixteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00702] [84] The variant of any one of paragraphs 1-68, which comprises a substitution in seventeen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00703] [85] The variant of any one of paragraphs 1-68, which comprises a substitution in eighteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00704] [86] The variant of any one of paragraphs 1-68, which comprises a substitution in nineteen positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00705] [87] The variant of any one of paragraphs 1-68, which comprises a substitution in twenty positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00706] [88] The variant of any one of paragraphs 1-68, which comprises a substitution in twenty-one positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00707] [89] The variant of any one of paragraphs 1-68, which comprises a substitution in twenty-two positions corresponding to any of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00708] [90] The variant of any one of paragraphs 1-68, which comprises a substitution in twenty-three positions corresponding to any of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00709] [91] The variant of any one of paragraphs 1-68, which comprises a substitution in twenty-four positions corresponding to any of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00710] [92] The variant of any one of paragraphs 1-68, which comprises a substitution in twenty-five positions corresponding to any one of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00711] [93] The variant of any one of paragraphs 1-68, which comprises a substitution in twenty-six positions corresponding to any of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00712] [94] The variant of any one of paragraphs 1-68, which comprises a substitution in twenty-seven positions corresponding to any of positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00713] [95] The variant of any one of paragraphs 1-68, which comprises a substitution in each position corresponding to positions 26, 32, 34, 40, 41, 42, 47, 56, 72, 102, 123, 138 , 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250.

[00714] [96] The variant of any one of paragraphs 1-95, which comprises one or more substitutions selected from the group consisting of S26I; G32E,S; Y34F; V40A; N41T; Q42I,E,V; S47E,L,R; S56C,E,T; S72Q,T; T102K,P; A123R; Q138C,E,G,K,L,M; V149I; D152S; T163E,F,V; V164C,L; I166L; S169R,C; S186F,K,T,Y; F200I,V; G207P; S213E; S219E,M,Q,C; K222R; S234G,K; A246P; N249Q,R,C, and A250C.

[00715] [97] The variant of any one of paragraphs 1-96, which comprises the substitutions S173C + F253C of the mature polypeptide of SEQ ID NO: 36.

[00716] [98] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + Q138K + K229W of the mature polypeptide of SEQ ID NO: 30.

[00717] [99] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + S47E + K229W of the mature polypeptide of SEQ ID NO: 30.

[00718] [100] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + S56A + K229W of the mature polypeptide of SEQ ID NO: 30.

[00719] [101] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + T102K + K229W of the mature polypeptide of SEQ ID NO: 30.

[00720] [102] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + S186T + K229W of the mature polypeptide of SEQ ID NO: 30.

[00721] [103] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + K229W + S234G of the mature polypeptide of SEQ ID NO: 30.

[00722] [104] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + T102K + E105K + K229W of the mature polypeptide of SEQ ID NO: 30.

[00723] [105] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + Q138K + G188F + K229W of the mature polypeptide of SEQ ID NO: 30.

[00724] [106] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + Q138K + V149I + G188F + K229W of the mature polypeptide of SEQ ID NO: 30.

[00725] [107] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + S169C + G188F + K229W + A250C of the mature polypeptide of SEQ ID NO: 30.

[00726] [108] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + S72T + Q138K + V149I + G188F + K229W of the mature polypeptide of SEQ ID NO: 30.

[00727] [109] The variant of any one of paragraphs 1-96, comprising the substitutions L111V + D152S + M155L + A162W + Q138K + V149I + G188F + G207P + K229W of the mature polypeptide of SEQ ID NO: 30

[00728] [110] The variant of any one of paragraphs 1-109, which further comprises a substitution at positions corresponding to positions 111, 152, 155, and 162 of the mature polypeptide of SEQ ID NO: 30, wherein the variant has enhancing cellulolytic activity.

[00729] [111] The variant of paragraph 110, where the number of additional substitutions is 1-4, eg, such as 1, 2, 3, or 4 substitutions.

