BR112016025052B1 - METHOD FOR DETERMINING THE PRESENCE OR ABSENCE OF AN ENTEROVIRUS AND/OR A PARECHOVIRUS IN A SAMPLE, COMPOSITION, PRIMER PROBE, AND KIT - Google Patents

Abstract

METHOD FOR DETERMINING THE PRESENCE OR ABSENCE OF AN ENTEROVIRUS AND/OR A PARECHOVIRUS IN A SAMPLE, COMPOSITION, PRIMER PROBE, AND KIT. Here provided are methods for determining the presence or absence of an enterovirus and parechovirus in a biological sample. The methods involve identifying the presence or absence of targeted viral nucleic acids using direct amplification from a biological sample, without a nucleic acid extraction step, but retaining substantially the same specificity and sensitivity as nucleic acid assay methods extracted. Diagnostic methods using the provided methods and compositions and kits for practicing the methods are also provided.

Description

FIELD OF THE INVENTION

[001] The present invention relates to methods for detecting and differentiating enteroviruses and parechoviruses in biological samples.

FUNDAMENTALS OF THE INVENTION

[002] The following discussion of the background of the invention is merely provided to aid the reader in understanding the invention and is not permitted to describe or constitute prior art for the present invention.

[003] Enteroviruses belong to the Picornaviridae family of viruses. They are spread from person to person via direct contact with the virus spread from the gastrointestinal or upper respiratory tract, affecting millions of people worldwide each year. They are often found in respiratory secretions, for example, saliva, phlegm, or nasal mucus, feces, and cerebrospinal fluid of an infected person. Enteroviral infection can result in a wide variety of symptoms ranging from mild respiratory illness (common cold), hand, foot, and mouth disease, acute hemorrhagic conjunctivitis, aseptic meningitis, myocarditis, illness resembling severe neonatal sepsis, and acute flaccid paralysis. Historically, poliomyelitis was the most significant disease caused by an enterovirus, poliovirus. However, there are additionally at least 62 non-polio enteroviruses that can cause disease in humans, including Coxsackie A virus, Coxsackie B virus, and echovirus.

[004] Parechovirus is a viral genus in the family Picornaviridae, a large family of non-enveloped, positive-sense, single-stranded RNA viruses that have an icosahedral capsid. The capsid is an array of 60 protomers, each made up of 4 proteins (VP1 to VP4), and encloses the linear RNA genome. The parechovirus genus is composed of two species: human parechovirus and Ljungan virus. Human parechoviruses are commonly disseminated and cause mild gastrointestinal or respiratory illness, but have been implicated in cases of myocarditis and encephalitis. More than 95% of humans are infected with human parechovirus in their youth, within two to five years of age.

[005] Clinical detection of viruses is usually performed using any of a variety of methods. For example, viral particles or nucleic acids can be isolated from a biological sample (eg, cerebrospinal fluid, nasopharyngeal aspirates, throat swabs, blood fluids, fecal material, urine, etc.). A retrospective diagnosis can be made by serology. Complement Fixation Tests (CFT) are most widely used in this method, although haemagglutination inhibition (HAI) and enzyme immunoassays (EIA) can be used to give a type-specific diagnosis. For faster diagnosis, antigen detection or RNA detection can be performed. However, screening for antigens or multiple nucleotide sequences may be necessary because of the large number of viruses in these families. Furthermore, nucleic acids usually must be extracted from a crude biological sample in order to accurately detect the presence of nucleic acids from microorganisms.

[006] Given the high degree of complexity associated with preparing and processing viral nucleic acids from biological samples for detection, diagnosis, and/or quantification in cases where rapid diagnosis is sought, there is a need for methods involving fewer steps , less technological requirements, and shorter durations. Furthermore, there is an additional need for methods that can detect and differentiate multiple types of enteroviruses and parechoviruses from other viruses in human samples with the fewest steps and without the need to extract nucleic acids from the samples.

SUMMARY OF THE INVENTION

[007] Methods are provided herein for determining the presence or absence of an enterovirus and/or a parechovirus in a biological sample.

[008] In one aspect, the present invention provides a method for determining the presence or absence of an enterovirus in a sample, the method comprising amplifying enteroviral nucleic acids, if present in the sample, with at least one pair of primers, wherein one first primer of the pair has a primer that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 1 or its entire complement, and a second primer of the pair has a primer that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 2 or the entire complement thereof.

[009] In some embodiments, the method for determining the presence or absence of an enterovirus in a sample includes (a) heating a biological sample to a first predetermined temperature for a first predetermined time to separate the secondary structure of the RNA present in the sample, (b) contacting the sample with a reaction mixture to form a reaction mixture, wherein the reaction mixture comprises a pair of primers, a DNA polymerase, a reverse transcriptase, and a plurality of free nucleotides comprising adenine, thymine, cytosine and guanine, wherein one primer of the pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 1 or its entire complement, and the other primer of the pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 2 or the entire complement thereof, (c) cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions to allow reverse transcription of the RNA , (d) amplifying a target nucleic acid sequence, the amplification comprising a step of cooling the reaction mixture to a third predetermined temperature for a third predetermined time under conditions to allow the primer element of the primers to hybridize with their sequences complementary, if present, on the first and second strands of cDNA, and to allow the DNA polymerase to extend the primers, and (e) repeat step (d). An enterovirus is determined to be present in the sample if an enteroviral target sequence is amplified to produce an amplicon in the reaction mixture. In some embodiments, step (a) is performed before step (b) (eg, the biological sample is heated, and the heated sample is contacted with the reaction mixture to form the reaction mixture). In some embodiments, step (b) is performed before step (a) (e.g., the biological sample is contacted with the reaction mixture to form the reaction mixture, and then the reaction mixture containing the biological sample is heated ).

[0010] In some embodiments, the first primer of the pair for detecting an enterovirus has a primer element that is at least 90% identical to SEQ ID NO: 1 or the full complement of SEQ ID NO: 1 and a detectable label that it is not a nucleic acid. In some embodiments, the first primer is a primer probe. In some embodiments, the primer probe has a probe element comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 3 or the full complement of SEQ ID NO: 3. The probe element may further comprise a quencher ( quencher), a fluorophore, and two self-complementary stem sequences where each stem sequence is at least 4, 5, 6, or 7 nucleotides in length. Furthermore, the second primer of the pair can have a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO: 2 or the full complement of SEQ ID NO: 2.

[0011] In some embodiments, the first primer of the pair for detecting an enterovirus has a primer element comprising a nucleotide sequence that is at least 90% identical with SEQ ID NO: 2 or the entire complement of SEQ ID NO: 2 or the entire complement of SEQ ID NO: 2 and a detectable label that is not a nucleic acid. In some embodiments, the first primer is a primer probe. In some embodiments, the primer probe has a probe element comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 3 or the full complement of SEQ ID NO: 3. In some embodiments, the probe element comprises further a quencher, a fluorophore, and two self-complementary stem sequences wherein each stem sequence is at least 4, 5, 6, or 7 nucleotides in length. In some embodiments, the second primer of the pair can have a primer element at least 90% identical to SEQ ID NO: 1 or the full complement of SEQ ID NO: 1.

[0012] Another aspect of the present invention provides a method for determining the presence or absence of parechovirus in a sample, the method comprising amplifying parechoviral nucleic acids, if present in the sample, with at least one pair of primers, wherein a first primer of the pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 4 or the entire complement thereof, and a second primer of the pair has a primer element that specifically hybridizes under stringent conditions to an acid core comprising or consisting of SEQ ID NO: 5 or its entire complement.

[0013] In some embodiments, the method for determining the presence or absence of a parechovirus in a sample includes (a) heating a biological sample to a first predetermined temperature for a first predetermined time to separate the RNA secondary structure present in the sample, providing a reaction mixture comprising a sample, a pair of primers, a DNA polymerase, (b) contacting the sample with a reaction mixture to form a reaction mixture, wherein the reaction mixture comprises a pair of primers, a DNA polymerase, a reverse transcriptase, and a plurality of free nucleotides comprising adenine, thymine, cytosine, and guanine, wherein a primer of the pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 4 or its entire complement, and the other primer in the pair has a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 5 or its entire complement, (c) cooling the reaction mixture to a second temperature predetermined for a second predetermined time under conditions to allow reverse transcription of the RNA, (d) amplifying a target nucleic acid sequence, the amplification comprising a step of cooling the reaction mixture to a third predetermined temperature for a third predetermined time under conditions to allow the primer element of the primers to hybridize to their complementary sequences, if present, on the first and second strands of cDNA, and to allow the DNA polymerase to extend the primers, (e) repeat step (d). A parechovirus is determined to be present in the sample if a parechoviral target sequence is amplified to produce an amplicon in the reaction mixture. In some embodiments, step (a) is performed before step (b) (eg, the biological sample is heated, and the heated sample is contacted with the reaction mixture to form the reaction mixture). In some embodiments, step (b) is performed before step (a) (e.g., the biological sample is contacted with the reaction mixture to form the reaction mixture, and then the reaction mixture containing the biological sample is heated ).

