BR112016002752B1

BR112016002752B1 - ANTIBODY OR FUNCTIONAL FRAGMENTS ITS WHICH MAY SPECIFICALLY BIND TO HER2, CONJUGATES, PHARMACEUTICAL COMPOSITION, AND, USE OF THE ANTIBODY OR ITS FUNCTIONAL FRAGMENTS, CONJUGATE OR PHARMACEUTICAL COMPOSITION

Info

Publication number: BR112016002752B1
Application number: BR112016002752-3A
Authority: BR
Inventors: Jianmin Fang; Changjiang Huang; Jing Jiang; Xuejing YAO; Hongwen Li; Qiaoyu Xu
Original assignee: RemeGen Co., Ltd
Priority date: 2013-11-19
Filing date: 2014-11-18
Publication date: 2023-05-30

Abstract

ANTICORPO OU SEUS FRAGMENTOS FUNCIONAIS QUE PODE ESPECIFICAMENTE SE LIGAR AO HER2, POLINUCLEOTÍDEO ISOLADO, COMBINAÇÃO DOS POLINUCLEOTÍDEOS ISOLADOS, VETOR DE EXPRESSÃO, CONJUGADO, CONJUGADO COM A FÓRMULA GERAL Ab-(L-U)n, COMPOSIÇÃO FARMACÊUTICA E USO DO ANTICORPO OU SEUS FRAGMENTOS FUNCIONAIS. São revelados um anticorpo anti-HER2 e um conjugado do anticorpo anti-HER2 e um fármaco de molécula pequena. Também são revelados usos do anticorpo e seu conjugado na preparação de fármaco para o tratamento de tumor.ANTIBODY OR FUNCTIONAL FRAGMENTS THEREOF WHICH MAY SPECIFICALLY BIND TO HER2, POLYNUCLEOTIDE ISOLATED, POLYNUCLEOTIDE ISOLATED COMBINATION, EXPRESSION VECTOR, CONJUGATE, CONJUGATE WITH THE GENERAL FORMULA Ab-(L-U)n, PHARMACEUTICAL COMPOSITION AND USE OF THE ANTIBODY OR ITS FRAGMENTS FUNCTIONAL. An anti-HER2 antibody and a conjugate of the anti-HER2 antibody and a small molecule drug are disclosed. Uses of the antibody and its conjugate in the preparation of drug for tumor treatment are also disclosed.

Description

FIELD OF THE INVENTION

[001] A presente invenção se refere a um novo anticorpo HER2 ou seus fragmentos funcionais, compreendendo cadeias pesadas e cadeias leves engenheiradas. A presente invenção ainda se refere a conjugados do anticorpo HER2 melhorado com fármacos de molécula pequena. A presente invenção ainda se refere ao uso do anticorpo e os conjugados na fabricação de um fármaco para o tratamento tumores.[001] The present invention relates to a new HER2 antibody or functional fragments thereof, comprising engineered heavy chains and light chains. The present invention further relates to conjugates of the improved HER2 antibody with small molecule drugs. The present invention further relates to the use of the antibody and the conjugates in the manufacture of a drug for the treatment of tumors.

BACKGROUND OF THE INVENTION 1. Summary of HER2

[002] ErbB2, também conhecido como HER2/neu, é o segundo membro da família EGFR, que forma um heterodímero com outros três membros na família EGFR, assim como para exercer a função biológica. Até o momento, o ligante que pode se ligar diretamente a ErbB2 ainda não foi encontrado. O gene neu codificando ErbB2 foi primeiramente separado da partir de neuroblastoma de rato. Um gene homólogo do gene neu em células somáticas humanas, conhecido como HER2, está localizado no cromossomo 17q21.1. O produto codificado é ErbB2, que é constituído de 1255 aminoácidos com o peso molecular de cerca de 185kDa, nas quais as posições 720-987 pertencem ao domínio ativo da tirosina quinase. Além de desempenhar um papel através da via de sinalização de PI3K e MAPK, ErbB2 pode também reduzir a expressão de ciclina D e c-myc, assim reduz a expressão da quinase dependente de ciclina (cdk) inibidor p27kipl, levando a proliferação celular resultante da inibição da atividade de cdk2 [1].[002] ErbB2, also known as HER2/neu, is the second member of the EGFR family, which forms a heterodimer with three other members in the EGFR family, so as to exert biological function. So far, the ligand that can directly bind ErbB2 has not yet been found. The neu gene encoding ErbB2 was first separated from rat neuroblastoma. A gene homologous to the neu gene in human somatic cells, known as HER2, is located on chromosome 17q21.1. The encoded product is ErbB2, which consists of 1255 amino acids with a molecular weight of about 185kDa, in which positions 720-987 belong to the active domain of tyrosine kinase. In addition to playing a role through the PI3K and MAPK signaling pathway, ErbB2 may also reduce the expression of cyclin D and c-myc, thereby reducing the expression of the cyclin-dependent kinase (cdk) inhibitor p27kipl, leading to cell proliferation resulting from inhibition of cdk2 activity [1].

[003] Com cada vez mais estudos se expandindo e se aprofundando, foi verificado que HER2 é expresso ou superexpresso em vários tumores. Até o momento, foi relatado que a taxa de expressão positiva, a taxa de superexpressão de HER2 em diversos tumores e o número de pessoas dentro do qual HER2 é superexpresso é como se segue: câncer de ovário, 45 %, 21 %, 23316 pessoas [2]; câncer de mama, 58 %, 38 %, 223112 pessoas [3]. Por isso, há uma necessidade urgente na prática clínica por fármacos eficazes visando HER2 para tratar tumor maligno. Até o momento, os anticorpos monoclonais comercialmente disponíveis que visam HER2 incluem Trastuzumab e Pertuzumab.[003] With more and more studies expanding and deepening, it has been found that HER2 is expressed or overexpressed in various tumors. So far, it has been reported that the positive expression rate, the rate of HER2 overexpression in various tumors, and the number of people within whom HER2 is overexpressed are as follows: ovarian cancer, 45%, 21%, 23316 people [2]; breast cancer, 58%, 38%, 223112 people [3]. Therefore, there is an urgent need in clinical practice for effective drugs targeting HER2 to treat malignant tumor. To date, commercially available monoclonal antibodies that target HER2 include Trastuzumab and Pertuzumab.

2. Trastuzumab and Pertuzumab

[004] Herceptin® (Trastuzumab) desenvolvido por Genentech é um anticorpo monoclonal humanizado que visa HER2. Em 1998, Trastuzumab em combinação com paclitaxel foi aprovado pelo US FDA como uma primeira linha de regime terapêutico para o tratamento de câncer de mama metastático de HER2/neu superexpresso, ou como um fármaco único para o tratamento de câncer de mama metastático de HER2/neu superexpresso que tenha sido submetido a pelo menos um ciclo de quimioterapia. Trastuzumab não só tem alta afinidade com receptor de HER2, mas também resolve o problema de imunogenicidade causada pela aplicação de anticorpo derivado de murina ao corpo humano. Os resultados dos testes clínicos mostram que, usando Trastuzumab só tem a taxa efetiva de 11, 6 %~16 %, enquanto sua terapia de combinação com fármacos químicos tem a taxa efetiva de até 50 %. Comparando com a quimioterapia apenas a dita combinação confere a pacientes com recorrência avançada de câncer de mama uma vida mais longa e uma redução da mortalidade.[004] Herceptin® (Trastuzumab) developed by Genentech is a humanized monoclonal antibody that targets HER2. In 1998, Trastuzumab in combination with paclitaxel was approved by the US FDA as a first-line therapeutic regimen for the treatment of HER2/neu overexpressing metastatic breast cancer, or as a single drug for the treatment of HER2/neu overexpressing metastatic breast cancer that has undergone at least one cycle of chemotherapy. Trastuzumab not only has high affinity for HER2 receptor, but also solves the problem of immunogenicity caused by applying murine-derived antibody to human body. Clinical test results show that using Trastuzumab only has the effective rate of 11.6%~16%, while its combination therapy with chemical drugs has the effective rate of up to 50%. Comparing with chemotherapy alone, the said combination gives patients with advanced breast cancer recurrence a longer life and a reduction in mortality.

[005] Um outro anticorpo fármaco que visa HER2 é Pertuzumab [4], que foi também desenvolvido por Genentech. Pertuzumab se liga a região II do domínio extracelular do receptor de HER2, inibindo a formação de um dímero, assim inibindo a via de sinalização mediada pelo receptor, enquanto Trastuzumab (Herceptin) se liga a região IV do domínio extracelular de receptor de HER2. Pertuzumab foi aprovado pelo US FDA em 8 de junho de 2012, para o tratamento de pacientes de câncer de mama metastático avançado HER2-positivos (veja CN101023100B).[005] Another drug antibody that targets HER2 is Pertuzumab [4], which was also developed by Genentech. Pertuzumab binds to region II of the HER2 receptor extracellular domain, inhibiting the formation of a dimer, thereby inhibiting the receptor-mediated signaling pathway, while Trastuzumab (Herceptin) binds to region IV of the HER2 receptor extracellular domain. Pertuzumab was approved by the US FDA on June 8, 2012, for the treatment of HER2-positive advanced metastatic breast cancer patients (see CN101023100B).

3. Antibody-Drug Conjugates

[006] Anticorpo monoclonal tem recebido cada vez mais atenção devido a suas características de alvo de alta especificidade, baixo efeito colateral e afins. Entretanto, quando usado sozinho, seu efeito terapêutico é limitado. Agora, os mais bem sucedidos anticorpos monoclonais fármacos contra tumor são aqueles contra linfoma tal como linfoma não Hodgkin (NHL) crônico. A Fase II do estudo clínico de Rituxan direcionado à NHL mostra que a taxa de resposta total foi apenas 6 %. Em relação a Herceptin® contra câncer de mama metastático, apenas 15 % tiveram uma resposta. Portanto, a maioria dos anticorpos monoclonais fármacos é usada em combinação com quimioterapia. Por exemplo, Rituxan é usado em combinação com quimioterapia padrão para o tratamento de linfoma crônico, que pode aumentar a taxa efetiva até 90 %. Até o momento, o principal caminho para o aumento do efeito terapêutico de anticorpo monoclonal são os conjugados anticorpo fármaco.[006] Monoclonal antibody has received increasing attention due to its target characteristics of high specificity, low side effect and the like. However, when used alone, its therapeutic effect is limited. Now, the most successful monoclonal antibody tumor drugs are those against lymphoma such as chronic non-Hodgkin's lymphoma (NHL). The Phase II clinical trial of Rituxan targeted at NHL shows that the overall response rate was only 6%. Regarding Herceptin® against metastatic breast cancer, only 15% had a response. Therefore, most monoclonal antibody drugs are used in combination with chemotherapy. For example, Rituxan is used in combination with standard chemotherapy for the treatment of chronic lymphoma, which can increase the effective rate up to 90%. So far, the main way to increase the therapeutic effect of monoclonal antibodies is through antibody-drug conjugates.

[007] O conjugado anticorpo fármaco pertence a um tipo de fármaco “míssil biológico” anticâncer, que é constituída por três partes: o anticorpo, a citotoxina e o ligante que liga as duas partes. Anticorpo monoclonal está acoplado à citotoxina através acoplamento químico. Então, o conjugado anticorpo fármaco especificamente reconhece o receptor na superfície de células cancerosas e se liga ao receptor usando o alvo do anticorpo monoclonal, e então, o conjugado entra nas células, e evita as células cancerosas de proliferarem e mata as células cancerosas usando proteases em células que podem liberar a citotoxina. A tecnologia de acoplamento anticorpo fármaco fez a pequena molécula de fármaco e proteína biológica se fundirem, que pode ter as vantagens de ambas e aumentar a potência dos fármacos notavelmente, reduzir os efeitos colaterais e deste modo se tornar uma nova geração de produto terapêutico.[007] The antibody-drug conjugate belongs to a type of anticancer “biological missile” drug, which consists of three parts: the antibody, the cytotoxin and the linker that connects the two parts. Monoclonal antibody is coupled to cytotoxin through chemical coupling. So, the antibody-drug conjugate specifically recognizes the receptor on the surface of cancer cells and binds to the receptor using the target of the monoclonal antibody, and then, the conjugate enters the cells, and prevents the cancer cells from proliferating and kills the cancer cells using proteases on cells that can release the cytotoxin. Antibody-drug coupling technology has made the small molecule drug and biological protein merge, which can have the advantages of both and increase the potency of drugs remarkably, reduce the side effects, and thus become a new generation of therapeutic product.

[008] O primeiro exemplo de sucesso na prática clínica de conjugado anticorpo fármaco alvo é Gemtuzumab ozogamicina (Wyeth, nome comercial: Mylotarg). Mylotarg é o primeiro anticorpo fármaco monoclonal conjugado aprovado. Este fármaco é composto do anticorpo anti-CD33, a Caliqueamicina (um fármaco que degrada DNA) e o ligante químico AcBut. Mylotarg é um fármaco em que um anti-CD33 IgG4 humanizado está acoplado com um fármaco antitumoral Caliqueamicina, para o tratamento de leucemia mieloide aguda [5]. Mylotarg é a primeira geração de conjugado anticorpo fármaco, que tem três defeitos críticos na tecnologia: em primeiro lugar, o ligante usado para ligar a toxina é muito instável, a meia-vida dele é apenas dois dias, levando a uma severa queda da toxina e um efeito colateral tóxico elevado na prática clínica; em segundo lugar, o anticorpo está acoplado ao ligante através do grupo amino de lisina, mesmo assim, há dezenas de lisinas na superfície de um anticorpo, e os sítios de acoplamento são aleatórios, que parcialmente afetam a potência dos fármacos; mais importante, uma vez que a tecnologia acoplamento não é madura nesse momento, apenas 50 % dos anticorpos pode acoplar com o fármaco, o que resulta em uma insatisfatória potência dos fármacos na prática clínica; em terceiro lugar, o anticorpo usado é IgG4, que carece de citotoxicidade mediada por células dependente do anticorpo (ADCC) e citotoxicidade dependente de complemento (CDC). Portanto, dez anos após a comercialização, Mylotarg foi retirado do mercado devido a um alto efeito colateral tóxico e limitado efeito terapêutico.[008] The first successful example in clinical practice of antibody-drug-targeting conjugate is Gemtuzumab ozogamicin (Wyeth, trade name: Mylotarg). Mylotarg is the first approved monoclonal drug-conjugated antibody. This drug is composed of the anti-CD33 antibody, Calicheamicin (a drug that degrades DNA) and the chemical linker AcBut. Mylotarg is a drug in which a humanized anti-CD33 IgG4 is coupled with an antitumor drug Calicheamicin, for the treatment of acute myeloid leukemia [5]. Mylotarg is the first generation of antibody-drug conjugate, which has three critical flaws in the technology: first, the linker used to bind the toxin is very unstable, the half-life of it is only two days, leading to severe toxin shedding and high toxic side effect in clinical practice; second, the antibody is coupled to the ligand through the amino group of lysine, yet there are dozens of lysines on the surface of an antibody, and the coupling sites are random, which partially affect the potency of drugs; more importantly, since the coupling technology is not mature at this time, only 50% of the antibodies can couple with the drug, which results in an unsatisfactory potency of the drugs in clinical practice; third, the antibody used is IgG4, which lacks antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC). Therefore, ten years after commercialization, Mylotarg was withdrawn from the market due to a high toxic side effect and limited therapeutic effect.

[009] O segundo exemplo de sucesso na prática clínica de conjugado anticorpo fármaco alvo é um novo fármaco para o tratamento de linfoma de Hodgkin. Uma vez tendo um efeito terapêutico muito bom, foi aprovada pelo US FDA em 2011 após apenas a realização da Fase II do teste clínico. Este fármaco foi desenvolvido por Seattle Genetics como um novo conjugado anticorpo fármaco alvo (ADC), que é tratamento alvo para dois tipos de pacientes com linfoma expressando o antígeno CD30. Este conjugado anticorpo fármaco, brentuximab vedotin, é composto de anticorpo monoclonal contra CD30, inibidor de microtúbulo (MMAE) e um ligante químico dipeptídeo. Este conjugado anticorpo fármaco tem características de baixo efeito colateral e inibição efetiva de linfoma. Em um único grupo da Fase II do teste clínico, 102 pacientes de 15 a 77 anos de idade (média de idade=31) com linfoma de Hodgkin recorrente ou refratário, receberam o tratamento de brentuximab vedotin, e o tratamento médio compreende 9 ciclos. Quando o curso do tratamento médio foi 6, 7 meses, a taxa de resposta global foi de 73 %. Quando o curso do tratamento médio foi 20,5 meses, a taxa de resposta completa foi de 34 %; 40 % dos pacientes que receberam o tratamento alcançaram resposta parcial e [7]. A reação adversa mais comum é a lesão do nervo periférico. O sucesso deste fármaco sugere uma viabilidade tecnológica e um futuro muito brilhante do conjugado anticorpo fármaco alvo.[009] The second successful example in clinical practice of antibody-targeting conjugate is a new drug for the treatment of Hodgkin's lymphoma. Once having very good therapeutic effect, it was approved by the US FDA in 2011 after just completing Phase II clinical trial. This drug was developed by Seattle Genetics as a new antibody-drug-targeting conjugate (ADC), which is a target treatment for two types of lymphoma patients expressing the CD30 antigen. This antibody-drug conjugate, brentuximab vedotin, is composed of a monoclonal antibody against CD30, microtubule inhibitor (MMAE) and a dipeptide chemical linker. This antibody-drug conjugate has the characteristics of low side effect and effective inhibition of lymphoma. In a single Phase II clinical trial cohort, 102 patients aged 15 to 77 years (mean age=31) with recurrent or refractory Hodgkin's lymphoma received brentuximab vedotin treatment, and the average treatment comprises 9 cycles. When the average treatment course was 6.7 months, the overall response rate was 73%. When the mean treatment course was 20.5 months, the complete response rate was 34%; 40% of patients who received the treatment achieved a partial response and [7]. The most common adverse reaction is peripheral nerve damage. The success of this drug suggests technological viability and a very bright future for the target-drug antibody conjugate.

[0010] Um outro exemplo de sucesso do conjugado anticorpo fármaco alvo é T-DM1 contra câncer de mama maligno desenvolvido por Genentech Inc. [8]. O anticorpo monoclonal neste conjugado anticorpo fármaco é um anticorpo anti-HER2 (ErbB2) na superfície das células de câncer de mama, que está acoplado à citotoxina, o inibidor de microtúbulo DM1. O resultado na Fase III do teste clínico deste fármaco mostra melhor efeito terapêutico que a quimioterapia, e um efeito colateral mais baixo. Aqueles pacientes com câncer de mama, que tenham recebido tratamento com Herceptin e fármacos de quimioterapia taxanos anteriormente, ainda têm o avanço da doença. Entretanto, recebendo o tratamento do conjugado anticorpo fármaco pode significativamente prolongar o tempo de sobrevivência daqueles pacientes com câncer de mama HER2-positivo sob a premissa de a doença não se torne pior [9] . Com base no bom efeito terapêutico deste fármaco, o fármaco foi aprovado pelo US FDA em 22 fevereiro de 2013 para o tratamento de pacientes de câncer de mama metastático avançado HER2-positivo (veja CN100482281C).[0010] Another successful example of antibody-drug-targeting conjugate is T-DM1 against malignant breast cancer developed by Genentech Inc. [8]. The monoclonal antibody in this antibody-drug conjugate is an anti-HER2 antibody (ErbB2) on the surface of breast cancer cells, which is coupled to the cytotoxin, the DM1 microtubule inhibitor. The result in the Phase III clinical trial of this drug shows better therapeutic effect than chemotherapy, and a lower side effect. Those breast cancer patients, who have received treatment with Herceptin and taxane chemotherapy drugs before, still have disease progression. However, receiving antibody-drug conjugate treatment can significantly prolong the survival time of those patients with HER2-positive breast cancer under the assumption that the disease does not get worse [9] . Based on the good therapeutic effect of this drug, the drug was approved by the US FDA on February 22, 2013 for the treatment of HER2-positive advanced metastatic breast cancer patients (see CN100482281C).

[0011] Embora o Herceptin seja um avanço na história do tratamento de câncer de mama com HER2 superexpresso em que vários tratamentos anticâncer já tinham sido tentados, cerca de 85 % dos indivíduas não têm resposta ou têm apenas uma fraca resposta a terapia com Herceptin [11]. Foi mostrado que HER2 é expresso ou superexpresso em vários tumores. Assim, há uma necessidade urgente na prática clínica para o desenvolvimento de fármacos anticâncer visando HER2, para aqueles pacientes com tumores de HER2 superexpresso ou outra doença relevante de HER2 superexpresso (não apenas incluindo câncer de mama), quem não têm resposta ou têm apenas uma fraca resposta a terapia com Herceptin.[0011] Although Herceptin is a breakthrough in the history of treating HER2 overexpressed breast cancer in which several anticancer treatments had already been tried, approximately 85% of individuals have no response or only a poor response to Herceptin therapy [11]. HER2 has been shown to be expressed or overexpressed in various tumors. Thus, there is an urgent need in clinical practice for the development of anticancer drugs targeting HER2, for those patients with HER2 overexpressing tumors or other relevant HER2 overexpressing disease (not just including breast cancer), who are unresponsive or have only a poor response to Herceptin therapy.

[0012] Portanto, há uma necessidade urgente na prática clínica para o desenvolvimento de um fármaco visando HER2. A presente invenção fornece uma solução técnica para atender a essa necessidade.[0012] Therefore, there is an urgent need in clinical practice for the development of a drug targeting HER2. The present invention provides a technical solution to meet this need.

