AU9137998A - DNA sequencing by mass spectrometry - Google Patents

Description

-1-

AUSTRALIA

PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT

ORIGINAL

Name of Applicant: Actual Inventor: 4 *a Address of Service: *"Name of Applicant: o 0* SEQUENOM, INC.

Hubert KOSTER BALDWIN SHELSTON WATERS 60 MARGARET STREET SYDNEY NSW 2000 Invention Title: "DNA SEQUENCING BY MASS SPECTROMETRY" Details of Original Application No. 59929/94 dated 6 January, 1994 The following statement is a full description of this invention, including the best method of performing it known to us:la- DNA SEQUENCING BY MASS SPECTROMETRY Technical Field The present invention relates to mass modified nucleic acid primers and mass modified nucleotides, and their uses in nucleic acid sequencing. The present application is related to AU 694,940. which is incorporated in its entirety herein by reference.

Backeround of the Invention Since the genetic information is represented by the sequence of the four DNA building blocks deoxyadenosine- (dpA). deoxyguanosine- (dpG). deoxycytidine- (dpC) and deoxythymidine-5'-phosphate (dpT). DNA sequencing is one of the most 10 fundamental technologies in molecular biology and the life sciences in general. The ease Sand the rate by which DNA sequences can be obtained greatly affects related technologies such as development and production of new therapeutic agents and new and useful varieties of plants and microorganisms via recombinant DNA technology. In particular, unraveling the DNA sequence helps in understanding human pathological S 15 conditions including genetic disorders, cancer and AIDS. In some cases. very subtle Sdifferences such as a one nucleotide deletion, addition or substitution can create serious.

Sin some cases even fatal. consequences. Recently, DNA sequencing has become the core technology of the Human Genome Sequencing Project J.E. Bishop and M.

Waldholz. 1991, Genome: The Story of the Most AstonishinP Scient;ic Adventure of 20 Our Time The Attempt to Map All the Genes in the Human Body, Simon Schuster, New York). Knowledge of the complete human genome DNA sequence will certainly help to understand, to-diagnose, to prevent and to treat human diseases. To be able to tackle successfully the determination of the approximately 3 billion base pairs of the human genome in a reasonable time frame and in an economical way, rapid, sensitive and inexpensive methods need to be developed, which also offer the possibility of automation. The present invention provides such a technology.

Recent reviews of today's methods together with future directions and trends are given by Barrell (The FASEB Journal 5.40-45 (1991), and Trainor (Anal. Chem. 62.

418-26 (1990)).

Currently, DNA sequencing is performed by either the chemical degradation method of Maxam and Gilbert (Methods in Enzvmology 65, 499-560 (1980)) or the -lbenzymatic dideoxynucleotide termination method of Sanger er al. (Proc. Natl. Acad. Sci.

USA 74. 5463-67 (1977)). In the chemical method, base specific modifications result in a base specific cleavage of the radioactive or fluorescently labeled DNA fragment. With the four separate base specific cleavage reactions, four sets of nested fragments are produced which are separated according to length by polyacrylamide gel electrophoresis (PAGE). After autoradiography. the sequence can be read directly since each band (fragment) in the gel originates from a base specific cleavage event. Thus. the fragment lengths in the four "ladders" directly translate into a specific position in the DNA sequence.

OCt t 1 0 In the enzymatic chain termination method, the four base specific sets of DNA Sfragments are formed by starting with a primerltemplate system elongating the primer o into the unknown DNA sequence area and thereby copying the template and B4 0 a synthesizing a complementary strand by DNA polymerases. such as Kienow fragment of E. coli DNA polymerasc 1, a DNA polymcrase from Tiwrmus aquozicus. Taq DNA polymerase. or a modified T7 DNA polymerase. Sequenase (Tabor er rcNal Aca.Sri- USA 8-4. 4767-4771 (1987)). in the presence of chain-terminating reagents.

Here. the chain-terminating event is achieved by incorporating into the four separate reaction mixtures in addition to the four normal deoxynucleoside triphosphates, dATP.

dGTP, dTTP and dCTP. only one of the chain-terminating dideoxynucleoside uiphosphates. ddATP. ddGTP. ddlTP or ddCTP. respectively, in a limiting smallI concentration- The four sets of resulting fragments produe, after electrophoresis. four o base spt.cific ladders from which the DNA sequence can be determined.

A recent modification of the Sanger sequencing siategy involves the aegradation of phosphorothioate-containing DNA fragments obtained by Using alpha-thic dNTP instead of the normally used ddNTPs during the primer extension reaction mediated by DNA polym erase (Labeit et DN[A 173-177 (1986): Amersham. PCI-Application 15 GB86/00349; Eckstein et Nucleic Acids Res .1 9947 (1988)). Here, the 6our sets of base-specific sequencing ladders are obtained by limited digestion with exonuclease Ill or snake venom phosphod iesterase. subsequent separation or PACE and visualization by radioisotopic labeling of either the primer or one of the dNT~s. In a further modification.

the base-specific cleavage is achieved by alkylating the sulphur atom in the modified phosphodiester band followed by a heat treatment (Max -Planck-Gesellschaft. DE 3930312 Both methods can be combined with the amplification of the DNA via the Pulymerase Chair Reaction (PCR).

On the upfront end, the DNA to be sequenced has to be fragmented into sequencable pieces of currently not more than 500 to 1000 nucleotidecs. Starting from a genome. this is a multi-step process involving cloning and subcloning steps using different and appropriate cloning vectors such as YAQ, cosmids. plasmids and MIV 13 vectors (Samnbrook era!.. Molecular Cloning: A L~iboratojry Martual, Cold Spring Harbor Laboratory Press. 1989). Finally, for Sanger sequencing. the fragments of about 500 to 1000 base pairs arc integrated into a specific restriction site of the replicative form I (RF 1) of a derivative of the N1 13 bacteriophage (Vieria and Messing. Q=~n 12. 259 (1982)) Wnd then the doubie-stranded fonin is transformed to the single -st--anded circular form to serve as a template for the Sanger sequencing process having a binding site f-or a universal primer obtained by chemical DNA synthesis (Sinha. Biernat. Mell~anus and Kdster.

Nucleic Acids Res. 12. 4539-57 (1984); U.S. Patent No. 4725677 upstream of the restriction site into which the unknownr DNA fragment has been insented. Under specific conditions. unknownr DNA sequences integrated into supercoiked double-stranded plasmnid DNA can be sequenced directly by the Sanger method (Chen and Seeburg. DN'A A. 165- 170 (1983)) and Lim ei Gene Anmal, Techn- 32-39 (1988). and, with the Polymecrasc Chain Reaction (PCR) (PCR Protocolse A Guide to Methods and Applicationr Innis ei al..

0* *O 4

S

S

editors. Academic Press. San Diego (1990)) cloning or subcloning steps could be omitted by directly sequencing off chromosomal DNA by first amplifying th- DNA segment by PCR and then applying the Sanger sequencing method (Innis et atl.. Proc. Nail. Acad. Sci.

USA 9436-9440 (1988)). In this case. however, the DNA sequence in the interested region most be known at least to the extent to bind a sequencing primer.

In order to be able to read the sequence from PAGE. detectable labels have to be used in either the primer (very often at the 5'-end) or in one of ihe deoxynucleoside triphosphates, dNTP. Using radioisotopes such as 32 p. 33 p. or 35S is still the most frequently used technique. After PAGE. the gels are exposed to X-ray films and silver to grain exposure is analyzed. The use ofradioisotopic labeling creates several problems.

Most labels useful for autoradiographic detection of sequencing fragements have relatively short half-lives which can limit the useful time of the labels. The emission high energy beta radiation. particularly from 3 2 P. can lead to breakdown of the products via radiolysis so that the sample should be used very quickly after labeling. In addition, high energy radiation can also cause a deterioration of band sharpness by scattering. Some of these problems can be reduced by using the less energetic isotopes such as 3 3 P or 3 5 S (see. e.g..

Omstein et Biotechniqus 476 (1985)). Here. however, longer exposure times have to be tolerated. Above all, the use of radioisotopes poses significant health risks to the experimentalist and. in heavy sequencing projects, decontamin"tion and handling the radioactive waste are other severe problems and burdens.

In response to the above mentioned problems related to the use of radioactive labels, non-radioactive labeling techniques have ben explored and. in recent years, integrated into partly automated DNA sequencing procedures. All these improvements utilize the Sanger sequencing strategy. The fluorescent label can be tagged to the primer (Smith er al., Nare 321.. 674-679 (1986) and EPO Patent No. 87300998.9; Du Pont De Nemours EPO Application No. 0359225; Ansorge el al. Biochem. Biophys. Mehods 1. 325-32 (1986)) or to the chain-terminating dideoxynucloside triphosphates (Prober et al. Science 238.336-41 (1987); Applied Biosystems, PCT Application WO 91/05060).

Based on either labeling the primer or the ddNTP, systems have been developed by Applied Biosystems (Smith et a. Scienc 235. G89 (1987); U.S. Patent Nos. 570973 and 689013). Du Pont De Nemours (Prober et a. Science 28. 336-341 (1987); U.S. Patents Nos. 881372 and 57566). Pharmacia-LKB (Ansorge et al. Iuc~kAidR J15. 4593- 4602 (1987) and EMBL Patent Application DE P3724442 and P3805808.1) and Hitachi (JP 1-90844 and DE 4011991 Al). A somewhat similar approach was developed 1:.

Brumbaugh er a. (Proc Natl. Sci. SA i. 5610-14 (1988) and U.S. Patent No.

4.729.947). An improved method for the Du Pont system usii:g two electrophoretic lanes with two different specific labels per lane is described (PCT Application W092102635).

A different approach uses fluorescently labeled avidin and biotin labeled primers. Here.

the sequencing ladders ending with biotin are reacted during electrophoresis with the

C

C

C C

C

C

labeled avidin which results in the detection of the individual sequencing bands (Brumbaugh ct al. U.S. Patent No. 594676).

More recently even more sensitive non-radioactive labeling techniques for DNA using chemiluminescence triggerable ard amplifyable by enzymes have been developed (Beck. O'Keefe. Coull and Koster, Nucleic Acids Res. 17. 5115-5123 (1989) and Beck and K6ster. Anal. Chem. 62, 2258-2270 (1990)). These labeling methods were combined with multiplex DNA sequencing (Church et al Scienc 240. 185-188 (1988) to provide for a strategy aimed at high throughput DNA sequencing (K6ster el al.

Nucleic Acids Res. Symoosium Ser. No. 24. 318-321 (1991). University of Utah. PCT 10 Application No. WO 90/15883); this strategy still suffers from the disadvantage of being very laborious and difficult to automate.

In an attempt to simplify DNA sequencing. solid supports have been introduced. In most cases published so far. the template strand for sequencing (with or without PCR amplification) is immobilized on a solid support most frequently utilizing the strong biotin-avidinistreptavidin interaction (Orion-Yhtyma Oy. U.S. Patent No. 277643.

M. Uhlen et al. Nucleic Acids Res. 16. 3025-33 (1988): Cemu Bioteknik. PCT Application No. WO 89109282 and Medical Research Council. GB. PCT Application No.

WO 92/03575). The primer extension products synthesized on the immobilized template strand are purified of enzymes. other sequencing reagents and by-products by a washing 20 step and then released under denaturing conditions by loosing the hydrogen bonds between the Watson-Crick base pairs and subjected to PAGE separation. In a different appro..ch. the primer extension products (not the template) From a DNA sequencing reaction are bound to a solid support via biotin'avidin (Du Pont De Nemours. PCT Application WO 91111533). In contrast to the above mentioned methods, here. the intt.action between biotin and avidin is overcome by employing denaturing conditions (formamide/EDTA) to release the primer extension products of the sequencing reaction from the solid support for PAGE separation. As solid supports. beads. magnetic beads (Dynabeads) and Sepharosc beads). filters. capillaries. plastii dipsticks polystyrene strips) and microtiter wells are being proposed.

All methods discussed so far have one central step in common.

polyacrvlamide gel electrophoresis (PAGE). In many instances, this represents a major drawback and limitation for each of these methods. Preparing a homogeneous gel by polymerization. loading of the samples. the electrophoresis itself, detection of the sequrnce pattern by autoradiorraphy). removing the gel and cleaning the glass plates to prepare another gel arc very laborious and time-consuming procedures. Moreover, the whole process is error-prone. difficult to automate, and. in order to improve reproducibility and reliability. highly trained and skilled personnel are required In the case of radioactive labeling. autoradiography itself can consume from hours to days. In the case of fluorescent labeling. at least the detection of the sequencing bands is being performed automatically when using the laser-scanning devices integrated into commercial available DNA sequencers. One problem related to the fluorescent labeling is the influence of the four different base-specific fluorescent tags on the mobility of the fragments durio-z clctirophoresis and a possible overlap in the spectral bandwidth of the s four specific dyes reducing the discriminating power between neighboring bands, hence.

increasing the probability of sequence ambiguities. Artifacts are also produced by basespeciftc interactions with the polvacrylarnide gel matrix (Frank and K6stcr. Nucleik AcisRes 2069 (1979); and by the formation of secondary structures which result in "band compressions" and hence do not allow one to read the sequence. This problem has.

to in part. been overcame by using 7-dcazadroxyguanosine triphosphates (Barr et aL .e ioihniq=~ 4. 428 (1986)). However, the reasons for some artifacts and conspicuous bands are still under investigation and need further improvement of the gel elcetrophoretic procedure.

recent innovation in elecr~rophoresis s capillar zone eleetrophoresis (CZE) (IJ.orgenson et aL..LChromnalogmnhy _12 337 (1986); Gesteland ci a21..

hLUde:c, Acid- Res5 1j. 1415-1419 (1990)) which. compared to slab gel electrophoresis jPAGE). significantly increases the ;esolution of the separation. reduces the time for an **~*electrophoretic run and allows the analysis of very small samples. Here, however. other problems arise due to Lhc miniaturization of the whole system such as wall effects and the necessity of highly sensitive on-line detection methods. Compared to PAGE. an,'ther drawback !s created by the fact that CZE is only a "one-lane" process. whereas in PACE sam ples in multiple lanes can be electrophoresed simu~ltaneously.

Due tothe severe limitations and problems related to having PAGE as an *e..intecra! and ce-utral part in the standard DNA sequencing protc-1'. several methods have 2s been prop'osed 1- do DNA sequencing withoui an electrophorctic step. One approach calls for hvbridizatij)n or fragmentation sequencing (Bains. llia1.zbnojaZny IQ. 757-58 (1992) and Mlirzabckev et EEB.SI is2.5i. H 18-122 (1989)) utilizing the specific h-;brdization oi knownm short oligonucleotides o ctadeoxynucleotildes which ives 65.536 different sequernces) to a complementary DNA sequence. Positive hybridization reveals z short stretch of the unknowna sequence. Repeating this process by performing hybridizations with all possible ociadeom.'.nucleotides should theoretically determine the sequence. In a completely different approach. rapid sequencing of DNA is done by unilatera!ly derrading one single. immobilized DNA fragment by an exonuclease in a mo-.inz flow stream and detecting the cleaved oucleotides by their specific fluorescent tag, via laser excitation (Jett et a, J. Biomolcujar Structure Dnamic~ I. 301-309.-11989): United States Department of Energy. PCT Application No. WO 89/,03432)- In anothersystem proposed by Hyinan (AilBiochem. 124. 423-436 (1988)). the pyrophosphatc generated when the correct nucleotide is attached to the growing chain on a primertemplate system is used to determine the DNA sequence. The enzymes used and the DN A *S.as

S

S

*S a are held in place by solid phases (DEAE-Sepharose and Sepharose) either by ionic interactions or by covalent attachment. In a continuous flow-through system. the amount ofpyrophosphate is determined via bioluminescence (luciferase). A synthesis approach to DNA sequencing is also used by Tsicn er al. (PCT Application No. WO 91/06678). Here.

the incoming dNTP's are protected at the 3-end by various blocking groups such as acetyl or phosphate groups and are removed before the next elongation step. which makes this process very slow compared to standard sequencing methods. The template DNA is immobilized on a polymer support. To detect incorporation, a fluorescent or radioactive label is additionally incorporated into the modified dNTP's. The same patent applicatior 10 also describes an apparatus designed to automate the process.

Mass spectrometry, in general, provides a means of "weighing" individual molecules by ionizing the molecules in vacuo and making them "fly" by volatilization.

Under the influence of combinations of electric and magnetic fields, the ions follow traj=c:ories depending on their individual mass and charge In the range of molecules with low molecular weight, mass spectrometry has long been pan of the routine physical-organic repertoire for analysis and charact:rization of organic molecules by the determination of the mass of the parent molecular ion. In addition. by arranging collisions of this parent molecular ion with other particles argon atoms). the molecular ion is fragmented forming secondary ions by the so-called collision induced dissociation (CID).

20 The fragmentation patternpathway very often allows the derivatiun of detailed structural information. Many applications of mass spectrometric methods in the known in the art.

particularly in biosciences. and can be found summarized in Methods in Enzvmoloev.

Vol. 193: "Mass Spectrzar:ry" McCloskey. editor). 1990. Academic Press. New York Due to the apparent analytical advantages of mass spectrometry in providing high detection sensitivity, accuracy of mass measurements, detailed structural information by CID in conjunction with an MS/MS configuration and speed. as well as on-line data transfer to a computer, there has been considerable interest in the use of mass spectrometry for the structural analysis of nucleic acids. Recent reviews summarizing this field include K. H. Schram. "Mass Spectrometry of Nucleic Acid Components. Biomedical Applications of Mass Spcctrometry" 3. 203-287 (1990); and P.F. Crain. "Mass Spectrometric Techniques in Nucleic Acid Research." Mass Spectrometry Reviews 2. 505- 554 (1990). The biggest hurdle to applying mass spectrometry to nucleic acids is the difficulty of volatilizing these very polar biopolymers. Therefore. "sequencing" has been limited to low molecular weight synthetic oligonucleotides by determining the mass of the parent molecular ion and through this. confirming the already known sequence, or alternatively. confirming the known sequence through the generation of secondary ions (fragment ions) via CID in an MS/MS configuration utilizing, in particular, for the ionization and volatilization, the method of fast atomic bombardment (FAB mass -7.

spectrometry) or plasma desorption (P D mass spectrometryv. As an example, the application of FAB to the analysis of protected dimenic blocks for chemical synthesis or oligodeoxynucleotides has been described (KUster ef at Biomedical Env' omental Mass 111-116 (1987)).

s Two more recent ionization/desorption tchnuiques are electrospraytionspray (ES) and matrix-assisted laser desorption/ionization (IMAILDI). ES mass spectrcmetry has been introduced by Fenn et at hys- hem. 4451-59 (1984), PCT Application No.