[0014] In some embodiments, the first primer of the pair for detecting a parechovirus has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO: 4 or the full complement of SEQ ID NO: 4 , and a detectable label that is not a nucleic acid. In some embodiments, the first primer is a primer probe. In some embodiments, the primer probe has a probe element comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 6 or the full complement of SEQ ID NO: 6. In some embodiments, the probe element comprises further a quencher, a fluorophore, and two self-complementary stem sequences wherein each stem sequence is at least 4, 5, 6, or 7 nucleotides in length. Furthermore, in some embodiments the second primer of the pair has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO: 5 or the full complement of SEQ ID NO: 5.

[0015] In some embodiments, the first primer of the pair for detecting a parechovirus has a primer element that is at least 90% identical to SEQ ID NO: 5 or the full complement of SEQ ID NO: 5 and a detectable label that it is not a nucleic acid. In some embodiments, the first primer is a primer probe. In some embodiments, the primer probe has a probe element comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 6 or the full complement of SEQ ID NO: 6. The probe element may further comprise a quencher, a fluorophore, and two self-complementary stem sequences wherein each stem sequence is at least 4, 5, 6 or 7 nucleotides in length. Furthermore, the second primer of the pair can have a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO: 4 or the full complement of SEQ ID NO: 4.

[0016] In some embodiments, the disclosed methods are used to determine the presence or absence of an enterovirus and a parechovirus in a sample that is a biological sample selected from the group consisting of cerebrospinal fluid, blood, stool, throat swab, rectal swab, nasopharyngeal swab, plasma, serum and urine. In some embodiments, nucleic acids are not extracted from the biological sample prior to reverse transcription or amplification. In some embodiments, the sample contains cDNA reverse transcribed from the RNA. In some embodiments, the sample comprises RNA, the reaction mixture further comprises a reverse transcriptase, and the reaction mixture is heated to a predetermined temperature for a predetermined time to separate RNA secondary structure present in the sample and then cooled to transcribe reverse converting the RNA in the sample into cDNA in the presence of a reverse transcriptase.

[0017] Another aspect of the invention provides a method for detecting the presence or absence of an enterovirus and a parechovirus in a sample includes (a) heating a biological sample to a first predetermined temperature for a first predetermined time to separate secondary structure from the RNA present in the sample, (b) contacting the sample with a reaction mixture to form a reaction mixture, wherein the reaction mixture comprises a first and second pair of primers, a DNA polymerase, a reverse transcriptase, and a plurality of free nucleotides comprising adenine, thymine, cytosine and guanine, wherein a primer of the first pair of primers has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 1 or the entire complement thereof, and the other primer of the first pair of primers has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 2 or its entire complement, and wherein a primer of the second pair of primers has an element primer that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 4 or its entire complement, and the other primer of the second pair of primers has a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO : 5 or its entire complement, (c) cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions to allow reverse transcription of the RNA, (d) amplifying a target nucleic acid sequence, wherein the amplification comprises a step of cooling the reaction mixture to a third predetermined temperature for a third predetermined time under conditions to allow the primer element of the primers to hybridize with their complementary sequences, if present, on the first and second strands of cDNA, and to allowing the DNA polymerase to extend the primers, and (e) repeating step (d). An enterovirus is determined to be present in the sample if an enteroviral target sequence is amplified to produce an amplicon in the reaction mixture, and a parechovirus is determined to be present in the sample if a parechovirus target sequence is amplified to produce an amplicon in the reaction mixture. In some embodiments, step (a) is performed before step (b) (eg, the biological sample is heated, and the heated sample is contacted with the reaction mixture to form the reaction mixture). In some embodiments, step (b) is performed before step (a) (e.g., the biological sample is contacted with the reaction mixture to form the reaction mixture, and then the reaction mixture containing the biological sample is heated ).

[0018] Another aspect of the invention provides a composition comprising a primer having a primer element that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, the full complement of SEQ ID NO: 1, SEQ ID NO: 2, the full complement of SEQ ID NO: 2, SEQ ID NO: 4, the full complement of SEQ ID NO: 4, SEQ ID NO: 5 and the full complement of SEQ ID NO: 5. In some embodiments , the initiator is bound directly or indirectly to a discoverable label. The composition may be a primer probe, further comprising a probe element linked directly or indirectly to the primer element by a polymerase blocking group wherein the probe element comprises a nucleic acid sequence at least 90% identical to SEQ ID NO: 3, the full complement of SEQ ID NO: 3, SEQ ID NO: 6 or the full complement of SEQ ID NO: 6. In some embodiments, the primer probe further comprises a quencher dye, and the detectable label is a fluorophore.

[0019] In a specific embodiment, a primer probe comprises a 5' quencher pigment, SEQ ID NO: 3 flanked by two self-complementary nucleotide sequences is at least 4 nucleotides in length, a fluorophore and/or a nucleic acid comprising the SEQ ID NO: 2. In another specific embodiment, a primer probe comprises a 5' fluorophore, a nucleic acid comprising SEQ ID NO: 6 flanked by two self-complementary nucleotide sequences is at least 4 nucleotides in length, a quencher dye , and a nucleic acid comprising SEQ ID NO: 5. In some embodiments, the primer probe further comprises a spacer consisting of polyethylene glycol. In some embodiments, the spacer comprises an 18-atom polyethylene glycol-based linker. In some embodiments, the spacer consists of material other than nucleotides (i.e., a non-nucleotide spacer). In some embodiments, the spacer may be located immediately 5' from the starter element.

[0020] The present invention also provides kits comprising the oligonucleotides, primers and primer probes disclosed herein. In one embodiment, a kit comprises a first primer having a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 1 or the entire complement thereof, and a second primer having a primer element that specifically hybridizes to an acid nucleic acid comprising or consisting of SEQ ID NO: 2 or its entire complement, wherein at least one of the primers is labeled with a detectable label that is not a nucleic acid. In one embodiment, a kit comprises a first primer having a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 4 or the entire complement thereof, and a second primer having a primer element that specifically hybridizes to an acid nucleic acid comprising or consisting of SEQ ID NO: 5 or its entire complement, wherein at least one of the primers is labeled with a detectable label that is not a nucleic acid.

[0021] In one embodiment, a kit comprises (a) a first pair of primers comprising a first primer having a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 1 or the entire complement thereof, and a second primer having a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 2 or its entire complement; and (b) a second pair of primers comprising a first primer having a primer that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 3 or the entire complement thereof, and a second primer having a primer that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 5 or its entire complement wherein at least one of the primers of the first and second pair of primers is labeled with a detectable label that is not a nucleic acid.

[0022] In one embodiment there is provided a kit comprising a primer pair that detects an enterovirus and a primer pair that detects a parechovirus as described herein. Another embodiment provides a kit comprising a primer pair that detects at least 64 enterovirus serotypes and a primer pair that detects at least 8 parechovirus serotypes.

[0023] Another aspect of the invention provides a method of amplifying a target nucleotide sequence comprising providing a reaction mixture comprising a double-stranded target DNA, a pair of primers wherein the first primer specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 1 or its entire complement, and the second primer specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 2 or its entire complement, a DNA polymerase, and a plurality of free nucleotides comprising adenine, thymine, cytosine and guanine; heating the reaction mixture to a first predetermined temperature for a first predetermined time to separate the strands of double-stranded DNA from each other, cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions to allow the first and second primers hybridize to their complementary sequences on the first and second strands of the target DNA, and to allow the DNA polymerase to extend the primers, repeat the above steps. In some embodiments, at least one of the primers is the primer probe comprising a detectable label that is not a nucleic acid. In some embodiments, the initiators are initiators as disclosed herein. In some embodiments, the DNA is a cDNA.

[0024] Another aspect of the invention provides a method of amplifying a target nucleotide sequence comprising providing a reaction mixture comprising a double-stranded target DNA, a pair of primers wherein the first primer specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 4 or its entire complement, and the second primer specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 5 or its entire complement, a DNA polymerase, and a plurality of free nucleotides comprising adenine, thymine, cytosine and guanine; heating the reaction mixture to a first predetermined temperature for a first predetermined time to separate the strands of double-stranded DNA from each other, cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions to allow the first and second primers hybridize to their complementary sequences on the first and second strands of the target DNA, and to allow the DNA polymerase to extend the primers, repeat the above steps. In some embodiments, at least one of the primers is the primer probe comprising a detectable label that is not a nucleic acid. In some embodiments, the initiators are initiators as disclosed herein. In some embodiments, the DNA is a cDNA.

[0025] The methods disclosed herein additionally can be used for diagnosing an individual as infected with enterovirus or parechovirus.

DETAILED DESCRIPTION

[0026] The present invention is directed to diagnostic methods for the detection of enteroviruses and parechoviruses using a multiplex analyte detection system. The method does not require an extraction or purification step to isolate viral nucleic acid (i.e., target) prior to PCR. The disclosed methods can detect 64 enterovirus serotypes and parechovirus serotypes 1-8 in an unextracted human biological sample.

