BR112016030147B1 - METHOD FOR MODIFYING A GENOMIC TARGET LOCUS ON A Y CHROMOSOME IN A MOUSE EMBRYONIC STEM (ES) CELL - Google Patents

Abstract

METHOD FOR MODIFYING A GENOMIC TARGET LOCUS IN A Y CHROMOSOME IN A MUSE EMBRYONIC STEM CELL (ES). Methods and compositions are provided for generating target genetic modifications at the Y chromosome or a target challenge locus. The compositions include an in vitro culture comprising an XY pluripotent and/or totipotent animal cell (i.e., XY ES cells or IPsXY cells) having a modification that decreases the level and/or activity of a Sry protein; and the cultivation of these cells in a medium that promotes the development of fertile XY females in F0. Such compositions can be used in various methods to produce a fertile female XY non-human mammal in an F0 generation.

Description

REFERENCE TO RELATED DEPOSIT REQUESTS

[001] This application claims the benefit of U.S. Provisional Application No. 62/017,582, filed June 26, 2014, and U.S. Provisional Application No. 62/017,627, filed June 26, 2014, each of which is incorporated herein in its entirety by reference.

REFERENCE TO SEQUENCE LISTING PRESENTED AS A TEXT FILE VIA EFS WEB

[002] The official copy of the sequence listing is sent electronically via EFS-Web as a sequence listing in ASCII format with a file called 463545SEQLIST.TXT, created on June 25, 2015, and which has a size of 14 Kb and is deposited concurrently with the report. The sequence listing contained in this document in ASCII format is part of the specification and is incorporated herein by reference in its entirety.

FIELD

[003] The invention relates to methods and compositions for maintaining or cultivating pluripotent and/or totipotent cells and to methods and compositions for generating populations of transgenic cells and animals.

BACKGROUND OF THE INVENTION

Perhaps, due to the unique structural features of the Y chromosome, conventional gene-targeting strategies in mouse embryonic stem cells to generate mutations in Y-linked genes have had limited success. Therefore, generally, understanding of these has had limited success. Therefore, generally, understanding of the functions of murine Y-linked genes is limited to knowledge obtained from studies of mice carrying spontaneous deletions, random genetic trap insertions, or autosomal transgenes. Methods are needed to improve the ability to target a genomic locus on the Y chromosome.

[005] The Sry protein (sex-determining region Y) is the main regulator of male sex determination in placental mammals. The Sry gene, also known as the Testis Determining Factor (TDF), resides on the Y chromosome. Sry is considered a transcription factor that binds DNA through its High Mobility Group (HMG) domain. Expression of the mouse Sry gene is restricted to the genital crystal in a narrow time frame around day 11 of embryonic development; both Sry mRNA and protein are detected. Sufficient sry needs to be produced in this time frame to convert the bipotential genital ridge into the testis formation program in males while inhibiting the ovarian development program in females. In tests with adults, a circular Sry transcript is detected, but not the Sry protein. Mutations in the Sry gene that lead to the production of an inactive Sry protein or that alter the timing and potency of gene expression can cause male-to-female sex reversal, resulting in animals that have one X and one Y chromosome, but which are anatomically female. So-called XY females are generally sterile or have low fertility. The possibility of controlling sex determination by regulating Sry would have great value in the production of genetically modified animals.

SUMMARY

[006] A method is provided for producing an XY embryonic stem (ES) cell line capable of producing a fertile female XY non-human mammal in an F0 generation. The method comprises: (a) modifying an XY non-human mammalian embryonic stem (ES) cell that has a modification that decreases the level and/or activity of a Sry protein; and, (b) cultivating the modified ES cell line under conditions that allow the production of an ES cell line that is capable of producing a fertile female non-human mammal XY in an F0 generation.

[007] Also provided is a method for producing a fertile female non-human mammal XY in an F0 generation. The method comprises: (a) introducing XY non-human mammalian ES cells, produced by the above method and having a modification that decreases the level and/or activity of a Sry protein, into a host embryo; (b) gestation of the host embryo; and (c) obtaining a female non-human mammal XY in F0, whereby, upon reaching sexual maturity, the female non-human mammal XY in F0 is fertile. In one embodiment, the female non-human mammal XY at F0 is fertile when crossed with a wild-type mouse. In specific embodiments, the wild-type mouse is C57BL/6.

[008] In one embodiment, the non-human mammalian ES cell XY is from a rodent. In a specific embodiment, the rodent is a mouse. In one embodiment, the XY mouse ES cell is derived from a 129 lineage. In one embodiment, the XY mouse ES cell is a VGF1 mouse ES cell. In one embodiment, the XY mouse ES cell comprises a Y chromosome derived from the 129 lineage. In one embodiment, the XY mouse ES cell originates from a C57BL/6 lineage. In another embodiment, the rodent is a mouse or a hamster.

[009] In some embodiments, the decreased level and/or activity of the Sry protein results from a genetic modification in the Sry gene. In some of these methods, the genetic modification in the Sry gene comprises an insertion of one or more nucleotides, a deletion of one or more nucleotides, a substitution of one or more nucleotides, a knockout, a knockin, a substitution of an endogenous acid sequence. nucleic acids by a homologous, heterologous or orthologous nucleic acid sequence, or a combination thereof.

[0010] In the methods provided here, the targeted genetic modification may comprise an insertion, a deletion, a knockout, a knockin, a point mutation or a combination thereof. In another embodiment, the targeted genetic modification occurs in an autosome.

[0011] In some embodiments, modification of the Sry gene comprises an insertion of a selectable marker and/or a reporter gene functionally linked to an active promoter in the non-human mammalian ES cell. In some embodiments, modification of the Sry gene comprises an insertion of a reporter gene functionally linked to the endogenous Sry promoter. In a specific embodiment, the reporter gene encodes the LacZ reporter protein.

[0012] In one embodiment, the cultivation step comprises cultivating the XY non-human mammalian ES cell in a medium comprising a base medium and supplements suitable for maintaining the non-human mammalian ES cell in culture, the medium being a low osmolality medium. In one embodiment, the low osmolality medium has an osmolality of about 200 mOsm/kg less than about 329 mOsm/kg. In other embodiments, the low osmolality medium has one or more of the following characteristics: a conductivity of about 11 mS/cm to about 13 mS/cm; a salt of an alkali metal and a halide in a concentration of about 50 mM to about 110 mM; a carbonic acid salt concentration of about 17 mM to about 30 mM; a total concentration of alkali metal halide salt and carbonic acid salt of about 85 mM to about 130 mM; and/or a combination of any two or more thereof.

[0013] In some embodiments, by introducing XY non-human mammalian ES cells into a host embryo and after gestation of the host embryo, at least 80%, at least 85%, at least 90% or at least 95% of non-human mammals in F0 are XY females who, upon reaching sexual maturity, non-human mammal females XY in F0 are fertile.

[0014] In one embodiment, the non-human mammalian ES cell XY comprises a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent, and wherein the nuclease agent induces an incision or break in the strand. duo at the reconnaissance site. This method may further comprise exposing the ES cell to the nuclease agent in the presence of a targeting vector comprising an insertion polynucleotide, wherein, following exposure to the nuclease agent and the targeting vector, the ES cell is modified to contain the insertion polynucleotide. In one embodiment, the nuclease agent is an mRNA encoding a nuclease. In specific embodiments, the nuclease agent is (a) a zinc finger nuclease (ZFN); (b) is a Transcription Activator-Like Effector Nuclease (TALEN) or (c) a meganuclease. In other embodiments, the nuclease agent comprises a protein (Cas) associated with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and a guide RNA (gRNA). In these methods, the guide RNA (gRNA) comprises (a) a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA) that targets the first recognition site; and (b) a transactivating CRISPR RNA (tracrRNA). In some cases, the recognition site is immediately flanked by a Protospacer Adjacent Motif (PAM) sequence. In one embodiment, the Cas protein is Cas9.

[0015] An in vitro culture comprising a non-human mammalian ES cell line XY is also provided in accordance with any of the methods provided herein.

[0016] An in vitro culture is provided and comprises (a) an XY non-human mammalian embryonic stem (ES) cell that has a modification that decreases the level and/or activity of a Sry protein; and, (b) a medium comprising a base medium and supplements suitable for maintaining the non-human mammalian ES cell in culture. In one embodiment, the base medium has an osmolality of about 200 mOsm/kg less than about 329 mOsm/kg. In other embodiments, the base medium has one or more of the following characteristics: a conductivity of about 11 mS/cm to about 13 mS/cm; a salt of an alkali metal and a halide in a concentration of about 50 mM to about 110 mM; a carbonic acid salt concentration of about 17 mM to about 30 mM; a total concentration of alkali metal halide salt and carbonic acid salt of about 85 mM to about 130 mM; and/or a combination of any two or more thereof. In one embodiment, the non-human mammalian ES cell XY is from a rodent. In one embodiment, the rodent is a mouse or a rat. In one embodiment, the XY mouse ES cell is a VGF1 mouse ES cell. In one embodiment, the rodent is a mouse or a hamster. In one embodiment, the decreased level and/or activity of the Sry protein results from a genetic modification in the Sry gene. In one embodiment, the genetic modification in the Sry gene comprises an insertion of one or more nucleotides, a deletion of one or more nucleotides, a substitution of one or more nucleotides, a knockout, a knockin, a substitution of an endogenous nucleic acid sequence by a heterologous sequence of nucleic acids, or a combination thereof. In one embodiment, the non-human mammalian ES cell comprises one, two, three or more target genetic modifications. In one embodiment, the targeted genetic modification comprises an insertion, a deletion, a knockout, a knockin, a point mutation, or a combination thereof. In one embodiment, the genetic modification comprises at least one insertion of a heterologous polynucleotide into the XY ES cell genome. In one embodiment, the targeted genetic modification occurs on an autosome. In one embodiment, the base medium has 50 ± 5 mM NaCl, 26 ± 5 mM carbonate and 218 ± 22 mOsm/kg. In one embodiment, the base medium has about 3 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 218 mOsm/kg. In one embodiment, the base medium has 87 ± 5 mM NaCl, 18 ± 5 mM carbonate and 261 ± 26 mOsm/kg. In one embodiment, the base medium has about 5.1 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 261 mOsm/kg. In one embodiment, the base medium has 110 ± 5 mM NaCl, 18 ± 5 mM carbonate and 294 ± 29 mOsm/kg. In one embodiment, the base medium has about 6.4 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 294 mOsm/kg. In one embodiment, the base medium has 87 ± 5 mM NaCl, 26 ± 5 mM carbonate and 270 ± 27 mOsm/kg. In one embodiment, the base medium has about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 270 mOsm/kg. In one embodiment, the base medium has 87 ± 5 mM NaCl, 26 ± 5 mM carbonate, 86 ± 5 mM glucose and 322 ± 32 mOsm/kg. In one embodiment, the base medium has about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate, 15.5 mg/ml glucose, and 322 mOsm/kg. In one embodiment, by introducing XY non-human mammal ES cells into a host embryo and after gestation of the host embryo, at least 80% of the non-human mammals in F0 are XY females which, upon reaching sexual maturity, the females of non-human mammal XY in F0 are fertile.

[0017] There is further provided a method for producing a fertile female XY non-human mammal in an F0 generation, comprising: (a) culturing a donor XY non-human mammal embryonic stem (ES) cell that has a modification that decreases the level and/or activity of a Sry protein in a medium comprising a base medium and supplements suitable for maintaining the non-human mammalian ES cell in culture, (b) introducing the donor non-human mammalian ES cell XY into a host embryo; (d) gestation of the host embryo; and, (d) obtain a female non-human mammal XY in F0, whereby, upon reaching sexual maturity, the female non-human mammal XY in F0 is fertile. In one embodiment, the medium has an osmolality of about 200 mOsm/kg less than about 329 mOsm/kg. In other embodiments, the medium has a characteristic comprising one or more of the following: a conductivity of about 11 mS/cm to about 13 mS/cm; a salt of an alkali metal and a halide in a concentration of about 50 mM to about 110 mM; a carbonic acid salt concentration of about 17 mM to about 30 mM; a total concentration of alkali metal halide salt and carbonic acid salt of about 85 mM to about 130 mM; and/or a combination of any two or more thereof; In one embodiment, the non-human mammalian ES cell XY is from a rodent. In one embodiment, the rodent is a mouse or a rat. In one embodiment, the XY mouse ES cell is a VGF1 mouse ES cell. In one embodiment, the rodent is a mouse or a hamster. In one embodiment, the decreased level and/or activity of the Sry protein originates from a genetic modification in the Sry gene. In one embodiment, the genetic modification in the Sry gene comprises an insertion of one or more nucleotides, a deletion of one or more nucleotides, a substitution of one or more nucleotides, a knockout, a knockin, a substitution of an endogenous nucleic acid sequence by a heterologous sequence of nucleic acids, or a combination thereof. In one embodiment, the non-human mammalian ES cell comprises one, two, three or more target genetic modifications. In one embodiment, the targeted genetic modification comprises an insertion, a deletion, a knockout, a knockin, a point mutation, or a combination thereof. In one embodiment, the targeted genetic modification comprises at least one insertion of a heterologous polynucleotide into an XY ES cell genome. In one embodiment, the targeted genetic modification occurs on an autosome. In one embodiment, the base medium has 50 ± 5 mM NaCl, 26 ± 5 mM carbonate and 218 ± 22 mOsm/kg. In one embodiment, the base medium has about 3 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 218 mOsm/kg. In one embodiment, the base medium has 87 ± 5 mM NaCl, 18 ± 5 mM carbonate and 261 ± 26 mOsm/kg. In one embodiment, the base medium has about 5.1 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 261 mOsm/kg. In one embodiment, the base medium has 110 ± 5 mM NaCl, 18 ± 5 mM carbonate and 294 ± 29 mOsm/kg. In one embodiment, the base medium has about 6.4 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 294 mOsm/kg. In one embodiment, the base medium has 87 ± 5 mM NaCl, 18 ± 5 mM carbonate and 270 ± 27 mOsm/kg. In one embodiment, the base medium has about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 270 mOsm/kg. In one embodiment, the base medium has 87 ± 5 mM NaCl, 26 ± 5 mM carbonate, 86 ± 5 mM glucose and 322 ± 32 mOsm/kg. In one embodiment, the base medium has about 5.1 mg//ml NaCl, 2.2 mg/ml sodium bicarbonate, 15.5 mg/ml glucose, 322 mOsm/kg.

[0018] Methods are further provided for producing a transgenic non-human mammal homozygote for a target genetic mutation in the F1 generation, comprising: (a) crossing a fertile XY female in F0 that has a decrease in the level and/or activity of the protein Sry with a cohort clonal sibling derived from the same ES cell clone, non-human mammal male XY at F0, the fertile non-human mammal female XY at F0 and the non-human mammal male XY at F0 are each , heterozygous for the genetic mutation; and (b) obtaining an F1 progeny mouse that is homozygous for the genetic modification.

[0019] Also provided is a method for modifying a genomic target locus on the Y chromosome in a cell comprising (a) providing a cell comprising a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent, (b) introducing, into the cell, (i) the nuclease agent, wherein the nuclease agent induces an incision or double-strand break at the recognition site; and (ii) a first targeting vector comprising a first insertion polynucleotide flanked by a first and a second homology arms that correspond to a first and a second target sites located in sufficient proximity to the first recognition site; and (c) identify at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus. In one embodiment, a total sum of the first homology arm and the second homology arm is at least 4 kb, but less than 150 kb. In one embodiment, the length of the first homology arm and/or the second homology arm is at least 400 bp, but less than 1000 bp. In another embodiment, the length of the first homology arm and/or the second homology arm is about 700 bp to about 800 bp.

[0020] There is further provided a method for modifying a genomic target locus on the Y chromosome in a cell comprising: (a) providing a cell comprising a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent , (b) introducing, into the cell, a first targeting vector comprising a first insertion polynucleotide flanked by a first and a second homology arms corresponding to a first and a second target site; and (c) identify at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus. In one embodiment, the length of the first homology arm and/or the second homology arm is at least 400 bp, but less than 1000 bp. In another embodiment, the length of the first homology arm and/or the second homology arm is about 700 bp to about 800 bp. In one embodiment, the cell is a mammalian cell. In one embodiment, the mammalian cell is a non-human cell. In one embodiment, the mammalian cell is from a rodent. In one embodiment, the rodent is a rat, mouse or hamster. In one embodiment, the cell is a pluripotent cell. In one embodiment, the mammalian cell is an induced pluripotent stem (iPS) cell. In one embodiment, the pluripotent cell is a non-human embryonic stem (ES) cell. In one embodiment, the pluripotent cell is a rodent embryonic stem (ES) cell, a mouse embryonic stem (ES) cell, or a rat embryonic stem (ES) cell. In one embodiment, the nuclease agent is an mRNA encoding a nuclease. In one embodiment, the nuclease agent is a zinc finger nuclease (ZFN). In one embodiment, the nuclease agent is a Transcription Activator-Like Effector Nuclease (TALEN). In one embodiment, the nuclease agent is a meganuclease. In some embodiments, the nuclease agent comprises a protein (Cas) associated with clustered regularly interspaced short palindromic repeats (CRISPR) and a guide RNA (gRNA). In this method, the guide RNA (gRNA) can comprise (a) a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA) that targets the first recognition site; and (b) a transactivating CRISPR RNA (tracrRNA). In one embodiment, the first or second recognition sites are immediately flanked by a Protospacer Adjacent Motif (PAM) sequence. In some embodiments, the Cas protein is Cas9.

[0021] In some embodiments, the modification comprises a deletion of an endogenous nucleic acid sequence. In some embodiments, the deletion is from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to about 60 kb. , from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, or from about 150 kb to about 200 kb, from about 200 kb to about 300 kb, from about 300 kb to about 400 kb, from about 400 kb to about 500 kb, from about 500 kb to about 1 Mb, from about 1 Mb to about 1, 5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb; In a specific embodiment, the deletion is at least 500 kb. In one embodiment, the cell is a mammalian cell. In one embodiment, the mammalian cell is a non-human cell. In one embodiment, the mammalian cell is from a rodent. In one embodiment, the rodent is a rat, mouse or hamster. In one embodiment, the cell is a pluripotent cell. In one embodiment, the mammalian cell is an induced pluripotent stem (iPS) cell. In one embodiment, the pluripotent cell is a non-human embryonic stem (ES) cell. In one embodiment, the pluripotent cell is a rodent embryonic stem (ES) cell, a mouse embryonic stem (ES) cell, or a rat embryonic stem (ES) cell. In some embodiments, the nuclease agent comprises a protein (Cas) associated with clustered regularly interspaced short palindromic repeats (CRISPR) and a guide RNA (gRNA). In this method, the guide RNA (gRNA) can comprise (a) a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA) that targets the first recognition site; and (b) a transactivating CRISPR RNA (tracrRNA). In one embodiment, the first or second recognition sites are immediately flanked by a Protospacer Adjacent Motif (PAM) sequence. In some embodiments, the Cas protein is Cas9. In one embodiment, the nuclease agent is a zinc finger nuclease (ZFN). In one embodiment, the nuclease agent is a Transcription Activator-Like Effector Nuclease (TALEN). In one embodiment, the nuclease agent is a meganuclease.

[0022] Methods for modifying the Y chromosome comprising exposing the Y chromosome to a Cas protein and a CRISPR RNA in the presence of a large targeting vector (LTVEC) comprising a nucleic acid sequence of at least 10 Kb and which , after exposure to Cas protein, CRISPR RNA and LTVEC, the Y chromosome is modified to contain at least 10 Kb of nucleic acid sequence. The LTVEC may comprise a nucleic acid sequence of at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb . In other embodiments, the LTVEC comprises a nucleic acid sequence of at least 100 kb, at least 150 kb, or at least 200 Kb.

[0023] There is further provided a method for modifying a genomic target locus on the Y chromosome comprising: (a) providing a mammalian cell comprising the genomic target locus on the Y chromosome, the genomic target locus comprising a target sequence guide RNA (gRNA); (b) introducing into the mammalian cell: (i) a large targeting vector (LTVEC) comprising a first nucleic acid flanked with targeting arms homologous to the genomic target locus, wherein the LTVEC is at least 10 kb; (ii) a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding a Cas protein, and (iii) a second expression construct comprising a second promoter operably linked to a third nucleic acid encoding a guide RNA (gRNA) comprising a nucleotide sequence that hybridizes to the gRNA target sequence and a transactivating CRISPR RNA (tracrRNA), with the first and second promoters being active in the mammalian cell; and (c) identifying a modified mammalian cell that comprises a target genetic modification at the genomic target locus on the Y chromosome. In other embodiments, the LTVEC is at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb. In other embodiments, the LTVEC is at least 100 kb, at least 150 kb, or at least 200 Kb. In one embodiment, the mammalian cell is a non-human mammalian cell. In one embodiment, the mammalian cell is a fibroblast. In one embodiment, the mammalian cell is from a rodent. In one embodiment, the rodent is a rat, mouse or hamster. In one embodiment, the mammalian cell is a pluripotent cell. In one embodiment, the pluripotent cell is an induced pluripotent stem (iPS) cell. In one embodiment, the pluripotent cell is a mouse embryonic stem (ES) cell or a rat embryonic stem (ES) cell. In one embodiment, the pluripotent cell is a developmentally restricted human progenitor cell. In one embodiment, the Cas protein is a Cas9 protein. In one embodiment, the gRNA target sequence is immediately flanked by a Protospacer Adjacent Motif (PAM) sequence. In one embodiment, the total sum of 5' and 3' homology arms of the LTVEC is about 10 kb to about 150 kb. In one embodiment, the sum total of the 5' and 3' homology arms of the LTVEC is from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to about 60 kb. kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 120 kb, or from about 120 kb to 150 kb. In one embodiment, the targeted genetic modification comprises: (a) a replacement of an endogenous nucleic acid sequence with a homologous or orthologous nucleic acid sequence; (b) a deletion of an endogenous nucleic acid sequence; (c) a deletion of an endogenous nucleic acid sequence, wherein the deletion ranges from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb , from about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, or from about 150 kb to about 200 kb, from about 200 kb to about 300 kb, from about 300 kb to about 400 kb, from about 400 kb to about 500 kb, from about 500 kb to about 1 Mb , from about 1 Mb to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb; (d) insertion of an exogenous nucleic acid sequence; (e) insertion of an exogenous nucleic acid sequence in the range of about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, from about 150 kb to about 200 kb , from about 200 kb to about 250 kb, from about 250 kb to about 300 kb, from about 300 kb to about 350 kb, or from about 350 kb to about 400 kb; (f) insertion of an exogenous nucleic acid sequence comprising a homologous or orthologous nucleic acid sequence; (g) inserting a chimeric nucleic acid sequence comprising a human and a non-human nucleic acid sequence; (h) insertion of a conditional allele flanked with site-specific recombinase target sequences; (i) insertion of a selectable marker or a reporter gene functionally linked to a third active promoter in the mammalian cell; or (j) a combination thereof. In one embodiment, the genomic target locus comprises (i) a 5' target sequence that is homologous to a 5' homology arm; and (iii) a 3' target sequence that is homologous to a 3' homology arm. In one embodiment, the 5' target sequence and the 3' target sequence are separated by at least 5 kb, but less than 3 Mb. In one embodiment, the 5' target sequence and the 3' target sequence are separated at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, at least 60 kb, but less than 80 kb, at least about 80 kb, but less than 100 kb, at least 100 kb, but less than 150 kb, or at least 150 kb, but less than 200 kb, at least about 200 kb, but less than about 300 kb, at least about 300 kb, but less than about 400 kb, at least about 400 kb, but less than about 500 kb, at least about 500 kb, but less than about 1 Mb, at least about 1 Mb, but less than about 1.5 Mb, at least about 1.5 Mb, but less than about 2 Mb, at least about 2 Mb, but less than about 2, 5 Mb, or at least about 2.5 Mb, but less than about 3 Mb. In one embodiment, the first and second expression constructs are on a single nucleic acid molecule. In one embodiment, the genomic target locus comprises the Sry locus.

[0024] A method is further provided for target genetic modification on the Y chromosome of a non-human animal, comprising: (a) modifying a genomic locus of interest on the Y chromosome of a non-human pluripotent cell, in accordance with the methods described herein invention, thereby producing a genetically modified non-human pluripotent cell comprising a target genetic modification on the Y chromosome; (b) introducing the modified non-human pluripotent cell according to (a) into a non-human host embryo; and gestating the non-human host embryo comprising the pluripotent cell modified in a substituent, wherein the substituent produces F0 progeny comprising the target genetic modification, wherein the target genetic modification is capable of being transmitted through the germline. In one embodiment, the genomic locus of interest comprises the Sry locus.

[0025] Methods and compositions are provided for generating target genetic modifications on the Y chromosome. The compositions include an in vitro culture comprising an XY pluripotent and/or totipotent animal cell (i.e., XY ES cells or XY iPS cells) having a modification that decreases the level and/or activity of a Sry protein; and culturing these cells in a medium that promotes the development of fertile XY females in F0. Such compositions can be used in various methods to produce a fertile female XY non-human mammal in an F0 generation.

BRIEF DESCRIPTION OF FIGURES

[0026] Figure 1 presents a schematic of the Cas9/gRNA CRISPR that targets the mouse Sry gene. VG-1 (SEQ ID NO:10); VG-2 (SEQ ID NO:11); VG-3 (SEQ ID NO:12). The primers and probes indicated in Figure 1 are shown in SEQ ID NOS: 13-29.

[0027] Figure 2 provides a scheme that targets the Sry gene with TALEN and CRISPR using a lacZ reporter gene. The Sry gene was targeted with either an LTVEC or a short-arm vector (smallTVEC) having shorter homology arms than an LTVEC in order to avoid challenge sites on the Y chromosome.

[0028] Figure 3 illustrates the expression of LacZ in embryos.

[0029] Figure 4 provides a schematic of a large deletion of more than 500 kb on the Y chromosome mediated by ZFNs or CRISPR guide RNAs in combination with Cas9 DNA endonuclease.

[0030] Figures 5 A, B, and C provide sequencing confirmation of the large deletion on the Y chromosome in different clones. Figure 5 is the sequencing result of clone 1-D5. The ascending Kdm5 sequence and the descending Uspy9 sequence are provided in SEQ ID NO:30; 1-D5 1500F (SEQ ID NO:31); 1-D5 1000R (SEQ ID NO:32); Figure 5B is the sequencing result of clone 5-C4. The ascending Kdm5 sequence and the descending Uspy9 sequence are provided in SEQ ID NO:33; 1500F (SEQ ID NO:34); 1000R (SEQ ID NO:35); 1000F (SEQ ID NO:36); and Figure 5C is the sequencing result of clone 6-A12. The ascending Kdm5 sequence and the descending Uspy9 sequence are provided in SEQ ID NO:37; 1500F (SEQ ID NO:38); 1000R (SEQ ID NO:39); 1000F (SEQ ID NO:40); 1500R (SEQ ID NO:41). The boxed regions in Figure 5B and Figure 5C represent regions of microhomology.

DETAILED DESCRIPTION Definitions

[0031] The terms "protein," "polypeptide," and "peptide," used interchangeably in the present invention, include polymeric forms of amino acids of any length, including coded and non-coded amino acids and chemically or biochemically modified or derived amino acids. The terms also include polymers that have been modified, such as polypeptides having modified peptide backbones.

[0032] The terms "nucleic acid" and "polynucleotide," used interchangeably in the present invention, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. They include single-, double-, and multiple-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers comprising purine bases, pyrimidine bases, or other chemically modified, biochemically modified, unnatural, or nucleotide-derived natural bases. . For the sake of simplicity, the size of the nucleic acid can be expressed in bp whether the nucleic acid is in single- or double-stranded form; in the second case, the bp is that formed if and when the single-stranded nucleic acid is duplicated with its exactly complementary strand.

[0033] "Codon optimization" includes, in general, a process of modifying a nucleic acid sequence for improved expression in particular host cells by replacing at least one codon of the native sequence with a codon that is most frequently used in genes of the host cell, while maintaining the native amino acid sequence. For example, a nucleic acid encoding a Cas protein can be modified to replace codons having a higher frequency of use in a given prokaryotic or eukaryotic cell, including a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, or any other host cell, compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example, in the "Codon Usage Database." These tables can be adapted in several ways. See Nakamura et al. (2000) Nucleic Acids Research 28:292. Computer algorithms for optimizing codons of a particular sequence for expression in a particular host are also available (see, for example, Gene Forge).

[0034] "Functional linkage" or "functionally linked" includes the juxtaposition of two or more components (e.g., a promoter or other sequence element), such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted on at least one of the other components. For example, a promoter may be functionally linked to a coding sequence if the promoter controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors.

[0035] "Complementarity" of nucleic acids means that a nucleotide sequence of a nucleic acid strand, due to the orientation of its nucleobase groups, forms hydrogen bonds with another sequence of an opposite nucleic acid strand. Complementary bases in DNA are typically A with T and C with G. In RNA, they are typically C with G and U with A. Complementarity can be perfect or substantial/sufficient. Perfect complementarity between two nucleic acids means that the two nucleic acids can form a duplex in which each base in the duplex is linked to a complementary base through Watson-Crick pairing. "Substantially" or "sufficiently" complementary means that a sequence on one strand is not completely and/or perfectly complementary to a sequence on an opposite strand, but that sufficient binding occurs between the bases on the two strands to form an overall stable hybrid complex of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by using standard mathematical sequences and calculations to predict the Tm of hybridized strands or by empirically determining the Tm using routine methods. Tm includes the temperature at which a population of hybridization complexes formed between two nucleic acid strands are 50% denatured. At a temperature below Tm, the formation of a hybridization complex is favored, whereas at a temperature above Tm, fusion or separation of the strands in the hybridization complex is favored. Tm can be estimated for a nucleic acid that has a known G+C content in an aqueous solution of 1 M NaCl, by using, for example, Tm=81.5+0.41 (% G+C), although other known computations of Tm take structural features of the nucleic acid into account.