WO 90/14148) and current applications are summarized in recent review articles (R.D.

Smith er at. Anal.LChem. 62. 882-89 (1990) and B. Ardrey. Ekectrospray Mass o Spectrometry. Snectrascopy Europt. 4. 10-18 (1992)). The molecular weights of the tetradecanucleotide d(CATr(ICCA rGGCATG) (SEQ I D N0:1) (Covey el all "The Determination of Protein, Oligonucleotide and Peptide llcular We-ights by lonspraN Mass Spectromctry." Rapid Communications in Mass Sneerrometry. 249-256 (1988)1.

of the 21-mer d(.4ATTGTGC,%CATCCTGCAGC) (SEQ ID NO:2) and without giving details of that of a RNA with 76 nucleotides (MLyethds in Enzymolonx. I2K. ",Mass Spectrometry- (McCloskey. editor), p. 42 i. 1990. Academic Press. New York) have been published. As a mass analyzer. a quadrupole is most frequently used. The determination of molecular weights in femtiomole amounts of sarrple is very accura-c due to the presencc of multiple ion peaks which all could be used for the mass calculation.

0 MALDI mass Npectrornciry. in contrast, can be pariicularly attractive when a atime-of-Ifight (TOF) configuration is used as a mass analyzer. The MIALDI-TOT mass spectrometry has been introduced bv Hillenkarnp eia!. (-Ntatrix Assisted UV-Laiser aDesorptioalonization: A N,.ew Approach to M&ass Spectrometry of Large Biumolcculcs." a: RBioloical Mass Spectrometp~(Burlingame and McCloskey. editors). Elsevier Science Publishers. Amsterdam, pp. 49-60. 1990.) Since, in most eases, no multiple molecular ion peaks are produced %kith this technique. the mass spectra. in principle, look simpler compared to ES mass spectrometry. Although DNA molecules up to a molecular weight of7410.000 daltoris could be dcsorbed and volatilized (Williams el at.. Woaiiainof High Molecular Weight DNA by Pulsed Lascf Ablation of Frozen Aqueous Solutions.'* Scene 2416. 1585-87 (1989)). this techniqu, has so far only been used to determine the molecular weights of relatively smail ofigoriuclcotides of known sequence. e.g..

oligothytnidylic acids up to 18 nucleutides (Huth-Fehre ei al.M*%atrix-Assisted Laser Desorption Mass Spectrometry of Oligodeoxythymidylic Acids." Rapid Communications in -Mass Sectrometn'. 209-13 (1992)) and a double-stranded DNA of 28 base pairs (Williams et Tme-of-Flight Mvass Spectrometry of Nucleic Acids by Laser Ablation and Ionization from a Frojzen Aqueous Matr-i\." R"~i Commumication-jr inass SncrOMeN 4. 348-351 (1990)), in one publication (I luth- Fehre e al.. 1992 supra). it was show,,n that a mixture of all the olieothvmidvlie acids from n=I2 to n=I8 nucleotides could be resolved.

S

S

*5

S

In U.S. Patent No. 5.064.754. RNA transcripts extended by DNA both of which are complementary to the DNA to be sequenced are prepared by incorporating NTP's, dNTPs and, as terminating nucleotides, ddNTP's which are substituted at the position of the sugar moiety with one or a combination of the isotopes 12 C, 13 C, 14C. IH.

2H, 3 H, 160, 170 and 180. The polynucleotides obtained are degraded to 3'-nucleotides, cleaved at the N-gtycosidic linkage and the isctopically labeled 5'-functionality removed by periodate oxidation and the resulting formaldehyde species determined by mass spectrometry. A specific combination of isotopes serves to discriminate base-specifically between internal nucleotides originating from the incorporation of NTP's and dNTP's and to terminal nucleotides caused by linking ddNTP's to the end of the polvnucleotide chain: A series of RNA/DNA fragments is produced, and in one embodiment, separated by electrophoresis. and, with the aid of the so-called matrix method of analysis, the sequence is deduced.

In Japanese Patent No. 59-131909. an instrument is described which detects nucleic acid fragments separated either by electrophoresis, liquid chromatography or high speed gel filtration- Mass spectrometric detection is achieved by incorporating into the nucleic acids atoms which normally do not occur in DNA such as S. Br. I or Ag. Au. Pt.

Os, Hg. The method, however, is not applied to sequencing of DNA using the Sanger method- In particular, it does not propose a base-specific correlation of such elements to an individual ddNTP.

PCT Application No. WO 89/12694 (Brennan et at. Proc SPIE-Int. Soc.

02. Enc. 1206. (New Technol. Cvtom. Mol. Biol.) pp. 60-77 (1990): and Brennan. U.S.

Patent No. 5,003.059) employs the Sanger methodology for DNA sequencing by using a combination of either the four stable isotopes 3 2 S, 3 3 S. 34S. 36S or 35CI. 3 7 C1. 7 9 Br.

8 1 Br to specifically label the chain-terminating ddNTP's. The sulfur isotopes can be located either in the base or at the alpha-position of the triphosphate moiety whereas the halogen isotopes are located either at the base or at the 3-position of the sugar ring. The sequencing reaction mixtures are separated by an electrophoretic technique such as CZE.

transferred to a combustion unit in which the sulfur isotopes of the incorporated ddNTP's are transformed at about 900 0 C in an oxygen atmosphere. The SO 2 generated with masses f 64. 65. 66 or 68 is determined on-line by mass spectrometry using. as mass analyzer. a quadrupoie with a single ion-multiplier to detect the ion current.

A similar approach is proposed in U.S. Patent No. 5.002.868 (Jacobson et at., EornS't-ln. Soc Opt Eng. 1435. (Opt Methods Ultrscn-siive Detect. Anal. Tech.

APL). 26-35 (1991)) using Sanger sequencing with four ddNTP's specifically substituted at the alpha-position of the triphosphate moiety with one of the four stable sulfur isotopes as described above and subsequent separation of the Four sets of nested sequences by tube gel electrophoresis. The only difTerence is the use of resonance ionization spectroscopy (RIS) in conjunction with a magnetic sector mass analyzer as disclosed in U.S. Patent No.

4A442.S54 to detect thle sulfur isotopes corresponding to the specific nucleotide termiators ,n hs allowing,_ the assiunment of the DNA equence- EPO Patent Application;3 No. 0160676 AlI and 0360677 Al also describe Sanger sequncig uingstale sotpe substitutions in the ddNrPs s;uch as D_ 13C

O

0, ISO S. S. S. S.llF3. "Br. "'Br and 2 71 or tinctional groups such as CF, or Si(CH 3 at thle base- the suigar or thle alpha position of the triphosphate mioiety accordingL seg.to chemical tiinctionality. The Sanger sequencing reaction mitxtures are separated by tube gel electrophoresis. The effluent is converted into an aerosol by the electrospray/'thernosprly nebulizer miethod and then atomized anld ionized byra hlot to plasma (7000 to 80000K) and analyzed by a simple mass analyzer- An instrument is proposed which enables one to automate the analysiss of the Sanger sequencing reaction mixture consisting of tube electrophoresis. a nebulizer and a mass analyzer.

The appl ication of imass spectrornetry to perfo rm DNA sequenc i ng by the h~lvbridization~fragnient method (see above) has been recently sugmested (Bains. ~N Sequencing by M,,ass Spectrometry: Outline of a Potential Futuire Application." Chimicaoa~!i 9. 13-16 (1991)).

According to a first aspect the present invention consists in a set of mass-modified nucleic acid primers selected from a group consisting of a collection of miass-miodified universal primers for prming! DNA synthesis. and a collection of mass-modified initiator oligonrucleotides for initiating transcriptional RNA synthesis.- According to a second aspect the present invention consists in a set of mlassmodified nucleotides selected from the group consisting ofmass-modifted 2'deoxvnucleoside triphosphates suitable for DNA synthesis- mass-modified dideoxynucleoside triphosphiates suitable for chain-terminating- DINA synthesis, massmodi fied nucleoside triphosphates stiitable for RNA synthesis and mass-modified 3'deoxvnucleoside triphosphiates suitable for chain-te-rminating RNA synrthesis.

According to a third aspect the present invention consists in an ionized massmodified nucleic acid molecule. comprising at least one mass modified nucleotide from the group consisting of a mass-modified 2'-deoxvnucluoside triphosphate, a mass 9a modified 2'.3'-dideo.y-nucleoside triphosphate. a mass-modified nucleoside triphosphate and a mass-modified 3-dcoxynucieoside triphosphate.

According to a fourth aspect the present invention consists in a set of massdifferentiated tag probes wherein, each tag probe in the set comprises a sequence of nucleotides which is complementary by Watson-Crick base pairing to a tag sequence present within at least one set of base-specifically terminated fragments: the tag sequences to which each tag probe is complementary are different for each tag probe: 10 each tag probe in the set comprises at least one mass-modified nucleotide; and the triass-modified nucleotides are not isotopically labeled and have different massmodifications in each tag probe.

According to a fifth aspect the present invention consists in an ionized massmodified nucleic acid molecule comprising two or more mass modified nucleotides 15 selected from the group consisting of a mass-modified 2'-deoxynucleoside triphosphate, a mass-modified 2',3'-dideoxynucleoside triphosphate, a mass-modified nucleoside triphosphate and a mass-modified 3 -deoxynucieoside triphosphate.

According to a sixth aspect the present invention consists in an ionized duplex comprising a mass-modified tag probe bound to a tag sequence present within a basespecifically terminated nucleic acid fragment, wherein the mass-modified tag probe comprises at least one mass-modified nucleotide- Unless the context requires otherwise, throughout the specification, and the claims which follow, the words "comprise", and the like, are to be construed in an inclusive sense, that is as "including, but not limited to".

Brief Description of the Figures FIGURE 1 is a representation of a process to generate the samples to be analyzed by mass spectrometry. This process entails insertion of a DNA fragment of unknown sequence into a cloning vector such as derivatives of M 13, pUC or phagemids; transforming the double-stranded form into the single-stranded form; performing the four Sanger sequencing reactions; linking the base-specifically terminated nested fragment family temporarily to a solid support; removing by a washing step all byproducts; *0 *C 4 01 Al 0 £0.

conditioning the nested DNA or RNA fragments by. for example. cition-ion exchange or modification reagent and presenting the immobilized nested fragments either directly to mass spectrometric analysis or cleaving the purified fragment family ofTthe support and evaporating the cleavage reagent.

FIGURE 2A shows the Sanger sequencing products using ddTTP as terminating deoxynucleoside triphosphate of a hypothetical DNA fragment of nucleotides (SEQ ID NO:3) in length wi;h approximately equally balanced base composition. Thz molecular masses of the various chain terminated fragments are given.

FIGURE 2B shows an idealized mass spectrum of such a DNA fragment mixture.

FIGURES 3A and 3B show. in analogy to FIGURES 2A and 2B. data for the same model sequence (SEQ ID NO:3) with ddATP as chain terminator.

FIGURES 4A and 4B show data. analogous to FIGURES 2A and 2B when ddGTP is used as a chain terminator for the same model sequence (SEQ ID NO:3).

FIGURES 5A and 5B illustrate the results obtained where chain termination is performed with ddCTP as a chain terminator, in a similar way as shown in FIGURES 2A and 2B for the same model sequence (SEQ ID NO:3).

FIGURE 6 summarizes the results of FIGURES 2A to 5B. showing the correlation of molecular weights of the nested four fragment families to the DNA 20 sequei.:e (SEQ ID NO:3).

FIGURES 7A and 7B illustrate the general structure of mass-modified sequencing nucleic acid primers or tag sequencing probes for either Sanger DNA or Sanger RNA sequencing.

FIGURES 8A and 8B show the general structure for the mass-modified triphosphates for either Sanger DNA or Sanger RNA sequencing. General formulas of the chain-elongating and the chain-terminating nucleoside triphosphates are demonstrated.

FIGURE 9 outlines various linking chemistries with either polyethylene glycol or terminally monoalkylated polyethylene glycol as an example.

FIGURE 10 illustrates similar linking chemistries as shown in FIGURES 8A and 88B and depicts various mass modifying moieties FIGURE I I outlines how multiplex mass spectrometric sequencing can work using the mass-modified nucleic acid primer (UP).

FIGURE 12 shows the process of multiplex mass spectrometric sequencing employing mass-modified chain-elongating and/or terminating nucleoside triphosphates.

FIGURE 13 shows multiplex mass spectrometric sequencing by involving the hybridization ofmass-modilied tag sequence specific probes.

FIGURE 14 shows a MALDI-TOF spectrum of a mixture ofoligothymidylic acids. d(pT) 12-18.

FIGURE 15 shows a superposition of MALDI-TOF spectra of the -11d(TAACGGTCATTACGGCCATTGACTGTAGGACCTGCATTACATGACTAGCT)

(SEQ

ID NO:3) (500 fmol) and dT(pdT) 99 (500 fmol).

FIGURES 16A-16M show the MALDI-TOF spcctra of all 13 DNA sequences representing the nested dT-terminated fragments of the Sanger DNA sequencing simulation of Figure 2. 500 fmol each. as follows: 16A is a 7-mer: 16B isa 10-mer: 16C isa 1 I-mer; 16D is a 19-mer: 16E is a 20-mer: 16F is a 24-mer: 16G is a 26-mer; 16H is a 33-mer: 161 is a 37-mer: 16J is a 38-mer: 16K is a 42-mer; 16L is a 46-mer and 16M is a FIGURES 17A and 17B show the superposition of the spectra of FIGURE 16.

The two panels show two different scales and the spectra analyzed at that scale. Figure 17A shows the superposition of the spectra of 16A-16F. The letter above each peak corresponds to the original spectra of the fragment in FIGURE 16. For example, peak B corresponds to FIGURE 16B: peak C corresponds to FIGURE 16C, etc.

FIGURE 18 shows the superimposed MALDI-TOF spectra from MALDI-MS analysis of mass-modified oligonucleotides as described in Example 21.

15 FIGURE 19 illustrates various linking chemistries between the solid support and the nucleic acid primer (NA) through a strong electrostatic interaction.

FIGURES 20A and 20B illustrate various linking chemistries between the solid support and the nucleic acid primer (NA) through a charge transfer complex of a charge transfer acceptor and a charge transfer donor FIGURE 21 illustrates various linking chemistries between the solid support and the nucleic acid primer (NA) through a stableorganic radical.

FIGURE 22 illustrates a possible linking chemistry between the solid support and the nucleic acid primer (NA) through Watson-Crick base pairing.

FIGURE 23 illustrates linking the solid support and the nucleic acid S 25 primer (NA) through a photolytically cleavable bond.

Detailed Description of the Invention This invention describes an improved method of sequencing DNA. In particular. this invention employs mass spcctrometry -such as matrix-assisted laser desorptioniionization (MALDI) or electrospray (ES) mass spectrometry to analyze the Saneer sequencing reaction mixtures.

In Sanger sequencing. four families of chain-terminated fragments are obtained. The mass difference per nucleotide addition is 289.19 for dpC. 313.21 for dpA.

329.21 for dpG and 304.2 for dpT. respectively.

In one embodiment. through the separate determination of the molecular weights of the four base-specifically terminated fragment families, the DNA sequence can be assigned via superpcsition interpolation) of the molecular weight peaks of the four individual experiments. In another embodiment, the molecular weights of the four specifically terminated fragment families can be determined simultaneously by MS. either 11.1 by mixing the products of all four reactions run in at least two separate reactiou. vessels a] I run separately, or two together. or three togethe) or by runining one reaction having all four chain-termninating rucleotides a reactiorn mixture comprising d1TP.

ddTTP. dATP. ddATP. dCTP. ddCTP, dGTP. ddGTP) in one reaction vessel. By simultaneously analyzing all four base-specifically terminated reaction products, the S a

S..

asasa a.

molecular weight values have been, in effect, interpolated. Comparison of the mass difference measured between fragments with the known masses of each chain-terminating nucleotide allows the assignment of sequence to be carried out. In some instances, it may be desirable to mass modify, as discussed below, the :hain-terminating nucleoides so as to expand the difference in molecular weight between each nucleotide. It will be apparent to those skilled in the art when mass-modification of the chain-terminating nucleotidcs is desirable and can depend, for instance, on the resolving ability of the particular spectrometer employed. By way of example, it may be desirable to produce four chainterminating nucleotides, ddTTP, ddCTPI, daATP 2 and ddGTP 3 where ddCTP 1 ddATP 2 to and ddGTP 3 have each been mass-modified so as to have molecular weights resolvable from one another by the particular spectrometer being used.

The terms chain-elongating nucleotides and chain-terminating nucleotides are well knowr in the art. For DNA. chain-elongating nucleotides include 2'-deoxyribonucleotides and chain-erriiinating nucleotides include 15 3'-dideoxyribonucleotides. For RNA, chain-elongating nucleotides inc!ude ribonucelotides and chain-terminating nucleotides include 3'-deoxyribonucleotides. The term nucleotide is also well known in the an. For the purposes of 'his invention.

nucleotides include nucleoside mono-, di-. and triphosphates. Nucleotides also include modified nucleotides such as phosphorothioate nucleotides.