SUMMARY OF THE INVENTION

[0013] Em um aspecto, a presente invenção fornece um anticorpo ou seus fragmentos funcionais que podem especificamente se ligar ao HER2. Particularmente, o anticorpo compreende uma cadeia pesada e uma cadeia leve, em que: (i) a cadeia pesada compreende três regiões CDR, em que pelo menos uma das regiões CDR tem uma sequência de aminoácidos como mostrada na SEQ ID NO: 1, 2 ou 3 ou tem pelo menos 80 % (de preferência, 85 %, 90 %, 95 %, 98 % ou 99 %) da identidade da sequência com SEQ ID NO: 1, 2 ou 3; e (ii) a cadeia leve compreende três regiões CDR, em que pelo menos uma das regiões CDR tem uma sequência de aminoácidos como mostrada na SEQ ID NO: 4, 5 ou 6 ou tem pelo menos 80 % (de preferência, 85 %, 90 %, 95 %, 98 % ou 99 %) da identidade da sequência com SEQ ID NO: 4, 5 ou 6.[0013] In one aspect, the present invention provides an antibody or functional fragments thereof that can specifically bind to HER2. Particularly, the antibody comprises a heavy chain and a light chain, wherein: (i) the heavy chain comprises three CDR regions, wherein at least one of the CDR regions has an amino acid sequence as shown in SEQ ID NO: 1, 2 or 3 or has at least 80% (preferably 85%, 90%, 95%, 98% or 99%) sequence identity with SEQ ID NO: 1, 2 or 3; and (ii) the light chain comprises three CDR regions, wherein at least one of the CDR regions has an amino acid sequence as shown in SEQ ID NO: 4, 5 or 6 or has at least 80% (preferably 85%, 90%, 95%, 98% or 99%) sequence identity with SEQ ID NO: 4, 5 or 6.

[0014] Em uma modalidade particular, o anticorpo compreende uma cadeia pesada e uma cadeia leve, em que: (i) a cadeia pesada compreende três regiões CDR, cada qual tem a sequência de aminoácidos como mostrada na SEQ ID NO: 1, 2 e 3, respectivamente; e/ou (ii) a cadeia leve compreende três regiões CDR, cada qual tem a sequência de aminoácidos como mostrada na SEQ ID NO: 4, 5 e 6, respectivamente.[0014] In a particular embodiment, the antibody comprises a heavy chain and a light chain, wherein: (i) the heavy chain comprises three CDR regions, each of which has the amino acid sequence as shown in SEQ ID NO: 1, 2 and 3, respectively; and/or (ii) the light chain comprises three CDR regions, each of which has the amino acid sequence as shown in SEQ ID NO: 4, 5 and 6, respectively.

[0015] Em uma modalidade preferida, a presente invenção fornece um anticorpo secretado a partir de células de hibridoma (depositado no Centro Geral de Coleção de Culturas Microbiológicas da China (localizado no Instituto de Microbiologia, Academia Chinesa de Ciências, N° 3, 1st Beichen West Rd., Chaoyang District, Beijing 100101, P. R.China) em 22 de agosto de 2013, com o número de depósito 8102 (CGMCC N° 8102) ) ou um anticorpo dele derivado (a data de transferência para o Tratado de Budapeste é 29 de outubro de 2013). Em uma outra modalidade preferida, a presente invenção fornece um anticorpo secretado a partir de células de ovário de hamster chinês (CHO) (depositado no Centro para Coleção de Tipos de Culturas da China (localizado na Universidade de Wuhan, Luojia Mountain, Wuchang District, Wuhan City, Hubei 430072, P. R.China) em 6 de novembro de 2013, com o número de depósito C2013170 (CCTCC C2013170)) ou um anticorpo dele derivado.[0015] In a preferred embodiment, the present invention provides an antibody secreted from hybridoma cells (deposited at the China General Microbiological Culture Collection Center (located at the Institute of Microbiology, Chinese Academy of Sciences, No. MCC No. 8102)) or an antibody derived therefrom (transfer date to the Budapest Treaty is October 29, 2013). In another preferred embodiment, the present invention provides an antibody secreted from Chinese hamster ovary (CHO) cells (deposited at China Type Culture Collection Center (located at Wuhan University, Luojia Mountain, Wuchang District, Wuhan City, Hubei 430072, P.R.China) on November 6, 2013, with deposit number C2013170 (CCTCC C2013170)) or an antibody derived therefrom.

[0016] Em um outro aspecto, a presente invenção fornece um polinucleotídeo isolado codificando o anticorpo da presente invenção.[0016] In another aspect, the present invention provides an isolated polynucleotide encoding the antibody of the present invention.

[0017] Em um aspecto adicional, a presente invenção fornece uma combinação dos polinucleotídeos isolados, que compreende o polinucleotídeo codificando a cadeia leve do anticorpo da presente invenção ou os seus fragmentos funcionais e o polinucleotídeo codificando a cadeia pesada do anticorpo da presente invenção ou os seus fragmentos funcionais.[0017] In a further aspect, the present invention provides a combination of isolated polynucleotides, comprising the polynucleotide encoding the light chain of the antibody of the present invention or its functional fragments and the polynucleotide encoding the heavy chain of the antibody of the present invention or its functional fragments.

[0018] Em um aspecto adicional, a presente invenção fornece um vetor de expressão que compreende o polinucleotídeo de acordo com a presente invenção ou a combinação dos polinucleotídeos de acordo com a presente invenção, em que o polinucleotídeo operacionalmente se liga a uma sequência reguladora que permite o polipeptídeo codificado pelo polinucleotídeo se expressar em uma célula hospedeira ou em um sistema de expressão livre de célula.[0018] In a further aspect, the present invention provides an expression vector comprising the polynucleotide according to the present invention or the combination of polynucleotides according to the present invention, wherein the polynucleotide operably binds to a regulatory sequence that allows the polypeptide encoded by the polynucleotide to be expressed in a host cell or in a cell-free expression system.

[0019] Em um outro aspecto, a presente invenção fornece um conjugado compreendendo o anticorpo da presente invenção ou os seus fragmentos funcionais que estão acoplados a um ou mais agentes terapêuticos. De preferência, o agente terapêutico é um fármaco citotóxico (tais como antimetabólitos, antibióticos antitumorais, alcaloides), imunopotenciadores ou isótopos radioativos. Mais preferencialmente, o agente terapêutico é selecionado a partir de maitansinoides (tal como Ansamicina ou Mertansina), dolastatina e seus derivados. Mais preferencialmente, o agente terapêutico é selecionado a partir de MMAE (Monometil auristatina E) e MMAF (Monometil auristatina F). Em outras modalidades, o agente terapêutico pode também ser selecionado a partir daqueles listados na Tabela 1 como abaixo. Tabela 1 Lista dos agentes terapêuticos disponíveis nos conjugados da presente invenção [0019] In another aspect, the present invention provides a conjugate comprising the antibody of the present invention or its functional fragments that are coupled to one or more therapeutic agents. Preferably, the therapeutic agent is a cytotoxic drug (such as antimetabolites, antitumor antibiotics, alkaloids), immunopotentiators or radioactive isotopes. More preferably, the therapeutic agent is selected from maytansinoids (such as Ansamycin or Mertansine), dolastatin and derivatives thereof. More preferably, the therapeutic agent is selected from MMAE (Monomethyl Auristatin E) and MMAF (Monomethyl Auristatin F). In other embodiments, the therapeutic agent can also be selected from those listed in Table 1 as below. Table 1 List of therapeutic agents available in the conjugates of the present invention

[0020] Em algumas modalidades específicas, o agente terapêutico está acoplado ao dito anticorpo ou os seus fragmentos funcionais através de um ligante. O ligante usado na presente invenção pode estar ligado ao anticorpo por qualquer meio conhecido no estado da técnica, de preferência, ligado através do tiol e/ou amino. Em uma modalidade particular preferida, o anticorpo da presente invenção está ligado ao ligante através do tiol. O ligante usado na presente invenção pode ser um ligante clivável (isto é, o ligante poderia ser quebrado em meio in vivo) ou um ligante não clivável. Em algumas modalidades, o ligante da presente invenção é selecionado a partir de ligantes cliváveis, de preferência, a partir de ligantes de peptídeo, hidrazona e dissulfeto, tais como maleimidocaproil-valina-citrulina-p- aminobenziloxicarbonil (abreviado no presente documento como mc-vc-pAB ou vc). Em outras modalidades, o ligante da presente invenção é selecionado a partir de ligantes não cliváveis, tais como maleimidocaproil (abreviado no presente documento como mc). Em outras modalidades, o ligante pode também ser selecionado a partir daqueles listados na Tabela 2 como abaixo. Tabela 2 Lista dos ligantes disponíveis nos conjugados da presente invenção [0020] In some specific embodiments, the therapeutic agent is coupled to said antibody or its functional fragments via a linker. The linker used in the present invention can be linked to the antibody by any means known in the art, preferably thiol and/or amino linked. In a particularly preferred embodiment, the antibody of the present invention is linked to the linker through the thiol. The linker used in the present invention can be a cleavable linker (i.e., the linker could be broken in an in vivo environment) or a non-cleavable linker. In some embodiments, the linker of the present invention is selected from cleavable linkers, preferably from peptide, hydrazone, and disulfide linkers, such as maleimidocaproyl-valine-citrulline-p-aminobenzyloxycarbonyl (abbreviated herein as mc-vc-pAB or vc). In other embodiments, the linker of the present invention is selected from non-cleavable linkers, such as maleimidocaproyl (abbreviated herein as mc). In other embodiments, the binder may also be selected from those listed in Table 2 as below. Table 2 List of linkers available in the conjugates of the present invention

[0021] Em um outro aspecto, a presente invenção fornece um conjugado anticorpo fármaco tendo a fórmula geral Ab-(L-U)n, em que Ab representa o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais, L representa um ligante (por exemplo, mc-vc-pAB ou mc) , U representa o agente terapêutico (de preferência, o agente terapêutico é selecionado a partir de um fármaco citotóxico, imunopot enc iadores e isótopos radioativos; mais preferencialmente, o agente terapêutico é selecionado a partir de maitansinoides, dolastatina e seus derivados; mais preferencialmente, o agente terapêutico é selecionado a partir de MMAE e MMAF), e n representa um número inteiro de 1 a 8 (por exemplo, 1, 2, 3, 4, 5, 6, 7 ou 8) . O ligante usado na presente invenção pode ser um ligante clivável (isto é, o ligante poderia ser quebrado in vivo) ou um ligante não clivável.[0021] In another aspect, the present invention provides an antibody-drug conjugate having the general formula Ab-(L-U)n, wherein Ab represents the antibody according to the present invention or its functional fragments, L represents a linker (for example, mc-vc-pAB or mc), U represents the therapeutic agent (preferably, the therapeutic agent is selected from a cytotoxic drug, immunopotentiators and radioactive isotopes; more preferably, the therapeutic agent is selected from of maytansinoids, dolastatin and their derivatives; more preferably, the therapeutic agent is selected from MMAE and MMAF), and n represents an integer from 1 to 8 (e.g., 1, 2, 3, 4, 5, 6, 7 or 8). The linker used in the present invention can be a cleavable linker (i.e. the linker could be broken in vivo) or a non-cleavable linker.

[0022] Em um aspecto adicional, a presente invenção fornece a composição farmacêutica, que compreende o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais e/ou o conjugado de acordo com a presente invenção, bem como um veículo farmaceuticamente aceitável.[0022] In a further aspect, the present invention provides the pharmaceutical composition, which comprises the antibody according to the present invention or its functional fragments and/or the conjugate according to the present invention, as well as a pharmaceutically acceptable carrier.

[0023] Em um outro aspecto, a presente invenção fornece um método para o tratamento de ou prevenção do câncer (especialmente câncer HER2- positivo), que inclui administrar o anticorpo, o polinucleotídeo, a combinação dos polinucleotídeos, o vetor de expressão, o conjugado e/ou a composição farmacêutica de acordo com a presente invenção em uma quantidade terapeuticamente eficaz em um indivíduo que dele necessite.[0023] In another aspect, the present invention provides a method for treating or preventing cancer (especially HER2-positive cancer), which includes administering the antibody, polynucleotide, polynucleotide combination, expression vector, conjugate and/or pharmaceutical composition according to the present invention in a therapeutically effective amount to an individual in need thereof.

[0024] Em um aspecto adicional, a presente invenção fornece o uso do anticorpo, o polinucleotídeo, a combinação dos polinucleotídeos, vetor de expressão, conjugado e/ou composição farmacêutica de acordo com a presente invenção na fabricação de um fármaco para o tratamento ou prevenção do câncer.[0024] In a further aspect, the present invention provides the use of the antibody, polynucleotide, combination of polynucleotides, expression vector, conjugate and/or pharmaceutical composition according to the present invention in the manufacture of a drug for the treatment or prevention of cancer.

[0025] Em um aspecto adicional, a presente invenção fornece o anticorpo, o polinucleotídeo, a combinação dos polinucleotídeos, o vetor de expressão, o conjugado e/ou a composição farmacêutica de acordo com a presente invenção, que são usados para o tratamento de ou prevenção do câncer. De preferência, o câncer é câncer HER2-positivo. Mais preferencialmente, o câncer é selecionado a partir de câncer de mama, câncer de ovário ou câncer gástrico. Mais preferencialmente, o câncer é câncer resistente a Lapatinib e/ou Herceptin, tais como câncer de mama, câncer de ovário ou câncer gástrico resistente a Lapatinib e/ou Herceptin.[0025] In a further aspect, the present invention provides the antibody, polynucleotide, combination of polynucleotides, expression vector, conjugate and/or pharmaceutical composition according to the present invention, which are used for the treatment of or prevention of cancer. Preferably, the cancer is HER2-positive cancer. More preferably, the cancer is selected from breast cancer, ovarian cancer or gastric cancer. More preferably, the cancer is cancer resistant to Lapatinib and/or Herceptin, such as breast cancer, ovarian cancer or gastric cancer resistant to Lapatinib and/or Herceptin.

[0026] Em um aspecto adicional, a presente invenção fornece uma célula de hibridoma, que foi depositada no Centro Geral de Coleção de Culturas Microbiológicas da China em 22 de agosto de 2013 com o número de depósito 8102 (a data de transferência para o Tratado de Budapeste é 29 de outubro de 2013).[0026] In a further aspect, the present invention provides a hybridoma cell, which was deposited at the China General Collection Center of Microbiological Cultures on August 22, 2013 with deposit number 8102 (the date of transfer to the Budapest Treaty is October 29, 2013).

[0027] Em um aspecto adicional, a presente invenção fornece uma célula CHO, que foi depositada no Centro para Coleção de Tipos de Culturas da China em 6 de novembro de 2013, com o número de depósito C2013170.[0027] In a further aspect, the present invention provides a CHO cell, which was deposited at the Center for Collection of Type Cultures of China on November 6, 2013, with deposit number C2013170.

[0028] Especificamente, a presente invenção se refere a um conjugado anticorpo fármaco (ADC), que pode tratar o câncer. O conjugado compreende a anticorpo monoclonal que é capaz de se ligar especificamente ao receptor de superfície da célula cancerosa, a pequena molécula de fármaco com efeito citotóxico bem como um ligante que pode se ligar as duas partes juntas acima mencionadas através de ligação covalente. A presente invenção também se refere ao uso desses conjugados na fabricação de um fármaco para o tratamento câncer de mama e/ou câncer de ovário e/ou câncer gástrico.[0028] Specifically, the present invention relates to an antibody drug conjugate (ADC) that can treat cancer. The conjugate comprises the monoclonal antibody which is able to specifically bind to the cancer cell surface receptor, the small molecule drug with cytotoxic effect as well as a linker which can bind the above-mentioned two parts together through covalent bonding. The present invention also relates to the use of these conjugates in the manufacture of a drug for the treatment of breast cancer and/or ovarian cancer and/or gastric cancer.

[0029] Em algumas modalidades específicas, a presente invenção se refere a um conjugado anticorpo fármaco, que tem a fórmula geral Ab- (L-U) n, em que Ab representa o anticorpo monoclonal visando HER2, L é selecionado a partir de mc-vc-pAB ou mc, U é selecionado a partir de MMAE ou MMAF, e n representa um número inteiro de 1 a 8.[0029] In some specific embodiments, the present invention relates to an antibody-drug conjugate, which has the general formula Ab-(L-U)n, where Ab represents the monoclonal antibody targeting HER2, L is selected from mc-vc-pAB or mc, U is selected from MMAE or MMAF, and n represents an integer from 1 to 8.

[0030] Particularmente, o anticorpo humanizado visando HER2 como revelado na presente invenção é RC48, em que as regiões CDR da cadeia pesada são tal como mostrado pela SEQ ID NO. 1, SEQ ID NO. 2 e SEQ ID NO. 3, respectivamente.[0030] Particularly, the humanized antibody targeting HER2 as disclosed in the present invention is RC48, wherein the heavy chain CDR regions are as shown by SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 respectively.

[0031] Particularmente, o anticorpo humanizado visando HER2 como revelado na presente invenção é RC48, em que as regiões CDR da cadeia leve são tal como mostrado pela SEQ ID NO. 4, SEQ ID NO. 5 e SEQ ID NO. 6, respectivamente.[0031] Particularly, the humanized antibody targeting HER2 as disclosed in the present invention is RC48, wherein the light chain CDR regions are as shown by SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, respectively.

[0032] Mais particularmente, o anticorpo humanizado visando HER2 como revelado na presente invenção é RC48, que é secretado a partir das células depositadas no Centro para Coleção de Tipos de Culturas da China em 6 de novembro de 2013, com o número de depósito C2013170.[0032] More particularly, the humanized antibody targeting HER2 as disclosed in the present invention is RC48, which is secreted from the cells deposited at the China Center for Culture Type Collection on November 6, 2013, with deposit number C2013170.

[0033] Trastuzumab (Herceptin®) é um anticorpo monoclonal recombinante humanizado, seletivamente visando o domínio extracelular receptor do fator de crescimento do epidérmico humano-2 (HER2), principalmente usado para o tratamento de câncer HER2-positivo. O anticorpo humanizado RC48 da presente invenção é um anticorpo HER2 humano recombinante, que é capaz de se ligar ao domínio extracelular de HER2 com alta afinidade. Em experimentos in vitro e in vivo, o anticorpo monoclonal RC48 mostra elevada capacidade de inibir a proliferação de células tumorais humanas HER2-superexpressas.[0033] Trastuzumab (Herceptin®) is a humanized recombinant monoclonal antibody, selectively targeting the human epidermal growth factor receptor-2 (HER2) extracellular domain, primarily used for the treatment of HER2-positive cancer. The RC48 humanized antibody of the present invention is a recombinant human HER2 antibody, which is capable of binding the extracellular domain of HER2 with high affinity. In in vitro and in vivo experiments, the RC48 monoclonal antibody shows high capacity to inhibit the proliferation of HER2-overexpressed human tumor cells.

[0034] As duas pequenas moléculas de citotoxinas envolvidas na presente invenção são MMAE (Monometil auristatina E) ou MMAF (Monometil auristatina F) (veja Fig. 6), que são dois tipos de pequenas moléculas inibidoras de tubulina celular. A presente invenção também se refere a dois tipos de ligantes: Maleimidocaproil (abreviado no presente documento como mc) e Maleimido-Caproil-Valina-Citrulina-p- AminoBenziloxi (abreviado no presente documento como mc-vc-pAB, que é também simplesmente representado pelo vc no nome de um conjugado) (veja Fig. 7); o anterior ligante é não clivável, enquanto o último é clivável, e os conjugados correspondentes mostram estabilidade e meia-vida diferentes in vivo. Os três conjugados anticorpo fármaco a seguir são formados pelo anticorpo monoclonal RC48 ligado ao ligante através da cisteína: RC48-vc- MMAE (veja Fig. 8), RC48-vc-MMAF (veja Fig. 9) e RC48- mc-MMAF (veja Fig. 10).[0034] The two small molecule cytotoxins involved in the present invention are MMAE (Monomethyl auristatin E) or MMAF (Monomethyl auristatin F) (see Fig. 6), which are two types of small molecule inhibitors of cellular tubulin. The present invention also relates to two types of linkers: Maleimidocaproyl (abbreviated herein as mc) and Maleimido-Caproyl-Valine-Citrulline-p-AminoBenzyloxy (abbreviated herein as mc-vc-pAB, which is also simply represented by vc in the name of a conjugate) (see Fig. 7); the former linker is non-cleavable, while the latter is cleavable, and the corresponding conjugates show different stability and half-life in vivo. The following three antibody-drug conjugates are formed by the RC48 monoclonal antibody linked to the linker via cysteine: RC48-vc-MMAE (see Fig. 8), RC48-vc-MMAF (see Fig. 9) and RC48-mc-MMAF (see Fig. 10).

