BR112019013010B1 - RECOMBINANT IPD-101 POLYPEPTIDE, RECOMBINANT POLYNUCLEOTIDE, METHOD FOR PRODUCING A TRANSGENIC PLANT OR PLANT CELL, DNA CONSTRUCTION, COMPOSITION, FUSION PROTEIN, METHOD FOR CONTROLING AN INSECT PEST POPULATION, METHOD FOR INHIBITING GROWTH OR EXTERMINATION AIR A PLAGUE OF INSECT AND USE OF IPD-101 POLYPEPTIDE - Google Patents

Abstract

These are compositions and methods for controlling pests. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that have insecticidal activity. Therefore, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal proteins and nucleic acids from bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation in organisms of interest, which includes plants, as probes for the isolation of other homologous (or partially homologous) genes. Pesticide proteins find use in the control, growth inhibition and extermination of pest populations of Lepidoptera, Coleoptera, Diptera, fungi, Hemiptera and nematodes and to produce compositions with insecticidal activity.

Description

CROSS REFERENCE TO RELATED ORDERS

[01] This application claims the benefit of the provisional application in U.S. 62/438,179, filed on December 22, 2016, which is incorporated herein by reference in its entirety.

REFERENCE TO ELECTRONICALLY PRESENTED SEQUENCE LISTING

[02] The official copy of the sequence listing is sent electronically via EFS-Web as an ASCII formatted sequence listing with a file named “6729WOPCT_Sequence_Listing” created on November 30, 2017 and having a size of 107 kilobytes and is deposited simultaneously with the descriptive report. The listing of sequences contained in this formatted ASCII document is part of the specification and is incorporated in its entirety in this document for reference.

FIELD

[03] This revelation refers to the field of molecular biology. Innovative genes encoding pesticide proteins are provided. These pesticidal proteins and the nucleic acid sequences that encode them are useful in the preparation of pesticide formulations and in the production of plants resistant to transgenic pests.

BACKGROUND

[04] Biological control of insect pests of agricultural significance with the use of a microbial agent, such as fungi, bacteria or other insect species, provides an environmentally friendly and commercially attractive alternative to synthetic chemical pesticides. Generally speaking, the use of biopesticides presents a lower risk of pollution and environmental hazards and biopesticides provide greater target specificity than is characteristic of traditional broad-spectrum chemical insecticides. Additionally, biopesticides typically cost less to produce and thereby improve economic yield for a wide variety of crops.

[05] Certain species of microorganisms of the genus Bacillus are known to have pesticidal activity against a range of insect pests including Lepidoptera, Diptera, Coleoptera, Hemiptera and others. Bacillus thuringiensis (Bt) and Bacillus popilliae are among the most successful biocontrol agents discovered to date. Insect pathogenicity has always been attributed to strains of B. larvae, B. lentimorbus, B. sphaericus and B. cereus. Microbial insecticides, particularly those obtained from Bacillus strains, have played an important role in agriculture as alternatives to chemical pest control.

[06] Crop plants have been developed with improved insect resistance by genetically modifying crop plants to produce pesticide proteins from Bacillus. For example, corn and cotton plants have been genetically modified to produce pesticide proteins isolated from strains of Bacillus thuringiensis. These genetically modified crops are now widely used in agriculture and have provided the farmer with an environmentally friendly alternative to traditional insect control methods. Although they have proven to be very successful commercially, these genetically modified insect-resistant crop plants can provide resistance to only a narrow range of economically important insect pests. In some cases, insects can develop resistance to different insecticidal compounds, which creates the need to identify alternative biological control agents for pest control.

[07] Consequently, there remains a need for new pesticidal proteins with different ranges of insecticidal activity against insect pests, for example, insecticidal proteins that are active against a variety of insects in the order Lepidoptera and the order Coleoptera, which includes but is not limited to , insect pests that have developed resistance to existing insecticides.

SUMMARY

[08] In one aspect, compositions and methods for imparting pesticidal activity to bacteria, plants, cells, tissues and plant seeds are provided. The compositions include nucleic acid molecules encoding sequences for pesticide and insecticidal polypeptides, vectors comprising such nucleic acid molecules, and host cells comprising the vectors. The compositions also include the sequences of pesticidal polypeptides and antibodies to these polypeptides. The compositions also comprise transformed bacteria, plants, plant cells, tissues and seeds.

[09] In another aspect, isolated or recombinant nucleic acid molecules are provided encoding IPD101 polypeptides including amino acid substitutions, deletions, insertions and fragments thereof. Isolated or recombinant nucleic acid molecules capable of encoding IPD101 polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28 are provided. 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, as well as substitutions, deletions, insertions of amino acids, fragments thereof and combinations thereof. Nucleic acid sequences that are complementary to a nucleic acid sequence of the embodiments or that hybridize to a sequence of the embodiments are also encompassed. The nucleic acid sequences can be used in DNA constructs or expression cassettes for transformation and expression in organisms, including microorganisms and plants. The nucleotide or amino acid sequences may be synthetic sequences that have been designed for expression in an organism including, but not limited to, a microorganism or a plant.

[010] In another aspect, IPD101 polypeptides are covered. Also provided are isolated or recombinant IPD101 polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46 , 48, 50, 52, 54, 56, 58, and 60, as well as substitutions, deletions, insertions of amino acids, fragments thereof and combinations thereof.

[011] In another aspect, methods are provided for producing the polypeptides and for using these polypeptides to control or exterminate Lepidoptera, Coleoptera, nematodes, fungi and/or Diptera pests. The transgenic plants of the embodiments express one or more of the pesticide sequences disclosed herein. In various embodiments, the transgenic plant further comprises one or more additional genes for insect resistance, for example, one or more additional genes for controlling pests of Coleoptera, Lepidoptera, Hemiptera or nematodes. It will be understood by a person skilled in the art that the transgenic plant can comprise any gene that confers an agronomic trait of interest.

[012] In another aspect, methods for detecting the nucleic acids and polypeptides of the modalities in a sample are also included. A kit is provided to detect the presence of an IPD101 polypeptide or detect the presence of a polynucleotide encoding an IPD101 polypeptide in a sample. The kit may be supplied together with all reagents and control samples necessary to perform a method to detect the intended agent, as well as instructions for use.

[013] In another aspect, the compositions and methods of the modalities are useful for producing organisms with improved tolerance or resistance to pests. Such organisms and compositions comprising the organisms are desirable for agricultural purposes. The compositions of the embodiments are also useful for generating altered or improved proteins that have pesticidal activity or for detecting the presence of IPD101 polypeptides.

BRIEF DESCRIPTION OF FIGURES

[014] Figures 1(a) to 1(d) show an amino acid sequence alignment, using the ALIGNX® module of the Vector NTI® package, of the IPD101Aa polypeptide (SEQ ID NO: 2), of the IPD101Ab polypeptide ( SEQ ID NO: 4), IPD101Ac polypeptide (SEQ ID NO: 6), IPD101Ba polypeptide (SEQ ID NO: 8), IPD101Ca polypeptide (SEQ ID NO: 10), IPD101Cb polypeptide (SEQ ID NO: 12) , IPD101Cc polypeptide (SEQ ID NO: 14), IPD101Cd polypeptide (SEQ ID NO: 16), IPD101Ce polypeptide (SEQ ID NO: 18), IPD101Cf polypeptide (SEQ ID NO: 20), IPD101Ea polypeptide (SEQ ID NO: 22), the IPD101Eb polypeptide (SEQ ID NO: 24), the IPD101Ee polypeptide (SEQ ID NO: 25), the IPD101Fa polypeptide (SEQ ID NO: 26), the IPD101Fb polypeptide (SEQ ID NO: 28), IPD101Ga polypeptide (SEQ ID NO: 29), IPD101Gb polypeptide (SEQ ID NO: 30), IPD101Gc polypeptide (SEQ ID NO: 32), IPD101Gd polypeptide (SEQ ID NO: 56), IPD101Ge polypeptide (SEQ ID NO: 58) and the IPD101Gf polypeptide (SEQ ID NO: 60). Amino acid sequence diversity among amino acid sequences is highlighted. Conservative amino acid differences are indicated by shading (A).

[015] Figure 2: Homologous competition of the binding of IPD101Aa identified with Alexa (1.5 nM) to WCRW BBMVs reveals specific binding with high apparent affinity (EC50=2 nM).

DETAILED DESCRIPTION

[016] It should be understood that this disclosure is not limited to the particular methodology, protocols, cell lines, genera and reagents described, as they may vary. It should also be understood that the terminology used herein is intended to describe only particular embodiments and is not intended to limit the scope of the present disclosure.

[017] As used herein, the singular forms "a", "an" and "the" include plural referents, unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and reference to "the protein" includes reference to one or more proteins and equivalents thereof, and so on. All technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art to which this disclosure pertains, unless clearly indicated otherwise.

[018] The present disclosure is directed to compositions and methods for controlling pests. The methods involve transforming organisms with nucleic acid sequences encoding IPD101 polypeptides. In particular, the nucleic acid sequences of the embodiments are useful for preparing plants and microorganisms that have pesticidal activity. In this way, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. The compositions include nucleic acids and pesticidal proteins from bacterial species. The nucleic acid sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other homologous (or partially homologous) genes, and for the generation of altered IPD101 polypeptides through methods known in the art. , such as site-directed mutagenesis, domain swapping or DNA shuffling. IPD101 polypeptides find use in the control or extermination of Lepidoptera, Coleoptera, Diptera, fungal, Hemiptera and nematode pest populations and to produce compositions with pesticide activity. Insect pests of interest include, but are not limited to, species of Lepidoptera which include, but are not limited to: Corn Ear Worm (CEW) (Helicoverpa zea), European Corn Borer (ECB) (Ostrinia nubialis), moth- crucifers, e.g. Helicoverpa zea Boddie; false caterpillar, e.g. Pseudoplusia includens Walker; and soybean caterpillar, e.g., Anticarsia gemmatalis Hübner and Coleoptera species, including but not limited to, Western Corn Rootworm (Diabrotica virgifera) - WCRW, Southern Corn Rootworm (Diabrotica undecimpunctata howardi) - SCRW and Northern corn rootworm (Diabrotica barberi) - NCRW.

[019] By "pesticide toxin" or "pesticide protein" is used herein to refer to a toxin that has toxic activity against one or more pests, including, but not limited to, members of the orders Lepidotera, Diptera, Hemiptera and Coleoptera or from the phylum Nematode or a protein that has homology to such a protein.Pesticidal proteins have been isolated from organisms including, for example, Bacillus sp., Pseudomonas sp., Photorhabdus sp.,

[020] In some embodiments the IPD101 polypeptide includes an amino acid sequence deduced from the full-length nucleic acid sequence disclosed herein and amino acid sequences that are shorter than the full-length sequences, or due to the use of a site alternative downstream start or due to processing that produces a shorter protein that has pesticidal activity. Processing can occur in the organism in which the protein is expressed or in the pest after ingestion of the protein.

[021] Therefore, innovative isolated or recombinant nucleic acid sequences that confer pesticidal activity are provided in this document. Amino acid sequences of IPD101 polypeptides are also provided. The polypeptide that results from the translation of these IPD101 genes allows cells to control or exterminate pests that ingest it.

IPD101 Proteins and Variants and Fragments Thereof

[022] IPD101 polypeptides are covered by the disclosure. "IPD101 polypeptide" and "IPD101 protein" as used herein interchangeably refer to a polypeptide that has insecticidal activity including, but not limited to, insecticidal activity against one or more insect pests of the orders Lepidoptera and/or Coleoptera and is sufficiently homologous to the IPD101Aa polypeptide of SEQ ID NO: 2. A variety of IPD101 polypeptides are contemplated. Sources of IPD101 polypeptides or related proteins include bacterial species selected from, but not limited to, Lysinibacillus species. Alignment of the amino acid sequences of IPD101 polypeptide homologs (e.g., see Figure 1) allows identification of residues that are highly conserved among the natural homologs of this family.

[023] "Sufficiently homologous" is used herein to refer to an amino acid sequence that is at least about 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72% , 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence homology compared to a reference sequence using one of the alignment programs described in this document using standard parameters. In some embodiments, the sequence homology is against the full-length sequence of an IPD101 polypeptide. In some embodiments, the IPD101 polypeptide is at least about 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60% , 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77 %, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity compared to any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 , 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60. The term "about" when used herein in context with percent sequence identity means +/- 0.5%. A person skilled in the art will recognize that these values can be appropriately adjusted to determine corresponding homology of proteins taking into account amino acid similarity and the like. In some embodiments, sequence identity is calculated using the ClustalW algorithm in the ALIGNX® module of the Vector NTI® Program Package (Invitrogen Corporation, Carlsbad, Calif.) with all default parameters. In some embodiments, sequence identity is the entire length of the polypeptide calculated using the ClustalW algorithm in the ALIGNX® module of the Vector NTI® Program Package (Invitrogen Corporation, Carlsbad, Calif.) with all default parameters.

[024] As used herein, the terms "protein", "peptide molecule" or "polypeptide" include any molecule comprising five or more amino acids. It is well known in the art that protein, peptide or polypeptide molecules can be subjected to modification, including post-translational modifications such as, but not limited to, disulfide bond formation, glycosylation, phosphorylation or oligomerization. Therefore, as used herein, the terms "protein", "peptide molecule" or "polypeptide" include any protein that is modified by any biological or non-biological process. The terms "amino acid" and "amino acids" refer to all naturally occurring L-amino acids.

[025] A "recombinant protein" is used herein to refer to a protein that is no longer in its natural environment, for example, in vitro or in a recombinant plant or bacterial host cell. An IPD101 polypeptide that is substantially free of cellular material includes protein preparations that have less than about 30%, 20%, 10% or 5% (by dry weight) non-pesticide protein (also referred to herein as a " contaminating protein").

[026] “Fragments” or “biologically active portions” include polypeptide fragments that comprise amino acid sequences sufficiently identical to an IPD101 polypeptide and that exhibit insecticidal activity. “Fragments” or “biologically active portions” of IPD101 polypeptides include fragments that comprise sequences of amino acids sufficiently identical to the amino acid sequence presented in any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30 , 32, 46, 48, 50, 52, 54, 56, 58, and 60 with the IPD101 polypeptide having insecticidal activity. Such biologically active moieties can be prepared by recombinant techniques and evaluated for insecticidal activity. In some embodiments, the IPD101 polypeptide fragment is an N-terminal and/or C-terminal truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or more N-terminal and/or C-terminal amino acids with respect to any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, for example, by proteolysis, by insertion of a start codon, by deletion of the codons encoding the deleted amino acids and concomitant insertion of a start codon and/or insertion of a stop codon. In some embodiments, the IPD101 polypeptide fragment is an N-terminal truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 N-terminal amino acids of any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 , 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60. In some embodiments, the IPD101 polypeptide fragment is an N-terminal and/or C-terminal truncation. terminal of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or more N-terminal and/or C-terminal amino acids in relation to any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60.

[027] "Variants" as used herein refers to proteins or polypeptides that have an amino acid sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80% , 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98%, 99% or more identical to the parental amino acid sequence.

[028] In some embodiments, an IPD101 polypeptide comprises an amino acid sequence that is at least about 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57% , 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72% 73%, 74% , 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85% 86%, 87%, 88%, 89%, 90%, 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98% 99% or more identity with the amino acid sequence of any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, with the IPD101 polypeptide having activity insecticide.

[029] In some embodiments, an IPD101 polypeptide comprises an amino acid sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity across the entire length of the amino acid sequence of any of SEQ ID NOS : 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58 , and 60.

[030] In some embodiments, sequence identity is the entire length of the polypeptide calculated using the ClustalW algorithm in the ALIGNX® module of the Vector NTI® Program Package (Invitrogen Corporation, Carlsbad, California) with all default parameters.

[031] In some embodiments, an IPD101 polypeptide comprises an amino acid sequence of any one or more of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 or more amino acid substitutions compared to the native amino acid at the corresponding position of any one or more of the respective SEQ ID NOS: 2, 4, 6, 8 , 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60.

[032] Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of an IPD101 polypeptide can be prepared through mutations in the DNA. This can also be achieved by one of several forms of mutagenesis and/or directed evolution. In some respects, the encoded changes in the amino acid sequence will not substantially affect the function of the protein. Such variants will have the desired pesticide activity. However, it is understood that the ability of an IPD101 polypeptide to impart pesticidal activity can be enhanced by the use of such techniques in the compositions of this disclosure.

[033] For example, conservative amino acid substitutions can be made at one or more predicted non-essential amino acid residues. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of an IPD101 polypeptide without altering biological activity. A "conservative amino acid substitution" is one in which the amino acid residue is replaced by an amino acid residue that has a similar side chain. Families of amino acid residues that have similar side chains have been defined in the art. These families include: amino acids with basic side chains (e.g., lysine, arginine, histidine); acidic side chains (e.g. aspartic acid, glutamic acid); polar negatively charged residues and their amides (e.g., aspartic acid, asparagine, glutamic acid, glutamine; uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine); small aliphatic residues, not polar or slightly polar (e.g., Alanine, serine, threonine, proline, glycine); nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); large aliphatic nonpolar residues ( e.g., methionine, leucine, isoleucine, valine, cysteine); beta-branched side chains (e.g., threonine, valine, isoleucine); aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine); large aromatic side chains (e.g., e.g., tyrosine, phenylalanine, tryptophan).

[034] Amino acid substitutions can be made in non-conserved regions that retain function. In general, such substitutions would not be made for conserved amino acid residues or for amino acid residues that reside in a conserved motif, where such residues are essential for protein activity. Examples of residues that are conserved and that may be essential for protein activity include, for example, residues that are identical among all proteins contained in an alignment of toxins similar to or related to the sequences of the embodiments (e.g., residues that are identical in an alignment of homologous proteins). Examples of residues that are conserved but can allow conservative amino acid substitutions and can still retain activity include, for example, residues that have only conservative substitutions among all proteins contained in an alignment of toxins similar to or related to the sequences of the embodiments ( e.g., residues that have only conservative substitutions among all proteins contained in the alignment of homologous proteins). However, the person skilled in the art would understand that functional variants may have minor conserved or non-conserved changes at conserved residues. Guidelines regarding appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff, et al., (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.).

[035] When making such changes, the hydropathic amino acid index can be considered. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, (1982) J Mol Biol. 157(1):105 to 132). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resulting protein, which in turn defines the interaction of the protein with other molecules, e.g., enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

[036] It is known in the art that certain amino acids can be replaced by other amino acids that have a similar hydropathic index or score and still result in a protein with similar biological activity, that is, still obtain a functionally biological equivalent protein. Each amino acid was assigned a hydropathic index based on its hydrophobicity and charge characteristics (Kyte and Doolittle, ibid). These are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9) and arginine (-4.5). In carrying out such changes, the substitution of amino acids whose hydropathic indices are within +2 is preferred, those of which are within +1 are particularly preferred, and those within +0.5 are even more particularly preferred.

[037] It is also understood that in the art that the replacement of similar amino acids can be done effectively based on hydrophilicity. U.S. Patent No. 4,554,101 states that the highest average local hydrophilicity of a protein, as manipulated by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein.

[038] As detailed in U.S. Patent No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0+0.1); glutamate (+3.0+0.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5+0.1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

[039] Alternatively, changes can be made to the protein sequence of many proteins at the amino or carboxy terminus without substantially affecting activity. This may include insertions, deletions, or changes introduced by modern molecular methods such as PCR, including PCR amplifications that alter or extend the protein coding sequence by virtue of the inclusion of amino acid coding sequences in the oligonucleotides used in the PCR amplification. Alternatively, the added protein sequences may include entire protein coding sequences, such as those commonly used in the art to generate protein fusions. Such fusion proteins are often used to (1) increase expression of a protein of interest (2) introduce a binding domain, enzymatic activity, or epitope to facilitate protein purification, protein detection, or other experimental uses known in the art. (3) directing the secretion or translation of a protein to a subcellular organelle, such as the periplasmic space of Gram-negative bacteria, mitochondria or chloroplasts of plants, or the endoplasmic reticulum of eukaryotic cells, the latter of which often results in glycosylation of the protein.

[040] The variant nucleotide and amino acid sequences of the disclosure also encompass sequences derived from mutagenic and recombinogenic procedures, such as DNA shuffling. With such a procedure, one or more different IPD101 polypeptide coding regions can be used to create a new IPD101 polypeptide that has the desired properties. In this manner, recombinant polynucleotide libraries are generated from a population of polynucleotides of related sequence that comprise sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest can be shuffled between a pesticide gene and other known pesticide genes to obtain a novel gene that encodes a protein with an improved property of interest, such as activity. increased insecticide. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer, (1994) Proc. Natl. Academic. Sci. USA 91:10747 to 10751; Stemmer, (1994) Nature 370:389 to 391; Crameri, et al., (1997) Nature Biotech. 15:436 to 438; Moore, et al., (1997) J. Mol. Biol. 272:336 to 347; Zhang, et al., (1997) Proc. Natl. Academic. Sci. USA 94:4,504 to 4,509; Crameri, et al., (1998) Nature 391:288 to 291; and U.S. Patent Nos. 5,605,793 and 5,837,458.

[041] Domain swapping or shuffling is another mechanism for generating altered IPD101 polypeptides. Domains can be switched between IPD101 polypeptides, resulting in hybrid or chimeric toxins with insecticidal activity or enhanced target spectrum. Methods for generating recombinant proteins and testing them for pesticidal activity are well known in the art (see, e.g., Naimov, et al., (2001) Appl. Environ. Microbiol. 67:5328 to 5330; de Maagd, et al. ., (1996) Appl. Environ. Microbiol. 62:1537 to 1543; Ge, et al., (1991) J. Biol. Chem. 266:17954 to 17958; Schnepf, et al., (1990) J. Biol Chem 265:20923 to 21010; Rang, et al., 91999) Appl. Environ. Microbiol. 65:2918 to 2925).

Phylogenetic, sequence motif, and structural analyzes of insecticidal protein families.

[042] A structure and sequence analysis method can be employed, which is composed of four components: phylogenetic tree construction, protein sequence motif discovery, secondary structure prediction, and alignment of protein sequences and secondary structures. Details about each component are illustrated below.

1) Construction of a phylogenetic tree

[043] Phylogenetic analysis can be carried out using the MEGA5 software. Protein sequences can be subjected to ClustalW version 2 analysis (Larkin M.A et al (2007) Bioinformatics 23(21): 2947 to 2948) for multiple sequence alignments. The evolutionary history is then inferred by the Maximum Likelihood method based on the JTT matrix-based model. The tree with the highest log likelihood is obtained, exported in Newick format, and further processed to extract the sequence IDs in the same order as they appeared in the tree. Some clades representing subfamilies can be manually identified for each insecticidal protein family.

2) Finding protein sequence motifs

[044] The protein sequences are reordered according to the previously constructed phylogenetic tree, and fed to the MEME (Multiple EM for MOTIF Elicitation) MOTIVE analysis tool (Bailey T.L., and Elkan C., Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pages 28 to 36, AAAI Press, Menlo Park, California, 1994) for identification of key sequence motifs. MEME is configured as follows: Minimum number of sites 2, Minimum motif width 5, and Maximum number of motifs 30. Sequence motifs unique to each subfamily were identified through visual observation. The distribution of MOTIFS across the entire gene family can be viewed on the HTML web page. REASONS are numbered in relation to the E-value rating for each REASON.

3) Secondary structure prediction

[045] PSIPRED, high-ranking secondary structure prediction method (Jones DT. (1999) J. Mol. Biol. 292: 195 to 202), can be used for protein secondary structure prediction. The tool provides accurate structure prediction using two feed-forward neural networks based on the PSI-BLAST product. The PSI-BLAST database is created by removing low-complexity, transmembrane, and coiled-coil regions in Uniref100. PSIPRED results contain the predicted secondary structures (Alpha helix: H, Beta strand: E, and Coil: C) and the corresponding confidence scores for each amino acid in a given protein sequence.

4) Alignment of protein sequences and secondary structures

[046] A script can be developed to generate a secondary structure alignment with gaps according to the multiple protein sequence alignment from step 1 for all proteins. All aligned protein sequences and structures are concatenated into a single FASTA file and then imported into MEGA for visualization and identification of conserved structures.

[047] In some embodiments, the IPD101 polypeptide has a modified physical property. As used herein, the term "physical property" refers to any parameter suitable for describing the physicochemical characteristics of a protein. As used herein, "physical property of interest" and "property of interest" are used interchangeably to refer to physical properties of proteins that are under investigation and/or modification. Examples of physical properties include, but are not limited to, net surface charge and charge distribution on the protein surface, effective hydrophobicity and distribution of hydrophobic residues on the protein surface, surface charge density, surface hydrophobicity density, count total surface ionizable groups, surface tension, protein size and its distribution in solution, melting temperature, heat capacity and second virial coefficient. Examples of physical properties also include the IPD101 polypeptide having increased expression, increased solubility, decreased phytotoxicity, and digestibility of proteolytic fragments in an insect gut. Models for digestion by simulated gastric fluids are known to one skilled in the art (Fuchs, R.L. and J.D. Astwood. Food Technology 50: 83 to 88, 1996; Astwood, J.D., et al Nature Biotechnology 14: 1269 to 1273, 1996; Fu TJ et al J. Agric Food Chem. 50: 7154 to 7160, 2002).

[048] In some embodiments, the variants include polypeptides that differ in amino acid sequence due to mutagenesis. The variant proteins covered by the disclosure are biologically active, that is, they continue to have the desired biological activity (i.e., pesticidal activity) of the native protein. In some embodiment, the variant will have at least about 10%, at least about 30%, at least about 50%, at least about 70%, at least about 80% or more of the insecticidal activity of the native protein. In some embodiments, the variants may have improved activity over the native protein.

[049] Bacterial genes often have several methionine start codons in close proximity to the beginning of the open reading frame. Typically, initiation of translation at one or more of these start codons will lead to the generation of a functional protein. These start codons may include ATG codons. However, bacteria, such as Bacillus sp., also recognize the GTG codon as a start codon, and proteins that initiate translation at GTG codons contain a methionine in the first amino acid. On rare occasions, translation in bacterial systems may initiate at a TTG codon, although in this case the TTG encodes a methionine. Additionally, it is not normally determined a priori which of these codons is used naturally in bacteria. Therefore, it is understood that the use of one of the alternative methionine codons can also lead to the generation of pesticide proteins. Such pesticidal proteins are covered by the present disclosure and can be used in the methods of the present disclosure. It will be understood that when expressed in plants, it will be necessary to change the alternate start codon to ATG for proper translation.

[050] In some embodiments, an IPD101 polypeptide comprises the amino acid sequence of any one or more of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60.

[051] In some embodiments, chimeric polypeptides are provided comprising regions of at least two different IPD101 polypeptides of the disclosure.

[052] In some embodiments, chimeric polypeptides are provided that comprise regions of at least two different IPD101 polypeptides selected from any one or more of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 , 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60.

[053] In some embodiments, the chimeric IPD101 polypeptide is provided comprising an N-terminal region of a first IPD101 polypeptide of the disclosure operatively fused to a C-terminal region of a second IPD101 polypeptide of the disclosure.

