AU9134298A - T-cell antigens, and their use in diagnosis and treatment of T-cell mediated conditions II - Google Patents

Description

AUSTRALIA

PATENTS ACT 1990 DIVISIONAL APPLICATION

S

a a.

a a NAME OF APPLICANT(S): Andrew Dale Weinberg AND Arthur Allen Vandenbark ADDRESS FOR SERVICE: DAVIES COLLISON CAVE Patent Attorneys 1 Little Collins Street Melbourne, 3000.

INVENTION TITLE: T-cell antigens, and their use in diagnosis and treatment of T-cell mediated conditions 11 The following statement is a full description of this invention, including the best method of performing it known to us: QW)PIERWdJ[RI5h35-D1-Z -1 00, I-CELL AN.TGENS, AND THiEIR USE IN DTAC-NOSIfS :UM TRE;AT7hE7NT, -0-O T-CELL MIEEDIATED CONj-OiTIS-11 TECENi CAL FIELD rn~ 4 ~en"on relates 'no~hds fo"c- soc~.' deole~ion of aclziva~ed T-lv,-.ihocvues parcicularly zLhose *belonging z:o the CD4* subclass- Such activ;atecT lymo hoc-vtes e.g. CDA- T-lymnihocvties, are i~~lc~ na number of condit-Ions in human~s 2cdrgm~i sclerosis anid transnihant r ejection. In oa-t"cular, this i in-v ent i an orovidies a treat~ment in w'elcn act:ivated T lymphocytes e.g. CDI4 T-cells invol-ved in a particular disease or condit-on are denletLed while the non-aczivatea T-lymphocyce e.g. CD4- T-cells -reorir _s unaffected.

:BACKGROUND OF TNVENTTON *The CD4- T-lymphocyte (herein referred; to as the CD4- T- 0.0.cell) Is the central player in the immunte system ;u- *of..tlre ;!helpll it urovides to~other leukocy-teo in fiahtina off infection andnpotential cancerous cells. CD4' T-cells play essential rcles in bot h hurneral and cell-mediated immunity and additionally they act during parasite infection to oromote the differentiation of eosinoohils and mast cells. If the CD4- T-cell nonulation is deoleted (as is the case in IDS cati'ents) the nosL is rendered suscentible to a number of pathogens and tumours that do not ordinarily pose a threat to the host.

U

0* Us en.

U

U.

au~om~/ and oths~ diseas= sra-s wa-br i cs1i Cu sq, a nd L -7O.7 n s3 Caszi 4 a 1 o~mmndinseases an vic CD4 -cell ave been i MC II"CaL d incl1ude mu I. i o1 e sc 1 eos_ ~U-a to id a arthritis and autommnunel i' L'se ge ane-aliy, es enS V l .0 Steinman, 1993". Ta ~se e se a se-~ o 5. an aber'ran: imraufl respon'se in wnich th imnm.C;,n system I s subverted from its normal role of ro pathogens and nstead attacksheosbo, sus leading to -ill-ness and even death- Th tar d~ host 15 tissues vary between autoiminune diseases, frr exaamile, in rnultinle sclerosis the immune system attacks the white matter of the brain and spinal cord, in rheuma"oid artLh-itis the irnvivne system attacks the syrioi c) lining of* IrHe joi*nts. Activated CD4* T-cells have a*-Co been zu imulicated in other illnesses, icungrejecti1on of transplant tissues and organs and in the develooment or CD4- T-cell lVL-mphomas.

U

U

U. UI investiaat2-ons into conditions caused bv abnerant CD- T'cei! act~i4ty are focused on several animal models, and in parti.cular on a number of experi mental! v induced autoimmune diseases. Research on chese exoerimenrtally induced diseases in animals is premised on the idea that crov: de zj nZ:C cr several _:e~rienaI 1- r dc aTt m ~sese s 5 animal s, includinga ext3erimnt.l ur encenalomvei (-EE co _acen induced s (CIal and exnerimental au~oimorurne uvei-is(AU A s induced by auto-i:-.muaizi na animalls against basic protel~ 1 3 D a comuonient of thie wlijte ma-Le_ if S the brain and the spinal cord) and oroduces che same clinical sy-iiitoms observed in multiple sclerosis: de-myel-ination ann paralysi-s. P r oof of the value of thei AE model as a comnarative model for multinle sclerosis 0.15 has been prvddby evidence showing chat. these conditions share a causative nexus: Stein'man and coworkers showed that the predominant cell type found in -the brain lesions of multiple scl eroEcis Patients is CD4- T-cells (Oksenerr, t al., -1990) arid that the Tcell receptor (the molecule responsible for antigen recognition) associated with the cells in these brain lesions 'nad the same 3 amino acid -bi-ndi4-na motif for antigen recognition as on the CD4- T-cells responsible for causing ex-rerimental autuoimmune encepialomyelitis

(EAE)

25 (Oksenberg, et al., 1993)_ All the evidence thus suggests that the EAB model will be useful in testing therapies for multiple sclerosis.

w ;ell as inh~~ttanolna'_o ejcLo (S;.a'orc, i .9S3 co'bbold, P. al 193 1. S _iman This an ihody-meiate. erfecz de: le-es or- inac _iv r _es all CDYcells- in the body,/ (ti- an-ibod'=s rc'-'ac birid to n CD4- clls presumably "Jock t~e accivt- o~ re cells and also tEaraet the CD4- Cells tor destrUCTcion7 by the immunIe S syscem.) Thiis str-atecv7, has shown some success withr reumazoid an Lis a'-d is owbeincr tested fOr multinle a sclerosis (see gen-ally Steinran, -93 osmdiWhile it appears that therapeutic aporoach-es that destroy *the CD4dJ T-1Irmpnhocyte population mi&it. be-effective in ameliorating these auto-'.un Q-ess hsaoroach has one very major drwak -h redtment'not only ihbt the rfu_-on of those, CD4' cells that ar antie 20 reactie and thus involved in the autoimmune aisease process, but also the CD4- 'P-cells th.at are omiescent and *not -nvoived in tne disease. cince CD4 '-cells a-z q -~~moortant in. the general immune response (protecting the body against infectious agent-s), destuct=tin or tac entire CDA- T-1Cell rporulatia'- leaves the patient severely -immunocom uromi sed and hence 'highnly susceptible to: nfection. ".preferable aporoach would be to remove only those CD4' T-cells that are activelv involved in the auto- J mi-*S of tr==znr 'nas nor veCL ceen ,_pV T tzh e eoec of 0n re_ -n 00E Cne Ore-'meth-od of s pci-'f .c a I-Iy depi.a :h cnu-aao o accr1vaced T cells a pacieri n ho"afcrn h ries cen: C3-4 T-C-i 1 pC-&iITt:Jon.

4

SC..

4* 6.

.9 4

S

r *S4 555 4

SOS

6

-S

a

S

SU M4)RY OF THE iIVENTION in one aspect- tole nresent irvention Drov.,ides a method wiac'. auto-antigen s-oecaic e-els es ic Ia 1 1 v or examnle actav-,ate6 T-cells, can b e soe=_ci_4fic a1- 4i5 el imin ln7Vw~e leavina the oues cen t 0 onrulation of T-cell-s especiallv for ercamnle uativae 86 CD4' T-cells intact This inventiLon therelore Provicdes a -reatmr-nt useful for T-cell maiated esnoecial-lv for example activa-ted CD4' 7-cell mediated autoimmune d-iseases such as mulcioule sclerosis, rncuwatoid aurts sarcoaodosis anci auto inrmune uveitis, graftz versus host disease (GVIHD) and/or in~lammatorv bowei~disease. Thi,;s anvetlonalso orovides a method for eiiminating t undesired immune _esoonses caused bv activated T-ceils es-oecj_:>;j for example activ-,,ated CD4 7-ceIls such as rejection of transplanted tissue and oro,,ans in transoaot recilants. F',urthermore, the o__sec invention providtes a method of specifically elimninating actiJvated CD4' T-cell v- s an o a~re -i,!--znmS c a o n z e no Cs o c t i -T27 anhi can ECic'tate earl,- rej ,_oacndition than mian: Gth-rW-.se !re zCosi-.Le The presen:. i4r ven.-_1on is also based an the discovery2 cnap a oauci~ ~t-n anti-,gen. te xe O- 0he I-n SO- ererren to as th OXT-_0 anti4.gen), is sp c c aex-ressed on t-he ce&- surface of antiJren activated T ceils especially for exampole activated CD4- T-cells. 7 parzicular, -is.4a the EAE disease 7mcdel in-7 rats, this antiaea, was Sho1w0 to be exzrassed on the surface cf *act ivaLL- au~oanct.aen-soeciric CD4 T-ceiis present atth 20 ~o n~main(h onIcrd rt his drsease mod) but: absen on CD4- T-cells at non-nljaor Sites. Furchermore, th'e hig±hest e.oression of this an" 4 ae on~ these CDA- T-cells was found to occu-r on the day Diorc- Lo initiJationa of cinical sicns o aum.n~;rE a-"rssin of zt-ns anriicen decreased as ted%s~ cr'oa-essed. The specifici:v of expression of the OX-40 antigen arid the transient nature this exDression, shown fo-r the first time in the present *6 0 a 0~ a .a a Oa a *000 cr Is avr clone- a a nulm c~ a-Ing Liia s e-i-ce sn-c-.n in ZZ= No o- tsun-seauence of S7Q ilD No, I whicih =--codes an ann~crrclv'~neo de; Cr ann or all -neroor a coMM1e-me-nzary strand r-o ofy Eis a_ I C uc'Ivsub-secaience of cE oD No p cmr is n uc I -ct idi, baSe s Cc 8413 sh'orwn in S I ID N.,o 1 or c o -mo imen "Lar v s ir a n d -rt ar a=ccordan i n-entiozl there is prc-vided a poo'veocle comrisina an a-mino acid seauence encoded bv a urecacid as described above or- a derivat ive t-HerCeorf Suitablyv t-he polvuotide cormn-rises ar:w~ acid secuenrce encoded bli a sub-sea-uence cf nh-e secojencesnw nSE.Q TD No 1 ana -wnic' include;s an a ei d 2 nan.

Atmoncz oL-ne var-iarts of nucleic acid secuences anda oo~oo~cescoremnlated by che invenrsion are~ fcr exauoe DNA. secuence va-riancs 1mC nance e-ncoded amtino acil seaiuence. T~en th-ere (fo-r frt- 0 r examol e) seacuence variants lmooroLa "conservazi-vel a-mino acid cianue s eq changces from one acidic amino acid Lo =-07ner, one ;nznnoz4 ~ne~,as W=s 1e± r~ c-:ere areor::nl V-Ln CO 4n'Z to a'ieii varian:s in he encodec pob'meotide, and othe vrint thtresult! in olyp=etj-ticies of anzticeni c os--re;acz4vj t and/or similar_ *Cirdinc Snec~i. Fc v.

he a ntig en ici C) t~ 0* olv-eoie a-3vr~~ me,tion-d i~ n ncfiaininclude for exaa i 1 anti:cenic determ.inanzs shared or c_osS-ractive witn'~-- OzX-AO aritigen as ericoder. byV Sea TD No. I, eg ancige _J Dolvne-otides wncn-' dezerZmiJnant-s tihat are sinared with) determinants of QX-40 that are acca sibli to 'speclc bindincr aaents when ::he OX-a40 is present_ on a cc! 1 l surface.

s~moly zindcn a nr. argen on a particular cell type does n~ot -crovi ie a: basis for a theraoeut.ic aoproach wh'Cn 2 reouLir-es de-olet-ing the particuilar cell cti-oe. Thus, manyv jo._iens are shned fron the cell surrace and are-noL suitable as taruets fror thranv. A frhrasoect or Lal nvt 4 o c he disco-very that a sroecific binding acent such-nas an ant--ibody raised agoainsc "the oroteln andc conjugated co a cvtotoc-r ca~ nhbthei vaitron oliferation of antigen activatedCITcls Th.is di-sco~very. imtolies that the OX-0 ancigen is rapidly -internalized by CD1 T cells- Additional research based o n "U s v~-e r' le zo ar '7rt-ant- COC-s ofZ~ artigen activ,,ated CD4* T-cll car be deplet-d ;r,vo.

coniucating a srOcCzr1C hlnAi= a genti such as an ancibody raised acai nst the OX-40 an.ige7 with a ny~t~ flt Procuce an Irrimunotoxin, arid ad,-i4n ei~c:4 mmunotox~n to a nos!-. Tn this mannaer, thle antibod binds to tlln OX- 40 antigen on the surface of activated CD4' T-cell. Int-9.rnali zatton of the immuzltooxln 0 resul ts 4 n the cvtotoxjin being taken into thne cell, ic Droduces cellI death. Hence, administration of this immunotoxin to a host sufferiric from activated T-cell (eg CD4' T-cel 1) mediated -inflamination deoletes (or ot-herwiise iaactivates) the activated T-cells especi ally for example activated CD4' T-ce-Ils atthe site- of inflammation or other sites, leading to amelioration ofE subsequcent inflammation and/or other clinical signs of disease.

*0 0 o e *0 en.

*CQegC p 0 0* 15 00 *000 0* 00 0 A furthter asnect of the present invention is therefore a io method of treating a patient suf-fering from a condition mediated by activated T-cells e.g. CD4- T-cells, whicn comrrses administe rig to the patient an effective amount of a suecific binding agent which can scecificallv bind to L Do!Yopeotide as described above, eg an antibody conjugatied with a cytotoxic acent wherein the antibody recognises and binds to tile OX-40 antigen Present on the surface of the T-cells, especially for example activated CD4 T-cells.

Prticulr ehosof:n n uea zod F~ red-c ic_- poula-i= f T-eT-csei ex--ress an OX-40 a:ticgen na uman 'nost ri a mechod of 11- -a -~rmue inziammazion In a patient sufferina from multinle sclerosis, which methods comprise ad seigan e-frective amlo=fl of a specIfIc d_' agent of the in.:vention.