20 Since mass spectrometry is a serial method. in contrast to currently used slab gel electrophoresis which allows several samples to be processed in parallel, in another embodiment of this invention, a further improvement can be achieved by multiplex mass spectrometric DNA sequencing to allow simultaneous sequencing of more than one DNA or RNA fragment. As described in more detail below, the range ofabout 300 mass units between one nucleotide addition can be utilized by employing either massmodified nucleic acid sequencing primers or chain-elongating and/or terminating nxucleoside triphosphates so as to shift the molecular weight of the base-specifically terminated fragments of a particular DNA or RNA species being sequenced in a predetermined manner. For the first time. several sequencing reactions can be mass spectrometrically analyzed in parallel. In yet another embodiment of this invention.

multiplex mass spectrometric DNA sequencing can be performed by mass modifying the fragment families through specific oligonucleotides (tag probes) which hybridize to specific tag sequences within each of the fragment families. In another embodiment, the tag probe can be covalently attached to the individual and specific tag s-quence prior to mass spectrometry.

In one embodiment )f the invention, the molecular weight values of at least two base-specifically terminated fragments are determined concurrently using mass spectrometry. The molecular weight val:es of preferably at least five and more preferably at least ten base-specifically terminated fragments are determined by mass spectrometry.

Also included in the invention are determinations of the molecular weight values of at least base-specifically terminated fragments and at least 30 base-specifically terminated fragments. Further, the nested base-specifically terminated fragments in a specific set can be purified of all reactarts and by-products but are not separated from one another. The entire set of nested base-specifically terminated fragments is analyzed concurrently and the molecular weight values are determined. At least two base-specifically terminated fragments are analyzed concurrently by mass spectrometry when the fragments are contained in the same sample.

In general, the overall mass spectrometric DNA sequencing process will start to with a library of small genomic fragments obtained after first randomly or specifically cutting the genomic DNA into large pieces which then, in several subcloning steps. are reduced in size and inserted into vectors like derivatives of Ml3 or pUC M 3mpl8 or Ml3mpl9) (see FIGURE In a different approach, the fragments inserted in vectors.

such as MI3, are obtained via subcloning starting with a cDNA library. In vet another approach. the DNA fragments to be sequenced are generated by the polymerase chain reaction Higuchi e al.. "A General Method of in vitro Preparation and Mutagenesis of DNA Fragments: Study of Protein and DNA Interactions." Nucleic Acids Rs.. 16.

7351-67 (1988)). As is known in the art. Sanger sequencing can start from one nucleic acid primer (UP) binding to the plus-strand or from another nucleic acid primer binding to the opposite minus-strand. Thus, either the complementary sequence of both strands of a given unknown DNA sequence can be obtained (providing for reduction of ambiguity in the sequence determination) or the length of the sequence information obtainable from one clone can be extended by generating sequence information from both ends of the unknown vector-inserted DNA fragment.

Tne nucleic acid primer carries, preferentially at the 5'-end. a linking functionality. L, which can include a spacer of sufficient length and which can ;nteract with a suitable functionality. on a solid support to form a reversible linkage such as a photoclevable bond. Since each of the four Sanger sequencing families starts with a nucleic aciu primer (L-UP; FIGURE 1) this fragment family can be bound tc the solid 33 support by reacting with functional groups. on the surface of a solid suppon and then intensively washed to remove all buffer salts. triphosphates, enzymes, reaction byproducts, etc. Furthermore, for mass spectrometric analysis, it can be of irportance at this stage to exchange the cation at the phosphate bacl.'one of the DN.\ fragments in order to eliminate peak broadening due to a heterogeneity in the cations bound per nuclcotide unit.

Since the L-L' linkage is only of a temporary nature with the purpose to capture the nested Sanger DNA or RNA fragments to properly cond.tion.them for mass spectrometric analysis. there are different chemistries which can serve this purpose. In addition to the examples given in which the nested fragments are coupled covalently to the solid support.

washed. and cleaved off the support for mass spectrometric analysis. the temporary -14linkage can be such that it is cleaved under the conditions of mass spectrometry. a photocleavable bond such as a charge transfer complex or a stable organic radical.

Furthermore. the linkage can be formed with L' being a quaternary ammonium group (some examples are given in FIGURE 19). In this case. preferably. the surface of the .olid support carries negative charges which repel the negatively charged nucleic acid backbone and thus facilitates desorption. Desorption will take p.ace either by the heat created by the laser pulse andior. depending on by specific absorption of laser energy which is in resonance with the L' chromophore (see. examples given in FIGURE 19). The functionalities. L and can also form a charge transfer complex and thereby form the temporary L-L' linkage. Various examples for appropriate functionalities with either acceptor or donator properties are depicted without limitation in FIGURES 20A and Since in manv cases the "charge-transfer band" can be determined by UV/vis spectrometry (see e.g. Organic Charge Transfer Comnelexes by R. Foster. Academic Press. 1969). the laser enercv can be tuned to the corresponding energy of the charge-transfer wavelk.ngth S. 15 and. thus. a specific desorption off the solid support can be initiated. Those skilled in the art willrecognize that several combinations can serve this purpuse and that the donor see functionality can he either on the solid support or coupled to the nested Sanger DNAIRNA ragments or vice versa.

In vet another approach. the temporary linkage L-L' can be generated by 20 homolyvically forming relatively stable radicals as exemplified in FIGURE 21. In example 4 of FIGURE 21. a combinatio; of the approaches using charge-transfer complexes and stable oreanic radicals is shown. Here. the nested Sanger DNA/RNA fragments are captured via the Stbrmation of a charge transfer complex. Under the influence of the laser pulse. desorption (as discussed anove) as well as ionization will take place at the radical position. In the other S 25 examples of FIGURE 21 under the influence of the laser pulse, the L-L linkage will be cleaved and the nested Sanger DNA/RNA fragments desorbed and subsequently ionized at the radical position formed. Those skilled in the art will recognize that other organic radicals can be selected and that. in relation to the dissociation energies needed to homolvtically cleave the bond between them. a corresponding laser wavelength can be selected (see e.g.

Reactive Molecules by C. WVcntrup. John Wiley Sons. 1984). In yet another approach. the nrsted Sancer DNAIRNA fragments are captured via Watson-Crick base pairing to a solid support-bound oliuonucleotide complementary to either the sequence of the nucleic acid primer or the tag oligonucleotide sequence (see FIGURE 22). The duplex formed will be cesaved under the influence ol-the laser pulse and desorption can be initiated. The solid support-bound base sequence can be presented through natural oligoribo- or Oliuodeoxvribonucleotide as well as analogs thio-modified phosphodiester or phosphotriester backbone) or employing oligonucleotide mimetics such as PNA analogs (see c.g. Nielsen er ul.. Scienc 54.147 (1991)) which render the base sequence less susceptible to enzymatic degradation and hence increases overall stability of the solid support-bound capture base sequence. With appropriate bonds. a cleavage can be obtained directly with a laser tuned to the energy necessary for bond cleavage. Thus, the immobilized nested Sanger fragments can be directly ablated during mass spectrometric analysis.

To increase mass spectrometric performance. it may be necessary to modify the phosphodiester backbone prior to MS analysis. This can be accomplished by. for example, using alpha-thio modified nucleotides for chain elongation and termination.

With alkylating agents such as akyliodides. iodoacetamide, P-iodoethanol. 2.3-epoxy-I propanol (see FIGURE 10). the monothio phosphodiester bonds of the nested Sanger o1 fragments are transformed into phosphotriester bonds. Multiplexing by mass modification in this case is obtained by mass-modifying the nucleic acid primer (UP) or.'.e nucleoside triphosphates a, the sugar or the base moiety. To those skilled in the an, other modifications of the nested Sanger fragments can be envisioned. In one embodiment of the invention, the linking chemistry allows one to cleave off the so-purified nested DNA 15 enzymatically. chemically or physically. By way of example, the L-L' chemistry can be of a type of disulfide bond (chemically cleavable, for example, by mercaptoethanol or dithioerythrol) a biotin/streptavidin system, a heterobifunctional derivative of a trityl ether group (Koster et a. "A Versatile Acid-Labile Linker for Modification of Synmhetic Biomolecules," Terahedron Letters 1. 7095 (1990)) which can be cleaved under mildly 20 acidic conditions, a levulinyl group cleavable under almost neutral conditions with a hydrazinium/acetate buffer, an arginine-arginine or lysine-lysine bond cleavable by an endopeptidase enzyme like trypsin or a pyrophosphate bond cleavable by a Spyrophosphatase, a photocleavable bond which can be, for example, physically cleaved and the like (see, FIGURE 23). Optionally, another cation exchange can be performed prior to mass spectrometric analysis. In the instance that an enzyme-cleavable bond is utilized to immobilize the nested fragments, the enzyme used to cleave the bond can serve as an internal mass standard during MS analysis.

The purification process andlor ion exchange process can be carried out by a number of other methods instead of. or in conjunction with, immobilization on a solid support. For example, the base-specifically terminated products can be separated from the reactants by dialysis, filtration (including ultrafiltration). and chromatography. Likewise.

these techniques can be used to exchange the cation of the phosphate backbone with a counter-ion which reduces peak broadening.

The base-specifically terminated fragment families can be generated by standard Sanger sequencing using the Large Klenow fragment of E. coli DNA polymerase 1, by Sequenase, Taq DNA polymerase and other DN polymerases suitable for this purpose, ihus generating nested DNA fragments for the mass spectrom-tric analysis. It is.

however, part of this invention that base-specifically terminated RNA transcripts of the DNA fragments to be sequenced can also be utilized for mass spectrometric sequence determination. In this case. various RNA polymerases such as the SP6 or the T7 RNA polymernse can be used on appropriate vectors containing, for example, the SP6 or the T7 promoters Axelrod et al. "Transcription from Bacteriophage T7 and SP6 RNA Polymerase Promoters in the Presence of 3'-Deoxyribonucleoside 5'-triphosphate Chain Terminators." Biachemistry 24. 5716-23 (1985)). In this case, the unknown DNA sequence fragments are inserted downstream from such promoters. Transcription can also be initiated by a nucle;_ acid primer (Pitulle et al.. "Initiator Oligonucleotides for the Combination of Chemical and Enzymatic RNA Synthesis," Gcne 112. 101-105 (1992)) which carries, as one embodiment of this invention, appropriate linking functionalities. L.

which allow the immobilization of the nested RNA fragments, as outlined above, prior to mass spectrometric analysis for purification and/or appropriate modification and/or S. conditioning.

Sor this immobilization process of the DNA/RNA sequencing products for mas spectrometric analysis. various solid supports can be used. beads (silica gel.

15 controlled pore glass, magnetic beads. Sephadex/Sephar- .e beads, cellulose beads. etc.).

capillaries, glass fiber filters, glass surfaces, metal surfaces or plastic material. Examples of useful plastic materials include membranes in filter or microtiter plate formats, the latter allowing the automation of the purification process by employing microtiter plates which.

as one embodiment of the invention, carry a permeable membrane in the bottom of the well functionalized with Membranes can be based on polyethylene, polypropylene.

polyvmide, polyvinylidenedifluoride and the like. Examples of suitable metal surfaces include steel, gold. silver, aluminum, and copper. After purification. cation exchange.

and/or modification of the phosphodiester backbone of the L-L' bound nested Sanger Sao&*: Sfragments, they can be cleaved off the solid support chemically, enzymatically or 25 physically. Also, the L-L' bound fragments can be cleaved from the support when they are subjected to mass spectrometric analysis by using appropriately chosen L-L' linkages and corresponding laser energies/intensities as described above and in FIGURES 19-23.

The highly purified, four base-specifically terminated DNA or RNA fragment families are then analyzed with regard to their fragment lengths via determination of their respective molecular weights by MALDI or ES mass spectrometry.

For ES, the samples, dissolved in water or in a volatile buffer, are injected either continuously or discontinuously into an atmospheric pressure ionization interface (API) and then mass analyzed by a quadrupole. With the aid of a computer program.. the molecular weight peaks are searched for the known molecular weight of the nucleic acid primer (UP) and determined which of the four chain-terminating nucleotides has been added to the UP. This represents the first nucleotide of the unknown sequence. Then. u'e second, the third, the nth extension product can be identified in a similar manner and. by this, the nucleotide sequence is assigned. The generation of multiple ion peaks which can be obtained using ES mass spectrome:rv can increase the accuracy of the mass 17determination.

In MALDi mass spectrometry. various mass analyzers can be used. e.g..

magnetic sectorlmagnetic deflection instruments in single or triple quadrupole mode (MS/MS). Fourier transform and time-of-flight (TOF) configuratiojis as is knowni in the art of mass spectrometry. FIGURES 2A through 6 are given as an example of the data obtainable when sequencing a hypothetical DNA fragment of 50 nucleotides in length (SEQ ID NO:3) and having a molecular weight of IS.344.02 daltons. The molecular weights calculated for the ddT (FIGURES 2A and 213). ddA (FIGURES 3A and 3B), ddG (FIGURES 4A and 413) and ddC (FIGURES 5A and 513) terminated products are given (corresponding to fragments of SEQ ID NO:3) and the idealized four MALDI-TOF mass spectra shown. All four spectra are superimposed. and from this. the DNA sequence can be generated. This is shown in the summarizing FIGURE 6. demonstrating how the molecularq~eights are correlated with the DNA seque nce. MALDT1-TOF spectra have been generated for the ddT termninated products (FIGURES 16A-16M) corresponding to 15 those shown in FIGURF 2 and these spectra have been superimposed (FIGURES I17A and I 7B). The correlation of calculated molecular weights of the ddT fragments and their *experimientally-verified weights arc shown in Table 1. Likewise. if all four chainterminating reactions are combined and then analyzed by mass spectrometry. the molecular weight difference between two adjacent peaks can be used to determine the 210 sequence. For the desorption/ionization process. numerous matrix/laser combinations can be used.

TABLE I 25 ~Correlation of calculated and experimentally veriekd molecular weights ofte1 N fragments of FIGURES 2_ and 16A-1 6M.

*:Fragment (n-mer) calculated mass experimental mass difference 7-mer 2104.45 2119.9 +15.4 1O-mer 3011.04 3026.1 1.

IlI-mer 3315.24 3330.! +14.9 19-mer _5771.32 5788.0 +16.2 6076.02 6093.8 -17.8 24-mer 7311.82 7374.9 -i63.1 26-mer 7945.22 7960.9 -15.7 33-mer l10112.63 10125.3 -12-7 37-mer 11348A43 11361.4 -1-3.0 38-mer 11I6_52.62 11670.2 -17.6 42-mer 12872.42 12888.3 -15.9 46-mcr 14108.22 14125.0 +16.8 15344.02 15362.6 i-18.6 -18- In order to increase throughput to a level neccssary for high volume genomic and cDNA sequencing projects. a further embodiment of the present invention is to utilize multiplex mass spectrometry to simultaneously determine more than one sequence. This can be achieved hb several, albeit different. methodologies, the basic principle being the mass modification of the nucleic acid primer the chain-elongating and/or terminating nucleoside triphosphates. or by using mass-differentiated tag probes hybridizable to specific tag sequences. The term "nucleic acid primer" as used herein encompasses primers for both DNA and RNA Sanger sequencing.

B\ way ofexample. FIGURE 7A presents a general formula of the nucleic acid primer (UP) and the tap probes The mass modifying moiety can be attached, for instance. to either the 5'-end of the oligonucleotide (M to the nucleobase (or bases)

MI

7 to the phosphate backbone and to the 2-position of the nucleoside (nucleosides) (1M 4

M

6 oriand to the terminal 3'-position Primer length can vary between 1 and 50 nucleotides in length. For the priming of DNA Sanger sequencing, the 15 primer is preferentially in the range ofabout 15 to 30 nucleotides in length. For artificially priming the transcription in a RNA polyvaerase-rr-diated Sanger sequencing reaction, the length of the primer is preferentially in the range of about 2 to 6 nucleotides.

If a tag probe (TP) is to hybridize to the integrated tag sequence of a family chainterminated fraLments. its preferential length is about 20 nucleotides.

S* 20 The table in FIGURE 7B depicts some examples of mass-modified primer!tag probe configurations for DNA. as well as RNA. Sanger sequencing. This list is. however. not meant to be limiting, since numerous other combinations of mass- S modifying functions and positions.within the oligonucleotide molecule are possible and are deemed part of the invention. The mass-modifying functionality can be. for example.

25 a hlogen. an azido. or of the type. XR. wherein X is a linking group and R is a massmodifying functionality. The mass-modifying functionality can thus be used to introduce defined mass increments into the oligonucleotide molecule.

In another embodiment, the r.ucleotides used for chain-elongation and/or termination are mass-modified. Examples of such modified nucleotides are shownt in FIGURE 8A and 8B. Here the mass-modifying moiety. M. can be attached either to the nucleobase- M 2 (in case of the c 7 -deazanucleosides also to C-7. M to the triphosphate group at the alpha phosphate. M 3 or to the '-position of the sugar ring of the nucleoside triphosphaie.

M

4 and M 6 Furthermore, the mass-modifying functionality can be added so as to affect chain termination, such as by attaching it to the 3'-positicn of the sugar ring in the nucleoside triphosphate. M 5 The list in FIGURE 8B represents examples of possible configurations for generating chain-tcrminating nucleoside triphosphates for RNA or DNA Sanger sequencing. For those skilled in the art. however, it is clear that many other combinations can serve the purpose of the invention equally well. In the same way. those skilled in the ar will recognize that chain-elongating nucleoside triphosphates can also be mass-modified .n a similar fashion with numerous variations and combinations in inctionality and attachment positions.

Without limiting the scope of the invention, FIGURE 9 gives a more detailed description of particular examples of how the mass-modification. M. can be introduced for s X in XR as well as using oligo-/polyethylene glycol derivatives for R. The massmodifying increment in ths case is 44. i.e. five different mass-modified species can be generated by just changing m from 0 to 4 thus adding mass units of 45 89 (m=l1).

133 177 and 221 to the nucleic acid primer die tag probe (TP) or the nucleoside tripticsphates respectively. The oligofpolvethylene glycols can also be monoalkylated by a lower alkyl such as methyl, ethyl, propyl. isopropyl, t-butyl and the like. A selection of linking functional ities. X are also illustrated. Other chemistries can be used in the mass-modified compounds, as for example. those described recently in Oionuclegfides and Analogues A Practical Approach. F. Eckstein. editor. IRI Press.