[054] In other embodiments, the IPD101 polypeptide can be expressed as a precursor protein with an intervening sequence that catalyzes multistep post-translational protein union. Protein splicing involves the removal of an intervening sequence from a polypeptide with the concomitant splicing of flanking sequences to yield a new polypeptide (Chong, et al., (1996) J. Biol. Chem., 271:22159 to 22168) . This intervening sequence or protein splice element, called inteins, catalyzes its own excision through three coordinated reactions at the N-terminal and C-terminal splice junctions: an acyl arrangement of the N-terminal cysteine or serine; a transesterfication reaction between the two termini to form a thioester or branched ester intermediate and peptide bond cleavage coupled to intein C-terminal asparagine cyclization to release the intein (Evans, et al., (2000) J. Biol Chem., 275:9091 to 9094. Elucidation of the mechanism of protein splicing has led to several intein-based applications (Comb, et al., U.S. Patent No. 5,496,714; Comb, et al., U.S. Pat. No. 5,834,247; Camarero and Muir, (1999) J. Amer. Chem. Soc. 121:5597 to 5598; Chong, et al., (1997) Gene 192:271 to 281, Chong, et al ., (1998) Nucleic Acids Res. 26:5109 to 5115; Chong, et al., (1998) J. Biol. Chem. 273:10567 to 10577; Cotton, et al., (1999) J. Am. Chem Soc 121:1100 to 1101; Evans, et al., (1999) J. Biol. Chem. 274:18359 to 18363; Evans, et al., (1999) J. Biol. ; Evans, et al., (1998) Protein Sci. 7:2256 to 2264; Evans, et al., (2000) J. Biol. Chem. 275:9091 to 9094; Iwai and Pluckthun, (1999) FEBS Lett. 459:166 to 172; Mathys, et al., (1999) Gene 231:1 to 13; Mills, et al., (1998) Proc. Natl. Academic. Sci. USA 95:3543 to 3548; Muir, et al., (1998) Proc. Natl. Academic. Sci. USA 95:6705 to 6710; Otomo, et al., (1999) Biochemistry 38:16040 to 16044; Otomo, et al., (1999) J. Biolmol. RMN 14:105 to 114; Scott, et al., (1999) Proc. Natl. Academic. Sci. USA 96:13,638 to 13,643; Severinov and Muir, (1998) J. Biol. Chem. 273:16,205 to 16,209; Shingledecker, et al., (1998) Gene 207:187 to 195; Southworth, et al., (1998) EMBO J. 17:918 to 926; Southworth, et al., (1999) Biotechniques 27:110 to 120; Wood, et al., (1999) Nat. Biotechnol. 17:889 to 892; Wu, et al., (1998a) Proc. Natl. Academic. Sci. USA 95:9,226 to 9,231; Wu, et al., (1998b) Biochim Biophys Acta 1387:422 to 432; Xu, et al., (1999) Proc. Natl. Academic. Sci. USA 96:388 to 393; Yamazaki, et al., (1998) J. Am. Chem. Soc., 120:5,591 to 5,592). For the application of inteins to plant transgenes, see Yang, et al., (Transgene Res 15:583 to 593 (2006)) and Evans, et al., (Annu. Rev. Plant Biol. 56:375 to 392 ( 2005)).

[055] In another embodiment, the IPD101 polypeptide can be encoded by two separate genes in which the precursor protein intein comes from the two genes, called separation intein, and the two portions of the precursor are joined by a peptide bond formation . This peptide bond formation is achieved by intein-mediated trans-coupling. For this purpose, a first and second expression cassette comprising the two separate genes additionally encode inteins capable of mediating trans protein splicing. By trans union, the proteins and polypeptides encoded by the first and second fragments can be linked by peptide bond formation. Trans-splicing inteins can be selected from the nucleolus and organelle genomes of different organisms, including eukaryotes, archobacteria, and eubacteria. The inteins that can be used are listed at neb.com/neb/inteins.html, which can be accessed via the world wide web using the prefix "www"). The nucleotide sequence encoding an intein can be divided into a 5' part and a 3' part that encode the 5' part and the 3' part of the intein, respectively. Portions of sequence not required for intein joining (e.g., migration endonuclease domain) can be deleted. The intein coding sequence is split so that the 5' and 3' parts are capable of trans splicing. To select a suitable division site from the intein coding sequence, considerations published by Southworth, et al., (1998) EMBO J. 17:918 to 926 can be followed. In constructing the first and second expression cassettes, the 5' intein coding sequence is ligated to the 3' end of the first fragment encoding the N-terminal part of the IPD101 polypeptide and the 3' intein coding sequence is ligated to the 5' end of the second fragment encoding the C-terminal part of the IPD101 polypeptide.

[056] In general, trans splicing partners can be designed using any split intein, including any artificially split or naturally occurring intein. Several naturally occurring split inteins are known, for example: the split intein from the DnaE gene of Synechocystis sp. PCC6803 (see Wu, et al., (1998) Proc Natl Acad Sci USA. 95(16):9226 to 9231 and Evans, et al., (2000) J Biol Chem. 275(13):9091 to 9094 and DnaE gene from Nostoc punctiforme (see Iwai, et al., (2006) FEBS Lett. 580(7):1853 to 1858). Non-split inteins were artificially split in the laboratory to create new split inteins, e.g., the DnaB intein artificially split Ssp (see, Wu, et al., (1998) Biochim Biophys Acta. 1387:422 to 432) and split Sce VMA intein (see, Brenzel, et al., (2006) Biochemistry. 45(6):1571 to 1578) and an artificially split fungal mini-intein (see, Elleuche, et al., (2007) Biochem Biophys Res Commun. 355(3):830 to 834). There are also intein databases available that catalog known inteins (consult, for example, the online database available at: bioinformatics.weizmann.ac.il/~pietro/inteins/Inteinstable.html, which can be accessed via the world-wide web using the prefix "www").

[057] Naturally occurring unsplit inteins may have endonuclease or other enzymatic activities that can typically be removed during the projection of an artificially split intein. Such mini-inteins or minimized split inteins are well known in the art and are typically less than 200 amino acid residues in length (see, Wu, et al., (1998) Biochim Biophys Acta. 1387:422 to 432). Suitable split inteins may have other purification-enabling polypeptide elements added to their structure, as such elements do not inhibit spliced intein splicing or are added in a manner that allows them to be removed prior to splicing. Protein splicing has been reported using proteins comprising bacterial intein-like (BIL) domains (see Amitai, et al., (2003) Mol Microbiol. 47:61 to 73) and porcupine self-processing domains ( pig) (the latter is combined with inteins when referring to the pig/intein superfamily or HINT family (see Dassa, et al., (2004) J Biol Chem. 279:32001 to 32007) and domains such as these can also be used to prepare artificially split inteins. In particular, non-splicing members of such families can be modified by molecular biology methodologies to introduce or restore splicing activity in such related species. Recent studies demonstrate that splicing can be observed when it is allowed that an N-terminal split intein component reacts with a C-terminal split intein component not found in nature to be its "partner"; for example, splicing has been observed using partners that have 30 to 50% homology to the "natural" mating partner (see, Dassa, et al., (2007) Biochemistry. 46(1):322 to 330). Other such mixtures of divergent split intein partners have been shown to be non-reactive with each other (see, Brenzel, et al., (2006) Biochemistry. 45(6):1571 to 1578). However, it is within the ability of a person skilled in the relevant art to determine the possibility that a particular pair of polypeptides can associate with each other to provide a functional intein using routine methods and without the exercise of inventive technique.

[058] In some embodiments, the IPD101 polypeptide is a circular permuted variant. In certain embodiments, the IPD101 polypeptide is a circular permuted variant of any of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, or a variant thereof that has an amino acid substitution, deletion, addition or combinations thereof. The approach used in creating novel sequences resembles that of naturally occurring pairs of proteins that are related by linear reorganization of their amino acid sequences (Cunningham, et al., (1979) Proc. Natl. Acad. Sci. U.S.A. 76:3218 to 3222; Teather and Erfle, (1990) J. Bacteriol. 172:3837 to 3841; Schimming, et al., (1992) Eur. J. Biochem. 204:13 to 19; Yamiuchi and Minamikawa, (1991) FEBS Lett 260:127 to 130; MacGregor, et al., (1996) FEBS Lett. 378:263 to 266). This type of arrangement for proteins was described by Goldenberg and Creighton (J. Mol. Biol. 165:407 to 413, 1983). In creating a circular permuted variant, a new N-terminus is selected at an internal site (interruption) of the original sequence, the new sequence having the same amino acid order as the original interruption until reaching an amino acid that is at or near the original C terminal. At this point, the new sequence is joined, directly or through an additional sequence portion (linker), to an amino acid that is at or near the original N-terminus and the new sequence continues with the same sequence as the original until it reaches a point wherein it is at or near the amino acid that was N-terminal to the interruption site of the original sequence, wherein this residue forms the new C-terminus of the chain. The length of the linker amino acid sequence can be selected empirically or with guidance from structural information or using a combination of the two approaches. When no structural information is available, a small series of ligands can be prepared for testing using a design whose length is varied to cover a range from 0 to 50 Å and whose sequence is chosen to be consistent with the surface exposure (hydrophilicity, Hopp and Woods, (1983) Mol. Immunol. 20:483 to 489; Kyte and Doolittle, (1982) J. Mol. Biol. 157:105 to 132; solvent exposed surface area, Lee and Richards, (1971) J. Mol. Biol. 55:379 to 400) and the ability to adopt the required conformation without disarranging the configuration of the pesticide polypeptide (conformationally flexible; Karplus and Schulz, (1985) Naturwissenschaften 72:212 to 213) . Considering an average translation of 2.0 to 3.8 Å per residue, this would mean the length to test would be between 0 to 30 residues, with 0 to 15 residues being the preferred range. An example of such an empirical series would be to construct ligands using a cassette sequence such as Gly-Gly-Gly-Ser repeated n times, where n is 1, 2, 3 or 4. Those skilled in the art will recognize that there are many such sequences that vary in length or composition that can serve as linkers with the primary consideration that they are not excessively long or short (cf., Sandhu, (1992) Critical Rev. Biotech. 12:437 to 462); If they are too long, entropy effects will likely destabilize the three-dimensional fold and also make folding kinetically impractical, and if they are too short, they will likely destabilize the molecule due to torsional or steric deformation. Those skilled in the analysis of protein structural information will recognize that the use of the distance between chain ends, defined as the distance between c-alpha carbons, can be used to define the length of the sequence to be used or at least limit the number of possibilities that must be tested in an empirical selection of ligands. They will also recognize that it is sometimes the case that the positions of the ends of the polypeptide chain are poorly defined in structural models derived from X-ray diffraction or nuclear magnetic resonance spectroscopy data and that, when true, this situation will need to be, therefore taken into consideration in order to properly estimate the required linker length. From these residues whose positions are well defined, two residues that are close in sequence to the chain ends are selected, and the distance between their c-alpha carbons is used to calculate an approximate length for a linker between them. Using the calculated length as a guide, ligands with a range of residue numbers (calculated using 2 to 3.8 Å per residue) are then selected. These linkers can be composed of the original sequence, shortened or lengthened as necessary, and when lengthened, additional residues can be chosen to be flexible and hydrophilic as described above; or optionally the original sequence may be replaced to use a series of linkers, an example of which is the Gly-Gly-Gly-Ser cassette approach mentioned above; or, optionally, a combination of the original sequence and the new sequence having the appropriate total length may be used.

[059] Pesticide polypeptide sequences with the ability to fold biologically active states can be prepared by appropriate selection of the beginning (amino terminal) and end (carboxyl terminal) positions within the original polypeptide chain using the linker sequence, as per described above. The amino and carboxyl termini are selected from within a common stretch of sequence, called the break region, using the guidelines described below. An innovative amino acid sequence is generated in this way by selecting amino and carboxyl termini within the same interruption region. In many cases, the selection of new termini will be carried out so that the original position of the carboxyl terminus immediately precedes that of the amino terminus. However, those skilled in the art will recognize that terminal selections at any location in the region can work and that they will effectively lead to any deletions or additions to the amino or carboxyl portions of the new sequence. It is a central tenet of molecular biology that the primary amino acid sequence of a protein dictates the folding into the three-dimensional structure necessary for the expression of its biological function. Methods are well known to those skilled in the art for obtaining and interpreting three-dimensional structural information using X-ray diffraction of single protein crystals or nuclear magnetic resonance spectroscopy of protein solutions. Examples of structural information that are relevant to identifying regions of disruption include the location and type of protein secondary structure (alpha and 3-10 helices, parallel and antiparallel beta sheets, strand inversions and turns, and loops; Kabsch and Sander, (1983) Biopolymers 22:2577 to 2637); the degree of solvent exposure of amino acid residues, the extent and type of interactions of residues with each other (Chothia, (1984) Ann. Rev. Biochem. 53:537 to 572) and the static and dynamic distribution of conformations throughout of the polypeptide chain (Alber and Mathews, (1987) Methods Enzymol. 154:511 to 533). In some cases, additional information about waste solvent exposure is known; an example is a post-translational carbohydrate binding site that is necessarily on the surface of the protein. When experimental structural information is not available or is not practicable to obtain, methods are also available to analyze the primary amino acid sequence in order to make predictions of protein tertiary and secondary structure, solvent accessibility, and the occurrence of turns and loops. . Biochemical methods are also sometimes applicable to empirically determine surface exposure when direct structural methods are not practical; for example, using the identification of chain scission sites that follows limited proteolysis in order to infer surface exposure (Gentile and Salvatore, (1993) Eur. J. Biochem. 218:603 to 621). Therefore, using experimentally derived structural information or predictive methods (e.g., Srinivisan and Rose, (1995) Proteins: Struct., Funct. & Genetics 22:81 to 99), the parental amino acid sequence is inspected to classify regions according to whether or not they are integral to the maintenance of secondary and tertiary structure. The occurrence of sequences within regions that are known to be involved in periodic secondary structure (alpha and 3-10 helices, parallel and antiparallel beta sheets) are regions that should be avoided. Similarly, regions of amino acid sequence that are observed or predicted to have a low degree of solvent exposure are more likely to be part of the so-called hydrophobic core of the protein and should also be avoided for selection of amino and carboxyl termini. In contrast, those regions that are known or predicted to be in surface loops or loops, and especially those regions that are known not to be required for biological activity, are the preferred sites for localizing polypeptide chain ends. The continuous stretches of amino acid sequence that are preferred based on the above criteria are called the break region. Polynucleotides encoding new N-terminal/C-terminal circular permuted IPD101 polypeptides that contain a linker region separating the original C-terminus and N-terminus can be produced essentially following the method described in Mullins, et al., (1994) J. Am. Chem. Soc. 116:5529 to 5533. Multiple steps of polymerase chain reaction (PCR) amplifications are used to rearrange the DNA sequence encoding the primary amino acid sequence of the protein. Polynucleotides encoding new N-terminal/C-terminal circular permuted IPD101 polypeptides that contain a linker region separating the original C-terminus and N-terminus can be produced based on the tandem duplication method described in Horlick, et al., (1992 ) Protein Eng. 5:427 to 431. Polymerase chain reaction (PCR) amplification of novel N-terminal/C-terminal genes is performed using consecutively duplicated template DNA.

[060] In another embodiment, fusion proteins are provided, which include in their amino acid sequence an amino acid sequence comprising an IPD101 polypeptide of the disclosure. Methods for designing and constructing fusion proteins (and polynucleotides encoding the same) are known to those skilled in the art. Polynucleotides encoding an IPD101 polypeptide can be fused to signal sequences that will direct the localization of the IPD101 polypeptide to specific compartments of a prokaryotic or eukaryotic cell and/or direct the secretion of the IPD101 polypeptide from modalities of a prokaryotic or eukaryotic cell. For example, in E. coli, one may wish to target protein expression to the periplasmic space. Examples of signal sequences or proteins (or fragments thereof) to which the IPD101 polypeptide can be fused in order to direct expression of the polypeptide to the periplasmic space of bacteria include, but are not limited to, the pelB signal sequence, the maltose binding protein (MBP) signal sequence, MBP, the ompA signal sequence, the periplasmic E. coli heat-labile enterotoxin B subunit signal sequence, and the alkaline phosphatase signal sequence. Several vectors are commercially available for constructing fusion proteins that will direct the localization of a protein, such as the pMAL series of vectors (particularly the pMAL-p series) available from New England Biolabs®. In a specific embodiment, the IPD101 polypeptide can be fused to the pelB pectate lyase signal sequence to increase the efficiency of expression and purification of such polypeptides in Gram-negative bacteria (see, U.S. Patent Documents Nos. 5,576,195 and 5,846,818). Plant plastid transition peptide/polypeptide fusions are well known in the art. Apoplast transition peptides such as alpha-amylase secretion signal from rice or barley are also well known in the art. The plastid transition peptide is generally fused N-terminally to the polypeptide to be targeted (e.g., the fusion partner). In one embodiment, the fusion protein essentially consists of the plastid transition peptide and the IPD101 polypeptide to be targeted. In another embodiment, the fusion protein comprises the plastid transition peptide and the polypeptide to be targeted. In such embodiments, the plastid transition peptide is preferably at the N-terminus of the fusion protein. However, additional amino acid residues may be N-terminal to the plastid transition peptide, since the fusion protein is at least partially targeted to a plastid. In a specific embodiment, the plastid transition peptide is in the N-terminal half, N-terminal third, or N-terminal fourth of the fusion protein. Most or all of the plastid transition peptides are usually cleaved from the fusion protein upon insertion into the plastid. The position of cleavage may vary slightly between plant species at different stages of plant development as a result of specific intercellular conditions or the particular transition peptide/fusion partner combination used. In one embodiment, plastid transition peptide cleavage is homogeneous, such that the cleavage site is identical across a population of fusion proteins. In another embodiment, the plastid transition peptide is not homogeneous, such that the cleavage site varies by 1 to 10 amino acids in a population of fusion proteins. The plastid transition peptide can be recombinantly fused to a second protein in one of several ways. For example, a restriction endonuclease recognition site can be introduced into the nucleotide sequence of the transition peptide at a position corresponding to its C-terminal end and the same or a compatible site can be designed into the nucleotide sequence of the protein to be targeted. at its N-terminal end. Care must be taken in designing these sites to ensure that the coding sequences of the transition peptide and the second protein are kept "in frame" to allow synthesis of the desired fusion protein. In some cases, it may be preferable to remove the initiator methionine from the second protein when the new restriction site is introduced. The introduction of restriction endonuclease recognition sites into both parent molecules and their subsequent joining via recombinant DNA techniques can result in the addition of one or more extra amino acids between the transition peptide and the second protein. This generally does not affect targeting activity as long as the transition peptide cleavage site remains accessible and the function of the second protein is not altered by the addition of these extra amino acids at its N-terminus. Alternatively, the person skilled in the art can create a targeting site. precise cleavage between the transition peptide and the second protein (with or without its initiator methionine) using gene synthesis (Stemmer, et al., (1995) Gene 164:49 to 53) or similar methods. Furthermore, the transition peptide fusion can intentionally include amino acids downstream of the cleavage site. Amino acids at the N terminus of the mature protein may affect the ability of the transition peptide to target proteins to plastids and/or the efficiency of cleavage that follows protein import. This may be dependent on the protein being targeted. See, for example, Comai, et al., (1988) J. Biol. Chem. 263(29):15104 to 15109. In some embodiments, the IPD101 polypeptide is fused to a heterologous signal peptide or heterologous transit peptide.

[061] In some embodiments, fusion proteins are provided comprising an IPD101 polypeptide or chimeric IPD101 polypeptide of the disclosure represented by a formula selected from the group consisting of: wherein R1 is an IPD101 polypeptide or chimeric IPD101 polypeptide of the disclosure and R2 is a protein of interest. In some embodiments R1 and R2 are an IPD101 polypeptide or chimeric IPD101 polypeptide of the disclosure. The R1 polypeptide is fused directly or through a linker segment (L) to the R2 polypeptide. The term "directly" defines fusions in which polypeptides are joined together without a linker peptide. Thus, "L" represents a chemical bond or polypeptide segment to which both R1 and R2 are fused in frame, most commonly L is a linear peptide to which R1 and R2 are linked by amide bonds that connect the carboxy terminus of R1 to the amino of L and the carboxy terminus of L to the amino terminus of R2. By "frame-fused" we mean that there is no termination or translation stop between the reading frames of R1 and R2. The linker group (L) is generally a polypeptide between 1 and 500 amino acids in length. The linkers that join the two molecules are preferably designed to (1) allow the two molecules to fold and act independently of each other, (2) do not have a propensity to develop an ordered secondary structure, which could interfere with the functional domains of the two proteins, (3) have minimal hydrophobic or charged characteristic that can interact with the functional protein domains, and (4) provide steric separation of R1 and R2, so that R1 and R2 can interact simultaneously with their corresponding receptors in a single cell. Typically, surface amino acids in flexible protein regions include Gly, Asn and Ser. Virtually any permutation of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above criteria for a linker sequence. Other neutral amino acids, such as Thr and Ala, can also be used in the linker sequence. Additional amino acids can also be included in linkers due to the addition of unique restriction sites in the linker sequence to facilitate construction of fusions.

[062] In some embodiments, the linkers comprise sequences selected from the group of formulas: (Gly3Ser)n, (Gly4Ser)n, (Gly5Ser)n, (GlynSer)n or (AlaGlySer)n where n is an integer . An example of a highly flexible linker is the (GlySer)-rich spacer region present within the pIII protein of filamentous bacteriophages, e.g., M13 or fd bacteriophages (Schaller, et al., 1975). This region provides a long flexible spacer region between two domains of the pIII surface protein. Also included are linkers in which an endopeptidase recognition sequence is included. Such a cleavage site may be valuable for separating individual fusion components to determine whether they are properly folded and active in vitro. Examples of various endopeptidases include, but are not limited to, Plasmin, Enterokinase, Kallikrein, Urokinase, Tissue Plasminogen Activator, Clostripain, Chymosin, Collagenase, Russell's Viper Venom Protease, Post-Proline Cleavage Enzyme, V8 Protease, Thrombin and factor Xa. In some embodiments, the linker comprises the amino acids EEKKN (SEQ ID NO:61) of the multigene expression vehicle (MGEV), which is cleaved by vacuolar proteases as disclosed in U.S. Patent Application Publication No. 2007/0277263 . In other embodiments, the linker peptide segments of the hinge region of IgG, IgA, IgM, IgD, or IgE heavy chain immunoglobulins provide an angular relationship between the linked polypeptides. Particularly useful are those hinge regions in which cysteines are replaced by serines. Linkers of the present disclosure include sequences derived from the gamma 2b hinge region of murine IgG in which the cysteines have been changed to serines. Fusion proteins are not limited by the shape, size or number of linker sequences employed and the only requirement of the linker is that it not functionally and adversely interfere with the folding and function of the individual fusion molecules.

Nucleic Acid Molecules and Variants and Fragments Thereof

[063] Isolated or recombinant nucleic acid molecules comprising nucleic acid sequences encoding IPD101 polypeptides or biologically active portions thereof, as well as nucleic acid molecules sufficient for use as hybridization probes to identify nucleic acid molecules encoding the proteins with regions of sequence homology are provided. As used herein, the term "nucleic acid molecule" refers to DNA molecules (e.g., recombinant DNA, cDNA, genomic DNA, plastid DNA, mitochondrial DNA) and RNA molecules (e.g., mRNA) and analogues of DNA or RNA generated using nucleotide analogues. The nucleic acid molecule can be single-stranded or double-stranded, but preferably it is double-stranded DNA.

[064] An "isolated" nucleic acid molecule (or DNA) is used herein to refer to a nucleic acid sequence (or DNA) that is no longer in its natural environment, for example, in vitro. A “recombinant” nucleic acid molecule (or DNA) is used herein to refer to a nucleic acid (or DNA) sequence that is in a recombinant plant or bacterial host cell. In some embodiments, an "isolated" or "recombinant" nucleic acid is free of sequences (preferably protein-coding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the DNA. genomic genome of the organism from which the nucleic acid is derived. For purposes of the disclosure, "isolated" or "recombinant" when used refers to nucleic acid molecules that exclude isolated chromosomes. For example, in various embodiments, the recombinant nucleic acid molecules encoding the IPD101 polypeptides may contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of sequences. of nucleic acid that naturally flank the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid is derived.

[065] In some embodiments, an isolated nucleic acid molecule encoding IPD101 polypeptides has one or more changes in the nucleic acid sequence compared to the native or genomic nucleic acid sequence. In some embodiments, the change in the native or genomic nucleic acid sequence includes, but is not limited to: changes in the nucleic acid sequence due to degeneration of the genetic code; changes in the nucleic acid sequence due to amino acid substitution, insertion, deletion and/or addition compared to the native or genomic sequence; removal of one or more introns; deletion of one or more upstream or downstream regulatory regions; and deletion of the 5' and/or 3' untranslated region associated with the genomic nucleic acid sequence. In some embodiments, the nucleic acid molecule encoding an IPD101 polypeptide is a non-genomic sequence.

[066] A variety of polynucleotides encoding IPD101 polypeptides or related proteins are contemplated. Such polynucleotides are useful for producing IPD101 polypeptides in host cells when operably linked to a suitable promoter, transcription termination and/or polyadenylation sequence. Such polynucleotides are also useful as probes for isolating homologous or substantially homologous polynucleotides encoding IPD101 polypeptides or related proteins.

Polynucleotides encoding IPD101 polypeptides

[067] A source of polynucleotides encoding IPD101 polypeptides or related proteins is a Lysinibacillus bacterium, which can contain an IPD101 polynucleotide of any of the SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 19 , 21, or 23, which encodes an IPD101 polypeptide of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 20, 22, or 24, respectively. The polynucleotides of any one or more of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 27, 31, 45, 47, 49, 51, 53 , 55, 57, or 59, can be used to express IPD101 polypeptides in recombinant bacterial hosts that include, but are not limited to, Bacillus, Escherichia, Salmonella, Lysinibacillus, Acetobacter, Pseudomonas, and Rhizobium bacterial host cells. Polynucleotides are also useful as probes for isolating homologous or substantially homologous polynucleotides encoding IPD101 polypeptides or related proteins. Such probes can be used to identify homologues or substantially homologous polynucleotides derived from Pseudomonas species.

[068] Polynucleotides encoding IPD101 polypeptides can also be synthesized de novo from an IPD101 polypeptide sequence. The polynucleotide gene sequence can be deduced from an IPD101 polypeptide sequence through the use of the genetic code. Computer programs such as "BackTranslate" (GCG™ Package, Acclerys, Inc. San Diego, California) can be used to convert a peptide sequence into the corresponding nucleotide sequence encoding the peptide. Examples of IPD101 polypeptide sequences that can be used to obtain corresponding nucleotide coding sequences include, but are not limited to, the IPD101 polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 , 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60. Furthermore, synthetic IPD101 polynucleotide sequences of the disclosure can be designed from to be expressed in plants.