[0035] O conjugado da presente invenção tem capacidade de ligação antígeno-anticorpo in vitro comparável com o anticorpo naked RC48, e T- DM1. No ensaio de viabilidade celular, sua citotoxicidade é significativamente maior que aquela do anticorpo naked RC48, Herceptin, T DM1, em que as células usadas no experimento incluem cepa de célula de câncer de mama SK-BR-3 com alta expressão de HER2 (Fig. 12) e cepa de célula de câncer de ovário SK-OV-3 com alta expressão de HER2 (Fig. 13). Nos experimentos animais de modelo de camundongos nude para transplante de tumor, o conjugado da presente invenção tem um significativo efeito antitumoral para camundongo nude portador de tumor de câncer de mama humano BT474 (Fig. 14) , e o conjugado preferido mostra significante atividade antitumoral para camundongo nude portador de tumor resistente a Herceptin® e Lapatinib, com o efeito significativamente melhor que fármacos de controle positivo (Fig. 15); enquanto isso, o anticorpo conjugado da presente invenção mostra inesperadamente efeito antitumoral para camundongo nude portador de tumor transplantado de câncer de ovário e câncer gástrico (Fig. 16 e Fig. 17) . Através do experimento em camundongo in vivo, determina-se que as doses de tolerância máxima do presente conjugado são como se segue: RC48-mc-MMAF: >150 mg/kg, RC48-vc- MMAF: 60 mg/kg, RC48-vc-MMAE: 100 mg/kg, respectivamente. Além disso, o teste de eficácia é realizado usando modelo de tumor transplantado de câncer de ovário humano de camundongos nu, e verifica-se que durante a administração do fármaco, observando a mudança dos volumes dos tumores dos camundongos modelos e os pesos dos corpos dos camundongos per se, a potência do conjugado é significativamente maior que aquelas do anticorpo naked e T-DM1. Além disso, os pesos dos corpos dos camundongos aumentaram (Fig. 18), mostrando uma boa potência com baixa toxicidade e alta eficiência. O conjugado fornece um novo fármaco candidato para escolha para o tratamento de câncer HER2-positivo, câncer resistente ao anticorpo fármaco HER2, câncer resistente a inibidor tirosina quinase e outras doenças relevantes.[0035] The conjugate of the present invention has in vitro antigen-antibody binding ability comparable to naked antibody RC48, and T-DM1. In the cell viability assay, its cytotoxicity is significantly higher than that of naked antibody RC48, Herceptin, T DM1, where the cells used in the experiment include breast cancer cell strain SK-BR-3 with high expression of HER2 (Fig. 12) and ovarian cancer cell strain SK-OV-3 with high expression of HER2 (Fig. 13). In the animal experiments of nude mouse model for tumor transplantation, the conjugate of the present invention has a significant antitumor effect for nude mouse bearing human breast cancer tumor BT474 (Fig. 14), and the preferred conjugate shows significant antitumor activity for nude mouse bearing tumor resistant to Herceptin® and Lapatinib, with the effect significantly better than positive control drugs (Fig. 15); Meanwhile, the conjugated antibody of the present invention unexpectedly shows anti-tumor effect for nude mice bearing transplanted ovarian cancer and gastric cancer tumor (Fig. 16 and Fig. 17). Through the in vivo mouse experiment, the maximum tolerable doses of the present conjugate are determined to be as follows: RC48-mc-MMAF: >150 mg/kg, RC48-vc-MMAF: 60 mg/kg, RC48-vc-MMAE: 100 mg/kg, respectively. Furthermore, the efficacy test is performed using human ovarian cancer transplanted tumor model from nude mice, and it is found that during drug administration, observing the change of the tumor volumes of the model mice and the body weights of the mice per se, the potency of the conjugate is significantly higher than those of the naked antibody and T-DM1. Furthermore, the body weights of the mice increased (Fig. 18), showing good potency with low toxicity and high efficiency. The conjugate provides a new drug candidate of choice for the treatment of HER2-positive cancer, HER2 drug-antibody-resistant cancer, tyrosine kinase inhibitor-resistant cancer, and other relevant diseases.

[0036] Em algumas modalidades específicas, o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais é isolado.[0036] In some specific embodiments, the antibody according to the present invention or its functional fragments is isolated.

[0037] Em algumas modalidades específicas, o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais é anticorpo monoclonal.[0037] In some specific embodiments, the antibody according to the present invention or functional fragments thereof is a monoclonal antibody.

[0038] Em algumas modalidades específicas, o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais é anticorpo humanizado.[0038] In some specific embodiments, the antibody according to the present invention or its functional fragments is humanized antibody.

[0039] Em algumas modalidades específicas, o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais têm atividade ADCC.[0039] In some specific embodiments, the antibody according to the present invention or its functional fragments have ADCC activity.

[0040] Em algumas modalidades específicas, o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais têm atividade CDC.[0040] In some specific embodiments, the antibody according to the present invention or its functional fragments have CDC activity.

[0041] Em algumas modalidades específicas, o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais especificamente se liga a HER2, enquanto basicamente não se liga a EGFR, HER3 e HER4.[0041] In some specific embodiments, the antibody according to the present invention or its functional fragments specifically bind to HER2, while basically not binding to EGFR, HER3 and HER4.

[0042] Em algumas modalidades específicas, o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais é anticorpo IgG1K.[0042] In some specific embodiments, the antibody according to the present invention or its functional fragments is IgG1K antibody.

[0043] Em algumas modalidades específicas, o anticorpo de acordo com a presente invenção ou os seus fragmentos funcionais é útil para o tratamento de ou prevenção do câncer, em que o câncer superexpresse HER2. BREVE DESCRIÇÃO DOS DESENHOS[0043] In some specific embodiments, the antibody according to the present invention or its functional fragments is useful for treating or preventing cancer, wherein the cancer overexpresses HER2. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] A Fig. 1 representa a figura SDS-PAGE da proteína recombinante humana purificada HER2-ECD, que é corada com Coomassie Brilliant Blue. Cada poço é carregado com 10 ug.[0044] Fig. 1 represents the SDS-PAGE figure of the purified human recombinant protein HER2-ECD, which is stained with Coomassie Brilliant Blue. Each well is loaded with 10 ug.

[0045] A Fig. 2 representa as figuras de análise de SDS-PAGE de cRC48, RC48, em que cada poço é carregado com 2 g de anticorpo.[0045] Fig. 2 depicts figures from SDS-PAGE analysis of cRC48, RC48, where each well is loaded with 2 g of antibody.

[0046] A Fig. 3 mostra a afinidade de ligação entre anticorpo humanizado RC48 e HER2-ECD determinado por teste ELISA, e a constante de afinidade de ligação calculada Kd. Herceptin e cRC48 são usados como controle neste ensaio.[0046] Fig. 3 shows the binding affinity between humanized antibody RC48 and HER2-ECD determined by ELISA test, and the calculated binding affinity constant Kd. Herceptin and cRC48 are used as controls in this assay.

[0047] A Fig. 4A representa a análise da capacidade de ligação do anticorpo humanizado anti-HER2 RC48 com células HER2+ (SK-BR3, BT474) e células HER2- (MDA-MB468) por citometria de fluxo. Fig. 4B mostra a análise da capacidade de ligação do anticorpo anti-HER2 com antígeno de superfície celular BT474 por citometria de fluxo em diferentes concentrações de anticorpo. O anticorpo anti-HER2 inclui Herceptin, cRC48, RC48. Um total de 5x104 células são analisadas.[0047] Fig. 4A depicts the analysis of the ability of humanized anti-HER2 antibody RC48 to bind to HER2+ cells (SK-BR3, BT474) and HER2- cells (MDA-MB468) by flow cytometry. Fig. 4B shows analysis of the binding ability of anti-HER2 antibody with BT474 cell surface antigen by flow cytometry at different antibody concentrations. Anti-HER2 antibody includes Herceptin, cRC48, RC48. A total of 5x104 cells are analyzed.

[0048] A Fig. 5 indica que RC48 apenas mostra a afinidade de ligação específica com HER2, mas não com EGFR, HER3 e HER4.[0048] Fig. 5 indicates that RC48 only shows specific binding affinity with HER2, but not with EGFR, HER3 and HER4.

[0049] A Fig. 6 mostra a estruturas moleculares de antitubulina, MMAE e MMAF.[0049] Fig. 6 shows the molecular structures of antitubulin, MMAE and MMAF.

[0050] A Fig. 7 mostra a estruturas moleculares dos ligantes químicos, mc-vc-pAB e mc.[0050] Fig. 7 shows the molecular structures of the chemical ligands, mc-vc-pAB and mc.

[0051] A Fig. 8 mostra a estrutura molecular do conjugado anticorpo fármaco RC48 (RC48-vc-MMAE).[0051] Fig. 8 shows the molecular structure of the RC48 antibody-drug conjugate (RC48-vc-MMAE).

[0052] A Fig. 9 mostra a estrutura molecular do conjugado anticorpo fármaco RC48 (RC48-vc-MMAF).[0052] Fig. 9 shows the molecular structure of the RC48 antibody-drug conjugate (RC48-vc-MMAF).

[0053] A Fig. 10 mostra a estrutura molecular do conjugado anticorpo fármaco RC48 (RC48-mc-MMAF).[0053] Fig. 10 shows the molecular structure of the RC48 antibody-drug conjugate (RC48-mc-MMAF).

[0054] A Fig. 11 mostra o efeito antitumoral de RC48 direcionado ao modelo de tumor transplantado de câncer de mama humano BT474.[0054] Fig. 11 shows the antitumor effect of RC48 targeting the BT474 human breast cancer transplanted tumor model.

[0055] A Fig. 12 mostra o efeito inibidor do crescimento do conjugado RC48 direcionado à célula HER2-positivo SK-BR-3.[0055] Fig. 12 shows the growth inhibitory effect of the RC48 conjugate targeted at the HER2-positive SK-BR-3 cell.

[0056] A Fig. 13 mostra o efeito inibidor do crescimento de conjugado RC48 direcionado à célula HER2-positivo SK-OV-3.[0056] Fig. 13 shows the growth inhibitory effect of RC48 conjugate targeted to HER2-positive SK-OV-3 cell.

[0057] A Fig. 14 mostra o efeito antitumoral do conjugado RC48 direcionado ao modelo de camundongo nude portadores de tumor de câncer de mama humano BT474.[0057] Fig. 14 shows the antitumor effect of the RC48 conjugate targeted to the nude mouse model bearing the BT474 human breast cancer tumor.

[0058] A Fig. 15 mostra os efeitos terapêuticos de RC48-vc-MMAE, T-DM1 direcionados a tumores de câncer de mama BT-474/L1.9 humano resistentes a Herceptin e Lapatinib transplantados em camundongo nude.[0058] Fig. 15 shows the therapeutic effects of RC48-vc-MMAE, T-DM1 targeting Herceptin and Lapatinib-resistant BT-474/L1.9 human breast cancer tumors transplanted into nude mice.

[0059] A Fig. 16 mostra o efeito antitumoral do conjugado RC48 direcionado ao modelo de tumor transplantado de câncer de ovário humano SK-OV-3.[0059] Fig. 16 shows the antitumor effect of the RC48 conjugate targeted to the SK-OV-3 human ovarian cancer transplanted tumor model.

[0060] A Fig. 17 mostra os efeitos terapêuticos de RC48-vc-MMAE, Herceptin, Lapatinib direcionados aos tumores de câncer gástrico NCI -N87 humano transplantados em camundongo nude.[0060] Fig. 17 shows the therapeutic effects of RC48-vc-MMAE, Herceptin, Lapatinib targeted at human NCI -N87 gastric cancer tumors transplanted into nude mice.

[0061] A Fig. 18 mostra o efeito de diferentes conjugados anticorpo fármaco nos pesos dos corpos dos camundongos.[0061] Fig. 18 shows the effect of different antibody-drug conjugates on mouse body weights.

DESCRIPTION OF SPECIFIC MODALITIES Definitions

[0062] A não ser de outro modo definido, todos os termos tecnológicos usados no presente documento têm os mesmos significados como entendido por aqueles técnicos no assunto. Com as definições e termos no estado da técnica, uma pessoa técnica no assunto pode fazer referência ao Current Protocols in Molecular Biology (Ausubel) para mais detalhes. A abreviação do resíduo de aminoácido é o código padrão de três letras e/ou uma letra usada no estado da técnica, que representa um dos 20 L- aminoácidos comuns.[0062] Unless otherwise defined, all technological terms used herein have the same meanings as understood by those skilled in the art. With definitions and terms in the prior art, a person skilled in the art can refer to Current Protocols in Molecular Biology (Ausubel) for further details. The amino acid residue abbreviation is the standard three-letter and/or one-letter code used in the prior art, which represents one of the 20 common L-amino acids.

[0063] Embora a presente invenção use a faixa de números e o valor do parâmetro aproximado em sentido amplo, o número como mostrado no exemplo específico é relatado o mais exato possível. Entretanto, qualquer número em si inclui inevitavelmente um erro em certa medida, que é causado pelo desvio padrão produzido a partir de cada uma das suas medições. Além disso, todas as faixas como reveladas na presente invenção devem ser entendida para cobrir qualquer e todas as subfaixas contidas no presente documento. Por exemplo, a faixa de “1 a 10” como relatado deve ser considerada como contendo qualquer e todas as subfaixas entre o valor mínimo de 1 e o valor máximo de 10 (incluindo os pontos finais); isto é, todas as subfaixas começando do valor mínimo de 1 ou a partir de um outro ponto maior (tais como de 1 a 6.1), e as subfaixas terminando com o valor máximo de 10 ou um outro ponto menor (tais como de 5,5 a 10). Além disso, qualquer uma das referências relatadas como “incorporada no presente documento” deve ser entendida como sendo incorporada na sua totalidade.[0063] Although the present invention uses the range of numbers and the approximate parameter value in a broad sense, the number as shown in the specific example is reported as accurate as possible. However, any number itself inevitably includes an error to some extent, which is caused by the standard deviation produced from each of your measurements. Furthermore, all ranges as disclosed in the present invention are to be understood to cover any and all subranges contained herein. For example, the range “1 to 10” as reported should be considered to contain any and all subranges between the minimum value of 1 and the maximum value of 10 (including the endpoints); that is, all subranges starting from the minimum value of 1 or one other greater point (such as 1 to 6.1), and the subranges ending with the maximum value of 10 or one other lesser point (such as 5.5 to 10). In addition, any of the references reported as “incorporated herein” shall be understood to be incorporated in their entirety.

[0064] Além disso, deve ser notado que, como usado na presente especificação, a forma singular inclui a forma plural do assunto indicado, a menos que seja claramente e definitivamente limitado a um assunto indicado. O termo “ou” pode ser de modo intercambiável usado com “e/ou”, a menos que seja claramente indicado no contexto.[0064] Furthermore, it should be noted that, as used in the present specification, the singular form includes the plural form of the indicated subject, unless it is clearly and definitely limited to an indicated subject. The term "or" may be used interchangeably with "and/or", unless clearly indicated in the context.

[0065] O termo “composição farmacêutica”, “combinação de fármaco” e “fármaco da combinação” como usado no presente documento pode ser usado de modo intercambiável, que significa a combinação para alcançar um certo objetivo específico combinando pelo menos um tipo de fármaco e opcionalmente um veículo farmaceuticamente aceitável ou adjuvante junto. Em algumas modalidades, a composição farmacêutica inclui a combinação separada no nível de tempo e/ou espacial, desde que possa atingir o objetivo da presente invenção trabalhando juntos. Por exemplo, os ingredientes contidos na composição farmacêutica (tais como o anticorpo, molécula de ácido nucleico, combinação e/ou conjugado de molécula de ácido nucleico) podem ser administrados em um indivíduo completamente ou separadamente. Quando os ingredientes contidos na composição farmacêutica são administrados separadamente no indivíduo, os ingredientes podem ser administrados simultaneamente ou sequencialmente. De preferência, o veículo farmaceuticamente aceitável é água, solução aquosa tamponada, solução salina isotônica tais como PBS (solução tampão de fosfato), glicose, manitol, dextrose, lactose, amido, estearato de magnésio, celulose, carbonato de magnésio, 0,3 % de glicerina, ácido hialurônico, etanol ou polialquileno glicol tais como poli (propileno glicol), triglicerídeo e afins. Os tipos de veículos farmaceuticamente aceitáveis usados especialmente dependem se a composição de acordo com a presente invenção é formulada para administração oral, nasal, intracutânea, subcutânea, intramuscular ou intravenosa. A composição de acordo com a presente invenção pode compreender agente úmido, emulsificante ou materiais tampão como aditivos.[0065] The term "pharmaceutical composition", "drug combination" and "drug combination" as used herein can be used interchangeably, which means the combination to achieve a certain specific purpose by combining at least one type of drug and optionally a pharmaceutically acceptable carrier or adjuvant together. In some embodiments, the pharmaceutical composition includes the combination separated on the level of time and/or space, as long as it can achieve the object of the present invention by working together. For example, the ingredients contained in the pharmaceutical composition (such as the antibody, nucleic acid molecule, nucleic acid molecule combination and/or conjugate) can be administered to an individual completely or separately. When the ingredients contained in the pharmaceutical composition are administered separately to the individual, the ingredients can be administered simultaneously or sequentially. Preferably, the pharmaceutically acceptable carrier is water, buffered aqueous solution, isotonic saline solution such as PBS (phosphate buffer solution), glucose, mannitol, dextrose, lactose, starch, magnesium stearate, cellulose, magnesium carbonate, 0.3% glycerin, hyaluronic acid, ethanol or polyalkylene glycol such as poly(propylene glycol), triglyceride and the like. The types of pharmaceutically acceptable carriers used especially depend on whether the composition according to the present invention is formulated for oral, nasal, intracutaneous, subcutaneous, intramuscular or intravenous administration. The composition according to the present invention may comprise wetting agent, emulsifier or buffer materials as additives.

[0066] A composição, vacina ou formulação farmacêutica de acordo com a presente invenção poderia ser administrada por quaisquer vias adequadas, tais como administração oral, nasal, intracutânea, subcutânea, intramuscular ou intravenosa.[0066] The composition, vaccine or pharmaceutical formulation according to the present invention could be administered by any suitable routes, such as oral, nasal, intracutaneous, subcutaneous, intramuscular or intravenous administration.

[0067] O termo “agente terapêutico” como usado no presente documento significa qualquer material ou entidade que pode desempenhar um papel no tratamento (por exemplo, tratar, prevenir, aliviar ou inibir quaisquer doenças e/ou condições), incluindo, mas não limitado a: agente terapêutico químico, agente terapêutico radioativo, agente terapêutico imunológico, agente terapêutico térmico e afins.[0067] The term "therapeutic agent" as used herein means any material or entity that can play a role in treatment (for example, treat, prevent, alleviate or inhibit any diseases and/or conditions), including, but not limited to: chemical therapeutic agent, radioactive therapeutic agent, immunological therapeutic agent, thermal therapeutic agent and the like.

[0068] “Região CDR” ou “CDR” como usado no presente documento significa a região hipervariável da cadeia pesada e cadeia leve da imunoglobulina, como definido por Kabat et al., (Kabat et al., Sequences of proteins of immunological interest, 5 Ed., U.S. Department of Health e Human Services, NIH, 1991 e as versões posteriores). Existem três CDRs da cadeia pesada e três CDRs da cadeia leve. Dependendo das situações, o termo “CDR” ou “CDRs” como usado no presente documento tem a intenção de se referir a uma das ou umas poucas das ou mesmo todas destas regiões que contém a maioria dos resíduos de aminoácidos que são responsáveis pela ligação através da afinidade do anticorpo direcionado ao antígeno ou seu epítopo de reconhecimento.[0068] "CDR region" or "CDR" as used herein means the hypervariable region of the immunoglobulin heavy chain and light chain, as defined by Kabat et al., (Kabat et al., Sequences of proteins of immunological interest, 5th Ed., U.S. Department of Health and Human Services, NIH, 1991 and later versions). There are three heavy chain CDRs and three light chain CDRs. Depending on the situations, the term "CDR" or "CDRs" as used herein is intended to refer to one or a few of or even all of these regions that contain most of the amino acid residues that are responsible for binding through the affinity of the targeted antibody to the antigen or its recognition epitope.

[0069] Por “uniformidade”, “identidade” ou “similaridade” entre duas sequências de ácido nucleico ou aminoácido na presente invenção, significa a percentagem de nucleotídeos ou resíduos de aminoácidos idênticos entre as duas sequências a serem comparadas, obtidas após o melhor alinhamento (alinhamento ótimo). Esta percentagem é puramente estatística, e as diferenças entre as duas sequências são aleatoriamente distribuídas e cobre seu comprimento total. Uma comparação de sequências entre duas sequências de ácido nucleico ou de aminoácidos é usualmente realizada comparando estas sequências após a sua correspondência ideal. A dita comparação poderia ser realizada através de um segmento ou uma “janela de comparação”. Além de ser realizada manualmente, o alinhamento ótimo para comparação de sequências pode ser realizado por meio do algoritmo de homologia local de Smith e Waterman (1981) (Ad. App. Math. 2:482), por meio do algoritmo de homologia local de Neddleman e Wunsch (1970) (J. Mol. Biol. 48:443), por meio do método de busca de similaridade de Pearson e Lipman (1988) (Proc. Natl. Acad. Sci. USA 85:2444) e por meio de softwares de computador usando estes algoritmos (GAP, BESTFIT, FASTA e TFASTA do Wisconsin Genetics Software Package, Genetics Computer Grupo, 575 Science Dr., Madison, WI, ou usando BLAST N ou BLAST P software comparação).[0069] By "uniformity", "identity" or "similarity" between two nucleic acid or amino acid sequences in the present invention, means the percentage of identical nucleotides or amino acid residues between the two sequences to be compared, obtained after the best alignment (optimal alignment). This percentage is purely statistical, and the differences between the two sequences are randomly distributed and cover their full length. A sequence comparison between two nucleic acid or amino acid sequences is usually performed by comparing these sequences after their ideal match. Said comparison could be carried out through a segment or a “comparison window”. In addition to being performed manually, the optimal alignment for comparing sequences can be performed using the local homology algorithm of Smith and Waterman (1981) (Ad. App. Math. 2:482), the local homology algorithm of Neddleman and Wunsch (1970) (J. Mol. Biol. 48:443), the similarity search method of Pearson and Lipman (1988) (Proc. Natl. Acad. Sci. USA 85:2444) and through computer software using these algorithms (GAP, BESTFIT, FASTA, and TFASTA from the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI, or using BLAST N or BLAST P comparison software).