[0027] More particularly, the disclosed sample-for-response assay is designed as a moderately complex, multiplex analyte detection system in which initial sample preparation is followed by reverse transcription and polymerase chain reaction detection and differentiation (Real-time PCR) of enteroviral and parechoviral analytes targets. In some embodiments, both reverse transcription and real-time PCR are performed on a centrifugal microfluidic disk such as a consumable Universal or Direct Amplification Disk (Focus Diagnostics (Cypress, CA, USA) and 3M Company (St. Paul, MN , USA)). In such embodiments, a biological sample is loaded directly into a sample-to-response disk, without requiring a separate initial interface sample preparation. Qualitative detection and differentiation of enteroviruses and parechoviruses then uses primer probes such as SCORPION® chemistry primers and real-time PCR for amplification and detection of target analytes in a cycler system such as the 3M Integrated System cycler. In some embodiments, target viral genomic RNA is reverse transcribed and specifically amplified and simultaneously detected by fluorescently labeled probes in the same reaction well. The presence of each pathogen is determined by a corresponding distinct fluorescent signal. In some embodiments the RNA in the sample is reverse transcribed in a first reaction that may or may not be performed on a consumable disk, and the real-time PCR is performed in a separate assay.

[0028] Primers, probes, and/or primer probes specific for amplification and detection of an internal control can be included in the same reaction mix to monitor potential PCR inhibition. Reagents required for amplification and detection of target and RNA internal control can be formulated as a multifunctional reaction mix, which is supplied as single reaction aliquots.

[0029] As used herein, unless otherwise stated, the singular forms "an," "an," and "the/the" include plural references. Thus, for example, a reference to "an oligonucleotide" includes a plurality of oligonucleotide molecules, and a reference to "a nucleic acid" is a reference to one or more nucleic acids.

[0030] As used herein, "about" means plus or minus 10%.

[0031] A pair of primers that “specifically hybridize under stringent conditions” to a target gene need not hybridize to the entire gene. Consequently, a pair of primers can amplify an entire amplified gene or just a segment of a gene, depending on the portion of the gene to which the primers specifically hybridize.

[0032] The term "amplification" or "amplify" as used herein includes methods for copying a target nucleic acid, thereby increasing the copy number of a selected nucleic acid sequence. The amplification can be exponential or linear. A target nucleic acid can be DNA (such as, for example, genomic DNA and cDNA) or RNA. Sequences amplified in this way form an “amplicon.” Although the exemplary methods described below pertain to amplification using the polymerase chain reaction (PCR), numerous other methods are known in the art for the amplification of nucleic acids (e.g., isothermal methods, rolling circle methods, etc.) . The skilled artisan will understand that these other methods can be used in place of, or in conjunction with, PCR methods. See, for example, Saiki, "Amplification of Genomic DNA" in PCR Protocols, Innis et al., Eds., Academic Press, San Diego, CA 1990, pp 13-20; Wharam, et al., Nucleic Acids Res. Jun 1, 2001; 29(11): E54-E54; Hafner, et al., Biotechniques Apr 2001; 30(4): 852-860.

[0033] The terms "complement," "complementary," or "complementarity" as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or target nucleic acid) refer to Watson's pairing rules /Crick default. The complement of a nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in "antiparallel association." For example, the sequence "5'-A-G-T-3'" is complementary to the sequence "3'-T-C-A-5'." Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids described herein; these include, for example, Inosine, 7-deazaguanine, Blocked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; Stable duplexes may contain mismatched base pairs, degenerate, or mismatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically by considering several variables including, for example, oligonucleotide length, base composition and oligonucleotide sequence, ionic strength, and incidence of mismatched base pairs. A complement sequence can also be an RNA sequence complementary to the DNA sequence or its complement sequence, and it can also be a cDNA. The term "substantially complementary" as used herein means that the two sequences specifically hybridize (defined below). The skilled artisan will understand that substantially complementary sequences need not hybridize over their entire length. A nucleic acid that is "full complement" or that is "fully complementary" to a reference sequence consists of a nucleotide sequence that is 100% complementary (under Watson/Crick matching rules) to the reference sequence along of the entire length of the nucleic acid that is the entire complement. An integer complement does not contain any mismatches with the reference sequence.

[0034] As used herein, the term "detect" used in the context of detecting a signal from a detectable label to indicate the presence of a target nucleic acid in the sample does not require the method to provide 100% sensitivity and/or 100% accuracy. specificity. As is well known, "sensitivity" is the probability that a test is positive, given that the person has a target nucleic acid, while "specificity" is the probability that a test is negative, given that the person does not have the target nucleic acid. target nucleic acid. A sensitivity of at least 50% is preferred, although sensitivities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred. A specificity of at least 50% is preferred, although specificities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred. Detect also covers false positive and false negative assays. False negative rates can be 1%, 5%, 10%, 15%, 20% or even higher. False positive rates can be 1%, 5%, 10%, 15%, 20% or even higher.

[0035] A "fragment" in the context of a nucleic acid refers to a sequence of nucleotide residues that is at least about 5 nucleotides, at least about 7 nucleotides, at least about 9 nucleotides, at least about 11 nucleotides, or at least about 17 nucleotides. The fragment is typically less than about 300 nucleotides, less than about 100 nucleotides, less than about 75 nucleotides, less than about 50 nucleotides, or less than 30 nucleotides. In certain embodiments, the fragments can be used in polymerase chain reaction (PCR), various hybridization procedures, or microarray procedures to identify or amplify identical or related parts of RNA or DNA molecules. A fragment or segment can uniquely identify each polynucleotide sequence of the present invention.

[0036] As used herein, a “kit” refers to a packaged collection of compounds used for a specific purpose. Non-limiting examples of materials in which a kit may be packaged include boxes, bags, envelopes and tubes, but the kit compounds may be supplied to a consumer in additional types of packaging materials. In some embodiments, the primers and/or probes included in a kit are isolated polynucleotides and may be provided in tubes, vials, or other types of containers within the kit. In some embodiments a kit further contains instructions for using the compounds in the kit. Instructions can be printed on a material inside the kit or provided in electronic format. In some embodiments, printed instructions specify how to use the reagents contained in the kit to detect the presence or absence of an enterovirus and/or parechovirus in a specimen.

[0037] The term "multiplex PCR" as used herein refers to the simultaneous amplification of two or more products within the same reaction vessel. Each product starts using a different pair of starters. A multiplex reaction can also include product-specific probes that are labeled with detectable moieties. In some embodiments, a multiplex PCR reaction uses a pair of primers where one primer is a primer probe such as, for example, a SCORPION® primer.

[0038] As used herein, the term "oligonucleotide" refers to a short polymer composed of deoxyribonucleotides, ribonucleotides, or any combination thereof. Oligonucleotides are generally at least about 10, 11, 12, 13, 14, 15, 20, 25, 40 or 50 to about 100, 110, 150 or 200 nucleotides (nt) in length, more preferably about 10, 11, 12, 13, 14, or 15 to about 70 or 85 nt, and most preferably from about 18 to about 26 nt in length. The single letter code for nucleotides is as described in the U.S. Patent Office Manual of Patent Examining Procedure, section 2422, table 1. In this regard, the nucleotide designation "R" means purine such as guanine or adenine, "Y" means pyrimidine such as cytosine or thymidine (uracilase RNA); and "M" means adenine or cytosine. An oligonucleotide can be used as a primer or as a probe.

[0039] As used herein, a "primer" for amplification comprises a primer element wherein the primer element is an oligonucleotide that is complementary to and hybridizes to a target nucleotide sequence and leads to the addition of nucleotides to the 3' end of the primer at the presence of a DNA or RNA polymerase. In some embodiments an initiator consists of an initiator element. However, an initiator as used here may contain additional elements in addition to the initiator element. For example, a primer can contain a primer element and a detectable label such as a fluorophore. Furthermore, a starter can contain a probe element in addition to a starter element. As used herein, the entire molecule is referred to as a primer. A primer probe is an exemplary primer. The 3' nucleotide of the primer element in a primer generally must be identical to the target nucleic acid sequence at a corresponding nucleotide position for optimal expression and amplification. The term "primer" as used herein includes all forms of primers that can be synthesized including peptide nucleic acid primers, gated nucleic acid primers, phosphorothioate-modified primers, labeled primers, and the like. As used herein, a "leader primer" has a primer element that is complementary to the antisense strand of dsDNA. A "reverse primer" has a primer element that is complementary to the dsDNA sense strand. An "exogenous primer" specifically refers to a primer that is added to a reaction vessel containing a sample and/or target nucleic acid to be amplified (ie, is not produced from amplification in the reaction vessel).

