AU780746B2 - Sphingosine kinase enzyme - Google Patents

Sphingosine kinase enzyme Download PDF

Info

Publication number
AU780746B2
AU780746B2 AU45239/00A AU4523900A AU780746B2 AU 780746 B2 AU780746 B2 AU 780746B2 AU 45239/00 A AU45239/00 A AU 45239/00A AU 4523900 A AU4523900 A AU 4523900A AU 780746 B2 AU780746 B2 AU 780746B2
Authority
AU
Australia
Prior art keywords
sphingosine kinase
sphingosine
sequence
activity
antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
AU45239/00A
Other versions
AU4523900A (en
Inventor
Richard James D'andrea
Jennifer Ruth Gamble
Stuart Maxwell Pitson
Mathew Alexander Vadas
Brian Wolff Wattenberg
Pu Xia
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Janssen Research and Development LLC
Original Assignee
Johnson and Johnson Pharmaceutical Research and Development LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AUPQ0339A external-priority patent/AUPQ033999A0/en
Priority claimed from AUPQ1504A external-priority patent/AUPQ150499A0/en
Application filed by Johnson and Johnson Pharmaceutical Research and Development LLC filed Critical Johnson and Johnson Pharmaceutical Research and Development LLC
Priority to AU45239/00A priority Critical patent/AU780746B2/en
Priority claimed from PCT/AU2000/000457 external-priority patent/WO2000070028A1/en
Publication of AU4523900A publication Critical patent/AU4523900A/en
Assigned to JOHNSON & JOHNSON PHARMACEUTICAL RESEARCH & DEVELOPMENT LLC reassignment JOHNSON & JOHNSON PHARMACEUTICAL RESEARCH & DEVELOPMENT LLC Alteration of Name(s) of Applicant(s) under S113 Assignors: JOHNSON & JOHNSON RESEARCH PTY. LIMITED
Application granted granted Critical
Publication of AU780746B2 publication Critical patent/AU780746B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Landscapes

  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Description

WO 00/70028 PCT/AU00/00457 -1- SPHINGOSINE KINASE ENZYME FIELD OF THE INVENTION The present invention relates generally to novel protein molecules and to derivatives, analogues, chemical equivalents and mimetics thereof capable of modulating cellular activity and, in particular, modulating cellular activity via the modulation of signal transduction.
More particularly, the present invention relates to human sphingosine kinase and to derivatives, analogues, chemical equivalents and mimetics thereof. The present invention also contemplates genetic sequences encoding said protein molecules and derivatives, analogues, chemical equivalents and mimetics thereof. The molecules of the present invention are useful in a range of therapeutic, prophylactic and diagnostic applications.
BACKGROUND OF THE INVENTION Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description.
Sphingosine kinase is a key regulatory enzyme in a variety of cellular responses. Its activity can affect inflammation, apoptosis and cell proliferation, and thus it is an important target for therapeutic intervention.
Sphingosine-1-phosphate is known to be an important second messenger in signal transduction (Meyer et al., 1997). It is mitogenic in various cell types (Alessenko, 1998; Spiegel et al., 1998) and appears to trigger a diverse range of important regulatory pathways including; prevention of ceramide-induced apoptosis (Culliver et al., 1996), mobilisation of intracellular calcium by an IP 3 -independant pathway, stimulation of DNA synthesis, activation of mitogen-activated protein (MAP) kinase pathway, activation of phospholipase D, and regulation of cell motility (for reviews see Meyer et al., 1997; Spiegel et al., 1998; Igarashi., 1997).
WO 00/70028 PCT/AU00/00457 -2- Recent studies (Xia et al.. 1998) have shown that sphingosine-1 -phosphate is an obligatory signalling intermediate in the inflammatory response of vascular endothelial cells to tumour necrosis factor-a (TNFa). In spite of its obvious importance, very little is known of the mechanisms that control cellular sphingosine-l-phosphate levels. It is known that sphingosine-1-phosphate levels in the cell are mediated largely by its formation from sphingosine by sphingosine kinase, and to a lesser extent by its degradation by endoplasmic reticulum-associated sphingosine-1-phosphate lyase and sphingosine-1-phosphate phosphatase (Spiegel et al., 1998). Basal levels of sphingosine-1-phosphate in the cell are generally low, but can increase rapidly and transiently when cells are exposed to mitogenic agents. This response appears correlated with an increase in sphingosine kinase activity in the cytosol and can be prevented by addition of the sphingosine kinase inhibitory molecules N,N-dimethylsphingosine and DL-threo-dihydrosphingosine. This indicates that sphingosine kinase is an important molecule responsible for regulating cellular sphingosine-1-phosphate levels. This places sphingosine kinase in a central and obligatory role in mediating the effects attributed to sphingosine-1-phosphate in the cell.
Accordingly, there is a need to identify and clone novel sphingosine kinase molecules to facilitate the progression towards the more sensitive control of intracellular signal transduction via, for example, the elucidation of the mechanism controlling the expression and enzymatic activity of sphingosine kinase thereby providing a platform for the development of interventional therapies to regulate the expression or activity of sphingosine kinase. In work leading up to the present invention the inventors have purified and cloned a novel sphingosine kinase molecule.
SUMMARY OF THE INVENTION The subject specification contains nucleotide and amino acid sequence information prepared using the programme PatentIn Version 2.0, presented herein after the bibliography. Each nucleotide or amino acid sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier <210>1, <210>2, etc). The length, type of sequence (DNA, protein (PRT), etc) and source organism for each nucleotide or WO 00/70028 PCT/AUOO/00457 amino acid sequence are indicated by information provided in the numeric indicator fields <211>, <212> and <213>. respectively. Nucleotide and amino acid sequences referred to in the specification are defined by the information provided in numeric indicator field <400> followed by the sequence identifier <400>1, <400>2, etc).
Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
One aspect of the present invention provides an isolated nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence encoding or complementary to a sequence encoding a novel sphingosine kinase protein or a derivative or mimetic of said sphingosine kinase protein.
Another aspect of the present invention provides an isolated nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence encoding or complementary to a sequence encoding a human sphingosine kinase protein or a derivative or mimetic of said sphingosine kinase protein.
Yet another aspect of the present invention provides a nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a nucleotide sequence encoding, an amino acid sequence substantially as set forth in <400>2 or a derivative or mimetic thereof or having at least about 45% or greater similarity to at least 10 contiguous amino acids in <400>2.
Still another aspect of the present invention contemplates a nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence substantially as set forth in <400>1 or a derivative thereof or capable of hybridising to <400>1 under low stringency conditions.
WO 00/70028 PCT/AU00/00457 -4- Still yet another aspect of the present invention contemplates a nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence substantially as set forth in <400>1 or a derivative thereof, or capable of hybridising to <400>1 under low stringency conditions and which encodes an amino acid sequence corresponding to an amino acid sequence set forth in <400>2 or a sequence having at least about 45% similarity to at least contiguous amino acids in <400>2.
A further aspect of the present invention contemplates a nucleic acid molecule comprising a sequence of nucleotides substantially as set forth in <400>1.
Another further aspect of the present invention contemplates a genomic nucleic acid molecule orderivative or analogue thereof capable of hybridising to <400>1 or a derivative thereof under low stringency conditions at 42°C.
Still another further aspect of the present invention provides a cDNA sequence comprising a sequence of nucleotides as set forth in <400>1 or a derivative or analogue thereof including a nucleotide sequence having similarity to <400>1.
Yet another further aspect of the present invention provides an amino acid sequence set forth in <400>2 or a derivative, analogue or chemical equivalent or mimetic thereof as defined above or a derivative or mimetic having an amino acid sequence of at least about similarity to at least 10 contiguous amino acids in the amino acid sequence as set forth in <400>2 or a derivative or mimetic thereof.
Stil yet another further aspect of the present invention is directed to an isolated protein selected from the list consisting of: A novel sphingosine kinase protein or a derivative, analogue, chemical equivalent or mimetic thereof.
WO 00/70028 PCT/AU00/00457 (ii) A human sphingosine kinase protein or a derivative, analogue, chemical equivalent or mimetic thereof.
(iii) A protein having an amino acid sequence substantially as set forth in <400>2 or a derivative or mimetic thereof or a sequence having at least about 45% similarity to at least 10 contiguous amino acids in <400>2 or a derivative, analogue, chemical equivalent or mimetic of said protein.
(iv) A protein encoded by a nucleotide sequence substantially as set forth in <400>1 or a derivative or analogue thereof or a sequence encoding an amino acid sequence having at least about 45% similarity to at least 10 contiguous amino acids in <400>2 or a derivative, analogue, chemical equivalent or mimetic of said protein.
A protein encoded by a nucleic acid molecule capable of hybridising to the nucleotide sequence as set forth in <400>1 or a derivative or analogue thereof under low stringency conditions and which encodes an amino acid sequence substantially as set forth in <400>2 or a derivative or mimetic thereof or an amino acid sequence having at least about 45% similarity to at least 10 contiguous amino acids in <400>2.
(vi) A protein as defined in paragraphs or (ii) or (iii) or (iv) or in a homodimeric form.
(vii) A protein as defined in paragraphs or (ii) or (iii) or (iv) or in a heterodimeric form.
Another aspect of the present invention contemplates a method of modulating activity of sphingosine kinase in a mammal, said method comprising administering to said mammal a modulating effective amount of an agent for a time and under conditions sufficient to increase or decrease sphingosine kinase activity.
WO oon70028 PCT/AU00/00457 -6- Still another aspect of the present invention contemplates a method of modulating cellular functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding sphingosine kinase or sufficient to modulate the activity of sphingosine kinase.
Yet another aspect of the present invention contemplates a method of modulating cellular functional activity in a mammal said method comprising administering to said mammal an effective amount of sphingosine kinase or sphingosine kinase.
Still yet another aspect of the present invention relates to a method of treating a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of sphingosine kinase or sufficient to modulate the activity of sphingosine kinase wherein said modulation results in modulation of cellular functional activity.
A further aspect of the present invention relates to a method of treating a mammal said method comprising administering to said mammal an effective amount of sphingosine kinase or sphingosine kinase for a time and under conditions sufficient to modulate cellular functional activity.
Yet another further aspect of the present invention relates to the use of an agent capable of modulating the expression of sphingosine kinase or modulating the activity of sphingosine kinase in the manufacture of a medicament for the modulation of cellular functional activity.
