BR112012004419A2 - production method of a seed-specific and / or seed-preferred plant promoter, production method of a plant or part of it, construction of recombinant expression, recombinant expression vector, transgenic plant or part of it, transgenic cell or transgenic plant or part of that, transgenic cell culture, use of neena and use of a transgenic cell culture - Google Patents

Abstract

METHOD OF PRODUCTION OF A PLANT PROMOTOR, METHOD OF PRODUCTION OF A PLANT, CONSTRUCTION, VECTOR, TRANSGENIC MICRO-ORGANISM AND USES OF NEENA, RECOMBINANT CONSTRUCTION, RECOMBINANT VECTOR, A TRANSGENIC CELL CULTURE, OF A TRANSGENIC CELL, OF A SEED TRANSGENIC OR PROPAGATING MATERIAL The present invention is in the field of plant molecular biology and provides methods for the production of high expression seed-specific and / or seed-preferred promoters and the production of plants with increased seed-specific and / or seed-preferred expression nucleic acids in which nucleic acids that increase nucleic acid expression (NEENAs) are functionally linked to said promoters and / or introduced into plants.

Description

'1 “PRODUCTION METHOD OF A SEED- VEGETABLE PROMOTER | : SPECIFIC AND / OR PREFERENTIAL SEED, PRODUCTION METHOD | OF A PLANT OR PART OF THAT, BUILDING RECOMBINANT EXPRESSION, RECOMBINANT EXPRESSION VECTOR, TRANSGENIC PLANT OR PART OF THAT, TRANSGENIC CELL OR TRANSGENIC PLANT OR PART OF THAT, TRANSGENIC CELL CULTURE, USE OF TRANSGENIC CULTURE AND USE OF A CULTURE The present invention is in the field of plant molecular biology and provides methods for the production of high expression seed-specific and / or seed-preferred promoters and the production of plants with increased seed-specific and / or seed-preferred expression of acids nucleic acids in which nucleic acids that increase nucleic acid expression (NEENAs) are functionally linked to said promoters and / or introduced into plants.

The expression of transgenes in plants is strongly affected by several external and internal factors that result in a variable and unpredictable level of transgenic expression.

Generally, a large number of transformants must be produced and analyzed to identify strains with the desired expression strength.

Since the transformation and screening of strains with the desired expression strength is expensive and laborious, there is a need for high expression of one or more transgenes in a plant.

This problem is especially evident when several genes have to be expressed differently | coordinated in a transgenic plant to obtain a specific effect since a plant must be identified where each and all genes are strongly expressed.

For example, the expression of a transgene can vary significantly, depending on the construction design and the effects Petition 870200133605, 10/23/2020, PÓGA NDOG MM

| . 2 positionals of the T-DNA insertion site in individual transformation events.

Strong promoters can partially overcome these challenges. | However, the availability of suitable promoters that show strong | expression with the desired specificity is generally limited.

To ensure the availability of sufficient promoters with the specificity of expression desired, the identification and characterization of additional promoters can help to close this gap.

However, the natural availability of promoters of the respective specificity and strength and the long characterization of candidates for promoters prevents the identification of suitable new promoters.

To overcome these challenges, several elements and / or genetic motives have been shown to positively affect gene expression.

Among these, some introns have been identified as genetic elements with a strong potential to increase gene expression.

Although the mechanism is largely unknown, some introns have been shown to positively affect the steady-state proportion of mature mMRNA, possibly due to increased transcriptional activity, improved MRNA maturation, increased nuclear mMRNA export and / or improved translation initiation (e.g. Huang and Gorman, 1990; Le Hir et al. 2003; Nott et al., 2004). Since only the selected introns have been | shown to increase expression, it is likely that the braiding is not responsible for the observed effects.

The increase in gene expression observed through the functional binding of introns to promoters is called an intron-mediated increase | 25 (IME) gene expression and has been shown in several plants | monocots (for example, CalMs et al., 1987; Vasil et al., 1989; Bruce et | al., 1990; Lu et al., 2008) and dicots (for example, Chung et al., 2006; Kim et al. ., 2006; Rose et al., 2008). In this respect, the position of the intron in Petition 870200133605, of 3100020, 26020008 —J ————..... 2D2Çri

. 3 relation to the place of beginning of translation (ATG) was shown to be crucial for the intron-mediated increase in gene expression (Rose et al., 2004).

Close to its potential to increase gene expression, some introns have also been shown to affect tissue specificity in their native nucleotide environment in plants. Reporter gene expression was identified as dependent on the presence of genomic regions containing up to two introns (Sieburth et al., 1997; Wang et al., 2004). The 5 'UTR introns have also been reported to be important for the proper functionality of promoter elements, probably due to tissue-specific genetic control elements found in the introns (Fu et al. 1995a; Fu et al. 1995b; Vitale et al. , 2003; Kim et al., 2006). However, these studies also showed that the combination of introns with heterologous promoters can have strong negative impacts on the strength and / or specificity of gene expression (Vitale et al., 2003; Kim et al., 2006, WOZ2006 / 003186, WO2007 / 098042). For example, the strong CaMV35S seed-specific and / or seed-preferred promoter of Cauliflower Mosaic Virus is negatively affected by combining with the sesame intron SeFAD2 5'UTR (Kim et al., 2006). Contrary to these observations, some documents show an increased expression of a nucleic acid by IME without affecting the tissue specificity of the respective promoter (Schúnmann | p et al., 2004). Introns or NEENAs that increase seed-specific and / or seed-preferential expression when functionally linked to a heterologous promoter have not been shown in the art. In the present application, additional nucleic acid molecules are described to increase the expression of said promoters without affecting their specificity by functional binding to seed-specific and / or seed-preferred promoters. Such nucleic acid molecules are in the present application described as "nucleic acids that increase expression

: 4 nucleic acid "(NEENA). Introns have the intrinsic characteristic that will be stranded outside the respective pre-mRNA. In contrast, nucleic acids presented for application purposes should not necessarily be included in the mRNA or, if present in the mRNA, should not necessarily be stranded outside the mMRNA to increase expression | derived from the promoter to which the NEENAs are functionally linked.

DETAILED DESCRIPTION OF THE INVENTION A first embodiment of the invention comprises a method for the production of a high-specific seed-specific and / or seed-specific promoter which comprises functionally binding one or more acid expression enhancing nucleic acid molecules to a promoter. nucleic acid (NEENA) comprising i) the nucleic acid molecule having a sequence as defined in any one of SEQ ID NO: 1 to 15, or ii) a nucleic acid molecule having a sequence with an 80% identity or more with any of the sequences as defined by SEQ ID NO: 1 to 15, preferably the identity is 85% or more, | more preferably, identity is 90% or more, with even more | preferably, identity is 95% or more, 96% or more, 97% or more, 98% or | more or 99% or more, in the most preferred modality, the identity is 100% with -. any one of the sequences as defined by SEQ ID NO: 1 to 15, or i à iii) a fragment of 100 or more consecutive bases, from | preferably 150 or more consecutive bases, more preferably 200 bases | consecutive or even more preference, 250 or more consecutive bases of | a nucleic acid molecule of i) or ii) that has an | increased expression, for example, 65% or more, preferably 70% or | more, more preferably, 75% or more, even more preferably 80% or more, 85% or more or 90% or more, in a more preferred modality this |

. 5 has 95% or more of the expression enhancing activity as the corresponding nucleic acid molecule that has the sequence of any of the sequences as defined by SEQ ID NO: 1 to 15, or iv) a nucleic acid molecule that is the complement or reverse complement of any of the nucleic acid molecules previously mentioned under i) to iii), or v) a nucleic acid molecule that is obtainable by PCR using oligonucleotide primers described by SEQ ID NO: 20 to 29, 34 a 41.44 to 51 and 54 to 57 as shown in the Table. 2 or vi) a nucleic acid molecule of 100 nucleotides or more, | 150 nucleotides or more, 200 nucleotides or more or 250 nucleotides or more, which hybridize under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50ºC with washing in 2 X SSC, 0.1% SDS at 50ºC or 65ºC, preferably 65ºC in | 15 a nucleic acid molecule comprising at least 50, preferably at least 100, more preferably, at least 150, even more preferably, at least 200, most preferably, at least 250 consecutive nucleotides of a nucleotide sequence of increase in transcription described by SEQ ID NO: 1 to 15 or the complement thereof.

Preferably, said nucleic acid molecule hybridizes under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5Mde = NaPO4, 1 mM EDTA at 50ºC with washing in 1 X SSC, 0, 1% SDS at 50ºC or 65ºC, preferably 65ºC in a nucleic acid molecule comprising at least 50, preferably at least 100, more 25 preferably, at least 150, even more preferably at least 200, most preferably at least 250 consecutive nucleotides of a transcription-enhancing nucleotide sequence described by SEQ ID NO: 1 a or the complement thereof, more preferably, said acid molecule

. 6 nucleicides hybridize under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50ºC with washing in 0.1 X SSC, 0.1% SDS a 50ºC or 65ºC, preferably 65ºC in a nucleic acid molecule comprising at least 50, preferably at least 100, more preferably, at least 150, with further | more preferably, at least 200, most preferably, at least 250 consecutive nucleotides of a transcription-enhancing nucleotide sequence described by any of the sequences as defined by SEQ ID NO: 1 to 15 or the complement thereof.

In one embodiment, the one or more NEENA is heterologous to the promoter to which it is functionally linked.

As described above under v) the PCR-obtainable nucleic acid molecule using oligonucleotides as defined by SEQ IDs 20 to 29, 34 to 41, 44 to 51 and 54 to 57 as shown in Table 2 is obtainable, for example, from Genomic DNA from Arabidopsis plants like A. thaliana using the conditions described in Example 1 below. | The person skilled in the art is aware of variations in the temperature profile, number of cycles and / or buffer or concentration composition to obtain the respective NEENA molecule.

The specific combination of —oligonucleotides that will be used in the respective PCR reaction to obtain one! respective NEENA molecule is described in Table 2. One skilled in the art is aware of methods for making a promoter unidirectional into bidirectional and methods for using the complement or reverse complement of a promoter sequence to create a promoter that has the same specificity promoter than the original sequence.

Such methods are, for example, described for seed-specific and / or seed-preferred promoters as well as inducible by Xie et al. (2001) "Bidirectionalization of polar promoters in plants" nature Petition 870200133605, 10/23/2020, DÁGIROG - ———— s ..————— rn. "

. 7 biotechnology 19 pages 677 to 679. The authors describe that it is sufficient to add a minimal promoter to the 5 'primer end of any given promoter to receive a promoter that controls expression in | both directions with the same promoter specificity.

So, a high-expression promoter functionally linked to a NEENA as described above is functional in complement or reverse complement and, therefore, the

NEENA is functional in complement or reverse complement as well.

In principle, NEENA can be functionally linked to any promoter as tissue-specific, inducible, developmental or constitutive promoters.

The respective NEENA will result in increased seed-specific and / or seed-preferred expression of the heterologous nucleic acid under the control of the respective promoter to which the one or more NEENA is functionally linked.

Increasing the expression of promoters instead of seed-specific and / or seed-preferred promoters, for example, seed-specific and / or seed-preferred promoters or promoters with different tissue specificity, will show the specificity of these promoters.

The expression of the nucleic acid under the control of the respective promoter will be significantly increased in seeds, in which the transcription of said nucleic acid may not have been detected or only weakly detected without NEENA physically

-: - linked to its promoter: Then, the woven or developing promoter - B Ú specific or any other can transform into seed-specific and / or seed-preferred promoters by functionally linking one or more molecules of NEENA as described above to the said prosecutor.

Therefore, another embodiment of the invention provides a method for presenting the specificity of any given plant functional promoter to a seed-specific and / or seed-preferred promoter by attaching the respective promoter to a NEENA molecule that comprises a sequence such as

. 8 described above under i) to vi).

Preferably, the one or more NEENA is functionally linked to any seed-specific and / or seed-preferred promoter and will increase the expression of the nucleic acid molecule under the control of said - promoter. The seed-specific and / or seed-preferred promoters that will be used in any method of the invention can be derived from plants, for example, monocot or dicot plants, from bacteria and / or viruses or can be synthetic promoters. The seed-specific and / or seed-preferred promoters that will be used are, for example, the Vicia faba SBP promoter, the Vicia faba Unknown Seed Protein promoter, the Brassica napus napine promoter, the Linum conlinin promoter. usitatissmum, the promoter of the A.thaliana At5sgo1670 gene that encodes the peroxiredoxin-like protein, the promoter of the peroxiredoxin-like protein from Linum usitatissmum, the protein promoter similar to —globulin from Brassica napus, the arcelin5-1 promoter from Phaseolus vulgaris , the | Zea maize Zeina promoter, Zea maize globulin promoter, Zea maize pKG86 promoter as described in Example 6 below and the like. The high expression seed-specific and / or seed-preferred promoters of the invention functionally linked to a NEENA can be used in any plant comprising, for example, moss,: fern, gymnosperm. Or angiosperm, for example, monocotyledonous or dicotyledonous plant . In a preferred embodiment, said promoter of the invention functionally linked to a NEENA can be used in monocotyledonous or dicotyledonous plants, preferably a "cultivation" plant such as corn, soybeans, canola, cotton, potatoes, beets, rice, wheat, sorghum, barley, musacea, sugar cane, miscanto and the like. In a preferred embodiment of the invention, said promoter that is functionally linked to a NEENA can be used in monocot plants such as | Petition 870200133605, of 23/10/2020, Pác

. 9 corn, rice, wheat, sorghum, barley, musceae, miscellaneous or sugarcane. In an especially preferred embodiment, the promoter functionally linked to a NEENA can be used in dicotyledonous plants such as soybeans, canola, cotton or potatoes. A high expression seed-specific and / or seed-preferred promoter as used in the application means, for example, a promoter that is functionally linked to a NEENA causing increased promoter specific and / or seed-preferred expression in a seed of the plant or part thereof in which the accumulation of RNA or the rate of synthesis of RNA in seeds derived from the nucleic acid molecule under the control of the respective promoter functionally linked to a NEENA is preferably greater significantly than expression in seeds caused by the same NEENA-less promoter of the invention. Preferably, the amount of RNA of the respective nucleic acid and / or the rate of RNA synthesis and / or the stability of RNA in a plant is increased by 50% or more, for example, 100% or more, preferably 200% or more, more preferably, 5 times or more, even more preferably, 10 times or more, most preferably, 20 times or more, for example, 50 times compared to a control plant of the same age developed under the same conditions comprising the same seed-specific and / or seed-preferred promoter, the latter not being functionally linked to a NEENA of the invention.

h When used here, significantly greater refers to the statistical significance that the person skilled in the art is aware of how to determine, for example, when applying statistical tests such as the t test to the respective data sets. Methods for detecting the expression conferred by a promoter are known in the art. For example, the promoter can be functionally

. 10 linked to a marker gene like GUS, GFP or luciferase and the activity of | respective protein encoded by the respective marker gene can be determined in the plant or part of it.

As a representative example, the method for detecting luciferase is described in detail below.

Other methods are, for example, measuring the steady state level or the RNA rate synthesis of the nucleic acid molecule controlled by the promoter by methods known in the art, for example, Northern blot analysis, qPCR, operational analyzes or other methods described in technical.

One skilled in the art is aware of several methods for functionally linking two or more nucleic acid molecules.

Such methods may include restriction / ligation, ligase independent cloning, recombination or synthesis.

Other methods can be employed to functionally link two or more nucleic acid molecules.

A further embodiment of the present invention is a method for producing a plant or part thereof with, compared to a respective control plant or part thereof, the increased seed-specific and / or seed-preferred expression of one or more nucleic acid molecules comprising the steps of introducing into the plant or part thereof one or more NEENA comprising a nucleic acid molecule as defined above under i) to vi) and functionally linking said one or more NEENA to one | promoter, preferably a seed-specific and / or seed- promoter | and a nucleic acid molecule that is under the control of said | promoter, preferably, seed-specific and / or seed-preferred promoter, in which NEENA is heterologous to said nucleic acid molecule. | NEENA can be heterologous to the nucleic acid molecule that | it is under the control of said promoter to which NEENA is functionally linked or it may be heterologous to the promoter and to the nucleic acid molecule under the control of said promoter.

. 1 The term "heterologous" in relation to a nucleic acid molecule or DNA refers to a nucleic acid molecule that is functionally linked to, or manipulated to be functionally linked to, a second nucleic acid molecule to which one is not functionally linked in nature, or to which it is functionally linked in a different location in nature.

For example, a NEENA of the invention is in its natural environment functionally linked to its native promoter, whereas in the present invention it is linked to another promoter that can be derived from the same organism, a different organism or can be a synthetic promoter.

This may also mean that the NEENA of the present invention is linked to its native promoter, however the nucleic acid molecule under the control of said promoter is heterologous to the promoter that comprises its native NEENA.

Furthermore, it is understood that the promoter and / or the nucleic acid molecule under the control of said promoter functionally linked to a NEENA of the invention is heterologous to said NEENA since its sequence has been manipulated, for example, by mutation such as insertions, deletions and so on so that the natural sequence of the promoter and / or the nucleic acid molecule under the control of said promoter is modified and therefore becomes heterologous to a NEENA of the invention.

It can also be understood that NEENA is —heterologous to the nucleic acid to which it is functionally linked when - - NEENA is functionally linked to its native promoter in which the position of - | Cv

NEENA in relation to said promoter is changed so that the promoter shows greater expression after such manipulation.

A plant that exhibits increased seed-specific and / or —sense-preferential expression of a nucleic acid molecule as understood here means a plant that has a greater, preferably statistically significantly greater, seed-specific and / or seed-preferred expression. a nucleic acid molecule compared to a

N 12. control plant developed under the same conditions without the respective NEENA functionally linked to the respective nucleic acid molecule. Such a control plant can be a naturally occurring plant or a transgenic plant that comprises the same promoter that controls the same gene as in the planted invention where the promoter is not linked to a NEENA of the invention.

