BG108256A - Interferon gamma polypeptide variants - Google Patents

Abstract

The present invention relates to novel interferon gamma polypeptide variants having interferon gamma (IFNG) activity, methods for their preparation, pharmaceutical compositions comprising the polypeptide variants and their use in the treatment of diseases, in particular for the treatment of interstitial pulmonary diseases, such as idiopathic pulmonary fibrosis. These novel polypeptide variants all comprise the substitution S99T as compared to the amino acid sequence of hulFNG or fragments thereof. By performing this mutation the naturally occurring N-glycosylation site present at position 97 is significantly better utilized. Preferably, the variants comprise further modifications, e.g. in order to increase the AUC of such variants when administered subcutaneously.

Description

The present invention relates to novel interferon gamma polypeptide variants exhibiting activity such as interferon gamma (IFNG), to methods for their preparation, to pharmaceutical compositions containing polypeptide variants and to their use in the treatment of various diseases, in particular the treatment of interstitial lung diseases, such as idiopathic pulmonary fibrosis.

BACKGROUND OF THE INVENTION

Interferon-gamma (IFNG) is a cytokine produced by T-lymphocytes and naturally occurring predatory cells and exists as a homodimer of two non-covalently linked polypeptide HBr3b. * The completed form of each dimer includes 143 amino acid residues (shown in SEQ ID NO: 17), and their precursor form includes a sequence of 166 amino acid residues (shown in SEQ ID NO: 18).

Each subunit has two potential N-glycosylation sites (Aggarwal et al., Human Cytokines, Blackwell Scientific Publications, 1992) at positions 25 and 97. Depending on the degree of glycosylation, the molecular weight of interferon-gamma in dimeric form is 34-50 kDa (Farrar et al. Ann. Rev. Immunol. 1993,11: 571-611).

The initial sequence of baseline human interferon gamma (hulFNG) was described by Gray et al. (Nature 298: 859-863, 1982), Taya et al.

(EMBO J. 1: 953-958, 1982), Devos et al. (Nucleic Acids Res. 10: 2487-2501, 1982) and Rinderknecht et al. (J. Biol. Chem. 259: 6790-6797, 1984) and in EP 77670, EP 89676 and EP 110044. The 3D structure of the human interferon-gamma has been described by Ealick et al. (Science 252: 698-702, 1991).

Various naturally occurring or mutated forms of interferon-gamma subunit polypeptides have been described, including one Cys-Tyr-Cys N terminal amino acid sequence (positions (-3) - (- 1) associated with SEQ ID NO: 17), one, including the sequence with the N-terminal methionine (position -1, © associated with SEQ ID NO: 17), and various C-terminal truncated forms including 127-134 amino acid residues. It is known that from 1 to 15 amino acid residues can be deleted from the C-terminus without destroying the interferon-gamma activity of the molecule. Moreover, heterogeneity of the C-terminus of human interferon-gamma has been described by Pan et al. (Eur. J. Biochem. 166: 145-149,1987).

Human interferon-gamma (hulFNG) mutants have been described by Slodowski et al. (Eur. J. Biochem. 202: 1133-1140, 1991), Luk et al. (J. Biol. Chem. 265: 1331413319, 1990), Seelig et al. (Biochemistry 27: 1981-1987, 1988), Trousdale et al. (Invest.

* · · * · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Ophthalmol. Vis. Sci. 26: 1244-1251, 1985) EF EF 146354. The natural variant of the human interferon-gamma has been described by Nishi et al. (J. Biochem. 97: 153-159, 1985).

US 6,046,034 discloses variants of thermostable recombinant human interferon-gamma (rhulFNG) with up to 4 pairs of cysteine residues introduced to provide a disulfide bridge and hence stabilize the interferon-gamma variant in a homodimeric form.

WO 92/08737 discloses interferon-gamma variants comprising the addition of methionine at the N-terminus of the complete (residues 1-143) or partial (residues 1-132) amino acid sequence of the non-basic human interferon gamma (hulFNG). EP 219 781 describes partial sequences of human interferon-gamma, including amino acid residues 3-124 (of SEQ ID NO: 17). US 4,832,959 describes partial sequences of human interferon-gamma, including residues 1-127,

5-146 and 5-127 of an amino acid sequence which, compared to SEQ ID NO: 17, has three additional N-terminal amino acid residues (CysTyr-Cys). US 5,004,689 describes a sequence of deoxyribonucleic acid encoding human interferon-gamma (hulFNG) without the 3 N-terminal amino acid residues (Cys-Tyr-Cys) and its expression in E.coI. EP 446582 describes an E.c.H recombinant human interferon-free N-terminal methionine produced. US 6,120,762 discloses a peptide fragment of human interferon-gamma comprising residues 95-134 (with reference to SEQ ID NO: 18).

From Wang et al. (Sci. Sin. B 24: 1076-1084, 1994) describes the strong manifestation of recombinant human interferon-gamma.

From Curling et al. (Biochem. J. 272: 333-337, 1990) and Hooker et al. (J. of Interferon and Cytokine Research, 1998, 18: 287-295) describes a glycosylated variant of recombinant human interferon-gamma.

From Kita et al. (Drug ώε.′ΌθΙϊνΤΒ′πδϊ-ίβ?, * * 1990), and EP 236987 and US 5,109,120 describe polymer modification of recombinant human interferon-gamma.

WO 92/22310 discloses asialoglycoprotein conjugated interferon derivatives, including human interferon gamma.

Condensed proteins of the human interferon-gamma have also been described. For example, EP 0237019 describes a single chain polypeptide having an area exhibiting interferon β activity and one region exhibiting interferon gamma activity.

EP 0158198 discloses a single chain polypeptide having a region showing interferon activity and a region showing IL-2 activity. Several reports have described single-stranded dimeric interferon-gamma proteins, for example, Landaretal. (J. Mol. Biol. 2000, 299: 169-179).

WO 99/02710 describes single chain polypeptides, one example of which is interferon-gamma.

WO 99/03887 describes polyethylene glycolylated variants of polypeptides belonging to the growth hormone family, where a minor amino acid residue localized in a specific region of the polypeptide is replaced by a cysteine residue. Interferon-gamma is mentioned as one example of a member of the growth hormone family, but its modification has not been discussed in detail.

Interferon-gamma is available for the treatment of interstitial lung disease (also known as interstitial pulmonary fibrosis (IPF) (Ziesche et al. (N. Engl. J. Med. 341: 1264-1269, 1999 and Chest 110: Suppl: 25S, 1996) and EP 795332) for which interferon-gamma can be administered in combination with prednisolone.In addition to interstitial pulmonary fibrosis, interferon-gamma can also treat granulomatous diseases (Bolinger et al., Clinical Pharmacy, 1992 , 11: 834-850), some mycobacterial infections (N. Engl. J. Med. 330: 1348-1355, 1994), kidney cancer (J. Urol. 152: 841-845, * 1994), obYedrtopodd (N J. Eng. Med. 332: 1594-1599, 1995), sclerodes rm (J. Rheumatol. 23: 654-658, 1996), hepatitis B (Hepatogastroenterology 45: 2282-2294, 1998), hepatitis C (Int. Hepatol. Communic. 6: 264-273, 1997), septic shock (Nature Medicine 3: 678-681, 1997) and rheumatoid arthritis.

Recombinant interferon-gamma has been used with some success as a pharmaceutical compound, especially against certain viral infections and tumors. Recombinant interferon-gamma is usually administered parenterally, preferably by subcutaneous injection. The maximum serum concentration was established after seven hours, the plasma half-life was 30 minutes after intravenous administration. Therefore, effective treatment with recombinant interferon-gamma involves frequent injection. The main side effects are fever, cold, sweating, headache, myalgia and drowsiness. These effects are associated with the injection of recombinant interferon-gamma and are observed in the first hours after injection. Rare side effects are local pain and erythema, increased liver enzymes, reversible granulo- and thrombopenia, and cardiotoxicity.

WO 01/36001 describes novel neat interferonam compounds comprising a non-peptide moiety bound to the interferon polypeptide that is modified by introducing and / or deleting attachment sites for such non-peptide moieties, for example, polyethylene glycol and glycosylated sites.

It is known that when N-glycosylated molecules, such as interferon-gamma, are produced in a glycosylating host, not all potential sites of N-glycosylation are used. This means that too often a mixture of proteins with a variable degree of in vivo N-glycosylation is obtained, which leads to the conclusion that further purification is required. Moreover, time is often consumed and it is difficult to separate identical proteins with variable * · · · · · · · · · · · · · · · · · · · · · · Degree of glycosylation. * Excess over ££ Csc5 < 5 > It is understood that substitution of one or more amino acid residues localized near the in vivo site for N-glycosylation (regardless of whether said N-glycosylation site is naturally present in interferon-gamma, or whether an in vivo N-glycosylation site is introduced as described in WO 01/36001) -g For sake fraction of fully glycosylated molecules of interferon-gamma. In particular, changing the naturally occurring N-glycosylation site N-Y-S at positions 97, 98 and 99 of human interferon-gamma in N-Y-T dramatically increases the fraction of fully glycosylated interferon-gamma molecules.

SUMMARY OF THE INVENTION

Therefore, the first aspect of the present invention relates to an interferon-gamma polypeptide variant exhibiting interferon-gamma activity and having the amino acid sequence shown in SEQ ID ΝΟ.Ί ([S99T] hulFNG) or an fragment exhibiting interferon-gamma activity.

In another aspect, the present invention relates to a variant of SEQ ID NO: 1 comprising a variant of fragments of SEQ ID ΝΟ.Ί (such as SEQ ID NO: 2-16), said variant comprising at least one modification and exhibiting interferon-gamma activity.

In other aspects, the present invention relates to a nucleotide sequence encoding the polypeptide variant of the present invention.

In other aspects, the present invention relates to an expression vector of a nucleotide sequence according to the present invention, and to glycosylated host cell comprising the nucleotide • ·· · · ♦ · ··· » ·· · · ······ _is The sequence according to the invention or expression vector according to the present invention.

The present invention also relates to a pharmaceutical composition comprising the polypeptide variant of the present invention, a polypeptide variant of the present invention, or to the pharmaceutical composition of the present invention for use as a medicament.

In other aspects, the present invention relates to the use of the polypeptide variant of the present invention, or to the use of the pharmaceutical composition according to the present invention for the manufacture of a medicament for the treatment of interstitial pulmonary diseases.

Similarly, the present invention also relates to a method for treating or preventing interstitial pulmonary diseases, wherein said method comprises administering to a mammal, in particular a human, an effective amount of the polypeptide variant of the present invention or the pharmaceutical composition according to the present invention.

Another aspect of the present invention relates to a population of interferon-gamma polypeptide variants, or to a composition comprising a population of interferon-gamma polypeptide variants, said population comprising at least 70% of the interferon-gamma polypeptide variant of the present invention.

In another aspect, the present invention relates to a method for enhancing the degree of in vivo N-glycosylation of a parent interferon-gamma polypeptide comprising at least one in vivo N glycosylation site with the NXS amino acid sequence, wherein X is an amino acid residue, except of proline, characterized in that said method involves the substitution of the serine residue in said amino acid sequence of the CG-X - $ * bridge with the threonine residue, to obtain of the interferon-gamma variety.

In another aspect, the present invention relates to a method for producing an interferon-gamma polypeptide variant of the present invention, wherein said method comprises (a) growing a glycosylating host cell comprising a nucleotide sequence that encodes an interferon-gamma the polypeptide variant of the present invention, under conditions for expressing the polypeptide variant;

(b) the possible in vitro interaction of said polypeptide variant with the non-polypeptide moiety under conjugation conditions; and (c) restoration of the polypeptide variant.

From the description below, other aspects of the present invention will become apparent.

Description of the attached figures

Figure 1 depicts a Western blot of optimized glycosylated variants of recombinant human interferon-gamma.

Western blot left: Row 1: standard, Row 2: Actimmune®, Row 3: recombinant human interferon-gamma, Row 4: [E38N] recombinant human interferon-gamma. Western blot in middle: Row 1: standard, Row 2: recombinant human interferon-gamma, Row 3: [E38N + S40T] recombinant human interferon-gamma. Western blot right: Row 1: standard, Row 2: recombinant human interferon gamma, Row 3: [S99T] recombinant human interferon gamma, Row

4: [E38N + S40T + S99T] recombinant human interferon-gamma.

Figure 2 shows the interferon-gamma ACTIVIBST curve with respect to serum time after subcutaneous administration in rats.

·: Actimmune®, □: recombinant human interferon-gamma,

V: [E38N + S40T + S99T] recombinant human interferon-gamma.

All compounds were administered in the same dose (1.15x10 ⁷

AU / kg).

Figure 3 shows the curve of interferon-gamma activity versus serum time after subcutaneous administration in rats.

·: [N16C + S99T] recombinant human interferon-gamma (5 kDa bound mPEG);

□: [N16C + S99T] recombinant human interferon-gamma (10 kDa bound mPEG);

V: [E38N + S40T + S99T] recombinant human interferon-gamma.

The [E38N + S40T + S99T] version is administered at a dose of 4.6x10®

AU / kg.

Detailed description of the invention

Definitions

The following definitions are used in the present invention:

The term "conjugated compound" (or equivalent "conjugated polypeptide" or "conjugated variant") means a heterogeneous (in the sense of composite or chimeric compound) molecule obtained by covalently binding one or more polypeptide variants to one or more non-polypeptide moieties.

The term " covalent binding " means that the polypeptide variant and the non-polypeptide moiety are either directly linked to each other, or others are indirectly covalently linked to each other through a transverse moiety or moieties, such as a bridge, spacer or binding moiety or moieties. Preferably, the fused compound is soluble at appropriate concentrations and is soluble at appropriate concentrations. ··· · conditions, ie soluble in * physiological fluids * as blood. Examples of conjugated polypeptide variants of the present invention include glycosylated and / or polyethylene glycolylated polypeptide variants. The term "unpaired polypeptide variant" may be used to refer to the polypeptide moiety of the conjugated polypeptide variant.

The term " non-polypeptide moiety " means a molecule capable of coupling with a group attached to an interferon-gamma polypeptide species. Preferred examples of such molecules include polymer molecules, lipophilic compounds, sugar residues or organic derivatives. It is to be understood that the non-polypeptide moiety is linked to the polypeptide via a fixed group of the polypeptide variety. Unless the number of non-polypeptide moieties, such as polymer molecules, associated with the interferon-gamma polypeptide variant is explicitly indicated, any reference to a "non-polypeptide moiety" related to the interferon-gamma polypeptide variant or elsewhere in the present invention will pertain to one or more non-polypeptide moieties associated with the interferon-gamma polypeptide variant.

The term "polymeric molecule" means a molecule obtained by covalently linking two or three monomers, with none of the monomers being an amino acid residue. The term "polymer" can be used interchangeably with the term "polymer molecule".

The term "sugar moiety" means a carbohydrate molecule bound by in vivo or in vitro glycosylation, such as N- or O-glycosylation.

"N-glycosylation site" has the sequence NXS / T / C "where X is an amino acid residue except proline, N is asparagine and S / T / C is series, threonine or cysteine, preferably, serine or threonine, most preferably threonine. "O-glycosylation site" is the hydroxyl group of serine or threonine.

• · · · · · · · ·

The term "attached * group" means an amino acid residue capable of binding to a corresponding non-polypeptide moiety, such as a polymer molecule or sugar moiety. The table below shows useful attachment groups or their corresponding polypeptide moieties.

Attached group Amino- celery Examples of a non-polypeptide moiety PEG Coupling Method / Activation Literature -MN _Mr N-terminal, Polymer, mPEG-SPA Shearwater Inc. Lys e.g. PEG Trailed Delgado et al., mPEG critical reviews in Therapeutic Drug Carrier Systems, 9 (3,4): 249-304 (1992) -COOH C-extreme, Polymer, mPEG-Hz Shearwater Inc. Asp, Glu e.g. PEG Sugar Connectivity the rest in vitro -SH Cys Polymer, PEG-vinylsulfone Shearwater Inc. e.g. PEG PEG-maleimide Delgado et al., Critical reviews in Therapeutic Drug Carrier Systems, 9 (3,4): 249-304 (1992) Sugar Connectivity the rest in vitro -He Sir, Thr, Sugar O-connected OH-, Lys the rest glycosylation in vivo -conh ₂ Asn like Sugar Glycosylation part of the the rest in vivo place for N-glyco- silage Fragrant Phe, Tug, Sugar Connectivity the rest Tr the rest in vitro

• · · · · · · · · · · · • ···· • 9 · -CONHg Gin _ · · · · · · Sugar ..... the rest Connectivity in vitro Yan and Wold, Biochemistry, 1984, Jul 31; 23 (16): 3759-3765 Aldehyde Oxidized Polymer, Polyethylene- Andresz et al., 1973, Ketone carbohydrate e.g. PEG PEG-hydrazide glycation Macromol. Chem. 179: 301; WO 92/16555 WO 00/23114

Guanidino Arg Sugar Connectivity Lundblad and the rest in vitro Noyes, Chimical Reagents for Protein Modification, CRC Press Inc. Bottle Raton, FL Imidazole His Sugar Connectivity As for ring the rest in vitro guanidino

For in vivo N-glycosylation, the term "attached group" is used in an unconventional manner to indicate amino acid residues defining the N-glycosylation site (with the sequence NXS / T / C, where X is an amino acid residue, except for proline, N is asparagine and S (T / C is serine, threonine or cysteine, preferably serine or threonine (most preferably threonine). Although the aspartic residue at the N-glycosylation site is a place where a sugar residue is attached during glycosylation, such attachment cannot occur unless other amino acid residues at the N-glycosylation site exist. Therefore, when the non-polypeptide moiety is a sugar moiety and coupling is effected by N-glycosylation, the term "amino acid moiety comprising a moiety attached to the non-polypeptide moiety" used in connection with changes in the amino acid sequence of the interferon-gamma polypeptide should be understood one, two or all of the amino acid residues constituting the N-glycosylation site are

999 • 9 · 9 • 999

9 · 99

99 »· • 999

alters (m) in such a way that * or the moiety 1 N-glycosylation nucleus is introduced into the amino acid sequence separated from said sequence, or a functional N-glycosylation site is left in the amino acid sequence (e.g., by substituting the rest of the serine, which already forms part of the N-glycosylation site, with the threonine residue, and vice versa).

In the present invention, the names of the amino acids and the names of the atoms (e.g. CA, CB, CD, CG, SG, NZ, N, O, C, etc.) are used as described in Protein DataBank (PDB) ( www.pdb.org), based on the IUPAC Nomenclature and Symbolism for Amino Acids and Peptides, Eur. J. Biochem., 138, 9-37 (1984), together with their corrections in Eur. J. Biochem, 152, 1 (1985). CA sometimes means Cm and CB means Cp. The term "amino acid residue" means an amino acid residue included in a group consisting of alanine residues ( Ala or A), cis ein (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (No or I) , lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glugamine (Gin or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Vai or V), tryptophan (Tp or W) and tyrosine (Tug or Y).

The amino acid residue numbering herein is from the N-terminus of [S99T] human interferon-gamma without signal leptide (i.e., SEQ ID NO: 1) or, where appropriate, from the N-terminus of human interferon gamma (i.e. SEQIDN0: 17).

The terminology used to identify amino acid positions / substitutions is as follows: G18 means position 18 occupied by glycine in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 17. G18N means that the glycine residue of position 18 is replaced by Asn. Multiple substitutions are denoted by, for example, · · · · · · · · · · ·

G18N + S20T stands for 'amino acid sequence which includes

substitution of the glycine residue at position 18 with asparagine and replacement of the serine residue at position 20 with threonine. Alternative substitutions are denoted by For example, G18S / T covers the following individual substitutions: G18S and G18T. Deletion is indicated by an asterisk. For example, G18 * indicates that the glycine residue at position 18 is deleted. The insertions are denoted as follows: The insertion of an additional serine residue after glycine at position 18 is referred to as G18GS. Mixed substitutions and insertions are denoted as follows: Substitution of the glycine residue at position 18 with serine and insertion of Ala after the amino acid residue at position 18 is referred to as G18SA.

The term 'nucleotide sequence' means the sequential extension of two or more nucleotide molecules The nucleotide sequence may be of genomic origin, of cDNA, of RNA, of semi-synthetic or synthetic origin or of mixed origin.

The term "polymerase chain reaction" or "PCR" generally refers to a method for extending a desired nucleotide sequence in vitro, as described, for example, in US 4,683,195. In general, the "polymerase chain reaction" method involves sequential cycles of primary synthesis for extension using oligonucleotide nuclei capable of hybridizing preferentially to template nucleic acid.

"Cell", "host cell", "cell line" and "cell culture" are used interchangeably in the present invention, and it should be understood that all of these terms include progeny resulting from the growth or cultivation of the cell.

"Transformation" or "transfection" is used interchangeably to describe the process of introducing deoxyribonucleic acid into the cell.

• ·

J5 f · ···· • · · • · · · ·

nucleotide sequences by enzymatic ligature or otherwise, in such a configuration that normal sequence function is performed. For example, a nucleotide sequence encoding a precursor sequence or a secretory leader is operably linked to a nucleotide sequence for a polypeptide, if expressed as a preprotein, which is involved in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it acts on a copy sequence. ; a ribosomal binding site is operably linked to a coding sequence if positioned to facilitate transformation. Generally, "operably linked" means that the linked nucleotide sequences are adjacent and, in the case of a secretory leader, adjacent to the read phase. The binding is accomplished by ligature at suitable restriction sites. If no such sites exist, synthetic oligonucleotide adapters or binders shall be used in accordance with standard methods for recombinant deoxyribonucleic acid.

The term "modification" as used herein covers substitution, insertion and deletion.

The terms "mutation" and "substitution" are used interchangeably.

The term " introduction " means, above all, substitution of an existing amino acid residue, but may also mean insertion of an additional amino acid residue.

The term "removal" means, above all, substitution of an amino acid residue that makes room for another amino acid residue, but may also mean deletion (without replacement) of the amino acid residue being removed.

. .. · · 46 ......

· · · · · · 1 II.

... · · · · · · ···· ······!

· · · ·

The term amino acid " residue including attachment group for the non-polypeptide moiety " means that the amino acid moiety is that to which the non-polypeptide moiety binds (in case of insertion of an amino acid residue) or will be linked (in the case of removal of an amino acid residue).

The term "one difference" or "different from" when used in connection with specific modifications, allows the addition of differences present separately from the specific amino acid difference. Therefore, in addition to altering the amino acid residues described in the present invention, to optimize the administration of glycosylation or removal sites and / or introduction of amino acid residues comprising a non-polypeptide moiety attached, the interferon-gamma polypeptide variant may, if seronepe wishes to include other modifications not related to these changes. They may, for example, include sharpening the C-terminus with one or more amino acid residues, adding one or more additional amino acid residues at the Ν- and / or C-terminus, for example, adding a Met residue at the N-terminus, adding the Cys-TyrCys amino acid sequence at the N-terminus, as well as "conservative amino acid substitutions", they. substitutions carried out within groups of amino acids having the same characteristics, for example, small amino acids, acidic amino acids, polar amino acids, basic amino acids, hydrophobic amino acids and aromatic amino acids. Examples of conservative substitutions according to the present invention, in particular, are selected from the groups shown below in the Table.

• • · • • _____. _ -. __ · ,, „· J? · · · · · · · · · · · · · · · · · · · · ; Z ....... · • · · · · · · · · I 1 I Alanine (Α) ie ··· --Ί j Glycine (G) Serine (S) Threonine (T) 1 ! n Aspartinova j Glutamine i | acid (D) acid (E) 1 1 ! 3 ί Asparagine (N) Glutamine (Q) 1 1 1; i > Λ ί Η ί Arginine (R) ί Histidine (H) Lysine (K) D - ------- 1 1 ί j 5 ί. , ... Isoleucn (1) Leucine (L) Methionine (M) Valine (V) \ ¹ 6 ί -J phenylalanine (F) Tyrosine (Υ) Tryptophan (W) i 1

The term "at least one" used for the non-polypeptide moiety, amino acid residue, substitution, etc. means one or more.

