BR112018000916B1 - METHOD FOR SELECTING A PARTICULAR CASTOR BEAN PLANT, METHOD OF PRODUCING OIL AND METHOD OF PRODUCING A CAKE - Google Patents

Abstract

DETERMINED CASTOR. A determinate castor bean is provided. Methods for generating and using it, as well as its products, are also provided.

Description

FIELD AND BACKGROUND OF THE INVENTION

[001] The present invention, in some of its embodiments, refers to a specific castor bean, products thereof and methods for generating the same.

[002] Castor bean (Ricinus communis L.) is a non-food crop used mainly as a natural source of hydroxylated fatty acids. India, China and Brazil are traditionally the main producers, while more developed countries are the main consumers of castor oil. In the 1960s, castor beans were a promising crop in the Texas High Plains, but in 1972 changes in federal agricultural programs ended production in the US. However, recently, research efforts have resumed into the production of castor seed oil containing significant levels of ricinoleic acid. This renewed interest in castor seed oil is also reinforced by the widespread applications of ricin as a potential therapeutic agent for many human diseases.

[003] Castor bean is generally considered an annual herb, shrub or tree, according to the different climatic zones, tropical or temperate, where it grows. In castor beans, the axillary buds on new shoots and branches. To enable the cultivation of castor beans in a modern agricultural context, the selection of a new genotype suitable for combined harvesting is desirable.

[004] Castor bean genotypes with low tendencies to branch were selected using the genealogical method, reviewed in Baldanzi and Pugliesi 1998 Plant Breeding 117: 392 to 394. However, successive rounds of self-pollination of these cultivars reduced plant vigor. It is reported that selection for short, non-bleaching castor plants has generally been difficult due to high genotype versus environment interaction (see Severino et al., 2012 Agronomy J. 104 (4): 853 to 880).

[005] Flowering plants have one of two types of inflorescence architecture: indeterminate, in which the inflorescence grows indefinitely, or determinate, in which a terminal flower is produced. Two important flowering pathway genes are FLOWERING LOCUS T (FT) and TERMINAL FLOWER 1 (TFL1). FT and TFL1 encode a pair of flowering regulators that function in diverse signaling pathways. FT and TFL1 share a high level of homology (above 60% at the amino acid level) but function in opposite ways. FT promotes the transition to reproductive development and flowering, while TFL1 represses it. Thus, a loss of function in TFL-1 has been associated with a certain phenotype and early flowering.

[006] To date, transgenic silencing of TFL1 to obtain a determined phenotype and/or early flowering phenotype has been successfully implemented in several plant families (reviewed by Dickland and Hanzawa 2015 Molecular Plant 1-15). However, in industrial plants of the Euphorbiaceae family, including prominent plants such as Jatropha, TFL-1 has recently been discovered to be a flowering promoter rather than a repressor. Patent Publication Number US 20150033414 teaches a method of promoting flowering time in Jatropha and related plants, e.g., castor bean, by transgenic expression of the flower-promoting activity of the JcTFL1L-1 protein.

SUMMARY OF THE INVENTION

[007] According to an aspect of some embodiments of the present invention, a determined non-genetically modified castor bean plant is provided.

[008] According to some embodiments of the invention, the plant comprises a loss of genetic function change at the TFL1 locus.

[009] According to some embodiments of the invention, the plant comprises a loss-of-function genetic alteration that confers a determined phenotype at a genetic locus selected from the group consisting of the genetic loci listed in Table 5.

[0010] According to some embodiments of the invention, the genetic alteration comprises a deletion.

[0011] According to some embodiments of the invention, the deletion is in scaffold 30055 (SEQ ID NO: 1).

[0012] According to some embodiments of the invention, the deletion is flanked by primers L3-F (SEQ ID NO: 10) and R6-R (SEQ ID NO: 57).

[0013] According to some embodiments of the invention, the deletion lacks a SNP marker selected from the group of SNPs in Table 2 above.

[0014] According to some embodiments of the invention, a deletion breakpoint is defined by SEQ ID NO: 2.

[0015] According to some embodiments of the invention, the plant has stable vigor for at least 5 generations.

[0016] According to some embodiments of the invention, the plant has a G nucleotide at position 371820 of SEQ ID NO: 1 in a homozygous form.

[0017] According to one aspect of some embodiments of the present invention, there is provided a specific castor bean plant that has been genetically modified to regulate the activity or expression of TFL1 (SEQ ID NO: 3 or 4).

[0018] According to one aspect of some embodiments of the present invention, there is provided a determined castor bean plant that has been genetically modified to regulate the activity or expression of a gene selected from the group consisting of SEQ ID NO: 67-90 or a polypeptide expression product thereof selected from the group of SEQ ID NO: 126, 119, 120, 121, 123, 127, 128, 124, 129, 125, 122 and 130.

[0019] According to some embodiments of the invention, the determined castor bean plant comprises an RNA silencing agent designed to regulate the expression of TFL1 or the genes codable by SEQ ID NO: 67-90.

[0020] According to some embodiments of the invention, the particular castor bean plant comprises a DNA nuclease to regulate the activity or expression of TFL1.

[0021] According to some embodiments of the invention, the determined castor bean plant is an inbred lineage.

[0022] According to an aspect of some embodiments of the present invention, a part of the castor bean plant is provided.

[0023] According to some embodiments of the invention, part of the castor bean plant is a seed.

[0024] According to an aspect of some embodiments of the present invention, a hybrid seed of the castor bean plant is provided.

[0025] According to an aspect of some embodiments of the present invention, there is provided a hybrid plant obtained by growing the hybrid seed.

[0026] According to an aspect of some embodiments of the present invention, a plant part of the hybrid plant is provided.

[0027] According to an aspect of some embodiments of the present invention, there is provided a method of selecting a determined castor bean matrix, the method comprising detecting in a genome of a castor bean plant a loss-of-function genetic alteration in a region chromosomal flanked by L3-F (SEQ ID NO: 10) and R6-R (SEQ ID NO: 57) or a G nucleotide at position 371820 of SEQ ID NO: 1 is in linkage disequilibrium with the deletion, in which the presence of a loss-of-function or genetic alteration in the chromosomal region is indicative of a particular castor bean plant.

[0028] According to some embodiments of the invention, the loss of genetic function alteration comprises a deletion.

[0029] According to some embodiments of the invention, the loss of function genetic alteration that confers the determined phenotype is a genetic locus selected from the group consisting of the genetic loci listed in Table 5.

[0030] According to some embodiments of the invention, a deletion breakpoint is defined by SEQ ID NO: 2.

[0031] According to some embodiments of the invention, detection is carried out by analyzing a SNP selected from these SNP positions 101086, 110318, 123602, 129239, 146591 of SEQ ID NO: 1.

[0032] According to an aspect of some embodiments of the present invention, there is provided a method of producing a determinate castor bean plant, the method comprising: (a) crossing or self-fertilizing a castor bean plant that comprises a genetic alteration of loss of function at a gene locus of a chromosomal region flanked by L3-F (SEQ ID NO: 10) and R6-R (SEQ ID NO: 57), the loss of functional genetic alteration being in a heterozygous form, so as to obtain F1 seeds; (b) cultivate a quantity of F1 seeds into F1 plants; (c) generate plants descended from F1 plants by crossing or selfing; (d) selecting from among the progeny plants a plant comprising the loss of functional genetic change in a homozygous form, the plant being a determinate castor bean plant.

[0033] According to some embodiments of the invention, the selection is carried out by analyzing the presence in the plant genome of at least one marker selected from the group consisting of 101086-146591.

[0034] According to an aspect of some embodiments of the present invention, there is provided a determined castor bean plant for which representative seeds were deposited under the Budapest Treaty on November 2, 2015 at NCIMB Ltd. under NCIMB 42477 (VS011) , NCIMB 42478 (VS018), NCIMB 42479 (VS025), NCIMB 42480 (VS030) or NCIMB 42481 (VS033). All deposits are F1 hybrids as in Table 6 below.

[0035] According to an aspect of some embodiments of the present invention, oil produced from the plant is provided.

[0036] According to an aspect of some embodiments of the present invention, there is provided a method of producing oil, the method comprising: (a) providing seeds of the castor bean plant; (b) extract the oil from the seeds.

[0037] According to an aspect of some embodiments of the present invention, a cake from the castor bean plant is provided.

[0038] According to an aspect of some embodiments of the present invention, there is provided a method of producing a cake, the method comprising: (a) providing seeds of the castor bean plant; (b) crush the seeds to obtain crushed seeds; and (c) removing the oil from the crushed seeds, thus producing the cake.

[0039] According to an aspect of some embodiments of the present invention, a castor bean porridge is provided.

[0040] According to an aspect of some embodiments of the present invention, there is provided a processed plant product, wherein the product comprises plant DNA.

[0041] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which the invention belongs. Although methods and materials similar or equivalent to those described herein may be used in practicing or testing embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. Furthermore, the materials, methods and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE VARIOUS VIEWS OF THE DRAWINGS

[0042] Some embodiments of the invention are described here, by way of example only, with reference to the attached drawings. With specific reference now to the detailed drawings, it is emphasized that the details shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description made with the drawings makes it clear to persons skilled in the art the embodiments of the invention that can be practiced.

[0043] In the drawings:

[0044] Figure 1 is a schematic representation of nucleotides 1-160,000 of scaffold 30055 (version Ricinus comunnis TIGR/JCVI v0.1). The schematic describes the deduced deletion region from the GBS dataset, primers used for fine-mapping the actual deletion breakpoints (listed in Table 4 below), and the final mapped deleted region. Annotated genes in the region of interest are represented as green rectangles (listed in Table 5 below).

