AU9331198A - Isoforms of the human vitamin d receptor - Google Patents

Description

WO 99/16872 PCT/AU98/00817 ISOFORMS OF THE HUMAN VITAMIN D RECEPTOR Field of the Invention: The present invention relates to isolated polynucleotide molecules 5 which encode novel isoforms of the human Vitamin D receptor (hVDR) or variant transcripts for hVDR. The polynucleotide molecules may be utilised in, for example, methods of screening compounds for VDR agonists and/or antagonists. 10 Background of the Invention: The active hormonal form of vitamin D, 1,25-dihydroxyvitamnin Da (1.25(OH)2D3), has a central role in calcium and phosphate homnleostasis, and the maintenance of bone. Apart from these calcitropic effects, 1,25-(OH) 2 D:, has been shown to play a role in controlling cell growth and differentiation in 15 many target tissues. The effects of 1,25-(OH) 2 D: are mediated by a specific receptor protein, the vitamin D receptor (VDR), a member of the nuclear receptor superfamily of transcriptional regulators which also includes steroid, thyroid and retinoid receptors as well as a growing number of orphan receptors. Upon binding hormone the VDR regulates gene expression by 20 direct interaction with specific sequence elements in the promotor regions of hormone responsive target genes. This transactivation or repression involves multiple interactions with other protein cofactors, heterodimerisation partners and the transcription machinery. Although a cDNA encoding the human VDR was cloned in 1988 (1), 25 little has been documented characterising the gene structure and pattern of transcription since that time. The regulation of VDR abundance is one potentially important mechanism for modulating 1.25-(OH)2D 3 responsiveness in target cells. It is also possible that VDR has a role in non transcriptional pathways, perhaps via localization to a non-nuclear 30 compartment and/or interaction with components of other signalling pathways. However, the question of how VDRs are targetted to different cell types and how they are regulated remains unresolved. There have been many reports in the literature describing translational or transcriptional control of VDR levels, both homologously and heterologously, mostly in non-human 35 systems.

WO 99/16872 PCT/AU98/00817 2 A recent study (2) showed that in the kidney, alternative splicing of human VDR transcripts transcribed from a GC rich promotor generates several transcripts which vary only in their 5' UTRs. The present inventors have now identified further upstream exons of the VDR gene which generate 5 5' variant transcripts, suggesting that the expression of the VDR gene is regulated by more than one promoter. A subset of these transcripts is expressed in a restricted tissue-specific pattern and further variant transcripts have the potential to encode an N-terminally variant protein. These results may have implications for understanding the actions of 1,25-(OH) 2 D, in 10 different tissues and cell types, and the possibility that N-terminally variant VDR proteins may be produced has implications for altered activities such as transactivation function or subcellular localisation of the receptor protein. Furthermore, these variants, by their level, tissue specificity, subcellular localisation and functional activity, may yield targets for pharmaceutical 15 intervention. The variants may also be useful in screening potential analogs and/or antagonists of vitamin D compounds. Disclosure of the Invention: In a first aspect, the invention provides an isolated polynucleotide 20 molecule encoding a human Vitamin D receptor (hVDR) isoform, said polynucleotide molecule comprising a nucleotide sequence which includes sequence that substantially corresponds or is functionally equivalent to that of exon ld of the human VDR gene. Exon ld (referred to as exon lb in the Australian Provisional Patent 25 Specification No. PO9500) is a 96 bp exon located 296 bp downstream from exon la (2). The sequence of exon ld is: 5'GTTTCCTTCTTCTGTCGGGGCGCCTTGGCATGGAGTGGAGGAATAAGAA AAGGAGCGATTGGCTGTCGATGGTGCTCAGAACTGCTGGAGTGGAGG3' 30 (SEQ ID NO: 1). The nucleotide sequence of the polynucleotide molecule of the first aspect of the invention, preferably does not include sequence corresponding to that of exon la, exon if and/or exon le. However, the nucleotide sequence 35 of the polynucleotide molecule of the first aspect of the invention, may or WO 99/16872 PCT/AU98/00817 3 may not include sequence that substantially corresponds or is functionally equivalent to that of exon lb and/or exon 1c. Preferably, the polynucleotide molecule of the first aspect comprises a nucleotide sequence which includes; 5 (i) sequence that substantially corresponds or is functionally equivalent to that of exons ld, ic and 2-9 and encodes a VDR isoformn of approximately 477 amino acids, (ii) sequence that substantially corresponds or is functionally equivalent to that of exons ld and 2-9 and encodes a VDR isoform of 10 approximately 450 amino acids, or (iii) sequence that substantially corresponds or is functionally equivalent to that of exons ld and 2-9 and further includes a 152 bp intronic sequence, and encodes a truncated VDR isoform of approximately 72 amino acids. 15 Most preferably. the polynucleotide molecule of the first aspect of the invention comprises a nucleotide sequence substantially corresponding to that shown as SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. In a second aspect, the invention provides an isolated polynucleotide molecule encoding a human Vitamin D receptor (hVDR), said polynucleotide 20 molecule comprising a nucleotide sequence which includes sequence that substantially corresponds to that of exon if and/or le of the human VDR gene. Exon if is a 207bp exon located more than 9kb upstream from exon la (2) bp upstream from exon lc(8). The sequence of exon if is: 25 5'TGCGACCTTGGCGGTGAGCCTGGGGACAGGGGTGAGGC CAGAGACGGACGGACGCAGGGGCCCGGCCCAAGGCGAGGG AGAACAGCGGCACTAAGGCAGAAAGGAAGAGGGCGGTGTG TTCACCCGCAGCCCAATCCATCACTCAGCAACTCCTAGAC 30 GCTGGTAGAAAGTTCCTCCGAGGAGCCTGCCATCCAGTCGT GCGTGCAG3' (SEQ ID NO: 5) Exon le is a 157 bp exon located 1826bp upstream from exon la (2). The sequence of exon le is: WO 99/16872 PCT/AU98/00817 4 5'AGGCAGCATGAAACAGTGGGATGTGCAGAG AGAAGATCTGGGTCCAGTAGCTCTGACACTCCTCAGCTGT AGAAACCTTGACAACTCTGCACATCAGTTGTACAATGGAA 5 CGGTATTTTTTACTCTTCATGTCTGAAAAGGCTATGATAA AGATCAA3' (SEQ ID NO: 6) The nucleotide sequence of the polynucleotide molecule of the second aspect of the invention, preferably does not include sequence corresponding 10 to that of exon la, ld or lb. However, the nucleotide sequence of the polynucleotide molecule of the second aspect of the invention, may or may not include sequence that substantially corresponds or is functionally equivalent to that of exon 1c. Preferably, the nucleotide molecule of the second aspect comprises a 15 nucleotide sequence which includes sequence that substantially corresponds or is functionally equivalent to that of exons if and 2-9. Most preferably, the polynucleotide molecule of the first aspect of the invention comprises a nucleotide sequence substantially corresponding to that shown as SEQ ID NO: 7. 20 The polynucleotide molecule of the first or second aspects may be incorporated into plasmids or expression vectors (including viral vectors), which may then be introduced into suitable host cells (e.g. bacterial, yeast, insect and mammalian host cells). Such host cells may be used to express the VDR or functionally equivalent fragment thereof encoded by the isolated 25 polynucleotide molecule. Accordingly, in a third aspect, the present invention provides a host cell transformed with the polynucleotide molecule of the first or second aspect. In a fourth aspect, the present invention provides a method of 30 producing a VDR or a functionally equivalent fragment thereof, comprising culturing the host cell of the first or second aspect under conditions enabling the expression of the polynucleotide molecule and, optionally, recovering the VDR or functionally equivalent fragment thereof. Preferably, the host cell is of mammalian origin. Preferred examples 35 include NIH 3T3 and COS 7 cells.