The production of a plant as used here comprises methods for stable transformation such as introducing a recombinant DNA construct into a plant or part thereof through Agrobacterium-mediated transformation, protoplast transformation, particle bombardment or the like and optionally subsequent regeneration of a transgenic plant. This also includes methods for the temporary transformation of a plant or part of it as a viral infection or infiltration of Agrobacterium. One skilled in the art is aware of additional methods for the stable and / or temporary transformation of a plant or part thereof. Approaches such as methods of reproduction or protoplast fusion should also be employed for the production of a plant of the invention and are covered with these. The method of the invention can be applied to any plant, for example, gymnosperm or angiosperm, preferably angiosperm, for example, dicotyledonous plants - or: monocotyledonous, preferably dicotyledonous plants. Preferred monocot plants are, for example, maize, wheat, rice, barley, sorghum, muscea, sugar cane, miscantum and brachipod, especially preferred monocot plants are corn, wheat and rice. Preferred —dicotyledonous plants are, for example, soy, rapeseed, canola, flax, cotton, potato, beet, tagetes and Arabidopsis, especially preferred dicotyledon plants are soy, rapeseed, canola and potato.

In one embodiment of the invention, the methods as defined

. 13. above comprise the steps of a) introducing the one or more NEENA comprising a nucleic acid molecule as defined above in i) to vi) into a plant or part thereof and b) integrating said one or more NEENA into the genome of said plant or —Party, thereby said one or more NEENA is functionally linked to an endogenous nucleic acid, preferably expressed in a seed-specific and / or seed-preferential manner heterologous to said one or more NEENA and optionally c) regenerate a plant or part of that comprising said one or more NEENA from said transformed cell.

One or more NEENA molecules can be introduced into the plant or part of it through particle bombardment, protoplast electroporation, viral infection, Agrobacterium-mediated transformation or any other approach known in the art. The NEENA molecule can be introduced integrated, for example, in a plasmid or viral DNA or viral RNA. The NEENA molecule can also be comprised of a BAC, YAC or artificial chromosome prior to introduction into the plant or part of the plant. It can also be introduced as a linear nucleic acid molecule comprising the NEENA sequence in which additional sequences may be present adjacent to the NEENA sequence in the nucleic acid molecule. Such sequences close to the NEENA sequence can be about 20 bp, for example, 20 bp to hundreds of base pairs, for example, 100 bp or more and can facilitate integration into the genome, for example, by homologous recombination. Any other method for genome integration can be employed, with these integration approaches being targeted, such as homologous recombination or random integration approaches, such as illegitimate recombination.

Preferably endogenous nucleic acid is expressed

E And seed-specific and / or seed-preferred to which the NEENA 'molecule can be functionally linked can be any nucleic acid, preferably any nucleic acid molecule expressed in a seed-specific and / or seed-preferred manner.

The nucleic acid molecule can be a non-coding protein nucleic acid molecule such as antisense RNA, rRNA, tRNA, miRNA, ta-siRNA, siRNA, dsRNA, SNRNA, snoRNA or any other non-coding RNA known in the art.

The skilled person is aware of methods to identify nucleic acid molecules expressed in a seed-specific and / or seed-preferred manner to which the method of the invention can preferably be applied, for example, by microarray chip hybridization. , qPCR, Northern blot analysis, next generation sequencing, etc.

An additional way of carrying out the methods of the invention may be a) providing an expression construct comprising one or | more NEENA comprising a nucleic acid molecule as defined above in i) to vi) functionally linked to a promoter, preferably a seed-specific and / or seed-preferred promoter such as | 20 defined above and to one or more nucleic acid molecules, the - - -last is heterologous to said one or more NEENA and which is under the control of said promoter, preferably seed-specific and / or seed-preferred promoter and b ) integrate said expression construction which comprises a —other NEENA in the genome of said plant or part of it and optionally c) regenerate a plant or part of it which comprises said one or more expression constructs from said transformed plant or part of it .

Petition 870200133605, of 23/10/2020, DISTO ——— Q. — ssmm—

.

. 15 'NEENA can be heterologous to the nucleic acid molecule that is under the control of said promoter to which NEENA is functionally linked or it can be heterologous to the promoter and to the nucleic acid molecule under the control of said promoter.

The expression construct can be integrated into the genome of the respective plant with any method known in the art. Integration can be random using methods such as particle bombardment or Agrobacterium-mediated transformation. In a preferred embodiment, integration occurs through the desired integration, for example, by homologous recombination. The latter method could allow the integration of the expression construct that comprises a high expression promoter functionally linked to a NEENA in a region of favorable genome. Favorable genome regions are, for example, regions of genome known to comprise genes that are highly expressed, for example, in seeds and, therefore, can increase the expression derived from said expression construction compared to a region of the genome that does not show transcriptional activity.

In another preferred embodiment said or more NEENA is functionally linked to a promoter, preferably a seed-specific and / or seed-preferred promoter near the transcription start site of said heterologous nucleic acid molecule. 'i Near the transcription start site as indicated here comprises functionally linking the one or more NEENA to a promoter, preferably a seed-specific and / or seed-preferred promoter of 2500 bp or less, preferably 2000 bp or less, more preferably, 1500 bp or less, even more preferably, 1000 bp or less and with | most preferably, 500 bp or less distant from the transcription start site of said heterologous nucleic acid molecule. It will be understood that NEENA Petição 870200133605, of B10 / 2020, 1606, DD ——.———

. 16 can be integrated downstream or upstream at the respective distance from the transcription start site of the respective promoter.

Therefore, the one or more NEENA should not necessarily be included in the transcription of the respective heterologous nucleic acid under the control, preferably, of the seed-specific and / or seed-preferred promoter to which one or more NEENA is functionally linked.

Preferably, the one or more NEENA is integrated downstream of the transcription start site of the respective promoter, preferably a seed-specific and / or seed-preferred promoter.

The integration site downstream of the transcription start site can be on the 5 ', 3' RTU, an exon or intron or it can replace an intron or partially or completely 5 'or 3' UTR of the heterologous nucleic acid under the control, preferably, of the seed-specific and / or seed-preferred promoter.

Preferably, the one or more NEENA is integrated into the 5 'RTU or an intron or the NEENA is replacing an intron or part of the complete 5' RTU, more preferably it is integrated into the 5 'RTU of the respective heterologous nucleic acid.

A further embodiment of the invention comprises a recombinant expression construct comprising one or more NEENA comprising a nucleic acid molecule as defined above in i) to vi). The recombinant expression construct may additionally comprise one or more promoters, preferably seed - "—- specific and / or seed-preferred promoter to which one or more NEENA is functionally linked and optionally one or more expressed nucleic acid molecules , the latter being heterologous to said one or more NEENA.

NEENA can be heterologous to the nucleic acid molecule that is under the control of said promoter to which NEENA is functionally linked or it can be heterologous to the promoter and to the nucleic acid molecule under

. . 117 control of said prosecutor.

The expression construct can comprise one or more, for example, two or more, for example, 5 or more, as 10 or more combinations of promoters, preferably seed-specific and seed-preferred elu promoters functionally linked to a NEENA and a nucleic acid molecule that will be expressed that is heterologous to the respective NEENA. The expression construct can also comprise additional promoters that do not comprise a NEENA functionally linked to the nucleic acid molecules that will be expressed homologous or heterologous to the respective promoter.

A recombinant expression vector comprising one or more recombinant expression constructs as defined above is another embodiment of the invention. A large number of expression vectors that can be used in the present invention are known for a well-known element - technical. Methods for introducing such a vector comprising such an expression construct comprising, for example, a promoter functionally linked to a NEENA and optionally other elements such as a terminator in a plant's genome and for recovering transgenic plants from a transformed cell are also well known in the technique. Depending on the method used to transform a plant or part of it, the entire vector must: be integrated into the genome of said plant or part of it or some components = of the vector must be integrated into the genome, such as, for example, a T-DNA. A transgenic plant or part thereof comprising one or more heterologous NEENA as defined above in i) to vi) is also contained in that | invention. A NEENA will be understood as being heterologous to the plant if it is synthetic, derived from another organism or the same organism, however its natural genomic location is compared with a control plant, for example, a naturally occurring plant. It will be understood that a means of

EN: genomic location tornado where NEENA is located on another chromosome or on the same chromosome, however 10 kb or more, for example, | 10 kb, preferably 5 kb or more, for example, 5 kb, more preferably, | 1000 bp or more, for example 1000 bp, more preferably 500 bp or | 5 more, for example 500 bp, especially preferably 100 bp or more, for example 100 bp, most preferably 10 bp or more, for example 10 bp | displaced from its natural genomic location, for example, in a naturally occurring plant.

A transgenic cell or transgenic plant or part thereof comprising a recombinant expression vector as defined above or a recombinant expression construct as defined above is a further embodiment of the invention.

The transgenic cell, transgenic plant or part of it can be selected from the group consisting of bacteria, fungi, yeasts or plants, insects or cells of mammals or plants.

Preferred transgenic cells are bacteria, fungi, yeasts or cells | | vegetables.

The preferred bacteria are Enterobacteria like E. coli and bacteria from | genus - Agrobacteria, for example, Agrobacterium tumefaciens and | | Agrobacterium rhizogenes.

The preferred plants are monocots or | dicots, for example, monocot plants or | dicots like corn, soybeans, canola, cotton, potatoes, beets, rice, - wheat, sorghum, barley, musceae, sugar cane, miscanthus and the like.

As | preferred crop plants are corn, rice, wheat, soy, canola, cotton or | potato.

Especially preferred dicot crop plants are soy, | canola, cotton or potato. | Especially preferred monocot culture plants | are corn, wheat and rice. | A transgenic cell culture, transgenic seed, parts | or propagation material derived from a transgenic cell or plant or | | |

. Part of that as defined above comprising said heterologous NEENA as defined above in i) a vi) or said recombinant expression construct or said recombinant vector as defined above are other embodiments of the invention.

The transgenic parts or propagating material as indicated here comprises all tissues and organs, for example, leaf, stem and fruit as well as material that is useful for the propagation and / or regeneration of plants such as cuts, grafts, layers, branches or shoots comprising the respective NEENA, recombinant expression construct or recombinant vector. A further embodiment of the invention is the use of NEENA as defined above in i) to vi) or the recombinant construct or recombinant vector as defined above to increase expression in plants or parts thereof.

Then, manual application provides acid molecules — nucleus of increased seed-specific and / or seed-preferred gene expression that comprises one or more promoters, preferably a seed-specific promoter and / or preferential seed functionally linked to one or more NEENA. In addition, the use of such gene expression enhancing nucleic acid molecules and expression constructs, expression vectors, transgenic plants or parts thereof and transgenic cells that: - comprise such gene expression enhancing nucleic acid molecules are provided.

A use of a transgenic cell culture, transgenic seed, parts or propagation material derived from a transgenic cell or plant or part thereof as defined above for the production of foodstuffs, animal feed, seeds, pharmaceuticals or fine chemicals as well is contained in that invention.

. | . 20 |

AND

DEFINITIONS Abbreviations: NEENA - nucleic acid for increased expression of nucleic acid, GFP - green fluorescent protein, GUS - beta Glucuronidase, = BAP - G6-benzylaminopurine 24-D - 2,4-dichlorophenoxyacetic acid; MS - Murashige and Skoog medium; NAA - 1- naphthalene acetic acid, MES, 2- (N-morpholino-ethanesulfonic acid, IAA indole acetic acid; Kan: kanamycin sulfate; GA3 - Gibberellic acid; Timentin '": disodium ticarcillin / potassium clavulanate, micro! L: Microliter It will be understood that this invention is not limited to particular methodology or protocols It will also be understood that the terminology used here is for the purpose of describing only the particular modalities, and is not intended to limit the scope of the present invention which will be limited only by. Attached claims. It should be noted that as used here and in the attached claims, the singular forms "a", "and", and "o" include references in the plural except where the context indicates otherwise. the reference to "a vector" is a reference to one or more vectors and includes equivalents of those known to those skilled in the art, and so on. The term "about" is used here to indicate roughly, more or less, in around, or at the level of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the upper and lower limits of the numerical values presented here. In general, the term "about" is used here to modify a numerical value above and below the declared value by a variance of 20 percent, preferably 10 percent above or below (greater or lesser). As used here, the word "or" means any element on a particular list and also includes any combination of elements on that list. The words "comprise," "comprising," "include," "including," and "includes" when used in this specification and in the following claims are intended

. . 21 | specify the presence of one or more characteristics, whole numbers, i components, or specific steps, but these do not exclude the presence or addition of one or more other characteristics, whole numbers, components, steps, or groups of these. For clarity, some terms used - descriptive report are defined and used as set out below: Antiparallel: "Antiparallel" refers here to two nucleotide sequences paired via hydrogen bonds between complementary base residues with phosphodiester bonds moving across the direction 5-3 'in one nucleotide sequence in direction 3'-5' in the other nucleotide sequence.

Antisense: The term "antisense" refers to a nucleotide sequence that is reversed from its normal orientation for transcription or function and then expresses an RNA transcription that is complementary to a target gene MRNA molecule expressed within the host cell (for example, it can hybridize with the target gene mMRNA molecule or single-stranded genomic DNA through Watson-Crick base pairing) or that is complementary to a target DNA molecule such as example, genomic DNA present in the host cell.

Coding region: As used herein the term "coding region" when used in reference to a structure gene refers to the nucleotide sequences that encode the amino acids found in the initial polypeptide as a result of translation of an MRNA molecule. The coding region is linked, in eukaryotes, on the 5 'side by the "ATG" nucleotide triplet that encodes the initiator methionine and on the 3' side by one of the three triplets that specify stop codons (ie TAA, TAG, TGA). In addition to containing introns, the genomic forms of a gene can also include sequences located at the 5 'and 3' end of the sequences that are Petition 870200133605, 10/23/2020, Dq. 39/206 ——-—----........ ==

. | | : present in RNA transcription.

These strings are referred to as | "flanking" sequences or regions (these flanking sequences are located 5 'or 3' to the untranslated sequences present in the MRNA transcript). The 5 'flanking region - may contain regulatory sequences such as promoters and enhancers that control or influence gene transcription.

The 3 'flanking region can contain sequences that direct transcription termination, post-transcriptional cleavage and polyadenylation.

Complementary: "Complementary" or "complementarity" refers to two nucleotide sequences that comprise antiparallel nucleotide sequences capable of pairing with each other | (by the base pairing rules) by forming links | of hydrogen between the residues of complementary bases in the sequences of | antiparallel nucleotide.

For example, the sequence 5: -AGT-3 'is complementary | 15 to the 5-ACT-3 'sequence. Complementarity can be "partial" or "total". "Partial" complementarity occurs when one or more nucleic acid bases are not compatible according to the base pairing rules.

The "total" or "complete" complementarity between the nucleic acid molecules occurs when each and every nucleic acid base is compatible with another base under the base pairing rules.

The degree of complementarity between the strands of nucleic acid molecules has significant effects on the efficiency and strength of hybridization between the strands of nucleic acid molecules.

A "complement" to a nucleic acid sequence as used herein refers to a nucleotide sequence whose nucleic acid molecules show complete complementarity to the nucleic acid molecules of the nucleic acid sequence.

Double-stranded RNA: A "double-stranded RNA" or "dsRNA" molecule comprises a sense RNA fragment from a | Petition 870200133605, of 10/23/2020-p = 29/296-c— ss —— m —- p — c ..

. 23. nucleotide sequence and an antisense RNA fragment from the nucleotide sequence, which comprise nucleotide sequences complementary to each other, thus allowing the sense and antisense RNA fragments to pair and form a double-stranded RNA molecule.

Endogenous: An "endogenous" nucleotide sequence refers to a nucleotide sequence, which is present in the genome of the untransformed plant cell.

Increased expression: "increase" or "elevate" the expression of a nucleic acid molecule in a plant cell is used in an equivalent manner here and indicates that the level of expression of the nucleic acid molecule in a plant, part of a plant or cell vegetate! after applying a method of the present invention is greater than its expression in the plant, part | of the plant or plant cell before applying the method, or compared to a reference plant devoid of a recombinant nucleic acid molecule of the invention. For example, the reference plant comprises the same construction that is only devoid of the respective NEENA. The terms "augmented" and "elevated" as used herein are synonymous and mean here greater, preferably significantly greater, expression of the nucleic acid molecule to be expressed. as used here, an "increase" or "elevation" of | 20 —level of an agent such as a protein, MRNA or RNA means that the level is increased in relation to a substantially identical plant, part of a plant or plant cell developed under substantially identical conditions, devoid of a recombinant nucleic acid molecule of the invention, for example example, devoid of the NEENA molecule, the recombinant construct or recombinant vector of the invention. As used herein, "raising" or "raising" the level of an agent, such as, for example, a preRNA, mRNA, rRNA, tRNA, snoRNA, snRNA expressed by the target gene and / or the protein product encoded by it, means that the level is increased 50% Petition 8702013605, of 23/10/2020, Dáq. 411206 -. . .N.R sus.

—— at 24 or more, for example, 100% or more, preferably 200% or more, more preferably, 5 times or more, even more preferably, 10 times or more, most preferably, 20 times or more, for example, 50 times in relation to a cell or organism lacking a recombinant nucleic acid molecule of the invention.

The increase or rise can be determined by methods with which the element versed in the familiar technique.

Thus, the increase or elevation of the nucleic acid or the amount of protein can be determined, for example, by means of an immunological detection of the protein.

In addition, techniques such as protein analysis, fluorescence, hybridization | 10 Northern, nuclease protection analysis, reverse transcription (quantitative RT-PCR), ELISA (enzyme linked immunosorbent assay), Western blotting, radioimmunoassay (RIA) or other immunoassays and fluorescence activated cell analysis (FACS) can be used to measure a specific protein or RNA in a plant or plant cell.

Depending on the type of protein product induced, its activity or the effect on the organism or cell phenotype can also be determined.

Methods for | determine the amount of protein are known by the element versed in | technical.

Examples that can be mentioned are: the micro-Biuret method (Goa J (1953) Scand J Clin Lab Invest 5: 218-222), the Fo-lin-Ciocalteau method (Lowry OH et al. (1951) J Biol Chem 193: 265-275) or measure the absorption of CBB G-250 (Bradford MM (1976) Analyt Biochem 72: 248-254). As an example to quantify the activity of a protein, the detection of luciferase activity is described in the Examples below.