IS Oxford, 1991.

In yet another embodiment, various mass-modifying functianali ties. R, other than oligo.'polyethylene glycols. can be selected and attached via appropriate linking chemistries, X. Without any limitation, some examples are given in FIGURE 10. A simple mass-modification can be achieved by substituting H for halogens l ike F. Cl. Br and/or 1. or pseudohalogens such as SCN, NCS. or by using different alkyl. aryl or aralkyl 20 moieties such as methyl, ethyl, propyl. isopropy!, t-butyl. hexyl. phenyl, substituted **phenyl. benzy;, or fiunctional groups such as CH-)F. CI4F-. CF 3 Si(CH 3 3 SK SiC 3 Si(CH 3 )(C2H 5 Si(C-,H 5 3 Yet another mass-modification can be obtained by attaching homo- or heteropeptides through X to the UP. TP or nucleoside triphosphates. One example useful in generating mass-modified species with a mass 25 increment of 57 is the attachment of oligoglycins e ms-odifications of 74 131 188 245 m=4) are achieved. Simple oligoamides also can be used, mass-modifications of 74 8 8 102 116 (r= 4 m0O). etc. are obtainable. For those skilled in the ant, it wmill be obvious that there are numne-ous possibilities in addition to those given in FIGURE 10 and the above mentioned reference (Oligonucleotides and Analoucs F. Eckstein. 1991). for introducing, in a predetermined manner. many different mass-modifying functionalities to UP, TP and nucleoside triphosphates which are acceptable for DNA and RUNA Sanger sequencing- As used herein, the superscript 0-i designates 1 mass differentiated nucleotides. primers or tags. In some instances, the superscript 0 NITP 0

UP

0 can designate an unmodified species of a particular reactant, and the superscript I NTPi.

NTPI. NTp 2 etc.) can designate the i-th mass-modified species of that reactant. If. for example. more than one species of nucleic acids DNA clones) arc to be concurrently sequenced by multiplex DNA sequencing, then i I different mass-modified nucleic acid 20 primers (UPO. UP I UP~i can be used to distinguish each set of base-specifically terminated fi-acrents- wherein each speci-s of mass-modified UPi carn be distinguished by mass spectrometrv from the rest.

As illustrative embodiments of this invention, three different basic processes for multiplex mass spectrometric DNA sequencing empi- the described massmidified reat=ent are described below: A) Multiplexing by the use of mass-mndifi:d nucleic acid primers (UP) for Sanger DNA or RNA sequencing (see for example FIGURE I i): B) Multiplexing by the use of mass-mcdified nucleoside triphosphates as chain elongators andior chain terminators for Sanger DNA or RNA sequenzing (see for example FIGURE 12): and C) Multiplexing by the use of tan probes which specifically hvbiidize to tag sequences which are ir-aegrate-d into part of the four 13 Sanv-er DN.IRNA base-specifically terminated fragment families.

Mass modification here can be achieved as described for FIGURES 7A.

7B. 9 and 10. or Jlternately, by designing different oligonucleotide sequences having the same or different length with unmodified nueleotides wvhich, in a predetermined way, generate appropriately S* 20 differentiated molecular weights (see for example FIGURE 13).

The process of multiplexing bY mass-modified nucleic acid primers (UP) is illustrated by way oFexarnple in FIGURE I I for mass analyzing four different DNA clones siniultaneousiv. The irst reaction mixture is obtained by standard Sang~er DNA sequencing! having unknown DNA fragment I (clone I) integrated in an appropriate vector 3lmpl employing, an unmiodified nucleic acid primer UP 0 and a standard **mixture of the four unmodified deoxynucieoside triphosphates. dNTPO, and with 1110th of one of the fioutr dideox,,nucleoside triphosphates. ddNTPO. A second reaction mixture for DNA fragment 2 (clone 2) is obtained by employing a mass-modified nucleic acid primer UPI and, as before, the foaur unmodified nucleoside triphosphates. dNTPO.

containing in each separate Sanger reaction l/10th of the chain-terminating unmodified dideoxynucleoside triphosphates ddNTPO. In the other two, experiments. the four Sanger reactions have the following compositions: DNA fragment 3 (clone Up 2 dNTPO.

ddNTP 0 and DNA fragment 4 (clone UP 3 dNTPO. ddNTPQ_ For mass spectrometric DNA sequencing. all base-specifically terminated reactions of the four clones are pooled and mass analyzed. The various mass peaks belonging to the four dideoxy-terrninated ddT-terminated) fragment families are assigned to specifically elongat:!d and ddTterminated fragmnents by searching tsuch as by a computer program) for the known molecular ion peaks of UP 0 UI. UP 2 and UP 3 extended br either one of the four dideoxynucleoside triphosphates. UP 0 -ddNO. UPI-ddN 0 Up 2 -ddN 0 and UP3-ddNO. In

S.

St** N this way, the first nucleotides of the four unknown DNA sequences of clone I to 4 are determined. The process is repeated, having memorized the molecular masses of the four specific first extension products, until the four sequences are assigned. Unambiguous mass/sequence assignments are possible even in the worst case scenario in which the four mass-modified nucleic acid primers are extended by th- same dideoxynucleoside triphosphate. the extension products then being, for example. UPO-ddT, UP I-ddT. UP2ddT and UP 3 -ddT, which differ by the known mass increment differentiating the four nucleic acid primers. In another embodiment of this invention, an analogous technique is employed using different vector; containing. for example, the SP6 and/or T7 promoter o0 sequences, and performing transcription with the nucleic acid primers UP 0

UP

I

UP

2 and

UP

3 and either an RNA polymerase SP6 or T7 RNA polymerase) with chainelongating and terminating unmodified nucleoside triphosphates NTPO and 3'-dNTP 0 Here, the DNA sequence is being determined by Sanger RNA sequencing.

FIGURE 12 illustrates the process of multiplexing by mass-modified chain- 15 elongating or/and terminating nucleoside triphosphates in which three different DNA fragments (3 clones) are mass analyzed simultaneously. The first DNA Sanger sequencing reaction (DNA fragment 1. clone 1) is the standard mixture employing unmodified nucleic acid primer UPO, dNTP 0 and in each of the four reactions one of the four ddNTP 0 The second (DNA fragment 2, clone 2) and the third (DNA fragment 3. clone 3) have the following contents: UP 0 dNTP 0 ddNTP I and UP 0 dNTP 0 ddNTP 2 respectively. In a variation of'his process, an amplification of the mass increment in mass-modifying the extended DNA fragments can be achieved by either using an equally mass-modiF:d deoxynucleoside triphosphate dNTP dNTF 2 for chain elongation alone or in conjunction with the homologous equally mass-modified dideoxynucleoside triphosphate- For the three clones depicted above, the contents of the reaction mixtures can be as follows: either UPOldNTPOddNTP 0 UP0/dNTP l/ddNTPO and UP 0 /dNTP 2 !ddNTP 0 or

UP

0 /dNTP 0 /ddNTp 0

UP

0 /dNTpl ddNTP and UPO/dNTP 2 iddNTP 2 As described above. DNA sequencing can be performed by Sanger RNA sequencing employing unmodified nucleic acid primers, UP 0 and an appropnate mixture of chain-elongating and terminating nucleoside triphosphates. The mass-modification can be again either in the chain-tenninating nucleoside triphosphate a:one or in conjunction with mass-modified chain-elongating nucleoside triphosphates. Multiplexing is achieved by pooling the three base-specifically terminated sequencing reactions tle ddTTP terminated products) and simultaneously analyzing the pooled products by mass spectrometry. Again, the first extension products of the known nucleic acid primer sequence are assigned, via a computer program. Mass/sequence assignments are possible even in the worst case in which the nucleic acid primer is extended/terminated by the same nucleotide. ddT. in all three clones. The following configurations thus obtained can be well differentiated by their different mass-modifications: UPO-ddT 0 UPO-ddT 1 UPO-ddT 2 -22a.

a a.

*4 a. e

S.

In yet another embodiment of this invention. DNA sequencing by multiples mass spectrometry can be achieved by cloning the DNA fragments to be sequenced in "plex-vectors" containing vector specific "tag sequences" as described (Koster et al..

"Oligonucleotide Synthesis and Multiplex DNA Sequencing Using Chemiluminescent Detection." Nucleic Acids Res. Symposium Ser. No. 24. 318-321 (1991)): then pooling clones from different plex-vectors for DNA preparation and the four separate Sanger sequencing reactions using standard dNTP 0 /ddNTP 0 and nucleic acid primer UP 0 purifying the four multiplex fragment families via linking to a solid support through the linking group. L. at the 5'-end of UP: washing out all by-products, and cleaving the purified multiplex DNA fragments off the support or using the L-L' bound ncsted Sanger fragments as such for mass spectrometric analysis as described above: performing demultiplexing by one-by-one hybridization of specific "tag probes": and subsequently analyzing by mass spectrometry (see. for example. FIGURE 13). As a reference point. the four base-specifically terminated multiplex DNA fragment families are run by the mass spectrometer and all ddT 0 ddA 0 ddC

O

and ddG 0 -terminated molecular ion peaks are respectively detected and memorized. Assignment of. for example. ddT 0 -lerminated DNA fragments to a specific fragment family is accomplished by another mass spectrometric analysis after hybridization of the specific tag probe (TP) to the corresponding tag sequence contained in the sequence of this specific fragment family. Only those 20 molecular ion peaks which arc capable of hybridizing to the specific tag probe are shifted to a higher molecular mass by the same known mass increment of the tag probe).

These shifted ion peaks. by virtue ofall hybridizing to a specific tag probe. belong to the same fragmeni family. For a given fragment family. this is repeated for the remaining chain terminated fragment families with the same tag probe to assign the complete DNA sequence. This process is repeated i-1 times corresponding to i clones multiplexed (the i-th clone is identified by default).

The differentiation of the tag probes for the different multiplexed clones can be obtained just by the DNA sequence and its ability to Watson-Crick base pair to the tag sequence. It is well known in the art how to calculate stringency conditions to provide for specific hybridization ofa given tag probe with a given tag sequence (see, for example.

Molecular Clonin,- A nlanratorv manual 2ed. ed. by Sambrook. Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: NY. 1989. Chapter 11). Furthermore.

differe>l:ation can be obtained by designing the tag sequence for each plex-vector to have a sufficient mass difference so as to be unique just by changing the length or base composition or by mass-modifications according to FIGURES 7A. 7B. 9 and 10. In order to keep the duplex between the tag sequence and the tag probe intact during mass spectrometric analysis, it is another embodiment of the invention to provide for a covalent attachment mediated by. for example. photoreactive groups such as psoralen and ellipticine and by other methods known to those skilled in the art (see. for example.

-23 0* Cr Helene el uL Nature 34. 358 (1990) and Thuong e ul. "Oligonucl.otides Attached to Intcrcalators. Photoreactive and Cleavage Agents" in F. Eckstein. ClionucEiidej an Analogues: A Practical Approach. IRL Press. Oxford 1991.283-306).

The DNA sequence is unraveled again by searching for the lowest molecular weight molecular inn peak corresponding to the known UP 0 -tag sequence/lag probe molecular weight plus the first extension product. ddT 0 then the second, the third.

etc.

In a combination of the latter approach with the previously described multiplexing processes, a further increase in multiplexing c;,n be achieved by using, in addition to the tag probe/tag sequence interaction, mass-modified nucleic acid primers (FIGURES 7A and 7B) andior mass-modified deoxynucleoside. dNTPO i and/or dideoxynucleoside triphosphates. ddNTP 0 Those skilled in the art will realize that t'.e tag sequence/tag probe multiplexing approach is not limited to Sanger DNA sequencing generating nested DNA fragments with DNA polymerases. The DNA sequence can also be determined by transcribing ,he unknown DNA sequence from appropriate promotercontaining vectors (see above) with various RNA polymerases and mixtures of NTPO-i'dNTPO-i. thus generating nested RNA fragments.

in vet another embodiment of this invention, the mass-modifying functionality can be introduced by a two or multiple step process. In this case, the nucleic acid primer, the chain-elongating or terminating nucleoside triphsphates and/or the tag probes are. in a first step. modified by a precursor functionality such as azido. -N 3 or modified with a functional group in which the R in XR is H (FIGURES 7A. 7B. 9) thus providing temporary functions. but not limited to -OH. -NH 2 -NHR. -SH, -NCS.

-OCO(CH2)rCOOH (r 1-20). -NHCO(CH2)rCOOH (r 1-20). -OSO2OH, -OCO(CH2)rl (r 1-20). -OP(O-Alkyl)N(Alkyl)2. These less bulky functionalities result in better substrate properties for the enzymatic DNA or RNA synthesis reactions of the DNA sequencing process- The appropriate mass-modifying functionality is then introduced after the generation of-the nested base-specifically terminated DNA or RNA fragments prior to mass spectrometry. Several examples of compounds which can serve as mass-modifying functionalities are depicted in FIGURES 9 and 10 without limiting the scope of this invention.

Another aspect of this invention concerns kits for sequencing nucleic acids by mass spectrometry which include combinations of the above-described sequencing reactants. For instance. in one embodiment, the kit comprises reactants for multiplex mass spectrometric sequencing ofsevcral different species of nucleic acid. The kit can include a solid support having a linking functionality (L for immobilization of the basespecifically terminated products: at least one nucleic acid primer having a linking group for reversibly and temporarily linking the primer and solid support through, for example. a phoiocleavable bond: a set of chain-elongating nucleotides dATP. dCTP.

dGTP and dTTP. or ATP, CTP, GTP and UTP); a set ofchain-terminating nucleotides (such as 2',3'-dideoxynuc.otides for DNA synthesis or 3'-deoxynucleotides for RNA synthesis); and an appropriate polymerase for synthesizing complementary nucleotides.

Primers and/or terminating nucleotides can be mass-modified so that the base-specifically terminated fragments generated from one of the species of nucleic acids to be sequenced can be distinguished by mass spectrometry from all of the others. Alternative to the use of mass-modified synthesis reactants, a set of tag probes (as described above) can be included in the kit. The kit can also include appropriate buffers as well as instructions for performing multiplex mass spectrometry to concurrently sequence multiple species of nucleic acids.

In another embodiment, a nucleic acid sequencing kit can comprise a solid support as described above, a primer for initiating synthesis of complementary nucleic acid fragments, a set of chain-elongating nucleotides and an appropriate polymerase. The mass-modified chain-terminating nucleotides are selected so that the addition of one of the 15 chain terminators to a growing complementary nucleic acid can be distinguished by mass spectrometry.

EXAMPLE I Immobilization of primer-:.ension products ofSanger DNA sequencing reaction for mass spectrometric analysis via disulfide bonds.

As a solid support, Sequelon membranes (Millipore Corp., Bedford. MA) with phenyl isothiocyanate groups are used as a starting material. The membrane disks.

.I with a diameter of 8 mm, are wetted with a solution of N-methylmorpholinelwater/2propanol (NMM solution) (2/49/49 the excess liquid removed with filter paper and placed on a piece of plastic film or aluminum foil located on a heating block set to 550C.

A solution of 1 mM 2-mercaptoethylamine (cysteamine) or 2.2'-dithio-bis(ethylamine) (cystamine) or S-(2-thiopyridyl)-2-thio-ethylamine (10 ul, 10 nmol) in NMM is added per disk and heated at 550C. After 15 min. 10 ul of NMM solution are added per disk and heated for another 5 min. Excess of isothiocyanate groups may be removed by treatment with 10 ul of a 10 mM solution ofglycine in NMM solution. For cystamine, the disks are treated with 10 ul of a solution of 1M aqueous dithiothreitol (DTT)/2-propanol (1:1 v/v) for 15 min at room temperature. Then, the disks are thoroughly washed in a filtration manifold with 5 aliquots of I ml each of the NMM solution, then with 5 aliquots of I ml acetonitrilelwater (I1 v/v) and subsequently dried. If not used immediately the disks are stored with free thiol groups in a solution of I M aqueous dithiothreitol/2-propanol (1:1 v/v) and, before use, DTT is removed by three washings with I ml each of the NMM solution. The primer oligonucleotides with 5'-SH functionality can be prepared by various methods B.C.F Chu edl., Nucleic Acids Res 14. 5591-5603 (1986). Sproa; et al..

Nucleic Acids Res. ,15 4837-48 (1987) and Oligoucleotides and Analogues: A Practical Approaci(F. Eckstein. editor), IRL Press Oxford, 19?1). Sequencing reactions according to the Sanger protocol are performed in a standard way H. Swerdlow et Nucleic Acids Res. 18, 1415-19 (1990)). In the presence of about 7-10 mM DTT the free 5'-thiol primer can be used; in other cases, the SH functionality can be protected, by a trityl group during the Sanger sequencing reactions and removed prior to anchoring to the support in the following way. The four sequencing reactions (150 ul each in an Eppendorf tube) are terminated by a 10 min incubation at 70 0 C to denature the DNA polymerase (such as Klenow fragment, Sequer-se) and the reaction mixtures are ethanol precipitated.

10 The supematants are removed and the pellets vo.xed with 25 ul of an IM aqueous silver nitrate solution, and after one hour at room temperature, 50 ul of an I M aqueous solution of DTT is added and mixed by vortexing. After 15 min, the mixtures are centrifuged and the pellets are washed twice with 100 ul ethylacetate by vortex..,g and centrifugation to remove excess DTT. The primer extension products with free 5'-thiol group are now 15 coupled to the thiolated membrane supports under mild oxidizing conditions. In general.

it is sufficient to add the 5'-thiolated primer extension products dissolved in 10 ul 10 mM de-aerated triethylammonium acetate buffer (TEAA) pH 7.2 to the thiolated membrane supports. Coupling is achieved by drying the sampi-s onto the membrane disks with a cold fan. This process can be repeated by wetting the membrane with 10 ul of 10 mM TEAA buffer pH 7.2 and drying as before. When using the 2-thiopyridyl derivatized compounds, anchoring can be monitored by the release of pyridine-2-thione Sspectrophotometrically at 343 nm.