In particular the specifEic binding acent_- used 4in riheset0 methods is an antibody conjugcated witih cytotoxic agent (an immunotoxin) wherein the antibody- recoganizes and binds; to the OX-110 anticren present on the sur-face of' the T-cells esoecially for example activated CD4I T-cells.

Alternatively ::he method may employ a specific binding agent which comprises a Fab, F(ab2)2, or Fv fragment of a monoclonal antibody capable of recognising Ox-q0 antigen :0 when expressed on the surface of T-celis. other specific binding agents useful in this method are imrnunoglobulins capable of cytotoxic-=etrect on cells bearing Ox-40 on 20 their surface or any specific binding agents which can 0 rix, complement. or mediate antibody-denendant cellular cytotoxicity such as a specif ic b4-irnig agent which has or is linked to structure characteristic of the Fc region or an immuncalobul-in of murine type cqG2a or human type IgGi or IgG3.

The methods of the invention are apolicable to any condition mediated by activated T-cells especially for exmmm:±e act~'za[ted CD4 Tciicui'c ut~j scl- sis, sarcoido- a a r uveizis, T-cell lymphomnas and rel acrion ofaorcan or ti ssue Addfi-*,-onal condk--cio. s to wh-i ch tn js matethod is applicable include graft-versus-Host disease or reaction and inflamrnatorv bowel disease- T-ceills can !De acztivate. bv for example an- iens, su-pe-a:nt-iqos, mitogens, or imo:7cion-.-al antibodies.

S.

*9 o S*.S*

SQ

0S *S S 0*SS 9 9*

S.O.S.

S S. e* The me thods o-F treatment se::othi the- oreceding mavaarauh- will oreferab-1v be per-ormea usinq soecjtaic binding agent-s such as moncional antibodies, or raaens c-heeof, can be= ra-,sed us ing tnhe nolvoectides of the invention. In a more prerferred embodiment, the imno~clonal ancibodv willI be a humanized monoclonal antibody. In alreracive eraoodimen-s, the metho '1.1 u~ 1 z a ooic conjugate, eg comprising Sfragment such as a -Fab, or Ev -Fragment o: a monoclonal ant-ibody conjugated with a CYLttoxiJC agent wnee~nthe fragment of the moroclonal ant--ihodv recognizes the OX-40 anticen.

This invention also encompasses specrr-fc o 4 ~'ding agents such as monoclonial antibodies haVina a 0uciictvo binding in cells to substantially only antigen activated T-cells especially for exam-ple activated CD4- T-cells. In a Preferred embodiment, the soecific binding agents can spec-i:jc al In o a no!lv-ep J e of r-n i n Part--icular specific binding a certs szDec-Iiicail~v bidto human Ox-A40 of amino acid sea-aence encoded by che coding region of nucleic acid sequence S&Z ID No 1, said 4 0 is Qresent on the surface of activated cellIs.

*4 *e 4 *4

S

S

5~54S

S

S 15

S

S.C.

S *5 *4S* 55

S

A

These specific binding agents suitably comorizse an antibody bindi'n domain and are oreferably monoclonal antibodies or bindirng fraament-s thereof. -4S menticiued above, the antibodies will preferably be at least partLially humanised, and so most preferably comprise a humanised monoclonal antibody.

'Specific binding' refers for example to specific noncovalent molecular binding such as that between an antibody and a corresponding antigen or hapten (its "binding partner") and also between ot her snecialised bindina molecules and their binding partners.

OS

55* "At least partly humanised", relating to antibodies and to their binding domains, means that: for examole embodiments are contemplated in which only the constant region (CH and CL) may correspond to human polypeptide: alternatively, both the constant and variable regions may be "humanised".

Another aspect of this invention provides a specific binding agent such as a monoclonal antibody as described a ove w,-,41c ru rce r c 0m 1r1's e s a wo I -cua r yli-,e cova-ient:I conugaredcytotc~xin- A t iho 0dvc L otox;~ conjuat.s (also known as immuncox'dns) are suizable o use in the meth ods of" treatmentL aescrined aboove.

Examcies ofsuch specific binding agents include Fab, or Fv fragments of a monoclonal antibody conjugated wizh a cytotoxic agent.

For therapeutic use, tb-- specific bir'd.inc agenc3 of the invention are suitably administered in the formr ot a e* pharmaceutical compositi4on which include a phar-maceutically acceptable carrier. The carrier may be sold or peerably liauid carriers such as 'wate o S saline, which are conventional in the art.

A further aspect of the invention comprises a method of detecting a condition meodiated by activated T-cells, e.g CD4* T-cells, in a patient comprising contacting a so~ecific binding agent- as described above with said Tcells and aruantifying the level of activated T-cells.

Suitably the method is carried out on a biopsy sample trom the patient, such as a skin or intestinal biopsy sample or a blood sample from a patient suspected of having a graft-versus-host disease, or an intestinal biopsy sample from a patient suspected or having an inflammatory bowel disorder, or a sample of cerebrosoinral fluid.

A zurzler aspc:_ of -he puresenu fnvn~z.c is a mez-od of aetLectlna an inflammatoZ"v Conalclon madiated by actjivace; T-cell-s esceciall'Y for example activated CD4 T-cells in a oaulent bvobr).ai-ninca a sutbebiopS.y samp le from the 5 atient_ and then, uuantif~ving the nercentage of activated Th-cells esioeci ally for examole activated-CD4' T-cells in th-e biLopsy samzple usincr a soecific binding agent sucn as an antibody that specifically binds uo the OX-40 antiaen.

Othcr aspects of the oresernt irzvenr-ion include test kics Lcr det -cting conditions mediated by activated T-cc-I~s esuecially for '-Xample activated CN4 T-el, and treatment kits romprising antibody iri pharmaceutically administrable forms and amounts with suitable excoients and conLainerS'..

in particular the invention provides a kit: for detecting *a condition mediated by activated T-cells e.g. CD4' Tcells in a patient comprisinq a spec-ific binding agent as described above which is l1abelled... Preferably Ithe _M ivin provides a kit for carrying out a specific binding assay for detection or quantitation of an analyte that comprises a polypeptide or a specific binding agent as described above, wherein said kit comprises a firsu reauent comrisina a speci-fic binding agent that can recognise the analyte, a second reacentL comprising a substance that can bind specifically either to the analyte or to the first reagent, and a label for the second reagent.

_rj such' a k'r ::he nirst recetn comorise an anti body soecai for tne a~nalvte, and the seccnd reagent comorl"ses a lab-elled an tinlo u-1i n szecifcic for the first: reagent.

Alternatively be fi rs reaaient can comor-ise an immobilised scecific 6indina reacient for the an-alyte, then the second reagent is a specific bi nding agent th,-atcan bind to heanalvoe,.- wh'-en the analvte is also bound to the fi~rst reagent.

In a further embodiment wherein the second reagent comprises a substance aole to compete with analyte for binding to the first reagent.

I*

C. 4 4.4.

4* C. CC.. 4 *4 4l For use in this method, the specific binding agent may f-urther comp~rises a label such as a radioactive label or a fluorescent label and-these specific binding agents form a fL.:ctber aspect of the -invention.

444* The specific binding agents of the invention may he cloned and sequaenced in the usual way. Thus the invention furthier provides a nucleic acid seo~uence encoding the amino acid seauence ofE a specific binding agent as described above.

Recombinant technology may be used to prepare both the polyopeptides and the specific binding agents of the 10 a 4 4.

*44.

*4 44 44*4t4 4* 13 invie n: shu asro~ io ve c tor2s, r a ns for ed h-ost organisms and mner_'Ods c pr-- Which include cuiturin Los orLs c- nt as;Dects of the invent'ion.

The OX40 binding agent: -fr instance an, azti-OxqO monoclonal antibody, can be adm--iiinistered to those patients suffering -from a disease imeat:ed by acti-vat-edT cell 1 s cr. cra rt -versus -host dibae. -h amoun-t admninstered willI decpend on the amount reoquired t-o nroduce an imo~rovement, either Dartial or total, in the oatient's symotoms. This will deneno not only on the severi4ty of the condition and rout e of-I administration bu: also on the administration of other therapeutic agents (eg glucocorticoids, cyclosporine A, orednisolone). The 0X40 binding agent may -be injected either sytemically (eg intravenous) or locally (eg incramuscular) As discussed elsewhere thd 0X40 binding agent may bp. coupled to a toxic substanrco- for maximumi the_-?euuic~ef-fect.

4 44 4. 4 4* 44

I

44..

444.

4..

OX-40 and Graft Versus Host Disease (GVH4D) in the case of GvPID, immunocomoetent T cells derived from the donor tissue or cells attack recinient tissue incl udi ng skin, gut and liver, which are severely compromised in their ability to carry out their normal function. Such attacks, iJf not controlled, can lead to death of the natient. The therapeutic agents of the present invention could be used to block the activation of or t:o =1i-cia-e the cdonor T cells ieeh revenr.inc or haltina tdie disease Process.

and GvED: diagnostics The oresent -invention can be used in diagnostic tests and proceauresa ir. Frasac the 0X40 binding agenL can be used to determine the presence of 0X40 T cells in biopsy sarmn 1 from a patient_ The 'niocsvr samole may,, be a tissue samnple or- a samuk ofr blood. Mononuclear cells isolated from the blood or tissue according to standard techniaues (see Practical- Tr,-munology. L. Hudson and FC Hay, eds- Blackwell Scientific Publications, Oxford) and stained with an anti-0X40 antibody or 0X40 bindina a gent fusion protein. The presence of the 0X40 binding agent is then detected with an anti-globulin reagent- coupled with a fluorochrome such as fluoroscein isothiocyanate or phycoerythrin and the number of positive cells analysed on a Iflow cytomreter or by fluorescence ma-croscopy (see eg Practical Flow Cytomecry.

Shapiro, ed. Alan R Liss, New York; Practical immunology. L. Hudson and Hay, eds. BlackAwell Scientific Publications, Oxford).- Alternatively the tissue sample is orocessed for immunohistochemical staining by standard techniques (see eg Tr unod0ytoc hem istLry: Practical AQolications in Pathology and Biology. J. Polak and S_ van Noorden, eds. john Wright and Sons, Bristol). The 0X40+ population of cells could be further characterised by two- or three-colour eo~- r Im'un'sozmsrj( rcz:ical Zlow -tmr. oH .ed-la, Yor0; mmunoCVtLoc-_JsrV Pr=ct icI Cns in~< Parnology- an 3Biolog. j. Polakc and S. d~NO~en.'en john Wright and Sons, Bristol) Detection of 0XI-0-- cells can aid in the diagnosis and management of d caused by activated T cells e.g. 4 n:Iammacorv bow;el disease and GvHD and may boe used to follow th'e Course Of the disease: an -increase in proportion of 0X O± c e1, s would suggest a worsening of the d~sease and may indicate 0 the need to increase the dose of therapeu tic agent ,being.

administered, while a decrease in the bro-portion of'_OX4O± o cells would suggest an imcroverent.ani thus indicaoe~a diminution in the amount of: therapeutic acrent being administeredi.

Determination of the levels of 0X40 cells in the blood of patients at Irisk of GvHD (eg following allogeni-c bonemarrow transulantation) may allow one to predict thre o imminent onset of GvHD. Early administration of lmmunosuppressive agents to control GvHD will improve the likelihood of successful treatment.

The oresent invention can be used in diagnostic tests and pr-ocedures in vivo. For instance, the adiministration of an 0X40 binding agent coupled to a radiLoisotoiee can be used -for the purposes of immunoscintigraphy.

4 C C 9 .9 0*99 *0 e* *9 9 9 9t .9 i9 oeco mor adlveo~ Yn: rom:hefolowing guires and desc ipon c= "ne nn n DESCRIPTION OF THE DRPAW7NGS Fia. shows dot olt frmafuorescence activated cell sorti-g (z*aCS) aucara~us s-owirc ti*ssue szec4fic dua exorss~lon of RT7.2 and ZThe MRC OX-0 antlaen.

.zw.Dhcvtes were isolatc, d fromhe various tissue comoarzments designated in tih~ figUres duin he onset of EAE. The cells were soained with The 0_,K-0 antibody conjugated co Fi-uo-rescein -isoioat (FIT-C) displayed on the x-ax-is and counterstained wi.th a R-Phycoeryt-hr-in conjugated to teRTI7.2 antibody displayed on the y-axis. An isotyoc matched control antibody was used to draw the quadrants for both the FTTC and PE conjugated Abs. The OX-40 antibody was ositive or,- the donor.T-cells isolated from the soinal cord, and 8, 2, an'd 1.8-1 positive for the donor cells isolated from th.e CS?, spleen, and blood respectively- 9.

0 9 9009 Os *9 C 99904 o 9 9909 Fi1g. 2 shows dot plots from a FACS aoparatus showing a time course of OX-40 expression on donor T-cells isolated from the spinal cords of rats with EA.E.

Lymphocyzes were isolated from the spinal cords of rats during the time course ofc disease. The cells were stained with the OX-40 antibody (FITC) and counterstained with a PE conjugated RT7_2 antibody. Anu isotype matcned ccrzro-: anzr1hody was usa :Cr Iorn the 77 Cn con ua- The a ofth RAE tmecourse for =each clt~ ~iated on Toe con oft-'- arachs and tIoe EQCSeCsC score (theSvrvo h clinical- signs and disea=se score is ocrovided ir met-hods section under do-ti-ve Thas;-o s snown in parenthesis next toc the dc=v of disease. The e rc e:nta ue. of R 7 .2 c ellIs ere= -77, 75, 31 3 7, anrd S 2 r es-,ectivelv for Days 0. 1, 2, 3, and 5after diseela.onset- The OX-a'0 antibody was 54 posit ivE for the donor .99: -cells on Day 0 (day before onset and 41, 30,S1, and oositive on, days 1, 2, 3, and 5 respectively. On Day e5 the EAE scolre of means the animnal had minimal 9 cliniIcal sIgns or oaralysis (less ta1)but was not completely well.