Expression: "Expression" refers to the biosynthesis of a product - genetic, preferably the transcription and / or translation of a nucleotide sequence, for example, an endogenous gene or a heterologous gene, in a cell.

For example, in the case of a structural gene, expression involves transcribing the structural gene into mRNA and - optionally - the translation

. 25 mMRNA in one or more polypeptides. In other cases, the expression may refer only to the transcription of the DNA that houses an RNA molecule.

Expression Construction: "Expression Construction" as used here means a DNA sequence capable of directing the expression of a particular nucleotide sequence in a suitable part of a plant or plant cell, which comprises a functional promoter in said part of a plant or plant cell into which it will be introduced, linked in a functional way to the nucleotide sequence of interest that is - optionally - linked in a functional way to termination signals. If translation is required, it also typically comprises sequences required for proper translation of the nucleotide sequence. The coding region can encode a protein of interest, but it can also encode a functional RNA of interest, for example, RNAa, siRNA, snoRNA, snRNA, microRNA, ta-siRNA - or any other non-coding regulatory RNA in the direction sense or antisense. The expression construct that comprises the nucleotide sequence of interest can be chimeric, indicating that one or more of its components is heterologous to one or more of its other components. The expression construct can also be one, which is - naturally occurring, but it was obtained in a recombinant form useful for heterologous expression. Typically, however, the expression construct is U heterologous to the host, that is, the particular DNA sequence of the expression construct does not occur naturally in the host cell and must be introduced into the host cell by a transformation event. The expression of the nucleotide sequence in the expression construct may be under the control of a seed-specific and / or seed-preferred promoter or an inducible promoter, which initiates transcription only when the host cell is exposed to any particular external stimulus. In the case of a

. 26 '| plant, the promoter can also be specific to a tissue or organ or | particular state of development. | Strange: The term "strange" refers to any molecule of | nucleic acid (eg, genetic sequence) that is introduced into a cell's genome by experimental manipulations and can include sequences found in that cell as long as the introduced sequence contains some modification (for example, a point mutation, the presence of a selectable marker gene , etc.) and is therefore distinguishable from the naturally occurring sequence.

Functional linkage: the term "functional linkage" or "functionally linked" should be understood as, for example, the sequential arrangement of a regulatory element (for example, a promoter) with a nucleic acid sequence that will be expressed and, if appropriate, additional regulatory elements (such as, for example, a terminator or a NEENA) so that each regulatory element can perform its intended function to allow, modify, facilitate or otherwise influence the expression of said nucleic acid sequence. As a synonym the word "operable link" or "operably linked" can be used. Expression may result depending on the disposition of the nucleic acid sequences in relation to sense or antisense RNA. For this, direct connection in the chemical sense is not B - necessarily required. Genetic control sequences, such as enhancer sequences, can also play their role on the target sequence from positions that are distant, or indeed from other DNA molecules. Preferred arrangements are those in which the sequence — nucleic acid that will be expressed recombinantly is positioned behind the sequence that acts as a promoter, so that the two sequences are covalently linked to each other. The distance between the promoter sequence and the nucleic acid sequence that Petition 870200133605, from 11/23 to

- 27 will be expressed recombinantly and is preferably less than 200 i base pairs, especially preferably less than 100 base pairs, most especially preferably less than 50 base pairs.

In a preferred embodiment, the nucleic acid sequence that will be transcribed is located behind the promoter so that the start of transcription is identical to the desired start of the chimeric RNA of the invention.

Functional binding, and an expression construct, can be generated through conventional recombination and cloning techniques, as described (for example, in Maniatis T, Fritsch EF and Sambrook J (1989) Molecular Cloning: À Laboratory Manual, 2nd Ed ., Cold Spring Harbor Laboratory, Cold Spring Harbor (NY); Silvey et al. (1984) Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor (NY); Ausubel et al. (1987) Current Protocols in Molecular Biology, Greene Publishing Assoc, and Wiley Interscience; Gelvin et al. (Eds) (1990) Plant Molecular Biology Manual; Kluwer Academic Publisher, Dordrecht, The Netherlands). However, additional sequences, which act, for example, as a linker with specific cleavage sites for restriction enzymes, or as a signal peptide, can also be positioned between the two sequences.

Sequence insertion can also result in the expression of fusion proteins.

Preferably, the expression construct, which consists of a linkage of a regulatory region, for example, a promoter and nucleic acid sequence that will be expressed, can present itself in a form integrated with the vector and be inserted into a plant genome, for example. example, by transformation.

Gene: The term "gene" refers to a region functionally linked to appropriate regulatory sequences capable of regulating the expression of the genetic product (for example, a polypeptide or a functional RNA) in some way.

A gene includes untranslated regulatory regions of DNA (for example, promoters, intensifiers, repressors, Petition 870200133605, 10/23/2020, pg, 45200 -!

. 28: etc.) that precede (upstream) and follow (downstream) the coding region (open reading frame, ORF) as well as, where applicable, strings | actors (ie introns) between the individual coding regions (ie exons). The term "structural gene" as used herein is intended to refer to a DNA sequence that is transcribed into mRNA which is then translated into an amino acid sequence characteristic of a specific polypeptide.

Genome and genomic DNA: The terms "genome" or "genomic DNA" are referring to the inheritable genetic information of a host organism. Said genomic DNA comprises the DNA of the nucleus (also referred to as chromosomal DNA), but also the DNA of plastids (for example, chloroplasts) and other cellular organelles (for example, mitochondria). Preferably, the terms genome or genomic DNA | refer to the chromosomal DNA of the nucleus. | Heterologist: The term "heterologous" in relation to a molecule of — nucleic acid or DNA refers to a nucleic acid molecule that is functionally linked, or is manipulated to become functionally linked, a second nucleic acid molecule to which one is not functionally linked in nature, or to which it is functionally linked in a different location in nature. A heterologous expression construct that comprises a nucleic acid molecule and one or more regulatory nucleic acid molecules (such as a promoter or a transcription termination signal) attached to it, for example, is a construction that originates from | experimental manipulations in which a) said nucleic acid molecule, or b) | said regulatory nucleic acid molecule or c) both (ie (a) and (b)) —not located in its natural (native) genetic environment or has been modified by experimental manipulations, an example of a modification is a substitution, addition , deletion, inversion or insertion of one or more nucleotide residues. The natural genetic environment refers to the chromosomal site

| : 29 I natural in the original organism, or the presence in a genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid molecule sequence is preferably maintained, at least in part. The environment flanks the nucleic acid sequence at least in one side and has a sequence of at least 50 bp, preferably at least 500 bp, especially preferably at least 1,000 bp, most especially preferably at least 5,000 bp, in height. A naturally occurring expression construct - for example - a naturally occurring combination of a promoter with the corresponding gene - becomes a transgenic expression construct when it is modified by unnatural, "artificial" synthetic methods such as, for example, mutagenization. Such methods have been described (US 5,565,350; WO 00/15815). For example, a protein that encodes the nucleic acid molecule functionally linked to a promoter, which is not the native promoter of that molecule, is considered to be heterologous to the promoter. Preferably, the heterologous DNA is not endogenous or not naturally associated with the cell in which it is introduced, but was obtained from another cell or was synthesized. Heterologous DNA also includes an endogenous DNA sequence, which contains some modification, is not naturally occurring, multiple copies of an endogenous DNA sequence, or a DNA sequence that is not naturally associated with another DNA sequence physically linked to that . Generally, though not necessarily, heterologous DNA encodes RNA or proteins that are not normally produced by the cell in which it is expressed.

High expression seed-specific and / or seed-preferred promoter: A "high expression seed-specific and / or seed-preferred promoter" as used herein means a promoter that causes seed-specific and / or seed-preferred expression in a plant or part of that Petition 870200133605, of 10/23/2020, pág. 47/1206 rs SS

«30: where the accumulation or rate of RNA synthesis or RNA stability derived from the nucleic acid molecule under the control of the respective promoter is preferably greater, significantly greater than the expression caused by the NEENA-free promoter of the invention.

Preferably, the amount of RNA and / or the rate of RNA synthesis and / or RNA stability is increased by 50% or more, for example, 100% or more, preferably 200% or more, more preferably, 5 times or more , even more preferably, 10 times or more, most preferably, 20 times or more, for example, 50 times with respect to a seed-specific and / or seed-preferred promoter lacking a NEENA of the invention.

Hybridization: The term "hybridization" as used herein includes "any process by which a strand of nucleic acid molecules attaches to a complementary strand through base pairing." (J.

Coombs (1994) Dictionary of Biotechnology, Stockton Press, New York). Hybridization and the intensity of hybridization (that is, the intensity of the association between the nucleic acid molecules) are impacted by such | factors such as the degree of complementarity between the nucleic acid molecules, the severity of the conditions involved, the Tm of the hybrid formed, and the | G: C ratio within nucleic acid molecules.

As used here, the term | "Tm" is used in reference to the "melting temperature." The melting temperature | 'is the temperature at which half of a population of double-stranded nucleic acid molecules becomes dissociated into single strands.

The equation | to calculate the Tm of nucleic acid molecules is well known in | technical.

As indicated by standard references, a simple estimate of the —valordeTm can be calculated by the equation: Tm = 81.5 + 0.41 (% G + C), when a nucleic acid molecule is in an aqueous solution in 1 M NaCl [ see, for example, Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985)]. Other references include computations | Petition 870200133605, dated 10/23/0020. page A8 / 206ua — CC «-— p ——." “——

. 31: more sophisticated, which take structural as well as sequential characteristics into account for the calculation of Tm. Severe conditions are known for elements skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6.3.1 -6.3.6.

"Identity": "Identity" when used in relation to the comparison of two or more nucleic acid or amino acid molecules means that the sequences of said molecules share a certain degree of sequence similarity, the sequences being partially identical.

To determine the percentage of identity (homology is used interchangeably here) of two amino acid sequences or two nucleic acid molecules, the sequences are written under each other for optimal comparison (for example, gaps can be inserted in the sequence of a protein or nucleic acid to generate optimal alignment with the other protein or other nucleic acid).

The amino acid residues or nucleic acid molecules at the corresponding amino acid positions or nucleotide positions are then compared. If a position in one sequence is occupied by the same amino acid residue or the same nucleic acid molecule as the corresponding position in the other sequence, the molecules are homologous in that position (i.e., amino acid or nucleic acid "homology" as used herein context corresponds to the "identity" of amino acid or nucleic acid). The percentage of homology between the two sequences is a function of the number of identical positions shared by the sequences (ie% homology = number of identical positions / total number of positions x 100). The terms "homology" and "identity" are thus considered synonymous.

For the determination of the identity percentage of two or Petition 870200133605, of 10/23/2020, TATA ——— J sssssssss.—

| . 32 On. more amino acids or two or more nucleotide sequences, several computer software programs have been developed.

The identity of two or more strings can be calculated with, for example, the fasta software, which was currently used in the fasta 3 (W.

R.

Pearson and D.

J. — Lipman, PNAS 85, 2444 (1988); W.

R.

Pearson, Methods in Enzymology 183, 63 (1990); W.

R.

Pearson and D.

J.

Lipman, PNAS 85, 2444 (1988); W.

R.

Pearson, Enzymology 183, 63 (1990)). Another useful program for calculating identities of different sequences is the standard blast program, which is included in the Biomax pedant software (Biomax, Munich, Federal Republic of Germany). This sometimes unfortunately results in suboptimal results since blast does not always include complete strings of the subject and the query.

However, since this program is very efficient, it can be used for comparison | a large number of sequences.

The following settings are typically used for such string comparisons: -p Program Name [String]; -d Database [String], default = nr; -i Consultation File [File In); default = stdin; -e Expected value (E) [Real]; standard = 10.0; - m alignment display options: O = in pairs; 1 = anchored query showing identities; 2 = anchored consultation without identities; 3 = exact query anchored, shows identities; 4 = exact query anchored, without identities; 5 = anchored consultation without identities and blind ends; 6 = exact consultation anchored, without identities and blind ends; 7 = XML Blast output; 8 = tabular; 9 tabular with comment lines [Integer]; default = O; -The BLAST Output File [File Out] report Optional; default = stdout; -F filter query string (DUST with blastn, SEG with others) [String]; default = T; -G Cost to open a gap (zero invokes default behavior) [Integer]; default = 0; -E Cost to extend a gap (zero invokes standard behavior) [Integer]; default = 0; -X X delivery value for alignment with gaps (in bits) (zero invokes standard behavior); | Petition 870200133605, of 23/10/2020, DáI. 50/0206 ——— Rw "? '. Sscqsc.s ss ss .-. Sssa

. 33. blastn 30, megablast 20, tblastx O, all other 15 flnteger]; default = O; - | Shows GI's in deflines [T / F], default = F; - q Penalty for a nucleotide mismatch (blastn only) [Integer]; default = -3; -r Reward for nucleotide compatibility (blastn only) [Integer]; default = 1; -vNumber of database strings to show one-line descriptions for (V) [Integer]; standard = 500; -b Number of database strings to show the alignments of (B) [Integer]; standard = 250; -f Limit to extend the hits, default if zero; blast 11, blastn O, blastx 12, tblastn 13; tblastx 13, megablast O [Integer]; default = O; -g Perform alignment with gaps (not available with tblastx) [T / F]; default = T; -Q Genetic code of the Consultation to use [Integer]; default = 1; -D DB Genetic code (for tblastinx] only) [Integer]; default = 1; -a Number of processors to use [Integer]; default = 1; -The SegAlign file [File Out] Optional; -J Believe in the consultation defline [T / F]; default = F; -M Matrix [String] standard = BLOSUM62; -W Word size, standard if zero (blastn 11, megablast 28, all other 3) [Integer]; default = 0; -z Effective length of the database (use zero for the actual size) [Real]; default = O; -K Number of best hits from a region to keep (out by default, if using a value of 100 is recommended) [Integer]; default = O; -P O for multiple hits, 1 for single hit [Integer]; default = 0; -Y Effective length of the search space (use zero for the actual size) [Real]; default = 0; -S Query strings for searching against databases (for blastínx], and tblastx); 3 is both, 1 is superior, 2 is inferior [Integer]; default = 3; - T Produce HTML output [T / F]; default = F; - | Restrict database search to Gl's [String] list Optional; -U Use FASTA sequence lower case filtering [T / F] Optional; default = F; -y X delivery value for extensions without gaps in bits (0.0 invokes the default behavior); blastn 20, megablast 10, all others 7 [Real]; default = 0.0; -Z X delivery value

. 34. for alignment with final gaps in (0.0 invokes standard behavior); blastn / megablast 50, tblastx O, all others 25 [Integer]; default = O; -R PSI- TBLASTN checkpoint file [File In) Optional; -n search for MegaBlast [T / F]; default = F; -L Location in the query string [String] Optional; -A Multi-hit window size, default if zero (blastn / megablast 0, all other 40 [Integer]; default = 0; -w Frame shift penalty (OOF algorithm for blastx) [Integer]; default = O ; + Length of the largest intron allowed in tblastn to connect HSPs (O disables the connection) [Integer]; default = O.

High quality results are obtained using the Needleman and Wunsch or Smith and Waterman algorithms.

Therefore, programs based on said algorithms are preferred.

Advantageously, sequence comparisons can be made with the PileUp program (J.

Mol.

Evolution., 25, 351 (1987), Higgins et al., CABIOS 5, 151 (1989)) or, preferably, with the programs "Gap" and "Needle", which are based on the algorithms of Needleman and Wunsch (J .

Mol.

Biol. 48; 443 (1970)), and "BestFit", which is based on the algorithm of Smith and Waterman (Adv.

Appl.

Math. two; 482 (1981)). "Gap" and "BestFit" are part of the GCG software package (Genetics Computer Group, | 575 Science Drive, Madison, Wisconsin, USA 5371 1 (1991); Altschul et al, | 20 - (Nucleic Acids Res. 25, 3389 (1997)), "Needle" is part of the European Molecular | Biology Open Software Suite (EMBOSS) (Trends in Genetics 16 (6), 276 | (2000)). Therefore, preferably, calculations to determine the percentages | of sequence homology are done with the "Gap" or "Needile" programs over the total range of the sequences.

The following standard settings for comparing nucleic acid sequences were used for "Needle": | matrix: EDNAFULL, Gap penalty: 10.0, Extend penalty: 0.5. The following standard settings for the comparison of nucleic acid sequences were used for "Gap": gap weight: 50, weight-length: 3, compatibility

. 35 average: 10,000, average incompatibility: 0.000. For example, a sequence, which is said to have 80% identity to the sequence SEQ ID NO: 1 at the nucleic acid level is understood to indicate a sequence which, upon comparison with | 5 - sequence represented by SEQ ID NO: 1 by the above program "Needle" with the parameter adjusted above, it has 80% identity.

Preferably, homology is calculated over the full length of the query string, for example SEQ ID NO: 1. Intron: refers to sections of DNA (intervening sequences) within a gene that does not encode part of the protein that the gene produces, and that is bound outside the MRNA that is transcribed from the gene before being exported from the cell nucleus.

Intron sequence refers to the nucleic acid sequence of an intron.

Thus, introns are those regions of DNA sequences that are transcribed together with the coding sequence (exons), but are removed during the formation of mature mRNA.

Introns can be positioned within the actual coding region or on untranslated 5 'or 3' pre-mRNA (unbound mRNA) leads. The introns in the primary transcription are cut and the coding sequences are simultaneously and precisely linked to form the mature MRNA.

The junctions of introns and exons form the braiding site.

The sequence of an intron starts with GU and ends with AG.

In addition, in plants, two examples of AU-AC introns have been described: the fourteenth intron of the protein gene similar to RecA and the seventeenth intron of the G5 gene of Arabidopsis thaliana are the AT-AC introns.

Pre-mRNAs that contain introns have three short sequences that are in addition to other sequences - essential for the intron that will be precisely braided.

These sequences are the 5 'plaiting site, the 3' plaiting site, and the branching point.