In another variation of this approach, the oligonucleotidc primer is functionalized with an amino group at the 5'-end which is introduced by standard S 25 procedures during automated DNA synthesis. After primer extension, during the Sanger sequencing process, the primary amino group is reacted with 3-(2-pyridyldithio) propionic acid N-hydroxysuccinimide ester. (SPDP) and subsequently coupled to the thiolated supports and monitored by the release ofpyridyl-2-thione as described above After denaturation of DNA polymerase and ethanol precipitation of the sequencing products, the supernatants are removed and the pellets dissolved in 10 ul 10 mM TEAA buffer pH 7.2 and 10 ul of a 2 mM solution of SPDP in 10 mM TEAA are added. The reaction mixture is vortexed and incubated for 30 min at 250C. Excess SPDP is then removed by three extractions (vortexing, centrifugation) with 50 ul each of ethanol and the resulting pellets are dissolved in 10 ul 10 mM TEAA buffer pH 7.2 and coupled to the thiolated supports (see above).

The primer-extension products are purified by washing the membrane disks three times each with 100 ul NMM solution and three times with 100 ul each of 10 mM TEAA buffer pH 7.2. The purified primer-extension products are released by three successive treatments with 10 ul of 10 mM 2-mercaptoethanol in 10 mM 1 EAA buffer pH 7.2, lyophilized and analyzed by either ES or MALDI mass spectrometry.

This procedure can also be used for the mass-modified nucicic acid primers in an analogous and appropriate way. taking into acctpir' T !he chemical properties of the mass-modifying flinctionalities.

Immobilization of primer-extension products of Sanger DNA sequencing reaction for 9::.mass spectrometric analysis via the levulinyl group 10 5-Aminolevulinic acid is protected at the primary amino group with the *..Fmoc group using 9-fluorenyltiethyl N-succinimidyl carbonate and is then transformed into the N-hydroxysuccinirnide ester (NI-S ester) using N-hydroxysuccinimide and dicyclohexyl'carbodiimide under standard conditions. For the Sanger sequencing ci:. reactions, nucleic acid primers, UPO 0 are used which are fanctionalized w6th a primary 1s amino group at the 5'-end introduced by standard procedures during automated DNA synthesis with amninolinker phosphoamidites as the fir.R1 synthetic step. Sanger sequencing is performed under standard conditions (see above). The four reaction mixtures (1S0 ul each in an Eppendorf tube) are heated to 70 0 C for 10 min to inactivate the DNA polymerase, ethanol precipitatcd. centrifuged and resuspended in 10 ul of 10 mM Goas: 20 TEAA buffer pH 7.2. 10 ul of a 2 n'.M solution of the Fmoc-5-aminolevulinyl-NiS ester in 10 mM TEAA buffer is added, vortexed and incubated at 250C for 30 min. The excess S of the reagent is removed by ethanol precipitation and centrifugatio::. The Fmoc group is cleaved off by resuspending the pellets in 10 ul of a solution of 20% piperidine in N.N- 6:.direthylforamidewatr(I: After 15 nin at 25 0 C, piperidine is thoroughly removed by three precipitations/centrifligatiofls with 100 ul each of ethanol. the pellets are r esuspended in 10 ul of a solution of N-methylmorpholine, 2-propanol and water (2/10/8 8 vlvlv) and are coupled to the solid support carrying an isathiocyanate group. In the case of the DITC-Sequelon membrane (Millipore Corp.. Bedford. MA). the membranes are prepared as described in EXAMPLE I and coupling is achievcd cn a heating block at 55 0 C as described above. RNA extension products are immobilized in an analogous way.

The procedure can be applied to other solid supports with isothiocyanate groups in a similar mariner.

The imrnG)ilized primer-extension products are extensively wash~ed three times with 100 ul each of NMM solution and three times with 100 ul 10 mM TEAA buffer The purified prim cr-ex tension products are released by three successive treatments with 10 1.1 of 100 mM hydraziniurn acetate b'iffier pH 6.5. lyophilized and analyzed by either ES or MALDI mass spectrometry.

EXAMPLE3 immobilization Of Prim ei-extension products of Sanger DNA sequencing reaction for mass spectrometric analysis via a trypsin sensitive linkage s Sequelon DITC membrane disks of 8 mun diameter (Millipore Corp., Bedford, MA) are wetted with 10 ul of NNW solution (N-methylmorpholinclpropanaol- 2lwater; 2.49149 vlvfv) and a linker arm introduced by reaction with 10 ul of a solution of I ,6-diaminohexane in NMM_ The excess diamine is remov'd by three washing steps with 100 ul of NMM solution. Using standard peptide synthesis protocols.

1 two L-lysine residues are attached by two successive condensations with N-Fmoc-N-tBoc- L-lysine pentafluorophenylester, the terminal Fmoc group is removed Aith piperidiiie in S NMM and the free a-amino group coupled to 1.4-phenylene. diisothiocyanate (DITC).

Excess DITC isercmoved by three washing steps with 100 ul 2-propanol and the N-tBoc o groups removed with trifluoroacetic vacid according to standard peptide synthesis 15 i procedures. The nucleic acid pr~ner-exteflsion products are prepared from oligonucleotides which carry a primary amino group at the 5'-termninus. The four Sanger DNA sequencing reaction mixtures (IS0 ul each in Eppendorf tubes) are heated for 10 min at 70 0 C to inactivate the DNA polymerase, ethanol precipitated, and the pellets resuspended in 10 ul of a solution ofN-methylmo-.pholine, 2-propanol and water (2110/88 26 vlvlv). This solution is transferred to the Lys-Lys-DITC membrane disks and coupled or.

*seen:a heating block set at 55 0 C. After drying, 10 ul of NMM solution is added and the drying process repeated.

The immobilized primer-extension products are extensively washed three times with ul each of NMM solution and thuee times with 100 ul each of 10 mMi TEAA buffer pH 7.2. For mass spectrometrid analysis, the bond between the primer. extension products and the solid support is cleaved by treatment with trypsin under standard conditions and the released products analyzed by either ES or M.ALDI mass spectrometry wt ypsin serving as an internal mass standard-

EXAMPLEA

Immobilization of primer-extension products of Sanger DNA sequencing reaction for mass spectrometric analysis via pyruphosphate linkage The DITC Sequilon membrane (disks of 8 mmn diame:e-r) are prepared as described in EXAMPLE 3 and 10 ul of a 10 mM solution of 3-aminopyridine adenine dinucleotide (APAD) (Sigma) in NMM solution added. The excess APAD is removed by a 10 ul wash of NMM solution and the disks are treated with 10 ul of 10 mM sodium periodate in NMM solution (15 min. 250Q). Excess periodate is removed and the primerextension products of the four Sanger DNA sequencing reactions (150 ul each in -28- Eppendorf tubes) employing nucleic acid primers with a primary amino group at the end are ethanol precipitated, dissolved in 10 ul of a solution of N-methylmorpholinel2propanol/water (2/10/88 v/v) and coupled to the 2' 3-dialdehydo groups of the immobilized NAD analog.

The primer-extension products are extensively washed with the NMM solution (3 times with 100 ul each) and 10 mM TEAA buffer pH 7.2 (3 times with 100 ul each) and the purified primer-extension products are released by treatment with either NADase or pyrophosphatase in 10 mM TEAA buffer at pH 7.2 at 3 7 0 C for 15 min, lyophilized and analyzed by either ES or MIALDI mass spectrometry, the enzymes serving o as internal mass standards.

15 Synthesis of nucleic acid primers mass-modified by glycine residues at the of tbe sugar moiety of the terminal nueleoside 01ligonticleo tides are synthesized by standard automated DNA synthesis a. using B-cyanoethylphosphoamiditcs Kdstcr et al., Nucleic Acids Res, 1_ 4539 (1984)) and a Y-amino group is introduced at the end nf solid phase DNA synthesis Agrawal et al., Nulickiidas es JA 6227-45 (1986) or Sproat el al.. Nucleic Acids Res, 6181-96 (1987)). The total amount of an oligonucleotide synthesis, starting with 0.25 o a umol CPG-bound nucleoside, is deprotected with concentrated aqueous ammonia, purified Via OligoPAKTM Cartridges (Millipore Corp.. Bedford. MA) and lyophilized- This material with a 5'-terminal amino group is dissolved in 100 ul absolute N.Ndimethviformamnide (DMIF) and condensed with 10 l.imole N-Frnoc-glycine peniafluorop'henyl ester for 60 min at 250C. Afler ethanol precipitation and centrifugation, the Fmnoc group is cleavedoff by a 10 mai treatment with 100 ul of a solution of 20% piperidine in N.N-dimethylformamide. Excess piperidine, DMF and the cleavage product from the Fmoc group are removed by ethanol precipitation and the precipitate lyophilized from 10 maM TEAA buffer pH 7-2. This material is now either used as primer for the Sanger DNA sequencing reactions or one or more glycine residues (or other suitable protected amino acid active esters) are added create a series of massmodified primer oligonucleotides suitable for Sanger DNA or RNA sequencing.

Immobilization of these mass-modified nucleic acid primers UPO-i after primer-extension during the sequencing process can be achieved as described. in EXAMPLES I to 4.

EXAMELE-f Synthesis of nucleic acid primers mass-modified at c-5 of the heterocyclic~ base of a pyrimidine aucleeside with glycine residues s Starting material was 5-( 3 -aminopropynyl- I S'-di-p-tolyldeoxyuridine: prepared and 3' S'-de-O-acylated according to literature procedures (Haralambidis etat.

Nucleic Acids Res, 1 4857-76 (1987)). 0.281I g (1.0 mmole) S-(3-aminopropynyl-l1)-2'deoxyuridine were reacted with 0.927 g (2.0 mniole) N-Fmoc-glycine pentafluorophenylester in 5 ml absolute N.N-dimetb-. Iformamide in the presence of 0. 129 g (I mrnole; 174 ul) N,N-diisopropylethylamine for 60 mmni at room zemperature. Solvents INS were removed by rotary evaporation and the product was purified by silica gel chromatography (Kieselgel 60, Merck;,column: 2.5x 50 cm. elution with chloroform/mcThanol mixtures). Yield was 0.44 g (0.78 mmole, 78 In order to add another glycitie residue. the Fmoc group is removed with a 20 min treatment with 15 solution of piperidine in DMF, evaporated in vacuo and the remaining solid material extracted three times with 20 ml ethylacetate. After having removed the remaining ethylacetate. N-Fmoc-glycine pentafluorophenviester is coupled as described above. S-(3- (N-Fmoc-glycyl)-amidopropynyl-l)-2-deoxyuridine is transformed into the dimethoxyritvlated nucleoside-3'-O-B -cyanoethyl-N.N-diisoprovpopomdt n b 0 20 incorporated into automated oligonucleotide synthesis by standard procedures K6ster et Nucleic Acids Res, 226 (1 984)). This glycinc modified thymidine analogue building block for chemical DNA synthesis can be used to substitute one or more of the thvmidineluridine nucleotides in the niucleic acid primcr sequence. The Fmoc group is removed at the end of the solid phase synthesis oith a 20 min~ treatment with a 20 25 solution of piperidine in DMF at room temperature. DMF is removed by a w~ashing step with acetonitrile and the oligonucleotide dcprotected and purified in the standard way.

EXAMPIL 7 Synthesis of a nucleic acid primer mass-modified at C-5 of the heterocyclic base of a pyrimidine nucleoside with fl-alanine residues Starting material was the same as in EXAMPLE 6. 0.281 g 5-(3-Arninopropynyl-l)-2'-dceoxyuridine was reacted wvith N-Fmoc-B-alanine pentafluorophenylester (0.955 g. 2.0 mmole) in 5 ml N.N-dimeth lformamide (DNIF) in the presence of 0.129 g (174 ul: 1.0 rnole) N.N-disopropylethyla mine for 60 min at room temperatuare. Solvents were removed and the product purified by silica gel chromatography as described in EXAMPLE 6. Yield was 0.425 g (0.74 mmole. 74%) Another 1-alanine moiety can be added in exactly the same way after removal of the Fmoc group. The preparation of the SY--dimethoxytritylated nucleoside-3'-O-B-cyanoethyl- N,N-.diisopropylphosphoamidite from 5-(3-(N-Fmoc-flalanyl}-amidopropynyl- deoxyuridine and incrrporatian into automated oligontucleotide synthesis is performed wnder standard conditions. This building block can substitute for any of the thymidine/widine residues in. the nucleic acid primer sequence. In the c~ase of only one incorporated mass-modified n,4cleotide, the nucleic acid primer molecules prepared according to EXAMPLES 6 and 7 would have a mass difference of 14 daltons.

S to Synthesis of a nucleic acid primer mass-modified at C-5 of the heterocyclic basc ofr a pyrimidine nucleoside with ethylene glycol monomethyl ether As a nucleosidic component, 5-(3.aminopropynyl-l)-2-doxyuridine was u sed in this exarhple (see EXAMPLES 6 and The mass-modifying funrctionality was obtained as follows: 7.61 g (100.0 rnnole) fr-eshly distilled ethylene glycol monomethyl 15 ether dissolved in 50 ml absolute pyridinle was reacted with 10.0 1 g (100.Ormole) recrystalized succinic anhydride in the presence of 1.228g (10.0 mrnole) 4-N.Ndimnethylaminoipyridine overnight at room temperature. The reaction was terminated by Omn the addition of water (5.0 ml), the reaction mixture evaporated in vacuo. co-evaporated twice with dry'toluene (20 ml each) and the residue redissolved in 100 ml e O dichloromethane. The solution was extrcted successively, twice with 10 aqueous citric oboes: acid (2 x 20 ml) and once with water (20 ml) and the organic phase dried over anhydrous sodium sulfate. The organic phase was evaporated in vacuo, the residue redissolved in ml dichioromethane and precipitated into 500 ml pentanec and the precipitate dred in vacun. Yield was 13.12 g (74.0 mmole, 74 ).8.86 g(50.0 nnole) ofsuccinylated ,at 2s ethylene glycol monomethyl ether was dissolved in 100 ml dioxane contzining'5% dry pyridine (5 ml) and 6.96 g (50.0 mmole) 4-nitrophenol and 10.32 g (50.0 mxnole) dicyclohexylcarbodiimnide was added and the reaction run--at room temperature for 4 hours.

Dicyclohexylurea was removed by filtration, the filtrate evaporated in vacua and the residue redissolved in 50 ml anhydrous rAF. 12.51 ml (about 12.5 mmole 4- 3o nitrophenyl ester) of tNs solution was used to dissolve 2.81 g (10.0 mrnole) 5-(3aniinopropynyl-l)-2-deoxyutridine. The reaction was performed in the presence of 1.0 1 g (10.0 mmole. 1.4 ml) triethylarnine at room temperature overnight. The reaction mixture was evaporated in vacuo, co-evaporated with toluene, redissolved in .dichloromethane and chromatographed on silicagel (Si6O, Merck:,colwnn 4x50 cm) with dichloromethanelmethanol mixtures. The fractions containing the desired compound were collected. evaporated redissolved in 25 ml dichloromcthane and precipitatcd into 250 ml pentane. The dried precipitate of 5-(3-N-(O-succinyl ethylene glycol monomethy! ether)aniidopropynyl-l)-2-deoxyuridinc (yield: 65 is 5'-O-.dimethoxytritylatcd and tranformed into the nucleoside-3-O -8-cYaflethyl-N, N-diisopropylphosphoanlidite and

AI

*0t *5

S

eC

S..

C S S C

C

.0CC..

incorporated as a building block in the automated oligonucleotide syntLhesis according to standard procedures. The mass-modified nucleotide can substitute for one or more of the thymidinelwidine residues in the nucleic acid primer sequence. Deprotection and purification of the primer oligonucleotide A4so follows standard procedures.

EXAMIPLE9 Svnthesis of a nucleic acid primer mass-modified at C-5 of the heterocyCliC base Of a pyrimidine nucleoside with diethylene glycol monometbyl ether I0 Nucleosidic starting material was as in previous examples. 5-(3aminopropyflyl- I )-T-deoxywiidine. The mass-modify-ing functionality was obtained similar to EXAMPLE S. 12.02 g (100.0 mmrole) freshly distilled diethylene glycol monomethyl ether dissolved in 50 ml absolute pyridine was reacted with 10.0] g (100.0 mmole) recrystallized succinic anhydride in the presence of 1.22 g (10.0 minole) 4-N. Nis dimethylaminopyridine (DMAP) overnight at room temperature. The work-up was as described in EXAMPLE S. Yield was 18.35 g (82-3 mmoke. 82.3 11.06 g (50.0 mmole) of succinylated diethylene glycol monometlv ether was transformed into the 4nitrophenylester and, subseq~uently, 12.5 mmole was reacted with 2.81 g (10.0 mmolc) of 5-(3-aminopropynyl-l)-2-deoxytidife as described in EXAMPLE 8. Yield after silica gel column chromatography and precipitation into pentane was 3.34 g (6.9 mmole, 69%) After dimethoxytritylation and transformation into the nucleoside-Bcyanoethylphosphoamidite, the mass-modified building block is incorporated into automated chemical DNA synthesis according to standard procedurcs. Within the sequence o F the nucleic acid primer 1JP 0 one or more of the thymidineluridine residues can be substituted by this mass-modified nucleotide. In the case of only one incorporated mass-modified nucleotide, the nucleic acid primers of EXAMPLES 8 and 9 would have a mass difference of 44.05 daltons.