WO 99/16872 PCT/AU98/00817 5 In a preferred embodiment, the VDR or functionally equivalent fragment thereof is localised to a cell membrane or other subcellular compartment as distinct from a nuclear localisation. The polynucleotide molecules of the first aspect of the invention 5 encode novel VDR isoforms which may be of interest both clinically and commercially. By using the polynucleotide molecule of the present invention it is possible to obtain VDR isoform proteins or functionally equivalent fragments thereof in a substantially pure form. Accordingly, in a fifth aspect, the present invention provides a human 10 VDR isoform or functionally equivalent fragment thereof encoded by a polynucleotide molecule of the first aspect. said VDR isoform or functionally equivalent fragment thereof being in a substantially pure form. In a sixth aspect. the present invention provides an antibody or antibody fragment capable of specifically binding to the VDR isoform of the 15 fourth aspect. The antibody may be monoclonal or polyclonal, however, it is presently preferred that the antibody is a monoclonal antibody. Suitable antibody fragments include Fab, F(ab')2 and scFv. In an eighth aspect. the present invention provides a non-human 20 animal transformed with a polynucleotide molecule according to the first or second aspect of the invention. In a seventh aspect, the invention provides a method for detecting agonist and/or antagonist compounds of a VDR isoform of the fourth aspect, comprising contacting said VDR isoform, functionally equivalent fragment 25 thereof or a cell transformed with and expressing the polynucleotide molecule of the first aspect, with a test compound under conditions enabling the activation of the VDR isoform or functionally equivalent fragment thereof, and detecting an increase or decrease in the activity of the VDR isoform or functionally equivalent fragment thereof. 30 An increase or decrease in activity of the receptor or functionally equivalent fragment thereof may be detected by measuring changes in interactions with known cofactors (e.g. SRC-1, GRIP-1 and TFIIB) or unknown cofactors (e.g. through use of the yeast dual hybrid system). In a ninth aspect, the present invention provides an oligonucleotide or 35 polynucleotide probe comprising a nucleotide sequence of 10 or more Inucleotides, the probe comprising a nucleotide sequence such that the probe WO 99/16872 PCT/AU98/00817 6 specifically hybridises to the polynucleotide molecule of the first or second aspect under high stringency conditions (Sambrook et al., Molecular Cloning: a laboratory manual, Second Edition, Cold Spring Harbor Laboratory Press). Preferably, the probe is labelled. 5 In a tenth aspect. the present invention provides an antisense polynucleotide molecule comprising a nucleotide sequence capable of specifically hybridising to an mRNA molecule which encodes a VDR encoded by the polynucleotide molecule of the first or second aspect, so as to prevent translation of the mRNA molecule. 10 Such antisense polynucleotide molecules may include a ribozyme region to catalytically inactivate mRNA to which it is hybridised. The polynucleotide molecule of the first or second aspect of the invention may be a dominant negative mutant which encodes a gene product causing an altered phenotype by, for example, reducing or eliminating the 15 activity of endogenous VDR. In an eleventh aspect, the invention provides an isolated polynucleotide molecule comprising a nucleotide sequence substantially corresponding or, at least, showing >75% (preferably >85% or, even more preferably, >95%) sequence identity to: 20 (i) 5'TGCGACCTTGGCGGTGAGCCTGGGGACAGGGGTGAGGCCAGAGA CGGACGGACGCAGGGGCCCGGCCCAAGGCGAGGGAGAACAGCGGCACTA AGGCAGAAAGGAAGAGGGCGGTGTGTTCACCCGCAGCCCAATCCATCAC TCAGCAACTCCTAGACGCTGGTAGAAAGTTCCTCCGAGGAGCCTGCCATC 25 CAGTCGTGCGTGCAG 3'(exon if) (SEQ ID NO: 5), (ii) 5'AGGCAGCATGAAACAGTGGGATGTGCAGAGAGAAGATCTGGGTC CAGTAGCTCTGACACTCCTCAGCTGTAGAAACCTTGACAACTCTGCACAT CAGTTGTACAATGGAACGGTATTTTTTACTCTTCATGTCTGAAAAGGCTA 30 TGATAAAGATCAA3' (exon le) (SEQ ID NO: 6), or (iii) 5'GTTTCCTTCTTCTGTCGGGGCGCCTTGGCATGGAGTGGAGGAATA AGAAAAGGAGCGATTGGCTGTCGATGGTGCTCAGAACTGCTGGAGTGGA GG3' (exon ld) (SEQ ID NO: 1). 35 WO 99/16872 PCT/AU98/00817 7 The polynucleotide molecules of the eleventh aspect may be useful as probes for the detection of VDR variant transcripts and as such may be useful in assessing cell or tissue-specific expression of variant transcripts. The terms "substantially corresponds" and "substantially 5 corresponding" as used herein in relation to nucleotide sequences is intended to encompass minor variations in the nucleotide sequence which due to degeneracy in the DNA code do not result in a substantial change in the encoded protein. Further, this term is intended to encompass other minor variations in the sequence which may be required to enhance expression in a 10 particular system but in which the variations do not result in a decrease in biological activity of the encoded protein. The term "functionally equivalent" as used herein in relation to nucleotide sequences encoding a VDR isoform is intended to encompass nucleotide sequence variants of up to 5% sequence divergence (i.e. retaining 15 95% or more sequence identity) which encode VDR isoforms of substantially equivalent biological activity(ies) as said VDR isoform. The term "functionally equivalent fragment" as used herein in respect of a VDR isoform is intended to encompass functional peptide and polypeptide fragments of said VDR isoform which include the domain or 20 domains which bestow the biological activity characteristic of said VDR isoform. The terms "comprise", "comprises" and "comprising" as used throughout the specification are intended to refer to the inclusion of a stated step, component or feature or group of steps, components or features with or 25 without the inclusion of a further step, component or feature or group of steps, components or features. The invention will hereinafter be further described by way of the following non-limiting example and accompanying figures. 30 Brief description of the figures: FIG.1. (A) Human VDR gene locus. Four overlapping cosmid clones were isolated from a human lymphocyte genomic library (Stratagene) and directly sequenced. Clone J5 extends from the 5' flanking region to intron 2; AE, from 35 intron lb to intron 5; D2, from intron 3 to the 3' UTR: WE, from intron 6 through the 3' flanking region. Sequence upstream of exon if was obtained by WO 99/16872 PCT/AU98/00817 8 anchored PCR from genomic DNA. (B) Structure of hVDR transcripts. Transcripts 1-5 originate from exon la. Transcript 1 corresponds to the published cDNA (1). Transcripts 6-10 originate from exon id and transcripts 11-14 originate from exon if. Boxed numbers indicate the major transcript 5 (based on the relative intensities of the multiple PCR products) within each exon-specific group of transcripts generated with a single primer set. While all transcripts have a translation initiation codon in exon 2, exon ld transcripts have the potential to initiate translation upstream in exon ld, with transcripts 6 and 9 encoding VDR proteins with extended N termini. (C) 10 N-terminal variant proteins encoded by novel hVDR transcripts. Transcript 1 corresponds to the published cDNA sequence (1) and encodes the 427-aa hVDR protein. Transcripts 6 and 9 code for a protein with an extra 50 aa or 23 aa, respectively, at the N-terminal. The 23 aa of the hVDR A/B domain are shown in bold. 15 FIG. 2. RT-PCR analysis of expression of variant hVDR transcripts. (A) Exon la transcripts (220 bp, 301 bp, 342 bp, 372 bp, and 423 bp). (B) Exon ld transcripts (224 bp, 305 bp, 346 bp, 376 bp, and 427 bp). (C) Exon if transcripts (228 bp, 309 bp, 387 bp, and 468 bp). RT-PCR was carried 20 out with exon la-, ld-, or if-specific forward primers and a common reverse primer in exon 3. The sizes of the PCR products and the pattern of bands are similar in A and B by virtue of the identical splicing pattern of exon la and ld transcripts and the fact that primers were designed to generate PCR products of comparable sizes. All tissues and cell lines are 25 human in origin. FIG. 3. Functional analysis of sequence-flanking exons la and id (A) and exon if (B) in NIH 3T3 (solid bars) and COS 7 cells (open bars). The parent vector pGL3basic was used as a promoterless control, and a 30 promoter-chloramphenicol acetyltransferase (CAT) gene reporter construct was cotransfected as an internal control for transfection efficiency in each case. The activity of each construct was corrected for transfection efficiency and for the activity of the pGL3basic empty vector control and expressed as a percentage of the activity of the construct la(-488,+ 75) 35 SEM of at least three separate transfections. Exon la and id flanking constructs are defined in relation to the transcription start site of exon WO 99/16872 PCT/AU98/00817 9 la, designated 11, which lies 54 nt upstream of the published cDNA (1). Exon if flanking constructs are defined relative to the exon if transcription start site, designated 11. Transcription start sites were determined by the 5' termini of the longest RACE clones. The open box corresponds to 5 the GC-rich region. FIG 4. Provides the nucleotide sequence of novel exons detected by 5' RACE: (A) exon lb (SEQ ID NO: 8), (B) exon if (SEQ ID NO: 5) [Plf is indicated by an arrow above the sequence], (C) exon le (SEQ ID NO: 6), (D) exon id (SEQ 10 ID NO: 1) [in-frame ATG codons are highlighted and Pid is indicated by an arrow above the sequence]. Intronic sequences are shown in lower case. Canonical splice site consensus sequences are indicated in bold. The transcription start sites for exons if and ld were determined by the 5' termini of RACE clones. No intron sequence is shown 3' to exon if as cosmid clone 15 J5 terminated in the intron between exons if and le. FIG 5. Provides the nucleotide sequence corresponding to transcript 6 (see figure 1) (SEQ ID NO: 2), together with the predicted amino acid sequence (SEQ ID NO: 9) of the encoded protein. Nucleotides 1-96 correspond to exon 20 id; nucleotides 97-1463 correspond to exons ic to the stop codon in exon 9 (or nucleotides -83-1283 of the hVDR cDNA (1)). FIG 6. Provides the nucleotide sequence corresponding to transcript 9 (see figure 1) (SEQ ID NO: 3), together with the predicted amino acid sequence 25 (SEQ ID NO: 10) of the encoded protein. Nucleotides 1-96 correspond to exon ld; nucleotides 97 - 1382 correspond to exon 2 to the stop codon in exon 9 (or nucleotides -2 - 1283 of the hVDR cDNA (1)). FIG 7. Provides the nucleotide sequence corresponding to transcript 10 (see 30 figure 1) (SEQ ID NO: 4), together with the predicted amino acid sequence (SEQ ID NO: 11) of the encoded protein. Nucleotides 1-96 correspond to exon ld; nucleotides 97-244 correspond to exon 2; nucleotides 245-396 correspond to intronic sequence immediately 3' to exon 2; nucleotides 397 1534 correspond to exons 3 to the stop codon in exon 9 (or nucleotides 146 35 1283 of the hVDR cDNA (1)).