[0040] A primer element in a primer is typically at least 10, 12, 15, 18, or 30 nucleotides in length up to about 25, 50, 60, 100, 110, 125, or 200 nucleotides in length, preferably of at least 15 to about 60 nucleotides in length, and most preferably at least 25 to about 40 nucleotides in length. In some embodiments, a primer, primer element, or probe is 15 to 35 nucleotides in length. There is no standard length for optimal polymerase chain reaction hybridization or amplification. An optimal length for a particular primer application can easily be determined in the manner described in H. Erlich, PCR Technology, Principles and Application for DNA Amplification, (1989). A primer element can be attached directly or indirectly to another constituent such as, for example, a probe element and/or a fluorophore. Indirect bonding means that the two compounds are connected through one or more additional compounds that reside between the two indirectly bonded compounds. Two compounds are directly linked when they are connected to each other directly without any intervening compounds.

[0041] A "primer pair" is a pair of primers with primer elements that are both directed to different regions of a target nucleic acid sequence. A primer pair contains a forward primer and a reverse primer, each of which has a primer element that hybridizes under stringent conditions to a different strand of a double-stranded target nucleic acid sequence. The forward primer element is complementary to the antisense strand of dsDNA and the reverse primer element is complementary to the sense strand. One primer of a primer pair can be a primer probe (i.e., a bifunctional molecule that contains a PCR primer element covalently linked by a polymerase blocking group to a probe element and, in addition, can contain a fluorophore that interacts with a fire extinguisher).

[0042] A "probe" as used herein is an oligonucleotide that specifically hybridizes to a target nucleotide sequence and is separated from a primer element. A probe sequence is not extended as a primer element, and a probe as used herein, other than a "probe element," does not comprise a primer element. However, a probe can contain additional non-hybridizing elements such as, for example, additional nucleotides or a fluorophore. A TaqMan® probe is an exemplary probe. A TaqMan® probe comprises a donor fluorophore and a quencher at each end of the probe and in close enough proximity to each other that the fluorescence from the donor is absorbed by the quencher. However, when the probe hybridizes to the amplified segment, the 5' to 3' exonuclease activity of Taq polymerase cleaves the probe thereby allowing the donor fluorophore to emit fluorescence that can be detected.

[0043] As used herein “TaqMan® PCR detection system” refers to a method for real-time PCR. In this method, a TaqMan® probe that hybridizes to the amplified nucleic acid segment is included in the amplification master mix.

[0044] A "probe element" or "probe sequence element" as used herein refers to a probe portion of a primer probe and is a stretch of nucleotides that is associated with a primer sequence in which it is connected to or adjacent to the nucleic acid primer sequence, and which specifically hybridizes under stringent conditions to a target nucleic acid sequence to be detected. In some embodiments, a probe sequence is fully complementary to a target sequence to which it is intended to hybridize under stringent conditions. In some embodiments, a probe element is 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, or 28 bases in length. In some embodiments, a probe element further comprises self-complementary stem sequences.

[0045] As used herein, the term "primer probe" is a bifunctional molecule such as, for example a SCORPION® primer, which contains a PCR primer element covalently linked at its 5' end by a polymerase blocking group to a probe element. The probe element comprises a target probe sequence (which specifically binds to the amplified product) - flanked by the self-complementary stem sequences and is capable of forming a hairpin structure with a fluorophore at one end and a quencher at the other. Sometimes the fluorophore interacts with the quencher to reduce background fluorescence. The primer probe portion of the primer is modified at the 5' end so as to contain a PCR blocker at the beginning of the hairpin loop (usually HEG monomers are added as a blocking agent).

[0046] In the initial PCR cycles, the primer portion of the primer probe hybridizes to the target and extension occurs due to the action of the polymerase. During PCR, the polymerase is blocked from extending onto the tail of the probe by the inclusion of hexaethylene glycol (HEG) or an equivalent substance. During the first round of amplification the 3' target specific primer anneals to the target nucleic acid and is extended such that the primer probe is now incorporated into the newly synthesized strand, which has a newly synthesized target region for the 5' probe. During the next round of denaturation and annealing, the hairpin loop probe region of the primer probe hybridizes to the target, thereby separating the fluorophore and quencher and creating a measurable signal. Such primer probes are described in Whitcombe et al., Nature Biotech 17: 804-807 (1999), incorporated herein by reference in their entirety.

[0047] As used herein, a "primer probe detection system" refers to a system for real-time PCR that uses primers wherein at least one primer of a pair of primers is a primer probe such as, for example, a SCORPION® starter.

[0048] An oligonucleotide (eg, a probe or a primer) that is specific for a target nucleic acid will "hybridize" to the target nucleic acid under stringent conditions. As used herein, "hybridization" or "hybridize" refers to the process by which a single strand of the oligonucleotide anneals with a complementary strand through base pairing under defined hybridization conditions.

[0049] “Specific hybridization” is an indication that two nucleic acid sequences share a high degree of complementarity. Specific hybridization complexes form under permissive annealing conditions and remain hybridized after any subsequent washing steps. Permissive conditions for annealing nucleic acid sequences are routinely determinable by a person of ordinary skill in the art and can occur, for example, at 65°C in the presence of about 6xSSC. Hybridization stringency can be expressed, in part, with reference to the temperature under which the washing steps are carried out. Such temperatures are typically selected to be about 5°C to 20°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target nucleic acid dissociates from a perfectly matched probe. Equations for calculating Tm and conditions for nucleic acid hybridization are known in the art. Specific hybridization preferably occurs under stringent conditions, which are well known in the art. Stringent hybridization conditions are hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1xSSC at 60°C. Hybridization procedures are well known in the art and are described for example in Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994.

[0050] As used herein, an oligonucleotide is "specific" for a nucleic acid if the oligonucleotide has at least 50% sequence identity with the nucleic acid when the oligonucleotide and nucleic acid are aligned. An oligonucleotide that is specific for a nucleic acid is one that, under the appropriate hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids that are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95% and most preferably at least 98% sequence identity. Sequence identity can be determined using a commercially available computer program with a default setting using algorithms well known in the art. As used herein, sequences having "high sequence identity" have identical nucleotides in at least about 50% of aligned nucleotide positions, preferably at least in about 60% of aligned nucleotide positions, and more preferably at least in about 75% of the nucleotide positions aligned.

[0051] Oligonucleotides used as primers or probes to specifically amplify (i.e., amplify a particular target nucleic acid) or specifically detect (i.e., detect a particular target nucleic acid sequence) a target nucleic acid generally are capable of specifically hybridizing to the target nucleic acid under severe conditions.

[0052] As used herein, the terms "sample" or "test sample" may comprise biological samples, isolated nucleic acids, or isolated microorganisms. In some embodiments, a sample is obtained from a biological source (i.e., a "biological sample"), such as tissue, body fluid, or microorganisms collected from an individual. Sample sources include, but are not limited to, sputum (processed or unprocessed), bronchial alveolar lavage (BAL), bronchial lavage (BW), blood, body fluids, cerebrospinal fluid (CSF), urine, plasma, serum or tissue (e.g., biopsy material). Preferred sample sources include nasopharyngeal swabs, wound swabs, and nasal washes, and CSF. The term "patient sample" as used herein refers to a sample obtained from a human being seeking diagnosis and/or treatment of a disease. In some embodiments, a sample comprises isolated nucleic acids. In some embodiments a sample comprises a crude biological sample from which nucleic acids have not been extracted. In some embodiments a sample may be a biological sample that has been reverse transcribed such that it comprises cDNA.

[0053] A reagent mix comprises a sample, primers, and reagents needed for PCR and/or reverse transcription (RT).

[0054] A “master amplification mix” or a “RT master amplification mix” comprises all reagents (including primers) for PCR amplification and/or reverse transcription, but does not contain a sample or target nucleic acid to be amplified.

[0055] The terms "target nucleic acid" "target nucleic acid sequence" or "target sequence" as used herein refer to a sequence that includes a segment of nucleotides of interest to be amplified and detected. Copies of the target sequence that are generated during the amplification reaction are referred to as amplification products, amplimers or amplicons. Target nucleic acid can be composed of segments of a chromosome, a complete gene with or without intergenic sequence, segments or portions of a gene with or without intergenic sequence, or nucleic acid sequence for which probes or primers are designed. Target nucleic acids may include a wild-type sequence(s), a mutation, deletion or duplication, tandem repeat regions, a gene of interest, a region of a gene of interest, or any region upstream or downstream thereof. such as a 5' untranslated region (UTR). Target nucleic acids may represent alternative sequences or alleles of a particular gene. Target nucleic acids can be derived from genomic DNA, cDNA, or genomic RNA. As used herein target nucleic acid can be DNA (such as genomic DNA or cDNA) or RNA. In some embodiments, a target sequence is a viral RNA sequence and/or the cDNA equivalent thereof. In some embodiments, a nucleic acid target is an enteroviral sequence or a parechoviral sequence.