EXAMELE-If Synthesis of a nucleic acid primer mass-modified at C-8 of the beterocyclic base of deoxy adenosinle with glycine Starting material was N6bnoi8booS--(,'dmtoytl-' deoxyadenosine prepared according to literature (Singh er at.. NulicisRs J.11 3339-45 (1990)). 632.5 mg (1.0 nole) of this 8-bromo-doxadefloZ;fle derivative was suspended in 5 ml absolute ethanol and reacted wkith 251.2 mg (2.0 mmole) glycine methyl ester (hydrochloride) in the presence of 241.4 mg (2.1 mnrole. 366 ul) N. Ndiisopropylethylamifle and refluxed until the starting nucleosidic material had disappeared (4-6 hours) as checked by thin layer chromatography (TLC). The solvent was evaporated -32and the residue purified by silica gel chromatography (column 2.5x50 cm) using solvent mixturs of chloroformn/methanol containing 0. 1 pyridine. The product fractions were combined, the solvent evaporated, the fractions dissolved in 5 ml d ichloromethane and precipitatcd into 100 ml pentane. Yield was 487 mag (0.76 rmole, 76 Transformation into the corresponding nucleoside-B-cyanoethylphosphoarnidite and integration into automated chemical DNA synthesis is performed under standard conditions. During final deprotection w~ith aqueous concentrated ammonia. the methyl group is removed from the glycine moiety. The mass-modified building block can substitute one or more todeoxvadenosine/adenosine residues in the nucleic acid primer sequence.

EXAMPLEII

Synthesis'of a nucleic acid primtr mass-modificd at C-8 ofthbe heterocyclic base of deoxyadenosine with glycyiglycine This derivative was prepared in analogy to the glycine derivative of **EXAMPLE 10. 632.5 mag (1.0 inn. N 6 -Benzoyl-8-bromo-5'-O-{4.4'-dimethoxy trityl)- 2'-deoxyadenosine was suspended in 5 ml absolute ethanol and reacted with 324.3 mg rarnole) glycyl-glycine methyl ester in the presence of 241._4 rag (2.1 ramole, 366 VII) N, N-diisopropylethylamine. The mixture was refluxed and comapleteness of the reaction checked by TLC_ Work-up and purification was similar to that d esribed in EXAMPLE Yield after silica gel columnn chromatography and precipitation into pentane was 464 mg (0.65 ramole, 65 Transformation into the nucleoside-C-cyarioethylpliosphoamidite and into synthetic oligonucleotides is done according to standard procedures. In the case where only one of the deoxyadenosine/adeniosine residues i n the nucleic acid primer is 2s substituted by this mass-modified nucleotide, the, mass difference between the nucleic acid primers of EXAMPLES 10 and I I is 57.03 daltons.

EXAMPEUJ

Synthesis of a nucleic acid primer mass-modified at the C-2' of the sugar moiety of 2'-amino-2'-deoxyhymidine with ethylene glycol monomethyl ether residues Starting material was 5'-O.(4,4-dimcthoxytrityl)2'amin-2'deoxythymidinC synthesized according to published procedures Verheyden et al.. .LO.Qx .Chem. 26.

250-254 (197 Sasaki et I rg. Chem. 41. 3139-3143 (1976); Imazawa et al, LOrr,- Chem. _44.2039-2041 (1979): Hobbs ei al., ,L~tg..Cci. 42, 7 14-719 (1976); Ikehara el Chem- Pharm Bill I-Japan 26, 240-244 (1978); see also PCT Application WO 88/00201). 5'O(.-iehxt'y)2-mn-'doyhmdn (559.62 mg: 1 .0 mmole) was reacted with 2.0 rnxole of the, 4-ntitrophenyl ester of succinylated ethylene glycol rnonomethyl ether (see EXAMPLE 8) in 10 ml dry DMF in the presence o f 1 .0 -33mmole (140 p1) triethylarnine for 18 hours at room temperature. The reaction mixture was evaporated in vacuo. co-evaporated with toluene. redissolved in dichioromethane and purified by silica gel chromatography (Si60. Merck: column: 2.Sx5t) cm: eluent: chloroform/methanol mixtures containing 0. 1 triethylamine). The preituct containing fractions were combined, evaporated and precipitated into pentanre. Yield was 524 mng (0.73 ramol, 73 Transformation into the nucleoside-f1-cyanoethyi-N.Ndiisopropy~phosphoamidite and incorporation into the automated chemical DNA synthesis protocol is performed by standard procedures. The mass-modified deoxythymidine P. derivative can substitute for one or more of the thymidine residues in the nucleic aciG primer.

In an analogous way, by employing the 4-nitrnphenyl ester of succinylated diethylene glycol monomethyl ether (see EXAMPLE 9) ar.d triethylene glycol mor.omethyl ether, the corresponding mass-modified oligonucleotides are prepared. In the case of only one incorporated mass-modified nucleoside within the sequence, the massF difference tc-xeen the ethylene, diethylene and triethylene glycol derivatives is 44.05, 88.1 and 132.15 daltons respectively.

EXAMfriLE.13 2o Synthesis of a nucleic acid primer mass-modified in the internutcleotidic liukmge via alkylation of phospborothioate groupis *0*00:Phosphorothioate-contaning ol igonucleot ides were prepared according to standard procedures (see e-g. Gait er aL., Nucleic Acid' Res., 12 11H83 (199 Onc, several or all internucleotide linkages can be modified in this way. The 13 nucleic acid primer sequence (I17-mer) S'-dGTAAAACGACGGCCAGT was synthesized in 0.25 Ilmole scale on a DNA synthesizer and one phosphorothioate group introduced after the final synthesis cycle (G to T coupling)., Sulfurization, deprotection and purification followed standard protocols. Yield was 31.4 rnole (12.6 overall yield), corresponding ,o 31.4 rimole phosphorothioate groups. Alkylation was performecd by dissiolving the residue in 31.4 pi TE buffer (01.01 M Tris pH 8.0, 0.001 M EDTA) and by adding 16 .dl of a solution of 20 mM solution of 2-iodoethanol (320 rnole. Il0:fold excess wt respect to phosphoroithioate diesters) in N,N-dimethylfor.-narnide (DMF). The alkylated oligonucleotide was purified by standard reversed phase HPLC (RP-1 8 Ultraphere, Beckman-, column: 4.5 x 250 mm; 100 mM[ triethylamamoniurn acetate, pH 7.0 and a gradient of 5 to 40 acetonitrile).

In a variation of this procedure, the nucleic acid primer containing one or more phosphorothioate phosphadiester band is used in the Sanger sequencing reactions.

The primer-extension products of the four sequencing reactions are purified as exemplified in EXA.MPLES I 4, cleaved off the solid support, lyophilized and dissolved in 4 pi each of TE buffer pH 8.0 and alkylated by addition of 2 pl of a 20 mM solution of 2iodoethanol in DMF. it is then analyzed by ES and/or MALDI mass spectromnetry.

In an analogous way, employing instead of 2-iodocthanol, 3iodopropanol, 4-iodobuxanol mass-modified nucicic acid printer are obtained with a mass difference of 14.03, 28.06 and 42.03 daltons respectively compared to the unmodified phosphorothioate phosphadiester-containing oligonucleoride.

EXAMPLE 14 io Syuthess3 f 2'amino..2'.deoxyuridinie.54-riphosph ate and 3'-amina-2',3'- t *glycine or fi-ainnine residues .:see: Starting material was 2-azido-2-deoxyutridine prepare-d according to literature (Verheyden et aLLQ~_h M~ 250 (197 1 which was 4,4is dimethoxytritylated at Y-O11 with 4.4-dimnethoxytrityl chloride in pyridine and acetylated at 3'-OH with acefic anhydride in a one-pot reaction using standard reaction conditions.

With 191 mg (0.71 nimole) 2-azido-T-deoxyuridine as starting material, 396 mg (0.65 rnmol, 90.8 5'-O-{4,4-dimethoxylrityl)-3 '-0-ace tyl-2-.azido-2'-deoxuridine was obtained after purification via silica gel chromatography. Reduction of the azido group Was performed using published conditions (Banta et aii. Tea-ahedron 4. 587-594 (1990)).

:n Yield of 5'-0-(44-dimethoxytrityl)-3-O-acetyl-2'-amino-2-deoxyuridine after silica gel chromatography was 288 mg (0.49 mrnole; 76 %.This protected T-amino-2-deoxyuridine derivative (588 mg, 1.0 tumole) was .~.reacted with 2 equivalents (927 mg, 2.0 mmole) N-Fmoc-glycine pentafluorophenyl ester in 10 ml dry DMF overnight at room temperature in the presence of 1.0 mrnole (174 p1) N,N-diisopropylethylamine. Solvents were removed by evaporation in ivacuo and the residue purified by silica gel chromatography. Yield was 711 mg (0-71 tumole, 82%) Detritylation was achieved by a one hour tretment with M0% aqueous acetic acid at room temperature. The residue was evaporated to dryness. co-evaporated twice -with toluene.

3o suspended in I ml dry acetonitrile and 5'-phosphorylated with POC1 3 according to literature (Yoshikawa el ali., Bull. Chem. SoC. JaMa 3505 (1969) and SowAa et ali..

Bull- Chem, Soc. Japan 41, 2084 (1975)) and directly transformed in a one-pot reaction to the 5'-triphosphate using 3 ml of a 0.5 M solution (1.5 mmole) tetra (tri-nbutylammonium) pyrophosphate in DMF according to literature Scela et al., Helvetica Chimica Ar-t 7. 1048 (1991)). The Fmoc: and the 3-O-acetyl groups were removed by a one-hour treatment with concentrated aqueous ammonia at room temperature and the reaction mixture evaporated and lyophilized. Purification also followed standard procedures by using anion-exchange chromatography on DEAE- Sephadex with a linear gradient of triethylammno-ium bicarbonate 1 M 1.-0 M).

Triphosphate containing fractions (checked by thin laver chromatography on polyethyleneimine cellulose plates) were collected. evaporated and lyophilized. Yield (by UV-absorbance of the uracil moiety) was 68% (0.48 mmole).

A glycyl-glycine modified 2'-anino-2.deoxyuridine-5Y-triphosphate was by removing the Fmoc group from 5S-O-(4.4-dimethaxytityl)-3-O-acetvl-2-N- (N-9-fluorenylmethyloxycarbonyl-glycyl)-2-aLrnino-2.-deoxyuridine by a one-hour treatment with a 20% solution of piperidine in DMF at room temperature, evaporation of solvents, two-fold co-evaporation with toluene and subsequent condensation with N- *Fmoc-glycine pentafluorophenyl ester. Starting with 1.0 rnrole of the 2-_N-glycyl-2't amino-T-deoxyuridine derivative and following the procedure described above. 0.72 mmanle of the corresponding 2'-(N-glycyl-glycyl)-2'-amino-2'-deoxvuridinc-5't. -hosphate w-as obtained.

Starting with S'-O-(4,4-dimethoxvtrityl)-3Y-O-acetyl,-2-amino-2'deoxyuridin an opigwt -mcBalanine pentafluorophenyl ester, the corresponding aanyl)-2-amnin-2'-deoxyuidine-S-triphosphaie can be synthesized. These modified nucleoside triphosphates are incorporated during the Sanger DNA sequencing process in the primer-extension products. The mass difference between the glycine. 13alanine and glycyl-glycine mass-modified nuclcosides is, per nucleotide incorporated. 58.06, 72-09 and 115.1 daltons respectively.

2D When starting with 5'--(4,4-dimethoxytrityl)-3'-amino-2'.3'dideoxythymidine (obtained by published procedures. see EXAMPLE 12), the corresponding T-(N-glycyl)-3'-amino-I 3Y-(-N-glycyl-glycyl)-3'-amino-/ and 3'-(N13alanyl)-3'-arnino--2.3'-dideoxythymidine-5'-tiphosphates can be obtained. These massmodified nucleoside tiphosphates serve as a terminating nucleotide unit in the Sanger DNA sequencing reactions providing a mass difference per terminated fragment of 58.06.

72.09 and 115.1 daltons respectively when used in the multiplexing sequencing mode.

The mass-differentiated fragments can then be analyzed by ES and/or MALDI mass spectrometry.

Synthesis of deoiyu ridine-5'-triphos ph ate mass--nodified at C-5 of the heterocyclic base with giveine, glycyl-glycine and fi-alanine residues.

0.28 18 (1.0 mmole) 5-(3-Aminopropynyl- I)-T-deoxyuidinc (see EXAMPLE 6) wAs reacted with either 0.927'g (2.0 mmole) N-Fmoc-glycine pentalluor-ophenylester or 0.955g (2.0 nunmole) 'N,-Fno c-B-alanine pentatluorophenyl ester ml dry DMF in the presence of 0. 1298g N. N-diisopropylethylamnine (174 ul, mmole) overnight at room temperature. Solvents were removed by evaporation in vocuo and the condensation products purified by flash chromatography on silica gel (Still er aL.

J. rg. Chem, 41 2923-2925 (1978)). Yields wern 476 mg (0.85 minolc: 85%) for the glycine -uid 436 Ing (0.76 minnle; 76%) for the 13-alanine derivatives. For the synthesis of the glycyl-glycine derivative. the Frnoc group Of 1 .0 m-mole Fmoc-glycine-doxyturidine cder.,ative was removed by one-hour treatment with 20% piperidine in DMF at roam temperature. Solvents were removed by evaporation in vacuo. the residue was coevaporated twice widh toluene and condensed with 0.927 g (2.0 minole) N-Fmoc-glycine pentafluorophenyl ester and purified as described above- Yield was 445 mg 10.12 minole; The glycyl-, glycyl-glycyl- and I3-alanyl-2'-dcoxyuridine derivatives. N-protected with the Finoc group were transformed to the 3-0-acetyl derivatives by tritylation with to 4.4-dimethoxytrityl chloride in pyridine and acety lation with acetic anhydride in pyridine in a one-pot reaction and subsequently detritylatcd by one hour treatmecnt with aqueous acetic acid according to standard. procedures. Solvents were removed, the residues dissolved in 100 ml chloroform and imtraicted twice with 50 ml 10% sodium bicarbonate and once with 50 ml water, dricd with sodium sulfate, the solvent evaporated and the residues purified by flash chromatography on silica gel. Yields were 361 mg (0.60 ~rnole; 71%) for the glycyl-. 351 mg (0.57ffmole; 75%) for the B-alanyl- and 323 mg (0-49 mniok; 68%) for the glycyl-glycyl-3-O'-acetyl-2'-dcoxyuridine derivatives respectively. Phosphorylation at the 5'-OH vifth POC1 3 trasformation Into the triphosphate by in-situ reaction with tetra(tri-n-butylanmoniuxn) pyrophosphate in D.MF, 2o 3.de-O-acecyiation., cleavage of the Fmoc group, and final purification by anion-exchange *:sees chromatography on DEAE-Sephadex was performed as described in EXAMPLE 14.

Yields according to UV-absorbance of the uracil moiety were 0-41 mniole, 5-(3 glycyl)-aniidopropynyl-l )-2'-deoxyuridine-5'-triphosphate 0.43 mole and 0.38 mmodc glycyl-glycyl)-amidopropynyl- I)-2'-deoxyuridine-S'-triphosphate These mass-modified nucleoside triphosphates were incorporated during the Sanger DNA sequencing primer-extension reactions.

When using 5-(3-amninopropynyl- I)-2',3'-dideoxyuridirie as startng material and following an analogous reaction sequence the corresponding glycyl-. glycyl-glycyland B&alanyl-2'.3-dideoxyuridine-5'-triphosphates were obtained in yields of 69. 63 and 7 1 %respectively. These mass-modified nucleoside triphosphates serve as chainterminating nucleotides during the Satiger DNA sequencing reactions. The mass-rnodificd sequencing ladders are analyzed by either ES or MALDI mass spectro)Metry.

X ML1 Synthesis of 8-glycyl- and 8.-glycyl-glycyl-2'-decoxya denosin e-5-triphosph ate 727 mg (1.0 mmole) N 6 -(4-tert-butylphenoxyacetyl)-8-giycvl-5-(4.4dimethoxytrity2- dexaenosine or 800 mg (1.0 ramole) N 6 -(4-tert- -37buypeoyctl--1CIgyy-'(,-iehxtiy)2doydnsn prepared according to EXAMPLES 10 and I I and literature (Kbster el at.. Jthmhrdwn 32. 362 (1981)) were acetylated with acetic anhydride in pyridine at the 3-O1I, detritylated at the Y-position with 80%/ acetic acid in a one-pot reaction and transformed into the triphosphates via phosphorylation with POC1 3 and reaction in-sin, with tetra(tri-nbutylanironium) pyrophosphate as described in EXAMPLE 14. Deprotection of the N 6 tert-butyiphenoxyacetyl. the 3-O-alCetyl and the 0-methyl group at the glycine residues was achieved with concentrated aqueous ammonia for ninety minutes at roam *4 0 temperature. Ammonia was removed by lyophilization and the residue washed with to dichiommethane. solvent removed by evaporation in vacua and the remaining solid material purified by anion-exchange chromatography on DEAE-Sephadex using a linear gradient of triethylanumonium bicarbonate from 0. 1 to 1.0 M. The nucleoside triphosphate a containing fr-acjions (checked by TLC on polyethyleneiniine cellulose plates) were Ccombined and lyophillized. Yield of the 8-glycyl-2.-dcoxyadenosine-'-ufjphosphate (determined by UV-absorbance of the adenine moiety) was 57% (0.57 mmole). The yield for the 8-glycyl-glycyl-2'-deoxyadenosine-5'-tiphosphate was 51% (0.51 rorole).

These mass-modified nucleoside triphosphates were incorporated during :.primer-extenision in the Sanger DN A sequencing reactions.

When using the corresponding N6-(4-tert-butylphenoxvacetyl)-g-glycyl- or glycyl-glycyl-S'-0-(4,4-dimethoxytity})2r.3rdideoxyadenosine derivatives as starting materials prepared according to standard procedures (see, for the introduction of the 2',3-fiinction: Seclaet at..Helyetica Chimica Acta 1048-1058 (1991)) and using an *:*analogous reaction sequence as described above, the chain-terminating mass-modified nucleoside triphosphates 8-glycyl- and 8-glycyl-giycyl-2'.3'-dideoxyadenosine-5striphosphates were obtaned in 53 and 47% yields respectively. The mass-modified sequencing fragment ladders are analyzed by either ES or MALDI mass spectrometry.