[069] In some embodiments, the nucleic acid molecule that encodes an IPD101 polypeptide is a polynucleotide that has the sequence shown in any of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17 , 19, 21, 23, 27, 31, 45, 47, 49, 51, 53, 55, 57, or 59, and variants, fragments and complements thereof. "Complement" is used herein to refer to a nucleic acid sequence that is sufficiently complementary to a given nucleic acid sequence so that it can hybridize to the given nucleic acid sequence to thereby form a stable duplex. “Polynucleotide sequence variants” is used herein to refer to a nucleic acid sequence that, except for degeneracy of the genetic code, encodes the same polypeptide.

[070] In some embodiments, the nucleic acid molecule encoding the IPD101 polypeptide is a non-genomic nucleic acid sequence. As used herein, a "non-genomic nucleic acid sequence" or "non-genomic nucleic acid molecule" or "non-genomic polynucleotide" refers to a nucleic acid molecule that has one or more changes in the nucleic acid sequence in comparison to a native or genomic nucleic acid sequence. In some embodiments, the change to a native or genomic nucleic acid molecule includes, but is not limited to: changes in the nucleic acid sequence due to degeneration of the genetic code; optimization of nucleic acid sequence for expression in plants; changes in the nucleic acid sequence to introduce at least one amino acid substitution, insertion, deletion and/or addition compared to the native or genomic sequence; removing one or more introns associated with the genomic nucleic acid sequence; insertion of one or more heterologous introns; deletion of one or more upstream or downstream regulatory regions associated with the genomic nucleic acid sequence; insertion of one or more heterologous upstream or downstream regulatory regions; deletion of the 5' and/or 3' untranslated region associated with the genomic nucleic acid sequence; insertion of a heterologous 5' and/or 3' untranslated region; and modification of a polyadenylation site. In some embodiments, the nongenomic nucleic acid molecule is a synthetic nucleic acid sequence.

[071] In some embodiments, the nucleic acid molecule encoding an IPD101 polypeptide disclosed herein is a non-genomic polynucleotide that has a nucleotide sequence that is at least 50%, 51%, 52%, 53%, 54% , 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity with the nucleic acid sequence of any of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 27, 31, 45, 47, 49, 51, 53, 55, 57, or 59, where the IPD101 polypeptide has insecticidal activity.

[072] In some embodiments, the nucleic acid molecule encodes a variant of the IPD101 polypeptide that comprises one or more amino acid substitutions in the amino acid sequence of any of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60.

[073] Nucleic acid molecules are also provided that encode transcription and/or translation products that are subsequently joined to ultimately produce functional IPD101 polypeptides. Joining can be achieved in vitro or in vivo, and can involve cis or trans joining. The substrate for splicing can be polynucleotides (e.g., RNA transcripts) or polypeptides. An example of cis-joining of a polynucleotide is when an intron inserted into a coding sequence is removed and the two flanking exon regions are joined to generate an IPD101 polypeptide coding sequence. An example of trans splicing would be when a polynucleotide is encrypted by separating the coding sequence into two or more fragments that can be separately transcribed and then subjected to splicing to form the full-length pesticide coding sequence. The use of a splice enhancing sequence, which can be introduced into a construct, can facilitate splicing in cis or trans splicing of polypeptides (U.S. Patent Nos. 6,365,377 and 6,531,316). Thus, in some embodiments, the polynucleotides do not directly encode a full-length IPD101 polypeptide, but instead encode a fragment or fragments of an IPD101 polypeptide. These polynucleotides can be used to express a functional IPD101 polypeptide through a mechanism involving splicing, where splicing can occur at the level of the polynucleotide (e.g., intron/exon) and/or the polypeptide (e.g., intein/extein). . This can be useful, for example, in controlling the expression of pesticidal activity, since a functional pesticidal polypeptide will only be expressed if all required fragments are expressed in an environment that allows the joining processes to generate the functional product. In another example, the introduction of one or more insertion sequences into a polynucleotide can facilitate recombination with a low homology polynucleotide; the use of an intron or intein for the insertion sequence facilitates removal of the intervening sequence, thereby restoring the function of the encoded variant.

[074] Nucleic acid molecules that are fragments of these nucleic acid sequences that encode IPD101 polypeptides are also encompassed by the embodiments. “Fragment” as used herein refers to a portion of the nucleic acid sequence that encodes an IPD101 polypeptide. A fragment of a nucleic acid sequence may encode a biologically active portion of an IPD101 polypeptide or the same may be a fragment that can be used as a hybridization probe or PCR primer using methods disclosed below. Nucleic acid molecules are fragments of a nucleic acid sequence encoding an IPD101 polypeptide comprising at least about 150, 180, 210, 240, 270, 300, 330, 360, 400, 450 or 500, contiguous nucleotides or up to the number of nucleotides present in a full-length nucleic acid sequence encoding an IPD101 polypeptide disclosed herein, depending on the intended use." "Contiguous nucleotides" is used herein to refer to nucleotide residues that are immediately adjacent to each other. Fragments of the nucleic acid sequences of embodiments will encode protein fragments that retain the biological activity of the IPD101 polypeptide and, therefore, retain insecticidal activity. “Retains insecticidal activity” is used herein to refer to a polypeptide that is at least about 10%, at least about 30%, at least about 50%, at least about 70%, 80%, 90 %, 95% or more of the insecticidal activity of any of the full-length IPD101 polypeptides set forth in SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60. In some embodiments, the insecticidal activity is against a species of Lepidoptera. In one embodiment, the insecticidal activity is against a species of Coleoptera. In some embodiments, the insecticidal activity is against one or more insect pests of the corn rootworm complex: Corn Rootworm, Diabrotica virgifera; northern corn rootworm, D. barberi: southern corn rootworm or root borer; Diabrotica undecimpunctata howardi, Diabrotica speciosa and the Mexican corn rootworm, D. virgifera zeae. In one embodiment, the insecticidal activity is against a species of Diabrotica.

[075] In some embodiments, the IPD101 polypeptide is encoded by a nucleic acid sequence sufficiently homologous to any of the nucleic acid sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17 , 19, 21, 23, 27, 31, 45, 47, 49, 51, 53, 55, 57, or 59.

[076] To determine the percentage identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for ideal comparison purposes. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity = number of identical positions/total number of positions (e.g., overlapping positions)x100). In one embodiment, the two sequences are the same length. In another embodiment, the comparison is across the entirety of the reference sequence (e.g., across the entirety of SEQ ID NO: 1). The percent identity between two sequences can be determined using techniques similar to those described below, with or without allowing for gaps. When calculating percent identity, exact matches are usually counted.

[077] Another non-limiting example of a mathematical algorithm used for comparing sequences is the algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48(3):443 to 453, used GAP Version 10 software to determine sequence identity or similarity using the following standard parameters: % identity and % similarity for a nucleic acid sequence using GAP Weight of 50 and Length Weight of 3, and the scoring matrix from nwsgapdna.cmpii; % Identity or % Similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2 and the BLOSUM62 scoring program. Equivalent programs can also be used. "Equivalent program" is used herein to refer to any sequence comparison program that, for any two sequences in question, generates an alignment that has identical nucleotide residue combinations and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.

[078] In some embodiments, an IPD101 polynucleotide encodes an IPD101 polypeptide comprising an amino acid sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity across the entire length of the amino acid sequence of any one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60.

[079] In some embodiments, polynucleotides are provided encoding chimeric polypeptides that comprise regions of at least two different IPD101 polypeptides of the disclosure.

[080] In some embodiments, polynucleotides are provided encoding chimeric polypeptides that comprise an N-terminal region of a first IPD101 polypeptide of the disclosure operatively fused to a C-terminal region of a second IPD101 polypeptide of the disclosure.

[081] Embodiments also encompass nucleic acid molecules that encode IPD101 polypeptide variants. "Variants" of the nucleic acid sequences encoding the IPD101 polypeptide include those sequences that encode the IPD101 polypeptides disclosed herein, but which differ conservatively due to degeneracy of the genetic code as well as those that are sufficiently identical as discussed above. Naturally occurring nucleic acid sequences can be identified using known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques as outlined above. Variant nucleic acid sequences also include synthetically derived nucleic acid sequences that have been generated , for example, with the use of site-directed mutagenesis, but which still encode the IPD101 polypeptides disclosed as discussed below.

[082] The present disclosure provides isolated or recombinant polynucleotides encoding any of the IPD101 polypeptides disclosed herein. Those individuals who have ordinary skill in the art will readily observe that, due to the degeneracy of the genetic code, there exists a multiplicity of nucleotide sequences that encode IPD101 polypeptides of the present disclosure.

[083] The person skilled in the art will observe that changes can be introduced by mutating the nucleic acid sequences which leads to changes in the amino acid sequence of the encoded IPD101 polypeptides, without altering the biological activity of the proteins. Therefore, variant nucleic acid molecules can be created by introducing one or more nucleotide substitutions, additions and/or deletions into the corresponding nucleic acid sequences disclosed herein, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques such as site-directed mutagenesis and PCR-mediated mutagenesis. Such variant nucleic acid sequences are also encompassed by the present disclosure.

[084] Alternatively, variant nucleic acid sequences can be made by introducing mutations randomly throughout all or part of the coding sequence, such as by saturation mutagenesis, and the resulting mutants can be screened for the ability to confer pesticidal activity. to identify mutants that retain activity. After mutagenesis, the encoded protein can be expressed recombinantly and the activity of the protein can be determined using standard assay techniques.

[085] The disclosure polynucleotides and fragments thereof are optionally used as substrates for a variety of recombination and recursive recombination reactions, in addition to standard cloning methods, as set forth in, for example, Ausubel, Berger and Sambrook, i.e. to produce additional pesticide polypeptide homologues and fragments thereof with desired properties. A variety of such reactions are known. Methods for producing a variant of any nucleic acid listed herein comprising recursively recombining such polynucleotide with a second (or more) polynucleotide, thereby forming a library of variant polynucleotides are also embodiments of the disclosure, as well as the libraries produced, the cells comprising the libraries and any recombinant polynucleotide produced by such methods. Additionally, such methods optionally comprise selecting a variant polynucleotide from such libraries based on pesticidal activity, wherein such recursive combination is made in vitro or in vivo.

[086] A variety of diversity generating protocols, including recursive nucleic acid recombination protocols, are available and fully described in the art. The procedures can be used separately, and/or in combination to produce one or more variants of a nucleic acid or set of nucleic acids, as well as encoded protein variants. Individually and collectively, these procedures provide broadly applicable and robust ways to generate diverse nucleic acids and sets of nucleic acids (including, e.g., nucleic acid libraries) useful, e.g., for the rapid design or evolution of nucleic acids, proteins, pathways, cells and/or organisms with new and/or improved characteristics.

[087] Although distinctions and classifications will be made in the course of the discussion for clarity, it will be noted that the techniques are typically not mutually exclusive. Of course, the various methods can be used singly or in combination, in parallel or in series, to access several sequence variants.

[088] The result of any of the diversity generation procedures described herein can be the generation of one or more nucleic acids, which can be selected or screened for nucleic acids with or that confer desirable properties or that encode proteins with or that confer desirable properties. After diversification by one or more of the methods herein or otherwise available to a person skilled in the art, any nucleic acids that are produced can be selected for a desired activity or property, e.g., pesticidal activity or such activity at a desired pH, etc. This may include identifying any activity that can be detected, for example, in an automated or automatable format, by any of the assays in the art, see, for example, the discussion of insecticidal activity screening, infra. A variety of related (or even unrelated) properties can be evaluated, in series or in parallel, at the discretion of the practitioner.

[089] Descriptions of a variety of diversity generation procedures for generating modified nucleic acid sequences, for example, those encoding polypeptides that have pesticidal activity or fragments thereof, are found in the following publications and in the references cited therein : Soong, et al., (2000) Nat Genet 25(4):436 to 439; Stemmer, et al., (1999) Tumor Targeting 4:1 to 4; Ness, et al., (1999) Nat Biotechnol 17:893 to 896; Chang, et al., (1999) Nat Biotechnol 17:793 to 797; Minshull and Stemmer, (1999) Curr Opin Chem Biol 3:284 to 290; Christians, et al., (1999) Nat Biotechnol 17:259 to 264; Crameri, et al., (1998) Nature 391:288 to 291; Crameri, et al., (1997) Nat Biotechnol 15:436 to 438; Zhang, et al., (1997) PNAS USA 94:4504 to 4509; Patten, et al., (1997) Curr Opin Biotechnol 8:724 to 733; Crameri, et al., (1996) Nat Med 2:100 to 103; Crameri, et al., (1996) Nat Biotechnol 14:315 to 319; Gates, et al., (1996) J Mol Biol 255:373 to 386; Stemmer, (1996) "Sexual PCR and Assembly PCR" in: The Encyclopedia of Molecular Biology. VCH Publishers, New York. pages 447 to 457; Crameri and Stemmer, (1995) BioTechniques 18:194 to 195; Stemmer, et al., (1995) Gene, 164:49 to 53; Stemmer, (1995) Science 270: 1510; Stemmer, (1995) Bio/Technology 13:549 to 553; Stemmer, (1994) Nature 370:389 to 391 and Stemmer, (1994) PNAS USA 91:10747 to 10751.

[090] Mutational methods of generating diversity include, for example, site-directed mutagenesis (Ling, et al., (1997) Anal Biochem 254(2):157 to 178; Dale, et al., (1996) Methods Mol Biol 57:369 to 374; Smith, (1985) Ann Rev Genet 19:423 to 462; Botstein and Shortle, (1985) Science 229:1,193 to 1201; Carter, (1986) Biochem J 237:1 to 7 and Kunkel , (1987) "The efficiency of oligonucleotide directed mutagenesis" in Nucleic Acids & Molecular Biology (Eckstein and Lilley, eds., Springer Verlag, Berlin)); mutagenesis using templates containing uracil (Kunkel, (1985) PNAS USA 82:488 to 492; Kunkel, et al., (1987) Methods Enzymol 154:367 to 382 and Bass, et al., (1988) Science 242:240 to 245); oligonucleotide-directed mutagenesis (Zoller and Smith, (1983) Methods Enzymol 100:468 to 500; Zoller and Smith, (1987) Methods Enzymol 154:329 to 350 (1987); Zoller and Smith, (1982) Nucleic Acids Res 10: 6,487 to 6,500), phosphorothioate-modified DNA mutagenesis (Taylor, et al., (1985) Nucl Acids Res 13:8,749 to 8,764; Taylor, et al., (1985) Nucl Acids Res 13:8,765 to 8,787 (1985) ; Nakamaye and Eckstein, (1986) Nucl Acids Res 14:9,679 to 9,698; Sayers, et al., (1988) Nucl Acids Res 16:791 to 802 and Sayers, et al., (1988) Nucl Acids Res 16:803 to 814); mutagenesis using incomplete duplex DNA (Kramer, et al., (1984) Nucl Acids Res 12:9,441 to 9,456; Kramer and Fritz, (1987) Methods Enzymol 154:350 to 367; Kramer, et al., (1988 ) Nucl Acids Res 16:7,207 and Fritz, et al., (1988) Nucl Acids Res 16:6,987 to 6,999).

[091] Additional suitable methods include mismatch point repair (Kramer, et al., (1984) Cell 38:879 to 887), mutagenesis with the use of repair-deficient host strains (Carter, et al., ( 1985) Nucl Acids Res 13:4431 to 4443 and Carter, (1987) Methods in Enzymol 154:382 to 403), deletion mutagenesis (Eghtedarzadeh and Henikoff, (1986) Nucl Acids Res 14:5115), restriction selection and purification restriction (Wells, et al., (1986) Phil Trans R Soc Lond A 317:415 to 423), mutagenesis by total gene synthesis (Nambiar, et al., (1984) Science 223:1,299 to 1,301; Sakamar and Khorana, (1988) Nucl Acids Res 14:6,361 to 6,372; Wells, et al., (1985) Gene 34:315 to 323 and Grundstrom, et al., (1985) Nucl Acids Res 13:3,305 to 3,316), repair double-strand break (Mandecki, (1986) PNAS USA, 83:7,177 to 7,181 and Arnold, (1993) Curr Opin Biotech 4:450 to 455). Additional details of many of the above methods can be found in Methods Enzymol Volume 154, which also describes controls useful for troubleshooting problems with various mutagenesis methods.

[092] Additional details regarding various diversity generating methods can be found in the following U.S. Patents, PCT applications and publications and EPO publications: U.S. Patent No. 5,723,323, U.S. Patent No. 5,763. 192, U.S. Patent No. 5,814,476, U.S. Patent No. 5,817,483, U.S. Patent No. 5,824,514, U.S. Patent No. 5,976,862, U.S. Patent No. 5,605. 793, U.S. Patent No. 5,811,238, U.S. Patent No. 5,830,721, U.S. Patent No. 5,834,252, U.S. Patent No. 5,837,458, Document No. WO 1995/22625 , document no. WO 1996/33207, document no. WO 1997/20078, document no. WO 1997/35966, document no. WO 1999/41402, document no. WO 1999/41383, document no. WO 1999/41369, document no. WO 1999/41368, document no. EP 752008, document no. EP 1012670, document no. WO 1999/23107, document no. WO 1999/21979, document no. WO 1998/31837, document no. WO 1998/27230, document no. WO 1998/27230, document no. WO 2000/00632, document no. WO 2000/09679, document no. WO 1998/42832, document no. WO 1999/29902, document no. WO 1998/41653, document no. WO 1998/41622, document no. WO 1998/42727, document no. WO 2000/18906, document no. WO 2000/04190, document no. WO 2000/42561, document no. WO 2000/42559, document no. WO 2000/42560, document no. WO 2001/23401 and document no. PCT/US01/06775.

[093] The nucleotide sequences of the embodiments can also be used to isolate the corresponding sequences from a bacterial source, including, but not limited to, a Pseudomonas species. In this way, methods such as PCR, hybridization and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences that are selected based on their sequence identity with the entire sequences set forth herein or with fragments thereof are encompassed by the embodiments. Such sequences include sequences that are orthologous to the disclosed sequences. The term "orthologs" refers to genes that are derived from a common ancestral gene and are found in different species as a result of speciation. Genes found in different species are considered orthologous when their nucleotide sequences and/or their encoded protein sequences share substantial identity, as defined elsewhere herein. The functions of orthologs are often highly conserved across species.

[094] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2nd edition, Cold Spring Harbor Laboratory Press, Plainview, New York), later in this document, "Sambrook". Also see Innis, et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known PCR methods include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene specific primers, vector specific primers, partially mispaired primers, and the like.

[095] To identify potential IPD101 polypeptides from bacterial collections, bacterial cell lysates can be screened with antibodies generated against IPD101 polypeptides using Western blotting and/or ELISA methods. This type of assay can be performed in a high-throughput mode. Positive samples can be further analyzed by various techniques such as purification and antibody-based protein identification. Methods for generating antibodies are well known in the art, as discussed below.

[096] Alternatively, the mass spectrometry-based protein identification method can be used to identify homologues of IPD101 polypeptides using protocols in the literature (Scott Patterson, (1998), 10.22, 1 to 24, Current Protocol in Molecular Biology published by John Wiley & Son Inc.). Specifically, the LC-MS/MS-based protein identification method is used to associate MS data from given cell lysate or samples enriched with desired molecular weight (excised from the SDS-PAGE gel of bands of molecular weight relevant to IPD101 polypeptides) with sequence information of an IPD101 polypeptide disclosed herein. Any matches in peptide sequences indicate the potential for having homologous proteins in the samples. Additional techniques (protein purification and molecular biology) can be used to isolate the protein and identify homologous sequences.

[097] In hybridization methods, all or part of the pesticide nucleic acid sequence can be used to screen cDNA or genomic libraries. Methods for constructing such cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook and Russell, (2001), supra. So-called hybridization probes can be fragments of genomic DNA, fragments of cDNA, fragments of RNA or other oligonucleotides and can be identified with a detectable group such as 32P or any other detectable label such as other radioisotopes, a fluorescent compound, an enzyme or an enzyme cofactor. Probes for hybridization can be produced by identifying synthetic oligonucleotides based on the IPD101 polypeptide-encoding nucleic acid sequences disclosed herein. Degeneration primers designed based on conserved nucleotides or amino acid residues in the nucleic acid sequences or encoded amino acid sequence can additionally be used. The probe typically comprises a region of nucleic acid sequence that hybridizes under stringent conditions to at least about 12, at least about 25, at least about 50, 75, 100, 125, 150, 175, or 200 consecutive nucleotides of sequences. of nucleic acids encoding IPD101 polypeptides of the disclosure or a fragment or variant thereof. Methods for preparing probes for stringency and hybridization conditions are generally known in the art and are disclosed in Sambrook and Russell, (2001), supra, incorporated herein by reference.

[098] For example, an entire nucleic acid sequence encoding an IPD101 polypeptide disclosed herein or one or more portions thereof can be used as a probe capable of specifically hybridizing to corresponding nucleic acid sequences encoding sequences of the IPD101 polypeptide type and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique and are preferably at least about 10 nucleotides in length or at least about 20 nucleotides in length. Such probes can be used to amplify corresponding pesticide sequences from a chosen organism by PCR. This technique can be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include hybridization screening of plated DNA libraries (plates or colonies; see, e.g., Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

[099] Hybridization of such sequences can be performed under stringent conditions. "String conditions" or "stringent hybridization conditions" is used herein to refer to conditions under which a probe will hybridize to its targeted sequence to a greater degree detectably than other sequences (e.g., at least 2 times on the bottom). The stringent conditions are sequence dependent and will be different in different circumstances. By controlling the stringency of hybridization and/or washing conditions, targeted sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, the stringency conditions can be adjusted to allow for some mismatch in the sequences so that lesser degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1,000 nucleotides in length, preferably less than 500 nucleotides in length.

Antibodies

[0100] Antibodies to an IPD101 polypeptide of the embodiments or to variants or fragments thereof are also encompassed. The antibodies of the disclosure include polyclonal and monoclonal antibodies as well as fragments thereof that retain their ability to bind to an IPD101 polypeptide. An antibody, monoclonal antibody or fragment thereof is said to have the ability to bind a molecule if it has the ability to specifically react with the molecule to thereby bind the molecule to the antibody, monoclonal antibody or fragment thereof. The term "antibody" (Ab) or "monoclonal antibody" (Mab) is intended to include intact molecules, as well as fragments or linker regions or domains thereof (such as, for example, Fab and F(ab).sub fragments. 2) that have the ability to bind hapten. Such fragments are typically produced by proteolytic cleavage, such as papain or pepsin. Alternatively, hapten linker fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry. Methods for preparing the antibodies of the present disclosure are generally known in the art. For example, see Antibodies, A Laboratory Manual, Ed Harlow and David Lane (eds.) Cold Spring Harbor Laboratory, N.Y. (1988), as well as the references cited therein. Standard reference works that establish the general principles of immunology include: Klein, J. Immunology: The Science of Cell-Noncell Discrimination, John Wiley & Sons, N.Y. (1982); Dennett, et al., Monoclonal Antibodies, Hybridoma: A New Dimension in Biological Analyzes, Plenum Press, N.Y. (1980) and Campbell, "Monoclonal Antibody Technology," In Laboratory Techniques in Biochemistry and Molecular Biology, Volume 13, Burdon, et al. ., (eds.), Elsevier, Amsterdam (1984). Also see U.S. Patent Nos. 4,196,265; 4,609,893; 4,713,325; 4,714,681; 4,716,111; 4,716,117 and 4,720,459. Antibodies against IPD101 polypeptides or antigen-binding portions thereof can be produced by a variety of techniques, including conventional monoclonal antibody methodology, for example, the standard somatic cell hybridization technique of Kohler and Milstein, (1975) Nature 256 :495. Other techniques for producing monoclonal antibody can also be employed, such as viral or oncogenic transformation of B lymphocytes. An animal system for preparing hybridomas is a murine system. Immunization protocols and techniques for isolating immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known. The disclosure antibody and monoclonal antibodies can be prepared using an IPD101 polypeptide as antigens.

[0101] A kit is provided for detecting the presence of an IPD101 polypeptide, or detecting the presence of a nucleotide sequence encoding an IPD101 polypeptide, in a sample. In one embodiment, the kit provides antibody-based reagents to detect the presence of an IPD101 polypeptide in a tissue sample. In another embodiment, the kit provides identified nucleic acid probes useful for detecting the presence of one or more polynucleotides encoding an IPD101 polypeptide. The kit is provided along with appropriate reagents and controls to perform a detection method, as well as instructions for using the kit.

Receptor identification and isolation

[0102] Receptors for the IPD101 polypeptides of the embodiments or for variants or fragments thereof are also covered. Methods for identifying receptors are well known in the art (see Hofmann, et. al., (1988) Eur. J. Biochem. 173:85 to 91; Gill, et al., (1995) J. Biol. Chem. 27,277 to 27,282) and can be used to identify and isolate the receptor that recognizes the IPD101 polypeptide using the brush border membrane vesicles of susceptible insects. In addition to the radioactive identification method listed in the cited literatures, an IPD101 polypeptide can be identified with fluorescent dye and other common identifications such as streptavidin. Brush border membrane vesicles (BBMV) from susceptible insects, such as caterpillars and stink bugs, can be prepared according to the protocols listed in the Hofmann and Gill references above and separated on an SDS-PAGE gel and transferred to suitable membrane. The identified IPD101 polypeptide can be incubated with transferred BBMV membrane and the identified IPD101 polypeptide can be identified with the identified reporters. Identification of protein band (or bands) that interact with the IPD101 polypeptide can be detected using N-terminal amino acid gas-phase sequencing or mass spectrometry-based protein identification method (Patterson, (1998) 10.22, 1 to 24, Current Protocol in Molecular Biology published by John Wiley & Son Inc). Once the protein is identified, the corresponding gene can be cloned from the genomic DNA or cDNA library of susceptible insects and the binding affinity can be measured directly with the IPD101 polypeptide. The receptor function for insecticidal activity by the IPD101 polypeptide can be verified by the RNAi type of gene knock-out method (Rajagopal, et al., (2002) J. Biol. Chem. 277:46,849 to 46,851).

Nucleotide Constructs, Expression Cassettes and Vectors

[0103] The use of the term "nucleotide constructs" herein is not intended to limit the embodiments to nucleotide constructs that comprise DNA. Those skilled in the art will recognize that nucleotide constructs, particularly polynucleotides and oligonucleotides composed of ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides, may also be employed in the methods disclosed herein. The nucleotide constructs, nucleic acids, and nucleotide sequences of the embodiments further encompass all complementary forms of such constructs, molecules, and sequences. Additionally, the nucleotide constructs, nucleotide molecules, and nucleotide sequences of the embodiments encompass all nucleotide constructs, molecules, and sequences that may be employed in the methods of the embodiments for transforming plants that include, but are not limited to, those comprised of deoxyribonucleotides, ribonucleotides and combinations thereof. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The nucleotide constructs, nucleic acids, and nucleotide sequences of the embodiments also encompass all forms of nucleotide constructs including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem and loop structures, and the like.