-Fgure 3 shows TO?. Vfl expression in OX-40 nositive and negative sorted DoDulations isolated from the spinal cords of Lewis rats with EAEH Lewis rats were actively 0 imnunised with rnvelin basic Protein ir' CFA. Spinal cord Otto lymphocytes were isolated at the onset of disease. The cells were immediately lysed after the OX-40 sep~aration, the _RNA was isolated, and analy-sed for VC T cell receptor gene usage. Tn the botitom two panels the cells were sorted with the F CStar (Becton-iesoSnOSC, while the top oanel compares the unsorted populaticn.

The unsorted cell oooulation was stainea with the V98.2- FITC antibody and showed a similar positive Percentage as Aiser-'-o w7tn dn a EaeiLnaz 1

I

*I

*4 8 a 0 8*e* a Ce a.

*,J

8955 C C C C C. C B.C C.

0 9 4' sh- e- LO Ox-.0 -C iveC -aeL1s f;:ecr-om sn~znal ccrci ann. 1 pv~ -ode. Lew2s rats were activeyinuisdwnhNPi h spinal cord ivm~ohocvtes and~vro node cell s were i solzated at, il onr ofi er soeted OX,-40 and O0-~Y-a fraccions, cul'ure E or 5 d avs, and. were sLtimulated the cnccresooncra annice'_ -h uino_ ea 0 soinal cord pcpUlation -was cultured I'n IL-2 for 5 ndavs a r d as s v ed iru ec nre cellIs -L e d Irraazated a nnvroc-VteS (APC) and antic-en arid 3[fHj- Thrid-,- was added -48 hr later. Triolica~ wells were harvested onto glass fiber filters 15 hr a-fter -he= label was added.. All oE =r ne cell types (except the unsorted pooulation) were stimulated with Con A- as a control and showed. aoiproxicmatelv 100,000 CPMs for ea=ch group (data not shcwn).

CCI,

Fig. 5 is a g raph showing dose dependent inibition of a n:i ae n sr-e c 4fi 41c CD4' T -Cl c Ioroli f e razi o n by L he conjugate. Varyingc concentracilons of the OX t-im-nc oxinwas added Lo a constamt a-mount of F'1 T-cells, antigen~ oresentina cells and NM3 P (mvelin basic oro-ern- antiaen) 7 -e ooen bars Cn-o the righ-t ofC he grao'n) show the nronreration (represented by -thyrnidine incorporation) of these T-cells with and without antigen with no immunot-oxin added (Pos and Neg 17" ;z;-and Fia. O'D arewoz~a showi na d osn edn SLon of anrzaqe- soecifc CD4- T-ce- Poloiferation byteOX-AO-e:xozcx-* con-jugate. var-vnq concenrra-iozas or f.ze CX 0 -exortcx:rni was added to a constanL amou-nt of LI T-ce~is [Fic. or Lewis T-cel-,s (Figu. a-pC, and M3P. The oneni bharsz 0o "tc, c:nt: of -:raohs) C)ow the -oroli1;feration (renresented by L 3 I-th-yfmidine irccoaction) of these T-cellIs wihand wiLthouc anzrae 4c r (Pos and Neg resoectively) Tihe assay was carried out in a 200 p1I volume- Fig. 7 is a graph- snowing dose dependent inhibition or PPD antigen specific CD4 T-elpro ~atio byth Z' 44l -1i' t-o -b h conjugate. Varying concentrations of the immunotoxil) was added to a constant amount of Fl T-cei ~~rj~iq nresenting c6 1 s (APC) and PFD (antie) Th onen bars (to the righat of the grauh) show the oroiferation (reoresented bv 3 EJI-t-vmidine i-cornoration) of these T-cells with and without antigen (Pos and Ne; respectiv-ely) .Th e assay was carried out in a 200 ,l vo I m-2 Frg. 8A and Fig. 83 are two dot olots from a FACS apparatus showing characterization of lymphocytes isolated from the spinal cord of rats that had been tretd withn a 400 pg dose of OX-40-4ca- i. EA .or were transf'err-ed intLo irradiated 7Lew,,is recipien ts and was giver on the same day of transfer. The transfer p)oulation was detected by the RT7.2 antibody conjtigated to PE (re-presented on th-e V-axis" and counterstainei with the control antibody anti-rat IgM-FIT-O.

to Figure 9 shows OX-40 immunotoxi n tZretment administer-ed on thne first day of disease onset. Fl1 MEP specific T cells were transferred into 8 iraitdLewis rats. On the first day of disease onset 4 or the animals were Go*:0 treated. with 400 gg of OX-40 irmunotoxin and were compared to the untreated "Control", animals. After treatment, both groups were scored daily until the clinical signs of EAE subsided. Each point on the graph represents the MearL clinical score of 4 -animals for the C trreated a'rd control groups. The clinical scores. wexe 4 treated on the same scale as described in orevious fligures.

Figure 10 shows effect on donor positive (MBP specific) T cells isolated from the spinal cord of animals treated with OX-40 immunotoxin. irradiated Lewis rats were injected with F1 (Lewis x Buffalo) MBP specific T cells (I x 10' cells/animal) .In panels A, C, and E the animals were used as "controls" and received encephalitogenic cells alone. In panels B, D, and F the animals received encephalitogenic cells plus a single dose of immunotoxin i.p. (400 ag/animal). Panel B shows the effect of the treatment given on the same day of cell transfer, while panels D and F show the effect of treatment given the day before disease onset (4 days after cell transfer). All the animals were sacrificed on the first day of disease onset which was 24 hr after treatment in panels D a!id F. The soinal cord lymphocytes were then stained with RT7.2-PE and the percent positive cells are shown in the top right corner. The total ee S .o number of RT7.2* spinal cord lymphocytes are also shown and was calculated by multiplying the percentage of RT7.2cells by the total number of lymphocytes isolated from the spinal cord prep. The EAE clinical score is represented in the top left corner and were the animals o were rated according to the following scale: 0, no signs; o 1, limp tail; 2, hind leg weakness, ataxia; 3, hind cuarter paralysis; 4, front and hind limb paralysis,

DODOS*

0 moribund condition. In this scale a half step means the animals were in between the severity of the numbered scale.

Fig. 11 shows the nucleotide sequence of the coding region of the human OX-40 cDNA and the theoretical amino acid sequence of the human OX-40 antigen. These sequences are encompassed within SEQ I.D. No. 1 set forth in the accompanying sequence listing.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides, for the first time, a method of eliminating undesired immune responses caused by antigen activated T-cells especially for example activated CD4' T-cells. Without wishing to be bound by theory, the inventors made the invention after making findings suggestive that a cell surface antigen, herein termed the Ox-40 antigen, is upregulated solely or a. preferentially on activated T-cells, especially for 10 example activated CD4* T-cells found at the site of inflammation, and that this cell surface antigen appears to be internalized rapidly. Based on this discovery, a e a therapeutic method has been developed which utilizes e antibodies which bind to the OX-40 protein (herein termed OX-40 antibodies) linked to cytotoxins, to destroy cells expressing the OX-40 antigen. This type of therapy will be extremely useful because it is targeted only to a.

activated T-cells especially for example activated CD4' Tcells and leaves the rest of the T-cell repertoire intact.

Activated T-cells especially for example activated CD4' Tcells have been implicated in a number of antigen activated autoimmune diseases, including multiple sclerosis, sarcoidosis, rheumatoid arthritis and autoimmune uveitis, as well as in transplantation rejections. (Swanborg, 1984; Cush, and Lipsky, 1988; Caspi et al, 1988; Cobbold, S.P. et al., 1984.) CD4- T-cell lymphomas have also been shown to have an activated phenotype (Gootenberg, J.E. et al 1981). The present invention provides both methods of diagnosis and methods of treatment for these and other conditions mediated by activated T-cells especially for example activated CD4' T-cells. More particularly, and following the description of relevant materials and methods used in this invention, experimental data obtained during the development of the present invention O0 is presented. These data demonstrate that the protein is exclusively expressed at the site of autoimmune inflammation in rats with EAE on the surface of myelin basic protein (MBP) activated CD4' T-cells. It 0a is further shown that the proliferation of MBP activated CD4' T-cells can be inhibited in vitro using an Santibody conjugated with a Ricin dgA cytotoxin. This inhibitory activity is shown not to be limited to MBP activated cells, but also to be effective in inhibiting the proliferation of CD4' T-cells activated by other antigens, including an antigen derived from Mycobacterium tuberculosis. The OX-40 antibody-cytotoxin conjugate is shown to be effective in vivo; use of the conjugate is shown to inhibit the clinical development of EAE.

Following this, the cloning of the human OX-40 homolog is presented along with the production of monoclonal antibodies to the human OX-40 protein.

Various examples are presented showing the application of the present invention. Specifically1-, Example 1 describes prererred mechods or producing Lhe hiuran OX-40o CDNA enabled by :hne Present invention. Example 2 describes methods of producing purified human OX-40 Protei n, and SExamole 3 describes the production of monoclonal and polyclonal antibodies that recognize the human protein.

Example 4' describes the Production of immunctoxins; based on these monoclonal antibodies, Lhat are suitable..for therapeutic use in humans, and cr-her antibody -con-ugates suitable for-diagnostic use. Example 5 describes the use of human OX-40 monoclonal antibodies in diagnosing activated CD4 T-cell mediated conditions and Example 6 describes the use of the immunotoxins in therapeutic applications_ Example 7 describes kits for the dlagnosis and treatment of activated CD4- T-cell mediated conditions.

MATERIALS AND METHODS AnimalsE -Lewis and Buffalo rats were obtained from Harlan Sprague-Dawley, i~nc., Indianapolis, IN. Twelve week old Lewis females were bred with 12 week old Buffalo male rats to generate the Fl Lewis x Buffalo hybrid animals.

These F1 progeny were used at 8 to 12 weeks of age for MBP immunization. The rats were housed under germ-free conditions at the V.21 Medical Center Animal Care Facility, Portland, OR according to institutional guidelines.

Selection of MBP Suecific F1 and Lewis CD4* Lymphocyte -vnzveLines w ere se cted c cay,. 12 az-[tcr 2mmunI~a iOn 1 insc ren (MSEPI De tail J oISc tcjHIs ozrccedur-e were descr ibed earlier7 (Vandenbark, a E-2 iefl, a 1-ymo'n node cell1 susuension was 5 incubated wit h M3P (30 pg/mi) in R MI 1640 with 1 autoloocus rac serum- After 3 days at_ 37aC in a CO, atmosohere the cells were cultured in RPM: with 10. harse serum and I- 2. The T-cel' lines were maintained inT- this *medium untili _'he rate of division slowed. At this point 000010 (7-14 days after IM2L' stimulation) the cells were restimulated with 10 pg/mi of MEP Presented by irradiated Lewis thvmTrocvtes, and subsequaently excnanded further in TL-2 containing medium.

:5 Adoptive Transfer of EAE Activation of the Fl or Lewis T-cell lines for passive transfer of EA- was carried out in 10 cm' culture dishes using 5 x 10' T-cells, 100 xc irracdiaced ARFC, ano 10 pg/mi MD2 in 10 ml of medium.

A-fter three days of :4ctivation the blasts were counted and 5-10 x 106 T-cell blasts were injected with the associated APC copulation i.p. into irradiated (600 rads for the F1 into Lewis transfers) or non-irradiated naive Lewis rats. The naive allogeneic recipients were irradiated the day before adoptive transfer. The recipient rats were inspected daily, and the clinical signs of disease were recorded and scored as follows EAE: 0 nlo signs; 1 flaccid tail; 2 ataxia; 3 hindquarter paralysis; 4 uadriolegic/moribund.

Cell Collection Cerebrospinal fluid (CSF) was collected by performing cister-na magna puncture using a 27 ga x 3/811 needle with 8' tubing (Abbott Hospitals, Inc., Chicago, -The CSF was diluted in RY~'I 1:4" and viable cell numbers were counted. On average, 100 p1/rat were a: collected. Samples were excluded if the RBCr-.TSC ratio 0 a' exceeded 2:1. The b1o was oi "t-ained by hear-, puncturce the lymphocytes were separated Qn-Ficoll-Hvmaque as described by Kruisbeek, 1992. The spleen cells were pushed through a wire mesh screen and the R3Cs were lysed by tche. N-HCl method (Kruisbeek, A.M4. 1992) Soinal Cord Lvmnhocvte Isolation Spinal cord mononuclear S ao* C cells were isolated following a modified version of a OV. published protocol (Bourdette, D.N. et 1991).

Briefly, spinal cor..ds were isolated by insufflation, washed 3x in RPMI in orde r-to remove any contaminating blood cells, homogenized, and then passed through a wire mesh screen. The cells were then washed and resuspended in isotonic Percoll For each individual spinal cord a 10 tnl step gradient was poured into a 15 ml conical tube. Each step gradient had 100-1 (2 ml), 801% (4 ml) and 40'- (4 ml) isotonic Percoll and the cells were layered as part off the 80%1 fraction. The interface between the 80/40% Percoll steps was harvested and the cells were directly spun down and washed. The res ina and blasting poula."ons as assessed by forward scatter. a tyD ical yield lwYnocy-Les Ortained. tom the sui nal cord of animals wilh EA2 wa usually 0 .5-1.5 x 1W~ cells. L-ymohocyte recovery was fairly consistent throughout the disease time cour-se, and decreased duri-a the last day of the recovery phase of EAE to 1/2 or 1/3 of the maximal cell number.

Fluorescence activated cell sortinaT (FACS) anaivsis o r the dual fluorescence analysis shown in -Fig. I and 2, the antibodies used were the RT7.2-PE Ab CPharmingen, La 0:::0Joll-a, CA) and the MIRC OX-40-FITC Ab (Pharmingen, La jolla, CA). All! the analysis was performed on a FACScan 15 with the FACScan Research Software Version A (Becton Dickenson, San Jose., CA) operated according to the manufacturer's instructions.