[00730] [112] The variant of paragraph 110 or 111, which comprises a substitution in a position corresponding to position 111.

[00731] [113] The variant of paragraph 112, where the replacement is Val.

[00732] [114] The variant of any one of paragraphs 110-113, which comprises a substitution in a position corresponding to position 152.

[00733] [115] The variant of paragraph 114, where the replacement is Ser.

[00734] [116] The variant of any one of paragraphs 110-115, which comprises a substitution in a position corresponding to position 155.

[00735] [117] The variant of paragraph 116, where the replacement is Leu.

[00736] [118] The variant of any one of paragraphs 110-117, which comprises a substitution in a position corresponding to position 162.

[00737] [119] The variant of paragraph 118, where the replacement is Trp.

[00738] [120] The variant of any one of paragraphs 110-119, which comprises a two-position substitution corresponding to any one of positions 111, 152, 155, and 162.

[00739] [121] The variant of any one of paragraphs 110-119, which comprises a three-position substitution corresponding to any one of positions 111, 152, 155, and 162.

[00740] [122] The variant of any one of paragraphs 110-119, which comprises a substitution in each position corresponding to positions 111, 152, 155, and 162.

[00741] [123] The variant of any one of paragraphs 110-119, which comprises one or more substitutions selected from the group consisting of L111V, D152S, M155L, and A162W.

[00742] [124] The variant of any one of paragraphs 1-123, which further comprises a substitution at positions corresponding to positions 96, 98, 200, 202, and 204 of the mature polypeptide of SEQ ID NO: 30, wherein the variant has enhancing cellulolytic activity.

[00743] [125] The variant of paragraph 124, where the number of additional substitutions is 1-5, eg, such as 1, 2, 3, 4, or 5 substitutions.

[00744] [126] The variant of paragraph 124 or 125, which comprises a substitution in a position corresponding to position 96.

[00745] [127] The variant of paragraph 126, where the replacement is Val.

[00746] [128] The variant of any one of paragraphs 124-127, which comprises a substitution in a position corresponding to position 98.

[00747] [129] The variant of paragraph 128 where the replacement is Leu.

[00748] [130] The variant of any one of paragraphs 124-129, which comprises a substitution in a position corresponding to position 200.

[00749] [131] The variant of paragraph 130, where the replacement is Ile.

[00750] [132] The variant of any one of paragraphs 124-131, which comprises a substitution in a position corresponding to position 202.

[00751] [133] The variant of paragraph 132, where the replacement is Leu.

[00752] [134] The variant of any one of paragraphs 124-133, which comprises a substitution in a position corresponding to position 204.

[00753] [135] The variant of paragraph 134, where the replacement is Val.

[00754] [136] The variant of any one of paragraphs 124-135, which comprises a two-position substitution corresponding to any of positions 96, 98, 200, 202, and 204.

[00755] [137] A variant of any one of paragraphs 124-135, comprising a three-position substitution corresponding to any one of positions 96, 98, 200, 202, and 204.

[00756] [138] The variant of any one of paragraphs 124-135, which comprises a four-position substitution corresponding to any one of positions 96, 98, 200, 202, and 204.

[00757] [139] The variant of any one of paragraphs 124-135, which comprises a substitution in each position corresponding to positions 96, 98, 200, 202, and 204.

[00758] [140] The variant of any one of paragraphs 124-135, which comprises one or more substitutions selected from the group consisting of I96V, F98L, F200I, I202L, and I204V.

[00759] [141] The variant of any one of paragraphs 1-140, which further comprises a substitution at positions corresponding to positions 105, 154, 188, 189, 216, and 229 of the mature polypeptide of SEQ ID NO: 30, in that the variant has enhancing cellulolytic activity.

[00760] [142] The variant of paragraph 141, where the number of additional substitutions is 1-6, eg, such as 1, 2, 3, 4, 5, or 6 substitutions.

[00761] [143] The variant of paragraph 141 or 142, which comprises a substitution in a position corresponding to position 105.