[0045] Figure 2 shows photomicrographs obtained when mapping the region excluded by PCR amplicons. Twenty ~200 bp of PCR amplicons spanning the region between nucleotides 58259 to 101086 to map the left breakpoint of the deletion, eight to 200 bp PCR amplicons spanning nucleotides 146591 to 153778. Red arrows mark the change between reactions where a PCR product is evident in both the determined and non-determined samples for reactions where a product is evident only in the non-determined castor samples, reducing the breakpoints to the region between these amplicons (L3-L4, R5 -R6) (non-Det: undetermined plants; Det: Determined plants).

[0046] Figure 3A shows the precise mapping of the deletion breakpoints. Shown is the deletion breakpoint flanking region sequence as analyzed by Sanger sequencing in a PCR product prepared using primers L3-F and R6-R.

[0047] Figure 3B shows Blast results using the sequence described in Figure 3A as query and scaffold 30055 (SEQ ID NO: 1) as case, done in bl2seq using default settings www.blast.ncbi.nlm.nih.gov/ Blast.cgi.

[0048] Figure 4 is a photomicrograph showing the 381 bp PCR product amplified using primers flanking the deletion region (L3F and R6R (SEQ ID NOs: 10 and 57, respectively). The PCR product is visible only in the determined samples .

[0049] Figure 5 is a graph showing the mRNA expression level of four genes. The pre-flowering mRNA expression level versus the two-leaf expression was demonstrated by amount of change in the undetermined castor bean plant (G-10), which does not include the deletion existing in the determinate castor bean plant phenotype.

[0050] Figures 6A to B are graphs showing the differential level of TFL1 mRNA expression in 2, 4, 6 and 8 leaves and pre-flowering in the undetermined castor bean plant (G-10) that does not include the deletion existing in the phenotype of the determined castor bean plant. The results demonstrate changes in mRNA expression compared to different stages of plant development. The main effect of mRNA expression level occurred at pre-flowering stages, when TFL1 mRNA expression was dramatically reduced.

DESCRIPTION OF THE SPECIFIC EMBODIMENTS OF THE INVENTION

[0051] The present invention, in some of its embodiments, refers to determined castor beans, products thereof and methods for generating the same.

[0052] Before explaining at least one embodiment of the invention in detail, it should be understood that the invention is not necessarily limited in its application to the details presented in the following description or exemplified by the examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0053] Ricinus communis, castor bean plant, is a species of flowering plant in the euphorbia family, Euphorbiaceae. It is the only species in the monotypic genus, Ricinus and subtribe, Ricininae. The castor seed is the source of castor oil, which has a wide variety of uses. The seeds contain between 40% and 60% oil rich in triglycerides, mainly ricinolein. The seed also contains ricin, a water-soluble toxin, which is also present in lower concentrations throughout the plant. Castor oil has many industrial uses (e.g. biopolymers, biodiesel) as well as applications in ointments and medicines.

[0054] To enable the cultivation of castor beans in a modern agricultural context, it is desirable to select new genotypes suitable for combined harvesting.

[0055] Thus, while reducing the modalities of the present invention to practice, the present inventors identified, through laborious screening, a castor bean plant with a determined phenotype. This phenotype is associated with a loss-of-function genotype involving a 90-kb deletion. Interestingly, the deletion spans a number of open reading frames, one of which is that of the TFL1 locus. Although, mutations in TFL-1 are generally associated with a certain phenotype and early flowering, in plants from the Euphorbiaceae family, including prominent plants such as jatropha and castor beans, TFL-1 has been suggested to be a flowering promoter rather than a repressor ( see Patent Publication Number US 20150033414).

[0056] The results of the present study are the first report of a determinate castor bean that exhibits stable vigor for a large number of generations (e.g., above 7) and, as such, may be an important breeding material for development. of castor beans and castor hybrids for optimal combined harvest and suitable size for uniform and dense planting.

[0057] As used herein, the expression "castor oil plant" also called "castor oil plant" and "Ricinus communis" refers to plant species of the Euphorbiaceae.

[0058] The term "plant", as used herein, encompasses whole plants, predecessors and progenies of plants and parts of plants, including seeds, fruits, shoots, trunks, roots (including tubers) and plant cells, tissues and organs. The plant can be of any form, including callus tissue, suspension culture, embryos, meristematic regions, leaves, gametophytes, sporophytes, pollen, ovules and microspores.

[0059] The term "cultivate" is used here to denote a plant with a biological state other than a "wild" state, which "wild" state indicates a plant's original uncultivated or natural state or ascension. The term "cultivar" (for cultivated variety) includes, but is not limited to, semi-natural, semi-wild, herbicide, traditional cultivar, landrace, breeding material, research material, breeder's line, synthetic population, hybrid , founder of stock/base population, inbred lineage (mother of hybrid cultivar), segregating population, mutant/genetic stock and advanced/improved cultivar. Examples of genetic backgrounds that can be used alongside current teachings include Bright Pink, Gibsoni, Zanziariensis, Bright Red, and Impala.

[0060] According to a specific embodiment, the castor bean plant is a plant strain (ingested).

[0061] According to a specific embodiment, the castor bean plant is an elite strain.

[0062] According to a specific embodiment, the castor bean plant is a hybrid. The castor bean plant of some embodiments of the present invention refers to a whole plant or portions thereof, processed or unprocessed (e.g., seeds, oil, dried tissue, flour, cake, etc.), regenerable tissue culture or cells isolated from it.

[0063] The plant part may comprise DNA (e.g., seeds) or may be devoid of DNA (e.g., oil).

[0064] As used herein, the term "determined" refers to a determined inflorescence.

[0065] The inflorescence of a plant is considered terminal or determined when the main trunk and main branches end in a flower or inflorescence without a leaf-bud. In castor beans determined by embodiments of the invention, the vegetative parts of the plant are below the productive parts of the plant. According to a specific modality, neither axillary branches nor secondary branches develop.

[0066] Consequently, the determined phenotype interrupts the branching of the plant, thus resulting in an overall less branched phenotype compared to an indeterminate plant of the same genetic background and developmental stage.

[0067] Thus, according to one aspect of the invention, a determined non-genetically modified castor bean plant is provided.

[0068] As used herein, the expression "non-genetically modified" refers to a non-transgenic plant or a plant that is devoid of a transgene that confers the determined habit.

[0069] According to a specific embodiment, the determined non-genetically modified castor bean plant of the invention results from a spontaneous genetic event incurred by multiple crossings/self-fertilizations (see Example 1 of the Examples section that follows).

[0070] Alternatively or additionally, the occurrence of the genetic event responsible for the determined habit can be improved by exposing the plant or part of it to a chemical mutagen. Examples of chemical mutagens include, but are not limited to, nitrous acid, alkylating agents such as ethyl methanesulfonate (EMS), methyl methanesulfonate (MMS), diethyl sulfate (DES), and base analogs such as 5-bromo -deoxyuridine (5BU).

[0071] The present inventors were able to associate a genetic alteration loss of function with the determined habit.

[0072] As used herein, "a loss of function genetic alteration" or a "loss of function mutation" refers to a change, e.g., mutation, in the sequence of a gene, which causes the function of the gene product, usually a protein, whether reduced or completely absent. A loss of function genetic change can be caused by an insertion or deletion of an entire chromosome or part of it. A loss-of-function mutation may, for example, be caused by truncation of the gene product because of a frameshift or nonsense mutation or by a change in one or more amino acids. A phenotype associated with an allele with a loss-of-function mutation is usually recessive, but can also be dominant.

[0073] According to a specific embodiment, the deletion is positioned at nucleic acid coordinates 60520-152129 of scaffold 30055 (SEQ ID NO: 1).

[0074] According to a specific embodiment, the deletion breakpoint is defined by the sequence shown in Figure 3A (see specifically the highlighted AC flanking the deletion).

[0075] According to a specific embodiment, the deletion is positioned in scaffold 30055 (SEQ ID NO: 1) characterized by any or all of the SNPs in Table 2 below (60520-152129). According to a specific embodiment, the positions of the SNPs within the deletion are 101086, 110318, 123602, 129239, 146591.

[0076] According to a specific modality SNP 371820 (see Table 3, SEQ ID NO: 1) is an informative SNP for the deletion, polymorphic, since in the determined samples the nucleotide is G when in a homozygous form and in the scaffold (indeterminate) the nucleotide at this position is C or C and G in a heterozygous form.

[0077] According to a specific embodiment, the deletion is flanked by primers L3-F (SEQ ID NO: 10) or R6-R (SEQ ID NO: 57). According to a specific embodiment, a 381 bp amplicon (see Figure 4) is evident in the determinate castor bean, while no product is evident at the same resolution in the indeterminate plant. Other primers to detect deletion are primers located at: DET_DEL_2_F: 60479 (SEQ ID NO: 64); DET_DEL_2_R: 152212 (SEQ ID NO: 65); ND_F: 152101 (SEQ ID NO: 66) corresponding to coordinates 30055.