[0070] A “quantidade terapeuticamente eficaz” ou “quantidade eficaz” como usado no presente documento se refere a uma dose suficiente para mostrar os benefícios direcionados ao indivíduo sendo administrado. A dose real bem como a taxa e período de tempo da administração irá variar dependendo da autocondição e do nível de gravidade do indivíduo sendo tratado. A prescrição do tratamento (tais como a determinação da dose, etc.) é finalmente a responsabilidade do médico clínico geral e outros médicos, e a determinação é feita com base nos fatores acima. Usualmente, a determinação é feita tendo em consideração a doença a ser tratada, a condição individual do paciente, local de administração, método de administração e quaisquer outros fatores conhecidos pelos médicos.[0070] The "therapeutically effective amount" or "effective amount" as used herein refers to a dose sufficient to show targeted benefit to the individual being administered. The actual dose as well as the rate and time period of administration will vary depending on the self-condition and level of severity of the individual being treated. The prescription of treatment (such as determining the dose, etc.) is ultimately the responsibility of the general practitioner and other physicians, and the determination is made based on the above factors. Usually, the determination is made taking into account the disease being treated, the individual condition of the patient, site of administration, method of administration and any other factors known to the physician.

[0071] O termo “indivíduo” como usado no presente documento significa mamíferos, tal como o ser humano, e também podem ser outros animais, tais como animais selvagens (tais como garça, cegonha, grou, etc.), animais domésticos (tais como pato, ganso, etc.) ou animais de laboratório (tais como chimpanzé, macaco, rato, camundongo, coelho, porquinho da Índia, marmota, esquilo terrestre, etc.).[0071] The term "individual" as used in this document means mammals, such as humans, and can also be other animals, such as wild animals (such as heron, stork, crane, etc.), domestic animals (such as duck, goose, etc.) or laboratory animals (such as chimpanzee, monkey, rat, mouse, rabbit, guinea pig, marmot, ground squirrel, etc.).

[0072] O termo “anticorpo” significa o anticorpo intacto e quaisquer dos seus fragmentos de ligação com o antígeno (“porção de ligação com o antígeno”) ou cadeia única. “Anticorpos de comprimento total” significa a proteína compreendendo pelo menos duas cadeias pesadas (H) e duas cadeias leves (L) interligadas por pontes de dissulfeto. Cada cadeia pesada contém uma região variável da cadeia pesada (abreviado como VH) e uma região constante da cadeia pesada. A região constante da cadeia pesada contém três domínios, CH1, CH2 e CH3. Cada cadeia leve contém uma região variável da cadeia leve (abreviado como VL) e uma região constante da cadeia leve. A região constante da cadeia leve contém um domínio, CL. As regiões VH e VL podem ser ainda subdividas em várias regiões com hipervariabil idade, denominadas região determinante de complementaridade (CDR), intercaladas com várias regiões que são mais conservadas, denominada região framework (FR) . Cada VH e VL é composta de três CDRs e quatro FRs, organizadas a partir do amino terminal para carboxi terminal na seguinte ordem: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Estas regiões variáveis das cadeias pesadas e das cadeias leves compreendem um domínio de ligação para interagir com um antígeno. A região constante dos anticorpos pode mediar a ligação da imunoglobulina para hospedar tecidos ou fatores, incluindo várias células do sistema imunológico (tais como células efetoras) e o primeiro componente do sistema complemento clássico (C1q). Anticorpo quimérico ou humanizado também está englobado no anticorpo de acordo com a presente invenção.[0072] The term "antibody" means the intact antibody and any of its antigen-binding fragments ("antigen-binding portion") or single chain. "Full-length antibodies" means protein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain contains a heavy chain variable region (abbreviated VH) and a heavy chain constant region. The heavy chain constant region contains three domains, CH1, CH2, and CH3. Each light chain contains a light chain variable region (abbreviated VL) and a light chain constant region. The light chain constant region contains one domain, CL. The VH and VL regions can be further subdivided into several regions with hypervariability, called the complementarity determining region (CDR), interspersed with several regions that are more conserved, called the framework region (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino terminus to carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. These heavy and light chain variable regions comprise a binding domain for interacting with an antigen. The constant region of antibodies can mediate immunoglobulin binding to host tissues or factors, including various immune system cells (such as effector cells) and the first component of the classical complement system (C1q). Chimeric or humanized antibody is also encompassed by the antibody according to the present invention.

[0073] O termo “anticorpo humanizado” se refere a um anticorpo compreendendo a região CDR de um anticorpo derivado de não humano, e as outras porções desta molécula anticorpo são de um (ou uns poucos) tipo(s) de anticorpo humano. Além disso, para o fim da afinidade de ligação retida, alguns resíduos no segmento da região framework (FR) podem ser modificados (Jones et al., Nature 321:522-525, 1986; Verhoeyen et al., Science, 239:1534-1536, 1988; Riechmann et al., Nature 332:323-327, 1988). O anticorpo humanizado ou seus fragmentos de acordo com a presente invenção podem ser preparados por meio daquelas tecnologias como as conhecidas por aqueles técnicos no assunto (tais como aqueles descritos nos seguintes documentos: Singer et al., J. Immun. 150:2844-2857, 1992; Mountain et al., Biotechnol. Genet. Eng. Rev., 10:1-142, 1992; ou Bebbington et al., Bio/Technology, 10:169-175, 1992).[0073] The term "humanized antibody" refers to an antibody comprising the CDR region of a non-human derived antibody, and the other portions of this antibody molecule are from one (or a few) type(s) of human antibody. Furthermore, for the purpose of retained binding affinity, some residues in the framework region (FR) segment can be modified (Jones et al., Nature 321:522-525, 1986; Verhoeyen et al., Science, 239:1534-1536, 1988; Riechmann et al., Nature 332:323-327, 1988). The humanized antibody or fragments thereof according to the present invention can be prepared by means of those technologies as known to those skilled in the art (such as those described in the following documents: Singer et al., J. Immun. 150:2844-2857, 1992; Mountain et al., Biotechnol. Genet. Eng. Rev., 10:1-142, 1992; or Bebbington et al., Bio/Technology, 10:169-175, 1992).

[0074] O termo “anticorpo quimérico” se refere a um anticorpo, em que a sequência da região variável é de uma espécie enquanto a sequência da região constante é de uma outra espécie; por exemplo, a sequência da região variável é de anticorpo de camundongo enquanto a sequência da região constante é de anticorpo humano. O anticorpo quimérico ou seus fragmentos de acordo com a presente invenção podem ser preparados usando uma tecnologia recombinante de genes. Por exemplo, o anticorpo quimérico pode ser produzido clonando o DNA recombinante que compreende um promotor e uma sequência codificando a região variável do anticorpo monoclonal não humano (especialmente murino) de acordo com a presente invenção e uma sequência codificando a região constante de anticorpo humano. O anticorpo quimérico da presente invenção codificado por este gene recombinante será, por exemplo, uma quimera murino-humano, que tem a especificidade determinada pela região variável derivada do DNA de murino e tem o seu isotipo determinado pela região constante derivada do DNA humano. Para o método de preparação do anticorpo quimérico, referência poderia ser feita, por exemplo, a Verhoeyn et al. (BioEssays, 8:74, 1988).[0074] The term "chimeric antibody" refers to an antibody, wherein the variable region sequence is from one species while the constant region sequence is from another species; for example, the variable region sequence is from a mouse antibody while the constant region sequence is from a human antibody. The chimeric antibody or its fragments according to the present invention can be prepared using recombinant gene technology. For example, the chimeric antibody can be produced by cloning recombinant DNA comprising a promoter and a sequence encoding the variable region of the non-human (especially murine) monoclonal antibody according to the present invention and a sequence encoding the constant region of human antibody. The chimeric antibody of the present invention encoded by this recombinant gene will be, for example, a murine-human chimera, which has the specificity determined by the variable region derived from murine DNA and has its isotype determined by the constant region derived from human DNA. For the method of preparing the chimeric antibody, reference could be made, for example, to Verhoeyn et al. (BioEssays, 8:74, 1988).

[0075] O termo “anticorpo monoclonal” significa um anticorpo molecular preparação com constituição molecular única. O anticorpo monoclonal composição mostra uma única especificidade e afinidade de ligação direcionada a um epítopo específico.[0075] The term “monoclonal antibody” means a molecular antibody preparation with unique molecular constitution. The monoclonal antibody composition shows a unique specificity and binding affinity directed to a specific epitope.

[0076] O termo “anticorpo mRC48” como usado no presente documento significa, a não ser de outro modo indicado, o anticorpo monoclonal anti-HER2 derivado de murino mRC48 obtido pelo inventor. O termo “anticorpo RC48” como usado no presente documento significa, a não ser de outro modo indicado, anticorpo humanizado anti-HER2 RC48, que é derivado do anticorpo mRC48 por engenharia de humanização.[0076] The term "mRC48 antibody" as used herein means, unless otherwise indicated, the murine-derived anti-HER2 monoclonal antibody mRC48 obtained by the inventor. The term "RC48 antibody" as used herein means, unless otherwise indicated, humanized anti-HER2 antibody RC48, which is derived from the mRC48 antibody by humanization engineering.

[0077] O anticorpo cRC48 como usado no presente documento significa anticorpo RC48 quimérico, isto é, anticorpo humano-murino quimérico, que contém uma região variável derivada de murino e uma região constante derivada de humano. A diferença entre o anticorpo cRC48 e o anticorpo RC48 está apenas na diferença da região framework na região variável, isto é, a região framework de cRC48 é derivada de murino, enquanto a região framework do RC48 é derivado de humano.[0077] The cRC48 antibody as used herein means chimeric RC48 antibody, i.e. chimeric human-murine antibody, which contains a murine-derived variable region and a human-derived constant region. The difference between the cRC48 antibody and the RC48 antibody is only the difference of the framework region in the variable region, i.e. the framework region of cRC48 is derived from murine while the framework region of RC48 is derived from human.

[0078] O termo “fragmento funcional” como usado no presente documento particularmente significa o fragmento de anticorpo, tais como os fragmentos Fv, scFv (sc indica cadeia única), Fab, F(ab’)2, Fab’, scFv-Fc ou diacorpo, ou quaisquer fragmentos que possam aumentar meia-vida por meio de modificação química ou sendo incorporado no lipossoma. A dita modificação química inclui, por exemplo, adicionar poli(alquileno) glicol tais como polietileno glicol (“peguilado”) (chamados fragmentos peguilados Fv- PEG, scFv-PEG, Fab-PEG, F(ab’)2-PEG ou Fab’-PEG, “PEG” indica polietileno glicol), e os ditos fragmentos têm atividade de ligação EGFR. De preferência, o fragmento funcional é composto de ou compreende sequências parciais das cadeias variáveis pesadas ou leves do anticorpo dele derivado, a sequência parcial é suficiente para reter a mesma especificidade de ligação e afinidade de ligação como o anticorpo dele derivado (para EGFR, de preferência, pelo menos igual a 1/100 da afinidade do anticorpo dele derivado, mais preferencialmente, pelo menos igual a 1/10). Este fragmento funcional conterá pelo menos 5 aminoácidos, de preferência, 10, 15, 25, 50 e 100 aminoácidos contínuos da sequência do anticorpo dele derivado.[0078] The term "functional fragment" as used herein particularly means the antibody fragment, such as Fv, scFv (sc indicates single chain), Fab, F(ab')2, Fab', scFv-Fc or diabody fragments, or any fragments that can increase half-life through chemical modification or by being incorporated into the liposome. Said chemical modification includes, for example, adding poly(alkylene) glycol such as ("pegylated") polyethylene glycol (called pegylated Fv-PEG fragments, scFv-PEG, Fab-PEG, F(ab')2-PEG or Fab'-PEG, "PEG" denotes polyethylene glycol), and said fragments have EGFR binding activity. Preferably, the functional fragment is composed of or comprises partial sequences of the variable heavy or light chains of the antibody derived therefrom, the partial sequence being sufficient to retain the same binding specificity and binding affinity as the antibody derived therefrom (for EGFR, preferably at least equal to 1/100 of the affinity of the antibody derived therefrom, more preferably at least equal to 1/10). This functional fragment will contain at least 5 amino acids, preferably 10, 15, 25, 50 and 100 continuous amino acids of the antibody sequence derived therefrom.

[0079] Tipicamente, para o fim de preparar anticorpo monoclonal ou seus fragmentos funcionais, especialmente anticorpo monoclonal derivado de murino ou seus fragmentos funcionais, referência pode ser feita às tecnologias descritas particularmente no manual “Antibodies” (Harlow e Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor NY, pp. 726, 1988), ou às tecnologias para preparação a partir das células de hibridoma como descrito por Kohler e Milstein (Nature, 256:495-497, 1975).[0079] Typically, for the purpose of preparing monoclonal antibody or functional fragments thereof, especially murine-derived monoclonal antibody or functional fragments thereof, reference may be made to technologies described particularly in the "Antibodies" manual (Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor NY, pp. 726, 1988), or to technologies for preparation from hybridoma cells as described by Kohler and Milstein (Nature, 256: 495-497, 1975).

[0080] O anticorpo monoclonal de acordo com a presente invenção pode ser, por exemplo, purificado na coluna de afinidade que já tenha sido fixada com antígeno HER2 (por exemplo, HER2-ECD) ou um dos fragmentos contendo o epítopo que pode ser especificamente reconhecido pelo anticorpo monoclonal de acordo com a invenção com antecedência. Mais especificamente, o anticorpo monoclonal pode ser purificado como a seguir: pela cromatografia com proteína A e/ou G, seguida ou não pela cromatografia de troca iônica que tem como objetivo eliminar contaminantes de proteína residual bem como DNA e LPS, seguida ou não pela cromatografia de exclusão no gel de sefarose que tem como objetivo eliminar os potenciais agregados causados pelos dímeros ou outros polímeros. De um modo mais preferido, todas estas tecnologias podem ser usadas simultaneamente ou continuamente.[0080] The monoclonal antibody according to the present invention can be, for example, purified on the affinity column that has already been fixed with HER2 antigen (for example, HER2-ECD) or one of the epitope-containing fragments that can be specifically recognized by the monoclonal antibody according to the invention in advance. More specifically, the monoclonal antibody can be purified as follows: by protein A and/or G chromatography, followed or not by ion exchange chromatography which aims to eliminate residual protein contaminants as well as DNA and LPS, followed or not by sepharose gel exclusion chromatography which aims to eliminate potential aggregates caused by dimers or other polymers. More preferably, all of these technologies can be used simultaneously or continuously.

[0081] O termo “dolastatina” como usado no presente documento significa a polipeptídeo separado a partir de um tipo de organismo marinho Dollabella auricularia, que inclui, mas não limita a dolastatina 10 e a dolastatina 15. A dolastatina é um inibidor de mitose, mostrando uma forte atividade anticâncer, e deste modo é considerada como um candidato ao fármaco anticâncer. Os pesquisadores ainda descobriram e sintetizaram muitos derivados da dolastatina, tais como MMAE e MMAF.[0081] The term "dolastatin" as used herein means the polypeptide separated from a type of marine organism Dollabella auricularia, which includes, but is not limited to, dolastatin 10 and dolastatin 15. Dolastatin is a mitosis inhibitor, showing strong anticancer activity, and thus is considered as an anticancer drug candidate. Researchers have even discovered and synthesized many dolastatin derivatives such as MMAE and MMAF.

[0082] O termo “ligante” como usado no presente documento significa a parte que liga o anticorpo com o fármaco no conjugado anticorpo fármaco (isto é, ADC), que poderia ser clivável ou não clivável. O ligante clivável (isto é, ligante quebrável ou ligante biodegradável) pode ser quebrado nas ou sobre as células alvo, e assim liberando o fármaco. Em algumas modalidades, o ligante da presente invenção tem uma estabilidade muito boa e diminui bastante a liberação do fármaco durante o processo de entregar ao alvo (por exemplo, no sangue), assim reduzindo o efeito colateral e toxicidade. Em algumas modalidades em particular, o ligante da presente invenção é selecionado a partir do ligante clivável, tais como o ligante com base em dissulfeto (que é seletivamente quebrado nas células de tumor a uma concentração mais alta de tiol), ligante peptídeo (que é clivado pela enzima nas células de tumor), e ligante hidrazona. Em mais modalidades em particular, o ligante da presente invenção é selecionado a partir de ligante não clivável, tais como ligante tioéter. De preferência, o ligante da presente invenção é selecionado a partir de ligante clivável mc-vc-pAB e ligante não clivável mc.[0082] The term "linker" as used herein means the part that links the antibody with the drug in the antibody-drug conjugate (ie, ADC), which could be cleavable or non-cleavable. The cleavable linker (i.e., cleavable linker or biodegradable linker) can be broken in or on the target cells, thereby releasing the drug. In some embodiments, the linker of the present invention has very good stability and greatly decreases drug release during the process of delivering to the target (e.g., into the blood), thus reducing side effect and toxicity. In some particular embodiments, the linker of the present invention is selected from the cleavable linker, such as the disulfide-based linker (which is selectively cleaved in tumor cells at a higher thiol concentration), peptide linker (which is cleaved by the enzyme in tumor cells), and hydrazone linker. In more particular embodiments, the linker of the present invention is selected from a non-cleavable linker, such as a thioether linker. Preferably, the linker of the present invention is selected from mc-vc-pAB cleavable linker and mc non-cleavable linker.

[0083] Os exemplos a seguir são fornecidos para demonstrar e ainda explicar algumas modalidades preferidas e aspectos da presente invenção, e não deve ser explicado para limitar seus escopos. Exemplo 1 Preparação e análise da sequência do anticorpo monoclonal derivado de murino mRC48 1) Expressão e purificação de antígeno HER2[0083] The following examples are provided to demonstrate and further explain some preferred embodiments and aspects of the present invention, and are not to be explained to limit its scope. Example 1 Preparation and sequence analysis of the murine-derived monoclonal antibody mRC48 1) HER2 antigen expression and purification

[0084] Primeiramente, no presente estudo, proteína recombinante humana HER2 HER2-ECD composta de seu domínio extracelular (ECD) foi preparada e utilizada como o antígeno para a seguinte imunização e geração de anticorpo monoclonal bem como vários ensaios biológicos.[0084] First, in the present study, recombinant human HER2 protein HER2-ECD composed of its extracellular domain (ECD) was prepared and used as the antigen for the following immunization and monoclonal antibody generation as well as various biological assays.

[0085] O fragmento cDNA codificando HER2-ECD (aminoácidos Thr23 a Thr652, acesso do GenBank M11730) foi clonado no vetor de expressão pcDNA3 (Invitrogen Inc.) por PCR.[0085] The cDNA fragment encoding HER2-ECD (amino acids Thr23 to Thr652, GenBank accession M11730) was cloned into the expression vector pcDNA3 (Invitrogen Inc.) by PCR.