The term "AUCsc" or "Area Under the Curve when administered subcutaneously" is used in its usual meaning, i.e. as an area under the serum-time interferon activity curve where the interferon-gamma polypeptide variant is administered subcutaneously, in particular when administered subcutaneously to rats. Once determined, the experimental points of the interferon activity-time curve, AUCsc can be easily calculated with a computer program such as GraphPad Prism 3 01.

The term "functional in vivo half-life" is used in its usual meaning, i.e. the time at which 50% of the biological activity of the polypeptide in the body / attacked organ still exists, or the time at which the activity of the polypeptide is 50% of the original value.

As an alternative to the determination of functional in vivo half-life. serum half-life can be determined, i. the time that 50% of the polypeptide circulates in the plasma or bloodstream before it is purified. Determination of serum half-life is often simpler than determination of serum half-life. functional in vivo half-life, and the magnitude of serum half-life is usually a good indication of the magnitude of functional in vivo half-life. Alternative terms for serum half-life include plasma half-life, ”.18

circulating half-life, "serum clearance, plasma clearance, and clearance half-life" The serum half-life can be conveniently determined in rats, see the Materials and Methods chapter. It is important to note that the term "serum half-life" used in the present invention for a polypeptide variant of interferon-gamma should be defined for a sample that is administered intravenously.

The term "serum" is used in its usual meaning, i.e. it refers to blood plasma without fibrinogen and other clotting factors

The polypeptide is usually cleared by the action of one or

more than the reticuloendothelial systems (RES), kidney, spleen or liver, or by specific or nonspecific proteolysis. The term "renal clearance" is used in its usual meaning to indicate renal clearance, for example, by glomerular filtration, tubular excretion, or tubular elimination. Typically, renal clearance depends on the physical characteristics of the polypeptide, including molecular weight, size (with respect to the glomerular filtration valve), symmetry, shape / hardness, loading.

attached carbohydrate chains and the presence of cellular receptors for the polypeptide. A molecular weight of about 67 kDa is normal for the value of the re-purge valve. Renal clearance can be measured by any suitable assay, for example, established in vivo assay. For example, renal clearance can be determined by administering a labeled (e.g., radiation-labeled or fluorescently labeled) conjugated polypeptide to a patient and measuring the activity of the mallet in the urine collected by the patient. Reduced renal clearance is determined relative to a comparator molecule such as human interferon-gamma, [S99T] human interferon-gamma. or Actimmune®. the delayed functionality is usually selected between

antiviral, antiproliferative, immunomodulatory or interferon-gamma receptor binding activity.

The term " elevated " used for functional half-life or serum half-life is used to indicate that the corresponding half-life of the interferon-gamma species is statistically significantly increased with respect to that of a comparative molecule, such as glycosylated human interferon-gamma (SEQ ID NO: 17), glycosylated [S99T] human interferongam (SEQ ID NO: 1) or Actimmune® (SEQ ID NO'34 - produced in E cob) when administered intravenously and when determined under comparative conditions. Therefore, interesting interferon-gamma polypeptide variants are those variants that have increased functional in vivo half-life or increased serum half-life compared to any of the above-mentioned comparator molecules.

In particular, the interferon-gamma polypeptide variants of interest are those species in which the ratio between the serum half-life (or functional in vpo half-life) of said variety and the serum half-life (or functional in vivo half-life) of human interferon-gamma or [S99T] interferon gamma in their glycosylated forms is at least 1.25, preferably at least 1.50, such as at least 1.75. for example, at least 2, more preferably at least 3, at least 4, for example, at least 5, when administered intravenously. in particular when administered intravenously to rats.

Other examples of interesting interferon-gamma polypeptide variants are those variants in which the relationship between the serum half-life (or functional in vivo half-life) of said variety and the serum half-life (or functional half-life) of Actimmune® (SEQ ID NO: 34 - products in E cob) is at least 2, more preferably at least 3, such as at least 4, for example, at least 5, more preferably at least 6, at least 7, for example, at least 8, and most preferably at least 9 , such as

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · At least 10 when administered 'intravenously , in particular when administered intravenously to rats

The term "elevated" when used for AUCsc is used to indicate that the Area Under the Curve when administered subcutaneously of the interferon-gamma variety of the present invention when administered subcutaneously is statistically significant increased relative to that of a comparator such as glycosylated human interferon-gamma (SEQ ID NO: 17), glycosylated [S99T] human interferon-gamma (SEQ ID NO: 1) or Actimmune® (SEQ ID NO: 34) E coA) determined under comparative conditions. Therefore, the preferred interferon-gamma variants are those variants that have an increased AUCsc compared to any of the above comparator molecules. Obviously, the same amount of interferon-gamma and comparator molecule should be administered for the interferon-gamma variety of the invention. Therefore, in order to make a direct comparison between different interferon-gamma molecules, AUCsc values should be normalized, i.e. they should be expressed as AUCsc / administered dose.

Particularly preferred interferon-gamma polypeptide variants are those species in which the ratio between the AUCsc of said variety and the AUC _sc of glycosylated human interferon-gamma or glycosylated [S99T] human interferon-gamma is at least 1.25, such as at least 1.5, for example, at least 2. more preferably at least 3, at least 4, for example, at least 5, more preferably at least 7, at least 8, for example, at least 9 or at least 10, and most preferably at least 12, at least 14, for example, at least 16 or at least 20, especially when administered subcutaneously to rats.

Other examples of particularly interesting interferon-gamma polypeptide variants are those varieties in which the ratio between the AUC _sc of said variant and the AUC _sc of Actimmune® is at least 100, more

«· · • · · • · • · • · • · • • · • ..21 • · • · • · • · • · ···· • · · • · · • · · · • · · · • · · · prefer, at least 150, • · · · · as at least '200, for example. at least 250, even more se prefer, at least 300, as at least 400, for example, at least 500, and most of all se prefer, at least 750, as at least 1000, for example, at least 1500 or at least 2000.

especially when administered subcutaneously to rats.

The term "T _m ax, sc" is used to refer to the time of activity of interferon-gamma in the serum curve - the time when the highest activity of interferon-gamma in serum is observed. Preferred interferon-gamma polypeptide variants are those variants that have an increased _{Tma <sc} compared to Actimmune® and / or to glycosylated human interferon gamma. In particular, these preferred variants have Tmax.sc (when determined after subcutaneous administration to rats) for at least 200 minutes, such as at least 250 minutes, for example, at least 300 minutes, more preferably at least 350 minutes, such as at least 400 minutes.

The term "reduced immunogenicity" indicates that the interferon-gamma polypeptide variant enhances a measurably lower immune response with respect to a comparator molecule, for example, human interferon or Actimmune®, determined under comparative conditions. The immune response can be a response of a cell or antibody (see, e.g., Roitt: Essentia! Immunology (8 ^th Edition, Blackwell) for further definition of immunogenicity). Generally, decreased antibody reactivity is an indication of reduced immunogenicity. Reduced immunogenicity can be determined using a method known in the art, for example, in vivo or in vitro.

In the context of the present invention, the terms "increased glycosylation", "increased degree of in vivo N-glycosylation" or "increased degree of N glycosylation" mean elevated levels of bound carbohydrate molecules typically obtained as a consequence of increased (or better) use of glycosylation sites. It is known (Hooker et al., 1998, J. Interferon and Cytokine Res. 18, 287-295; Sarenva et al., 1995, Biochem ···· · ·· · ♦ ······ ♦: ::.:::.:: '·::: .. · · · _{# <} · ·,. ·

J., 308, 9-14) that when * interferon-gamma is expressed in CAO cells, only about 50% of interferon-gamma molecules use both glycosylation sites, about 40% use a single glycosylation site ( 1N) and about 10% are not glycosylated (0N). The increased degree of in vivo N-glycosylation can be determined by a method known in the art, for example, by SDS-PAGE. A convenient assay for determining elevated glycosylation is the method described in the "Determination of elevated glycosylation" section in Materials and Methods.

The term "population of interferon-gamma polypeptide variants" or "composition comprising a population of interferon-gamma polypeptide variants" refers to a composition comprising at least two interferon-gamma polypeptides, glycosylated to different degrees. As is to be understood, the present invention relates to methods of producing a population of interferon-gamma polypeptides in which an increased amount of interferon-gamma molecules present in the population are completely glycosylated.

Therefore, the present invention also relates to a homogeneous population of interferon gamma polypeptides according to the present invention (ie a population in which most of the interferon gamma polypeptides are completely glycosylated) or to a composition comprising a homogeneous population of interferon gamma polypeptides according to the present invention. For example, the population of interferon-gamma polypeptides may include at least 70% of the interferon-gamma polypeptide of the present invention, preferably at least 75%, such as at least 80%, for example, at least 85%, more preferably at least 90%, such as at least 95%, for example, at least 96%, more preferably at least 97%, such as at least 98%, for example, at least 99%.

The term 'interferon-gamma' activity means that the polypeptide variant possesses one or more of the functions of the natural human interferon-gamma or of the recombinant human interferon-gamma. · · · · · · · · · Interferon-gamma, including the ability to bind to the interferon-gamma receptor and cause transduction of interferon-gamma. the signal transduced by binding of the human interferon-gamma to its receptor, as determined by µl / zfro or in vivo (i.e., in vitro or in vivo bioactivity). The interferon-gamma receptor has been described by Aguet et al. (Cell 55: 273-280, 1988) and Calderon et al. (Proc. Natl. Acad. Sci. USA 85: 4837-4841, 1988). A suitable assay for the study of interferon-gamma activity is the assay called "Primary Assay" described in the present invention. When using the primary assay described in the present invention, the polypeptide variant "exhibiting interferon-gamma activity" has a specific activity of at least% compared to that of recombinant human interferon-gamma. It should be understood that, depending on what modifications are made, for example, whether the variety is polyethylene glycolated or not, activity can be achieved over a wide range. Therefore, examples of specific activity can range from 5% to 150% compared to recombinant human interferon-gamma. For example, the specific activity may be at least 10% (e.g., 10-125%), such as at least 15% (e.g., 15-125%), for example, at least 20% (such as 20-125%), at least 25% (e.g. , 25-125%). at least 30% (e.g., 30-125%), at least 35% (e.g., 35-125%), at least 40% (e.g., 40-125%), at least 45% (e.g., 45-125%), at least 50 % (e.g., 50-125%), at least 55% (e.g., 55-125%), at least 60% (e.g., 60-125%), at least 65% (e.g., 65-125%), at least 70% ( for example, 70-125%), at least 75% (eg, 75-125%), at least 80% (eg, 80-125%) or at least 90% (eg, 90 110%), compared to the specific activity of the recombinant human interferon-gamma.

An "interferon-gamma polypeptide" is a polypeptide that exhibits interferon-gamma activity, i. E. the term "interferon-gamma polypeptide" has been used for any interferon-gamma molecule (whether that molecule is human interferon-gamma, its shape, or a variant thereof) for so long,

..24 • · • · • · · • · how many * Mentioned

an interferon-gamma molecule indicates interferon-gamma activity as defined in the present invention The term "interferon-gamma polypeptide" is used in the present invention as a polypeptide in monomeric or dimeric form, as appropriate. For example, when specific substitutions are determined, they are usually determined with respect to the monomer of the human interferon-gamma polypeptide. When compared to the interferon-gamma molecule of the present invention, it is usually in dimeric form (and, for example, contains two interferon- monomers,

gamma polypeptide modified as described). The dimeric form of interferon-gamma polypeptides can be obtained by the usual association of two monomers or may be in the form of dimeric single-stranded interferon polypeptide

The term starting interferon-gamma "means an interferon-gamma polypeptide having a glycosylation site improved according to the present invention. Although the parent polypeptide modified according to the present invention may be any interferon-gamma activity polypeptide and, therefore, be of any origin, for example, non-human, it is preferable that the parent polypeptide be human interferon-gamma with the amino acid the sequence shown in SEQ ID NO: 17 or a fragment thereof.

A "fragment" is part of a complete sequence of an interferon-gamma polypeptide (for example, a fragment of a human full-chain human interferon polypeptide shown in SEQ ID NO: 17 or a fragment of a [S99T] human interferon-gamma full-chain polypeptide variety, shown in SEQ ID NO: 1) showing interferon-gamma activity, for example, its C-terminal or N-terminal truncated variant. Specific examples of fragments of interferon-gamma polypeptide variant include the [S39T] human interferon-gamma polypeptide variant, at the C-terminus reduced by 1-

amino acid residues, for example, 1 * am * inocular residue (SEQ iD NO: 2), 2 amino acid residues (SEQ ID NO: 3), 3 amino acid residues (SEO ID NO: 4). 4 amino acid residues (SEQ ID NO: 5), 5 amino acid residues (SEQ ID NO: 6), 6 amino acid residues (SEQ ID NO: 7), 7 amino acid residues (SEQ ID NO: 8), 8 amino acid residues (SEQ ID NO: 8) NO: 9), 9 amino acid residues (SEQ ID NO: 10), 10 amino acid residues (SEQ ID NO: 11), 11 amino acid residues (SEQ ID NO: 12), 12 amino acid residues (SEQ ID NO: 13), amino acids residue (SEQ ID NO: 14), 14 amino acid residues (SEQ ID NO: 15) or 15 amino acid residues (SEQ ID NO: 16) and / or at the N terminus reduced by 13 amino acid residues. Specific examples of fragments of human interferon-gamma include human interferon gamma, which at the C-terminus is reduced by 1 15 amino acid residues, for example, 1 amino acid residue (SEQ ID NO: 19), 2 amino acid residues (SEQ ID NO: 20) , 3 amino acid residues (SEQ ID NO: 21), 4 amino acid residues (SEQ ID NO: 22), 5 amino acid residues (SEQ ID NO: 23), 6 amino acid residues (SEQ ID NO: 24), 7 amino acid SE residues (SEQ ID NO: 24) NO: 25), 8 amino acid residues (SEQ ID NO: 26), 9 amino acid residues (SEQ ID NO: 27), 10 amino acid residues (SEQ ID NO: 28), 11 amino acid residues (SEQ ID NO: 29). 12 © amino acid residues (SEQ ID NO: 30), amino acid residues (SEQ ID

NO: 31), 14 amino acid residues (SEQ ID NO: 32) or 15 amino acid residues (SEQ ID NO: 33) and / or at the N-terminus reduced by 1-3 amino acid residues.

As shown above, the interferon-gamma polypeptide variant may include at least one modification in addition to the S99T substitution, whereas said variant exhibits interferon-gamma activity, i. the variant may be a [S99T] human interferon-gamma polypeptide variant or a fragment of a [S99T] human interferon-gamma polypeptide variety. Specific examples of such

The variants are variants having introduced and / or removed amino acid residues including an attached group to the non-polypeptide moiety. Other examples of [S99T] human interferon-gamma polypeptide variant (or fragments thereof) are those described in the Background of the Invention, above, which include, for example, [S99T] human interferon-gamma polypeptide variant with addition at the N-terminus of Cys-Tyr-Cys or Met, and cysteine-modified variants described in US 6,046,034.

Typically, the variants of the present invention are encoded by a nucleotide sequence that, in comparison with the nucleotide sequence encoding the parent interferon-gamma polypeptide, is modified according to the present invention.

However, this is not always the case since the polypeptide variant may undergo C- or N-terminal truncation during post-displacement processing, for example by C- or N-terminal cleavage of proteases in the cell, in the expression environment , during purification, etc., so that the resulting polypeptide variant is a truncated version of the originally obtained polypeptide variant (e.g., although a full length variant is first obtained, a truncated polypeptide can be obtained variety, Depending on the processing after moving the polypeptide variant of the full length). In this case, 'starting' may mean a truncated form which is modified according to the present invention.

The term "variety" means a polypeptide that differs by one or more amino acid residues from the parent polypeptide (usually SEQ ID NO: 17 or any other truncated form thereof shown in SEQ ID NO: 19-33), typically 1-15 amino acid residues (such as by 1, 2. 3, 4. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid residues), for example, by 1-10

_a · ·> 27 a <. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · amino acid residue or 1-3 amino acid residue.

The term functional site means one or more amino acid residues that are of great importance for inclusion in the function or expression of interferon-gamma These amino acid residues are &quot; placed at the functional site. The functional site can be determined by methods known to those skilled in the art, preferably by analyzing the structure of the polypeptide coupled complexly to the corresponding receptor, such as the interferon-gamma receptor.

The term &quot; human interferon-gamma &quot; means the advanced form of a non-fertile human interferon-gamma species having the amino acid sequence shown in SEQ ID NO: 17.

The term "recombinant human interferon-gamma" means the advanced form of a non-fertile human interferon-gamma species having the amino acid sequence shown in SEQ ID NO: 17, which is obtained by recombinant method.

The term "[899T] human interferon-gamma" means the advanced form of a non-fertile type of human interferon-gamma in which the serine residue at position 99 is replaced by the threonine residue (shown in SEQ ID NO: 1).

As used herein, the term "glycosylated human interferon gamma" means that the human interferon gamma polypeptide is produced in a cell capable of glycosylating the polypeptide and, therefore, the human interferon gamma polypeptide is glycosylated at its native sites for N-glycosylation. and 97 of SEQ ID NO: 17)

Similarly, the term "glycosylated variety of human interferon-gamma" means that the interferon-gamma polypeptide variety is produced in a cell capable of glycosylating the polypeptide variety.

• · · · · · · · · · · · · · · · e • · · • · · · · »

Used • · · · · »·· ·· ··· in the present • ·. The invention term 'Actimmune® refers to 140 amino acid form (Actimmune® is truncated at the C terminus by 4 amino acid residues and includes one N-terminal Met residue) of the interferongam (shown in SEQ ID NO: 34) fermentation of the genetically engineered bacterium £ cob. More information on

Actimmune® can be found at www, actimmune.com.

INTERFERON-GAMA POLYPEPTIDE VARIETY, ACCORDING TO

The present invention

The interferon-gamma variety according to the present with optimized vivo glycosylated sites

As shown above. it is surprisingly found that glycosylation of the naturally occurring N-glycosylation site at human interferon-gamma position 97 can be enhanced, i. an enhanced fraction of fully or almost fully glycosylated interferon-gamma molecules can be obtained by replacing the serine residue at position 99 of the human interferon gamma (or fragments thereof) with threonine. Consideration of Figure 1 shows that a significant increase in the degree of fully glycosylated interferon-gamma polypeptide can be achieved. For the [899T] human interferon-gamma (SEQ ID NO: 1) polypeptide variant, it can be seen that two glycosylation sites are completely glycosylated in about 90% of the polypeptide species present in cultivated media, whereas only about 60% recombinant human interferon-gamma polypeptides present in the culture medium are completely glycosylated.

Therefore, in the first aspect, the present invention relates to an interferon-gamma polypeptide variant exhibiting interferon activity and having the amino acid sequence shown

SEQ ID NO: 1 (i.e., [SlfelT human interferon-gamma) or a fragment thereof exhibiting interferon-gamma activity. · · · · · · · · · · · · · · · · · · · · · · · · ·

As discussed above, it is known that the C-truncated forms of human interferon-gamma remain active and, in some cases, even have increased activity as compared to human interferon-gamma. Therefore, an interesting aspect of the present invention relates to the interferon-gamma polypeptide variant of the present invention, which is a fragment of SEQ ID NO: 1, C-terminally truncated by 1-15 amino acid residues, generally, C-terminally truncating by 1 -10 amino acid residues. Specific examples of such truncated forms of SEQ ID NO: 1 are described in SEQ ID NO: 2-16. The interferon-gamma polypeptic fragment according to this aspect of the present invention exhibits interferon-gamma activity.

It should be understood that the glycosylated interferon-gamma lolipeptide variants of this aspect of the present invention should be expressed recombinantly in gpcosylating host cells, preferably in mammalian host cells, such as some described in the section "Binding to a sugar residue ".

As explained above, only about 50-60% of the entire population of expressed interferon-gamma polypeptides are fully glycosylated when recombinant human interferon-gamma is expressed in CHO cells. Therefore, one of the main advantages of the interferon-gamma polypeptide variants of the present invention is the greater application of position 97 at the vivo N-glycosylation site, which results in a more homogeneous population than human interferon- range. Due to the more homogeneous population, compositions (e.g., culture medium) comprising such a population of interferon-gamma lollipptide species do not require heavy and time-consuming purification as in recombinant human interferon-gamma.

·· «·

Therefore, another aspect of the * present invention relates to a population of interferon-gamma polypeptide variants, or to compositions comprising a population of interferon-gamma polypeptide species, characterized in that said population comprises at least about 70% of the interferon-gamma polypeptide a variety according to the present invention. The composition is preferably comprised of at least 75%, more preferably at least 80%, more preferably at least 85%, such as about 90% of the interferon-gamma polypeptide variant of the present invention.

In particular, the present invention relates to a population of interferon-gamma polypeptide variants, or compositions comprising a population of interferon-gamma polypeptide species, characterized in that said population comprises at least about 70%, preferably at least 75% , more preferably at least 80%, even more preferably at least 85%, with about 90% of the interferon-gamma polypeptide variant having the amino acid sequence shown in SEQ ID NO: 1.

Similarly, the present invention also relates to a population of interferon-gamma polypeptide variants, or compositions comprising a population of interferon-gamma polypeptide species, characterized in that said population comprises at least about 70%, preferably at least 75%. more preferably at least 80%, even more preferably at least 85%, with about 90% of the interferon-gamma polypeptide variant having the amino acid sequence selected from the group consisting of SEQ ID NO: 1. SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16.

f <31 ·· <·· «« · · <

• · · · · · · · · · · · · · · · · · · · · · · · · · · ·

In addition to the aforementioned S99T mutation required to optimize the in vivo N-glycosylation site at position 97 in recombinant human interferon-gamma, other in vivo glycosylation sites introduced into SEQ ID NO: 1 can also be optimized. or fragments thereof (eg, to increase serum half-life and / or increase AUCsc) · Generally, the in vivo glycosylation site is a site for in vivo N-glycosylation, but also an O-glycosylation site according to the present invention. This optimization can be achieved by performing a modification, preferably substitution, at a position localized near the glycosylation site, in particular near the in vivo N-glycosylation site. Typically, such a site for in vivo N-glycosylation is a site for in vivo N-glycosylation. Specific examples of suitable insertion positions for in vivo N glycosylation sites are described in WO 01/36001 and below in the present invention.

The amino acid residue "localized near" the glycosylation site is generally in the -4, -3, -2, -1, +1, +2, +3 or +4 position relative to the amino acid residue of the glycosylation site to which attach a carbohydrate, preferably in the -1, +1 or +3 position, in particular the +1 or +3 position. Therefore, the amino acid residue localized near the in vivo N-glycosylation site (in sequence NXS / T / C) may be at position -4, -3, -2, -1, +1, +2, +3 or +4, relative to the N-residue.

When the +2 position with respect to the N-residue is modified, it should be understood that only a limited number of modifications are possible, since in order to maintain / introduce a site for in vivo N-glycosylation, the amino acid residue in said position can be Ser, Thr or Cys.

A particularly preferred aspect of the present invention relates to a modification of the amino acid residue at position +2 with respect to the in vivo N-glycosylation site which is substituted when said

, .. · ·· ³² * ····.:. * ·:::: ::. · •::

amino acid ocTaftk 'de replaced with thr residue. If. on the other hand, said amino acid residue is already a Thr residue, it is normal not to prefer or need any substitution at this position. When X is modified, X should not be Pro and preferably not Tr, Asp, Glu and Leu. Moreover, the amino acid residue that is introduced is preferably selected from the group consisting of Phe, Asn, Gin, Tyr, Vai, Ala, Met, He, Lys, Gly, Arg, Thr, His, Cys and Ser , more preferably, Ala, Met, lie, Lys, Gly, Arg, Thr, His, Cys and Ser, in particular, Ala or Ser.

When position +3. with respect to the N-residue is modified, the amino acid residue to be introduced is preferably selected from the group consisting of His, Asp, Ala, Met, Asn, Thr, Arg, Ser and Cys, more preferred , Thr, Arg, Ser and Cys. These modifications are significant if the X residue is Ser.