[0078] According to a specific embodiment, the loss of function of the genetic alteration that confers a determined habit at a genetic locus selected from the group consisting of 30055.t000008 (gene and transcript, SEQ ID Nos: 67 and 79, respectively) , 30055.t000009 (gene and transcript, SEQ ID Nos: 68 and 80, respectively), 30055.t000010 (gene and transcript, SEQ ID Nos: 69 and 81, respectively), 30055.t000011 (gene and transcript, SEQ ID Nos: 70 and 82, respectively), 30055.t000012 (gene and transcript, SEQ ID Nos: 71 and 83, respectively), 30055.t000013 (gene and transcript, SEQ ID Nos: 72 and 84, respectively), 30055.t000014 (gene and transcript, SEQ ID Nos: 73 and 85 respectively), 30055.t000015 (gene and transcript, SEQ ID Nos: 74 and 86, respectively), 30055.t000016 (gene and transcript, SEQ ID Nos: 75 and 87, respectively) , 30055.t000017 (gene and transcript, SEQ ID NOs: 76 and 88, respectively), 30055.t000018 (gene and transcript, SEQ ID Nos: 77 and 89, respectively) and 30055.t000019 (gene and transcript, SEQ ID Nos: : 78 and 90, respectively).

[0079] According to another specific region, the genetic alteration is in an intergenic region within nucleic acid coordinates 60520-152129 of SEQ ID NO: 1.

[0080] According to a specific embodiment, the loss of function genetic alteration is in the TFL1 locus (TFL1 Coordination 113916-114125 of scaffold 30055 in SEQ ID NO: 1 see bold in Table 5 below: 30055.t000014).

[0081] As used herein, the term "TFL1" refers to the Arabidopsis TERMINAL FLOWER 1 homolog of castor bean. Since loss of function genetic alterations and/or transgenic silencing is contemplated herein, the endogenous castor bean variant is contemplated herein being the subject for targeting.

[0082] According to a specific embodiment, the determined castor bean plant comprises a loss of function genetic alteration in both alleles of the TFL1 locus.

[0083] The term "allele", as used herein, refers to any of one or more alternative forms of a gene locus, all alleles relating to a characteristic or trait. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.

[0084] The term "gene", as used herein, refers to a hereditary factor that determines a biological characteristic of an organism (i.e., a melon plant), an "allele" is an individual gene in the gene pair present in the melon plant (diploid).

[0085] A plant is called "homozygous" for a gene when it contains the same alleles of said gene and "heterozygous" for a gene when it contains two different alleles of said gene. The use of capital letters denotes a dominant gene (the form of a) and the use of small letters denotes a recessive gene: "X,X" therefore denotes a dominant genotype homozygous for gene or property X; "X,x" and "x,X" designate heterozygous genotypes; and "x,x" denotes a homozygous recessive genotype. As commonly known, only the homozygous recessive genotype will generally give the corresponding recessive phenotype (i.e. lead to a plant showing property or trait "x") whereas the heterozygous and homozygous dominant genotypes will generally give the corresponding dominant phenotype (i.e. , lead to a plant that shows the property or trait "X"), unless other genes and/or factors such as multiple alleles, suppressors, codominance, etc. (also) play a role in determining the phenotype.

[0086] As mentioned, the castor plant hybrids of the invention may be heterozygous (i.e., only one of the alleles with the loss-of-function mutation at the determination check site as described above) for the determined trait, but in this case In this case, as the inherence is recessive there will be no apparent determined phenotype.

[0087] It will be recognized that the particular castor bean plants of the invention or hybrids thereof can be genetically modified to express a gene expression product (e.g., RNA or protein) that confers an economically favorable trait, e.g., tolerance to biotic stress. , abiotic stress tolerance, insect/nematode resistance and the like.

[0088] According to another aspect of the invention, there is provided a determined castor bean plant that has been genetically modified to regulate the activity or expression of TFL1 (SEQ ID NO: 3 and 4, corresponding to TFL1 genomics and transcription, respectively ).

[0089] Thus, the determined castor bean plant of the present invention can also be generated using other including, but not limited to, (a) deletion of the TFL1 locus (SEQ ID NO: 4) and alternatively or additionally other genes, e.g. SEQ ID NO: 80, 81, 82, 83, 86, 88 and/or 89, (or the codable polypeptide sequences, e.g., SEQ ID NO: 126, 119, 120, 121, 123, 127, 128, 124, 129, 125, 122 or 130) which are included in the exclusion, as detailed above; (b) inactivating transcription of the TFL1 gene and optionally other genes that are included in the deletion, as described above; (c) antisense RNA-mediated inactivation of TFL1 gene transcripts and optionally other genes that are included in the deletion, as detailed above; (d) translational inactivation of TFL1 gene transcripts and optionally other genes that are included in the deletion, as detailed above; and (e) genome editing of the TFL1 gene and alternatively or additionally other genes that are included in the deletion, as detailed above.

[0090] Below is a description of the platform technologies for effecting Knockin, Knockout and transcriptional silencing in plants.

[0091] Methods of introducing nucleic acid changes into a gene of interest are well known in the art [see, for example, Menke D. Genesis (2013) 51: 618; Capecchi, Science (1989) 244: 1288 to 1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105: 5809 to 5814; International Patent Application Nos. WO 2014085593, WO 2009071334 and WO 2011146121; Patent Nos. US 8771945, 8586526, 6774279 and Patent Application Publications No. UP 20030232410, 20050026157, US 20060014264; the contents of which are incorporated by reference in their entirety] and include targeted homologous recombination, site-specific recombinases, PB transposases, and genome editing by engineered nucleases. Agents for introducing nucleic acid changes into a gene of interest can be designed from publicly available sources or obtained commercially from Transposagen, Addgene and Sangamo Biosciences.

[0092] The following is a description of several exemplary methods used to introduce nucleic acid changes into a gene of interest and agents for implementing the same that can be used in accordance with specific embodiments of the present invention.

[0093] Genome building using engineered endonucleases - this approach refers to a reverse genetics method using artificially engineered nucleases to cut and create specific double-strand breaks at the desired location in the genome, which are then repaired by endogenous cellular processes such as repair homology directed (HDR) and non-homologous end joining (NHEJ). NHEJ joins directly to the DNA ends in a double-strand break, while HDR uses a homologous sequence as a template to regenerate the missing DNA sequence at the breakpoint. In order to introduce specific nucleotide modifications to genomic DNA, a DNA repair template containing the desired sequence must be present during HDR. Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs in DNA as their target and the probability is very high for the recognized base pair combination to be found. at many locations in the genome resulting in multiple cuts not limited to a desired location. To overcome this challenge and create site-specific single- or double-stranded stops, several distinct classes of nucleases and bioengineering have been discovered to date. These include meganucleases, zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), and the CRISPR/Cas system.

[0094] Meganucleases - Meganucleases are commonly grouped into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family and the HNH family. These families are characterized by structural motifs, which affect catalytic activity and recognition sequence. For example, members of the LAGLIDADG family are characterized by having one or two copies of the conserved LAGLIDADG motif. The four families of meganucleases are largely separated from each other with respect to conserved structural elements and, consequently, DNA recognition sequence specificity and catalytic activity. Meganucleases are commonly found in microbial species and have the unique property of having very long recognition sequences (>14 bp), making them naturally very specific for cutting at a desired location. This can be exploited to create site-specific double-strand breaks in genome editing. A person skilled in the art can use these naturally occurring meganucleases, but the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutagenesis and high-throughput selection methods have been used to create meganuclease variants that recognize unique sequences. For example, several meganucleases have been fused to create hybrid enzymes that recognize a new sequence. Alternatively, the meganuclease DNA-interacting amino acids can be changed to designate sequence-specific meganucleases (see, for example, US Patent 8,021,867). Meganucleases can be designed using the methods described by, for example, Certo, MT et al. Nature Methods (2012) 9: 073 to 975; Patent Nos. US 8,304,222; 8,021,867; 8,119,381; 8,124,369; 8,129,134; 8,133,697; 8,143,015; 8,143,016; 8,148,098; or 8,163,514, the contents of each of which are incorporated herein by reference in their entirety. Alternatively, meganucleases with site-specific cutting characteristics can be obtained using commercially available technologies, for example, Precision Biosciences' Directed Nuclease Editor™ genome editing technology.

[0095] ZFNs and TALENs - Two distinct classes of engineered nucleases, zinc finger nucleases (ZFNs) and transcriptional activator-like effector nucleocytes (TALENs), have proven to be effective in producing targeted double-strand breaks (Christian et al., 2010; Kim et al., 1996; Li et al., 2011;

[0096] Basically, ZFNs and TALENs restriction endonuclease technologies utilize a non-specific DNA cutting enzyme that is linked to a specific DNA-binding domain (either a series of zinc domains or TALE repeats, respectively). Typically, a restriction enzyme whose DNA recognition site and cleavage site are separated from each other is selected. The cleavage portion is separated and then linked to a DNA-binding domain, thus producing an endonuclease with a very high specificity for a desired sequence. An exemplary restriction enzyme with such properties is Fokl. Furthermore, Fokl has the advantage of requiring dimerization to have nuclease activity and this means that specificity increases dramatically as each nuclease partner recognizes a unique DNA sequence. To enhance this effect, Fokl nucleases were designed, which only function as heterodimers and increased catalytic activity. Functional heterodimer nucleases avoid the possibility of unwanted homodimer activity and thus increase the specificity of double-strand interruption.

[0097] Thus, for example, to target a specific site, ZFNs and TALENs are constructed as pairs of nucleases, with each member of the pair designed to bind adjacent sequences at the target site. Upon transient expression in cells, nucleases bind to their target sites and the Fokl domains heterodimerize to create a double-strand break. Repair of these double-strand breaks through the non-homologous end joining (NHEJ) pathway generally results in small deletions or insertions of small sequences. Since each repair performed by NHEJ is unique, the use of a single pair of nucleases can produce an allelic array with a range of different deletions at the target site. Deletions generally range anywhere from a few base pairs to a few hundred base pairs in length, but larger deletions have been successfully generated in cell culture using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al. , 2010). Furthermore, when a DNA fragment with homology to the target region is introduced together with the nuclease pair, the double-strand break can be repaired through targeted homology repair to generate specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).