[0086] O método detalhado compreendeu: obter o cDNA da região de codificação HER2-ECD da cepa de célula HER2+ SKBR3 (ATCC NO. HTB- 3 0) por meio do método de RT- PCR (o kit ImProm- I ITM Reverse Transcription System de Promega Inc. foi aplicado). Os primers foram: P1: 5’CGGGATCCTGCCACCAGCTGTGCGCC (SEQ ID NO: 7), P2: 5’GCTCTAGA TCAGTTGATGGGGCAAGGCT (SEQ ID NO: 8); as sequências sublinhadas foram introduzidas sítios das enzimas BamHI e XbaI respectivamente. A amplificação por PCR foi executada com o molde de cDNA do HER2-ECD transcrito em reverso usando os primers acima mencionados, com as condições de amplificação compreendendo 30 ciclos de desnaturação a 94 °C por 30 s, anelamento a 60 °C por 30s, extensão a 72 °C por 1 min, finalmente extensão a 72 ° C por 10 min. Então, os fragmentos do PCR foram recuperados, digerido com enzimas BamHI e XbaI (NEB), e ligado ao vetor pcDNA3. O C-terminal de HER2- ECD foi adicionado a cauda de polihistidina para purificação convenientemente. As células HEK293 (US ATCC) foram transfectadas com o vetor de expressão construído de DNA, e a proteína HER2-ECD solúvel com His-tag foi purificada do fluido da cultura de células por cromatografia de afinidade Ni-NTA (Qiagen). O SDS-PAGE e o corante Coomassie Brilliant Blue indicaram que as proteínas HER2-ECD purificadas tiveram uma homogeneidade maior que 95 %, e o resultado foi mostrado na Fig. 1. A HER2-ECD solúvel foi na forma de monômero, com o peso molecular relativo de ~75 kDa que foi ligeiramente maior que o peso molecular calculado (71 kDa), sugerindo que a proteína foi glicosilada nas células HEK293. A proteína purificada HER2-ECD resultante foi ainda concentrada, e transferida para o tampão PBS estéril (pH 7, 4), para subsequente análise in vivo e in vitro. 2) Produção e varredura de células de hibridoma[0086] The detailed method comprised: obtaining the cDNA of the HER2-ECD coding region of the HER2+ SKBR3 cell strain (ATCC NO. HTB-30) by means of the RT-PCR method (the ImProm-I ITM Reverse Transcription System kit from Promega Inc. was applied). The primers were: P1: 5'CGGGATCCTGCCACCAGCTGTGCGCC (SEQ ID NO: 7), P2: 5'GCTCTAGA TCAGTTGATGGGGCAAGGCT (SEQ ID NO: 8); the underlined sequences were introduced into BamHI and XbaI enzyme sites respectively. PCR amplification was performed with the reverse-transcribed HER2-ECD cDNA template using the aforementioned primers, with the amplification conditions comprising 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 1 min, finally extension at 72 °C for 10 min. Then, the PCR fragments were recovered, digested with BamHI and XbaI (NEB) enzymes, and ligated into the pcDNA3 vector. The C-terminus of HER2-ECD was added to the polyhistidine tail for convenient purification. HEK293 cells (US ATCC) were transfected with the expression vector constructed from DNA, and the His-tagged soluble HER2-ECD protein was purified from the cell culture fluid by Ni-NTA affinity chromatography (Qiagen). SDS-PAGE and Coomassie Brilliant Blue dye indicated that the purified HER2-ECD proteins had a homogeneity greater than 95%, and the result is shown in Fig. 1. Soluble HER2-ECD was in monomer form, with the relative molecular weight of ~75 kDa which was slightly greater than the calculated molecular weight (71 kDa), suggesting that the protein was glycosylated in HEK293 cells. The resulting purified HER2-ECD protein was further concentrated, and transferred into sterile PBS buffer (pH 7.4), for subsequent in vivo and in vitro analysis. 2) Hybridoma cell production and screening

[0087] HER2-ECD como descrito acima foi usado como o antígeno para imunizar o camundongo e a geração de anticorpo monoclonal. A imunização, a fusão de células de hibridoma e a varredura primária foram conduzidos de acordo com procedimentos padrão (referência: WHO Technical Report Series, N° 822, 1992 Annex 3). Quatro camundongos Balb/c (comercialmente obtidos de Shanghai Slac Laboratory Animal Co. Ltd.) foram imunizados com volume igual a 0,25 ml de proteína HER2-ECD (50100 ug) bem misturada e 0,25 ml adjuvante completo de Freund (Difco Lab) . Duas semanas depois, a segunda injeção foi realizada com adjuvante incompleto de Freund (Difco Lab) em que a quantidade de antígeno foi 25-50 ug/0,5 ml/camundongo. Três semanas depois, a terceira injeção foi realizada em que a quantidade foi a mesma com aquela na segunda injeção. Dez dias após a terceira injeção o sangue foi extraído. O soro dos camundongos foi detectado por ensaio imunossorvente ligado a enzima (ELISA), e os baços dos dois camundongos com o mais alto teor de anticorpo anti-HER2 no soro foram levados, os quais foram então fundidos com a célula de mieloma P3X63Ag8 (ATCC CRL-1580). As células fundidas foram diluídas em 10 placas de 96 poços, e a varredura preliminar foi realizado através método ELISA dependendo da capacidade de ligação com HER2-ECD. Em um teste ELISA clássico, a placa de 96 poços Nunc Maxisord foi revestida com HER2- ECD (0,2-1 pg/ml), e então incubada com a diluição em gradiente do soro do camundongo ou o sobrenadante de hibridoma (100pL). O anticorpo anti- HER2 derivado de murino foi detectado pelo segundo anticorpo específico de cabra F(ab’)2 antimurino IgG Fc acoplado com peroxidase de raiz forte (Invitrogen Inc.).[0087] HER2-ECD as described above was used as the antigen to immunize the mouse and generate monoclonal antibody. Immunization, hybridoma cell fusion and primary screening were conducted according to standard procedures (reference: WHO Technical Report Series, No. 822, 1992 Annex 3). Four Balb/c mice (commercially obtained from Shanghai Slac Laboratory Animal Co. Ltd.) were immunized with a volume equal to 0.25 ml of HER2-ECD protein (50100 ug) mixed well and 0.25 ml complete Freund's adjuvant (Difco Lab). Two weeks later, the second injection was performed with incomplete Freund's adjuvant (Difco Lab) in which the amount of antigen was 25-50 ug/0.5 ml/mouse. Three weeks later, the third injection was performed in which the amount was the same as that in the second injection. Ten days after the third injection, blood was drawn. Sera from the mice was detected by enzyme-linked immunosorbent assay (ELISA), and the spleens of the two mice with the highest serum anti-HER2 antibody content were taken, which were then fused with the myeloma cell P3X63Ag8 (ATCC CRL-1580). The fused cells were diluted into 10 96-well plates, and the preliminary screening was performed by ELISA method depending on the binding capacity with HER2-ECD. In a classic ELISA assay, the Nunc Maxisord 96-well plate was coated with HER2-ECD (0.2-1pg/ml), and then incubated with either the gradient dilution of mouse serum or the hybridoma supernatant (100pL). Murine-derived anti-HER2 antibody was detected by the second goat-specific F(ab')2 anti-murine IgG Fc antibody coupled with horseradish peroxidase (Invitrogen Inc.).

[0088] Os sobrenadantes de 400 cepas de células de hibridoma foram varridos por meio de método ELISA, 36 dos quais mostraram uma forte capacidade de ligação HER2-ECD. Dez cepas de células de hibridoma com a mais forte capacidade de ligação HER2 foram escolhidas, e as cepas de subclone de células de hibridoma foram varridas através do limitado método de diluição. A afinidade de ligação das cepas de subclone de células de hibridoma com HER2 foi determinada por cultura em suspensão das cepas de células de hibridoma subclone, purificação de proteína e ELISA, e a capacidade de ligação das cepas de subclone de células de hibridoma com HER2 expressas naturalmente na superfície das cepas de células de câncer de mama humano foi ainda examinada pelo citômetro de fluxo (BD FACS Calibur) (veja Exemplo 4 para descrições mais detalhadas). Finalmente, uma cepa de célula de hibridoma mRC48 (derivada de murino IgG1k) foi determinada através da análise da sequência, que possuía uma forte capacidade de ligação HER2, e então foi ainda analisada através de ELISA e experimentos com células. A célula de hibridoma mRC48 foi depositada no Centro Geral de Coleção de Culturas Microbiológicas da China em 22 de agosto de 2013, com o número de depósito 8102 (a data de transferência para o Tratado de Budapeste é 29 de outubro de 2013). 3) Análise da sequência do clone de célula de hibridoma anti-HER2 mRC48[0088] The supernatants of 400 hybridoma cell strains were screened by means of ELISA method, 36 of which showed a strong HER2-ECD binding capacity. Ten hybridoma cell strains with the strongest HER2 binding capacity were chosen, and subclone hybridoma cell strains were screened by the limited dilution method. The binding affinity of the hybridoma cell subclone strains with HER2 was determined by suspension culture of the subclone hybridoma cell strains, protein purification and ELISA, and the binding ability of the hybridoma cell subclone strains with HER2 naturally expressed on the surface of the human breast cancer cell strains was further examined by flow cytometer (BD FACS Calibur) (see Example 4 for more detailed descriptions). Finally, an mRC48 hybridoma cell strain (murine-derived IgG1k) was determined through sequence analysis, which had a strong HER2 binding capacity, and then was further analyzed through ELISA and cell experiments. The mRC48 hybridoma cell was deposited at the China General Collection Center for Microbiological Cultures on August 22, 2013, with deposit number 8102 (the date of transfer to the Budapest Treaty is October 29, 2013). 3) Sequence analysis of mRC48 anti-HER2 hybridoma cell clone

[0089] As regiões variáveis das cadeias leves e pesadas do clone de célula de hibridoma mRC48 foram sequenciadas pela rápida amplificação da extremidade 5' usando kit comercialmente disponível SMARTTM RACE cDNA Amplification Kit (Clontech Inc.) de acordo com a instrução.[0089] The variable regions of the light and heavy chains of the mRC48 hybridoma cell clone were sequenced by rapid amplification of the 5' end using commercially available SMARTTM RACE cDNA Amplification Kit (Clontech Inc.) according to the instruction.

[0090] O RNA total foi extraído das células de hibridoma pelo Kit RNApure Tissue (Beijing Kangweishiji Biological Technology Co. Ltd.) , e a transcrição reversa do RNA total foi realizada pelo Kit SMARTTM RACE cDNA Amplification, usando o RNA total como o molde, usando os primers no kit, adicionando a transcriptase reversa SMARTScribeTM Reverse Transcriptase e obtendo a primeira cadeia de cDNA RACE-Ready através da transcrição reversa de acordo com as etapas como fornecido pelo kit, e então executando dois rodadas de PCR em que: a primeira rodada de PCR foi realizada usando o cDNA obtido como o molde, UPM fornecido no kit como primer da extremidade 5’, e mRC48-VL-1/mRC48-VH-1 como primer da extremidade 3’. As condições de reação de PCR incluíram pré-desnaturação a 94 °C por 5 min, 25 ciclos de amplificação (desnaturação a 94 °C por 30 s, anelamento a 68 °C por 30s, extensão a 72 °C por 2 min), finalmente extensão a 72 °C por 10 min.[0090] Total RNA was extracted from the hybridoma cells by the RNApure Tissue Kit (Beijing Kangweishiji Biological Technology Co. Ltd.), and reverse transcription of the total RNA was performed by the SMARTTM RACE cDNA Amplification Kit, using the total RNA as the template, using the primers in the kit, adding the SMARTScribeTM Reverse Transcriptase reverse transcriptase, and obtaining the RACE-Ready first strand cDNA by reverse transcription accordingly with the steps as provided by the kit, and then performing two rounds of PCR where: the first round of PCR was performed using the obtained cDNA as the template, UPM provided in the kit as the 5' end primer, and mRC48-VL-1/mRC48-VH-1 as the 3' end primer. PCR reaction conditions included pre-denaturation at 94 °C for 5 min, 25 cycles of amplification (denaturation at 94 °C for 30 s, annealing at 68 °C for 30 s, extension at 72 °C for 2 min), finally extension at 72 °C for 10 min.

[0091] A segunda rodada de PCR foi realizada usando o produto da primeira rodada de PCR como o molde, NUP fornecido no kit como primer da extremidade 5’, e mRC4 8 -VL - 2 /mRC4 8 -VH- 2 como primer da extremidade 3’. As condições de reação de PCR incluíram: pré-desnaturação a 94 °C por 5 min, 25 ciclos de amplificação (desnaturação a 94 °C por 30 s, anelamento a 68 °C por 30s, extensão a 72 ° C por 2 min), finalmente extensão a 72 ° C por 10 min. Deste modo, as regiões variáveis das cadeias leves e pesadas do clone de célula de hibridoma mRC48 acima foram obtidas. [0091] The second round of PCR was performed using the product of the first round of PCR as the template, NUP provided in the kit as the 5' end primer, and mRC4 8 -VL - 2 /mRC4 8 -VH- 2 as the 3' end primer. PCR reaction conditions included: pre-denaturation at 94 °C for 5 min, 25 cycles of amplification (denaturation at 94 °C for 30 s, annealing at 68 °C for 30 s, extension at 72 °C for 2 min), finally extension at 72 °C for 10 min. In this way, the variable regions of the light and heavy chains of the above hybridoma cell clone mRC48 were obtained.

[0092] Os produtos de PCR foram purificados por eletroforese em gel de agarose, e subclonado no vetor de clone pCR2.1TOPO (Invitrogen Inc.). Através do PCR, o DNA de 10 plasmídeos clonados independentes foram obtidos, e ainda sequenciados usando M13 primers diretos e reversos. A análise da sequência de DNA indicou que, todos estes 10 clones possuíam cDNA codificando o mesmo polipeptídeo VH ou VL. A sequência de aminoácidos da região determinante de complementaridade (CDR) foi definida por Kabat Code, e listado na Tabela 3. A análise da comparação das sequências indicou que, o CDR de anti-HER2 mRC48 é significativamente diferente daqueles dos anticorpos HER2 conhecido incluindo Herceptin (Trastuzumab). Tabela 3 A sequência de aminoácidos dos CDRs de anticorpo monoclonal anti-HER2 mRC48 Exemplo 2 Humanização do anticorpo monoclonal anti-HER2 mRC48[0092] The PCR products were purified by agarose gel electrophoresis, and subcloned into pCR2.1TOPO clone vector (Invitrogen Inc.). Through PCR, the DNA of 10 independent cloned plasmids was obtained, and further sequenced using M13 forward and reverse primers. DNA sequence analysis indicated that all of these 10 clones had cDNA encoding the same VH or VL polypeptide. The amino acid sequence of the complementarity determining region (CDR) was defined by Kabat Code, and listed in Table 3. Sequence comparison analysis indicated that, the CDR of anti-HER2 mRC48 is significantly different from those of known HER2 antibodies including Herceptin (Trastuzumab). Table 3 The amino acid sequence of the mRC48 anti-HER2 monoclonal antibody CDRs Example 2 Humanization of the mRC48 anti-HER2 monoclonal antibody

[0093] Nós humanizamos o anticorpo monoclonal murino anti-HER2 mRC48 enxertando seus CDRs de cadeia leve ou cadeia pesada em uma região framework de IgG1x. humano.[0093] We humanized the murine anti-HER2 monoclonal antibody mRC48 by grafting its light chain or heavy chain CDRs into an IgG1x framework region. human.

[0094] De acordo com os métodos publicados, nós sabemos que IgG1x humano foi altamente homólogo ao anticorpo RC48 de murino (mRC48). Assim, nós projetamos uma região variável da cadeia leve do anticorpo RC48 humanizado (RC48-VL), e uma região variável da cadeia pesada do anticorpo RC48 humanizado (RC48-VH), combinando eles a um anticorpo humanizado anti-HER2: RC48. A sequência global de RC48-VH tinha uma similaridade de 84 % com gene IgG1 VH humano. O anticorpo RC48 continha a região variável da cadeia leve RC48-VL e a região variável da cadeia pesada RC48-VH.[0094] According to published methods, we know that human IgG1x was highly homologous to murine antibody RC48 (mRC48). Thus, we designed a humanized RC48 antibody light chain variable region (RC48-VL), and a humanized RC48 antibody heavy chain variable region (RC48-VH), combining them with a humanized anti-HER2 antibody: RC48. The overall sequence of RC48-VH had 84% similarity to the human IgG1 VH gene. The RC48 antibody contained the RC48-VL light chain variable region and the RC48-VH heavy chain variable region.

[0095] O anticorpo monoclonal humanizado anti-HER2 RC48 foi obtido pelo método de transplante de CDR, em que a região variável da cadeia leve ou pesada foi sintetizada diretamente por GenScript(Nanjing) Co. Ltd., e a região variável sintetizada continha sequência de consenso Kozak, códon de iniciação, peptídeo sinal de cadeia leve ou pesada, região framework derivada de humano e CDR derivado de murino, que foi ligado à região constante IgG1x humano para formar um fragmento completo através do método de PCR por sobreposição e extensão.[0095] The humanized anti-HER2 monoclonal antibody RC48 was obtained by the CDR transplantation method, in which the light or heavy chain variable region was directly synthesized by GenScript(Nanjing) Co. Ltd., and the synthesized variable region contained Kozak consensus sequence, initiation codon, light or heavy chain signal peptide, human-derived framework region, and murine-derived CDR, which was ligated with the human IgG1x constant region to form a complete fragment by the overlap-extension PCR method.

[0096] Os primers de PCR por sobreposição e extensão incluíram: Cadeia pesada: VH1:5'CGCGGATCC GCCGCCACCATGGGATGGAGCT3' (SEQ ID NO: 13) VH2:5'GATGGGCCCTTGGTGCTAGCGGAGCTCACTGT CACCAGTGTT3' (SEQ ID NO: 14) 5'GCTAGCACCAAGGGCCCATC 3' (SEQ ID NO: 15) 5'CCGGAATTCTTTACCGGGAGACAGGGAGA 3' (SEQ ID NO: 16) Cadeia leve: VL1:5'CGCGGATCC GCCGCCACCATGGACATGAGGGT 3' (SEQ ID NO: 17) VL2:5'GATGGTGCAGCCACAGTACGCTTTATCTCAACT TTTG TAC3' (SEQ ID NO: 18) CL1: 5'CGTACTGTGGCTGCACCAT 3' (SEQ ID NO: 19) CL2:5'CCGGAATTCACACTCTCCCCTGTTGAAGC3' (SEQ ID NO: 20).[0096] The overlap and extension PCR primers included: Heavy chain: VH1:5'CGCGGATCC GCCGCCACCATGGGATGGAGCT3' (SEQ ID NO: 13) VH2:5'GATGGCCCTTGGTGCTAGCGGAGCTCACTGT CACCAGTGTT3' (SEQ ID NO: 14) 5'GCTAGCACCAAGGGCCCATC 3' (SEQ ID NO: 1 5) 5'CCGGAATTCTTTACCGGGAGACAGGGAGA 3' (SEQ ID NO: 16) Light chain: VL1:5'CGCGGATCC GCCGCCACCATGGACATGAGGGT 3' (SEQ ID NO: 17) VL2:5'GATGGTGCAGCCACAGTACGCTTTATCTCAACT TTTG TAC3' (SEQ ID NO: 18) CL1: 5'CGTACT GTGGCTGCACCAT 3' (SEQ ID NO: 19) CL2:5'CCGGAATTCACACTCTCCCCTGTTGAAGC3' (SEQ ID NO: 20).

[0097] A amplificação da cadeia pesada foi realizada como a seguir: primeiramente usou a região variável sintetizada como molde e VH1 e VH2 como primers para amplificar a região variável da cadeia pesada; usou região constante de IgG1x humano da cadeia pesada como molde e CH1 e CH2 como primers para amplificar a região constante da cadeia pesada. As condições de amplificação incluíram 30 ciclos de desnaturação a 94 °C por 30 s, anelamento a 60 °C por 30s, extensão a 72 °C por 1 min, finalmente extensão a 72 °C por 10 min. Então, a sequência de cadeia pesada de RC48 foi amplificada usando os dois produtos de PCR como molde e VH1 e CH2 como primers. As condições de amplificação incluíram 30 ciclos de desnaturação a 94 °C por 30 s, anelamento a 60 °C por 30s, extensão a 72 °C por 2 min, finalmente extensão a 72 °C por 10 min.[0097] Amplification of the heavy chain was performed as follows: firstly, used the synthesized variable region as a template and VH1 and VH2 as primers to amplify the variable region of the heavy chain; used human IgG1x heavy chain constant region as a template and CH1 and CH2 as primers to amplify the heavy chain constant region. Amplification conditions included 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 1 min, finally extension at 72 °C for 10 min. Then, the RC48 heavy chain sequence was amplified using the two PCR products as a template and VH1 and CH2 as primers. Amplification conditions included 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 2 min, finally extension at 72 °C for 10 min.

[0098] A amplificação da cadeia leve foi realizada como a seguir: primeiramente usou a região variável sintetizada como molde e VL1 e VL2 como primers para amplificar a região variável da cadeia leve; usou a região constante de IgG1x humano da cadeia leve como molde e CL1 e CL2 como primers para amplificar a região constante da cadeia leve. As condições de amplificação incluíram 30 ciclos de desnaturação a 94 °C por 30 s, anelamento a 60 °C por 30s, extensão a 72 °C por 1 min, finalmente extensão a 72 °C por 10 min. Então, a sequência de cadeia leve foi amplificada usando os dois produtos de PCR como molde e VL1 e CL2 como primers. As condições de amplificação incluíram 30 ciclos de desnaturação a 94 °C por 30 s, anelamento a 60 °C por 30s, extensão a 72 °C por 2 min, finalmente extensão a 72 °C por 10 min.[0098] The light chain amplification was performed as follows: firstly, used the synthesized variable region as a template and VL1 and VL2 as primers to amplify the light chain variable region; used the human IgG1x light chain constant region as a template and CL1 and CL2 as primers to amplify the light chain constant region. Amplification conditions included 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 1 min, finally extension at 72 °C for 10 min. Then, the light chain sequence was amplified using the two PCR products as a template and VL1 and CL2 as primers. Amplification conditions included 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 2 min, finally extension at 72 °C for 10 min.

[0099] Portanto, nós obtivemos um anticorpo humanizado monoclonal anti-HER2 RC48, em que RC48 continha a região constante de IgG1x humano da cadeia pesada e a região variável da cadeia pesada RC48- VH, e a região constante de IgG1x humano da cadeia leve e a região variável da cadeia leve RC48-VL.[0099] Therefore, we obtained a humanized monoclonal anti-HER2 antibody RC48, wherein RC48 contained human IgG1x heavy chain constant region and heavy chain variable region RC48-VH, and human IgG1x light chain constant region and light chain variable region RC48-VL.

[00100] O anticorpo quimérico humano-murino cRC48 foi também obtido pelos mesmos métodos, em que a região variável de murino foi ligada à região constante de IgG1x humano para formar um fragmento completo através de PCR por sobreposição e extensão.[00100] The human-murine chimeric antibody cRC48 was also obtained by the same methods, in which the murine variable region was joined to the constant region of human IgG1x to form a complete fragment through PCR by overlap and extension.