[0036] "Hybridization condition" includes the cumulative environment in which the nucleic acid strand binds to a second nucleic acid strand by complementary strand interactions and by hydrogen bonding to produce a hybridization complex. Such conditions include the chemical components and their concentrations (e.g., salts, chelating agents, formamide) of an aqueous or organic solution containing the nucleic acids and the temperature of the mixture. Other factors, such as incubation time or dimensions of the reaction chamber, can contribute to the environment. See, for example, Sambrook et al., Molecular Cloning, A Laboratory Manual, 2.sup.nd ed., pp. 1.90-1.91, 9.47-9.51, 11.47-11.57 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).

[0037] Hybridization requires that the two nucleic acids contain complementary sequences, although disparities between the bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of complementation between two nucleotide sequences, the higher the melting temperature (Tm) value for nucleic acid hybrids that have those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g., complementarity over 35 or less, 30 or less, 25 or less, 22 or less, 20 or less, or 18 or less nucleotides), the position of disparities becomes important (see Sambrook et al., supra, 11.7-11.8). Typically, the length of a hybridizable nucleic acid is at least about 10 nucleotides. Illustrative minimum lengths for a hybridizable nucleic acid include at least about 15 nucleotides, at least about 20 nucleotides, at least about 22 nucleotides, at least about 25 nucleotides, and at least about 30 nucleotides. Furthermore, the temperature and salt concentration of the washing solution can be adjusted as needed according to factors such as the length of the complementation region and the degree of complementation.

[0038] The polynucleotide sequence does not need to be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Furthermore, a polynucleotide may hybridize along one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). A polynucleotide (e.g., gRNA) may comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence complementarity with a target region within the sequence of target nucleic acids to which it is directed. For example, a gRNA in which 18 of 20 nucleotides are complementary to a target region, and which would therefore hybridize specifically, would represent 90% complementarity. In this example, the remaining non-complementary nucleotides may be clustered or interspaced with complementary nucleotides and need not be contiguous with each other or with complementary nucleotides.

[0039] Percent complementarity between particular lengths of nucleic acid sequences within nucleic acids can be routinely determined using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al. (1990) J. Mol. Biol. 215:403 to 410; Zhang and Madden (1997) Genome Res. 7:649 to 656), or using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the Smith and Waterman algorithm (Adv. Appl. Math., 1981, 2, 482 to 489).

[0040] The methods and compositions provided here employ a variety of different components. It is recognized throughout the description that some components may have active variants and fragments. Such components include, for example, Cas proteins, CRISPR RNAs, tracrRNAs, and guide RNAs. The biological activity of each of these components is described elsewhere in the present invention.

[0041] "Sequence identity" or "identity", in the context of two polynucleotide or polypeptide sequences, refers to residues in the two sequences that are the same when aligned for maximum correspondence in a specified comparison window. When percentage sequence identity is used in reference to proteins, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, in which amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g. example, charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percentage of sequence identity can be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". The means for making this adjustment are well known to those skilled in the art. Typically, this involves scoring a conservative substitution as a partial disparity rather than a complete disparity, thereby increasing the percentage of sequence identity. Thus, for example, when an identical amino acid receives a score of 1 and a non-conservative substitution receives a score of zero, a conservative substitution receives a score between zero and 1. The score for conservative substitutions is calculated, for example, as implemented in the PC/GENE program (Intelligenetics, Mountain View, California).

[0042] "Percent sequence identity" includes the value determined by comparing two ideally aligned sequences along a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., "gaps") when compared to the reference sequence (which does not include additions or deletions) for ideal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to produce the number of paired positions, then dividing the number of paired positions by the total number of positions in the comparison window , and multiplying the result by 100 to obtain the percentage of sequence identity.

[0043] Except where otherwise specified, sequence identity/similarity values include the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP weight of 50 and Length weight of 3, and the scoring matrix from nwsgapdna.cmp; % Identity and % Similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2 and the BLOSUM62 scoring matrix; or any equivalent program thereto. "Equivalent program" includes any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue correlations and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10 .

[0044] Compositions or methods "comprising" or "including" one or more mentioned elements may include other elements not specifically mentioned. For example, a composition that "comprises" or "includes" a protein may contain the protein alone or in combination with other ingredients.

[0045] The designation of a range of values includes all integers within or defining the range and all sub-ranges defined by integers within the range.

[0046] Unless otherwise evident from the context, the term "about" encompasses values within a standard measurement error margin (i.e., SEM, standard margin of error) of an established value.

[0047] The singular forms of the articles "a", "an" and "the" include plural references, unless the context clearly establishes otherwise. For example, the term "a Cas protein" or "at least one Cas protein" may include a plurality of Cas proteins, including mixtures thereof.

I. Methods and Compositions for Producing a Fertile Female of Animal XY in an F0 Generation.

[0048] Methods for producing non-human animals from donor ES cells and host embryos are known. Donor ES cells are selected for certain characteristics that improve the ability of the cells to populate a host embryo and thus contribute in part or a substantial part to the formation of an animal by the donor ES cells and the host embryo. The animal formed can be male or female, based largely on the genotype of the ES cell (e.g., XY or XX).

[0049] Most ES cell lines for producing transgenic animals have a male XY genotype. Due to the dominance of the Y chromosome in sex determination in mammals, when ES XY cells are introduced into a blastocyst host embryo and gestated, they almost always produce, in the first generation (F0), phenotypically male animals that are chimeras, that is, which contain cells derived from the male donor ES cell (XY) and cells derived from the host embryo, which can be either male (XY) or female (XX). XY ES cells, when introduced into an 8-cell host embryo by the VelociMouse method and gestated, can produce, in the first generation (F0), phenotypically male animals that are completely derived from XY ES cells.

[0050] Document WO2011/156723 provides methods and compositions that employ a culture medium to maintain donor XY cells in culture, such that, after introduction of the donor XY cells into a host embryo and after pregnancy in a suitable host, fertile females of XY animals are produced in the F0 population. Such compositions can be used in the production of F1 progeny that are homozygous for said target genetic modification.

[0051] The present application provides methods and compositions that employ a combination of donor XY cells having a modification that decreases the level and/or activity of the Sry protein in combination with a culture medium that promotes the production of fertile XY females in Anatomically normal fertile F0. Such methods and compositions allow the production of a fertile female XY non-human animal in an F0 generation. The combination of XY ES cells having a modification that decreases the level and/or activity of the Sry protein in combination with the culture medium described in the present invention significantly increases the percentage of progeny of fertile XY females in the F0 generation. Methods for efficient male-to-female sex conversion are valuable to the pet industry. For example, female calves are much more valuable to the dairy industry than males. The same is true for poultry. For breeding purposes, whether cattle, pigs or sheep, it is preferred to breed many females for just a few bulls, male pigs or rams. Thus, the various methods provided here can be used in several commercially important breeding industries.

[0052] Methods and compositions for the production of an XY embryonic stem (ES) cell line capable of producing a fertile female non-human mammal XY in an F0 generation without culture in a feminization medium are also presented. In such methods, the ES cell line XY having a modification that decreases the level and/or activity of a Sry protein can produce an ES cell line that is capable of producing a fertile female non-human mammal XY in an F0 generation. in the absence of a feminization medium provided elsewhere in the present invention (e.g., by culturing in a base medium, such as DMEM, described elsewhere herein).

. Animal XY Cells Having a Modification that Decreases the Level and/or Activity of a Sry Protein

[0053] In the present document, various compositions and methods are provided that comprise several pluripotent and/or totipotent XY cells of an animal. The term "pluripotent cell" as used herein includes an undifferentiated cell that has the ability to develop into more than one type of differentiated cell. These pluripotent and/or totipotent XY cells can be, for example, an embryonic stem (ES) cell or an induced pluripotent stem (iPS) cell. The term "embryonic stem cell" or "ES cell", as used in the present invention, includes an embryo-derived totipotent or pluripotent cell that is capable of contributing to any tissue of the developing embryo upon introduction into an embryo.

[0054] The term "animal", in reference to cells, pluripotent and/or totipotent cells, XY cells, ES cells, iPS cells, donor cells and/or host embryos, includes mammals, fish and birds. Mammals include, for example, humans, non-human primates, monkeys, apes, dogs, cats, horses, bulls, deer, bison, sheep, rodents (e.g. mice, rats, hamsters, guinea pigs), livestock (e.g. cattle, e.g. cows, bulls, etc.; sheep, e.g., sheep, goats, etc.; and pigs, e.g., pigs and wild boars). Poultry includes, for example, chickens, turkeys, ostriches, geese, ducks, etc. Domesticated animals and agricultural animals are also included. The phrase "non-human animal", in reference to cells, XY cells, ES cells, donor cells and/or host embryos, excludes humans.

[0055] In specific embodiments, the pluripotent cell is an XY human ES cell, an XY human iPS cell, an XY human adult ES cell, a developmentally restricted human progenitor ES cell, a non-human ES cell human XY, a non-human iPS cell XY, a rodent ES cell XY, a rodent iPS cell XY, a mouse ES cell XY, a mouse iPS cell XY, a rat ES cell mouse XY, a hamster ES cell XY, a hamster iPS cell XY, a monkey ES cell XY, a monkey iPS cell XY, an agricultural mammal ES cell from domesticated mammal XY, or an iPS cell from domesticated mammal XY. Furthermore, the XY ES cell or the XY iPS cell may be from an inbred lineage, a hybrid lineage, or an outbred lineage. It is further recognized that XY pluripotent and/or totipotent cells may comprise an XYY karyotype or an XXY karyotype.

[0056] Mouse pluripotent and/or totipotent cells (i.e., ES XY cells or iPS XY cells) can be of a 129 lineage, a C57BL/6 lineage, a mixture of 129 and C57BL/6, a BALB/lineage c, or a strain of Swiss Webster. In a specific embodiment, the mouse is 50% 129 and 50% C57BL/6. In one embodiment, the mouse is from a strain 129 selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/Svlm), 129S2, 129S4, 129S5, 129S9/ SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2. See, for example, Festing et al. (1999) Mammalian Genome 10:836). In one embodiment, the mouse is a C57BL strain, and in a specific embodiment, it is of C57BL/A, C57BL/An, C57BL/GrFa, C57BL/Kal_wN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ , C57BL/6NTac, C57BL/10, C57BL/10ScSn, C57BL/10Cr, or C57BL/Ola. In a specific embodiment, the mouse is a mixture of an above-mentioned 129 strain and an above-mentioned C57BL/6 strain. In another specific embodiment, the mouse is a mixture of the above-mentioned 129 strains, or a mixture of the above-mentioned BL/6 strains. In a specific embodiment, the 129 strain of the mixture is a 129S6 (129/SvEvTac) strain. In some embodiments, the XY mouse ES cell comprises a Y chromosome derived from lineage 129.

[0057] In yet another embodiment, the XY mouse ES cell is a VGF1 mouse ES cell. VGF1 (also known as F1H4) mouse ES cells were derived from hybrid embryos produced by crossing a female C57BL/6NTac mouse with a male 129S6/SvEvTac mouse. Therefore, VGF1 ES cells contain mouse Y chromosome 129S6/SvEvTac. See, for example, Auerbach, W. et al. (2000) Establishment and chimera analysis of 129/SvEv- and C57BL/6-derived mouse embryonic stem cell lines. Biotechniques 29, 1024-1028, 1030, 1032, incorporated herein by reference in its entirety.

[0058] A pluripotent and/or totipotent mouse cell (i.e., XY ES cells or XY iPS cells) can be from any mouse lineage, including, but not limited to, an ACI mouse lineage, a Dark mouse lineage Agouti (DA), a Wistar rat strain, a LEA rat strain, a Sprague Dawley (SD) rat strain, or a Fischer rat strain, e.g., Fisher F344 or Fisher F6. Rat pluripotent or totipotent cells (i.e., XY ES cells or XY iPS cells) can also be obtained from a lineage derived from a mixture of two or more of the above-mentioned lineages. In one embodiment, the rat pluripotent and/or totipotent cell (i.e., XY ES cells or XY iPS cells) is derived from a lineage selected from an AD lineage and an ACI lineage. In a specific embodiment, the rat pluripotent and/or totipotent cell (i.e., XY ES cells or XY iPS cells) is derived from an ACI lineage. The ACI rat line is characterized by having Black Agouti, with white belly and feet and RT1 av1 haplotype. Such strains are available from a variety of sources, including Harlan Laboratories. In other embodiments, the various mouse pluripotent and/or totipotent cells (i.e., ES XY cells or iPS XY cells) are from a Dark Agouti (DA) mouse lineage, which is characterized by having an agouti coat and a haplotype RT1av1. Such mice are available from several sources, including Charles River and Harlan Laboratories. In another embodiment, the rat pluripotent and/or totipotent cells (i.e., XY ES cells or XY iPS cells) are from a pure rat lineage. In specific embodiments, the mouse ES cell line originates from an ACI mouse and comprises the ACI.G1 mouse ES cell. In another embodiment, the rat ES cell line originates from a DA rat and comprises the rat ES cell line DA.2B or the rat ES cell line DA.2C. See, for example, U.S. Utility Application No. 14/185, 703, filed February 20, 2014 and incorporated herein by reference in its entirety.

[0059] In various embodiments, the pluripotent and/or totipotent cells (i.e., XY ES cells or XY iPS cells), the donor cell and/or the host embryo do not originate from one or more of the following: Akodon spp ., Myopus spp., Microtus spp., Talpa spp. In several embodiments, the donor cell and/or host embryo are not of any species, wherein a normal wild-type characteristic is the fertility of the XY female. In various embodiments in which a genetic modification is present in the pluripotent and/or totipotent cell (i.e., XY ES cells or XY iPS cells), the donor cell, or the host embryo, the genetic modification is not an XYY or XXY, a Tdy-negative sex reversal, a Tdy-positive sex reversal, an X0 modification, an aneuploidy, an fgf9-/- genotype, or a SOX9 modification.

[0060] The pluripotent and/or totipotent XY cells (i.e., an XY ES cell or an XY iPS cell), used in the methods and compositions, have a genetic modification that results in a decreased level and/or activity of the Sry protein. The "Sex Determination Region Y" protein or "Sry" protein is a transcription factor that is a member of the high mobility group (HMG)-family of DNA-binding proteins. Sry is the testicular determining factor that initiates male sex determination. The sequence of the Sry protein from a variety of organisms is known, including that from mice (Accession No. Q05738); mouse (GenBank: CAA61882.1) human (Accession No. Q05066); cat (Accession No. Q67C50), and horse (Accession No. P36389), each of which is incorporated herein by reference.

[0061] In general, the level and/or activity of the Sry protein is decreased if the protein level and/or the activity level of the Sry protein is statistically lower than the Sry protein level in a suitable control cell that has not been genetically modified or mutagenized to inhibit the expression and/or activity of the Sry protein. In specific embodiments, the concentration and/or activity of the Sry protein is decreased by at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90 % relative to a control cell that was not modified to have decreased Sry protein level and/or activity.

[0062] An "individual cell" is one in which a genetic alteration, such as a genetic modification disclosed in the present invention, has been effected, or is a cell that descends from a cell so altered and that comprises the alteration. A "control" or "control cell" provides a reference point for measuring changes in the individual's cell phenotype. In one embodiment, the control cell is correlated as closely as possible to the cell with reduced Sry activity, except that it lacks the genetic modification or mutation that results in the reduced activity (e.g., the respective cells may originate from if from the same cell line). In other cases, the control cell may comprise, for example: (a) a wild-type cell, that is, of the same genotype as the starting material for the genetic alteration that resulted in the individual's cell; (b) a cell of the same genotype as starting material, but which has been genetically modified with a null construct (i.e., with a construct that has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) a cell that is a non-genetically modified progeny of an individual's cell (i.e., the control cell and the individual's cell originate from the same cell lineage); (d) a cell genetically identical to the individual's cell, but which is not exposed to conditions or stimuli that would induce expression of the gene of interest; or (e) the individual's cell itself, under conditions where the genetic modification does not result in a change in the expression of the polynucleotide of interest.

[0063] The expression level of the Sry polypeptide can be measured directly, for example, by testing for the level of the Sry polypeptide in the cell or organism, or indirectly, for example, by measuring the activity of the Sry polypeptide. Several methods for determining Sry protein activity are known. See, Wang et al. (2013) Cell 153:910-918, Mandalos et al. (2012) PLOS ONE 7:e45768:1-9, and Wang et al. (2013) Nat Biotechnol. 31:530-532, each of which is incorporated herein by reference.

[0064] In other cases, cells that have targeted genetic modification that reduces the activity and/or level of the Sry polypeptide are selected using methods including, but not limited to, Southern blot analysis, DNA sequencing, PCR analysis , or phenotypic analysis. These cells are then used in the various methods, compositions and kits described here.

[0065] A target genetic modification may comprise a target change to a polynucleotide of interest, including, for example, a target change to a genomic target locus on the Y chromosome, a target change to the Sry gene, or a target change to target for other desired polynucleotides. Such target modifications include, but are not limited to, additions of one or more nucleotides, deletions of one or more nucleotides, substitutions of one or more nucleotides, a knockout of the polynucleotide of interest or a portion thereof, a knock-in of the polynucleotide of interest or a portion thereof, a replacement of an endogenous nucleic acid sequence with a heterologous nucleic acid sequence, or a combination thereof. In specific embodiments, at least 1, 2, 3, 4, 5, 7, 8, 9, 10 or more nucleotides are changed to form the target genomic modification.

[0066] A decrease in the level and/or activity of the Sry protein may result from a genetic modification in the Sry gene (that is, a genetic modification in a regulatory region, the coding region and/or introns, etc.). Such genetic modifications include, but are not limited to, additions, deletions and substitutions of nucleotides in the genome. Such genetic modifications may include an alteration of the Sry gene, including, for example, an insertion of one or more nucleotides within the Sry gene, a deletion of one or more nucleotides from the Sry gene, a substitution of one or more nucleotides in the Sry gene, a knockout of the Sry gene or a portion thereof, a knockin of the Sry gene or a portion thereof, a replacement of an endogenous nucleic acid sequence with a heterologous nucleic acid sequence, or a combination thereof. Thus, in specific embodiments, the activity of a Sry polypeptide can be reduced or eliminated by disrupting the gene encoding the Sry polypeptide. In specific embodiments, at least 1, 2, 3, 4, 5, 7, 8, 9, 10 or more nucleotides are changed in the Sry gene. Various methods can be used to generate additional target genetic modification. See, for example, Wang et al. (2013) Cell 153:910-918, Mandalos et al. (2012) PLOS ONE 7:e45768:1- 9, and Wang et al. (2013) Nat Biotechnol. 31:530 to 532, each of which is incorporated herein by reference. Furthermore, the various methods described here for modifying the genomic locus on the Y chromosome can be used to introduce the desired genetic modification into the Sry gene.

[0067] In other embodiments, the activity and/or level of the Sry polypeptide is reduced or eliminated by introducing, into the cell, a polynucleotide that inhibits the level or activity of the Sry polypeptide. The polynucleotide can inhibit expression of the Sry polypeptide directly by preventing translation of the Sry messenger RNA or indirectly by encoding a polypeptide that inhibits transcription or translation of the gene encoding a Sry protein. In other embodiments, the activity of the Sry polypeptide is reduced or eliminated by introducing into the cell a sequence encoding a polypeptide that inhibits the activity of the Sry polypeptide.

[0068] In one embodiment, XY pluripotent and/or totipotent cells (i.e., XY ES cells or XY iPS cells) comprise a conditional Sry allele that reduces the activity and/or level of Sry protein. A "conditional Sry allele" includes a modified Sry gene designed to have the level and/or activity of the Sry protein decreased within a developmental period and/or within a desired tissue of interest. The reduced level and/or activity can be compared with a control cell that does not have the modification, giving rise to the conditional allele or, in the case of reduced activity in a desired developmental period, with previous and/or following times or, in the case of a desired tissue, with an average activity of all tissues. In one embodiment, the Sry conditional allele comprises a Sry null conditional allele that can be inactivated at a desired point in the developmental period and/or in specific tissues. Such a conditional allele can be used to create fertile XY females derived from any target gene clone. As described elsewhere in the present invention, this method allows the creation of a desired homozygous genetic modification in the F1 generation. These methods provide a quick look at the phenotype without needing to breed to the F2 generation.

[0069] In a non-limiting embodiment, the conditional allele Sry is a multifunctional allele, as described in US 2011/0104799, which is incorporated by reference in its entirety. In specific embodiments, the conditional allele comprises: (a) a sequence acting in sense orientation with respect to transcription of a target gene, and a drug selection cassette (DSC) in sense or antisense orientation ; (b) in antisense orientation, a nucleotide sequence of interest (NSI) and a conditional by inversion (COIN) module that uses an exon-splitting intron and an invertible genetrap-type module; see, for example, US 2011/0104799, which is incorporated by reference in its entirety); and (c) recombinant units that recombine upon exposure to a first recombinase to form a conditional allele (i) that lacks the acting sequence and the DSC, and (ii) contains the NSI in sense orientation and the COIN in the antisense.

[0070] The conditional allele of the Sry gene can be generated in any cell type and is not limited to a pluripotent and/or totipotent XY cell. These cell types, along with non-limiting methods for targeting a genomic locus on the Y chromosome, are discussed in more detail elsewhere in this document.

[0071] As discussed elsewhere herein, the pluripotent and/or totipotent XY cell (i.e., an XY ES cell or an XY iPS cell) having genetic modification that reduces the level and/or activity of the Sry protein may comprise, additionally, at least one additional target genetic modification for a polynucleotide of interest. The at least one additional target genetic modification may comprise a replacement of one or more nucleic acids, a replacement of an endogenous nucleic acid sequence with a heterologous nucleic acid sequence, a knockout and a knock-in. The additional target genetic modification can be on the Y chromosome, the X chromosome, or an autosome. Various methods can be used to generate additional targeted genetic modification, including the employment of targeting plasmids and large targeting vectors as discussed herein. See also US20080092249, WO/1999/005266A2, US20040177390, WO/2008/017234A1, and US Patent No. 7,612,250, each of which is incorporated herein by reference, for methods related to nuclear transfer. Furthermore, the various methods described here to modify the genomic locus on the Y chromosome (i.e., the Sry gene) can also be used to introduce targeted genetic modifications to polynucleotides of interest that are not located on the Y chromosome.

B. Means for Cultivating Pluripotent and/or Totipotent XY Cells Having a Modification that Reduces the Level and/or Activity of a Sry Protein

[0072] The culture media employed in the various methods and compositions that promote fertile XY females in the F0 generation maintain pluripotent and/or totipotent cells (i.e., ES cells, iPS cells, XY ES cells, XY iPS cells, etc.). The terms "maintain", "maintaining" and "maintenance" refer to the stable preservation of at least one or more of the characteristics or phenotypes of pluripotent and/or totipotent cells described in the present invention (including ES cells or iPS cells) . These phenotypes may include the maintenance of pluripotency and/or totipotency, cellular morphology, gene expression profiles and other functional characteristics of the cells. The terms "maintain", "maintaining" and "maintenance" may also encompass cell propagation or an increase in the number of cells being cultured. The terms further contemplate culture conditions that allow cells to remain pluripotent, while cells may or may not continue to divide and increase in number.

[0073] In some embodiments, XY cells having the genetic modification that reduces the level and/or activity of the Sry protein are maintained by culturing in any base medium known in the art (e.g., DMEM) that is suitable for use ( with addition of complements) to cultivate or maintain pluripotent and/or totipotent cells (i.e., ES cells, iPS cells, XY ES cells, XY iPS cells, etc.) in culture. In such cases, cultured XY ES cells have the potential to develop fertile female animals, but still maintain pluripotency and/or totipotency, so that the cells can be implemented into a recipient embryo and give rise to fertile female progeny. .

[0074] In other embodiments, XY cells having genetic modification that reduces the level and/or activity of the Sry protein are maintained by culturing in a medium, as defined below, for a time sufficient for some cells to convert to XY cells with the potential to develop into fertile female animals, but still maintaining pluripotency and/or totipotency, so that the cells can be implemented into a recipient embryo and give rise to fertile female progeny.

[0075] The medium employed to maintain pluripotent and/or totipotent XY cells (i.e., XY ES cells, XY iPS cells, etc.), having genetic modification that reduces the level and/or activity of the Sry protein promotes development of fertile XY females in F0. Thus, cultivation in this culture medium increases the number of fertile XY females in F0 obtained compared to cultivation in a suitable control medium (such as, for example, a DMEM-based medium). Thus, a greater number of fertile XY females in F0 can comprise at least 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of non-human animals at F0 (after introduction of XY non-human animal ES cells into a host embryo and gestation of the host embryo) are XY females and that, upon reaching sexual maturity, the Female non-human animal XY at F0 is fertile.

[0076] The phrase "base medium" or "base media" includes, for example, a base medium known in the art (e.g., DMEM) that is suitable for use (with addition of complements) in cultivation and/or maintenance of pluripotent and/or totipotent cells (i.e., ES cells, iPS cells, XY ES cells, XY iPS cells, etc.) in culture. Suitable background media for producing a fertile female For purposes of discussing base media in general, base media that are not suitable for producing fertile XY females are described in this section as "DMEM" and in Table 1 (e.g., typical DMEM media). For the purpose of discussing suitable base media for the production of fertile XY females, the terms "low salt DMEM" or "low osmolality DMEM" are used. The differences between stock media typically used to maintain pluripotent and/or totipotent cells in culture (e.g., DMEM) and stock media suitable for producing fertile XY females (e.g., "low-salt DMEM") are articulated in the present invention. The phrase "low-salt DMEM" is used for convenience; DMEM suitable for producing fertile XY females has characteristics that are not limited to "low salt" but include those described herein. For example, the DMEM shown in Table 1 may be suitable for producing fertile XY females by changing the concentrations of sodium chloride and/or sodium bicarbonate as set forth in the present invention, which will also result in a different osmolality and a different conductivity compared to DMEM shown in Table 1. An example of base media is Dulbeco's Modified Eagle's Medium (DMEM), in various forms (e.g., DMEM Invitrogen, Cat. No. 1 1971 - 025) (Table 1). A suitable low-salt DMEM is commercially available as KO-DMEM™ (Invitrogen Cat. No. 10829-018). The base medium is typically supplemented with an amount of supplements known in the art when used to maintain cells in culture for use as donor cells. Such supplements are indicated as "supplements" or "+ supplements" in this description. Table 1: DMEM-Based Media for Maintaining or Cultivating Pluripotent and/or Totipotent Cells

[0077] The term "supplements" or the phrase "+ supplements," includes elements added to the base medium to cultivate or maintain pluripotent and/or totipotent cells (i.e., XY ES cells or XY iPS cells) in culture, e.g. for example, to maintain the pluripotency or totipotency of donor cells in culture. For example, supplemental media suitable for the growth or maintenance of pluripotent and/or totipotent cells in culture include, but are not limited to, fetal bovine serum (FBS), glutamine, antibiotic(s), penicillin and streptomycin (e.g., penstrep), pyruvate salts (e.g., sodium pyruvate), non-essential amino acids (e.g., MEM NEAA), 2-mercaptoethanol, and Leukemia Inhibitory Factor (LIF).

[0078] In one embodiment, the base medium comprises one or more supplements suitable for maintaining pluripotent cells in culture, including, for example, ES or XY cells or iPS XY cells that have a reduced ability to contribute to the developmental program for male sex determination after injection into an embryo and intrauterine transfer to a surrogate mouse mother.

[0079] In a specific embodiment, the one or more supplements suitable for maintaining the pluripotent cell in culture are FBS (90 ml of FBS/0.5 l of base medium), glutamine (2.4 mmol/0.5 l of base medium), sodium pyruvate (0.6 mmol/0.5 l of base medium), non-essential amino acids (<0.1 mmol/0.5 l of base medium), 2-mercaptoethanol, LIF , and one or more antibiotics.

[0080] In other embodiments, the means for maintaining pluripotent cells in culture, including, for example, XY ES cells or XY iPS cells that have a reduced ability to contribute to the developmental program for male sex determination after injection in an embryo and intrauterine transfer to a surrogate mouse mother, comprise about 500 ml of base medium to which the following supplements are added: about 90 ml of FBS (e.g. FBS Hylcone Cat. No. SH30070.03), about 2.4 millimoles of glutamine (e.g., about 12 ml of a 200 mM glutamine solution, e.g., Invitrogen, Cat. No. 25030-081, penicillin:streptomycin (e.g., 60,000 units of Penicillin G sodium and 60 mg of streptomycin sulfate, with about 51 mg of NaCl; for example, about 6 ml, of pennstrep Invitrogen, Cat. No. 15140-122), about 0.6 millimoles of sodium pyruvate (e.g. , 6 ml of 100 mM sodium pyruvate, Invitrogen, Cat. No. 1 1360-070), about 0.06 millimoles of non-essential amino acids (e.g., about 6 ml of MEM NEAA, e.g., MEM NEAA from Invitrogen Cat. No. 1 1 140-050), about 1.2 ml. 2-mercaptoethanol, and about 1.2 micrograms of LIF (e.g., about 120 microliters of a 106 units/ml LIF preparation; e.g., about 120 microliters of Millipore ESGRO™-LIF, Cat. No. ESG1 107). When composing a base medium to maintain XY ES or iPS XY cells to produce fertile XY females, typically the same supplements in approximately the same amounts are employed, but the composition of the base medium will be different (from DMEM, for example, from described in the table above) and the difference(s) correspond to the difference(s) taught here.