MRNA braiding is the removal of intervening sequences (introns)

present in primary mMRNA transcripts and junction or ligation of exon sequences. This is also known as cis braiding which | joins two exons in the same RNA with the removal of the intervening sequence (intron). The functional elements of an intron comprise the sequences - which are identified and linked by the specific protein components of the | spliceossoma (for example, braiding consensus sequences at the ends of introns). The interaction of functional elements with | spliceossoma results in the removal of the intron sequence from the premature MRNA and the reunion of exon sequences. Introns have three short strings that are essential - although not enough - for the intron that will be precisely braided. These sequences are the 5 'plaiting site, the 3' plaiting site and the branching point.

The sequence of branching points is important in braiding and selecting braiding sites in plants. The sequence of branch points is generally located 10 to 60 nucleotides upstream of the 3 'plaiting site.

Isogenic: organisms (eg plants) that are | genetically identical, except that they may differ by | presence or absence of a heterologous DNA sequence. | Isolated: The term "isolated" as used here means that a material has been removed manually and is separated from its original native environment and is therefore not a product of nature. An isolated material or molecule (such as a DNA molecule or enzyme) may present itself in a purified form or may present itself in a non-native environment such as | example, in a transgenic host cell. Per. For example, a naturally occurring polynucleotide or polypeptide present in a living plant is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the materials coexisting in the natural system, is isolated. Such

. 37 polynucleotides may be part of a vector and / or such polynucleotides or.

polypeptides could be part of a composition, and could be isolated, as such a vector or composition is not part of its original environment. Preferably, the term "isolated" when used in relation to a nucleic acid molecule, as in "an isolated nucleic acid sequence" refers to a nucleic acid sequence that is identified and separated from at least one nucleic acid molecule contaminant with which it is usually associated in its natural source. The isolated nucleic acid molecule is the nucleic acid molecule present in a form or configuration that is different from that found in nature. In contrast, non-isolated nucleic acid molecules are nucleic acid molecules such as DNA and RNA, which are found in the state they present in nature. For example, a given DNA sequence (for example, a gene) is | found on the host cell's chromosome in proximity to adjacent genes; RNA sequences, such as a specific mMRNA sequence that encodes a specific protein, are found in the cell as a mixture with numerous other mMRNAs, which encode a large amount of proteins. However, an isolated nucleic acid sequence comprising, for example, SEQ ID NO: 1 includes, by way of example, such nucleic acid sequences in cells that generally contain SEQ ID NO: 1 where the nucleic acid sequence is at a chromosomal or extrachromosomal site other than that of natural cells, it is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid sequence can be present in the form of single or double stranded. When an isolated nucleic acid sequence is used to express a protein, the nucleic acid sequence will contain at least at least a portion of the sense or coding strand (i.e., the nucleic acid sequence may be stranded

. 38. simple). Alternatively, it can contain both sense and antisense strands (that is, the nucleic acid sequence can be double-stranded). Minimum Promoter: the promoter elements, particularly a TATA element, which are inactive or have very little promoter activity in the absence of upstream activation.

In the presence of an appropriate transcription factor, the minimal promoter works to allow for transcription.

NEENA: see "Nucleic acid that increases nucleic acid expression". Non-coding: The term "non-coding" refers to sequences of | nucleic acid molecules that do not encode part or all of an express protein.

Non-coding sequences include, but are not limited to, introns, enhancers, promoter regions, 3 'untranslated regions, and 5' untranslated regions. | Nucleic acid that increases nucleic acid expression (NEENA): The term "nucleic acid that increases nucleic acid expression" refers to a sequence and / or a nucleic acid molecule of a specific sequence that has the intrinsic property to increase the expression of a nucleic acid under the control of a promoter to which —NEENA is functionally linked.

Unlike the promoter sequences, - NEENA as such is not capable of conducting expression.

To perform the "function of increasing the expression of a nucleic acid molecule functionally linked to NEENA, NEENA itself must be functionally linked to a promoter.

Unlike the enhancer sequences known in the art, —NEENA is acting on cis, but not on trans and must be located close to the nucleic acid transcription start site that will be expressed.

Nucleic acids and nucleotides: The terms "Nucleic acids" and "Nucleotides" refer to occurring nucleic acids or nucleotides |

. 39. natural or synthetic or artificial. The terms "nucleic acids" "and" nucleotides "include deoxyribonucleotides or ribonucleotides or any nucleotide analog and polymers or hybrids thereof in the sense or antisense single or double strand.

Except where otherwise noted, a particular nucleic acid sequence also implicitly includes conservatively modified variants of it (for example, degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. The term "nucleic acid" is used interchangeably here with the "gene", "cDNA," mRNA "," "oligonucleotide," and "polynucleotide". Nucleotide analogs include nucleotides that have changes in the chemical structure of the base, sugar and / or phosphate, including, but not limited to, changes in pyrimidine in position 5, changes in purine in position 8, changes in exocyclic amines of cytosine, substitution of 5-bromo-uracil, and the like; and changes in sugar in position 2 ', including, but not limited to, ribonucleotides with modified sugar in which 2'-OH is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN. Short-clip RNAs (ShRNAs) may also comprise unnatural elements such as unnatural bases, for example, ionosine and xanthine, unnatural sugars, Ú for example, 2'-methoxy ribose, or non-phosphodiester bonds for example, methylphosphonates, phosphorothioates and peptides.

Nucleic acid sequence: the phrase "nucleic acid sequence" refers to a single or double-base polymer of deoxyribonucleotide or ribonucleotide read from the 5 'to the 3' end. This includes chromosomal DNA, self-replicating plasmids, infectious polymers of DNA or RNA and DNA or RNA that performs an essentially structural function. "Nucleic acid sequence" also refers to

THE REOAO EAEEAR AAA AAA AA EE AE AA AA EA AA AA A E E AE EE E A E E E E AA AA AA AAEEEi3o create â E AO çõk | CçççççsSS SRS FEI the JD EEE IDP EDP E o o o o a. 40 '

: a consecutive list of abbreviations, letters, characters or words, which represent nucleotides.

In one embodiment, a nucleic acid can be a "probe" which is a relatively short nucleic acid, generally less than 100 nucleotides in length.

Generally, an acid probe

—Nucleic is about 50 nucleotides in length to about 10 nucleotides in length.

A "target region" of a nucleic acid is a portion of a nucleic acid that is identified to be of interest.

A "coding region" for a nucleic acid is the portion of the nucleic acid, which is transcribed and translated in a sequence-specific manner for production into a particular polypeptide or protein when placed under the control of appropriate regulatory sequences.

The coding region is considered to encode such a polypeptide or protein.

Oligonucleotide: The term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or —deoxyribonucleic acid (DNA) or mimetics thereof, as well as oligonucleotides that have non-naturally occurring portions that work in a similar way.

Such modified or substituted oligonucleotides are generally | preferred over native forms due to desired properties such as, for example, increased cell absorption, increased affinity for target nucleic acid and increased stability in the presence of nucleases.

An oligonucleotide preferably includes two or more nucleomonomers | covalently coupled to each other by bonds (e.g., phosphodiesters) or substitute bonds.

Bounce: A "bounce" is a relatively short, single-stranded nucleotide sequence at the 5'- or 3'-hydroxyl end of a double-stranded oligonucleotide molecule (also referred to as an "extension", "protruding end", or "end" sticky "). Plant: it is generally understood as any organism Petition 870200133605, dated 10/23/2020, pógoB58 / 206 rcÔÔCCCEEccc—— .s —————————

. 41 uni or multicellular eukaryotic or a cell, tissue, organ, part or material; propagation (such as seeds or fruits) of the one who is able to perform photosynthesis.

For the purpose of the invention, all genera and species of upper and lower plants of the Vegetal Kingdom are included.

Perennial, monocotyledonous and dicotyledonous plants are preferred.

The term includes mature plants, seed, shoots and seedlings and their derived parts, propagating material (such as seeds or microspores), plant organs, tissue, protoplasts, callus and other cultures, for example, cell cultures, and any other type of grouping of plant cells to provide functional or structural units.

Mature plants refer to plants at any desired stage of development other than that of seedling.

Muda refers to a young immature plant at an early stage of development.

Biennial monocotyledonous and dicotyledonous plants are preferred host organisms for the generation of transgenic plants.

The expression of genes is, in addition, advantageous in all ornamental plants, useful or ornamental trees, flowers, cut flowers, shrubs or grasses.

The plants that can be mentioned as an example, but without an imitative character, are angiosperms, bryophytes such as, for example, Hepaticae (hepatic) and Musci (moss); Pteridophytes such as ferns, mackerel and club mosses; gymnosperms such as conifers, cicadaceae, ginkgo and Gnetatae; algae like Chlorophyceae, Phaeophpyceae, Rhodophyceae, Myxophyceae, —Xanthophyceae, Bacillariophyceae - (diatoms) and Euglenophyceae.

The preferred plants used for food purposes such as Legume families are peas, alfalfa and soybeans; —Grasses such as rice, corn, wheat, barley, sorghum, millet, rye, triticale, or oats; the Umbelliferae family, especially the genus Daucus, very 'especially the species carota (carrot) and Apium, very especially the | Graveolens dulce (celery) and many others; the Solanaceae family, Petition 870200133605, of 23/10/2070, DSJF5INUS mw, Ú —— c «—ac <-» ccCc —- CCJqcípubux — ssme — ep — p »——

especially the genus Lycopersicon, very especially the species esculentum (tomato) and the genus Solanum, very especially the species tuberosum (potato) and melongena (eggplant), and many others (such as tobacco); and the Capsicum genus, especially the annuum species (peppers) and many others; the Legume family, especially the genus Glycine, most especially the max species (soy), alfalfa, peas, lucerne, beans or peanuts and many others; and the family of Cruciferae (Brassicacae), especially the genus Brassica, very especially the species napus (oilseed rape), campestris (beet), oleracea cv Tastie (cabbage), oleracea cv Snowball Y (cauliflower) and oleracea cv Emperor ( broccoli); and the Arabidopsis genus, especially the Thaliana species and many others; the Compositae family, especially the Lactuca genus, especially the sativa species (lettuce) and many others; the Asteraceae family such as sunflower, Tagetes, lettuce or Calendula and many others; the Cucurbitaceae family like melon, pumpkin or zucchini, and flax seed. Additionally preferred are cotton, sugar cane, hemp, flax, peppers, and various trees, species of walnut and wine.

Polypeptide: The terms "polypeptide", "peptide", "oligopeptide", "polypeptide", "genetic product", "expression product" and "protein" are used interchangeably here to refer to a polymer or oligomer of residues consecutive amino acids.

Pre-protein: Protein, which is normally directed to a cellular organelle, such as a chloroplast, and further comprises its transit peptide.

Primary transcription: The term "primary transcription" as used here refers to a premature RNA transcription of a gene. A "primary transcript," for example, further comprises introns and / or does not yet comprise a polyA tail or buffer structure and / or is neo o o to Ú. 43 | . without other modifications necessary for the correct function such as transcription, for example, trimming or correction.

Promoter: The terms "promoter", or "promoter sequence" are equivalent and as used here, refer to a DNA sequence that - when linked to a nucleotide sequence of interest is able to control the transcription of the nucleotide sequence of interest in RNA.

Such promoters can be found, for example, in the following public databases http://www.grassius.org/grasspromdb.html, http://mendel.cs.rhul.ac.uk/mendel .php? Topic = plantprom , http://ppdb.gene.nagoya-u.ac.jp/cgi- bin / index.cgi.

Related promoters can be addressed with the methods of the invention and are included here for reference.

A promoter is located 5 '(that is, upstream), close to the transcriptional start site of a nucleotide sequence of interest whose mRNA transcription is controlled, and provides a site for specific binding by RNA polymerase and other transcription factors for initiation of transcription.

Said promoter comprises, for example, at least 10 kb, for example, 5 kb or 2 kb close to the transcription start site.

This can also comprise at least 1500 bp close to the transcriptional start site, preferably at least 1000 bp, more preferably, at “minus 500 bp, even more preferably, at least 400 bp, at least 300 bp, at least 200 bp or at least 100. bp.

In an additional preferred embodiment, the promoter comprises at least 50 bp close to the transcription start site, for example, at least 25 bp.

The promoter does not comprise exon and / or intron regions or 5 'untranslated regions. The promoter can be, for example, heterologous or homologous to the respective plant.

A polynucleotide sequence is "heterologous to" an organism or a second polynucleotide sequence if it originates from a foreign species, or if it is from the same species, it is modified from its original form.

For example, a

. 44 y promoter functionally linked to a heterologous coding sequence refers to a coding sequence of a different species from that from which the promoter was derived, or, if it is of the same species, a coding sequence that is not naturally associated with the promoter (for example, a genetically engineered coding sequence or an allele of a different ecotype or variety). Suitable promoters can be derived from genes in the host cells where expression is to occur or from pathogens for those host cells (for example, plants or plant pathogens such as plant viruses). A plant-specific promoter is a promoter suitable for regulating expression in a plant.

This can be derived from a plant, but also from plant pathogens or this can be a synthetic promoter designed by man.

If a promoter is a | inducible promoter, then the rate of transcription increases in response to an inducing agent.

Also, the promoter can be regulated in a tissue specific manner or preferred tissue so that it is just or | predominantly active to transcribe the associated coding region | in a specific type (s) of tissue such as leaves, roots or meristem.

The term "tissue specific" as it applies to a promoter refers to a promoter | which is capable of directing the selective expression of a nucleotide sequence of interest to a specific type of tissue (eg, petals) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue (eg , roots). The tissue specificity of a promoter can be assessed, for example, by functionally linking a reporter gene to the promoter sequence to generate a reporter construct, introducing the reporter construct into the genome of a plant so that the reporter construct is integrated into each tissue from the resulting transgenic plant, and detecting the expression of the reporter gene (for example, detecting MRNA, protein, or the activity of a protein encoded by the reporter gene)

. 45 i in tissues other than the transgenic plant.

The detection of a higher level of expression of the reporter gene in one or more tissues in relation to the level of expression of the reporter gene in other tissues shows that the promoter is specific to the tissues where higher levels of expression are detected.

The term "specific cell type" as applied to a promoter refers to a promoter, which is capable of directing the selective expression of a nucleotide sequence of interest in a specific cell type in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue.

The term "specific cell type" when applied to a promoter also means a promoter capable of promoting the selective expression of a nucleotide sequence of interest in a region within a single tissue.

The cell type specificity of a promoter can be assessed using methods well known in the art, for example, staining GUS activity, protein staining or immunohistochemistry.

The term "constitutive" when determined in reference to a promoter or expression derived from a promoter means that the promoter is capable of directing the transcription of a nucleic acid molecule that is functionally linked in the absence of a stimulus (for example, thermal shock) , chemicals, light, etc.) in most plant tissues and cells over substantially the lifetime of a plant or part of a plant.

Typically, seed-specific and / or seed-preferred promoters | they are able to direct the expression of a transgene in substantially any cell and any tissue.

Promoter specificity: The term "specificity" when referring to a promoter means the standard of expression conferred by the respective promoter.

The specificity describes the tissues and / or the state of development of a plant or part of it, in which the promoter is only conferring the expression of the nucleic acid molecule under the control of the

. 46 y respective promoter. The specificity of a promoter may also include environmental conditions, under which the promoter may be activated or under-regulated, such as induction or repression by biological or environmental stresses such as cold, dryness, wounds or infection.

Purified: As used here, the term "purified" refers to molecules, nucleic acid or amino acid sequences that are removed from their natural environment, isolated or separated. The "substantially purified" molecules are at least 60% free, preferably at least 75% free, and more preferably, at least 90% free from other components with | 10 which these are naturally associated. A purified nucleic acid sequence can be an isolated nucleic acid sequence.

Recombinant: The term "recombinant" in relation to nucleic acid molecules refers to nucleic acid molecules produced by recombinant DNA techniques. Recombinant nucleic acid molecules can also comprise molecules, which as such do not exist in nature, but are modified, altered, modified or otherwise manipulated by man. Preferably, a "recombinant nucleic acid molecule" is a non-naturally occurring nucleic acid molecule | which differs in sequence from a naturally occurring nucleic acid molecule by at least one nucleic acid. A "recombinant nucleic acid molecule" can also comprise a "recombinant construct" which preferably comprises a sequence operably linked to | non-naturally occurring nucleic acid molecules in that order. Preferred methods for producing said recombinant nucleic acid molecule may comprise cloning techniques, targeted mutagenesis | or non-directed, synthesis or recombination techniques.

"Seed-specific promoter" ”in the context of this invention means a promoter that is regulating the transcription of a | Petition 8702001323605, of 10/22/2020, page 64 / 20G ——— C «—paosscd = ssssqsqWLuscs =.-.—

V nucleic acid under the control of the respective promoter in seeds in which transcription in any tissue or seed cell contributes more than 90%, preferably more than 95%, more preferably, more than 99% of the total amount of RNA transcribed from said nucleic acid sequence in all plants during any stage of development.

The term | "seed-specific expression" and "seed-specific NEENA" must be understood accordingly.

So, a "seed-specific NEENA" increases the transcription of a seed-specific or seed-preferred promoter so that the transcription in seeds derived from said promoter functionally linked to the respective NEENA contributes more than 90%, preferably more 95%, more preferably, more than 99% of the total amount of RNA transcribed from the respective promoter functionally linked to a NEENA and the entire plant during any stage of development. "Seed-preferred promoter" in the context of this invention means a promoter that is regulating the transcription of a nucleic acid molecule under the control of the respective promoter in seeds in which transcription in any tissue or seed cell contributes more than 50% preferably more than 70%, more preferably more than 80% of the total amount of RNA transcribed from said nucleic acid sequence

- throughout the plant during any stage of development.

The terms = | "preferred-seed expression" and "preferred-seed NEENA" must be understood accordingly.

Then, a "seed-preferred NEENA" increases the transcription of a seed-specific or seed-preferred promoter so that the transcription in seeds derived from said promoter functionally linked to the respective NEENA contributes more than 50%, preferably more more than 70%, more preferably, more than 80% of the total amount of RNA transcribed from the respective promoter

. 48. functionally linked to a NEENA throughout the plant during any stage of development.