[00101] Cada um dos fragmentos amplificados foi subclonado no vetor de expressão pcDNA3.0 respectivamente. Os diferentes plasmídeos construídos foram transfectados nas células CHO suspensas (Invitrogen), para gerar anticorpos recombinantes diferentes, a purificação foi realizada pela proteína A e as análises características subsequentes foram realizadas. O quimérico anti-HER2 RC48 (chamado cRC48) foi constituído de uma cadeia pesada e uma cadeia leve de quimérico murino-humano cRC48. RC48 compreende cadeia pesada humanizada RC48-VH e cadeia leve humanizada RC48-VL. cRC48 e RC48 foram ambos capazes de ser expressos, e o anticorpos foram coletados a partir do sobrenadante de célula CHO, purificado pela proteína A, e analisado por ensaio SDS-PAGE sob condições redutoras e não redutoras (veja Fig. 2). As células CHO acima mencionadas secretando o anticorpo RC48 (isto é, as células CHO transfectadas com a região constante de IgG1x humano da cadeia pesada e a região variável da cadeia pesada RC48-VH, e a região constante de IgG1x humano da cadeia leve e a região variável da cadeia leve RC48-VL) foram depositadas no Centro para Coleção de Tipos de Culturas da China em 6 de novembro de 2013 com o número de depósito C2013170. Exemplo 3 Análise de caracterização do anticorpo RC48 anti-HER2[00101] Each of the amplified fragments was subcloned into the expression vector pcDNA3.0 respectively. The different constructed plasmids were transfected into suspended CHO cells (Invitrogen), to generate different recombinant antibodies, purification was performed by protein A and subsequent characteristic analyzes were carried out. The RC48 anti-HER2 chimeric (named cRC48) was made up of a heavy chain and a light chain from the murine-human chimeric cRC48. RC48 comprises humanized heavy chain RC48-VH and humanized light chain RC48-VL. cRC48 and RC48 were both able to be expressed, and the antibodies were collected from CHO cell supernatant, purified by protein A, and analyzed by SDS-PAGE assay under reducing and non-reducing conditions (see Fig. 2). The above-mentioned CHO cells secreting RC48 antibody (i.e., CHO cells transfected with human IgG1x heavy chain constant region and heavy chain variable region RC48-VH, and human IgG1x light chain constant region and light chain variable region RC48-VL) were deposited at the Center for Collection of Type Cultures of China on November 6, 2013 with deposit number C20131 70. Example 3 Characterization analysis of anti-HER2 antibody RC48

[00102] As constantes de afinidade de ligação HER2 (Kd) quimérico cRC48 e anticorpo RC48 humanizado (RC48) foram determinadas por método ELISA, e o método detalhado podia ser encontrado no Exemplo 1, isto é, a placa de 96 poços foi revestida com proteína HER2-ECD solúvel, então incubada com anticorpos diluídos (Herceptin e quimérico cRC48 como controles), e os anticorpos HER2-ECD relevantes (todos as formas do IgG1x humano) foram detectados pelo segundo anticorpo específico HRP-acoplado cabra F(ab’)2 anti-humano IgG Fc (Invitrogen). A curva de foi traçada, e o valor da superfície da constante de afinidade de ligação (Kd) foi ainda calculado para cada anticorpo anti-HER2 pela equação não linear de sítio único específico de ligação (Journal of Immunological Methods, 270:155162, 2002) (Fig. 3 mostrou uma típica a curva de ligação de HER2 obtida a partir de 3 testes ELISA independentes). Os resultados do teste ELISA são mostrados na Fig. 3.[00102] The HER2 binding affinity constants (Kd) of chimeric cRC48 and humanized RC48 antibody (RC48) were determined by ELISA method, and the detailed method could be found in Example 1, i.e., the 96-well plate was coated with soluble HER2-ECD protein, then incubated with diluted antibodies (Herceptin and chimeric cRC48 as controls), and the relevant HER2-ECD antibodies (all forms of human IgG1x) were detected by the second F(ab')2 goat specific HRP-coupled anti-human IgG Fc antibody (Invitrogen). The curve was plotted, and the surface binding affinity constant (Kd) value was further calculated for each anti-HER2 antibody by the non-linear single-site-specific binding equation (Journal of Immunological Methods, 270:155162, 2002) (Fig. 3 showed a typical HER2 binding curve obtained from 3 independent ELISA tests). The ELISA test results are shown in Fig. 3.

[00103] Como conhecido pelos 3 ensaios independentes, comparado com cRC48 (constante de afinidade média de 77 pM) e Herceptin (constante de afinidade média de 97 pM), o anticorpo humanizado anti-HER2 RC48 tive maior afinidade de ligação HER2-ECD, com a constante de afinidade média de 44 pM. O resultado é mostrado na Tabela 4. Tabela 4 Comparação da constante de afinidade média entre o anticorpo da presente invenção e Herceptin Exemplo 4 Capacidade de ligação do anticorpo humanizado RC48 com HER2 1) Experimentos de afinidade de ligação do anticorpo RC48 com HER2[00103] As known from the 3 independent assays, compared with cRC48 (average affinity constant of 77 pM) and Herceptin (average affinity constant of 97 pM), the humanized anti-HER2 antibody RC48 had higher binding affinity HER2-ECD, with the average affinity constant of 44 pM. The result is shown in Table 4. Table 4 Comparison of the average affinity constant between the antibody of the present invention and Herceptin Example 4 Binding Ability of Humanized Antibody RC48 to HER2 1) Binding Affinity Experiments of RC48 Antibody to HER2

[00104] A capacidade de ligação do anticorpo humanizado anti-HER2 RC48 com HER2 que foi endogenamente expressa em células humanas de câncer de mama foi detectada pelo citômetro de fluxo, e o resultado foi mostrado na Fig. 3. 6 g de IgG humano (grupo controle), Herceptin, cRC48, RC48 foram coincubados com dois tipos de linhagens de células HER2+, célula de câncer de mama humano SK-BR-3, BT474 e célula HER2- MDA- MBA468 (2x107 células) no gelo por 30-45 minutos, respectivamente. Após lavar bem 2 vezes com 4 ml de PBS gelado, os anticorpos ligando com a superfície da célula foram detectados pelo segundo anticorpo específico R- PE-acoplado cabra anti-humano IgG Fc (15 ul, 25 ug/ml) , e então analisados pelo citômetro de fluxo (BD FACSCalibur). Nenhuma ligação foi detectada entre o IgG1 humano (grupo controle) e os três tipos de células cancerosas. Em contraste, houve uma forte ligação entre Herceptin, cRC48, RC48 com os dois tipos de células HER2 positivo, enquanto nenhuma ligação com células HER2 negativa, sugerindo que esta ligação foi HER2 específica (como mostrada na Fig. 4a). Comparando a intensidade média de fluorescência do grupo controle de isotipo, foi encontrado que comparado com Herceptin e cRC48, RC48 mostrou uma maior afinidade de ligação. Titulando a concentração de anticorpo anti-HER2 e analisando o número de células na citometria de fluxo, uma curva com base na ligação da célula de anticorpo anti-HER2 com HER2 na superfície da célula foi obtida, e o resultado foi mostrado na Fig. 4b. O anticorpo humanizado anti-HER2 RC48 mostrou uma significativa afinidade de ligação, que tinha a afinidade de ligação (Kd) com HER2 na superfície da célula BT474 de 4 nM, enquanto as afinidades de ligação para Herceptin e cRC48 foram 10 nM e 5 nM respectivamente, e os resultados foram mostrados na Tabela 5. Tabela 5 Afinidade de ligação do anticorpo da presente invenção com HER2 na superfície da célula BT474 2) Experimento de especificidade de ligação do antígeno[00104] The binding capacity of the humanized anti-HER2 antibody RC48 with HER2 that was endogenously expressed in human breast cancer cells was detected by the flow cytometer, and the result was shown in Fig. 3. 6 g of human IgG (control group), Herceptin, cRC48, RC48 were co-incubated with two types of HER2+ cell lines, human breast cancer cell SK-BR-3, BT474 and HER2-MDA-MBA468 cell (2x107 cells) on ice for 30-45 minutes, respectively. After washing well 2 times with 4 ml of ice-cold PBS, antibodies binding with the cell surface were detected by the second R-PE-coupled goat anti-human IgG Fc specific antibody (15 ul, 25 ug/ml), and then analyzed by flow cytometer (BD FACSCalibur). No link was detected between human IgG1 (control group) and the three types of cancer cells. In contrast, there was strong binding between Herceptin, cRC48, RC48 with the two HER2 positive cell types, while no binding with HER2 negative cells, suggesting that this binding was HER2 specific (as shown in Fig. 4a). Comparing the mean fluorescence intensity of the isotype control group, it was found that compared to Herceptin and cRC48, RC48 showed a higher binding affinity. Titrating the concentration of anti-HER2 antibody and analyzing the number of cells in flow cytometry, a curve based on the cell binding of anti-HER2 antibody with HER2 on the cell surface was obtained, and the result was shown in Fig. 4b. The humanized anti-HER2 antibody RC48 showed a significant binding affinity, which had the binding affinity (Kd) with HER2 on the surface of BT474 cell of 4 nM, while the binding affinities for Herceptin and cRC48 were 10 nM and 5 nM respectively, and the results were shown in Table 5. Table 5 Binding affinity of the antibody of the present invention with HER2 on the surface of BT474 cell 2) Antigen binding specificity experiment

[00105] As capacidades ligação de Herceptin, cRC48, RC48 com diferentes antígenos de superfície EGFR, HER2, HER3 e HER4 foram determinadas por método ELISA. O método ELISA podia ser encontrado no Exemplo 1. A placa de 96 poços foi revestida com antígenos EGFR, HER2, HER3, HER4, respectivamente, cada poço do qual foi carregada com 20 ng, e incubada com diferentes anticorpos anti-HER2, isto é, anticorpos Herceptin, cRC48, RC48 e então detectados pelo segundo anticorpo específico cabra F (ab’) 2 antimurino IgG Fc acoplado a peroxidase de raiz forte (Invitrogen Inc.). O resultado foi mostrado na Fig. 5, indicando que os anticorpos Herceptin, cRC48, RC48 quase não tinham capacidade de ligação com EGFR, HER3 e HER4, mas tinham uma forte capacidade de ligação com HER2, sugerindo que Herceptin, RC48 ligando altamente específico com HER2.[00105] The binding capacities of Herceptin, cRC48, RC48 with different surface antigens EGFR, HER2, HER3 and HER4 were determined by ELISA method. The ELISA method could be found in Example 1. The 96-well plate was coated with EGFR, HER2, HER3, HER4 antigens respectively, each well of which was loaded with 20 ng, and incubated with different anti-HER2 antibodies, i.e. Herceptin antibodies, cRC48, RC48 and then detected by the second goat specific antibody F(ab') 2 antimurine IgG Fc coupled to horseradish peroxidase (In vitrogen Inc.). The result was shown in Fig. 5, indicating that Herceptin, cRC48, RC48 antibodies had almost no binding ability with EGFR, HER3 and HER4, but had strong binding ability with HER2, suggesting that Herceptin, RC48 binds highly specifically with HER2.

[00106] Exemplo 5 Ensaio para inibição de tumor de RC48 em direção ao modelo de tumor transplantado de câncer de mama humano BT474[00106] Example 5 Assay for tumor inhibition of RC48 towards BT474 human breast cancer transplanted tumor model

[00107] O modelo de tumor transplantado em camundongo nude de câncer de mama humano BT474 foi estabelecido pela inoculação de células BT474 em camundongo nude subcutaneamente. Após crescer continuamente in vivo por 3 gerações, o tecido de tumor que cresceu vigorosamente foi levado cortado em cerca de 1, 5 mm3, e inoculado subcutaneamente a axila do lado direito do camundongo nude (fornecido por Shanghai Slac Laboratory Animal Co. Ltd., com o certificado N° 2007000540582 licença N° SCXK(hu)2012-0002) sob condições estéreis. O diâmetro do tumor transplantado camundongo nude foi medido por paquímetro. Os animais foram agrupados aleatoriamente até que o tumor cresceu até 100~300 mm3. Os fármacos testados huIgG1, Herceptin, RC48 (cada 10 mg/kg) foram administradas, e uma semana depois dosada pela segunda vez, e outras duas semanas depois dosada pela terceira vez, isto é, os fármacos foram administradas ao todo por três vezes.[00107] The nude mouse tumor transplant model of BT474 human breast cancer was established by inoculating BT474 cells into nude mice subcutaneously. After growing continuously in vivo for 3 generations, vigorously growing tumor tissue was taken cut to about 1.5 mm 3 , and subcutaneously inoculated into the right-side axilla of nude mice (supplied by Shanghai Slac Laboratory Animal Co. Ltd., certificate No. 2007000540582 license No. SCXK(hu)2012-0002) under sterile conditions. The diameter of the tumor transplanted into nude mice was measured by a caliper. The animals were randomly grouped until the tumor grew to 100~300 mm3. The tested drugs huIgG1, Herceptin, RC48 (each 10 mg/kg) were administered, and one week later dosed for the second time, and another two weeks after dosed for the third time, that is, the drugs were administered three times in all.

[00108] O resultado foi mostrado na Fig. 11. Após administrar huIgG1, o tumor não foi inibido, e o volume do qual ainda cresceu continuamente. Após administrar Herceptin e RC48, os tumores BT474 foram ambos inibidos. Comparado com Herceptin, RC48 teve um efeito inibidor de tumor significativamente melhor.[00108] The result was shown in Fig. 11. After administering huIgG1, the tumor was not inhibited, and the volume of which still grew continuously. After administering Herceptin and RC48, BT474 tumors were both inhibited. Compared with Herceptin, RC48 had a significantly better tumor inhibitory effect.

[00109] Exemplo 6 Preparação de conjugado de anticorpo fármaco 1) Purificação do anticorpo monoclonal RC48[00109] Example 6 Preparation of antibody drug conjugate 1) Purification of monoclonal antibody RC48

[00110] O anticorpo monoclonal RC48 foi capturado a partir da cultura de célula CHO pela proteína A, que foi então submetido a eletroforese SDS- PAGE, com a pureza de até 95 % ou maior pela análise SEC. As proteínas anticorpos obtidas foram ultrafiltradas por diálise em Tampão PBS usando cartucho de membrana 30KD, concentrada, e a concentração foi calibrada pelo espectrômetro ultravioleta, para a subsequente reação de acoplamento. 2) Acoplamento do anticorpo monoclonal RC48 com a molécula de fármaco[00110] The monoclonal antibody RC48 was captured from the CHO cell culture by protein A, which was then subjected to SDS-PAGE electrophoresis, with the purity of up to 95% or greater by SEC analysis. The obtained antibody proteins were ultrafiltered by dialysis in PBS buffer using a 30KD membrane cartridge, concentrated, and the concentration was calibrated by the ultraviolet spectrometer, for the subsequent coupling reaction. 2) Coupling of the RC48 monoclonal antibody with the drug molecule

[00111] O agente redutor e o agente de proteção foram formulados com Tampão PBS como a seguir: 1~20mmol/L TCEP (Tris-2- carboxietil - fosfina), 1~20mmol/L DTPA (ácido dietilenotriamina pentacético) solução estoque, o agente redutor que pode ser adicionado em uma certa faixa de concentrações com a quantidade dependendo da razão fármaco anticorpo requerida, misturada com o anticorpo monoclonal a uma certa concentração (por exemplo, 5~30 mg/ml) com uma certa razão de volume (por exemplo, 1:1), em que a razão molar da concentração final de TCEP para o anticorpo foi 0,5~6,0 : 1, e a reação foi realizada com agitação por 2 h a 25 °C. A concentração de tiol livre foi detectada a 412 nm pelo método DTNB, e calculado os números de tiol livre com a razão molar de anticorpo. A reação redutora com TCEP teve uma reprodut ibil idade muito boa, e os números de tiol livre puderam chegar a 1,0-8,0 após redução.[00111] The reducing agent and the protective agent were formulated with PBS Buffer as follows: 1~20mmol/L TCEP (Tris-2-carboxyethyl - phosphine), 1~20mmol/L DTPA (diethylenetriamine pentaacetic acid) stock solution, the reducing agent which can be added in a certain range of concentrations with the amount depending on the antibody-drug ratio required, mixed with the monoclonal antibody at a certain concentration (for example, 5~30 mg/ml) with a certain volume ratio (e.g. 1:1), wherein the molar ratio of the final concentration of TCEP to the antibody was 0.5~6.0 : 1, and the reaction was carried out with stirring for 2 h at 25 °C. The free thiol concentration was detected at 412 nm by the DTNB method, and free thiol numbers were calculated with the antibody molar ratio. The reducing reaction with TCEP had very good reproducibility, and free thiol numbers could reach 1.0-8.0 after reduction.

[00112] Após a redução com TCEP, o anticorpo pode ser diretamente submetido a subsequente conjugação. Os fármacos (vc-MMAE, vc-MMAF, mc-MMAF) (comprados de Shanghai Haoyuan Chemexpress Co. Ltd.) a uma certa concentração (10 mM) foram dissolvidos em 25 % DMSO (dimetilsulfóxido), no qual os fármacos foram adicionados lentamente na razão molar do fármaco para tiol de 0,3~2,8: 1, e a reação foi realizada com agitação por 2 h a 25 °C. A concentração de tiol livre (próxima de zero) foi detectada a 412 nm pelo método DTNB, os fármacos residuais que não reagiram e pequenas moléculas livres tais como DMSO foram removidos por purificação Sephadex G-25, e a condição de acoplamento foi determinada pelos métodos de eletroforese SDS-PAGE, cromatografia líquida de alta eficiência de fase reversa (R-HPLC) e cromatografia líquida de alta eficiência hidrofóbica (HIC-HPLC). Exemplo 7 Ensaio de afinidade de ADC Ensaio de afinidade pelo método ELISA[00112] After reduction with TCEP, the antibody can be directly subjected to subsequent conjugation. Drugs (vc-MMAE, vc-MMAF, mc-MMAF) (purchased from Shanghai Haoyuan Chemexpress Co. Ltd.) at a certain concentration (10 mM) were dissolved in 25% DMSO (dimethyl sulfoxide), to which drugs were slowly added in the molar ratio of drug to thiol of 0.3~2.8: 1, and the reaction was carried out with stirring for 2 h at 25 °C. Free thiol concentration (close to zero) was detected at 412 nm by the DTNB method, residual unreacted drugs and free small molecules such as DMSO were removed by Sephadex G-25 purification, and the coupling condition was determined by SDS-PAGE electrophoresis, reversed phase high performance liquid chromatography (R-HPLC) and hydrophobic high performance liquid chromatography (HIC-HPLC) methods. Example 7 ADC Affinity Assay ELISA Affinity Assay

[00113] A placa de ELISA foi revestida com proteína recombinante HER2-ECD (com a concentração de 0,5 mg/ml), durante a noite a 2 - 8 ° C. A placa foi lavada 3 vezes com o lavador de placa. A 37 °C, 3 % de solução BSA-PBST foi usada para bloquear por 2 h. A placa foi lavada 3 vezes com o lavador de placa. As amostras foram carregadas como a seguir: a 37 °C, 11 pontos foram de modo gradiente diluído a partir de 1000 ng/ml (linha padrão) com solução PBST, 100 ul/poço, por 2 h. A placa foi lavada 3 vezes com o lavador de placa. O segundo anticorpo (cabra anti-humano IgG-Fc-HRP) foi diluído 5000 vezes com solução PBST. O reagente de desenvolvimento de cor TMB foi adicionado para desenvolver cor por 8-10 minutos ao abrigo da luz à temperatura ambiente. A reação foi parada por 2M de H2SO4, e lida a 450/655 nm no instrumento marcado com enzima. O resultado é mostrado na Tabela 6. Tabela 6 Comparação da afinidade entre os conjugados e T-DM1 [00113] The ELISA plate was coated with recombinant HER2-ECD protein (with the concentration of 0.5 mg/ml) overnight at 2 - 8 ° C. The plate was washed 3 times with the plate washer. At 37°C, 3% BSA-PBST solution was used to block for 2 h. The plate was washed 3 times with the plate washer. Samples were loaded as follows: at 37 °C, 11 points were gradient diluted from 1000 ng/ml (standard line) with PBST solution, 100 ul/well, for 2 h. The plate was washed 3 times with the plate washer. The second antibody (goat anti-human IgG-Fc-HRP) was diluted 5000 times with PBST solution. TMB color development reagent was added to develop color for 8-10 minutes in the dark at room temperature. The reaction was stopped by 2M H2SO4, and read at 450/655 nm on the enzyme-labeled instrument. The result is shown in Table 6. Table 6 Comparison of affinity between conjugates and T-DM1

[00114] Como conhecido dos resultados, as afinidades com HER2- ECD de RC48-vc-MMAE, RC48-vc-MMAF e RC48-mc-MMAF são comparáveis aos de T-DM1.[00114] As known from the results, the HER2-ECD affinities of RC48-vc-MMAE, RC48-vc-MMAF and RC48-mc-MMAF are comparable to those of T-DM1.

[00115] Exemplo 8 Efeito inibidor da ADC RC48 em células de tumor[00115] Example 8 Inhibitory effect of ADC RC48 on tumor cells

[00116] As células que cresceram bem foram digeridas com tripsina (comprada de Sigma), após as quais as células de câncer de mama HER2 positivo SK-BR-3 e as células de câncer de ovário HER2 positivo SK-OV-3 foram ressuspensas com meio DMEM contendo 10 % de soro fetal bovino, meio McCoy’s 5A (ambos os meios foram comprados de Gibco), e inoculadas em placa de 96 poços na densidade de 5000, 4000 células/poço, respectivamente, e incubadas na incubadora a 37 °C, em 5 % CO2 por 24 h. RC48, Herceptin, RC48-vc-MMAE, RC48-vc-MMAF, RC48-mc-MMAF e T-DM1 (feitos pelo próprio) foram diluídos com o meio contendo 10 % de soro fetal bovino nas concentrações como mostrada na figura a seguir antes de adicionado na placa de 96 poços. Após ser incubada na incubadora a 37 °C, em 5 % CO2 por 72 h, a detecção foi realizada usando o kit CCK-8 (comprado de DOJINDO), e os dados resultantes foram submetidos a uma análise estatística usando o software Prism.[00116] Cells that grew well were digested with trypsin (purchased from Sigma), after which SK-BR-3 HER2 positive breast cancer cells and SK-OV-3 HER2 positive ovarian cancer cells were resuspended with DMEM medium containing 10% fetal bovine serum, McCoy's 5A medium (both media were purchased from Gibco), and inoculated into a 96-well plate at a density of 5000 , 4000 cells/well, respectively, and incubated in the incubator at 37°C, in 5% CO2 for 24 h. RC48, Herceptin, RC48-vc-MMAE, RC48-vc-MMAF, RC48-mc-MMAF and T-DM1 (home made) were diluted with the medium containing 10% fetal bovine serum at the concentrations as shown in the figure below before adding to the 96-well plate. After being incubated in the incubator at 37°C, in 5% CO2 for 72 h, detection was performed using the CCK-8 kit (purchased from DOJINDO), and the resulting data were subjected to statistical analysis using Prism software.