[0056] A "positive nucleic acid control" or "internal control" as used herein is a nucleic acid known to be present in a sample at a certain amount or level. In some embodiments, a positive control nucleic acid is not naturally present in a sample and is added to the sample prior to subjecting the sample-reaction mixture to real-time polymerase chain reaction in the disclosed methods for determining the presence or absence of enterovirus and/or parechovirus. As used herein, a "cycle threshold" (Ct) for an analyte is the PCR cycle at which the fluorescence signal crosses a specified fluorescence threshold. The Ct depends on the efficiency of the amplification reaction which includes the starting copy number, organism lysis, PCR amplification, fluorogenic probe hybridization or cleavage, and detection sensitivity.

[0057] A "stem sequence" as used herein is a pair of self-complementary nucleotide sequences that flank a probe or probe element that hybridizes to the nucleotide sequence. Each of the stem sequences is 4, 5, 6, 7, 8, 9 or 10 nucleotides in length. In some embodiments, a stem sequence is 6 to 7 nucleotides in length. Stem sequences flanking a probe element allow for the formation of the hairpin loop of the probe element.

Biological sample and sample preparation

[0058] Samples in which enteroviruses and parechoviruses can be detected using the disclosed methods may be from sterile and/or non-sterile sites. Samples can be biological samples including body fluids such as whole blood, plasma, serum, cell-free plasma, urine, cerebrospinal fluid (CSF), synovial fluid, pleural fluid, pericardial fluid, intraocular fluid and phlegm. Typical specimens are serum, plasma, throat or rectal swab in transport medium, stool, and CSF. Additional suitable biological specimens include tissue biopsies, stool specimens, endotracheal aspirates, throat and rectal swab specimens, nasopharyngeal specimens (nasal swabs). As used herein, "cell-free plasma" denotes plasma containing less than 1% cells by volume.

[0059] In some embodiments, a biological sample is suspected of containing enterovirus and/or parechovirus nucleic acids and/or it may be obtained from an individual suspected of being infected with enterovirus and/or parechovirus. In some embodiments, a sample is a biological sample that has been reverse transcribed such that the RNA initially present in the biological sample (including enteroviral and/or parechoviral RNA if present) has been reverse transcribed into cDNA. In this embodiment, the sample contains target cDNA. In some embodiments the cDNA is not extracted from the sample prior to RT-PCR or other detection assay.

[0060] Although the disclosed methods preferably use unprocessed biological samples thus resulting in a process, the detection methods disclosed herein are also effective if used on nucleic acid (DNA and/or RNA) isolated purified from a sample-to-sample biological sample -direct response, simplified according to any of the methods well known to those of skill in the art. If desired, the sample can be collected or concentrated by centrifugation and the like. Alternatively, a biological sample can be processed using a commercially available nucleic acid extraction kit.

Reverse transcription and real-time PCR

[0061] In the present methods, the presence of target enteroviral and/or parechoviral RNA in a sample is tested by reverse transcription and polymerase chain reaction (RT-PCR). When used together, reverse transcription and polymerase chain reaction can be performed sequentially in two steps, or together in one step with all of the reagents making up the RT and PCR reactions being added to the sample.

[0062] In a two-step method, incubation of a sample in a reverse transcription reaction composition allows a DNA copy of the target RNA to be synthesized. The RT reagent mix includes a primer that hybridizes to target RNA to initiate copy DNA synthesis. In addition, the RT reagent mix includes dNTPs, MgC12, KCl, a reverse transcriptase and a reverse transcriptase buffer. More than one primer can be included if it is desired to make DNA copies of more than one target RNA. Typically, however, no RNase inhibitor is used. The product of the reverse transcription reaction optionally can then be transferred to another test tube where PCR is performed according to protocol well known in the art. The master amplification mix typically includes a pair of primers that initiate synthesis of the desired segment of reverse transcribed pattern DNA. Furthermore, the master amplification mix usually comprises dNTPs, a DNA polymerase such as a thermostable DNA polymerase such as Taq polymerase, and polymerase buffer. In some embodiments, the master amplification mix further comprises a cationic surfactant. More than one primer pair is included if synthesis of multiple target sequences is desired. Also, in some embodiments, a single new primer can be added that will amplify a DNA segment with the original RT primer as the second primer of the pair. Additional reverse transcriptases that can be used for viral samples include, but are not limited to, HIV Reverse Transcriptase (Ambion), Transcriber Reverse Transcriptase (Roche), Thermoscript Reverse Transcriptase (Invitrogen). Additional DNA polymerases that can be used include, but are not limited to, Pfu, Vent, and Sequitherm DNA Polymerase (EPICENTRE).

[0063] In some embodiments of the method of the present invention, a biological sample is combined with a master RT amplification mixture that contains DNA polymerase, reverse transcriptase, RNase inhibitor, salts, deoxynucleotides, an internal control, and probes and primers for target and internal control so that RT and PCR can be performed in a single run. In some embodiments, the biological sample is heated to separate secondary structure from the RNA present in the sample, and the heated sample is contacted with the master RT amplification mixture to form the reaction mixture. In some embodiments, the biological sample is contacted with the master RT amplification mixture to form the reaction mixture, and then the reaction mixture containing the biological sample is heated to separate secondary structure from the RNA present in the sample.

[0064] Regardless of whether the RT-PCR is performed as two steps or one step, the RT step is conducted first and typically consists of a single temperature incubation. In some embodiments, the single temperature is from about 42°C to about 60°C. Different temperatures are appropriate for different RT enzymes and different primers, as is known to a person skilled in the art, and the temperature must be sufficient to allow reverse transcription of RNA into cDNA. The subsequent PCR reaction typically consists of an initial incubation at a predetermined temperature sufficient to denature the cDNA and also to activate heat-activated Taq polymerase enzymes. This is then followed by multiple cycles of amplification of the target cDNA. In some embodiments, the heating and cooling cycle is repeated at least 12, 13, 14, 15, 18, 19, 20, 21, 22 or 23 times up to 15, 20, 25, 20, 25, 30, 35, 40 or more times. In some embodiments, three operations are performed during each cycle: target denaturing, primer annealing, and primer extension. In some embodiments, target denaturation occurs at greater than about 90°C. The primer annealing temperature is dictated by the melting temperature of the specific primers used in the reaction, and primer extension can be performed at temperatures ranging from about 56°C to about 72°C. When annealing and primer extension are performed at the same temperature, this is a two-temperature PCR compared to a three-temperature PCR where each of the three steps takes place at a different temperature. After the amplification step is complete, a final extension time is typically added to ensure synthesis of all amplification products.

[0065] The PCR preferably is a multiplex PCR reaction. A reaction mix can contain one pair of enterovirus-targeted primers and one pair of parechovirus-targeted primers. An internal control (IC) can also be included in the sample using oligonucleotide primers, probes and/or primer probes.

[0066] In some embodiments, PCR and/or RT-PCR are performed on a centrifugal microfluidic disk. As used herein, a "centrifugal microfluidic disk" is a circular disk that rotates on its axis inside a thermal cycler and contains compartments into which a biological sample can be deposited. Exemplary centrifugal microfluidic disks are the Direct Amplification Disks (8 wells) and the Universal Disk (96 wells) from Focus Diagnostics which are used in conjunction with a 3M® Integrated Cycler thermal cycler sold by 3M®. The 3M® Integrated Cycler can be fitted with either a Universal or Direct Amplification Disc and is capable of performing multiple assays per disc. In some embodiments a biological sample is deposited on a gene rotor disk. As used herein, a "gene rotor disk" is an inserted centrifugal rotor that holds tubes or other compartments that can house samples and/or sample amplification mixes. Examples of a gene rotor disk are the Qiagen Rotor Disks and/or Gene Disks that are used with the Qiagen Rotor-Gene Q thermal cycler.

Nucleic Acids and Target Primers

[0067] In accordance with the present invention, oligonucleotide primers and/or probes are used in the methods described herein to amplify and detect enteroviral and/or parechoviral target nucleic acids such as all or a portion of enterovirus-specific marker genes and/or parechovirus. In one embodiment, the method involves using a pair of primers targeted to the 5' untranslated region (UTR) of the enterovirus genome and a pair of primers targeted to the 5' UTR of the parechovirus genome, including fragments of either or both of these regions. The enterovirus primer pair is capable of detecting and/or hybridizing to the 5' UTR of at least 64 enterovirus serotypes. The parechovirus primer pair is able to detect and/or hybridize to the 5' UTR of at least 8 parechovirus serotypes. In some embodiments, enterovirus primers specifically hybridize to sequences within nucleotides 452-599 of the 5' UTR of the enterovirus genome (or its complement) shown in GenBank Accession No. KC436272. In some embodiments, parechovirus primers specifically hybridize to sequences within positions 535-599 of the 5' UTR of the parechovirus genome (or its complement) shown in GenBank Accession No. AJ005695.

[0068] In addition, primers can also be used to amplify one or more control nucleic acid sequences.