Sense: The term "sense" is understood to refer to a nucleic acid molecule that has a sequence that is complementary or identical to a target sequence, for example, a sequence that binds to a protein transcription factor and that is involved in the expression of a particular gene. According to a preferred embodiment, the nucleic acid molecule comprises a gene of interest and elements that allow for | expression of said gene of interest.

Significant increase or decrease: An increase or decrease, for example, in enzyme activity or gene expression, which is greater than the margin of error inherent in the measurement technique, preferably an increase or decrease of about 2 times or more of the control or expression enzyme activity in the control cell, more preferably, an increase or decrease of about 5 times more, and most preferably, an increase or decrease of about 10 times or more.

Small molecules of nucleic acid: "small molecules of nucleic acid" are understood to be molecules consisting of nucleic acids or derivatives thereof such as RNA or DNA. These can be double or single chain and are between about 15 and about 30 bp, for example, - .. between 15 and 30 bp, more preferably, between about 19 and about 26 bp, for example, between 19 and 26 bp, more preferably between about 20 and about 25 bp, for example, between 20 and 25 bp. In an especially preferred embodiment, the oligonucleotides are between about 21 and about 24 bp, for example, between 21 and 24 bp. In a more preferred embodiment, the small nucleic acid molecules are about 21 bp and about 24 bp, for example, 21 bp and 24 bp.

Substantially complementary: In its broadest sense, the term "substantially complementary" when used here in relation to a] nucleotide sequence in relation to a reference reference or target nucleotide sequence, means a nucleotide sequence that has a percentage of identity between the substantially complementary nucleotide sequence and the exact complementary sequence of said reference or target nucleotide sequence of at least 60%, more desirably, at least 70%, more desirably, at least 80% or 85%, preferably at least 90% , more preferably, at least 93%, even more preferably, at least 95% or 96%, even more preferably, at least 97% or 98%, even more preferably, at least 99% or most preferably, 100% (the latter being equivalent to the term "identical" in this context). Preferably, identity is assessed over a length of at least 19 nucleotides, preferably at least 50 nucleotides, more preferably, the total length of the nucleic acid sequence up to said reference sequence (if not specified elsewhere) below). Sequence comparisons are performed using standard GAP analysis with GCG from University of Wisconsin, SEQWEB application of GAP, based on the algorithm of Needleman and Wunsch (Needleman and Wunsch (1970) J Mol.

Biol. 48: 443-453; as defined above). A nucleotide sequence "substantially complementary" to a reference nucleotide sequence. hybridizes to the reference nucleotide sequence under conditions of low severity, preferably conditions of medium severity, most preferably, conditions of high severity (as defined above). Transgene: The term "transgene" as used here refers to - any nucleic acid sequence, which is introduced into a cell's genome by experimental manipulations.

A transgene can be an "endogenous DNA sequence", or a "heterologous DNA sequence" (ie "foreign DNA"). The term "endogenous DNA sequence" refers to a

. 50, nucleotide sequence, which is naturally found in the cell into which it is introduced as long as it does not contain modification (for example, a point mutation, the presence of a selectable marker gene, etc.) relative to the naturally occurring sequence. Transgenic: The term transgenic when referring to a | organism means preferably transformed, stably transformed, with a recombinant DNA molecule which preferably comprises a suitable promoter functionally linked to a DNA sequence of interest.

Vector: As used here, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it is attached. One type of vector is an integrated genomic vector, or "integrated vector", which can become integrated into the host cell's chromosomal DNA. Another type of vector is an episomal vector, that is, a molecule — nucleic acid capable of extrachromosomal replication. Vectors capable of directing the expression of genes to which they are functionally linked are referred to here as "expression vectors". In this specification, "plasmid" and "vector" are used interchangeably, except where otherwise stated in context. Expression vectors designed to produce RNAs as described here in vitro or in vivo can contain V p - sequences identified by any RNA polymerase, including mitochondrial RNA polymerase, pol | RNA, pol RNA, and RNA pol Ill. These vectors can be used to transcribe the desired RNA molecule into the cell according to that invention. A plant transformation vector will be understood - as a suitable vector in the plant transformation process.

Wild type: The term "wild type", "natural" or "natural origin" means in relation to an organism, polypeptide, or nucleic acid sequence, that said organism is naturally occurring or available in

. 51 i at least one naturally occurring organism that is not altered, modified or otherwise manipulated by man. '| EXAMPLES | Common chemicals and methods Except where otherwise noted, cloning procedures performed for the purposes of the present invention including | restriction enzyme digestion, agarose gel electrophoresis, purification | nucleic acid binding, nucleic acid binding, transformation, selection and | cultivation of bacterial cells were performed as described (Sambrook et al., | 1989). Recombinant DNA sequence analysis was performed with a laser fluorescence DNA sequencer (Applied Biosystems, Foster City, CA, USA) using Sanger's technology (Sanger et al., 1977). Except where otherwise noted, chemicals and reagents were obtained from Sigma Aldrich (Sigma Aldrich, St. Louis, USA), Promega (Madison, WI, USA), Shower (Haarlem, The Netherlands) or Invitrogen (Carilsbad, CAUSE). Restriction endonucleases were obtained from New England Biolabs (IPpswichh MA, USA) or Roche Diagnostiss GmbH (Penzberg, Germany). The oligonucleotides were synthesized by Eurofins MWG Operon (Ebersberg, Germany). Example 1: Identification of Nucleic Acid candidates that - increase Nucleic Acid Expression (NEENA) from genes with seed-specific and / or seed-preferred expression

1.1 Identification of NEENA molecules from A. thaliana genes Using publicly available genomic DNA sequences (for example, http: // www. Ncbi.nlm.nih.gov/genomes/PLANTS/PlantList.html) and expression data transcript (for example, http: // www. weigelworld.org/resources/microarray/AtGenExpress/), a set

. 52 'of 19 candidates for NEENA which is derived from Arabidopsis thaliana transcripts with seed-specific and / or seed-preferred expression was selected for detailed analysis. The candidates were named | as shown below: TABLE 1: CANDIDATES TO SEED-SPECIFIC NEENA (NEENAss). Location Name Observation SEQ

NEENA ID

NO NEENAss1 Atig62290 Protein from the aspartyl protease family NEENAss15 At2g27040 Protein containing the PEACE domain NEENAssS18 Atlig01170 Protein related to ozone-4 responsive, putative F INEENAss14 JAt5g63190 Protein containing the MA3 Po domain NEENAssS4 At5g07830 Hydrogen-containing gaseous domain similar to betaglucuronidase AtGUS2 NEENAss13 AAt2g904520 Eukaryotic translation initiation factor 1A, putative / elF-1A NEENAss3 At5g60760 Related to 2-phosphoglycerate kinase AND NEENAssS5 JAtlg11170 Express protein contains profile Pfam PL050E4E4 (homologous to the activating protein11 Heme (yeast) 5B) NEENAss16 JAtig54100 Aldehyde —dehydrogenase, putative 12 lantiquitin NEENAsS9 At3gi12670 synthase CTP, putative / UTP —ammonia3 ligase, putative NEENAss20 JAt4g04460 | resistance to Arabidopsis thaliana multidrug 5) Petition 870200133605, from 11/23 to

. 53 Place name Note SEQ. NEENA ID

NO NEENAss6 JAtag41070 leucinal6 zipper transcription factor | basic (BZIP12) 'NEENAss12 JAtigo05450 Related to the proteasel7 inhibitor seed / lipid transfer protein (LTP) storage NEENAss7 JAt4g03050 dioxigenase dependent on 2 bxoglutarate, putative (AOP3) NEENAss17 At3g12490 Cysteine inhibitor / cysteine protease 19

1.2 Isolation of NEENA candidates Genomic DNA was extracted from A. thaliana green tissue using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Genomic DNA fragments containing the putative NEENA molecules were isolated by conventional polymerase chain reaction (PCR). The primers were designed based on the genomic sequence of A. thaliana with a large number of candidates for NEENA. The reaction comprised 19 sets of primers (Table 2) and followed the protocol described by Phusion High Fidelity DNA Polymerase (Cat No F-540L, New England Biolabs, Ipswich, MA, USA). Isolated DNA was used as the model DNA in a PCR amplification using the following primers: TABLE 2: STARTING SEQUENCES Initiator name Sequence Yield: PCR step

SEQ ID

NO NEENAss1 aataatggtacctagtgcttaaacactctagtgagt 20 is NEENAss1 1 rev aataatccatggtttgacctacaaaatcaaageagtea - 21 NEENAss2 is ttttggtaccagttetttactttogaagttae NEENAss2 P2 rev ttttecatggtactacgtactatttteaattct 23 NEENAss3 aaaaaaggtaccatttecacacgctttetateattte R4 is NEENAss3 rev aaaaaaccatggttatctetetetaaaaaataaaaacgaat25 NEENAss4 is well aataaaggtacegtecagaattttetecatiga BR 870 200 133 605 Application, the 10/23/2020, paddle

. 54. PCR ID

NO SEQID

NO NEENASSA rev. - pataaacoalggtocaciatocanaettva - 7 NEENAss5 is tttttgagtaccgtetacttteattacagtgacteta PR 9 NEENASS rev - mccstggistatitacgeancacaateas ROM NEENAss6 rev ttatccatgagttatgtagectttacacagaaaacaa 31 NEENAss7 rev atataccatggttatcttactgatttttaaccaaaaaataaaat 33 NEENAss8 rev ttccatggtactaagctatctetattaatataaaattg B5 INEENAss9 is ttggtaccatttttattggtaaaaggtaga BB 13 NEENASSA rev - Rmtaccaaacamaicatta Air NEENAss10 is atattggtacctctagggaaatategattttgatct BB NS NeENASSTO re - ataacostgaticaeeaeatczaadão RO NEENAss11 is atggtaccgcacaatcttagcttaccttgaa 40 1st NSENASS A Zret - acc aatamccacasgeetgato NEENAss12 for ttttaggtacctgteggagaagtaggeg 42 7 tatggtacctagettaateteagattiegaategt | NEENAss13 rev atccatggtagtatctacataccaatcatacaaatg 45 NsENAss 4 rev imecatagicacacaanancãaceata AZ INEENAss14 rev ttccatggtctacaacattaaaacgaccatta 47 NsENASS15-rer - ataraccatagtaticoigicasaganaeo 9 NEENAss15 rev atataccatogttatetectgcteaaagaaacea 4 NEENAssS16 rev ttataccatggtctetacgcaaaaattcace 51 NEENAss17 is atattggtacctcetaaaaatacagggeace 52 19 CO NesNASITOo Iaamcenogradateanacadamneda 88 ee NAee DDR Ltaacoaomelananozanas - F) NEENAss18 rev atataccatggtttcttetaaagctgaaagt 55 atataggtaccttaagcttttaagaatetetacteaca NEENAss20 (2) rev atatatccatggttaaattttacctgteateaaaaacaaca 57: Amplification during PCR was performed with the following composition (50 microl):

3.00 microl of A. thaliana genomic DNA (50 ng / microl)

. 55 '10.00 microl 5x Phusion HF Buffer 4.00 microl dNTP (2.5 mM) | 2.50 microl for Initiator (10 microM)

2.50 microl of Initiator rev (10 microM)

0.50 micro! of DNA Polymerase Phusion HF (2U / micro!) A touch-down approach was used for PCR with the following parameters: 98.0ºC for 30 sec. (1 cycle), 98.0ºC for 30 sec,., 56 , 0ºC for 30 sec. And 72.0ºC for 60 sec. (4 cycles), 4 additional cycles each for 54.0ºC, 51.0ºC and 49.0ºC for tempering temperature, followed by 20 cycles with 98.0ºC for 30 46.0 ° C for 30 sec and 72.0 ° C for 60 sec (4 cycles) and 72.0 ° C for 5 min The amplification products were loaded onto a 2% (w / v) agarose gel and separated at 80 V. PCR products were excised from the gel and purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). After restriction DNA digestion with Ncol restriction endonuclease (10 U / microl) and Kpnl ( 10 U / micro!), The digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

1.3 Vector construction Using the Multisite Gateway System (Invitrogen, Carisbad, CA, USA), the promoter :: NEENA :: reporter gene cassettes were assembled in binary constructs for plant transformation The p-AtPXR from A. thaliana, '(At1g48130, GenBank AC023673.3; WO2006089950; with the prefix p- denotes the promoter) the seed-specific promoter was used in the construction of the reporter gene, and firefly luciferase (Promega, Madison, WI, USA) was used eat b reporter protein to quantitatively determine the effects that increase the expression of the NEENA molecules that will be analyzed. The pENTR / A vector containing the p-AtPXR promoter was cloned through site-specific recombination (BP reaction) between the pDONR / A vector and the

. 56 p-AtPXR amplification products with p-AtPXR-for and p-AtPXR-rev primers (Table 3) in genomic DNA (see above) with site-specific recombination sites at each end according to the manufacturer's manual ! (Invitrogen, Carlisbad, CA, USA). The positive pENTR / A clones were subjected to sequence analysis to ensure the accuracy of the p-AtPXR promoter.

TABLE 3: STARTING SEQUENCES (P-ATPXR) SEQ Sequence Name A. pAPXRITeY goggacigeltitiiacaaaciigitacoitiatatitatatatag - Se | An ENTR / B vector containing the firefly luciferase coding sequence (Promega, Madison, WI, USA) followed by the transcriptional terminator of nopaline synthase t-nos (Genbank VOO087) was generated.

The PCR fragments of the NEENA candidate (see above) were cloned separately upstream of the firefly luciferase coding sequence using the restriction enzymes Kpnl and Ncol.

The resulting pENTR / B vectors are summarized in Table 4, with the promoter molecules having the prefix p, the coding sequences having the prefix c, and the terminating molecules having the prefix t.

TABLE 4: ALL PENTR / B VECTORS PLUS AND LESS CANDIDATES TO NEENA Te ROO) ISEQ ID NO :: gene reporter :: terminator

'57: etor pENTR / B Composition of the partial expression cassette | SEQ ID NO :: reporter gene :: terminator LJK23 SEQ ID NO09 :: c-LUC :: t-LJK24 SEQ ID NO016 :: c-LUC :: t-LJK25 SEQ ID NO018 :: c-LUC :: t us LJK26 SEQ ID NO11 :: c-LUC :: us LJK27 SEQ ID N013 :: c-LUC :: us LJK28 SEQ ID N015 :: c-LUC :: us LJK29 SEQ ID NO10 :: c-LUC :: t-us LJK30 SEQ ID NO017 :: c-LUC :: t-us LJK31 SEQ ID NO07 :: 0-LUC :: t-us LJK32 SEQ ID NO05 :: 0-LUC :: t-us LJK33 SEQ ID N03 :: c-LUC :: t-LJK34 SEQ ID N012 :: 0-LUC :: t-LJK35 'SEQ ID N019 :: c-LUC :: t-LJK36 EQ ID N04 :: c -LUC :: t-nos LJK38 EQ ID N014 :: 0-LUC :: t-nos The vector pENTR / C was constructed by introducing a multiple cloning site (SEQ ID NOG60) through Kpnl and Hindlll restriction sites.

When performing a site-specific recombination (LR reaction), the created pENTR / A, PENTR / B and pENTR / C were combined with the target vector pSUN (derived from pSUN) according to the manufacturers manual (Invitrogen, Carlsbad, CA, USA) Multisite Gateway.

The reactions produced 1 binary vector with promoter p-AtPXR, the coding sequence for firefly luciferase c-LUC and the terminator t-nos and 19 vectors harboring SEQ ID NO1, NO? 2, NO3, NO4, NO5 , NO6, NO7, NO8, NO9, NO10, NO1 1, NO12, NO13, NO14, NO15, NO16, NO17, NO18 and NO19 immediately upstream of the firefly luciferase coding sequence (Table 5). combination

| '58 b with SEQ ID NO1 is determined by way of example (SEQ ID NO61). Except to vary SEQ ID NO2 to NO19, the nucleotide sequence is identical in all vectors (Table 5). The resulting plant transformation vectors are summarized in Table 5: TABLE 5: VEGETABLE EXPRESSION VECTORS FOR THE TRANSFORMATION OF A.

THALIANA ector of plant expression SEQ Promoter expression cassette :: SEQ ID NO :: reporter gene:: terminator D NO LJK134 P-AtPXR :: - :: 0-LUC :: t-PF PF LIK71 p-AtPXR :: SEQ ID NO1 :: 0-LUC :: t-nos LJK72 p-AtPXR :: SEQ ID N02 :: c-LUC :: t-nos [| LJK73 | -AtPXR :: SEQ ID NOB :: c-LUC :: t-nos [| LJIK74 Pp-AtPXR :: SEQ ID NOB :: c-LUC :: t-nos [the LJIK75 b-AtPXR :: SEQ ID NO8 :: c-LUC :: t-us | LJK76 p-AtPXR :: SEQ ID NO16 :: c-LUC :: t.nos PA LJK77 p-AtPXR :: SEQ ID NO18 :: c-LUC :: t-nos [PA LJK78 p-AtPXR :: SEQ ID NO11 :: 0-LUC :: t-us [| LJK79 p-AtPXR :: SEQ ID NO13 :: c-LUC :: t-nos PA LJK80 p-AtPXR :: SEQ ID NO15 :: c-LUC :: t-nos [o LJK81 p-AtPXR :: SEQ ID NO10 :: c-LUC :: t-nos [| LJK82 p-AtPXR :: SEQ ID NO17 :: 0-LUC :: t-nos [| JK83 p-AtPXR :: SEQ ID N07 :: c-LUC :: t-nos [JK84 | p-AtPXR :: SEQ ID NO5 :: c-LUC :: t-us [A JK85 p-AtPXR :: SEQ ID NO3 :: c-LUC :: t-us [| LJK86 p-AtPXR :: SEQ ID N012 :: 0-LUC :: t-nos [| LJK87 p-AtPXR :: SEQ ID NO18 :: c-LUC :: t-nos E: JK88 p-AtPXR :: SEQ ID NO4 :: c-LUC :: t-nos PA | LJK90 p-AtPXR :: SEQ ID NO014 :: c-LUC :: t-nos EF The resulting vectors were subsequently used to generate transgenic A. thaliana plants. Example 2: Screening of NEENA molecules that increase gene expression in transgenic A. thaliana plants. This example illustrates that only selected NEENA candidate molecules are capable of increasing gene expression.