[00117] Os resultados foram mostrados na Fig. 12 a Fig. 13, como conhecido da qual o fármaco ADC da presente invenção teve significativamente o efeito inibidor mais forte em direção a várias células que anticorpo fármaco naked na mesma concentração, e a taxa de inibição direcionada à proliferação celular poderia ser aumentada pela metade. O fármaco ADC acoplado com MMAF de acordo com a presente invenção teve um efeito inibidor mais forte direcionado às células SK-BR-3, SK-OV-3 que o fármaco ADC acoplado com MMAE de acordo com a presente invenção, mesmo assim, ambos os quais tiveram significativamente melhores efeitos que o controle positive T-DM1.[00117] The results were shown in Fig. 12 to Fig. 13, as known from which the ADC drug of the present invention had significantly stronger inhibitory effect towards various cells than naked drug antibody at the same concentration, and the inhibition rate directed at cell proliferation could be increased by half. The ADC drug coupled with MMAF according to the present invention had a stronger inhibitory effect directed at SK-BR-3, SK-OV-3 cells than the ADC drug coupled with MMAE according to the present invention, even so, both of which had significantly better effects than the positive control T-DM1.

[00118] Exemplo 9 Atividade antitumoral dos conjugados anticorpo fármaco direcionado ao câncer de mama 1) Experimento antitumoral de conjugados RC48 direcionado ao modelo camundongo nude portador de tumor de câncer de mama humano BT474[00118] Example 9 Antitumor activity of antibody-drug conjugates directed to breast cancer 1) Antitumor experiment of RC48 conjugates directed to the nude mouse model bearing human breast cancer tumor BT474

[00119] Cinco milhões de células BT474 foram suspensas em PBS, e inoculadas na axila de camundongo nude BALB/c (fornecido por Shanghai Slac Laboratory Animal Co. Ltd., com o certificado N° 2007000540582 e licença N° SCXK(hu)2012-0002). Após o tumor ter sido formado, o tecido de tumor que cresceu vigorosamente foi levado e cortado em cerca de 1, 5 mm3, e inoculado subcutaneamente a axila do lado direito do camundongo nude sob condições estéreis. O diâmetro do tumor transplantado camundongo nude foi medido por paquímetro. Os animais foram agrupados aleatoriamente até que o tumor cresceu até 100~300 mm3. Os fármacos testados RC48 10 mg/kg, RC48-vc-MMAE 10 mg/kg, RC48-vc-MMAF 10 mg/kg e RC48-mc-MMAF 10 mg/kg foram administrados, e os fármacos foram administrados ao todo por três vezes; o grupo controle negativo foi administrado com igual quantidade da solução salina fisiológica.[00119] Five million BT474 cells were suspended in PBS, and inoculated into the armpit of BALB/c nude mice (provided by Shanghai Slac Laboratory Animal Co. Ltd., with certificate N° 2007000540582 and license N° SCXK(hu)2012-0002). After the tumor was formed, the vigorously growing tumor tissue was taken and cut to about 1.5 mm 3 , and subcutaneously inoculated the right-side axilla of the nude mouse under sterile conditions. The diameter of the tumor transplanted into nude mice was measured by a caliper. The animals were randomly grouped until the tumor grew to 100~300 mm3. The tested drugs RC48 10 mg/kg, RC48-vc-MMAE 10 mg/kg, RC48-vc-MMAF 10 mg/kg, and RC48-mc-MMAF 10 mg/kg were administered, and the drugs were administered three times in total; the negative control group was administered an equal amount of the physiological saline solution.

[00120] Como mostrada na Fig. 14, 37 dias após dosagem, o volume do tumor do grupo controle negativo chegou a 485mm3, enquanto o volume do tumor do grupo RC48 é 83 % do grupo controle, que indicou que RC48 teve o efeito inibidor até certo ponto no crescimento do tumor BT474. Todos os três anticorpo conjugados testados no presente experimento (RC48-vc- MMAE, RC48-vc-MMAF, RC48-mc-MMAF) poderiam inibir o crescimento do tumor BT474 significativamente, e 37 dias após dosagem, os volume do tumor encolham 13-19 % no grupo controle. Durante o dia 37 do experimento, havia 3 camundongos mortos no grupo controle, enquanto todos os camundongos no grupo RC48-vc-MMAE sobreviveram. 2) Experimento antitumoral de RC48-vc-MMAE direcionado ao modelo de tumor transplantado subcutaneamente em camundongo nude de câncer de mama humano BT-474/L1.9 resistente a Herceptin® e Lapatinib[00120] As shown in Fig. 14, 37 days after dosing, the tumor volume of negative control group reached 485mm3, while the tumor volume of RC48 group is 83% of control group, which indicated that RC48 had the inhibitory effect to some extent on BT474 tumor growth. All three antibody conjugates tested in the present experiment (RC48-vc-MMAE, RC48-vc-MMAF, RC48-mc-MMAF) could inhibit BT474 tumor growth significantly, and 37 days after dosing, tumor volumes shrank by 13-19% in the control group. During day 37 of the experiment, there were 3 dead mice in the control group, while all mice in the RC48-vc-MMAE group survived. 2) RC48-vc-MMAE antitumor experiment targeting subcutaneously transplanted tumor model in nude mouse of human breast cancer BT-474/L1.9 resistant to Herceptin® and Lapatinib

[00121] BT474/L1.9 é a célula BT-474 que foi tratada por um longo tempo com Herceptin® e Lapatinib, e também resistente a Herceptin® e Lapatinib.[00121] BT474/L1.9 is the BT-474 cell that has been treated for a long time with Herceptin® and Lapatinib, and also resistant to Herceptin® and Lapatinib.

[00122] Os camundongos nude de nível SPF BALB/c foram inoculados subcutaneamente com uma certa quantidade de células de tumor BT-474/L1.9, e após o crescimento do tumor até 100-200 mm3, os animais foram aleatoriamente agrupados. A dose foi indicada pelas legendas: para RC48-vc-MMAE, KadcylaTM (comprados de Roche Pharmaceuticals), dosagem uma vez por semana, ao todo 2 vezes; para Herceptin® (comprado de Roche Pharmaceuticals), dosagem uma vez por semana, ao todo 3 vezes; para Lapatinib (comprado de GSK), dosagem todos os dias. O volume do tumor foi medido 2 vezes por semana. O peso murino foi pesado e a capacidade de resistência dos camundongos portadores de tumor em direção os fármacos foi observada. Os dados foram registados. O volume do tumor e a taxa de inibição de tumor de cada camundongo portador de tumor foram calculados em diferentes pontos de tempo de observação.[00122] BALB/c SPF-level nude mice were subcutaneously inoculated with a certain amount of BT-474/L1.9 tumor cells, and after tumor growth to 100-200 mm3, the animals were randomly grouped. The dose was indicated by the legends: for RC48-vc-MMAE, KadcylaTM (purchased from Roche Pharmaceuticals), dosing once a week, 2 times in all; for Herceptin® (purchased from Roche Pharmaceuticals), dosing once a week, 3 times in all; for Lapatinib (purchased from GSK), dosing every day. Tumor volume was measured twice a week. The murine weight was weighed and the resistance capacity of the tumor-bearing mice towards the drugs was observed. The data has been registered. Tumor volume and tumor inhibition rate of each tumor-bearing mouse were calculated at different observation time points.

[00123] Como mostrada na Fig. 15, a taxa de inibição de tumor de Herceptin® (10 mg/kg) em direção ao tumor de transplante subcutâneo em camundongo nude BT4 74 /L1.9 foi de 51 %; a taxa de inibição de tumor de Lapatinib (200 mg/kg) em direção a BT474/L1. 9 foi de 45 %; sugeriria que o câncer de mama BT474/L1. 9 foi resistente a ambos Herceptin® e Lapatinib. RC48-vc-MMAE (1, 5, 5 mg/kg) inibiu o crescimento do tumor de transplante subcutâneo em camundongo nude BT474/L1.9 de uma forma dependente da dose, com a taxa de inibição de tumor de 38 % e 91 % respectivamente; a taxa de inibição de tumor do fármaco de referência KadcylaTM (5 mg/kg) em direção ao tumor de transplante subcutâneo em camundongo nude BT474/L1.9 foi de 58 %, indicando que BT474/L1.9 foi também resistente a KadcylaTM. Os camundongos portadores de tumor foram bem resistentes a todos os fármacos acima.[00123] As shown in Fig. 15, the tumor inhibition rate of Herceptin® (10 mg/kg) towards subcutaneous transplant tumor in BT4 74 /L1.9 nude mouse was 51%; the tumor inhibition rate of lapatinib (200 mg/kg) towards BT474/L1. 9 was 45%; would suggest that breast cancer BT474/L1. 9 was resistant to both Herceptin® and Lapatinib. RC48-vc-MMAE (1, 5, 5 mg/kg) inhibited subcutaneous transplant tumor growth in BT474/L1.9 nude mice in a dose-dependent manner, with tumor inhibition rates of 38% and 91% respectively; the tumor inhibition rate of the reference drug KadcylaTM (5 mg/kg) towards the subcutaneous transplant tumor in the BT474/L1.9 nude mouse was 58%, indicating that BT474/L1.9 was also resistant to KadcylaTM. The tumor-bearing mice were quite resistant to all of the above drugs.

[00124] Em conclusão, a ADC da presente invenção mostra uma significativa atividade antitumoral em direção ao tumor de transplante subcutâneo em camundongo nude de célula BT474/L1.9, que é significativamente mais forte que Herceptin e Lapatinib (p<0,01); comparado com KadcylaTM com a mesma dose de 5 mg/kg, o efeito inibidor de tumor de RC48-vc-MMAE da presente invenção tem uma evidente vantagem (p<0,01), com a taxa de inibição de tumor de 91 %: 58 %. Exemplo 10 A atividade antitumoral do fármaco conjugados em direção a câncer de ovário 1) Experimento inibidor de tumor de conjugados RC48 em direção a modelo de tumor de transplante de câncer de ovário humano SK-OV-3[00124] In conclusion, the ADC of the present invention shows a significant antitumor activity towards subcutaneous transplant tumor in BT474/L1.9 cell nude mouse, which is significantly stronger than Herceptin and Lapatinib (p<0.01); compared to KadcylaTM at the same dose of 5 mg/kg, the tumor inhibitory effect of RC48-vc-MMAE of the present invention has a clear advantage (p<0.01), with the tumor inhibition rate of 91% : 58%. Example 10 The antitumor activity of drug conjugates towards ovarian cancer 1) Tumor inhibitor experiment of RC48 conjugates towards human ovarian cancer transplant tumor model SK-OV-3

[00125] O modelo de tumor de transplante em camundongo nude de câncer de ovário humano SK-OV-3 foi estabelecido pela inoculação de SK- OV-3 células no camundongo nude (fornecido por Shanghai Slac Laboratory Animal Co. Ltd., com o certificado N° 2007000540582 e licença N° SCXK(hu)2012-0002) subcutaneamente. Os animais foram agrupados aleatoriamente até que o tumor cresceu até 100~300 mm3. Os fármacos testados RC48 10 mg/kg, T-DM1 10 mg/kg, RC48-vc-MMAE 3 mg/kg, RC48-vc-MMAE 10 mg/kg, RC48-vc-MMAF 3 mg/kg, RC48-vc-MMAF 10 mg/kg, RC48-mc-MMAF 3 mg/kg e RC48-mc-MMAF 10 mg/kg foram administrados, dosagem uma vez por semana, ao todo dosagem por 3 vezes; paclitaxel 10 mg/kg, 3 vezes por semana, ao todo 3 semanas; enquanto isso, o controle negativo foi administrado com igual quantidade da solução salina fisiológica.[00125] The nude mouse transplant tumor model of SK-OV-3 human ovarian cancer was established by inoculating SK-OV-3 cells into the nude mouse (provided by Shanghai Slac Laboratory Animal Co. Ltd., with certificate No. 2007000540582 and license No. SCXK(hu)2012-0002) subcutaneously. The animals were randomly grouped until the tumor grew to 100~300 mm3. The tested drugs RC48 10 mg/kg, T-DM1 10 mg/kg, RC48-vc-MMAE 3 mg/kg, RC48-vc-MMAE 10 mg/kg, RC48-vc-MMAF 3 mg/kg, RC48-vc-MMAF 10 mg/kg, RC48-mc-MMAF 3 mg/kg and RC48-mc-MMAF 10 mg/kg were given, dosing once a week, total dosing 3 times; paclitaxel 10 mg/kg 3 times a week for a total of 3 weeks; meanwhile, the negative control was administered with an equal amount of the physiological saline solution.

[00126] Os efeitos inibidores de tumor de RC48 ligado a diferentes ligantes e agentes terapêuticos em SK-OV-3 sugerem que: comparado com anticorpo naked RC48 que não é acoplado, todos os ADCs da presente invenção têm bons efeitos inibidores de tumor; comparado com T-DM1 na mesma dose de 10 mg/kg, os efeitos inibidores de tumor de conjugados RC48 da presente invenção têm evidentes vantagens. Os resultados detalhados são mostrados na Fig. 16. Exemplo 11 Experimento inibidor de tumor de conjugados de fármaco em direção ao tumor de transplante subcutâneo em camundongo nude de célula de câncer gástrico humano HER2 positivo NCI-N87[00126] The tumor inhibitory effects of RC48 bound to different ligands and therapeutic agents on SK-OV-3 suggest that: compared with naked antibody RC48 which is not coupled, all ADCs of the present invention have good tumor inhibitory effects; compared to T-DM1 at the same dose of 10 mg/kg, the tumor inhibitory effects of RC48 conjugates of the present invention have clear advantages. Detailed results are shown in Fig. 16. Example 11 Tumor inhibiting experiment of drug conjugates towards subcutaneous transplant tumor in NCI-N87 HER2 positive human gastric cancer cell nude mouse

[00127] As células de câncer gástrico humano NCI-N87 expressaram altamente HER2 e EGFR, que foi resistente a Herceptin®, e o modelo foi estabelecido com o mesmo método como o Exemplo 9. O resultado foi mostrado na Fig. 17.[00127] NCI-N87 human gastric cancer cells highly expressed HER2 and EGFR, which was resistant to Herceptin®, and the model was established with the same method as Example 9. The result was shown in Fig. 17.

[00128] Como mostrada na Fig. 17, uma injeção intravenosa única de RC48-vc-MMAE (2,5, 5, 10 mg/kg) poderia significativamente inibir o crescimento de tumor de transplante subcutâneo em camundongo nude de câncer gástrico humano NIC-N87 de HER2 altamente expresso, com a taxa de inibição de tumor de 133 %, 193 % e 200 %. O grupo de baixa dosagem causou regressão parcial de tumores em 6/6 camundongos; o grupo de dosagem média causou regressão parcial de causou regressão parcial de tumores em 1/6 camundongo e regressão completa em 5/6 camundongos; o grupo de dosagem alta causou regressão completa de tumores em todos os camundongos (6/6), o qual não reincidiu até o experimento terminar (D21) . O fármaco de referência Herceptin® (10 mg/kg, dosagem uma vez por semana, por 3 vezes) podia inibir o crescimento de tumor de transplante subcutâneo em camundongo nude NCI-N87, com a taxa de inibição de tumor apenas de 49 %; um outro fármaco de referência para a pequena molécula Lapatinib inibidora de EGFR/HER2 (200 mg/kg, dosagem uma vez por semana, por 21 dias) teve efeito no tumor de transplante subcutâneo em camundongo nude NCI-N87, com a taxa de inibição de tumor de 78 %. Os camundongos portadores de tumor foram resistentes a todos os fármacos acima, e nenhum sintoma tal como perda de peso do corpo ocorreu.[00128] As shown in Fig. 17, a single intravenous injection of RC48-vc-MMAE (2.5, 5, 10 mg/kg) could significantly inhibit subcutaneous transplant tumor growth in highly expressed HER2 NIC-N87 human gastric cancer nude mouse, with the tumor inhibition rate of 133%, 193%, and 200%. The low-dose group caused partial tumor regression in 6/6 mice; the medium dose group caused partial regression of tumors in 1/6 mice and complete regression in 5/6 mice; the high dose group caused complete tumor regression in all mice (6/6), which did not relapse until the experiment ended (D21). The reference drug Herceptin® (10 mg/kg, dosing once a week, for 3 times) could inhibit subcutaneous transplant tumor growth in NCI-N87 nude mouse, with the tumor inhibition rate only 49%; another reference drug for the small molecule EGFR/HER2 inhibitor Lapatinib (200 mg/kg, dosing once a week, for 21 days) had effect on subcutaneous transplant tumor in NCI-N87 nude mouse, with the tumor inhibition rate of 78%. The tumor-bearing mice were resistant to all of the above drugs, and no symptoms such as loss of body weight occurred.

[00129] Este resultado de pesquisa indica: 1) uma injeção intravenosa única de RC48-vc-MMAE (2, 5, 5, 10 mg/kg) pode significativamente inibir o crescimento do tumor de transplante subcutâneo em camundongo nude câncer gástrico humano NIC-N87 de HER2 altamente expresso, causando regressão parcial ou mesmo completa dos tumores; 2) o efeito terapêutico de RC48-vc- MMAE em direção ao tumor de transplante subcutâneo em camundongo nude NCI-N87 é evidentemente mais forte que aquela dos fármacos de referência Herceptin® e Lapatinib (p<0,01). Exemplo 12 O ensaio de tolerância do camundongo de conjugados RC48[00129] This research result indicates: 1) a single intravenous injection of RC48-vc-MMAE (2, 5, 5, 10 mg/kg) can significantly inhibit tumor growth from subcutaneous transplantation in nude mouse human gastric cancer NIC-N87 of highly expressed HER2, causing partial or even complete regression of tumors; 2) The therapeutic effect of RC48-vc-MMAE towards the subcutaneous transplant tumor in NCI-N87 nude mice is evidently stronger than that of the reference drugs Herceptin® and Lapatinib (p<0.01). Example 12 The Mouse Tolerance Test of RC48 Conjugates

[00130] Os camundongos KM machos e fêmeas que passaram inspeção de quarentena foram divididos aleatoriamente nos seguintes grupos de dosagem de acordo com pesos dos corpos: MMAE 2 mg/kg, MMAF 50 mg/kg, RC48-vc-MMAE 25 mg/kg (a dose de MMAE correspondente foi 0,5 mg/kg) ~ 200 mg (a dose de MMAE foi 4,0 mg/kg), RC48-vc-MMAF 50 mg/kg (a dose de MMAF foi 1,0 mg/kg)~ 450 mg/kg (a dose de MMAF foi 9,0 mg/kg) e RC48-mc-MMAF 50 mg/kg (a dose de MMAF foi 1,0 mg/kg) ~ 450 mg/kg (a dose de MMAF foi 9, 0 ml/kg), em que havia 13 grupos de doses diferentes, com metade machos e metade fêmeas, e os fluidos de fármaco correspondentes foram injetados intravenosamente. Os grupos de camundongos no mesmo lote foram usados como os grupos controle, que foram dadas injeções de 0, 9 % de NaCl de mesmo volume via veia da cauda. Após a dosagem, o peso do corpo foi pesado uma vez em dias alternados, até o dia 16. A curva a de aumento do peso do corpo dos camundongos MMAE ou MMAF serial podia ser encontrada na Fig. 18 respectivamente.[00130] Male and female KM mice that passed quarantine inspection were randomly divided into the following dosage groups according to body weights: MMAE 2 mg/kg, MMAF 50 mg/kg, RC48-vc-MMAE 25 mg/kg (corresponding MMAE dose was 0.5 mg/kg) ~ 200 mg (MMAE dose was 4.0 mg/kg), RC48-vc- MMAF 50 mg/kg (MMAF dose was 1.0 mg/kg) ~ 450 mg/kg (MMAF dose was 9.0 mg/kg) and RC48-mc-MMAF 50 mg/kg (MMAF dose was 1.0 mg/kg) ~ 450 mg/kg (MMAF dose was 9.0 ml/kg), in which there were 13 different dose groups, with half male and half females, and the corresponding drug fluids were injected intravenously. Groups of mice in the same batch were used as control groups, which were given injections of 0.9% NaCl of the same volume via the tail vein. After dosing, body weight was weighed once every other day until day 16. The body weight increase curve a of serial MMAE or MMAF mice could be found in Fig. 18 respectively.

[00131] O resultado do experimento indica: sob as condições do presente experimento, a toxicidade de RC48-vc-MMAE é mais baixa que MMAE não acoplado na mesma dose. A dose de tolerância máxima de camundongo em direção a RC48-vc-MMAE está entre 100 mg/kg (a dose de MMAE é 2,0 mg/kg) e 150 mg/kg (a dose de MMAE é 3,0 mg/kg).[00131] The result of the experiment indicates: under the conditions of the present experiment, the toxicity of RC48-vc-MMAE is lower than uncoupled MMAE at the same dose. The maximum mouse tolerance dose towards RC48-vc-MMAE is between 100 mg/kg (MMAE dose is 2.0 mg/kg) and 150 mg/kg (MMAE dose is 3.0 mg/kg).