Antigen Specific Proliferat.-ion Assays Proliferation assays were per-Formed'in 9G-well Dlates as descrihed previously (Vandenbark, A.A. et al., 1985). Briefly, 2 x CD4- T-cells and 1 x 106 irradiated thyrnocytes/well were incubated in RPMI and rat serum along with antigen and varying concentrations of the immunotoxin or the toxin alone in a 200 p1 volume. The cultures were incubated for 72 hr, the last 18 hr in the presence of 0 .5 Eq -thymidine. The cells were harvested onto glass fiber filters and ['H1 -thymidine

S.

SbS

S

*5e S

SOS.

S

S.

S

*SS

S

S

S

S

3 1 uota-ce was assessed by au i d _at1nCR were calculazed from triolilsz 7-,n fro reo_ L~ca=te wells varie from Elhe mean valuaes.

S OX-40 Irnmunotox-in Inhibition of EAE Naive Lewis rats were injected with an encephalitogenic dose of NIRP 0 soecifir-c CD4* T-cells injected in one flank and injected with the immunocoxin at the same time in the opposite lan originally a dose cucve for the immunotoxin was 0 set up and the oQtimal Cose was found to be between 300-500 pg/8 week old rat. As controls the same molar amount -of the toxin alone (dgA) was given to animals in parallel.

EXPERIMENTAL RESULTS One of the keys to understanding the mechanism(s) by which autoantigen specific T-cells destroy self-tissue is to study the diffezences anssociated with an autoreactIve T' llat the site of fr~Iammation versus a non-inflammatory site. To'this end an experimental model system was set up in EAE to detect the cells that cause the disease i .n -vivo.

E~kE can be induced by the adoptive transfer r -in vitroactivated MBP specific CD-1 T-cells into naive recipient rats. Four days after the transfer the animals start showing the paralytic signs of EAE- To allow detection of the donor population within the host, MBP specific F1 (ELewis x Su Falo! CD4" T-cel-swr rn~erdit Irraiated Lewis recinienrs. L ews aa du f f:al1o rats exuress allelic viariants of. an enitooe of Lhe CD4-5 cell surface molecule. These allelic var~zan s are termed.

RT7.l (Lewis) and RT 7.2 (Buffalo)) The RT7.2 allelic marker can therefore be used to detect the F! T-cell in Lewi-s hosts because these cells express both forms of the allele while Lewis rats only express the IRT7_1 form of t he allele. Thc CD45 mol-c-cule is expressed only on *leukocytes and constitLutes approximately of the tonal surfrace Protein.

VPia. 1 shows that on the first day of disease onset *of the MEP sppcif -tran'sferred population (RT7.2P) was positive for the activation marker OX-40 at the site of a inflammation (spinal cord.) but the transferred o population was negative for this cell surface antigen at *the non-inflammatory sites (blood and spleen). This suggested that the OX-40 antigen was expressed on thhe cell surface of autoreact-ive CD4- T-cells upon antigen recognition in vivo, because the M22 antigen is present on the T-cells in the spinal cord but not in the blood or spleen. The highest expression of the OX-40 antigen on .the donor population isolated from the spinal cord was on the day before clinical signs of EAE and as the disease progressed this cell surface molecule went away (Fig. The V138.2 T cell receptor (TCR) component is believed to bt te oredcm i nt.~ genea crcc- c as sociaedwh Lcen sw;eciflc CD4- -1 cellrepn othmao enceon'alitocenic eolcOOC of mrvel~ bai MPP) i4 Lewis rat s. Lewis rats were actiively immu--nised -with MBP, and OX-40 nositive and necat-v-- cells were analysed for antigt-4v-ac-v-vv and TCR Y 3 utiIisation (Fig 3 and 4i) *Sorted OX-40- T cells isolated from the s~inal cord were highly enriched for exocress--on of the V,68.2 T cell C receotor compcnent compared to Oh~ X-40- or unsorted spinal cord populations (see Fig. Figure 4 Oshows that whereas both MEP and PPD reactive T cells sh1owed enriched reszonses in the OX-40- fraction of the draining lymoh node, only PM11? reactive T cells were found in the fraction in the inflamned CNS. These data k 5 demonstrate the selective ability of the OX-40 antibody to mark the autoantigen reactive pathogenic T cells within the affected target. organ in EAE. These data strongly suggest that Ag spec-ific T cells can be isolatad and characterised at the site of. Thflarnrnetion with the OX-40 antibody, thereby diagnosing the cell type directly involved with inflammation caused by autoantigen recognition. The data also imply that isolation of cells will be useful in identifying K3 biases and autoantigen specific cells within inflamed tissues even 25 when the antigen specificity is unknown.

Therefore, the OX-40 antigen is shown to be expressed ex vrivo on antigen activated CD4' T-cells and, furthermore, 44.

.4 644

B.

tLiis anticren is shown to be excius-ije'iv es s eC on cells at infl_=mrnjatorv. sit-eS thr the anrciaen is prese-.1 (OX-4o is not exzoressetd on cells at non- inflartmlatory sites in thne absence o. alnti aen-) These resul-s (the transient nature and target organ expression of: the marker) suaested that OX-40 may be a diagnostic marker and a suitable target for antibody mediated deletion of activated autoimmunie CD4' T-cells.

The deletion of ;alective subsets of lympohocytes can e mediated by antibodies or other binding proteins in viva. This can be done either by choosing an antibody or other binding molecule which upon binding to cells ex~ressin- OX-40 will then activate other effector cells or proteins of the immune system to destroy the targetted cells: examples of this include lysis of cells via activation of the complement cascade or via triggering of antibody-dependent cellular cytotoxicity (ADCC). (see Hale et al 1.583, Blood G2: 873-82: Greenwood et al 1993, Eur.

J. immunology 2_3: 1098-1104); or byptodifying the antibody or binding molecule such that a toxic agenL iJs attached which will kill the cell upon binding and ingestion.

B

SB,

4 04 4534

OS...

Cal a*.

It is possible to modify binding proteins, monoclonal or fragments thereof by a variety of means.

For instance, it is possible by means oE standard molecular biological techniques to construct a cDDLA encoding a fusion protein part of which is a toxin Ceg see 11 aws e:al. I~ 'Procei--- 7-n7'-eerin-ac i:4933;z A~trna~v~v oe can couoz)-e tox~rs, czuzs or- otnr molecu-les to oPrcrneins by standard che'mical cconli na rocedures such as via thnioeth- er bonds (Genniz et a! 1987, J. irnrunoloav 139: 2367).

m 40 0~a4 0 *000 00 00 0 0 -i-u 0000 a 00 0 Several groups hav-,e s-ovn thaz a-nfi-'bodies lin-ked to oi mleculas (tered mmunotox,:insI can d~~eecs'al ooulations ex--essincr the acorouriate antiaen (FultZon, et al. 19B8).- The ad--antage o imunolo-xins is chat they are hig-hly selective in:, their target cell specC1Z0v and thar: small doses car, el~minate unwanted/nocentiallv har-mful calls.

to 4 00 0040 Oa *0 a 0 *OSO*0 000 A variety of cytotoxins can be used to produce immunotoxins. Ricin A chain-antibody conjugates have been used to delete both normal and neoplastic ymphccytes in vivo and in vitro, (Fulton, R.J. et al., 1988; Street, E. et al., 1987). other toxins such as Pseudomonas exotoxin A and diD1htheria toxin have also been conjugated to antibodies and used to kill1 speci-fic populations of cells (May;, and Fultion, R.J- 1992).

in the late 1980s and early '90s several human Phase nI/T clinical trials were Performed using antibodies conjugated to th.e Ricin A chain (Weiner, et al.1989; Spliter, et al., 1987; Vitetta, et antObcG-es 5CZc_,_ C ace anIe-' art ower I-e tor burden in cancer oa ler"S. RecentLl-y, Ehere has been a dee-r.e-nt~ of "second aeneration', i mrmunc ox I-s which'-- have avoided some of the pobjlems of non-speci- ic immunoge~nicit-v- arid "oxicity in the treaced catients.

.This stra-aev uses the deglycosylated form of th Rcn A (dgA) ch ain r c o nju aa ted t o th e t umo0r s pe c i fic anib o d v 08 *6 One such Phazse Tst-udv u-1 this !viedform ~fte 10 immunotoxlan against B cell 1 lymohomas in I- patients (Vitetta. et. 1991). A3Doroximately 410% of the patients achieved partial remissions in which theirp overall -umor burden was reduced by SO! or more. Killinag of the tumor cells was rapi4d occu~ring within 1 week ~15 after compoletion off the therapy.

*All of trhe inL. vivo studies pDresented herein use an *antibody-dglk conijuga3te. The antibody ricin A cinjugaticn was performed with a .heterobifunccional cross-linke-- 3PDP or SMPT by the method described by May, R.D. and F'ulton, R.j. (1992) Briefly, a free amino group on the antibody was reacted with the crosslinker and the macromolecule was Duritied. The purified OX-40 antibody product was then reacted with reduced ricin A chain (which has one free cysteine) and the hvrid molecule was nur-ified.

Initially the rat OX-40 antibody was conjugated to the da-A form ofr Ricin and t-his hezteroconjugaze was -sed to inn-init th'e in vi t-c 0-ooIterat ion of ant i en soecifrjic CD4' T-cell lines. The T-cell lines used were snecific for MBOD and uDri adootive transfer caused EA-E in naive recipients. Fig. 5 shows thaz the OX-40 heteroconjugate inhibited antigen specific proliferation of the MBP speci-fic T-cell line in a dose dependent manne-r with 501 inhibition at approxiLmately 20 ng/well. A control using Ricin A alone showed iJnhibit:ion of the assay only ligh 4 the assay at lower concentrations (data not shown).

Controls using the OX-40 antibody alone and an isotypea a9 ***matched unrelated antibody conjugated to dqA also showed no inhibition (data not shown).

a a The OX-40 antibody was then conjugated to the Pseudomonas exotoxin and this conjugate was tested for inhibitory *effect on antigen specific CD4- T-cell prolifera -ion (Figures GA-65). This heteroconjugate was approximately 4-fold more efficient at inhibiting the in vitro assay, and the toxin alone did not inhibit the assay at any concentration. This assay was performed with a Lewis MBP specific line (Fig- 6B) and an Fl (Lewis x Buffalo) MB? soecific line (Pig. GA) with the same result showing that the inhibition of proliferation was not strain specific.

The OX-40-dgA was also used to inhibit the in vitro 00 9 0 0 *940 09 715 et0 9.0 Drolife -atio1 of a CD4' T-cell linre activated wita an anticgen that was irrelevant to EAE or autoimmnunity. Th 1e antigen used was the purified protein derivat-ive (PPD) antigen from Mycobacterium tuberculosis. This antigen was used to ascertain whether the OX-40 antigen was specific to CD141 T-cells activated by the I4BP antigen, or whether it is Present on the surface of-all antigen activated CD4- T-cells regardless of T-cell receotor specficty.As shown in -Fig. 7, there wa- a -7ose 0 dependent inhibition of proliferation of the PPD activated T-cell line with a comparable 50- inhibition to the MBP activated lines. This shows that the immunotoxin will inhibit proliferation of any activated CD4* T-cell line regardless of the antigen specificity.

go 0 0 Since the OX-40 immunotoxin was effective at inhibiting the proliferation of MBP specific autoimmune CDC T-cells vitro, experiaientz'were then performed to determine tr-t -Qotential of -his immunotoxin to. kill MBP specific CD4' T-cells in vivo. To this end irradi4 ated rats were used initially; these animals received an encephalitogenic dose of MBP specific F1 T-cells. At the same time the ani4Mals were injected with the A conjugate or Ricin A alone. The effect of irradiation is to deplete the rat's immune system so that it would not recognize and deplete the allelic variant F1 donor Tcells. The use of irradiated rats facilitates the detection of the donor T-cells with the RT7.2 antibody in 39 the host a te he transrfer o. -ns cells and allows th.

fate of these transferred cells to be dete~z-ried (see Figs. 1, 2, 8A and 8B).

As shown in Table T, experiments 1 and 2, only 1/8 animals eceivir the. OX-!0 immunotoxin showed clinical signs of disease while all 8 animals that received unconjugated Ricin A came down withn EAE. The inhibitory effect of the immunlotoxin appeared to be mediated by the 4 0 OX-40 antibody/ since the Ricin A, chain alone showed the same disease score when compared to animals injected with e enceohalitouenic CD4' T-cells alone (data nor shown).

Table I OX-40 Ricin A Immunotoxin Effect on Experimental Autoinimune Encephalomyelitis a 0*00 C. C

C.

C

Transfer Treatmen tb Incidence Day of EAE Dose' Onset Score' Ex.

G .5 x 106 OX-40-Ricin A 1/3 G 0.66 6.5 x: 10' Ricin A 3/3 4 6.33 Exp 2 10 X 106 OX-40-Ricin A 0/ .5 25 10 x 106 Ricin A 5/5 4.90 Exp, 3 X10 OX-40-Ricin A 0/2 X 106 No treatment 3/3 4 6.50 aMBp specific CD4* T-cells were stimulated for 3 days in vitro with antigen and antigen presenting cells and transferred into naive recipients.

'3400 jag of OX-40-Ricin A or the same molar amount of Ricin A alone was injected at the same time the cells were transferred.

cValue, represents the mean cumulative EAB score for each group. 0, no signs; 1, limp tail; 2, hind leg weakness;.

3, hind quarter paralysis; 4, moribund.