. 59 |

EE: All binary constructs containing candidate molecules | NEENA described in example 1 have been stably transformed into | Arabidopsis thaliana plants together with a control construction without NEENA. To generate transgenic A. thaliana plants, Agrobacterium — tumefaciens (strain C58C1 pGV2260) was transformed with the various vector constructs described above. For the transformation of A. thaliana, the method “Floral Dip" was used (Clough and Bent, 1998, Plant Journal 16: 735-743). The transgenic T1 plants were selected when germinating and | developing seedlings in kanamycin. After 12 days , cotyledons from transformants and wild-type control plants were sampled and distributed in 96-well plates pre-loaded with Murashige-Skoog 50 microl 0.5 x Medium and subjected to Luciferase reporter gene analyzes (protocol attached after Weigel and Glazebrook , 2002, Arabidopsis, a laboratory manual, Cold Spring Harbor Laboratory Press, Chapter 7, ISBN 0- 87969-572-2.) The cotyledon luminescence was determined in a solution containing 0.1 mM D-Luciferin (Cat No: L-8220, BioSynth, Staad, Switzerland) and 0.01% Tween20 (Sigma, Aldrich, St. Louis, USA) in a MicroLumat Plus LB96V (Berthold Technologies, Bad Wilbad, Germany) recorded 60 min after adding D-Luciferin The average of instrument readings was calculated for c construction and based on these values of | average expression, modulation values were calculated to assess the impact of the presence of a putative NEENA on the reporter gene constructs devoid of the respective putative NEENA. Compared to | seed-specific constructs of reporter gene without NEENA with only | p-AtPXR promoter, the 19 NEENA candidates tested containing the | constructions showed negative as well as positive effects, ranging from | 0.8 times to 22.2 times Luciferase activity induction (Figure 1). In total, | 15 putative NEENA molecules comprising the sequences with SEQ ID

'60: | : NO1, NO2, NO3, NO4, NO5, NO6, NO7, NO8, NO9, NO10, NO1 1, NO12, | NO13, NO14 and NO15 conferred a greater than 2.5-fold increase in gene expression based on luciferase reporter gene activity compared to the construction of a reporter gene without NEENA with only the “promoter” (Figure 1) and then are functional NEENA molecules. Since numerous tested NEENA candidate molecules have marginal or even negative effects on increased gene expression, not all putative NEENA molecules are mediating a common stimulatory effect, but the selected NEENA sequences lead to a significant increase in gene expression (SEQ ID NO 1 to 15). Example 3: Testing of NEENA molecules for seed-specific increase in gene expression in oilseed rape plants This example illustrates that NEENA molecules can be used in species to increase the gene expression of a promoter | tissue-specific compared to the promoter-only approach without NEENA. | The NEENA molecules that measure the most vigorous increase | in pre-screening gene expression (cp. Example 2, SEQ ID NO1, NO2, | —NO3, NO4, NOS, NO6 and NO7) were selected to determine the increase | on levels of gene expression in transgenic oilseed rape plants. |

3.1 Construction of vector for transformation of B. napus plant | For the transformation of oilseed rape plants, the reporter gene expression cassettes without and with the gene expression control molecules (SEQ IDs NO1 - NO7) were combined with a gene expression cassette carrying a selectable marker gene for detect strains of transgenic plants within a

. 61 | | | . pENTR / C vector. when performing a site-specific recombination (LR reaction), | as previously described (see 1.3 above), pENTR / A, pENTR / B and | PENTR / C that drives the selectable marker cassette have been combined with | the target vector pPSUN according to the manufacturer's manual (Invitrogen, —Carisbad, CA, USA) Multisite Gateway. The reactions produced a binary vector with the p-AtPXR promoter, the c-LUC firefly luciferase coding sequence, the t-nos terminator and the selectable marker cassette as well as 7 | vectors harboring SEQ ID NO1, NO2, NO3, NO4, NOS, NO6 and NO7 immediately upstream of the vacant luciferase coding sequence | 10 light (Table 6), for this the combination with SEQ ID NO1 is determined as an example (SEQ ID NO62). Except for the variation of SEQ ID NO2 to NO7, the nucleotide sequence is identical in all vectors (Table 6). The resulting plant transformation vectors are summarized in Table 6: TABLE 6: VEGETABLE EXPRESSION VECTORS FOR TRANSFORMATION OF B. NAPUS expression ectorComposition of the expression cassette EQ egetal Promoter :: SEQ ID NO :: genelD NO | | LJK148 p-AtPXR :: - :: 0-LUC :: t-nos TA LJK156 p-AtPXR :: SEQ ID NO1 :: c-LUC :: t-nos | LJK157 p-AtPXR :: SEQ ID N02 :: c-LUC :: t-PA | LJK158 p-AtPXR :: SEQ ID NO07 :: c-LUC :: t-us Lo 'LJK159 p-AtPXR :: SEQ ID NO5 :: c-LUC :: t-us IF LJK160 p-AtPXR :: SEQ ID NO4 :: c-LUC :: t-nos F LJK161 p-AtPXR :: SEQ ID NO6 :: c-LUC :: t-nos Fo LJK162 p-AtPXR :: SEQ ID N038 :: c-LUC :: t-nos - [o

3.2 Generation of transgenic rapeseed plants (protocol corrected according to Moloney et al., 1992, Plant Cell Reports, 8: 238-242). In preparation for the generation of transgenic rapeseed plants, the binary vectors were transformed into Agrobacterium tumefaciens C58C1: pGV2260 (Deblaere et al., 1985, Nucl. Acids. Res. 13: 4777-4788). A 1:50 dilution of an evening culture of Agrobacteria that

. 62 i | houses the respective binary construction was developed in Murashige-Skoog Medium (Murashige and Skoog, 1962, Physiol. Plant 15, 473) supplemented with 3% sucrose (Medium 3MS). For the transformation of seed plants from | rapeseed, petioles or hypocotyledons from sterile plants were incubated with | 5 a 1:50 solution of Agrobacterium for 5 to 10 minutes followed by a | three-day co-incubation in the dark at 25ºC in 3 MS. The supplemented medium | with 0.8% bacto-agar. After three days, the explants were transferred to the MS medium containing 500 mg / l of Claforan (Cefotaxime Sodium), 100 nM of Imazetapyr, 20 microM of Benzylaminopurine (BAP) and 1.6 g / l of Glucose in a regime of 16 h in the light / 8 h in the dark, which was repeated in weekly periods. The developing shoots were transferred to the MS medium containing 2% sucrose, 250 mg / l Claforan and 0.8% Bacto-agar. After 3 weeks, growth hormone 2-Indolbutyl acid was added to the medium to promote root formation. The shoots were transferred to the soil after root development, developed for two weeks in a growth chamber and were grown to maturity in greenhouse conditions.

3.3 Plant analysis Tissue samples were collected from transgenic plants generated from leaves, flowers and seeds of varying stages of development, | stored in a freezer at -80ºC and subjected to an É gene analysis | Luciferase reporter (protocol attached after Ow et al., 1986). After grinding, the frozen tissue samples were resuspended in 800 | buffer microl | (0.1 M phosphate buffer pH 7.8, 1 mM DTT (Sigma — Aldrich, St. Louis, MO, USA), 0.05% Tween 20 (Sigma Aldrich, St. Louis, MO, USA) ) followed by centrifugation at 10,000 g for 10 minutes. 75 microl of the aqueous supernatant was transferred to 96-well plates. After adding 25 microl of buffer Il (80 mM glycine-glycyl (Carl Roth,

| . 63, D Karlsruhe, Germany), 40 mM MgSO4 (Duchefa, Haarlem, The Netherlands), 60 mM ATP (Sigma Aldrich, St. Louis, MO, USA), pH 7.8) and D-Luciferin at a concentration end of 0.5 mM (Cat No: L-8220, BioSynth, Staad, | Switzerland), luminescence was recorded on a MicroLumat Plus LB96V - (Berthold Technologies, Bad Wildbad, Germany) producing the relative light unit RLU per minute (RLU / min). To normalize the luciferase activity between samples, the protein concentration was determined in the aqueous supernatant in parallel with the luciferase activity (adapted from Bradford, 1976, Anal. Biochem. 72, 248). 5 micro! of aqueous cell extract in buffer | were mixed with 250 microl of Bradford reagent (Sigma Aldrich, St. Louis, MO, USA), incubated for 10 min at room temperature. Absorption was | determined at 595 nm in a plate reader (Thermo Electron Corporation, Multiskan Ascent 354). The total amounts of protein in the samples were | calculated using a previously generated standard concentration curve. The values resulting from a ratio of RLU / min and sample of mg of protein / ml were calculated for transgenic plants that host identical constructs and the modulation values were calculated to assess the impact of the presence of the NEENA molecule on the reporter gene constructs without NEENA.

3.4 NEENA sequences measure the vigorous increase of - gene expression in oilseed rape seeds. To assess the potential for increased gene expression of selected NEENA molecules (SEQ ID NO1, NO2, NO 3, NO4, NO5, NO6 or NO7) in oilseed rape seeds, seeds of identical developmental stages were collected of individual oilseed rape plant lines that harbor a promoter-only reporter gene construct or Luciferase reporter gene constructs containing | a NEENA (SEQ ID NO1, NO2, NO3, NO4, NO5, NO6 and NO7). 10 seeds |

. 64. were collected from each transgenic event, processed and analyzed for Luciferase activity as described above (Example 3.3). In comparison with the reporter gene constructs without NEENA only with the seed-specific p-AtPXR promoter, the 7 —NEENA molecules tested mediated vigorous increases in gene expression, ranging from 54 times to 380 times the induction in Luciferase activity in seeds canola (Figure 2a). The comparable increase in expression was detected in oilseed rape seeds in later maturation stages (data not shown).

3.5 NEENA molecules stimulate gene expression in tissues specifically in oilseed rape seeds To assess the specific tissue growth of gene expression mediated by NEENA molecules (SEQ ID NO1, NO? 2, NO3, NO4, NO5, NO6 or NO7 ), Luciferase activity was determined in fully developed and open flowers of transgenic oilseed rape plants that harbor the reporter gene constructs described above. Three samples of identical sized leaves as well as an entire flower were collected from each plant separately and subjected to Luciferase reporter gene analyzes as described above (Example 3.3). 5 (Seq.IDNO1, NO? 2, NO3, NO4, NO5) of the 7 NEENA molecules tested showed levels of Luciferase expression comparable to those of the p-AtPXR promoter construction without NEENA in leaves and flowers and thus do not alter the tissue specificity of the seed-specific p-AtPXR promoter (Figure 2, b and c). 2 molecules of NEENA (SEQ ID NO6, NO7) slightly increased the Luciferase activity in leaves and flowers of the oilseed rape seed plants analyzed (Figure 2, b and c) compared with plants that comprise the construction without NEENA. So, these NEENAS SEQ ID NO 6 and 7 are seed-preferred NEENAs while the other NEENAs | | '| - Petition 870200133605, of 10/23/2020, p. 82/206 SLI

. 65 B SEQ ID NO 1 to 5 are seed-specific NEENAs. Example 4: NEENA analysis for seed-specific enhancement of strong seed-specific promoters This example clarifies that NEENA molecule-enhancing capabilities can be used in combination with a variety of promoter molecules to increase tissue expression levels -specific compared to those of individual promoters. 4.1 Construction of vector for B. napus plant transformation The NEENA molecules selected from the group tested in example 3 (SEQ IDs NO1, NO2, NO3, NO5 and NOB6) were tested for their effect on the tissue-specific gene expression of strong seed-specific promoters p-LuPXR (WO2Z006089950, Sequence 9) and p-VIUSP (X56240, Baeumlein et al., 1991). The vector construction was performed as described above (cp. Example 1.3 and 3.1), with the primers described in table 7 and the vector LJB765 (WO2009016202) as the DNA model. The positive pENTR / A clones were subjected to sequence analysis to ensure the accuracy of p-LuPXR and p-VUSP promoters. TABLE 7: STARTING SEQUENCES FOR P-LUPXR AND P-VFUSP Initiator name Sequence EQ A and rereea

E E EA EA EA CEEE aaa A a a A ed | When performing a site-specific recombination (LR reaction) like! previously described (see above, 1.3), the vectors pENTR / A, pENTR / B and the vector pENTR / C that drives the selectable marker cassette have been combined with the target vector pSUN according to the manufacturer's manual (Invitrogen, Carisbad, CA, USA) Multisite Gateway. The reactions

. 66 A produced 1 binary vector with the p-LuPXR promoter, the firefly luciferase coding sequence and the terminator t-nos as well as the selectable marker cassette and the 4 vectors harboring SEQ ID NO1, NO? 2, NO3 and NO6 immediately upstream of the firefly luciferase coding sequence (Table 8), for this the combination with SEQ ID NO1 is determined as an example (SEQ ID NO67). Except for the variation of SEQ ID NO2, NO3 and NOS6, the nucleotide sequence is identical in all vectors (Table 8). Similarly, the p-VÍUSP promoter was used to generate the LJK219 construct with only the promoter as well as the LJK220, LJK221, LJK224 and LJK225 constructs that contain SEQ IDs NO1, NO2, NO3 and NOS5 (Table 8). The resulting plant transformation vectors are summarized in table 8: TABLE 8: VEGETABLE EXPRESSION VECTORS FOR TRANSFORMATION OF B. NAPUS expression ector Expression cassette composition SEQ egetal Promoter :: SEQ ID NO :: reporter gene :: terminator ID

NO RT p-LuPXR: - "e-LUC :: tr PO PO LJK213 bp-LuPXR :: SEQ ID NO1 :: c-LUC :: t-us EK wu pLuPXR: SEQ ID N02 :: c-LUC :: t- nos [| pr paPxR SEG Io Noaendenas EK2T8 À "uu pLluPXR: SEQ ID NO03 :: c-LUC :: t-nos | LJK219 p-VfUSP :: - :: 0-LUC :: t us IA EJK220 p-VUSP :: SEQ ID NO1 :: c-LUC ": t-us [A LJK221 p-VfUSP :: SEQ ID N02 :: 0-LUC :: t-nos Po | K224 - pVIUSP: SEQ ID NOS5 :: c-LUC :: t-nos E Exa NNNNN p-VIUSP: SEQ ID NO3 :: c-LUC :: t-nos [o

4.2. The NEENA sequences measure the specific increase in gene expression of strong seed-specific promoters in oilseed rape seeds The generation of transgenic rape seed plants and plant analyzes were conducted as described above (examples 3.2 and 3.3). For the test and effect of NEENA molecules selected in

| NR 67 | | s combination with seed-specific promoters (SEQ ID NO1, NO2, NO3, NOS and NO6) in oilseed rape seeds, seeds of identical developmental stages were collected from individual transgenic oilseed rape plant lines harboring a gene construct reporter with only the promoter (LJK212 and LJK219) or Luciferase reporter gene constructs containing a NEENA (SEQ ID NO1, NO2, NO3, NOS and NOS6) (Table 9). From each transgenic event, 10 seeds were collected, processed and analyzed for Luciferase activity as described above (Example 3.3).

In comparison to the seed-specific reporter gene constructs with only the p-LuPXR and p-VUSUSP promoter without NEENA, all NEENA molecules tested mediated vigorous increases in gene expression in medium-mature oilseed rape seeds in combination with both, the p-LuPXR and p-VfUSP promoter (Table 9). A similar increase in expression was detected in oilseed rape seeds in later maturation stages.

TABLE 9: LUC EXPRESSION IN SEEDS OF STAINLESSLY TRANSFORMED OIL SEEDING RAPE PLANTS. Expression Expression cassette composition Expression - LUC egetal Promoter :: SEQ ID NO :: reporter seed gene :: oilseed terminator rr a - LIKDTZ pLuPXR: =: "0-LUC: tnos A LJK213 - p-LuPXR :: SEQ ID NO1 :: c-LUC :: t-LJK214 - p-LuPXR :: SEQ ID NO2 :: 0-LUC :: t-LJK215 - bp-LuPXR :: SEQ1ID NO6 :: c-LUC :: t us IS LJK218 - p-LuPXR :: SEQID NO03 :: c-LUC :: t-us LJK219 - p-VIUSP :: - "c-LUC :: t-us LJK220 - p-VfUSP :: SEQ ID NO1: : c-LUC :: t-nos H ++++ 100% LJK221 - p-VfUSP :: SEQ ID NO02 :: 0-LUC :: t-nos +++ 100% LJK224 - p-VfUSP :: SEQ ID NO05 :: 0 -LUC :: t-nos +++ LJK225 p-VfUSP :: SEQ ID NO03 :: c-LUC :: t-nos H ++++ 100% - Petition 870200133605, of 10/23/2020, p. 85 /

EA RR TJPE ET ET AA a AAA at NO: nm 68 * LUC expression determined as a range of firefly luciferase activities (- no expression a +++++ expression too high), the relative LUC expression compared to expression of the flax seed p-LuPXR promoter within the respective tissue. ** Relative luciferase 5 expression compared to expression controlled by the p-LUPXR promoter from | flax seed peroxiredoxin. | To assess tissue-specific increase in gene expression | mediated by NEENA molecules (SEQ ID NO1, NO2, NO3, NOS5 and NOS), | Luciferase activity was determined in leaves completely | developed from the transgenic oilseed rape plants that house the reporter gene constructs described above. 3 leaf samples | of identical sizes were collected from each plant separately and were subjected to Luciferase reporter gene analyzes as described above (Example 3.2). The tissue specificities of the NEENA molecules tested (SEQIDNO1, NO2, NO3, NO5, NO6) in combination with the p-LuPXR promoter and the p-VUSP promoter are similar to those tested with the p-AtPXR promoter analyzed above (example 3.5) . According to the p-AtPXR promoter (example 3.5), NEENA molecules (SEQ ID NO1, NO2, NO3 and NO5) did not show alteration in the tissue specificity of the p-LuPXR or p-VfUSP promoter (Table 10). Similar to the activity with the p-AtPXR promoter (example 3.5), NEENA (SEQ ID NO6) led to increased activity of - Luciferase in seeds, but also mediated the expression of Luciferase in the leaves of the oilseed rape plants analyzed ( Table 10). TABLE 10: LUC EXPRESSION IN LEAVES OF SEED Rape Plants

OLEAGINOSA STABLE TRANSFORMED Expression cassette composition vector - -> | LUC expression in | oilseed vegetable | [DEE RE Tom

. 69, promoter expression :: SEQIDNO :: reporter gene :: oilseed rape seed terminator Ae boa eee ==) [RT pre SE To Names og) | [HRETS poPAR SEG TO In etETRS o om [RS I put arrows ow O) to EL EE when seeing Ar [985 Tm * LUC expression determined as a range of firefly luciferase activities (- no expression a ++++ + very high expression), | the relative LUC expression compared to the expression of the flax seed p-LuPXR promoter within the respective tissue. ** Expression of relative luciferase compared to expression controlled by the p-LuPXR promoter of flaxseed peroxiredoxin.