[00762] [144] The variant of paragraph 143, where the replacement is Pro or Lys.

[00763] [145] The variant of any one of paragraphs 141-144, which comprises a substitution in a position corresponding to position 154.

[00764] [146] The variant of paragraph 145, where the replacement is Leu.

[00765] [147] The variant of any one of paragraphs 141-146, which comprises a substitution in a position corresponding to position 188.

[00766] [148] The variant of paragraph 147, where the replacement is Ala or Trp.

[00767] [149] The variant of any one of paragraphs 141-148, which comprises a substitution in a position corresponding to position 189.

[00768] [150] The variant of paragraph 149, where the replacement is Lys.

[00769] [151] The variant of any one of paragraphs 141-150, which comprises a substitution in a position corresponding to position 216.

[00770] [152] The variant of paragraph 151, where the replacement is Leu or Tyr.

[00771] [153] The variant of any one of paragraphs 141-152, which comprises a substitution in a position corresponding to position 229.

[00772] [154] The variant of paragraph 153, where the substitution is Trp, His, Ile, or Tyr.

[00773] [155] The variant of any one of paragraphs 141-154, which comprises one or more substitutions selected from the group consisting of E105P,K; E154I, L; G188F, M, A, W; N189H, K; A216L,Y; and A229W,H,I,Y.

[00774] [156] The variant of any one of paragraphs 1-155, which has an increased thermostability of at least 1.01 times, e.g., at least 1.05 times, at least 1.1 times, at at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.8 times, at least 2 times, at least 5 times, at least 10 times, at least at least 15 times, at least 20 times, at least 25 times, at least 30 times, at least 50 times, at least 75 times, or at least 100 times compared to the parent.

[00775] [157] An isolated polynucleotide encoding the variant of any one of paragraphs 1-156.

[00776] [158] A nucleic acid construct comprising the polynucleotide of paragraph 157.

[00777] [159] An expression vector comprising the polynucleotide of paragraph 157.

[00778] [160] A recombinant host cell comprising the polynucleotide of paragraph 157.

[00779] [161] A method of producing a variant of the GH61 polypeptide, comprising: culturing the host cell of paragraph 160 under conditions suitable for expression of the variant.

[00780] [162] The method of paragraph 161, further comprising variant recovery.

[00781] [163] A transgenic plant, plant part or plant cell transformed with the polynucleotide of paragraph 157.

[00782] [164] A method of producing a variant of any one of paragraphs 1-156, comprising: cultivating a transgenic plant or plant cell comprising a polynucleotide encoding the variant under conditions conducive to production of the variant.

[00783] [165] The method of paragraph 164, further comprising variant recovery.

[00784] [166] A method for obtaining a GH61 polypeptide variant, comprising introducing into a parent GH61 polypeptide a substitution at one or more positions corresponding to positions 26, 32, 34, 40, 41, 42, 47, 56 , 72, 102, 123, 138, 149, 152, 163, 164, 166, 169, 186, 200, 207, 213, 219, 222, 234, 246, 249, and 250 of the mature polypeptide of SEQ ID NO: 30 , wherein the variant has enhancing cellulolytic activity; and variant recovery.

[00785] [167] The method of paragraph 166, further comprising introducing into the parent GH61 polypeptide a substitution at one or more positions corresponding to positions 111, 152, 155, and 162 of the mature polypeptide of SEQ ID NO: 30, wherein the variant has enhancing cellulolytic activity.

[00786] [168] The method of paragraph 166 or 167, further comprising introducing into the parent GH61 polypeptide a substitution at one or more positions corresponding to positions 96, 98, 200, 202, and 204 of the mature polypeptide of SEQ ID NO: 30, in which the variant has enhancing cellulolytic activity.

[00787] [169] The method of any one of paragraphs 166-168, further comprising introducing into the parent GH61 polypeptide a substitution at one or more positions corresponding to positions 105, 154, 188, 189, 216, and 229 of the mature polypeptide of SEQ ID NO: 30, wherein the variant has enhancing cellulolytic activity.