[0081] In some embodiments, the supplements include Wnt-conditioned media, for example, Wnt-3a-conditioned media.

[0082] In one embodiment, the pluripotent cell, including, for example, an XY ES cell or an XY iPS cell having a reduced ability to contribute to the developmental program for male sex determination following injection into an embryo and intrauterine transfer for a surrogate mouse mother, is maintained in an in vitro culture in a medium comprising base medium and supplements, the base medium having one or more of the following characteristics: (a) an osmolality of about 200 mOsm/kg a less than about 329 mOsm/kg; (b) a conductivity of about 11 mS/cm to about 13 mS/cm; (c) a salt of an alkali metal and a halide in a concentration of about 50 mM to about 110 mM; (d) a carbonic acid salt concentration of about 17 mM to about 30 mM; (e) a total concentration of alkali metal halide salt and carbonic acid salt of about 85 mM to about 130 mM; and/or (f) a combination of any two or more thereof. In other embodiments, XY and/or totipotent pluripotent cells (i.e., XY ES cells or XY iPS cells) are maintained in an in vitro culture in a medium as described in WO2011/156723, incorporated herein by reference in its entirety.

[0083] In one embodiment, the base medium is a low-salt DMEM. In a specific embodiment, the low-salt DMEM has a NaCl concentration of 85 to 130 mM. In one embodiment, the base medium is a low osmolality DMEM. In a specific embodiment, the low osmolality DMEM has an osmolality of 250 to 310 mOsm/kg. In one embodiment, the base medium is a low conductivity DMEM. In a specific embodiment, the low conductivity DMEM has a conductivity of 11 to 13 mS/cm.

[0084] In other embodiments, the base medium has an osmolality of no more than about 320, 310, 300, 290, 280, 275, 270, 260, 250 or 240 mOsm/kg. In one embodiment, the base medium or the medium comprising the base medium and supplements has an osmolality of no more than about 240 to 320, 250 to 310, 275 to 295, 260 to 300 mOsm/kg. In a specific embodiment, the base medium or the medium comprising the base medium and supplements has an osmolality of about 270 mOsm/kg.

[0085] In other embodiments, the base medium has a conductivity of no more than about 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13, 5, or 14.0 mS/cm. In one embodiment, the base medium has a conductivity of no more than about 10 to 14 mS/cm or 11 to 13 mS/cm. In a specific embodiment, the base medium has a conductivity of about 12 to 13 mS/cm.

[0086] In a specific embodiment, the base medium has a conductivity of about 12 to 13 mS/cm and an osmolality of about 260 to 300 mOsm/kg. In another specific embodiment, the base medium comprises sodium chloride at a concentration of about 90 mM NaCl. In another specific embodiment, the concentration of sodium chloride is about 70 to 95 mM. In another specific embodiment, the base medium comprises sodium bicarbonate in a concentration of less than about 35 mM. In another specific embodiment, the concentration of sodium bicarbonate is about 20 to 30 mM.

[0087] In one embodiment, the base medium has a concentration of an alkali metal salt and a halide of no more than about 100 mM. In one embodiment, the alkali metal halide salt is NaCl. In one embodiment, the concentration of the alkali metal salt and halide is not greater than 90, 80, 70, 60, or 50 mM. In one embodiment, the concentration in the base medium of the alkali metal salt and halide is about 60 to 105, 70 to 95, or 80 to 90 mM. In a specific embodiment, the concentration is about 85 mM.

[0088] In one embodiment, the base medium has a concentration of a carbonic acid salt. In one embodiment, the carbonic acid salt is a sodium salt. In one embodiment, the sodium salt is sodium bicarbonate. In one embodiment, the concentration of carbonic acid salt in the base medium is not greater than 40, 35, 30, 25, or 20 mM. In one embodiment, the concentration of carbonic acid salt in the base medium is about 10 to 40, in another embodiment, it is about 20 to 30 mM. In a specific embodiment, the concentration is about 25 or 26 mM. In still other embodiments, the concentration of sodium bicarbonate is from about 26 mM, from about 18 mM, from about 18 mM to about 26 mM, or from about 18 mM to about 44 mM.

[0089] In one embodiment, the sum of the concentration of the alkali metal salt and halide and the carbonic acid salt in the base medium is no more than 140, 130, 120, 110, 100, 90, or 80 mM. In one embodiment, the sum of the concentration of the alkali metal and halide salt and the carbonic acid salt in the base medium is about 80 to 140, 85 to 130, 90 to 120, 95 to 120, or 100 to 120 mm. In a specific embodiment, the sum of the concentration of the alkali metal salt and halide and the carbonic acid salt in the base medium is about 115 mM.

[0090] In one embodiment, the molar ratio between the alkali metal and halide salt and the carbonic acid salt is greater than 2.5. In one embodiment, the ratio is about 2.6-4.0, 2.8-3.8, 3-3.6, or 3.2-3.4. In one embodiment, the ratio is 3.3-3.5. In a specific modality, the ratio is 3.4.

[0091] In one embodiment, the base medium has an osmolality of about 250 to 310 mOsm/kg, and a concentration of an alkali metal salt and a halide of about 60 to 105 mM. In another embodiment, the base medium has a concentration of a carbonic acid salt of about 20 to 30 mM. In another embodiment, the sum of the concentrations of the alkali metal salt and halide and the carbonic acid salt is about 80 to 140 mM. In another embodiment, the conductivity of the base medium is about 12 to 13 mS/cm.

[0092] In one embodiment, the base medium comprises about 50 ± 5 mM NaCl and about 26 ± 5 mM carbonate, with an osmolality of about 218 ± 22 mOsm/kg. In a specific embodiment, the base medium comprises about 3 mg/ml NaCl and 2.2 mg/ml sodium bicarbonate, with an osmolality of about 218 mOsm/kg.

[0093] In another embodiment, the base medium comprises about 87 ± 5 mM NaCl and about 18 ± 5 mM, with an osmolality of about 261 ± 26 mOsm/kg. In a specific embodiment, the base medium comprises about 5.1 mg/ml NaCl and about 1.5 mg/ml sodium bicarbonate, with an osmolality of about 261 mOsm/kg.

[0094] In another embodiment, the base medium comprises about 110 ± 5 mM NaCl and about 18 ± 5 mM carbonate, with an osmolality of about 294 ± 29 mOsm/kg. In a specific embodiment, the base medium comprises about 6.4 mg/ml NaCl and about 1.5 mg/ml sodium bicarbonate, with an osmolality of about 294 mOsm/kg.

[0095] In another embodiment, the base medium has about 87 ± 5 mM NaCl and about 26 ± 5 mM carbonate, with an osmolality of about 270 ± 27 mOsm/kg. In a specific embodiment, the base medium has about 5.1 mg/ml of NaCl and 2.2 mg/ml of sodium bicarbonate, with an osmolality of about 270 mOsm/kg.

[0096] In another embodiment, the base medium comprises about 87 ± 5 mM NaCl, about 26 ± 5 mM carbonate and about 86 ± 5 mM glucose, with an osmolality of about 322 ± 32 mOsm /kg. In a specific embodiment, the base medium comprises about 5.1 mg/ml NaCl, about 2.2 mg/ml sodium bicarbonate, and about 15.5 mg/ml glucose, with an osmolality of about of 322 mOsm/kg.

[0097] Additional base media that can be employed in the various methods and compositions described herein include a base medium comprising 50 ± 5 mM NaCl and 26 ± 5 mM carbonate, with an osmolality of 218 ± 22 mOsm/kg. In a particular embodiment, the base medium comprises about 3 mg/ml NaCl and 2.2 mg/ml sodium bicarbonate, with an osmolality of about 218 mOsm/kg.

[0098] In other embodiments, the base medium comprises 50 ± 5 mM NaCl and 26 ± 5 mM carbonate, with an osmolality of 218 ± 22 mOsm/kg. In a specific embodiment, the base medium comprises about 3 mg/ml NaCl and 2.2 mg/ml sodium bicarbonate, with an osmolality of about 218 mOsm/kg.

[0099] In other embodiments, high glucose DMEM media (LifeTech) with NaHCO3 concentrations as disclosed herein, including about 44 mM, 26 mM or 18 mM, were supplemented with 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, 0.1 mM 2-mercaptoethanol, 2 mM L-glutamine, 50 ug/ml each of penicillin and streptomycin (LifeTech), 15% FBS (Hyclone), and 2,000 U/ml LIF (Millipore).

C. Method for Producing Targeted Genetic Modifications

[00100] Various methods for producing targeted genetic modifications that reduce the level and/or activity of the Sry protein can be used. For example, in one case, the targeted genetic modification employs a system that will generate a targeted genetic modification through a homologous recombination event. In other cases, the animal cell may be modified with the use of nuclease agents that generate a single-strand or double-strand break at a targeted genomic locus. The single-strand or double-strand break is then repaired by the non-homologous end joining pathway (NHEJ). These systems can be used, for example, in the generation of target genetic modifications with loss of function. Non-limiting methods for generating such targeted genetic modification are discussed in detail elsewhere in this document, including, for example, the use of target plasmids, small targeting vectors (smallTVECs) or large targeting vectors. See also Wang et al. (2013) Cell 153:910 to 918, Mandalos et al. (2012) PLOS ONE 7:e45768:1 to 9, and Wang et al. (2013) Nat Biotechnol. 31:530 to 532, each of which is incorporated herein by reference.

[00101] It is recognized that, in specific embodiments, target genetic modification of the Sry gene and/or target genetic modification of any other polynucleotide of interest may occur while the pluripotent cell (e.g., the ES cell) is being maintained in the media culture described herein (i.e., a medium that promotes the development of fertile XY females in F0). Alternatively, targeted genetic modification of the Sry gene and/or any other polynucleotide of interest may occur while the pluripotent cell (e.g., ES cell) is being maintained in different culture media, and is subsequently transferred to the disclosed culture media. in the present invention (e.g., a means that promotes the development of fertile XY females in F0).

D. Method for Cultivating and Maintaining a Pluripotent and/or Totipotent Cell in Culture

[00102] A method is provided for maintaining or cultivating a pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) in an in vitro culture, wherein the cell comprises a modification that decreases the level and/or the activity of a Sry protein and the cell is maintained in an in vitro culture under the conditions described in the present invention. These methods for maintaining or cultivating a pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) in an in vitro culture promote an increase in the number of fertile females of XY animals in F0 by introducing the XY non-human animal ES cells in a host embryo and after gestation of the host embryos.

[00103] Although any media disclosed in the present invention may be employed for these maintenance or cultivation methods, a non-limiting example includes cultivation in a medium comprising a base medium and supplements suitable for maintaining or cultivating the pluripotent and/or XY cell. totipotent (e.g., an XY ES cell or an XY iPS cell) in culture, wherein the base medium or the medium comprising the base medium and supplements has an osmolality of about 200 mOsm/kg to less than about 329 mOsm/kg.

[00104] In some embodiments, the base medium or the medium comprising the base medium and supplements has one or more of the following characteristics: a conductivity of about 11 mS/cm to about 13 mS/cm; a salt of an alkali metal and a halide in a concentration of about 50 mM to about 110 mM; a carbonic acid salt concentration of about 17 mM to about 30 mM; a total concentration of alkali metal halide salt and carbonic acid salt of about 85 mM to about 130 mM; and/or a combination of any two or more thereof.

[00105] In one embodiment, the method comprises maintaining or culturing the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) in a suitable culture medium comprising a base medium and supplements, wherein the base medium or the medium comprising the base medium and the supplements comprises an osmolality of about 240 to 320 mOsm/kg, a conductivity of about 10 to 14 mS/cm, a halide salt concentration alkali metal salt concentration of about 50 to 105 mM, a carbonic acid salt concentration of 10 to 40 mM, and/or a combined alkali metal salt and carbonic acid salt concentration of about 80 to 140 mM. In one embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained in the medium (with supplements to maintain the ES cells) for a period of 1, 2, 3, 4 , 5, 6, 7, 8, 9, 10, 11, 12 or 13 days, or 2 weeks, 3 weeks or 4 weeks before introduction into a host embryo. In a specific embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained in medium (low-salt base medium with supplements to maintain the ES cells) for about 2 to 4 weeks before introduction into the host embryo.

[00106] In another embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained in a medium with a low-salt base medium for at least 1. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 days, 2 weeks, 3 weeks or 4 weeks before the introduction of the donor cell into a host embryo. In a specific embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained in a medium with a low-salt base medium for at least 2 to 4 weeks before introduction of the cell into the host embryo.

[00107] In another embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained (e.g., frozen) in a medium that promotes fertile XY females at F0 and the donor cell is thawed and maintained in medium that promotes fertile XY females in F0 for at least 1, 2, 3, or 4 or more days before introduction of a pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an iPS XY cell) in the host embryo. In a specific embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) passes at least once through a medium that promotes fertile XY females in F0, the cell is frozen in the medium that promotes fertile XY females at F0, and the cell is thawed in a medium that promotes fertile XY females at F0 and grown for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days, 2 weeks, 3 weeks, 4 weeks, or more before introduction into the host embryo.

[00108] In yet another embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained in the medium that promotes fertile XY females in F0 for a period of one, two, three or four days before introduction into a host embryo. In one embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained in the medium that promotes fertile XY females in F0 for a period of 3 days.

[00109] In one embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained in the medium that promotes fertile XY females at F0 prior to introduction into the host embryo for about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 days, 2 weeks, 3 weeks, or 4 weeks or more. In a specific embodiment, the donor cell is maintained in the medium that promotes fertile XY females in F0 for at least one week before introduction into the host embryo. In a specific embodiment, the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is maintained in the medium that promotes fertile XY females in F0 for 2 to 4 weeks before introduction into the host embryo.

[00110] Thus, a method is provided for maintaining or cultivating a pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) in culture, wherein the cell is maintained under conditions that promote or favor the development of a female XY animal after introduction of the XY cell into a host embryo and after gestation in a suitable female host.

[00111] In one aspect, a method is provided for maintaining or cultivating a donor pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) in culture, under conditions as described in the present invention, wherein, upon introduction of the donor ES XY cell into a host embryo to form an F0 embryo and gestation of the F0 embryo in a suitable animal, the F0 embryo develops into an F0 animal that is at least 70%, 75% , 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more XY and is a female that, upon reaching sexual maturity , is fertile.

E. Generation of F0 Embryos and F1 Progeny Having a Targeted Genetic Modification

[00112] The various methods and compositions employing the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) having decreased level and/or activity of Sry protein provided herein can be used to generate a genetically modified animal. Various methods for introducing genetic modifications are discussed in detail elsewhere in this document.

i. Method for Producing a Fertile Female of Non-Human Animal XY in an F0 Generation

[00113] A method is provided for producing a fertile female non-human mammal XY in an F0 generation. These methods comprise: (a) maintaining or culturing a pluripotent and/or totipotent XY cell from a non-human animal donor (e.g., an XY ES cell or an XY iPS cell) having a modification that decreases the level and/or activity of a Sry protein in a medium that promotes the development of ES cells from fertile XY females; (b) introducing the pluripotent and/or totipotent XY cell from a non-human animal donor (e.g., an XY ES cell or an XY iPS cell) into a host embryo; (d) gestation of the host embryo; and (d) obtain a female non-human animal XY in F0, whereby, upon reaching sexual maturity, the female non-human animal XY in F0 is fertile. In specific embodiments, the XY non-human animal donor cell may comprise at least one additional target genetic modification in a polynucleotide of interest. Such modifications are discussed in detail elsewhere in this document.

[00114] XY ES cells having a modification that decreases the level and/or activity of a Sry protein can be maintained without a low-salt medium and can develop into a fertile XY female.

[00115] In some embodiments, the medium that promotes the development of fertile females of XY animals in F0 may comprise a low-salt base medium comprising a base medium and supplements suitable for maintaining or cultivating the mammalian ES cell. non-human in culture, wherein the low-salt base medium has one or more of the following characteristics: an osmolality of about 200 mOsm/kg less than about 329 mOsm/kg; a conductivity of about 11 mS/cm to about 13 mS/cm; a salt of an alkali metal and a halide in a concentration of about 50 mM to about 110 mM; a carbonic acid salt concentration of about 17 mM to about 30 mM; a total concentration of alkali metal halide salt and carbonic acid salt of about 85 mM to about 130 mM; and/or a combination of any two or more thereof.

[00116] In other embodiments, these methods for producing a fertile female non-human animal XY in an F0 generation can be carried out using the media disclosed in the present invention including, but not limited to, (a) a base medium comprising 50 ± 5 mM NaCl, 26 ± 5 mM carbonate and 218 ± 22 mOsm/kg; (b) a base medium comprising about 3 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 218 mOsm/kg. (c) a base medium comprising 87 ± 5 mM NaCl, 18 ± 5 mM carbonate and 261 ± 26 mOsm/kg. (d) a base medium comprising about 5.1 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 261 mOsm/kg. (e) a base medium comprising 110 ± 5 mM NaCl, 18 ± 5 mM carbonate and 294 ± 29 mOsm/kg. (f) a base medium comprising about 6.4 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 294 mOsm/kg. (g) a base medium comprising 87 ± 5 mM NaCl, 26 ± 5 mM carbonate and 270 ± 27 mOsm/kg. (h) a base medium comprising about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 270 mOsm/kg. (i) a base medium comprising 87 ± 5 mM NaCl, 26 ± 5 mM carbonate, 86 ± 5 mM glucose and 322 ± 32 mOsm/kg. and/or (j) a base medium comprising about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate, 15.5 mg/ml glucose and 322 mOsm/kg.

[00117] The pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) having a modification that decreases the level and/or activity of a Sry protein and having been cultured in the medium that promotes the development of fertile females XY in F0 can be implanted into a host embryo. Cells that have been implanted into a host embryo are herein referred to as "donor cells." In specific embodiments, the genetically modified pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) is of the same lineage as the host embryo or of a different lineage than the host embryo. Likewise, the substituent may come from the same lineage as the genetically engineered pluripotent and/or totipotent XY cell (i.e., XY ES cells or an XY iPS cell) and/or the host embryo, or the substituent may come from a different lineage in relation to the genetically modified pluripotent and/or totipotent XY cell (i.e., an XY ES cell or an XY iPS cell) and/or the host embryo. In one embodiment, the donor XY cell is implanted into an XX host embryo.

[00118] Various host embryos can be used in the methods and compositions disclosed herein. In some embodiments, pluripotent and/or totipotent XY cells (e.g., the XY ES cell or the XY iPS cell) having the target genetic modification that results in a decreased level and/or activity of the Sry protein are introduced into an embryo at premorula stage originating from a corresponding organism, for example, an 8-cell stage embryo. See, for example, US 7,576,259, US 7,659,442, US 7,294,754, and US 2008-0078000 A1, all of which are incorporated herein by reference in their entireties. In other embodiments, donor ES cells can be implanted into a host embryo at the 2-cell stage, 4-cell stage, 8-cell stage, 6-cell stage, 32-cell stage, or 64-cell stage of the host embryo. . In another embodiment, the host embryo is a blastocyst. In one embodiment, the host embryo is at a stage selected from a pre-blastocyst embryo, a pre-morula stage, a morula stage, a non-compacted morula stage, and a compacted morula stage. In one embodiment, when employing a mouse embryo, the host embryo stage is selected from a Theiler Stage 1 (TS1), a TS2, a TS3, a TS4, a TS5 and a TS6, with reference to the Theiler stages described in Theiler (1989) "The House Mouse: Atlas of Mouse Development," Springer-Verlag, New York. In a specific modality, the Theiler Stage is selected between TS1, TS2, TS3 and a TS4. In one embodiment, the host embryo comprises a zona pellucida, and the donor cell is an ES XY cell that is introduced into the host embryo through a hole in the zona pellucida, whereas, in other embodiments, the host embryo is a no zone. In still other specific embodiments, the host embryo at the morula stage is aggregated.

[00119] Nuclear transfer techniques can also be used to generate genetically modified animals. In summary, nuclear transfer methods include the steps of: (1) enucleating an oocyte; (2) isolating a donor cell or nucleus to be combined with the enucleated oocyte; (3) inserting the cell or nucleus into the enucleated oocyte to form a reconstituted cell; (4) implant the reconstituted cell into the uterus of an animal to form an embryo; and (5) allow the embryo to develop. In these methods, oocytes are generally recovered from dead animals, although they can also be isolated from oviducts and/or ovaries of living animals. Oocytes may be matured in various media known to those skilled in the art prior to enucleation. Oocyte enucleation can be carried out in several ways well known to those skilled in the art. Insertion of the donor cell or nucleus into the enucleated oocyte to form a reconstituted cell usually occurs by microinjection of a donor cell beneath the zona pellucida prior to fusion. Fusion can be induced by applying a DC electrical pulse across the contact/fusion plane (electrofusion), by exposing cells to fusion-promoting chemicals such as polyethylene glycol, or by means of an inactivated virus, e.g. the Sendai virus. A reconstituted cell is typically activated by electrical and/or non-electrical means before, during and/or after fusion of the nuclear donor and recipient oocyte. Methods of activation include electrical pulses, chemically induced shock, sperm penetration, increasing levels of divalent cations in the oocyte, and reduced phosphorylation of cellular proteins (such as through kinase inhibitors) in the oocyte. Activated reconstituted cells, or embryos, are typically cultured in a medium well known to those skilled in the art and then transferred to the uterus of an animal. See, for example, US20080092249, WO/1999/005266A2, US20040177390, WO/2008/017234A1, and US Patent No. 7,612,250, each of which is incorporated herein by reference.

[00120] The host embryo comprising the pluripotent and/or totipotent XY cell (e.g., an XY ES cell or an XY iPS cell) genetically modified and having decreased level and/or activity of the Sry protein is incubated until the blastocyst stage and , then implanted into a substituent to produce an F0 animal. Animals that possess the genetically modified genomic locus can be identified by the modification of allele assay (MOA) as described in the present invention.

[00121] In one embodiment, the host embryo comprising pluripotent and/or totipotent XY cells (e.g., an XY ES cell or an XY iPS cell) and having decreased level and/or activity of the Sry protein is maintained in a medium that promotes the development of fertile female ES XY cells (i.e., a low-salt base medium) for one, two, three, or four or more days prior to implantation into a suitable host. Such methods favor the generation of a fertile female animal in F0.

[00122] In one embodiment, the cultured host embryo is implanted into a substituent and the cultured host embryo is gestated in the substituent.

[00123] In specific embodiments, after the introduction of pluripotent and/or totipotent XY cells (for example, an XY ES cell or an XY iPS cell) from a non-human animal into a host embryo and after gestation of the host embryo, at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80% 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of non-human animals in F0 are XY females which, upon reaching sexual maturity, the female non-human mammal XY in F0 is fertile.

[00124] There is also provided an F0 embryo comprising an inner cell mass having at least one heterologous stem cell comprising an XY ES cell or an XY iPS cell having a target genetic modification that decreases the level and/or activity of the Sry protein. .

[00125] The various methods described in the present invention for generating a fertile female non-human animal XY in an F0 generation can employ pluripotent and/or totipotent XY cells (for example, an XY ES cell or an XY iPS cell) having (1 ) genetic modification to reduce the level and/or activity of the Sry polypeptide; and, in specific embodiments, (2) one or more additional target genetic modifications in a polynucleotide of interest. As described elsewhere herein, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more additional target genetic modifications can be carried out in a pluripotent and/or totipotent XY cell (e.g. example, an ES XY cell or an iPS XY cell). In such cases, the fertile female of non-human animal XY in F0 may comprise one or more of these additional target genetic modifications.

[00126] In other embodiments, the fertile female of non-human animal XY in F0 produces 1, 2, 3, 4, 5, 6, 7, 8, or 9 litters during her life cycle. In one embodiment, the fertile female of non-human animal XY in F0 produces at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 offspring per litter. In one embodiment, the fertile female of non-human animal XY in F0 produces about 4 to 6 offspring per litter. In one embodiment, the fertile female of non-human animal XY in F0 produces 2 to 6 litters, wherein each litter has at least 2, 3, 4, 5, or 6 offspring. In one embodiment, at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% of the offspring are fertile XY female offspring.

[00127] A method for generating a rodent litter (e.g., a mouse or rat litter) is also provided and comprises introducing a donor pluripotent and/or totipotent XY cell (e.g., a donor XY ES cell or a donor iPS at least one female XY rodent who, upon reaching sexual maturity, is a fertile female XY rodent. In one embodiment, the percentage of XY rodent females in F0 born that, upon reaching sexual maturity, are fertile is about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45 %, 50%, 60%, 70%, 75%, 80%, 85%, 95% or 100%.

[00128] In other embodiments, the F0 progeny produced from these methods is about 3%, about 10% or more, or about 63% or more, derived from the genetically modified donor XY cell.

[00129] The methods and compositions provided in the present invention allow at least 1%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% , 55%, 60%, 65%, 70%, 75% or more of the F0 animals have the target genetic modification (i.e., the reduction in the level and/or activity of the Sry protein and/or the target genetic modification to a polynucleotide of interest) to transmit the genetic modification to the F1 progeny.

[00130] In one embodiment, the female of non-human animal XY in the F0 generation and/or the male of non-human animal XY is at least 90%, 92%, 94%, 96%, 98%, 99%, or 99 .8% derived from donor cell. In one embodiment, the female non-human animal XY in F0 and/or the male non-human animal XY in F0 has a skin color that is 100% derived from the donor cell.

[00131] In one embodiment, the female non-human animal XY in the F0 generation is a rodent (e.g. a mouse or a rat) and has a skin color 100% derived from the donor cell. In one embodiment, the non-human animal female XY formed in the F0 generation is at least 90%, 92%, 94%, 96%, 98%, or 99.8% derived from the donor XY cell. In one embodiment, the non-human animal female XY in the F0 generation is about 100% derived from the donor cell. In one embodiment, the contribution of a host embryo cell to the non-human animal female XY in the F0 generation is determined by a quantitative assay capable of detecting 1 cell in 2,000 (0.05%) and, in tissue from the female animal XY, is positive for contribution from the host embryo cell.

ii. Various Methods of Breeding Fertile Female of XY in F0 Generation

[00132] In specific embodiments, the resulting fertile female XY in F0 generation is derived from pluripotent and/or totipotent XY cells (e.g., the XY ES cell or the XY iPS cell) having the genetic modification that decreases the level and/or the Sry protein activity is crossed with an animal to obtain the offspring in F1 generation. In specific embodiments, the fertile female XY in F0 is crossed with a wild-type animal. In one embodiment, the female non-human mammal XY at F0 is fertile when crossed to a wild-type mouse. In specific embodiments, the wild-type mouse is C57BL/6. F1 progeny can be genotyped using specific primers and/or probes to determine whether the target genetic modification comprising decreased level and/or activity of the Sry protein is present. Furthermore, if additional target genetic modifications are present in the F0 generation, the F1 progeny can be genotyped using specific primers and/or probes that determine whether these modifications are present. A suitable F1 progeny for a desired use can then be identified. In specific embodiments, F1 progeny are selected without the genetic modification that reduced the level and/or activity of the Sry protein. In other embodiments, F1 progeny are selected without the genetic modification that decreased the level and/or activity of the Sry protein and that comprise at least one additional target genetic modification.

[00133] In a non-limiting example, after genotyping with specific primers and/or probes, F1 animals that are heterozygous for the target genetic modification for the polynucleotide of interest and that do not possess the target modification that reduces the level of e/ or the activity of the Sry protein are crossed with each other. This cross produces F2 progeny that are homozygous for the genetically modified genomic locus of interest and do not comprise genetic modification to reduce Sry protein levels and/or activity.

[00134] A method is further provided for producing a transgenic non-human animal homozygote for a target genetic modification in the F1 generation. The method comprises (a) crossing a fertile female of non-human animal XY at F0 having a target genetic modification that decreases the level and/or activity of the Sry protein with a male of non-human animal of non-human animal on the polynucleotide of interest. In a specific embodiment, the selected F1 progeny are homozygous for the target genetic modification in the polynucleotide of interest and do not possess the target genetic modification that decreases the activity and/or level of the Sry protein. These methods can be employed to develop breeding pairs of non-human animals, each entirely derived from a donor ES cell or iPS cell, in the same F0 generation.

[00135] Several methods can be used to obtain the F0 animals described above. In a non-limiting embodiment, an XY cell clone with a target modification in a polynucleotide of interest on any chromosome is isolated. It is recognized that several methods can be used to generate the target modification on the polynucleotide of interest. In a second step, a target modification is introduced into the Sry gene such that the modification decreases the level and/or activity of the Sry protein. Such methods also employ the cultivation of the XY ES cell in a medium that promotes the development of fertile XY females in F0, as described in detail elsewhere in this document. Methods of target modification of the Sry gene are disclosed in detail elsewhere herein and may comprise, for example, the use of a targeting vector (including an LTVEC) either alone or in combination with a nuclease, as described elsewhere. location in this document (i.e., a Talen or CRISPR or ZFN system). A subclone is isolated, which comprises both the first target modification on the polynucleotide of interest and the second target modification of the Sry gene that decreases the level and/or activity of the Sry protein. Both the original XY clone, with the target modification to the polynucleotide of interest, and the XY subclone, comprising both the target modification to the Sry gene and the polynucleotide of interest, are introduced into separate non-human host embryos, as discussed elsewhere. location in this document. In specific embodiments, the non-human host embryos comprise a premorula embryo (i.e., an 8-cell stage embryo). Each of the non-human host embryos comprising the modified pluripotent cells is introduced into a gestation surrogate. Each of the substituents produces F0 progeny comprising the target genomic modification (e.g., an XY male in F0 having the target modification in the polynucleotide of interest, and a fertile female XY in F0 having the target modification in the polynucleotide of interest and having the genetic modification that decreases the level and/or activity of the Sry protein). In specific embodiments, each of the targeted genomic modifications can be transmitted through the germline. These F0 animals reproduce with each other to generate an F1 animal comprising a homozygous target modification in the polynucleotide of interest. One-quarter of the F1 generation is expected to be homozygous for the target modification in the polynucleotide of interest. F1 progeny can be selected to maintain the target modification for the Sry gene or F1 progeny can be selected not to maintain the target modification for the Sry gene.