[0104] An additional embodiment refers to a transformed organism, such as an organism selected from plant and insect cells, bacteria, yeast, baculovirus, protozoa, nematodes and algae. The transformed organism comprises a DNA molecule of the embodiments, an expression cassette comprising the DNA molecule, or a vector comprising the expression cassette, which can be stably incorporated into the genome of the transformed organism.

[0105] The sequences of the modalities are provided in DNA constructs for expression in the organism of interest. The construct will include 5' and 3' regulatory sequences operably linked to a sequence of the embodiments. The term "operatively linked", as used herein, refers to a functional link between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the linking nucleic acid sequences are contiguous and where necessary to join two protein coding regions in the same reading frame. The construct may additionally contain at least one additional gene to be cotransformed in the organism. Alternatively, the additional gene(s) may be provided in multiple DNA constructs.

[0106] Such DNA construct is provided with a plurality of restriction sites for the insertion of the IPD101 polypeptide gene sequence of the disclosure to be under the transcriptional regulation of the regulatory regions. The DNA construct may additionally contain selectable marker genes.

[0107] The DNA construct will generally include in the 5' to 3' direction of transcription: a transcription and translation initiation region (i.e., a promoter), a DNA sequence of the embodiments, and a transcription termination region and translation (i.e., termination region) functional in the organism that serves as a host. The transcription initiation region (i.e., the promoter) may be native, analogous, foreign, or heterologous to the host organism and/or the sequence of the modalities. Additionally, the promoter may be the natural sequence or alternatively a synthetic sequence. The term "foreign" as used herein indicates that the promoter is not found in the native organism into which the promoter is introduced. When the promoter is "foreign" or "heterologous" to the sequence of the embodiments, the promoter is intended to be non-native or a naturally occurring promoter for the operably linked sequence of the embodiments. As used herein, a chimeric gene comprises a coding sequence operatively linked to a transcription initiation region that is heterologous to the coding sequence. When the promoter is a native or natural sequence, expression of the operably linked sequence is altered from wild-type expression which results in a change in phenotype.

[0108] In some embodiments, the DNA construct comprises a polynucleotide encoding an IPD101 polypeptide of the embodiments. In some embodiments, the DNA construct comprises a polynucleotide encoding a fusion protein comprising an IPD101 polypeptide of the embodiments.

[0109] In some embodiments, the DNA construct may also include a transcription enhancement sequence. As used herein, the term an "enhancer" refers to a DNA sequence that can stimulate promoter activity and may be an innate promoter element or a heterologous element inserted to enhance the level or tissue specificity of a district Attorney. Various enhancers are known in the art including, for example, introns with gene expression enhancing properties in plants (Publication Patent Application Number US 2009/0144863, the ubiquitin intron (i.e., the maize 1 ubiquitin intron). see, for example, NCBI sequence S94464)), the omega enhancer or the omega primer enhancer (Gallie, et al., (1989) Molecular Biology of RNA ed. Cech (Liss, New York) 237 to 256 and Gallie, et al., (1987) Gene 60:217 to 225), the CaMV 35S enhancer (see, e.g., Benfey, et al., (1990) EMBO J. 9:1685 to 1696) and the US Patent Number 7,803,992 may also be used. The above list of transcription enhancers is not intended to be limiting. Any appropriate transcription enhancer may be used in the embodiments.

[0110] The termination region may be native to the transcription initiation region, may be native to the DNA sequence of interest operably linked, may be native to the plant host, or may be derived from another source (i.e. is, foreign or heterologous to the promoter, the sequence of interest, the plant host, or any combination thereof).

[0111] Convenient termination regions are available from the A. tumefaciens Ti plasmid, such as the octopine synthase and nopaline synthase termination regions. Also see Guerineau, et al., (1991) Mol. Gen. Genet. 262:141 to 144; Proudfoot, (1991) Cell 64:671 to 674; Sanfacon, et al., (1991) Genes Dev. 5:141 to 149; Mogen, et al., (1990) Plant Cell 2:1261 to 1272; Munroe, et al., (1990) Gene 91:151 to 158; Ballas, et al., (1989) Nucleic Acids Res. 17:7891 to 7903 and Joshi, et al., (1987) Nucleic Acids Res. 15:9627 to 9639.

[0112] When appropriate, a nucleic acid can be optimized for increased expression in the host organism. Thus, when the host organism is a plant, synthetic nucleic acids can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri, (1990) Plant Physiol. 92:1 to 11 for a discussion of preferred host use. For example, although the nucleic acid sequences of the embodiments may be expressed in both monocot and dicot plant species, the sequences may be modified to represent the specific preferences and GC content preferences of monocots or dicots, since These preferences have been shown to differ (Murray et al. (1989) Nucleic Acids Res. 17:477 to 498). Thus, the most preferred amino acid for a particular amino acid can be derived from known gene sequences. The use of maize for 28 maize plant genes is listed in Table 4 of Murray, et al., supra. Methods are available in the art to synthesize preferred genes for plants. See, for example, Murray, et al., (1989) Nucleic Acids Res. 17:477 to 498, and Liu H et al. Mol Bio Rep 37:677 to 684, 2010, incorporated into this document by reference. A Zea maize usage table can also be found at kazusa.ou.jp//cgi-bin/show.cgi?species=4577, which can be accessed using the prefix www. A table of Glycine max usage can be found at kazusa.ou.jp//cgi- bin/show.cgi?species=3847&aa=1&style=N, which can be accessed using the prefix www.

[0113] In some embodiments, the recombinant nucleic acid molecule encoding an IPD101 polypeptide has maize-optimized codons.

[0114] Additional sequence modifications are known to enhance gene expression in a cellular host. These include the elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other well-characterized sequences that may be detrimental to gene expression. The GC content of the sequence can be adjusted to average levels for a given cellular host, as calculated by reference to known genes expressed in the host cell. The term "host cell", as used herein, refers to a cell that contains a vector and supports the replication and/or expression of the intended expression vector. Host cells can be prokaryotic cells, such as E. coli, or eukaryotic cells, such as yeast, insect, amphibian, or mammalian cells, or cells from monocotyledonous or dicot plants. An example of a monocot host cell is a maize host cell. When possible, the sequence is modified to avoid predicted secondary hairpin mRNA structures.

[0115] Expression cassettes may additionally contain 5' leader sequences. Such leader sequences may act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, e.g., EMCV leader (Encephalomyocarditis 5' non-coding region) (Elroy-Stein, et al., (1989) Proc. Natl. Acad. Sci. USA 86:6,126 to 6,130); potyvirus leaders, e.g., TEV (Tobacco Engraved Virus) leader (Gallie, et al., (1995) Gene 165(2):233 to 238), MDMV (Maize Dwarf Mosaic Virus) leader, human immunoglobulin heavy chain (BiP) (Macejak, et al., (1991) Nature 353:90 to 94); untranslated leader of alfalfa mosaic virus coat protein mRNA (AMV RNA 4) (Jobling, et al., (1987) Nature 325:622 to 625); leader of tobacco mosaic virus (TMV) (Gallie, et al., (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pages 237 to 256) and leader of maize chlorotic spot virus (MCMV) (Lommel, et al., (1991) Virology 81:382 to 385). Also see Della-Cioppa, et al., (1987) Plant Physiol. 84:965 to 968. Such constructs also contain a "signal sequence" or "leader sequence" to facilitate cotranslational or posttranslational transport of the peptide to certain intracellular structures, such as the chloroplast (or other plastid), endoplasmic reticulum, or of Golgi.

[0116] “Signal sequence”, as used herein, refers to a sequence that is known or suspected to result in co-translational or post-translational peptide transport across the cell membrane. In eukaryotes, this involves typically secretion in the Golgi apparatus with some resulting in glycosylation. Bacterial insecticidal toxins are often synthesized as pro-toxins that are proteolytically activated in the stomach of the target pest (Chang, (1987) Methods Enzymol. 153:507-516). In some embodiments, the signal sequence is located in the native sequence or may be derived from a sequence of the embodiments. "Leader sequence" as used herein refers to any sequence that, when translated, results in a sufficient amino acid sequence to trigger cotranslational transport of the peptide chain to a subcellular organelle. Thus, this includes leader sequences that direct transport and/or glycosylation through passage in the endoplasmic reticulum, passage into vacuoles, plastids including chloroplasts, mitochondria and the like. Nuclear-encoded proteins targeting the chloroplast thylakoid lumen compartment have a characteristic bipartite transition peptide, composed of a stromal-targeting signal peptide and a lumen-targeting signal peptide. The stromal targeting information is in the aminoproximal portion of the transition peptide. The lumen-targeting signal peptide is in the carboxyl-proximal portion of the transition peptide and contains all the information for lumen targeting. Recent research in higher plant chloroplast proteomics has achieved the identification of several nuclear-encoded lumen proteins (Kieselbach et al. FEBS LETT 480:271 to 276, 2000; Peltier et al. Plant Cell 12:319 to 341, 2000; Bricker et al. Biochim. Biophys Acta 1503:350 to 356, 2001), whose lumen-targeting signal peptide can potentially be used in accordance with the present disclosure. About 80 Arabidopsis proteins, as well as homologous proteins from spinach and pea, are reported by Kieselbach et al., Photosynthesis Research, 78:249 to 264, 2003. In particular, Table 2 of that publication, which is incorporated into the description of this document by way of reference, discloses 85 chloroplast lumen proteins, identified by their accession number (also see U.S. Patent Application Publication No. 2009/09044298).

[0117] Suitable chloroplast transition peptides (CTP) are well known to a person skilled in the art and also include chimeric CTs that comprise, but are not limited to, an N-terminal domain, a central domain or a C-terminal domain of a CTP from Oryza sativa 1-decoi-D xylose-5-phosphate synthase, Superoxide dismutase from Oryza sativa, soluble starch synthase from Oryza sativa, NADP-dependent malic acid enzyme-Oryza sativa, Oryza sativa-Phospho-2-dehydro- 3-deoxyheptonate aldolase 2, Oryza sativa-L-Ascorbate peroxidase 5, Oryza sativa-phosphoglucan water dikinase, Zea Mays ssRUBISCO, Zea Mays-beta-glucosidase, Zea Mays-malate dehydrogenase, Zea Mays type M trioredoxin (see Order Publication U.S. Patent No. 2012/0304336).

[0118] The IPD101 polypeptide gene to be targeted to the chloroplast can be optimized for expression in the chloroplast to account for differences in use between the plant nucleus and its organelle. In this way, the nucleic acids of interest can be synthesized using chloroplast-preferred sequences.

[0119] In preparing the expression cassette, the various DNA fragments can be manipulated so as to provide the DNA sequences in the appropriate orientation and, as appropriate, in the appropriate reading frame. To this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide convenient restriction sites, removal of superfluous DNA, removal of restriction sites or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, can be involved.

[0120] Various promoters can be used in the practice of modalities. Promoters can be selected based on the desired outcome. Nucleic acids can be combined with constitutive, tissue-preferred, inducible or other promoters for expression in the host organism. Suitable constitutive promoters for use in a plant host cell include, for example, the Rsyn7 promoter core promoter and other constitutive promoters disclosed in WO 1999/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell, et al., (1985) Nature 313:810 to 812); rice actin (McElroy, et al., (1990) Plant Cell 2:163 to 171); ubiquitin (Christensen, et al., (1989) Plant Mol. Biol. 12:619 to 632 and Christensen, et al., (1992) Plant Mol. Biol. 18:675 to 689); pEMU (Last, et al., (1991) Theor. Appl. Genet. 81:581 to 588); BUT (Velten, et al., (1984) EMBO J. 3:2,723 to 2,730); ALS promoter (U.S. Patent No. 5,659,026) and the like. Other constitutive promoters include, for example, those discussed in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611.

[0121] Depending on the desired result, it may be beneficial to express the gene from an inducible promoter. Wound-inducible promoters are of particular interest for regulating the expression of the nucleotide sequences of the embodiments in plants. Such wounding-inducible promoters may respond to insect feeding damage and include the potato proteinase inhibitor (pin II) gene (Ryan, (1990) Ann. Rev. Phytopath. 28:425 to 449; Duan, et al ., (1996) Nature Biotechnology 14:494 to 498); wun1 and wun2, U.S. Patent No. 5,428,148; win1 and win2 (Stanford, et al., (1989) Mol. Gen. Genet. 215:200 to 208); systemin (McGurl, et al., (1992) Science 225:1570 to 1573); WIP1 (Rohmeier, et al., (1993) Plant Mol. Biol. 22:783 to 792; Eckelkamp, et al., (1993) FEBS Letters 323:73 to 76); MPI gene (Corderok, et al., (1994) Plant J. 6(2):141 to 150) and the like.

[0122] Additionally, pathogen-inducible promoters can be employed in the methods and nucleotide constructs of the modalities. Such pathogen-inducible promoters include those of pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; for example, PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi, et al., (1983) Neth. J. Plant Pathol. 89:245 to 254; Uknes, et al., (1992) Plant Cell 4: 645 to 656 and Van Loon, (1985) Plant Mol. Virol. 4:111 to 116. See also WO 1999/43819.

[0123] Of interest are promoters that are expressed at or near the site of pathogen infection. See, for example, Marineau, et al., (1987) Plant Mol. Biol. 9:335 to 342; Matton, et al., (1989) Molecular Plant-Microbe Interactions 2:325 to 331; Somsisch, et al., (1986) Proc. Natl. Academic. Sci. USA 83:2427 to 2430; Somsisch, et al., (1988) Mol. Gen. Genet. 2:93 to 98 and Yang, (1996) Proc. Natl. Academic. Sci. USA 93:14972 to 14977. Also see Chen, et al., (1996) Plant J. 10:955 to 966; Zhang, et al., (1994) Proc. Natl. Academic. Sci. USA 91:2507 to 2511; Warner, et al., (1993) Plant J. 3:191 to 201; Siebertz, et al., (1989) Plant Cell 1:961 to 968; U.S. Patent No. 5,750,386 (nematode inducible) and references cited therein. Of particular interest is the inducible promoter for the maize gene PRms, whose expression is induced by the pathogen Fusarium moniliforme (see, for example, Cordero, et al., (1992) Physiol. Mol. Plant Path. 41:189 to 200). .

[0124] Chemically regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending on the objective, the promoter may be a chemically inducible promoter, where application of the chemical induces gene expression, or a chemically repressible promoter, where application of the chemical represses gene expression. Chemically inducible promoters are known in the art and include, but are not limited to, the corn In2-2 promoter, which is activated by benzenesulfonamide herbicide protectants, and the corn GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemically regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421 to 10425 and McNellis et al. , (1998) Plant J. 14(2):247 to 257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al., (1991) Mol. Gen. Genet. 227:229 to 237 and US Patent numbers 5,814,618 and 5,789,156).

[0125] Tissue-preferred promoters can be used to direct enhanced IPD101 polypeptide expression in a specific plant tissue. Preferred tissue promoters include those discussed in Yamamoto, et al., (1997) Plant J. 12(2)255 to 265; Kawamata, et al., (1997) Plant Cell Physiol. 38(7):792 to 803; Hansen, et al., (1997) Mol. Gen Genet. 254(3):337 to 343; Russell, et al., (1997) Transgenic Res. 6(2):157 to 168; Rinehart, et al., (1996) Plant Physiol. 112(3):1331 to 1341; Van Camp, et al., (1996) Plant Physiol. 112(2):525 to 535; Canevascini, et al., (1996) Plant Physiol. 112(2):513 to 524; Yamamoto, et al., (1994) Plant Cell Physiol. 35(5):773 to 778; Lam, (1994) Results Probl. Cell Difference. 20:181 to 196; Orozco, et al., (1993) Plant Mol Biol. 23(6):1129 to 1138; Matsuoka, et al., (1993) Proc Natl. Academic. Sci. USA 90(20):9586 to 9590 and Guevara-Garcia, et al., (1993) Plant J. 4(3):495 to 505. Such promoters can be modified, if necessary, for weak expression.

[0126] Sheet preferential promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2):255 to 265; Kwon et al. (1994) Plant Physiol. 105:357 to 367; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773 to 778; Gotor et al. (1993) Plant J. 3:509 to 518; Orozco et al. (1993) Plant Mol. Biol. 23(6):1,129 to 1,138 and Matsuoka et al. (1993) Proc. Natl. Academic. Sci. USA 90(20):9,586 to 9,590.

[0127] Root-preferred or root-specific promoters are known and can be selected from the many available from the literature or isolated de novo from the various compatible species. See, for example, Hire, et al., (1992) Plant Mol. Biol. 20(2):207 to 218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner, (1991) Plant Cell 3(10):1051 to 1061 (root-specific control element in the Pod GRP 1.8 gene); Sanger, et al., (1990) Plant Mol. Biol. 14(3):433 to 443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens) and Miao, et al., (1991) Plant Cell 3(1):11 to 22 (glutamine synthetase (GS ) cytosolic full-length cDNA clone encoding, which is expressed in soybean roots and root nodules). Also see Bogusz, et al., (1990) Plant Cell 2(7):633 to 641, in which two root-specific promoters isolated from hemoglobin genes of the nitrogen-fixing non-legume Parasponia andersonii and the non-nitrogen-fixing non-legume of nitrogen Trema tomentosa are described. The promoters of these genes were linked to a β-glucuronidase reporter gene and introduced into both the non-legume Nicotiana tabacum and the legume Lotus corniculatus, and in both cases the root-specific promoter activity was preserved. Leach and Aoyagi (1991) describe their analysis of the promoters of the highly expressed rolC and rolD root-inducing genes of Agrobacterium rhizogenes (see, Plant Science (Limerick) 79(1):69 to 76). They concluded that the enhancer and tissue-preferable DNA determinants are dissociated at those promoters. Teeri, et al., (1989) used gene fusion for lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the root tip epidermis and that the TR2' gene is specific to root in the intact plant and stimulated by wounding of leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene (see, EMBO J. 8(2):343 to 350). The TR1' gene fused to nptII (neomycin phosphotransferase II) showed similar characteristics. Additional preferred root promoters include the VfENOD-GRP3 gene promoter (Kuster, et al., (1995) Plant Mol. Biol. 29(4):759 to 772) and the rolB promoter (Capana, et al., (1994) Plant Mol Biol. 5,023,179. The preferred regulatory sequences for Arabidopsis thaliana root are disclosed in document no. US20130117883.

[0128] "Seed-preferred" promoters include both "seed-specific" promoters (those promoters active during seed development such as seed storage protein promoters) as well as "seed germination" promoters (those promoters active during seed germination). See Thompson et al., (1989) BioEssays 10:108. Such preferred seed promoters include, but are not limited to, Cim1 (cytokinin-induced message); cZ19B1 (19 kDa apple zein); and milps (myo-inositol-1-phosphate synthase) (see U.S. Patent No. 6,225,529). Gamma-zein and Glb-1 are endosperm-specific promoters. For dicots, seed-specific promoters include, but are not limited to, Kunitz trypsin inhibitor 3 (KTi3) (Jofuku and Goldberg, (1989) Plant Cell 1:1079 to 1101), bean β-phaseolin, napin, β-conglycinin, glycinin 1, soy lectin, cruciferin and the like. For monocots, seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2, globulin 1, etc. See also WO 2000/12733, in which seed-preferred promoters of end1 and end2 genes are disclosed. In dicots, seed-specific promoters include, but are not limited to, the Arabidopsis seed coat promoter, pBAN; and the Arabidopsis early seed promoters, p26, p63, and p63tr (U.S. Patent Nos. 7,294,760 and 7,847,153). A promoter that has "preferred" expression in a particular tissue is expressed in that tissue to a greater degree than at least one other plant tissue. Some tissue-preferred promoters show expression almost exclusively in the particular tissue.

[0129] When low level expression is desired, weak promoters will be used. Generally, the term "weak promoter" as used herein refers to a promoter that drives expression of a coding sequence at a low level. By low level expression, levels between about 1/1,000 transcripts to about 1/100,000 transcripts to about 1/500,000 transcripts are intended. Alternatively, it is recognized that the term "weak promoters" also encompasses promoters that drive expression only in some cells and not in others to generate an overall low level of expression. When a promoter drives expression at unacceptably high levels, portions of the promoter sequence may be deleted or modified to decrease expression levels.

[0130] Such weak constitutive promoters include, for example, the core promoter of the Rsyn7 promoter (Document No. WO 1999/43838 and U.S. Patent No. 6,072,050), the CaMV 35S core promoter and the like. Other constitutive promoters include, for example, those discussed in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611.

[0131] The above list of promoters is not intended to be limiting. Any appropriate promoter may be used in the embodiments.

[0132] Generally, the expression cassette will comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are used for the selection of transformed cells or tissues. Marker genes include genes that encode antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes that confer resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones and 2, 4-dichlorophenoxyacetate (2,4-D). Additional examples of suitable selectable marker genes include, but are not limited to, gene encoding resistance to chloramphenicol (Herrera Estrella, et al., (1983) EMBO J. 2:987 to 992); methotrexate (Herrera Estrella, et al., (1983) Nature 303:209 to 213 and Meijer, et al., (1991) Plant Mol. Biol. 16:807 to 820); streptomycin (Jones, et al., (1987) Mol. Gen. Genet. 210:86 to 91); spectinomycin (Bretagne-Sagnard, et al., (1996) Transgenic Res. 5:131 to 137); bleomycin (Hille, et al., (1990) Plant Mol. Biol. 7:171 to 176); sulfonamide (Guerineau, et al., (1990) Plant Mol. Biol. 15:127 to 136); bromoxynil (Stalker, et al., (1988) Science 242:419 to 423); glyphosate (Shaw, et al., (1986) Science 233:478 to 481 and U.S. Patent Application Nos. 10/004,357 and 10/427,692); phosphinothricin (DeBlock, et al., (1987) EMBO J. 6:2513 to 2518). See generally Yarranton, (1992) Curr. Opinion. Biotech. 3:506 to 511; Christopherson, et al., (1992) Proc. Natl. Academic. Sci. USA 89:6314 to 6318; Yao, et al., (1992) Cell 71:63 to 72; Reznikoff, (1992) Mol. Microbiol. 6:2419 to 2422; Barkley, et al., (1980) in The Operon, pages 177 to 220; Hu, et al., (1987) Cell 48:555 to 566; Brown, et al., (1987) Cell 49:603 to 612; Figge, et al., (1988) Cell 52:713 to 722; Deuschle, et al., (1989) Proc. Natl. Academic. Sci. USA 86:5400 to 5404; Fuerst, et al., (1989) Proc. Natl. Academic. Sci. USA 86:2549 to 2553; Deuschle, et al., (1990) Science 248:480 to 483; Gossen, (1993) Ph.D. Thesis, University of Heidelberg; Reines, et al., (1993) Proc. Natl. Academic. Sci. USA 90:1917 to 1921; Labow, et al., (1990) Mol. Cell. Biol. 10:3343 to 3356; Zambretti, et al., (1992) Proc. Natl. Academic. Sci. USA 89:3952 to 3956; Baim, et al., (1991) Proc. Natl. Academic. Sci. USA 88:5072 to 5076; Wyborski, et al., (1991) Nucleic Acids Res. 19:4647 to 4653; Hillenand-Wissman, (1989) Topics Mol. Struc. Biol. 10:143 to 162; Degenkolb, et al., (1991) Antimicrob. AgentsChemother. 35:1591 to 1595; Kleinschnidt, et al., (1988) Biochemistry 27:1094 to 1104; Bonin, (1993) Ph.D. Thesis, University of Heidelberg; Gossen, et al., (1992) Proc. Natl. Academic. Sci. USA 89:5547 to 5551; Oliva, et al., (1992) Antimicrob. AgentsChemother. 36:913 to 919; Hlavka, et al., (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin) and Gill, et al., (1988) Nature 334:721 to 724.

[0133] The above list of selectable marker genes is not intended to be limiting. Any selectable marker gene can be used in the embodiments.

Plant Transformation

[0134] The methods of the embodiments involve introducing a polypeptide or polynucleotide into a plant. "Introducing" means, as used herein, presenting the polynucleotide or polypeptide to the plant in such a way that the sequence gains access to the interior of a plant cell. The methods of the embodiments do not depend on a specific method for introducing a polynucleotide or polypeptide into a plant, only that the polynucleotide (or polynucleotides) or polypeptide (or polypeptides) gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotide (or polynucleotides) or polypeptide (or polypeptides) into plants are known in the art, including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

[0135] “Stable transformation”, as used herein, means that the nucleotide construct introduced into a plant integrates the plant's genome and has the capacity to be inherited by its progeny. "Transient transformation" means, as used herein, that a polynucleotide is introduced into the plant and does not integrate into the plant genome or a polypeptide is introduced into a plant. "Plant" refers, as used herein, to whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, propagules, embryos and progeny thereof. Plant cells can be differentiated or undifferentiated (e.g., callus, suspension culture cells, protoplasts, leaf cells, root cells, phloem cells, and pollen).

[0136] Transformation protocols, as well as protocols for introducing nucleotide sequences into plants, may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway, et al., (1986) Biotechniques 4:320 to 334), electroporation (Riggs, et al., (1986) Proc. Natl. Acad. Sci. USA 83:5,602 to 5,606), Agrobacterium-mediated transformation (US Patents 5,563,055 and 5,981,840), direct gene transfer (Paszkowski, et al., (1984) EMBO J 3:2,717 to 2,722) and ballistics particle acceleration (see, e.g., U.S. Patent Nos. 4,945,050; 5,879,918; 5,886,244 and 5,932,782; Tomes, et al., (1995) in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips, (Springer-Verlag, Berlin) and McCabe, et al., (1988) Biotechnology 6:923 to 926) and Lecl transformation (document no. WO 00/28058). For potato transformation, see Tu, et al., (1998) Plant Molecular Biology 37:829 to 838 and Chong, et al., (2000) Transgenic Research 9:71 to 78. Additional transformation procedures can be found in Weissinger, et al., (1988) Ann. Rev. Genet. 22:421 to 477; Sanford, et al., (1987) Particulate Science and Technology 5:27 to 37 (onion); Christou, et al., (1988) Plant Physiol. 87:671 to 674 (soy); McCabe, et al., (1988) Bio/Technology 6:923 to 926 (soy); Finer and McMullen, (1991) In Vitro Cell Dev. Biol. 27P:175 to 182 (soy); Singh, et al., (1998) Theor. Appl. Genet. 96:319-324 (soy); Datta, et al., (1990) Biotechnology 8:736 to 740 (rice); Klein, et al., (1988) Proc. Natl. Academic. Sci. USA 85:4,305 to 4,309 (Mais); Klein, et al., (1988) Biotechnology 6:559 to 563 (more); U.S. Patent Nos. 5,240,855; 5,322,783 and 5,324,646; Klein, et al., (1988) Plant Physiol. 91:440 to 444 (more); Fromm, et al., (1990) Biotechnology 8:833 to 839 (more); Hooykaas-Van Slogteren, et al., (1984) Nature (London) 311:763 to 764; U.S. Patent No. 5,736,369 (cereals); Bytebier, et al., (1987) Proc. Natl. Academic. Sci. USA 84:5,345 to 5,349 (Liliaceae); De Wet, et al., (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman, et al., (Longman, New York), pages 197 to 209 (pollen); Kaeppler, et al., (1990) Plant Cell Reports 9:415 to 418 and Kaeppler, et al., (1992) Theor. Appl. Genet. 84:560 to 566 (fiber-mediated transformation); D'Halluin, et al., (1992) Plant Cell 4:1,495 to 1,505 (electroporation); Li, et al., (1993) Plant Cell Reports 12:250 to 255 and Christou and Ford, (1995) Annals of Botany 75:407 to 413 (rice); Osjoda, et al., (1996) Nature Biotechnology 14:745 to 750 (more via Agrobacterium tumefaciens).