The data in Table I was generated using Lhe EAE model 00 151 0 0e 0 0o where Fl MB T-ceil lines (Lewis :x Buffalo) were injected into irradiated Lewis (parental host) recipients. Thus, the transferred T-cell population could be detected in the spinal cord of these animals with the RT7.2 (Buffalo) 3 antibody. Figs. 8A and 8B show the outcome of the treatment as assessed by the number of donor cells isolated from the spinal cord of the treated (clinically well) and control groups (paralyzed) on the first day of disease onset. A total of 200,000 spinal cord lymphocytes was isolated from the control group and 80% were found to be donor derived. In contrast 80,000 spinal cord lymphocytes was isolated from the treated group and only 15% were found to be donor derived. There was over a log-fold difference in the total amount of donor derived MBP reactive CD4' T-cells isolated from the spinal cord (the inflammatory site) between the two groups (160,000 vs. 12,000). This suggested that dGA conjugate was specifically deleting the MBP-reactive CD4' T-cells in vivo.

600 As shown in Figure 9, animals were treated with immunotoxin on the first day of disease onset when both groups had an average clinical score of 1. The day after treatment all the control animals showed signs of complete hind limb paralysis (score while the treated animals progressed only slightly (score The mean cumulative score after treatment was 8.0 in the control group and 3.75 in the treated group.

in a separate experiment, animals were created on che first day of disease, and were sacrificed 24 hr later.

The lymphocytes were then isolated from the spleens and spinal cords. Three groups were analysed for in vivo labelling of the OX-40 antibody. The controls received no treatment, the second group received unconjugated OXand the third group received the OX-40 immunotoxin.

Similar number of cells were recovered from the spleens, but half the amount of spinal cord lymphocytes were O0 recovered from the OX-40 immunotoxin-treated animals compared to the control and the unconjugated treated groups. In vivo binding of the OX-40 antibody was detected with an anti-mouse Ig-FITC. Approximately 15-20%- of the lymphocytes isolated from the spinal cords of OX-40 and OX-40 immunotoxin treated rats were antimouse Ig positive. Cells isolated from the spinal cords of control rats were mouse Ig negative, even though 18%' of the lymphocytes were OX-40 positive (Table Ia). There were very f:w anti-mouse Ig-FITC positive cells isolated 20 from the spleens in any of the groups. A similar percentage of OX-40' cells and anti-mouse Ig' cells were isolated from the spinal cord of the OX-40 and immunotoxin groups. The majority of anti-mouse Ig positive cells were associated with the donor population isolated from the spinal cord (RT7.2'/anti-mouse Ig'; Table Ia). These results demonstrate that the in vivo administration of the OX-40 antibody resulted in the exclusive binding of autoantigen specific cells isolated from tIhe inflamrued -,issue.

.4.

C

S..

S.

S

o V S C tee.

TA-BLE in Vivo Labelling of OX-40 Positive T Cells Treatment' Donor-/ Cell Isolation OX-40' a-mouse ig, Donior* amouse rg' Control Soinal Cord 17.90%1 0.2% 54.4% Spleen 0.5% 2.4% 0 0.2-.

Spinal Cord 17.7% 17.59kc 53.2*- Spleen 0.3%6 0.4! .6 0.3*- OX-d0-Ricin Ad Spinal Cord 19.0%* 18.1-* 50.3*6 18 Spleen -0.51 2.3%.

0. 4% aFl T cells specific for MBP were transferred into irradiated Lewis hosts and 400 gg of OX-40 immunotoxin or GX-40 ab alone was administered i.p. the day of disease or-set.

All of the pe-cent positive cells were deterinlined by FACs analysis using isotypE control, antibodies to draw quadrants for negative comparisons.

The mean fluorescence intensity (MPI) of the a-mouse 1g' cells was very similar to MET of the OX-40 FITC stained cells.

d The total number of spinal cord lymphocytes isolated from the OX-40 immunotoxin animals was half that of the and the control groups.

In order to assess the efficacy of the treatment w~e isolated spinal cord lymphocytes and analysed the amount of BP reactive donor cells with the RT7.2 antibody from immunotoxin treated rats versus control rats (Fl donor cells transferred into irradiated Lewis reci'oents) .Ficr. 10A and 10B show heouco7=~ of ~mmun otoxin admnini s tered on the- same day o f cell trans-:7r as assessed by- the num.ber of myelin, reactive donor T cells isolat-ed from the spinal cord. RT7.2-nosiztjva S cells were analysed the first day or disease onset; the treated animal was clinically well (EA-E score with 1 .2 x i04 donor- spinal cord lymp'hocvtes) while the control animal was paralysed (REscore with 1.6 x donor* sninal cord lymphocy-tes). in Figs. 10C, D,E' lq and F the treatment was given the day beforce disease onset,. when the only OX-q0 positive donor T cells U, isolated from the rats were from the spinal cord (Fig.

1)-Suinal cord and. spleen lymphoc-vtes were Isolated 2q .4e hr after the treatment. The number of donor-derived cells isolated from the recipients wras unaffected by the treatment (data not shown) In all the comparisons the number of donor* cells isolated from the pinal cord was decreased by over a log in thp_ treated animals (Fig. 10) These data demonstrate that the OX-qC immunotoxin specifically depleted MBP reactive donor cells in vivo, and as a consequence less encephalitogenic cells were isolated from the spinal cord of the treated animals.

25 The same in vivo experiments were then performed in a non-irradiated host; a Lewis MEP activated T-cell line was transferred into a Lewis host. The non-irradiated host was used because this host has an intact immune svsri=- more simi 1ar cc Human pa- irs cr~ toe-se same LYrics of aucormr.une Cdise=S=S. -s exoer2.mencs it was nta'/o'--served chath nJection of the conjugate at th re of Lransfer of T-cells only partially inhibited subsecquenL development of the disease. Therefore exoeri.ments were nerformeQ utilizing two injections at different t imEs 2.0 .4 4.

*4 Ce em C

C

CS COO 6 0 *B 6* o e.

C,

8* .0CC 4 4..

Ce Three animals were* injected on day 0 and day 3 and Comoared to 3 control animals (Table if) These results Suggest that the inmmunooxin was recognizing and killing the autoimmune T-cells at the site of inflammation on day 3 because, the only donor T-cells expressing the OX-40 antigen on day 3 (the day before disease onset) were -in the spinal cord compartment (Fig- 1) and the highest percentage of OX-40 expression on donor T-cells in the soinal cord was the day before disease onset (Fig.

Table Z' lmmunr:,roxia Effect an Exnerizaental Autojinmune Encephalomyelitis (in non-irradiated host) Do~ njectiJon Onset Score' 9-0 106 OX-40-R-cin A. 0/3 5 1.33 9.01 1G Ioing 8.25 M~w~3P s2 e Jifc CD4 T-cells were stirmulated for 3 dal/s ~'~cowirth anticen arnd anticen oresenting cells and tr ansrfelrd into Lew" s recipients 0400 ,a of Z%40Rca or the saime molar amount of Ricin A alone was injected at the same time rhe cells we're transferred.

cValue reoresents troe mean cumulative E-A.E score For each goup r 3animls. 0, no signs; 1, limp tail; 2, hind ea wealnss 3, hind :uarter paraly1,sis; 4, orbund.

The conclusi4on frcm the data or-esen'.t- is the immunotoxin is extremely effective at! k1-4 inhlibiting antigen soecif ic CD4- T-cell function both 2 vitro and invivo. The effect of*L this specific immunotoxin dces not seem to be restricted by strain or antign sneiclt ahd will most likely have a wide ra =eo aor-licatinsi a.

rac f-i io The exDerirnents described above wezre performed using the rat mo del system and antibodies acainst the ralt protein. However, the rat OX-40 antibody does not recognize human or murine activated CD4- T-cells (data not shown).- To facilitate the development of the oresent invention for human theraueutic use. it is necessary to rroduce antibodies against the human OX-40 protein.

To that end, a human cDUA. en coding the human 0 homolog was cloned. Initially, two oligonucleotide primers were synthesized for use in the polymerase chain reaction (PCR) These primers were des-igned-to amplify the full length OX-40 cDN.A sequence; one primer was homologous to the coding strand in the region of the start codon of the rat cDN-TA secruence and the other was the inverse compleiment of the coding strand in the region of the stop codon of the rat cDNA seouence.

Surprisingly, no product was ever obtained when these PCR primers were used with RNA isolated from activated CD4* T 1Vm,.o'Ccvtes from huma=ns.

59 9 5p

S.

0* *a -a.

a. e.

S

'04.4 a a Since the standanrd method of clorning the human Ox-4o cDNA was unsuccessful, an alternati-Lve a=,croach was reouaren.

First, the PCR primers were successfully used to clone the mul-ine OX-40 cD-NA bY PCR from RAisolated from murine T-cells activated with Concanavalin A (da-ta not shown) Then, the murine OX-40 cDNA was used to probe a cD-NA lambda gtl 1lbra.r cno humaia activated T 0 lymphocytIes (No. HLI-0316 purchased from Clontech, Palo Alto, CA) Five similarly sized positive clones (1050-1200 bo) were obtained. These five recombinant lambda clones were subcloned into the Bluescript plasmid (Stratagene, La Jolla) and then sequenced on the 370A automated sequencer (Applied Biosvstems, Pasadena CA).

The searuence of the human OX-40 cDNA is set forth in SEQ.

!D No. 1 in. tne accompanying sequence listing and is shown. in Fig. 11:so 0 S 9@ 5056 a.

a.

a as. a.

a a *ObtSS a ad

I

A comnarison of the predicted amino, acid sequence of the human OX-40 protein with peptide sequences in the Genbank database indicated a high degree of homology with the nuqrine OX-IO and rat OX-40 secrences; the probabilities that the oredicted amino acid seauence of the human protein shown in Seqr. I.D. No. 1 was not related to the murine or rat OX-40 amino acid sequences were predicted to be 3.4 x 10-5 and 2.9 x 1 0 -56 respectively. The next most closely related peptide sequence gave a probability of 0~ comztarzsj or homolocgies between the hu-,-man and rat- O--0 oDN-,% and amj-ino acid secquences cver a amm.-"no a- base oair) region starcti-a at ami-no acid 321 Of Che rat secruence revealed a ami-no acid homology of 62.5 and a nucleotide homnology of all ten cysteine residues within this 64 amino acid srretcn were conserved.

4 44, 4*

I

S.

0

S

041

S

04 4 44~ 10 0 04 44 0-0Exuression- in -V,-D The ex;-oression of OX-40 on T-cels was studlid in natients with- araft versus host dies (G'D) Three narr-ents wo-o underwent alloqenei-c bone marrow .4 Lansu'-ptacion came cr3own wi-th V-zD. The day of C-VHD onset varied between the oatients from 7-50 days after transpr)t Table3shw a summarv fO-0eyrs-o U' durinc r th-e GV9hJ enisode. All the oazients showed an Lncras:-i pErcentage off CD4' periphpzal blo'od cells exnoressria OX-40 during the- early stage of disease 20 develooment. LIn all the patients the percentage of ce-I-s declined after the initial clinical eoisode (7-14 days post c-VHD). Thnis data is con .sisztent with the transient exoression of OX-40 observed during the early staces or- disease develooment in EAE (Fig. exressrion in c-VD correlated with the early develonment Of the clinical signs and may have direct diagnostic anQ therapeutic applications for this anid other humain transplant/autoimmune2 disorders.

TatC OX-43 L'EL Of resc oe rrowq Tr nsj:)-- Patl eGnt's w~rn Craft: V~ruSz Hst Di'Sease Paziel Days Post Gv CID 4 O-0o CDa Sv iA G E 8.3 grrade~ t Qc-ade 2 arade 2 0.

10.6 b~e

S.J*O

055 4 2 0 a Donor and reciniJ.ent Deripneral DIcoG lvmchocvLes wer screened for OX-4C explression rlo-f to te tran~splant process and the CD4 T cells were less than OX Value reuresents the maximum severity each patient obtained during clinical signs of: GNFD C skin involvement) 0, no signls; 1 greater than no involvement but involving 25% of skin; 2 23% involvement but 50S*- involvement; 3 50-. involvement; 4 50Tk involvement with blisters; 5 leading to death.

CLymphocytes fLrom the peripheral blood, of GVH-D patients were isolated by Hypacue-Picoill Samples were isolated and analysed at various. Qays post 01/H. The sampoles were dual stained with an anci-humarL CD4-PE antibody and an anti-human OX-40 antibody. The OX-40 antibody was detected with an anti-mouse Ic;G.-FITC and the indirect, antibody alone was used as the neaative control.

0X40 and IBD it has been found that OX-40 can be of use in connection w it I BD.

Tne tissue excression of 0X40 was investicated usinar the standard techniaue of-: indirect alkaline ohos-ohatase immunohistochemical staining (see eg Immunocytochemistry: Zrcrca C 'lca-ions Pat'coa an and S. van Ncordenr, ecis- johnn vrictanSos "itl S1iooSv tissuC snmoIes of intestne OiZC uc nounr-s and Crohri's dicae nenssrC zse~~ with an anti- 0X-10 antzbody. C!lusters of cXa0 cells w-e seen amonco the lym-phoao. cells infiltratir nC he l amina zDronria at sie of inflammation, in sapnoles ofF antetina1 tssue Erom norimals or in samples oz unin-volved intestinal tiSS11 7from pQ.iencs 0onl1y ared, scattered GX4,_0 cells were seen.

EXMPLE ONE :a-ving h-erein n:rovided the secuence of th-e human cDNA, one ski Hd in Z:he ar2t will recoani.Ze that: the full1 length cDNA clone can now readily be obtained bDy standard methods. Such methods include, -for exarnle, the )olvrnerase chain reaction (PC-R) by-v which means DNA sequences can be amolifJied. Metbhods a-ad conditions -for PC?. amplificat i on of DNA are described in Innis et a!.