A further aspect of the present invention relates to the use of sphingosine kinase or sphingosine kinase in the manufacture of a medicament for the modulation of cellular functional activity.
WO 00/70028 PCT/AU00/00457 -7- Still yet another aspect of the present invention relates to agents for use in modulating sphingosine kinase expression or sphingosine kinase activity wherein said modulation results in modulation of cellular functional activity.
Another aspect of the present invention relates to sphingosine kinase or sphingosine kinase for use in modulating cellular functional activity.
In a related aspect of the present invention, the mammal undergoing treatment may be a human or an animal in need of therapeutic or prophylactic treatment.
In yet another further aspect the present invention contemplates a pharmaceutical composition comprising sphingosine kinase, sphingosine kinase or an agent capable of modulating sphingosine kinase expression or sphingosine kinase activity together with one or more pharmaceutically acceptable carriers and/or diluents. Sphingosine kinase, sphingosine kinase or said agent are referred to as the active ingredients.
Yet another aspect of the present invention contemplates a method for detecting sphingosine kinase or sphingosine kinase mRNA in a biological sample from a subject said method comprising contacting said biological sample with an antibody specific for sphingosine kinase or sphingosine kinase mRNA or its derivatives or homologs for a time and under conditions sufficient for an antibody-sphingosine kinase or antibody-sphingosine kinase mRNA complex to form, and then detecting said complex.
wo oono028 WO 0070028PCT/AUOO/00457 -8- Single and three letter abbreviations used throughout the specification are defined in Table 1.
TABLE 1 Single and three letter amino acid abbreviations Amnino Acid Three-letter One-letter Abbreviation Symbol Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C Glutamnine Gin Q Glutamic acid Glu E Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine The T Tryptophan Trp W Tyrosine Tyr Y Valine Val V Any residue Xaa X WO 00/70028 PCT/AU00/00457 -9- BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic representation of the 'Sphingomyelin pathway'.
Figure 2 is a graphical representation of anion exchange chromatography of human sphingosine kinase. A, Anion exchange chromatography with Q Sepharose fast flow of the
(NH
4 )2SO 4 precipitated fraction of the human placenta extract showing two peaks of sphingosine kinase activity. Extracts were applied in buffer A and sphingosine kinase activity was eluted with a NaC 1 gradient of 0 to 1M Protein eluted was followed by absorbance at 280 nm Figure 3 is a graphical representation of the purification of human placenta SKI by anion exchange chromatography. Purification on a Mono-Q column is enhanced by reapplication and elution from the same column in the presence of ATP. A, The fractions from the calmodulin-Sepharose 4b column containing sphingosine kinase activity were pooled, desalted and applied to the Mono-Q column in buffer A. B, Active fractions from the Mono- Q column were desalted and reapplied to the Mono-Q column in buffer A with 1 mM ATP and 4mM MgCl 2 In both cases sphingosine kinase activity was eluted with a NaCl gradient of 0 to 1M with protein elution followed by absorbance at 280 nm Figure 4 is an image of SDS-PAGE of purified human placenta sphingosine kinase. The fraction from the Superdex 75 column containing the highest sphingosine kinase activity was applied to SDS-PAGE with silver staining, yielding a single oand of 45 kDa.
Figure 5 is a graphical representation of preparative anion exchange chromatography. Only a single chromatographically identified sphingosine kinase isoform is present in HUVEC.
Preparative anion exchange chromatography with HiTrap-Q columns of human placenta, HUVEC and TNFa treated HUVEC extracts showing, in HUVEC, the presence of a single sphingosine kinase peak that increases in activity following treatment of cells with TNFa.
Cells were harvested, lysed and the soluble extracts applied to the HiTrap-Q column in buffer A. Total sphingosine kinase activity in human placenta, HUVEC and TNFa treated WO 00/70028 PCT/AU00/00457 HUVEC extracts were 51, 78 and 136 U/mg protein, respectively. Sphingosine kinase activity was eluted with a NaC 1 gradient of 0 to 1M Figure 6 is a schematic representation of the strategy used to clone sphingosine kinase (SPHK) from HUVEC.
Figure 7 is a schematic representation of the nucleotide (<400>1) and deduced amino acid (<400>2) sequences and putative domain structure of human sphingosine kinase. A, cDNA nucleic acid sequence and the deduced amino acid sequence ofhSK. Amino acids are numbered from the first methionine residue. The stop codon is indicated by an asterisk. The sphingosine kinase coding region is in capital letters (nucleotides 33-1187), while lower case letters denote untranslated and vector sequence. B, Schematic representation of human sphingosine kinase showing locations of the putative PKC and CKII phosphorylation sites, a possible N-myristoylation site, calcium/calmodulin binding motifs and the region with similarity to the putative DGK catalytic domain.
Figure 8 is a graphical representation of the expression and TNFa stimulation of human sphingosine kinase activity in HEK293 cells. HEK293 cells transiently transfected with either empty pcDNA expression vector alone or pcDNA containing human sphingosine kinase cDNA Transfected cells were either untreated or treated with TNFa for 10 min, harvested and sphingosine kinase activity in cell lysates determined. Data are means of duplicates and are representative of three independent experiments.
Figure 9 is a schematic representation of the sequence comparison of human sphingosine kinase with other known and putative sphingosine kinases. Comparison of the deduced human sphingosine kinase amino acid sequence with the amino acid sequences of the murine (mSKla and mSKlb; Kohama et al., 1998) and S. cereviaiae (LCB4 and LCB5; Nagiec et al., 1998) sphingosine kinases, and EST sequences of putative sphingosine kinases from S.
pombe and C. elegans (GenbankT' accession numbers Z98762 and Z66494, respectively).
Although the amino acid sequence similarity to human sphingosine kinase was high (36% identity), the A. thaliana putative sphingosine kinase sequence (Genbank T M accession WO 00/70028 PCT/AUOO/00457 -llnumber AL022603) gave relativey poor alignment and, for clarity, is not shown. The consensus sequence represents amino acids that are conserved in at least six of the seven aligned sequences, while conservation of structurally similar amino acids are denoted with an asterisk. Multiple sequence alignment was performed with CLUSTALW, and percentage identities to the human sphingosine kinase were determined using the GAP algorithm (Needleman Wunsch, 1970).
Figure 10 is an image of the expression of recombinant human sphingosine kinase in E. coli BL21. E. coli BL21 was transformed with the pGEX4-2T human sphingosine kinase expression construct and expression of the GST-SK fusion protein analysed after induction with 100 pM IPTG. A, Sphingosine kinase activity in uninduced and IPTG induced E. coli BL21 cell extracts. B, Coomassie stained SDS-PAGE gel showing GST-SK fusion protein expression in E. coli cell lysates. C, Purity of the isolated recombinant human sphingosine kinase. The fraction from the Mono-Q column containing sphingosine kinase activity was applied to SDS-PAGE with silver staining yielding a single band of 45 kDa.
Figure 11 is an image of the purification of recombinant human sphingosine kinase.
Calmodulin Sepharose 4B allows the separation of active and inactive enzyme. The GST- SK fusion protein was partially purified using glutathione-Sepharose 4B, cleaved by thrombin and applied to the calmodulin-Sepharose 4B column in Buffer B containing 4 mM CaC 2. Elution of the active sphingosine kinase bound to the column was performed with Buffer A containing 2 mM EGTA and 1 M NaC1. A, SDS-PAGE analysis of fractions eluted from the calmodulin-Sepharose 4B column. B, Sphingosine kinase activity in column fractions showing most of the recombinant human sphingosine kinase protein did not bind to the column and displayed no catalytic activity.
Figure 12 is a graphical representation of the physico-chemical properties of the native and recombinant sphingosine kinases. A, pH optima. The effect of pH on SK activity was determined by assaying the activity over the pH range of 4 to 11 in 50 mM buffers (sodium acetate, pH 4.0-5.0; Mes, pH 6.0-7.0; Hepes, pH 7.0-8.2; Tris/HC1, pH 8.2-10.0; Caps, pH 10.0-11.0). B, pH stability. Data shown is the SK activity remaining after preincubation of WO 00/70028 PCT/AU00/00457 -12the enzymes at various pH at 4 0 C for 5h. C, Temperature stability. Data shown is the SK activity remaining after preincubation of the enzymes at various temperatures (4 to 80 0 C) for min at pH 7.4 (50mM Tris/HC1 containing 10% glycerol. 0.5 M NaCi and 0.05% Triton X-100). D, Metal ion requirement. The various metal ions or EDTA were supplied in the assay mixture at a final concentration of 10 mM. In all cases the maximum activities of the native (0 and filled bars) and recombinant (O and open bars) sphingosine kinases were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU, respectively. Data are means
S.D.
Figure 13 is a graphical representation of the substrate specificity and kinetics of the native and recombinant sphingosine kinases. A, Substrate specificity of the native (filled bars) and recombinant (open bars) sphingosine kinases with sphingosine analogues and other lipids supplied at 100 pM in 0.25% Triton X-100. The rates ofphosphorylation of sphingosine by the native and recombinant Sks were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU, respectively. Activity against other potential substrates were expressed relative to the activity against sphingosine. No phosphorylation was observed with DL-threodihydrosphingosine, N,N-dimethylsphingosine, N,N,N,-trimethylsphingosine, Nacetylsphingosine (C,-ceramide), diacylglycerol (1,2-dioctanoyl-sn-glycerol and 1,2dioleoyl-sn-glycerol), and phosphatidylinositol. B, Substrate kinetics of the recombinant human sphingosine kinase with sphingosine and D-erythro-dihydrosphingosine as substrates. C, Kinetics if inhibition of the recombinant human sphingosine kinase with N,N,N-trimethylsphingosine at 5 ViM and 25 pM and in the absence of N,N,Ntrimethylsphingosine Inset: Lineweaver-Burk plot. Data are means S.D.
Figure 14 is a graphical representation of the acidic phospholipids which stimulate the activity of the native and recombinant sphingosine kinases. The effect of various phospholipids on the activity of the native and recombinant sphingosine kinases were determined by assaying the activity under standard conditions in the presence if these phospholipids at 10 mol% of Triton X-100. The activities of the native (filled bars) and recombinant (open bars) sphingosine kinases in the absence of phospholipids were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU, respectively. PC, phosphatidylcholine; WO 00/70028 PCT/AUOO/00457 13- PS, phosphatidylserine; PE. phosphat idyl ethanolamine:- PI phosphat idylinos itol1; PA, phosphatidic acid. Data are means S.D.