[0137] In specific embodiments, sequences of embodiments can be provided to a plant using a variety of transient transformation methods. Such transient transformation methods include, but are not limited to, introducing the IPD101 polypeptide or variants and fragments thereof directly into the plant or introducing the IPD101 polypeptide transcript into the plant. Such methods include, for example, microinjection or particle bombardment. See, for example, Crossway, et al., (1986) Mol Gen. Genet. 202:179 to 185; Nomura, et al., (1986) Plant Sci. 44:53 to 58; Hepler, et al., (1994) Proc. Natl. Academic. Sci. 91:2176 to 2180 and Hush, et al., (1994) The Journal of Cell Science 107:775 to 784. Alternatively, the IPD101 polynucleotide can be transiently transformed in the plant using techniques known in the art. Such techniques include viral vector systems and precipitation of the polynucleotide in a manner that prevents subsequent release of the DNA. Therefore, transcription from DNA bound to the particle can occur, but the frequency with which it is released to integrate into the genome is greatly reduced. Such methods include the use of polyethylamine (PEI; Sigma #P3143) coated particles.

[0138] Methods for the targeted insertion of a polynucleotide at a specific location in the plant genome are known in the art. In one embodiment, insertion of the polynucleotide into a desired genomic location is achieved using a site-specific recombination system. See, for example, documents WO 1999/25821, WO 1999/25854, WO 1999/25840, WO 1999/25855 and WO 1999/25853. Briefly, the polynucleotide of the embodiments may be contained in a transfer cassette flanked by two non-identical recombination sites. The transfer cassette is introduced into a plant that has stably incorporated into its genome a targeted site that is flanked by two non-identical recombination sites that correspond to the transfer cassette sites. An appropriate recombinase is provided and the transfer cassette is integrated into the targeted site. The polynucleotide of interest is thus integrated into a specific chromosomal position in the plant genome.

[0139] Plant transformation vectors can be comprised of one or more DNA vectors necessary to achieve plant transformation. For example, it is common practice in the art to use plant transformation vectors that are comprised of more than one contiguous DNA segment. These vectors are often called "binary vectors" in the art. Binary vectors, as well as vectors with helper plasmids, are most often used for Agrobacterium-mediated transformation, in which the size and complexity of the DNA segments required to achieve efficient transformation are much larger, and this is advantageous for separating functions in DNA molecules. separate DNA. Binary vectors typically contain a plasmid vector that contains the cis-acting sequences required for T-DNA transfer (such as left edge and right edge), a selectable marker that is genetically modified to have the capacity for expression in a plant cell, and a "gene of interest" (a gene genetically modified to have the capacity for expression in a plant cell for which the generation of transgenic plants is desired). The sequences required for bacterial replication are also present in this plasmid vector. The cis-acting sequences are arranged in a manner to allow efficient transfer to and expression thereof. For example, the selectable marker gene and the pesticide gene are located between the left and right borders. Often, a second plasmid vector contains the trans -acting factors that mediate the transfer of Agrobacterium T-DNA into plant cells. This plasmid often contains the virulence functions (Vir genes) that allow Agrobacterium infection of plant cells, and transfer of DNA by cleavage at border sequences and Vir-mediated DNA transfer, as is understood in the art (Hellens and Mullineaux , (2000) Trends in Plant Science 5:446 to 451). Various types of Agrobacterium strains (e.g., LBA4404, GV3101, EHA101, EHA105, etc.) can be used for plant transformation. The second plasmid vector is not required to transform plants by other methods such as microprojection, microinjection, electroporation, polyethylene glycol, etc.

[0140] In general, plant transformation methods involve transferring heterologous DNA into targeted plant cells (e.g., immature or mature embryos, suspension cultures, undifferentiated callus, protoplasts, etc.), followed by application of a maximum threshold level of appropriate selection (depending on the selectable marker gene) to recover transformed plant cells from a pool of untransformed cell mass. Following integration of heterologous foreign DNA into plant cells, a maximum threshold level of appropriate selection is applied to the medium to kill untransformed cells and separate and proliferate putatively transformed cells that survive from this transfer selection treatment. the same on a regular basis for a new medium. By continuous passaging and challenge with appropriate selection, cells that are transformed with the plasmid vector are identified and proliferated. Molecular and biochemical methods can then be used to confirm the presence of the heterologous gene of interest integrated into the genome of the transgenic plant.

[0141] Explants are typically transferred to a fresh supply of the same medium and cultured routinely. Subsequently, the transformed cells are differentiated into buds after placement in regeneration medium supplemented with a maximum threshold level of selection agent. The shoots are then transferred to a selective rooting medium to recover the rooted shoot or plantlet. The transgenic seedling then grows into a mature plant and produces fertile seeds (e.g., Hiei, et al., (1994) The Plant Journal 6:271 to 282; Ishida, et al., (1996) Nature Biotechnology 14: 745 to 750). Explants are typically transferred to a fresh supply of the same medium and cultured routinely. A general description of the techniques and methods for generating transgenic plants are found in Ayres and Park, (1994) Critical Reviews in Plant Science 13:219 to 239 and Bommineni and Jauhar, (1997) Maydica 42:107 to 120. Since the material transformed contains many cells, both transformed and non-transformed cells are present in any part of the submitted targeted callus or tissue or group of cells. The ability to kill untransformed cells and allow transformed cells to proliferate results in transformed plant cultures. Often, the ability to remove nontransformed cells is a limitation to the rapid recovery of transformed plant cells and successful generation of transgenic plants.

[0142] Cells that have been transformed can be grown into plants according to conventional ways. See, for example, McCormick, et al., (1986) Plant Cell Reports 5:81 to 84. Such plants can then be grown and pollinated with the same transformed strain or different strains, and the resulting hybrid that has expression constitutive or inducible of the identified desired phenotypic characteristic. Two or more generations can be grown to ensure that expression of the desired phenotypic trait is stably maintained and inherited, and then seeds grown to ensure that expression of the desired phenotypic trait has been achieved.

[0143] The nucleotide sequences of the embodiments can be provided to the plant by placing the plant in contact with a virus or viral nucleic acids. Generally, such methods involve incorporating the nucleotide construct of interest into a viral RNA or DNA molecule. It is recognized that the recombinant proteins of the embodiments may be initially synthesized as part of a viral polyprotein, which may subsequently be processed via in vivo or in vitro proteolysis to produce the desired IPD101 polypeptide. It is also recognized that such a viral polyprotein, which comprises at least a portion of the amino acid sequence of an IPD101 polypeptide of the embodiments, may have the desired pesticidal activity. Such viral polyproteins and the nucleotide sequences encoding them are encompassed by the embodiments. Methods for providing plants with nucleotide constructs and producing plant-encoded proteins involving viral RNA or DNA molecules are known in the art. See, for example, U.S. Patent No. 5,889,191; 5,889,190; 5,866,785; 5,589,367 and 5,316,931.

[0144] Methods for transforming chloroplasts are known in the art. See, for example, Svab, et al., (1990) Proc. Natl. Academic. Sci. USA 87:8526 to 8530; Svab and Maliga, (1993) Proc. Natl. Academic. Sci. USA 90:913 to 917; Svab and Maliga, (1993) EMBO J. 12:601 to 606. The method depends on gun delivery of DNA particles containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination. Additionally, plastid transformation can be accomplished by transactivation of a silenced plastid-originated transgene by tissue-preferred expression of a plastid-directed, nuclear-encoded RNA polymerase. Such a system was reported in McBride, et al., (1994) Proc. Natl. Academic. Sci. USA 91:7301 to 7305.

[0145] The embodiments further refer to plant propagation material from a transformed plant of the embodiments which includes, but is not limited to, seeds, tubers, corms, bulbs, leaves and cuttings of roots and shoots.

[0146] The modalities can be used to transform any plant species, including, but not limited to, monocots and dicotyledons. Examples of plants of interest include, but are not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum ( Sorghum bicolor, Sorghum vulgare), millet (e.g. pearl millet (Pennisetum glaucum), millet (Panicum miliaceum), millet (Setaria italica), giant crow's foot grass (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea Batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig tree (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive tree (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale ), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beet (Beta vulgaris), sugar cane (Saccharum spp.), oats, barley, ornamental and coniferous plants.

[0147] Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.) and members of the genus Cucumis, such as cucumber (C. sativus), cantaloupe (C. cantalupensis) and melon (C. melo). Ornamental plants include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima) and chrysanthemum. Conifers that can be used in the practice of the modalities include, for example, pine trees, such as pine (Pinus taeda), American pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta) and jack pine. -Monterey (Pinus radiata); Oregon pine (Pseudotsuga menziesii); western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs, such as spruce (Abies amabilis) and balsam fir (Abies balsamea); and cedars, such as western red cedar (Thuja plicata) and Alaskan yellow cedar (Chamaecyparis nootkatensis). The plants of the embodiments include crop plants (e.g., corn, alfalfa, sunflower, Brassica, soybeans, cotton, safflower, peanuts, sorghum, wheat, millet, tobacco, etc.), such as corn and soybean plants.

[0148] Lawns include, but are not limited to: annual poa (Poa annua); annual ryegrass (Lolium multiflorum); Canadian poa (Poa compressa); red fescue (Festuca rubra); Tenuous Agrostide (Agrostis tenuis); fine grass (Agrostis palustris); desert wheatgrass (crested wheatgrass) (Agropyron desertum); Mombasa grass (Agropyron cristatum); hard fescue (Festuca longifolia); fever weed (Poa pratensis); panasco (Dactylis glomerata); perennial ryegrass (Lolium perenne); red fescue (Festuca rubra); rubra germinia (Agrostis alba); poa- common (Poa trivialis); sheep fescue (Festuca ovina); bromine (Bromus inermis); tall fescue (Festuca arundinacea); cattail (Phleum pratense); Velvet bentgrass (Agrostis canina); weeping alkaligrass (Puccinellia distans); western wheatgrass (Agropyron smithii); Bermuda grass (Cynodon spp.); St. Augustine grass (Stenotaphrum secundatum); Zoysia grass (Zoysia spp.); bahiagrass (Paspalum Notatum); carpet grass (Axonopus affinis); centipede grass (Eremochloa ophiuroides); Kikuio grass (Pennisetum clandesinum); beach wire grass (Paspalum vaginatum); blue grass (Bouteloua gracilis); American grass (Buchloe dactyloids); sideoats gramma (Bouteloua curtipendula).

[0149] Plants of interest include grain plants that provide seeds of interest, oil seed plants and legumes. Seeds of interest include grain seeds such as corn, wheat, barley, rice, sorghum, rye, millet, etc. Oil seed plants include cotton, soybean, safflower, sunflower, Brassica, corn, alfalfa, palm, coconut, flax, castor, olive, etc. Legume plants include beans and peas. Beans include guar, carob bean, fenugreek, soybean, garden bean, cowpea, mung bean, lima bean, fava bean, lentils, chickpea, etc.

[0150] After the introduction of heterologous foreign DNA into plant cells, the transformation or integration of heterologous gene into the plant genome is confirmed by various methods, such as analysis of nucleic acids, proteins and metabolites associated with the integrated gene.

[0151] PCR analysis is a rapid method for screening transformed cells, tissue or shoots for the presence of incorporated gene at an early stage before transplantation into soil (Sambrook and Russell, (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). PCR is performed using oligonucleotide primers specific to the gene of interest or Agrobacterium vector background, etc.

[0152] Plant transformation can be confirmed by Southern blot analysis of genomic DNA (Sambrook and Russell, (2001) supra). In Northern blot analysis, RNA is isolated from specific tissues of transformants, fractionated on a formaldehyde agarose gel, and transferred to a nylon filter according to standard procedures that are routinely used in the art (Sambrook and Russell, ( 2001) above). The expression of RNA encoded by the pesticide gene is then tested by hybridizing the filter to a radioactive probe derived from a pesticide gene by methods known in the art (Sambrook and Russell, (2001) supra). Western blot, biochemical and similar assays can be performed on transgenic plants to confirm the presence of protein encoded by the pesticide gene through standard procedures (Sambrook and Russell, 2001, supra) with the use of antibodies that bind to one or more epitopes present in the IPD101 polypeptide.

Methods for Introducing Genome Editing Technologies into Plants

[0153] In some embodiments, the disclosed IPD101 polynucleotide compositions can be introduced into the genome of a plant using genome editing technologies, or IPD101 polynucleotides previously introduced into the genome of a plant can be edited using genome editing technologies. genome editing. For example, the disclosed polynucleotides can be introduced into a desired location in a plant's genome through the use of double-strand breaking technologies, such as TALENs, meganucleases, zinc finger nucleases, CRISPR-Cas and the like. For example, the revealed polynucleotides can be introduced into a desired location in a genome using a CRISPR-Cas system for the purpose of site-specific insertion. The desired location in a plant genome can be any target site desired for insertion, such as a genomic region favorable for improvement, or it can be a target site located in a genomic window with an existing trait of interest. The existing traits of interest could be an endogenous trait or a previously introduced trait.

[0154] In some embodiments, when the disclosed IPD101 polynucleotide has previously been introduced into a genome, genome editing technologies can be used to alter or modify the introduced polynucleotide sequence. Site-specific modifications that can be introduced into the disclosed IPD101 polynucleotide compositions include those produced using any method for introducing the site-specific modification, including, but not limited to, through the use of gene repair oligonucleotides (e.g., U.S. Publication 2013/0019349), or through the use of double-strand breaking technologies such as TALENs, meganucleases, zinc finger nucleases, CRISPR-Cas, and the like. Such technologies can be used to modify the previously introduced polynucleotide through insertion, deletion or substitution of nucleotides within the introduced polynucleotide. Alternatively, double-strand break technologies can be used to add additional nucleotide sequences to the introduced polynucleotide. Additional sequences that can be added include additional expression elements, such as enhancer and promoter sequences. In another embodiment, genome editing technologies can be used to position additional insecticidal active proteins in proximity to the IPD101 polynucleotide compositions disclosed herein within a plant genome in order to generate molecular stacks of insecticidal active proteins. .

[0155] An “altered target site”, “altered target sequence”, “modified target site” and “modified target sequence” are used interchangeably herein and refer to a target sequence as disclosed in present document that comprises at least one change compared to the unaltered target sequence. Such “changes” include, for example: (i) substitution of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i ) to (iii).

Trait stacking in transgenic plant

[0156] Transgenic plants may comprise a stack of one or more insecticidal polynucleotides disclosed herein with one or more additional polynucleotides that result in the production or suppression of multiple polypeptide sequences. Transgenic plants comprising stacks of polynucleotide sequences can be obtained by either or both of traditional breeding methods or through genetic manipulation methods. These methods include, but are not limited to, individual crop lines each comprising a polynucleotide of interest, transforming a transgenic plant comprising a gene disclosed herein with a subsequent gene, and cotransformation of genes in a single plant cell. As used herein, the term "stacked" includes having multiple traits present in the same plant (i.e., both traits are incorporated into the nuclear genome, one trait is incorporated into the nuclear genome, and one trait is incorporated into the genome of a plastid or both traits are incorporated into the genome of a plastid). In a non-limiting example, "stacked traces" comprise a molecular stack in which the sequences are physically adjacent to each other. A trait, as used herein, refers to the phenotype derived from a particular sequence or groups of sequences. Gene cotransformation can be performed using single transformation vectors comprising multiple genes or genes ported separately on multiple vectors. If sequences are stacked by genetically transforming plants, the polynucleotide sequences of interest can be combined at any time and in any order. Traces can be introduced simultaneously into a cotransformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes. For example, if two sequences are to be introduced, the two sequences may be contained in separate transformation cassettes (trans) or contained in the same transformation cassette (cis). The expression of sequences can be driven by the same promoter or by different promoters. In certain cases, it may be desirable to introduce a transformation cassette that suppresses expression of the polynucleotide of interest. This can be combined with any combination of other suppression cassettes or overexpression cassettes to generate the desired combination of traits in the plant. It is further recognized that polynucleotide sequences can be stacked at a desired genomic location using a site-specific recombination system. See, for example, documents No. WO 1999/25821, No. WO 1999/25854, No. WO 1999/25840, No. WO 1999/25855 and No. WO 1999/25853, all of which are incorporated into this document by reference.

[0157] In some embodiments, one or more of the polynucleotides encoding the IPD101 polypeptide (or IPD101 polypeptides) disclosed herein, alone or stacked with one or more additional insect resistance traits, can be stacked with one or more traits additional input traits (e.g., herbicide resistance, fungal resistance, virus resistance, stress tolerance, disease resistance, male sterility, stem resistibility, and the like) or output traits (e.g., yield enhancement, modified starches , improved oil profile, balanced amino acids, high lysine or methionine content, increased digestibility, improved fiber quality, drought resistance and the like). Therefore, polynucleotide modalities can be used to provide a complete agronomic package of improved crop quality with the ability to flexibly and cost-effectively control any agronomic pests.

[0158] Transgenes useful for stacking include, but are not limited to: transgenes that confer resistance to an herbicide; transgenes that confer or contribute to an altered grain trait; genes that control male sterility; genes that create a site for site-specific DNA integration; genes that affect resistance to abiotic stress; genes that confer increased yield, genes that confer plant digestibility; and transgenes that confer resistance to insects or disease.

[0159] Examples of transgenes that confer resistance to insects include genes encoding a Bacillus thuringiensis protein, a derivative thereof or a synthetic polypeptide modeled thereon. See, for example, Geiser, et al., (1986) Gene 48:109, which discloses the cloning and nucleotide sequence of a Bt delta-endotoxin gene. Additionally, DNA molecules encoding delta-endotoxin genes can be purchased from the American Type Culture Collection (Rockville, Md.), for example, under ATCC® accession numbers 40098, 67136, 31995, and 31998. Other non-limiting examples of Bacillus thuringiensis transgenes that are generically modified are given in the following patents and patent applications: U.S. Patent Nos. 5,188,960; 5,689,052; 5,880,275; 5,986,177; 6,023,013, 6,060,594, 6,063,597, 6,077,824, 6,620,988, 6,642,030, 6,713,259, 6,893,826, 7,105,332; 7,179,965, 7,208,474; 7,227,056, 7,288,643, 7,323,556, 7,329,736, 7,449,552, 7,468,278, 7,510,878, 7,521,235, 7,544,862, 7,605,304, 7,696,412, 7,629,504, 7,705. 216, 7,772,465, 7,790,846, 7,858,849 and document No. WO 1991/14778; document no. WO 1999/31248; document no. WO 2001/12731; document no. WO 1999/24581 and document no. WO 1997/40162.

[0160] Genes encoding pesticidal proteins can also be stacked, which includes, but is not limited to: insecticidal proteins from Pseudomonas sp., such as PSEEN3174 (Monalysin, (2011) PLoS Pathogens, 7:1 to 13), from strains of Pseudomonas protegens CHA0 and Pf-5 (formerly fluorescens) (Pechy-Tarr, (2008) Environmental Microbiology 10:2,368 to 2,386: GenBank Accession No. EU400157); of Pseudomonas taiwanensis (Liu, et al., (2010) J. Agric. Food Chem. 58:12,343 to 12,349) and of Pseudomonas pseudoalcaligenes (Zhang, et al., (2009) Annals of Microbiology 59:45 to 50 and Li , et al., (2007) Plant Cell Tiss. Organ Cult. 89:159 to 168); insecticidal proteins from Photorhabdus sp. and Xenorhabdus sp. (Hinchliffe, et al., (2010) The Open Toxinology Journal 3:101 to 118 and Morgan, et al., (2001) Applied and Envir. Micro. 67:2,062 to 2,069), U.S. Patent No. 6,048,838 and U.S. Patent No. 6,379,946; a PIP-1 polypeptide from U.S. Patent Application Publication No. US20140007292; an AfIP-1A and/or AfIP-1B polypeptide from U.S. Patent Application Publication No. US20140033361; a PHI-4 polypeptide from U.S. patent application publications Nos. US20140274885 and US20160040184; a PIP-47 polypeptide from U.S. Patent Application Publication No. US20160186204, a PIP-72 polypeptide from U.S. Patent Application Publication No. US20160366891; a PtIP-50 polypeptide and a PtIP-65 polypeptide from U.S. Patent Application Publication No. 20170166921; a PtIP-83 polypeptide from U.S. Patent Application Publication No. 20160347799; a PtIP-96 polypeptide from U.S. Patent Application Publication No. 20170233440; an IPD079 polypeptide from US 62/201977; an IPD082 polypeptide of US 62/269482 and δ-endotoxins, including, but not limited to, the classes Cry1, Cry2, Cry3, Cry4, Cry5, Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12, Cry13, Cry14 , Cry15, Cry16, Cry17, Cry18, Cry19, Cry20, Cry21, Cry22, Cry23, Cry24, Cry25, Cry26, Cry27, Cry 28, Cry 29, Cry 30, Cry31, Cry32, Cry33, Cry34, Cry35,Cry36, Cry37, Cry38, Cry39, Cry40, Cry41, Cry42, Cry43, Cry44, Cry45, Cry47, Cry49, Cry50, Cry51, Cry53, Cry 54, Cry55, Cry57, Cry59, Cry59, Cry61, Cry62, Cry63, Cry64, Cry65, Cry66, Cry67, Cry68, Cry69, Cry70, Cry71, and Cry 72 of δ-endotoxin genes and the B. thuringiensis cytolytic genes Cyt1 and Cyt2. Members of these B. thuringiensis insecticidal proteins are well known to those of skill in the art (see, Crickmore, et al., "Bacillus thuringiensis toxin nomenclature" (2011), at lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/ which can be accessed on the world wide web using the prefix "www").

[0161] Examples of δ-endotoxins also include, but are not limited to, CrylA proteins of U.S. patents Nos. 5,880,275 and 7,858,849; a DIG-3 or DIG-11 toxin (N-terminal deletion of α-helix 1 and/or α-helix 2 variants of Cry proteins, such as Cry1A) of U.S. Patent Nos. 8,304,604 and 8,304,605, Cry1B of U.S. Patent Application No. 10/525,318; Cry1C of U.S. Patent No. 6,033,874; Cry1F of U.S. Patent Nos. 5,188,960, 6,218,188; Cry1A/F chimeras of U.S. Patent Nos. 7,070,982; 6,962,705 and 6,713,063; a Cry2 protein, such as the Cry2Ab protein of U.S. Patent No. 7,064,249; a Cry3A protein, including, but not limited to, a genetically engineered hybrid insecticidal protein (eHIP) created by fusing unique combinations of variable regions and conserved blocks of at least two different Cry proteins (U.S. Patent Application Publication No. 2010/0017914 ); a Cry4 protein; a Cry5 protein; a Cry6 protein; Cry8 proteins of U.S. Patent Nos. 7,329,736, 7,449,552, 7,803,943, 7,476,781, 7,105,332, 7,378,499, and 7,462,760; a Cry9 protein, such as members of the Cry9A, Cry9B, Cry9C, Cry9D, Cry9E and Cry9F families; a Cry15 protein from Naimov, et al., (2008) Applied and Environmental Microbiology 74:7,145 to 7,151; a Cry22, a Cry34Ab1 protein of US patents 6,127,180, 6,624,145 and 6,340,593; a CryET33 and CryET34 protein of US patents 6,248,535, 6,326,351, 6,399,330, 6,949,626, 7,385,107 and 7,504,229; homologues of CryET33 and CryET34 from U.S. Patent Publication Nos. 2006/0191034, 2012/0278954, and U.S. PCT Publication No. WO 2012/139004; a Cry35Ab1 protein of U.S. Patent Nos. 6,083,499, 6,548,291 and 6,340,593; a Cry46 protein, a Cry 51 protein, a binary Cry toxin; a TIC901 or related toxin; TIC807 of document no. US 2008/0295207; ET29, ET37, TIC809, TIC810, TIC812, TIC127, TIC128 of PCT document no. 2006/033867; AXMI-027, AXMI-036 and AXMI-038 of U.S. Patent No. 8,236,757; AXMI-031, AXMI-039, AXMI-040, AXMI-049 of document No. US 7,923,602; AXMI-018, AXMI-020 and AXMI-021 of document No. WO 2006/083891; AXMI-010 of document No. WO 2005/038032; AXMI-003 of document No. WO 2005/021585; AXMI-008 of document No. US 2004/0250311; AXMI-006 of document no. US 2004/0216186; AXMI-007 of document No. US 2004/0210965; AXMI-009 of document No. US 2004/0210964; AXMI-014 of document no. US 2004/0197917; AXMI-004 of document no. US 2004/0197916; AXMI-028 and AXMI-029 of document No. WO 2006/119457; AXMI-007, AXMI-008, AXMI-0080rf2, AXMI-009, AXMI-014 and AXMI-004 of WO 2004/074462; AXMI-150 of U.S. Patent No. 8,084,416; AXMI-205 of document no. US20110023184; AXMI-011, AXMI- 012, AXMI-013, AXMI-015, AXMI-019, AXMI-044, AXMI-037, AXMI-043, AXMI-033, AXMI-034, AXMI-022, AXMI-023, AXMI- 041, AXMI-063, and AXMI-064 of document no. 0 US 2011/0263488; AXMI-R1 and related proteins from US 2010/0197592; AXMI221Z, AXMI222z, AXMI223z, AXMI224z and AXMI225z of WO 2011/103248; AXMI218, AXMI219, AXMI220, AXMI226, AXMI227, AXMI228, AXMI229, AXMI230, and AXMI231 of WO11/103247; AXMI-115, AXMI-113, AXMI-005, AXMI-163 and AXMI-184 of U.S. Patent No. 8,334,431; AXMI-001, AXMI-002, AXMI-030, AXMI-035, and AXMI-045 of US 2010/0298211; AXMI-066 and AXMI-076 of document no. US2009/0144852; AXMI128, AXMI130, AXMI131, AXMI133, AXMI140, AXMI141, AXMI142, AXMI143, AXMI144, AXMI146, AXMI148, AXMI149, AXMI152, AXMI153, AXMI154, AXMI155, AXMI156, AXMI 157, AXMI158, AXMI162, AXMI165, AXMI166, AXMI167, AXMI168, AXMI169, AXMI170, AXMI171, AXMI172, AXMI173, AXMI174, AXMI175, AXMI176, AXMI177, AXMI178, AXMI179, AXMI180, AXMI181, AXMI182, AXMI185, AXMI186, AXMI187, AXMI188, AXMI 189 of the U.S. Patent. No. 8,318,900; AXMI079,AXMI080,AXMI081,AXMI082,AXMI091,AXMI092,AXMI096,AXMI097,AXMI098,AXMI099,AXMI100,AXMI101,AXMI102,AXMI103,AXMI104,AXMI107,AXMI108 XMI109, AXMI110, AXMI111, AXMI112, AXMI114, AXMI116, AXMI117, AXMI118, AXMI119, AXMI120, AXMI121, AXMI122, AXMI123, AXMI124, AXMI1257, AXMI1268, AXMI127, AXMI129, AXMI164, AXMI151, AXMI161, AXMI183, AXMI132, AXMI138, AXMI137 document No. US 2010/0005543; and Cry proteins such as Cry1A and Cry3A that have modified proteolytic sites from U.S. Patent No. 8,319,019; and a Cry1Ac, Cry2Aa and Cry1Ca toxin protein from the Bacillus thuringiensis strain VBTS 2528 of U.S. patent application publication no. 2011/0064710. Other Cry proteins are also well known to one skilled in the art (see, Crickmore, et al., "Bacillus thuringiensis toxin nomenclature" (2011), at lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/ which may be accessed via the World Wide Web using the prefix "www"). The insecticidal activity of Cry proteins is well known to one skilled in the art (for review, see van Frannkenhuyzen, (2009) J. Invert. Path. 101:1 to 16). The use of Cry proteins as transgenic plant traits is well known to one skilled in the art and Cry transgenic plants including, but not limited to, Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105, Cry1F, Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, mCry3A, Cry9c and CBI-Bt have received regulatory approval (see Sanahuja, (2011) Plant Biotech Journal 9:283 to 300 and CERA (2010) GM Crop Database Center for Environmental Risk Assessment (CERA), ILSI Research Foundation, Washington D.C. at cera-gmc.org/index.php?action=gm_crop_database, which can be accessed via the World Wide Web using the prefix "www"). More than one pesticidal protein well known to one skilled in the art can also be expressed in plants such as Vip3Ab and Cry1Fa (document no. US2012/0317682), Cry1BE and Cry1F (document no. US2012/0311746), Cry1CA and Cry1AB (document no. US2012/0311745 ), Cry1F and CryCa (document no. US2012/0317681), Cry1DA and Cry1BE (document no. US2012/0331590), Cry1DA and Cry1Fa (document no. US2012/0331589), Cry1AB and Cry1BE (document no. US2012/0324606) and Cry1Fa and Cry2Aa, Cry1I or Cry1E (document no. US2012/0324605). Insecticidal proteins also include insecticidal lipases that include lipid acyl hydrolases of U.S. Patent No. 7,491,869, and cholesterol oxidases such as from Streptomyces (Purcell et al. (1993) Biochem Biophys Res Commun 15:1,406 to 1,413). Pesticide proteins also include VIP toxins (vegetative insecticidal proteins) of U.S. Patent Nos. 5,877,012, 6,107,279, 6,137,033, 7,244,820, 7,615,686 and 8,237,020 and the like. Other VIP proteins are well known to one skilled in the art (see, lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html which can be accessed via the world wide web using the prefix "www" ). Pesticide proteins also include toxin complex (TC) proteins obtainable from organisms such as Xenorhabdus, Photorhabdus and Paenibacillus (see US Patent Nos. 7,491,698 and 8,084,418). Some TC proteins have "autonomous" insecticidal activity and other TC proteins enhance the activity of autonomous toxins produced by the same given organism. The toxicity of a "standalone" TC protein (from Photorhabdus, Xenorhabdus, or Paenibacillus, for example) can be improved by one or more TC protein "enhancers" derived from a source organism of a different genus. There are three main types of TC proteins. As stated herein, Class A proteins ("Protein A") are autonomous toxins. Class B proteins ("Protein B") and Class C proteins ("Protein C") improve the toxicity of Class A proteins. Examples of Class A proteins are TcbA, TcdA, XptA1, and XptA2. Examples of Class B proteins are TcaC, TcdB, XptB1Xb and XptC1Wi. Examples of Class C proteins are TccC, XptC1Xb and XptB1Wi. Pesticide proteins also include spider, snake, and scorpion venom proteins. Examples of spider venom peptides include, but are not limited to, lycotoxin-1 peptides and mutants thereof (U.S. Patent No. 8,334,366).