[00136] In another embodiment, the introduction of the target modification of the Sry gene that employs a targeting vector (and, in specific embodiments, nucleases such as Talen, Crispr, or Zfn) can occur simultaneously with the targeting of the vector for the modification genetics of the polynucleotide of interest. Such methods allow the generation of an XY ES cell having both a genetic modification that decreases the level and/or activity of the Sry protein and the target modification for the polynucleotide of interest.

[00137] In one embodiment, the F1 generation progeny comprises a genome completely derived from the donor ES cell. In other embodiments, the frequency of crossings of males in the F0 generation and females in the F0 generation of mice that result in fully ES cell-derived mice is 100%.

II. Methods and Compositions for Modifying a Challenge Genomic Target Locus or a Genomic Target Locus on the Y Chromosome

[00138] Methods and compositions are provided that allow modification of a genomic target locus on the Y chromosome in a cell. Methods are also provided that allow modification of a "challenge" genomic locus. The term "challenge locus" includes a chromosomal region that is difficult to target by conventional gene targeting strategies. These loci can be located on the Y chromosome, the X chromosome, or an autosome. In certain embodiments, the challenge loci are located in or in the vicinity of gene-poor, repeat-rich and/or broadly heterochromatic chromosomal regions. See, for example, Bernardini et al., Proc. Natl. Academic. Sci. USA 111:7600-7605 (2014), incorporated herein by reference, in its entirety for all purposes. In certain embodiments, a challenge locus is located in or in the vicinity of chromosomal regions in which the accessibility of chromosomal DNA is limited by the chromatin structure. In certain embodiments, a challenge locus is within or in the vicinity of chromosomal regions characterized by a high percentage of heterochromatin, e.g., at least about ~20%, at least about ~30%, at least about 40%, at least about 50%, at least about 60%, or at least about 70% heterochromatin. In certain embodiments, a challenge locus is located in or in the vicinity of chromosomal regions that have undergone duplications and rearrangements or that are characterized by the presence of repeats or inverted repeats. See, for example, Gubbay et al., Proc. Natl. Academic. Sci. USA 89:7953 to 7957 (1992), incorporated herein by reference, in its entirety for all purposes.

[00139] The term "chromatin" includes nucleoprotein complexes that compact and organize cellular genetic material to contain it within cells. The term "heterochromatin" includes regions in the genome that are in a highly condensed state and that are, in general, transcriptionally silent. Heterochromatin is, in general, more tightly coiled and generally has more repetitive DNA sequences than euchromatin. The term "euchromatin" includes regions in the genome characterized by more extended and less condensed chromatin domains that are generally transcriptionally active and accessible.

[00140] The term "exposure" includes the use of any method whereby the desired components are placed in immediate proximity or in direct contact.

[00141] Methods and compositions are provided that allow modification of a challenge genomic target locus or a genomic target locus on the Y chromosome in a cell. Perhaps, due to the unique structural features of the Y chromosome, conventional gene targeting strategies in mouse embryonic stem cells to generate mutations in Y-linked genes have had limited success. Therefore, generally understanding the functions of murine Y-linked genes is limited to observations obtained from studies of mice that have spontaneous deletions, random gene trap insertions, or autosomal transgenes. The methods provided in the present invention allow targeting a genomic locus on the Y chromosome by employing a targeting vector in the absence of or in combination with a nuclease agent.

[00142] Some of these methods use a small targeting vector or smallTVEC. A "smallTVEC" includes a targeting vector comprising short homology arms. The length of a homology arm in a smallTVEC can be about 400 to 1,000 bp. A smallTVEC homology arm can be any length that is sufficient to promote a homologous recombination event with a corresponding target site, including, for example, from about 400 bp to about 500 bp, from about 500 bp to about from 600 bp, from about 600 bp to about 700 bp, from about 700 bp to about 800 bp, from about 800 bp to about 900 bp, or from about 900 bp to about 1,000 bp. A preferred length of a homology arm in a smallTVEC is about 700 bp to about 800 bp. In another embodiment, the total sum of smallTVEC's 5' and 3' homology arms is about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb , 7 kb, 8 kb, 9 kb, from about 0.5 kb to about 1 kb, from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, from about 2 kb to about 3 kb, from about 3 kb to about 4 kb, from about 4 kb to about 5 kb, from about 5 kb to about 6 kb, from about 6 kb to about of 7 kb, from about 8 kb to about 9 kb or is at least 10 kb. In such methods, the short length of the homology arms increases the targeting efficiency compared to a targeting vector with longer homology arms. Due to the nature of the Y chromosome which has highly repetitive sequences, the short arms of smallTVECs allow for highly specific targeting on the Y chromosome.

[00143] Methods are provided for modifying a genomic target locus on the Y chromosome in a cell comprising: (a) providing a cell comprising a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent, (b ) introducing, into the cell, a first targeting vector comprising a first insertion polynucleotide flanked by a first and a second homology arms corresponding to a first and a second target site; and (c) identifying at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus on the Y chromosome. In specific embodiments, the sum total of the first homology arm and the second homology arm of the targeting vector is about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, about 0.5 kb to about 1 kb, from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, from about 2 kb to about 3 kb, from about 3 kb to about 4 kb, from about 4 kb to about 5 kb, from about 5 kb to about 6 kb, from about 6 kb to about 7 kb, from about 8 kb to about 9 kb or is of at least 10 kb or at least 10 kb and less than 150 kb. In some embodiments, a smallTVEC is employed. In specific embodiments, an LTVEC is employed. Similar methods can be performed when targeting a challenge genomic target locus. In a non-limiting embodiment, these methods are carried out using the culture media that promote the development of fertile females XY in F0 disclosed in the present invention and, in this way, generate fertile females of animals XY in F0. In another case, the methods described herein are employed to produce a target genetic modification in the Sry gene, as discussed elsewhere in this document.

[00144] Methods are further provided for modifying a genomic target locus on the Y chromosome in a cell comprising: (a) providing a cell comprising a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent, (b ) introducing into the cell (i) the nuclease agent, wherein the nuclease agent induces an incision or break in the double strand at the first recognition site; and (ii) a first targeting vector comprising a first insertion polynucleotide flanked by a first and a second homology arms that correspond to a first and a second target sites located in sufficient proximity to the first recognition site; and (c) identifying at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus on the Y chromosome. In specific embodiments, the sum total of the first homology arm and the second homology arm of the targeting vector is about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, about 0.5 kb to about 1 kb, from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, from about 2 kb to about 3 kb, from about 3 kb to about 4 kb, from about 4 kb to about 5 kb, from about 5 kb to about 6 kb, from about 6 kb to about 7 kb, from about 8 kb to about 9 kb or is of at least 10 kb or at least 10 kb and less than 150 kb. In some embodiments, a smallTVEC is employed. In specific embodiments, an LTVEC is employed. Similar methods can be performed when targeting a challenge genomic target locus. In a non-limiting embodiment, these methods are carried out using the culture media that promote the development of fertile females XY in F0 disclosed in the present invention and, in this way, generate fertile females of animals XY in F0. In another case, the methods described herein are employed to produce a target genetic modification in the Sry gene, as discussed elsewhere in this document.

[00145] It is recognized that the various methods disclosed in the present invention for generating a target modification at a Y chromosome genomic locus (or any challenge genomic locus) employing a targeting vector, a smallTVEC or an LTVEC can be carried out in any cell type and are not limited to a pluripotent and/or totipotent XY cell. Such cell types include, but are not limited to, a human cell, a non-human cell, a mammalian cell, a non-human mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster, a fibroblast or any other host cell. Such cells include pluripotent cells, including, for example, induced pluripotent stem (iPS) cells, mouse embryonic stem (ES) cells, rat embryonic stem (ES) cells, human embryonic (ES) cells, or progenitor cells restricted in terms of development.

[00146] Methods for generating a large deletion on the Y chromosome that employ any of the various nuclease agents provided herein (e.g., CRISPR gRNAs in combination with Cas9; ZFNs; or TALENs) are further disclosed. This deletion on the Y chromosome may be a deletion of an endogenous nucleic acid sequence. The deletion may range from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to about 60 kb, from about from 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, from about 150 kb to about 200 kb, from about 200 kb to about 300 kb, from about 300 kb to about 400 kb, from about 400 kb to about 500 kb, from about 500 kb to about 600 kb, from about 600 kb to about 700 kb, from about 700 kb to about 800 kb, from about 800 kb to about 900 kb, from about 900 kb to about 1 Mb, from about 500 kb to about 1 Mb, from about 1 Mb to about 1 .5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb. In one embodiment, the deletion is greater than 500 kb. In another embodiment, the deletion is of about 500 kb to about 600 kb. In a specific embodiment, the deletion is about 500 kb. This deletion on the Y chromosome can be a deletion of any nucleic acid sequence. In one embodiment, the deletion comprises a gene that is associated with fertility/infertility. The deletion on the Y chromosome may comprise a deletion of multiple genes. In these methods, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more genes can be deleted. In specific embodiments, the Kdm5d gene is 5d-specific demethylase (Lysine (K); e.g., Entrez Gene ID 20592 (mus musculus)) and/or the Usp9y gene (Ubiquitin-specific peptidase 9, Y-linked; e.g., Entrez gene ID 107868 (mus musculus)) is the target for deletion. In other embodiments, the Sry gene is the target for deletion.

A. Nuclease Agents and Recognition Sites for Nuclease Agents

[00147] The term "recognition site for a nuclease agent" includes a DNA sequence in which an incision or double-strand break is induced by a nuclease agent. The recognition site for a nuclease agent may be endogenous (or native) to the cell or the recognition site may be exogenous to the cell. In specific embodiments, the recognition site is exogenous to the cell and, thus, is not naturally occurring in the cell's genome. In still other embodiments, the recognition site is exogenous to the cell and to the polynucleotides of interest that are desired to be positioned at the target locus. In other embodiments, the exogenous or endogenous recognition site is present only once in the host cell genome. In specific embodiments, an endogenous or native site is identified that occurs only once within the genome. This site can then be used to design nuclease agents that will produce an incision or double-strand break at the endogenous recognition site.

[00148] The length of the recognition site can vary and includes, for example, recognition sites that are about 30 to 36 bp for a zinc finger nuclease (ZFN) pair (e.g., about 15 to 18 bp for each ZFN), around 36 bp for a nuclease with a transcriptional activator-like effector (TALEN - Transcription Activator-Like Effector Nuclease), or around 20 bp for a CRISPR/Cas9 guide RNA.

[00149] In one embodiment, each monomer of the nuclease agent recognizes a recognition site of at least 9 nucleotides. In other embodiments, the recognition site is from about 9 to about 12 nucleotides in length, from about 12 to about 15 nucleotides in length, from about 15 to about 18 nucleotides in length, or from about 18 nucleotides in length. to about 21 nucleotides in length, and any combination of these subranges (e.g., 9 to 18 nucleotides). It is recognized that a particular nuclease agent can bind to the recognition site and cleave that binding site or, alternatively, the nuclease agent can bind to a sequence that is different from the recognition site. Furthermore, the term recognition site comprises both the nuclease agent binding site and the incision/cleavage site regardless of whether the incision/cleavage site is inside or outside the nuclease agent binding site. In another variation, cleavage by the nuclease agent may occur at nucleotide positions immediately opposite each other to produce a blunt end cut or, in other cases, the incisions may be staggered to produce single-stranded projections, also called "sticky ends." ", which can be either 5' or 3' projections.

[00150] Any nuclease agent that induces an incision or a double-strand break at a desired recognition site can be used in the methods and compositions disclosed in the present invention. A naturally occurring or native nuclease agent may be employed, as long as the nuclease agent induces an incision or double-strand break at a desired recognition site. Alternatively, a modified or genetically engineered nuclease agent may be employed. A "genetically engineered nuclease agent" includes a nuclease that is genetically engineered (modified or derived) from its native form to specifically recognize and induce an incision or double-strand break at the desired recognition site. Thus, a genetically engineered nuclease agent may be derived from a naturally occurring native nuclease agent or may be artificially created or synthesized. The modification of the nuclease agent can be as small as an amino acid in a protein cleaving agent or a nucleotide in a nucleic acid cleaving agent. In some embodiments, the engineered nuclease induces an incision or double-strand break at a recognition site, wherein the recognition site was not a sequence that would have been recognized by a native (not engineered) nuclease agent. genetic or unmodified). The production of an incision or a double-strand break in a recognition site or other DNA may be referred to in the present invention as "cutting" or "cleavage" of the recognition site or other DNA.

[00151] Active variants and fragments of the exemplified recognition sites are also provided. These active variants may comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % or more sequence identity for the given recognition site, where active variants maintain biological activity and therefore can be recognized and cleaved by a nuclease agent in a sequence-specific manner. Assays to measure double-strand breakage of a recognition site by a nuclease agent are known in the art (e.g., TaqMan® qPCR assay, Frendewey D. et al., Methods in Enzymology, 2010, 476:295 to 307, which is incorporated herein by reference in its entirety).

[00152] In specific embodiments, the recognition site is positioned within the polynucleotide encoding the selection marker. This position may be located within the selection marker coding region or within regulatory regions, which influence the expression of the selection marker. Thus, a nuclease agent recognition site may be located in an intron of the selection marker, a promoter, an enhancer, a regulatory region, or any non-protein coding region of the polynucleotide encoding the selection marker. In specific embodiments, an incision or double-strand break at the recognition site disrupts the activity of the selection marker. Methods for determining the presence or absence of a functional selection marker are known.

[00153] In one embodiment, the nuclease agent is a Transcription Activator-Like Effector Nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to generate double-strand breaks at specific target sequences in the genome of a prokaryotic or eukaryotic organism. TAL effector nucleases are created by fusing a native or genetically engineered transcriptional activator-like (TAL) effector, or functional part thereof, to the catalytic domain of an endonuclease, for example, FokI. The unique modular TAL effector DNA binding domain allows the creation of proteins with potentially any given DNA recognition specificity. Thus, the DNA-binding domains of TAL effector nucleases can be modified by genetic engineering to recognize specific DNA target sites and can thus be used to generate double-strand breaks at desired target sequences. See, WO 2010/079430; Morbitzer et al. (2010) PNAS 10.1073/pnas.1013133107; Scholze & Boch (2010) Virulence 1:428 to 432; Christian et al. Genetics (2010) 186:757 to 761; Li et al. (2010) Nuc. Acids Res. (2010) doi:10.1093/nar/gkq704; andMiller et al. (2011) Nature Biotechnology 29:143 to 148; all these documents are incorporated here by reference.

[00154] Examples of suitable TAL nucleases and methods of preparing suitable TAL nucleases are disclosed, for example, in US Patent Application Nos. 2011/0239315 A1, 2011/0269234 A1, 2011/0145940 A1, 2003/0232410 A1, 2005/0208489 A1, 2005/0026157 A1, 2005/0064474 A1, 2006/0188 987 A1, and 2006/0063231 A1 (each incorporated herein for reference purposes). In various embodiments, TAL effector nucleases are modified by genetic engineering that makes a cut at or near the target nucleic acid sequence, e.g., at a locus of interest or a genomic locus of interest, where the sequence Target nucleic acid is at or near a sequence to be modified by a targeting vector. TAL nucleases suitable for use with the various methods and compositions provided herein include those that are specifically designed to bind to or near target nucleic acid sequences to be modified by targeting vectors as described in the present invention.

[00155] In one embodiment, each TALEN monomer comprises 33 to 35 TAL repeats that recognize a single base pair through two hypervariable residues. In one embodiment, the nuclease agent is a chimeric protein comprising a TAL repeat-based DNA binding domain functionally linked to an independent nuclease. In one embodiment, the independent nuclease is a FokI endonuclease. In one embodiment, the nuclease agent comprises a first TAL repeat-based DNA binding domain and a second TAL repeat based DNA binding domain, wherein each of the first and second DNA binding domains TAL repeat-based DNA binding domains are functionally linked to a FokI nuclease, with the first and second TAL repeat-based DNA binding domains recognizing two contiguous DNA target sequences on each strand of the DNA target sequence separated by a spacer sequence of variable length (12 to 20 bp), and the FokI nuclease subunits dimerize to create an active nuclease that generates a double-strand break in a target sequence.

[00156] The nuclease agent employed in the various methods and compositions disclosed herein may further comprise a zinc finger nuclease (ZFN). In one embodiment, each ZFN monomer comprises 3 or more zinc finger-based DNA-binding domains, wherein each zinc finger-based DNA-binding domain binds to a 3 bp subsite. In other embodiments, ZFN is a chimeric protein comprising a zinc finger-based DNA binding domain functionally linked to an independent nuclease. In one embodiment, the independent endonuclease is a FokI endonuclease. In one embodiment, the nuclease agent comprises a first ZFN and a second ZFN, each of the first and second ZFN is functionally linked to a FokI nuclease subunit, wherein the first and second ZFN recognize two sequences- target DNA contiguous on each strand of the target DNA sequence separated by a spacer of about 5 to 7 bp double strand, and in which the FokI nuclease subunits dimerize to create an active nuclease to generate a break. See, for example, US20060246567; US20080182332; US20020081614; US20030021776; WO/2002/057308A2; US20130123484; US20100291048; WO/2011/017293A2; and Gaj et al. (2013) Trends in Biotechnology, 31(7):397 to 405, each of which is incorporated here by reference.

[00157] In yet another embodiment, the nuclease agent is a meganuclease. Meganucleases are classified into four families based on conserved sequence motifs, the families are LAGLIDADG, GIY-YIG, H-N-H, and His-Cys Box families. These motifs participate in the coordination of metal ions and the hydrolysis of phosphodiester bonds. Meganucleases are notable for their long recognition sites and for tolerating some sequence polymorphisms in their DNA substrates. The meganuclease domains, structure, and function are known; see, for example, Guhan and Muniyappa (2003) Crit Rev Biochem Mol Biol 38:199 to 248; Lucas et al., (2001) Nucleic Acids Res 29:960 to 9; Jurica and Stoddard, (1999) Cell Mol Life Sci 55:1304 to 26; Stoddard, (2006) Q Rev Biophys 38:49 to 95; and Moure et al., (2002) Nat Struct Biol 9:764. In some examples, a naturally occurring variant and/or genetically engineered derivative meganuclease is used. Methods to modify the kinetics, cofactor interactions, expression, optimal conditions, and/or site specificity of recognition and screening for activity are known; see, for example, Epinat et al., (2003) Nucleic Acids Res 31:2952 to 62; Chevalier et al., (2002) Mol Cell 10:895 to 905; Gimble et al., (2003) Mol Biol 334:993 to 1008; Seligman et al., (2002) Nucleic Acids Res 30:3870 to 9; Sussman et al., (2004) J Mol Biol 342:31 to 41; Rosen et al., (2006) Nucleic Acids Res 34:4791 to 800; Chames et al., (2005) Nucleic Acids Res 33:e178; Smith et al., (2006) Nucleic Acids Res 34:e149; Gruen et al., (2002) Nucleic Acids Res 30:e29; Chen and Zhao, (2005) Nucleic Acids Res 33:e154; WO2005105989; WO2003078619; WO2006097854; WO2006097853; WO2006097784; and WO2004031346.

[00158] Any meganuclease can be used here, including, but not limited to, I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I- CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F- TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I- NjaI, I-Nsp236IP, I-PakI, I-PboIP, I- PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorI, I-PorIIP, I-PbpIP, I- SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I- SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I- TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP PI-MtuHIIP, PI-PfuI, PI -PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII, or any active variants or fragments thereof .

[00159] In one embodiment, the meganuclease recognizes double-stranded DNA sequences of 12 to 40 base pairs. In one embodiment, the meganuclease recognizes a perfectly matched target sequence in the genome. In one embodiment, the meganuclease is a homing nuclease. In one embodiment, the homing nuclease is a LAGLIDADG family of homing nucleases. In one embodiment, the LAGLIDADG family of homing nucleases is selected from I-SceI, I-CreI, and I-Dmol.

[00160] Nuclease agents may further comprise restriction endonucleases, which include Type I, Type II, Type III and Type IV endonucleases. Type I and Type III restriction endonucleases recognize specific recognition sites, but typically perform cleavage at a variable position relative to the nuclease binding site that may be hundreds of base pairs away from the cleavage site. (recognition site). In Type II systems, restriction activity is independent of any methylase activity, and cleavage typically occurs at specific sites within or near the binding site. Most Type II enzymes cut palindromic sequences, however, Type IIa enzymes recognize non-palindromic recognition sites and perform cleavage outside the recognition site, Type IIb enzymes cut sequences twice with both sites outside the site recognition site, and Type II enzymes recognize an asymmetric recognition site and perform cleavage on one side and at a defined distance of about 1 to 20 nucleotides from the recognition site. Type IV restriction enzymes target methylated DNA. Restriction enzymes are further described and classified, for example, in the REBASE database (webpage at rebase.neb.com; Roberts et al., (2003) Nucleic Acids Res 31:418 to 20), Roberts et al. , (2003) Nucleic Acids Res 31:1805 to 12, and Belfort et al., (2002) in Mobile DNA II, pp. 761 to 783, Eds. Craigie et al., (ASM Press, Washington, DC).

[00161] The nuclease agent employed in the various methods and compositions may also comprise a CRISPR/Cas system. Such systems may employ a Cas9 nuclease that, in some cases, is codon optimized for the desired cell type in which it is to be expressed. The system further employs a fused crRNA-tracrRNA construct that works with codon-optimized Cas9. This simple RNA is often called a guide RNA or gRNA. Within a gRNA, the crRNA portion is identified as the ‘target sequence’ for the given recognition site and the tracrRNA is generally called the ‘scaffold’. This system has demonstrated its functioning in several eukaryotic and prokaryotic cells. In short, a short DNA fragment containing the target sequence is inserted into a guide RNA expression plasmid. The gRNA expression plasmid comprises the target sequence (in some embodiments around 20 nucleotides), a form of the tracrRNA sequence (the scaffold), as well as a suitable promoter that is active in the cell and elements necessary for proper processing in eukaryotic cells. Many of the systems rely on custom complementary oligos that are annealed to form double-stranded DNA and then cloned into the gRNA expression plasmid. The gRNA expression cassette and the Cas9 expression cassette are then introduced into the cell. See, for example, Mali P et al. (2013) Science 2013 Feb 15; 339 (6121):823 to 6; Jinek M et al. Science 2012 Aug 17;337(6096):816 to 21; Hwang WY et al. Nat Biotechnol 2013 Mar;31(3):227 to 9; Jiang W et al. Nat Biotechnol 2013 Mar;31(3):233 to 9; and, Cong L et al. Science 2013 Feb 15;339(6121):819 to 23, each being incorporated here by reference.

[00162] The methods and compositions disclosed in the present invention may utilize Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas) systems or components of such systems to modify a genome within a cell. CRISPR/Cas systems include transcripts and other elements involved in expressing or directing the activity of Cas genes. A CRISPR/Cas system can be a type I, type II, or type III system. The methods and compositions disclosed in the present invention employ CRISPR/Cas systems by using CRISPR complexes (comprising a guide RNA (gRNA) complexed with a Cas protein) for site-directed cleavage of nucleic acids.

[00163] Some CRISPR/Cas systems used in the methods disclosed in the present invention are non-naturally occurring. A "non-naturally occurring" system includes anything that indicates the involvement of human action, for example, one or more components of the system that are altered or mutated from their naturally occurring state, are at least substantially free from at least one other component with which they are naturally associated in nature, or are associated with at least one other component with which they are not naturally associated. For example, some CRISPR/Cas systems employ non-naturally occurring CRISPR complexes comprising a gRNA and a Cas protein that together are not naturally occurring.

(i) A. Cas RNA-Guided Endonucleases

[00164] Cas proteins generally comprise at least one RNA recognition or binding domain. These domains can interact with guide RNAs (gRNAs, described in more detail below). Cas proteins may also comprise nuclease domains (e.g., DNase or RNase domains), DNA-binding domains, helicase domains, protein-protein interaction domains, dimerization domains, and other domains. A nuclease domain has catalytic activity for nucleic acid cleavage. Cleavage includes the breaking of the covalent bonds of a nucleic acid molecule. Cleavage can produce blunt ends or staggered ends and can be single-stranded or double-stranded.

[00165] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Casl0d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, and homologous or modified of these.

[00166] Cas proteins can be from a type II/CRISPR Cas system. For example, the Cas protein may be a Cas9 protein or may be derived from a Cas9 protein. Cas9 proteins typically share four main motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-type motifs and motif 3 is an HNH motif. The Cas9 protein may originate from, for example, Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, AlicyclobacHlus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens , Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosirup tor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methano halobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp ., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina. Additional examples of Cas9 family members are described in WO 2014/131833, incorporated herein by reference in its entirety. The S. pyogenes Cas9 protein or derivative thereof is a preferred enzyme. The S. pyogenes Cas9 protein is assigned the SwissProt accession number Q99ZW2.

[00167] Cas proteins can be wild-type proteins (i.e., those that occur in nature), modified Cas proteins (e.g., Cas protein variants), or fragments of wild-type or modified Cas proteins. Cas proteins can also be active variants or fragments of wild-type or modified Cas proteins. Active variants or fragments may comprise at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity relative to the wild-type or modified Cas protein or a portion thereof, with the active variants retaining the ability to cut at a desired cleavage site and therefore maintaining incision-inducing or strand break-inducing activity pair. Assays for incision-inducing or double-strand break-inducing activity are known and generally measure the general activity and specificity of the Cas protein on DNA substrates containing the cleavage site.

[00168] Cas proteins can be modified to increase or reduce nucleic acid binding affinity, nucleic acid binding specificity and/or enzymatic activity. Cas proteins can also be modified to alter any other activity or property of the protein, for example stability. For example, one or more nuclease domains of the Cas protein may be modified, deleted, or inactivated, or the Cas protein may be truncated to remove domains that are not essential for the protein's function or to optimize (i.e., increase or decrease) the activity of the Cas protein.

[00169] Some Cas proteins comprise at least two nuclease domains, for example, DNase domains. For example, a Cas9 protein may comprise a RuvC-type nuclease domain and an HNH-type nuclease domain. The RuvC and HNH domains each cut a different strand of double-stranded DNA to produce a double-strand break in the DNA. See, for example, Jinek et al. (2012) Science 337:816 to 821, incorporated herein by reference in its entirety.

[00170] One or both nuclease domains can be deleted or mutated so that they are no longer functional or have reduced nuclease activity. If one of the nuclease domains is deleted or mutated, the resulting Cas protein (i.e., Cas9) can be called a nickase and can generate a single-strand break in a CRISPR RNA recognition sequence within double-stranded DNA. , but not a double-strand break (i.e., it can cleave either the complementary strand or the non-complementary strand, but not both). If both nuclease domains are deleted or mutated, the resulting Cas protein (i.e., Cas9) will have a reduced ability to cleave both strands of a double-stranded DNA. An example of a mutation that converts Cas9 into a nickase is a D10A (aspartate to alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from S. pyogenes. Similarly, H939A (histidine to alanine at amino acid position 839) or H840A (histidine to alanine at amino acid position 840) in the HNH domain of Cas9 from S. pyogenes can convert Cas9 into a nickase. Other examples of mutations that convert Cas9 to a nickase include the corresponding mutations in Cas9 from S. thermophilus. See, for example, Sapranauskas et al. (2011) Nucleic Acids Research 39:9275 to 9282 and WO 2013/141680, each of which is incorporated herein by reference in its entirety. These mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Examples of other mutations that create nickases can be found, for example, in documents WO/2013/176772A1 and WO/2013/142578A1, each of which is incorporated herein by reference.

[00171] Cas proteins can also be fusion proteins. For example, a Cas protein can be fused into a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. See WO 2014/089290, incorporated herein by reference, in its entirety. Cas proteins can also be fused into a heterologous polypeptide providing greater or lesser stability. The fused domain or heterologous polypeptide can be located at the N-terminus, the C-terminus, or internally in the Cas protein.

[00172] The Cas protein can be fused into a heterologous polypeptide that provides subcellular localization. These heterologous peptides include, for example, a nuclear localization signal (NLS), e.g., the SV40 NLS for nuclear targeting, a mitochondrial localization signal for mitochondrial targeting, an ER retention signal, and the like. See, for example, Lange et al. (2007) J. Biol. Chem. 282:5101 to 5105. These subcellular localization signals can be located at the N-terminus, the C-terminus, or any other location within the Cas protein. An NLS may comprise a stretch of basic amino acids and may be a monopartite sequence or a bipartite sequence.

[00173] Cas proteins can also be linked to a cell penetration domain. For example, the cell-penetrating domain may be derived from the HIV-1 TAT protein, the cell-penetrating motif TLM from the human hepatitis B virus, MPG, Pep-1, VP22, a cell-penetrating peptide from the Herpes simplex virus, or a polyarginine peptide sequence. See, for example, WO 2014/089290, incorporated herein by reference, in its entirety. The cell penetration domain can be located at the N-terminus, the C-terminus, or any other location within the Cas protein.

[00174] Cas proteins may also comprise a heterologous polypeptide to facilitate screening or purification, for example, a fluorescent protein, a purification tag or an epitope tag. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP , Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g. eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g. eCFP, Cerulean, CyPet, AmCyanl , Midoriishi-Cyan), red fluorescent proteins (mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc , AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV- G, histidine (His), carboxylbiotin-bearing protein (BCCP), and calmodulin.