WO 99/16872 PCT/AU98/00817 10 FIG 8. Provides the nucleotide sequence corresponding to transcript 11 (see figure 1) (SEQ ID NO: 7), together with the predicted amino acid sequence (SEQ ID NO: 12) of the encoded protein. Nucleotides 1-207 correspond to exon if; nucleotides 208-1574 correspond to exon ic to the stop codon in 5 exon 9 (or nucleotides -83-1283 of the hVDR cDNA (1)). Example: EXPERIMENTAL PROCEDURES 10 Isolation and Characterisation of Genomic Clones A human lymphocyte cosmic library (Stratagene, La Jolla, Ca) was screened using a 2.1kb fragment of the hVDR cDNA encompassing the entire coding region but lacking the 3'UTR, a 241 bp PCR product spanning exons 1 15 to 3 of the human VDR cDNA, and a 303 bp PCR product spanning exons 3 and 4 of the hVDR cDNA, following standard colony hybridisation techniques. DNA probes were labelled by nick translation (Life Technologies, Gaithersburg, MD) with [oc 32 P] dCTP. Positively hybridising colonies were picked and secondary and tertiary screens carried out until complete 20 purification. Cosmid DNA from positive clones was purified (Qiagen), digested with different restriction enzymes and characterised by Southern blot analysis using specific [y 32 P]ATP labelled oligonucleotides as probes. Cosmid clones were directly sequenced using dye-termination chemistry and automated fluorescent sequencing on an ABI Prism, 377 DNA Sequencer 25 (Perkin-Elmer, Foster City, Ca). Sequence upstream of the most 5' cosmid was obtained by anchored PCR from genomic DNA using commercially available anchor ligated DNA (Clontech, Palo Alto, Ca). Rapid Amplification of cDNA 5-prime Ends (5'-RACE) 30 Alternative 5' variants of the human VDR gene were identified by 5'RACE using commercially prepared anchor-ligated cDNA (Clontech) following the instructions of the manufacturer. Two rounds of PCR using nested reverse primers in exons 3 and 2 (P 1: 5'ccgcttcatgcttcgcctgaagaagcc-3', P2: 5'-tgcagaattcacaggtcatagcattgaag-3') were carried out on a Corbett FTS 35 4000 Capillary Thermal Sequencer (Corbett Research, NSW, Australia). After 26 cycles of PCR, 2% of the primary reaction was reamplified for 31 cycles.