[0162] Additional transgenes that confer resistance to insects can downregulate the expression of targeting genes in insect pest species by interfering ribonucleic acid (RNA) molecules through RNA interference. RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire, et al., (1998) Nature 391:806). RNAi transgenes may include, but are not limited to, the expression of dsRNA, siRNA, miRNA, iRNA, antisense RNA, or sense RNA molecules that downregulate the expression of target genes in insect pests. PCT Publication No. WO 2007/074405 describes methods for inhibiting the expression of driver genes in invertebrate pests including Colorado potato beetle. PCT Publication No. WO 2005/110068 describes methods for inhibiting the expression of driver genes in invertebrate pests including, in particular, western corn rootworm as a means of controlling insect infestation. Additionally, PCT Publication No. WO 2009/091864 describes compositions and methods for suppressing targeting genes of insect pest species including pests of the genus Lygus.

[0163] RNAi transgenes are provided to target the vacuolar ATPase H subunit, useful for controlling a Coleoptera pest population and infestation as described in U.S. Patent Application Publication No. 2012/0198586. PCT Publication WO 2012/055982 describes a ribonucleic acid (RNA or double-stranded RNA) that inhibits or down-regulates the expression of a target gene encoding: an insect ribosomal protein, such as L19 ribosomal protein, the ribosomal L40 or ribosomal protein S27A; an insect proteasome subunit, such as Rpn6 protein, Pros 25, Rpn2 protein, proteasome beta 1 subunit protein, or Pros beta 2 protein; an insect β-coatomer of the COPI vesicle, the Y-coatomer of the COPI vesicle, the β'-coatomer protein or the Z-coatomer of the COPI vesicle; an insect Tetraspanin 2A protein that is a putative transmembrane domain protein; an insect protein that belongs to the actin family, such as Actin 5C; an insect ubiquitin-5E protein; an insect Sec23 protein that is a GTPase activator involved in intracellular protein transport; an insect pleated protein that is an unconventional myosin that is involved in motor activity; an insect crooked neck protein that is involved in the regulation of nuclear alternative mRNA splicing; an insect vacuolar H+-ATPase G subunit protein and an insect Tbp-1, as a Tat binding protein. PCT Publication WO 2007/035650 describes a ribonucleic acid (RNA or double-stranded RNA) that inhibits or downregulates the expression of a target gene encoding Snf7. U.S. Patent Application Publication No. 2011/0054007 describes polynucleotide silencing elements that target RPS10. U.S. Patent Application Publication Nos. 2014/0275208 and US2015/0257389 describe polynucleotide silencing elements that target RyanR and PAT3. PCT publication numbers WO 2016/138106, WO 2016/060911, WO 2016/060912, WO 2016/060913 and WO 2016/060914 describe polynucleotide silencing elements that target COPI coatomer subunit nucleic acid molecules that confer pest resistance Coleoptera and Hemiptera. U.S. Patent Application Publications No. 2012/029750, No. US 20120297501, and No. 2012/0322660 describe interfering ribonucleic acids (RNA or double-stranded RNA) that function upon uptake by a pest species insect pest to downregulate the expression of a targeting gene in said insect pest, wherein the RNA comprises at least one silencing element, wherein the silencing element is a region of double-stranded RNA comprising complementary strands ringed, wherein a strand comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide targeting sequence within the targeting gene. U.S. Patent Application Publication No. 2012/0164205 describes potential targets for interfering double-stranded ribonucleic acids to inhibit invertebrate pests including: a Chd3 Homologous Sequence, a Beta-Tubulin Homologous Sequence, a 40 kDa, an EF1α Homologous Sequence, a 26S Proteasome Subunit p28 Homologous Sequence, a Juvenile Hormone Epoxide Hydrolase Homologous Sequence, a Swelling-Dependent Chloride Channel Protein Homologous Sequence, a Glucose-Protein Homologous Sequence 6-Phosphate 1-Dehydrogenase, an Act42A Protein Homologous Sequence, an ADP Ribosylation Factor 1 Homologous Sequence, a Transcription Factor IIB Protein Homologous Sequence, a Chitinase Homologous Sequence, a Ubiquitin, a Glyceraldehyde-3-Phosphate Dehydrogenase Homologous Sequence, a Ubiquitin B Homologous Sequence, a Juvenile Hormone Esterase Homolog, and an Alpha Tubulin Homologous Sequence.

Use in Pesticide Control

[0164] General methods for employing strains comprising a nucleic acid sequence of the embodiments or a variant thereof in pesticide control or in the projection of other organisms as pesticidal agents are known in the art.

[0165] Hosts of microorganisms that are known to occupy the "phytosphere" (phylloplane, phyllosphere, rhizosphere and/or rhizoplane) of one or more crops of interest can be selected. These microorganisms are selected so that they have the ability to compete successfully in the specific environment with wild-type microorganisms, provide stable maintenance and expression of the gene (or genes) expressing one or more of the IPD101 polypeptides, and, desirably, provide improved pesticide protection against environmental degradation and inactivation.

[0166] Alternatively, the IPD101 polypeptide is produced by introducing a heterologous gene into a cellular host. Expression of the heterologous gene results, directly or indirectly, in the intracellular production and maintenance of the pesticide. These cells are then treated under conditions that prolong the activity of the toxin produced in the cell when the cell is applied to the target pest (or pests) environment. The resulting product retains the toxicity of the toxin. These naturally encapsulated IPD101 polypeptides can then be formulated according to conventional techniques for application to the environment hosting a target pest, for example, soil water, water and plant foliage. See, for example, document no. EPA 0192319 and the references cited therein.

Pesticide Compositions

[0167] In some embodiments, the active ingredients can be applied in the form of compositions and can be applied to the crop or plant area to be treated, simultaneously or in succession, with other compounds. These compounds can be fertilizers, grass killers, cryoprotectants, surfactants, detergents, pesticide soaps, inactive oils, polymers, and/or time-release or biodegradable carrier formulations that allow for long-term dosing of a target area after an application. unique to the formulation. They may also be selective herbicides, chemical insecticides, virucides, microbiicides, amoebicides, pesticides, fungicides, bactericides, nematocides, molluscicides or mixtures of several of these preparations, if desired, together with additional agriculturally acceptable carriers, surfactants or adjuvants. application promotion customarily employed in the formulation technique. Suitable carriers and adjuvants can be solid or liquid and correspond to substances commonly used in formulation technology, for example, natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackiness enhancers, binders or fertilizers. Similarly, the formulations can be prepared into edible “bait” or manufactured into pest “traps” to allow feeding or ingestion by a pest targeted by the pesticide formulation.

[0168] Methods of applying an active ingredient or an agrochemical composition that contains at least one of the IPD101 polypeptide (or polypeptides) produced through bacterial strains include leaf application, seed coating and soil application. The number of applications and the application rate depend on the intensity of the infestation by the corresponding pest.

[0169] The composition may be formulated as a powder, dust, pellet, granule, spray, emulsion, colloid, solution or the like, and may be prepared by such conventional means as desiccation, lyophilization, homogenization, extraction, filtration, centrifugation, sedimentation or concentration of a cell culture comprising the polypeptide. In all such compositions containing at least one such pesticidal polypeptide, the polypeptide may be present in a concentration of from about 1% to about 99% by weight.

[0170] Pests of Lepidoptera, Diptera, Heteroptera, nematodes, Hemiptera or Coleoptera can be exterminated or reduced in numbers in a given area by the methods of disclosure or can be applied prophylactically to an environmental area to prevent infestation by a pest susceptible. Preferably, the pest ingests or comes into contact with a pesticide-effective amount of the polypeptide. "Pesticide effective amount" as used herein refers to an amount of the pesticide that is capable of exterminating at least one pest or noticeably reducing the growth, feeding, or normal physiological development of the pest. This amount will vary depending on such factors as, for example, the specific target pests to be controlled, the specific environment, the location, the plant, crop or agricultural site to be treated, the environmental conditions and the method, rate, concentration , stability and application amount of pesticide-effective polypeptide composition. Formulations may also vary with respect to weather conditions, environmental considerations, and/or frequency of application and/or severity of pest infestation.

[0171] The described pesticide compositions can be made by formulating the bacterial cell, crystal and/or spore suspension or isolated protein component with the desired agriculturally acceptable carrier. The compositions may be formulated prior to administration in appropriate media, such as lyophilized, cold-dried, desiccated, or in a suitable aqueous carrier, medium or diluent, such as saline or other buffer. The formulated compositions may be in the form of a dust or granular material or a suspension in oil (vegetable or mineral) or water or oil/water emulsions or as a wettable powder or in combination with any other carrier material suitable for agricultural application. Suitable agricultural carriers may be solid or liquid and are well known in the art. The term "agriculturally acceptable carrier" encompasses all adjuvants, inert components, dispersants, surfactants, tackiness enhancers, binders, etc. which are commonly used in pesticide formulation technology; these are well known to those skilled in the art of pesticide formulation. The formulations can be mixed with one or more solid or liquid adjuvants and prepared by various means, for example, by homogeneously mixing, blending and/or grinding the pesticide composition with suitable adjuvants using conventional formulation techniques. Suitable formulations and application methods are described in U.S. Patent No. 6,468,523. Plants may also be treated with one or more chemical compositions, including one or more herbicides, insecticides or fungicides. Exemplary chemical compositions include: Fruit/Vegetable Herbicides: Atrazine, Bromacil, Diuron, Glyphosate, Linuron, Metribuzin, Simazine, Trifluralin, Fluazifop, Glufosinate, Halosulfuron Gowan, Paraquat, Propizamide, Sethoxidim, Butafenacil, Halosulfuron, Indaziflam; Fruit/Vegetable Insecticides: Aldicarb, Bacillus thuriengiensis, Carbaryl, Carbofuran, Chlorpyrifos, Cypermethrin, Deltamethrin, Diazinon, Malathion, Abamectin, Cyfluthrin/beta-cyfluthrin, Esfenvalerate, Lambda-cyhalothrin, Acequinocyl, Bifenazate, Methoxyfenozide, Novaluron, Chromafenozide, Thiacloprid , Dinotefuran, FluaCrypyrim, Tolfenpyrad, Clothianidin, Spirodiclofen, Gamma-cyhalothrin, Spiromesifen, Spinosad, Rynaxypyr, Cyazypyr, Spinoteram, Triflumuron, Spirotetramat, Imidacloprid, Flubendiamide, Thiodicarb, Metaflumizone, Sulfoxaflor, Cyflumetofen, Cyanopyrafen, Imidacloprid, Clothianidin, Thiamethoxam, Spinotoram , Thiodicarb, Flonicamid, Methiocarb, Emamectin- benzoate, Indoxacarb, Forthiazate, Fenamiphos, Cadusaphos, Pyriproxifen, Fenbutatin-oxid, Hexthiazox, Methomyl, 4-[[(6- Chlorpyridin-3-yl)methyl](2,2-difluoroethyl )amino]furan-2(5H)-on; Fungicides from fruits/vegetables: carbendazim, chlorotalonil, ebdcs, sulfur, methyl thioophanate, azoxistro, cimoxanil, fl, flsate, fosetil, iprodione, metalaxil/mefenoxam kresoxim, trifloxistro, ethoboxam, iprovallib, trifloxtrobin, fenexami, fenexami, fenexami da, oxpoconazole fumarate, ciazofamide, Fenamidone, Zoxamide, Picoxystrobin, Pyraclostrobin, Ciflufenamide, Boscalid; Cereal Herbicides: Isoproturon, Bromoxynil, Ioxinil, Phenoxides, Chlorosulfuron, Clodinafope, Diclofope, Diflufenican, Fenoxaprope, Florasulam, Fluoroxipyr, Metsulfuron, Triasulfuron, Flucarbazone, Iodosulfuron, Propoxycarbazone, Picolinafen, Mesosulfuron, Beflubutamide, Pinoxaden, Amidosulf uron, Thifensulfuron Methyl, Tribenuron , Flupirsulfuron, Sulfosulfuron, Pirasulfotol, Piroxsulam, Flufenacet, Tralcoxidim, Piroxasulfon; Cereal Fungicides: Carbendazim, Chlorothalonil, Azoxystrobin, Ciproconazole, Ciprodinil, Fenpropimorph, Epoxiconazole, Kresoxim methyl, Quinoxifen, Tebuconazole, Trifloxystrobin, Simeconazole, Picoxystrobin, Piraclostrobin, Dimoxystrobin, Prothioconazole, Fluoxastrobin; Cereal Insecticides: Dimethoate, Lambda-cyhalothrin, Deltamethrin, alpha-Cypermethrin, β-cyfluthrin, Bifenthrin, Imidacloprid, Clotianidin, Thiamethoxam, Thiaclopride, Acetamipride, Dinetofuran, Chlorpyrifos, Methamidophos, Methyl Oxidemeton, Pirimicarb, Methiocarb; Corn Herbicides: Atrazine, Alachlor, Bromoxynil, Acetochlor, Dicamba, Clopyralid, (S-) Dimethenamid, Glufosinate, Glyphosate, Isoxaflutole, (S-) Metolachlor, Mesotrione, Nicosulfuron, Primisulfuron, Rimsulfuron, Sulcotrione, Foramsulfuron, Topramezone, Tembotrione, Saflufenacil, Thiencarbazone, Flufenacet, Pyroxasulfon; Apple Insecticides: Carbofuran, Chlorpyrifos, Bifenthrin, Fipronil, Imidacloprid, Lambda-Cialothrin, Tefluthrin, Terbufós, Thiamethoxam, Clotianidin, Spiromesifene, Flubendiamide, Triflumuron, Rinaxipir, Deltamethrin, Thiodicarb, β-Cyfluthrin, Cypermethrin, Bifenthrin, Lufenuron, Triflu moron, Tefluthrin, Tebupirimiphos, Etiprol, Ciazipyr, Thiaclopride, Acetamipride, Dinetofuran, Avermectin, Methiocarb, Spirodiclofen, Spirotetramate; Corn Fungicides: Fenitropane, Tiram, Prothioconazole, Tebuconazole, Trifloxystrobin; Rice Herbicides: Butachlor, Propanil, Azimsulfuron, Bensulfuron, Cialofope, Daimuron, Fentrazamide, Imazosulfuron, Mefenacet, Oxaziclomephone, Pirazosulfuron, Piributicarb, Quinclorac, Thiobencarb, Indanophane, Flufenacet, Fentrazamide, Halosulfuron, Oxaziclomephone, Benzobicyclon, Pyrifthalide, Penoxsulam, Bispiribac, Oxadiargyl, Ethoxysulfuron, Pretilachlor, Mesotrione, Tefuryltrione, Oxadiazone, Fenoxaprope, Pyrimisulfan; Rice Insecticides: Diazinon, Fenitrothion, Fenobucarb, Monocrotophos, Benfuracarb, Buprofezin, Dinotefuran, Fipronil, Imidacloprid, Isoprocarb, Thiaclopride, Cromafenozide, Thiaclopride, Dinotefuran, Clotianidin, Etiprol, Flubendiamide, Rinaxipir, Deltamethrin, Acetamipride, Thiamethoxam, Ci azipyr, Spinosad, Espinotoram, Emamectin Benzoate, Cypermethrin, Chlorpyrifos, Cartape, Methamidophos, Etofenprox, Triazophos, 4-[[(6-Chloropyridin- 3-yl)methyl](2,2-difluoroethyl)amino]furan-2(5H)-on , Carbofuran, Benfuracarb; Rice Fungicides: Methyl Thiophanate, Azoxystrobin, Carpropamide, Edifenfós, Ferimzone, Iprobenfós, Isoprothiolane, Pencicuron, Probenazole, Piroquilon, Tricyclazole, Trifloxystrobin, Diclocimet, Fenoxanil, Simeconazole, Tiadinil; Cotton Herbicides: Diuron, Fluometuron, MSMA, Oxifluorfen, Promethrin, Trifluralin, Carfentrazone, Clethodim, Fluazifope-butyl, Glyphosate, Norflurazon, Pendimethalin, Pyrithiobaque sodium, Trifloxisulfuron, Tepraloxidim, Glufosinate, Flumioxazin, Thidiazuron; Cotton insecticides: acephato, aldicarb, chlorifós, cypermethrin, deltametrin, malacin, monocrotofós, abamectin, acetamipride, emamectin benzoate, imidacloprida, indoxacarbe, lambda-dial, tiodicarbe, gama-cialotrin, spiromeifestic, pyridelil, flubediamida , Triflumuron, Rinaxipyr, Beta-Cyfluthrin, Spirotetramate, Clothianidin, Thiamethoxam, Thiaclopride, Dinetofuran, Flubendiamide, Cyazipyr, Spinosad, Spinotoram, Gamma Cialothrin, 4-[[(6-Chloropyridin-3-yl)methyl](2,2-difluoroethyl )amino]furan- 2(5H)-on, Thiodicarb, Avermectin, Flonicamide, Pyridalil, Spiromesifen, Sulfoxaflor, Profenofos, Triazophos, Endosulfan; Cotton Fungicides: Etridiazole, Metalaxyl, Quintozene; Soy Herbicides: Alachlor, Bentazone, Trifluralin, Ethyl Chlorimuron, Methyl Cloransulam, Fenoxaprope, Fomesafen, Fluazifop, Glyphosate, Imazamox, Imazaquin, Imazetapyr, (S-)Metolachlor, Metribuzin, Pendimethalin, Tepraloxidim, Glufosinate; Soy Insecticides: Lambda-cyhalothrin, Methomyl, Parathion, Thiocarb, Imidacloprid, Clothianidin, Thiamethoxam, Thiaclopride, Acetamipride, Dinetofuran, Flubendiamide, Rinaxipyr, Ciazipyr, Spinosad, Spinotoram, Emamectin Benzoate, Fipronil, Etiprole, Deltamethrin, β-Cyfluthrin, gamma and lambda Cyalothrin, 4- [[(6-Chloropyridin-3-yl)methyl](2,2-difluoroethyl)amino]furan-2(5H)- on, Spirotetramate, Spinodiclofen, Triflumuron, Flonicamide, Thiodicarb, beta- Cyfluthrin; Soy Fungicides: Azoxystrobin, Cyproconazole, Epoxiconazole, Flutriafol, Pyraclostrobin, Tebuconazole, Trifloxystrobin, Prothioconazole, Tetraconazole; Sugar beet herbicides: Chloridazon, Desmedifam, Etofumesato, Fenmedifam, Trialato, Clopyralid, Fluazifope, Lenacil, Metamitron, Quinmerac, Cycloxidim, Triflusulfuron, Tepraloxidim, Quizalofope; Sugar Beet Insecticides: Imidacloprid, Clothianidin, Thiamethoxam, Thiaclopride, Acetamipride, Dinetofuran, Deltamethrin, β-Cyfluthrin, gamma/lambda Cialothrin, 4-[[(6-Chloropyridin-3-yl)methyl](2,2-difluoroethyl) amino]furan-2(5H)-on, Tefluthrin, Rinaxipyr, Ciaxipyr, Fipronil, Carbofuran; Canola Herbicides: Clopyralid, Diclofope, Fluazifop, Glufosinate, Glyphosate, Metazaclor, Trifluralina Etametsulfuron, Quinmerac, Quizalofope, Clethodim, Tepraloxidim; Canola Fungicides: Azoxystrobin, Carbendazim, Fludioxonil, Iprodione, Prochloraz, Vinclozolin; Canola Insecticides: Carbofuran organophosphates, Pyrethroids, Thiaclopride, Deltamethrin, Imidacloprid, Clothianidin, Thiamethoxam, Acetamipride, Dinetofuran, β-Cyfluthrin, gamma and lambda Cyalothrin, tau-Fluvaleriate, Etiprol, Spinosad, Spinotoram, Flubendiamide, Rinaxipyr, Cyazipyr, 4 -[[(6-Chloropyridin-3-yl)methyl](2,2-difluoroethyl)amino]furan-2(5H)-on.

[0172] In some embodiments, the herbicide is Atrazine, Bromacil, Diuron, Chlorsulfuron, Metsulfuron, Tifensulfuron Methyl, Tribenuron, Acetochlor, Dicamba, Isoxaflutole, Nicosulfuron, Rimsulfuron, Pyritiobaque-sodium, Flumioxazin, Chlorimuron-Ethyl, Metribuzin, Quizalofop, S -metolachlor, Hexazinone or combinations thereof.

[0173] In some embodiments, the insecticide is Esfenvalerate, Chlorantraniliprole, Methomyl, Indoxacarb, Oxamil or combinations thereof.

Pesticide and insecticide activity

[0174] "Pest" includes, but is not limited to, insects, fungi, bacteria, nematodes, mites, ticks and the like. Insect pests include insects selected from the orders Coleoptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera, Orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera, etc., particularly Lepidoptera and Coleoptera.

[0175] Those skilled in the art will recognize that not all compounds are equally effective against all pests. The compounds of the embodiments exhibit activity against insect pests, which may include agronomic, forestry, greenhouse, nursery, ornamental plant, food and fiber, public and animal health, domestic and commercial structure, household and stored product pests of economic importance. .