WO 00/70028 PCT/AU00/00457 14- DETAILED DECRIPTION OF THE INVENTION The present invention is predicated, in part, on the purification and cloning of a novel sphingosine kinase molecule. The identification of this novel molecule permits the identification and rational design of a range of products for use in therapy, diagnosis and antibody generation, for example for use in signal transduction. These therapeutic molecules may also act as either antagonists or agonists of sphingosine kinase function and will be useful, inter alia, in the modulation of cellular activation in the treatment of disease conditions characterised by unwanted cellular activity.
Accordingly, one aspect of the present invention provides an isolated nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence encoding or complementary to a sequence encoding a novel sphingosine kinase protein or a derivative or mimetic of said sphingosine kinase protein.
Reference to "sphingosine kinase" should be understood as a reference to the molecule which is, inter alia, involved in the generation of sphingosine-1-phosphate during the activation of the sphingosine kinase signalling pathway. Reference to "sphingosine kinase" in italicised text should be understood as a reference to the sphingosine kinase nucleic acid molecule. Reference to "sphingosine kinase" in non-italicised text should be understood as a reference to the sphingosine kinase protein molecule.
More parti ularly, the present invention provides an isolated nucleic acid molecule or derivati% e or analogue thereof comprising a nucleotide sequence encoding of complementary to a sequence encoding a human sphingosine kinase protein or a derivative or mimetic of said sphingosine kinase protein.
In a preferred embodiment, the present invention provides a nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a nucleotide sequence encoding, an amino acid sequence WO 00/70028 PCT/AU00100457 substantially as set forth in <400>2 or a derivative or mimetic thereof or having at least about 45% or greater similarity to at least 10 contiguous amino acids in <400>2.
The term "similarity" as used herein includes exact identity between compared sequences at the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, "similarity" includes amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. The percentage similarity may be greater than such as at least 70% or at least 80% or at least 90% or at least 95% or higher.
Another aspect of the present invention contemplates a nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence substantially as set forth in <400> 1 or a derivative thereof, or capable of hybridising to <400>1 under low stringency conditions.
Reference herein to a low stringency includes and encompasses from at least about 0% v/v to at least about 15% v/v formamide and from at least about 1M to at least about 2M salt for hybridisation, and at least about 1M to at least about 2M salt for washing conditions.
Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at least about 0.5M to at least about 0.9M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01M to at least about 0. 15M salt for hybridisation, and at least about 0.01M to at least about 0. 15M salt for washing conditions.
Stringency may be measured using a range of temperature such as from about 40'C to about Particularly useful stringency conditions are at 42 0 C. In general, washing is carried out at T, 69.3 0.41 (G C) [19] -12°C. However, the Tm ofa duplex DNA decreases by I°C with every increase of 1% in the number of mismatched based pairs (Bonner et al (1973) J. Mol. Biol, 81:123).
WO 00/70028 PCT/AU00/00457 16- Preferably, the present invention contemplates a nucleic acid molecule or derivative or analogue thereof comprising a nucleotide sequence substantially as set forth in <400>1 or a derivative thereof or capable of hybridising to <400>1 under low stringency conditions and which encodes an amino acid sequence corresponding to an amino acid sequence set forth in <400>2 or a sequence having at least about 45% similarity to at least 10 contiguous amino acids in <400>2.
More particularly, the present invention contemplates a nucleic acid molecule comprising a sequence of nucleotides substantially as set forth in <400>1.
The nucleic acid molecule according to this aspect of the present invention corresponds herein to human sphingosine kinase. Without limiting the present invention to any one theory or mode of action, the protein encoded by sphingosine kinase is a key element in the functioning of the sphingosine kinase signalling pathway. Sphingosine kinase acts to facilitate the generation of the second messenger, sphingosine-1-phosphate, and may be activated by: post-translational modifications such as phosphorylation or proteolytic cleavage; protein-protein interactions such as dimerisation, and G protein-coupled receptor mediated interactions; translocational events where the enzyme is targeted to an environrnmnt that increases catalytic activity or allows access to its substrate.
The expression product of the human sphingosine kinase nucleic acid molecule is human sphingosine kinase. Sphingosine kinase is defined by the amino acid sequence set forth in <400>2. The cDNA sequence for sphingosine kinase is defined by the nucleotide sequence set forth in <400>1. The nucleic acid molecule encoding sphingosine kinase is preferably a sequence of deoxyribonucleic acids such as a cDNA sequence or a genomic sequence. A WO 00/70028 PCT/AU00/00457 -17genomic sequence may also comprise exons and introns. A genomic sequence may also include a promoter region or other regulatory regions.
Another aspect of the present invention contemplates a genomic nucleic acid molecule or derivative thereof capable of hybridising to <400>1 or a derivative thereof under low stringency conditions at 42 0
C.
Reference herein to sphingosine kinase and sphingosine kinase should be understood as a reference to all forms of human sphingosine kinase and sphingosine kinase, respectfully, including, for example, any peptide and cDNA isoforms which arise from alternative splicing of sphingosine kinase mRNA, mutants or polymorphic variants of sphingosine kinase or sphingosine kinase, the post-translation modified form of sphingosine kinase or the non-post-translation modified form of sphingosine kinase. To the extent that it is not specified, reference herein to sphingosine kinase and sphingosine kinase includes reference to derivatives, analogues, chemical equivalents and mimetics thereof.
The protein and/or gene is preferably from the human. However, the protein and/or gene may also be isolated from other animal or non-animal species.
Derivatives include fragments, parts, portions, mutants, variants and mimetics from natural, synthetic or recombinant sources including fusion proteins. Parts or fragments include, for example, active regions of sphingosine kinase. Derivatives may be derived from insertion, deletion or substitution of amino acids. Amino acid insertional derivatives include amino and/or carboxylic terminal fusions as well as intrasequence insertions of single or multiple amino acids. Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the protein although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterized by the removal of one or more amino acids from the sequence.
Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. An example of substitutional amino acid variants are conservative amino acid substitutions. Conservative amino acid WO 00/70028 PCT/AU00/00457 18substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine: and phenylalanine and tyrosine. Additions to amino acid sequences including fusions with other peptides, polypeptides or proteins.
Chemical and functional equivalents of sphingosine kinase or sphingosine kinase should be understood as molecules exhibiting any one or more of the functional activities of sphingosine kinase or sphingosine kinase and may be derived from any source such as being chemically synthesized or identified via screening processes such as natural product screening.
The derivatives of sphingosine kinase include fragments having particular epitopes or parts of the entire sphingosine kinase protein fused to peptides, polypeptides or other proteinaceous or non-proteinaceous molecules.
Analogues of sphingosine kinase contemplated herein include, but are not limited to, modification to side chains, incorporating of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteinaceous molecules or their analogues.
Derivatives of nucleic acid sequences may similarly be derived from single or multiple nucleotide substitutions, deletions and/or additions including fusion with other nucleic acid molecules. The derivatives of the nucleic acid molecules of the present invention include oligonucleotides, PCR primers, antisense molecules, molecules suitable for use in cosuppression and fusion of nucleic acid molecules. Derivatives of nucleic acid sequences also include degenerate variants.
Examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH 4 amidination with methylacetimidate; acylation with WO 00/70028 PCT/AU00/00457 -19acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with followed by reduction with NaBH 4 The guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitisation, for example, to a corresponding amide.
Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides.
Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carboethoxylation with diethylpyrocarbonate.
Examples of incorporating unnatural amino acids and derivatives during protein synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3-hydroxyacid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, omithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D- WO 00/70028 PCT/AUOO00457 isomers of amino acids. A list of unnatural amino acid contemplated herein is shown in Table 2.