[0098] Although the nuclease portions of ZFNs and TALENs have similar properties, the difference between these engineered nucleases is in their DNA recognition peptide. ZFNs depend on Cys2-His2 zinc fingers and TALENs in TALEs. Both peptide DNA recognition domains have the characteristic that they are found naturally in combinations in their proteins. Cys2-His2 zinc fingers typically found in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid-interacting proteins. TALEs, on the other hand, are found in repeats with a one-to-one recognition relationship between the amino acids and the recognized nucleotide pairs. As both zinc fingers and TALEs occur in repeating patterns, different combinations can be tried to create a wide variety of sequence specificities. Approaches for manufacturing site-specific zinc finger endonucleases include, for example, modular assembly (where zinc fingers correlated with a triplet sequence are appended into a lineage to cover the required sequence), OPEN (low selection stringency of peptide domains versus triplet nucleotides followed by high stringency selections of the peptide combination versus the final target in bacterial systems) and bacterial screening of one-hybrid zinc finger libraries, among others. ZFNs can also be designed and obtained commercially, for example, from Sangamo Biosciences™ (Richmond, CA).

[0099] The method for designing and obtaining TALENs is described in, for example, Reyon et al. Nature Biotechnology 2012 May; 30 (5): 460 to 465; Miller et al. Nat Biotechnol. (2011) 29: 143 to 148; Cermak et al. Nucleic Acids Research (2011) 39 (12): e82 and Zhang et al. Nature Biotechnology (2011) 29 (2): 149 to 153. A recently developed web-based program called Mojo Hand has been introduced by Mayo Clinic for the design of TAL and TALEN constructs for genome editing applications (can be accessed through www .talendesign.org). TALEN can also be designed and obtained commercially, for example, from Sangamo Biosciences™ (Richmond, CA).

[00100] Another agent capable of downregulating TFL1 and/or any other gene from the aforementioned loci is an RNA-guided endonuclease technology, for example, CRISPR System.

[00101] As used herein, the term "CRISPR system" also known as the Set of Regularly Spaced Palindromic Repeats refers collectively to transcripts and other elements involved in the expression or directing the activity of CRISPR-associated genes, including sequences encoding a gene Cas9 (e.g., CRISPR-associated endonuclease 9), a tracr (CRISPR trans-activation) sequence (e.g., tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a partial direct repeat " and a partial direct repeat processed by tracrRNA) or a guide sequence (also referred to as a "spacer"), including, but not limited to, a crRNA sequence (i.e., an endogenous bacterial RNA that confers target specificity, but requires tracrRNA to bind to Cas) or an sgRNA sequence (i.e., a single guide RNA).

[00102] In some embodiments, one or more elements of a CRISPR system are derived from a type I, type II or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system (e.g., Cas) are derived from a particular organism that comprises an endogenous CRISPR system, such as Streptococcus pyogenes, Neisseria meningitides, Streptococcus thermophilus, or Treponema denticola.

[00103] In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also known as a protospacer in the context of an endogenous CRISPR system).

[00104] In the context of forming a CRISPR complex, the "target sequence" refers to a sequence to which a guide sequence (i.e., a guide RNA, e.g., sgRNA or crRNA) is designed to have a complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily necessary as long as there is sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex. Thus, according to some embodiments, the overall homology to the target sequence may be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell.

[00105] Thus, the CRISPR system comprises two distinct components, a guide RNA (gRNA) that hybridizes to the target sequence and a nuclease (e.g., Type II Cas9 protein), in which the gRNA targets the target sequence and the nuclease (e.g., Cas9 protein) cleaves the target sequence. The guide RNA may comprise a combination of an endogenous bacterial mRNA and tracrRNA, i.e., the gRNA combines the targeting specificity of crRNA with the scaffolding properties of tracrRNA (required for Cas9 binding). Alternatively, the guide RNA may be a single guide RNA capable of directly attacking Cas.

[00106] Typically, in the context of an endogenous CRISPR system, the formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both chains at or close (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs) of the target sequence. Without wishing to be bound by theory, the tracr sequence, which may comprise or consist of part or a wild-type tracr sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54 , 63, 67, 85 or more nucleotides of a wild-type tracr sequence), may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a sequence tracr mate which is operationally linked to the guide sequence.

[00107] In some embodiments, the tracr sequence has sufficient complementarity to a mate tracr sequence to hybridize and participate in the formation of a CRISPR complex. As with the target sequence, complete complementarity is not necessary as long as it is sufficient to be functional. In some embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% sequence complementarity over the length of the mate tracr sequence when optimally aligned.

[00108] The introduction of CRISPR/Cas into a cell can be carried out using one or more vectors that direct the expression of one or more elements of a CRISPR system, so that the expression of the elements of the CRISPR system directly forms a complex CRISPR at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr mate sequence, and a tracr sequence can be operatively linked to separate regulatory elements in separate vectors. Alternatively, two or more of the elements expressed by the same or different regulatory elements can be combined into a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. The elements of the CRISPR system that are combined into a single vector can be arranged in any suitable orientation, such as an element located 5' to ("upstream" of) or 3' to ("downstream" of) a second element. The coding sequence of one element may be located on the same or opposite strand as the coding sequence of a second element and oriented in the same or opposite direction. A single promoter can generate expression of a transcript encoding a CRISPR enzyme and one or more guide sequences, mate tracr sequence (optionally linked to the guide sequence), and a tracr sequence incorporated within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron).

[00109] The "hit and run" or "in-out" procedure involves a two-step recombination procedure. In the first step, an insertion type vector containing a double/positive selectable marker cassette is used to introduce the desired sequence change. The insertion vector contains a single continuous region of homology to the target locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at a single site within the region of homology, transformed into cells, and positive selection is performed to isolate homologous recombinants. These homologous recombinants contain a local duplication that is separated by the intervening vector sequence, including the selection cassette. In the second step, targeted clones are subjected to negative selection to identify cells that have lost the selection cassette through intrachromosomal recombination between the duplicated sequences. The local recombination event removes the duplication and, depending on the site of recombination, the allele either retains the introduced mutation or reverts to wild type. The end result is the introduction of the desired modification without retaining any exogenous sequences.

[00110] The "double replacement" or "tag and swap" strategy - involves a two-step selection procedure similar to the hit and run approach, but requires the use of two different segmentation constructs. In the first step, a standard targeting vector with 3' and 5' homology arms is used to insert a positive/negative selectable cassette near the site where the mutation is to be introduced. After transformation and positive selection, homologously targeted clones are identified. Then, a second targeting vector that contains a region of homology to the desired mutation is transformed into targeted clones and negative selection is applied to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation while eliminating unwanted exogenous sequences.

[00111] Site-specific recombinases - Cre recombinase derived from bacteriophage P1 and Flp recombinase derived from the yeast Saccharomyces cerevisiae are site-specific DNA recombinases, each recognizing a unique 34 base pair DNA sequence (termed "Lox " and "FRT", respectively) and sequences that are flanked with Lox or FRT sites can be easily removed through site-specific recombination following expression of Cre or Flp recombinase, respectively. For example, the Lox sequence is composed of an asymmetric spacer region of eight base pairs flanked by inverted repeats of 13 base pairs. Cre recombines the 34 base pair lox DNA sequence, binding to the 13 base pair inverted repeats and catalyzing chain cleavage and religation within the spacer region. The staggered DNA cuts made by Cre in the spacer region are separated by 6 base pairs to give an overlapping region that acts as a homology sensor to ensure that only recombination sites that have the same overlapping region recombine.

[00112] Basically, the site-specific recombinase system provides a means for removing selection cassettes after homologous recombination. This system also allows the generation of conditional altered alleles that can be inactivated or activated in a temporal or tissue-specific manner. It should be noted that the Cre and Flp recombinases leave behind a "scar" of 34 Lox or FRT base pairs. The Lox or FRT sites that remain are typically left behind in an intron or 3' UTR of the modified locus, and current evidence suggests that these sites generally do not significantly interfere with gene function.

[00113] Thus, Cre/Lox and Flp/FRT recombination involves the introduction of a targeting vector with 3' and 5' homology arms containing the mutation of interest, two Lox or FRT sequences and typically a selectable cassette placed between the two Lox or FRT sequences. Positive selection is applied and homologous recombinants that contain targeted mutation are identified. Transient expression of Cre or Flp in conjunction with negative selection results in excision of the selection cassette and selects cells where the cassette has been lost. The final oriented allele contains the Lox scar or FRT from exogenous sequences.

[00114] Silencing at the transcription (RNA) level can be carried out using the exemplary platforms below.

[00115] As used herein, the phrase "RNA silencing" refers to a group of regulatory mechanisms [e.g., RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS ), removal, cosuppression, and translational repression] mediated by RNA molecules that result in the inhibition or "silencing" of expression of a corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.

[00116] As used herein, the term "RNA silencing agent" refers to an RNA that is capable of specifically inhibiting or "silencing" the expression of a target gene (e.g., TFL1 and/or SEQ ID NO: 67-90). In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g., complete translation and/or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include non-coding RNA molecules, e.g., RNA duplexes comprising paired strands, as well as precursor RNAs from which RNAs so small that they are non-coding can be generated. Examples of RNA silencing agents include dsRNAs such as siRNAs, miRNAs, and shRNAs.