Therefore, with respect to naturally occurring in vivo N glycosylation, it can be seen that the N-glycosylation site at position 97 must be optimized by carrying out a modification, such as substitution, at a position selected from the group consisting of E93, K94, L95, T96, Y98, V100 and T101 (ie in positions -4, -3, -2, -1, +1, +2, +3 or +4, with respect to N97). Specific examples of substitutions at position 98 of SEQ ID NO: 1 (or fragments thereof) include Y98F, Y98N, Y98Q, Y98V, Y98A, Y98M, Y98I, Y98K, Y98G, Y98R, Y98T, Y98H, Y98C and Y98S, preferably. Y98A, Y98M, Y98I, Y98K, Y98G, Y98R, Y98T, Y98H, Y98C and Y98S, in particular, Y98S. Specific examples of substitutions at position 100 of SEQ ID NO: 1 (or fragments thereof) include V100H, V100D, V100A, V100M, V100N, V100T, V100R V100S and V100C, in particular, V100T, V100R V100S and V100C.

Similarly, with respect to the in vivo N-glycosylation site at position 25, it can be seen that this site can be optimized by carrying out a modification, such as substitution, at a position selected from the group consisting of D21, V22, A23, D24, G26, L28 and F29 (ie in positions -4, -3, ·· • »• · • 9

..33 «· · · · · · · · · · · · · · · · · · · · · ·

2. -1, +1, +2, +3 or * 4 * 4, * with respect to * N25). Specific examples of substitutions at position 25 of SEQ ID NO: 1 (or fragments thereof) include

G26F, G26N, G26Y, G26Q, G26V, G26A, G26M, G26I, G26K, G26R. G26T, G26H, G26C and G26S, preferably, G26A, G26M, G26I, G26K, G26R, G26T, G26H, G26C and G26S, more preferably G26A and G26S, in particular G26A. Specific examples of substitutions at position 28 of SEQ ID NO: 1 (or fragments thereof) include G28H, G28D, G28A, G28M, G28N, G28T, G28R, G28S or G28C, in particular, G28A, G28T, G28R, G28S or G28C .

Obviously, any of the modifications mentioned in connection with

optimization of glycosylation at position 97 may be combined with any of the above modifications carried out in connection with the optimization of glycosylation at position 25.

Interferon-gamma variants of the present invention, ____ with increased AUCsc and / or serum half-life

Another aspect of the present invention relates to an interferon polypeptide variant. having the amino acid sequence shown in SEQ ID NO: 1, wherein said variant exhibits interferon-gamma activity.

Moreover, the present invention also relates to an interferon-gamma polypeptide fragment having the amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4. SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16, wherein said variant exhibits interferon-gamma activity.

Therefore, such a variant includes at least one modification with respect to SEQ ID NO: 1-16.

• «ί - ····.

In order to avoid too much protein (S) in the structure and function of the [S99T] human interferon-gamma polypeptide variant (or fragments thereof), the total number of amino acid residues that are altered according to the present invention does not typically exceed 15. Generally, interferon gamma polypeptide variant includes 1-10 modifications with respect to the amino acid sequence shown in SEQ ID NO: 1, such as 1-8, 2-8, 1-5, 1-3 or 2-5 modifications with respect to the amino acid sequence shown in SEQ ID NO: 1. Modifiers are preferred It should be understood that this refers to variants of fragments of an interferon-gamma polypeptide variant having the amino acid sequence shown in SEQ ID NO: 1. Therefore, when the variant is a variant of any of the sequences described in SEQ ID NO: 2-16, such a variant typically includes less than 15 modifications, typically 1-10 modifications, with respect to the amino acid sequence shown in SEQ ID NO: 2-16, such as 1- 8, 2-8, 1-5, 1-3 or 2-5 amino acid modifications acid sequence shown in SEQ ID N0: 216. It is preferred that the modification (s) is (are) a substitute.

Therefore, such an interferon-gamma polypeptide variant (i.e., a variant comprising at least one modification in addition to the S99T substitution) contains an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 1 (or fragments thereof) by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid residues.

In a preferred aspect of the present invention, the interferon-gamma variant also includes at least one introduced and / or at least one distinct amino acid residue, includes a moiety attached to the non-polypeptide moiety.

By removing or introducing an amino acid residue containing a group attached to the non-polypeptide moiety, it is possible for the polypeptide to be specifically triplet & T, so that the molecule becomes susceptible to coupling with the selected non-polypeptide moiety and optimizes conjugation for example, to provide an optimal distribution of non-polypeptide moieties on the surface of an interferon-gamma polypeptide variant) and, therefore, to obtain a novel conjugated molecule that exhibits interferon-gamma activity and, in addition, we, one or more improved properties, compared to the molecules known today on the basis of human interferon-gamma or recombinant human interferon-gamma. For example, when introducing attachment groups, the interferon-gamma polypeptide variant is enhanced or otherwise altered by the content of specific amino acid residues to which the corresponding non-polypeptide moiety is attached, thereby achieving a more efficient, specific and / or wide coupling. By removing one or more attachment groups, it is possible to avoid coupling with the non-polypeptide moiety in portions of the polypeptide in which such coupling is not desirable, for example, with an amino acid residue localized at or near the functional site of the polypeptide (since coupling in such a site results in the inactivation or reduction of interferon-gamma activity of the resulting fusion polypeptide due to impaired receptor recognition). Moreover, it is advantageous to separate an attachment group located close to another attachment group to avoid heterogeneous coupling of these groups. In preferred embodiments, more than one amino acid residue of an interferon-gamma polypeptide is altered, for example, the change comprises separation as well as introduction of amino acid residues including attachment sites for the selected non-polypeptide moiety. This aspect is of great interest since it is possible to specifically design the interferon-gamma polypeptide variant to obtain optimal pairing with the non-polypeptide moiety.

·· · ** · * * * · · ···· •• and ······.

:::

In addition to the removal and / or introduction of amino acid residues, the polypeptide variant may include other modifications, for example, substitutions that do not relate to the removal and / or introduction of amino acid residues including attached groups to the non-polypeptide moiety. Examples of such modifications include conservative amino acid substitutions and / or introduction of Cys-Tyr-Cys or Met at the N-terminus.

The exact number of coupling moieties present in the interferon-gamma dimeric form of the polypeptide variant depends on the effect desired to be achieved upon coupling. The effect obtained, for example, depends on the nature and extent of the coupling (e.g., the identity of the non-polypeptide moiety, the number of non-polypeptide moieties desired and which may be related to the lolipeptide, where they should be coupled or where the binding should be avoid, etc.).

It should be understood that an amino acid residue comprising a moiety for the non-polypeptide moiety, whether removed or introduced, is selected on the basis of the nature of the non-polypeptide moiety selected and, in most cases, based on the conjugation method used. For example, when the non-polypeptide moiety is a polymeric molecule, such as derived from polyethylene glycol or polyalkylene oxide, an amino acid residue capable of functioning as a attached group may be selected from the group consisting of cysteine, lysine, aspartic acid, glutamic acid and arginine. In particular, cysteine is preferred. When the non-polypeptide moiety is a sugar moiety, the attached group is, for example, a site for in vivo glycosylation, preferably, a site for N-glycosylation.

Whenever introduced into or separated from an interferon-gamma polypeptide having the amino acid sequence shown as SEQ ID NO: 1 (or fragments thereof), the attached group for the non-polypeptide moiety is the · · · · · · · of the polyggetgid, «oyav'se * m0ikf14cyra, is selected as follows:

Preferably, the position is located on the surface of the interferon-gamma polypeptide and more preferably occupied by an amino acid residue to which more than 25% of its side chain is exposed to the solvent, preferably more than 50% of the side its chain is exposed to the solvent, based on the 3D structure or interferon-gamma model in its dimeric form, the structure or model may include one or two interferon-gamma receptor molecules. These positions are exemplified in Example 1 below in the present invention.

It is also of interest to modify some of the 23 terminal amino acid residues of the starting interferon-gamma (in particular by introducing amino acid residues including a non-polypeptide moiety, such as cysteine residues), since these residues are believed to be are located on the surface of the interferon-gamma polypeptide.

In addition, it would be interesting to modify one or more amino acid residues localized in the loop regions of the interferon polypeptide, since most amino acid residues localized in the loop regions are exposed to the surface and localized substantially far from functional sites, so that non-polypeptide moieties, such as polymeric molecules, in particular polyethylene glycol molecules and / or N-glycosylation sites, can be introduced without impairing the function of the molecule. These stitched areas can be identified by expectation for the three-dimensional structure of the human interferon-gamma. The amino acid residues constituting said loops are residues N16K37 ("AB-loop"), F60-S65 ("BC-loop"), N83-S84 ("CD-loop") Y98-L103 ("DE loop") ).

· · · · ·

The amino acid residues of the interferon-gamma receptor binding site are Q1, D2, Y4, V5, E9, U12, G18, H19, S20, D21, V22, A23, D24, N25, G26, T27 , L30, K34, K37, K108, H111, E112, 1114, Q115, A118, E119 (see also Example 2, below). In general, it is preferred that the attached groups to the non-polypeptide moiety (such as additional sites for N-glycosylation and / or cysteine residues) are not introduced at this site of the molecule.

In order to determine the optimal distribution of the attached groups, the distance between the amino acid residues localized on the surface of the interferon-gamma polypeptide is cleaved based on the 3D structure of the interferon-gamma dimeric polypeptide. In particular, the distance between the CB of the amino acid residues comprising these attached groups is determined, or the distance between the functional group (NZ for lysine, CG for aspartic acid, CD for glutamic acid, SG for cysteine) of one and CB for the other amino acid residue , which includes an attachment group. In the case of glycine, CA is used instead of CB. In the interferoname polypeptide portion of the fusion compound of the present invention, it is preferred that some of said distances be greater than 8 A, in particular greater than 10 A, to avoid or reduce heterogeneous coupling.

Also, the amino acid sequence of the interferon-gamma polypeptide may be different from that of SEQ ID NO: 1 (or fragments thereof) in that one or more amino acid residues constituting part of the epitope are separated, preferably, by substitution of an amino acid residue comprising an attachment group with a non-polypeptide moiety such that the epitope is destroyed or inactivated. The epitopes of [S99T] human interferon-gamma, human interferon-gamma or recombinant human interferon-gamma can be identified by methods known in the art, also known as epitope mapping, see, Romagnoli et al., Biol. Chem., 1999, 380 (5): 553-9, DeLisser HM, Methods Mol. Biol., • · · * l:: · · · ·

1999, 96: 11-20. Van de Water et al., * GliR 1mrhur1 (5k.lYnmunopathol .. 1997, 85 (3): 229 35, Saint-Remy JM, Toxicology, 1997, 119 (1): 77-81 and Lane DP, Stephen CW , Curr Opin. Immunol., 1993, 5 (2): 268-71 A library of statistical oligopeptides of, for example, nine amino acid residues, IgG1 antibodies from specific antisera against [S99T] human interferon-gamma is observed by one method. , human interferon-gamma or recombinant human interferon-gamma, are purified by immunoprecipitation and reactive phages are identified by immunolabeling. the acid of the purified reactive phages, the sequence of the oligopeptide can be determined, followed by localization of the sequence on the 3D structure of interferon-gamma.The thus identified region on the structure contains an epitope and can then be selected as the desired region of introduction of the attached group for the non-polypeptide moiety.

Functional in vivo half-life and serum half-life are, for example, dependent on the molecular weight of the polypeptide variant and the number of attachment groups required to extend the half-life, therefore, depends on the molecular weight of the non-polypeptide moiety. In one aspect, the interferon-gamma polypeptide variant of the present invention has a molecular weight of at least 67 kDa, in particular at least 70 kDa, measured by SDS-PAGE according to Laemmli, U.K., Nature, Vol. 227 (1970), p. 680-85. Interferon-gamma has a molecular weight in the range of 34-50 kDa and, therefore, an additional about 20-40 kDa is required to obtain the desired effect This can be achieved, for example, by 2-4 10 kDa polyethylene glycol molecules or by combining additional in vivo glycosylation sites and additional polyethylene glycol molecules, or otherwise.

Preferably, the conjugated interferon-gamma polypeptide variant of the present invention includes MO (additional) non-polypeptide moieties, such as 1-8, 2-8, 1-5 13 or 2-5

(additional) non-polypeptide moieties * The commonly conjugated variety comprises 1-3 (additional) non-polypeptide moieties, such as 1, 2 or 3 (additional) non-polypeptide moieties.

As noted above, under physiological conditions, human interferon gamma exists as a dimeric polypeptide. The polypeptide is typically in a homodimeric form (e.g., obtained by associating two interferon-gamma polypeptide molecules prepared as described in the present invention). However, if desired, the interferon-gamma polypeptide variant can be obtained in the form of a single chain, where two interferon-gamma polypeptide monomers are linked via a peptide bond or peptide spacer. The preparation of the interferon-gamma polypeptide variant in the form of a single chain has the advantage that the two constituent interferon-gamma polypeptides may be different, which is an advantage, for example, when asymmetric mutagenesis of the polypeptides is performed. For example, polyethylene glycol binding sites may be removed from the receptor binding site of one of the monomers but remain in the other. Thus, after binding to polyethylene glycol, one monomer has an intact receptor binding site, while the other can be completely bound to polyethylene glycol (and hence, a significant increase in molecular weight).

The interferon-gamma variants of the present invention wherein the non-polypeptide moiety is a sugar residue

In a preferred aspect of the present invention, the interferoname variant of SEQ ID NO: 1 (or fragments thereof) includes at least one introduced glycosylation site and / or at least one removed glycosylation site. Preferably, the glycosylation site is a site for in vivo N-glycosylation, i. the non-polypeptide moiety is a sugar residue.

* · · · · ·. For example, a 0-linked II-linked sugar moiety, preferably an N-linked sugar moiety.

In an interesting aspect of the present invention, said variant includes at least one introduced glycosylation site, specifically, an introduced site for in vivo N-glycosylation. Preferred. The introduced glycosylation site should be introduced by substitution.

For example, a site for in vivo N-glycosylation is introduced into the position of the interferon-gamma polypeptide of SEQ ID NO: 1 (or fragments thereof), including an amino acid residue on the surface. It is preferred that said amino acid residue on the surface has at least 25% of the side chain facing the surface, in particular at least 50% of the side chain facing the surface. Details regarding the definition of these positions can be found in Example 1 below.

The N-glycosylation site is introduced in such a way that the N-residue at said site is located at said position. Similarly, the O-glycosylation site is introduced in such a way that the S or T residue is located at said position. It should be understood that when the term "at least 25% (or 50% of its side chain exposed to the surface" "is used in connection with the introduction of a vivo N glycosylation site, this term refers to the surface reachability of the lateral amino acid chain at the position where attachment of the sugar residue is possible.In many cases, it is necessary to introduce serine or threonine at position +2 with respect to the asparagine residue to which the sugar residue is actually attached, and those positions in which introduced serine or reonin, it is possible to hide, ie less than 25% (or 50%) of their side chains to be exposed to the surface of the molecule.

Moreover, in order to achieve effective glycosylation, it is preferable that the in vivo glycosylation site, in particular the N-residue at the N42 site, is glycosylation or S or ·! The O-glycosylation target to localize to the 118 N terminal amino acid residues of the interferon gamma polypeptide is preferably the 97 N terminal amino acid residues. Moreover, it is preferable to insert the in vivo glycosylation site at a position where only one mutation is required to create the site (i.e., where any other amino acid residues required to create a functional glycosylation site are already present in the molecule).

For example, the substitutions leading to the introduction of an additional N-glycosylation site at the surface positions of the interferon-gamma polypeptide occupied by amino acid residues having more than 25% side chains in contact with the surface (in structure with a receptor molecule) include:

Q1N + P3S / T, P3N + V5S / T, K6N + A8S / T, E9N + L11S / T, K12S / T, K13N + F15S / T. Y14N + N16S / T, Q18S / T, Q18N, Q18N + S20T, H19N + D21S / T, D21N + A23S / T, G26N + L28S / T, G31N + L33S / T, K34N + W36S / T, K37S / T. K37N + E39S / T, E38N, E38N + S40T, E39N + D41S / T, S40N + R42S / T, K55N + F57S / T. K58N + F60S / T, K61S / T, K61N + D63S / T, D62N + Q64S / T, D63N, D63N + S65T, Q64N + I66S / T,

S65N + Q67S / T, Q67N, Q67N + S69T, K68N + V70S / T, E71N + I73S / T, T72N + K74S / T, K74N + D76S / T, E75N + M77S / T, K80S / T, W9N + F81S / Т. K80N + F82S / T N85S / T. S84N + K86S / T, K87S / T, K86N + K88S / T, K87N + R89S / T, D90N + F92S / T,

E93N + L95S / T, K94N, K94N + T96S, S99N, S99N + T101S, T101N + L103S / T,

D102N + N104S / T, L103N + V105S / T, Q106S / T, E119N, E119N + S121T,

P122N + A124S / T, A123N + K125S / T, A124N, A124N + T126S, K125N + G127S / T,

T126N + K128S / T. G127N + R129S / T, K128N + K130S / T, R129N + R13IS / T. K130N. K130N + S132T, R131N + Q133S / T, S132N + M134S / T, Q133N + L135S / T,

M134N + F136S / T, L135N + R137S / T, F136N + G138S / T, R137N + R139S / T

G138N + R140S / T, R139N + A141S / T, R140N and R140N + S142T. the substitution being with respect to the [399T] human interferon-gamma with the amino acid sequence shown in SEQ ID NO: 1 (or with respect to its human amino acid fragment being shown in SEQ ID NO: 1). NO: 2-16). S./T means substitution with serine or threonine, preferably threonine.

Substitutions leading to the introduction of an additional N glycosylation site at the surface positions of the interferon-gamma polypeptide having more than 50% side chains in contact with the surface (in structure with a receptor molecule) include:

P3N + V5S / T, K6N + A8S / T, K12S / T, K13N + F15S / T, Q18S / T, D21N + A23S / T, G26N + L28S / T, G31N + L33S / T, K34N + W36S / T. K37N + E39S / T. E38N, E38N + S40T. E39N + D41S / T, K55N + F57S / T, K58N + F60S / T, K61S / T, D62N + Q64S / T, Q64N + I66S / T, S65N + Q67S / T, K68N + V70S / T, E71N + I73S / Т. E75N + M77S / T. N85S / T, S84N + K86S / T, K86N + K88S / T, K87N + R89S / T K94N, K94N + T96S, S99N, S99N + T101S, T101N + L103S / T, D102N + N104S / T, L103N + V105S / T , Q106S / T.

P122N + A124S / T, A123N + K125S / T, A124N, A124N + T126S, K125N + G127S / T,

T126N + K128S / T, G127N + R129S / T, K128N + K130S / T, R129N + R131S / T, K130N, K130N + S132T, R131N + Q133S / T S132N + M134S / T, Q133N + L135S / T, Q133N + L135S / T,

M134N + F136S / T, L135N + RI37S / T, F136N + G138S / T, R137N + R139S / T.

G138N + R140S / T, R139N + A141S / T, R140N and R140N + S142T, the substitution being with respect to the [899T] human interferon gamma with the amino acid sequence shown in SEQ ID NO: 1 (or with respect to its fragment, having the amino acid sequence shown in SEQ ID NO: 2-16). S / T means substitution with serine or threonine, preferably threonine.

Substitutions when only one amino acid substitution is required for N-glycosylation site insertion include K12S / T, G18S / T, G18N, K37S / T, E38N, M45N, I49N, K61S / T, D63N, Q67N, V70N, K80S / T F82N, N85S / T, K87S / T, K94N, S99N, Q106S / T, E119N, A124N, K130N and R140N, specifically, K12S / T, G18S / T, G18N, K37S / T, E38N, K61S / T. D63N, Q67N, K80S / T, N85S / T. K94N, S99N, Q106S / T, A124N. K130N and R140N (positions where more than · · · · · · · ·:: · · · · · · · · · · · · · · · · · · · · · · · ·

25% of the side chains of the sagittal surface in a structure without a receptor molecule), or especially, G18N, E38N, D63N, Q67N, K94N, S99N,

Ai24N, KI SON and R140N (positions in which more than 50% of the side chains are in contact with the surface in a structure without a receptor molecule).

Typically, it is not preferable to introduce N-glycosylation sites in the regions that make up the receptor binding site (except in special cases, see section "Variants with reduced receptor affinity")

Therefore, the Q1N + P3S / T, E9N + UIS / T mutations, G18N, G18N + S20T,

H19N + D21S / T, D21N + A23S / T G26N + L28S / T. K34N + W36S / T, K37N + E39S / T.

E119N and E119N + S121T are usually not performed unless reduced receptor affinity is desired.

Particularly preferred variants of the present invention include a variant of SEQ ID NO: 1 (or fragments thereof having the amino acid sequence shown in SEQ ID NO: 216), characterized in that said variant exhibits interferon-gamma activity and thus that includes at least one substitution selected from the group consisting of K12S, K12T. G18S, G18T. Ε38Ν. E38N + S40T. K61S, K61T, N85S, Ν85Τ, Κ94Ν, Q106S and Q106T, preferred ©, selected from the group consisting of K12T, GI8T, E38N + S40T, K61T, Ν85Τ, Κ94Ν and Q106T, more preferably selected from the group consisting of such as ΚΙ2Τ, G13T, E38N + S40T, K61T and Ν85Τ, in particular, E38N + S40T.

In another interesting aspect of the present invention, the variant of SEQ ID NO: 1 (or fragments thereof having the amino acid sequence shown in SEQ ID NO: 2-16) includes at least two introduced glycosylation sites, in particular at least two introduced sites for glycosylation. The modifications, in particular substitutions of at least two, lead to the introduction of at least two introduced N-glycosylation sites, and may be selected from the group consisting of K12S, K12T, G18S, G18T, E3SN, E38N + S40T , K61S, K61T, N85S, N85T, K94N, Q106S and Q106T, for

Preferably selected from the group consisting of K12T, G18T, E38N + S40T, K61T, N85T, K94N and Q106T, more preferably selected from the group consisting of of K12T, G18T, E38N + S40T, K61T and N85T Specific examples of such substitutions that result in a variant comprising at least two additional N-glycosylation sites. include · K12T + G18T. K12T + E38N + S40T, K12T + K61T, K12T + N85T, G18T + E38N + S40T, G18T + K61T, G18T + N85T, E38N + S40T + K61T, E38N + S40T + N85T and K61T + N85T.

From the above list of substitutions, those localized to the 118 N-terminal amino acid residues, in particular 97 N-terminal amino acid residues, are preferably selected.

The interferon-gamma gulipeptide variant of the present invention may contain a single site for in vivo glycosylation (compared to SEQ ID NO: 1 or fragments thereof). However, in order to achieve a sufficiently prolonged serum half-life, it is often necessary for the polypeptide to include more than one site for in vivo N-glycosylation, in particular, 2 7 or 2-5 additional sites for tn vivo N-glycosylation, such as 2, 3, 4 or 5 sites for tn vivo N-glycosylation. Such sites for in vivo N-glycosylation. are preferably introduced by one or more of the substitutions listed above.

Varieties of interferon-gamma according to the present invention, in which the non-polypeptide moiety is a molecule having a cysteine as an attached group

In another preferred aspect of the present invention, the interferon gamma variety of SEQ ID NO: 1 (or fragments thereof) includes at least one introduced cysteine residue. For example, a cysteine residue can be introduced into the interferon gamma position of SEQ ID NO: 1 ( or fragments thereof) comprising an amino acid residue exposed to the surface. It is preferred that said amino acid residue exposed to the surface has &lt; &gt; * &gt; 5%. 0Tra * Night chains exposed to the surface, in particular at least 50% of the side chains exposed to the surface. Details regarding the determination of these positions can be found in Example 1 of the present invention.