[0069] The target nucleic acids described herein can be detected singly or in a multiplex format using individual labels for each target. In a particular embodiment, a multiplex reaction comprises a fluorescently labeled primer probe such as a SCORPION® primer probe used in a pair of primers specifically targeted to the 5' UTR of the enterovirus genome and another fluorescently labeled primer probe such as a SCORPION® primer probe used on a pair of primers specifically targeted to the 5' UTR of the parechovirus genome. In some embodiments, the fluorescent label of the enterovirus primer pair is different from that of the parechovirus primer pair.

[0070] In some embodiments, a mixture of primers is provided having degeneracy at one or more nucleotide positions. Degenerate primers are used in PCR where variability exists in the target nucleic acid sequence, i.e., the sequence information is polymorphic. Typically, degenerate primers will exhibit variability at no more than about 4, no more than about 3, preferably no more than about 2, and most preferably no more than about 1 nucleotide position within the primer .

[0071] Consequently, in some embodiments, at least one primer of each pair of primers in the amplification reaction comprises a detectable moiety. The detectable moiety can be on a probe that is covalently attached to the primer, such as with a primer probe. The probe can be detectably labeled by methods known in the art. Useful labels include, for example, fluorophores (e.g., Cy5®, Cy3®, FITC, rhodamine, lantamide phosphors, Texas red, a carboxyfluorescein fluorophore such as fluorescein amidite (FAM), JOE®, a xanthene dye such as such as Cal Fluor Red 610® (“CFR610”) which fluoresces in the red region of the visible spectrum and can be effectively extinguished by an extinguisher such as a Black Hole Quencher® TM 32 35 3 14 125 131 (BHQ ) dark, dye I-BHQ2 , Quasar 670®, P, S, H, C, I, I, electron-dense reagents (e.g., gold), enzymes, e.g., as commonly used in an ELISA (e.g., horseradish peroxidase, beta-galactosidase , luciferase, alkaline phosphatase), colorimetric labels (eg, colloidal gold), magnetic labels (eg, Dynabeads®), biotin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available. A fluorophore has the ability to absorb energy from light, transfer this energy internally, and emit this energy as light of a characteristic wavelength. Following absorption of energy (one photon) of light, a fluorophore will be excited from its ground state to a higher vibrational level of an excited singlet state. In the next phase, some energy is lost as heat, returning the fluorophore to the lower vibrational level of an excited singlet state. The lower vibrational level of an excited singlet state is relatively stable and has a longer lifetime. From this excited singlet state, the fluorophore can return to its ground state, either by emitting light (one photon) or by a non-radiative energy transition. The light emitted from the excited singlet state is called fluorescence. Other labels include linkers or oligonucleotides capable of forming a complex with the corresponding oligonucleotide receptor or complement, respectively. The label can be directly incorporated into the nucleic acid to be detected, or it can be coupled to a probe (eg an oligonucleotide) or antibody which hybridizes or binds to the nucleic acid to be detected.

[0072] Thus, following and/or during amplification, enteroviral and/or parechoviral target segment amplicons can be identified, if present, using different detectable moieties such as by size and/or color. Although the targets are alluded to as "enteroviral targeting amplicon" or "parechovirus targeting amplicon" it is mentioned that the amplicon is in fact generated from a cDNA equivalent of the viral genomic RNA sequence (so the amplicon target is not identical to the viral target RNA sequence due to the presence of thymine instead of uracil). The detectable moiety can be a fluorescent dye. In some embodiments, the different primer pairs are labeled with different distinguishable detectable moieties. Thus, for example, the fluorescent dyes CFR610 and FAM may be present on different primers in multiplex PCR and associated with different resulting amplicon sequences. In other embodiments, the forward primer is labeled with one detectable moiety, while the reverse primer is labeled with a different detectable moiety, for example the FAM dye for a forward primer and the HEX dye for a reverse primer. The use of different detectable moieties is useful for discriminating between amplified products that are the same length or are very similar in length.

[0073] In some embodiments, the probe element of the primers used are detectably labeled and detection is performed by detecting the label for each amplification product. A quencher may further be associated with the detectable label that prevents detection of the label prior to amplification of the probe's target element. SCORPION® primers comprise such probe elements.

[0074] In certain embodiments, at least one primer of each pair of primers is a primer probe. In these embodiments, the primer probe further contains a fluorophore associated with a quencher to reduce background fluorescence. Following PCR extension with such a fluorophore-labeled primer probe, the synthesized target region is ligated to the same strand as the probe. On denaturation, the probe portion of the primer probe specifically hybridizes to a portion of the freshly produced PCR product, physically separating the fluorophore from the quencher, thereby producing a detectable signal. Thus, in some embodiments, one primer of each pair of primers can be a primer probe comprising a probe sequence element at the 5' end of a primer, where the probe element further comprises a fluorophore and a quencher.

[0075] The present inventors have found that detection of a specific region of the 5' UTR of the enterovirus genome (i.e., nucleotides 452-599 of the 5' UTR) allows detection of any of the 64 enterovirus serotypes and can distinguish a enterovirus-containing sample from one containing viral species or strains other than enteroviruses. Furthermore, the present inventors have found that detection of a specific region of the 5' UTR of the parechovirus genome (i.e. nucleotides 535-599 of the 5' UTR) allows detection of any of the 8 parechovirus serotypes and can distinguish a sample containing parechovirus from one containing other viral species or strains other than parechovirus.

Enterovirus detection

[0076] The primers of a pair of primers for detecting and/or amplifying enteroviruses have primer elements that hybridize to regions within nucleotides 452-599 of the 5' UTR of the enterovirus genome. In some embodiments, a primer pair contains a primer with a primer element that specifically hybridizes to a nucleic acid comprising or consisting of the sequence 5'-AATTTCACCATAAGCAGCCA-3' (SEQ ID NO: 1) or its entire complement. In some embodiments, a primer of a pair of primers comprises or consists of a primer element sequence that is at least 90% identical to SEQ ID NO: 1 or at least 90% identical to the full complement of SEQ ID NO: 1 and that specifically hybridizes under stringent conditions to SEQ ID NO: 1 or its entire complement. In some embodiments the primer element is at least 16, 17, 18, 19 nucleotides and/or up to 18, 19, 20, 22, 25, 30, 40 or 50 nucleotides in length and is at least 84, 85, 86 or 90% identical to SEQ ID NO: 1. The primer element may comprise or consist of at least 16, 17, 18, 19, 20 or 21 consecutive nucleotides of SEQ ID NO: 1 or the entire complement of SEQ ID NO: 1 , and hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 1 or its entire complement under stringent conditions.

[0077] In some embodiments, a primer pair for detecting and/or amplifying enteroviruses contains a primer with a primer element that specifically hybridizes to a nucleic acid comprising or consisting of the sequence 5'-CCCCTGAATGCGGCTAATC-3' (SEQ ID NO: 2 ) or its entire complement. In some embodiments, the primer element comprises a sequence that is at least 90% identical to SEQ ID NO: 2 or at least 90% identical to the full complement of SEQ ID NO: 2 and that specifically hybridizes under stringent conditions to a nucleic acid comprising or consisting of SEQ ID NO: 2 or its entire complement. In some embodiments the primer element is at least 16, 17, 18, 19 nucleotides and/or up to 18, 19, 20, 22, 25, 30, 40 or 50 nucleotides in length and is at least 84, 85, 86 or 90% identical to SEQ ID NO: 2. The primer element may comprise or consist of at least 16, 17, 18, 19, 20 or 21 nucleotides of SEQ ID NO: 2 or the entire complement of SEQ ID NO: 2, and hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 2 or its entire complement under stringent conditions.

[0078] In some embodiments a pair of primers for detecting and/or amplifying enterovirus nucleic acid is a primer probe. The primer probe can comprise a primer element as discussed above, and a probe element comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 3 or at least 90% identical to the full complement of SEQ ID NO: 3. In some embodiments, a probe frame comprises at least 19, 20, 21, 22, 23 or 24 consecutive nucleotides of SEQ ID NO: 3 or the complement of SEQ ID NO: 3. The probe frame specifically hybridizes to the corresponding region of SEQ ID NO: 3 or the complement of SEQ ID NO: 3 under stringent hybridization conditions.

[0079] In a specific embodiment, an enterovirus primer pair contains both of the enterovirus primers described above (i.e., a primer with a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 1 or its complement and a primer with a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 2 or its complement).

[0080] In another specific embodiment, one primer of an enterovirus primer pair comprises or consists of SEQ ID NO: 1 and the other primer of the enterovirus primer pair is a primer probe comprising or consisting of (from the direction from 5' to 3') a quencher moiety linked to a nucleotide sequence consisting of a first stem sequence followed by ACACGGACCCCCAAAGTAGTCGGT (SEQ ID NO: 3) and a second stem sequence that is complementary to the first stem sequence, linked at its 3' end to a fluorophore and a spacer nucleotide which is a 10, 14, 15, 16, 17, 18, 19, 20, 21 or 25 atom polyethylene glycol based ligand followed by SEQ ID NO: 2.