[00132] A toxicidade de RC48-vc-MMAF é evidentemente mais alta que aquela de RC48-mc-MMAF na mesma dose. A dose de tolerância máxima de camundongo em direção a RC48-vc-MMAF está entre 50 mg/kg (a dose de MMAF é 1,0 mg/kg) e 100 mg/kg (a dose de MMAF é 2, 0 mg/kg). O MTD do camundongo em direção a RC48-mc-MMAF está entre 150 mg/kg (a dose de MMAF é 3,0 mg/kg) e 450 mg/kg (a dose de MMAF é 9,0 mg/kg). Exemplo 13 O experimento de toxicidade dos conjugados do fármaco em relação ao rato SD dosado via perfusão intravenosa única[00132] The toxicity of RC48-vc-MMAF is evidently higher than that of RC48-mc-MMAF at the same dose. The maximum mouse tolerance dose towards RC48-vc-MMAF is between 50 mg/kg (MMAF dose is 1.0 mg/kg) and 100 mg/kg (MMAF dose is 2.0 mg/kg). The mouse MTD towards RC48-mc-MMAF is between 150 mg/kg (MMAF dose is 3.0 mg/kg) and 450 mg/kg (MMAF dose is 9.0 mg/kg). Example 13 The drug conjugate toxicity experiment in relation to the SD rat dosed via a single intravenous infusion

[00133] Ratos SD de nível SPF (o certificado é N° SCXK (jing)2012- 0001) comprados de Beijing Vital River Laboratories Animal Technology Co, Ltd. foram divididos aleatoriamente em 7 grupos de acordo com o gênero, em que havia 10 ratos em um grupo com metade machos e metade fêmeas. Estes 7 grupos incluíram o grupo controle negativo de soro fisiológico, grupo controle de 0,48 mg/kg MMAE, grupo controle 40 mg/kg anticorpo naked RC48 e séries de grupos de dose de RC48-vc-MMAE, em que os ratos foram dosados via perfusão da veia da cauda, e o período de observação experimental foi de 21 dias. Os pesos dos corpos foram medidos no D1 (pré- dosagem), D8, D15 e D22. Após o período de observação, os animais foram sacrificados e foi realizado uma observação anatômica patológica geral, e os tecidos ou órgãos anormais observados pela observação anatômica geral foram submetidos a um exame histológico.[00133] SPF Level SD Mice (Certificate No. SCXK(jing)2012-0001) purchased from Beijing Vital River Laboratories Animal Technology Co, Ltd. were randomly divided into 7 groups according to gender, in which there were 10 rats in a group with half male and half female. These 7 groups included the saline negative control group, 0.48 mg/kg MMAE control group, 40 mg/kg naked antibody RC48 control group, and series of RC48-vc-MMAE dose groups, in which rats were dosed via tail vein perfusion, and the experimental observation period was 21 days. Body weights were measured on D1 (pre-dosing), D8, D15 and D22. After the observation period, the animals were sacrificed and a general pathological anatomical observation was performed, and the abnormal tissues or organs observed by the general anatomical observation were subjected to histological examination.

[00134] As condições de morte dos animais: 9/10 animais (grupo controle MMAE), 1/10 animal (RC48-vc-MMAE, 30 mg/kg grupo) e 2/10 animais (RC48-vc-MMAE, 40 mg/kg grupo) foram encontrados mortos durante os experimentos, enquanto os grupos de animais restantes não foram encontrados mortos ou em estado de agonia.[00134] The conditions of death of the animals: 9/10 animals (MMAE control group), 1/10 animal (RC48-vc-MMAE, 30 mg/kg group) and 2/10 animals (RC48-vc-MMAE, 40 mg/kg group) were found dead during the experiments, while the remaining groups of animals were not found dead or in a state of agony.

[00135] Sob as condições do presente experimento, a dose letal de RC48-vc-MMAE direcionada ao rato foi de 30 mg/kg, e dose de tolerância máxima foi maior que ou igual a 24 mg/kg (a dose correspondente de MMAE acoplado foi de 0,48 mg/kg). O anticorpo naked RC48 foi dado para o rato SD com a dose de 40 mg/kg via perfusão intravenosa única, e não houve evidente sintoma de resposta de toxicidade, sugerindo a dose de tolerância máxima de rato foi maior que ou igual a 40 mg/kg. Este resultado mostrou que, mesmo se o conjugado da presente invenção for usado com a dose muito mais alta que aquela de fármaco não conjugado MMAE (40 mg/kg vs 0, 48 mg/kg), ainda mostrou a toxicidade muito mais baixa que aquela do fármaco não conjugado MMAE, demonstrando que com a formação de ADC acoplando MMAE com anticorpo, a toxicidade diminui significativamente.[00135] Under the conditions of the present experiment, the lethal dose of RC48-vc-MMAE directed to the rat was 30 mg/kg, and maximum tolerable dose was greater than or equal to 24 mg/kg (the corresponding dose of coupled MMAE was 0.48 mg/kg). Naked antibody RC48 was given to the SD rat at a dose of 40 mg/kg via a single intravenous infusion, and there was no evident symptom of toxicity response, suggesting the maximum tolerable dose of the rat was greater than or equal to 40 mg/kg. This result showed that even if the conjugate of the present invention is used with the much higher dose than that of the MMAE unconjugated drug (40 mg/kg vs 0.48 mg/kg), it still showed much lower toxicity than that of the MMAE unconjugated drug, demonstrating that with the formation of ADC by coupling MMAE with antibody, the toxicity decreases significantly.

[00136] Acima como descrito são só as modalidades preferidas, que são apenas consideradas como exemplos enquanto a combinação não limitante das características necessárias para realizar a presente invenção. A legenda como fornecida não tem a intenção de limitar as várias modalidades da presente invenção. Os termos tais como “compreender”, “conter” e “incluir” não tem a intenção de limitar. Além disso, a não ser de outro modo indicado, o termo sem modificação numérica inclui as suas formas plurais, e “ou” significa “e/ou”. A não ser de outro modo definido no contexto, todos os termos tecnológicos e científicos como usados no presente documento têm os mesmos significados como entendido por aqueles técnicos no assunto.[00136] Above as described are only the preferred embodiments, which are only considered as examples while the non-limiting combination of characteristics necessary to carry out the present invention. The legend as provided is not intended to limit the various embodiments of the present invention. Terms such as “comprehend”, “contain” and “include” are not intended to be limiting. Furthermore, unless otherwise indicated, the term without numerical modification includes its plural forms, and "or" means "and/or". Unless otherwise defined in context, all technological and scientific terms as used herein have the same meanings as understood by those skilled in the art.

[00137] Todas as publicações e patentes como mencionadas no presente pedido estão incorporadas no presente documento por referência. Sem se afastarem do escopo e espírito da presente invenção, várias modificações e variantes dos métodos e composições descritos na presente invenção são evidentes para aqueles técnicos no assunto. Embora a presente invenção seja descrita através modalidades preferidas em particular, deve ser entendido que a presente invenção não deve ser inadequadamente limitada a essas modalidades particulares. Na verdade, várias variantes, que são evidentes para aqueles técnicos no assunto para realizar os modos descritos pela presente invenção, se destinam a ser incluídas no escopo das reivindicações anexas. Referências[00137] All publications and patents as mentioned in the present application are incorporated herein by reference. Without departing from the scope and spirit of the present invention, various modifications and variants of the methods and compositions described in the present invention are apparent to those skilled in the art. While the present invention will be described by particular preferred embodiments, it is to be understood that the present invention should not be inappropriately limited to those particular embodiments. Indeed, several variants, which are obvious to those skilled in the art to carry out the modes described by the present invention, are intended to be included within the scope of the appended claims. References

[00138] Nahta, R.and F.J.Esteva(2007). Trastuzumab triumphs and tribulations. Oncogene 6(25) 3637-43. HER2 /neu, 2009(12):1268-1271., HER2, 2008 (49) :39-40. de Bono JS, Bellmunt J, Attard G, Droz JP, Miller K, Flechon A, Sternberg C, Parker C, Zugmaier G, Hersberger-Gimenez V, Cockey L, Mason M, Graham J Open-label phase II study evaluating the efficacy and safety of two doses of pertuzumab in castrate chemotherapy- naive patients with hormone-refractory prostate cancer. J Cl in Onco, 2007, Jan 20;25 (3):257-62Petersdorf SH, Kopecky KJ, Slovak M, Willman C, Nevill T, Brandwein J, Larson RA, Erba HP, Stiff PJ, Stuart RK, Walter RB, Tallman MS, Stenke L, Appelbaum FR. A phase III study of gemtuzumab ozogamicin during induction and post-consolidation therapy in younger patients with acute myeloid leukemia. Blood. 16 de abril de 2013.[00138] Nahta, R.and F.J.Esteva(2007). Trastuzumab triumphs and tribulations. Oncogene 6(25) 3637-43. HER2 /neu, 2009(12):1268-1271., HER2, 2008(49):39-40. de Bono JS, Bellmunt J, Attard G, Droz JP, Miller K, Flechon A, Sternberg C, Parker C, Zugmaier G, Hersberger-Gimenez V, Cockey L, Mason M, Graham J Open-label phase II study evaluating the efficacy and safety of two doses of pertuzumab in castrate chemotherapy-naive patients with hormone-refractory prostate cancer. JCl in Onco, 2007, Jan 20;25(3):257-62Petersdorf SH, Kopecky KJ, Slovak M, Willman C, Nevill T, Brandwein J, Larson RA, Erba HP, Stiff PJ, Stuart RK, Walter RB, Tallman MS, Stenke L, Appelbaum FR. A phase III study of gemtuzumab ozogamicin during induction and post-consolidation therapy in younger patients with acute myeloid leukemia. Blood. April 16, 2013.

[00139] de Vries JF, Zwaan CM, De Bie M, Voerman JS, den Boer ML, van Dongen JJ, van der Velden VH. The novel cal icheamicin- conj ugated CD22 antibody inotuzumab ozogamicin (CMC-544) effectively kills primary pediatric acute lymphoblastic leukemia cells. Leukemia. 2012 Feb;26(2):255-64„ Katz J, Janik JE, Younes A. 2011 Brentuximab Vedotin (SGN-35).Clin Cancer Res. 2011 Oct 15;17(20):6428-36.[00139] de Vries JF, Zwaan CM, De Bie M, Voerman JS, den Boer ML, van Dongen JJ, van der Velden VH. The novel cal icheamicin-conjugated CD22 antibody inotuzumab ozogamicin (CMC-544) effectively kills primary pediatric acute lymphoblastic leukemia cells. Leukemia. 2012 Feb;26(2):255-64„ Katz J, Janik JE, Younes A. 2011 Brentuximab Vedotin (SGN-35).Clin Cancer Res. 2011 Oct 15;17(20):6428-36.

[00140] Girish S, Gupta M, Wang B et al. Clinical pharmacology of trastuzumab emtansine (T-DM1): an antibody-drug conjugate in development for the treatment of HER2-positive cancer. Cancer Chemotherapy and Pharmacology 2012; 69:1229-40.[00140] Girish S, Gupta M, Wang B et al. Clinical pharmacology of trastuzumab emtansine (T-DM1): an antibody-drug conjugate in development for the treatment of HER2-positive cancer. Cancer Chemotherapy and Pharmacology 2012; 69:1229-40.

[00141] Lewis Phillips GD, Li G, Dugger DL et al. Targeting HER2- Positive Breast Cancer with Trastuzumab-DMl, an Antibody-Cytotoxic Drug Conjugate. Cancer Research 2008; 68:9280-90.[00141] Lewis Phillips GD, Li G, Dugger DL et al. Targeting HER2- Positive Breast Cancer with Trastuzumab-DMl, an Antibody-Cytotoxic Drug Conjugate. Cancer Research 2008; 68:9280-90.

[00142] Krop IE, Beeram M, Modi S et al. Phase I Study of Trastuzumab-DMl, an HER2 Antibody-Drug Conjugate, Given Every 3 Weeks to Patients With HER2-Positive Metastatic Breast Cancer. Journal of Clinical Oncology 2010; 28:2698-2704.[00142] Krop IE, Beeram M, Modi S et al. Phase I Study of Trastuzumab-DMl, an HER2 Antibody-Drug Conjugate, Given Every 3 Weeks to Patients With HER2-Positive Metastatic Breast Cancer. Journal of Clinical Oncology 2010; 28:2698-2704.

[00143] Baselga J. Treatment of HER2-overexpressing breast cancer. Annals of Oncology 2010; 21:vii36-vii40.[00143] Baselga J. Treatment of HER2-overexpressing breast cancer. Annals of Oncology 2010; 21:vii36-vii40.

[00144] Joseph A. Francisco, Charles G. Cerveny, Damon L. Meyer, Bruce J. Mixan, Kerry Klussman, Dana, F. Chace, Starr X. Rejniak, Kristine A. Gordon, Ron DeBlanc, Brian E. Toki, Che-Leung Law, Svetlana O. Doronina, Clay B. Siegall, Peter D. Senter and Alan F. Wahl. 2003 cAClO- vcMMAE, an anti-CD30-monomethyl auristatin E conjugate with Potent and selective antitumoral activity. Blood. 2003 102: 1458-1465.[00144] Joseph A. Francisco, Charles G. Cerveny, Damon L. Meyer, Bruce J. Mixan, Kerry Klussman, Dana, F. Chace, Starr X. Rejniak, Kristine A. Gordon, Ron DeBlanc, Brian E. Toki, Che-Leung Law, Svetlana O. Doronina, Clay B. Siegall, Peter D. Senter and Alan F. Wahl. 2003 cAClO- vcMMAE, an anti-CD30-monomethyl auristatin E conjugate with Potent and selective antitumor activity. Blood. 2003 102: 1458-1465.

[00145] Dosio F P. Brusa and L Cattel. 2011 Immunotoxins and anticancer drugs conjugate assemblies: the role of the linkage between components. Toxins 3:848-883.[00145] Dosio F P. Brusa and L Cattel. 2011 Immunotoxins and anticancer drugs conjugate assemblies: the role of the linkage between components. Toxins 3:848-883.

[00146] Concortis Biosystems Corp. USA www.concortisbiosystems.com CN1993146A Referência do Arquivo do Depositário ou No. internacional de depósito Agente OP140851 INDICAÇÕES RELACIONADAS AO MICRORGANISMO DEPOSITADO OU OUTRO MATERIAL BIOLÓGICO (REGRA PCT 13bis)[00146] Concortis Biosystems Corp. USA www.concortisbiosystems.com CN1993146A Depositary File Reference or No. international depot Agent OP140851 INDICATIONS RELATED TO THE DEPOSITED MICRO-ORGANISM OR OTHER BIOLOGICAL MATERIAL (PCT RULE 13bis)

[00147] As indicações feitas abaixo se referem ao microrganismo depositado ou outro material biológico que se refere a descrição na página 6 , linha 18-25.[00147] The indications made below refer to the deposited microorganism or other biological material that refers to the description on page 6, line 18-25.

DEPOSIT IDENTIFICATION

[00148] Depósitos adicionais são identificados em uma folha adicionalX Nome da instituição depositária[00148] Additional deposits are identified on an additional sheetX Name of depository institution

[00149] Centro Geral de Coleção de Culturas Microbiológicas da China Endereço da instituição depositária (incluindo código postal e país)[00149] China General Collection Center of Microbiological Cultures Address of the depositary institution (including postal code and country)

[00150] Instituto de Microbiologia, Academia Chinesa de Ciências, No. 3, 1st Beichen West Rd., Chaoyang District, Beijing 100101, P. R. China Data de depósito Número de Registro[00150] Institute of Microbiology, Chinese Academy of Sciences, No. 3, 1st Beichen West Rd., Chaoyang District, Beijing 100101, P.R. China Date of Deposit Registration Number

[00151] 22 de agosto de 2013 CGMCC No.8102 INDICAÇÕES ADICIONAIS (deixe em branco se não aplicável)[00151] August 22, 2013 CGMCC No.8102 ADDITIONAL INDICATIONS (leave blank if not applicable)

[00152] Esta informação é continuada em uma folha adicional 0 células de hibridoma ESTADOS DESIGNADOS PARA AS QUAIS AS INDICAÇÕES SÃO FEITAS (se as indicações não são para todos os Estados designados) FORNECIMENTO SEPARADO DAS INDICAÇÕES (deixe em branco se não aplicável) Formulário PCT/RO/134 (julho de l998; reimpresso em janeiro de 2004) Folha Adicional para Material Biológico Identificação de depósitos adicionais: O nome e endereço da instituição depositária para os depósitos são: Centro para Coleção de Tipos de Culturas da China Universidade de Wuhan, Luojia Mountain, Wuchang District, Wuhan City, Hubei 430072, P. R.China Indicações adicionais para todos os depósitos acima mencionados: Células de ovário de hamster chinês Depositante: Todos os depósitos mencionados acima foram feitos por: RC Biotechnologies, Ltd. N° 1 Rongchang Road, ETDZ Yantai, Shandong 264006[00152] This information is continued on an additional sheet 0 hybridoma cells DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if nominations are not for all Designated States) SEPARATE PROVISION OF INDICATIONS (leave blank if not applicable) Form PCT/RO/134 (July 1998; reprinted January 2004) Additional Sheet for Biological Material Identification of additional deposits: The name and address of the depository institution for the deposits are: Center for Collection of Types of Cultures of China Wuhan University, Luojia Mountain, Wuchang District, Wuhan City, Hubei 430072, PRChina Additional indications for all above mentioned deposits: Chinese hamster ovary cells Depositor: All above mentioned deposits were made by: RC Biotechnologies, Ltd. No. 1 Rongchang Road, ETDZ Yantai, Shandong 264006

Claims

1. ANTIBODY OR FUNCTIONAL FRAGMENTS THEREOF WHICH CAN SPECIFICALLY BIND TO HER2, characterized in that the antibody comprises a heavy chain and a light chain, wherein: (i) the heavy chain comprises three CDR regions, wherein the CDR regions have the amino acid sequences as shown in SEQ ID NO: 1, 2 and 3, respectively; and (ii) the light chain comprises three CDR regions, wherein the CDR regions have the amino acid sequences as shown in SEQ ID NO: 4, 5 and 6, respectively.

2. ANTIBODY OR ITS FUNCTIONAL FRAGMENTS, according to claim 1, characterized in that the antibody comprises the same CDR sequences as those of the antibody secreted from hybridoma cells that were deposited at the China General Collection Center of Microbiological Cultures on August 22, 2013, with deposit number CGMCC No. 8102.

3. ANTIBODY OR ITS FUNCTIONAL FRAGMENTS, according to claim 1, characterized in that the antibody is a humanized antibody.

4. ANTIBODY OR ITS FUNCTIONAL FRAGMENTS, according to claim 3, characterized in that the antibody is an antibody secreted from CHO cells that were deposited at the Center for Collection of Culture Types in China on November 6, 2013, with the deposit number CCTCC C2013170.

5. ANTIBODY OR ITS FUNCTIONAL FRAGMENTS, according to claim 1, characterized in that the antibody is a monoclonal antibody.

6. ANTIBODY OR ITS FUNCTIONAL FRAGMENTS, according to claim 1, characterized in that the antibody binds specifically to HER2, but not to EGFR, HER3 or HER4.

7. ANTIBODY OR ITS FUNCTIONAL FRAGMENTS, according to claim 1, characterized in that the antibody is an IgG1K antibody.

8. CONJUGATE, comprising the antibody or its functional fragments as defined in any one of claims 1 to 7, characterized in that they are conjugated with one or more therapeutic agents; preferably, the therapeutic agent is selected from a cytotoxic drug, immunopotentiators and radioactive isotopes; more preferably, the therapeutic agent is selected from dolastatin and its derivatives; more preferably, the therapeutic agent is selected from monomethyl auristatin E (MMAE) and monomethyl auristatin F (MMAF).

9. CONJUGATE according to claim 8, characterized in that the therapeutic agent is MMAE.

10. CONJUGATE, according to claim 8 or claim 9, characterized in that the therapeutic agent is coupled to the antibody or its functional fragments through a linker; preferably, the linker is linked to the antibody through the thiol; more preferably, the linker is selected from maleimidocaproyl-valine-citrulline-p-aminobenzyl (mc-vc-pAB) and mc.

11. CONJUGATE, according to claim 10, characterized in that the linker is mc-vc-pAB.

12. CONJUGATE WITH THE GENERAL FORMULA Ab-(L-U)n, characterized in that Ab represents the antibody or its functional fragments as defined in any one of claims 1 to 7, L represents a ligand (for example, mc-vc-pAB or mc), U represents a therapeutic agent (preferably, the therapeutic agent is selected from a cytotoxic drug, immunopotentiators and radioactive isotopes; more preferably, the therapeutic agent is selected from dolastatin and derivatives thereof; more preferably, the therapeutic agent is selected from MMAE and MMAF), and n represents an integer from 1 to 8.

13. CONJUGATE, according to claim 12, characterized in that the linker is mc-vc-pAB, and the therapeutic agent is MMAE.

14. PHARMACEUTICAL COMPOSITION, characterized in that it comprises the antibody or its functional fragments as defined in any one of claims 1 to 7 and/or the conjugate as defined in any one of claims 8 to 13, as well as a pharmaceutically acceptable vehicle.

15. USE OF THE ANTIBODY OR ITS FUNCTIONAL FRAGMENTS, as defined in any one of claims 1 to 7, of the conjugate as defined in any of claims 8 to 13 or of the pharmaceutical composition as defined in claim 14 characterized by being in the manufacture of a drug for the treatment or prevention of cancer.

16. USE, according to claim 15, characterized by the cancer being HER2-positive cancer, preferably breast cancer or ovarian cancer or gastric cancer, more preferably breast cancer or ovarian cancer or gastric cancer resistant to Lapatinib and/or Trastuzumab.