20 (1990) and Sambrook et al. (1989) The selection of PC?. orimers for aimplificat-ion of the numan OX-40 cO-NA will be made accordi~ng to the portions of the cDNA wni ch are desired to be amplified. _Primer.s m.,ay hcosen to ammo±4 z small fragments or the cMDNA or the entire cON:A molecule. Va r ia tion s i n a mnIfic a t ion conditions may be reauired to accommodate primers of aiffe-ring lengths; such considerations are well known in ~ne arc and are ciscusse-d in1 nise a- (190 s,ia o e. camp L oIe on Iy, he e -i r e cDNA4 molecule- ccrresppondia to the human OX-40 cDNI.A may be arili-fied using the folownoorme-~ Pri-mers 1 and 2 are also se for~h in accomp~any~ing sequence listing as S::Q Nos. 27 and 3, respectively.

Primer 1: 5' ATGTGCGTCGGCGCTC GGCG- -GCTG 3' Primer 2: 5' TCAGAACTTGACCAGGGTGAGTG 3' *Temlate DN::A for PCR amplification to oroduce thre huRan=D QX-40 cDNA can be extracted -from the lambda GT11 cDNA library froma human activa ted T ly-mohocytes produced by Clontech, Palo Alto, California (Catalog No. HU0316) Alternatively, the human OX-40 cDNA may be obtained by 15 PCR amplification of reverse transcribed RNA (RT-PCR) (Veres et 1987;. Kawasaki et al., 1990).

Essentially, total IRNA Is extracted from activated human CD4 T-cells by anyv one of a variety of methods routinely used as described in Sambrook-et al. (1989) and Ausubel et al. (1987). Suitable human CD4 T-cells include the human CD4' T-cell lymphoma cell line described by CGootanberg et al. (19B1).- Alternatively, activated CD4* T-cells can be isolated from human peripheral blood as described by Kruisheek (1992). The extracted IRMA is then used as a LemDlat e for performing RT-PCR amoiilification of the human OX-40 cDNA.

Standard methods for the purification and cloning of PCR orcducts are well ~nowfl inl tt're art and are~ descr~bed ov innis et k-19901 and Sambroo'K et al. (11989) EXAMPLE TWO With the provision of the human OX(-40 cm'IA, the exoression and Purification of the human OX-40 orote4- by standard laboratory techniques is now enabled. The Purified orot~ein may be used f-'or antibody production'and pratienc tiaerau,,. 0*

S

.4 4 *0* *0 4 41 0* 0 54 @04.

II

040*4 444 J0 Partial or full-length cDNA sequences, which encode for the subject Protein, may be ligated into bacterial expression vectors. Methods for expressing large amounts of Protein from a cloned gene introduced into Escherichia 61D coli coi) may be utilized for the Purification of the human OX-40 protein. For examPle, fusion proteins consisting of amino terminal peptides encoded by a portion of the E-coil. lacZ or trE gene linked to the part or- all-cof the hnuman OX-40 protein maybe used to prepare polyclonal and monoclonal antibodies that recognize the human OX-40 protein. Intact, native Proteins may also be Produced in E. coli in large amounts frfunctional studies. Methods and olasmid vectors for producing fusion proteins and intact native proteains Ln bacteria are described in Sa-mrook et (!989) (ch. !7, herein incorporated by reference).- Such fusion proteins may be made in large amounts, are easy to purify, and can be used to produce antibodies. Native Proteins can be 0 0* 0*,

S.

produced in bacteria by placing a strona, regulated Dromoter and an. efficient ribosome binding site unsLream of the cloned gene. 7f low levels ofpoei r oroduced, additional steos may be Laken to i ncrease protein production; if high levels of protein are produced, purification is relatively easy. Suitable methods are presented in Sambrook et al. (1989) and are well known in the art. Often, proteins expressed at high levels are found in Insolubli, inclusion bodies. Methods for extracting proteins trom these aggqregates are do: described by Sambrook et al. (1989) (oh. 17) Vector systems suitable for the expression of lacZ fusion grenes include the pUR series of vectors (Ruther and Muller- Hill, 1983) pEX1-3 (Stanley and rLuzio, 19841) and -pMRlOO Is (Gray et al., 19821. Vectors suitable for the production of intact native protieins include pKC30 (Shimatake and Rosenberg, 1981), pKK17h-3 (Amann and Brosius, 1985) and pET- (Studiar and Moffatt, 198G) Human tJX-40 fusion pr-oteins may be i-oiated from protein gels, lyophilized, ground into a powder and used as antigen preparations.

S

S

0 0# 0 For expression in mammalian cells, the cDNA sequence may be ligated to heterologous promoters, such as the sim ian virus (SV)40 promoter in the pSV2 vector (Mulligan and 2E Berg, 1981), and in troduced into cells, such as monkey COS-l cells (Gluzman, 1981) to achieve transient or long-term expression. The cDNA sequence (or portions derived from it) or a mini gene (a oDNA with an intron and its own promoter) is introduced into eukarvotic expression vectors by conventional techniques. These vectors are designed to permit the transcription of the cDNA eukaryotic cells by providing reculatory sequences S 5 that initiate and enhance the transcriotion of the cDNA.

Vectors containing the promoter and enhancer regions of the SV40 or long terminal repeat (LTR) of the Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan et ai 1981; 4 10 German et al., 1982). The level of expression of the cDNA can be manipulated with this type of vector, either by using promoters that have different activities (for 0 example, the baculovirus pAC373 can express cDNAs at high levels in S. frugiperda cells (Summers and Smith, 1985)) or by using vectors that contain promoters amenable to modulation, for example, the glucocorticoid-responsive e o romoter from the mouse mammary tumor virus (Lee et al.,

S

1982).

In addition, some vectors contain selectable markers such as the cot (Mulligan and Berg, 1981) or neo (Southern and Berg, 1982) bacterial genes. These selectable markers permit selection of transfected cells that exhibit stable, long-term expression of the vectors (and therefore the cDNA). The vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses such as papilloma (Sarver et al., 1981) or Epstein-Barr (Sugden et al., 1985). Alternatively, one can also prcduce cell lines that have integrated the vector inCo cenomic DNA. Both of these types of cell lines produce the gene product on a continuous basis. One can also produce cell lines that have amplified the number of copies of the vector (and therefore of the cDNA as well) to create cell lines that can produce high levels of the gene product (Alt et al., 1978). *0 a a e.

0U 0 0 @00 000 00 000 a The transfer of DNA into eukaryotic, in particular human or other mammalian cells, is now a conventional I0 o technique. The vectors are introduced into the recipient cells as pure DNA (transfection) by, for example, S precipitation with calcium phosphate (Graham and Vander Eb, 1973) or strontium phosphate (Brash et al., 1987), electroporation (Neumann et al., 1982), lipofection (Felgner et al., 1987), DEAE dextran (McCuthan et al., 1968), microinjection (Mueller.et al., 1978), protoplast fusion (Schafner, 1980), or pellet guns (Klein et al., 1987). Alternatively, the cDNA can be introduced by infection with virus vectors. Systems are developed that use, for example, retroviruses (Bernstein et al., 1985), adenoviruses (Ahmad et al., 1985), or Herpes virus (Spaete et al., 1982).

The human OX-40 protein expressed in eukaryotic cells may be purified and used to produce antibodies. The human protein may be extracted following release of the

IMS,

orotein 4n?-0 t,,O sunernatant, or, rhe c3NA seqruen~ce may be incorporared into a eukarvotic e:P-=sio: vector and exuressed as a chnimeric proteini wich, ffor example, fl-globin. ADntibodv to /3-globir is thereafter used to purify_ the chimeric protein. Corresponding protease cleavage sites engineered between the -globin gene and the cDNA are Lnen used to separate the two poly-peptide fragments from one another after translation. one useful exnression vector for generating /3-cl7obin chimeric see: 06 .*61 proteins is pSG5 (Strataaepne, La Jolla, CA) This vector encodes rabbit g-globin.

0 This invention encompasses recombinant cloning vectors 0* 0 containing the human OX-40 cDNA sequence, or Portions ~5 thereof. The human OX-40 oDNA is operatively linked in Steve: the vector to an expression control sequence in the tests: recombinant DNA molecule so that the human polypentide, or a portion thereof, can be expressed. The exression control sequence may be selected from the group consisting of sequences chat control the expressioni of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof. The expression control sequence may be specifically selected from the group consisting of the lac system, the trp system, the tac system, the tro system, major operator and promoter regions of phage lambda, the control region of' fd coat protein, the early and late promoters of SV4O, promoters derived from polyoma, adenovirus, retrovirus, baculovirus 56 anda simian virus, the promocer tot 3-QhosPLhojglycerare kinase, the promoters of yeast acid pchospriatase, the oromoter of the veast a lpha-mating t"at tots anid comiat ions thereof The host cell, which may be transfected with the vector of this invention, may be selectedfo h ru consisting of E. coli, Pseudomoias, 9acillus subti 7 is, Bacilus~seazohermphilzs r other bacilli; other bacteria; yeast; fungi; insect; mouse or other tissue cells, including human tissue culture cells.

a. a a ea nO.

0 *000 '.10 a a Oaee a a. a In a pr-eferred embodiment of the -present invention, the full length human OX-40 cDNA as shown in Fig. 9 (from 8G. 15 start codon to stop codon) is ligated into a baculovirus a vector and the recombinant human protein is produced in 0000 the appropriate insect cells. Suitable baculovirus expression systems include the BacPAKTh Baulviru aExpression System produced by Clontech (Palo Alto, CA).

Thus, by way of example, the full length human OX-40 cDNA is ligated into the plasmid pBacPAXl and expressed in Spodoptera fugiperda cells according to the manufacturer' s instructions.

25 The human OX-40 protein produced in the inetcells is then purified by standard techniarues. A preferred technique of isolating the recombinant product is to use a vector that adds an additional 6 residues of histidine to the recombinant protein. Fusion proteins produced in this manner chelate metal, which facilitates orotein purification enormously. Thus, for example, in high salt, polyhistidine fusion proteins bind with a high affinity to a metal chelate matrix whereas the majority of host proteins do not bind at all. Low affinity binding host proteins can be washed off the matrix by decreasing the pH to 6.0. Specific elution of the polyhistidine-containing fusion protein can be 0 accomplished with 300 mM imidazole buffer at pH 00 *00* 4 0 *0 4.

a a o 00O 000 4 4 0( 6«404 0 *a*

**I

004o e0e SEXAMPLE THREE Monoclonal antibodies may be produced to the human S protein for therapeutic use. Substantially pure human 55 OX-40 protein suitable for use as an immunogen is isolated from the transfected or transformed cells as •I described in Example 2 above. Concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon filter device, to the level of a few milligrams per millilitre. Monoclonal antibody to the protein can then be prepared as follows: A. Monoclonal Antibody Production by Hybridoma Fusion.

Monoclonal antibody to epitopes of the human protein identified and isolated as described can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (1975) or -e -y _ocu la Le, 4 a -C r ms seece p url:: cc. cro!tein over ao~ X ofa few week-s.

I Lnem nouse s t:he sacrificed, a nd tr'Le anztiiody-p roduci-ng cell-s o-F the soleeri isolated. he soleen cells are fused bv mea=ns of oolvethilere glycol with mouse myeloma cells, arid the excess unfused cells destroyed bygot of, the svstem on selective media comprising aminoozerr n (SAT media). The Sliccessfully fused cell11s are diluted anda 0 aliquots of the dilut:ion placed in .wells of a microtiter plate where growth of the culture is continued.

0* Antibodv-rproducing clones are identified by detection of antLibody in the suuernatant- fluid of the wells by immunoassav orocedures, such as ELISA, as originally described by Engvall (1.980) and derivative methods thereof. Selected positive clones can be expanded and *:e~si their monoclonal antibody product harvested for use.

Detailed proce~dures nor monoclonal antibody production a-e described in Harlow and Lane (1988).

B. Antibodies Raised Against Synthetic Peptides.

An alternative approach to raising antibodies against the human OX-40 protein is to use synthetic peptides synthesized on a commercially available oeotide svnthesizer-based upoon the Dredicted amino acid seauance of the human OX-40 protein shown in Figure 11.

In a preferred emubodiment of the present invention, monoclonal arnibodieS thaE _recocni ze the hutman protein are produced. Cotimally, Monoclo~nal antibhodies ra'sed aga'-s" the human OX-40 or Ii scificailv detecL the human OX-4110 protein. That is, such azntibodies recognize and bind the human OX-40 protein anda do not substantially recognize or bind to other proteins f:ound inhuman cells. Put another wav, such antibodies have a specificity of binding in humans to substantially only the h-uman. OX-40 protein and thus tz; substantially only 0 a ctivated CD4- T-cells.

.4 4 4S 6* 404* 4 *4SO 0* 0 6004e0 6 Sq

U

*1 4 4440

S

S.

The determination that an antibody specifically detects the human OX-40 protein is made by any one of a number of standard immunoassay methods; for instance, the Western 15 blotting technique (Samnbrook et al., 1989). To determine that a given antibody preparation (such as one produced i: n a mouse) specifically detects the human OX-40 protein -e by Western blotting, total. cellular protein, is extracted from 4man.cells that do not express the OX-40 antigen, such as non-activated lymphocytes. As a pos;itive control, total cellular protein is also extracted from activated T-cells especially for example activated CD4* Tcells. These brotein preparations are then electrouhoresed on a sodium dodecyl sulfatepolyacrylamide gel. Thereaffter, t-he proteins are transferred to a membrane (for example, nitrocellulose) by western blotting, and the antibody preparation is incubated with the membrane. After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase; application of the substrate bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a dense blue compound by immuno-localized alkaline phosphatase. Antibodies which specifically detect the human OX-40 protein will, by this

GO

technique, be shown to bind to the human OX-40 protein band (which will be localized at a given position on the gel determined by its molecular weight). Non-specific binding of the antibody to other proteins may occur and may be detectable as a weak signal on the Western blot.

S The non-specific nature of this binding will be 3*5 recognized by one skilled in the art by the weak signal obtained on the Western blot relative to-the strong primary signal arising from the specific antibody-human OX-40 protein binding. Preferably, no-antibody would be oo..

found to bind to proteins extr-acted from the unactivated T-cells especially for example CD4T-cells.