[0081] A specific enterovirus primer pair consists of: Enterovirus Primer 1: 5'd AATTGTCACCATAAGCAGCCA 3' (SEQ ID NO: 1) Enterovirus Primer 2 (one primer probe): 5'd BHQ-1- agCgçACACGGACCCCAAAGTAGTCGGTgcgçt-FAM -Spacer18- CCCCTGAATGCGGCTAATC 3' where “BHQ-1” is a black hole quencher moiety, the underlined sequences are the self-complementary stem sequences, “FAM” is the fluorescein amidite, and “Spacer18” is a spacer containing a linker of 18-atom hexaethylene glycol.

Parechovirus detection

[0082] The primers of a pair of primers for detecting and/or amplifying parechoviruses contain primer elements that hybridize to regions within nucleotides 535-599 of the 5' UTR of the parechovirus genome. In some embodiments, a primer of a pair of primers comprises or consists of a primer element sequence that is at least 90% identical to 5' GTTGTAAGGCCCACGAA 3' (SEQ ID NO: 4) or at least 90% identical to the full complement of SEQ ID NO: 4 and which specifically hybridizes under stringent conditions to SEQ ID NO: 4 or its entire complement. In some embodiments the primer element is at least 16, 17, 18, 19 bases and/or up to 18, 19, 20, 22, 25, 30, 40 or 50 bases in length and is at least 84, 85, 86 or 90 % identical to SEQ ID NO: 4. The primer element may comprise or consist of at least 16, 17, 18, 19, 20 or 21 consecutive nucleotides of SEQ ID NO: 4 or the entire complement of SEQ ID NO: 4, and hybridizes to SEQ ID NO: 4 or its entire complement under stringent conditions.

[0083] In some embodiments, a primer pair for detecting and/or amplifying parechoviruses contains a primer with a primer element that specifically hybridizes to a nucleic acid comprising or consisting of the sequence 5'-TCAGATCCATAGTGTCICTTGTTA -3' (SEQ ID NO: 5 ) or its entire complement. In some embodiments, the primer comprises a sequence that is at least 90% identical to SEQ ID NO: 5 or at least 90% identical to the full complement of SEQ ID NO: 5 and that specifically hybridizes under stringent conditions to SEQ ID NO: 5. 5 or its full complement. In some embodiments the primer element is at least 16, 17, 18, 19 nucleotides and/or up to 18, 19, 20, 22, 25, 30, 40 or 50 nucleotides in length and is at least 84, 85, 86 or 90% identical to SEQ ID NO: 5. The primer element may comprise or consist of at least 16, 17, 18, 19, 20 or 21 nucleotides of SEQ ID NO: 5 or the entire complement of SEQ ID NO: 5, and hybridizes to SEQ ID NO: 5 or its entire complement under stringent conditions.

[0084] In some embodiments a pair of primers for detecting and/or amplifying parechovirus nucleic acid is a primer probe. The primer probe may comprise a primer element sequence (discussed above) and a probe element comprising a nucleotide sequence at least 90% identical to 5'-ATGCCCAGAAGGTACCCG-3' (SEQ ID NO: 6) or at least 90% identical identical to the full complement of SEQ ID NO: 6. In some embodiments, a probe element comprises 19, 20, 21, 22, 23 or 24 consecutive nucleotides of SEQ ID NO: 6 or the complement of SEQ ID NO: 6. probe element specifically hybridizes to the corresponding region of SEQ ID NO: 6 of the complement of SEQ ID NO: 6 under stringent hybridization conditions.

[0085] In a specific embodiment, a parechovirus primer pair contains both of the parechovirus primers described above (i.e., a primer with a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 4 or its complement and a primer with a primer element that specifically hybridizes to a nucleic acid comprising or consisting of SEQ ID NO: 5 or its complement).

[0086] In another specific embodiment, one primer of a pair of parechovirus primers comprises or consists of SEQ ID NO: 4 and the other primer of the pair of parechovirus primers is a primer probe that comprises or consists of (of 5 ' to 3') a fluorophore linked to a nucleotide sequence consisting of a first stem sequence followed by SEQ ID NO: 5 and a second stem sequence which is complementary to the first stem sequence, linked at its 3' end to a extinguisher and a spacer which is a polyethylene glycol linker having 10, 14, 15, 16, 17, 18, 19, 20, 21 or 25 atoms followed by SEQ ID NO: 6.

[0087] A specific parechovirus primer pair consists of: Parechovirus Primer 1: 5'd GTTGTAAGGCCCACGAA 3' (SEQ ID NO: 4) Parechovirus Primer 2 (one primer probe): 5'd CFR610-Cgcgcg.ATGCCCAGAAGGTACCCGcgcg -BHQ-2-Spacer18- TCAGATCCATAGTGTCICTTGTTA 3' where “CFR610” is Cal Fluor Red 610® xanthene dye, boxed sequences are the self-complementary stem sequences, “BHQ-2” is a black hole quencher, and “ Spacer18” is a spacer containing an 18-atom hexaethylene glycol linker.

[0088] The present inventors found that the above primer pairs surprisingly outperformed the other primer pairs in a multiplexed, direct amplification reaction on human biological samples and were able to detect 64 enterovirus serotypes as well as parechovirus serotypes from 1 to 8.

Product Detection

[0089] The disclosed methods for determining the presence or absence of an enterovirus and/or parechovirus in a sample involve, among other steps, determining whether an enteroviral or a parechoviral nucleotide sequence is amplified in a sample. The determination step can be performed during and/or after PCR amplification. In some embodiments, at least one primer of each primer pair (i.e., the enterovirus-directed primer pair and the parechovirus-directed primer pair) is a primer probe and generates a fluorescent signal during PCR amplification. The signal is detected for the enterovirus sequence amplification and/or parechovirus sequence amplification, thus indicating that virus is/are present in the sample.

[0090] Real-time PCR methods, which do not require a preparation step before detection of the amplified product, are preferably used in the present invention. Most real-time methods detect the formation of amplified product by monitoring changes in fluorescence during thermocycling. In some embodiments, a different fluorescent signal is generated for the parechovirus sequence amplification versus the enterovirus sequence amplification, thereby allowing the viewer to distinguish between the two viruses.

[0091] A detectably labeled primer probe can be used for real-time PCR. Suitable detectable labels for primer probes such as the SCORPION® primer probes include fluorophores such as fluorescein bioconjugates and amine-reactive succinimidyl esters of carboxyfluorescein (commonly called FAM). An initiator probe also contains an extinguisher. In the absence of the target, the extinguisher almost absorbs the fluorescence emitted by the fluorophore. During the Scorpion PCR reaction, in the presence of the target, the fluorophore and the quencher separate which leads to an increase in emitted fluorescence. Fluorescence can be detected and measured in the reaction tube. Suitable extinguishers include the Black Hole Extinguisher® (BHQ®, Biosearch Technologies). Dark quenchers, such as DABCYL, are dyes with no native fluorescence. BHQ dyes are true dark quenchers with no native emissions due to their polyaromatic azo backbone. Replacing the electron-withdrawing and donating groups on the aromatic rings produces a full range of extinguishers with broad absorption curves that span the visible spectrum: BHQ-0 (493 nm), BHQ-1 (534 nm), BHQ-2 (579 nm ) and BHQ-3 (672 nm). These quenchers can be paired with all common reporter dyes to build efficiently quenched qPCR probes for multiplexing assays. In addition to quenching at FRET, BHQ dyes have also been shown to efficiently quench fluorescence through static quenching via formation of a ground state complex with the reporter dye. Other fluorophores and quenchers with various absorption and emission values are known in the art.

EXAMPLES

[0092] The present methods, as generally described, will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present methods and kits.

Example 1

[0093] A panel of clinical samples of cerebrospinal fluid (CSF) or artificial panels of synthetic CSF were tested and the results were compared with real-time PCR results to determine the clinical performance of the Simplexa Enterovirus and Parechovirus Direct Assay when compared to that of real-time PCR methods using conventional nucleic acid extraction.