wo oono028 WO 0070028PCT/AUO0100457 -21- TABLE 2 Non-conventional Code Non-conventional Code amino acid amino acid tx-aminobutyric acid c-amino-ax-methylbutyrate amninocyclopropanecarboxylate amninoisobutyric acid amninonorbornylcarboxylate cyclohexylalanine cyclopentylalanine D-alanine D-arginine D-aspartic acid D-cysteine D-glutamnine D-glutamic acid D-histidine D-isoleucine D-leucine D-lysine D-methionine D-omnithine D-phenylalanine D-proline D-serine D-threonine D-tryptophan D-tyrosine D-valine Abu Mgabu Cpro Aib Norb Cpen Dal Darg Dasp Dcys Dgln Dglu Dhis Dule Dileu Dlys Dmet Dom Dphe Dpro Dser Dthr Dtrp Dtyr Dval L-N-methylalanine L-N-methylarginine L-N-methy lasparagine L-N-methylaspartic acid L-N-methylcysteine L-N-methylglutamine L-N-methylglutamic acid Chexa L-N-methylhistidine L-N-methylisolleucine L-N-methylleucine L-N-methyllysine L-N-methylmethionine L-N-methylnorleucine L-N-methylnorvaline L-N-methylornithine L-N-methylphenylalanine L-N-methylproline L-N-methylserine L-N-methylthreonine L-N-methyltryptophan L-N-methyltyrosine L-N-methylvaline L-N-methylethylglycine L-N-methyl-t-butylglycine L-norleucine L-norvaline rx-methyl-aminoisobutyrate ax-methyl-y-aminobutyrate Nmala Nmarg Nmasn Nrnasp Nmcys Nmgln Nmglu Nmnhis Nmile Nmleu Nmlys Nmmet Nmnle Nmnva N morn Nmphe Nmpro Nmser Nmthr Nmtrp Nmtyr Nmval Nmetg Nmtbug NMe Nva Maib Mgabu WO 00/70028 WO 0070028PCT/AUOO/00457 D-cc-i-ethvla lani ne D-a-i-nethylarginine D-ac-metlvasparagine D-a-i-nethylaspartate D-a-methylcysteine D-a-methylglutamine D-a-methylhistidine D-a-methylisoleucine D-a-methyl leucine D-a-methyllysine D-a-rnethylImethion mne D-a-methylornithine D-a-methylphenylalanine D-u-methylproline D-a-methylserine D-a-methylthreonine D-a-methyltryptophan D-a-methyltyrosine D-a-methylvaline D-N-methylalanine D-N-methylarginine D-N-methylasparagine D-N-methylaspartate D-N-methy Icysteine D-N-methylglutamine D-N-methylglutamate D-N-methylhistidine D-N-methyl isoleucine D-N-methyl leucine D-N-methyllysine N-methylcyclohexy laIan ine D-N-methylornithine N-methylglycine Dmala Dmar2 Dmasn Dmnas p Dmcys Dmgln Dmhis Dmile Dmleu Drnlys Drnet Dmom Dmnphe Dmnpro Dmnser Dmthr Dmtrp Dmnty Dmnval Dnmala Dnmarg Dnmasn Dnniasp Dnmcys Dnmgln Dnmglu Dnmhis Dnniile Dnrnleu Dnnilys Nmchexa Dnmom Nala a-rnethvlcvc lohexy lalani ne a-rnethylcy lcopenty lalan ine a-inethyl-a-napthylalaiiine a-methylpenici I lamnine N-(4-aminobutyl)glycine N-(2-aminoethyl)glycine N-(3-arninopropyl)glycine N-am ino-a-mrethylbutyrate a-napthylalanine N-benzylglycine N-(2-carbamylethyl)glycine N-(carbamylmethyl)glycine N-(2-carboxyethyl)glyci ne N-(carboxymethyl)glycine N-cyclobutylglycine N-cycloheptylglycine N-cyclohexylglycine N-cyclodecylglycine N-cylcododecylglycine N-cyclooctylglycine N-cyclopropylglycine N-cycloundecylglycine N-(2,2-diphenylethyl)glycine N-(3,3-diphenylpropyl)glycine N-(3-guanidinopropyl)glycine I -hydroxyethyl)glycine N-(hydroxyethyl))glycine N-(imidazolylethyl))glycine N-(3-indolylyethyl)glycine N-methyl-y-aminobutyrate D-N-methylmeth ion inc N-methylcyclopentylalanine D-N-methylphenylalanine Mchexa Mcpen Manap Mpen Nglu Naeg Norn N rnaabu Anap Nphe Ngin Nasn N glu Nasp Ncbut Nchep Nchex Ncdec Ncdod Ncoct Ncpro Ncund Nbhm Nbhe Narg Nthr Nser Nhis Nhtrp Nmgabu Dnmmet Nmcpen Dnmphe WO 00/70028 WO 0070028PCTIAUOO/00457 23 N- methyIa rn in o isobutvrate Nmaib N-(l -r-nethlpropyl)glycine Nile N-(2-rnethylpropyl)glycine N leu D-N-r-nethyltryptophan Dnmtrp D-N-methyltyrosine Dnmtyr D-N-rnethylvaline Dnmval y-aminobutyric acid Gabu L-t-butylglycine Tbug L-ethylglycine Etg L-homophenylalanine Hphe L-a-methylarginine Marg L-a-methylaspartate Masp L-a-methylcysteine Mcys L-a-methylglutamine Mgln L-a-methylhistidine Mhis L-a-methylisoleucine Mile L-a-methylleucine Mleu L-a-methylmethionine Mmet L-a-methyinorvaline Mnva L-a-methylphenylalanine Mphe L-a-methylserine Mser L-a-methyltryptophan Mtrp L-u-methylvaline Mval N-(N-(2,2-diphenylethyl) Nnbhm carbamylmethyl)glycine I -carboxy- 1 -(2,2-diphenyl-Nmbc ethylamino)cyclopropane D-N-methylproi me D-N-methylserine D-N-methy lthireonine I -mnethyletliyl)glycine N-methyla-napthylalanine N-methylpenicilIlamnine N-(p-hydroxyphenyl)gl\ycine N-(thiornethyl)glycine penicillamine L-c-methylalanine L-a-methylasparagine L-a-methyl-l-butylglycine L-methylethylglycine L-a-methylIglutamate L-a-methylhomophenylaianine N-(2-methylthioethyl)glycine L-ca-methyllysine L-ca-methylnorleucine L-a-methylornithine L-u-methylproline L-a-methylthreonime L-a-methyltyrosine L-N-methylhomophenylalanine N-(N-(3,3-diphenylpropyl) carbamylmethyl)glycine Dnmpro Dnmser Dnmthr N val Nrnanap Nmnpen Nhtyr Ncys Pen Mala Masn Mtbug Metg Mgl u Mhphe Nmet Mlys Mnle Morn Mpro Mthr Mtyr Nmhphe Nnbhe Crosslinkers can be used, for example, to stabilise 3D conformations, using homobifunctional crosslinkers such as th-e bifunctional imido esters having (CH2)n spacer groups with n=1 to n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero- bifunctional WO 00/70028 PCT/AU00/00457 -24reagents which usually contain an amino-reactive moiety such as N-hydroxysuccinimide and another group specific-reactive moiety.
The nucleic acid molecule of the present invention is preferably in isolated form or ligated to a vector, such as an expression vector. By "isolated" is meant a nucleic acid molecule having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject nucleic acid molecule, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about 40-50%, even still more preferably at least about 60-70%, yet even still more preferably 80-90% or greater of subject nucleic acid molecule relative to other components as determined by molecular weight, encoding activity, nucleotide sequence, base composition or other convenient means. The nucleic acid molecule of the present invention may also be considered, in a preferred embodiment, to be biologically pure.
The term "protein" should be understood to encompass peptides, polypeptides and proteins.
The protein may be glycosylated or unglycosylated and/or may contain a range of other molecules fused, linked, bound or otherwise associated to the protein such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins. Reference hereinafter to a "protein" includes a protein comprising a sequence of amino acids as well as a protein associated with other molecules such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins.
In a particularly preferred embodiment, the nucleotide sequence corresonding to sphingosine kinase is a cDNA sequence comprising a sequence of nucleotides as set forth in <400>1 or a derivative or analogue thereof including a nucleotide sequence having similarity to <400>1.
A derivative of a nucleic acid molecule of the present invention also includes a nucleic acid molecule capable of hybridising to a nucleotide sequence as set forth in <400>1 under low stringency conditions. Preferably, low stringency is at 42 0
C.
WO 00/70028 PCT/AUOO/00457 The nucleic acid molecule may be ligated to an expression vector capable of expression in a prokaryotic cell E.coli) or a eukarvotic cell yeast cells, fungal cells, insect cells, mammalian cells or plant cells). The nucleic acid molecule may be ligated or fused or otherwise associated with a nucleic acid molecule encoding another entity such as, for example, a signal peptide. It may also comprise additional nucleotide sequence information fused, linked or otherwise associated with it either at the 3' or 5' terminal portions or at both the 3' and 5' terminal portions. The nucleic acid molecule may also be part of a vector, such as an expression vector. The latter embodiment facilitates production of recombinant forms of sphingosine kinase which forms are encompassed by the present invention.
The present invention extends to the expression product of the nucleic acid molecules as hereinbefore defined.
The expression product is sphingosine kinase having an amino acid sequence set forth in <400>2 or is a derivative, analogue or chemical equivalent or mimetic thereof as defined above or is a derivative or mimetic having an amino acid sequence of at least about similarity to at least 10 contiguous amino acids in the amino acid sequence as set forth in <400>2 or a derivative or mimetic thereof.
Another aspect of the present invention is directed to an isolated protein selected from the list consisting of: A novel sphingosine kinase protein or a derivative, analogue, chemical equivalent or mimetic thereof.
(ii) A human sphingosine kinase protein or a derivative, analogue, chemical equivalent or mimetic thereof.
(iii) A protein having an amino acid sequence substantially as set forth in <400>2 or a derivative or mimetic thereof or a sequence having at least about 45% similarity to WO 00/70028 PCT/AU00/00457 -26at least 10 contiguous amino acids in <400>2 or a derivative, analogue, chemical equivalent or mimetic of said protein.
(iv) A protein encoded by a nucleotide sequence substantially as set forth in <400>1 or a derivative or analogue thereof or a sequence encoding an amino acid sequence having at least about 45% similarity to at least 10 contiguous amino acids in <400>2 or a derivative, analogue, chemical equivalent or mimetic of said protein.
A protein encoded by a nucleic acid molecule capable of hybridising to the nucleotide sequence as set forth in <400>1 or a derivative or analogue thereof under low stringency conditions and which encodes an amino acid sequence substantially as set forth in <400>2 or a derivative or mimetic thereof or an amino acid sequence having at least about 45% similarity to at least 10 contiguous amino acids in <400>2.
(vi) A protein as defined in paragraphs or (ii) or (iii) or (iv) or in a homodimeric form.
(vii) A protein as defined in paragraphs or (ii) or (iii) or (iv) or in a heterodimeric form.
The protein of the present invention is preferably in isolated form. By "isolated" is meant a protein having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject protein, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about even still more preferably at least about 60-70%, yet even still more preferably or greater of subject protein relative to other components as determined by molecular weight, amino acid sequence or other convenient means. The protein of the present invention may also be considered, in a preferred embodiment, to be biologically pure.
WO 00/70028 PCT/AU00/00457 -27- The sphingosine kinase of the present invention may be in multimeric form meaning that two or more molecules are associated together. Where the same sphingosine kinase molecules are associated together, the complex is a homomultimer. An example of a homomultimer is a homodimer. Where at least one sphingosine kinase is associated with at least one non- sphingosine kinase molecule, then the complex is a heteromultimer such as a heterodimer.
The ability to produce recombinant sphingosine kinase permits the large scale production of sphingosine kinase for commercial use. The sphingosine kinase may need to be produced as part of a large peptide, polypeptide or protein which may be used as is or may first need to be processed in order to remove the extraneous proteinaceous sequences. Such processing includes digestion with proteases, peptidases and amidases or a range of chemical, electrochemical, sonic or mechanical disruption techniques.
Notwithstanding that the present invention encompasses recombinant proteins, chemical synthetic techniques are also preferred in synthesis of sphingosine kinase.
Sphingosine kinase according to the present invention is conveniently synthesised based on molecules isolated from the human. Isolation of the human molecules may be accomplished by any suitable means such as by chromotographic separation, for example using CM-cellulose ion exchange chromotography followed by Sephadex column) filtration. Many other techniques are available including HPLC, PAGE amongst others.
Sphingosine kinase may be synthesised by solid phase synthesis using F-moc chemistry as described by Carpino et al. (1991). Sphingosine kinase and fragments thereof may also be synthesised by alternative chemistries including, but not limited to, t-Boc chemistry as described in Stewart et al. (1985) or by classical methods of liquid phase peptide synthesis.