[00117] In one embodiment, the RNA silencing agent is capable of inducing RNA interference.

[00118] In another embodiment, the RNA silencing agent is capable of mediating translational repression.

[00119] According to one embodiment of the invention, the RNA silencing agent is specific to the target RNA (e.g., TFL1 and/or SEQ ID NO: 79-90) and does not inhibit or silence other targets or a variant of union that exhibits 99% or less overall homology to the target gene, e.g., less than 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88 %, 87%, 86%, 85%, 84%, 83%, 82%, 81% overall homology to target gene; as determined by PCR, Western blot, immunohistochemistry and/or flow cytometry.

[00120] RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs).

[00121] The following is a detailed description of RNA silencing agents that can be used in accordance with specific embodiments of the present invention.

[00122] DsRNA, siRNA and shRNA - The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of dsRNA into small dsRNA fragments known as short interfering RNAs (siRNAs). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair pairs. The RNAi response also has an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates the cleavage of single-stranded RNA with sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex.

[00123] Consequently, some embodiments of the invention contemplate the use of dsRNA to minimize protein expression from mRNA.

[00124] According to one embodiment, dsRNA longer than 30 bp are used. Several studies demonstrate that long dsRNAs can be used to silence gene expression without inducing the stress response or causing significant off-target effects - see, for example [Strat et al., Nucleic Acids Research, 2006, Vol. 34, No .13 3803 to 3810; Bhargava A et al. Brain Res. Protocol. 2004; 13: 115 to 125; Diallo M., et al., Oligonucleotides. 2003; 13: 381 to 392; Paddison P.J., et al., Proc. Natl Acad. Sci. USA. 2002; 99: 1443 to 1448; Tran N., et al., FEBS Lett. 2004; 573: 127 to 134].

[00125] According to some embodiments of the invention, dsRNA is provided in cells in which the interferon pathway is not activated, see, for example, Billy et al., PNAS 2001, Vol. 98, pages 14428 to 14433. and Diallo et al., Oligonucleotides, October 1, 2003, 13 (5): 381 to 392. doi: 10.1089/154545703322617069.

[00126] According to one embodiment of the invention, the long dsRNA is specifically designed not to induce the interferon and PKR pathways for the expression of down-regulating genes. For example, Shinagwa and Ishii [Genes & Dev. 17 (11): 1340 to 1345, 2003] developed a vector, called pDECAP, to express long double-stranded RNA from an RNA polymerase II (Pol II) promoter. Because pDECAP transcripts lack the 5'-cap structure and 3'-poly(A) tail that facilitate dsRNA export to the cytoplasm, pDECAP's long dsRNA does not induce the interferon response.

[00127] Another method of evading the interferon and PKR pathways in mammalian systems is through the introduction of short inhibitory RNAs (siRNAs) either by transfection or endogenous expression.

[00128] The term "siRNA" refers to small inhibitory RNA duplexes (generally between 18 to 30 base pairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a 19-bp central duplex region and symmetrical 2-base 3'-end overhangs, although it has been recently described that chemically synthesized duplex RNAs with a base length of 25 to 30 can have as much as a 100-fold power increase compared to 21mers in the same location. The observed increased potency obtained using longer RNAs in RNAi triggering is suggested to be a result of providing Dicer with a substrate (27mer) rather than a product (21mer) and that this improves the rate or efficiency of duplex siRNA entry into RISC.

[00129] It has been found that the position of the influencing power of the 3' overhangs of an siRNA and asymmetric duplexes with a 3' overhang on the antisense strand are generally more potent than those with the 3' overhang on the sense strand ( Rose et al., 2005). This may be attributed to asymmetric strand loading in RISC, as opposite efficacy patterns are observed when targeting antisense transcription.

[00130] The strands of a double-stranded interference RNA (e.g., an siRNA) can be linked to form a hairpin or stem structure (e.g., an shRNA). Thus, as mentioned, the RNA silencing agent of some embodiments of the invention may also be a short hairpin RNA (shRNA).

[00131] The term "shRNA", as used herein, refers to an RNA agent having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient to base pairing occurs between the regions, with the first and second regions being joined by a loop region, the circuit resulting from the mismatch of bases between nucleotides (or nucleotide analogues) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop may be involved in base pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5'-CAAGAGA-3' and 5'-UUACAA-3' (International Patent Application Nos. WO 2013126963 and WO 2014107763). It will be recognized by one skilled in the art that the resulting single-stranded oligonucleotide forms a stem-loop structure comprising a double-stranded region capable of interacting with the RNAi machinery.

[00132] The synthesis of RNA silencing agents suitable for use with some embodiments of the invention can be carried out as follows. First, the TFL1 mRNA sequence (or SEQ ID NO: 79-90) is checked downstream of the AUG start codon for AA dinucleotide sequences. The occurrence of each AA and the 19 3' adjacent nucleotides are recorded as possible siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with the binding of the siRNA endonuclease complex [Tuschl ChemBiochem. 2: 239-245]. However, it will be recognized that siRNAs targeting untranslated regions can also be effective, as demonstrated for GAPDH, where siRNA targeting the 5' UTR mediated about 90% decrease in cellular GAPDH mRNA and completely abolished the level (www.ambion.com/techlib/tn/91/912.html).

[00133] Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat, etc.) using any sequence alignment software such as BLAST software available on the NCBI server ( www.ncbi.nlm.nih.gov/BLAST/). Putative target sites that exhibit significant homology to other coding sequences are filtered out.

[00134] Qualified target sequences are selected as templates for siRNA synthesis. Preferred sequences are those that include low G/C content, as these have proven to be more effective in mediating gene silencing compared to those with G/C content greater than 55%. Multiple target sites are preferentially selected along the length of the target gene for evaluation. For a better evaluation of the selected siRNAs, a negative control is preferably used together. Negative control siRNA preferentially includes the same nucleotide composition as siRNAs but lacks significant homology to the genome. Thus, a nucleotide sequence encoded from the siRNA is preferably used, as long as it does not exhibit any significant homology to any other gene.

[00135] The constructs useful in the methods according to the present invention can be constructed using recombinant DNA technology well known to those skilled in the art. Coding sequence constructs (e.g., encoding a silencing agent for any of SEQ ID NOs: 79-90) can be inserted into vectors, which may be commercially available, suitable for transformation into plants and suitable for expression of the gene of interest in the transformed cells. The genetic construct may be an expression vector in which the nucleic acid sequence is operably linked to one or more regulatory sequences that allow expression in plant cells.

[00136] Plant cells can be stably or transiently transformed with the nucleic acid constructs of the present invention. In stable transformation, the nucleic acid molecule of the present invention is integrated into the plant genome and, as such, represents a stable and heritable characteristic. In transient transformation, the nucleic acid molecule is expressed by the transformed cell but is not integrated into the genome and as such represents a transient trait.

[00137] There are several methods of introducing external genes into monocotyledonous and dicotyledonous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42: 205 to 225; Shimamoto et al. , Nature (1989) 338: 274 to 276).

[00138] The main methods of producing stable integration of exogenous DNA into plant genomic DNA include two main approaches: (i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38: 467 to 486; Klee and Rogers in Cell culture and somatic cell genetics of plants, Vol. 6, Molecular biology of plant nuclear genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, California (1989) p. 2 to 25; Gatenby, in Plant Biotechnology, eds. Kung, S. and Arntzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93 to 112. (ii) direct DNA absorption: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular biology of plant nuclear genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, California (1989) p. 52 to 68; including methods for the direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio/Technology 6: 1072 to 1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988) 7: 379 to 384. Fromm et al. Nature (1986) 319: 791 to 793. Injection of DNA into plant cells or tissues by particle bombardment, Klein et al. Bio/Technology (1988) 6: 559 to 563; McCabe et al. Bio/Technology (1988) 6: 923-926; Sanford, Physiol. To plant. (1990) 79: 206 to 209; by the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet. (1987) 75: 30 to 36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79: 213 to 217.

[00139] Transformation using glass or silicon carbide fibers of cell cultures, embryos or callus tissue, Patent No. US 5,464,765 or by direct incubation of DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197 to 209; and Ohta, Proc. Natl. Academic. Sci. USA (1986) 83: 715 to 719.

[00140] The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant's genomic DNA. Plant tissue inoculation methods vary depending on the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiating whole plant differentiation. Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1 to 9. A complementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in creating transgenic dicotyledonous plants.

[00141] There are several methods of direct DNA transfer to plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field. In microinjection, DNA is mechanically injected directly into cells using very small micropipettes. In microparticle bombardment, DNA is adsorbed onto microprojectiles, such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated in plant cells or tissues.

[00142] After stable transformation, plant propagation is carried out. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that, due to heterozygosity, there is a lack of uniformity in the culture, since seeds are produced by plants according to genetic variances governed by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant is produced in such a way that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. Therefore, it is preferable that the transformed plant is regenerated by micropropagation, which provides rapid and consistent reproduction of the transformed plants.

[00143] However, other production methods are also contemplated, including sexual reproduction (and selection for the determined phenotype, either morphologically or using molecular markers, as described herein), tissue culture, and more.

[00144] Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected plant or cultivar. This process allows for the mass reproduction of plants with the preferred tissue expressing the fusion protein. The new generation plants that are produced are genetically identical and have all the characteristics of the original plant. Micropropagation allows the mass production of quality plant material in a short period of time and offers rapid multiplication of selected cultivars while preserving the characteristics of the original transgenic or transformed plant. The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of the plants produced.