WO 99/16872 PCT/AU98/00817 11 The PCR products were cloned into PUC18 and sequenced by the dideoxy chain termination method. Cell-Culture 5 The embryonal kidney cell line, HEK-293, an embryonic intestine cell line, Intestine-407 and WS 1, a foetal skin fibroblast cell line were all cultured in Eagle's MEM with Earle's BSS and supplemented with either 10% heat-inactivated FBS, 15% FBS or 10% FBS with non-essential amino acids, respectively. The osteosarcoma cell lines MG-63 and Saos-2 were cultured in 10 Eagle's MEM with nonessential amino acids and 10% heat-inactivated FBS and McCoy's 5a medium with 15% FBS. respectively. The breast carcinoma cell line T47D and the colon carcinoma cell lines LIM 1863 and COLO 206F were cultured in RPMI medium supplemented with 0.2 IU bovine insulin/ml and 10% FBS, 5% FBS or 10% FBS, respectively. LIM 1863 were a gift from 15 R.H. Whitehead (3). HK-2 kidney proximal tubule cells were grown in keratinocyte-serum free medium supplemented with 5ng/ml recombinant EGF, 40ug/ml bovine pituitary extract. BC1 foetal osteoblast-like cells were kindly donated by R. Mason (4) and were grown in Eagle's MEM with 5% FBS and 5mg/L vitamin C. Unless otherwise stated all cell lines were obtained 20 from the American Type Culture Collection (Manassas, VA). Reverse Transcriptase-PCR (RT-PCR). Total RNA extracted from approximately 1.5 x 103 cells, from leukocytes prepared from 40 ml blood, or from human tissue using acid 25 phenol extraction was purified by using a guanidium isothiocyanate-cesium chloride step gradient. First-strand cDNA was synthesized from 5 tg of total RNA primed with random hexamers (Promega) using Superscript II reverse transcriptase (Life Technologies). One-tenth of the cDNA (2tl) was used for subsequent PCR, with 36 cycles of amplification, using exon-specific forward 30 primers (exon la: corresponding to nucleotides 1-21 of hVDR cDNA (1); exon ld: 5'-GGCTGTCGATGGTGCTCAGAAC-3'; exon 1f: 5'-AAGTTCCTCCGAGGAGCCTGCC-3'); and a common reverse primer in exon 3 [corresponding to nucleotides 301 280 of hVDR cDNA (1)]. All RT-PCRs were repeated multiple times by using 35 RNA/cDNA prepared at different times from multiple sources. Each PCR included an appropriate cDNA-negative control, and additional controls WO 99/16872 PCT/AU98/00817 12 included RT-negative controls prepared alongside cDNA and RNA/cDNA prepared from VDR-negative cell lines. PCR products were separated on 2% agarose and visualized with ethidium bromide staining. 5 Functional Analysis of h VDR Gene Promoters. Sequences flanking exons la, ld, and if (see Fig. 1A) were PCR amplified by using Pfu polymerase (Stratagene) and cloned into the pGL3basic vector (Promega) upstream of the luciferase gene reporter. Promoter-reporter constructs were transfected into NIH 3T3 and COS 7 cells 10 by using the standard calcium phosphate-precipitation method. Cells were seeded at 2.3±2.5 x 10" per 150-cm 2 flask the day before transfection. Several hours before the precipitates were added the medium was changed to DMEM with 2% charcoal-stripped FBS. Cells were exposed to precipitate for 16 h before subculturing and were harvested 24 h later. The parent vector 15 pGL3basic was used as a promoterless control in these experiments and a simian virus 40 promoter-chloramphenicol acetyltransferase (CAT) gene reporter construct was cotransfected as an internal control for transfection efficiency in each case. The activity of each construct was corrected for transfection efficiency and for the activity of the pGL3 basic empty vector 20 control and expressed as a percentage of the activity of the construct la(-488,+75). Luciferase and CAT assays were carried out in triplicate, and each construct was tested in transfection at least three times. RESULTS 25 Identification of Alternative 5' Variants of the hVDR Gene. Upstream exons were identified in human kidney VDR transcripts by 5' RACE (exons if, le, ld, and lb) and localized by sequencing of cosmid clones (Fig. 1A). To verify these results and to characterize the structure of 30 the 5' end of the VDR gene, exon-specific forward primers were used with a common reverse primer in exon 3 to amplify specific VDR transcripts from human tissue and cell line RNA (Fig. 1B). The identity of these PCR products was verified by Southern blot and by cloning and sequencing. Five different VDR transcripts originating from exon la were identified. The major 35 transcript (transcript 1 in Fig. 1B) corresponds to the published cDNA sequence (1). Three less-abundant forms (2, 3, and 4 in Fig. 1B) arise from WO 99/16872 PCT/AU98/00817 13 alternative splicing of exon ic and a novel 122-bp exon lb into or out of the final transcript. These three variant transcripts were described recently by Pike and colleagues (2). A fifth minor variant was identified (5 in Fig. IB) that lacks exons lb and ic, but includes an extra 152 bp of intronic sequence 5 immediately 3' to exon 2, potentially encoding a truncated protein as a result of an in-frame termination codon in intron 2. Four more transcripts were characterized that originate from exon if, a novel 207-bp exon more than 9 kb upstream from exon la. The major if containing transcript (11 in Fig.iB) consists of exon if spliced immediately 10 adjacent to exon ic. Three less-abundant variants (12, 13, and 14 in Fig. 1B) arise from alternative splicing of exon ic and a novel 159-bp exon le into or out of the final transcript. All these hVDR variants differ only in their 5' UTRs and encode identical proteins from translation initiation in exon 2. Of considerable interest, another five hVDR transcripts were identified 15 that originate from exon id, a novel 96-bp exon located 296 bp downstream from exon la. The major exon id-containing transcript (6 in Fig. lB) utilizes exon ld in place of exon la of the hVDR cDNA. Three minor variants (7, 8, and 9 in Fig. 1B) arise from alternative splicing of exons lb and 1c into or out of the transcript, analogous to the exon la-containing variants 2, 3, and 4. A 20 fifth minor variant transcript (10 in Fig. 1B) lacks exons lb and lc, but includes 152 bp of intron 2 analogous to the exon la-containing transcript 5, and also potentially encodes a truncated protein. Two of these exon ld containing hVDR transcripts encode an N-terminal variant form of the hVDR protein. Utilization of an ATG codon in exon id, which is in a favorable 25 context and in-frame with the major translation start site in exon 2, would generate a protein with an additional 50 aa N-terminal to the ATG codon in exon 2 in the case of variant 6 or 23 aa in the case of variant 9 (Fig. 1C). The relative level of expression of the different transcripts is difficult to address with PCR since relatively minor transcripts may be amplified. 30 However, Southern blots of PCR products from the linear range of PCR amplification indicated that equivalent amounts of PCR product were accumulated after 26 cycles for exon la transcripts compared with 30 cycles for exon ld transcripts, suggesting that id abundance is about 5% of that of la transcripts. This is consistent with the frequency of clones selected and 35 sequenced from RACE analysis of two separate samples of kidney RNA: la (21/27;78%), ld (2/27; 7%), and if (4/27; 15%). RT-PCR with exon la-, ld-, or WO 99/16872 PCT/AU98/00817 14 if-specific forward primers and reverse primers in exons 7 or 9, followed by cloning and sequencing. suggests that these 5' variant transcripts are not associated with differences at the 3' end of the transcript. 5 Exon-Intron Organization of the hVDR Gene. Overlapping cosmid clones were isolated from a human lymphocyte genomic library and characterized by hybridization to exon-specific oligonucleotide probes (Fig. 1A). The exon-intron boundaries of the hVDR gene were determined by comparison of the genomic sequence from cosmid 10 clones with the cDNA sequence. Upstream exons were localized in the VDR gene by sequencing cosmid clones, which extend approximately 7 kb into the intron between exons le and if, enabling verification of both their sequence and the presence of consensus splice donor/acceptor sites. Sequence upstream of exon if was obtained by anchored PCR from genomic DNA by 15 using commercially available anchor-ligated DNA (CLONTECH). In total, the hVDR gene spans more than 60 kb and consists of at least 14 exons (Fig. 1A). Tissue-Specific Expression of hVDR Transcripts. The pattern of expression of variant hVDR transcripts was examined by 20 RT-PCR in a variety of cell lines and tissues with exon la-, ld-, or if-specific forward primers and a common reverse primer in exon 3. Exon la and ld transcripts (Fig. 1B, variants 1-10) were coordinately expressed in all RNA samples analyzed (Fig. 2 A and B). Exon if transcripts (Fig. lB, variants 11 14), however, were detected only in RNA from human kidney tissue (two 25 separate samples), human parathyroid adenoma tissue, and an intestinal carcinoma cell line, LIM 1863 (Fig. 2C). Interestingly, these represent major target tissues for the calcitropic effects of vitamin D. Functional An alysis of hVDR Gene Promoters. 30 Promoter activities of the 5' flanking regions of exons la, ld, and if were examined in NIH 3T3 and COS 7 cells (Fig. 3). Sequences flanking exon la exhibited high promoter activity in both cell lines (Fig. 3A). Maximum luciferase expression of 36- and 54-fold over the empty vector was attained for construct la(-488,+75) in NIH 3T3 and COS 7 cells, respectively. This 35 activity could be attributed largely to a GC-rich region containing multiple consensus Spl-binding motifs lying within 100 bp immediately adjacent to WO 99/16872 PCT/AU98/00817 15 the transcription start site. This region alone, upstream of a luciferase reporter [construct la(-94, + 75)], accounted for 43% of the maximum activity observed in NIH 3T3 cells and 86% of the maximum observed in COS 7 cells. The removal of this GC-rich region [construct la(-29,+ 75)] reduced luciferase 5 activity to only 13% of the maximum in NIH 3T3 and 19% in COS 7 cells. Despite the fact that VDR transcripts that originated from exon ld were identified, distinct promoter activity was not associated with sequences within 300 bp of exon ld [constructs Id(+87,+424) and 1d(+244,+424)]; rather, the sequence immediately adjacent to exon ld may contain a 10 suppressor element (Fig. 3A). Construct la-ld(-846,+470). spanning the 5' flanking regions of both exons la and id, resulted in only 42% and 60% of the activity of la(-898,+75) in NIH 3T3 and COS 7 cells, whereas the 3' deletion of 227 bp restored luciferase activity to 65% and 97% of the activity of la(-898,+75), respectively. Similarly. the 5' truncated construct la-ld ( 15 94,+470), spanning the 5' flanking regions of both la and ld. resulted in only 35% and 40% of the activity of la(-94,+ 75), while a further 3' deletion of 227 bp restored luciferase activity to 69% and 91% of the activity of la(-94,+ 75) in NIH 3T3 and COS 7 cells. It is possible that transcription from exons la and ld is driven by overlapping promoter regions rather than from two 20 distinct promoters, as has been described for the mouse androgen receptor gene. Sequence upstream of exon if showed significant promoter activity in NIH 3T3 cells of 22% of that of the most active construct, la(-488,+ 75), or 9 fold over pGL3basic [construct lf(-1168,+58)] (Fig. 3B). A shorter construct 25 [lf(-172,+58)] had similar activity, with evidence of a suppressor element (between nucleotides -278 and +172) able to repress luciferase activity by 70%. Interestingly, the same constructs were not active in COS 7 cells. This cell line-specific activity of exon if flanking sequences may reflect a requirement for tissue- or cell-specific protein factors. 30 Identification of VDR isoforms in whole cell lysates The existence of a VDR isoform including exons ld and ic has been confirmed in cell lysates from multiple human, monkey, rat and mouse cell lines derived from kidney, intestine, liver and bone. by immunoprecipitation 35 (using the anti-VDR 9A7 rat monoclonal antibody; Affinity Bioreagents Inc., WO 99/16872 PCT/AU98/00817 16 Golden, Colorado) followed by Western blot analysis. The id- and ic-exon specific antibodies detected the same band in all inmniunoprecipitations. DISCUSSION 5 The present inventors have identified 5' variant transcripts of the hVDR that suggest the existence of alternative promoters. These transcripts may not have been discriminated in previous Northern analyses because of their similarity in size. Transcription initiation from exons la or if and 10 alternative splicing generate VDR transcripts that vary in their 5' UTRs but encode the same 427-aa protein. Transcription initiation from exon ld and alternative splicing generate hVDR transcripts with the potential to encode variant proteins with an additional 50 or 23 aa at the N terminus. There was no evidence that these 5' variants are associated with differences at the 3' end 15 of the transcript. Although isoforms are common in other members of the nuclear receptor superfamily, the only evidence for isoforms of the hVDR is a common polymorphismn in the triplet encoding the initiating methionine of the 427-aa form of the VDR that results in initiation of translation at anll alternative start codon beginning at the 10th nucleotide down-stream, 20 encoding a protein truncated by 3 aa at the N terminus (5). Similarly, two forms of the avian VDR, differing in size by 14 aa, are generated from a single transcript by alternative translation initiation (6), and in the rat a dominant negative VDR is generated by intron retention (7). Heterogeneity in the 5' region is a common feature of other nuclear 25 receptor genes. Tissue-specific alternative-promoter usage generates multiple transcripts of the human estrogen receptor a (ERa), the human and rat mineralocorticoid receptors, and the mouse glucocorticoid receptor (GR), which differ in their 5' UTRs but code for identical proteins. However, other members of the nuclear receptor superfamily have multiple, functionally 30 distinct isoforms arising from differential promoter usage and/or alternative splicing. The generation of N-terminal variant protein isoforms has been described for the progesterone receptor (PR), peroxisome proliferator activated receptor (PPARJ), and the retinoid and thyroid receptors. Some receptor isoforms exhibit differential promoter-specific transactivation 35 activity. The N-terminal A/B regions of many nuclear receptor proteins possess a ligand-independent transactivation function (AF1). An AF1 WO 99/16872 PCT/AU98/00817 17 domain has been demonstrated for the thyroid receptor bi (TRbl), ER, GR, PR, PPARg, and the retinoid receptors. The activity of the AFI domain has been shown to vary in both a tissue- and promoter-specific manner. The N terminal A/B region of nuclear receptors is the least-conserved domain across 5 the family and between receptor subtypes, varying considerably both in length and sequence. The VDR, however, is unusual as its N-terminal A/B region is much shorter than that of other nuclear receptors, with only 23 aa N-terminal to the DNA-binding domain, and deletion of these residues seems to have no effect on VDR function. This region in other receptors is 10 associated with optimal ligand-dependent transactivation and can interact directly with components of the basal transcription complex. Two stretches of basic amino acid residues, RNKKR and RPHRR, in the predicted amino acid sequences of the variant hVDR N termini (Fig. 1C) resemble nuclear localization signals. An N-terminal variant VDR protein therefore might 15 exhibit different transactivation potential, possibly mediated by different protein interactions, or may specify a different subcellular localization. The tissue-specific expression of exon if-containing transcripts is mediated by a distal promoter more than 9 kb upstream of exons la and ld. Exon if transcripts were detected only in kidney tissue, parathyroid adenoma tissue, 20 and an intestinal cell line, LIM 1863. It is interesting that these tissues represent major target tissues for the calcitropic effects of vitamin D. The absence of if-containing transcripts in two other kidney cell lines, HK-2 (proximal tubule) and HEK-293 (embryonal kidney). as well as one other embryonal intestinal cell line, Intestine-407, suggests that the expression of 25 If transcripts is cell type-specific. The cell line-specific activity of exon if flanking sequences in promoter reporter assays may reflect a requirement for tissue- or cell-specific protein factors to mediate expression from this promoter. This study has demonstrated that expression of the human VDR gene, 30 which spans more than 60 kb and consists of 14 exons, is under complex transcriptional control by multiple promoters. The expression of multiple exon if transcripts is mediated by utilization of a distal tissue-specific promoter. Transcription from a proximal promoter, or promoters, generates multiple variant hVDR transcripts, two of which code for N-terminal variant 35 proteins. Multiple, functionally distinct isoforms mediate the tissue- and/or developmental-specific effects of many members of the nuclear receptor WO 99/16872 PCT/AU98/00817 18 superfamily. Although the actual relative abundance of the various transcripts and their levels of translation in vivo have not yet been characterized, the results suggest that major variant isoforms of the hVDR exist. Differential regulation of these hVDR gene promoters and of 5 alternative splicing of variant VDR transcripts may have implications for understanding the various actions of 1,25-(OH) 2

D

3 in different cell types, and variant VDR transcripts may play a role in tissue specific VDR actions in bone and calcium honeostasis. 10 It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are. therefore, to 15 be considered in all respects as illustrative and not restrictive.