For example, substitutions leading to the introduction of a cysteine residue at positions exposed to the surface of an interferon-gamma polypeptide occupied by an amino acid residue having at least 25% side chains exposed to the surface (in structure with a receptor molecule) include: Q1C, D2C, RZS, K6C, E9C, N10C, K13C, Y14C, N1SC. G18C. H19C, D21C, N25C, G26C, G31C, K34C, N35C, K37C, E38C, E39C, S40C, K55C, K58C, N59C, K61C. D62C, D63C. Q64C, S65C, Q67C, K68C, E71C. T72C, K74C, E75C, N78C,

V79C, K80C, N83C, S84C, N85C, K86C, K87C, D90C, E93C, K94C, T101C, D102C, L103C, N104C and E119C, with the substitutions referring to the [S99T] human interferon-gamma with amino acid sequence SE, the amino acid sequenceQ, NO: 1 (or to the corresponding fragment having the amino acid sequence shown in SEQ ID NO: 2-16).

Substitutions leading to the introduction of a cysteine residue at positions facing the surface of the interferon-gamma polypeptide and occupied by an amino acid residue, at least 50% of the side chains exposed to the surface (in structure with a receptor molecule) include; RZS, K6C, N10C, K13C. N16D, D21C, N25C, G26C, G31C, K34C, K37C, E38C, E39C, K55C, K58C, N59C, D62C, Q64C, S65C, K68C, E71C, E75C, N83C, S84C, K86C, K87C, K94C, N97C, S99C, S99C, S99C T101C, D102C, L103C and N104C, the substitutions being for the [S99T] human interferon-gamma with the amino acid sequence shown in SEQ ID NO: 1 (or its corresponding fragment having the amino acid sequence shown in SEQ ID NO: 2 16 ).

It is generally not preferred to introduce a cysteine residue (and subsequent attachment of the cysteine residue to the non-polypeptide moiety) in the regions constituting the receptor binding site (except in special

J · · ···· ..

• J J * ·· »« ·· »cases, for example, see section ^ · * SchnbaD" with £ you with reduced receptor activity "). Therefore, the QIC, E9C, G18C mutations. H19C, D21C G26C, K34C, K37C, and E119C should not normally be performed unless a decrease in receptor activity is desired.

In particular, said cysteine residue is introduced by substitution selected from the group consisting of N10C, N16C, E38C, N59C, N83C, K94C, N104C and A124C.

In another interesting aspect of the present invention, the variant with SEQ ID NO: 1 (or fragments thereof having the amino acid sequence shown in SEQ ID NO: 2-16) has at least two introduced cysteine residues. These at least two modifications, preferably substitutions leading to the introduction of at least two cysteine residues, are preferably selected from the group consisting of N10C, N16C, E38C, N59C, N83C, K94C, N104C and A124C. Specific examples of these species-extending substitutions comprising at least two introduced cysteine residues include N10C + N16C, N10C + E38C, N10C + N59C, N10C + N83C,

N10C + K94C, N10C + N104C, N10C + A124C, N16C + E38C, N16C + N59C,

N16C + N83C, N16C + K94C, N16C + N104C, N16C + A124C, E38C + N59C, E38C + N83C, E38C + K94C, E38C + N104C. E38C + A124C. N59C + N83C, N59C + K94C, © N59C + N104C, N59C + A124C, N83C + K94C, N83C + N104C, N83C + A124C,

K94C + N104C, K94C + A124C and N104C + A124C.

It should be understood that the introduced cysteine residue (s) can bind to a non-polymeric moiety, for example, polyethylene glycol or, preferably, mPEG. The conjugation between the cysteine-containing polypeptide variant and the polymer molecule may be effected in any suitable manner, for example, as described in the section "Binding to a polymer molecule, for example, using a one-step or multi-step method. The preferred method for connecting the IFNG polypeptide variant with polyethylene glycol is covalently linking gyulietilenglikola • ·> ^w · <

·· Cysteine

Such as using cysteine reactive polyethylene glycols A number of highly specific cysteine reactive polyethylene glycols of different g / l

(for example, ortho-pyridyl disulfide, maleimide and vinig sulfones) and polyethylene glycols with different molecular weights (2-20 kDa, such as 5 kDa 10 kDa, 12 kDa or 15 kDa) are commercially available, for example, Shearwater Polymers production Inc. Huntsville, AL, USA).

It should be understood that the aforementioned modifications may be combined with any other modification described in the Interferonama section of the present invention with optimized in vivo glycosylated sites, "in particular, by substitution of G26A.

The interferon-gamma variants of the present invention wherein the first non-polypeptide moiety is a sugar moiety and the second non-polypeptide moiety is a molecule having a cysteine as a moiety

In another preferred aspect of the present invention, the interferon variant with SEQ ID NO: 1 (or fragments thereof) includes at least one introduced N-glycosylation site and at least one introduced cysteine residue. These variants can be obtained by selecting residues described in the two previous section, with suitable insertion positions, respectively, at N-glycosylation sites and cysteine residues. However, in a preferred aspect of the present invention, the interferon-gamma variant includes substitutions selected from the group consisting of K12T + N16C, K12T + E38C, K12T + N59C, K12T + N83C, K12T + K94C, K12T + N104C, K12T + A124C . GI8T + NWC, G18T + E38C, G18T + N59C, G18T + N83C. G18T + K94C, G18T + N104C, G18T + A124C, E38N + S40T + N10C, E38N + $ 4PT + M16C.

E38N + S40T + N59C, E38N + S40T + N83C, E38N + S40T + K94C. E38N + S40T + N104C, E38N + S40T + A124C, KS1T + N10C, K61T + N16C, K61T + E38C, K61T + N83C,

K61T + K94C, K61T + N104C, K61T + A124C. N85T + N10C, N85T + N16C, N85T + E38C,::: · ·.

N85T + N59C. N85T + K9 «fe, H85TW1SS. М85ЧЧД124С,

K94N + N10C. K94N + N16C.

K94N + E38C, K94N + N59C, K94N + N83C, K94N + N104C, K94N + A124C,

Q106T + N10C, Q106T + N16C, Q106T + E38C, Q106T + N59C. Q106T + N83C.

Q106T + K94C and Q106T + A124C, more preferred are substitutions selected from the group consisting of E38N + S40T + N10C. E38N + S40T + N16C, E38N + S40T + N59C, E38N + S40T + N83C, E38N + S40T + K94Cn E38N + S40T + N104C.

It should be understood that the introduced cysteine residue may preferably be linked to a non-polypeptide moiety, for example, polyethylene glycol or, preferably, mPEG. The conjugation between the cysteine containing polypeptide variant and the polymer molecule can be

by any suitable means, for example, as described in the section "Binding to a polymer molecule", for example, using a one-step or multi-step method. A preferred polymer is VS mPEG or OPSS-mPEG.

It should be understood that the aforementioned modifications can be combined with any of the other modifications described in the Interferonama section of the present invention with optimized glycosylated sites, in particular by replacing G26A.

Interferon-gamma variants with reduced receptor affinity

One way to prolong the serum half-life of the interferon-gamma polypeptide is to decrease receptor-driven internalization, thereby reducing receptor-mediated clearance. Receptor-driven internalization is dependent on the affinity of the interferon-gamma-type affinity for the interferon-gamma receptor complex and, therefore, new properties of the interferon-gamma species with reduced affinity to the interferon-gamma receptor complex are expected to be imparted, and hence, to a lesser extent.

The affinity of the dimer of the gmuterfer © n′-1 * a {a) to its receptor complex can be reduced by performing one or more modifications, in particular substitutions, at the receptor binding site of the interferon-gamma polypeptide. The amino acid residues that make up the receptor binding site are defined in Example 2 of the present invention. One class of substitutions that can be made is conservative amino acid substitutions In another aspect, the modification performed enhances the introduction of an N-glycosylation site.

Therefore, in another particularly preferred aspect of the present invention, the interferon-gamma variant is SEQ ID NO: 1 (or fragments thereof) includes at least one modification, in particular substitution, at the receptor binding site (as described in the present invention) . In particular, the interferon gamma polypeptide comprises at least one modification, in particular a substitution, thereby creating a site for in vivo N-glycosylation at said receptor binding site. For example, these substitutions may be selected from the group consisting of Q1N + P3S / T. D2N + Y4S / T, Y4N + K6S / T, V5N + E7S / T. E9N + L11S / T. KI2N + Y14S / T. G18N, G18N + S20T, H19N + D21S / T. S20N + V22S / T, D21N + A23S./T, V22N f D24S / T, D24N + G26S / T, G26N + L28S / T, L30N + I32S / T, K34N + W36S / T, K37N + E39S / T, K108N + I110S / T, H111N + L113S / T, E112N + 1114S / T, 1114N + V116S / t,

Q115N + M117S / T, A118N + L120S / T, E119N and E119N + S121T, preferably these substitutions are selected from the group consisting of Q1N + P3S / T, D2N + Y4S / T, E9N + L11S / T. K12N + Y14S / T, G18N, G18N + S20T, H19N + D21S / T, S20N + V22S / T, D21N + A23S / T, K34N + W36S / T, K37N + E39S / T. H111N + L.113S / T. Q115N + M117S / T, A118N + L120S / T, EII9N and E119N + S121T (insertion of N-glycosylation sites at positions including an amino acid residue having at least 25% side chains facing the surface), more preferably these substitutions are selected from the group consisting of Q1N + P3S / T, D2N + Y4S / T, E9N + L11S / T, G18N. G18N + S20T. H19N + D21S / T, ···· • ·· * ··:: <

S20N + V22S / T. D21N + A29S / T. CRJ + M & b8lT ΊΚ37Ν + E39S / T. Q115Ν + Μ117S / T.

A118N + L120S / T, Ε119Ν and E119N + S121T (insertion of M-

glycosylation at positions including an amino acid residue having at least 50% side chains facing the surface), more preferably these substitutions are selected from the group consisting of Q1N + P3S / T, D2N + Y4S / T, E9N + L11S / T. G18N + S20T, H19N + D21S / T, S20N + V22S / T, D21N + A23S / T, K34N + W36S / T, K37N + E39S / T, Q115N + M117S / T, A118N + L120S / T and E119N + S121T at most it is much preferred that these substitutions be selected from the group consisting of Q1N + P3S / T, H19N + D21S / T. D21N + A23S / T and E119N + S121T, in particular D21N + A23S / T

These variants show reduced receptor affinity compared to human interferon-gamma or Actimmune®. Receptor affinity can be measured by any suitable assay and is known to those skilled in the art. An example of a suitable assay for determining receptor binding affinity is the BIAcore® assay described by Michiels et al., Int. J. Biochem., Cell Biol., 30 '505-516 (1998). Using the aforementioned analysis, interferon-gamma variants considered useful for the purposes of the present invention are those interferon gamma variants in which the binding affinity (K _d ) is 1-95% of the value of the binding affinity (K _d ) for glycosylated [ B99T] human interferon gamma or Actimmune®. For example, the value of the binding affinity _(K;) for interferon-gamma gyulipeptid may be 1-75% or 1-50% such as 1-25%, such as 1-20, or even 1-15%, 1-10 % or 1-5% of the binding affinity value (K _d ) for glycosylated [899T] human interferon-gamma or Actimmune®.

Typically, these interferon-gamma variants having reduced receptor affinity exhibit reduced interferon-gamma activity, for example, when applying the Primary Assay described in the present invention. " For example, the interferon-gamma polypeptide · · · · · · · · · · · · ·

The species may 'Show 1 · 95% specific activity 33. AC-ih Decay or recombinant human interferon-gamma, for example 1-75%, such as 1-50 %, for example 1-20% or 1-10% specific activity of Actimmune® or recombinant human interferon gamma.

As described above, these interferon-gamma varieties are considered.

that they have an increased serum half-life due to reduced receptor-driven clearance. Therefore, interferon-gamma polypeptide variants according to an aspect of the present invention,

meet the increased serum half-life requirements previously described in connection with the definition of increased serum half-life

Obviously, some of the aforementioned modifications enhancing receptor binding affinity can be combined with other modifications described in the present invention, in particular modifications mentioned in the sections "Interferon-gamma variants of the present invention, with optimized N-glycosylation sites '', The interferon-gamma variants of the present invention, in which the non-polypeptide moiety is a sugar moiety. ' Interferon-gamma variants according to the present invention, in which the non-polypeptide moiety is a molecule having a cysteine as an attachment group and Interferon-gamma variants according to the present invention, in which the first non-polypeptide moiety is a sugar moiety and the second non-polypeptide moiety is a cysteine molecule as an attachment group "such as G26A, E38N + S40T and combinations thereof.

LEGISLATION METHODS

Non-polypeptide moiety

As mentioned above, the non-polypeptide moiety is preferably selected from the group consisting of a polymeric molecule, a pipophilic compound,.:.:. ··. . · * ···· * »: * ······.

sugar ether (rt & njiMlUe ^ .tipiaJ m vivo N-glycosylation) and organic compound derivative All of these agents can confer the desired properties of the interferon-gamma polypeptide variety, in particular, increased AUCsc, prolonged serum lolubility and / or reduced immunogen. The polypeptide variant typically binds to only one type of non-polypeptide moiety, but can also bind to two or more different types of non-polypeptide moieties, for example, to a polymer molecule and a sugar moiety, to a lipophilic moiety and a sugar moiety, to an organic matter derivative and a sugar moiety , to a lipophilic group and a polymeric molecule, etc. When attached to two different types of non-polypeptide moieties, they are preferably a sugar moiety and a polymer moiety. Conjugation of two or more different non-polypeptide moieties can be carried out simultaneously or sequentially.

In the following sections, Binding to a Lipophilic Compound / Binding to a Polymeric Molecule, "" Binding to a Sugar Residue "" and "Binding to a Derivative of Organic Substance /" Binding to specific types of non-polypeptide moieties is described.

Binding to a lipophilic compound

The polypeptide variant and the lipophilic compound may be coupled to each other either directly or by a binder. The lipophilic compound can be a natural compound such as saturated or unsaturated fatty acid, diketone of fatty acid, terpen, prostaglandin, vitamin, carotenoid or steroid, or a synthetic compound such as carbonic acid, alcohol, amine and sulfonic acid with one or more alkyl-, a.rilappxyl- or other multifunctional chiaisitic compounds. The coupling between the polypeptide variant and the lipophilic compound through a binder can be accomplished by methods known to those skilled in the art: ··· * '* J ·· · · methods, for example, cacto * 6 bicolor * opening02 and ** 52! Quo Peptide Synthesis, John Wiley,

New York, 1976 and in WO 96/12505.

Binding to a polymer molecule

The polymeric molecule that binds to the polypeptide variant can be any suitable polymeric molecule, such as a natural or synthetic homopolymer or heteropolymer, typically with a molecular weight in the range of 300-100,000 Da or 1000-50,000 Da, within the range of 2000- 40,000 Da or 2000-30,000 Da, for example, in the range 2000-20,000 Da, 2000-10,000 or 1000-5000 Da. In particular, a polymeric molecule such as polyethylene glycol. in particular, mPEG, with a molecular weight of about 5 kDa, 10 kDa. 12 kDa, 15 kDa or 20 kDa.

The word "around", when used in the present invention for a polymeric molecule, means approximately the same molecular weight and reflects the fact that it is normal to have a molecular weight distribution for a given polymeric preparation.

Examples of homopolymers include polyol (i.e. poly-OH), polyamine (i.e. poly NH ₂ ) and polycarboxylic acid (i.e. poly-COOH). The heteropolymer is a polymer that includes one or more different coupling groups, such as a hydroxyl group or an amino group.

Examples of suitable polymeric molecules include polymeric molecules selected from the group consisting of polyalkylene oxide (GMSC, including polyalkylene glycol (PAG) such as polyethylene glycol (DEG) and polypropylene glycol (PPG), branched polyethylene glycols, polyvinyl alcohol, PVA, polycarbonyl alcohol (PVA). poly (vinylpyrrolidone), copolymer of polyethylene and maleic anhydride, copolymer of polystyrene and malic acid anhydride, dextran including carboxymethyl dextran or some other biopolymer suitable for reducing immunogenicity and / or for lengthening of functional in vivo half-life and / or serum survival.

»· · · · · ·::: ·::: ··. ···::; · ·.

Another example of a polymeric * molecule * is PgVBlkY albumin or other plasma protein in large quantity. Generally, polyalkenylene glycol polymers are biocompatible, non-toxic non-antigenic, non-immunogenic, have different solubilities in water and are easily separated from living organisms.

A preferred polymer molecule to be used is polyethylene glycol, since it has few reactive groups capable of crosslinking, compared to, for example, polysaccharides such as dextran and the like. In particular, the monofunctional polyethylene glycol. for example, monomethoxy polyethylene glycol (mPEG) is of interest because the binding chemistry is relatively simple (only one reactive group is available for binding to the attached groups of the polypeptide). Therefore, the risk of cross-linking is eliminated, the resulting polypeptide-coated compounds are more homogeneous and the interaction between the polymer molecules with the polypeptide is more easily controlled.

In order to covalently bind the polymer molecule (s) to the polypeptide variant, the terminal hydroxyl groups of the polymer molecule must be in active form, i.e. with reactive

functional groups, examples of which include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidylpropionate (SPA) succinimidylcarboxymethylate (SCZ), benzoxazolate (SC), , aldehyde, nitrophenyl carbonate (NPC) and trisilate (TRES)) Commercially available polymer molecules are commercially available, for example, from Snear / vatsi rorymers.

Huntsville, Al. USA. Alternatively, the polymer molecules may be activated by conventional methods known to those skilled in the art, for example, as described in WO

90/13540. Specific examples of activated linear or branched polymer molecules that can be used according to the present ·> ♦ · ·: · ** ·.:. ··. . ·. ::: * ··: · :: * · invention, described 6 · Shemwdrte'r Inc., 1997 and 2000 Catalogs (Functionalized Biocompatible Polymers for Research and Pharmaceuticals

Polyethylene Glycol and Derivatives given for comparison). Specific examples of activated polyethylene glycols include the following linear polyethylene glycols: NHS-PEG (e.g., SPA-PEG, SSPA PEG, SRA-PEG, SS PEG, SSA-PEG, SC-PEG, SG-PEG and SCM-PEG) and NOR-PEG ). BTC-PEG. EPOX-PEG NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG, TRES-PEG, VS-PEG, IODO-PEG and MAL

PEG. and branched polyethylene glycols such as PEG2-NHS and those described in US

No. 5,932,462 and U.S. Pat. No. 5,643,575. given both for comparison. Moreover, the average publications given for comparison are described as applicable

Polymeric molecules and / or methods for reacting with polyethylene glycols:

No. 5,281,698, US 5,122,614. US 5,219,564 WO 92/16555 WO 94/04193 WO 94/14758

WO 94/17039, WO 94/18247, WO 94/28024, WO 95/00162, WO 95/11924, WO

95/13090, WO 95/33490, WO 96/00080, WO 97/18832, WO 98/41562, WO 98/48837,

WO 99/32134, WO 99/32139, WO 99/32140, WO 96/40791 WO 98/32466, WO

95/06058, EP 439 508, WO 97/03106, WO 96/21469, WO 95/13312. EP 921 131. US

No. 5,736,625, WO 98/05363, EP 809 996, US 5,629,384, WO 96/41813, WO 96/07670, US

6,4 / 3,034, US 5,516,673, EP 605 963, US 5,382,657, EP 310 356, EP 400 472, EP 183 503 and EP 154 316.

Specific examples of activated polyethylene glycol polymers preferred for binding to cysteine residues include the following linear polyethylene glycols: vinylsulfone-polyethylene glycol (VS-PEG), preferably vinylsulfone-mPEG (VS-mPEG); maleimide-polyethylene glycol (MAL-PEG), preferably maleimide-mPEG (MAL-mPEG); and orthopyridyl disulfide polyethylene glycol (OPSS-PEG), preferably orthopyridyl disulfide mPEG (10 (OPSS-mPEG)); typically, these polyethylene glycol or mPEG polymers have a molecular weight of about 5 kDa, 10 kDa, 12 kDa or 20 kDa.

• · · ·

Linking the polypeptide? The activity of the activated polymer molecules is carried out by any conventional method, for example, as described in the literature (where suitable methods for activating the polymer molecules are also described). Harris, Zalipsky, eds., Polyethylene glycol) Chemistry and Biological Applications, AZC. Washington: R.F. Taylor, (1991), Protein immobilization. Fundamental and Applications, Marcei Dekker, N.Y .; S.S. Wong, (1992), “Chemistry of Protein Conjugation and Crosslinking”, CRC Press, Boca Raton; G.T. Hermanson et al., (1993), "Immobilized Affinity Ligand Techniques", Academic Press, N.Y.). For the binding of polyethylene glycol to cysteine residues (see above), interferon-gamma

the variant is usually treated with a reducing agent such as dithiothreitol (DDT) before binding to polyethylene glycol. The reducing agent is then removed by any conventional method, such as desalting. The polyethylene glycol-bound cysteine residue is usually run in a suitable buffer at pH 6-9 at a temperature between 4 and 25 ° C for up to 16 hours.

Those of skill in the art will understand that the activation and / or binding method to be used depends on the attached groups in the interferon-gamma polypeptide variety, as well as the functional groups of the polymer (e.g., amino, hydroxyl, carboxyl, aldehyde, or sulfidryl). The binding to polyethylene glycol can be accomplished by direct binding to all available attachment groups of the polypeptide variety (i.e., those attachment groups facing the surface of the polypeptide) or binding to specific attachment groups, e.g., the N terminus amino group (US 5,985.265) Moreover, the coupling can be carried out in one step or in many steps (for example, as described in WO 99/55377)

It will be appreciated that the binding to polyethylene glycol is aimed at obtaining the optimal molecule in terms of the number of polyethylene glycol molecules attached, the size and shape (for example, whether they are · · · · · · · · · · · · · · · · · · ··· ··· ··· · · ♦ ···· ··· ♦ ··· linear or branched) · No. ’· those * 1VLBkuli, · and * · where in the polypegic week variety are they attach these molecules. For example, the molecular weight of the polymer used can be selected based on the desired effect to be achieved. For example, if the main purpose of binding is to produce a neat compound of high molecular weight (for example, to reduce renal clearance), it is usually desirable to bind polymer molecules to as high molecular weight as possible to obtain the desired molecular weight. When the epitope is heavily protected, this can be achieved by using a substantially large number of low molecular weight polymers (e.g., with a molecular weight of about 5,000 Da) to effectively protect all or most of the epitopes of the polypeptide. For example, 2-8 such as 3 6 such polymers may be used.

In connection with binding to only one attached group of the protein (as described in US 5,985,265), it is advantageous that the polymer molecule, which may be linear or branched, has a high molecular weight, for example, about 20 kDa

Typically, the polymer bonding is carried out under conditions that allow all polymer attachments present in the polymer to interact with the polymer molecules. Most commonly, the molar ratio of activated polymer molecules to the polypeptide variant is 1000.1, in particular 200: 1, for example, 100: 1, such as 10: 1 or 5: 1, to give optimum interaction. However, equivalence ratios may also be used.

According to the present invention, it is possible to bind the polymer molecules to the peptide variant and via a binder. Suitable binders are known to those skilled in the art. A preferred example is cyanuric chloride (Abuchowski et al, (1977), J. Biol.Chem. 252, 3578-3581; US 4,179,337; Snater et al, (1986). J. Polym.Sci. Polym.Chem.Ed., 24 , 375-378.

Qiyud and BorZVaneYu,

The papal * activated 'polymer molecules are blocked by known methods in the art, for example by adding to the reaction mixture a primary amine and the resulting inactivated polymer molecules are separated by a suitable method.