Without limiting the theory or mode of action of the present invention, sphingosine kinase is a key regulatory enzyme in the activity of the sphingosine kinase signalling pathway. By WO 00/70028 PCT/AU00/00457 -28 "sphingosine kinase signalling pathway" is meant a signalling pathway which utilises one or both of sphingosine kinase and/or sphingosine-1-phosphate. It is thought that a sphingosine kinase signalling pathway cascade which results in adhesion molecule expression may take the form of: the generation of ceramide from sphingomyelin via S.Mase activity, said ceramide being converted to sphingosine; (ii) sphingosine-1-phosphate (referred to hereinafter as "Sph-1-P") generation by stimulation of sphingosine kinase; and (iii) the activation of MEK/ERK and nuclear translocation of NF-KB downstream from Sph-1-P generation.
The sphingosine kinase signalling pathway is known to regulate cellular activities such as those which lead to inflammation, apoptosis and cell proliferation. For example, upregulation of the production of inflammatory mediators such as cytokines, chemokines, eNOS and upregulation of adhesion molecule expression. Said upregulation may be induced by a number of stimuli including, for example, inflammatory cytokines such as tumour necrosis factor-a (TNF-a) and interleukin-1 endotoxin, oxidised or modified lipids, radiation or tissue injury.
The cloning and sequencing of this gene -nd its expression product now provides additional molecules for use in the prophylactic and therapeutic treatment of diseases characterised by unwanted cellular activity, which activity is either directly or indirectly modulated via the activity of the sphingosine kinase signalling pathway. Examples of diseases involving unwanted sphingosine kinase regulated cellular activity include rheumatoid arthritis, asthma, atherosclerosis, meningitis, multiple sclerosis and septic shock. Accordingly, the present invention contemplates therapeutic and prophylactic uses of sphingosine kinase amino acid and nucleic acid molecules, in addition to sphingosine WO 00/70028 PCT/AU00/00457 -29kinase agonistic and antagonistic agents. for the regulation of cellular functional activity, such as for example, regulation of inflammation.
The present invention contemplates, therefore, a method for modulating expression of sphingosine kinase in a subject, said method comprising contacting the sphingosine kinase gene with an effective amount of an agent for a time and under conditions sufficient to upregulate or down-regulate or otherwise modulate expression of sphingosine kinase. For example, sphingosine kinase antisense sequences such as oligonucleotides may be introduced into a cell to down-regulate one or more specific functional activities of that cell. Conversely, a nucleic acid molecule encoding sphingosine kinase or a derivative thereof may be introduced to up-regulate one or more specific functional activities of any cell not expressing the endogenous sphingosine kinase gene.
Another aspect of the present invention contemplates a method of modulating activity of sphingosine kinase in a mammal, said method comprising administering to said mammal a modulating effective amount of an agent for a time and under conditions sufficient to increase or decrease sphingosine kinase activity.
Modulation of said activity by the administration of an agent to a mammal can be achieved by one of several techniques, including but in no way limited to introducing into said mammal a proteinaceous or non-proteinaceous molecule which: modulates expression of sphingosine kinase; (ii) functions as an antagonist of sphingosine kinase; (iii) functions as an agonist of sphingosine kinase.
Said proteinaceous molecule may be derived from natural or recombinant sources including fusion proteins or following, for example, natural product screening. Said nonproteinaceous molecule may be, for example, a nucleic acid molecule or may be derived WO 00/70028 PCT/AU00/00457 from natural sources, such as for example natural product screening or may be chemically synthesised. The present invention contemplates chemical analogs of sphingosine kinase or small molecules capable of acting as agonists or antagonists of sphingosine kinase.
Chemical agonists may not necessarily be derived from sphingosine kinase but may share certain conformational similarities. Alternatively, chemical agonists may be specifically designed to mimic certain physiochemical properties of sphingosine kinase. Antagonists may be any compound capable of blocking, inhibiting or otherwise preventing sphingosine kinase from carrying out its normal biological functions. Antagonists include monoclonal antibodies specific for sphingosine kinase, or parts of sphingosine kinase, and antisense nucleic acids which prevent transcription or translation ofsphingosine kinase genes or mRNA in mammalian cells. Modulation ofsphingosine kinase expression may also be achieved utilising antigens, RNA, ribosomes, DNAzymes, RNA aptamers or antibodies.
Said proteinaceous or non-proteinaceous molecule may act either directly or indirectly to modulate the expression of sphingosine kinase or the activity of sphingosine kinase. Said molecule acts directly if it associates with sphingosine kinase or sphingosine kinase to modulate the expression or activity ofsphingosine kinase or sphingosine kinase. Said molecule acts indirectly if it associates with a molecule other than sphingosine kinase or sphingosine kinase which other molecule either directly or indirectly modulates the expression or activity ofsphingosine kinase or sphingosine kinase. Accordingly, the method of the present invention encompasses the regulation of sphingosine kinase or sphingosine kinase expression or activity via the induction of a cascade of regulatory steps which lead to the regulation ofsphingosine kinase or sphingosine kinase expression or activity.
Another aspect of the present invention contemplates a method of modulating cellular functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression ofa nucleotide sequence encoding sphingosine kinase or sufficient to modulate the activity of sphingosine kinase.
WO 00/70028 PCT/AU00/00457 -31 Yet another aspect of the present invention contemplates a method of modulating cellular functional activity in a mammal said method comprising administering to said mammal an effective amount of sphingosine kinase or sphingosine kinase.
The sphingosine kinase, sphingosine kinase or agent used may also be linked to a targeting means such as a monoclonal antibody, which provides specific delivery of the sphingosine kinase, sphingosine kinase or agent to the target cells.
In a preferred embodiment of the present invention, the sphingosine kinase, sphingosine kinase or agent used in the method is linked to an antibody specific for said target cells to enable specific delivery to these cells.
Reference to "modulating cellular functional activity" is a reference to up-regulating, downregulating or otherwise altering any one or more of the activities which a cell is capable of performing such as, but not limited to, one or more ofchemokine production, cytokine production, nitric oxide synthesase, adhesion molecule expression and production of other inflammatory modulators.
Administration of the sphingosine kinase, sphingosine kinase or agent, in the form of a pharmaceutical composition, may be performed by any convenient means. Sphingosine kinase, sphingosine kinase or agent of the pharmaceutical composition are contemplated to exhibit therapeutic activity when administered in an amount which depends on the particular case. The variation depends, for example, on the human or animal and the sphingosine kinase, sphingosine kinase or agent chosen. A broad range of doses may be applicable. Considering a patient, for example, from about 0.1 mg to about 1 mg of sphingosine kinase or agent may be administered per kilogram of body weight per day.
Dosage regimes may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, weekly, monthly or other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation. The sphingosine kinase or agent may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intranasal, WO 00/70028 PCT/AU00/00457 32intraperitoneal, intramuscular, subcutaneous, intradermal or suppository routes or implanting using slow release molecules). With particular reference to use of sphingosine kinase or agent, these peptides may be administered in the form of pharmaceutically acceptable nontoxic salts, such as acid addition salts or metal complexes, e.g. with zinc, iron or the like (which are considered as salts for purposes of this application). Illustrative of such acid addition salts are hydrochloride, hydrobromide, sulphate, phosphate, maleate, acetate, citrate, benzoate, succinate, malate, ascorbate, tartrate and the like. If the active ingredient is to be administered in tablet form, the tablet may contain a binder such as tragacanth, corn starch or gelatin; a disintegrating agent, such as alginic acid; and a lubricant, such as magnesium stearate.
A further aspect of the present invention relates to the use of the invention in relation to mammalian disease conditions. For example, the present invention is particularly useful, but in no way limited to, use in inflammatory diseases.
Accordingly, another aspect of the present invention relates to a method of treating a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression ofsphingosine kinase or sufficient to modulate the activity of sphingosine kinase wherein said modulation results in modulation of cellular functional activity.
In another aspect the present invention relates to a method of treating a mammal said method comprising administering to said mammal an effective amount of sphingosine kinase or sphingosine kinase for a time and under conditions sufficient to modulate cellular functional activity.
Yet another aspect of the present invention relates to the use of an agent capable of modulating the expression of sphingosine kinase or modulating the activity of sphingosine kinase in the manufacture of a medicament for the modulation of cellular functional activity.
WO 00/70028 PCT/AU00/00457 A further aspect of the present invention relates to the use of sphingosine kinase or sphingosine kinase in the manufacture of a medicament for the modulation of cellular functional activity.
Still yet another aspect of the present invention relates to agents for use in modulating sphingosine kinase expression or sphingosine kinase activity wherein said modulation results in modulation of cellular functional activity.
Another aspect of the present invention relates to sphingosine kinase or sphingosine kinase for use in modulating cellular functional activity.
In a related aspect of the present invention, the mammal undergoing treatment may be a human or an animal in need of therapeutic or prophylactic treatment.
In yet another further aspect the present invention contemplates a pharmaceutical composition comprising sphingosine kinase, sphingosine kinase or an agent capable of modulating sphingosine kinase expression or sphingosine kinase activity together with one or more pharmaceutically acceptable carriers and/or diluents. Sphingosine kinase, sphingosine kinase or said agent are referred to as the active ingredients.
The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as licithin, by the maintenance of the required particle size in the case of dispersion and by the use of superfactants. The preventions of the action of microorganisms can be brought WO 00/70028 PCT/AU00/00457 34about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid. thirmerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.
When sphingosine kinase, sphingosine kinase and sphingosine kinase modulators are suitably protected they may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit. The amount of active compound in such therapeutically useful compositions in such that a suitable dosage will be obtained.
Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 gg and 2000 mg of active compound.
WO 00/70028 PCT/AU00/00457 35 The tablets, troches, pills, capsules and the like may also contain the following: A binder such as gum tragacanth, acacia. corn starch or gelatin- excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and formulations.
Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated.
Supplementary active ingredients can also be incorporated into the compositions.
It is especially advantageous to formulate parenteral corriositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the novel dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active material and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding WO 00/70028 PCT/AU00/00457 -36such an active material for the treatment of disease in living subjects having a diseased condition in which bodily health is impaired.
The principal active ingredient is compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form as hereinbefore disclosed. A unit dosage form can, for example, contain the principal active compound in amounts ranging from 0.5 Lg to about 2000 mg. Expressed in proportions, the active compound is generally present in from about 0.5 pg to about 2000 mg/ml of carrier. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.
The pharmaceutical composition may also comprise genetic molecules such as a vector capable oftransfecting target cells where the vector carries a nucleic acid molecule capable of expressing sphingosine kinase, modulating sphingosine kinase expression or sphingosine kinase activity. The vector may, for example, be a viral vector.