[00175] Cas proteins can be provided in any form. For example, the Cas protein may be provided in the form of a protein, e.g., a Cas protein complexed with a gRNA. Alternatively, the Cas protein may be provided in the form of a nucleic acid encoding the Cas protein, e.g., an RNA (e.g., messenger RNA (mRNA)) or DNA). Optionally, the nucleic acid encoding the Cas protein can be codon optimized for efficient translation into the protein in a particular cell or organism.

[00176] Nucleic acids encoding Cas proteins can be stably integrated into the cell's genome and can be functionally linked to an active promoter in the cell. Alternatively, nucleic acids encoding Cas proteins may be functionally linked to a promoter in an expression construct. Expression constructs include any nucleic acid constructs capable of directing the expression of a gene or other nucleic acid sequence of interest (e.g., a Cas gene) and which can transfer that nucleic acid sequence of interest to a target cell . Promoters that can be used in an expression construct include, for example, promoters active in a rat, eukaryotic, mammalian, non-human mammalian, human, rodent, mouse or hamster pluripotent cell. Examples of other promoters are described elsewhere in this document.

(ii) B. Guide RNAs (gRNAs)

[00177] A "guide RNA" or "gRNA" includes an RNA molecule that binds to a Cas protein and directs the Cas protein to a specific location within a target DNA. Guide RNAs can comprise two segments: a "DNA-targeting segment" and a "protein-binding segment." The term "segment" includes a segment, section, or region of a molecule, for example, a contiguous stretch of nucleotides in an RNA. Some gRNAs comprise two separate RNA molecules: an "activating RNA" and a "targeting RNA." Other gRNAs are a single RNA molecule (single RNA polynucleotide), which may also be called a "single-molecule gRNA," a "single guide RNA," or an "sgRNA." See, for example, WO/2013/176772A1, WO/2014/065596A1, WO/2014/089290A1, WO/2014/093622A2, WO/2014/099750A2, WO/2013142578A1, and WO 2014/131833 A1, each of them being here incorporated by reference. The terms "guide RNA" and "gRNA" include both double-molecule gRNAs and single-molecule gRNAs.

[00178] An exemplary two-molecule gRNA comprises a crRNA-like molecule ("CRISPR RNA" or "targeting RNA" or "crRNA" or "crRNA repeat") and a corresponding tracrRNA-like molecule ("transactional CRISPR RNA" or " activating RNA" or "tracrRNA" or "scaffold"). A crRNA comprises both the DNA-targeting (single-stranded) segment of the gRNA and a stretch of nucleotides that forms half of the dsRNA duplex of the protein-binding segment of the gRNA.

[00179] A corresponding tracrRNA (activating RNA) comprises a stretch of nucleotides that forms the other half of the dsRNA duplex of the protein binding segment of the gRNA. A nucleotide stretch of a crRNA is complementary to and hybridizes with a nucleotide stretch of a tracrRNA to form the protein-binding domain dsRNA duplex of the gRNA. Thus, it can be said that each said crRNA has a corresponding tracrRNA.

[00180] The crRNA and the corresponding tracrRNA hybridize to form a gRNA. The crRNA additionally provides the single-stranded DNA targeting segment that hybridizes to a CRISPR RNA recognition sequence. If used for modification within a cell, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecules will be used. See, for example, Mali et al. (2013) Science 339:823 to 826; Jinek et al. (2012) Science 337:816 to 821; Hwang et al. (2013) Nat. Biotechnol. 31:227 to 229; Jiang et al. (2013) Nat. Biotechnol. 31:233 to 239; and Cong et al. (2013) Science 339:819 to 823, each of which is incorporated herein by reference.

[00181] The DNA targeting segment (crRNA) of a given gRNA comprises a nucleotide sequence that is complementary to a sequence in a target DNA. The DNA-targeting segment of a gRNA interacts with a target DNA in a sequence-specific manner by hybridization (e.g., base pairing). In this way, the nucleotide sequence of the DNA targeting segment can vary and determines the location within the target DNA with which the gRNA and target DNA will interact. The DNA targeting segment of an individual's gRNA can be modified to hybridize to any desired sequence within the target DNA. Naturally occurring crRNAs differ depending on the Cas9 system and the organism, however, they often contain a targeting segment between 21 and 72 nucleotides in length, flanked by two direct repeats (DR) with a length between 21 and 46 nucleotides ( See, for example, WO2014/131833). In the case of S. pyogenes, the DRs are 36 nucleotides long and the targeting segment is 30 nucleotides long. The 3'-located DR is complementary and hybridizes with the corresponding tracrRNA, which, in turn, binds to the Cas9 protein.

[00182] The DNA targeting segment can have a length of about 12 nucleotides to about 100 nucleotides. For example, the DNA targeting segment may have a length of about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 nt, from from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, or from about 12 nt to about 19 nt. Alternatively, the DNA targeting segment may have a length of about 19 nt to about 20 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 19 nt to about 70 nt, from about 19 nt to about 80 nt, from about 19 nt to about 90 nt, from about 19 nt to about 100 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from from about 20 nt to about 50 nt, from about 20 nt to about 60 nt, from about 20 nt to about 70 nt, from about 20 nt to about 80 nt, from about 20 nt to about from 90 nt, or from about 20 nt to about 100 nt.

[00183] The nucleotide sequence of the DNA targeting segment, which is complementary to a nucleotide sequence (CRISPR RNA recognition sequence) of the target DNA, may have a length of at least about 12 nt. For example, the DNA targeting sequence (i.e., the sequence within the DNA targeting segment that is complementary to a CRISPR RNA recognition sequence within the target DNA) may have a length of at least about 12 nt. , at least about 15 nt, at least about 18 nt, at least about 19 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 35 nt, or at least about 40 nt. Alternatively, the DNA targeting sequence may have a length of about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 45 nt, from about from 12 nt to about 40 nt, from about 12 nt to about 35 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, from about 12 nt to about 19 nt, from about 19 nt to about 20 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, or from about 20 nt to about 60 nt. In some cases, the DNA targeting sequence may be about 20 nt long.

[00184] TracrRNAs can be in any form (e.g., full-length tracrRNAs or active partial tracrRNAs) and can be of variable lengths. They may include primary transcriptions or processed forms. For example, tracrRNAs (as part of a single guide RNA or as a separate molecule as part of a two-molecule gRNA) may comprise or consist of all or a portion of a wild-type tracrRNA sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracrRNA sequence). Examples of wild-type tracrRNA sequences from S. pyogenes include versions of 171 nucleotides, 89 nucleotides, 75 nucleotides, and 65 nucleotides. See, for example, Deltcheva et al. (2011) Nature 471:602 to 607; WO 2014/093661, each of which is incorporated herein by reference, in its entirety. Examples of tracrRNAs within simple guide RNAs (sgRNAs) include the tracrRNA segments found in +48, +54, +67, and +85 versions of sgRNAs, where "+n" indicates that up to the +n nucleotide of the tracrRNA of the type wild-type is included in the sgRNA. See US 8,697,359, incorporated herein by reference, in its entirety.

[00185] The percentage complementarity between the DNA targeting sequence and the CRISPR RNA recognition sequence within the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%). The percentage complementarity between the DNA targeting sequence and the CRISPR RNA recognition sequence within the target DNA can be at least 60% over about 20 contiguous nucleotides. As an example, the percentage complementarity between the DNA targeting sequence and the CRISPR RNA recognition sequence within the target DNA is 100% along the 14 contiguous nucleotides at the 5' end of the CRISPR RNA recognition sequence within the complementary strand of the target DNA and 0% or less along the remainder. In this case, the DNA targeting sequence can be considered to be 14 nucleotides long. As another example, the percentage complementarity between the DNA targeting sequence and the CRISPR RNA recognition sequence within the target DNA is 100% along the seven contiguous nucleotides at the 5' end of the CRISPR RNA recognition sequence within of the complementary strand of the target DNA and 0% or less along the remainder. In this case, the DNA targeting sequence can be considered to be 7 nucleotides long.

[00186] The protein binding segment of a gRNA can comprise two nucleotide extensions that are complementary to each other. The complementary nucleotides of the protein binding segment hybridize to form a double-stranded RNA (dsRNA) duplex. The protein-binding segment of an individual's gRNA interacts with the Cas protein, and the gRNA directs the bound Cas protein to a specific nucleotide sequence within the target DNA via the DNA-targeting segment.

[00187] Guide RNAs may include modifications or sequences that provide additional desirable characteristics (e.g., modified or regulated stability; subcellular targeting; tracking with a fluorescent label; a binding site for a protein or protein complex; and the like). Examples of such modifications include, for example, a 5' cap (e.g., a 7-methylguanylate (m7G) cap); a polyadenylated 3' end (i.e., a poly(A) 3' end); a riboswitch sequence (i.e., to allow regulated stability and/or regulated accessibility of proteins and/or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin); a modification or sequence that directs the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like); a modification or sequence that provides tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, to a sequence that allows fluorescent detection, and so on); a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like); and combinations thereof.

[00188] Guide RNAs can be provided in any form. For example, gRNA can be provided in the form of RNA, either as two molecules (separate crRNA and tracrRNA) or as one molecule (sgRNA), and optionally in the form of a complex with a Cas protein. gRNA can also be supplied in the form of DNA that encodes RNA. The DNA encoding the gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding the gRNA can be provided as separate DNA molecules encoding the crRNA and tracrRNA, respectively.

[00189] DNAs encoding gRNAs can be stably integrated into the cell's genome and functionally linked to an active promoter in the cell. Alternatively, DNAs encoding gRNAs can be functionally linked to a promoter in an expression construct. Such promoters may be active, for example, in a pluripotent rat, eukaryotic, mammalian, non-human mammalian, human, rodent, mouse or hamster cell. In some cases, the promoter is an RNA polymerase III promoter, for example, a human U6 promoter, a rat U6 polymerase III promoter, or a mouse U6 polymerase III promoter. Examples of other promoters are described elsewhere in this document.

[00190] Alternatively, gRNAs can be prepared by various other methods. For example, gRNAs can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, for example, WO 2014/089290 and WO 2014/065596). Guide RNAs can also be a synthetically produced molecule prepared by chemical synthesis.

(iii) C. CRISPR RNA Recognition Sequences

[00191] The term "CRISPR RNA recognition sequence" includes nucleic acid sequences present in a target DNA to which a DNA targeting segment of a gRNA will bind, provided that sufficient conditions for binding exist. For example, CRISPR RNA recognition sequences include sequences to which a guide RNA is designed to have complementarity, wherein hybridization between a CRISPR RNA recognition sequence and a DNA targeting sequence promotes the formation of a complex CRISPR. Full complementarity is not necessarily required, as long as there is sufficient complementarity to carry out hybridization and promote the formation of a CRISPR complex. CRISPR RNA recognition sequences also include cleavage sites for Cas proteins, described in more detail below. A CRISPR RNA recognition sequence may comprise any polynucleotide that may be located, for example, in the nucleus or cytoplasm of a cell or within an organelle of a cell, for example, a mitochondria or chloroplast.

[00192] The CRISPR RNA recognition sequence within a target DNA can be targeted by (i.e., be bound by, or hybridize with, or be complementary to) a Cas protein or a gRNA. Suitable DNA/RNA binding conditions include physiological conditions normally present in a cell. Other suitable DNA/RNA binding conditions (i.e., conditions in a cell-free system) are known in the art (See, e.g., Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001 )). The strand of target DNA that is complementary to and that hybridizes to the Cas protein or gRNA can be called the "complementary strand," and the strand of target DNA that is complementary to the "complementary strand" (and therefore is not complementary to the Cas protein or gRNA) may be called a “noncomplementary strand” or “template strand.”

[00193] The Cas protein can cleave the nucleic acid at a site within or outside the nucleic acid sequence present in the target DNA to which the DNA targeting segment of a gRNA will bind. The "cleavage site" includes the position of a nucleic acid at which a Cas protein produces a single-strand break or a double-strand break. For example, the formation of a CRISPR complex (comprising a gRNA hybridized to a CRISPR RNA recognition sequence and complexed with a Cas protein) can result in the cleavage of one or both strands in the nucleic acid sequence present in a target DNA. , or close to it (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs), to which a DNA targeting segment of a gRNA will bind. If the cleavage site is outside the nucleic acid sequence to which the DNA targeting segment of the gRNA will bind, the cleavage site is still considered to be within the "CRISPR RNA recognition sequence." The cleavage site can be on just one strand or on both strands of a nucleic acid. Cleavage sites may be in the same position on both strands of the nucleic acid (producing blunt ends) or they may be in different locations on each strand (producing staggered ends). Staggered ends can be produced, for example, using two Cas proteins, each of which produces a single-strand break at a different cleavage site on each strand, thus producing a double-strand break. For example, a first nickase may create a single-strand break in the first strand of double-stranded DNA (dsDNA) and a second nickase may create a single-strand break in the second strand of dsDNA so that projection sequences are created. In some cases, the nickase CRISPR RNA recognition sequence on the first strand is separated from the nickase CRISPR RNA recognition sequence on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10 , 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.

[00194] Site-specific cleavage of the target DNA by Cas9 can occur at sites determined either by (i) base pairing complementarity between the gRNA and the target DNA or by (ii) a short motif, called the Adjacent Motif Protospacer (PAM) in target DNA. PAM can flank the CRISPR RNA recognition sequence. Optionally, the CRISPR RNA recognition sequence can be flanked by the PAM. For example, the Cas9 cleavage site may be from about 1 to about 10 or from about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence. In some cases (e.g., when S. pyogenes Cas9 or a closely related Cas9 is used), the non-complementary strand PAM sequence may be 5'-N1GG-3', where N1 is any DNA nucleotide and is immediately 3' of the CRISPR RNA recognition sequence of the non-complementary strand of the target DNA. Thus, the PAM sequence of the complementary strand would be 5'-CC N2-3', where N2 is any DNA nucleotide and is immediately 5' of the CRISPR RNA recognition sequence of the complementary strand of the target DNA. In some of these cases, N1 and N2 may be complementary and the N1-N2 base pair may be any base pair (e.g., N1=C and N2=G; N1=G and N2=C; N1=A and N2 =T, N1=T, and N2=A).

[00195] Examples of CRISPR RNA recognition sequences include a DNA sequence complementary to the DNA targeting segment of a gRNA, or a DNA sequence in addition to a PAM sequence. For example, the target motif may be a 20-nucleotide DNA sequence immediately preceding an NGG motif recognized by a Cas protein (see, for example, WO 2014/165825). Guanine at the 5' end can facilitate transcription by RNA polymerase in cells. Other examples of CRISPR RNA recognition sequences may include two guanine nucleotides at the 5' end (e.g., GGN20NGG; SEQ ID NO: 9) to facilitate efficient transcription by T7 polymerase in vitro. See, for example, WO 2014/065596.

[00196] The CRISPR RNA recognition sequence can be any nucleic acid sequence endogenous or exogenous to a cell. The CRISPR RNA recognition sequence may be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or may include both.

[00197] In one embodiment, the target sequence is immediately flanked by a Protospacer Adjacent Motif (PAM) sequence. In one embodiment, the locus of interest comprises the nucleotide sequence of SEQ ID NO: 1. In one embodiment, the gRNA comprises a third nucleic acid sequence that encodes a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA. Regularly Interspaced Short Palindromic Repeats") (crRNA) and a transactivating CRISPR RNA (tracrRNA). In another embodiment, the rat pluripotent cell genome comprises a target DNA region complementary to the target sequence. In some of these methods, the Cas protein is Cas9. In some embodiments, the gRNA comprises (a) chimeric RNA of the nucleic acid sequence of SEQ ID NO: 2; or (b) the chimeric RNA of the nucleic acid sequence of SEQ ID NO: 3. In some such methods, the crRNA comprises the sequence defined in SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 In some of these methods, the tracrRNA comprises the sequence defined in SEQ ID NO: 7 or SEQ ID NO: 8.

[00198] Active variants and fragments of nuclease agents (e.g., a genetically engineered nuclease agent) are also provided. These active variants may comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % or more sequence identity to the native nuclease agent, wherein the active variants maintain the ability to perform cutting at a desired recognition site and thus maintain incision- or double-strand break-inducing activity. For example, any of the nuclease agents described in the present invention can be modified from a native endonuclease sequence and designed to recognize and induce a nick or double-strand break at a recognition site that was not recognized by the nuclease agent. native nuclease. Thus, in some embodiments, the genetically engineered nuclease has a specificity to induce an incision or a double-strand break at a recognition site that is different from the corresponding recognition site of the native nuclease agent. Incision or double-strand break induction activity assays are known and generally measure the general activity and specificity of the endonuclease on DNA substrates containing the recognition site.

[00199] The nuclease agent can be introduced into the cell by any means known in the art. The polypeptide encoding the nuclease agent can be directly introduced into the cell. Alternatively, a polynucleotide encoding the nuclease agent can be introduced into the cell. When a polynucleotide encoding the nuclease agent is introduced into the cell, the nuclease agent can be temporarily, conditionally or constitutively expressed within the cell. Thus, the polynucleotide encoding the nuclease agent may be contained in an expression cassette and may be functionally linked to a conditional promoter, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. These promoters of interest are discussed in more detail elsewhere in this document. Alternatively, the nuclease agent is introduced into the cell as an mRNA encoding a nuclease agent.

[00200] In specific embodiments, the polynucleotide encoding the nuclease agent is stably integrated into the cell's genome and functionally linked to an active promoter in the cell. In other embodiments, the polynucleotide encoding the nuclease agent is in the same targeting vector that comprises the insertion polynucleotide, while in another case, the polynucleotide encoding the nuclease agent is in a vector or on a plasmid that is separate from the targeting vector comprising the insertion polynucleotide.

[00201] When the nuclease agent is delivered to the cell by introducing a polynucleotide encoding the nuclease agent, that polynucleotide encoding a nuclease agent can be modified to replace codons having a greater frequency of use in the cell of interest in comparison to the naturally occurring polynucleotide sequence encoding the nuclease agent. For example, the polynucleotide encoding the nuclease agent can be modified to replace codons having a higher frequency of use in a particular prokaryotic or eukaryotic cell of interest, including a bacterial cell, a yeast cell, a human cell, a non- human, a mammalian cell, a rodent cell, a mouse cell, a rat cell or any other host cell of interest, compared to the naturally occurring polynucleotide sequence.

B. Use of the CRISPR/Cas System in Combination with a Large Targeting Vector (LTVEC) or a Small Targeting Vector (SmallTVEC) to Modify a Genomic Challenge Loci or a Y Chromosome Locus

[00202] Non-limiting methods for modifying a challenge genomic locus or a Y chromosome locus comprise exposing the chromosome (i.e., the Y chromosome) to a Cas protein and a CRISPR RNA in the presence of a large targeting vector (LTVEC ) comprising a nucleic acid sequence of at least 10 kb, and after exposure to the Cas protein, CRISPR RNA and LTVEC, the chromosome (i.e., the Y chromosome) is modified to contain at least 10 kb of sequence of nucleic acids.

[00203] The method may employ any of the LTVECs or smallTVECs described herein. In non-limiting embodiments, the LTVEC or smallTVEC comprises a nucleic acid sequence of at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb or at least 200 kb. In other embodiments, the total sum of 5' and 3' homology arms of the LTVEC is from about 10 kb to about 150 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb. kb, from about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 120 kb, or from about 120 kb to 150 kb. In another embodiment, the total sum of 5' and 3' homology arms of smallTVEC is about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, from about 0.5 kb to about 1 kb, from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, from about 2 kb to about 3 kb, from about 3 kb to about 4 kb, from about 4 kb to about 5 kb, from about 5 kb to about 6 kb, from about 6 kb to about 7 kb, from about 8 kb to about 9 kb or is at least 10 kb.

[00204] Further provided is a method for modifying a challenge target locus or a genomic target locus on the Y chromosome, comprising: (a) providing a mammalian cell comprising the challenge target locus or a genomic target locus on the Y chromosome, in which the genomic target locus comprises a guide RNA (gRNA) target sequence; (b) introducing into the mammalian cell: (i) a large targeting vector (LTVEC) comprising a first nucleic acid flanked with targeting arms homologous to the genomic target locus, wherein the LTVEC is at least 10 kb; (ii) a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding a Cas protein, and (iii) a second expression construct comprising a second promoter operably linked to a third nucleic acid encoding a guide RNA (gRNA) comprising a nucleotide sequence that hybridizes to the gRNA target sequence and a transactivating CRISPR RNA (tracrRNA), with the first and second promoters being active in the mammalian cell; and, (c) identifying a modified mammalian cell comprising a target genetic modification at the challenge genomic target locus or at the genomic target locus on the Y chromosome. In specific embodiments, the first and second expression constructs are in a molecule of single nucleic acid. In other embodiments, the genomic target locus of the Y chromosomes is the Sry locus.

[00205] As described above, in one embodiment, the Cas protein may comprise a Cas9 protein. In another embodiment, the gRNA target sequence is immediately flanked by a Protospacer Adjacent Motif (PAM) sequence.

[00206] The method may employ any of the LTVECs or smallTVECs described herein. In non-limiting embodiments, the LTVEC or smallTVEC is at least 0.5 kb, at least 1 kb, at least 5 kb, at least 10 kb, at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb or at least 200 kb. In other embodiments, the total sum of 5' and 3' homology arms of the LTVEC is from about 10 kb to about 150 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb. kb, from about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 120 kb, or from about 120 kb to 150 kb.

[00207] The various methods employing the CRISPR/Cas system (or any method disclosed in the present invention) can be carried out, for example, in mammalian cells, non-human mammalian cells, fibroblasts, rodent cells, rat cells, mouse cells or hamster cells. The cell may be a pluripotent cell, an induced pluripotent stem (iPS) cell, a mouse embryonic stem (ES) cell, a rat embryonic stem (ES) cell, a human embryonic stem (ES) cell, or a developmentally restricted human progenitor cell.

[00208] As discussed in detail below, upon modification of a challenge genomic locus or a genomic locus of interest on the Y chromosome (i.e., the Sry locus) of a non-human pluripotent cell employing, for example, the CRISPR system /CAS described above, the genetically modified non-human pluripotent cell that is produced can be introduced into a non-human host embryo; and the non-human host embryo comprising the pluripotent cell modified in a substituent is generated. The substituent produces F0 progeny comprising the target genetic modification. In specific embodiments, the targeted genetic modification is capable of being transmitted through the germline.

C. Selection Markers

[00209] Various selection markers can be used in the methods and compositions disclosed in the present invention, which provide for the modification of a genomic target locus on the Y chromosome or a challenge genomic target locus. Such markers are disclosed elsewhere herein and include, but are not limited to, selection markers that confer resistance to an antibiotic, e.g., G418, hygromycin, blastocidin, neomycin, or puromycin. The polynucleotide encoding the selection markers is functionally linked to an active promoter in the cell. These expression cassettes and their various regulatory components are discussed in more detail elsewhere in this document.

D. Genomic Target Locus

[00210] Various methods and compositions are provided that allow the integration of at least one insertion polynucleotide into a genomic target locus on the Y chromosome or into a challenge genomic target locus. As used herein, a "Y chromosome genomic target locus" comprises any segment or region of DNA on the Y chromosome into which an insertion polynucleotide is desired.

[00211] The genomic locus on the Y chromosome or a challenge genomic target locus being targeted may be native to the cell or, alternatively, may comprise a heterologous or exogenous segment of DNA that has been integrated into the cell's chromosome. These heterologous or exogenous segments of DNA may include transgenes, expression cassettes, polynucleotides encoding selection markers, or heterologous or exogenous regions of genomic DNA. The genomic target locus on the Y chromosome or the challenge genomic target locus may comprise any target genomic integration system including, for example, the recognition site, the selection marker, previously integrated insertion polynucleotides, polynucleotides encoding agents of nuclease, promoters, etc. Alternatively, the genomic target locus on the Y chromosome or the challenge genomic target locus may be located within a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a human, or any other genetically engineered genomic region contained in a suitable host cell. Thus, in specific embodiments, the genomic target locus on the Y chromosome or the challenge genomic target locus may comprise a native, heterologous, or exogenous genomic nucleic acid sequence from a non-human mammal, a non-human cell, a rodent, a human, a rat, a mouse, a hamster, a rabbit, a pig, a cattle, a deer, a sheep, a goat, a chicken, a cat, a dog, a ferret, a primate (e.g. marmoset , Rhesus monkey), a domesticated mammal or an agricultural mammal or any other organism of interest or a combination thereof.

[00212] Non-limiting examples of the genomic target locus on the Y chromosome include the Sry gene, the Uty gene, the Eif2s3y gene, the Ddx3y gene, the Ube1y gene, the Tspy gene, the Usp9y gene, the Zfy1 gene and the Zfy2 gene and the region on the Y chromosome that encompasses the Kdm5d, Eif2s3y, Tspy, Uty, Ddx3y and Usp9y genes. This locus on the Y chromosome may be from a non-human mammal, a mammal, a rodent, a human, a rat, a mouse, a hamster, a rabbit, a swine, a cattle, a deer, a sheep, a goat, a chicken, a cat, a dog, a ferret, a primate (e.g. marmoset, rhesus monkey), a domesticated mammal or an agricultural mammal or any other organism of interest or a combination thereof. Such cells include pluripotent cells, including, for example, induced pluripotent stem (iPS) cells, mouse embryonic stem (ES) cells, rat embryonic stem (ES) cells, human embryonic stem (ES) cells, or developmentally restricted human progenitor cells.

[00213] As described elsewhere in this document, various methods and compositions are provided that comprise pluripotent and/or totipotent XY cells (e.g., ES cells or XY iPS cells) having a lower activity or level of Sry protein. The various methods described in the present invention for modifying the genomic locus on the Y chromosome can also be used to introduce targeted genetic modifications to polynucleotides of interest that are not located on the Y chromosome.

E. Targeting Vectors and Insertion Polynucleotides

[00214] As described above, the methods and compositions provided herein employ targeting vectors alone or in combination with a nuclease agent. The term "homologous recombination" is conventionally used to refer to the exchange of DNA fragments between two DNA molecules at crossover sites within regions of homology.

i. Insertion Polynucleotide

[00215] As used herein, the term "insertion polynucleotide" comprises a segment of DNA that is desired to integrate into the genomic target locus. In specific embodiments, the genomic target locus is on the Y chromosome. In other embodiments, the genomic target locus is a challenge genomic locus. In one embodiment, the insertion polynucleotide comprises one or more polynucleotides of interest. In other embodiments, the insertion polynucleotide may comprise one or more expression cassettes. A given expression cassette may comprise a polynucleotide of interest, a polynucleotide encoding a selection marker and/or a reporter gene with the various regulatory components that influence expression. Non-limiting examples of polynucleotides of interest, selection markers and reporter genes that may be included in the insertion polynucleotide are discussed in detail elsewhere in this document.

[00216] In specific embodiments, the insertion polynucleotide may comprise a genomic nucleic acid. In one embodiment, the genomic nucleic acid is derived from an animal, a mouse, a human, a non-human, a rodent, a non-human, a rat, a hamster, a rabbit, a swine, a bovine, a deer, a sheep, a goat, a chicken, a cat, a dog, a ferret, a primate (e.g., marmoset, rhesus monkey), a domesticated mammal or an agricultural mammal, a bird, or any other organism of interest or a combination thereof .

[00217] In other embodiments, the insertion polynucleotide comprises a conditional allele. In one embodiment, the conditional allele is a multifunctional allele, as described in US 2011/0104799, which is incorporated by reference in its entirety. In specific embodiments, the conditional allele comprises: (a) a sequence acting in sense orientation with respect to transcription of a target gene and a drug selection cassette in sense or antisense orientation; (b) in antisense orientation, a nucleotide sequence of interest (NSI) and a conditional inversion (COIN) module that utilizes an exon-splitting intron and an invertible genetrap-like module; see, for example, US 2011/0104799, which is incorporated by reference in its entirety); and (c) recombinant units that recombine upon exposure to a first recombinase to form a conditional allele (i) that lacks the acting sequence and the DSC, and (ii) contains the NSI in sense orientation and the COIN in the antisense.

[00218] The insertion polynucleotide can be from about 5 kb to about 200 kb, from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 30 kb, from about 30 kb to about 40 kb, from about 40 kb to about 50 kb, from about 60 kb to about 70 kb, from about 80 kb to about 90 kb, from about 90 kb to about 100 kb, from about 100 kb to about 110 kb, from about 120 kb to about 130 kb, from about 130 kb to about 140 kb, from about 140 kb to about 150 kb, from about 150 kb to about 160 kb, from about 160 kb to about 170 kb, from about 170 kb to about 180 kb, from about 180 kb to about 190 kb, from about 190 kb to about 200 kb, from about 200 kb to about 250 kb, from about 250 kb to about 300 kb, from about 300 kb to about 350 kb, or from about 350 kb to about 400 kb.

[00219] In specific embodiments, the insertion polynucleotide comprises a nucleic acid flanked with site-specific recombination target sequences. It is recognized that although the entire insertion polynucleotide may be flanked by this site-specific recombination target sequence, any individual region or polynucleotide of interest within the insertion polynucleotide may also be flanked by these sites. The term "recombination site" as used herein includes a nucleotide sequence that is recognized by a site-specific recombinase and that can serve as a substrate for a recombination event. The term "site-specific recombinase" as used herein includes a group of enzymes that can facilitate recombination between recombination sites when the two recombination sites are physically separated within a single nucleic acid molecule or across nucleic acid molecules. separated. Examples of site-specific recombinases include, but are not limited to, Cre, Flp, and Dre recombinases. The site-specific recombinase can be introduced into the cell by any means, including by introducing the recombinase polypeptide into the cell or by introducing a polynucleotide encoding the site-specific recombinase into the host cell. The polynucleotide encoding the site-specific recombinase may be located within the insertion polynucleotide or within a separate polynucleotide. The site-specific recombinase can be functionally linked to a promoter active in the cell including, for example, an inducible promoter, a promoter that is endogenous to the cell, a promoter that is heterologous to the cell, a cell-specific promoter, a form of tissue-specific or a developmental stage-specific promoter. Site-specific recombination target sequences that may flank the insertion polynucleotide or any polynucleotide of interest in the insertion polynucleotide may include, but are not limited to, loxP, lox511, lox2272, lox66, lox71, loxM2, lox5171, FRT, FRT11, FRT71, attp, att, FRT, rox, and a combination of these.