In addition to binding assays using extracted proteins, monoclonal antibodies raised against the human protein are tested to confirm their ability to recognize the appropriate cell type (activated human T-cells especially for example activated CD4' T-cells) by conjugating the human OX-40 antibody to a fluorescent tag (such as FITC) and analyzing cell populations by FACS as desriedanove The 1human CX-C antibcdy will crefer-ablv reccgniz accivated 7-cells especiall-v o examzole acti;'vated CD4- 7Tcell-s. Tnerefore, dual stainn o-f an activaced T-cell PoooulatinJn wich CD4-PE and OX-4io- FITIC Should show cells that are double positive.

Monoclonal antibhodies for use in the present invention will geineraliv be of the IgM or fgG isoztvpe, and will .cre'er-ably be of mouse, human or other !!iam-.malian or-icrin.

La .0 a 00 e 0~a9 08 .o1C 00 0 4 'a.

00 0 *0 a 0, 4 *0I a .4 000.

a JO 04 0 0 *~0 0 In one oreferred emabodime~nt of the presenit invention, the a monoclonal antibodies that recognize the human antigen are mouse monoclonal aatibodies that have been as "humanized". Such humanized antibodies can be more safely administered to human patients than can unmodified a monoclonal antibodies produced in mouse cells.

Monoclonal antibodies vroduced in non-human cells, such as mouse cells, generally ev:cke an immune response when administeramd tn a human host, thus limiting the duration of the biological efficacy of the monoclonal antibody.

(see generally, U.S. Patent No. 4,731,244 and WO 89/()697;3) Humanized antibodies are produced by recombinant DNA technology and generally comprise the antibody constant region from human monoclonal antibodies combined with the variable (antigen recognition) region from the mouse monoclonal antibody that recognizes the target antigen (in this case the human 0X-40 protein).

Because only the variable region is of murine origin, 62 'humanized~ monoclonal antibodies are sli ifcan:Iv less likely to in~duce an immune rEsoonse when admnizered to a human patien.

Methods for humaniazing antibodies are described b'o- Riechmann at (1988) Riechmann et al- introduced the six hyoervariable regions from the heavy and lighc chain domains of a rat antibody into a human IgGI antibody Sdirected against human lymnhocytes. Rieclamann :a.

0ao: ,ol showed that this "humanized" antibody was able to bin-d to ts -taract antigen in vivo without eitngan anti-- 4 immunoglobulin. immune response.

ease'~ For the preferred embodiments of this invention, intact Sea is mnonoclonal antibodies are used. However, one skilled in the art will recognize that portions of monoclonal antibodies that are capable of recognizing and binding to h% human OX-40 protein may also be employed. -Theste .~antihcdy1, fragntents ge-nerally include Fab, F(ab) "2 and, F-v.fragments of antibodies which recognize the human protein. Immunotoxins comprising antibody fragments have been shown to be effective in deleting CD4* T-cells both in vivo and in vitro using an antibody that recognizes all cells that express the CD4 antigen (St-reet at al., 1987).

EXAMPLE FOUR As set forth in the preceding examples, this invention enables the production of monoclonal antibodies that, in nurrans, nir a sucs C r, t a I on: V e Zu-Or Such rannoclonal an-ibodies carb use'd in -heraneumic ~cns, for examot1e in ra-e :cnm coinjuciares withr cvtotoxic moleculias, e~.as an'~o-~cnAconjae C, as discussed below. Such cor-jugaues are- cornmon~v referred to _s mmunotox-ins. Im-munotoxins are characterized by two components; a cyzotoxic agent which Is usually fatal- to a cec1 1 when attache-d or absorbed, and a 'deLiverv vehicle" wh-ich serves to deliver t-he 'Qcvtotoxin to th, e target- cell tvoe F'ol thie oresent -in-vention, the tar-get--- cell type is activated T-cellsesnecialiv for examole activated CD-" T-cells and the *del1iverv vehicle is a: ant-Libody or antibody frgettat recoan'izes and binds to the human OX-40 antigen, as described in Excample 8 below.

A nuimber of suitable cytotoxi-ns are known in the art, 'ncluding: cytotoxaic proteins such asteRci can tne deglvcosvlated form of the Ricin A chain thte Pqeudooroa s exoto'cin; radionuclide s such as Iodine-131, Yt-trium-90, Rhenium-lBS and Bismuth-212; and a numbter or chemotheraoeutic drugs such as vindesine, rnetnotrexate, adriamycin and cis-olatinium. (See generally, Olsnes and Phil (19 a2) and Baldwin and svers (1 98 Tn one embodiment of the nresent invention, the cytoto'dn Is the deglycosylated form orf tne Ricin- a chain, as described in U.S. Patent No. 4,590,071.

A selected cytotoxin may be conjugated with an anti- 64 t~ma 0 ":iocv to co'uc* =n ON cvtotoxjns b- -of elknwn procedures, as e a I I y d sc -i ibe in '-orpe e z al (12) r n examp where the CvtO~oxic acent is a Urotein (such as the Ricin A chain) and the delivrv- vehicle is an Lntact, OGG* moncclonal antibody, the_ I nkage may be b-v wav of

OGG:

OGG heterobifuncciional cross lin 1 -ars, such as carbodimideor *sees: gluter-aldehvryde P Dre'erred merh-is of oroducina OG* -b imnnn-rv-;ns th~e decJ1vcosyl-c ateo ar orovided in U.S. Patent No. 45 9C, 0 7 1,a~ O 89/00'967, *whi4ch are herein incorcorated bv rerere-ic TMrnunotoxins as orovidad bv the oresent invention and 4 produced as described above are subsequently tested to conf-irn their in vit-o efficacy.Suhivtrtetn is perrformed using human CD4- T-cels and the methods described above. For examp.c. an imrnunoto-xL prcduced according to the. -orcsent invention (i.a cvtotoxin conjugated to a monoclonal antibody that has been shown to be specific to the human OX-40 protein), iJs tested using in vitro inhibition studies on M3P soacific cD4- T cell lines from multniole sclerosis nDatients.

immunotoxln-s potentially suitable For use in humuan theraov are those cazable of inhibiting the in. vitro proliferation of such cells.

Since these immunotoxins are caoable of inhibiting the in vitr'Oo ol i~-fe-ation of a cciva ed CD4_ T-c'1 !Is m multiple sclerosis patients, they sr'ou d be canalie of 1nniting the Proliferation o-f all act _ivated CD4-T cells, recardless of origin. This conclusion is supported by the evidence set forth above, where the rat immunotoxin was shown to he effective against -MP3 activated rat CD4' T-celis and PPD activated rat CD4- T-cells. To confirm that the human OX-40 imrnunotoxin has this general activity, similar in, ;itro proliferat-,on iz studies as described abc-; may also be performed with human CD4- T-cells specific for other antigens (such as C* heroes simolex virus.) In an alternative embodiment of the Present invention C C:..described in Example 5 below, anti-human OX-40 antibodies can also be used to diagnose conditions mediated by activated T-cells especially for example activated CD4' Tcells. FAsuch applications, it -is preferable that the anti-ridy is cortjugatel to a suitable chemical which facilitates detection of the antibody. Suitable molicules include the fluorescent molecules fluorescein isothiocyanate (FITC) and R-phycoerythrin (PE) as utilized in the Present invention.

EXAMPLE FIVE In one embodiment of the present invention, monoclonal antibodies that specifically bind the human OX-40 protein are used to detect conditions mediated by activated T- 66 cells especially for example activated CD4" T-cells. For such purposes, human OX-40 antibodies are conjugated with other molecules, such as fluorescent markers.

Biopsy samples are taken from inflamed tissue for analysis. One skilled in the art will recognize that the source of the biopsy sample will vary between different conditions. In the case of multiple sclerosis the lymphocytes will be isolated from the CSF, while in 0 rheumatoid arthritis the lymphocytes will be isolated from the synovial fluid of inflamed joints. In the case .0 of transplant rejection biopsies will be taken directly from the target organ during a rejection episode.

5 In a preferred embodiment, a biopsy sample taken from a patient will be fractioned into a lymphocyte fraction (by methods described earlier; see Materials and Methods).

-The purified lymphocytes will be stained with the OX-eo-- FLTC antibody and the percentage of positive lymphocytes S 20 will be quantitated on a FACScan apparatus. This percentage will be compared with the percentage found in healthy individuals. Any statistically significant increase will provide an early indication of an inflammatory event and will lead to early diagnosis of autoimmune disorders.

4.

440 4444 44 0i ruQ 4 4*o 4 4 44 444 44 4 EXAMPLE SIX For therapeutic applications, such as treatment of autoimmune inflammations associated with multiple sclerosis, it is anticipated that the oresence of activated T-cells especially for example activated CD4' Tcells at the site of inflammation will be established before treatment is commenced. The presence of these cells can be established using the diagnostic methods described in Example 5 a!ove. If the diagnostic test produces a result indicating the presence of activated Tcells especially for example activated CD4- T-cells at the inflammatory site, then therapeutic application of the immunotoxin may be appropriate.

For therapeutic administration of the immunotoxins for S* treatment of conditions mediated by activated T-cells, especially for example activated CD4' T-cells, standard Spublished protocols that set forth treatment regimes using .iimunotoxins may be utilized. These incJude.

protocols described by Vitetta et al., 1991, and in W089/06967. These documents are herein incorporated by reference.

In general, the method of treating a patient suffering from a condition mediated by antigen-activated T-cells especially for example activated CD4' T-cells will comprise administering to the patient an effective amount of an antibody (or a portion of an antibody) conjugated with a cytotoxic agent wherein the antibody (or the portion of the antibody) recognizes and binds to the human OX-40 antigen. As discussed above, antibodies and portions of antibodies conjugated with a cytotoxic agent are commonly referred to as immunotoxins. Effective amounts of these immunotoxins may generally be referred S to as a suitable dose of an immunotoxin.

9 96e

I

9.

I

0 a 90 9 O 099 "5 One skilled in the art will recognize that any dose of 910 the immunotoxins greater than zero will have some effect on- the activated CD4" T-cell population in a patient.

However, suitable doses are limited by the onset of adverse side effects of high doses of immunotoxin. As S described in W089/06967, for immunotoxins comprising a monoclonal antibody conjugated with the ricin A chain, suitable.doses are in the range of 0.05 1.0 mg/kg daily for up to 14 days. As described by Vitetta et al.

(1IS1), for immunctoxins comprising antibody fragments an, t-h Fab' fragment) linked to the chemically deglycosylated ricin A chain, doses will preferably be in the range of 25 150 mg/m 2 EXAMPLE SEVEN One embodiment of the present invention is a kit containing monoclonal antibodies that recognize the human antigen. Such a kit would comprise a container within which the monoclonal antibody is contained.

69 In one embodiment of such a kit, the kit would contain the monoclonal antibody in a form conjucated with a cycotoxin, such as dgA, whereby the kit could be used to treat patients suffering from a condition mediated by activated T-cells especially for example activated CD4' T-cells. This antibody-cytotoxin conjugate would preferably be provided in a form suitable for adminis- S. tration to a patient by injection. Thus, the kit might contain the antibody-cytoto.x,.i conjugate in a suspended 10 form, such as suspended in a suitable pharmaceutical excipient. Alternatively, the conjugate could be in a solid form suitable for reconstitution.

So In an alternative embodiment, the kit would contain the monoclonal antibody in a form suitable for diagnostic use, such as conjugated to a fluorescent marker. Such kits would be used in the detection of inflammatory conditions mediated by activated T-cells especially for example activa.aed CD4* T-cells. The foregoing examples are illustrative of the present invention, but are not limiting. Numerous variations and modifications on the invention as set forth can be effected without departing from the spirit and scope of the present invention.

70 *9 0.

0-90: so S Ahmad et al, (1986). J. Vir,01. U:267.

A3aann and Brosius (198.5). Gene 4_0:183.

Alt et al. (1978). J, biol. Ch-em. 2L3:1357.

Baldwin and Byers (Edo.) (198S). "Monoclonal Antibodies for Cancer Detection and Therapy,"I pp. 159- 179; 224-266.

Bernstein at al. (1985). Ge. a~g Z.235.

Birkeland, and A.N. Barclay (1992). Abstract: 15 8th internat onal Congtesa o-f ImMnCOUg !Ui1g(j,:82.

Bourdetta, D.N. at al.. (1991). 3. liegroggi. Res.

20 Brasjh et al. (1987). KO-1. CAjl UId 2:2013.

Caspi, R.Le- t al. (1988). T. of Immaun;ol.

Cobbold, U.P. et al. (1984). Nature =l:548-552.

Cash, and-Lipsky, P.E. (1988). Atriig 011 Rheuiiatipm 31(011230-1238.

Felgnar et al. (1987). 2rog.. Natl. Acad. EcI'USA A4:7413.

Fulton, R.J. et al. (1988). Cancer REsiearch A.~:2626-2631.

Cluzzan (1981). _qjU 3:175-182.

Gootenbarg, T.E. at al. (1981). jrnnjL" Emr. 2~ntJUeigine, 154:140:3-1418.

Graham and vander Eb (1973). L~QI U:466._ Cray et al. (1982). Prc,.Nt.Aa.S~.TS 21:6398.

Gorman et al. (1982). Proa. Nati. Acad,. Sc UP& 21~:6777-6701.

Harlow and Lane (1988). Afltjb4~OjgG.A Laborator Hanlfuai, Cold Spring Hlarbor Laboratory, New York.

-71 e S 0 as 4 56.0 ease* 002: Innis at al. (Eds.) (1990). PC1R PZrotocals, -A Guide to Methods and Applicationsu, Academic Proe, inc., San Viego, California.

Kle.in et al.. (1987). )Nature 327:70.

Kohler and Mqilstein (1975). N~X 156:495.