[0176] Larvae of the order Lepidoptera include, but are not limited to, armyworms, cutterworms, bollworms and bollworms in the Noctuidae family Spodoptera frugiperda JE Smith (autumn armyworm); S. exigua Hübner (beet armyworm); S. litura Fabricius (tobacco cutterworm, tobacco cutworm); Mamestra configurata Walker (bertha military caterpillar); M. brassicae Linnaeus (cabbage moth); Agrotis ipsilon Hufnagel (thread caterpillar); A. orthogonia Morrison (western screwworm); A. subterranea Fabricius (grained screwworm); Alabama argillacea Hübner (Cotton leafworm); Trichoplusia ni Hübner (cabbage falsewort); Pseudoplusia includens Walker (soybean falsewort); Anticarsia gemmatalis Hübner (soybean caterpillar); Hypena scabra Fabricius (green clover worm); Heliothis virescens Fabricius (apple caterpillar); Pseudaletia unipuncta Haworth (army caterpillar); Athetis mindara Barnes and Mcdunnough (rough-skinned screwworm); Euxoa messoria Harris (dark-sided screwworm); Earias insulana Boisduval (spiny boll caterpillar); E. vittella fabricius (dotted boll caterpillar); Helicoverpa armigera Hübner (American boll caterpillar); H. zea Boddie (corn earworm or cotton boll caterpillar); Melanchra picta Harris (zebra caterpillars); Egira (Xylomyges) curialis Grote (citrus cutworm); borers, wall moths, cone caterpillars and skeletonizers of the family Pyralidae Ostrinia nubilalis Hübner (European corn borer); Amyelois transitella Walker (naval orange caterpillar); Anagasta kuehniella Zeller (Mediterranean wheat moth); Cadra cautella Walker (cocoa moth); Chilo suppressalis Walker (rice stem borer); C. partellus, (sorghum borer); Corcyra cephalonica Stainton (rice moth); Crambus caliginosellus Clemens (corn rootworm); C. teterrellus Zincken (grass web-spinning caterpillar); Cnaphalocrocis medinalis Guenée (tortricid rice moth); Desmia funeralis Hübner (grape leaf bender); Diaphania hyalinata Linnaeus (melon caterpillar); D. nitidalis Stoll (pickle caterpillar); Diatraea grandiosella Dyar (southwestern corn borer), D. saccharalis Fabricius (sugar cane borer); Eoreuma loftini Dyar (Mexican rice drill); Ephestia elutella Hübner (tobacco (cocoa) moth); Galleria mellonella Linnaeus (great wax moth); Herpetogramma licarsisalis Walker (catworm); Homoeosoma electellum Hulst (sunflower moth); Elasmopalpus lignosellus Zeller (collar borer ); Achroia grisella Fabricius (wax moth); Loxostege sticticalis Linnaeus (beet net caterpillar); Orthaga thyrisalis Walker (tea tree web moth); Maruca testulalis Geyer (bean borer); Plodia interpunctella Hübner (Meal moth Indiana); Scirpophaga incertulas Walker (yellow stem borer); Udea rubigalis Guenée (celery moth); and roller caterpillars, bud caterpillars, seed caterpillars, and fruit caterpillars in the family Tortricidae Acleris gloverana Walsingham (black-headed bud caterpillar west); A. variana Fernald (eastern black-headed budworm); Archips argyrospila Walker (fruit tree leafroller); A. rosana Linnaeus (European leafroller); and other Archips species, Adoxophyes orana Fischer von Rosslerstamm (summer fruit tortricid moth); Cochylis hospes Walsingham (sunflower banded moth); Cydia latiferreana Walsingham (hazel moth); C. pomonella Linnaeus (Bichado das 5 pomoideas); Platynota flavedana Clemens (variegated leafroller); P. stultana Walsingham (omnivorous leafroller); Lobesia botrana Denis & Schiffermüller (Eudémis); Spilonota ocellana Denis & Schiffermüller (red 10-bud moth); Endopiza viteana Clemens (grape berry moth); Eupoecilia ambiguella Hübner (Cochilis); Bonagota salubricola Meyrick (Apple roller caterpillar); Grapholita molesta Busck (Eastern peach moth); Suleima helianthana Riley (sunflower bud moth); Argyrotaenia spp.; Choristoneura spp.

[0177] Other agronomic pests selected from the order Lepidoptera include, but are not limited to, Alsophila pometaria Harris (locusts); Anarsia lineatella Zeller (peach borer); Anisota senatoria J.E. Smith (orange-striped oak caterpillar); Antheraea pernyi Guérin-Méneville (Chinese Oak Tussah Moth); Bombyx mori Linnaeus (Silk Moth); Bucculatrix thurberiella Busck (Leaf mining caterpillar); Colias eurytheme Boisduval (alfalfa caterpillar); Datana integerrima Grote & Robinson (walnut caterpillar); Dendrolimus sibiricus Tschetwerikov (Siberian silk moth), Ennomos subsignaria Hübner (elm caterpillar) ); Hemileuca oliviae Cockrell (bandworm); Hyphantria cunea Drury (autumn webworm); Keiferia lycopersicella Walsingham (tomato pinworm); Lambdina fiscellaria fiscellaria Hulst (eastern hemlock webworm); L. fiscellaria lugubrosa Hulst (western hemlock caterpillar); Leucoma salicis Linnaeus (satin moth); Lymantria dispar Linnaeus (gypsy moth); Manduca quinquemaculata Haworth (5-spotted hawk moth, tomato hornworm); M. sexta Haworth (tomato hornworm). tomato, tobacco hornworm); Operophtera brumata Linnaeus (Winter moth); Paleacrita vernata Peck (spring gangrene caterpillar); Papilio cresphontes Cramer (giant swallowtail, orange dog); Phryganidia californica Packard (California oak caterpillar); Phyllocnistis citrella Stainton (citrus leaf miner); Phyllonorycter blancardella Fabricius (spotted leaf miner); Pieris brassicae Linnaeus (large white butterfly); P. rapae Linnaeus (small white butterfly); P. napi Linnaeus (white butterfly with green streaks); Platyptilia carduidactyla Riley (feathery artichoke moth); Plutella xylostella Linnaeus (diamond-backed moth); Pectinophora gossypiella Saunders pink boll caterpillar); Pontia protodice Boisduval and Leconte (southern cabbageworm); Sabulodes aegrotata Guenée (omnivorous rolling caterpillar); Schizura concinna J.E. Smith (red arched caterpillar); Sitotroga cerealella Olivier (Angoumois cereal moth); Thaumetopoea pityocampa Schiffermuller (pine processionary moth); Tineola bisselliella Hummel (striped house moth); Tuta absolute Meyrick (tomato leaf miner); Yponomeuta padella Linnaeus (ermine moth); Heliothis subflexa Guenée; Malacosoma spp. and Orgyia spp.

[0178] Of interest are the larvae and adults of the order Coleoptera, including weevils of the families Anthribidae, Bruchidae and Curculionidae (including, but not limited to: Anthonomus grandis Boheman (cotton weevil); Lissorhoptrus oryzophilus Kuschel (rice water weevil ); Sitophilus granarius Linnaeus (barn weevil); S. oryzae Linnaeus (rice weevil); Hypera punctata Fabricius (clover leaf weevil); Cylindrocopturus adspersus LeConte (sunflower stem weevil); Smicronyx fulvus LeConte (red weevil sunflower seed); S. sordidus LeConte (gray sunflower seed weevil); Sfenophorus maidis Chittenden (maize weevil)); flea beetles, cucumber beetles, rootworms, leaf beetles, potato beetles and leafminers in the family Chrysomelidae (including but not limited to: Leptinotarsa decemlineata Say (Colorado potato beetle); Diabrotica virgifera virgifera western corn root); D. barberi Smith and Lawrence (northern corn rootworm); D. undecimpunctata howardi Barber (southern corn rootworm); Chaetocnema pulicaria Melsheimer (corn flea beetle); Phyllotreta cruciferae Goeze (cruciferous flea beetle); Phyllotreta striolata (striped flea beetle); Colaspis brunnea Fabricius (grape colaspis); Oulema melanopus Linnaeus (cereal leaf beetle); Zygogramma exclamationis Fabricius (sunflower beetle)); beetles of the family Coccinellidae (including, but not limited to: Epilachna varivestis Mulsant (Mexican bean beetle)); Beetles and other beetles of the family Scarabaeidae (including, but not limited to: Popillia japonica Newman (Japanese beetle); Cyclocephala borealis Arrow (northern masked beetle, white beetle); C. immaculata Olivier (southern masked beetle, white beetle); Rhizotrogus majalis Razoumowsky (European beetle); Phyllophaga crinita Burmeister (white beetle); Ligyrus gibbosus De Geer (carrot beetle)); carpet beetles from the family Dermestidae; wire larvae of the family Elateridae, Eleodes spp., Melanotus spp.; Conoderus spp.; Limonius spp.; Agriotes spp.; Ctenicera spp.; Aeolus spp.; bark beetles in the family Scolytidae and beetles in the family Tenebrionidae.

[0179] Adults and immatures of the order Diptera are of interest, including Agromyza parvicornis Loew leaf miner (corn leaf miner); flies (including, but not limited to: Contarinia sorghicola Coquillett (sorghum fly); Mayetiola destructor Say (Hessian fly); Sitodiplosis mosellana Géhin (wheat fly); Neolasioptera murtfeldtiana Felt, (sunflower seed fly)); fruit flies (Tephritidae), Oscinella frit Linnaeus (fruit flies); worms (including, but not limited to: Delia platura Meigen (corn seed worm); D. coarctata Fallen (wheat bulb fly) and other Delia spp., Meromyza americana Fitch (wheat stem worm); Musca domestica Linnaeus (house flies); Fannia canicularis Linnaeus, F. femoralis Stein (lesser house flies); Stomoxys calcitrans Linnaeus (stable flies)); face flies, horn flies, blow flies, Chrysomya spp.; Phormia spp. and other pest flies, horse flies Tabanus spp.; flies from the Gastrophilus spp. family; Oestrus spp.; cattle beetles Hypoderma spp.; deer flies Chrysops spp.; Melophagus ovinus Linnaeus (keds) and other Brachycera, Aedes spp. mosquitoes; Anopheles spp.; Culex spp.; black flies Prosimulium spp.; Simulium spp.; biting flies, sand flies, sciarids and other Nematocera.

[0180] Included as insects of interest are adults and nymphs of the orders Hemiptera and Homoptera, such as, but not limited to, adelgids of the Adelgidae family, plant insects of the Miridae family, cicadas of the Cicadidae family, leafhoppers, Empoasca spp.; of Cicadellidae, plant leafhoppers of the families Cixiidae, Flatidae, Fulgoroidea, Issidae and Delphacidae, tree leafhoppers of the family Membracidae, psyllids of the family Psyllidae, whiteflies of the family Aleyrodidae, aphids of the family Aphididae, pphylloxera of the family Phylloxeridae, mealybugs from the family Pseudococcidae, scales from the families Asterolecanidae, Coccidae, Dactylopiidae, Diaspididae, Eriococcidae Ortheziidae, Phoenicococcidae and Margarodidae, lace bug from the family Tingidae, stink bugs from the family Pentatomidae, cincha bugs, Blissus spp.; and other seed bugs of the family Lygaeidae, leafhoppers of the family Cercopidae, pulp bugs of the family Coreidae, and red stink bugs and cotton-spotted stink bugs of the family Pyrrhocoridae.

[0181] Agronomically important members of the order Hemiptera additionally include, but are not limited to: Acyrthisiphon pisum Harris (pea aphid); Aphis craccivora Koch (cowpea aphid); A. fabae Scopoli (black bean aphid); A. gossypii Glover (cotton aphid, melon aphid); A. maidiradicis Forbes (corn root aphid); A. pomi De Geer (apple aphid); A. spiraecola Patch (spiraea aphid); Aulacorthum solani Kaltenbach (Dedalis aphid); Chaetosiphon fragaefolii Cockerell (strawberry aphid); Diuraphis noxia Kurdjumov/Mordvilko (Russian wheat aphid); Dysaphis plantaginea Paaserini (gray apple aphid); Eriosoma lanigerum Hausmann (apple woolly aphid); Brevicoryne brassicae Linnaeus (cabbage aphid); Hyalopterus pruni Geoffroy (plum mealy aphid); Lipaphis erysimi Kaltenbach (turnip aphid); Metopolophium dirrhodum Walker (cereal aphid); Macrosiphum euphorbiae Thomas (potato aphid); Myzus persicae Sulzer (peach aphid, green peach aphid); Nasonovia ribisnigri Mosley (lettuce aphid); Pemphigus spp. (root aphids and gall aphids); Rhopalosiphum maidis Fitch (corn leaf aphid); R. padi Linnaeus (wild cherry aphid); Schizaphis graminum Rondani (cereal aphid); Sipha flava Forbes (yellow sugarcane aphid); Sitobion avenae Fabricius (English grain aphid); Therioaphis maculata Buckton (spotted alfalfa aphid); Toxoptera aurantii Boyer de Fonscolombe (black citrus aphid) and T. citricida Kirkaldy (brown citrus aphid); Adelges spp. (adelgids); Phylloxera devastatrix Pergande (pecan phylloxera); Bemisia tabaci Gennadius (tobacco whitefly, sweet potato whitefly); B. argentifolii Bellows & Perring (silverleaf whitefly); Dialeurodes citri Ashmead (citrus whitefly); Trialeurodes abutiloneus (striped-wing whitefly) and T. vaporariorum Westwood (greenhouse whitefly); Empoasca fabae Harris (potato leafhopper); Laodelphax striatellus Fallen (lesser brown planthopper); Macrolestes quadrilineatus Forbes (aster leafhopper); Nephotettix cinticeps Uhler (green leafhopper); N. nigropictus Stâl (rice leafhopper); Nilaparvata lugens Stâl (brown leafhopper); Peregrinus maidis Ashmead (corn leafhopper); Sogatella furcifera Horvath (white-backed planthopper); Sogatodes orizicola Muir (rice delphacid); Typhlocyba pomaria McAtee (white apple leafhopper); Erythroneoura spp. (grape leafhoppers); Magicicada septendecim Linnaeus (periodic cicada); Icerya purchasi Maskell (white aphid); Quadraspidiotus perniciosus Comstock (São José aphid); Planococcus citri Risso (citrus scale insect); Pseudococcus spp. (another cochineal complex); Cacopsylla pyricola Foerster (pear psyllid); Trioza diospyri Ashmead (persimmon psyllid).

[0182] Agronomically important species of interest from the order Hemiptera include, but are not limited to: Acrosternum hilare Say (green stink bug); Anasa tristis De Geer (pumpkin beetle); Blissus leucopterus leucopterus Say (grass beetle); Corythuca gossypii Fabricius (cotton lace beetle); Cyrtopeltis modesta Distant (tomato beetle); Dysdercus suturellus Herrich-Schaffer (cotton stain bug); Euschistus servus Say (brown stink bug); E. variolarius Palisot de Beauvois (spotted stink bug); Graptostethus spp. (seed beetle complex); Leptoglossus corculus Say (leaf-footed pine seed beetle); Lygus lineolaris Palisot de Beauvois (spotted plant beetle); L. Hesperus Knight (western spotted plant beetle); L. pratensis Linnaeus (common meadow beetle); L. rugulipennis Poppius (European spotted plant beetle); Lygocoris pabulinus Linnaeus (common green capsid); Nezara viridula Linnaeus (southern green stink bug); Oebalus pugnax Fabricius (rice bug); Oncopeltus fasciatus Dallas (large milkweed beetle); Pseudatomoscelis seriatus Reuter (cotton flea).

[0183] Additionally, the modalities may be effective against Hemiptera such as Calocoris norvegicus Gmelin (strawberry beetle); Orthops campestris Linnaeus; Plesiocoris rugicollis Fallen (apple capsid); Cyrtopeltis modestus Distant (tomato beetle); Cyrtopeltis Notatus Distant (fly); Spanagonicus albofasciatus Reuter (white tag flea); Diaphnocoris chlorionis Say (Virginia hawthorn beetle); Labopidicola allii Knight (onion plant beetle); Pseudatomoscelis seriatus Reuter (cotton flea); Adelphocoris rapidus Say (fast plant beetle); Poecilocapsus lineatus Fabricius (four-lined plant beetle); Nysius ericae Schilling (false grass beetle); Nysius raphanus Howard (false grass beetle); Nezara viridula Linnaeus (southern green stink bug); Eurygaster spp.; Coreidae spp.; Pyrrhocoridae spp.; Tinidae spp.; Blostomatidae spp.; Reduviidae spp. and Cimicidae spp.

[0184] Also included are adults and larvae of the order Acari (mites), such as Aceria tosichella Keifer (wheat rolling mite); Petrobia latens Müller (brown wheat mite); spider mites and red mites in the family Tetranychidae, Panonychus ulmi Koch (European red mite); Tetranychus urticae Koch (two-spotted spider mite); (T. mcdanieli McGregor (McDaniel mite); T. cinnabarinus Boisduval (crimson spider mite); T. turkestani Ugarov & Nikolski (strawberry spider mite); flat mites in the family Tenuipalpidae, Brevipalpus lewisi McGregor (citrus flat mite); spider mites rust and bud mites in the family Eriophyidae and other foliar-feeding mites and mites important in human and animal health, i.e. dust mites in the family Epidermoptidae, follicle mites in the family Demodicidae, grain mites in the family Glycyphagidae, ticks in the order Ixodidae. Ixodes scapularis Say (deer tick); I. holocyclus Neumann (Australian paralysis tick); Dermacentor variabilis Say (American dog tick); Amblyomma americanum Linnaeus (lone star tick) and scabies and itch mites in the families Psoroptidae , Pyemotidae and Sarcoptidae.

[0185] Insect pests of the order Thysanura are of interest, such as Lepisma saccharina Linnaeus (moth); Thermobia domestica Packard (earwig).

[0186] Additional arthropod pests covered include: spiders in the order Araneae such as Loxosceles reclusa Gertsch and Mulaik (brown recluse spider) and the Latrodectus mactans Fabricius (black widow spider) and centipedes in the order Scutigeromorpha such as Scutigera coleoptrata Linnaeus (house centipede).

[0187] Insect pests of interest include the bedbug superfamily and other related insects including, but not limited to, species that belong to the family Pentatomidae (Nezara viridula, Halyomorpha halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare, Euschistus heros, Euschistus tristigmus, Acrosternum hilare, Dichelops furcatus, Dichelops melacanthus and Bagrada hilaris (Bagada beetle)), the family Plataspidae (Megacopta cribraria - Bean Plataspid) and a family Cydnidae (Scaptocoris castanea - root bug) and species of Lepidoptera including but not limited to limitation: diamondback moth, e.g. Helicoverpa zea Boddie; false caterpillar, for example, Pseudoplusia includens Walker and soybean caterpillar, for example, Anticarsia gemmatalis Hübner.

[0188] Methods for measuring pesticide activity are well known in the art. See, for example, Czapla and Lang, (1990) J. Econ. Entomol. 83:2,480 to 2,485; Andrews, et al., (1988) Biochem. J. 252:199 to 206; Marrone, et al., (1985) J. of Economic Entomology 78:290 to 293 and U.S. Patent No. 5,743,477. Generally, the protein is mixed and used in feeding trials. See, for example, Marrone, et al., (1985) J. of Economic Entomology 78:290 to 293. Such tests may include placing plants in contact with one or more pests and determining the ability of the plant to survive and/or cause the extermination of pests.

[0189] Nematodes include parasitic nematodes, such as root-knot nematodes, cyst-forming and lesion-forming nematodes, including Heterodera spp., Meloidogyne spp. and Globodera spp.; particularly members of the cyst nematodes, including, but not limited to, Heterodera glycines (soybean cyst nematode); Heterodera schachtii (beet cyst nematode); Heterodera avenae (cereal cyst nematode) and Globodera Roschiensis and Globodera pailida (potato cyst nematode). Lesion nematodes include Pratylenchus spp.

Seed Treatment

[0190] To protect and enhance yield and trait production technologies, seed treatment options can provide additional crop plan flexibility and cost-effective control against insects, grasses, and diseases. The seed material may be treated, typically surface treated, with a composition comprising combinations of chemical or biological herbicides, herbicide safeners, insecticides, fungicides, germination inhibitors and enhancers, nutrients, plant growth regulators and activators, bactericides, nematocides, avicides and/or molluscicides. These compounds are typically formulated together with additional carriers, surfactants or application promoting adjuvants customary in the formulation technique. Coatings can be applied by impregnating the propagation material with a liquid formulation or by coating with a combined wet or dry formulation. Examples of the various types of compounds that can be used as seed treatments are given in The Pesticide Manual: A World Compendium, C.D.S. Tomlin Ed., published by the British Crop Production Council.

[0191] Some seed treatments that can be used on crop seed include, but are not limited to, one or more of abscisic acid, acibenzolar-S-methyl, avermectin, amitrol, azaconazole, azospirillum, azadirachtin, azoxystrobin, Bacillus spp. (which includes one or more species among cereus, firmus, megaterium, pumilis, sphaericus, subtilis and/or thuringiensis), bradyrhizobium spp. (which includes one or more of betae, canariense, elkanii, iriomotense, japonicum, liaonigense, pachyrhizi and/or yuanmingense), capitan, carboxin, chitosan, clothianidin, copper, cyazipyr, difenoconazole, etidiazole, fipronil, fludioxonil, fluoxastrobin, fluquinconazole , flurazole, flowfenim, harpin protein, imazalil, imidacloprid, ipconazole, isoflavonoids, lipo-chito-oligosaccharide, mancozeb, manganese, maneb, mefenoxam, metalaxyl, metconazole, myclobutanil, PCNB, penflufen, penicillium, penthiopyrad, permethrin, picoxystrobin, prothioconazole, pyraclostrobin, rinaxipyr, S-metolaclor, saponin, sedaxane, TCMTB, tebuconazole, thiabendazole, thiamethoxam, tiocarb, thiram, tolclofos-methyl, triadimenol, tricoderma, trifloxystrobin, triticonazole and/or zinc. PCNB seed coating refers to EPA Registration Number 00293500419, which contains quintazen and terrazole. TCMTB refers to 2-(thiocianomethylthio) benzothiazole.

[0192] Seed varieties and seeds with specific transgenic traits can be tested to determine which seed treatment options and application rates can complement such transgenic varieties and traits in order to improve yield. For example, a variety with satisfactory yield potential but susceptibility to corn rust may benefit from the use of a seed treatment that provides protection against corn rust, a variety with satisfactory yield potential but susceptibility cyst nematode may benefit from the use of a seed treatment that provides protection against cyst nematode, and so on. Similarly, a variety that encompasses a transgenic trait that confers insect resistance may benefit from the second mode of action conferred by seed treatment, a variety that encompasses a transgenic trait that confers herbicide resistance may benefit from a seed treatment with a phytoprotectant that improves plant resistance to that herbicide, etc. Additionally, satisfactory root establishment and early emergence resulting from the appropriate use of a seed treatment can result in more effective nitrogen use, an improved ability to withstand drought, and an overall increase in yield potential of a variety or varieties. that contain a certain trait when combined with a seed treatment.

Methods for exterminating an insect pest and controlling an insect population

[0193] In some embodiments, methods are provided for exterminating an insect pest comprising placing the insect pest, either simultaneously or sequentially, in contact with an insecticidally effective amount of a recombinant IPD101 polypeptide of the disclosure. In some embodiments, methods for killing an insect pest are provided which comprise contacting the insect pest with an insecticidally effective amount of one or more of a recombinant pesticidal protein of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, or a variant or an insecticide-active fragment thereof.

[0194] In some embodiments, methods for controlling an insect pest population are provided that comprise placing the insect pest population, simultaneously or sequentially, in contact with an insecticidally effective amount of one or more of an IPD101 polypeptide. recombinant of the disclosure. In some embodiments, methods for controlling an insect pest population are provided which comprise contacting the insect pest population with an insecticidally effective amount of one or more of a recombinant IPD101 polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60 , or an insecticide-active variant or fragment thereof. As used herein, "controlling a pest population" or "controlling a pest" refers to any effect on a pest that results in limiting the damage that the pest causes. Controlling a pest includes, but is not limited to, exterminating the pest, inhibiting the development of the pest, altering the fertility or growth of the pest in such a way that the pest causes less damage to the plant, decreasing the number of offspring produced, producing less adapted pests, produce pests more susceptible to attack by predators or prevent pests from feeding on the plant.

[0195] In some embodiments, methods are provided for controlling an insect pest population resistant to a pesticide protein that comprise placing the insect pest population, simultaneously or sequentially, in contact with an insecticide-effective amount of one or more plus a recombinant IPD101 polypeptide of the disclosure. In some embodiments, methods for controlling an insect pest population resistant to a pesticidal protein are provided which comprise contacting the insect pest population with an insecticidally effective amount of one or more of a recombinant IPD101 polypeptide of SEQ. ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56 , 58, and 60, or an insecticide-active variant or fragment thereof.

[0196] In some embodiments, methods are provided for protecting a plant against an insect pest, comprising expressing in the plant or cell thereof at least one recombinant polynucleotide encoding an IPD101 polypeptide of the disclosure. In some embodiments, methods for protecting a plant against an insect pest are provided which comprise expressing, in the plant or cell thereof, a recombinant polynucleotide encoding one or more IPD101 polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, or active variants or fragments in terms of their insecticide.

Insect Resistance Management (IRM) Strategies

[0197] The expression of B. thuringiensis δ-endotoxins in transgenic corn plants has been demonstrated as an effective means of controlling agriculturally important insect pests (Perlak, et al., 1990; 1993). However, in certain cases, insects have evolved to become resistant to B. thuringiensis δ-endotoxins expressed in transgenic plants. Such resistance, if widespread, would clearly limit the commercial value of germplasm containing genes encoding such B. thuringiensis δ-endotoxins.

[0198] One way to increase the effectiveness of transgenic insecticides against target pests and contemporaneously reduce the development of insecticide-resistant pests is to provide non-transgenic (i.e., non-insecticidal proteins) refugia (a section of non-insecticide crops/corn). ) for use with transgenic crops that produce a unique insecticidal protein active against target pests. The United States Environmental Protection Agency (epa.gov/oppbppdl/biopesticides/pips/bt_corn_refuge_2006.htm, which can be accessed using the prefix www) publishes requirements for use with transgenic crops that produce a single active Bt protein against target pests. Additionally, the National Corn Growers Association, on its website: (ncga.com/inseto-resistência-management-fact-sheet-bt-corn, which can be accessed using the prefix www) also provides similar guidance on in relation to asylum requirements. Due to insect losses within the refuge area, larger refuges may reduce overall yield.

[0199] Another way to increase the effectiveness of transgenic insecticides against target pests and contemporaneously reduce the development of insecticide-resistant pests would be a replacement of insecticidal genes that are effective against groups of insect pests and that manifest their effects through different modes of action.

[0200] The expression in a plant of two or more insecticide compositions toxic to the same insect species, wherein each insecticide is expressed at effective levels, would be another way to achieve control of the development of resistance. This is based on the principle that the evolution of resistance against two separate modes of action is much more unlikely than just one. Roush, for example, highlights two-toxin strategies, also called "pyramiding" or "stacking" for managing insecticidal GM crops. (The Royal Society. Phil. Trans. R. Soc. Lond. B. (1998) 353:1777 to 1786). Stacking or pyramiding two different proteins, each effective against the target pests and with little or no cross-resistance, may allow use of a smaller refuge. The United States Environmental Protection Agency requires significantly less structured refuge (generally 5%) of non-Bt corn to be planted relative to single-trait products (generally 20%). There are several ways to provide the IRM effects of a refuge, including various geometric planting patterns in fields and seed mixtures in bags, as further discussed by Roush.

[0201] In some embodiments, the IPD101 polypeptides of the disclosure are useful as an insect resistance management strategy in combination (i.e., pyramided) with other pesticide proteins or other transgenes (i.e., an RNAi trait) including, but without limitation, Bt toxins, insecticidal proteins from Xenorhabdus sp. or Photorhabdus sp., other insecticidal active proteins and the like.

[0202] Methods for controlling Lepidoptera and/or Coleoptera insect infestation (or infestations) in a transgenic plant that promote insect resistance management are provided, comprising expressing in the plant at least two different insecticidal proteins that have different modes of action. .

[0203] In some embodiments, methods for controlling Lepidoptera and/or Coleoptera insect infestation in a transgenic plant and promoting insect resistance management comprise presenting at least one of the IPD101 polypeptide insecticidal proteins to insects in the order Lepidoptera and /or Coleoptera.

[0204] In some embodiments, methods for controlling Lepidoptera and/or Coleoptera insect infestation in a transgenic plant and promoting insect resistance management comprise presenting at least one of the IPD101 polypeptides of SEQ ID NOS: 2, 4, 6 , 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, or variants or insecticide-active fragments thereof, insecticides for insects in the order Lepidoptera and/or Coleoptera.