Example 5: Analysis of tissue-specific increase in gene expression in soybean plants This example illustrates that the claimed NEENA molecules can be used in a wide range of plant species and over species edges of different plant families to increase expression | tissue-specific genetics compared to an approach only | with the prosecutor without NEENA. | The NEENA sequence molecules that measure the increase | more vigorous in the pre-screening gene expression (cp.

Example 2, SEQ ID NO1, NO2, NO 3, NO4, NO5, NO6 and NO7) were selected to determine the increase in the levels of gene expression in transgenic soybean plants.

The plant expression vectors LJK148, LJK156, LJK1I57, | Petition 870200133605, of 10/23/2020, p. 87/206

: 70 - LJK158, LJ K159, LJK160 and LJK1I61 (see example 3.1) were used for the transformation of stable soybeans.

5.1 Generation of transgenic soybean plants (attached protocol according to WO2005 / 121345; Olhoft et al., 2007). | 5 The germination of soybean seeds, propagation, A. rhizogenes and preparation of an auxiliary meristem explant, and inoculations were performed as previously described (WOZ2005 / 121345; Olhoft et al., 2007) with a | exception that constructs LJK148, LJK156, LIK157, LIKIS8, LJ K159, LJK160 and LJK161 (cp. example 3.1) contained a modified AHAS gene carried by the parsley ubiquitin promoter PcUbi4-2, mediating | tolerance to imidazolinone herbicides for selection.

5.2 The NEENA sequences measure the vigorous increase in gene expression in soybean plants while maintaining the promoter tissue specificity Tissue samples were collected from transgenic plants generated from leaves, flowers and seeds. The tissue samples were processed and analyzed as described above (cp. Example 3.3). Compared to the construction of the LIK148 reporter gene without NEENA with only the p-AtPXR seed-specific promoter, the seven NEENA molecules tested mediated vigorous increases in expression genetics in soybean seeds based on Luciferase activity (Figure 3a). In contrast, no significant change in Luciferase activity mediated by NEENA molecules (SEQ ID NO1, NO2, NO4, NO5, NO6 and NO7) could be detected in soybean leaves and flowers (Figure 3, be o). Example 6: Analysis of NEENA activity in monocot plants This example describes the analysis of NEENA sequences with SEQIDNO 1, 2,3,4,5,6e7 in monocot plants.

to 71. 6.1 Vector construction To analyze the NEENA sequences with SEQ ID NO 1,2,3, 4, 5,6 and 7 in monocotyledonous plants, a pUC-based expression vector that houses an expression cassette composed of the p-KG86 promoter of seed-specific monocotyledon without NEENA of Z. plus combined with a coding sequence for the beta-Glucuronidase (GUS) gene followed by the transcriptional nopaline synthase (NOS) terminator is used. Genomic DNA is extracted from A. thaliana green tissue using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Genomic DNA fragments containing NEENA molecules are isolated by conventional polymerase chain reaction (PCR). The primers are designed based on the genomic sequence of A. thaliana with a large number of candidates for NEENA. The reaction comprises 7 sets of primers (Table 11) and follows the protocol described by Phusion High Fidelity DNA Polymerase (Cat No F-540L, | 15 New England Biolabs, Ipswich, MA, USA) using the following primers: TABLE 11: SEQUENCES INITIATORS Initiator name - [PCR Yield Sequence

EQ ID | In NEENAss1 forll laataatggcgcgcctagtgcttaaacactctagigagt s8 1 NEENAss1. revll laataatggcgegectttgacetacaaaatoaaageagtea 69 INEENAss2 Foril tttttggegegecagttetttactitegaagttac - o - 1 NEENAss2 revll tttttagegegectactacatactattttcaattct INEENAss4 forll aataaaggegegecgtecagaattttetecatiga 2 6 3 INEENAsSSA4 revil aataaaggcgegectettcactatccaaagetetea INEENAsS13 forll tttatagegegectagettaateteagatticgaategt NEENAss13 revll ttttatagegegcctagtatetacataccaatcatacaaato INEENASS14 forll tttttagegegocttteacgatttagaatttga Hs) 5 SEN 14 revl NASS | | fttttttggegegectoetacaacattaaaacgaccatta 7 NEENAss15 forll tatataggcgegecagggtttegtttttatitea 8 B INEE NAss 15 rev! |! tatataggcgcgccttatetoctgctrcaaagaaacca 79 t 72 Initiator name - (Sequence SEQ Yield. PCR ID

NO SEQID

NO NEENAss18 forll atataggegegoecactatttaagettcactgatet BO 4 NEENAss18 revll atataggegegectttettetaaagetgaaagt 81 Amplification during PCR and purification of the amplification products were performed as detailed above (example 1.2). After restriction digestion of DNA with Ascl restriction endonuclease (10 Ulmicrol), the digested products are purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

The NEENA PCR fragments (see above) are cloned separately upstream of the beta Glucuronidase coding sequence using Ascl restriction sites. The reaction produces a binary vector with the p-KG86 promoter, the beta-Glucuronidase c-GUS coding sequence and the terminator t-nos and seven vectors that harbor SEQ ID NO1, NO2, NO3, NO4, NO5, NOB6 and NO7, immediately upstream of the beta-Glucuronidase coding sequence (Table 12), for this the combination with SEQ ID NO1 is determined as an example (SEQ ID NOB82). Except for the variation of SEQ ID NO2 to NO7, the sequence —nucleotide is identical in all vectors (Table 12). The resulting vectors are summarized in table 12, with the promoter molecules having the prefix p, the coding sequences having the prefix c, and the terminator molecules having the prefix t. TABLE 12: PLANT EXPRESSION VECTORS etor delComposition of the expression cassette SEQID expression Promoter :: SEQIDNO :: gene reporter :: terminator NO egetal RTP2933 | p-KG86 :: - :: c-GUS :: t-nos [1 EJKS51 - p-KG86: SEQ ID NO1 :: c-GUS :: t-nos LJK352 p-KG86 :: SEQ ID N02 :: c-GUS :: t-nos | LJK353 - -KG86 :: SEQ ID N03 :: c-GUS :: t-FP o 73 | . . expression Promoter :: SEQIDNO :: reporter gene :: terminator NO egetal E e rg re ea seo re eee FeeEELL EEE HA aa a ra dl The resulting vectors were used to analyze the NEENA molecules in the experiments described below (Example 6.2). |

6.2 Analysis of NEENA molecules that increase expression | genetics in tissues of monocots | These experiments are carried out by bombarding tissues of monocotyledonous plants or culture cells (Example 6.2.1), or by Agrobacterium-mediated transformation (Example 6.2.2). The target tissue for these experiments can be plant tissue (eg, leaf tissue), cells from cultured plants (eg, Black Mexican Sweetcorn (BMS) corn, or plant embryos for Agrobacterium protocols.

6.2.1 Temporary analysis using microprojectile bombardment Plasmid constructs are isolated using the Qiagen plasmid kit (catt 12143). The DNA is precipitated in 0.6 microM of gold particles (Bio-Rad catff 165-2262) according to the protocol described by Sanford et al. (1993) (Optimizing the biolistic process for different biological applications. Methods in Enzymology, 217: 483-509) and accelerated in target tissues (for example, two-week-old maize leaves, cultured BMS cells, etc.) using a PDS-1000 / He system device (Bio-Rad). All DNA precipitation and bombardment steps are performed under sterile conditions at room temperature. Cells grown in suspension of Black Mexican Sweetcorn (BMS) maize are propagated in medium

. 74 - BMS cell culture liquid [Murashige and Skoog (MS) salts (4.3 g / L), 3% (wWv) sucrose, myo-inositol (100 mg / L)) 3 mg / L of acid 2, 4- dichlorophenoxyacetic (2,4-D), casein hydrolyzate (1 g / L), thiamine (10 mg / L) and L-proline (1.15 g / L), pH 5.8]. Each week 10 mL of a cell culture — stationary is transferred to 40 mL of fresh medium and cultured on a rotary shaker operated at 110 rpm at 27ºC in a 250 mL flask. 60 mg of gold particles in a siliconized Eppendorf tube are resuspended in 100% ethanol followed by centrifugation for 30 seconds.

The pellet is washed once in 100% ethanol and twice in sterile water with centrifugation after each wash.

The pellet is finally resuspended in 1 mL of 50% sterile glycerol.

The gold suspension is then divided into 50 microl aliquots and stored at 4ºC.

The following reagents are added to an aliquot: 5 microL of 1 microg / microL of total DNA, 50 microL of 2.5 M CaCb, 20 microL of 0.1 M spermidine, free base.

The DNA solution is vortexed for 1 minute and placed at -80ºC for 3 minutes followed by centrifugation for 10 | seconds.

The supernatant is removed.

The pellet and carefully | | resuspended in 1 mL. 100% ethanol by shaking the tube followed by centrifugation for 10 seconds.

The supernatant is removed and the pellet is carefully resuspended in 50 microL of 100% ethanol and placed at - .. 80ºC until used (30 min to 4 h before bombardment). If the gold aggregates are visible in the solution, the tubes are sonicated for a second in a water bath sonicator just before use.

For bombardment, two-week-old maize leaves are cut into pieces approximately 1 cm long and placed adaxial side up in the osmotic induction medium M-N6- 702 [N6 salts (3.96 g / L ), 3% (w / w) sucrose, 1.5 mg / L of 2.4 - dichlorophenoxyacetic acid (2,4-D), casein hydrolyzate (100 mg / L), and L-proline (2, 9 | Petition 870200133605, from A DE o A to EN

. 75 "g / L), vitamin MS stock solution (1 mL / L), 0.2 M mannitol, 0.2 M sorbitol, pH 5.8]. The pieces are incubated for 1 to 2 hours.

In the case of cultured BMS cells, week-old suspension cells are pelleted in 1000 g in a centrifuge — Beckman / Coulter Avanti J25 and the supernatant is discarded. The cells are placed in round Whatman filters free of No 42 ash as a 1/16 inch thick layer using a spatula. The filter papers that retain the plant materials are placed in the osmotic induction medium at 27ºC in the dark for 1 to 2 hours before the bombardment.

Shortly before the bombardment, the filters are removed from the medium and placed on a stack of sterile filter paper to allow the callus surface to dry partially.

Each plate is launched with 6 microL of gold DNA solution twice, at 1,800 psi for leaf materials and 1,100 psi for cultured BMS cells. To maintain the position of plant materials, a sterile wire mesh screen is placed over the sample. After the bombardment, the filters that retain the samples are transferred to the M-N6-702 medium, which is devoid of mannitol and sorbitol and incubated for 2 days in the dark at 27ºC before the temporary analyzes.

Temporary transformation through microprojectile bombardment of other monocot plants is carried out using, for example, a technique described in Wang et al., 1988 (Transient expression. Of foreign genes in rice, wheat and soybean cells following particle bombardment. Plant Molecular Biology, 11 (4), 433-439), Christou, 1997 (Rice transformation: — bombardment. Plant Mol Biol. 35 (1-2)).

The expression levels of the genes expressed in the constructions described above (example 6.1) are determined by GUS staining, luminescence / fluorescence quantification, RT-PCR, protein abundance 870200133605, from 10/23/2020, p. 93/2068 —------ and

| Di RD o ii A oo js ooo io o “PIOUS OIJIEO DIS SS SIS OE ICS AND IEEE PP» »FJ '> ISCS Sr IPO PE») O »PI» PSIPP IPEP APPEAR EEE PO EE EP EE PE EP EE PE EEE EEE EA EEE EEE EEE EEE EEE EA EEE EA AA SS. 76. (detection by specific antibodies) or metabolic products generated through the expression cassettes described above using protocols in the art. GUS staining is performed by incubating plant materials in GUS solution [100 mM NaHPOA4, 10 mM EDTA, 0.05% Triton X100, 0.025% - X-Gluc solution (5-bromo-d4-chloro acid - 3-indolyl-beta-D-glucuronic acid dissolved in DMSO), 10% methanol, pH 7.0] at 37ºC for 16 to 24 hours. Vegetable tissues are vacuum infiltrated twice for 15 minutes to help achieve uniform color. Analyzes of luciferase activities are performed as described above (see examples 2 and 3.3).

In comparison to reporter gene constructs without NEENA only with the p-ZmKG86 seed-specific promoter, all NEENA molecules measure the vigorous increase in gene expression in these analyzes.

6.2.2 Transformation and regeneration of crop plants — monocotyledons Agrobacterium-mediated plant transformation using standard transformation and regeneration techniques can also be performed for the purposes of transforming crop plants (Gelvin and Schilperoort, 1995, Plant Molecular Biology Manual, 2nd Edition, Dordrecht: Kluwer Academic Publ. ISBN 0-7923-2731 -4; Glick and Thompson (1993) Methods in Plant Molecular Biology and Biotechnology, Boca Raton: CRC Press, ISBN 0- 8493-5164-2). The transformation of corn or other monocot plants can be carried out using, for example, a technique described in US

5,591,616. The transformation of plants using particle bombardment, DNA absorption mediated by polyethylene glycol or through the silicon carbonate fiber technique is described, for example, by Freeling & Walbot (1993) "The maize handbook" ISBN 3-540- 97826-7, Springer Verlag New York.

- 77 e The expression levels of the expressed genes are determined by GUS staining, luminescence or fluorescence quantification, RT-PCR or protein abundance (detection by specific antibodies) using the protocols in the art. GUS staining is performed when incubating materials | vegetables in GUS solution [100 mM NaHPO4, 10 mM EDTA, 0.05% Triton X100, 0.025% X-Gluc solution (dissolved 5-bromo-4-chloro -3-indolyl-beta-D-glucuronic acid in DMSO), 10% methanol, pH 7.0] at 37 ° C for 16 to 24 hours. Vegetable tissues are vacuum infiltrated twice for 15 minutes to help achieve uniform color. Analyzes of deluciferase activities are performed as described above (examples 2 and 3.3). In comparison with the reporter gene constructs without NEENA only with the seed-specific p-ZmKG86 promoter, the NEENA molecules measure the vigorous and tissue-specific increase in plant gene expression. Example 7: Quantitative analyzes of NEENA activity in monocot plants This example describes the analysis of NEENA sequences with SEQ ID NO 1 and 2 in corn plants.

7.1 Vector construction To analyze the NEENA sequences with SEQ ID NO 1 e2 in monocotyledonous plants in a quantitative way, an expression vector based on pUC that houses an expression cassette composed of the promoter | p-KG86 seed-specific monocyte without NEENA of Z. plus was combined with a coding sequence for the firefly luciferase (LUC) gene (Promega, Madison, Wi, USA) followed by the transcriptional terminator of nopaline synthase (NOS ). Genomic DNA was extracted from A. thaliana green tissue using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). The fragments of genomic DNA containing the molecules of

And the aa SS 78. NEENA were isolated by conventional polymerase chain reaction (PCR). The primers are designed based on the genomic sequence of A. thaliana with a large number of candidates for NEENA. The reaction comprises 2 sets of primers (Table 11) and followed the protocol described by Phusion High Fidelity DNA Polymerase (Cat No F-540L, New England Biolabs, Ipswich, MA, USA) using the following primers: TABLE 11: INITIATING SEQUENCES Name equator primer PCR yield- ng SEQ

ATE Nemvtcst rom - Putngcgmengmc heartburn - | NEENAsS1 revill atatggegegectttagacctacaaaatcaaageagtea 84 peetcsa on Dossencgeteeae amet - e | NEENAss2 revl ll jatataggegegectactacgtactattttcaattct 86 Amplification during PCR and purification of the amplification products were performed as detailed above (example 1.2). After restriction digestion of DNA with Mlul (10 Ulmicrol) and Ascl (10 U / microl) restriction endonucleases, the digested products are purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). The NEENA PCR fragments (see above) are cloned separately upstream of the firefly luciferase coding sequence using Ascl restriction sites. The reaction produces a binary vector with the p-KG86 promoter, the coding sequence for firefly luciferase c- - LUC and the terminator t-nos and five vectors harboring SEQ ID NO1 and NO?, Immediately upstream of the sequence coding of firefly luciferase (Table 12), for this the combination with SEQ ID NO1 is determined as an example (SEQ ID NO 87). Except for the variation of SEQ ID NO? 2, the nucleotide sequence is identical in all vectors (Table 12). The resulting vectors are summarized in table 12, with the promoter molecules having the prefix p, the coding sequences having the - Petition 870200133605, of 10/23/2020, p. 96/206 s.-.-..— o

SS 79 p prefix c, and terminator molecules having the prefix t. TABLE 12: VEGETABLE EXPRESSION VECTORS ector of expression cassette SEQ ID expression Promoter :: SEQIDNO :: gene NO RTPSS7S pKGAO IDOL | | The resulting vectors were used to analyze the NEENA molecules in the experiments described below (Example 7.2).

7.2 Generation of transgenic corn plants Corn germination, propagation, preparation of A. tumefaciens and inoculations were performed as previously described (WOZ2006136596, US20090249514) with the exception that constructions RTP5679, RTP5683 and RTP5684 (cp. Example 7.1) contained one modified AHAS gene conducted by the corn ubiquitin promoter p-Ubi, mediating tolerance to imidazolinone herbicides for selection.