[00788] [170] A process for degrading or converting a cellulosic material, comprising: treating the cellulosic material with an enzyme composition in the presence of the GH61 polypeptide variant having enhancing cellulolytic activity of any of paragraphs 1156.

[00789] [171] The process of paragraph 170, in which cellulosic material is pre-treated.

[00790] [172] The process of paragraph 170 or 171, further comprising recovery of degraded cellulosic material.

[00791] [173] The process of any one of paragraphs 170-172, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of a cellulase, a polypeptide having enhancing cellulolytic activity, a hemicellulase, an esterase, a expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swolenin.

[00792] [174] The process of paragraph 173, wherein the cellulase consists of one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase.

[00793] [175] The process of paragraph 173, wherein the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.

[00794] [176] The process of any one of paragraphs 170-175, wherein the degraded cellulosic material is a sugar.

[00795] [177] The process of paragraph 176, wherein the sugar is selected from the group consisting of glucose, xylose, mannose, galactose, and arabinose.

[00796] [178] A process for producing a fermentation product, comprising: (a) saccharification of a cellulosic material with an enzyme composition in the presence of the GH61 polypeptide variant having enhancing cellulolytic activity of any one of paragraphs 1156; (b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.

[00797] [179] The process in paragraph 178, where cellulosic material is pre-treated.

[00798] [180] The process of paragraph 178 or 179, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of a cellulase, a polypeptide with increased cellulolytic activity, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swolenin.

[00799] [181] The process of paragraph 180, wherein the cellulase consists of one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase.

[00800] [182] The process of paragraph 180, wherein the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.

[00801] [183] The process of any one of paragraphs 178-182, wherein steps (a) and (b) are carried out simultaneously in a simultaneous saccharification and fermentation.

[00802] [184] The process of any one of paragraphs 178-183, wherein the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid , or polyketide.

[00803] [185] A fermentation process of a cellulosic material, comprising: fermentation of the cellulosic material with one or more fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition in the presence of the GH61 polypeptide variant having cellulolytic activity enhancer of any of paragraphs 1-156.

[00804] [186] The process of paragraph 185, in which cellulosic material is pre-treated prior to saccharification.

[00805] [187] The process of paragraph 185 or 186, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of a cellulase, a polypeptide with increased cellulolytic activity, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swolenin.

[00806] [188] The process of paragraph 187, wherein the cellulase consists of one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase.

[00807] [189] The process of paragraph 187, wherein the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.

[00808] [190] The process of any one of paragraphs 185-189, wherein fermentation of cellulosic material produces a fermentation product.

[00809] [191] The process of paragraph 190, further comprising recovery of fermentation product from fermentation.

[00810] [192] The process of paragraph 190 or 191, wherein the product of fermentation is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid, or polyketide .

[00811] [193] A composition comprising the variant of any one of paragraphs 1-156.

[00812] [194] A whole broth cell culture formulation or composition comprising the variant of any one of paragraphs 1-156.

[00813] [195] A detergent composition, comprising a surfactant and the variant of any one of paragraphs 1-156.

[00814] [196] The composition of paragraph 195, further comprising one or more enzymes selected from the group consisting of an amylase, arabinase, cutinase, carbohydrase, cellulase, galactanase, laccase, lipase, mannanase, oxidase, pectinase, peroxidase, protease, and xylanase.

[00815] [197] The composition of paragraph 195 or 196, which is formulated as a bar, tablet, powder, granule, paste, or liquid.

[00816] [198] A method for cleaning or laundering a hard surface or clothing, comprising the method of contacting the hard surface or clothing with the composition of any of paragraphs 195-197.

[00817] The invention described and claimed herein is not to be limited in scope by the specific aspects disclosed herein, as these aspects are intended as illustrations of various aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the aforementioned description. Such modifications are also intended to be within the scope of the appended claims. In case of conflict, this disclosure including definitions will control.