Binding to the sugar residue

The binding of the sugar residue is carried out in vivo or in vitro. In order to effect in vitro glycosylation of an interferon-gamma polypeptide, it must be modified to introduce one or more in vitro glycosylation sites (see section "Interferon-gamma variants of the present invention, in which the non-polypeptide part is a sugar residue ”), as the nucleotide sequence encoding the polypeptide moiety is to be introduced into the glycosylating eukaryotic developing host. Host expression cells may be selected from fungal cells (fibrous or yeast), insect or animal cells, or transgenic plant cells. Moreover, glycosylation can be enhanced in the human body when a nucleotide sequence encoding the polypeptide variant of the present invention is used for gene therapy. In one aspect, the host cell is a mammalian cell, such as CHO cell, BHK or HEK cell, e.g. HEK293, or an insect cell, such as SF9 cell, or yeast cell, e.g., Sacchatomyces cerevistae, Ptchta pastons, or some other a suitable glycosylating host, for example, as described below. It is possible that the sugar residues bound to the interferon-gamma polypeptide variant by / l vitro glycosylation. then be modified using glycosyltransferases, for example, using Neose glycoAdvance ^ 'technology. Horsham, PA. USA. In doing so, it is possible, for example, to increase the silencing of the glycosylated interferon-gamma • · · · · · · · · · · · · · · · · · · · · · · · Polypeptide variant, · subsequent etching and in vitro glyxylation by CHO cells

Covalent in vitro coupling of glycosides with amino acid residues of interferon gamma polypegides may be used to modify or increase the number or profile of carbohydrate substituents. IN

depending on the mode of binding, sugars may be coupled to a) arginine and histidine, b) free carboxyl groups, c) free sulfhydryl groups such as cysteine, d) free hydroxyl groups such as series, threonine, tyrosine or hydroxyproline, e) aromatic residues such as phenylalanine or tryptophan or the o) amide group of glutamine. These amino acid residues are examples of attached moieties for the sugar moiety that can be introduced and / or removed into the interferon-gamma polypeptide. Suitable methods for in vitro binding are described, for example, in WO 87/05330 and in Αίρΐπ et al, CRC Grit Rev Biochern., Pp. 259-306, 1981. In vitro binding of sugar residues or polyethylene glycol to protein- and peptide-linked Gln residues can also be carried out by transglutaminases ((gases, &quot; for example, as described by Sato et al. 1996. Biochemistry, 35. 13072-13080 or in EP 725145.

Binding to a derivative of organic matter

The covalent modification of the interferon-gamma polypeptide variant can be carried out by reacting a coupled group of the polypeptide variant with an organic matter derivative. Suitable organic derivatives and methods are known to those skilled in the art. For example, cysteinyloxy moieties are most commonly reacted with achaloacetates (and the corresponding amines), such as chloroacetic acid or chloroacetamide, to provide carboxymethyl or carboxyamidomethyl derivatives. Cysteinyl residues are also obtained by reaction with bromotrifluoroacetone. α-Bromo-p- (4-imidozoyl) propionic acid.

chloroacetyl phosphorus g.

M-alkyLiSiT0 imiDi? 3'nitro-2-pyridyldisulfide, methyl 2 pyridyldisulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenyl or chloro-7-nitrobenzo-2-oxa-1 3-diazole Histidyl residues are obtained by reacting with 5.5 diethylcarbamide. as this substance is relatively specific to the histidyl side chain.

Also p-bromophenacetyl bromide is used, preferably the reaction is carried out in 0.1M sodium cacodylate at pH 6.0.

Pisinyl and terminal amino moieties are reacted with succinic or other carboxylic acid anhydrides. The derivatives of these substances act to reverse the charge of the pizinyl residues. Other suitable

reagents for producing derivatives of α-amino-containing residues are imidoesters, such as methylpixliminidate; pyridoxal phosphate; pyridoxaa; Chlorbohydride: Trinitrobenzenesulfamic acid: 0-Methylisocarbamide:

2,4-pentathione; and transaminase catalyzed interaction with glyoxylate. The arginyl residues are modified by the interaction with one or more of several conventional substances, among them, Phenipioxal, 2,3-6 butane, 1,2-cyclohexanedione and ninhydrin. In the preparation of arginine residue derivatives, the reaction must be carried out under alkaline conditions due to the high pKa of the guanidine functional group. Moreover, these substances can interact with the lysine groups as well as with the arginine guanidine group. The side carboxyl groups (aspartyl and glutamide) are selectively modified by reaction with carbodiimides (R-N = C = N-R), where R and R 'are different alkyl groups, such as 1-cyclohexyl-3- (2-morpholines ~ -

4-ethyl) carbodiimide or 1-ethyl-3- (4-azonia-4,4-dimethylpentyl) carbodiimide. Moreover, aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl by reaction with ammonium ions.

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Blocking the functional * m * dish

It is known that excess polymer coupling can lead to a loss of activity of the polypeptide to which the polymer is bound. This problem can be eliminated, for example, by separating attachment groups localized at the function site or by blocking the function site before pairing. The latter method is a further aspect of the present invention, the first msec being

presented above, for example, by separating lysine residues that can be located close to the functional site and / or by introducing cysteine residues and / or in vivo glycosylated © sites at positions that differ from functional sites

In particular, according to the second method, the coupling of the polypeptide

the non-polypeptide moiety is conducted under conditions in which the functional site of the interferon-gamma polypeptide moiety is blocked by an auxiliary molecule capable of binding to the functional site of the polypeptide moiety. Preferably, the accessory molecule is one that specifically recognizes the functional site of the polypeptide variant as a receptor. Alternatively, the accessory molecule may be an antibody, in particular, a monoclonal antibody recognizing the polypeptide variant. In particular, the accessory molecule may be a neutralizing monoclonal antibody

The polypeptide variant may interact with the accessory molecule before coupling begins. This enables the functional site of the polypeptide variant to be protected or protected and then not involved in the preparation of derivatives of the non-polypeptide moiety, for example, a polymer. After separation from the accessory molecule, the conjugated compound between the non-polypeptide moiety and the polypeptide moiety can be restored to a partially protected functional site.

A bird species with a blocked functional site to a polymer, a lipophilic compound, a sugar residue, an organic derivative or other compound is carried out in the usual way, for example, as described above in the "Connecting to

In another aspect, the auxiliary molecule first covalently binds to a solid phase, such as column fillers, such as Sephadex or grains agarose, or to a surface, for example, a re-vessel. After this, the polypeptide variant is introduced into the column material carrying the auxiliary molecule and conjugation. proceeds according to methods known to those skilled in the art, for example, as described above in the coupling sections. This method allows the conjugated polypeptide species to be separated from the accessory molecule by elution. The conjugated polypeptide variant is eluted by conventional methods under such physicochemical conditions that do not lead to further destruction of the conjugated polypeptide variant. The liquid phase containing the suspended polypeptide variant is separated from the solid phase to which the auxiliary molecule remains covalently bound. The release can be accomplished in two ways: For example, the accessory molecule may be obtained with a second molecule (e.g., biotin) that can be recognized by a specific binding agent (e.g., streptavidin). The specific binder may be coupled to a solid phase, thereby separating the fused polypeptide variant from the auxiliary molecule-second molecule complex by passing over a second auxiliary solid phase in the column which it leaves after the next elution. complex auxiliary molecule second molecule but not conjugated polypeptide variant. The conjugated polypeptide variant can be appropriately separated from the accessory molecule. Deprotection may occur under conditions in which the accessory molecule is · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · It is dissociated from the functional / fat * fat * * 'nA * interferon-gamma polypeptide species to which it is associated. For example, a complex between an antibody to which a polymer is bound and an anti-idiotypic antibody can be dissociated by adjusting the pH to acidic or alkaline pH.

Binding of a labeled polypeptide

In one possible aspect, the interferon-gamma polypeptide variant manifests itself as a fused protein with a marker, i.e., as an amino acid sequence or peptide extension, typically composed of 1-30, for example, 1-20 amino acid residues In addition to possible rapid and easy purification, the marker is a convenient means of conjugating between the labeled interference range of the polypeptide variant and the non-polypeptide moiety. In particular, the marker can be used to produce conjugation in microtiter plates or other carriers, such as the paramagnetic grains to which the labeled polypeptide can be immobilized through the marker. The binding to the labeled interferon-gamma polypeptide variety in. for example, microtiter plates, has the advantage that the labeled polypeptide variety can be immobilized in microtiter plates directly from the culture medium. without purification) and subjected to vaporization. In addition, the total number of process steps (from manifestation to conjugation) can be reduced. Moreover, the marker can function as an extender of a molecule providing enhanced compatibility with the immobilized polypeptide variant to which it is attached. Pairing using the maiokioan polypeptide variant may be with any of the non-peptide peptides described in the present invention, for example, with a polymeric molecule such as polyethylene glycol.

The identity of the specific tag used is irrelevant, in that the tag is capable of expression with the polypeptide variety and is

• · · · · 444444

4 4 4 ···· · ··

4 4 4 4 4 ··· ···· 4 4 4 4 4 4 · ··· ··· 4 · 4 · uiivGuoert To be immersed on a suitable surface or support material. A number of suitable markers are known in the commercial network, for example, by Dnizvme Laboratories. Denmark. For example, the tag can be one of the following sequences:

His-His-His-His-His-His (SEQ ID NO: 35).

Met-Lys-His-His-His-His-His-His (SEQ ID NO: 36),

Met-Lys-His-His-Ala-His-His-GIn-His-His (SEQ ID NO: 37), Met-Lys-His-Gln-His-Gin-His-Gln-His-Gln-His-G ! n-His-G * n (SEQ ID NO ^ 8) (all from Unizyme Laboratories. Denmark) and any of the following:

EQKLI SEEDL (SEQ ID NO: 39), (C-terminal marker described in Moi. Ceil. Βίοι, 5: 361016, 1985)

DYKDDDDK (SEQ ID NO: 40), (C- or N-terminal marker)

YPVDVPDYA (SEQ ID NO: 41).

The antibodies for the above markers are commercially available, for example, by ADI, Aves Lab and Research Diagnostics

Subsequent cleavage of the marker from the polypeptide can be accomplished using commercially available enzymes.

Methods for producing the interferon-gamma polypeptide variant of the present invention

The interferon-gamma polypeptide variant may be prepared by any of the methods known in the art. These methods pklyuchva ^m constructing a nucleotide sequence encoding the polypeptide variant and the occurrence of the sequence in a suitable transformed host. However, the polypeptide variants of the present invention can be obtained, albeit less effectively, by chemical synthesis or by a combination of chemical synthesis and recombinant DNA technology.

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

The nucleotide sequence 'according to the present invention encoding an interferon-gamma polypeptide variant (as mon-omar: cm ·' as a single strand) can be constructed by sequencing or synthesizing a nucleotide sequence, interferon-gamma, such as human interferon-gamma. with the amino acid

sequence SEQ ID NO: 17 or a fragment thereof, and then altering the nucleotide ps sequence to trigger the insertion (i.e. insertion or replacement) or deletion (i.e. separation or replacement) of the corresponding (us) sequence. ) amino acid residue (s).

The nucleotide sequence is conveniently modified by site-directed mutagenesis according to known methods, see, for example. Mark et al., “Sits specific Mutagenesis of the Human Fibroblast Interferon Gene”, Proc Natl. Acad. Sci. USA. 81 pp. 5662-66 (1984): and US 4,588,585.

Alternatively, the nucleotide sequence is obtained by chemical synthesis, for example, using oligonucleotides constructed on the basis of the amino acid sequence of the desired polypeptide variant and, preferably, selecting those columns that are preferred in the host cell in which produces the recombinant polypeptide variety. For example, some small oligonucleotides encoded for portions of the desired polypeptide variant can be synthesized and bound by PCR, ligature, or liggur chain reaction (LCR). The individual oligonucleotides typically contain 5 or 3 'free hanging elements for further binding.

Once coupled (via site-directed mutagenesis or other synthesis), the nucleotide sequence encoding the polypeptide is inserted into the recombinant vector and binds to the co-sequences necessary for the expression of the interferon-gamma polypeptide variant in the desired transformed home cell.

Of course, you don't have to, 'not all vectors and manifest control sequences work equally well for: ->

the nucleotide sequence encoding the interferon-gamma lolipeptide variant described in the present invention. Not all hosts will function equally well with the same manifestation system. However, one of skill in the art may choose between these vectors, sequences for control of manifestation, and host experimentation. For example, when selecting a vector, the host must be recognized as the vector must replicate it or be able to integrate into the chromosome. Number of copied sectors. the ability to control the copy number and the expression of other proteins encoded by the vector, such as inhibitory markers, should also be taken into account. In selecting the sequence to control the manifestation, a number of factors must also be considered. These include, for example, the relative length of the sequence, its controllability, and its compatibility with the nucleotide sequence encoding the polypeptide variant, especially with respect to potential secondary structures. be selected taking into account their compatibility with the vector selected, the toxicity of the product encoded for the nucleotide sequence, their secreting characteristics, their ability to correctly duplicate the polypeptide. their fermentation or culture requirements and whether the products encoded for the nucleotide sequence are readily purified.

The recombinant vector may be a self-duplicating vector, i.e. a vector that exists as an extrachromosomal unit whose duplication is independent of chromosomal duplication, for example, a plasmid. Or else, the vector is what it is. when introduced into a host cell, it integrates into the genome of the host cell and duplicates with the chromoscale (s) in which it was integrated.

68 • · · · · · · · · · · · · · · · · · · · · · · · · · · • · · · · · · · · · · · · · · · · · · · · lta se ajb * | zT * yes ”is a 'vector of manifestation in which 1 nucleotide a sequence encoding an interferon-gamma polypeptide variety, connects to additional segments required for transcription of the nucleotide sequence. The vector is usually

obtained from a plasmid or viral deoxyribonucleic acid. A number of suitable expression vectors for expression in said host cells can be found commercially available in the literature.

Applicable manifestation vectors for eukaryotic hosts include, for example, vectors including expression control sequences

from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. There are specific vectors. for example. pCDNA3.1 (+) \ Hyg (invitrogen. Carisoaa. GA, USA) and pGineo (Stratagene, La Jola, CA, USA). Applicable expression vectors for bacterial hosts include known bacterial plasmids such as E colt plasmids, including pBR322, pET3a and pET12a (both from Novagen

Inc., Wl, USA), plasmids with a broader range of hosts, such as RP4, phage of deoxyribonucleic acids, for example, a number of phage lambda derivatives. for example, NM9S9 and other deoxyribonucleic acid phages, such as M13 and fibril single stranded deoxyribonucleic acid phages. The yeast cell manifestation vectors include

2µ plasmid and its derivatives, the POT1 vector is described in Okkels. Ann New York Acad. Sci. 782, 202-207 1996 and pPICZ A, B or C dnvitrogen). Applicable expression vectors for insect cells include pVL941, pBG3ll (Cate et a! .. "Isolation of Bovine and Human Genes or Mullerian Inhibiting Substance and Expression of the Human Gene in Animal Ceils, Cell. 45, pp. 885- 98 (1986) pBluebac 4.5 and pMelbac (both produced by Invitrogen)

Other vectors for use in the present invention include those that allow the nucleotide sequence encoding the interferon-gamma polypeptide variant to be extended by µc with ® ohm · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · Copier .. Thin copy copy factor ss.

include, for example, vectors capable of lengthening by 'lengthening by DHFR (see, e.g., Kaufman. Sharp, Construction ot a Modular

Dihydrafolate Reductase cDNA Gene. Analysis of Signa's Uti'izsd for ETfk ±:. ·. '.

Expression ”, Mol.Cell. Biol., 2, pp. 1304-19 (1982)) and glutamine synthetase (GS) elongation (see, e.g., US 5,122,464 and EP 338,841).

The recombinant vector may also include a sequence of

deoxyribonucleic acid which allows the vector to duplicate in the host cell in question. An example of such a sequence (when the host cell <= mammalian cell) is the SV40 origin of duplication When the host cell is a yeast cell, suitable sequences allowing the vector to duplicate are the duplicate genes REP 1 3 of the yeast plasmid 2μ and the origin of duplication.

The vector may also include a selectable tag, for example. an Ioduk gene 'which adds a defect in the host cell, such as the gene encoding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe gene ΤΡΙ (described by R. R. Russell, Gene 40, 1985. pp. 125-130), or such which he imparts

drug resistance, for example, ampicillin, kanamycin tetracycline chloramphenicol, neomycin, hydromycin or methotrexate. For fibril fungi, selectable markers include amdS, pyrG, arcB, niaD, sC.

The term "control sequences" as used in the present invention encompasses all components that are necessary and advantageous for the development of the interferon-gamma polypeptide variant. Each control sequence may be close to or alien to the nucleic acid sequence encoding the polypeptide variant. Such control sequences include, but are not limited to, a leading sequence, a polyadenylated sequence, a proptide sequence, a promoter, an extension or an increasing activating sequence. * ri,. · π Μ 2 Π 9 PTI Π Η 3 sequence and a transferable * 'ending' sequence.

At a minimum, the control sequences activate a promoter

A variety of control sequences of expression sequences are used in the present invention to include expression control sequences related to structural genes of the abovementioned expression vectors, as well as any sequence known to control the expression of prokaryotic and eukaryotic cell genes or their

viruses, and various combinations of them.

Examples of suitable control sequences for direct insertion into mammalian cells include early and late SV40 promoters and the promoter of

MT 1 (metallothionein gene), an immediate wound gene promoter of human cytomegalovirus (CMV), a promoter of human extension factor b (EF-1a),

Drosophila protein promoter 70, Rous Sarcorra Virus (RSV) promoter. human ubiquitin C (UbC) promoter, human growth hormone terminating sequence, polyadenylated SV40 oolase signals or Elb adenovirus and Kozak sequence ((Kozak, M. J. Mol Bio .., 1987, Aug 20: 196 (4 ): 947-50).

In order to improve expression in mammalian cells, a synthetic intron may be inserted into the 5 'unbranched region of the nucleotide sequence encoding the interferon-gamma polypeptide variant. Synthetic intron primo for the synthetic intron of plasmid pCI-peo (from Pgspeda Corporation, Wl, USA).

Examples of suitable control sequences for direct entry into insect cells include the polyhedrin promoter, the P10 promoter, the Autographa caifornfca basic protein promoter polyhedrosis virus, the immediately wound gene 1 baculovirus promoter, and the retained a ·· • a · a • · · · · · • a · bJuHcH ΓβΗβΗ PROMOTOR ha

Hu a «a

a a

a a a bakulovi bl • • · · · · a a ♦ • «a a a · a a a a a ** 39K and a polyadenylated SV40 sequence.

Examples of suitable control sequences for use in host yeast cells include promoters of the yeast and coupled system, promoter of yeast triose phosphatismerase (TPI) translated by yeast glycolytic genes or alcohol dehydrogenase genes, ADH2-4C and inducible GAL.

Examples of suitable control sequences for administration to fibril host host cells include ADH3 and termination

sequence, the promoter being derived from genes encoding Aspergillus oryzae SO amylase triose phosphatisomerase or alkaline protease, A ntger amylase, .A. Ldeg or nidulans glucoamylase, A. ddulans acetamidase,

Rhizomucor mtehei aspartic proteinase or lipase. THREE terminating sequence and ADH3 terminating sequence.

Examples of suitable control sequences for use in host bacterial cells include promoters of the lac system, the Tf TDS system or the TRC system and major promoter regions of the phage lamod.

The nucleotide splicing according to the present invention, obtained either by site-directed mutagenesis, synthesis, or other methods, may or may not be a non-truncated noupeotide sequence encoding the signal peptide. The signal peptide is present, obliquely, the polypeptide is separated from the cells in which such a signal peptide is present, if present, must be recognized from the cluster selected for expression of the polypeptide variant. The signal peptide may be a homologue (e.g., which is commonly associated with human interferon-gamma) and heterologous other than the human interferon-gamma * of the polypeptide or mo ** - be a homolog or host cell heterologist,

You

a peptide commonly expressed by the host cell or one that is abnormally expressed in a host cell. ······· ··· ··· · · «♦ __...... ··· / * · _Λ ~ ·· it ..-, khArA-jAvAt FROM THE ROCK-HOME. DEGREE, THE SIGNAL MG / KS PVPG SUDS pc-karyotic, for example, derived from a bacterium, such as E soybean, or eukarnastom, for example, obtained from a mammalian cell, insect or yeast cell

The presence or absence of a signal peptide will depend, for example, on the expression of the host cell used to produce the polypeptide variant, on the protein expressed (whether it is intracellular protein) and whether secretion is required. For use in fibrous fungi, the signal peptide can conveniently be obtained from a gene. encoding Aspergillus sp. amylase or glucoamylase. gene encoding Rhizomucor miehei lipase or protease or Humicola lanuginosa missing? - * Preferably, the signal peptide is derived from a gene encoding A. oryzae THAT amylase, A. niger neutral α-amylase, A. niger acid-resistant amylase or A. niger glucoamylase. For use in insect cells, the signal peptide can conveniently be obtained from an insect gene. " "Νϋ" 0 / m5 / S3) whom lepidopteran

MGI and CHI * 's jr * pL -w p- ν' · * *

5,023,328) bee melitin Hnvitrogenj, ecdysteroid NGlucosyl transferase.

(egt) (Murphy et al. Protein Expression and Purification. 4. 349-35 D (.393} or human pancreatic lipase (hpl) (Methods in Enzymology, 234,

pp. 262-272 W97).

The preferred signal peptide for use in HAO-3 * cells; is obtained from human interferon gamma or from murine IgG light chain signal peptide (Coloma, Μ. (1992 / a. imm. Methods, 152. 89-104). For use yeast suitable signal peptide with S-Factor S .

'' θ ^ νια ^ θ tcf. US 4,870,008) g> <4 gm? "Party ion" FROM salivary amylase in mice. C. hagenwucnle et a :.

Nature. 289. ί t, ρρ.

643-646), signal peptide and modified carboxypeptidase (cf. LA. Valls at al., Ceil. 48. 1987 op. 887-897) BAR yeast signal peptide) (cf WO 87/02 70t and yeast signal peptide aspartin protease 3 (YAP3) (cf. M. Egel Mitani eta !, Yeast6, 1990, pp. 127-137.

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · »·

Any suitable host comprising cells: -un fungi (including yeast), plants, insect mammals, or other suitable animal cells or cell lines, as well as transgenic animals or plants, may be used to produce the peptide-variety polypeptide variety. . Examples of host bacterial cells include gram-positive bacteria, such as Bacillus strains, eg, B. brevis or b.

subtife, Pseudomonas or Streptomyces, or gram-negative bacteria, such as strains of t strain. The introduction of a vector into a bacterial host cell may, for example, be affected by protoplast transformation (see, e.g., Chang and Cohen, 1979. Molecular General Genetics 168 '111 115), using resistant cells (see, e.g., Young and Spizizen 196 *. Journal of Bacteriology, 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, btotechniques 6. 742- 751) or conjugation (see, e.g., Koehler and Thome, 1987, Journal of Bacteriology, 169: 5771-5278).

Examples of suitable fibrous host host cells include Aspergillus strains, for example. A oryzae, A. gideg, or A / marry. Fusanum or

Trichoderma. Fungal cells can be transformed by a method involving protoplast formation. transformation of lrogoplags and regeneration of the cell wall in a gene-like manner. &lt; / RTI &gt; waxing guides wu transformation of Aspergillus host cells have been described! - * m EP 238 028 ”U9 6,879,543. Suitable methods for transforming Fusaaum species have been described by Malardier et al. To be transformed using methods described by Keener ana Guarente, in Abelson. J. N. and Simon, Μ. 1 .. editors. Guide to Yeast Genetics anu Molecular Biology, Methods in Enzymology, Volume 194, pp. 182-187. Academic Press, inc., New York, ito et al, 1983, Journal of Bacteriology, 153: 163: Hinnen et al. 1976 Frcceedings of the National Academy of Sciences USA ΐΰ. 1920.

rhymers for suitable * Drs »kdeny ^ etki-demakin include strains of

Saccharomyces. for example, S cerevisiae, Schizosaccharomyces, Kfuyvernmycas,

Hchta, such as P. pastons or P. metnanoiica, Hansenuia, as H. Poiymofoha, or

Yarrowia. Methods for the transformation of PBS and deoxyribonucleic acid cells and the preparation of heterologous polypeptide thereof are provided by Clontech Laboratories, inc. Palo Alto, CA, USA (in Yeastmaker ™ Yeast Transformation System K ^f t product protocol) and by Reeves - ~ ta *.,

FEMS Microbiology Letters 99 (1992) 193-198, Manivasakam and Sehiest ·. Nucleic

Acids Research, 1993, Vol. 21, No. 3 18, pp. 4414-4415, Gar.eva st ai .. fTMS Microbiology Letters 121 (1994) 159-164.