7.3 The NEENA sequences measure the vigorous and tissue-specific increase in gene expression in corn plants. Tissue samples were collected from transgenic plants generated from leaves and grains. The tissue samples were processed and analyzed as described above (cp. Example 3.3). : | Compared to the reporter gene construction without NEENA only with the seed-specific p-KG86 promoter, the NEENA molecules tested (SEQ ID NO1 and NO2) measured vigorous increases in gene expression in grains (Figure 4a): In contrast, none significant change in Luciferase activity mediated by NEENA molecules (SEQ ID NO1 and NO2) could be detected in maize leaves (Figure 4b). Example 8: Quantitative analysis of sequence activity

| 80 | - NEENA with SEQ ID NO 1 and 2 in rice plants

8.1 Vector construction To analyze the NEENA sequences with SEQ ID NO 1 and 2 in rice plants in a quantitative way, the vectors pENTR / B LJK1, LJK19 andJK20 (compare with example 1.3) were combined with a target vector that houses the PROO090 seed-preferred rice promoter upstream of the recombination site using site-specific recombination (LR reaction) according to the manufacturer's manual (Invitrogen, Carlsbad, CA, USA) Gateway. The reactions produced a binary vector with the PROO0O090 promoter, the firefly luciferase coding sequence c-LUC and the terminator t-nos as well as 2 vectors harboring SEQ ID NO1 and NO2 immediately upstream of the coding sequence of firefly luciferase (Table 13). Except for the variation of SEQ ID NO 2, the nucleotide sequence is identical in the vectors (table 13). The resulting vectors are summarized in table 13, with the promoter molecules having the prefix p, the coding sequences having the prefix c, and the terminator molecules having the prefix t. TABLE 13: VEGETABLE EXPRESSION VECTORS ector of Composition of the expression cassette SEQ ID egetal NO :: reporter gene :: terminator CDso77 p-PRODOSO: elMOtmas MM CDI07T - pPRODOSO SEGIDNOToLUCErHos - | The resulting vectors were used to analyze the —NEENA molecules in the experiments described below (Example 8.2).

8.2 Generation of transgenic rice plants Agrobacterium containing the respective expression vector was used to transform Oryza sativa plants. The ripe dry seeds of the japonica rice cultivar Nipponbare were hulled. Ã 81 - sterilization was performed by incubation for one minute in 70% ethanol, followed by 30 minutes in 0.2% HgCb, followed by 6 washes of 15 minutes with sterile distilled water.

The sterile seeds were then germinated in a medium containing 2,4-D (callus induction medium). After incubation in the dark for four weeks, scutellum-derived embryogenic calluses were excised and propagated in the same medium.

After two weeks, the calluses were multiplied or propagated by subculture in the same medium for another 2 weeks.

The embryogenic callus pieces were subcultured in fresh medium 3 days before co-cultivation (to stimulate cell division activity). The Agrobacterium LBA4404 strain containing the respective expression vector was used for co-cultivation.

Agrobacterium was inoculated in AB medium with the appropriate antibiotics and cultivated for 3 days at 28ºC.

The bacteria were then collected and suspended in liquid co-culture medium at a density (OD) of about 1. The suspension was then transferred to a Petri dish and the calluses were immersed in the suspension for 15 minutes.

Callus tissues were then dried with filter paper and made into | solidified co-culture medium and incubated for 3 days in the dark at 25ºC.

The co-cultured corns were grown in medium containing 2,4-D for 4 weeks in the dark at 28ºC in the presence of a selection agent.

During . And - during this period, fast-growing resistant callus islands were developed.

After transferring this material to a medium for regeneration and incubation in the light, the embryogenic potential was released and the buds developed in the next four to five weeks.

The shoots were excised from the calluses and incubated for 2 to 3 weeks in a medium containing auxin from which they were transferred to the soil.

The hardened shoots were grown under high humidity and a few days in a greenhouse.

1 Approximately 35 independent TO rice transformants were generated for a construction. The primary transformants were transferred from a tissue culture chamber to a greenhouse. After a quantitative PCR analysis to verify the number of copies of the T- —DNA insert, only single copy transgenic plants that exhibit tolerance to | selection agent were maintained for the T1 seed harvest. The seeds were then harvested three to five months after transplantation. O | method produced single site transformants at a rate of more than 50% (Aldemita and Hodges1996, Chan et al. 1993, Hiei et al. 1994).

8.3 NEENA sequences measure the vigorous and tissue-specific increase in gene expression in rice plants Tissue samples were collected from transgenic plants generated from leaves and seeds. The tissue samples were processed and analyzed as described above (cp. Example 3.3). x Compared to the construction of the reporter gene without NEENA only with the seed-specific p-PROO0090 promoter, the NEENA molecules tested (SEQ ID NO1 and NO2) mediated vigorous increases in gene expression in seeds (Figure 5a). in contrast, no significant change in Luciferase activity mediated by - NEENA molecules (SEQ ID NO1 and NO2) could be detected in rice leaves (Figure '5b). a Fe Ds ese Captions of the Figures: Figure 1: Analysis of Luciferase reporter gene expression in cotyledons of A. thaliana plants stably transformed from construction without NEENA (LJK134) and containing NEENA (LJK71 - LJK90) representing the putative NEENA molecules which are derived from seed-preferred genes expressed under the control of the p-AtPXR promoter. Expression values are shown in relation to the control construction without NEENA

Yes (LJK134 = 1).

Figure 2: Bar graphs of luciferase reporter gene activity shown as units of relative light (RLU) from independent transgenic oilseed rape seed strains that - harbor reporter gene constructs without NEENA (LJK148) or containing NEENA that represent the NEENA molecules of expressed seed-preferred genes (LJK156 - LJK162) under the control of the p-AtPXR promoter and after normalization against the protein content of each sample. The expression values of plants that house the buildings containing NEENA are shown in relation to the plants that express the control construction without NEENA (LJKI148) (mean values, tissues from 20 transgenic plants analyzed independently). A) seed, B) leaf tissue, C) flowers Figure 3: Bar graphs of luciferase reporter gene activity shown as relative light units (RLU) of independent transgenic soybean plant lines that harbor the reporter gene constructs without NEENA (LJK148) or containing NEENA representing the NEENA molecules of expressed seed-preferred genes (LJK156 - LJK161) under the control of the p-AtPXR promoter and after normalization against the protein content of each sample. The expression values of plants that | 20 housing constructions containing NEENA are shown in relation to the plants expressing the control construction without NEENA (LJK148) (“average values, tissues from 10 transgenic plants analyzed independently). A) seed, B) leaf tissue, C) flowers Figure 4: Bar graph of the luciferase reporter gene activity shown as relative light units (RLU) of independent transgenic maize plant lines that harbor the reporter gene constructs without NEENA (RTP5679) or containing NEENA representing the NEENA molecules of expressed seed-preferred genes (RTP5683 -

At DD A AND A A | |

84 p RTP5684) under the control of the p-KG86 promoter and after normalization against the protein content of each sample (calculated values, tissues from 15 independent transgenic plants analyzed) A) seeds, B) leaf tissue. | |

Claims (8)

. CLAIMS | 1. A PROMOTER'S PRODUCTION METHOD | SEED-SPECIFIC AND / OR SEED-PREFERENTIAL VEGETABLE, of high expression that comprises functionally binding to one promoter one or more nucleic acid molecules that increase the expression of nucleic acid (NEENA) heterologous to said promoter comprising: | i) the nucleic acid molecule that has a sequence like | defined in SEQ ID NO: 1 to 15, or ii) a nucleic acid molecule that has a sequence with at least 80% identity to SEQ ID NO: 1 to 15, or iii) a fragment of at least 100 bases consecutive steps of a nucleic acid molecule of i) or ii) that has expression enhancing activity like the corresponding nucleic acid molecule that has the sequence of SEQ ID NO: 1 to 15, or iv) a nucleic acid molecule that is the complement or reverse complement of any of the nucleic acid molecules | previously mentioned under i) or ii), or À v) a nucleic acid molecule that is obtainable by PCR using oligonucleotide primers described by SEQ ID NO: 20 to 29, 34 ad41,44a51e54a57 as shown in the Table. 2 or | q á vi) a nucleic acid molecule that hybridizes under conditions = | equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M | NaPO4, 1 mM EDTA at 50ºC with washing in 2 X SSC, 0.1% SDS a | 50ºC in a nucleic acid molecule comprising at least 50 consecutive nucleotides of a transcription-enhancing nucleotide sequence described by SEQ ID NO: 1 to 15 or the complement thereof. 2. METHOD OF PRODUCTION OF A PLANT OR PART OF THAT, compared to a respective control plant or part thereof, . increased seed-specific and / or preferred seed expression of one or more nucleic acid molecules comprising the steps of a) introducing into the plant or part thereof one or more NEENA comprising a nucleic acid molecule according to claim 1iavi ) and b) functionally linking said one or more NEENA to a seed-specific and / or seed-preferred promoter and to a nucleic acid molecule that is under the control of said seed-specific and / or seed-preferred promoter, where NEENA is heterologous to the said nucleic acid molecule. 3. METHOD according to claims 1 and 2, comprising the steps of a) introducing one or more NEENA comprising a nucleic acid molecule, according to claim 1 i) to vi) in a plant or part thereof and b) integrating said one or more NEENA into the genome of said plant or part thereof where said or more NEENA is functionally linked to an acid | seed-specific and / or preferential seed nucleic expressed endogenous - heterologous to said one or more NEENA and optionally AT c) regenerating a plant or part of that comprising said or more NEENA of said transformed cell. A method according to claim 1 to 3, comprising the steps of a) providing an expression construct comprising one or more NEENA comprising a nucleic acid molecule, according to claim 1 i) to vi) functionally linked to a seed-specific and / or seed-preferred promoter and to one or more nucleic acid molecules, the latter being heterologous to said one or more NEENA and which is under the control of said seed-specific promoter and / or preferential seed and b) integrating said expression construction which comprises said umoumaisNEENA into the genome of said plant or part thereof and optionally c) regenerating a plant or part of it comprising said one or more expression constructions of said transformed plant or part of it. 5. METHOD, according to claims 1 to 4, in which it is a monocot or dicot plant. 6. METHOD according to claim 5, wherein the plant is a dicotyledonous plant. | 7. METHOD, according to claim 5, wherein the plant is a monocot plant. 8. METHOD according to claims 1 to 7, wherein said one or more NEENA is functionally linked to a seed-specific and / or seed-preferred promoter near the transcription start site of said heterologous nucleic acid molecule . 9. METHOD according to claim 8, wherein said one or more NEENA is functionally linked to a seed-promoter. specific and / or seed-preferred 2500 bp or less, preferably 2000 bp or less, more preferably 1500 bp or less, even more preferably 1000 bp or less and most preferably 500 bp or less distant from transcription initiation site for said nucleic acid molecule - heterologous. 10. METHOD according to claims 1 to 9, wherein said one or more NEENA is functionally linked to a seed-specific and / or seed-preferred promoter upstream of the translation start site That of the nucleic acid molecule whose expression is under the control of said seed-specific and / or seed-preferred promoter. 11. METHOD, according to the claims | to 9, wherein said one or more NEENA is functionally linked to a seed-specific and / or seed-preferred promoter within the 5UTR of the acid molecule | nucleic whose expression is under the control of said seed-specific and / or seed-preferred promoter. 12. "RECOMBINANT EXPRESSION CONSTRUCTION, comprising one or more NEENA comprising a molecule of acid | —nucleic according to claim 11) to vi). | 13. - “RECOMBINANT EXPRESSION CONSTRUCTION, by | according to claim 12, which comprises one or more NEENA that | comprises a nucleic acid molecule according to claim 1 i) to vi) functionally linked to one or more seed-specific promoters | 15 selected seed-preferred and one or more nucleic acid molecules | | expressed, the latter being heterologous to said one or more NEENA. | 14. RECOMBINANT EXPRESSION VECTOR, comprising one or more recombinant expression constructs, according to any one of claims 12 to 13. 15. TRANSGENIC PLANT OR PART OF THAT, which -. comprises another heterologous NEENA according to claim 1)) avi. 16. TRANSGENIC CELL OR TRANSGENIC PLANT | OR PART OF THAT, which comprises a recombinant expression vector, of —according to claim 14 or a recombinant expression construct, according to any one of claims 12 to 13. | 17. TRANSGENIC CELL, transgenic plant or part thereof, according to claim 16, selected or derived from Petition 870200133605, dated 10/23/2020, D6a. 106/2068 ———— "= y group consisting of bacteria, fungi, yeasts or plants | 18. - TRANSGENIC PLANT OR PART OF IT, according to | with claim 17, wherein said plant or part thereof is a dicot plant. | 19. - TRANSGENIC PLANT OR PART OF THAT, according to claim 17, in which said plant or part of it is a monocot plant. 20. TRANSGENIC CELL CULTURE, transgenic seed, parts or propagation material derived from a transgenic cell or plant or part thereof, according to claim 15 to 19, which comprises said heterologous NEENA, according to claim 1 i) a vi) the recombinant expression construct according to claim 12 or 13 or the recombinant vector according to claim 14. 21. USE OF NEENA, according to claim 1 i) to vi) or the recombinant construct or recombinant vector, according to any | one of claims 12 to 14 to increase expression in plants or parts thereof. 22. USE OF A TRANSGENIC CELL CULTURE, transgenic seed, transgenic plant, parts or propagation material derived from a transgenic cell or plant, according to claim E 20, for the production of foodstuffs, animal feed, seeds, | | pharmaceutical products or fine chemicals. | 1/5 | | | = 25 "3 20 8 x 315 o 107" o Ss ES | - | 3 in AMAS | c St E egS5S gas 8 ZEBEFESPESS ERES BER | > $ 33335333333333333333 | | | Fig. 1 | | | | s - =. - J | | | | | | A) À - 4.0E + 06 E Rapeseed seeds TD 3.0E + 06 E E 2.0E + 06 À E 3 2 1.0E + 06 ZE 0.0E + 00 co o nm co o o = o ss sense o o o <x x x X x x x B) 3 3 3 3 3 3 3 3 - | 10504 Rapeseed seeds Is 8.0E + 03 Is 6.0E + 03 Es E 4.0E + 03 3 20603 z? 0,0E + 00 2 8 58 3858 = 2 2 2 222 & 8 S 4 6 & S&S 1,2E + 05 Cc) = 12EH Rapeseed flowers E 1,0E + 05 =) E 80E + 04 AND 60E + 04 E S 40E + 04 PE p E 20E + 04 | : | 0,0E + 00 + 'co o mm co DD o = e Tv o O oO O Oo oo RBS es e Í MOX X XY XY ÀY Y x = = - = = = - = - - - - - - - —- Fig. 2 1 | ! i CDE aa to SSSSSSS0NSOSCSCSSSSSSSSSSSR A) 3.0E + 07 + Soybean seeds £ 25E07 FE) E 2.0E + 07 E 1.5E + 07 £ 1.0E + 07 = E 5.0E + 06 0.0E + 00 with ne oo o Just like OG EE Ss & S = XxX € x EE XxX 3S 3 3 3 3 3 53 - - - - - - - B) 1.0E + 05 - í. = Soy leaves E 2 8.0E + 04 - = 6.0E + 04 = E 4.0E + 04 s3 = 2.0E + 04 <0.0E00 “- ENE - = E = em. co o pd co oO o 7 oooooox MW XxX XxX XY XY X m à à à (à 05 - - - - - - - o) - 1.0E + 05 Soy flowers E 8.0E + 04 É 6.0E +04 E E 4.0E + 04 3 2.0E + 04 z? 0,0E + 00 co o [> co oo = xooo oO oo Soo SU Ss SD SUS Cv <= x == << = x S 3 3 S3 $ S 3 $ 53 - - - = - - - - Fig. 3 e A) = 3) 0E + O5 Corn grains E 2.5e + 05> E 20E + 05 = É 1.5E + 05 É 10605 3 5,0E + 04 z 0,0E + 00 oox Nm with Co Fr s Ss É E É «C X B) E 1,0E + 05 Corn leaves S 80ErO4 É so s E 40Er04 2 20E + 04 z = 0.0E + 00 o x NNW co o o o o o o É is: XÁ - Á— Fig. 4 Ea 5/5 = "2.0E + 07 Rice seeds Ss 1.5E + 07 E E 1.0E + 07 3 | 3 5.0E + 06 | z | 0.0E + 00 | CD30977 CD30971 CD30972 | | B)) 1.0E + 05 Rice leaves It is 80Er04> It is 60604 E E 40E + 04 = x 2.0E + 04 0.0E + 00 CD30977 CD30971 CD30972 Fig. 5 - = Summary “PRODUCTION METHOD OF A SEED- SPECIFIC AND / OR PREFERENTIAL SEED-PLANT PROMOTER, METHOD OF PRODUCTION OF A PLANT OR PART OF IT, RECOMBINANT EXPRESSION BUILDING, RECOMBINANT EXPRESSION VECTOR, PLANT | TRANSGENIC OR PART OF THAT, TRANSGENIC CELL OR TRANSGENIC PLANT OR PART OF THAT, TRANSGENIC CELL CULTURE, USE OF NEENA AND USE OF A TRANSGENIC CELL CULTURE ”The present invention is in the field of molecular plant biology and provides methods for the production of promoters high expression seed-specific and / or seed-preferred and production of plants with increased seed-specific and / or seed-preferred expression of nucleic acids in which nucleic acids that increase nucleic acid expression (NEENAs) are functionally linked said promoters and / or introduced into the plants. | E AE RE IT TE ET EP NEAR PE TIP DP EERE3 O âDECEIP 3 E PO PE IP PE E LO E IPO IPEP II A A E ED »O O E A o A A E E | . This annex presents the control code for the listing of biological sequences dealt with in INPI Resolution 228 of 11/11/2009: Control Code Field 1 Mnnooneoneoeeooonoonan Field 2 DO nocnc | Other Information: - File Name: 2012 02 24 1057-0237 Sequence listing FAK PCM.txt | - Code Generation Date: 27-02-2012 '- Code Generation Time: 09:34:30: - Control Code: - Field 1: BSS4CDD44081A2C4': - Field 2: 73512663E622F3BE Generated by the Sequence Listing System Biological (SisBioList)