WO 99/16872 PCT/AU98/00817 19 References: 1. Baker, A.R. et.al. (1988) Proc. Natl. Acad. Sci. USA 85. 3294-3298 2. Miyamoto, K. et.al. (1997) Mol. Endocrinol. 11, 1165-1179 5 3. Whitehead, R.H.et.al. (1987) Cancer Res. 47, 2683-2689 4. Slater, M. et al. (1994) Am. J. Physiology 267, E990-1001 5. Saijo, T.et.al. (1991) Amj.Hum.Genet. 49, 668-673 6. Lu, Z. et.al. (1997) Arch. Biochem. Biophys. 339. 99-106 7. Ebihara, K. et.al. (1996) Mol.Cell.Biol. 16, 3393-3400 WO 99/16872 PCT/AU98/00817 20 Sequence listings: <110> Garvan Institute of Medical Research Title of the Invention: Isoforms of the Human Vitamin D Receptor <130> 91317 <140> <141> <160> 12 <170> PatentIn Ver. 2.0 SEQ ID NO: 1 <211> 96 <212> DNA <213> Homo sapiens <400> 1 gtttccttct tctgtcgggg cgccttggca tggagtggag gaataagaaa aggagcgatt 60 ggctgtcgat ggtgctcaga actgctggag tggagg 96 SEQ ID NO: 2 <211> 1413 <212> DNA <213> Homo sapiens <400> 2 gtttccttct tctgtcgggg cgccttggca tggagtggag gaataagaaa aggagcgatt 60 ggctgtcgat ggtgctcaga actgctggag tggaggaagc ctttgggtct gaagtgtctg 120 tgagacctca cagaagagca cccctgggct ccacttacct gccccctgct ccttcaggga 180 tggaggcaat ggcggccagc acttccctgc ctgaccctgg agactttgac cggaacgtgc 240 cccggatctg tggggtgtgt ggagaccgag ccactggctt tcacttcaat gctatgacct 300 gtgaaggctg caaaggcttc ttcaggcgaa gcatgaagcg gaaggcacta ttcacctgcc 360 ccttcaacgg ggactgccgc atcaccaagg acaaccgacg ccactgccag gcctgccggc 420 tcaaacgctg tgtggacatc ggcatgatga aggagttcat tctgacagat gaggaagtgc 480 agaggaagcg ggagatgatc ctgaagcgga aggaggagga ggccttgaag gacagtctgc 540 ggcccaagct gtctgaggag cagcagcgca tcattgccat actgctggac gcccaccata 600 agacctacga ccccacctac tccgacttct gccagttccg gcctccagtt cgtgtgaatg 660 atggtggagg gagccatcct tccaggccca actccagaca cactcccagc ttctctgggg 720 actcctcctc ctcctgctca gatcactgta tcacctcttc agacatgatg gactcgtcca 780 gcttctccaa tctggatctg agtgaagaag attcagatga cccttctgtg accctagagc 840 tgtcccagct ctccatgctg ccccacctgg ctgacctggt cagttacagc atccaaaagg 900 tcattggctt tgctaagatg ataccaggat tcagagacct cacctctgag gaccagatcg 960 tactgctgaa gtcaagtgcc attgaggtca tcatgttgcg ctccaatgag tccttcacca 1020 tggacgacat gtcctggacc tgtggcaacc aagactacaa gtaccgcgtc agtgacgtga 1080 ccaaagccgg acacagcctg gagctgattg agcccctcat caagttccag gtgggactga 1140 agaagctgaa cttgcatgag gaggagcatg tcctgctcat ggccatctgc atcgtctccc 1200 cagatcgtcc tggggtgcag gacgccgcgc tgattgaggc catccaggac cgcctgtcca 1260 acacactgca gacgtacatc cgctgccgcc acccgccccc gggcagccac ctgctctatg 1320 ccaagatgat ccagaagcta gccgacctgc gcagcctcaa tgaggagcac tccaagcagt 1380 accgctgcct ctccttccag cctgagtgca gcatgaagct aacgcccctt gtgctcgaag 1440 tgtttggcaa tgagatctcc tga 1463 WO 99/16872 PCT/AU98/00817 21 SEQ ID NO: 3 <211> 1382 <212> DNA <213> Homo sapiens <400> 3 gtttccttct tctgtcgggg cgccttggca tggagtggag gaataagaaa aggagcgatt 60 ggctgtcgat ggtgctcaga actgctggag tggaggggat ggaggcaatg gcggccagca 120 cttccctgcc tgaccctgga gactttgacc ggaacgtgcc ccggatctgt ggggtgtgtg 180 gagaccgagc cactggcttt cacttcaatg ctatgacctg tgaaggctgc aaaggcttct 240 tcaggcgaag catgaagcgg aaggcactat tcacctgccc cttcaacggg gactgccgca 300 tcaccaagga caaccgacgc cactgccagg cctgccggct caaacgctgt gtggacatcg 360 gcatgatgaa ggagttcatt ctgacagatg aggaagtgca gaggaagcgg gagatgatcc 420 tgaagcggaa ggaggaggag gccttgaagg acagtctgcg gcccaagctg tctgaggagc 480 agcagcgcat cattgccata ctgctggacg cccaccataa gacctacgac cccacctact 540 ccgacttctg ccagttccgg cctccagttc gtgtgaatga tggtggaggg agccatcctt 600 ccaggcccaa ctccagacac actcccagct tctctgggga ctcctcctcc tcctgctcag 660 atcactgtat cacctcttca gacatgatgg actcgtccag cttctccaat ctggatctga 720 gtgaagaaga ttcagatgac ccttctgtga ccctagagct gtcccagctc tccatgctgc 780 cccacctggc tgacctggtc agttacagca tccaaaaggt cattggcttt gctaagatga 840 taccaggatt cagagacctc acctctgagg accagatcgt actgctgaag tcaagtgcca 900 ttgaggtcat catgttgcgc tccaatgagt ccttcaccat ggacgacatg tcctggacct 960 gtggcaacca agactacaag taccgcgtca gtgacgtgac caaagccgga cacagcctgg 1020 agctgattga gcccctcatc aagttccagg tgggactgaa gaagctgaac ttgcatgagg 1080 aggagcatgt cctgctcatg gccatctgca tcgtctcccc agatcgtcct ggggtgcagg 1140 acgccgcgct gattgaggcc atccaggacc gcctgtccaa cacactgcag acgtacatcc 1200 gctgccgcca cccgcccccg ggcagccacc tgctctatgc caagatgatc cagaagctag 1260 ccgacctgcg cagcctcaat gaggagcact ccaagcagta ccgctgcctc tccttccagc 1320 ctgagtgcag catgaagcta acgccccttg tgctcgaagt gtttggcaat gagatctcct 1380 ga 1382 SEQ ID NO: 4 <211> 1534 <212> DNA <213> Homo sapiens <400> 4 gtttccttct tctgtcgggg cgccttggca tggagtggag gaataagaaa aggagcgatt 60 ggctgtcgat ggtgctcaga actgctggag tggaggggat ggaggcaatg gcggccagca 120 cttccctgcc tgaccctgga gactttgacc ggaacgtgcc ccggatctgt ggggtgtgtg 180 gagaccgagc cactggcttt cacttcaatg ctatgacctg tgaaggctgc aaaggcttct 240 tcaggtgagc ccccctccca ggctctcccc agtggaaagg gagggagaag aagcaaggtg 300 tttccatgaa gggagccctt gcatttttca catctccttc cttacaatgt ccatggaaca 360 tgcggcgctc acagccacag gagcaggagg gtcttggcga agcatgaagc ggaaggcact 420 attcacctgc cccttcaacg gggactgccg catcaccaag gacaaccgac gccactgcca 480 ggcctgccgg ctcaaacgct gtgtggacat cggcatgatg aaggagttca ttctgacaga 540 tgaggaagtg cagaggaagc gggagatgat cctgaagcgg aaggaggagg aggccttgaa 600 ggacagtctg cggcccaagc tgtctgagga gcagcagcgc atcattgcca tactgctgga 660 cgcccaccat aagacctacg accccaccta ctccgacttc tgccagttcc ggcctccagt 720 tcgtgtgaat gatggtggag ggagccatcc ttccaggccc aactccagac acactcccag 780 cttctctggg gactcctcct cctcctgctc agatcactgt atcacctctt