Kawasaki et al. (1990). It~ PCL ProOCgjS. A Guide to Meithods ard AnnDie~tinse Innis et al.- 21-27, Acadezia Press, Inc. San Dis40, California, IKruiabook, A.M. (1992). Current Protogogsain Imunology Coligan, A.M. Kruisbeek, D.N.

Margulias, Shevach, and W. Strober, ads.) pp.

3.1.3-3.1.5. Greene Publish~ing and Wiley-Interscjence, New Yor.

-Lee at al.. (1582). Natura 294t229.

May,-R.O., and Fulton, R.J. (1992). Tn Vitro Mothods go-Tomigolocy(.. Watson, editor) pp. 9-20.

25 CRC Press Inc Boca Raton, Florida.

McCutlian eal1. (1-968). Hatl Calicer Inst.

30 Mueller at al. (1978). an2J. 1..:579.

Mulligan and Berg (1981). Proc. NatL. Acad. gpi, MPL U.:2072-2076.

3S Mulligan at al. (1981). Proc. Natl, Acad. Set.-USA 2_9:1078-2076.

Neumann at al. (1982). EMBO J .1:841.

Okeenberg, J.R. et al. (1993). Not-Ure 362:68-70.

Oksenberg, J.R. et al. (1990). Naur IUj:344-345.

Oisnes and Phil, (1982). "Chimueric Toxins"s, Phari.

Riechmann at al. (1988). Nature =a.:323-327.

Ruther and Muller-Hill (1963). MO _Z:1791.

Samubrook at al. (1989). In lNolecular Cloning: A Labgratory Manlual, Cold Spring Harbor, New York.

Sarver et al. (1981). Mi.l Call Bigd. 1:486.

0: .9 72 Schafner (.190l0). Proc. Nai cd c.USA 2163-2167.

Shilzatake and Rosenberg (1981). HtUX, 2922..

Southern and Berg (1982). J, Mol.p1~ 1:327-341.

so 1 Space at al. (1982). Coll. 22:295.

Spliter at al.. (1987). Rgero .4Z2717-1723.

:Stanley and Luzia (1984). ZN~j .1;1429.

Se tean (1993). Scientific Aieriean Street, S.E. at al. (1987). a-o =nl 20 I39:1734-1738.

,Studiar and Moffatt (1986). J. NaL. DiA2., 19:113.

$sees: sugden et al, (1985) xl. cll Bid, 410.

*see.:S1.fllaers and Smith (2985). In Ggantioglly Altered, Viruses and the nxionagsnt Fields at al. (Eds.) 22:319-328, Cold Spring Harbor Laboratory Fress, Cold 4: 00Spring Harbor, Now York.

Swanbcrq, R.N. (1983). LImmngl l&0_:503-510.

Thorpe et al. (1902). "Monoclonal Antibody-Toxin Conjugatess Aining the Mlagic gullet," kI=ng.l2ni] Antibohdiqsiq lnca eiie Academic Press, p 168-19G..

Vandenbarc, A.A. at al. (1985). L.i~ 1"~;223-228.

Vergs at al. (1987). w 4 35-4 17.

'Vitetta, E.S. at al. (1991). Cancer Re er-ch a: 4D05 2-4 058.

Wainer et al. (1989). Cancer Resarch aj:4062- 4067.

73 SEQUECM LISTINa GERAL INFORMXION APPLICANTS: AndreW Do Winberg (ii) TITLE OF IIVTIOf: TRELT(ENT OF CD4 T-CELL NEDIhTED CD)NDITIONS X M ER Or SEgUENCEU 3 C0.1mmPOHOENCZ

ADDRES

Gese ADDRFSSEE: Kijhar* J. ftlley, Esq.

La K3arquiat SparCzan Campbell Leigh whiniston STREET; S.W. Salmon Street, Suite 1600 CITY: Portl~id 6 15(D) S TATZ; Oreqerr as CoUmytRY United States of America DCb@UTEEL URUZIL FM i4 KMZM Disk, inef.

4bNPUTU: IBM PC comptible OPERATIG SYSTEM.: HS DOS D) SOFTWAREB. VardPerfect 1 (vi) CURRENT APPLMTOP DAT~t MPLI0ITION NUKBU: FILING DATE: aCLSMcATION: (vii) PPXOR APPLICATION DATkA: N/A APPLICATION NtTMDER: FILING DATE., (viii) AT ORNEY/AGENT =FORMATION (AL) SAME: Richard T3. Polley, Esq., REGISTRATION NUMBER: -28,107 REFEREBNCE/DOCKET NUNBER,. 4282-36649 (l)TELECOMMNCATION

INFORMATION:

TELEPHONE: (503) Z26-7391 TELEFAX: (503)'222-9446 74 *a a a Ca a.

as so SC C a -j a a Ca age a a 'Ca.

a So 5* a a G~ *1 a a a so a a a -a a a aaaaaa a *aa C a.

a SOda a 5 .10 INFORMCATION FOR SEQ ID NO; 1 SEQUENCE CHARACTERISTICS: LENOTH: 948 -bass pairs TYPE. Nucleic eaid STU~flRDK=.6 Double TOPOLOGY: Line&~ (ii) MOLECULE TYPE! CDNA tO IMA (ii KYPOTHETIC&L: 6o ijv) ANT'I-5mNIt No (vF) FRA(GNM( TYPLe (xi) SEQUEN3CE DESCPTIOK; SEQ ID NO: I! CGOC AGMSR LT oc emO 0c= OCT cG GG C1c GW C 0C*O M MX OCT w-t- eye val gly ala arg arg Ima 91y arg 9ir pro CYR 1 al&I q0 CC CTC mc m CT 7 A=C acc a= AcO. UOE cm CAC mL Lou a Im1* gly la %Ly Law. ear tr va.l tkw gly [mm. him it U 1

U

S

C

IQ T 9 0 W CC A= TIC 0 h=C &W G= am cyn val gly acp thr tyr pr war am~ ap arg TUC AO=CM OW~ AML W G A 20 70 is cys Azv Pro gLy Mau g3LY mat Val ear arg eye aurt thr va3. eya arg pra qy. SLy pcq gly phe 65 70 JW= 2CC AM coo TOe AM CDC TOO AM0 200 val mar mar Iym pro eye lys pr cya thr txp ICOT 00 AGT? GMA CGG AA.C CR4 CTA TGC AM0 GC war gly car glu arg lye gln lau cy. thr &I& 100 GOW TOT cac Toe OG G 00m GC cc CKG TCC CTG val, eye arg cya arg ale 91ly thr gin mar Lou 110 115 CC2 GOA GTE OMC TOT 0CC CCC TCO CMT CCA G040 pro gly ye]. amp cyn &Ia pro cyx pro pro gly 129 130 TG= T= c *m ny" *yW him glZ 4S AGC C~ CK6 ear egWtgin TIC w~ CC ty? an amp V813 75 TOT me CTC =A cys Ran

I=

ACK CAS GXO 1CK thr 91n amp thr 103 GAC ACC TIC AMD &up ear tyx lye.

3.20 CAC TTC PVC CCI his ph& max pro 135 29 329 37' 419 O3CC gly 0403 717 oAC RAC CAM asp &on gin AG CAC Ace ly him thr WeC TGC A.M ala cys lyn 140 OTOA 010 COO led gin pro Is$ CCC TG pro txp OC OT 81a mer ACC ACC TOT thr tbr Cys 145 AP MGC TOOA amat mar sar 160 ACC TT0 GTT thr Lo.u uval

ISO

GAG CC RTC asp &Ia Lie 165 75 T!r GhG GIIC ?,CG GAC CCC CCA GCC ?.CG Ca CCC GAG GAGQ ACC CiAQ 554 cy.; glu asp arg asp pro pro ala thr gin pro gin glu t3br i 170 175 ISO S wr C 0C= AGO ~ce ATC xm CTO cm ccc ACT ORA cce, To& 599 gly pco pro &Ila arg Vo 13.* thr va. In pro thr glu ala try MRCAG AMO Md =A A CCX !G CC04IC GAG GTC CC 44 30 pm~ ag thr ier gla g m pro thra mmX va.] glia vil Pio 200 210 =O OC 4 C ~0kC Gh O 0 C *TGTG 68*.

gly gly ozg &a&lal] ala aaa Us. leu gly lou gly lou vol lou 5215 220." 225 sea* OW0 MT CMC CCIL =C CTC GAC I=t CTS CTG GCC CTS ThC Cm:M:C 714 gly Lla .u gly pro leu sp LW' L~ou l.aua ala lom~ tyr lau Lie 230 2-15 740 Ltg Arg asp gIn arg lou pro pro amp ala hislye pVo pro gly: 641 4 24S 250 255 Go Gar WOC "Cv C=I 3C C A GAG Q CMC GC 0CC 524 *0gly g3.7 ow ph. arg thr pro Lle qln glu giu gin aLI asp *I& 260 532 C T= a= CT GTC JLAS flm MU Lisu mae tbzw lou va]. Lyn Vb '275A 76 Golse a GetS INFORMATION FOR SEQ TD NO. 2 SEQUENCE MH&RAPERISTICS.- LENGTH 24 baa. pairs Typx: Nucleic acid STRANDEDNESS.: SingLe TopmodxG: Liniear (iii) HYPOTEMICAL: No (iv) ANTJ:-SENSE: No (Xi) SZQMECE DESCRIONt SEM ID NO: 2: ATGTGCGTGG GeGCTCGGGC GGCTQ tMMMlNTION FOR SEQ ID NO: 3 Mi S=UENCE CARACTERMITI: is LZNGMT; 24 ba.me pairs TM: LIMI-Iftie mod.

STBAN~NES=: Singilm TOPOLWY: ~ine~ar (111) HYFOTM=QrtC'- jNd So (iv) AM=-6DISX! No (XL) SEQU2ZICE DESCRIPTIONS On XD NO: 3:

AM?

Claims (13)

1. 2. A method according to claim 1 wherein the Eaciflu binding agent is a specific binding partner able to bind a poliypeptide other than a protein consisting of the full sequence of human qp34 protein as defined in 5. Miura et al. Mol. Cell Riol. 11(3) (1991) pp 1313-1325. F *eo1 SOS. *4 A method according to claim 2 wherein said specific 20 binding agent specifically binds to human Ox-40 of amino as acid sequence encoded by the coding region of nucleic acid sequence Seq ID No 1, when said Ox-40 is present on the surface of activated T-cells.
2. 4. A method according to any one of claims 1 to 3 wherein said specific binding agent comprises an antibody binding domain. A method according to claim 4 wherein said specific binding agent comprises a monoclonal antibody or a binding -78 tragmenc. thereof. A method according to claim 5 wherein the specific binding agent is at leas-- partially humanised.
3. 7- A method according to claim 6 wherein the specific binding agent comprises a humanised monoclonal antibody.
4. 8. A method according to any one of claims 1 to 7 wherein the specific binding agent further comprises a molecularly linked cytotoxin-
5. 9. A method according to claim 8 wherein the specific binding agent comprises a Fab, or Pv fragment of a 5monoclonal antibody conjugated with a cytotoxic agent. 10, A method according to any one of claims 1 to 9 whereinl the specific binding agent further comprises a label.
6. 11. A method according to claim 10 wherein the 2label is a radioactive label.
7. 12. A method according to claim 10 wherein the label is a fluorescent label.
8. 13. A method according to claim 1, wherein sai~d specific binding agent comprises a monoclonal antibody, eg an antibody carrying a label for detect-ioii or quantitation, that binds substantially only to human QX-40 antigen. -79-
9. 14. A method according to any one oz claims 1 to 13 which is carried out or. a biopsy sample from the patient. A method according to claim 14 wherein the biopsy sample is from a patient suspected of having an inflammatory condition for detection of said condition. .10 s I S.. 20
10. 16. A method according to claim 15 wherein the biopsy sample is e.g. a skin or intestinal biopsy sample or a blood sample from a patient suspected of having a graft-versus- host disease.
11. 17. A method according to claim 15 wherein the biopsy sample, e.g. an intestinal biopsy sample, is from a patient suspected of having an inflammatory bowel disorder.
12. 18. A method according to claim 14 wherein the biopsy sample is a sample of cerebrospinal fluid.
13. 29. A kit for detecting a condition mediated by activated T-cells e.g. CD4' T-cells in a patient comprising a specific binding agent as defined in claim 10 or claim 11 or claim 12. 20. A kit for carrying out a specific binding assay for detection or quantitation of an analyte that comprises a polypeptide as defined in claim 1 or claim 2 or a specific binding agent as defined in claim 1 or claim 2, wherein said kit comprises a fir-st reagen: compriaini a specific binding agent that can recognise nhe analyte, a second reagent comprising a substance thaL can bind specifically either to the analyte or to the first reagent, and a label for the second reagent. 21. A kit according to claim 20, wherein the first reagent comprises an antibody specific for the analyte, and the second reagent comprises a labelled antiglobulin specific :10 for the first reagent. 22. A kit according to claim 20, wherein the first reagent comprises an immobilised specific binding reagent for the analyte, the second reagent is a specific binding agent that can bind to the analyte when the analyte is also bound to the first reagent. 23. A kit according to claim 20, wherein the second reagent comprises a substance able to compete with analyte for binding to the first reagent. 24. A kit for treating a condition mediated by activated T- cells, eg activated CD4- T cells, said kit comprising a container containing a suitable amount of a specific binding agent antibody according to any of claims 2 to 13 in a pharmaceutically acceptable excipient. Use of polypeptides as defined in claim 1 or claim 2 and/c:r specl-fic hindinq, =gents as defined in~ any one of claimns I to 1'I in specific binding reactions for detection or quantitation of polypeptides as defined in claim 1 or claimn 2 and/or specific binding agents complementary DATED this 4th day of November, 1998 Andrew Dale Weinberg AND Arthur Alan Vandenbark By DAVIES COLLISON CAV'E Patent Attorneys for the Applicants