[00145] Micropropagation is a multi-stage procedure that requires changing the culture medium or growth conditions between stages. Thus, the micropropagation process involves four basic stages: stage one, initial tissue cultivation; stage two, tissue culture multiplication; stage three, plant differentiation and formation; and stage four, greenhouse cultivation and hardening off. During the first stage, initial tissue culture, the tissue culture is established and certified free of contaminants. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to gradually increase so that it can be grown in the natural environment.

[00146] Viruses that have proven useful for transforming plant hosts include CaMV, TMV, TRV and BV. Transformation of plants using plant viruses is described in Patent No. US 4,855,237 (BGV), EP A 67,553 (TMV), application No. JP 63-14693 (TMV), EP A 194,809 (BV), EP A 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, p. 172 to 189 (1988). Pseudovirus particles for use in expressing external DNA in many hosts, including plants, are described in WO 87/06261.

[00147] As the determined habit is controlled by the FT/TFL1 molecular switch, the present invention also contemplates an upregulation of FT to confer the determining habit (e.g., upregulation of TFL1 Coordinate 113916-114125 of scaffold 30055 in SEQ ID NO: 1 see bold in Table 5 below: 30055.t000014 or an ortholog with at least 70% overall homology to SEQ ID NO: 1).

[00148] According to some embodiments of the present invention, the vigor of the determined castor bean plant (whether genetically modified or non-genetically modified) is stable for at least 4, 5, 7, 9 or 10 generations.

[00149] As used herein, the expression "plant vigor" refers to the amount (measured by weight) of tissue produced by the plant at a given time.

[00150] Regardless of the method used to produce the determined castor bean of some embodiments of the invention, once the plants or any reproductive material are at hand, it is selected based on the determined habit.

[00151] Thus, according to an aspect of the invention, a method of selecting a determined castor bean matrix is provided, comprising the method of detecting in a genome of a castor bean plant a loss-of-function genetic alteration in a chromosomal region flanked by L3-F (SEQ ID NO: 10) and R6-R (SEQ ID NO: 57), wherein the presence of a loss-of-function genetic alteration in said chromosomal region is indicative of a particular castor bean plant.

[00152] Many methods are known in the art for mutation analysis, including, for example, single base extension (SBE), allele-specific primer extension (ASPE) sequencing, DNA sequencing, RNA sequencing, analysis based on microarray, universal PCR, allele-specific extension, hybridization, mass spectrometry, ligation, extension-ligation, flip endonuclease-mediated assays, limiting fragment length polymorphism (RFLP), electrophoresis, sequence alignment, allele oligonucleotide hybridization -specific (ASO) and random amplified DNA polymorphism (RAPD).

[00153] Thus, the present invention contemplates oligonucleotides (e.g., primers) that can be used to distinguish between the mutated and non-mutated form of TFL1. An exemplary set of primers is described in the example section, for example, SEQ ID NOs: 10 and 57.

[00154] Thus, once a plant that carries the loss-of-function genetic change is identified, it is considered to have a certain habit. This plant material can be used as breeding material in the development of castor bean varieties with desired characteristics in agriculture.

[00155] According to one embodiment, the plants of the present invention are of a hybrid variety - that is, they are generated after crossing (that is, mating) two non-isogenic plants. The hybrid could be an F1 hybrid.

[00156] An "F1 hybrid", as used herein, refers to the first generation progeny of the crossing of two non-isogenic plants.

[00157] The development of castor bean hybrids of the present invention requires the development of stable parental lines while at least one of them is heterozygous for the loss-of-function genetic alteration as described above, for example, in the TFL1 gene. In breeding programs, desirable traits from two or more germplasm sources or gene pools are combined to develop superior breeding varieties. Desirable inbred or parental lines are developed by continuous self-pollinations and/or backcrosses and selection of the best breeding lines, sometimes using molecular markers to speed up the selection process.

[00158] Once the parental lines giving the best hybrid performance have been identified, for example both leading to the loss-of-function genetic alteration as described above, for example in the TFL1 gene, the hybrid seed can be produced indefinitely, as long as that parental homogeneity is maintained. According to one embodiment, the castor plants of the present invention are stable brown plant lines (carrying the loss-of-function genetic alteration, for example, in the TFL1 gene in a heterozygous form).

[00159] As defined herein, the phrase "stable parental lines" refers to open pollinated cosanguine lines, stable for the desired plants throughout cycles of self-pollination and planting. According to a specific embodiment, 95% of the genome is in a homozygous form in the parental lines of the present invention.

[00160] A common practice in plant breeding is using the backcrossing method to develop new varieties by single trait conversion.

[00161] The phrase "single trait conversion", as used herein, refers to the incorporation of a new single gene into a parent strain, in which essentially all of the desired morphological and physiological characteristics of the parental strains are recovered in addition to the gene single transferred.

[00162] The term "backcrossing", as used herein, refers to the repeated crossing of a hybrid progeny back to one of the parental castor bean plants. The parental castor bean plant that contributes the gene for the desired trait is called the non-recurrent parent or donor. This terminology refers to the fact that the non-recurrent parent is used once in the backcross protocol and is therefore not repeated. The parental castor plant to which the gene of the non-recurrent parent is transferred is known as the recurrent parent as it is used for several castor beans in the backcrossing protocol.

[00163] In a typical backcross protocol, a plant from the original varieties of interest (recurrent parental) is crossed to a plant selected from second varieties (non-recurrent parental) that carries the only gene of interest to be transferred. The progeny resulting from this crossing are then crossed back to the recurrent parent and the process is repeated until a castor bean plant is obtained in which essentially all of the desired morphological and physiological characteristics of the recurrent parent are recovered in the converted plant, in addition to the single gene transferred from the non-recurrent parenatal.

[00164] Thus, near-isogenic lines (NIL) can be created by many backcrosses to produce a series of individuals that are nearly identical in genetic makeup except for the trait or genomic region under interrogation, in this case, loss of functional genetic alteration , for example, in the TFL1 gene.

[00165] Backcrossing methods can be used with the present invention to improve or introduce a trait into parental lines. Marker-assisted creation (selection) as described above can be used in this method.

[00166] By implementing embodiments of the present invention, the present inventors were able to generate a determinate castor bean plant for which representative seeds were deposited under the Budapest Treaty on November 2, 2015 at NCIMB Ltd. under NCIMB 42477 (VS011 ), NCIMB 42478 (VS018), NCIMB 42479 (VS025), NCIMB 42480 (VS030), or NCIMB 42481 (VS033).

[00167] Examples of such hybrid plants that exhibit the determined phenotype are provided below, Table 6.

[00168] Thus, the present invention provides new castor bean plants and cultivars, and seeds and tissue culture to generate the same.

[00169] Castor bean plants generated based on the present teachings can be processed to generate castor bean products that are commonly used in numerous industrial applications, including lubricants, waxes, biology-based paints and coatings, plastics, medicinal compounds, antifungals, and cosmetics. . According to a specific embodiment, the processed castor bean product comprises the DNA of the plant.

[00170] Thus, according to one aspect of the present invention, there is provided a method of producing castor oil, the method comprising: providing (for example, by harvesting) seeds of the castor bean plant or plant part as described above; and extract the oil from the seeds to produce castor oil.

[00171] The following is a non-limiting description of seed collection and processing.

[00172] Castor beans are harvested when fully ripe and the leaves can be dry, in about 95 to 180 days, depending on the cultivar. Planting and harvesting can be done by manual methods or completely mechanized (where the determined phenotype gives a great advantage). Harvesting should begin before the rainy season in tropical regions, but in dry regions it is best to harvest when all the fruit is ripe. The racemes are cut or broken and the capsules are removed and collected. Unless the capsules are dry, they should be spread out to dry quickly, for example by sun drying, freeze drying or the use of defoliants. Harvesting machines, such as modified wheat heads, can be used, which agitate the plant bolls by shaking the plants at their bases. Relative humidity of 45% or less is required for efficient operation with mechanical harvesters. Some indehiscent varieties are threshed by ordinary grain crusher at a cylinder speed of 400 to 800 rpm. A dedicated harvesting machine can be used for a given phenotype. After harvesting, the seeds must be removed from the capsules or hulls, usually with shelling machines if the capsules are dry.

[00173] Percentages of seed to shell averages from 55 to 70, depending on seed maturity at harvest and genetic background and agrotechnics and conditions.

[00174] Extracting oil from castor seeds is done in a similar way to most other oil seeds. The seeds are cleaned, cooked and dried before extraction. Cooking is done to coagulate proteins (necessary to allow for efficient extraction) and to release the oil at efficient pressure.

[00175] The first stage of oil extraction is pre-pressing, using a high-pressure continuous screw press - called an extruder. The extracted oil is filtered and the material removed from the oil is fed back into the stream along with fresh material. The material finally discharged from the press, called cake, contains 8 to 10 percent oil. It is crushed into a coarse mush and subjected to solvent extraction with hexane or heptane.

[00176] Once the seed oil has been extracted, it is necessary to remove impurities from the oil. The oil is essentially a pure triglyceride and contains almost 90% glyceryl tricinoleate. It is ricinoleic triglyceride that is needed to produce high-quality castor oil.