Examples of suitable insect host cells include the Lepidvpiaa cell line, such as Spodoptera frugiperda (Sf9 or S121) or Ttichoplustoa rv cells (High Five) (US 5,077,214). Transformation of insect cells and production of heterologous polypeptides thereof can be carried out as described by Invitrogen.

Examples of suitable mammalian host cells include Chinese hamster ovary (CHO) cell lines (eg. CHO Κί, ATCC CCL 61), Green Monkey cell lines (COS) (eg, COS 1 (ATCC GRL-1650). COS 7 (ATCC CRL-1651)), mouse cells (e.g., NS / O). newborn hamster kidney (BHK) cell lines (eg, ATCC CRL1632 or ATCC CCL-10) and human cells (eg, HEK 293 (ATCC CRL-1573)) as well as plant cells in gill culture. Specialists are also aware of other additional cell lines that are supplied by public depositories, such as the American Type Culture Collection. Rockville. Maryland Also, mammalian cells, such as CHO cells, can be modified to exhibit cialyltransferase, e.g., 1,6-sialyltransferase, for example, as described in US 5,047,335. to achieve improved glycosylation of the interferon-gamma polypeptide variant.

• · · · · · · · · · · · · · · · · · · · _β

Methods for Introduction LaEADSk'Og * n & D8oxg? Onuclein &? 1 kcelino 3 mammalian host cells include calcium-dependent phosphate transfection electroporation dependent on DEAE-dextran transFecima liposome-dependent transfection, viral vectors and transfection method described by Life Technologies Ltd, Paisley, UK using Lipofectamin 2000 These media are known to those skilled in the art and described, for example, by Ausbei et al., ( eds.), 1996, Current Protocols in Molecular Biology, John Wiley & Sons, Nsv. · York, USA. Mammalian cell culture is performed according to established methods, for example, as described in (Animal Cell Biotechnology. Methods and Protocols, Edited by Nigel Jenkins, 1999, Human Press Inc, Totowa, New Jersey, USA and Harrison MA and Rae IF , General Techniques it Cell Culture, Cambridge University Press 1997).

To produce glycosylated polypeptide. the use of a eukaryotic host cell, for example, of the type mentioned above is preferred.

In the production method of the present invention, the cells are grown in a culture medium suitable for producing the polypeltidine

variety, when using. known to those skilled in the art For example, the cell may be grown in a shake flask, under any kind of fermentation (including continuous, in mass, in storage, or solid-phase fermentation) in laboratory or industrial fermenters, carried out in suitable media and under conditions that allow the manifestation of the polypeltidine

Growing is carried out in a suitable culture medium, including carbon and nitrogen sources and inorganic salts, using methods known to those skilled in the art. Suitable media are commercially available or can be prepared according to published concepts (for example, in American Type Culture Collection catalogs ). If the polypeptide variant is not released, it can be restored from the body of pizzas directly in the nutrient medium, can the polypeptide species directly from the medium * be 'recovered? *

The resulting polypeptide variant can be recovered e.g. using methods known in the art. For example, the polypeptide variant can be recovered from the nutrient medium by conventional methods including, but not limited to, centrifugation,

filtration, extraction. spraying, evaporation or precipitation, and the julipeptide species can be purified by a number of methods known to those skilled in the art, including, but not limited to, chromatography (for example, ion exchange affinity hypophobicity, chromatophocusing, and size-dependent}, electrophoresis *; methods; , preparative isoelectric focusing), solubility solubility «eg, precipitation with ammonium sulfate), SDS-PAGE or extracted (see, e.g., Protein Purification, J. 0. Janson an cl Lars Ry J ~ r.

New York, 1989) Specific methods for purifying polypeptides exhibiting interferon-gamma activity are described in EP 110044 and Japanese petent application No ί96995 / 84.

The biological activity of the interferon-gamma polypeptide variant can be investigated using methods known in the art. These assays include neutralization of an antibody with antiviral activity, introduction of protein kinase, &lt; RTI ID = 0.0 &gt; silk &lt; / RTI &gt; activity of 2.5 A synthase or phosphodiesterase as described in EP 41313 B1. These assays also include immunomodulatory assays (see, e.g.,

US 4,753,735). growth inhibition assays and evaluation of binding to cells that are interferon receptors. Specific analyzes are described in the section describing the materials and methods of the present invention.

• · · · · · · · · · · · · · · · · · · · · · · · · · ·

Pharmaceutical * Composed zhyatnyuYarideksenie

Moreover, the present invention relates to improved methods of treating or preventing, in particular, inflammation, for example, interstitial lung diseases, such as idiopathic pulmonary fibrosis, but also granulomatous diseases; cancer, in particular, ovarian cancer; infections such as pulmonary atypical mycobacterial infections; bone disorders (e.g., bone metabolism disorders such as malignant osteoporosis); autoimmune diseases, such as rheumatoid arthritis, and other diseases such as multidrug-resistant tuberculosis; cryptococcal meningitis; cystic fibrosis and liver fibrosis, in particular hepatic fibrosis due to hepatitis C, said method comprising administering to a mammal, in particular, a human in need, an effective amount of a polypeptide variant of the present invention or composition of the present invention; the key advantages being less frequent and / or less intrusive administration in more effective treatment, and possibly a lower risk of immune reactions with the therapeutically active compound (s).

The molecule of the present invention is preferably administered in the form of a composition comprising a pharmaceutically acceptable carrier or excipient. "Pharmaceutically acceptable" means a carrier or excipient that does not cause adverse effects in the patients to whom it is administered. Such pharmaceutically acceptable carriers and excipients are known in the art (Remingtons Pharmaceutical Sciences, 18 ^{ifl edition, AR Gennaro, Ed.} , Mack Publishing Company [ 1990]: Pharmaceutical Formulation Development of Peptides and Proteins, S. Frokjaer and L Hovgaard, Eds., Taylor & Francis [2000]; Handbook of Pharmaceutical Excipients, 3 ^rd edition, A. Kibbe, Ed., Pharmaceutical Press [2000]).

The molecules according to the present invention can be used as they are and / or in the form of their salt. Suitable salts include, but are not limited to, alkali metal or alkaline earth metal salts such as sodium, potassium, calcium and magnesium, as well as zinc salts. These salts or complexes may exist as crystalline and / or amorphous structures.

The variant of the present invention is administered at a dose approximately the same as that used for treatment with known interferon-gamma formulations, such as Actimmune® or as described in EP 795332. The exact dosage for administration depends on the circumstances. Usually, the dose is such that it can prevent or reduce the severity or spread of the condition or indication being treated. It will be apparent to those skilled in the art that the effective amount of the variety or composition according to the present invention depends on the disease, dose, mode of administration, whether the polypeptide variety or composition is administered alone or in combination with other therapeutic agents, the serum half-life of the compositions and the overall health the patient's condition.

The present invention also relates to the interferon-gamma polypeptide variant of the present invention, or to the pharmaceutical composition of the present invention for use as a medicament.

Moreover, the present invention also relates to the use of a) an interferon-gamma polypeptide variant according to the present invention, or b) a pharmaceutical composition according to the present invention intended for the preparation of a medicament, pharmaceutical composition or a set of treatment parts inflammation, for example, interstitial lung diseases, such as idiopathic pulmonary fibrosis, cancer, in particular, ovarian cancer, infections, such as atypical mycobacterial lung infections: bone disorders (e.g., · · · · · • · · • · · • · · violation of • · · • · · · • · · • · · · w · ₉ bone metabolism catego * malignant osteoporosis):

granulomatous diseases; autoimmune diseases, such as rheumatoid arthritis, and other diseases such as multidrug-resistant tuberculosis;

cryptococcal meningitis; cystic fibrosis and liver fibrosis, in particular, liver fibrosis due to hepatitis C. The most preferred disease for treatment is interstitial lung disease, in particular, idiopathic pulmonary fibrosis.

Improved methods of delivering the molecules of the compositions are also described and may be further used.

glucocorticoids.

The preferred dose is 1-4, more preferably 2-3 micrograms per kilogram body weight per patient of the polypeptide component per dose. The preferred dose is 100-350, more preferably 100-150 microgram glucocorticoid per kilogram body weight per patient per dose.

The present invention also relates to a kit of parts suitable for the treatment of interstitial lung disease, comprising a first pharmaceutical composition comprising the active components a) or b). mentioned above, and a second pharmaceutical composition comprising at least one glucocorticoid. each together with a pharmaceutically acceptable carrier and / or excipient.

The polypeptide variant of the present invention is formulated into pharmaceutical compositions by known methods. Suitable compositions are described in Remington s Pharmaceutical Sciences by E. W. Martin and US 5,183,746.

The pharmaceutical composition can be formulated in various forms, including liquid, gel, lyophilized form, powder, pressed solid or other suitable form. The preferred form depends on the particular disease to be treated and understood by those skilled in the art.

The pharmaceutical composition may be administered orally, subcutaneously, intravenously, intracerebrally, intranasally, transdermally, tapereditoneally. muscle.

ethnopulmenary? '' 'Vaginally, rectally.

intraocular or other appropriate means, for example, using PowderJect or ProLease technologies. The compositions can be administered continuously by infusion, although bolus injection is acceptable, using techniques known to those skilled in the art, such as pumps or implants. In some cases, the compositions may be administered directly in the form of a solution or aerosol. The preferred route of administration depends on the particular disease to be treated and understood by those skilled in the art.

The pharmaceutical composition of the present invention can be administered together with other therapeutic agents. These agents may be introduced as an integral part of the same pharmaceutical composition or may be administered separately from the polypeptide variant,

according to the present invention, either competitively or in accordance with another acceptable treatment regimen. Moreover, the polypeptide variant or pharmaceutical composition of the present invention can be used in addition to other treatments. In particular, combinations with glucocorticoids as described in EP 795332 are acceptable.

In another aspect, the present invention relates to a method of treating mammals having circulating antibodies to human interferon gamma or recombinant human interferon gamma, characterized in that it comprises administering interferon gamma species having interferon gamma bioactivity. and which does not interact with said antibodies. Preferably, the compound is a variant described in the present invention and the mammal is preferably a human. The mammals to be treated may suffer from any of the diseases listed above for which interferon-gamma treatment is effective. Moreover, the present invention relates to a method for preparing a pharmaceutical product for use in the treatment of mammals.

• - - · ·· · · ···· ···· ··· »,,, ··· ......

Having circulating antibodies to 'human' interferon-gamma or recombinant human interferon-gamma, characterized in that the interferon-gamma species having interferon bioactivity and which does not interact with said antibodies, is formulated in an injectable or in any other form suitable composition. The term circulating antibodies '' means mammalian autoantibodies in response to treatment with any commercially available interferon-gamma composition.

The present invention also relates to the use of a nucleotide sequence encoding an interferon gamma polypeptide variant of the present invention in gene therapy. Of particular interest is the use of a nucleotide sequence encoding the interferon-gamma polypeptide variant described in the interferon-gamma section of the present invention, wherein the non-polypeptide moiety is a sugar moiety above. The glycosylation of the polypeptide variant is therefore achieved during the course of gene therapy, i. E. after expression of the nucleotide sequence in the human body.

Gene therapy involves treating those diseases in which the polypeptide variety is expected to provide effective therapy.

Topical administration of gene therapy using interferon-gamma variants leads to directing the therapeutic agent to the correct area, avoiding potential toxic problems associated with nonspecific administration.

Both in vitro and in vivo gene therapy are administered.

Various methods are known for transferring potentially therapeutic genes to specific cell populations. For comparison, see, for example, Mulligan, “The Basic Science of Gene Therapy,” Science, 260, pp. 92631 (1993). These methods include:

• · · · · * · · · · · · · · · · · · · · · · · · · · · · 0

Direct gene transfer, for example. * "Described * in" "Wolff et al .. Direct Gene Transfer Into Mouse Muscle In Vivo". Science, 247, pp. 1465-68 (1990);

Liposome-guided DNA transfer, for example, is described in Calpen et al., 'Liposome-mediated CFTR Gene Transfer to the Nasal Epithelium Of Patients With Cystic Fibrosis', Nature Med., 3, pp. 39-46 (1995); Crystal. “The Gene As A Drug,” Nature Med., 1, pp. 15-17 (1995); Gao and Huang, “A Novel Cationic Liposome Reagent for Effective Transfection of Mammalian Cells,” Biochem. Biophys. Really. Comm., 179, pp. 280-85 (1991);

Retroviral DNA transfer control, for example, described in Kay et al. "In vivo Gene Therapy og Hemophilia B; Sustained Partial Correction In Factor IXDeficient Dogs ”, Science, 256, pp. 808-13 (1992);

DNA-driven virus transfer DNA transfer. These DNA viruses include adenoviruses (preferably, Ad-2 or Ad-5 based vectors), herpes viruses (preferably, herpes simplex virus vectors), or parvoviruses (preferably, "defective vectors" "Or non-autonomous parvoviruses, more preferably vectors based on the adeno-associated virus, most preferred are vectors based on AAV-2). See, e.g., Alt et al., “Use of DNA Viruses as Vectors for Gene Therapy,” Gene Therapy, 1, pp. 367-84 (1994); US 4,797,368; US 5,139,941.

pharmaceutical compositions for parenteral administration

An example of a pharmaceutical composition is a solution intended for parenteral administration. Although in many cases the pharmaceutical compositions in solution form are obtained in a liquid state suitable for timely use, these parenteral administration compositions may also be frozen or in lyophilized form. In the first case, the composition should be melted before use. The second form is often used to improve the stability of the active compound contained in the composition under a wide variety of storage conditions, as is known

those of ordinary skill in the art, ¹ g ^, 10 * filtered &lt; RTI ID = 0.0 &gt;&lt; / RTI &gt; are generally more stable than their liquid counterparts. Such lyophilized compositions are dissolved before use by the addition of one or more suitable pharmaceutically acceptable solvents, such as sterile injectable water or sterile saline saline.

In the case where the composition is to be administered parenterally, they are prepared as lyophilized storage compositions or aqueous solutions by mixing, if appropriate, a polypeptide variant having the desired degree of purity with one or more pharmaceutically acceptable carriers, excipients or stabilizers, generally used in practice (all called "excipients"), for example buffers, stabilizers, preservatives, isotonics, non-ionic surfactants, antioxidants and / or other various boots.

Buffers help maintain pH within a range that approximates physiological conditions. They are usually present in concentrations of from about 2 mM to about 50 mM. Suitable buffers used according to the present invention include organic and inorganic acids and their salts, such as citrate buffers (e.g., monosodium citrate-disodium citrate mixture, citric acid-trisodium citrate mixture, citric acid mixture - monosodium citrate, etc.), succinate buffers (eg succinic acid mixture - monosodium succinate, succinic acid mixture - sodium hydroxide, succinic acid mixture - disodium succinate, etc.), tartrate bu ery (eg tartaric acid mixture - sodium tartrate, tartaric acid mixture - potassium tartrate, tartaric acid mixture sodium hydroxide, etc.), fumarate buffers (eg, fumaric acid mixture - monosodium fumarate, fumaric acid mixture - disodium fumarate, mixture monosodium fumarate - disodium fumarate, etc.), gluconate buffers (for example, gluconic acid mixture - sodium gluconate, gluconic acid mixture - sodium hydroxide, gluconic acid mixture - potassium

S4

gluconate, etc.). oxalate buffers (for example '' ®µ'θο 'oxalic acid sodium oxalate, oxalic acid-sodium hydroxide mixture, oxalic acid-potassium oxalate mixture etc.), lactate buffers (eg lactic acid sodium lactate mixture, lactic acid mixture acid - sodium hydroxide, lactic acid - potassium lactate mixture, etc.) and acetate buffers (eg, acetic acid - sodium acetate mixture, acetic acid - sodium hydroxide mixture, etc.). Other options are phosphate buffers, histidine buffers, and trimethylamino salts, such as Tris.

Preservatives are added to retain microbial growth and are usually added in an amount of about 0.2% - 1% (w / v). Suitable for use according to the present invention include phenol, benzyl alcohol, metacresol, methylparaben, propylparaben, octadecyldimethylbenzylammonium chloride, benzalkonium halides (e.g., benzalkonium chloride, bromide or iodide), hexabenamethyl, pentylbenzamide or chlorophenylbenzamide. catechol. resorcinol, cyclohexanol and 3-pentanol.

Isotonics are added to ensure the isotonicity of the liquid compositions and include polyvalent sugar alcohols, preferably trivalent or higher sugar alcohols such as glycerin, erythritol, arabitol, xylitol, sorbitol and mannitol. Polyvalent alcohols may be present in an amount of between 0.1 and 25% by weight, typically from 1 to 5% by weight, taking into account the corresponding amounts of the other ingredients

Stabilizers refer to a large group of excipients that can range in size from bulking agents to additives that solubilize the therapeutic agent or help prevent denaturation or sticking to the container wall. Typical stabilizers may be polyvalent sugar alcohols (listed above); amino acids such as arginine, lysine, glycine, glutamine, asparagine, histidine, alanine. omitin. L-leucine, 2-phenylalanine. glutamic acid.

9 Threonine, etc., Organic 3Zaryan alcohols Sugar alcohols such as lactose, trehalose, stachiosis, mannitol, sorbitol, xylitol, ribitol, myoinisitol, galactitol, glycerol and others, including cyclitol. such as inositol; lolethylene glycol; polymers of amino acids; sulfur-containing reducing agents, such as urea, glutathione, thioctic acid, sodium thioglycolate, thioglycerol, α-monothioglycerol and sodium thiosulphate, low molecular weight polypeptides (e.g., with less than 10 residues); proteins such as human serum albumin, bovine serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; monosaccharides such as xylose, mannose, fructose and glucose; disaccharides such as lactose, maltose and sucrose; trisaccharides such as raffinose and polysaccharides such as dextran. The stabilizers are usually present in amounts of 0.1 to 10,000 parts by weight relative to the weight of the active protein.

Non-ionic surfactants or detergents (also known as "wetting agents") help solubilize the therapeutic agent as well as protect the therapeutic polypeptide from aggregation. induction by stirring, allowing exposure of the surface to tension without causing denaturation of the polypeptide Suitable non-ionic surfactants include polysorbates (20, 80, etc.), polyoxamers (184, 188, etc.), PlurcnicG polyols, polyoxyethylene sorbitan monoethers (Tween®-20, Tween © -80, etc.)

Other additional excipients include bulk fillers or excipients (e.g., starch), chelating agents (e.g., EDTA), antioxidants (e.g., ascorbic acid, methionine, vitamin E), and co-solvents.

The active ingredient may also be incorporated into the microcapsules obtained, for example, by coacervate techniques or phase boundary polymerization, for example, mycocaleules o ^g hydroxymethylcellulose, gelatin or polymethyl methacrylate. in colloidal drug delivery systems (e.g., ·· * liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules), or in microemulsions. These techniques are described in Remington s Pharmaceutical Sciences, suora

Compositions for parenteral administration used for in vivo administration should be sterile. This is easily achieved, for example, by filtration through sterile filtration membranes.

In a preferred aspect of the present invention, said pharmaceutical composition comprises a) an interferon-gamma variety according to the present invention, b) a buffering agent, in particular, an organic acid salt capable of maintaining a pH between 5.0 and 6.5, c) a stabilizer, -specifically, organic sugar or sugar alcohol, d) a non-ionic surfactant, and e) sterile water. In particular, the buffering agent is selected from the group consisting of acetate, succinate and citrate, the stabilizer is mannitol or sorbitol, the nonionic surfactant is Tween®-20 or Tween®-80. Preferably, the pharmaceutical composition does not include any preservatives

Delayed release formulations

Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the polypeptide variant, the matrices having a suitable shape, such as a film or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (e.g., poly (2-hydroxyethyl methacrylate) or polyvinyl alcohol), polylactides, copolymers of 6-glutamic acid and ethyl 6-glutamate, indigestible ethylene vinyl acetate, degradable methylene ethyl acetate and glycolic acid, such as ProLease® or Birgop Depot® (injectable microspheres composed of a copolymer of lactic acid and glycolic acid and leuprolidacetate) and poly D - (-) 3 hydroxybutyric acid As polymers • ♦ * · ·· ·· · · · · · · · · · · · · · · · · · Such as ethylene vinyl acetate and a coupler of lemic acid and glycolic acid allow molecules to be released over long periods of time, with up to or more than 100 days some hydrogels releasing progeny for shorter periods of time. When the encapsulated polypeptides remain in the body for a long period of time, they

can be disaggregated or aggregated as a result of contact with moisture at 37 ° C, resulting in loss of biological activity and possible changes in immunogenicity. A rational stabilization strategy may be devised depending on the mechanism involved. For example, if the mechanism of aggregation is found to be intermolecular SS bond formation through thiodisulfide, stabilization can be achieved by modifying sulfhydryl residues, lyophilized from acidic solutions controlling moisture content, using appropriate additives and developing specific formulations polymer matrices.

Oral administration

For oral administration, the pharmaceutical compositions may be solid or liquid, for example, in the form of a capsule, tablet, emulsion suspension or solution. The pharmaceutical composition is preferably obtained in the form of a dosage unit containing a given amount of active ingredient. The appropriate daily dose for a human or other mammal varies widely depending on the patient's condition and other factors, but cannot be determined by one of ordinary skill in the art using routine methods.

Solid dosage forms for oral administration include capsules, tablets, suppositories, powders and granules. In these solid dosage forms, the active compound may be mixed with at least one inert diluent, such as sucrose, lactose or starch. These dosage forms may also contain, as is customary, additional substances, for example.

* - * · · · ···· ί ί: ί ·! 'J ····· · lubricants, such as magnesium stearate. Cases, capsules, tablets, and tablets, dosage forms may also contain buffers. The tablets and pills may also be coated.

The polypeptide variants may be mixed with additives such as

lactose, sucrose, starch powder, cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, polyvinylpyrrolidine be tableted or encapsulated for conventional administration. Or, they can be dissolved in saline, water, polyethylene glycol, propylene glycol. ethanol, oils (such as corn oil, peanut oil, cottonseed oil or sesame oil), tragacanth and / or various buffers. Other additives and routes of administration are known to those skilled in the art of pharmacy. The carrier or diluent may include a time-delayed material such as glyceryl monostearate alone or with wax or other materials known to those skilled in the art.

The pharmaceutical compositions may be subjected to conventional pharmaceutical operations such as sterilization and / or may include conventional additives such as preservatives, stabilizers, wetting agents, emulsifiers, buffers, fillers, etc., as described in the present invention.

Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups and elixirs containing inert diluents commonly used by those skilled in the art, such as water. These compositions may also contain additives such as wetting agents, sweeteners, flavoring agents and flavoring agents.

j ίϋΚαΑίΐΰ cttjitfLihUCii ipUpciiiiJ

Formulations suitable for topical administration include liquid or semi-liquid compositions suitable for penetration through the skin (eg, ointments, lotions, ointments, creams or pastes) and drops suitable for administration to the eyes, ears or nose.

Pulmonary administration

Compositions suitable for application with a nebulizer or spray or ultrasound generally comprise polypeptide variants dissolved in water at a concentration of, for example, from about 0 to 25 mg of the polypeptide variant per mL, preferably from about 0 to 10 mg / mL. The composition may also include buffer and plain sugar (e.g., for protein stabilization and regulation of osmotic pressure) and / or human serum albumin in a concentration range of 0.1 to 10 mg / mL. Examples of buffers that may be used are sodium acetate, citrate and glycine. Preferably, the buffer is of such composition and molarity as to establish a pH of the solution from 3 to 9. In general, a buffer molarity of from 1 ppm to 50 mM is suitable for this purpose. Examples of sugars that can be used are lactose maltose, macitol, sorbitol, trehalose and xylose, typically from 1% to 10% by weight of the composition.

The aerosol composition may also comprise a surfactant to reduce or prevent the protein surface aggregation caused by the atomization of the solution to form an aerosol. Different conventional surfactants, such as esters and alcohols of polyoxyethylene and fatty acids, and esters of polyoxyethylene sorbitan and fatty acids, may be used. The amount generally ranges from 0 001% to 4% by weight of the composition. A particularly preferred surfactant for the purposes of the present invention is polyoxyethylene sorbitan monooleate.