[00220] In other embodiments, the site-specific recombination sites flank a polynucleotide encoding a selection marker and/or a reporter gene contained within the insertion polynucleotide. In these cases, after integration of the insertion polynucleotide into the genomic target locus, the sequences between the site-specific recombination sites can be removed.

[00221] In one embodiment, the insertion polynucleotide comprises a polynucleotide that encodes a selection marker. These selection markers include, but are not limited to, neomycin phosphotransferase (neor), hygromycin B phosphotransferase (hygr), puromycin-N-acetyltransferase (puror), blasticidin S deaminase (bsrr), xanthine/guanine phosphoribosyl transferase (gpt), or herpes simplex virus thymidine kinase (HSV-k), or a combination thereof. In one embodiment, the polynucleotide encoding the selection marker is functionally linked to an active promoter in the cell. By serially attaching the polynucleotides of interest to a genomic target locus, the selection marker can comprise a recognition site for a nuclease agent, as described above. In one embodiment, the polynucleotide encoding the selection marker is flanked with site-specific recombination target sequences.

[00222] The insertion polynucleotide may further comprise a reporter gene functionally linked to a promoter, the reporter gene encoding a reporter protein selected from the group consisting of LacZ, mPlum, mCherry, tdTomato, mStrawberry, J-Red , DsRed, mOrange, mKO, mCitrine, Venus, YPet, enhanced yellow fluorescent protein (EYFP), Emerald, enhanced green fluorescent protein (EGFP), CyPet, cyan fluorescent protein (CFP), Cerulean, T-Sapphire, luciferase, alkaline phosphatase and a combination thereof. These reporter genes can be functionally linked to an active promoter in the cell. Such promoters may be an inducible promoter, a promoter that is endogenous to the reporter gene or the cell, a promoter that is heterologous to the reporter gene or the cell, a cell-specific promoter, a tissue-specific promoter, or a tissue-specific promoter. stage of development.

ii. Targeting Vectors

[00223] Targeting vectors are employed to introduce the insertion polynucleotide into the genomic target locus on the Y chromosome or into a challenge target locus or other chromosome of interest. The targeting vector comprises the insertion polynucleotide and further comprises an upstream and downstream homology arm flanking the insertion polynucleotide. The homology arms flanking the insertion polynucleotide correspond to genomic regions within the genomic target locus. For ease of reference, the corresponding genomic regions within the genomic target locus are herein referred to as "target sites". Thus, in one example, a targeting vector may comprise a first insertion polynucleotide flanked by a first and a second homology arms that correspond to a first and a second target sites located in sufficient proximity to the first recognition site; In this way, the targeting vector thus assists the integration of the insertion polynucleotide into the genomic target locus by a homologous recombination event that occurs between the homology arms and the corresponding target sites in the cell's genome.

[00224] A homology arm of the targeting vector can be any length that is sufficient to promote a homologous recombination event with a corresponding target site, including, for example, from about 400 bp to about 500 bp, from about from 500 bp to about 600 bp, from about 600 bp to about 700 bp, from about 700 bp to about 800 bp, from about 800 bp to about 900 bp, or from about 900 bp to about 1000 bp; or at least 5 to 10, 5 to 15, 5 to 20, 5 to 25, 5 to 30, 5 to 35, 5 to 40, 5 to 45, 5 to 50, 5 to 55, 5 to 60, 5 to 65 , 5 to 70, 5 to 75, 5 to 80, 5 to 85, 5 to 90, 5 to 95, 5 to 100, 100 to 200, or 200 to 300 kilobases in length or more. In specific embodiments, the sum total of the targeting arms is at least 0.5 kb, 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb or at least 10 kb. In other embodiments, the sum total of the homology arms is between about 0.5 kb to about 1 kb, from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb , from about 2 kb to about 3 kb, from about 3 kb to about 4 kb, from about 4 kb to about 5 kb, from about 5 kb to about 6 kb, from about 6 kb to about 7 kb, from about 7 kb to about 8 kb, from about 8 kb to about 9 kb, or from about 10 kb to about 150 kb. As described in more detail below, large targeting vectors may employ longer targeting arms.

[00225] Target sites within the genomic target locus that correspond to the upstream and downstream homology arms of the targeting vector are located in "sufficient proximity to the recognition site" located on the polynucleotide encoding the selection marker. As used herein, the upstream and downstream homology arms of a targeting vector are "located in sufficient proximity" to a recognition site when the distance is such as to promote the occurrence of a homologous recombination event between the target sites. and the homology arms after an incision or double-strand break at the recognition site. Thus, in specific embodiments, target sites corresponding to the upstream and/or downstream homology arm of the targeting vector are within at least 10 nucleotides about 14 kb of a given recognition site. In specific embodiments, the recognition site is immediately adjacent to at least one or both target sites.

[00226] The spatial relationship of the target sites corresponding to the homology arms of the targeting vector in relation to the recognition site within the polynucleotide encoding the selection marker may vary. For example, both target sites may be located 5' to the recognition site, both target sites may be located 3' to the recognition site, or the target sites may flank the recognition site.

[00227] In specific embodiments, the genomic target locus comprises (i) a 5' target sequence that is homologous to a 5' homology arm; and (iii) a 3' target sequence that is homologous to a 3' homology arm. In specific embodiments, the 5' target sequence and the 3' target sequence are separated by at least 5 kb but less than 3 Mb, at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, at least 60 kb but less than 80 kb, at least about 80 kb but less than 100 kb , at least 100 kb but less than 150 kb or at least 150 kb but less than 200 kb at least about 200 kb but less than about 300 kb at least about 300 kb but less than about 400 kb, at least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb but less than about 2.5 Mb, or at least about 2.5 Mb but less than about 3 MB.

[00228] As used herein, a homology arm and a target site "match" or are "corresponding" to each other when the two regions share a sufficient level of sequence identity with each other to act as substrates for a homologous recombination reaction . The term "homology" means DNA sequences that are identical or that share sequence identity with a corresponding sequence. The sequence identity between a given target site and the corresponding homology arm found in the targeting vector can have any degree of sequence identity that allows homologous recombination to occur. For example, the amount of sequence identity shared by the homology arm of the targeting vector (or a fragment thereof) and the target site (or a fragment thereof) may be at least 50%, 55%, 60%, 65 %, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, such that the sequences undergo homologous recombination. Furthermore, a corresponding region of homology between the homology arm and the corresponding target site can be any length that is sufficient to promote homologous recombination at the cleaved recognition site. For example, a particular homology arm and/or corresponding target site may comprise corresponding homology regions that are from about 400 bp to about 500 bp, from about 500 bp to about 600 bp, from about 600 bp to about 700 bp, from about 700 bp to about 800 bp, from about 800 bp to about 900 bp, or from about 900 bp to about 1000 bp (as described for the smallTVEC vectors described elsewhere of this document); or at least about 5 to 10, 5 to 15, 5 to 20, 5 to 25, 5 to 30, 5 to 35, 5 to 40, 5 to 45, 5 to 50, 5 to 55, 5 to 60, 5 to 65, 5 to 70, 5 to 75, 5 to 80, 5 to 85, 5 to 90, 5 to 95, 5 to 100, 100 to 200, or 200 to 300 kilobases in length or more (as described in the LTVEC vectors described elsewhere in this document), such that the homology arm has sufficient homology to undergo homologous recombination with the corresponding target sites within the cell's genome.

[00229] For ease of reference, the homology arms are referred to herein as an upstream and downstream homology arm. This terminology refers to the relative position of the homology arms to the insertion polynucleotide within the targeting vector.

[00230] The homology arms of the targeting vector are therefore designed to correspond to a target site with the genomic target locus on the Y chromosome or within a challenge target locus. Thus, homology arms may correspond to a genomic locus that is native to the cell or, alternatively, they may correspond to a region of a heterologous or exogenous segment of DNA that has been integrated into the Y chromosome, including, but not limited to, transgenes, expression cassettes, or heterologous or exogenous regions of genomic DNA. Alternatively, the homology arms of the targeting vector may correspond to a region of a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a human artificial chromosome, or any other genetically engineered genomic region contained within a suitable host cell. Additionally, the homology arms of the targeting vector may correspond to or may be derived from a region of a BAC library, a cosmid library, or a P1 phage library. Thus, in specific embodiments, the homology arms of the targeting vector correspond to a genomic locus on the Y chromosome or a challenge target locus that is native, heterologous or exogenous to a non-human mammal, a rodent, a human, a rat, a mouse, a hamster, a rabbit, a pig, a cattle, a deer, a sheep, a goat, a chicken, a cat, a dog, a ferret, a primate (e.g., marmoset, Rhesus monkey), a domesticated mammal or an agricultural mammal, a bird, or any other organism of interest. In other embodiments, the homology arms correspond to a genomic locus of the cell that cannot be targeted using a conventional method or that can be targeted only incorrectly or only with significantly low efficiency, in the absence of an incision or a break in the strand. double induced by a nuclease agent. In one embodiment, the homology arms are derived from a synthetic DNA.

[00231] In still other embodiments, the upstream and downstream homology arms correspond to the same genome as the target genome. In one embodiment, the homology arms originate from a related genome, i.e., the target genome is a mouse genome from a first lineage, and the targeting arms are from a mouse genome from a second lineage, wherein the first lineage and the second lineage are different. In other embodiments, the homology arms originate from the genome of the same animal or originate from the genome of the same strain, e.g., the target genome is a mouse genome from a first strain, and the targeting arms are from a genome of mice from the same mouse or strain.

[00232] The targeting vector (e.g., a large targeting vector) may also comprise a selection cassette or a reporter gene as discussed elsewhere in this document. The selection cassette may comprise a nucleic acid sequence that encodes a selection marker, the nucleic acid sequence being operably linked to a promoter. Such promoters may be an inducible promoter, a promoter that is endogenous to the reporter gene or the cell, a promoter that is heterologous to the reporter gene or the cell, a cell-specific promoter, a tissue-specific form of promoter, or a promoter. specific to the developmental stage. In one embodiment, the selection marker is selected from neomycin phosphotransferase (neor), hygromycin B phosphotransferase (hygr), puromycin-N-acetyltransferase (puror), blasticidin S deaminase (bsrr), xanthine/guanine phosphoribosyl transferase (gpt), and herpes simplex virus thymidine kinase (HSV-k), and a combination thereof. The targeting vector selection marker may be flanked by the upstream and downstream homology arms or found at either 5' or 3' to the homology arms.

[00233] In one embodiment, the targeting vector (e.g., a large targeting vector) comprises a reporter gene functionally linked to a promoter, the reporter gene encoding a reporter protein selected from the group consisting of LacZ , mPlum, mCherry, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mCitrine, Venus, YPet, enhanced yellow fluorescent protein (EYFP), Emerald, enhanced green fluorescent protein (EGFP), CyPet, cyan fluorescent protein (CFP ), Cerulean, T-Sapphire, luciferase, alkaline phosphatase and a combination thereof. These reporter genes can be functionally linked to an active promoter in the cell. Such promoters may be an inducible promoter, a promoter that is endogenous to the reporter gene or the cell, a promoter that is heterologous to the reporter gene or the cell, a cell-specific promoter, a tissue-specific form of promoter, or a promoter. specific to the developmental stage.

[00234] In a non-limiting embodiment, the combined use of the targeting vector (including, for example, a large targeting vector) with the nuclease agent results in an increase in targeting efficiency compared to the use of the targeting vector alone . In one embodiment, when the targeting vector is used with the nuclease agent, the targeting efficiency of the targeting vector is increased by at least two-fold, at least three-fold, at least 4-fold, or at least 10-fold. compared to when the targeting vector is used alone.

iii. Large Targeting Vectors

[00235] The term "large targeting vector" or "LTVEC", as used herein, includes large targeting vectors that comprise homology arms that correspond to and are derived from nucleic acid sequences larger than those typically used by other approaches aimed at carrying out homologous targeting in cells and/or comprising insertion polynucleotides comprising nucleic acid sequences larger than those typically used by other approaches aimed at carrying out homologous recombination targeting in cells. In specific embodiments, the homology arms and/or the LTVEC insertion polynucleotide comprise a genomic sequence from a eukaryotic cell. The size of LTVEC is too large to allow screening for targeting events by conventional assays, e.g., Southern blotting and long-range PCR (e.g., 1 kb to 5 kb). Examples of LTVEC include, but are not limited to, vectors derived from a bacterial artificial chromosome (BAC), a human artificial chromosome, or a yeast artificial chromosome (YAC). Non-limiting examples of LTVECs and methods for producing them are described, for example, in US Patent Nos. 6,586,251, 6,596,541, 7,105,348, and WO 2002/036789 (PCT/US01/45375), each of which is incorporated herein by reference.

[00236] The LTVEC may be any length, including, but not limited to, at least about 10 kb, about 15 kb, about 20 kb, about 30 kb, about 40 kb, about 50 kb, about from 60 kb, about 70 kb, about 80 kb, about 90 kb, about 100 kb, about 150 kb, about 200 kb, from about 10 kb to about 15 kb, about 15 kb to about 20 kb, about 20 kb to about 30 kb, from about 30 kb to about 50 kb, from about 50 kb to about 300 kb, from about 50 kb to about 75 kb, from about from 75 kb to about 100 kb, from about 100 kb to 125 kb, from about 125 kb to about 150 kb, from about 150 kb to about 175 kb, about 175 kb to about 200 kb, from about 200 kb to about 225 kb, from about 225 kb to about 250 kb, from about 250 kb to about 275 kb, or from about 275 kb to about 300 kb.

[00237] In one embodiment, the LTVEC comprise an insertion polynucleotide ranging from about 5 kb to about 200 kb, from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about from 20 kb to about 30 kb, from about 30 kb to about 40 kb, from about 40 kb to about 50 kb, from about 60 kb to about 70 kb, from about 80 kb to about 90 kb, from about 90 kb to about 100 kb, from about 100 kb to about 110 kb, from about 120 kb to about 130 kb, from about 130 kb to about 140 kb, from about 140 kb to about 150 kb, from about 150 kb to about 160 kb, from about 160 kb to about 170 kb, from about 170 kb to about 180 kb, from about 180 kb to about 190 kb, or from about 190 kb to about 200 kb, from about 200 kb to about 250 kb, from about 250 kb to about 300 kb, from about 300 kb to about 350 kb, or from about from 350 kb to around 400 kb.

[00238] In other cases, the design of the LTVEC may be such as to allow substitution of a particular sequence that is from about 5 kb to about 200 kb or from about 5 kb to about 3.0 Mb as described in the present invention. In one embodiment, the substitution is from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 30 kb, from about 30 kb to about 40 kb , from about 40 kb to about 50 kb, from about 50 kb to about 60 kb, from about 60 kb to about 70 kb, from about 80 kb to about 90 kb, from about 90 kb to about 100 kb, from about 100 kb to about 110 kb, from about 110 kb to about 120 kb, from about 120 kb to about 130 kb, from about 130 kb to about 140 kb, from about 140 kb to about 150 kb, from about 150 kb to about 160 kb, from about 160 kb to about 170 kb, from about 170 kb to about 180 kb, from about 180 kb to about 190 kb, from about 190 kb to about 200 kb, from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, or from about 150 kb to about 200 kb, from about 200 kb to about 300 kb, from about 300 kb to about 400 kb, from about 400 kb to about 500 kb, from about 500 kb to about 1 Mb, from about 1 Mb to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 MB.

[00239] In one embodiment, the LTVEC homology arms are derived from a BAC library, a cosmid library, or a P1 phage library. In other embodiments, the homology arms are derived from the cell's genomic target locus, and in some cases, the genomic target locus that the LTVEC is intended to target is not targetable using a conventional method. In still other embodiments, the homology arms are derived from synthetic DNA.

[00240] In one embodiment, the total sum of the upstream homology arm and the downstream homology arm in the LTVEC is at least 10 kb. In other embodiments, the upstream homology arm ranges from about 5 kb to about 100 kb. In one embodiment, the downstream homology arm ranges from about 5 kb to about 100 kb. In other embodiments, the sum total of the upstream and downstream homology arms is from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 30 kb, from about 30 kb to about 40 kb, from about 40 kb to about 50 kb, from about 50 kb to about 60 kb, from about 60 kb to about 70 kb, from about 70 kb to about 80 kb, from about 80 kb to about 90 kb, from about 90 kb to about 100 kb, from about 100 kb to about 110 kb, from about 110 kb to about 120 kb, from about 120 kb to about 130 kb, from about 130 kb to about 140 kb, from about 140 kb to about 150 kb, from about 150 kb to about 160 kb, from about 160 kb to about from 170 kb, from about 170 kb to about 180 kb, from about 180 kb to about 190 kb, or from about 190 kb to about 200 kb. In one embodiment, the size of the deletion is equal to or similar to the size of a sum total of the 5' and 3' homology arms of LTVEC.

[00241] In one embodiment, the LTVEC comprises a selection cassette or a reporter gene as discussed elsewhere in this document.

iv. Methods for Integrating an Insertion Polynucleotide Near the Recognition Site on the Y Chromosome by Homologous Recombination

[00242] Methods are provided for modifying a genomic target locus on the Y chromosome in a cell comprising: (a) providing a cell comprising a genomic target locus on the Y chromosome, (b) introducing, into the cell, a first targeting vector comprising a first insertion polynucleotide flanked by first and second homology arms corresponding to first and second target sites; and (c) identify at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus on the Y chromosome. Similar methods can be used to reach a challenge chromosomal locus. As discussed in detail elsewhere herein, in specific embodiments, the total sum of the first homology arm and the second homology arm of the targeting vector is about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, from about 0.5 kb to about 1 kb, from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, from about 2 kb to about 3 kb, from about 3 kb to about 4 kb, from about 4 kb to about 5 kb, from about 5 kb to about 6 kb, from about 6 kb to about 7 kb, from about 8 kb to about 9 kb or is at least 10 kb or at least 10 kb and less than 150 kb. In specific embodiments, an LTVEC is employed. In other specific embodiments, a smallTVEC is employed. In a non-limiting embodiment, these methods are carried out using the culture media that promote the development of fertile females XY in F0 disclosed in the present invention and, in this way, generating fertile females of animals XY in F0. In another case, the methods described herein are employed to produce a target genetic modification in the Sry gene, as discussed elsewhere in this document.

[00243] Further provided are methods for modifying a genomic target locus on the Y chromosome in a cell comprising: (a) providing a cell comprising a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent, (b ) introducing into the cell (i) the nuclease agent, wherein the nuclease agent induces an incision or break in the double strand at the first recognition site; and (ii) a first targeting vector comprising a first insertion polynucleotide flanked by a first and a second homology arms that correspond to a first and a second target sites located in sufficient proximity to the first recognition site; and (c) identify at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus on the Y chromosome. Similar methods can be used to reach a challenge target locus. As discussed in detail elsewhere herein, in specific embodiments, the total sum of the first homology arm and the second homology arm of the targeting vector is about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, from about 0.5 kb to about 1 kb, from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, from about 2 kb to about 3 kb, from about 3 kb to about 4 kb, from about 4 kb to about 5 kb, from about 5 kb to about 6 kb, from about 6 kb to about 7 kb, from about 8 kb to about 9 kb or is at least 10 kb or at least 10 kb and less than 150 kb. In specific embodiments, an LTVEC is employed. In other specific embodiments, a smallTVEC is employed. In a non-limiting embodiment, these methods are carried out using the culture media that promote the development of fertile females XY in F0 disclosed in the present invention and, in this way, generating fertile females of animals XY in F0. In another case, the methods described herein are employed to produce a target genetic modification in the Sry gene, as discussed elsewhere in this document.

[00244] Various methods can also be employed to identify cells having the insertion polynucleotide integrated into the genomic target locus. Insertion of the insertion polynucleotide into the genomic target locus results in an "allele modification." The term "allele modification" or "MOA" includes modification of the exact DNA sequence of an allele of one or more genes or chromosomal locus(s) in a genome. Examples of "modification of allele (MOA)" include, but are not limited to, deletions, substitutions or insertions ranging from a single nucleotide to multi-kilobase deletions spanning one or more genes or chromosomal loci of interest, as well as any and all possible modifications between these two extremes.

[00245] In various embodiments, to facilitate identification of the target modification, a high-throughput quantitative assay, e.g., allele modification assay (MOA), is employed. The MOA assay described here allows large-scale screening of one or more modified alleles on a precursor chromosome following a genetic modification. The MOA assay can be performed using various analytical techniques, including, but not limited to, a quantitative PCR, e.g., a real-time PCR (qPCR). For example, real-time PCR comprises a first probe and primer set that recognizes the target locus and a second probe and primer set that recognizes a reference locus that is not the target. Furthermore, the primer and probe set comprises a fluorescent probe that recognizes the amplified sequence. Quantitative assay can also be performed by various analytical techniques, including, but not limited to, fluorescence-mediated in situ hybridization (FISH), comparative genomic hybridization, isothermal DNA amplification, quantitative hybridization in a or more immobilized probes, Invader Probes®, MMP assays®, TaqMan® Molecular Beacon, and Eclipse™ probe technology. (See, for example, US2005/0144655, incorporated herein by reference, in its entirety).

[00246] In various embodiments, in the presence of incision or double-strand break, the efficiency of targeting a targeting vector (e.g., an LTVEC or a smallTVEC) at the genomic target locus is at least about 2 times greater , at least about 3 times larger, at least about 4 times larger than in the absence of the incision or double-strand break (using, for example, the same targeting vector and the same homology arms and corresponding target sites in the genomic locus of interest, but in the absence of an added nuclease agent that performs the incision or double-strand break).

[00247] The various methods presented above can be sequentially repeated to allow target integration of any number of insertion polynucleotides into a given genomic target locus on the Y chromosome or into a challenge target locus. Thus, the various methods provide the insertion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more insertion polynucleotides at the genomic target locus on the Y chromosome or at a challenge target locus. In particular embodiments, these sequential fixation methods allow the reconstruction of large genomic regions from an animal cell or a mammalian cell (e.g., a human, a non-human, a rodent, a mouse, a monkey, a mouse, a hamster, a domesticated mammal, or an agricultural animal) at a genomic target locus on a Y chromosome. In these cases, the transfer and reconstruction of genomic regions that include both coding and non-coding regions allows the complexity of a given region is preserved by maintaining, at least partially, the coding regions, non-coding regions, and copy number variations found within the native genomic region. Thus, the various methods provide, for example, methods for generating "heterologous" or "exogenous" genomic regions within any mammalian or animal cell of interest. In a non-limiting example, a "humanized" genomic region is generated within a non-human animal.

[00248] It is further recognized that, with the modification of the genomic target locus on the Y chromosome, the various methods and compositions disclosed in the present invention can also be employed to generate target genetic modification on another chromosome.

v. Polynucleotides of Interest

[00249] Any polynucleotide of interest may be contained in the various insertion polynucleotides and thus integrated into the genomic target locus on the Y chromosome or in a challenge target locus. The methods disclosed in the present invention provide at least 1, 2, 3, 4, 5, 6 or more polynucleotides of interest to be integrated into the genomic target locus.

[00250] The polynucleotide of interest within the insertion polynucleotide, when integrated into the genomic target locus on the Y chromosome or into a challenge target locus, can introduce one or more genetic modifications into the cell. Genetic modification may comprise a deletion of an endogenous nucleic acid sequence and/or the addition of an exogenous or heterologous or orthologous polynucleotide at the genomic target locus. In one embodiment, the genetic modification comprises a replacement of an endogenous nucleic acid sequence with an exogenous polynucleotide of interest at the genomic target locus. Thus, the methods provided here allow the generation of a genetic modification comprising a knockout, a deletion, an insertion, a substitution ("knock-in"), a point mutation, a domain swap, an exon swap, a intron, a regulatory sequence swap, a gene swap, or a combination of these at a genomic target locus on the Y chromosome. These modifications can occur upon integration of the first, second, third, fourth, fifth, sixth, seventh, or any polynucleotides of subsequent insertions into the genomic target locus.

[00251] The polynucleotide of interest within the insertion polynucleotide and/or integrated into the genomic target locus may comprise a sequence that is native or homologous to the cell into which it is introduced; the polynucleotide of interest may be heterologous to the cell into which it is introduced; the polynucleotide of interest may be exogenous to the cell into which it is introduced; the polynucleotide of interest may be orthologous to the cell into which it is introduced; or the polynucleotide of interest may be from a species different from the cell into which it is introduced. As used herein, the term "homologous", in reference to a sequence, is a sequence that is native to the cell. As used herein, the term "heterologous", in reference to a sequence, is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or locus. genomics by deliberate human intervention. As used herein, the term "exogenous", in reference to a sequence, is a sequence that originates from a foreign species. As used herein, the term "ortholog" is a polynucleotide from one species that is functionally equivalent to a known reference sequence in another species (e.g., a species variant). The polynucleotide of interest may originate from any organism of interest including, but not limited to, a non-human organism, a rodent, a hamster, a mouse, a rat, a human, a monkey, a bird, an agricultural mammal or a non-agricultural mammal. The polynucleotide of interest may further comprise a coding region, a non-coding region, a regulatory region or a DNA (ypnnwicn Aççim o 1o Qo 3o 4o So 6o o— p/mi ΠIIPH^ΠIIPT HGÇ 1 1 / \ S^^ zÃÃvy AÜLC^y. ASSUll, \_y J. , , , , , , , Vy , / ^y/^y^A ^qu-^i-Ls^q^A^yr uus subsequent insertion polynucleotides may comprise these sequences .

[00252] In one embodiment, the polynucleotide of interest within the insertion polynucleotide and/or integrated into the genomic target locus on the Y chromosome is homologous to a mouse nucleic acid sequence, a human nucleic acid, a non-human nucleic acid, a rodent nucleic acid, a rat nucleic acid, a hamster nucleic acid, a monkey nucleic acid, an agricultural mammal nucleic acid, or a non-agricultural mammal nucleic acid. In still other embodiments, the polynucleotide of interest integrated into the target locus is a fragment of a genomic nucleic acid. In one embodiment, the genomic nucleic acid is a mouse genomic nucleic acid, a human genomic nucleic acid, a non-human nucleic acid, a rodent nucleic acid, a rat nucleic acid, a hamster nucleic acid, a monkey, an agricultural mammalian nucleic acid or a non-agricultural mammalian nucleic acid or a combination thereof.

[00253] In one embodiment, the polynucleotide of interest can range from about 500 nucleotides to about 200 kb as described above. The polynucleotide of interest may be from about 500 nucleotides to about 5 kb, from about 5 kb to about 200 kb, from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 30 kb, from about 30 kb to about 40 kb, from about 40 kb to about 50 kb, from about 60 kb to about 70 kb, from about 80 kb to about 90 kb, from about 90 kb to about 100 kb, from about 100 kb to about 110 kb, from about 120 kb to about 130 kb, from about 130 kb to about 140 kb, from about 140 kb to about 150 kb, from about 150 kb to about 160 kb, from about 160 kb to about 170 kb, from about 170 kb to about 180 kb, from about 180 kb to about of 190 kb, or from about 190 kb to about 200 kb.

[00254] The polynucleotide of interest within the insertion polynucleotide and/or inserted into the genomic target locus on the Y chromosome or into a challenge target locus may encode a polypeptide, may encode a miRNA, may encode a long non-coding RNA , or may comprise any regulatory regions or non-coding regions of interest including, for example, a regulatory sequence, a promoter sequence, an enhancer sequence, a transcriptional repressor binding sequence, or a deletion of a non-coding sequence. protein, but does not comprise a deletion of a protein coding sequence. Furthermore, the polynucleotide of interest within the insertion polynucleotide and/or inserted into the genomic target locus on the Y chromosome or into a challenge target locus may encode a protein expression in the nervous system, the skeletal system, the digestive system, in the circulatory system, the muscular system, the respiratory system, the cardiovascular system, the lymphatic system, the endocrine system, the urinary system, the reproductive system, or a combination of these.

[00255] The polynucleotide of interest within the insertion polynucleotide and/or integrated into the genomic target locus on the Y chromosome or in a challenge target locus may comprise a genetic modification in a coding sequence. Such genetic modifications include, but are not limited to, a deletion mutation of a coding sequence or the fusion of two coding sequences.

[00256] The polynucleotide of interest within the insertion polynucleotide and/or integrated into the genomic target locus on the Y chromosome or in a challenge target locus may comprise a polynucleotide encoding a mutant protein. In one embodiment, the mutant protein is characterized by an altered binding characteristic, altered localization, altered expression, and/or altered expression pattern. In one embodiment, the polynucleotide of interest within the insertion polynucleotide and/or integrated into the genomic target locus on the Y chromosome or a challenge target locus comprises at least one disease allele. In these cases, the disease allele may be a dominant allele or the disease allele may be a recessive allele. Furthermore, the disease allele may comprise a single nucleotide polymorphism (SNP) allele. The polynucleotide of interest encoding the mutant protein may be from any organism, including, but not limited to, a mammalian, non-human mammalian, rodent, mouse, rat, human, monkey, agricultural mammal or domestic mammal that encodes a mutant protein.