Sphingosine kinase can also be utilised to create gene knockout models in either cells or animals, which knocked out gene is the sphingosine kinase gene expressed by said cells or animals. Accordingly in another aspect the present invention should be understood to extend to methods of creating sphingosine kinase gene cell or animal knockout models wherein sphingosine kinase has been utilised to facilitate knocking out of the endogenous sphingosine kinase gene of said cell or animal, and to the knockout models produced therefrom.
Still, another aspect of the present invention is directed to antibodies to sphingosine kinase including catalytic antibodies. Such antibodies may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to sphingosine kinase or may be specifically raised to sphingosine kinase. In the case of the latter, sphingosine kinase may first need to be associated with a carrier molecule. The antibodies and/or recombinant sphingosine kinase of the present invention are particularly useful as therapeutic or diagnostic agents.
WO 00/70028 PCT/AU00/00457 -37- 37 Alternatively, fragments of antibodies may be used such as Fab fragments. Furthermore, the present invention extends to recombinant and synthetic antibodies and to antibody hybrids. A "synthetic antibody" is considered herein to include fragments and hybrids of antibodies. The antibodies of this aspect of the present invention are particularly useful for immunotherapy and may also be used as a diagnostic tool, for example, for monitoring the program of a therapeutic regime.
For example, sphingosine kinase can be used to screen for naturally occurring antibodies to sphingosine kinase. These may occur, for example in some inflammatory disorders.
For example, specific antibodies can be used to screen for sphingosine kinase proteins. The latter would be important, for example, as a means for screening for levels of sphingosine kinase in a cell extract or other biological fluid or purifying sphingosine kinase made by recombinant means from culture supernatant fluid. Techniques for the assays contemplated herein are known in the art and include, for example, sandwich assays, ELISA and flow cytometry.
It is within the scope of this invention to include any second antibodies (monoclonal, polyclonal or fragments of antibodies) directed to the first mentioned antibodies discussed above. Both the first and second antibodies may be used in detection assays or a first antibody may be used with a commercially available anti-immunoglobulin antibody. An antibody as contemplated herein includes any antibody specific to any region of sphingosine kinase.
Both polyclonal and monoclonal antibodies are obtainable by immunization with the protein or peptide derivatives and either type is utilizable for immunoassays. The methods of obtaining both types of sera are well known in the art. Polyclonal sera are less preferred but are relatively easily prepared by injection of a suitable laboratory animal with an effective amount of sphingosine kinase, or antigenic parts thereof, collecting serum from the animal, and isolating specific sera by any of the known immunoadsorbent techniques.
Although antibodies produced by this method are utilizable in virtually any type of WO 00/70028 PCT/AU00/00457 -38immunoassay, they are generally less favoured because of the potential heterogeneity of the product.
The use of monoclonal antibodies in an immunoassay is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product. The preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an immortal cell line and lymphocytes sensitized against the immunogenic preparation can be done by techniques which are well known to those who are skilled in the art. (See, for example Douillard and Hoffman, Basic Facts about Hybridomas, in Compendium of Immunology Vol II, ed. by Schwartz, 1981; Kohler and Milstein, Nature 256: 495-499, 1975; European Journal oflmmunology 6: 511-519, 1976).
In another aspect of the present invention, the molecules of the present invention are also useful as screening targets for use in applications such as the diagnosis of disorders which are regulated by sphingosine kinase.
Yet another aspect of the present invention contemplates a method for detecting sphingosine kinase or sphingosine kinase mRNA in a biological sample from a subject said method comprising contacting said biological sample with an antibody specific for sphingosine kinase or sphingosine kinase mRNA or its derivatives or homologs for a time and under conditions sufficient for an antibody-sphingosine kinase or antibody-sphingosine kinase mRNA complex to form, and then detecting said complex.
The presence of sphingosine kinase may be determined in a number of ways such as by Western blotting, ELISA or flow cytometry procedures. Sphingosine kinase mRNA may be detected, for example, by in situ hybridization or Northern blotting. These, of course, include both single-site and two-site or "sandwich" assays of the non-competitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labelled antibody to a target.
WO 00/70028 PCT/AU00/00457 -39- Sandwich assays are among the most useful and commonly used assays and are favoured for use in the present invention. A number of variations of the sandwich assay technique exist, and all are intended to be encompassed by the present invention. Briefly, in a typical forward assay, an unlabelled antibody is immobilized on a solid substrate and the sample to be tested brought into contact with the bound molecule. After a suitable period of incubation, for a period of time sufficient to allow formation of an antibody-antigen complex, a second antibody specific to the antigen, labelled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing time sufficient for the formation of another complex of antibody-antigen-labelled antibody. Any unreacted material is washed away, and the presence of the antigen is determined by observation of a signal produced by the reporter molecule. The results may either be qualitative, by simple observation of the visible signal, or may be quantitated by comparing with a control sample containing known amounts of hapten. Variations on the forward assay include a simultaneous assay, in which both sample and labelled antibody are added simultaneously to the bound antibody. These techniques are well known to those skilled in the art, including any minor variations as will be readily apparent. In accordance with the present invention the sample is one which might contain sphingosine kinase including cell extract, tissue biopsy or possibly serum, saliva, mucosal secretions, lymph, tissue fluid and respiratory fluid. The sample is, therefore, generally a biological sample comprising biological fluid but also extends to fermentation fluid and supernatant fluid such as from a cell culture.
In the typical forward sandwich assay, a first antibody having specificity for the sphingosine kinase or antigenic parts thereof, is either covalently or passively bound to a solid surface. The solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. The solid supports may be in the form of tubes, beads, discs of microplates, or any other surface suitable for conducting an immunoassay. The binding processes are well-known in the art and generally consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody complex is washed in preparation for the test sample. An aliquot of the sample to be tested is then added to the solid phase complex and WO 00/70028 PCT/AU00/00457 incubated for a period of time sufficient 1-40 minutes) and under suitable conditions 25°C) to allow binding of any subunit present in the antibody. Following the incubation period, the antibody subunit solid phase is washed and dried and incubated with a second antibody specific for a portion of the hapten. The second antibody is linked to a reporter molecule which is used to indicate the binding of the second antibody to the hapten.
An alternative method involves immobilizing the target molecules in the biological sample and then exposing the immobilized target to specific antibody which may or may not be labelled with a reporter molecule. Depending on the amount of target and the strength of the reporter molecule signal, a bound target may be detectable by direct labelling with the antibody. Alternatively, a second labelled antibody, specific to the first antibody is exposed to the target-first antibody complex to form a target-first antibody-second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.
By "reporter molecule" as used in the present specification, is meant a molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound antibody. Detection may be either qualitative or quantitative. ihe most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionuclide containing molecules radioisotopes) and chemiluminescent molecules.
In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate. As will be readily recognized, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan. Commonly used enzymes include horseradish peroxidase, glucose oxidase, beta-galactosidase and alkaline phosphatase, amongst others. The substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable color change. Examples of suitable enzymes include alkaline phosphatase and peroxidase. It is also possible to employ fluorogenic substrates, which yield a fluorescent product rather than the chromogenic substrates noted above. In all cases, the enzyme-labelled antibody is added to the first antibody hapten WO 00/70028 PCT/AU00/00457 -41 complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the complex of antibody-antigenantibody. The substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated. usually spectrophotometrically, to give an indication of the amount ofhapten which was present in the sample. "Reporter molecule" also extends to use of cell agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like.
Alternately, fluorescent compounds, such as fluorecein and rhodamine, may be chemically coupled to antibodies without altering their binding capacity. When activated by illumination with light of a particular wavelength, the fluorochrome-labelled antibody adsorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic color visually detectable with a light microscope.
As in the EIA, the fluorescent labelled antibody is allowed to bind to the first antibodyhapten complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light of the appropriate wavelength the fluorescence observed indicates the presence of the hapten of interest. Immunofluorescene and EIA techniques are both very well established in the art and are particularly preferred for the present method.
However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.
The present invention also contemplates genetic assays such as involving PCR analysis to detect sphingosine kinase or its derivatives.
Further features of the present invention are more fully described in the following nonlimiting examples.
WO 00/70028 PCT/AU00/00457 42- EXAMPLE 1 PURIFICATION AND CLONING OF HUMAN SPHINGOSINE KINASE EXPERIMENTAL PROCEDURES Materials D-erythro-Sphingosine, D-erythro-dihydrosphingosine, DL-threo-dihydrosphingosine, N,N-dimethylsphingosine, N-acetylsphingosine (C,-ceramide), SIP and Fumosin BI were purchased from Biomol Research Laboratories Inc. (Plymouth Meeting, PA).
Phytosphingosine, L-a-phosphatidic acid, L-a-phosphatidylinositol, L-aphosphatidylserine, L-a-phosphatidylcholine. L-ac-phosphatidvlethanolamine, 1,2dioctanoyl-sn-glycerol, 1,2-dioleoyl-sn-glycerol, ATP, calmodulin, glutathione and bovine serum albumin (BSA) were from Sigma. N,N,N-trimethylsphingosine and ADP were purchased from Calbiochem (Band Soden, Germany), [y 32 P]ATP from Geneworks (Adelaide, South Australia), TNFa from R&D Systems Inc. (Minneapolis, MN), and isopropyl-p-D-thiogalactoside (IPTG) from Promega (Madison, WI). Prepacked Mono-Q, Superose 75 and HiTrap-Q columns, Q Sepharose fast flow, calmodulin Sepharose 4B, glutathione Sepharose 4B, thrombin and gel filtration molecular mass protein standards were from Amersham Pharmacia Biotech. SDS-PAGE molecular mass protein standards, silver stain plus kit, Coomassie Brilliant Blue R250 and Coomassie protein reagent were from Bio-Rad. Centricon concentrators were purchased from Amicon Inc. (Beverly, MA) and BCA protein reagent was from Pierce Chemical Company (Rockford, IL).
Sphingosine kinase enzyme assay Sphingosine kinase activity was routinely determined using D-erythro-sphingosine and [y"P]ATP as substrates, essentially as previously described (Olivera et al., 1998) with some modifications. Briefly, assays were performed by incubating samples at 37 0 C for min with sphingosine (100 iM stock dissolved in 5% Triton X-100) and [y- 32 P]ATP (1 mM; 10 [Ci/ml) in assay buffer containing 100 mM Tris/HCI (pH 10 mM MgCI, glycerol, 1 mM dithiothreitol, 1 mM EGTA, 1 mM Na 3
VO
4 15mM NaF, mM 4-deoxypyridoxine in a total volume of 100 pl. Reactions were terminated and sphingosine-1-phosphate extracted by the addition of 700 pl of chloroform/methanol/HCI WO 00/70028 PCT/AU00/00457 -43- (100:200:1, followed by vigorous mixing, addition of 200 pl of chloroform and 200 Pl of 2 M KC1. and phase separation by centrifugation. The labeled SIP in the organic phase was isolated by TLC on Silica Gel 60 with 1-butanol/ethanol/acetic acid/water (8:2:1:2, v/v) and quantitated by phosphorimager (Molecular Dynamics, Sunnyvale, CA). One unit of activity is defined as 1 pmol of SlP formed per minute.