EXAMELE 17 Mass-modificationi of Sanger DNA sequencing fragment ladders by incorporation of cha[4'elongating 2'-.deoxy- and chain-terminating 2',3'-dideoxythymidine-5S-{alpha..

S-)triphosphate aind subsequent alkylation with 2-iodoethanof and 3-iodopropanol 2.3'-Didcoxythymidine-5'-(alpha-S)-rphosphate was prepared according to published procedures for the alpha-S-triphosphate moiety: Eckstein ef aL, Biochemista L, 1685 (1976) and Accounts Chemn. Res. 1. 204 (1978) and for the dideoxy moiety: Seela e al, Helvetica Chimica Aca, 74, 1048-1058 (199i)). Sanger DNA sequencing reactions employing 2'-deoxythymidine-5'-(alpha-S)-triphosphate a-re performed according to standard protocols Eckstein, Ann. Rev- Riochem, M. 367 (1985)). When using 2',3-dideoxythymid in-5Y-(apha-S)-tri phosphates, this is used -38instead of the unmodified 2Z.3*-dideoxythymidine--iphosphtc in standard Sanger DNA sequencing (see e.g. Swerdlow et of., NuleijcAcids Res, 11 1415-1419 (1990)). The template (2 pmole) and thc nucleic acid M 13 sequencing primer (4 pmole) modified according to EXAMPLE I are annealed by heating to 65 0 C in 100 ul of 10 mnM Tris-HCI pH 7.5. 10 MM MgCI2, 50 mM NaCI, 7 mnM dithiothreitol (DMT for 5 rain and slowly brought to 370C during a one hour period. The sequencing reaction mixtures contain, as exemplified for the T-specific termination reaction, in a final volume of 150 ul. 200 uM (final concentration) each of dATP, dCTP. dTTP. 300 uM c7-dcaza-dGTP, 5 uM dideoxythymidine-S5(a]phaS)-trphosphate and 40 units Sequenase (United States io Biochemicals). Polymerization is performed for 10 min at 370C. the reaction mixture heated to 70 0 C to inactivate the Sequenase, ethanol precipitated and coupled to thiolated Sequeion membrane disks (8 mm diameter) as described in EXAMPLE 1. Alkylation is performed by treating the disks with 10 ul of 10 mM solution of either 2-iodoethanol or 3io-dopropanol in NMM (N-methylmorpholine/watcr/2-propanll 2/49/49, vlv) (three times), washing with 10 ul NMM (three times) and cleaving the alkylated T-terminated primer-extension products off the support by treatment with DTr as described in EXAMPLE 1. Analysis of the mass-modified fragmeniL families is performed with either ES or MALDI mass spectrometry.

20 EXAMELE-2 Analysis Of ak Mixture of Oligothyinidylic Acids Oligothymidylic acid. oligo p(dT) 12-18, is commercially available (United States Biochemical, Cleveland. OH). Generally. a matrix solution of 0.5 M in ethanol was prepared. Various matrices were used for this Example and Examples 19- 21 such as dihydroxybenzoic acid, sinapinic, acid, 3-hydroxypicolinic acid, 2,4,6trihydroxyacetophetlole. Oligonucleotides were lyophilized after purification by HPLC and taken up in ultrapure water (MilliQ, Millipore) using amounts to obtain a concentration of pmoleslfil as stock solution. An aliquot (I iltl) of this concentration or a dilution in ultrapure water was mixed with 1 ftl of the matrix solution on a flat mneta surface serving as the prob e tip and dried with a fan using cold air. In some experiments, cation-ion exchange beads in the acid form were added to the mixture of matrix and sample solution.

MALDI-TOF spectra were obtained for this Example and Examples 19-21 on different commercial instruments such as Vision 2000 (Finnigan-MAT). VG Tof~pec (Fisons Instruments), LaserTec Research (Vestec). The conditions for this Example were linear negative ion mode with an acceleration voltage of 25. kV. The MALDI-TOF spectrum generated is shown in FIGURE 14. Mass calibration was done externally and generally achieved by using defined peptides of appropriate mass range such as insulin, gramicidin

S,

trypsinogen. bovine serum albumen, and cytochrome C. All spectra were generated by .39employing a nitrogen laser with 5 nscc pulses at a wavclcnigth of 337 rim. Laser energy varied between 106 and 10 W/cm 2 To improve signal-to-noise ratio generally. the intensities of 10 to 30 laser shots were accumulated.

EXAMPLE 19 Mass Spectrometric Analysis of 2 50-mer and 2 99-mer *Two large olIigonucleo tides were analyzed by mass spectramrrcry. The 0O Cd (TAACGGTCATACGGCCATTGACTGTAGGACCTGCATTACATGACTAGCT)

(SEQ

10 ID NO:J) and dT(pdT) 9 9 were used. The ol igodeoxyn ucklo tides were sy1nLhceized using P cynnoet.hylphosphoamidites and purified'using published proccdures.(e.g. N.D. Sinha. J.

Biernat. J. McManus and H. K~ster. Nucleic Acids Res. 12.4539(1984)) employing commercially available DNA synthesizers from either Millipore (Bedford. MA) or Applied Biosystems (Foster City. CA) and I-PLC equipment and RP18 reverse phase columns from in Example I8. The conditions used for.MALDI-MvS analysis of each oligonucleotide were 500 Imlof each oligonucleotide. reflectron positive ion mode Aith an acceleration of 5 kV and postaccelcration or2O. kV. The MALDI-TOF spectra generated were superimposed and are snow,.n in FIGURE 1 EXArYIWQ Simulation of the DNA Sequencing Results of FIG URE 2 The 13 DNA sequences representing the nested dT-termninatcd fragn.nts Of LflT Sanger DNA sequencing for th e 50-mer described in Example 19 (SEQ ID NO:3) were synthesized as described in Example 19. The samples were treated and 500 fmol of each fragment was analyzed by MALDW-S as described in Example 18.. The resulting MALD1- TOF spectra are shownM in FIGURES 1,6A-16M. The conditions were reflectron positive ion mode with an acceleration of 5 kV and postacceleration of 20 WV. Calculated molecular masses and experimental molecular masses are showvn in Table I1.

The MALDI-TOF spectra were superimposed (FIGURES 17A and 17B) to demonstrate that the individual peaks are resolvable even between the I 0-mer and I I -mer (upper panel) and the 37-mer and 38-mer (lower panel). The two panels show two different scales and the spectra analyzed at that scale.

MALDI-MS Analysis of a Mas-Mddified Oligotaucleotide A 17-mer was mass-modified at C-5 Of one Or two deoxy-uridiine moieties. 5.[13- (2-Methoxyethoxy)-trdcynC-1I-ylI-5'.tJ(4.4-dimethoxyriyl-2deoxyuridileY3-cyanocthyI- N. N-diisopropylphosphoaifidite was used to synthesize the modified I 7-mets using the methods described in Example 19.

The modified 17-mets were x a(TAAAACGACGGCCAGUG) (molecular mass: 5454) :(SEQ ID NO:4) X b: d (UAAAACGACGGCCAGUG) (molecular mass 5634) (SEQ ID 20where X 1

-OH

(unmodified 17-mer molecular mass- 5273)~ The samples were prepared and 500 final of each modified I 7-mer was analyzed using MALDI-S as described in Example 18. The conditions used were 25 reflection positive ion mode with an accecleration of 5 WV and postacceleration of 20 MV The MALDI-TOF spectra which were generated were superimposed and arc shown in' FIGURE 18.

All of the above-cited references and publicatins axe hereby incorporated by

FQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures describcd herein. Such equivalents are considered to be within the scope of this invention and arc covered by the following claims.

.41- SEQUENCE LISTING GENERAL INFORMATION: Wj APPLicPNT: NAME: KOSTEl;. HUBERT STREET: 1640 MONUMENT STREET CITY: CONCORD STATE: MASSACHUSETTS COUNTRY: USA POSTAL CODE (ZIP): 011742 6o =ELPHONE: (S08) 369-9790 IS (ii) TITLE OF INVENTION: DNA SEQUENCING BY MASS SPECTROETY (iii) NUMBER OF SEQUENCES: COMPTER READABLE FORM: 2 Ae*A) MEDIUM TYPE: Floppy diu)k COMPUJTER: IBM PC comipatible OPERATING SYSTEM; PC-DOS/MS-DOS SOFTWARE- ASCII (tex~t) 25 (vi) CURRENT APPL!CATION DATA! APPLICATION NUMBER: FILING DATE: 06-JAN-1994

CLASSIFICATION:

30 (vii) PRIOR APPLICATION DATA: *Sao APPLICATION NUMBER: US 08/001.323 FILING DATE- 07-JAN-1993 CLASSIFICATION: 1807 (viii) ATTOPYEIP-s3D INFORMATION: NAME: DeConti, Giulio A.

REGISTRATION NUMBER: 31,503 REFERENCE/DOCKET NUMBER: HKI-003CP aix) TELECOI(uNicATom INFRMATIn: TELEPHONE: (617) 227-7400 TELEFAX:- (617) 227-5941 INFORMATION FOR SEQ ID NO:1: Mi SEQUENCE CHARACTERISTICS: LENGTH: 14 base pairs TYPE: nucleic acid STRAIIDEDNESSj* single TOPOLOGY: linear (ii).MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CATGCCATGG CATG 14 IFl~ORMATION FOR SEQ ID NO:2: (M SEQUENICE CHARACTERISTICS: LENGTH: 21 base pairs (BI TYPE: nucleic acid ICI STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL. YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2; 20 AAATTGcA eATCcTGcAG c 2 INFORMATION FOR SEQ ID NO:.3: SE12UE2CE CHARACTERISTICS: 25 LENGTH: 50 base pairs TYPE: nucleic acid SB S STRANDEDNESS: single ED) TOPOLOGY: linear O 30 (ii) MOLECULE TYPE.- other nucleic acid (iii) HYPOTHETICAL-. YES %ago (xi)-SEQUENCE DESCRIPTION- SEQ ID NO:.3t TAACGGTCAT TACGGCCATT GACTGTAGGA CCTGCATTAC ATGACTAGCT so INFORMATION FOR SEQ ID NO:4: 1i) SEQUENCE CHARACTERISTICS: LENGTH: 17 base pairs TYPE: nucleic acid STRAiNDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: 'rAAAACGACG GGCCAGXG 17 fIMR?4ATION FOR SEO IV NO S SEOUEICs CIHACTERXSTICS; LmGHI: 17 bass pairs 3 (al) TYPE. nIflaicC acid STY-MDNDES3. single TOPOLOGY: linear (ii) moLECuLE TYPE. other nucleic acid (iii) HYPOTMTICAL:. YES is (xi) SEOUENCE DESCRIPTION- SEQ ID XAAAACGACG GGCCAQ.XG as* *.so

Claims (34)

1. A set of mass-modified nucleic acid primers selected from a group consisting of a collection of mass-modified universal primers for priming DNA synthesis, and a collection of mass-modified initiator oligonucleotides for initiating transcriptional RNA s synthesis.

2. A set of mass-modified nucleic acid primers according to claim I wherein at least one of the mass-modified primers is modified with a mass modifying functionality (M) at one or more heterocyclic bases within the primers.

3. A set of mass-modified nucleic acid primers according to claim 1 or claim 2 wherein at least one of the mass modified primers comprises at least one heterocyclic base-modified nucleotide selected from the group consisting of a cytosine nucleotide modified at C-5, a Sthymine nucleotide modified at C-5, a thymine nucleotide modified at the C-5 methyl S*group, a uracil nucleotide modified at C-5, an adenine nucleotide modified at C-8. a c deazaadenine modified at C-8, a c'-deazaadenine modified at C-7, a guanine nucleotide S 15 modified at C-8, a c-deazaguanine modified at C-8, a c-deazaguanine modified at C-7, a hypoxanthine modified at C-8, a c'-deazahypoxanthine modified at C-7 and a c deazahypoxanthine modified at C-8.

4. A set of mass-modified nucleic acid primers according to any one of claims I to 3. wherein at least one of the mass-modified primers is modified with a mass-modifying 20 functionality attached to one or more phosphorous atoms of the internucleotidic Slinkages within the mass modified primer. A set of mass-modified nucleic acid primers according to any one of claims 1 to 3, wherein at least one the mass-modified primers is modified with a mass-modifying functionality attached to at least one sugar moiety of the nucleotides within the mass-modified primer at least one sugar position selected from the group consisting of an internal C-2' position, an external C-2' position and an external C-5' position.

6. A set of mass-modified nucleic acid primers according to any one of claims I to 3. wherein at least one of the mass-modified primers is modified with a mass-modifying functionality attached to the sugar moiety of a 5'-terminal nucleotide of the primer, 3o and wherein the mass-modifying function is the linking functionality

7. A set of mass-modified nucleotides selected from the group consisting of mass- modified 2'-deoxynucleoside triphosphates suitable for DNA synthesis, mass-modified 2'.3'-dideo\xnucleoside triphosphates suitable for chain-terminating DNA synthesis, mass-modified nucleoside triphosphates suitable for RNA synthesis and mass-modified 3'-deoxynucleoside triphosphates suitable for chain-terminating RNA synthesis.

8. A set ofmass-modified nucleotides according to claim 7. wherein a mass-modified functionality is attached to a heterocyclic base of the mass-modified nucleotide.

9. A set of mass-modified nucleotides according to claim 7 or claim 8. wherein the mass-modified nucleotide comprises a modified heterocyclic base selected from the group consisting of a cytosine moiety modified at C-5, a thymine moiety modified at a thymine moiety modified at the methyl group of C-5. a uracil moiety modified at andenine moiety modified at C-8. a c'-deazaadenine moiety modified at C-8;-a c 7 -deazaadenine moiety modified at C-7. a guanine moiety modified at C-8. a c 7 -deazaguanine moiety modified at C-8. a c-deazaguanine moiety modified at C-7. a hypoxanthine moiety modified at C-8, a c-deazahypoxanthine moiety modifiedat C-8 Sand a c -deazahypoxanthine moiety modified at C-7.

10. A set of mass-modified nucleotides according to claim 7, wherein a rass-modified functionality is attached to an alpha phosphorus atom of a triphosphate moiety of the mass-modified nucleotide. 20 11. A set of mass-modified nucleotides according to claim 7, wherein the mass- modified nucleotide comprises a deoxynucleoside triphosphate, and a mass-modifying Sfunctionality is attached to a C-2' position of a sugar moiety of the deoxynucleoside triphosphate.

12. A set of mass-modified nucleotides according to claim 7, wherein the mass- modified nucleotide comprises a dideoxynucleoside triphosphate and a mass-modifying functionality is attached to at least one sugar moiety position selected from the group consisting of a C-2' position and a C-3' position.

13. A set of mass-modified nucleic acid primers according to any one of claims 1 to 6, or a set of mass-modified nucleotides according to any one of claims 7 to 12, wherein the mass-modifying functionality is selected from a group consisting of F, Cl, Br, 1, Si(CH 3 3 Si(CH 3 2 HS). Si(CH,)(CH 2 Si(C 2 H) 3 CH2F. CHF,, and CF 3 -46-

14. A set of nmass-niodified nucleic acid primers according to any one of claims I to 6, or a set of mass-modified nucleotides according to any one of claims 7 to 12. wherein the mass-modifyving functionality (NI) is generated from a precursor functionality (PF) attached to the miass-miodified primers or mnass-modified nucleotides. the precursor (PF) from a group consisting of and XR. wherein R is H and X is selected fromt a group consisting of -OH. -NHR. -SH. -NCS. -OCO(CH,)..COOH (where r 1-20). -NHCO(CH,)rCOOHl (where r 1 -OSO 3 OH, -OCO(CH,),l (where r 1-20). and 13. A set of mass-moiditied nucleic acid primers according toayoeo liIto6 or a set or miass-miodified nucleotides according to an%. one of claims 7 to 12. wherein the mass-modil~in- functionality is given by the general formula XR in which X Is~ selected from a group C I -nsistino of -OH. -NIl, -NHR, -SH. -NCS. -OCO(CH,)COOHI V, (where r -\,HCO(CH-,)rCOOH (W,%here r 0OS0 2 0H. 0OC0(CH,)rI (where r= 1-20). and -OP(O-Alkvl)N(AlkN'l)2, and R is selected from a group consisting of H. :is methyl, ethyl. propyl. isopropyl, t-butyl. hexyl, benzyl, benzhvdrx'l. trityl. substituted me..titv]. arvl. substituted anI polyoxyrnethylene. nionoalkylated polyoxymethylene. a polyethylene imine. a polyamide of the general formula (-NH(CHI),NHCO(CH 2 ),CO-)n,j a polyamide of the general formula a polyester of the general formiula em (0(CH 2 )rCO~m. an lated silx'l compound of the general formiula -iY 3 20 heterooligo/p olyarnin6icid of t he general formula (-NHCHakC-b 7pdytyln *glycol of the general formula -(CH CH 2 ,O)m-C1HI 2 CHOH, and a monoalkylated polyethylene glycol of the general formula -(CH 2 CHO)m-CHCHO-Y, where m is in the rang-e of 0 to 200, Y is a lower alkyl group selected from a group consisting of methyl, .:~*ethyl, propyl, isopropyl. t-butyl. hexyl, r is in the range of I to 20. and aa represents the amino acid side chain of a naturally-occurring amino acid.

16. An ionized mass-modified nucleic acid molecule, comprising-al least one mass modified nucleotide firm the group consisting of a mass-modified 2'-deoxyniucleoside triphosphate, a mass modified 2',3'-dideoxy-nucleoside triphosphate. a miass-modified nucleoside triphosphate and a mass-modified 3'-deoxynucleoside triphosphate. -47-

17. An ionized miass-modi fled nucleic acid molecule of claim 16. comprising a member selected from the gopcnisting of- a mass-miodified universal primer and a mass- modified initiator oligonucleotide.7

18. An ionized mass-modified nucleic ac-id miolecule of claim 16 or claim 1 7, wherein a mass-niodi fvinio fuinctionality (MI) is attached to S heterocyclic base of the nicleic acid molecule.