[00257] The polynucleotide of interest within the insertion polynucleotide and/or integrated into the genomic target locus on the Y chromosome or a challenge target locus may also comprise a regulatory sequence, including, for example, a promoter sequence, a enhancer sequence, a transcriptional repressor binding sequence, or a transcriptional terminator sequence. In specific embodiments, the polynucleotide of interest within the insertion polynucleotide and/or integrated into the genomic target locus on the Y chromosome or a challenge target locus comprises a polynucleotide having a deletion of a non-protein coding sequence, but does not comprise a deletion of a protein coding sequence. In one embodiment, the deletion of the non-protein coding sequence comprises a deletion of a regulatory sequence. In another embodiment, deletion of the regulatory element comprises deletion of a promoter sequence. In one embodiment, deletion of the regulatory element comprises deletion of an enhancer sequence. Such polynucleotide of interest may originate from any organism, including, but not limited to, a mammalian, non-human mammal, rodent, mouse, rat, human, monkey, agricultural mammal or domestic mammal that encodes a mutant protein.

[00258] The various methods disclosed in the present invention can be employed to generate a variety of modifications at a challenge genomic locus or at the Y chromosome locus (i.e., Sry). Such modifications include, for example, a replacement of an endogenous nucleic acid sequence with a homologous sequence or an orthologous nucleic acid sequence; a deletion of an endogenous nucleic acid sequence; a deletion of an endogenous nucleic acid sequence, wherein the deletion ranges from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about from 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, from about 150 kb to about 200 kb, from about 200 kb to about 300 kb, from about 300 kb to about 400 kb, from about 400 kb to about 500 kb, from about 500 kb to about 600 kb, from about 600 kb to about 700 kb, from about 700 kb to about 800 kb, from about 800 kb to about 900 kb, from about 900 kb to about 1 Mb, from about 500 kb to about 1 Mb, from about 1 Mb to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb; an insertion of an exogenous nucleic acid sequence; an insertion of an exogenous nucleic acid sequence ranging from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to about from 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, from about 150 kb to about 200 kb, from about from about 200 kb to about 250 kb, from about 250 kb to about 300 kb, from about 300 kb to about 350 kb, or from about 350 kb to about 400 kb; an insertion of an exogenous nucleic acid sequence comprising a homologous sequence or an orthologous nucleic acid sequence; an insertion of a chimeric nucleic acid sequence comprising a human sequence and a non-human nucleic acid sequence; an insertion of a conditional allele flanked with site-specific recombinase target sequences; an insertion of a selectable marker or a reporter gene operably linked to a third active promoter in the mammalian cell; or a combination of these.

III. Methods for Sequence Introduction and Generation of Transgenic Animals

[00259] As described above, provided herein are methods and compositions to enable targeted genetic modification of one or more polynucleotides of interest located on the Y chromosome, at a challenge target locus, or a reduction in the level and/or activity of the protein. Sry. It is further recognized that, in addition to a targeted genetic modification of a sequence on the Y chromosome or a challenge chromosomal target locus, additional targeted genetic modifications can be carried out on other chromosomes. Such systems that enable such targeted genetic modifications may employ a variety of components, and for ease of reference, the term "target genomic integration system" in the present invention includes generically all components necessary for an integration event (i.e., the various nuclease agents, recognition sites, DNA insertion polynucleotides, targeting vectors, genomic target locus, and polynucleotides of interest).

[00260] The methods provided herein comprise introducing into a cell one or more polynucleotides or polypeptide constructs comprising the various components of the target genomic integration system. "Introduce" means to present the sequence (polypeptide or polynucleotide) to the cell in such a way that the sequence has access to the interior of the cell. The methods provided here do not depend on a particular method for introducing any component of the target genomic integration system into the cell, only that the polynucleotide has access to the interior of at least one cell. Methods for introducing polynucleotides into various cell types are known in the art and include, but are not limited to, stable transfection methods, transient transfection methods, and virus-mediated methods.

[00261] In some embodiments, the cells employed in the methods and compositions have a DNA construct stably incorporated into their genome. The term "stably incorporated" or "stably introduced" means the introduction of a polynucleotide into the cell in such a way that the nucleotide sequence is integrated into the cell's genome and can be inherited by its progeny. Either protocol can be used for the stable incorporation of DNA constructs or the various components of the target genomic integration system.

[00262] Transfection protocols, as well as protocols for introducing polypeptides or polynucleotide sequences into cells, may vary. Non-limiting transfection methods include chemical transfection methods that include the use of liposomes; nanoparticles; calcium phosphate (Graham et al. (1973). Virology 52 (2): 456 to 67, Bacchetti et al. (1977) Proc Natl Acad Sci USA 74 (4): 1590-4 and, Kriegler, M (1991) . Transfer and Expression: A Laboratory Manual. New York: W. H. Freeman and Company. pp. 96 to 97); dendrimers; or cationic polymers such as DEAE-dextran or polyethylenimine. Non-chemical methods include electroporation; Sonoporation; and optical transfection. Particle-based transfection includes the use of a gene gun magnet-assisted transfection (Bertram, J. (2006) Current Pharmaceutical Biotechnology 7, 277 to 28). Viral methods can be used for transfection.

[00263] In one embodiment, the nuclease agent is introduced into the cell simultaneously with the targeting vector, the smallTVEC, or the large targeting vector (LTVEC). Alternatively, the nuclease agent is introduced separately from the targeting vector, smallTVEC or LTVEC over a period of time. In one embodiment, the nuclease agent is introduced before the introduction of the targeting vector, smallTVEC or LTVEC, whereas, in other embodiments, the nuclease agent is introduced after the introduction of the targeting vector, smallTVEC or LTVEC.

[00264] Non-human animals can be generated using the various methods disclosed in the present invention. These methods comprise (1) integrating one or more polynucleotides of interest into the Y chromosome genomic target locus of a pluripotent cell of the non-human animal to generate a genetically modified pluripotent cell comprising the insertion polynucleotide into the Y chromosome genomic target locus employing the methods disclosed in the present invention; (2) selecting the genetically modified pluripotent cell having the one or more polynucleotides of interest at the Y chromosome genomic target locus; (3) introducing the genetically modified pluripotent cell into a non-human animal host embryo at a premorula stage; and (4) implanting the host embryo comprising the genetically modified pluripotent cell into a surrogate to generate an F0 generation derived from the genetically modified pluripotent cell. Similar methods can be employed to target a chromosomal challenge locus. The non-human animal may be a non-human mammal, a rodent, a mouse, a rat, a hamster, a monkey, an agricultural mammal or a domestic mammal, or a fish or a bird.

[00265] The pluripotent cell can be a human ES cell, a non-human ES cell, a rodent ES cell, a mouse ES cell, a rat ES cell, a hamster ES cell, a monkey ES cell, a agricultural mammal ES cell or a domesticated mammal ES cell. In other embodiments, the pluripotent cell is a mammalian cell, a human cell, a non-human mammalian cell, a human pluripotent cell, a human ES cell, an adult human stem cell, a restricted human progenitor cell. development, a human iPS cell, a human cell, a rodent cell, a rat cell, a mouse cell, a hamster cell. In one embodiment, the targeted genetic modification decreases the level and/or activity of the Sry protein. In such cases, the pluripotent cell may comprise an XY ES cell or an XY iPS cell. Methods of culturing said cells to promote the development of fertile females of XY animals in F0 are described in detail elsewhere in this document.

[00266] Nuclear transfer techniques can also be used to generate non-human mammalian animals. In summary, nuclear transfer methods include the steps of: (1) enucleating an oocyte; (2) isolating a donor cell or nucleus to be combined with the enucleated oocyte; (3) inserting the cell or nucleus into the enucleated oocyte to form a reconstituted cell; (4) implant the reconstituted cell into the uterus of an animal to form an embryo; and (5) allow the embryo to develop. In these methods, oocytes are generally recovered from dead animals, although they can also be isolated from oviducts and/or ovaries of living animals. Oocytes may be matured in various media known to those skilled in the art prior to enucleation. Oocyte enucleation can be carried out in several ways well known to those skilled in the art. Insertion of the donor cell or nucleus into the enucleated oocyte to form a reconstituted cell generally occurs by microinjection of a donor cell beneath the zona pellucida prior to fusion. Fusion can be induced by applying a DC electrical pulse across the fusion contact/plane (electrofusion), by exposing cells to fusion-promoting chemicals such as polyethylene glycol, or by means of an inactivated virus, e.g. Sendai. A reconstituted cell is typically activated by electrical and/or non-electrical means before, during and/or after fusion of the nuclear donor and recipient oocyte. Methods of activation include electrical pulses, chemically induced shock, sperm penetration, increasing levels of divalent cations in the oocyte, and reduced phosphorylation of cellular proteins (such as through kinase inhibitors) in the oocyte. Activated reconstituted cells, or embryos, are typically cultured in a medium well known to those skilled in the art and then transferred to the uterus of an animal. See, for example, US20080092249, WO/1999/005266A2, US20040177390, WO/2008/017234A1, and US Patent No. 7,612,250, each of which is incorporated herein by reference.

[00267] Other methods are provided for producing a non-human animal comprising, in its germline, one or more genetic modifications, as described in the present invention, comprising: (a) modifying a genomic target locus on the Y chromosome of a non-human animal human in a prokaryotic cell employing the various methods described in the present invention; (b) selecting a modified prokaryotic cell comprising genetic modification at the genomic target locus; (c) isolating the genetically modified targeting vector from the genome of the modified prokaryotic cell; (d) introducing the genetically modified targeting vector into a pluripotent cell of the non-human animal to generate a genetically modified pluripotent cell comprising inserting the nucleic acid into the Y chromosome genomic target locus; (e) selecting the genetically modified pluripotent cell; (f) introducing the genetically modified pluripotent cell into a host embryo of the non-human animal at a pre-morula stage; and (g) implanting the host embryo comprising the genetically modified pluripotent cell into a surrogate to generate an F0 generation derived from the genetically modified pluripotent cell. In these methods, the targeting vector may comprise a large targeting vector or a smallTVEC. Similar methods can be employed to target a challenge locus. The non-human animal may be a non-human mammal, a rodent, a mouse, a rat, a hamster, a monkey, an agricultural mammal, or a domestic mammal. The pluripotent cell may be a human ES cell, a non-human ES cell, a rodent ES cell, a mouse ES cell, a rat ES cell, a hamster ES cell, a monkey ES cell, a agricultural mammal or a domestic mammal ES cell. In other embodiments, the pluripotent cell is a mammalian cell, a human cell, a non-human mammalian cell, a human pluripotent cell, a human ES cell, an adult human stem cell, a restricted human progenitor cell. developmental cells, a human iPS cell, a human cell, a rodent cell, a rat cell, a mouse cell, and a hamster cell. In one embodiment, the targeted genetic modification decreases the level and/or activity of the Sry protein. In such cases, the pluripotent cell may comprise an ES XY cell or an iPS XY cell. Methods of culturing said cells to promote the development of fertile females of XY animals in F0 are described in detail elsewhere in this document.

[00268] In other methods, the isolation step (c) further comprises (c1) linearizing the genetically modified targeting vector (i.e., the genetically modified LTVEC). In still other embodiments, the introduction step (d) further comprises (d1) introducing, into the pluripotent cell, a nuclease agent as described in the present invention. In one embodiment, selection steps (b) and/or (e) are carried out by applying, to the prokaryotic cell or pluripotent cell, a selectable agent as described in the present invention. In one embodiment, selection steps (b) and/or (e) are performed by an allele modification assay (MOA) as described in the present invention.

[00269] Other methods for modifying a genomic target locus of an animal cell by bacterial homologous recombination (BHR) in a prokaryotic cell are provided and comprise: (a) providing a prokaryotic cell comprising a Y chromosome genomic target locus; (b) introducing, into the prokaryotic cell, a targeting vector (as described above) comprising an insertion polynucleotide flanked with a first upstream homology arm and a first downstream homology arm, wherein the insertion polynucleotide comprises a region mammalian genomic genome, and introducing into the prokaryotic cell a nuclease agent that makes an incision or double-strand break at or near the first recognition site, and (c) selecting a target prokaryotic cell comprising the insertion polynucleotide at the locus -genomic target of the chromosome, in which the prokaryotic cell is capable of expressing a recombinase that mediates BHR. Similar methods can be employed to target a challenge locus. Steps (a) to (c) can be repeated serially, as disclosed in the present invention, to allow the introduction of multiple insertion polynucleotides into the genomic target locus in the prokaryotic cell. Once the genomic target locus is "built" with the prokaryotic cell, a targeting vector comprising the modified Y chromosome genomic target locus can be isolated from the prokaryotic cell and introduced into a Y chromosome genomic target locus within a mammalian cell. Mammalian cells comprising the modified Y chromosome genomic locus can then be produced in non-human transgenic animals.

[00270] Other methods for modifying a genomic target locus of an animal cell by bacterial homologous recombination (BHR) in a prokaryotic cell are provided and comprise: (a) providing a prokaryotic cell comprising a Y chromosome genomic target locus; (b) introducing, into the prokaryotic cell, a targeting vector (as described above) comprising an insertion polynucleotide flanked with a first upstream homology arm and a first downstream homology arm, wherein the insertion polynucleotide comprises a region mammalian genomics, and (c) selecting a target prokaryotic cell comprising the insertion polynucleotide at the target genomic locus of the chromosome, wherein the prokaryotic cell is capable of expressing a recombinase that mediates BHR. Similar methods can be employed to target a challenge locus. Steps (a) to (c) can be repeated serially, as disclosed in the present invention, to allow the introduction of multiple insertion polynucleotides into the genomic target locus in the prokaryotic cell. Once the genomic target locus is "built" with the prokaryotic cell, a targeting vector comprising the modified Y chromosome genomic target locus can be isolated from the prokaryotic cell and introduced into a Y chromosome genomic target locus within a mammalian cell. Mammalian cells comprising the modified Y chromosome genomic locus can then be produced in non-human transgenic animals.

[00271] In some embodiments, various genetic modifications of the genomic target loci described herein can be carried out by a series of homologous recombination (BHR) reactions in bacterial cells using an LTVEC derived from Bacterial Artificial Chromosome (BAC) DNA using the technology of VELOCIGENE® genetic engineering (See, for example, US Patent No. 6,586,251 and Valenzuela, D. M. et al. (2003), High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotechnology 21(6 ): 652 to 659, which are incorporated here by reference, in their entirety).

[00272] In some embodiments, target pluripotent and/or totipotent XY cells (e.g., XY ES cells or XY iPS cells) comprising various genetic modifications as described in the present invention are used as donor insertion cells and introduced into a premorula stage embryo of a corresponding organism, e.g., an 8-cell stage mouse embryo, by the VELOCIMOUSE® method (see, for example, US patents 7,576,259, US 7,659,442, US 7,294,754, and US 2008 -0078000 A1, all of which are incorporated herein by reference in their entirety). The non-human animal embryo comprising genetically modified pluripotent and/or totipotent XY cells (e.g., XY ES cells or XY iPS cells) is incubated until the blastocyst stage and is then implanted into a surrogate to produce an F0 generation . In some embodiments, target mammalian ES cells comprising various genetic modifications as described in the present invention are introduced into a blastocyst stage embryo. Non-human animals having the genetically modified genomic locus of the Y chromosome can be identified by the modification of allele assay (MOA) as described in the present invention. The resulting F0 generation non-human animal derived from genetically modified pluripotent and/or totipotent XY cells (e.g., XY ES cells or XY iPS cells) is crossed with a wild-type non-human animal to obtain an F1 generation offspring. After genotyping with specific primers and/or probes, non-human animals in F1, which are heterozygous for the genetically modified genomic locus, are crossed with each other to produce offspring of F2 generation non-human animals that are homozygous for the genomic locus. genetically modified Y chromosome or to the genetically modified challenge target locus.

IV. Cells and Expression Cassettes

[00273] The various methods described in the present invention employ a genomic locus targeting system for the Y chromosome or for a challenge target locus in a cell. Such cells include prokaryotic cells, such as bacterial cells including E. coli, or eukaryotic cells, such as yeast, insect, amphibian, plant, or mammalian cells, including, but not limited to, a mouse cell, a rat cell, a rabbit cell, a pig cell, a bovine cell, a deer cell, a sheep cell, a goat cell, a chicken cell, a cat cell, a dog cell, a ferret cell, a cell primate (e.g., marmoset, rhesus monkey), and the like, and cells from domesticated mammals or cells from agricultural mammals. Some cells are non-human, particularly non-human mammalian cells. In some embodiments, for those mammals for which suitable genetically modifiable pluripotent cells are not readily available, other methods are employed to reprogram somatic cells into pluripotent cells, for example, by introducing into somatic cells a combination of pluripotency-inducing factors, including, but not limited to, Oct3/4, Sox2, KLF4, Myc, Nanog, LIN28, and Glis1. In these methods, the cell may also be a mammalian cell, a human cell, a non-human mammal cell, a non-human cell, a cell from a rodent, a rat, a mouse, a hamster, a fibroblast, or any other host cell. In other embodiments, the cell is a pluripotent cell, an induced pluripotent stem (iPS) cell, a non-human embryonic stem (ES) cell. Such cells include pluripotent cells, including, for example, induced pluripotent stem (iPS) cells, mouse embryonic stem (ES) cells, rat embryonic stem (ES) cells, human embryonic (ES) cells, or progenitor cells developmentally restricted human cells, a rodent embryonic stem (ES) cell, a mouse embryonic stem (ES) cell, or a rat embryonic stem (ES) cell.

[00274] The terms "polynucleotide," "polynucleotide sequence," "nucleic acid sequence," and "nucleic acid fragment" are used interchangeably herein. These terms cover nucleotide sequences and the like. A polynucleotide can be a polymer of RNA or DNA that is single-stranded or double-stranded, which optionally contains synthetic, unnatural, or altered nucleotide bases. A polynucleotide in the form of a DNA polymer can be comprised of one or more segments of cDNA, genomic DNA, synthetic DNA or mixtures thereof. Polynucleotides may comprise deoxyribonucleotides, and ribonucleotides include both naturally occurring molecules and synthetic analogues and any combination thereof. The polynucleotides provided herein also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpin forms, stem and loop structures and the like.

[00275] Recombinant polynucleotides are also provided. The terms "recombinant polynucleotide" and "recombinant DNA construct" are used interchangeably herein. A recombinant construct comprises an artificial or heterologous combination of nucleic acid sequences, e.g., regulatory and coding sequences that are not found together in nature. In other embodiments, a recombinant construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source but arranged differently from that found in nature. This construct can be used alone or can be used in conjunction with a vector. If a vector is used, then the choice of vector depends on the method that is used to transform the host cells, as is well known to those skilled in the art. For example, a plasmid vector may be used. Screening can be performed by Southern analysis of DNA, Northern analysis of mRNA expression, enzyme-linked immunosorbent assay analysis of protein expression or phenotypic analysis, among others.

[00276] In specific embodiments, one or more of the components described herein can be provided in an expression cassette for expression in the pluripotent and/or totipotent cell. The cassette may include 5' and 3' regulatory sequences operably linked to a polynucleotide provided herein. "Functionally linked" means a functional connection between two or more elements. For example, a functional link between a polynucleotide of interest and a regulatory sequence (e.g., a promoter) is a functional link that allows expression of the polynucleotide of interest. Functionally linked elements can be contiguous or non-contiguous. When used to refer to the junction of two protein-coding regions, the term functionally linked means that the coding regions are in the same reading frame. In another case, the nucleic acid sequence encoding a protein may be functionally linked to regulatory sequences (e.g., promoter sequence, enhancer, silencer, etc.) in order to maintain proper transcriptional regulation. The cassette may additionally contain at least one additional polynucleotide of interest to be introduced simultaneously into the ES cell. Alternatively, the additional polynucleotide of interest may be provided in multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of a recombinant polynucleotide to come under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.

[00277] The expression cassette may include, in the 5'-3' direction of transcription, a transcription and translation initiation region (i.e., a promoter), a recombinant polynucleotide provided herein, and a transcription termination region and translational (i.e., the termination region) functional in the mammalian cell or in a host cell of interest. The regulatory regions (e.g., promoters, transcriptional regulatory regions, and transcription and translation termination regions) and/or a polynucleotide provided herein may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or a polynucleotide provided herein may be heterologous to the host cell or to each other. For example, a promoter functionally linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if it is from the same/analogous species, one or both are substantially modified with respect to its shape and/or locus. original genomic, or the promoter is not the native promoter for the functionally linked polynucleotide. Alternatively, the regulatory regions and/or a recombinant polynucleotide provided herein may be entirely synthetic.

[00278] The termination region may be native to the transcriptional initiation region, may be native to the functionally linked recombinant polynucleotide, may be native to the host cell, or may be derived from another source (e.g., foreign or heterologous) with respect to the promoter, the recombinant polynucleotide, the host cell or any combination thereof.

[00279] In preparing the expression cassette, the various DNA fragments can be manipulated to provide the DNA sequences in the appropriate orientation. For this purpose, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide convenient restriction sites, removal of superfluous DNA, removal of restriction sites or the like. To this end, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g. transitions and transversions, may be involved.