Purification ofsphingosine kinasefrom human placenta Sphingosine kinase was purified from 1240 g of human placenta (4 placentas), with all steps performed at 4 0 C. The placentas were diced, washed in buffer A (25 mM Tris/HC 1 buffer, pH 7.4 containing 10% glycerol, 0.05% Triton X-100 and 1 mM dithiothreitol), transfered to 1.5 L of fresh buffer A containing a protease inhibitor cocktail (Complete
TM
Boehringer Mannheim) (buffer and minced in a Waring blender. The resultant homogenate was stored on ice for 30 min to enhance enzyme extraction, and the soluble fraction of the homogenate then isolated by centrifugation at 17 000 g for 60 min.
This preparation was then fractionated by (NH 4
),SO
4 precipitation by the addition of solid
(NH
4 2
SO
4 at pH 7.4 and collection of the precipitated proteins by centrifugation (17 000 g, min). The 25-35%-saturated (NH 4
),SO
4 fraction was then redissolved in a buffer B, desalted by extensive dialysis against this same buffer, and centrifuged (17 000 g, 30 min) to remove insoluble material. All subsequent chomatographic steps were performed using a FPLC system (Pharmacia Biotech) at 4°C.
The dialysed (NH 4 2
SO
4 fraction was applied to a Q-Sepharose fast flow column (50 mm diamter, 250 ml bed volume) pre-equilibrated with buffer A at a flow rate of 7 ml/min.
Sphingosine kinase activity was eluted with a NaC 1 gradient of 0 to 1M in buffer A and collected in 10 ml fractions. Fractions containing highest SKI activity were then combined, and CaC12 and NaCl added to give final concentrations of 4 mM and 250 mM, respectively. This pooled extract was then applied to a calmodulin-Sepharose 4B column (16 mm diameter, 10 ml bed volume), pre-equilibrated with buffer A containing 2 mM CaC12, at a flow rate of 1 ml/min. The column was then washed with several column volumes of equilibration buffer, followed by buffer A containing 4 mM EGTA, and then SKI eluted with buffer A containing 4 mM EGTA and 1 M NaC 1. The fractions containing WO 00/70028 PCT/AU00/00457 -44 highest sphingosine kinase activity were pooled, desalted on a Sephadex G-25 column, and applied at a flow rate of 1 ml/min to a Mono-Q column (5 mm diamter, 1 ml bed volume) pre-equilibrated with buffer A. Sphingosine kinase activity was eluted with a NaC 1 gradient to 0 to 1M in buffer A. NaCI (to 500 mM) was immediately added to the fractions (1 ml) collected to stabilise enzyme activity. The Mono-Q fractions containing highest sphingosine kinase activity were combined and desalted on a Sephadex G-25 column. ATP and MgC12 were then added to the pooled fractions to a final concentrations of 1 mM and mM, respectively, before reapplication at a flow rate of 1 ml/min to the Mono-Q column pre-equilibrated with buffer A containing 1 mM ATP and 5 mM MgC Sphingosine kinase activity was eluted with a NaC 1 gradient of 0 to 1M in the equilibration buffer.
Again, NaC 1 (to 500 mM) was immediately added to the fractions (1 ml) collected to stabilise enzyme activity. The ATP-Mono-Q fractions containing highest sphingosine kinase activity were pooled and concentrated 10-fold to a final volume of 200 .l in a concentrator and applied at a flow rate of 0.4 ml/min to a Superdex column (10 mm diameter, 20 ml bed volume) pre-equilibrated with buffer A containing 500 mM NaC 1. Sphingosine kinase activity was eluted with the same buffer and 0.4 ml fractions collected. The molecular mass of the enzyme was estimated from this column by comparison to the elution volumes ofribonuclease A, chymotrypsinogen A, ovalbumin and
BSA.
Cloning of human sphingosine kinase The human sphingosine kinase (hSK) was amplified from a HUVEC X Zap cDNA library using PCR primers derived from human EST sequences (GenBank
T
accession numbers D31133, W63556, AA026479, AA232791, AA081152, AI769914 and AI769914) aligned to the murine sphingosine kinases (Olivera et al., 1998). These primers, spanning a central SacII site (P1, 5'-CGGAATTCCCAGTCGGCCGCGGTA-3' [<400>3] and P2, TAGAATTCTACCGCGGCCGACTGGCT-3' were used in combination with T3 and T7 primers to generate two overlapping PCR products of 669 bp and 550 bp that represented the 5' and 3' ends of hSK, respectively. These two PCR products were then separately cloned into pGEM4Z. A 584 bp SacII fragment from the 5' hSK PCR clone was then sub-cloned in the correct orientation into the SacII site of the 3' hSK PCR clone, to WO 00/70028 PCT/AU00/00457 generate a 1130 bp partial hSK cDNA clone. A full length clone encoding hSK was then generated by sub-cloning a 120 bp EcoRl/StuI fragment from the 669 bp 5' hSK clone into this pGEM4Z-1130 bp clone digested with EcoRl/StuI. Sequencing the cDNA clone in both directions verified the integrity of the hSK cDNA sequence.
For mammalian cell expression the hSK cDNA was FLAG epitope tagged at the 3'-end by PFU polymerase PCR with oligonucleotide primers T7 and TAGAATTCACTTGTCATCGTCGTCCTTGTAGTCTAAGGGCTCTTCTGGCGGT-3' This FLAG-tagged hSK cDNA was then cloned into pCDNA3 by digestion with EcoRI. The orientation was determined by restriction analysis and sequencing verified the integrity of the hSK-FLAG cDNA sequence. For bacterial expression, the full length hSK cDNA was sub-cloned into pGEX4T2. The pGEM4Z-hSK clone was digested with BamHI and blunted with 3U PFU polymerase in 1 x PFU buffer, 501IM dNTP's at 72 0 C for niinutes. The 1163 bp hSK cDNA was gel purified following digestion with Sall and the blunt/Sail fragment was then ligated to pGEX4T2 SmaI/XhoI.
Sphingosine kinase amino acid sequence analysis The human sphingosine kinase amino acid sequence was searched against non-redundant amino acid and nucleotide sequence databases at the Australian National Genome Information Service using the blastp and tblastn algorithms (Altschul et al., 1990).
Cell culture Human umbilical vein endothelial cells (HUVEC) were isolated as previously described (Wall et al., 1978) and cultured on gelatin-coated culture flasks in medium M199 with Earle's salts supplemented with 20% fetal calf serum, 25 ig/ml endothelial growth supplement (Collaborative Research) and 25 pg/ml heparin. The cells were passaged three times and grown to 80% confluency before treatment and harvesting. Human embryonic kidney cells (HEK293, ATCC CRL-1573) cells were cultured on Dulbecco's modified Eagle's medium containing 10% fetal calf serum, 2 mM glutamine, 0.2% sodium bicarbonate, penicillin (1.2 mg/ml), and gentamycin (1.6 mg/ml). HEK293 cells were transiently transfected using the calcium phosphate precipitation method (Graham van WO 00/70028 PCT/AU00/00457 -46der Eb, 1973). Treatment of HUVEC and HEK293 cells with TNFa (1 ng/ml) was performed as previously described (Xia et al., 1998).
EXAMPLE 2 EXPRESSION AND ISOLATION OF RECOMBINANT HUMAN SPHINGOSINE KINASE FROM E. COLI EXPERIMENTAL PROCEDURE The full length SPHK cDNA cloned into pGEX4T2 was transformed into E. coli BL21.
Overnight cultures (100 ml) of transformed isolates were grown with shaking (200 rpm) at 30 0 C in Superbroth (20 g/L glucose, 35 g/L tryptone, 20 g/L yeast extract, 5 g/L NaC1, pH medium containing ampicillin (100 mg/L). The cultures were diluted 1:20 in fresh medium and grown at 30°C with shaking to an OD 6 00 of 0.6-0.7. Expression of the glutathione-s-transferase (GST)-coupled sphingosine kinase (GST-SK) was then induced by addition of 0.1 mM isopropyl-P-D-thiogalactoside and further incubation of the cultures at 30 0 C for 3 h. After this time the bacterial cells were then harvested by centrifugation at 6,000 g for 20 min at 4°C and resuspended in 20 ml of buffer B containing 250 mM NaCl.
the cells were then lysed with lysozyme at a final concentration of 0.3 mg/ml for 15 min at °C followed by sonication, consisting of three cycles of 20s ultrasonic pulses followed by one minute cooling. The lysate was then clarified by centrifugation at 50,000 g for min at 4 0 C, followed by filtrating through 0.22 pm filters. To be filtered supernatant was then incubated with 0.2 volumes of 50% glutathione-Sepharose 4B (Pharmacia) that was washed and pro-equilibrated with buffer B, for 60 min at 4°C with constant mixing.
After this time the mixture was poured into a glass chromatography column (10 mm diam.) and the beads (with bound GST-SK) washed with 10 column volumes of buffer B at 4 0
C.
The GST-SK was then eluted from the column in 10 ml of buffer B containing 10 mM reduced glutathione. Cleavage of the GST away from sphingosine kinase was then performed by incubation with 20 gg (30 N.I.H. units) thrombin (Pharmacia) for 3h at 25 C.
The released sphingosine kinase was then purified by application of the cleavage mix to a calmodulin-Sepharose column and then a Mono-Q anion exchange column for the purification of the sphingosine kinase from human placenta. These columns resulted in purification of the recombinant sphingosine kinase to homogeneity.