cagacatgat 840 ggactcgtcc agcttctcca atctggatct gagtgaagaa gattcagatg acccttctgt 900 gaccctagag ctgtcccagc tctccatgct gccccacctg gctgacctgg tcagttacag 960 catccaaaag gtcattggct ttgctaagat gataccagga ttcagagacc tcacctctga 1020 ggaccagatc gtactgctga agtcaagtgc cattgaggtc atcatgttgc gctccaatga 1080 gtccttcacc atggacgaca tgtcctggac ctgtggcaac caagactaca agtaccgcgt 1140 cagtgacgtg accaaagccg gacacagcct ggagctgatt gagcccctca tcaagttcca 1200 ggtgggactg aagaagctga acttgcatga ggaggagcat gtcctgctca tggccatctg 1260 catcgtctcc ccagatcgtc ctggggtgca ggacgccgcg ctgattgagg ccatccagga 1320 WO 99/16872 PCT/AU98/00817 22 ccgcctgtcc aacacactgc agacgtacat ccgctgccgc cacccgcccc cgggcagcca 1380 cctgctctat gccaagatga tccagaagct agccgacctg cgcagcctca atgaggagca 1440 ctccaagcag taccgctgcc tctccttcca gcctgagtgc agcatgaagc taacgcccct 1500 tgtgctcgaa gtgtttggca atgagatctc ctga 1534 SEQ ID NO: 5 <211> 207 <212> DNA <213> Homo sapiens <400> 5 tgcgaccttg gcggtgagcc tggggacagg ggtgaggcca gagacggacg gacgcagggg 60 cccggcccaa ggcgagggag aacagcggca ctaaggcaga aaggaagagg gcggtgtgtt 120 cacccgcagc ccaatccatc actcagcaac tcctagacgc tggtagaaag ttcctccgag 180 gagcctgcca tccagtcgtg cgtgcag 207 SEQ ID NO: 6 <211> 157 <212> DNA <213> Homo sapiens <400> 6 aggcagcatg aaacagtggg atgtgcagag agaagatctg ggtccagtag ctctgacact 60 cctcagctgt agaaaccttg acaactctgc acatcagttg tacaatggaa cggtattttt 120 tactcttcat gtctgaaaag gctatgataa agatcaa 157 SEQ ID NO: 7 <211> 1574 <212> DNA <213> Homo sapiens <400> 7 tgcgaccttg gcggtgagcc tggggacagg ggtgaggcca gagacggacg gacgcagggg 60 cccggcccaa ggcgagggag aacagcggca ctaaggcaga aaggaagagg gcggtgtgtt 120 cacccgcagc ccaatccatc actcagcaac tcctagacgc tggtagaaag ttcctccgag 180 gagcctgcca tccagtcgtg cgtgcagaag cctttgggtc tgaagtgtct gtgagacctc 240 acagaagagc acccctgggc tccacttacc tgccccctgc tccttcaggg atggaggcaa 300 tggcggccag cacttccctg cctgaccctg gagactttga ccggaacgtg ccccggatct 360 gtggggtgtg tggagaccga gccactggct ttcacttcaa tgctatgacc tgtgaaggct 420 gcaaaggctt cttcaggcga agcatgaagc ggaaggcact attcacctgc cccttcaacg 480 gggactgccg catcaccaag gacaaccgac gccactgcca ggcctgccgg ctcaaacgct 540 gtgtggacat cggcatgatg aaggagttca ttctgacaga tgaggaagtg cagaggaagc 600 gggagatgat cctgaagcgg aaggaggagg aggccttgaa ggacagtctg cggcccaagc 660 tgtctgagga gcagcagcgc atcattgcca tactgctgga cgcccaccat aagacctacg 720 accccaccta ctccgacttc tgccagttcc ggcctccagt tcgtgtgaat gatggtggag 780 ggagccatcc ttccaggccc aactccagac acactcccag cttctctggg gactcctcct 840 cctcctgctc agatcactgt atcacctctt cagacatgat ggactcgtcc agcttctcca 900 atctggatct gagtgaagaa gattcagatg acccttctgt gacectagag ctgtcccagc 960 tctccatgct gccccacctg gctgacctgg tcagttacag catccaaaag gtcattggct 1020 ttgctaagat gataccagga ttcagagacc tcacctctga ggaccagatc gtactgctga 1080 agtcaagtgc cattgaggtc atcatgttgc gctccaatga gtccttcacc atggacgaca 1140 tgtcctggac ctgtggcaac caagactaca agtaccgcgt cagtgacgtg accaaagccg 1200 gacacagcct ggagctgatt gagcccctca tcaagttcca ggtgggactg aagaagctga 1260 acttgcatga ggaggagcat gtcctgctca tggccatctg catcgtctcc ccagatcgtc 1320 ctggggtgca ggacgccgcg ctgattgagg ccatccagga ccgcctgtcc aacacactgc 1380 agacgtacat ccgctgccgc cacccgcccc cgggcagcca cctgctctat gccaagatga 1440 tccagaagct agccgacctg cgcagcctca atgaggagca ctccaagcag taccgctgcc 1500 WO 99/16872 PCT/AU98/00817 23 tctccttcca gcctgagtgc agcatgaagc taacgcccct tgtgctcgaa gtgtttggca 1560 atgagatctc ctga 1574 SEQ ID NO: 8 <211> 122 <212> DNA <213> Homo sapiens <400> 8 ggctcctgaa cctagcccag ctggacggag aaatggactc tagcctcctc tgatagcctc 60 atgccaggcc ccgtgcacat tgctttgctt gcctccctca atcctcatag cttctctttg 120 99gg 122 SEQ ID NO: 9 <211> 477 <212> PRT <213> Homo sapiens <400> 9 Met Glu Trp Arg Asn Lys Lys Arg Set Asp Trp Leu Ser Met Val Leu 1 5 10 15 Arg Thr Ala Gly Val Glu Glu Ala Phe Gly Ser Glu Val Ser Val Arg 20 25 30 Pro His Arg Arg Ala Pro Leu Gly Ser Thr Tyr Leu Pro Pro Ala Pro 35 40 45 Set Gly Met Glu Ala Met Ala Ala Ser Thr Ser Leu Pro Asp Pro Gly 50 55 60 Asp Phe Asp Arg Asn Val Pro Arg Ile Cys Gly Val Cys Gly Asp Arg 65 70 75 80 Ala Thr Gly Phe His Phe Asn Ala Met Thr Cys Glu Gly Cys Lys Gly 85 90 95 Phe Phe Arg Arg Set Met Lys Arg Lys Ala Leu Phe Thr Cys Pro Phe 100 105 110 Asn Gly Asp Cys Arg Ile Thr Lys Asp Asn Arg Arg His Cys Gln Ala 115 120 125 Cys Arg Leu Lys Arg Cys Val Asp Ile Gly Met Met Lys Glu Phe Ile 130 135 140 Leu Thr Asp Glu Glu Val Gln Arg Lys Arg Glu Met Ile Leu Lys Arg 145 150 155 160 Lys Glu Glu Glu Ala Leu Lys Asp Set Leu Arg Pro Lys Leu Set Glu 165 170 175 Glu Gln Gln Arg Ile Ile Ala Ile Leu Leu Asp Ala His His Lys Thr 180 185 190 Tyr Asp Pro Thr Tyr Set Asp Phe Cys Gln Phe Arg Pro Pro Val Arg 195 200 205 WO 99/16872 PCT/AU98/00817 24 Val Asn Asp Gly Gly Gly Ser His Pro Ser Arg Pro Asn Ser Arg His 210 215 220 Thr Pro Ser Phe Ser Gly Asp Ser Ser Ser Ser Cys Ser Asp His Cys 225 230 235 240 Ile Thr Ser Ser Asp Met Met Asp Ser Ser Ser Phe Ser Asn Leu Asp 245 250 255 Leu Ser Glu Glu Asp Ser Asp Asp Pro Ser Val Thr Leu Glu Leu Ser 260 265 270 Gln Leu Ser Met Leu Pro His Leu Ala Asp Leu Val Ser Tyr Ser Ile 275 280 285 Gln Lys Val Ile Gly Phe Ala Lys Met Ile Pro Gly Phe Arg Asp Leu 290 295 300 Thr Ser Glu Asp Gln Ile Val Leu Leu Lys Ser Ser Ala Ile Glu Val 305 310 315 320 Ile Met Leu Arg Ser Asn Glu Ser Phe Thr Met Asp Asp Met Ser Trp 325 330 335 Thr Cys Gly Asn Gln Asp Tyr Lys Tyr Arg Val Ser Asp Val Thr Lys 340 345 350 Ala Gly His Ser Leu Glu Leu Ile Glu Pro Leu