Claims (17)

1. A variant of the GH61 parent polypeptide, comprising: (1) a substitution at amino acid residues corresponding to positions 169 and 250 of the mature polypeptide of SEQ ID NO: 30, wherein the GH61 parent polypeptide comprises or consists of mature polypeptide of SEQ ID NO: 36; wherein the substitution at a position corresponding to position 169 is Cys; and the substitution at a position corresponding to position 250 is Cys; and wherein the variant has cellulolytic enhancing activity. 2. Variant according to claim 1, characterized by the fact that it comprises or consists of substitutions selected from the group consisting of: S169C; and A250C of the mature polypeptide of SEQ ID NO: 30. 3. Variant according to claim 1 or 2, characterized in that it has increased thermostability compared to the parent of the variant, wherein the thermostability of the variant is increased by at least 1.01 times compared to the parent. 4. Recombinant microbial host cell, characterized in that it expresses the variant as defined in any one of claims 1 to 3. 5. Method for producing a variant of the GH61 polypeptide having cellulolytic enhancing activity, characterized in that it comprises: (a) cultivating the recombinant microbial host cell as defined in claim 4 under suitable conditions for expression of the variant; and optionally (b) retrieving the variant. 6. Method for producing a variant of the GH61 polypeptide having enhancing cellulolytic activity, characterized in that it comprises: (a) growing a transgenic plant or a plant cell expressing the variant as defined in any one of claims 1 to 3 under conditions suitable for expression of the variant; and optionally (b) recovering the variant. 7. Process for degradation or conversion of a cellulosic material, characterized in that it comprises: treating the cellulosic material with an enzyme composition comprising the GH61 polypeptide variant as defined in any one of claims 1 to 3 and optionally recovering the material degraded or converted cellulosic material, in which the cellulosic material is pre-treated. 8. Process according to claim 7, characterized in that the degraded cellulosic material is a sugar selected from the group consisting of glucose, xylose, mannose, galactose and arabinose. 9. Process for producing a fermentation product, characterized in that it comprises: (a) saccharification of a cellulosic material with an enzyme composition comprising the GH61 polypeptide variant as defined in any one of claims 1 to 3, in which the cellulosic material is pre-treated; (b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation. 10. Process according to claim 9, characterized in that steps (a) and (b) are carried out simultaneously in simultaneous saccharification and fermentation. 11. Process for fermenting a cellulosic material, characterized in that it comprises: fermenting the cellulosic material with one or more fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition comprising the GH61 polypeptide variant as defined in any one of claims 1 to 3, and wherein the cellulosic material is pre-treated prior to saccharification. 12. Process according to claim 11, characterized in that the fermentation of the cellulosic material produces a fermentation product and optionally further comprises recovering the fermentation product from the fermentation. 13. Process according to any one of claims 9, 10 and 12, characterized in that the fermentation product is an alcohol, an organic acid, a ketone, an amino acid or a gas. 14. Process according to any one of claims 7 to 13, characterized in that the enzyme composition additionally comprises one or more enzymes selected from the group consisting of a cellulase, a polypeptide having enhancing cellulolytic activity, a hemicellulase, a catalase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease and a swolenin. 15. Enzyme composition, whole broth formulation or microbial cell culture composition, characterized in that it comprises the GH61 polypeptide variant as defined in any one of claims 1 to 3. 16. Detergent composition, characterized in that it comprises a surfactant and the GH61 polypeptide variant as defined in any one of claims 1 to 3, and optionally comprising one or more enzymes selected from the group consisting of an amylase, arabinase, cutinase, carbohydrase , cellulase, galactanase, laccase, lipase, mannanase, oxidase, pectinase, peroxidase, protease and xylanase, which is optionally formulated as a bar, tablet, powder, granule, paste or liquid. 17. Method for cleaning or washing a hard surface or clothing, characterized in that it comprises contacting the hard surface or clothing with the composition as defined in claim 16.