[00177] The steps to refine crude oil include: decanting and degumming the oil - Done to remove the aqueous phase of lipids and to remove phospholipids from the oil. bleaching - Bleaching results in the removal of coloring materials, phospholipids and oxidation products. neutralization - the neutralization step is necessary to remove free fatty acids from the oil. This can be done in two ways: (a) alkali (chemical) or (b) steam extraction means (physical). Alkali/Chemical Method: Caustic soda (alkali) is mixed in appropriate quantities and the aqueous solution is removed, leaving the neutral oil behind. Steam extraction: This is done under vacuum to remove moisture, free fatty acids, odor bodies and other impurities from the oil. As it is carried out under vacuum conditions, the oil can be kept at a low temperature, preserving its chemical structure by not subjecting it to temperatures at which undesirable dehydration reactions may occur. oil deodorization - Deodorization results in the removal of odor from the oil.

[00178] Many derivatives can be produced from castor oil. Some of these derivatives have chemical compositions similar to those of petroleum-based oils.

[00179] Castor bean seed residue, also called castor bean porridge - Castor bean porridge is the residue obtained from the solvent extraction process of castor bean cake. It is one of the most versatile natural fertilizers. This fertilizer improves soil fertility without causing damage or deterioration. It is enriched with the three vital elements conducive to proper crop growth, i.e., nitrogen, phosphorus and potassium. It also has traces of nutrients such as manganese, zinc and copper, making it a balanced fertilizer. Additionally, it helps neutralize the harmful effects of chemical fertilizers. In addition to their contribution to nutrients, they have a series of benefits in agriculture that no synthetic fertilizers or pesticides can offer. They provide slow and steady feeding, stimulation, protection against nematodes and soil insects, improve yields and product quality such as taste, flavor, amino acid composition etc.

[00180] The pressed cake obtained after the castor bean extraction process is often used as a fertilizer. The protein content of castor seed cake varies from 21 to 48% depending on the extent of decortications. It has an ideal amino acid profile with moderately high cysteine, methionine and isoleucine. But its antinutritional substances, ricin and various allergens restrict its use in poultry feed, even at a very low level of inclusion.

[00181] Hydrogenated castor oil (HCO) - also known as castor wax is an insoluble, hard, brittle wax. It is produced by adding hydrogen in the presence of a nickel catalyst. It is mainly used for coatings and greases where resistance to moisture, oils and other petrochemicals is required.

[00182] HCO is produced by the hydrogenation of castor oil with a nickel catalyst. Its white flakes are extremely insoluble and are water resistant. The main use is in the manufacture of greases and in the coating of paper for food packaging.

[00183] Hydrogenated oil is also used in the manufacture of waxes, enamels, carbon paper, candles and crayons.

[00184] 12 Hydroxystearic acid (12 HSA) - 12 HSA is a whitish solid fatty acid used to manufacture lithium and calcium-based lubricating greases. When reacted with an ester, 12 HSA provides a hard finish for the automotive and small appliance industries.

[00185] Methyl 12HSA (12 Methyl Stearate Acid, 12 Methyl Hydroxystearate) - Methyl 12HSA is formed by direct esterification of 12HSA with methanol. It is usually sold in liquid form and is widely used in the continuous greasing process. It has a lower melting point than 12HSA and is therefore easier to handle in liquid form. Greases made with methyl 12HSA can be formulated for higher dropping points, and they experience less bleeding and improved oxidative stability.

[00186] Blown castor oil - Blown castor oil is a castor oil derivative that has a higher viscosity and specific gravity than natural castor oil. These properties are induced by bubbling air through elevated temperatures. Blown castor oil finds use as a plasticizer for paints, lacquers and adhesives.

[00187] COLM, urethane grade - COLM (low moisture castor oil) is a refined grade of castor oil for specific applications that require minimal moisture. Typical applications include urethane coatings, adhesives and paints. COLM also finds use in urethane blowing and urethane molding.

[00188] Dehydrated oil is an excellent drying agent that compares favorably with tung oil and is used in paints and varnishes.

[00189] It is expected that, during the life of a patent expiring from this application, several relevant castor bean plants of determinate habit will be developed and the scope of the term determinate castor bean should include all such new a priori technologies.

[00190] As used herein, the term "about" refers to ± 10%.

[00191] The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including, but not limited to".

[00192] The term "consisting of" means "including and limited to".

[00193] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic characteristics and new composition, method or structure claim.

[00194] As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[00195] Throughout this application, various embodiments of this invention may be presented in a strip format. It should be understood that the description in strip format is for convenience and brevity only and should not be construed as an inflexible limitation on the scope of the invention. Consequently, the description of a range must be considered to have specifically revealed all possible subranges as well as individual numerical values within that range. For example, the description of a range such as 1 to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, from 3 to 6, etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5 and 6. This applies regardless of the width of the range.

[00196] Whenever a numerical range is indicated here, it is intended to include any cited number (fractional or integer) within the indicated range. The phrases "range/range between" a first indication number and a second indication number and "range/ranges from" a first indication number "to" a second indication number are used interchangeably herein and mean to include the first and the second indicated numbers and all fractional and integer numbers between them.

[00197] As used herein, the term "method" refers to ways, means, techniques and procedures for carrying out a particular task, including, but not limited to, known or easily developed ways, means, techniques and procedures using ways, means, techniques and procedures known to professionals in chemical, pharmacological, biological, biochemical and medical techniques.

[00198] As used herein, the term "treatment" includes nullifying, substantially inhibiting, delaying or reversing the progression of a condition, substantially improving the clinical or aesthetic symptoms of a condition or substantially preventing the appearance of clinical or aesthetic symptoms of a condition. condition.

[00199] When referring to particular sequence listings, such reference should be understood to also encompass sequences that substantially correspond to their complementary sequence as well as including minor sequence variations resulting from, for example, sequencing errors, cloning errors or other changes resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively less than 1 in 100 nucleotides, alternatively less than 1 in 200 nucleotides, alternatively less of 1 in 500 nucleotides, alternatively, less than 1 in 1,000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

[00200] It is recognized that certain features of the invention, which are, for greater clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. On the other hand, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various modalities should not be considered essential features of those modalities unless the modality would be inoperative without those elements.

[00201] Various embodiments and aspects of the present invention as outlined above and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

[00202] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting way. EXAMPLE 1 Genealogical Description

EXAMPLE 2 Mapping of the determined locus

[00203] To associate the phenotypic characteristic of the plant determined with the genomic event, a GBS/RAD analysis was performed.

[00204] Restriction site-associated DNA (RAD) relates to the associated DNA method of restriction endonuclease recognition that reduces genome complexity. In the absence of a reference genome, this technology identifies SNP sites so that a high-density genetic map can be constructed. This map can be used for QTL mapping.

[00205] A total of 150 plant samples were collected from the parental line, i.e., 502 and 503 (see Table 3 below) and their F2 segregated population derived from crossing the aforementioned parental lines (see Table 3 below). High-quality DNA was prepared from each sample collected as follows: 150 mg of tissue was weighed, frozen in liquid nitrogen, and crushed using a mortar and pestle. Samples were then resuspended in 750 μL of CTAB lysis buffer [300 mM Tris-HCl, pH 8.0, 25 mM EDTA pH 8.0, 2 M NaCl, 2% (w/v) soluble PVP ( PM 40000), 2% (w/v) CTAB], added with 5 μl of RNAseA [3.3 mg/ml], vortexed and incubated 30 minutes in a water bath at 65 °C. The samples were then cooled to room temperature and added with 750 μL of chloroform-isoamylalcohol (24:1, v/v).

[00206] After gently shaking the tubes for 5 minutes, the samples were centrifuged at 14,000 RPM for 15 min. The upper phase was transferred to a clean tube added with 650 μL of 100% isopropanol and incubated in a −20°C freezer for 2 hours, after which the DNA was pelleted by centrifugation, 14,000 RPM, for 15 min. The pellet was washed with pre-cooled 70% ethanol (EtOH) and resuspended in 120 μL of TE buffer.

[00207] After DNA preparation, samples were quantified using the Qubit HS assay (Life Technologies) and run on a gel to verify that the DNA was not degraded in the process. Ninety-six samples from an F2 segregation population were selected according to phenotypic representation in the field. This F2 population is segregated for non-determined and determinate plants. Determinates and non-determined were selected, while some of the non-determined were homozygous and some were heterozygous. DNA was sequenced by BGI, China.

[00208] The DNA was sequenced on an Illumina Hiseq 2000 machine producing paired 91 bp data. The raw data selection was QC checked using FASTQC, filtered and assigned to samples according to the barcode linked to each sample. Samples were aligned using SOAP. SAMTOOLS was used to call the SNP variation in each of the aligned tags. SNP analysis detected between 42926 to 60876 SNP markers compared to the draft castor bean genome with approximately 5000 of them showing heterozygosity between parental lines.

[00209] Once genotype data was obtained for 88 samples and 2 samples from each parental sample (i.e., 502 and 503), the file type was converted from genotypes to a hapmap format. 1,657 hapmap files were constructed for all available scaffolds in the castor bean genome. Each file consisted of all markers available within the scaffold, and the genotypes identified in all samples that were sequenced. The Tassel software tool was used to perform association tests of the determined characteristic among all available samples. All 1,657 hapmap files were uploaded to the Tassel database along with the trait table containing phenotype information. The scaffold information was merged into a genotype table for the entire castor bean genome. Association analysis was done using the General Linear Model (GLM) statistical approach and was tested for a possible randomization effect using a 1,000 permutation permutation test. The results were then filtered by the most stringent association: P-values supported by the smallest possible permutation (p-value in this case of 0.001).