Ile Lys Phe Gln Val 355 360 365 Gly Leu Lys Lys Leu Asn Leu His Glu Glu Glu His Val Leu Leu Met 370 375 380 Ala Ile Cys Ile Val Ser Pro Asp Arg Pro Gly Val Gln Asp Ala Ala 385 390 395 400 Leu Ile Glu Ala Ile Gln Asp Arg Leu Ser Asn Thr Leu Gln Thr Tyr 405 410 415 Ile Arg Cys Arg His Pro Pro Pro Gly Ser His Leu Leu Tyr Ala Lys 420 425 430 Met Ile Gln Lys Leu Ala Asp Leu Arg Ser Leu Asn Glu Glu His Ser 435 440 445 Lys Gln Tyr Arg Cys Leu Ser Phe Gln Pro Glu Cys Ser Met Lys Leu 450 455 460 Thr Pro Leu Val Leu Glu Val Phe Gly Asn Glu Ile Ser 465 470 475 WO 99/16872 PCT/AU98/00817 25 SEQ ID NO: 10 <211> 450 <212> PRT <213> Homrno sapiens <400> 10 Met Glu Trp Arg Asn Lys Lys Arg Ser Asp Trp Leu Ser Met Val Leu 1 5 10 15 Arg Thr Ala Gly Val Glu Gly Met Glu Ala Met Ala Ala Ser Thr Ser 20 25 30 Leu Pro Asp Pro Gly Asp Phe Asp Arg Asn Val Pro Arg Ile Cys Gly 35 40 45 Val Cys Gly Asp Arg Ala Thr Gly Phe His Phe Asn Ala Met Thr Cys 50 55 60 Glu Gly Cys Lys Gly Phe Phe Arg Arg Ser Met Lys Arg Lys Ala Leu 65 70 75 80 Phe Thr Cys Pro Phe Asn Gly Asp Cys Arg Ile Thr Lys Asp Asn Arg 85 90 95 Arg His Cys Gln Ala Cys Arg Leu Lys Arg Cys Val Asp Ile Gly Met 100 105 110 Met Lys Glu Phe Ile Leu Thr Asp Glu Glu Val Gln Arg Lys Arg Glu 115 120 125 Met Ile Leu Lys Arg Lys Glu Glu Glu Ala Leu Lys Asp Ser Leu Arg 130 135 140 Pro Lys Leu Ser Glu Glu Gln Gln Arg Ile Ile Ala Ile Leu Leu Asp 145 150 155 160 Ala His His Lys Thr Tyr Asp Pro Thr Tyr Ser Asp Phe Cys Gln Phe 165 170 175 Arg Pro Pro Val Arg Val Asn Asp Gly Gly Gly Ser His Pro Ser Arg 180 185 190 Pro Asn Ser Arg His Thr Pro Ser Phe Ser Gly Asp Ser Ser Ser Ser 195 200 205 Cys Ser Asp His Cys Ile Thr Ser Ser Asp Met Met Asp Ser Ser Ser 210 215 220 Phe Ser Asn Leu Asp Leu Ser Glu Glu Asp Ser Asp Asp Pro Ser Val 225 230 235 240 Thr Leu Glu Leu Ser Gln Leu Ser Met Leu Pro His Leu Ala Asp Leu 245 250 255 Val Ser Tyr Ser Ile Gln Lys Val Ile Gly Phe Ala Lys Met Ile Pro 260 265 270 Gly Phe Arg Asp Leu Thr Ser Glu Asp Gln Ile Val Leu Leu Lys Ser 275 280 285 WO 99/16872 PCT/AU98/00817 26 Set Ala Ile Glu Val Ile Met Leu Arg Set Asn Glu Set Phe Thr Met 290 295 300 Asp Asp Met Ser Trp Thr Cys Gly Asn Gln Asp Tyr Lys Tyr Arg Val 305 310 315 320 Set Asp Val Thr Lys Ala Gly His Ser Leu Glu Leu Ile Glu Pro Leu 325 330 335 Ile Lys Phe Gln Val Gly Leu Lys Lys Leu Asn Leu His Glu Glu Glu 340 345 350 His Val Leu Leu Met Ala Ile Cys Ile Val Set Pro Asp Arg Pro Gly 355 360 365 Val Gln Asp Ala Ala Leu Ile Glu Ala Ile Gln Asp Arg Leu Set Asn 370 375 380 Thr Leu Gln Thr Tyr Ile Arg Cys Arg His Pro Pro Pro Gly Set His 385 390 395 400 Leu Leu Tyr Ala Lys Met Ile Gln Lys Leu Ala Asp Leu Arg Set Leu 405 410 415 Asn Glu Glu His Set Lys Gln Tyr Arg Cys Leu Set Phe Gln Pro Glu 420 425 430 Cys Set Met Lys Leu Thr Pro Leu Val Leu Glu Val Phe Gly Asn Glu 435 440 445 Ile Set 450 SEQ ID NO: 11ii <211> 72 <212> PRT <213> Homo sapiens <400> 11ii Met Glu Trp Arg Asn Lys Lys Arg Set Asp Trp Leu Set Met Val Leu 1 5 10 15 Arg Thr Ala Gly Val Glu Gly Met Glu Ala Met Ala Ala Set Thr Set 20 25 30 Leu Pro Asp Pro Gly Asp Phe Asp Arg Asn Val Pro Arg Ile Cys Gly 35 40 45 Val Cys Gly Asp Arg Ala Thr Gly Phe His Phe Asn Ala Met Thr Cys 50 55 60 Glu Gly Cys Lys Gly Phe Phe Arg 65 70 WO 99/16872 PCT/AU98/00817 27 SEQ ID NO: 12 <211> 427 <212> PRT <213> Homo sapiens <400> 12 Met Glu Ala Met Ala Ala Set Thr Set Leu Pro Asp Pro Gly Asp Phe 1 5 10 15 Asp Arg Asn Val Pro Arg Ile Cys Gly Val Cys Gly Asp Arg Ala Thr 20 25 30 Gly Phe His Phe Asn Ala Met Thr Cys Glu Gly Cys Lys Gly Phe Phe 35 40 45 Arg Arg Ser Met Lys Arg Lys Ala Leu Phe Thr Cys Pro Phe Asn Gly 50 55 60 Asp Cys Arg Ile Thr Lys Asp Asn Arg Arg His Cys Gln Ala Cys Arg 65 70 75 80 Leu Lys Arg Cys Val Asp Ile Gly Met Met Lys Glu Phe Ile Leu Thr 85 90 95 Asp Glu Glu Val Gln Arg Lys Arg Glu Met Ile Leu Lys Arg Lys Glu 100 105 110 Glu Glu Ala Leu Lys Asp Set Leu Arg Pro Lys Leu Set Glu Glu Gln 115 120 125 Gin Arg Ile Ile Ala Ile Leu Leu Asp Ala His His Lys Thr Tyr Asp 130 135 140 Pro Thr Tyr Ser Asp Phe Cys Gln Phe Arg Pro Pro Val Arg Val Asn 145 150 155 160 Asp Gly Gly Gly Set His Pro Set Arg Pro Asn Set Arg His Thr Pro 165 170 175 Set Phe Set Gly Asp Set Ser Set Set Cys Set Asp His Cys Ile Thr 180 185 190 Ser Ser Asp Met Met Asp Set Set Set Phe Set Asn Leu Asp Leu Set 195 200 205 Glu Glu Asp Set Asp Asp Pro Set Val Thr Leu Glu Leu Set Gln Leu 210 215 220 Ser Met Leu Pro His Leu Ala Asp Leu Val Set Tyr Ser Ile Gln Lys 225 230 235 240 Val Ile Gly Phe Ala Lys Met Ile Pro Gly Phe Arg Asp Leu Thr Set 245 250 255 Glu Asp Gln Ile Val Leu Leu Lys Set Set Ala Ile Glu Val Ile Met 260 265 270 Leu Arg Set Asn Glu Set Phe Thr Met Asp Asp Met Set Trp Thr Cys 275 280 285 WO 99/16872 PCT/AU98/00817 28 Gly Asn Gin Asp Tyr Lys Tyr Arg Val Ser Asp Val Thr Lys Ala Gly 290 295 300 His Ser Leu Glu Leu Ile Glu Pro Leu Ile Lys Phe Gln Val Gly Leu 305 310 315 320 Lys Lys Leu Asn Leu His Glu Glu Glu His Val Leu Leu Met Ala Ile 325 330 335 Cys Ile Val Ser Pro Asp Arg Pro Gly Val Gln Asp Ala Ala Leu Ile 340 345 350 Glu Ala Ile Gln Asp Arg Leu Ser Asn Thr Leu Gin Thr Tyr Ile Arg 355 360 365 Cys Arg His Pro Pro Pro Gly Ser His Leu Leu Tyr Ala Lys Met Ile 370 375 380 Gln Lys Leu Ala Asp Leu Arg Ser Leu Asn Glu Glu His Ser Lys Gln 385 390 395 400 Tyr Arg Cys Leu Ser Phe Gln Pro Glu Cys Ser Met Lys Leu Thr Pro 405 410 415 Leu Val Leu Glu Val Phe Gly Asn Glu Ile Ser 420 425