19. An ionized miass-miodified nucleic acid molecule of iwv of claims 16 to 18. comprising a modified heterocyclic base selected from a group consisting ofactsn mioiety modified at C-5. a thymnine mnoiety modified a .t C thyrnine moiety modified at the methIr group of C-5. a uracil moi'ety modifigd at'C-S. an idenine moiety modified at a C -deazaadeiiine moiety modified at C-8 a c -deazaadenine mioietv modified at C-7. a -uwiine moiety miodified at C-S. a c 7deaziouaiiine mo ie t' modified at C-8.a c- cdeazanuanine moiety modified at C-7? a hiN poxanthifte moiety i111ified at C-g. a -deazahypoxanthin Ie mnoiety-modified at C-8, and a c 7 -deazihypovmnthine moiety modified at C-7. An ionized mass-modifi ed nucleic acid mol~cule of any. of claims 16 to 19, wherein a mass-iodfyifunctionalitf(NI) is attached to at least one phosphorous of the nucleic acid molecule.

21. An ionized miass-modified nucleic -acid of any of clims 16 to 20. wherein a mass- 20 modified functionality (NI) is attachedfioaf least-one-supar moieti of the nucleic acid molecule. 2.An ionized mass-modified-nucleic-acid mnolecule of haimr 21, wherein the sugar is 9modified at a position -selected from the roup consisting of'an internal )osition, an :aexternial C-2' position; and an extemrdUC position

23. 'An ioniz~d mass-modified nucleic: acid molecule of clalimi 16. wherein* mass- modifying flln~tl'onpalt is attached to at least one~sugar fniolety of a 5- -terminal -nucleotide of thieprimier, apad v, herein the maiss modified function is the linking -flinctionality:(L) -24. An ionized mass-modifed nuclei acid moleculeodf~aim.16; herein amass- triodifringflnctimality injcorporated.into the mnolecule is slected-from a group -48- C C C. CS C C CCC.. S.C. -C C C. C C CC S. C. CC C .CS. consisting of F. Cl, Br. 1. Si(CH-s)s. Si(CH-,)(C 2 Si(CH- 3 )(C 2 Hr) 2 Si(CHS) 3 CHF. CHF,. and CF>, The ionized miass-miodified nucleic acid molecule of claim 16. wherein a mass- miodifving functionalitv incorporated into the miolecule is generated From a precursor s futnctionality (PF) attached to one or more of a nucleic acid primier, a chiaini-elonigating nucleoside triphosphate or a chain-terminating nucleoside triphosphate. and wherein the precursor functionality (PF) is selected from the group consisting of -NH 2 -SH. -NCS. -OCO(CH),COOH (where 1 -NHCO(CHI)rCOOH (where r 1-20). dOSO'OH ;-OCO(CH,),I (where r 1-20). and -OP(O-Alkyl)N(Alkyl)2. to An ionized mass-modified nucleic acid molecule of claim 16. wherein a mass- modifying functionality (N4) incorporated into the miolecuile is XR. whlereini X is selected from the group consisting of-0-, -OCO(CH,),COO- (where r 1-20), -NHCO(CH,),COO- (where r 1 -OSOO- and R is selected from the group consistin.- of H. methvl ethyl. propyl, isopropyl, t-buty 1. hexyl. benzyl. benzhydryl,. 15 halotlen.. tritvi. substituted trityl. aryl, substituted aryl, polyoxyrnethylene. monoalkylated polvoxvmethvlene. a polyethylene imine. NH-CO-(CH,),-COQH. -i\H(CH)CO-)n,,INH-CH- 2 )rCOOH. -(O(CH-)rCO)m0 (CH,)f-COOH. -(NHCHaaCQOH). -(CH 2 ,CHO),mCHCHOH. and -(CH 2 CH 2 1 -CH 2 tCH 2 O-Y, where il is in the range of 0 to 200, Y is a lower alkyl group selected from a group consisting of methyl. ethyl, propyl. isopropyl, t-butyl and hexyl. r is in the range of 1 to 20. and aa represents the amino acid side chain. 617-a naturally occurring amino acid.

27. A set of mass-differentiated tag probes wherein. each tag probe in dhe set comprises a sequence of nucleotides which is complementary by Watson-Crick base pairing to a tag sequence present within at- least one set of base-specifically terminated fragments; the tag sequences'to which each tag probe is comiplementary are diffierent for each tag probe; each tag probe in the set comprises at least one mass-modified nucleotide, and the mass-modified nucleotides are not isotopically labeled and have different mass- modifications in each tag probe. -49-

28. The set ofmass-difterentiated tag piobes of claim 27. wherein at least one of the mnass-modified nucleotides comprises a miass-modil\'ing functionality attached to the heterocyclic base.

29. The set of mass-differentiated tag probes of claim 28, wherein the mass-modified -s heterocyclic base is selected from the group consisting of a cytosine mioiety modified at a thvmine moiety modified at C-5. a thvNmine moietv modified at the C-5 methl- Oroup. a uracilI moiety modified at C-5, an adenine moiety modi fied at C-S. a c 'kleazaiadenine mioiety modified at C-S. a. a c'-deazaadenine moiety modified at C-7, a guanine moiety modified at C-8- a c'-deazatiuanine moietv modified at C-S. a t0 c 'deazaguanine mioiety modified at C-7, a hypoxanthine moiety modified at C-S. a c -deazahvpoxanthilne mioiety modified at C-S. and a c-deazahypoxanthine moiety modified at C-7. The set of mass-differentiated tag probes of claim 27, wherein at least one of the mass-modi fled nucleotides comprises a mass-miodifying functionality attached to the i S phosphorus atom forming an internucleotidic linkage of the tag probe..

31. The set of mass-diffTerentiated tag probes of claim 27, wherein at least one of the miass-modified nucleotides comprises a mass-modifying functionality attached to the sugar moietv. *32. The set ofmass-diferentiated tag probes of any of claims 27 toj 31 wherein at least one of the tag probes further comprises a cross-linking group (CL) which allows for covalent binding to the corresponding and complementary tag sequences., The set of mass-differentiated tag probes of claim 32. wherein the cross-linking group (CL) is activated photochemically and is derived from, at least one photoactivatable group selected lfrm the group consisting of psoralen and an ellipticine.

34. The set of mass-differentiated tag probes of claim 27, wherein at least one .of the tag- probes is mass-modified with a mass-modifying fucIonlt eetdfo h group consisting of XR. F. Cl. Br. 1, Si(CH4 3 3 SiC 3 )2(C 2 'H 5 Si(CH 3 )(C2H )2. Si(C,Hj) 3 CH4,F, CHF 2 and CF 3 wherein X is selected from the group consisting of -OCO(CH-4 COO- (where r 1-20), -NHCO(CH4)COO- (where r 1-20). and R is selected from the group consisting of H.I methyl. ethyl, propyl. isopropyl, t-butvl. hexyl. benzyl, benzhydzyl. halogen, trityl. substituted trityl. aryl, substituted aryl, polyoxymethylene, monoalkylated polyoxymethylene, a polyethylene imine. -(NH(CH),NHCO(CH 2 ),CO-)m-NH-(CH),-NH-CO-(CH)r-COOH. -(NH(CH 2 ),CO-)m-NH-(CH 2 )r-COOH, -(O(CH 2 -Si(Y) 3 -(NHCHaaCOOH). -(CH 2 CHiO)m-CCH 2 CHOH and -(CH ICHI20)m-CH2CHzO-Y, where m is in the range of 0 to 200. Y is a lower alkyl group selected from a group consisting of methyl, ethyl, propyl, isopropyl, t-butyl and hexyl, r is in the range of I to 20, and aa represents the amino acid side chain of a naturally occurring amino acid. The set of mass-differentiated tag probes of claim 27, wherein one or more mass- modifying functionalities incorporated into the probes are generated from one or more precursor functionalities (PF) attached to the mass-differentiated tag probes, and wherein the precursor functionalities (PF) are selected from a group consisting of-N 3 -SH, -NCS. -OCO(CH,),COOH (where r 1-20), -NHCO(CHA),COOH (where r 1-20). -OSOzOH. -OCO(CH 2 )I (where r 1-20), and -OP(O-Alkyl)N(Alkyl),.

36. An ionized mass-modified nucleic acid molecule comprising two or more mass S' 15 modified nucleotides selected from the group consisting of a mass-modified S2'-deoxyuucleoside triphosphate, a mass-modified 2',3'-dideoxynucleoside triphosphate, a mass-modified nucleoside triphosphate and a mass-modified 3'-deoxynucleoside triphosphate.

37. The ionized mass-modified nucleic acid molecule of claim 36, wherein the two or 20 more mass-modified nucleotides are different from each other.

38. The ionized mass-modified nucleic acid molecule of claim 18, wherein the modified heterocyclic base is a c -deazaadenine moiety modified at C-8, a c -deazaadenine moiety modified at C-7, a c 7 -deazaguanine moiety modified at C-8, a c 7 -deazaguanine moiety modified at C-7, a hypoxaniiine moiety modified at C-8, a c 7 -deazahypoxanthine moiety modified at C-8, or a c deazahypoxanthine moiety modified at C-7.

39. The ionized mass-modified nucleic acid molecule of claim 16 or claim 36, wherein the molecule is positively charged. The ionized mass-modified nucleic acid molecule of claim 16 or claim 36, wherein the molecule has been ionized in vacuo and exists in the absence of counter-ions. -51

41. An ionized duplex comprising a mass-modified tag probe bound to a tag sequence present within a base-specifically terminated nucleic acid fragment, wherein the mass- modified tag probe comprises at least one mass-modified nucleotide.

42. The ionized duplex of claim 41, wherein at least one of the mass-modified nucleotides comprises a mass-modifying functionality attached to the heterocyclic base.

43. The ionized duplex of claim 42, wherein the mass-modified heterocyclic base is selected from the group consisting of a cytosine moiety modified at C-5, a thymine moiety modified at C-5. a thymine moiety modified at the C-5 methyl group, a uracil moiety modified at C-5. an adenine moiety modified at C-8, a c -deazaguanine moiety modified at C-8, a, c'-deazaadenine moiety modified at C-7, a guanine moiety modified at C-8, a c-deazaguanine moiety modified at C-8, a c -deazaguanine moiety modified at SC-7, a hypoxanthine moiety modified at C-8, a c -deazahypoxanthine moiety modified at C-8, and a c 7 -deazahypoxanthine modified at C-7. 0 15 44. The ionized duplex of claim 41, wherein a mass-modifying functionality (M) incorporated into the tag probe is attached to the phosphorus atom forming an intemucleotidic linkage of the tag probe. The ionized duplex of claim 41, wherein at least one of the mass-modified nucleotides comprises a mass-modifying functionality attached to the sugar moiety. S, 20 46. The ionized duplex of claim 41, wherein at the tag probe further comprises a cross- .linking group (CL)which allows for covalent binding to the tag sequence. S47. The ionized duplex of claim 46, wherein the cross-linking group (CL) is activated S photochemically and is derived from at least one photoactivatable group selected from the group consisting of psoralen and an ellipticine.

48. The ionized duplex of claim 41, wherein the tag probe is mass-modified with a mass-modifying functionality selected from the group consisting ofXR, F, Cl, Br, I, Si(CH 3 3 Si(CH3)2(C 2 H 5 Si(CH3)(C 2 H 5 2 Si(C 2 H 5 3 CH 2 F, CHF,, and CF 3 wherein X is selected from the group consisting of-O-, -OCO(CH 2 ),COO- (where r= 1-20), NHCO(CH 2 ),COO- (where r 1-20), -OSOO0- and OP(O-Alkyl)O- and R is selected from the group consisting of H, methyl, ethyl, propyl, isopropyl, t-butyl, hexyl, benzyl, benzhydryl, halogen, trityl, substituted trityl, aryl, substituted aryl, -52- polyoxymethylene. monoalkylated polyoxymethylene, a polyethylene imine, -(NH(CH),NHCO(CH4),CO-)i-NH-(CH,),-NH-CO-(CH 2 )r-COOH, NH-(CH),-COOH, -(O(CH 2 ),CO-)m-O-(CH 2 )j-COOH, Si(Y)3, -(NHCHaaCO),- NHCHaaCOOH. -(CH 2 CHiO)m-CH 2 CH 2 OH, and -(CH 2 CH 2 O)m,-CHCH 2 O-Y, where m s is in the range of 0 to 200. Y is a lower alkyl group selected from a group consisting of methyl, ethyl, propyl, isopropyl, t-butyl and hexyl. r is in the range of 1 to 20. and an represents the amino acid side chain of a naturally occurring amino acid.

49. The ionized duplex of claim 41, wherein one or more mass-modifying functionalities incorporated into the tag probe are generated from one or more precursor functionalities (PF) attached to the tag probe, and wherein the precursor functionalities (PF) are selected from a group consisting of-N 3 -SH, -NCS, -OCO(CH),COOH (where r= 1-20), -NHCO(CH 2 )rCOOH (where r 1-20), -OS0 2 0H, -OCO(CH,)rl (where r= 1-20), and -OP(O-Alkyl)N(Alkyl)2. The ionized duplex of claim 41, wherein one or more mass-modifying *b S 15 functionalities incorporated into the tag probe are generated from one or more I-obee precursor functionalities (PF) attached to the tag probe, and wherein the precursor 5 functionalities (PF) are selected from a group consisting of-N 3 -NH 2 -SH, -NCS, -OCO(CH 2 ),COQH (where r 1-20), -NHCO(CH,),COOH (where r 1-20), -OSOOH, -OCO(CH,),I (where r 1-20), -CONH 2 -NH-C(S)-NH 2 OP(O-Alkyl)OH, and 20 O-CO-CH 2 -SH.

51. The ionized mass-modified nucleic acid molecule of claim 16, wherein a mass- modifying functionality incorporated into the molecule is generated from a precursor functionality (PF) attached to one or more of a nucleic acid primer, a chain-elongating .nucleoside triphosphate or a chain-terminating nucleoside triphosphate, and wherein the precursor functionality (PF) is selected from a group consisting of -N 3 -NH 2 -SH, -NCS, -OCO(CH 2 ),COOH (where r 1-20), -NHCO(CH 2 )COOH (where r= 1-20), -OS020H, -OCO(CH 2 (where r 1-20), -CONH 2 -NH-C(S)-NH 2 OP(O-Alkyl)OH, and O-CO-CH 2 -SH.

52. The ionized mass-modified nucleic acid molecule of claim 16, wherein a mass- modifying functionality incorporated into the molecule is XR, wherein X is selected from the group consisting of-O-, -OCO(CH 2 ),COO- (where r -53 1-20). -NHCO(CH4)COO- (where r 1-20), -OSO-,O- and -OP(O-Alkyl)O- and R is selected from the group consisting of H, mnethyl. ethyl, propyl, isopropyl, t-butyl, hexyl. benzyl. benzhvdryl, halogen, trityl, substituted trityl. aryl, substituted aryl, (-NH(CH- 2 )rNHCO(CH)CO)niNH(Ci)rNHCO-(Ci 2 X&COOl{. (-NH(CH4)CO-) NH-(CH,),-COOH. (-O(CH 2 )rCO-)nO(CH),COOA. -Si( Y) 3 -(NH CHaaCO-)m *NHCHaaCOOH. -(CH 2 CH 2 O),,-Cl+,CH 2 OH. and -(CH,CHO),,-CH,CH-kO-Y, where m is in the range of 0 to 200. Y is a lower alkyl group selected frorn.a group consistinig ofL methyl, ethyl, propyl, isopropyl, t-butyl and hexyl, r is in the, range of I to 20, and aa represents the amino acid side chain of a naturally occurring amino acid. to 53. The set of mass-differentiated tag probes of claim 27. wherein one or more mass- modify'ing functionalities incorporated into the probes are generated from a precursor functionality (PH) attached to the mass-differenitiated tag probes. and wherein the precursor fuictionalities arc selected from the group consisting of -N 3 -SH. -NCS, -OCO(CH4,)COOH (where r =1 -NHCO(CfH 2 ),COOH (where r 1 -OSO,OH, is -OCO(CH)1 (where r 1-20), -CONII,, -NH-C(S)-NH- 2 OP(O-Alkvl)OH, and O-CO-CIl,-SH. 54 h e fms-differentiated-tag probes of claimi 27, wherein the tag probes are mass-modified with a miass-modifying functionality (MA) selected from the group *consisting of XR, F. Cl, Br,-I. Si(CHA), Si(CH 3 2 CH5). Si(CH 3 )(C 2 H 5 Si(C-H 5 3 CH 2 F. CHF,, and CF 3 wherein X is selected from the group consisting of -OCO(CHl,XCOO- (where," 1-20), -NHCO(CH,)COO- (where r 1-20), 9 0 -0S0 2 0- and -OP(O-Alky])O- and R is selected from the group consisting of H, N 3 methyl, ethyl, propyl isopropyl., t-butyl, hexyl, benzyl, benzhydryl, halogen, trityl, *substituted trityl, aryl, substituted aryl, (-NH(CH,),NHCO(CH )rCO mNH-(CH 2 )-NH 2 rOO,(-NH(CH 2 )C0-)mNH-(CH,)r-COOH, (0(CH,),CO-)m0-O(CF 2 )r -COOH, -Si(Y) 3 -(NHCHaaCO-)-NHCHaaCOOH, -(CH,CHO),,-Cl-lCHOH, and -(CH 2 CH 2 O)mCHiCHO-Y, where m is in the range of 0 to 200, Y is a lower alkyl group selected from a group consisting of methyl, ethyl, propyl, isopropyl, t-butyl and hexyl, r is in the range of I to 20. and aa represents the amino acid side chain of a naturally *occurring amnino acid. s DATED this 6'th Day of November 1999 R 4 SEQUENOM. INC. Attorney: PAUL-cL- HARRISON 6 Fellow Institute of Patent Attorneys of Australia of BALDWIN SHELSTON W-ATE'RS; 4IP* 0 #*ae ese us