[00210] Table 2 below shows the highest scoring markers associated with the trait determined by castor beans. The region deleted in the determined castor plant comprises 12 coding genes annotated as described in Table 5 below. Table 2: Output table of SNP markers found by Tassel to be associated with the given trait:

EXAMPLE 3 Mapping the causal mutation for castor bean determinate

[00211] Examining the SNP designations of the GBS data set (see Table 3, below), it is evident that the plants that presented a given phenotype were missing the SNPs for markers 1 to 2 and 4 to 5 (see Table 2 above). , which led to the hypothesis that the determined phenotype is caused by a genomic deletion in the region (scaffold 30055, nucleotides 101086 to 146591, SEQ ID NO: 1) with the exact breakpoints situated between the markers present in both the determined samples and not determined. The markers display only the undetermined samples, namely the left breakpoint: 58259 to 101086 and the right deletion breakpoint: 146591 to 153778. To map the deletion area efficiently, the primers were designed to amplify specific small PCR products, covering the suspected breakpoint region and for ranges of 2000 to 5000 bp (see Figure 1). Figure 2 shows that amplicons L1 to L3 (see Table 4 below) are positive in both the determined and non-determined samples, while amplicons L4 to L20 (see Table 4) are missing from the non-determined samples, narrowing the left breakpoint for 60494 to 61345 and the amplicons R6 to R8 (see Table 4, below) positive in both determined and undetermined while R1 to R5 (see Table 4, below) positive only in the undetermined samples, restricting the direct exclusion breakpoint for 15226 to 151623. The primers used for mapping amplicons are described in Table 4, below. To further map the exact breakpoint, primers L3-F (SEQ ID NO: 10) and L6-R (SEQ ID NO: 57) were used to amplify the breakpoint region which was then Sanger sequenced. . The resulting sequence (Figure 3A, SEQ ID NO: 2) was aligned to the castor genome (Figure 3B), mapping the exact deletion breakpoints to coordinates 60520 to 152129 in scaffold sequence 30055 (SEQ ID NO: 1) .

EXAMPLE 4 Castor TFL1 homolog is located within the determined deleted region

[00212] Gene annotation for the deleted region 30055: 60520 to 152129 found 12 mapped genes (described in Table 5, below). Locus ID: 30055. t000014 was found to be homologous to a conserved protein family involved in the regulation of flowering. 30055. t000014 included missing nucleotides in the published draft. To sequence the complete transcript, the gene was amplified and sequenced using the primers TFL1_30055_F CAAAAGTTCACAAGCCATGAG (SEQ ID NO: 62) and TFL1_30055_R TTCTCCCAACAAGGCAGAAG (SEQ ID NO: 63), the resulting sequence (SEQ ID NO: 3 of the polynucleotide; SEQ ID NO : 4 of the CDS and the deduced protein sequence SEQ ID NO: 5) is highly homologous to TFL1. Table 3: Markers and associations derived from GBS data S = according to IUPAC nucleotide code is G or C. Table 4: Primers used for breakpoint mapping Table 5. Genes located within the deleted region and their annotations: Table 6. Lineage of hybrid castor bean plants determined from some embodiments of the invention

EXAMPLE 5 Expression of castor bean genes located within the determined deleted region and during the plant developmental stage Materials and methods Plant material

[00213] Castor bean plants (Ricinus communis L.) of the determined inbred lineage, G-60 (see above), and of the undetermined lineage, g-10, were grown in pots in the greenhouse. Tissue samples were collected from shoots, leaves and roots at different stages of plant development. Tissue samples from G-60 plants were collected at 2 leaves, 4 leaves, 6 leaves and early flowering (pre-flowering). G-10 plant tissue samples were collected at 2-leaf, 4-leaf, 6-leaf, 8-leaf, and early flowering (pre-bloom) due to the later flower stage. All tissue samples were snap-frozen in liquid nitrogen and stored at −80°C for later analysis.

Isolation of RNA and cDNA synthesis

[00214] Frozen tissue samples were ground into a fine powder in liquid nitrogen. Total RNA was isolated from 100 mg tissue samples using the HiYield™ Total RNA Isolation Kit according to the manufacturer's instructions (Real Biotech Corporation). A portion of total RNA (1 μg RNA) was reverse transcribed using the Verso cDNA Synthesis Kit (Thermo Scientific).

Primer design and quantitative real-time polymerase chain reaction

[00215] Primers were designed using Primer3 software (www./primer3plus.com/cgi-bin/dev/primer3plus.cgi) to produce amplicons between 70 and 150 bp. The primer sequences used for qRT-PCR, including two housekeeping genes, ubiquitin and GAPDH, which were used as internal reference genes, are represented in Table 7. qRT-PCR was performed in 96-well plates in a system StepOne Plus real-time PCR (Applied Biosystems). The qRT-PCR reaction (total volume 12 μ l) contained 4 μ l cDNA (13 ng), 1.5 μ l primers (2.5 μ M of each primer), 0.5 μ l water and 6 μl of Fast SYBR® Green Master Mix (Applied Biosystems). The qRT-PCR reaction was performed as follows: initial melting step at 95 °C for 20 seconds followed by 40 cycles of 3 seconds at 95 °C for denaturation and 30 seconds at 60 °C for annealing, stretching and acquisition of fluorescent sign. Melting curve profiles were obtained by incubation at 95°C for 3 seconds followed by gradual warming of 0.3°C from 60°C to 95°C. The relative cDNA level of each sample was calculated using the 2-CT method. Table 7. Primers used for qRT-PCR analysis

Results

[00216] The determined castor bean plant (G-60) comprises the deletion at coordinates 60520 to 152129 in the scaffold sequence 30055 (SEQ ID NO: 1), which confers this determined phenotype.

[00217] To evaluate the contribution of the annotated genes located in this deletion region to the determined castor bean phenotype, the present inventors studied the expression of the genes listed in Table 5 at different stages of plant development. Plant tissue samples of the determinate castor strain (G-60) and the undetermined strain (G-10) were collected from different parts of the plant at different stages of plant development, as described in Material and Methods, above. For the evaluation of gene expression, the apices of the inbred lines G-60 and G-10 were shot and, for example, 4 genes (see Table 5) mRNA expression levels were determined by qRT-PCR. The shoot apices that were collected from plants at 2, 4, 6 and 8 leaves are essentially leaf buds, while the shoot apex at the pre-flowering stage is a flower bud.

[00218] As expected, the purely G-60 strain samples did not contain detectable levels of mRNA of the genes listed in Table 5 above. In contrast, all 12 genes (see Table 5) were expressed at different mRNA levels at various stages of plant development in the G-10 inbred line (see Figure).

[00219] The results demonstrated changes in mRNA expression at different stages of plant development. Important differences were found in the level of mRNA expression comparing 8 leaves with the pre-flowering stages. 30055.m001542 (SEQ ID NO: 83), 30055.m001544 (TFL1) (SEQ ID NO: 3 or 4), 30055.m001545 (SEQ ID NO: 86) and 30055.m001547 (SEQ ID NO: 88) presented infraregulation in its reproductive tissue differentiation (see Figure 5). The downregulation in the expression of these genes in pre-flowering suggests a potential role in flowering inhibition. The lack of expression of these genes in undetermined cosanguineous castor bean lines could promote flower differentiation and the initial flower, as in the purely defined lineage described in some embodiments of the invention. For example, TFL1 (SEQ ID NO: 3 or 4) is known in the art as a flowering inhibitor. In the present study, SEQ ID NO: 3 or 4, TFL1, the level of pre-flowering mRNA expression was predominantly downregulated, consistent with the technique (see Figures 6A to B). Figure 6B clearly demonstrates that while TFL1 was expressed in 2, 4, 6 and 8 leaf samples collected from the undetermined leaves (G-10), no TFL1 mRNA expression was detected at the pre-flowering stage. similarly to the determined castor bean was observed in the inbred line (G-60) (Figure 6B). These results further support the hypothesis that genes that were dramatically downregulated or upregulated within the deletion described above are associated with the given castor bean phenotype.

[00220] Although the invention has been described together with its specific embodiments, it is clear that many alternatives, modifications and variations will be evident to those skilled in the art. Accordingly, it is intended to encompass all alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

[00221] All publications, patents and patent applications mentioned in this specification are incorporated herein in their entirety by reference in the specification, to the same extent as if each individual publication, patent or patent application were specifically and individually indicated to be herein incorporated by reference. Furthermore, the citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to the present invention. To the extent section titles are used, they should not be construed as necessarily limiting. PCT Print (Original in Electronic Form) (This sheet is not part of and does not count as an international application sheet) For Official Use only receive For International Bureau Use Only

Claims (3)

1) Method for selecting a determined castor bean plant, characterized by identifying in a genome of a castor bean plant, using molecular markers, a deletion comprising coordinates 60520-152129 of the sequence established in scaffold 30055 (SEQ ID NO: 1) , the deletion being indicative of a particular castor bean plant. 2) Oil production method, characterized by: a) providing seeds from a determined non-genetically modified castor bean plant, comprising a genome with a deletion comprising coordinates 60520152129 of the sequence established in scaffold 30055 (SEQ ID NO: 1) ; b) extract oil from said seeds. 3) Method of producing a cake, characterized in that it comprises: a) providing castor bean plant seeds from a determined non-genetically modified castor bean plant comprising a genome with a deletion comprising coordinates 60520-152129 of the sequence established in scaffold 30055 ( SEQ ID NO: 1); b) crush said seeds in order to obtain crushed seeds; and c) removing the oil from said crushed seeds, thus producing the cake.