[0205] In some embodiments, methods for controlling Lepidoptera and/or Coleoptera insect infestation in a transgenic plant and promoting insect resistance management comprise expressing in the transgenic plant an IPD101 polypeptide and a Cry protein or other insect insecticidal protein in the order Lepidoptera and/or Coleoptera that have different modes of action.

[0206] In some embodiments, methods for controlling Lepidoptera and/or Coleoptera insect infestation in a transgenic plant and promoting insect resistance management comprise expressing in the transgenic plant at least one of an IPD101 polypeptide of SEQ ID NOS: 2 , 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, or insecticidally active variants or fragments thereof and a Cry protein or other insecticidal protein for insects in the order Lepidoptera and/or Coleoptera, with the IPD101 polypeptide and the Cry protein having different modes of action.

[0207] Methods are also provided for reducing the probability of emergence of resistance to Lepidoptera and/or Coleoptera insects to transgenic plants that express, in plants, insecticidal proteins to control insect species that comprise the expression of at least one of a polypeptide IPD101 insecticide for insect species in combination with a second insecticidal protein for insect species that have different modes of action.

[0208] Means are also provided for effective Lepidoptera and/or Coleoptera insect resistance management of transgenic plants comprising co-expressing at high levels in the plants two or more insecticidal proteins or other insecticidal transgenes (e.g., an RNAi trait) toxic to Lepidoptera and/or Coleoptera insects, but each exhibits a different way of carrying out its killing activity, in which two or more of the insecticidal proteins or other insecticidal transgenes comprise an IPD101 polypeptide and a Cry protein. Also provided are means for effective Lepidoptera and/or Coleoptera insect resistance management of transgenic plants comprising co-expressing, at high levels in the plants, two or more insecticidal proteins or other insecticidal transgenes (e.g., an RNAi trait) toxic to insects. Lepidoptera and/or Coleoptera, but each exhibiting a different way of carrying out its extermination activity, with two or more insecticidal proteins or other insecticidal transgenes comprising at least one of an IPD101 polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, or variants or insecticidally active fragments thereof, and a Cry protein or other insecticidally active protein.

[0209] Additionally, methods are provided for obtaining regulatory approval for the planting or commercialization of plants that express insecticidal proteins for insects in the order Lepidoptera and/or Coleoptera, comprising the step of referring to, presenting or relying on linkage data from insect assays showing that the IPD101 polypeptide does not compete with binding sites for Cry proteins in such insects. Additionally, methods for obtaining regulatory approval for planting or marketing plants that express insecticidal proteins for insects in the order Lepidoptera and/or Coleoptera are provided that comprise the step of referring to, presenting, or relying on insect assay binding data. which show that one or more of the IPD101 polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 28, 29, 30, 32, 46, 48, 50, 52, 54, 56, 58, and 60, or variants or insecticidally active fragment thereof, do not compete with the binding site for Cry proteins in such insects.

Methods for Increasing Plant Yield

[0210] Methods for increasing plant yield are provided. The methods comprise providing a plant or plant cell that expresses a polynucleotide encoding the pesticidal polypeptide sequence disclosed herein and cultivating the plant or a seed thereof in a field infested with a pest against which the polypeptide has pesticidal activity. In some embodiments, the polypeptide has pesticidal activity against a pest of Lepidoptera, Coleoptera, Diptera, Hemiptera or nematodes and the field is infested with a pest of Lepidoptera, Hemiptera, Coleoptera, Diptera or nematodes.

[0211] As defined herein, the "yield" of the plant refers to the quality and/or quantity of biomass produced by the plant. "Biomass" as used herein refers to any measured plant product. An increase in biomass production is any improvement in the measured plant product yield. Increasing plant yield has several commercial applications. For example, increasing plant leaf biomass can increase the yield of leafy vegetables for human or animal consumption. Additionally, increased leaf biomass can be used to increase the production of plant-derived pharmaceutical or industrial products. An increase in yield may comprise any statistically significant increase including, but not limited to, at least a 1% increase, at least a 3% increase, at least a 5% increase, at least a 10% increase, at least an increase of 20%, at least 30%, at least 50%, at least 70%, at least 100% or a greater increase in yield compared to a plant that does not express the pesticidal sequence.

[0212] In specific methods, plant yield is increased as a result of improved pest resistance of a plant that expresses at least one IPD101 polypeptide disclosed herein. Expression of the IPD101 polypeptide (or IPD101 polypeptides) results in a reduced ability of a pest to infest or feed on the plant, thereby improving plant yield.

Processing Methods

[0213] Further provided are methods for processing a plant, part of plants or seed to obtain a food or food product from a plant, part of plants or seed comprising at least one IPD101 polynucleotide. The plants, plant parts or seeds provided herein may be processed to yield oil, protein products and/or by-products which are derivatives obtained by processing that have commercial value. Non-limiting examples include transgenic seeds comprising a nucleic acid molecule encoding one or more IPD101 polypeptides that can be processed to yield soybean oil, soybean products and/or soybean by-products.

[0214] "Processing" refers to any physical and chemical methods used to obtain any soybean product and include, but are not limited to, heat conditioning, flocculation and grinding, extrusion, solvent extraction or aqueous soaking, and extraction of whole seeds or partial.

[0215] The following examples are offered by way of illustration and not as a limitation.

EXAMPLES Example 1 - Identification of an Insecticidal Protein Active Against Western Corn Rootworm (WCRW) of Strain JH70371-1

[0216] The insecticidal protein IPD101Aa was identified by protein purification, N-terminal amino acid sequencing and PCR cloning of the bacterial strain JH70371-1 as follows. Insecticidal activity against WCRW was observed from a cell lysate of strain JH70371-1 that was grown in Terrific Broth (BD Difco™, catalog no. 243820) and grown overnight at 28°C with shaking at 200 rpm . This insecticidal activity exhibited sensitivity to protease and heat indicating a proteinaceous nature.

[0217] WCRW bioassays were conducted using cell lysate samples mixed with low melting point WCRW diet (Frontier Agricultural Sciences, Newark, DE) in a 96-well format. WCRW neonates were placed in each well of a 96-well plate. The assay was run for four days at 25°C and then scored for insect mortality and insect growth stunting. Classifications were denoted as dead (3), severely stunted (2) (little or no growth, but alive), stunted (1) (growth to second stage of development, but not equivalent to controls), or no activity observed (0). . Samples demonstrating mortality or severe atrophy were further studied.

[0218] Genomic DNA from the isolated strain JH70371-1 was prepared according to a library construction protocol and sequenced using the Illumina® Genome Analyzer IIx (Illumina Inc., San Diego, CA). Contiguous nucleic acid sequences were assembled and open reading frames were generated. The 16S ribosomal DNA sequence of strain JH70371-1 was searched in BLAST against the NCBI database, which indicated that it is a Lysinibacillus sp.

[0219] Cell pellets from strain JH70371-1 were homogenized at ~30,000 psi after resuspension in 20 mM MOPS buffer, pH 7 with "Complete, EDTA-free" protease inhibitor cocktail (Roche, Indianapolis, Indiana). The crude lysate was cleared by centrifugation and desalted in 20 mM Tris, pH 8.5 using a HiPrepTM 26/10 desalting column (GE Healthcare, Piscataway, NJ) and then loaded onto a CaptoQ™ column (GE Healthcare, Piscataway, NJ) equilibrated in 20 mM Tris, pH 8.5 and eluted with a gradient of 0 to 0.4 M NaCl in 30 column volumes (CV). The active fractions were pooled and loaded onto a Superdex™ 200 column (GE Healthcare) equilibrated in 100 mM ammonium bicarbonate. SDS-PAGE analysis of the fractions indicated that WCRW activity coincided with a prominent protein band after staining with GelCode® Blue Staining Reagent (Thermo Fisher Scientific®). The protein band was excised, digested with trypsin, and analyzed by nanoliquid chromatography/tandem electrospray mass spectrometry (nano-LC/ESI-MS/MS) on a Thermo Q Exactive™ Orbitrap™ mass spectrometer (Thermo Fisher Scientific® , 81 Wyman Street, Waltham, MA 02454) interfaced with an Eksigent NanoLC 1-D Plus nano-lc system (AB Sciex™, 500 Old Connecticut Path, Framingham, MA 01701). Protein identification was performed by database searches using Mascot® (Matrix Science, 10 Perrins Lane, London NW3 1QY, United Kingdom). Searches against an internal database and non-redundant NCBI database (nr) identified the novel IPD101Aa polypeptide (SEQ ID NO: 2) which is encoded by the polynucleotide of SEQ ID NO: 1. Cloning and recombinant expression confirmed the insecticidal activity of IPD101Aa against WCRW.

Example 2 - Identification of IPD101Aa Homologs

[0220] In addition to the presence in strain JH70371-1, BLAST searches identified several homologues that have varying percentages of amino acid identity with IPD101Aa (SEQ ID NO: 2): IPD101Ab (SEQ ID NO: 4) with 98.2% identity and 99.7% similarity to IPD101Aa was identified in DuPont Pioneer strain PMCH4031E7-1. IPD101Ac (SEQ ID NO: 6) with 97.9% identity and 99.4% similarity to IPD101Aa was identified in DuPont Pioneer strain PMCH4053D11b. IPD101Ba (SEQ ID NO: 8) with 80.9% identity and 89.7% similarity to IPD101Aa was identified in the NCBI public database as gi_928971774_ref_WP_053996211, as a hypothetical protein from Lysinibacillus macroides. IPD101Ca (SEQ ID NO: 10) with 77.0% identity and 87.9% similarity to IPD101Aa was identified in the NCBI public database as gi_499133538_ref_WP_010861479, as a hypothetical protein from Lysinibacillus sphaericus. Furthermore, IPD101Cb (SEQ ID NO: 12) was identified in the AM2685 DuPont Pioneer strain with 78.2% identity with IPD101Aa. IPD101Cc (SEQ ID NO: 14) with 88.2% identity to IPD101Aa was identified in DuPont Pioneer strain JAPH0723-1. IPD101Cd (SEQ ID NO: 16) with 73.0% identity to IPD101Aa was identified in DuPont Pioneer strain AM11987. IPD101Ce (SEQ ID NO: 18) with 69.4% identity to IPD101Aa was identified in DuPont Pioneer strain DP3525M. IPD101Cf (SEQ ID NO: 20) with 78.8% identity to IPD101Aa was identified in DuPont Pioneer strain BD22. IPD101Ea (SEQ ID NO: 22) with 54.1% identity to IPD101Aa was identified in the NCBI public database as WP_024363526.1, as a hypothetical protein from Lysinibacillus sphaericus. IPD101Eb (SEQ ID NO: 24) with 53.5% identity to IPD101Aa was identified in the NCBI public database as AHN24097.1, as a hypothetical protein from Lysinibacillus varians. IPD101Ee (SEQ ID NO: 25) with 55.4% identity to IPD101Aa was identified in the NCBI public database as WP_058336899, as a hypothetical protein from Bacillus sp. IPD101Fa (SEQ ID NO: 26) with 45.0% identity to IPD101Aa was identified in the NCBI public database as WP_047474321, as a hypothetical protein from Bacillus amyloliquefaciens. IPD101Fb (SEQ ID NO: 28) with 44.6% identity to IPD101Aa was identified in DuPont Pioneer strain PMC4018E9-1. IPD101Ga (SEQ ID NO: 29) with 33.7% identity to IPD101Aa was identified in the NCBI public database as WP_050637303, as a hypothetical protein from Candidatus stoquefichus. IPD101Gb (SEQ ID NO: 30) with 37.8% identity to IPD101Aa was identified in the NCBI public database as WP_050637304, as a hypothetical protein from Candidatus stoquefichus. IPD101Gc (SEQ ID NO: 32) with 32.3% identity to IPD101Aa was identified in the NCBI public database as AL041133, as a hypothetical protein from Pseudoalteromonas phenolica. IPD101Gd (SEQ ID NO: 56) with 34.8% identity to IPD101Aa was identified in the NCBI public database as WP_066332372, as a hypothetical protein from Flavobacterium crassostreae. IPD101Ge (SEQ ID NO: 58) with 35.1% identity to IPD101Aa was identified in the NCBI public database as WP_066758778, as a hypothetical protein from Chryseobacterium sp. IPD101Gf (SEQ ID NO: 60) with 33.7% identity to IPD101Aa was identified in the NCBI public database as WP_063304516, as a hypothetical protein from Pseudovibrio sp. The IPD101Aa homologues and the sequence source in which they were identified are shown in Table 1. Table 1:

[0221] The amino acid sequence identities of the IPD101Aa homologues using the Needlemann-Wunsch algorithm, calculated with a Gap creation penalty: 8 and Gap extension penalty: 2, are shown in Table 2. Table 2 :

Example 3 - Cloning and Expression of IPD101Aa in E. coli

[0222] An open reading frame containing the IPD101Aa coding sequence was identified in the genomic sequence of strain JH70371 using MS analysis peptide fragments. This sequence was used to design the following primers, AAAGGATCCATGCATACAACAATTGATATTGATCT (IPD101Aa Forward) (SEQ ID NO: 33) and TTTCTCGAGCTATTTTTTAAATGCACGAGC (IPD101Aa Reverse) (SEQ ID NO: 34), to subclone the IPD101Aa coding sequence into the pET-28a vector ( Novagen) with the use of in-frame BamHI/XhoI restriction sites with an N-terminal 6X-His tag and the native IPD101Aa stop codon (TAG). KOD Hot Start Master Mix (EMD Biosciences, San Diego, CA) was used for PCR amplification of the IPD101Aa gene in a BioRad C1000 Touch thermal cycler. Amplicons were gel purified, ligated (T4 DNA Ligase, New England BioLabs, Ipswich, MA) to BamHI/XhoI-digested pET28a, transformed into high-efficacy chemically competent E. coli TOP10 cells (Invitrogen), and clones were confirmed by sequencing.

[0223] The N-terminal 6x-His tagged construct of IPD101Aa was transformed into chemically competent BL21 (DE3) cells (Invitrogen) and grown overnight at 37°C with kanamycin selection and then inoculated into fresh medium 2xYT (1:100) and then developed to an optical density of about 0.8 to 1.2. Protein expression was induced by adding 1.0 mM IPTG, and cells were further grown at 16°C for 16 hours. Proteins expressed in E. coli were purified by immobilized metal ion chromatography (IMAC) using Talon Cobalt resin (Clonetech: Mountain View, CA) according to the manufacturer's protocols. Purified 1.5 ml fractions eluted in 250 mM imidazole were dialyzed in PBS buffer using 6K MWCO Flextubes (IBI: Peosta, IA) overnight on a shaker plate at 4°C. The dialyzed protein was run in diet assays to evaluate the effects of the insecticidal protein on larvae of a diversity of Lepidoptera and Coleoptera. The purified and desalted protein labeled with the N-terminal 6X-His of IPD101Aa was bioassayed against WCRW and found to be active as shown in Table 4 below.

Example 4 - Cloning of Homologues of IPDlOlAa IPD101Cb, Cc, Cd, Ce and Cf

[0224] Genes with sequence similarity to the polynucleotide sequence for IPD101Aa (SEQ ID NO: 1) identified in the banks and internal data were amplified by PCR from DNA prepared from the source organism (Table 1) using of primers designed for the coding sequences of each homologue (Table 3). All primers contained more than 30 nucleotides of homology to pET28a (Novagen) or a modified version of pET28a. PCR products were gel purified, assembled using the Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA) with expression vectors having the corresponding overlapping sequence, transformed into highly efficient TOP10 chemically competent cells. of E. coli (Invitrogen), and clones were confirmed by sequencing. The purified and desalted N-terminal 6X-His-tagged homologous protein of IPD101 was bioassayed against WCRW and found to have activity as referenced below (Table 4 below). Table 3: PCR primers used to clone IPD101Aa homologues.

Example 5 - Cloning of Homologs of IPDlOlAa IPD101Ca, Ea and Eb

[0225] The amino acid sequences of IPD101Ca, IPD101Ea and IPD101Eb were identified by a BLAST search of the public non-redundant protein sequence database (Table 1). The corresponding coding sequences (SEQ ID NO: 9, SEQ ID NO: 21 and SEQ ID NO: 23, respectively) were generated as synthetic DNA fragments with BamHI/XhoI restriction site, ligated into pET28a (Novagen) digested with BamHI /XhoI, transformed into E. coli TOP10 high-efficiency chemically competent cells (Invitrogen) and confirmed by sequencing. The purified and desalted N-terminal 6X-His-tagged homologous protein of IPD101 was bioassayed against WCRW, and the activity results are presented below (Table 4 below). Table 4

[0226] "NT" denotes untested; "WCRW" denotes Western Corn Root Worm; "FAW" denotes Fall Armyworm; "CEW" denotes Corn Earworm; "ECB" denotes Eastern Corn Borer; "SBL" denotes Measuring Caterpillar; "BCW" denotes Threadworm; "VBC" denotes soybean caterpillar; "SCRW" denotes Southern Corn Rootworm.

Example 6 - Chimeras Between Homologues of IPD101

[0227] To generate active variants with diverse sequences, chimeras between the polypeptides IPD101Aa (SEQ ID NO: 2) and IPD101Cc (SEQ ID NO: 14) were generated by overlapping assembly of multi-PCR fragments. A total of five chimeras between IPD101Aa and IPD101Cc were constructed and cloned into pET28a with a 6X N-terminal histidine tag as described in Example 4. The constructs were transformed into BL21 DE3 and grown for protein expression. Cell lysates were generated using B-PER® Protein Extraction Reagent from Thermo Scientific (3747 N. Meridian Rd., Rockford, IL USA 61101) and screened for WCRW insecticidal activity. Table 5 shows the chimera thresholds and % sequence identity with IPD101Aa (SEQ ID NO: 2) as calculated using the Needlemann-Wunsch algorithm with a Gap creation penalty: 8 and Gap extension penalty : 2. Table 5. Percent sequence identity of chimeras with IPD101Aa.

Example 7 - Diet-based bioassays with corn rootworm to determine LC50 and IC50

[0228] Standardized corn rootworm diet incorporation bioassays similar to Zhao, J.-Z. et al. (J. Econ. Entomol. 109: 1369 to 1377 (2016)) were used to test the activity of the IPD101Aa polypeptide (SEQ ID NO: 2) against WCRW. The corn rootworm diet was prepared according to the manufacturer's guidelines for the Diabrotica diet (Frontier, Newark, DE). The test involved six different doses of IPD101Aa polypeptide plus buffer control with 32 observations for each dose in each bioassay. Neonates were infested in 96-well plates containing a mixture of the IPDlOlAa polypeptide (5 μl/well) and diet (25 pl/well), each well with approximately 5 to 8 larvae (<24 h after hatching). After one day, a single larva was transferred to each well of a second 96-well plate containing a mixture of the IPDlOlAa polypeptide (20 μl/well) and diet (100 μl/well) at the same concentration as the treatment to which the extract was administered. exposed on the first day. For NCRW assays, two neonates were infested directly into each well of a 96-well plate containing a mixture of the IPDlOlAa polypeptide (20 μl/well) and diet (100 μl/well).

[0229] The plates were incubated at 27 °C, 65% RH in the dark for 6 days. Plates with a single WCRW larvae per well were classified as dead, severely stunted (>60% size reduction compared to control larvae), or unaffected. Plates infested with two NCRW larvae per well were sorted based on the least affected individual for each well. Mortality data were analyzed by the PROBIT procedure in SAS software (Version 9.4, SAS Institute. Cary, NC, USA) to determine lethal concentrations affecting 50% of larvae (LC50). Similarly, the total numbers of dead and severely stunted larvae were used to calculate growth inhibition concentrations affecting 50% of larvae (IC50).

[0230] The LC50 and IC50 against WCRW (Diabrotica virgifera virgifera) were 5.1 ppm and 3.0 ppm, respectively, and against NCRW (Diabrotica barberi) were 54.2 ppm and 11.6 ppm, respectively. The results are shown in Table 6. Table 6. Diet-based bioassays of IPD101Aa in WCRW and NCRW. * Method of one larva per well; ** Two larvae per well method.

Example 8 - Mode of Action

[0231] The bioactivity of the purified recombinant protein incorporated into an artificial diet revealed toxicity of IPD101Aa (SEQ ID NO: 2) for WCRW larvae. To understand the toxicity mechanism of IPD101Aa, specific binding of the purified protein with WCRW midgut tissue was assessed by in vitro competition assays. Midguts were isolated from third-stage WCRW larvae to prepare brush border membrane vesicles (BBMV) following a modified method of Wolfersberger et al. (Comp Bioch Physiol 86A: 301 to 308 (1987)) with the use of amino-peptidase activity to track enrichment. BBMVs represent the apical membrane component of the epithelial cell lining of insect midgut tissue and therefore serve as a model system regarding how insecticidal proteins interact within the gut following ingestion.

[0232] Recombinant IPD101Aa was expressed and purified from an E.coli expression system that utilizes a carboxy-terminal polyhistidine (6x His) fusion tag. The purified full-length protein (SEQ ID NO: 2) was identified with Alexa-Fluor® 488 (Life Technologies) and the unincorporated fluorophore was separated from the identified protein using buffer exchange resin (Life Technologies, A30006) following the manufacturer's recommendations. Prior to binding experiments, proteins were quantified by gel densitometry after Simply Blue® (Thermo Scientific) staining of SDS-PAGE-resolved samples that included BSA as a standard.

[0233] The binding buffer consisted of PBS supplemented with 0.1% Tween 20, pH 7.4. To demonstrate specific binding and to assess affinity, BBMVs (1 μg) were incubated with Alexa-tagged IPDIOlAa (1.5 nM) in 100 μl of binding buffer for 1 h at RT in the absence and presence of increasing concentrations of IPD101Aa. Not identified. Centrifugation at 20,000 x g was used to pellet the BBMVs to separate the unbound toxin remaining in solution. The BBMV pellet was then washed twice with binding buffer to eliminate remaining unbound toxin. The final BBMV pellet (with bound fluorescent toxin) was solubilized in reducing Laemmli sample buffer, heated to 100°C for 5 minutes, and subjected to SDS-PAGE using Bis-Tris polyacrylamide gels at 4 to 12°C. % (Life Technologies). The amount of IPD101Aa identified with Alexa in the gel of each sample was measured by a digital fluorescence imaging system (Image Quant LAS4000 GE Healthcare). The digitized images were analyzed by densitometry software (Phoretix 1D, TotalLab, Ltd.).

[0234] The apparent affinity of IPD101Aa for WCRW BBMVs was estimated based on the concentration of unidentified protein that was required to reduce binding of Alexa-identified IPD101Aa by 50% (EC50 value). This value was approximately 2 nM for IPD101Aa binding to WCR BBMVs (Figure 2).

[0235] The above description of various illustrated embodiments of the disclosure is not intended to be exhaustive or to limit the scope to the precise form disclosed. Although specific embodiments and examples are described herein for purposes of illustration, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. The teachings provided in this document can be applied for other purposes, different from those of the examples described above. Various modifications and variations are possible in light of the above teachings and, therefore, are within the scope of the attached claims.

[0236] These and other changes can be made in light of the detailed description above. In general, in the following claims, the terms used should not be construed as limiting the specific embodiments disclosed in the specification and claims.

[0237] The entire disclosure of each document cited (which includes patents, patent applications, journal articles, abstracts, manuals, books and other disclosures) in the Background Art, Detailed Description and Examples is incorporated herein by way of reference in its entirety.

[0238] Efforts have been made to ensure accuracy regarding the numbers used (e.g., quantities, temperature, concentrations, etc.), but some experimental errors and deviations must be allowed. Unless otherwise indicated, parts are parts by weight, molecular weight is the average molecular weight; the temperature is in degrees centigrade; and the pressure is at or near atmospheric.

Claims (19)

1. Recombinant IPD-101 polypeptide characterized by the fact that it has the amino acid sequence of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52 or SEQ ID NO: 54. 2. Recombinant IPD-101 polypeptide according to claim 1, characterized in that the IPD-101 polypeptide has insecticidal activity against Western Corn Root Worm (Diabrotica virgifera virgifera). 3. Recombinant polynucleotide characterized by the fact that it comprises a polynucleotide selected from SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53 and degenerates thereof that respectively encode the IPD-101 polypeptide with the amino acid sequence select tooth SEQ ID NO: 2, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54, operably linked to a heterologous promoter. 4. Recombinant polynucleotide according to claim 3, characterized in that the polynucleotide is a non-genomic polynucleotide. 5. Recombinant polynucleotide according to claim 4, characterized in that the polynucleotide is a synthetic polynucleotide. 6. Recombinant polynucleotide according to claim 5, characterized in that the polynucleotide has codons optimized for expression in an agriculturally important crop. 7. Method for producing a transgenic plant or plant cell characterized by the fact that it comprises: a) transforming a plant cell by introducing an IPD-101 polynucleotide selected from SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, and degenerates thereof that respectively encode an IPD-101 polypeptide with the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54; b) cultivating said transformed cell under plant cell growth conditions; and c) regenerating a transgenic plant from said transformed plant cell. 8. DNA construct characterized by the fact that it comprises an IPD-101 polynucleotide selected from SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, and degenerates thereof, which respectively encode an IPD-101 polypeptide with the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 46, SEQ ID NO : 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54, operably linked to a heterologous promoter. 9. Method for producing a transgenic plant or plant cell characterized by the fact that it comprises: a) transforming a plant cell by introducing the DNA construct, as defined in claim 8; b) cultivating said transformed cell under plant cell growth conditions; and c) regenerating a transgenic plant from said transformed plant cell. 10. Composition characterized by the fact that it comprises the IPD-101 polypeptide, as defined in claim 1 and an agriculturally acceptable carrier. 11. Fusion protein characterized by the fact that it comprises the IPD-101 polypeptide, as defined in claim 1. 12. Method for controlling an insect pest population characterized by the fact that it comprises contacting the insect pest population with an IPD-101 polypeptide having the amino acid sequence of SEQ ID NO: 2, SSEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54. 13. Method for inhibiting the growth of or exterminating an insect pest characterized by the fact that it comprises contacting the insect pest with a composition comprising an IPD-101 polypeptide having the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54. 14. Method for inhibiting the growth or exterminating an insect pest, according to claim 13, characterized by the fact that the insect pest is a Lepidoptera and/or Coleoptera insect pest. 15. Method for controlling an insect pest population characterized by the fact that it comprises placing the insect pest population in contact with the transgenic plant or plant cell, as obtained by the method defined in claim 9. 16. Method for inhibiting the growth or exterminating an insect pest characterized by the fact that it comprises transforming a plant with the DNA construct as defined in claim 8 and placing the insect pest in contact with the transgenic plant or plant cell. 17. Method according to claim 16, characterized by the fact that the insect pest is Western Corn Root Worm (Diabrotica virgifera virgifera). 18. Method according to any one of claims 13 to 17, characterized by the fact that the insect pest or insect pest population is resistant to at least one Bt toxin. 19. Use of the IPD-101 polypeptide, as defined in claim 1, characterized by the fact that it is to inhibit the growth or extermination of an insect or an insect population.