[0094] Simplexa Direct Assay: Simplexa Direct kits (Focus Diagnostics, Cypress, CA) contain all reagents for onboard extraction and real-time PCR. For each reaction on the Direct Amplification Disc, the unprocessed CSF sample was loaded directly into a sample well from one edge of the Disc without any of the sample preparation steps. The amplification reaction mix was pipetted into a rim reaction well, where the amplification reaction mix contained Enterovirus primers 1 and 2 and Parechovirus primers 1 and 2 as described below: Enterovirus Primer 1: 5'd AATTGTCACCATAAGCAGCCA 3 ' (SEQ ID NO: 1) Enterovirus Primer 2 (one primer probe): 5'd BHQ-1- agcgcACACGGACCCCAAAAGTAGTCGGTgcgct-FAM-Spacer18- CCCCTGAATGCGGCTAATC 3' Parechovirus Primer 1: 5'd GTTGTAAGGCCCACGAA 3' (SEQ ID NO: 4 ) Parechovirus primer 2 (one primer probe): 5'd CFR610- cgcgcgATGCCCAGAAGGTACCCGcgcg-BHQ-2- Spacer 18- TCAGATCCATAGTGTCICTTGTTA 3'

[0095] The reaction mixture also contained DNA polymerase, reverse transcriptase, RNase inhibitor, salts, deoxynucleotides, an internal control, and probes and primers for the internal control. The edge was sealed with metallic foil and the Direct Amplification Disc was then inserted into a 3M® Integrated Cycler (3M, St. Paul, MN, USA) and reverse transcription and real-time PCR began in the cycler. PCR cycling conditions include the following steps: i) pre-warming the sample to 75 °C, 180 seconds, 1 cycle ii) reverse transcription at 50 °C, 720 seconds, 1 cycle, iii) polymerase activation at 97 °C, 120 seconds, 1 cycle iv) denaturation at 97 °C, 10 seconds and annealing/extension/detection at 56 °C, 10 seconds and 58 °C, 30 seconds for 45 cycles. Target DNA (derived from enteroviral and/or parechoviral genomic RNA) was specifically amplified and simultaneously detected by fluorescently labeled primer probes in the same reaction. Data collection and analysis were performed using the Integrated Ciclor Studio software.

[0096] Viral Strains: The following strains were used in the LoD studies: CVA1, CVA17, and CVA9, and parechoviruses HPEV-1 and HPEV-3 (ZeptoMetrix, Buffalo, NY). The following parechovirus strains were used in the specificity study: HPEV1, HPEV2, HPEV3, HPEV4, HPEV5, and HPEV6 (ZeptoMetrix, Buffalo, NY).

[0097] Limit of Detection (LoD) Studies: LoD studies were performed to determine the analytical sensitivity of the assays. The presumed LoD for each viral stock was determined as the lowest concentration with 4/4 replicates detected in synthetic CSF (Golden West Biologicals, Temecula, CA).

[0098] Sensitivity and Specificity Studies: The clinical performance of the Simplexa Enterovirus and Parechovirus Direct assay was evaluated using a panel of 154 CSF samples comprising 7 Parechovirus positives, 74 Enterovirus positives, and 74 Parechovirus/Enterovirus negatives, as reported by a real-time PCR assay. Additionally a panel of 24 artificial Parechovirus positive samples in synthetic CSF was used. The artificial panel was made using quantified viral stocks of parechovirus serotypes 1 to 6 at 10X, 4X, 2X and 1X concentration of Simplexa LoD.

[0099] Cross-Reactivity Studies: Cross-reactivity was evaluated using a diverse panel of bacteria and viruses. A panel of organisms, the infection with which may exhibit similar clinical symptoms as enterovirus and/or parechovirus infection, was used to determine cross-reactivity. The panel consisted of 106 CFU/ml bacteria or 105 TCID50/ml virus in synthetic CSF.

[00100] Results: LoD: LoD studies using synthetic CSF showed that Simplexa Enterovirus and Parechovirus Direct detected enterovirus and parechovirus strains at <1 X 103 TCID50/ml. The positive and negative confirmations for Simplexa Enterovirus and Parechovirus Direct when compared to a real-time PCR assay using a conventional extraction procedure were 95.6% (65/68) and 89% (65/73) for enterovirus and 92.6% (25/27) and 92.2% (71/77) for Parechovirus respectively. Table 1 - Limit of Detection for Enterovirus and Parechovirus Strains

Tabela 3- Concordância de Parechovírus para Amostras de CSF

[00101] The Relative Confirmations of Positive and Negative in Simplexa Enterovirus and Parechovirus Direct are as listed in Tables 2 and 3. Table 2 - Enterovirus Agreement for CSF Samples

Table 3- Parechovirus Concordance for CSF Samples

[00102] Cross-Reactivity: No cross-reactivity for the pathogens in Table 4 was detected. Table 4 - Cross Reactivity of Pathogens Tested in the Synthetic CSF

[00103] The ability to detect selected types of enteroviruses was further confirmed in a catamnesis study. Exemplary enterovirus types detected in the catamnesia study using the Simplexa Enterovirus and Parechovirus Direct assay are shown in Table 5. Table 5 - Selected Enterovirus Strains Detected in the Catamnesia Study

[00104] Conclusions: Simplexa Enterovirus and Parechovirus Direct was able to directly detect and differentiate between enteroviruses and parechoviruses from unextracted CSF samples, with a performance comparable to that of the conventional PCR assay that uses nucleic acid extraction. Targeting the enterovirus 5' UTR and the parechovirus 5' UTR, 64 enterovirus serotypes as well as serotypes 1 to 6 in human CSF were efficiently detected in this rapid "sample-to-response" assay. HPEV7 and HPEV8 are not commercially available for testing, but in silico analysis shows that these serotypes can be detected. The performance of the Simplexa Enterovirus and Parechovirus Direct assay on a centrifugal microfluidic disk using an integrated thermal cycler that was able to accommodate the disk, provided a compact system for the rapid detection of enteroviruses and parechoviruses directly from human biological samples.

[00105] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art to which this invention belongs.

[00106] The inventions illustratively described herein can be properly practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Additionally, the terms and expressions used herein are used as terms of description and not limitation, and the use of such terms and expressions is not intended to exclude any equivalents of the traits shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the claimed invention.

[00107] Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification, improvement and variation of the inventions embodied herein disclosed herein may be used by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this invention. The materials, methods, and examples provided herein are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention.

[00108] The invention has been broadly and generically described herein. Each of the more limited species and subgeneric groupings that fall within the generic disclosure also form part of the invention. This includes describing the invention generically with a negative condition or limitation removing any subject matter of that kind, regardless of whether or not the excised material is specifically cited herein.

[00109] Furthermore, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also hereby described in terms of any individual member or subgroup of members of the Markush group.

[00110] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same degree as if each were incorporated by reference individually. In case of conflict, this descriptive report, including the definitions, will control.

[00111] Other embodiments are presented within the following claims.

Claims (8)

1. Method for determining the presence or absence of an enterovirus and optionally a parechovirus in a sample, the method characterized in that it comprises: (1) amplifying enterovirus nucleic acids, if present in the sample, with at least one first primer pair, wherein the first primer pair comprises: (i) a first primer comprising SEQ ID NO: 1, and (ii) a second primer comprising a 5' quencher dye, a nucleic acid comprising SEQ ID NO: 3 flanked by two self-complementary nucleotide sequences at least 4 nucleotides in length, a fluorophore and a nucleic acid comprising SEQ ID NO: 2; and optionally further comprising: (8) amplifying the parechovirus nucleic acids, if present in the sample, with at least one second pair of primers, wherein the second pair of primers comprises: (9) a first primer comprising SEQ ID NO : 4, and (11) a second primer comprising a 5' fluorophore, a nucleic acid comprising SEQ ID NO: 6 flanked by two self-complementary nucleotide sequences at least 4 nucleotides in length, a quencher dye and a nucleic acid comprising SEQ ID NO: 5. 2. Method according to claim 1, characterized in that each stem sequence of the two self-complementary nucleotides that flank the nucleic acid of (a) (ii) is 4, 5, 6, 7, 8, 9 or 10 nucleotides in length. 3. Method according to claim 1, characterized in that each stem sequence of the two self-complementary nucleotide sequences flanking the nucleic acid of (b) (ii) is 4, 5, 6, 7, 8, 9 , or 10 nucleotides in length. 4. Method according to claim 1, characterized in that the sample is a biological sample selected from the group consisting of cerebrospinal fluid, blood, feces, throat swab, rectal swab, nasopharyngeal swab, plasma, serum and urine . 5. Method according to claim 4, characterized in that the nucleic acids are not extracted from the biological sample. 6. Kit, comprising: (A) a first primer of a first pair of primers comprising SEQ ID NO: 1, and a second primer of the first pair of primers comprising a 5' quencher dye, a nucleic acid comprising SEQ ID NO: 3 flanked by two self-complementary nucleotide sequences at least 4 nucleotides in length, a fluorophore, and a nucleic acid comprising SEQ ID NO: 2; and optionally further comprising (b) a first primer of a second primer pair comprising SEQ ID NO: 4, and a second primer of the second primer pair comprising a 5' fluorophore, a nucleic acid comprising SEQ ID NO: 6 flanked by two nucleic acid sequences at least 4 nucleotides in length, a quencher dye, and a nucleic acid comprising SEQ ID NO: 5. 7. Kit according to claim 6, characterized in that each stem sequence of the two self-complementary nucleotide sequences that flank the nucleic acid of (a) has 4, 5, 6, 7, 8, 9 or 10 nucleotides of length. 8. Kit according to claim 6, characterized in that each stem sequence of the two self-complementary nucleotide sequences that flank the nucleic acid of (b) has 4, 5, 6, 7, 8, 9 or 10 nucleotides of length.