• · · · ·

Particular compositions and for obtaining inappropriate dispersions of the particulate matter according to the present invention are described in WO 94/20069, US 5,915,378, US 5,960,792, US 5,957,124, US 5,934,272, US 5,915,378. U-S 5,355,564, US 5,826,570 and US 5,522,385 given herein for comparison.

Formulations intended for use in a dose inhaler typically contain fine powder. This powder may be obtained by lyophilization and subsequent grinding of the liquid composition of the polypeptide variant and may also contain a stabilizer such as human serum albumin (HSA). More than 0.5% (w / w) human serum albumin (HSA) is usually added. ). Moreover, if necessary, one or more sugars or sugar alcohols may be added to the composition. Examples include lactose, maltose, mannitol, sorbitol, sorbitosis. trehalose, xylitol and xylose. The amount added to the composition may vary from 0.01 to 200% (w / w), preferably from about 1 to 50% of the conjugated compound. These formulations are then pyophysized and milled to the desired particle size.

The particles of suitable size are then suspended in a reactive substance (propellant) with the aid of a surfactant. Propellant may be any conventional substance used for such purpose, such as chlorofluorocarbon, hydrochlorofluorocarbon. hydrofluorocarbon. or a hydrocarbon comprising trichlorofluoromethane, dichlorodifluoromethane. dichlorotetrafluoroethanol and 1,1,1,2-tetrafluoroethane, or mixtures thereof. Suitable surfactants include sorbitan trioleate and soy lecithin. Oleic acid can also be used as a surfactant. This mixture is then introduced into the administration device. An example of a commercially available dosage inhaler for use in the present invention is the Ventolin fixed dose inhaler, which is known as Glaxo inc.

Triangle Park.

Powder inhaler compositions include a fine dry odor containing the polypeptide variant and may also contain a bulking agent such as lactose, sorbitol, sucrose or mannitol in an amount that facilitates the dispersion of the powder from the device, for example, from 50% to 90% by weight. the weight ratio of the composition. The particulate matter must have aerodynamic properties in the lung, corresponding to particles with a density of about 1 g / cm ² , having an average diameter of less than 10 micrometers, preferably between 0.5 and 5 micrometers, and in particular between 45 and 3.5 micrometers An example of a powder inhaler suitable for use according to the present invention is the Spinhaler powder inhaler manufactured by Fisons Corp., Bedford, Mass.

The powders for these devices may be prepared by the methods described in US 5,997,848, US 5,993,783, US 5,985,248, US 5,976,574, US 5,922,354, US 5,785 049 and US 5 654,007

Mechanical devices designed for the pulmonary administration of therapeutic products include, but are not limited to, nebulizers, fixed dose inhalers and powder inhalers, all of which are known to those skilled in the art. Specific examples of commercially available devices suitable for use according to the present invention are the Ultravent atomizer manufactured by Mallinckrodt, Inc., St. Louis, Missouri; Acorn !! nebulizer, production of Marquest Medical Products, Englewood, Colorado; Ventolin fixed dose inhaler, manufactured by Glaxo inc., Research triangle Park. North Carolina; Spinhaler powder inhaler, manufactured by Fisons Corp., Bedford. Massachusetts; standing cloud device, manufactured by inhale Therapeutic Systems, Inc., San Carlos, California, AIR inhaler, produced AMKci 'manure! nsa,

• · · · · · · * *

Cambridge, Massachusetts; AEIA ^ systema ^ a ^ ulmonary drug administration manufactured by Aradigm Corporation, Hayward. California.

Examples of carrying out the invention

The present invention is described using the following examples.

The examples in no way limit the description of the present invention and the claims.

MATERIALS AND METHODS

Materials

CHO-K1 cells (obtained from American Type Culture Collection (ATCC # CCL81)).

HeLa cells, (obtained from American Type Culture Collection (ATCC # CCL ·

2)).

ISRE-Luc. obtained from Stratagene. La Jolla, USA.

pCDNA 3.1 / hydro obtained from Invitrogen, Carlsbad, USA.

Restriction enzymes and polymerases obtained from New England Biolabs inc., Beverly, USA.

DMEM medium: Dublecco s Modified Eagle Media (DMEM), 10% fetal bovine serum and Hygromycin B obtained from Life Technologies A / S, Copenhagen, Denmark.

LucLite substrate obtained from Packard Biosence, Groningen. The Netherlands.

TopCount luminometer, manufactured by Packard Biosence. Groningen.

The Netherlands

Biotinylated polyclonal anti-human interferon-gamma antibody,

BAF285, obtained from R&D Systems Inc., Minneapolis, USA.

·· · ···· • · · · «• · · · · • · ♦ · f · ·· • · • · • · · · · · · · · ·

Horse Radish Peroxidase - tkbpsdtta with streptavidin. P0397, obtained from DAKO, Copenhagen, Denmark.

TM8 marking reagent obtained from KEM-EN-itC. Copenhagen, Denmark

Methods

Analysis for interferon

It has already been reported that interferon-gamma interacts with and activates interferon-gamma receptors on HeLa cells. As a consequence, copying is activated at promoters. containing an interferon-stimulated element (ISRE). Therefore, an assay for interferon receptor agonists is possible using an interferon stimulated luciferase gene reporter (ISRE luc) element inserted into HeLa cells.

Primary analysis

HeLa cells are transformed together with an interferon-stimulated element. coupled with luciferase reporter gene (ISRE-luc) and pCDNA 3.1 / hydr. and, when selected in a DMEM medium containing Hydromycin B, foci (cell doubles) are generated. Cell duplicates were examined for luciferase activity in the presence or absence of interferon-gamma. Those doubles that show the highest ratio of stimulated to unstimulated luciferase activity are used in the following assays.

To examine polypeptide variants, 15,000 cells / well were placed in 96-well culture plates and incubated overnight in DMEM medium. The next day, the polypeptide variants as well as a known standard were added to the cells in different concentrations. Actimmune © is used as the "known standard".

Aciimmune® 4 ampoules were diluted 5 ^ a ** to ·· »·

5¾} bovine serum embryos and stored at -80 ° C until use

The plates were incubated for 6 hours at 37 ° C in an air atmosphere with 5% carbon dioxide and then added to each well.

LucLite substrate (Packard Bioscience, Groningen, The Netherlands). The plates were closed and the luminescence was measured using a TopCount luminometer (Packard) in single photon counting (SPC) mode.

Each individual plate contains wells incubated with interferon-gamma

such as stimulated control and other wells containing a normal environment such as unstimulated control. The activity ratio of stimulated and unstimulpran luciferase serves as an internal standard for both interferon-gamma activity and experiment-experiment variations. For each interferon-gamma sample, unit quantities are determined with respect to the Aciimmune® standard and given as AU .

Determination of increased glycosylation

To determine the different degrees of glycosylation of the interferon-gamma monomer varieties, the SDS-PAGE gel was transferred under standard conditions and transferred to a nitrocellulose membrane. Western blotting was performed according to standard methods using a biotinylated polyclonal antibody against anti-human interferon-gamma (BAF285 by R&D Systems) as primary antibody and streptavidin-bound Horese Radish peroxidase (P0397 by DAKO) as a secondary antibody, followed by of TMB staining reagent (KEM-EN-TEC, Copenhagen, Denmark). The distribution of the interferon-gamma monomer species with different degrees of glycosylation of the colored membrane is carried out visually.

·· »·

X with: · · · · · · · · · · · · · · · · · · · · · · ·

Determination of AUCsc. * '* ** · ^: · * ·· *' ·· ** ·· *

The AUCsc was determined at 200 μ! bolus subcutaneous administration: an equal amount (on an active basis) of the interferon-gamma polypeptide variant of the present invention in rats.

Female Sprag Dawley rats weighing between 220 and 260 grams were used for these experiments. The interferon-gamma polypeptide was mixed with sodium succinate (720 mg / l), mannitol (40 g / Ι), polysorbate 20 (100 mg / l) at pH 6.0.

Before subcutaneous administration, a blood sample is taken from the caudal vein to ensure that interferon gamma activity will not be detectable After administration, caudal blood is taken from the caudal vein after 10 minutes, 20 minutes, 40 minutes, 60 minutes, 120 minutes, 240 minutes, 480 minutes, 720 minutes, 1440 minutes, 1620 minutes, 1920 minutes and 2880 minutes (sometimes after 3600 minutes). Serum was prepared by leaving the coagulate on a blood sample for 20 minutes at room temperature, followed by centrifugation at 5000 grams, 20 minutes at room temperature. The serum was then isolated and stored at ~ 0 ^with C at

determination of interferon-gamma activity using the above primary assay. It should be noted that when determining the amount of units in serum samples from PK studies of rats, the Actimmune® standard was diluted in DMEM, 5% FBS and 5% rat serum.

Then, the amount of units in serum (AU / ml) relative to time (minutes) is plotted and the AUC _sc is calculated using GraphPad Prism 3.01.

The same experiments were performed with human interferon-gamma in its glycosylated form and / or with Actimmune® to evaluate the increase in AUCsc of the interferon-gamma polypeptide variant of the present invention, compared to human interferon-gamma in its glycosylated form and / or with Actimmune®.

9G · · · ·

Serum half-life

Serum half-life is determined at one 200 μ 200 bolus intravenous administration of an equal amount (on an active basis) of the interferon-gamma polypeptide variant of the present invention in rats.

For these experiments female Sprag-Dawley rats weighing between 220 and 260 grams were used. The interferon-gamma polypeptide was mixed with sodium succinate (720 mg / l), mannitol (40 g / Ι), polysorbate 20 (100 mg / l) at pH 6.0.

Prior to intravenous administration, a blood sample is taken from the tail vein to ensure that interferon-gamma activity will not be detectable. Following administration, blood samples are taken from the tail vein after 5 minutes, 10 minutes, 20 minutes, 40 minutes, 60 minutes, 120 minutes, 240 minutes, 480 minutes, 720 minutes, 1440 minutes, 1620 minutes, 1920 minutes, and 2880 minutes. Serum was prepared by leaving the coagulate on a blood sample for 20 minutes at room temperature, followed by centrifugation at 5000 grams, 20 minutes at room temperature. The serum was then isolated and stored at -80 ° C until interferon-gamma activity was determined using the "Primary Assay" described above. It should be noted that when determining the amount of units in serum samples from PK studies of rats, the Actimmune® standard was diluted in DMEM, 5% FBS and 5% rat serum.

Then, the amount of units in serum (AU / ml) relative to time (minutes) is plotted and the serum half-life is calculated using WinNonLin Pro 3.3.

The same experiments were performed with human interferon-gamma in its glycosylated form and / or with Actimmune® to evaluate the increase in serum half-life of the interferon-gamma polypeptide variant of the present invention as compared to human interferon-gamma in its glycosylated form and / or with Actimmune®.

• ·· 9ϊ · · · · · ·····. ..

; · · ...

· · · ·. .1. · · · · · · · · · · ·

Identification of surface-facing amino acid residues Structures

Experimental 3D structures of human interferon-gamma, determined by X-ray crystallography, are described by: Ealick et al., Science, 252: 698-702 (1991), which gives the C-alpha trace of an interferon-gamma homodimer. Walter et al., Nature 376: 230-235 (1995) describe the structure of an interferon-gamma homodimer in complex with two molecules of the soluble form of the interferon-gamma receptor. The coordinates of this structure were never available. Thiel et al .. Structure 8: 927-936 (2000) describe the structure of an interferon-gamma homodimer in complex with two molecules of the soluble form of the interferon-gamma receptor having a third molecule of the receptor in the structure that does not interact with interferon-gamma homodimer.

Reached Surface Area (ASA)

The computer program Access (B. Lee and F. M. Richards, J. Mol. Biol. 55: 379-400 (1971)) option 2 (Copyright ( c) 1983 Yale University). This method is typically used for aperture size of 1.4 A and defines the surface area reached (ASA) as the area formed by the center of the opening. Prior to this calculation, all water molecules, hydrogen atoms and other atoms not directly related to the protein were separated from the coordination network.

fractional reach surface area (ASA) of the side chain

The fractional reach surface area (ASA) of the side chain atoms is calculated by dividing the sum of the fractional reach surface area (ASA) of the side chain atoms by the value of the fractional reach surface area (ASA) ··· ·· .. ..

of the atoms of the side chain of the residue species of the extended ALA-x-ALA tripeptide. See, Hubbard, Campbell & Thornton (1991), J. Mol. Biol. 220: 507-530. For this example, the CA atom is referred to as part of the side chain of glycine residues, but not the remaining residues. The following table is used as the standard 100% fractional reach surface area (ASA) for the side chain:

Ala 69.23 A ² Arg 200.35 A ² Asn 106.25 A ² Asp 102.06 A ² Cys 96.69 A ² Gin 140.58 A ² Giu 134.61 A ² Gly 32.28 A ² His 147.00 A ² lie 137.91 A ² Leu 140.76A ² Lys 162.50 A ² Met 156.08 A ² Phe 163.90 A ² Pro 119.65 A ² Sir 78.16 A ² Thr 101.67 A ² Trp 210.89 A ² Tyr 176.61 A ² Vai 114.14 A ²

Residues that are not detected in the structure are defined as having 100% manifestation as they are considered to reside in flexible areas. Determination of distances between atoms

The distances between atoms are determined by molecular graphics software, for example, Insightll v. 98.0, MSI INC.

95 .....

•::. ·. ··· * · * · ··· * ·· * * · «·· * Determining the receptor binding site

A receptor binding site is defined as containing all residues having their surface surface area altered by receptor binding. This is determined by at least two calculations of the surface area reached; one of the isolated ligand (s) in the ligand (s) / receptor complex (s) and one of the completed ligand (s) / receptor complex (s).

EXAMPLE 1 - Determination of surface-facing amino acid

residues

The X-ray structure used is an interferon-gamma homodimer in complex with two molecules of the soluble form of the interferon-receptor having a third molecule of the interferon-gamma receptor in the structure that does not interact with the interferon-gamma homodimer described by Thiel et al., Structure 8 : 927-936 (2000). The structure consists of an interferon-homodimer in which two molecules are labeled A and B. For the purpose of construction, additional methionine is placed before the interferon-gamma sequence, labeled MO, and the sequence is truncated at the C-terminus by 10 residues (Q133 is the last residue in the engineered molecules). The MO is separated from the structure in all calculations of this example. The structure of the two interferon-gamma monomers has a very small electron density after residue 120, and the residues are only modeled until residue T126. Therefore, residues S121-T126 are separated from the structure prior to the calculations in this example. The two receptor fragments, labeled C and D, interact directly with the interferon-gamma homodimer, and the third receptor molecule, labeled E, has no contact with the interferon-gamma homodimer and is not included in these calculations.

• Surface manifestation

Performing fractional reach surface area (ASA) calculations for the homodimer of molecules A and B, excluding MO and S121-T126 in both molecules, yields the following residues having more than 25% of their side chain exposed to the surface in at least one of the monomers: Q1, D2, P3, K6, E9, N10, K12, K13, Y14, N16, G18, H19, S20, D21, A23, D24, N25, G26, T27, G31, K34, N35, K37, E38, E39, S40, K55, K58, N59, K61, D62, D63, Q64, S65, Q67, K68, E71, T72, K74, E75, N78, V79, K80, N83, S84, N85, K86, K87, D90, E93, K94, N97, S99, T101, D102, L103, N104, H111, Q115, A118 and E119.

The following residues have more than 50% of their side chain exposed to the surface in at least one of the monomers: Q1, D2, P3, K6, E9, N10, K13, N16, G18, H19, S20, D21, A23, D24, N25 , G26, T27, G31, K34, K37, E38, E39, K55, K58, N59, D62, Q64, S65, K68, E71, E75, N83, S84, K86, K87, K94, N97, S99, T101, D102 , L103, N104, Q115, A118 and E119.

Performing fractional reach surface area (ASA) calculations for the homodimer of molecules A and B, excluding MO and S121-T126 in both molecules, and including receptor molecules C and D, yields the following residues having more than 25% of their side chain exposed to the surface in at least one of the monomers: Q1, D2, P3, K6, E9, N10, K13, Y14, N16, G18, H19, D21, N25, G26, G31, K34, N35, K37, E38, E39, S40, K55, K58, N59, K61, D62, D63, Q64, S65, Q67, K68, E71, T72, K74, E75, N78, V79, K80, N83, S84, N85, K86, K87, D90, E93, K94, N97, S99, T101, D102, L103, N104 and E119.

The following residues account for more than 50% of their side chain exposed to the surface in at least one of the monomers: P3, K6, N10, K13, N16, D21, N25, G26, G31, K34, K37, E38, E39, K55, K58 , N59, D62, Q64, S65, K68, E71, E75, N83, S84, K86, K87, K94, N97, S99, T101, D102, L103 and N104.

Each of the above items is a target for modification according to the present invention

103.

• · · · • · ·.

• · · · · ........ * .. ·

Compare the results of the two lists, for K12, S20, A23, D24, T27, H111, Q115 and A118, separated by more than 25% of the surface area (ASA) achieved by the side chain at receptor binding, and Q1, D2, E9, G18, H19, S20, A23, D24, T27, Q115, A118 and E119 separated by more than 50% of the surface area (ASA) reached from the side chain by receptor binding.

Residues not identified in the structure are treated as deposited over their entire surface, i.e., residues S121, P122, A123, A124, K125, Τ12Θ, G127, K128, R129, K130, R131, S132, Q133, M134, L135, F136, R137, G138, R139, R140, A141, S142, Q143. These residues also contain separate targets for the introduction of the attached groups of the present invention (or may be considered to belong to the group of surface-facing amino acid residues, for example, having more than 25% or more than 50% inverted side chains).

EXAMPLE 2: Determination of the Receptor Binding Site

Performing surface area (ASA) calculations as described above yields residues from an interferon-gamma molecule having a smaller surface area attained in at least one of the monomers in the complex compared to the calculation of the isolated dimer : Q1, D2, Y4, V5, E9, K12, G18, H19, S20, D21, V22, A23, D24, N25, G26, T27, L3, K34, K37, K108, H111, E112, 1114, Q115, A118 and E119.

EXAMPLE 3: Design of an interferon-gamma manifestation cassette with optimized codon application

The DNA sequence of GenBank entry number X13274, comprising a full-length cDNA encoding a human interferon-gamma with its natural signal peptide, is modified to facilitate strong

· 99 · manifestation in CHO cells. The codons of the nucleotide sequence of human interferon-gamma are modified by a slope made in the codon to target the codons commonly used in homo sapiens. Subsequently, some nucleotides in the sequence are replaced by others to introduce recognition sites for the deoxyribonucleic acid restriction endonucleases. The precursors are designed so that the gene can be synthesized.

The precursors were linked to a synthetic gene by one-step PCR using a platinum YaH polymerase kit (Life Technologies) and standard cyclic parameters of three-step PCR. The resulting gene is amplified by PCR under the same conditions and has the sequence shown in SEQ ID NO: 42. The synthesized gene was cloned into pcDNA3.1 / hydro (In Vitrogen) between the BamHI and Xbal sites, resulting in the production of plGY-22.

plGY-22 was converted to CHO K1 cells using Lipofectaim 2000 (Life Technologies) as a conversion agent. After 24 hours, the culture medium was harvested and assayed for activity and concentration of interferonam by ELISA. Using the Primary Assay described above, an activity of 1.4 x 10 ⁷ AU / ml was obtained.

EXAMPLE 4 Site-directed mutagenesis

Preparation of glycosylated varieties

For introduction of mutations into interferon-gamma, oligonucleotides are arranged in such a way that changes made by PCR can be introduced into the plasmid of expression (plGY-22) by classical two-step PCR.

Two vector precursors are used in conjunction with specific mutation precursors: ADJ013: 5′-GATGGCTGGCAACTAGAAG-3 ′ (antisense downstream vector precursor) (SEQ ID NO: 43) and ADJ014: 5′-

; ; ........ .

..... _a j _a * ·· * · _<φ · · _<β ·

TGTACGGTGGGAGGTCTAT-3 '(sensory upstream vector precursor) (SEQ ID NO: 44).

The S99T variant was obtained by classical two-step PCR using ADJ013 and ADJ014 as vector lecursors, ADJ093 (5GTTCAGGTCTGTCACGGTGTAATTGGTCAGCTT-3 ') (SEQ ID NO: 45) and ADJ094: 5AAGACACGGCATGCTGCATGCATGCGGTACCACCACGCATGCTGCATGCA mutation, and pIGY 22 as a template. The reaction product of 447 bp was cloned to pcDNA3.1 / hydro (In Vitrogen) using BamHI and Xbal, resulting in plasmid plGY-48.

plGY-48 was converted to CHO K1 cells using Lipofectaim 2000 (Life Technologies) as a conversion agent. After 24 hours, the culture medium is harvested and assayed for interferon-gamma activity. Using the Primary Assay described above, an activity of 5.1 x 10 ⁶ AU / ml was obtained.

The E38N + S40T + S99T variant was obtained by classical two-step PCR using ADJ013 and ADJ014 as vector precursors, ADJ091 (5-CATGATTCTTCCGATCGGTCTCGTTCTTCCAATT-3) (SEQ ID NO: 47) and ADJ0ACGAAG-5C-AG-AGC-AG SEQ ID NO: 48) as mutation parameters, and plGY-48 as template. The reaction product 447 bp was cloned to pcDNA3.1 / hydro (In Vitrogen) using BamHI and Xbal, resulting in plasmid plGY-54.

plGY-54 was converted to CHO K1 cells using Lipofectaim 2000 (Life Technologies) as a conversion agent. After 24 hours, the culture medium is harvested and assayed for interferon-gamma activity. Using the Primary Assay described above, an activity of 1.3 x 10 ⁷ AU / ml was obtained.

Using the standard methods described above, a number of glycosylated varieties of full-chain interferon-gamma are obtained. These varieties are shown in Table 1 below.

·· 104 · ···· • · · ·· • · · ·· • · · · · f • · ·· · · • · · · · · • · · · · f

Obtaining truncated C-terminus interferon-gamma variants

Shortened C-terminus interferon-gamma variants containing a stop codon directly downstream of the Leu135 codon were obtained by one-step PCR using plGY-22, plGY-48, and plGY-54 as standards, followed by subcloning of the products of reaction in pcDNAS.I / hydro (In Vitrogen) using BamHI and Xbal. The precursors used to construct these variants are: ADJ014 (see above, upward facing) and 5′-GAGTCTAGATTACAGCATCTGGCTTCTCTT-3 '(SEQ ID NO: 49) (downward facing). The resulting plasmids were terminated with plGY-72 (non-pubic interferon-gamma truncated after Leu135), plGY-73 (S99T variant truncated after Leu135) and plGY-74 (E38N + S40T + S99T truncated short after Leu135).

Preparation of interferon-gamma variants containing cysteine

Cysteine-containing interferon-residue residues were obtained using Stratagene's QuikChange ™ XL site-directed mutagenesis kit according to the manufacturer's specification. Using plGY-48 as a standard, seven interferon-gamma species were obtained, each containing one introduced cysteine: N10C + S99T, N16T + S99T, E38N + S99T, N59C + S99T, N83C + S99T. K94C + S99T and S99T + N104C. Similarly, using plGY-54 as a reference, six interferon-gamma species were obtained, each containing one introduced cysteine: N10C + E38N + S40T + S99T, N16T + E38N + S40T + S99T,

E38N + S40T + N59C + S99T, E38N + S40T + N83C + S99T, E38N + S40T + K94C + S99T and E38N + S40T + S99T + N104C.

EXAMPLE 5 Binding of cysteine-containing variants. with polyethylene glycol

105.

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

All buffers are deoxidized before use. Protein concentrations were calculated by measuring A280.