[00280] Various promoters can be used in the expression cassettes provided here. Promoters can be selected based on the desired outcome. It is recognized that different applications can be improved by the use of different promoters in the expression cassettes to modulate the timing, localization and/or level of expression of the polynucleotide of interest. Such expression constructs may also contain, if desired, a promoter regulatory region (e.g., one that confers inducible, constitutive, environmentally or developmentally regulated, or cell- or tissue-specific/selective expression), a transcription, a ribosome binding site, an RNA processing signal, a transcription termination site and/or a polyadenylation signal. Non-limiting embodiments include: 1. An in vitro culture comprising (a) an XY non-human mammalian embryonic stem (ES) cell that has a modification that decreases the level and/or activity of a Sry protein; and, (b) a medium comprising a base medium and supplements suitable for maintaining the non-human mammalian ES cell in culture, the medium having one or more of the following characteristics: an osmolality of about 200 mOsm/kg to less which is about 329 mOsm/kg; a conductivity of about 11 mS/cm to about 13 mS/cm; a salt of an alkali metal and a halide in a concentration of about 50 mM to about 110 mM; a carbonic acid salt concentration of about 17 mM to about 30 mM; a total concentration of alkali metal halide salt and carbonic acid salt of about 85 mM to about 130 mM; and/or a combination of any two or more thereof. 2. The in vitro culture of claim 1, wherein the XY non-human mammalian ES cell is from a rodent. 3. The in vitro culture of claim 2, wherein the rodent is a mouse. 4. The in vitro culture of modality 3, wherein the XY mouse ES cell is a VGF1 mouse ES cell. 5. The in vitro culture of modality 2, in which the rodent is a rat or a hamster. 6. The in vitro culture of any of modalities 1 to 5, in which the decreased level and/or activity of the Sry protein results from a genetic modification in the Sry gene. 7. The in vitro culture of modality 6, in which the genetic modification in the Sry gene comprises an insertion of one or more nucleotides, a deletion of one or more nucleotides, a substitution of one or more nucleotides, a knockout, a knockin, a replacement of an endogenous nucleic acid sequence with a heterologous nucleic acid sequence, or a combination thereof. 8. The in vitro culture of any of embodiments 1 to 7, wherein the non-human mammal contains one ES cell, two, three or more genetic modifications. 9. The in vitro culture of modality 8, wherein the target genetic modification comprises an insertion, a deletion, a knockout, a knockin, a point mutation or a combination thereof. 10. The in vitro culture of modality 8, wherein the target genetic modification comprises at least one insertion of a heterologous polynucleotide into the XY ES cell genome. 11. The in vitro culture of any of modalities 8 to 10, in which the target genetic modification occurs in an autosome. 12. In vitro culture of any of modalities 1 to 11, in which the base medium has 50 ± 5 mM NaCl, 26 ± 5 mM carbonate and 218 ± 22 mOsm/kg. 13. In vitro culture of any of modalities 1 to 11, in which the base medium has about 3 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 218 mOsm/kg. 14. In vitro culture of any of modalities 1 to 11, in which the base medium has 87 ± 5 mM NaCl, 18 ± 5 mM carbonate and 261 ± 26 mOsm/kg. 15. In vitro culture of any of modalities 1 to 11, in which the base medium has about 5.1 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 261 mOsm/kg. 16. In vitro culture of any of modalities 1 to 11, in which the base medium has 110 ± 5 mM NaCl, 18 ± 5 mM carbonate and 294 ± 26 mOsm/kg. 17. In vitro culture of any of modalities 1 to 11, in which the base medium has about 6.4 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 294 mOsm/kg. 18. In vitro culture of any of modalities 1 to 11, in which the base medium has 87 ± 5 mM NaCl, 26 ± 5 mM carbonate and 270 ± 26 mOsm/kg. 19. In vitro culture of any of modalities 1 to 11, in which the base medium has about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 270 mOsm/kg. 20. In vitro culture of any of modalities 1 to 11, in which the base medium has 87 ± 5 mM NaCl, 26 ± 5 mM carbonate, 86 ± 5 mM glucose and 322 ± 32 mOsm/kg. 21. In vitro culture of any of modalities 1 to 11, in which the base medium has about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate, glucose/15 ml, 5 mg, 322/kg and mOsm. 22. The in vitro culture of any of modalities 1 to 21, in which, upon introduction of XY non-human mammalian ES cells into a host embryo and after gestation of the host embryo, at least 80% of the non-human mammals in F0 are XY females who, upon reaching sexual maturity, XY non-human mammal females in F0 are fertile. 23. A method for producing a fertile female XY non-human mammal in an F0 generation, comprising: (a) culturing a donor XY non-human mammal embryonic stem (ES) cell having a modification that lowers the level and/or the activity of a Sry protein in a medium comprising a base medium and supplements suitable for maintaining the non-human mammalian ES cell in culture, the medium having one or more of the following characteristics: an osmolality of about 200 mOsm /kg to less than about 329 mOsm/kg; a conductivity of about 11 mS/cm to about 13 mS/cm; a salt of an alkali metal and a halide in a concentration of about 50 mM to about 110 mM; a carbonic acid salt concentration of about 17 mM to about 30 mM; a total concentration of alkali metal halide salt and carbonic acid salt of about 85 mM to about 130 mM; and/or a combination of any two or more thereof; (b) introducing the donor XY non-human mammalian ES cell into a host embryo; (c) gestation of the host embryo; and, (d) obtain a female non-human mammal XY in F0, whereby, upon reaching sexual maturity, the female non-human mammal XY in F0 is fertile. 24. The method of embodiment 23, wherein the non-human mammalian ES cell XY is from a rodent. 25. The method of embodiment 24, wherein the rodent is a mouse. 26. The method of embodiment 25, wherein the XY mouse ES cell is a VGF1 mouse ES cell. 27. The method of embodiment 24, wherein the rodent is a mouse or a hamster. 28. The method of any one of embodiments 23 to 27, wherein the decreased level and/or activity of the Sry protein results from a genetic modification in the Sry gene. 29. The method of embodiment 28, wherein the genetic modification in the Sry gene comprises an insertion of one or more nucleotides, a deletion of one or more nucleotides, a substitution of one or more nucleotides, a knockout, a knockin, a substitution of an endogenous nucleic acid sequence with a heterologous nucleic acid sequence, or a combination thereof. 30. The method of any one of embodiments 23 to 29, wherein the non-human mammal contains one ES cell, two, three or more genetic modifications. 31. The method of embodiment 30, wherein the targeted genetic modification comprises an insertion, a deletion, a knockout, a knockin, a point mutation, or a combination thereof. 32. The method of embodiment 30, wherein the genetic modification comprises at least one insertion of a heterologous polynucleotide into an XY ES cell genome. 33. The method of any one of embodiments 30 to 32, wherein the target genetic modification occurs in an autosome. 34. The method of any of embodiments 23 to 33, wherein the base medium has 50 ± 5 mM NaCl, 26 ± 5 mM carbonate and 218 ± 22 mOsm/kg. 35. The method of any of embodiments 23 to 33, wherein the base medium has about 3 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 218 mOsm/kg. 36. The method of any of embodiments 23 to 33, wherein the base medium has 50 ± 5 mM NaCl, 26 ± 5 mM carbonate and 261 ± 26 mOsm/kg. 37. The method of any one of embodiments 23 to 33, wherein the base medium has about 5.1 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 261 mOsm/kg. 38. The method of any of embodiments 23 to 33, wherein the base medium has 50 ± 5 mM NaCl, 29 ± 5 mM carbonate and 294 ± 26 mOsm/kg. 39. The method of any one of embodiments 23 to 33, wherein the base medium has about 6.4 mg/ml NaCl, 1.5 mg/ml sodium bicarbonate and 294 mOsm/kg. 40. The method of any of embodiments 23 to 33, wherein the base medium has 87 ± 5 mM NaCl, 26 ± 5 mM carbonate and 270 ± 27 mOsm/kg. 41. The method of any one of embodiments 23 to 33, wherein the base medium has about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate and 270 mOsm/kg. 42. The method of any of embodiments 23 to 33, wherein the base medium has 87 ± 5 mM NaCl, 26 ± 5 mM carbonate, 86 ± 5 mM glucose and 322 ± 32 mOsm/kg. 43. The method of any of embodiments 23 to 33, wherein the base medium has about 5.1 mg/ml NaCl, 2.2 mg/ml sodium bicarbonate, 15.5 mg/ml glucose and 322 mOsm/kg. 44. A method for producing a transgenic non-human mammal homozygote for a target genetic mutation in the F1 generation comprising: (a) crossing a fertile XY female in F0 that has a decrease in the level and/or activity of the Sry protein with a clonal sibling in cohort derived from the same ES cell clone, non-human mammal male XY at F0, the fertile non-human mammal female XY at F0 and the non-human mammal male genetic mutation; and, (b) obtain an F1 progeny mouse that is homozygous for the genetic modification. 45. A method for modifying a genomic target locus on the Y chromosome in a cell comprising: (a) providing a cell comprising a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent, (b) introducing , in the cell, (i) the nuclease agent, wherein the nuclease agent induces an incision or double-strand break at the first recognition site; and, (ii) a first targeting vector comprising a first insertion polynucleotide flanked by a first and a second homology arms corresponding to a first and a second target sites located in sufficient proximity to the first recognition site, wherein the The total sum of the first homology arm and the second homology arm is at least 4 kb, but less than 150 kb; and (c) identify at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus. 46. A method for modifying a genomic target locus on the Y chromosome in a cell comprising: (a) providing a cell comprising a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent, (b) introducing , in the cell, a first targeting vector comprising a first insertion polynucleotide flanked by a first and a second homology arms corresponding to a first and a second target sites, wherein the sum total of the first homology arm and the second arm of homology is at least 4 kb, but less than 150 kb; and, (c) identify at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus. 47. The method of embodiment 45 or 46, wherein the cell is a mammalian cell. 48. The method of embodiment 47, wherein the mammalian cell is a non-human cell. 49. The method of embodiment 47, wherein the mammalian cell is from a rodent. 50. The method of embodiment 49, wherein the rodent is a rat, mouse or hamster. 51. The method of any one of embodiments 45 to 50, wherein the cell is a pluripotent cell. 52. The method of any one of embodiments 45 to 50, wherein the mammalian cell is an induced pluripotent stem (iPS) cell. 53. The method of embodiment 51, wherein the pluripotent cell is a non-human embryonic stem (ES) cell. 54. The method of embodiment 51, wherein the pluripotent cell is a rodent embryonic stem (ES) cell, a mouse embryonic stem (ES) cell, or a rat embryonic stem (ES) cell. 55. The method of any one of embodiments 45 and 47 to 54, wherein the nuclease agent is an mRNA encoding a nuclease. 56. The method of any one of embodiments 45 and 47 to 54, wherein the nuclease agent is a zinc finger nuclease (ZFN). 57. The method of any of embodiments 45 and 47 to 54, wherein the nuclease agent is a Transcription Activator-Like Effector Nuclease (TALEN). 58. The method of any one of embodiments 45 and 47 to 54, wherein the nuclease agent is a meganuclease. 59. The method of any one of embodiments 45 and 47 to 54, wherein the agent is an endonuclease cas9 guided CRISPR RNA nuclease. 60. A method for modifying the Y chromosome comprising exposing the Y chromosome to a Cas protein and a CRISPR RNA in the presence of a large targeting vector (LTVEC) comprising a nucleic acid sequence of at least 10 kb, wherein, after Upon exposure to Cas protein, CRISPR RNA, and LTVEC, the Y chromosome is modified to contain at least 10 kb of nucleic acid sequences. 61. The method of modality 60, wherein the LTVEC comprises a nucleic acid sequence of at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least least 80 kb or at least 90 kb. 62. The method of embodiment 60, wherein the LTVEC comprises a nucleic acid sequence of at least 100 kb, at least 150 kb, or at least 200 kb. 63. A method for modifying a genomic target locus on the Y chromosome, comprising: (a) providing a mammalian cell comprising the genomic target locus on the Y chromosome, the genomic target locus comprising an RNA target sequence guide (gRNA); (b) introducing into the mammalian cell: (i) a large targeting vector (LTVEC) comprising a first nucleic acid flanked with targeting arms homologous to the genomic target locus, wherein the LTVEC is at least 10 kb; (ii) a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding a Cas protein, and (iii) a second expression construct comprising a second promoter operably linked to a third nucleic acid encoding a guide RNA (gRNA) comprising a nucleotide sequence that hybridizes to the gRNA target sequence and a transactivating CRISPR RNA (tracrRNA), with the first and second promoters being active in the mammalian cell; and (c) identifying a modified mammalian cell comprising a target genetic modification at the genomic target locus on the Y chromosome. 64. The method of embodiment 63, wherein the LTVEC is at least 15 kb, at least 20 kb, at least at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb or at least 90 kb. 65. The method of embodiment 63, wherein the LTVEC is at least 100 kb, at least 150 kb, or at least 200 kb. 66. The method of embodiment 63, wherein the mammalian cell is a non-human mammalian cell. 67. The method of embodiment 63, wherein the mammalian cell is a fibroblast. 68. The method of embodiment 63, wherein the mammalian cell is from a rodent. 69. The method of embodiment 68, wherein the rodent is a rat, mouse or hamster. 70. The method of embodiment 63, wherein the mammalian cell is a pluripotent cell. 71. The method of embodiment 70, wherein the pluripotent cell is an induced pluripotent stem (iPS) cell. 72. The method of embodiment 70, wherein the pluripotent cell is a mouse embryonic stem (ES) cell or a rat embryonic stem (ES) cell. 73. The method of embodiment 70, wherein the pluripotent cell is a developmentally restricted human progenitor cell. 74. The method of embodiment 63, wherein the Cas protein is a Cas9 protein. 75. The method of embodiment 74, wherein the gRNA target sequence is immediately flanked by a Protospacer Adjacent Motif (PAM) sequence. 76. The method of embodiment 63, wherein the total sum of 5' and 3' homology arms of the LTVEC is from about 10 kb to about 150 kb. 77. The method of embodiment 76, wherein the sum total of the 5' and 3' homology arms of the LTVEC is from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about from 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 120 kb, or from about 120 kb to about 150 kb . 78. The method of embodiment 63, wherein the target genetic modification comprises: (a) a replacement of an endogenous nucleic acid sequence with a homologous or orthologous nucleic acid sequence; (b) a deletion of an endogenous nucleic acid sequence; (c) a deletion of an endogenous nucleic acid sequence, wherein the deletion ranges from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb , from about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, or from about 150 kb to about 200 kb, from about 200 kb to about 300 kb, from about 300 kb to about 400 kb, from about 400 kb to about 500 kb, from about 500 kb to about 1 Mb , from about 1 Mb to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb; (d) insertion of an exogenous nucleic acid sequence; (e) insertion of an exogenous nucleic acid sequence ranging from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, from about 150 kb to about 200 kb, from about 200 kb to about 250 kb, from about 250 kb to about 300 kb, from about 300 kb to about 350 kb, or from about 350 kb to about 400 kb; (f) insertion of an exogenous nucleic acid sequence comprising a homologous or orthologous nucleic acid sequence; (g) inserting a chimeric nucleic acid sequence comprising a human and a non-human nucleic acid sequence; (h) insertion of a conditional allele flanked with site-specific recombinase target sequences; (i) insertion of a selectable marker or a reporter gene functionally linked to a third active promoter in the mammalian cell; or (j) a combination thereof. 79. The method of embodiment 63, wherein the genomic target locus comprises (i) a 5' target sequence that is homologous to a 5' homology arm; and (iii) a 3' target sequence that is homologous to a 3' homology arm. 80. The method of embodiment 79, wherein the 5' target sequence and the 3' target sequence are separated by at least 5 kb, but less than 3 Mb. 81. The method of embodiment 79, wherein the The 5' target sequence and the 3' target sequence are separated by at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb at least 60 kb but less than 80 kb at least about 80 kb but less than 100 kb at least 100 kb but less than 150 kb or at least 150 kb , but less than 200 kb, at least about 200 kb, but less than about 300 kb, at least about 300 kb, but less than about 400 kb, at least about 400 kb, but less than about 500 kb, at least about 500 kb, but less than about 1 Mb, at least about 1 Mb, but less than about 1.5 Mb, at least about 1.5 Mb, but less than about 2 Mb , at least about 2 Mb, but less than about 2.5 Mb, or at least about 2.5 Mb, but less than about 3 Mb. 82. The method of embodiment 63, wherein the first and second expression constructs are on a single nucleic acid molecule. 83. The method of embodiment 63, wherein the genomic target locus comprises the Sry locus. 84. A method for target genetic modification on the Y chromosome of a non-human animal, comprising: (a) modifying a genomic locus of interest on the Y chromosome of a non-human pluripotent cell, in accordance with the method of embodiment 4, thereby producing a non-human genetically modified pluripotent cell comprising a targeted genetic modification on the Y chromosome; (b) introducing the modified non-human pluripotent cell of (a) into a non-human host embryo; and (c) gestating the non-human host embryo comprising the pluripotent cell modified in a substituent, wherein the substituent produces F0 progeny comprising the target genetic modification, wherein the target genetic modification can be transmitted through the germline. 85. The method of embodiment 84, wherein the genomic locus of interest comprises the Sry locus. 86. A method for modifying a genomic target locus on the Y chromosome in a cell comprising: (a) providing a cell comprising a genomic target locus on the Y chromosome comprising a recognition site for a nuclease agent, (b) introducing , in the cell, (i) the nuclease agent, wherein the nuclease agent induces an incision or double-strand break at the first recognition site; and, (ii) a first targeting vector comprising a first insertion polynucleotide flanked by a first and a second homology arms corresponding to a first and a second target sites located in sufficient proximity to the first recognition site, wherein the length of the first homology arm and/or the second homology arm is at least 400 bp, but less than 1000 bp; and (c) identify at least one cell that comprises, in its genome, the first insertion polynucleotide integrated into the genomic target locus. 87. The method of embodiment 86, wherein the length of the first homology arm and/or the second homology arm is about 700 bp to about 800 bp. 88. The method of embodiment 86, wherein the modification comprises a deletion of an endogenous nucleic acid sequence. 89. The method of embodiment 88, wherein the deletion ranges from about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to about 150 kb, or from about 150 kb to about 200 kb, from about 200 kb to about 300 kb, from about 300 kb to about 400 kb, from about 400 kb to about 500 kb, from about 500 kb to about 1 Mb, from about 1 Mb to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb. 90 .The method of modality 88, in which the deletion is at least 500 kb.

[00281] The present methods and compositions can be configured in many different ways and should not be considered as a limitation of the modalities defined in the present invention; rather, these embodiments are provided so that this disclosure meets applicable legal requirements. Similar numbers refer to similar elements throughout this document.

[00282] Various modifications and other modalities of the methods and compositions defined in the present invention will be recognized by those skilled in the art to which these methods and compositions belong, having the benefit of the teachings presented in the following descriptions and in the associated drawings. Therefore, it is to be understood that the methods and compositions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are included within the scope of the appended claims. Although specific terms are employed in the present disclosure, they are used only in a generic and descriptive sense and not for limiting purposes.

[00283] The following examples are presented by way of illustration, but without this constituting a limitation.

EXAMPLES Example 1. Targeting of the Sry Gene on the Y Chromosome Aided by TALENs or CRISPR

[00284] A targeted deletion comprising a lacZ replacement allele for Sry was created with a targeting vector comprising, in order, an upstream homology arm of approximately 700 bp, a beta-galactosidase (lacZ) coding sequence followed of a polyadenylation signal, a neomycin resistance cassette flanked by loxP sites comprising a human ubiquitin C promoter, including the first exon, the first intron and part of the second exon, a neomycin phosphotransferase coding sequence and a polyadenylation signal and a downstream homology arm of approximately 650 bp. The allele created by correctly targeting the Sry gene with the targeting vector comprises a deletion of the Sry open reading frame of approximately 1 kb and replacement with the lacZ-neo cassette such that the beta-galactosidase coding sequence is fused in frame at the start codon of Sry. The targeting vector was used to target the Sry gene in both F1 hybrid ES cell lines, namely VGB6 (also called B6A6) C57BL/6 and VGF1 (also called F1H4) C57BL6/129. Mouse VGF1 (F1H4) ES cells were derived from hybrid embryos produced by crossing a female C57BL/6NTac mouse with a male 129S6/SvEvTac mouse. Therefore, VGF1 ES cells contain mouse Y chromosome 129S6/SvEvTac. Female XY mice produced from the VGF1 cell line contain a 129S6/SvEvTac mouse-derived Y chromosome.

Example 2. TALEN or CRISPR-Induced Mutations in the Sry Gene on the Y Chromosome

[00285] Deletion mutations, presumably the result of non-homologous end-joint repair (NHEJ) of double-stranded DNA breaks, ranging from 3 bp to 1.2 kb and larger, were created in the Sry gene by the action of a TALEN or CRISPR guide RNAs, in combination with Cas9 DNA endonuclease (see Figure 1). ES cells comprising TALEN- and CRISPR-induced mutations in the Sry gene also carried random transgenic insertions from the NIH KOMP VG12778 LTVEC project (available via the Internet on the World Wide Web (www) at "velocigene.com/komp/detail/12778 "), which comprises a deletion of the Sry coding sequence and replacement with an insertion cassette comprising lacZ fused in frame to the Sry start codon and a neomycin resistance gene flanked by 38 and 37 kb homology arms and based on a BAC from the bMQ library (129S7/SvEv Brd- Hprt b-m2). LTVEC comprises, in its homology arms, all known control elements for Sry expression. Its lacZ-encoded betagalactosidase serves as a reporter for tissue-specific and developmental stage-specific expression of the Sry gene. TALEN- and CRISPR-induced mutations, accompanied by LTVEC insertions, were created in both VGB6 (also called B6A6) and VGF1 (also called F1H4) ES cell lines.

[00286] We obtained a TALEN (TALEN-1) designed to target part of the HMG box DNA binding motif coding sequence (upstream recognition sequence: 5'-TCCCGTGGTGAGAGGCAC- 3'; downstream recognition sequence: 5' -TATTTTGCATGCTGGGAT- 3') in the Sry gene. TALEN-1 was active in creating NHEJ mutations at the Sry locus in multiple experiments.

[00287] Both VGB6 and VGF1 mouse ES cells were created with TALEN-induced mutations. Table 1 contains a list of all clones and the sizes of the deletion mutations they carry. (ND in Table 1 indicates that a mutation was detected by a qPCR assay, but that the exact molecular nature of the mutation was not determined.) All clones also carry at least one copy of the NIH KOMP VG12778 LTVEC project.Table 1 *Also contained a 50 bp insertion

[00288] The results of microinjections of mutant Sry clones are presented in Table 2 and the results of culturing sex-reversed females are presented in Table 3. Table 2 Table 3 * The XY female with ID No. 1460406 had to be euthanized before birth, as she had a crisis close to term and was unable to give birth. Their dead offspring (4 males, 5 females) were recovered by dissection and none had the Sry mutation.

[00289] All VelociMice with Sry mutations derived from VGB6 ES cells were female, as expected for Sry inactivation (Table 2). Those without Sry mutations but carrying at least one copy of the NIH KOMP VG12778 LTVEC produced only VelociMice males (Table 2, clones GB4 and GG1). When 17 B6 VelociMice females with mutant Sry were produced as a test, only one became pregnant after about four months of reproductive setup (Table 3), and that female had to be euthanized before birth because she had a seizure near term and couldn't give birth. Their dead offspring (4 males, 5 females) recovered by dissection were all WT; none had the Sry mutation. It was concluded that almost all mice with mutant Sry produced from VGB6 ES cells are sterile, which is in agreement with the literature on Sry mutations. However, our data demonstrated a very different result with VGF1 clones.

[00290] First, VGF1 ES cells were maintained, as usual, in our low osmotic potential growth medium of the KO-DMEM type which is feminizing: some of the microinjected XY clones raised in this medium will produce fertile XY females, i.e. a phenomenon of XY females, although these do not carry mutations. An example is the TH4 clone, which does not have the Sry mutation, but which carries at least one copy of the NIH KOMP VG12778 LTVEC. This clone produced 2 females and 6 males VelociMice (Table 2). Two other VGF1 clones without Sry mutations (TA3 and TA4, Table 2) produced only male VelociMice. We aimed to determine whether XY VGF1 ES cells with mutations in Sry can also be feminized by the medium. In other words, unlike VGB6 ES cells with mutant Sry, would they produce some fertile XY females with mutant Sry? (Note that VGB6 ES cells cannot be maintained in low osmotic potential media of the KO-DMEM type and maintain the ability to produce mice.) The answer is yes, as shown in Table 3.

[00291] Six VGF1 ES cell clones with small TALEN-induced deletions ranging from 5 bp to more than 1 kb were microinjected. All VelociMice females produced, 32 of which were bred. Notably, all VelociMice XY females with mutant Sry were fertile; each produced at least one litter (Table 3). Many of the XY females with mutant Sry produced multiple normal-sized litters, whereas some of the XY females produced only one or two small litters. Of the 299 F1 mice from these breedings that were genotyped, approximately half (146.49%) are normal XY males or normal XX females. 174 (58%) of the F1 mice were phenotypic females, while 125 (42%) were phenotypic males. 26 of the females (15% of females, 8.7% of the total F1 generation) were XY females that inherited a mutant Sry allele. Due to meiotic nondisjunction events associated with XY oocytes, several aberrant genotypes - XXY, XYY, XO, XXYY - some of which included mutant Sry alleles, were observed in the F1 progeny of VelociMice XY females with mutant Sry.

[00292] A method for efficiently creating fertile XY VelociMice females from XY ES cells has been discovered. If inactivating mutations are created in the Sry gene in ES cells that have been maintained in feminizing growth medium, a high proportion of fertile XY mouse females are obtained which, when crossed with males, produce mostly male and female mice. mice with normal X and Y chromosomes.

Example 3. Embryo recovery in KO-DMEM or DMEM after TALEN-induced mutations in the Y Chromosome Sry Gene

[00293] The correct targeting of mouse Sry by LTVEC was confirmed or denied by genotyping the F1 litter derived from F0 females, which were XY and carried the Sry mutation. Cosegregation in F1 mice of the LacZ/Neo cassette with the Sry mutation (as assessed by Sry LOA assays) strongly suggests correct targeting. The failure of LacZ/Neo to cosegregate with the mutation indicates that the original clone contained a Sry deletion mutation (induced by TALEN) linked to a LacZ/Neo transgenic insertion elsewhere in the genome.

[00294] The offspring of XY females with Sry mutations presented a variety of abnormal karyotypes at a high frequency (including XXY, XYY and XO). Sex chromosome count was assessed using loss of allele (LOA) assays for genes on the X and Y chromosomes. Sry copy number was then determined using LOA assays. The presence of the mutant Sry allele was deduced in mice in which the number of copies of the Y chromosome exceeded the number of copies of Sry (e.g., 1 copy of Y and 0 copies of Sry, or 2 copies of Y and 1 copy of Sry). Finally, the presence of LacZ and Neo was determined using TaqMan assays.

[00295] In the set of original clones, which were created by Sry LTVEC with TALEN nuclease and grown in KO-DMEM, it was evident that the LacZ/Neo cassette was not cosegregating with the Sry mutation. A sample litter of these clones is shown in Table 4. Table 4: Screening of clones generated by Sry LTVEC with TALEN nuclease

[00296] In subsequent sets of clones, each was created by Sry LTVEC with TALEN nuclease and grown in DMEM, the LacZ/Neo cassette was completely cosegregating with the Sry mutation, indicating correct targeting. A typical litter of these clones is shown in Table 5. Table 5: Screening results for clones created by Sry LTVEC with TALEN nuclease

Example 4. TALEN and CRISPR-Assisted Targeting of Sry by SmallTVECs or LTVECs

[00297] As illustrated in Figure 2, the targeted deletion comprising a lacZ replacement allele for Sry was created with an LTVEC or with a small targeting vector (smallTVEC) or with TALEN nuclease or CRISPR guide RNAs, in combination with DNA endonuclease of Cas9. smallTVEC comprised, in order, an upstream homology arm of approximately 700 to 800 bp, a beta-galactosidase (lacZ) coding sequence followed by a polyadenylation signal, a neomycin resistance cassette flanked by loxP sites comprising a human ubiquitin C promoter, including the first exon, the first intron and part of the second exon, a neomycin phosphotransferase coding sequence and a polyadenylation signal, and a downstream homology arm of approximately 700-800 bp. The allele created by correctly targeting the Sry gene with the targeting vector comprises a deletion of the Sry open reading frame of approximately 1 kb and replacement with the lacZ-neo cassette, such that the beta-galactosidase coding sequence be fused in frame at the start codon of Sry. The targeting vector was used to target the Sry gene in the F1 VGF1 (also called F1H4) hybrid ES cell line C57BL6/129 and the VGB6 (also called B6A6) ES cell line.

[00298] As illustrated in Table 6, clones produced using four different gRNAs and a pair of TALEN were produced and screened for cleavage and allele loss by TaqMan assays. Table 6: Screening results for cleavage and allele loss

[00299] LTVEC transgenic clones produced embryos with the same lacZ pattern. Figure 3 illustrates LacZ expression in embryos.

[00300] Table 7 presents the fertility results of XY females derived from ES cells cultured in conventional DMEM-based medium that had Sry target mutations by LTVEC deletion-replacement assisted by TALEN. Unexpectedly compared with results from a similar experiment with ES cells cultured in KO-DEMEM-based medium (Table 3), targeting LTVEC in DMEM-based medium produced clones with correctly targeted Sry deletions and lacZ-neo insertions. . Forty of 41 XYSry(lacZ) females derived from four target clones produced offspring that were born alive after mating - a fertility rate of 98%. Thus, two new ways of producing highly fertile XY females from mutant ES cells were devised: (1) TALEN-induced inactivating mutations in Sry in ES cells cultured in a KO-DMEM-based medium; and (2) precise target mutations by TALEN-assisted LTVEC deletion-replacement in ES cells cultured in DMEM-based medium. Table 7: Production of XY Females with Mutant Sry by TALEN

Example 5: Large Deletion on the Y Chromosome Mediated by ZFNs

[00301] As illustrated in Figure 4, large deletions, of 500 kb or more, were made on the Y chromosome using targeting by ZFNs and the Kdm5d and Usp9y genes. Table 8 presents examples of zinc finger sequences on the Y chromosome.Table 8: Zinc Finger Sequences on the Y Chromosome

[00302] In an experiment, 3.3 million ES cells from clones VGB6 D-G5 and E-G7 (Table 3) were electroporated with the ZFN mRNA pairs Kdm5d-ZFN5(NM011419-r17347a1)/ZFN6(NM011419-17353a1) and Usp9y-ZFN3(NM148943-r11830a1)/ZFN4(NM148943-11836a1) (10 ug each) and with an LTVEC targeting of the Ch25 h gene (0.67 ug) to allow selection for puromycin resistance. Puromycin-resistant colonies were selected and screened for the deletion. The results are shown in Table 9.Table 9: Screening results for large deletion on the Y chromosome in 12778D-G5 and 12778E-G7

[00303] Table 10 shows the exact size of deletions larger than 500 kb that were precisely determined for one deletion clone (4306A-D5) derived from the E-G7 precursor clone (Table 3) and two deletion clones (4306E-C4 and 4306F-A12) derived from the D-G5 precursor clone (Table 3). Table 10: ZFN-mediated deletions of Kdm5d and Usp9y

[00304] The deletion of the Kdm5d, Eif2s3y, Uty, Ddx3y and Usp9y genes (Figure 4) was confirmed in deletion allele loss assays and DNA sequencing as shown in Figure 5. Clone 4306A-D5 produced nine VelociMice females XY cells derived entirely from ES cells after microinjection into 8-cell stage embryos and transfer to substituents. None of the XY females of clone 4306A-D5 were fertile.

Example 6: Large Deletion on the Y Chromosome Mediated by CRISPR/Cas

[00305] A large deletion on the Y chromosome targeting the region between the Kdm5d and Usp9y genes was performed using CRISPR guide RNAs in combination with Cas9 DNA endonuclease. The gRNAs were designed to target the Kdm5d gene and the Usp9y gene. The following gRNAs were designed to target the Kdm5d gene: Kdm5dgA (Guide No. 1) UUUGCCGAAUAUGCUCUCGU (SEQ ID NO:66); Kdm5dgB (Guide No. 2) UUGCCGAAUAUGCUCUCGUG (SEQ ID NO:67); and Kdm5dgC (Guide No. 5) CGGGCAUCUCCAUACUCCCU (SEQ ID NO:68). The following gRNAs were designed to target the Usp9y gene: Usp9ygA (Guide No. 1) UAGCUCGUUGUGUAGCACCU (SEQ ID NO:69); Usp9ygB (Guide No. 1) UAUAGUUUCUUCGGGGUAAC (SEQ ID NO:70); and Usp9ygC (Guide No. 2) GGAUACCCUUCUAUAGGCCC (SEQ ID NO:71).

[00306] VGF1 mouse ES cells were electroporated with 5 μg of a plasmid expressing Cas9 and 10 μg each of plasmids expressing Kdm5d gRNA B and Usp9y gRNA C and with an LTVEC targeting of the Ch25 h gene (0.67 ug) to allow selection for puromycin resistance.

[00307] As illustrated in Figure 4, Kdm5dgB (gRNA B) and Usp9ygC (gRNA C) were used to perform the deletion of the Kdm5d and Usp9y genes. The resulting clones were screened for deletion by allele loss assays for sequences in the Kdm5d and Usp9y genes and the intermediate genes (Eif2s3y, Uty, and Ddx3y) and for the genes outside the target deletion (Zfy2 and Sry). As shown in Table 11, four clones comprising the large deletion were obtained. The R-A8 clone produced seven XY males and 3 fully ES cell-derived VelociMice XY females after microinjection into 8-cell stage embryos and transfer to substituents. Cas9

[00308] All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which the present invention belongs. All publications and patent applications are incorporated herein by reference in the same manner as if each individual publication or patent application were specifically and individually designated to be incorporated by reference. If the information associated with a citation, for example, a filing number changes over time, the version of the information in effect on the actual filing date of the request is considered; the effective filing date means the actual filing date or the date of a priority application that first files service. Unless otherwise evident from the context of any embodiment, the aspect, step or features of the invention may be used in combination with any other. Reference to a range of values includes any integers within the range and any subranges within the range. Reference to multiple tracks includes compounds of these tracks.

Claims (12)

1. Method for modifying a genomic target locus on a Y chromosome in a mouse embryonic stem (ES) cell, characterized in that it comprises: (a) providing the mouse embryonic stem (ES) cell comprising the target locus genomic on the Y chromosome, wherein the genomic target locus comprises a recognition site for a nuclease agent, and wherein the mouse embryonic stem (ES) cell is in a culture comprising a DMEM-based medium; (b) introducing, into the mouse embryonic stem (ES) cell: (i) the nuclease agent, wherein the nuclease agent induces an incision or double-strand break at the recognition site; and (ii) a large targeting vector comprising an insertion polynucleotide flanked by first and second homology arms corresponding to the first and second target sites located within the target genomic locus, wherein the sum total of the first homology arm and of the second arm of homology is at least 10kb, and in which the targeting vector undergoes homologous recombination with the target genomic locus; and (c) identifying at least one mouse embryonic stem (ES) cell that comprises, in its genome, the insertion polynucleotide integrated into the genomic target locus, wherein integration of the insertion polynucleotide introduces a genetic modification comprising deletion of an endogenous nucleic acid sequence and replacement with an exogenous nucleic acid sequence at the target genomic locus. 2. Method according to claim 1, characterized by the fact that the total sum of the first homology arm and the second homology arm is less than 150 kb. 3. Method according to claim 1 or 2, characterized by the fact that the nuclease agent is: (a) a zinc finger nuclease (ZFN); (b) a transcriptional activator-like effector nuclease (TALEN - Transcription Activator-Like Effector Nuclease) (c) a meganuclease; (d) a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-associated protein (Cas) and a guide RNA (gRNA), or (e) an mRNA encoding a nuclease. 4. Method according to claim 3, characterized by the fact that the nuclease agent is the Cas protein and the gRNA, wherein the Cas protein is Cas9, and wherein the gRNA comprises: (a) a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) (crRNA) that targets the recognition site, with the recognition site being immediately flanked by a PAM (Protospacer Adjacent Motif) sequence; and (b) a transactivating CRISPR RNA (tracrRNA). 5. Method according to any one of claims 1 to 4, characterized in that the insertion polynucleotide is from about 5 kb to about 400 kb in length. 6. Method according to any one of claims 1 to 5, characterized in that the insertion polynucleotide comprises a conditional allele, a polynucleotide encoding a selection marker, a nucleic acid flanked by site-specific recombination target sequences, or a reporter gene operably linked to a promoter, the reporter gene encoding a reporter protein selected from the group consisting of LacZ, mPlum, mCherry, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mCitrine, Venus, YPet, enhanced yellow fluorescent protein (EYFP), Emerald, enhanced green fluorescent protein (EGFP), CyPet, cyan fluorescent protein (CFP), Cerulean, T-Sapphire, luciferase, alkaline phosphatase and a combination thereof. 7. Method according to any one of claims 1 to 6, characterized in that the modification comprises a domain permutation, an exon permutation, an intron permutation, a regulatory sequence permutation, a gene permutation, or a combination thereof. 8. Method according to any one of claims 1 to 7, characterized by the fact that the deleted endogenous nucleic acid sequence: is from about 5 kb to about 3 Mb. 9. Method according to any one of claims 1 to 8, characterized by the fact that the deleted endogenous nucleic acid sequence is at least 500 kb. 10. Method according to any one of claims 1 to 9, characterized in that the modification comprises a replacement of an endogenous nucleic acid sequence with a homologous or orthologous nucleic acid sequence. 11. Method according to any one of claims 1 to 10, characterized by the fact that the genomic target locus on the Y chromosome is the Sry gene, the Uty gene, the Eif2s3y gene, the Ddx3y gene, the Ube1y gene, the Tspy, the Usp9y gene, the Zfy1 gene, the Zfy2 gene, or a region encompassing the Kdm5d, Eif2s3y, Tspy, Uty, Ddx3y, and Usp9y genes. 12. Method according to any one of claims 1 to 10, characterized by the fact that the genomic target locus on the Y chromosome comprises the Sry gene.