Claims (25)

1. An isolated polynucleotide molecule encoding a human Vitamin D receptor (hVDR) isoform, said polynucleotide molecule comprising a 5 nucleotide sequence which includes sequence that substantially corresponds or is functionally equivalent to that of exon ld of the human VDR gene.

2. A polynucleotide molecule according to claim 1, wherein said nucleotide sequence further includes sequence that substantially 10 corresponds or is functionally equivalent to that of exon lb and/or exon lc.

3. A polynucleotide molecule according to claim 1. wherein the nucleotide sequence includes: (i) sequence that substantially corresponds or is functionally 15 equivalent to that of exons ld, 1c and 2-9 and encodes a VDR isoform of approximately 477 amino acids, (ii) sequence that substantially corresponds or is functionally equivalent to that of exons ld and 2-9 and encodes a VDR isoform of approximately 450 amino acids, or 20 (iii) sequence that substantially corresponds or is functionally equivalent to that of exons ld and 2-9 and further includes a 152bp intronic sequence and encodes a truncated VDR isoform of approximately 72 amino acids. 25

4. A polynucleotide molecule according to claim 1, wherein the nucleotide sequence substantially corresponds to that shown as SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

5. An isolated polynucleotide molecule encoding a human Vitamin D 30 receptor (hVDR), said polynucleotide molecule comprising a nucleotide sequence which includes sequence that substantially corresponds or is functionally equivalent to that of exon if and/or le of the human VDR gene.

6. A polynucleotide molecule according to claim 5, wherein the 35 nucleotide sequence further includes sequence that substantially corresponds or is functionally equivalent to that of exon ic. WO 99/16872 PCT/AU98/00817 30

7, A polynucleotide molecule according to claim 5, wherein the nucleotide sequence includes sequence that substantially corresponds or is functionally equivalent to that of exons if and 2-9. 5

8. A polynucleotide molecule according to claim 5, wherein the nucleotide sequence substantially corresponds to that shown as SEQ ID NO: 7. 10

9. A plasmid or expression vector including a polynucleotide molecule according to any one of the preceding claims.

10. A host cell transformed with a polynucleotide molecule according to any one of claims 1-8 or a plasmid or expression vector according to claim 9. 15

11. A host cell according to claim 10. wherein the cell is a mammalian cell.

12. A host cell according to claim 10, wherein the cell is a NIH 3T3 or COS 20 7 cell.

13. A method of producing a VDR or VDR isoform or functionally equivalent fragments thereof, comprising culturing a host cell of any one of claims 10-12 under conditions enabling the expression of the polynucleotide 25 molecule and, optionally, recovering the VDR or VDR isoform or functionally equivalent fragments thereof.

14. A method according to claim 13, wherein the VDR or VDR isoform or functionally equivalent fragments thereof are expressed onto the host cell 30 membrane or other sub-cellular compartment.

15. A human Vitamin D receptor (hVDR) isoform or functionally equivalent fragment thereof encoded by a polynucleotide molecule according to any one of claims 1-4, said hVDR isoform or functionally equivalent 35 fragment thereof being in a substantially pure form. WO 99/16872 PCT/AU98/00817 31

16. An antibody or antibody fragment capable of specifically binding to a VDR isoformn according to claim 15.

17. A non-human animal transformed with a polynucleotide molecule 5 according to any one of claims 1-8.

18. A method for detecting agonist and/or antagonist compounds of a VDR isoform of claim 15, comprising contacting said VDR isoform, functionally equivalent fragment thereof or a cell transformed with and expressing a 10 polynucleotide molecule according to any one of claims 1-4, with a test compound under conditions enabling the activation of the VDR isoform or functionally equivalent fragment thereof, and detecting an increase or decrease in the activity of the VDR isoform or functionally equivalent fragment thereof. 15

19. An oligonucleotide or polynucleotide probe comprising a nucleotide sequence of 10 or more nucleotides, the probe comprising a nucleotide sequence such that the probe specifically hybridises to a polynucleotide molecule according to any one of claims 1-8 under high stringency 20 conditions.

20. An antisense polynucleotide molecule comprising a nucleotide sequence capable of specifically hybridising to a mRNA molecule which encodes a VDR or VDR isoform encoded by a polynucleotide molecule 25 according to any one of claims 1-8, so as to prevent translation of the mRNA molecule.

21. An isolated polynucleotide molecule comprising a nucleotide sequence showing greater than 75% sequence identity to: 30 (i) 5'TGCGACCTTGGCGGTGAGCCTGGGGACAGGGGTGAGGCCAGAGA CGGACGGACGCAGGGGCCCGGCCCAAGGCGAGGGAGAACAGCGGCACTA AGGCAGAAAGGAAGAGGGCGGTGTGTTCACCCGCAGCCCAATCCATCAC TCAGCAACTCCTAGACGCTGGTAGAAAGTTCCTCCGAGGAGCCTGCCATC 35 CAGTCGTGCGTGCAG3' (SEQ ID NO: 5) WO 99/16872 PCT/AU98/00817 32 (ii) 5'AGGCAGCATGAAACAGTGGGATGTGCAGAGAGAAGATCTGGGTC CAGTAGCTCTGACACTCCTCAGCTGTAGAAACCTTGACAACTCTGCACAT CAGTTGTACAATGGAACGGTATTTTTTACTCTTCATGTCTGAAAAGGCTA TGATAAAGATCAA3' (SEQ ID NO: 6), or 5 (iii) 5'GTTTCCTTCTTCTGTCGGGGCGCCTTGGCATGGAGTGGAGGAATA AGAAAAGGAGCGATTGGCTGTCGATGGTGCTCAGAACTGCTGGAGTGGA GG3'(SEQ ID NO: 1) 10

22. An isolated polynucleotide molecule comprising a nucleotide sequence showing greater than 85% sequence identity to: (i) 5'TGCGACCTTGGCGGTGAGCCTGGGGACAGGGGTGAGGCCAGAGA CGGACGGACGCAGGGGCCCGGCCCAAGGCGAGGGAGAACAGCGGCACTA 15 AGGCAGAAAGGAAGAGGGCGGTGTGTTCACCCGCAGCCCAATCCATCAC TCAGGAACTCCTAGACGCTGGTAGAAAGTTCCTCCGAGGAGCCTGCCATC CAGTCGTGCGTGCAG3" (SEQ ID NO: 5) (ii) 5'AGGCAGCATGAAACAGTGGGATGTGCAGAGAGAAGATCTGGGTC 20 CAGTAGCTCTGACACTCCTCAGCTGTAGAAACCTTGACAACTCTGCACAT CAGTTGTACAATGGAACGGTATTTTTTACTCTTCATGTCTGAAAAGGCTA TGATAAAGATCAA3' (SEQ ID NO: 6), or (iii) 5'GTTTCCTTCTTCTGTCGGGGCGCCTTGGCATGGAGTGGAGGAATA 25 AGAAAAGGAGCGATTGGCTGTCGATGGTGCTCAGAACTGCTGGAGTGGA GG3'(SEQ ID NO: 1).

23. An isolated polynucleotide molecule comprising a nucleotide sequence showing greater than 95% sequence identity to: 30 (i) 5'TGCGACCTTGGCGGTGAGCCTGGGGACAGGGGTGAGGCCAGAGA CGGACGGACGCAGGGGCCCGGCCCAAGGCGAGGGAGAACAGCGGCACTA AGGCAGAAAGGAAGAGGGCGGTGTGTTCACCCGCAGCCCAATCCATCAC TCAGCAACTCCTAGACGCTGGTAGAAAGTTCCTCCGAGGAGCCTGCCATC 35 CAGTCGTGCGTGCAG3'(SEQ ID NO: 5) WO 99/16872 PCT/AU98/00817 33 (ii) 5'AGGCAGCATGAAACAGTGGGATGTGCAGAGAGAAGATCTGGGTC CAGTAGCTCTGACACTCCTCAGCTGTAGAAACCTTGACAACTCTGCACAT CAGTTGTACAATGGAACGGTATTTTTTACTCTTCATGTCTGAAAAGGCTA TGATAAAGATCAA3' (SEQ ID NO: 6), or 5 (iii) 5'GTTTCCTTCTTCTGTCGGGGCGCCTTGGCATGGAGTGGAGGAATA AGAAAAGGAGCGATTI'GGCTGTCGATGGTGCTCAGAACTGCTGGAGTGGA GG3'(SEQ ID NO: 1) 10

24. An isolated polynucleotide molecule comprising nucleotide sequence substantially corresponding to: (i) 5'TGCGACCTTGGCGGTGAGCCTGGGGACAGGGGTGAGGCCAGAGA CGGACGGACGCAGGGGCCCGGCCCAAGGCGAGGGAGAACAGCGGCACTA 15 AGGCAGAAAGGAAGAGGGCGGTGTGTTCACCCGCAGCCCAATCCATCAC TCAGCAACTCCTAGACGCTGGTAGAAAGTTCCTCCGAGGAGCCTGCCATC CAGTCGTGCGTGCAG3'(SEQ ID NO: 5) (ii) 5'AGGCAGCATGAAACAGTGGGATGTGCAGAGAGAAGATCTGGGTC 20 CAGTAGCTCTGACACTCCTCAGCTGTAGAAACCTTGACAACTCTGCACAT CAGTTGTACAATGGAACGGTATTTTTTACTCTTCATGTCTGAAAAGGCTA TGATAAAGATCAA3'(SEQID NO: 6), or (iii) 5'GTTTCCTTCTTCTGTCGGGGCGCCTTGGCATGGAGTGGAGGAATA

25 AGAAAAGGAGCGATTGGCTGTCGATGGTGCTCAGAACTGCTGGAGTGGA GG3' (SEQ ID NO: 1) 30