Binding to polyethylene glycol using an OPSS coupling chemical reaction

7.2 ml of interferon-gamma variety N16C + S99T (full length) at a concentration of 1.3 mg / ml in 5 mM sodium succinate, 4% mannitol, 0.01% Tween 20, pH 6.0 are reduced by incubation with 300 μ | 0.5 M DTT for 30 minutes at room temperature. The interferon-gamma variety was desalted by passing 3 aliquots of 2.5 ml each through a NAP25 gel filtration column (Pharmacia) in buffer A (50 mM sodium phosphate, 1 mM EDTA, pH 8.1). Each aliquot was eluted with 3.5 ml.

mPEG-OPSS (10 kDa) was dissolved in buffer A to a concentration of 2 mg / ml and added in an equal volume to the reduced and desalted interferon-gamma variant and then incubated for 60 minutes with gentle shaking at room temperature.

ml of the reaction mixture was concentrated to 1-6 ml using a Vivaspin 20 column (VivaScience), and the remaining mPEG was separated by gel filtration using a Sephacryl S-100 column (Pharmacia) equilibrated with buffer A.

The polyethylene glycol-bound interferon-gamma variety was diafiltered into 5 mM sodium succinate, 4% mannitol, pH 6.0 using a Vivaspin 6 column (VivaScience), and Tween 20 to 0.01% was added. The purified polyethylene glycol interferon-gamma variant has a specific activity of 1.3 x 10® AU / rng, as measured in the Primary Analysis described above (15% of the specific activity of the corresponding polyethylene glycol non-interferon-gamma variant).

10§.

• · · «

·· · · ·· · ** · ·::: · :::.:

......: · .... * ..

Binding to polyethylene glycol using a MAL coupling chemical reaction

1.6 ml of interferon-gamma variety N59C + S99T (full length) at a concentration of 1.5 mg / ml in 5 mM sodium succinate, 4% mannitol, 0.01% Tween 20, pH 6.0 were reduced by 64 μg incubation | 0.5 M DTT for 30 minutes at room temperature. The interferon-gamma variety was desalted by passing through a acΑΡ25 gel filtration column (Pharmacia) in buffer A (50 mM sodium phosphate, 1 mM EDTA, pH 8.1). Each aliquot was eluted with 3.5 ml.

mPEG-MAL (5 kDa) was dissolved in buffer A to a concentration of 0.5 mg / ml and added in an equal volume to the reduced and desalted interferon-gamma species and then incubated for 120 minutes with gentle shaking at room temperature.

Ammonium sulfate was added to a concentration of 0.9 M and the polyethylene glycol-related interferon-gamma variety was placed on 1 ml of Resource ™ phenyl column (Pharmacia) in buffer B (20 mM sodium phosphate, 0.9 M ammonium sulfate, pH 6.6). The column was washed with 5 column volumes of buffer B before elution of the polyethylene glycol-related interferon-gamma variety in a linear gradient of 0-50% buffer C (20 mM sodium phosphate, pH 6.6) over 30 column volumes. The polyethylene glycol-bound interferon-gamma species elutes about 0.6 M ammonium sulfane.

The fractions containing the polyethylene glycol-related interferongam variety were poured and diafiltered into 5 mM sodium succinate, 4% mannitol, pH 6.0 using a Vivaspin 6 column (VivaScience), and Tween 20 to 0.01% was added. The purified polyethylene glycol interferon-gamma species had a specific activity of 2.4 x 10 ⁶ AU / mg, as measured in the Primary Analysis described above (15% of the specific activity of the corresponding polyethylene glycol non-interferon-gamma species).

• 4

4 ·

4 · · ···.

:::

• f e 4 · • 4 4 4 4 • * • 44 ·· _ф

EXAMPLE 6: Expression of interferon-gamma and varieties of interferon gamma in mammalian cells

For short-term interferon-gamma expression, cells grow to 95% confluence in medium (Dulbecco's MEM / Nut-mix F-12 (Ham) L-glutamine, 15 mM Hepes, Pyridoxine-HCI (Life Technologies Cat # 31330-038)) containing 1:10 embryonic bovine serum (BioWhittaker Cat # 02-701F) and 1: 100 penicillin and streptomycin (BioWhittaker Cat # 17-602E), according to the manufacturers specifications. Plasmids encoding interferon-gamma were transferred to the cells using Lipofectamine 2000 (Life Technologies) according to the manufacturer's specifications. 24 hours after transfer, the culture medium was separated and analyzed for interferon-gamma activity. Moreover, to quantify the relative number of glycosylation sites used, Western blotting was performed using the culture medium.

Transfer of CHO K1 cells with plasmids encoding interferongamma results in stable clones expressing interferon-gamma, followed by incubation of the cells in medium containing 0.36 mg / ml hydromycin. Stably bound cells are isolated and cloned to limited dissolution. Clones producing high levels of interferon-gamma are identified by ELISA

EXAMPLE 7: Large-size production

Stable cell lines expressing interferon-gamma or variants thereof are grown in Dulbecco's MEM / Nut-mix F-12 (Ham) L-glutamine, 15 mM Hepes, Pyridoxine-HCI (Life Technologies Cat # 31330-038), 1:10 embryonic bovine serum (BioWhittaker Cat # 02-701F), 1: 100 penicillin and streptomycin (BioWhittaker Cat # 17-602E), in cylindrical cylinders with capacity? ·· ·· ··

1700 cm (Corning, # 431200) to merger. The medium was then changed to 300 ml of UltraCHO with L-glutamine (BioWhittaker Cat # 12-724Q) by adding 1: 500 EX CYTE VLE (Serological Proteins Inc. # 81-129) and 1: 100 penicillin and streptomycin (BioWhittaker Cat # 17-602E). After 24 hours of growth, the medium was replaced with fresh UltraCHO with the same additives. After another 24 hours of growth, the medium was replaced with Dulbecco's MEM / Nut.-mix F-12 (Ham) L-glutamine, pyridoxine-HCI (Life Technologies Cat # 21041-025), with 1: 100 ITS-A added ( Gibco / BRL # 51300044), 1: 500 EX-CVTE VLE (Serological Proteins Inc. # 81-129) and 1: 100 penicillin and streptomycin (BioWhittaker Cat # 17-602E). Then, every 24 hours, the culture medium is replaced with 300 ml of fresh serum free medium with the same additives. The separated medium was filtered through 0.22 μΙ cell separation filters.

EXAMPLE 8 Purification The filtrate was filtered (0.22 μΙ) before ultrafiltration to approximately 1/15 volume using a Millipore TFF system. With the same system, the concentrate was diafiltered using 10 mM Tris, pH 7.6. Ammonium sulfate was added to a concentration of 1.7 M and, after stirring, the precipitate was separated by centrifugation at 8000 rpm for 25 minutes in a Sorvall centrifuge using a GS3 rotor.

The supernatant was placed on a 25 ml Phenyl High Performance (Pharmacia) column, which was pre-calibrated with 10 mM Tris, 1.7 M ammonium sulfate, pH 7.6. After use, the column was washed with 3 column volumes of 10 mM Tris, 1.7 M ammonium sulfate, pH 7.6, and the coupled interferon gamma was eluted in a linear gradient over 10 column volumes to 100% 10 mM Tris, pH 7.6. The flow through the column and the eluted interferon species are fractionated. Fractions enriched with interferon-gamma were poured and buffered by diafiltration over

109

• :::. :: ·

· .. ·· .. · mM Tris, pH 9.0, using a Vivaflow 200 system (VivaScience) with a cut-off molecular weight of 10000 Da.

The interferon-gamma variety was then placed on 18 ml Qsepharose Fast Flow (Pharmacia), a column that was pre-calibrated with 10 mM Tris, pH 9.0. After use, the column was washed with 3 column volumes of 10 mM Tris, pH 9.0, before eluting the bound interferon gamma with a gradient of 0-100% 10 mM Tris, 0.5 M sodium chloride, pH 9.0, over 15 column volumes The column passing and the eluted interferon gamma are fractionated. Fractions enriched in interferon-gamma were poured and exchanged with buffer in 10 mM sodium phosphate, pH 7.0, by diafiltration using a Vivaspin 20 (VivaScience) column, with a cut-off molecular weight of 10000 Da.

The interferon-gamma strain was then placed on an 8 ml CHT ceramic hydroxyapatite column (Biorad), which was pre-calibrated with 10 mM sodium phosphate, pH 7.0. After use, the column was washed with 5 column volumes of 10 mM sodium phosphate, pH 7.0, before eluting the coupled interferon-gamma with a gradient of 0-80% 500 mM sodium phosphate, pH 7.0, over 30 column volumes. The flow through the column and the eluted interferon gamma are fractionated. Fractions enriched in interferon-gamma were poured and exchanged with buffer in 5 mM sodium succinate, 4% mannitol, pH 6.0 using a Vivaspin 20 (VivaScience) column and then Tween 20 was added to a concentration of 0.01% . The interferon-gamma variety was sterile filtered and stored at -80 ° C.

Alternatively, interferon-gamma varieties can be purified according to the purification scheme shown below:

The filtrate was filtered (0.22 μΙ) before ultrafiltration to approximately 1/15 volume using a Millipore TFF system. With the same system, the concentrate was diafiltered using 10 mM Tris, pH 7.6, and then

The pH was adjusted to 9.0 and the precipitate was separated by filtration through a microfilter.

The sample was placed on 18 ml of Q-Sepharose Fast Flow (Pharmacia), a column pre-calibrated with 10 mM Tris, pH 9.0. After use, the column was washed with 3 column volumes of 10 mM Tris, pH 9.0, before eluting the coupled interferon gamma with a gradient of 0-100% 10 mM Tris, 0.5 M sodium chloride, pH 9.0, over 15 column volumes. The flow through the column and the eluted interferon gamma are fractionated. The fractions enriched in interferon-gamma were poured and the pH was adjusted to 7.6. Ammonium sulfate was added to 1.5 M and, after stirring, the precipitate was separated by centrifugation.

The interferon-gamma strain was then placed on a Phenyl High Performance (Pharmacia) column, which was pre-calibrated with 10 mM Tris, 1.5 M ammonium sulfate, pH 7.6. After use, the column was washed with 3 column volumes of 10 mM Tris, 1.5 M ammonium sulfate, pH 7.6, and the coupled interferon gamma eluted in a linear gradient over 10 column volumes to 100% 10 mM Tris, pH 7.6. The flow through the column and the eluted interferon gamma are fractionated. the fractions enriched with interferon-gamma were poured and the ammonium sulfate was recovered to 1.7 M.

The interferon-gamma strain was then placed on a Butyl Sepharose column, which was pre-calibrated with 10 mM sodium phosphate, 1.7 M ammonium sulfate, pH 7.6. After use, the column was washed with 10 mM sodium phosphate, 1.7 M ammonium sulfate, pH 7.6, before eluting the coupled interferon-gamma in a step using 10 mM sodium phosphate, pH 6.5. The flow through the column and the eluted interferon gamma are fractionated.

The fractions enriched with interferon-gamma were poured and placed on a hydroxyapatite column, which was pre-calibrated ··

⁹ * with 10 mM sodium phosphate, pH 6.5. After use, the column was washed with 5 column volumes of 10 mM sodium phosphate, pH 6.5, before eluting the coupled interferon gamma with a linear gradient of 0-100% 500 mM sodium phosphate, pH 6.5, over 30 column volumes. The flow through the column and the eluted interferon gamma are fractionated.

Fractions enriched with interferon-gamma were poured and exchanged with buffer in buffer containing 5 mM sodium succinate, 4% mannitol, pH 6.0 using a Vivaspin 20 (VivaScience) column and then Tween 20 was added to concentration of 0.01%. The interferon-gamma variety was filtered sterile and stored at 80 ° C.

EXAMPLE 9: Activity of varieties and of polyethylene glycol related varieties

Using the Primary Analysis described above, the following activity data were obtained (after brief transference):

Mutations Activity (AU / ml) % mol weight activity (full length) Unfeeded (full length) 1.4 x 10 ⁷ S99T (full length) 5.1 x 10 ^b 36% E38N (full length) 1.4 X 10 ⁷ 100% E38N + S40T (full length) 9.9 x S ⁶ 71% E38N + S40T + S99T (full length) 1.3 x 10 ⁷ 93% E38N + K61T (full length) 1.2 x 10 ⁷ 86% E38N + K61T + S99T (full length) 1.4 x 10 ⁶ 10% N10C + S99T (full length) 2.5 x 10 ⁱⁿ 18% N16C + S99T (full length) 1.1 x 10 ⁷ 79%

112

E38C + S99T (full length)

S99T + N104C (full length)

N10C + E38N + S40T + S99T (full length)

N16C + E38N + S40T + S99T (full length)

E38N + S40T + N59C + S99T (full length)

E38N + S40T + N83C + S99T (full length)

E38N + S40T + K94C + S99T (full length)

E38N + S40T + S99T + N104C (full length)

Poor (shortened)

S99T (short)

1.0 x 10 ⁷ 71% 5.0x10® 36% 1.5 x 10 ⁶ 11% 3.7 x 10 ⁶ 26% 1.1 x 10 ' 79% 7.2 X 10 ⁵ 5% 9.4 X 10 ⁵ 7% 2.3 x 10® 16% 6.3 x 10® 45% 3.5 x 10 ⁶ 25% 4.0 X 10® 29%

E38N + S40T + S99T (shorted)

Table 1: Activity of full-length variants and truncated recombinant human interferon-gamma polypeptides after short-term transfer

Using the "Primary Analysis" described above, the following activity-specific data (after purification) were obtained:

Mutations Specific activity (AU / mg) % mol weight activity (full length) Unfeeded (full length) 2.1 x 10 ⁷ - S99T (full length) 2.2 x 10 ⁷ 105% E38N + S40T + S99T (full length) 1.4 x 10 ⁷ 67% N10C + S99T (full length) 3.8X10 ⁶ 18% N16C + S99T (full length) 2.3x10 ^b 11% N16C + S99T (full length + 10 kDa mPEG) 1.3 x 10® 6% E38C + S99T (full length) 3.4 x 10® 16%

··

11β.

···· • · · ::: ·: · · ……….

"- · · · ·" E59C + S99T (full length) 6.3 x 10 ⁶ 30% E59C + S99T (full length + 2.4 x 10 ^s 11% 5 kDa mPEG) S99T + N104C (full length) 3.5 x 10 ⁶ 17%

Table 2: Activity of full-length variants of recombinant human interferon-gamma polypeptides after purification

The activity of a number of polyethylene glycol-related varieties was measured by comparing the activity of polyethylene glycol-related products with samples subjected to the same polyethylene glycol binding procedure (see Example 5 above) but without actually adding polyethylene glycol to the reaction mixture. . The results are given in Table 3 below:

Mutations

Activity on non-polyethylene glycol subjected to "Polyethylene glycol" (%)

N10C + S99T (full length + 5 kDa mPEG)

N16C + S99T (full length + 5 kDa mPEG) 59

E38C + S99T (full length + 10 kDa mPEG) ^IJ 41

S99T + N104C (full length + 5 kDa mPEG) 42

Table j: Activity of polyethylene glycol-bound variants of full-length recombinant human interferon-gamma ¹ 'polypeptides An ODSS coupling chemical reaction was used. A MAL coupling chemical reaction was used for all other polyethylene glycol related species.

114 • f ·· ·· · * · ♦ · ««.

It should be emphasized that the activity data shown in Table 1 reflect a combination of specific activity and expression level in CHO-K1 cells. Therefore, it can be concluded that all varieties show comparable expression / specific activity levels with respect to recombinant human interferon-gamma.

As can be seen in Table 2, all cysteine variants showed reduced specific activity compared to recombinant human interferon-gamma, whereas in the variants containing E38N. S40T and / or S99T mutations, the specific activity remains comparable to the recombinant human interferon-gamma. When cysteine variants bind to polyethylene glycol or 5 or 10 kDa, specific activity is 2-3 times lower (Table 3). Without limitation by any specific theory, it can be suggested that the decrease in specific activity may be due to a decreased receptor binding caused by the ethereal inhibition of the polyethylene glycol bound groups.

EXAMPLE 10: Evaluation of the use of N-glycosylation sites

To quantify the relative number of glycosylation sites used, Western blotting of the culture medium was applied (Figure 1). For unbound recombinant human interferons (full-length), it is estimated that about 50% of both glycosylation sites (2N) are used, about 40% of one glycosylation site (1N), and about 10% are not glycosylation sites (0N). These data are in agreement with previously published data by Hooker et al. 1998, J. Interferon and Cytokine Res. 18, 287-295; Sarenva et ai., 1995, Biochem. J., 308, 9-14.

As can be seen from Figure 1, the S99T variety (full-length) uses both of its glycosylation sites significantly more efficiently, in comparison with the non-native species. For the S99T variety, it is estimated that about 90% of both glycosylation sites (2Ν) are used, about 7% of one glycosylation site (1Ν), and about 3% are not glycosylation (0Ν).

Moreover, it can be seen from Figure 1 that the introduced glycosylation site at position 38 is significantly better used for the E38N + S40T (full length) version than the non-optimized E38N (full length) version

These data clearly indicate that better use of glycosylation sites, whether these sites naturally exist or are introduced, is achieved by introducing a threonine residue rather than a serine residue at position +2 with respect to the asparagine residue.

EXAMPLE 11 Pharmacokinetic Studies

The AUC for subcutaneous administration (AUC _S c) in rats was determined as described above in the present invention for a variety of interferon species. The results are presented in Table 4 and Figures 2 and 3.

Variety AUCsc / dose (min x g./ml) AUCsc, variety AUCsc, Actimmune® AUCsc, variety AUCgr full extension, m. Tmax.SC (min) Aciimmune® 0.3-0.4 - 0.013-0.027 43 rhulFNG 15-24 37-80 - 362-446 (full length) E38N + S40T + S99T ¹ * 111-192 277-640 4.6-13 308-374 N16C + S99T ² ' 37 92-123 1.5-2.5 247 N16C + S99T3) 114 285-380 4.8-7.6 249

. ··. . ···· ; : · ·! Table 4 rats . ............ · .. ··., · Pharmacokinetic data for subcutaneous administration at

full length ²⁾ full length, 5 kDa mPEG linked to introduced cysteine residue ³ - full length, 10 kDa mPEG linked to introduced cysteine residue

Figures 2 and 3 and Table 4 show that the variants (including those associated with polyethylene glycol) have a significant elevation of AUC when administered subcutaneously compared to recombinant human interferon-gamma and, in particular, compared to commercially available interferon gamma. the Actimmune® network. Figure 3 shows that the administered dose of the two polyethylene glycol-related varieties was reduced 2.5-fold compared to the administered dose of the [E38N + S40T + S99T] variety.

It is obviously possible to administer lower doses with fewer side effects and / or less administration of the active substance than is currently the case, thereby improving the patient's condition.

Claims (37)

1 Interferon-gamma (IFNG) polypeptide. having the amino acid sequence shown in SEQ ID NO; 1, or a fragment thereof, wherein said interferon-gamma polypeptide, or fragment thereof, exhibits interferon-gamma activity. The polypeptide of claim 1, wherein said polypeptide has the amino acid sequence shown in SEQ ID NO: 1. The polypeptide of claim 1, wherein said polypeptide is a fragment of the amino acid sequence shown in SEQ ID NO. 1, which is truncated by 1-15 amino acid residues at the C-terminus. The polypeptide according to claim 3, characterized in that said polypeptide has an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO 3. SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO : 14, SEQ ID NO: 15 and SEQ ID NO: 16. The polypeptide according to any one of claims 1-4, characterized in that said polypeptide is glycosylated. 6 A polypeptide variant of SEQ ID NO: 1 or a fragment thereof, characterized in that said polypeptide comprises 1-10 modifications related to SEQ ID NO: 1 or a fragment thereof and exhibits interferon activity. The polypeptide of claim 6, wherein said polypeptide comprises 1-10 modifications related to a fragment of SEQ ID NO: 1, which is truncated by 115 amino acid residues at the C-terminus. replacement page 118 ···· ···· .. * 8 A polypeptide according to the invention. .7, xxxxi, wherein said polypeptide comprises 1-10 modifications related to the amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 , SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16. The polypeptide of claim 8, wherein said polypeptide comprises 1-10 modifications related to the amino acid sequence shown in SEQ ID NO. 12. The polypeptide according to any of claims 6-9, characterized in that said polypeptide comprises at least one introduced and / or at least one deleted amino acid residue comprising a group that attaches to the non-polypeptide moiety. The polypeptide of claim 10, wherein said polypeptide comprises at least one glycosylation site introduced. The polypeptide of claim 11, wherein said glycosylation site is an N-glycosylation site. The polypeptide of claim 12, wherein said N-glycosylation site is introduced into a position comprising an amino acid residue to which at least 25% of its side chains are facing the surface (as defined in Example 1 of the present invention) . The polypeptide of claim 13, wherein said N-glycosylation site is introduced into a position comprising an amino acid residue to which at least 50% of its side chains are facing the surface (as defined in Example 1 of the present invention) . replacement page 119 ···· · * ····, 15 A polypeptide according to <RTI ID = 0.0> Lp4 </RTI> gene13l ^, 13 ^, or 4), characterized in that said N-glycosylation site is introduced by substitution. The polypeptide of claim 15, wherein said substitution is selected from the group consisting of K12S, K12T, G18S, G18T, E38N, E38N + S40T, K61S, K61T, N85S, N85T, K94N, Q106S and Q106T . The polypeptide of claim 16, wherein said substitution is selected from the group consisting of K12T, G18T, E38N + S40T, K61T, N85T, K94N and Q106T. The polypeptide of claim 17, wherein said substitution is E38N + S40T. The polypeptide according to claim 10, characterized in that said polypeptide comprises at least one introduced cysteine residue. The polypeptide of claim 19, wherein said cysteine residue is introduced into a position including an amino acid residue to which at least 25% of its side chains are facing (defined in Example 1 of the present invention). The polypeptide of claim 20, wherein said cysteine residue is introduced into a position comprising an amino acid residue to which at least 50% of its side chains are facing the surface (defined in Example 1 of the present invention). The polypeptide of claim 20 or 21, wherein said cysteine residue is introduced by substitution. The polypeptide of claim 22, wherein said substitution is selected from the group consisting of N10C, N16C, E38C, N59C, N83C, K94C, N1040 and A124C. replacement page 120 * ·· · ·· ······ ···· · · · · · · · · · · · · · · The polypeptide of Claims 49-23, characterized in that said cysteine moiety is covalently bound to the non-polypeptide moiety. The polypeptide of claim 24, wherein said non-polypeptide moiety is a polymer molecule. The polypeptide of claim 25, wherein said polymer molecule is a linear or branched polyethylene glycol. The polypeptide of claim 10, wherein said polypeptide comprises at least one introduced glycosylation site and at least one introduced cysteine residue. The polypeptide according to claim 27, wherein said N-glycosylation site is introduced into the position according to claims 13-18 and the cysteine residue is introduced according to claims 20-23. A nucleotide sequence characterized in that it encodes a polypeptide as defined in claims 1-28. An expression vector comprising the nucleotide sequence defined according to claim 29. A glycosylation host cell comprising the nucleotide sequence defined according to claim 29 or the expression vector defined according to claim 30. The host cell of claim 31, wherein it is a CHO cell or BHK cell. A pharmaceutical composition comprising a polypeptide defined according to claims 1-28 and a pharmaceutically acceptable diluent, carrier or additive. The polypeptide according to claims 1-28 or the pharmaceutical composition according to claim 33, characterized in that they are used as a medicament. replacement page ··· ··· · · · · ........ 12G ·· ·· Use of a polypeptide according to claims 1-28 or a pharmaceutical composition according to claim 33, characterized in that a medicament for treating interstitial lung diseases is produced. The use according to claim 35, wherein the interstitial lung disease is idiopathic pulmonary fibrosis. A method for the preparation of an interferon-gamma polypeptide as defined in claims 1-28, wherein said method comprises: (a) growing a glycosylating host cell comprising a nucleotide sequence that encodes an interferon-gamma polypeptide defined according to claims 1-28 under conditions for expression of the polypeptide; (b) possible in vitro interaction of said polypeptide with the non-polypeptide moiety under conjugation conditions; and (c) recovering the polypeptide.