WO 00/70028 PCT/AU00/00457 -47- EXAMPLE 3 CHARACTERISATION OF SPHINGOSINE KINASES EXPERIMENTAL
PROCEDURES
The effect of pH on the activity of the isolated sphingosine kinases was determined over the pH range 4.0 to 11.0 in 50 mM buffers (sodium acetate, pH 4.0-5.0; Mes, pH 6.0-7.0; Hepes, pH 7.0-8.2; Tris/HC1, pH 8.2-10.0; Caps, pH 10.0-11.0) at 37°C. pH stability was determined by assaying the residual activity after pre-incubation of the enzymes in the same buffers for 5h at 4 0 C. Similarly, thermal stabilities were determined by assaying the residual activity after pre-incubation of the enzymes at various temperatures (4-80 0 C) for min at pH 7.4 (50mM Tris/HCl containing 10% glycerol, 0.5 M NaCI and 0.05% Triton X-100). Substrate kinetics were analysed using Michaelis-Menten kinetics with a weighted non-linear regression program (Easterby, 1996). Since sphingosine and its analogues were added to the enzyme assays in mixed micelles with Triton X-100, where they exibit surface dilution kinetics (Buehrer and Bell, 1992), all Km and K i values obtained for these molecules were expressed as mol of Triton X-100, rather than as bulk solution concentrations. For assays to determine the effect of calcium/calmodulin on sphingosine kinase activity, calcium and calmodulin were added to the standard assay mixtures containing 20 nM of isolated sphingosine kinase at final concentrations of 4 mM and 0.6 pM, respectively.
EXAMPLE 4 OTHER ANALYTICAL METHODS Protein was determined using either the Coomassie Brilliant Blue (Bradford et al., 1976) or Bicinchoninic acid (Smith et al., 1985) reagents using BSA as standard. In some cases protein estimations were performed after concentration and removal of detergent by precipitation (Wessel and Fltigge, 1984) to increase the sensitivity and accuracy of the determinations. SDS-PAGE was performed according to the method of Laemmli (1970) using 12% acrylamide gels. Protein bands on gels were visualised with either Coomassie Brilliant Blue R250 or silver staining. Molecular mass was estimated by comparison to the WO 00/70028 PCT/AU00/00457 -48electophoritic mobility of myosin, P-galactosidase. BSA, ovalbuminm, carbonic anhydrase, soybean trypsin inhibitor, lysozyme and aprotinin.
EXAMPLE PURIFICATION OF HUMAN SPHINGOSINE KINASE RESULTS Just over half of the total sphingosine kinase activity in human placenta was present in the cytosol after tissue homogenisation (Table The purification of sphingosine kinase from human placenta is summarised in Table 4. The soluble fraction from the homogenate of four human placentae was initially subjected to ammonium sulphate precipitation. This resulted in a remarkably good purification of sphingosine kinase (33-fold), which precipitated in the 25-35% saturated ammonium sulphate fraction. For anion exchange chromatography the ammonium sulphate fraction was rapidly desalted through the use of Sephadex G25 column and the desalted fraction loaded immediately onto a Q Sepharose FF column. The speed of this desalting step appeared critical since the sphingosine kinase activity appeared very unstable at NaC 1 concentrations below about 0.2 M, meaning slower desalting steps, such as dialysis, resulted in substantial losses of enzyme activity.
Application of a NaC 1 gradient of 0 to 1 M to the Q Sepharose FF column resulted in two peaks of sphingosine kinase activity, eluting at approximately 0.15 M and 0.6 M NaC 1, and designated SKI and SK2, respectively (Fig. For this study SK1 was selected for further purification due to its greater abundance and stability; SK2 activity appeared very unstable and, unlike SKI, could not be stabilised by the addition of 0.5M NaCl, 10% glycerol and 0.05% Triton X-100. SK1 was also chosen since it appeared to be the isoform present in HUVEC, as discussed later.
Fractions from Q Sepharose FF column containing SKI were then affinity purified by application to a calmodulin-Sepharose 4B column in the presence of 4mM CaC and elution of SKI performed with EGTA and NaC1, resulting in further substantial purification (38-fold) and high enzyme yields. SK1 could not be eluted from the calmodulin Sepharose 4B column with EGTA alone, indicating an unusual association of the enzyme with this affinity matrix. The active fractions that eluted from the calmodulin WO 00/70028 PCT/AU00/00457 -49- Sepharose 4B column were then desalted and applied to two subsequent steps of analystical anion exchange chromatography on a Mono Q column, with the second step performed in the presence of 1 mM ATP and 5mM MgC 1, (Fig. The active fractions resulting from these anion exchange steps were then applied to gel filtration chromatography with a Superdex 75 column as a final purification step. SK1 eluted from this column as a single peak with a molecule mass corresponding to 44 kDa. Analysis of the active fraction from this final column by SDS-PAGE with silver staining (Fig. 4) revealed a single band of molecular mass 45kDa, indicating a homogenous protein that has been purified over a million-fold from the original placenta extract with remarkably good yield of 7% of the original sphingosine kinase activity (Table This is the first sphingosine kinase to be purified to homogeneity from a human source.
EXAMPLE 6 SPHINGOSINE KINASE ISOFORMS IN HUVEC RESULTS Since two sphingosine kinase activities were identified in human placenta (Fig 2) we examined the multiplicity of this enzyme activity in HUVEC by the use of preparative anion exchange columns. In contrast to other human tissues and cells, application of HUVEC extracts to these columns resulted in the appearance of only a single sphingosine kinase peak that eluted at the same point as the human placenta SKI (Fig. Similarly, only a single sphingosine kinase peak eluted after application of HUVEC extracts in which sphingosine kinase activity had been stimulated by 10 min treatment of HUVEC with TNFa (Xia et al., 1999). These results would indicate that SKI, the human placenta sphingosine kinase isolated in this study, is probably the main isoform found in HUVEC, and that TNFa treatment results in an increase in the activity of this enzyme, rather than the activation of another, otherwise latent, isoform.
WO 00/70028 PCT/AU00/00457 EXAMPLE 7 CLONING OF HUMAN SPHINGOSINE KINASE AND TRANSIENT EXPRESSION IN HEK293 CELLS RESULTS A human sphingosine kinase cDNA was generated from a HUVEC Zap library using primers designed from human ESTs aligned with the published murine sphingosine kinase sequence (Kohama et al., 1998). The cloning strategy is shown in Figure 6 (prov). The cDNA has an apparent open reading frame coding for 384 amino acids (Fig. it should be noted that the sequence lacked a recognisable Kozak consensus motif raising the possibility that the actual initiation sequence may not be included in this cDNA. The sphingosine kinase cDNA encodes for a protein (hSK) with a predicted isoelectric point of 6.64 and a molecular mass of 42,550 kDa, consistent with the molecular mass determined for the purified human placenta sphingosine kinase (SKI). Subcloning into pcDNA3 and transient expression ofhSK in HEK293 cells resulted in a 3200-fold increase in sphingosine kinase activity in these cells (Fig. compared with untransfected HEK293 cells or HEK293 cells transfected with empty vector, indicating that the generated hSK cDNA encodes a genuine sphingosine kinase. Interestingly, although hSK-transfected HEK293 cells had 3200-fold higher levels of sphingosine kinase activity, treatment of these cells with TNFa resulted in a rapid (10 min) increase in sphingosine kinase activity by a similar proportion (approximately 2-fold) to that seen in untransfected HEK293 cells (Fig.
8) (Xia et al., 1998). This indicates the high levels of over-expressed sphingosine kinase are not saturating the TNFa mediated activation mechanism in these cells.
EXAMPLE 8 HUMAN SPHINGOSINE KINASE ANALYSIS RESULTS A search of the database shown hSK has a high amino acid sequence similarity (28 to 36% identity) to two recently identified Saccharomyces cerevisiae sphingosine kinases (Nagiec et al., 1998) and several other ESTs encoding putative sphingosine kinase proteins from Schizosaccharomyces pombe, Caenorhabditis elegans and Arabidopis thaliana. Multiple WO 00/70028 PCT/AU00/00457 -51 sequence alignment of hSK with these homologues (Fig. 9) revealed several regions of highly conserved amino acids throught the protein, but particularly towards the N-terminus.
A search of the domain structures of hSK sequence revealed three calcium/calmodulin binding motifs (Rhoads Friedberg, 1997), one of the 1-8 14 type A ([FILVW]xxx{FAILVW]xx[FAILVW]xxxxx{FILVW] with net charge of +3 to +6) spanning residues 290 to 303, and two of the 1-8 14 type B ([FILVW]xxxxx{FAILVW]xxxxx[FILVW] with net charge of +2 to that overlap between residues 134 to 153. Further analysis of the hSK sequence revealed a possible Nmyristoylation site close to the N-terminus (at Gly 5 that may be applicable if the protein is subject to proteolytic cleavage. Also identified were one putative casein kinase II (CKII) phosphorylation site (at Ser' 30 and four putative PKC phosphorylation sites (at Thr 54 Ser' 8 0 Thr 20 5 and Ser"') (Fig. These putative phosphorylation sites are also found in both murine sphingosine kinase isoforms, although the mouse enzymes also display six more possible phosphorylation sites; four for PKC, and one each for CKII and protein kinase A, that do not occur in hSK.
A search of signalling domain sequences using the SMART search tool (Schultz et al., 1998; Ponting et al., 1999) revealed similarity in residues 16 to 153 of hSK to the putative diacylglycerol kinase (DGK) catalytic domain. hSK showed an overall 36% identity to the consensus sequence of the DGK catalytic domain family, and possessed 17 of the 24 very highly conserved amino acids of this domain. hSK, however, showed no homology with the proposed ATP binding motif of this domain (GxGxxGx,K), although it should be noted that the applicability of this protein kinase ATP-binding site motif (Hanks et al., 1988) to DGKs remains contentious (Schaap et al., 1994); Sakane et al., 1996; Masai et al., 1993).
Further sequence analysis of the human sphingosine kinases also failed to find regions showing any marked similarity to the proposed nucleotide-binding motifs found in other protein families (Saraste et al., 1990; Walker et al., 1982). Apart from the similarity to the DGK catalytic domain, hSK shows no similarity to other lipid binding enzymes, and does not appear to have any recognizable lipid binding domains, like PKC C2 or pleckstrin homology domains. There are also no other obvious regulatory domains, with the possible WO 00/70028 PCT/AU00/00457 -52exception of a proline-rich region at the C-terminus which has some similarity to SH3 binding domains (Ren et al.. 1993; Yu et al., 1994).
EXAMPLE 9 EXPRESSION IN E. COLI AND ISOLATION OF RECOMBINANT SPHINGOSINE KINASE RESULTS The hSK cDNA was subcloned into the pGEX 4T-2 plasmid and hSK expressed as a glutathione s-transferase (GST) fusion protein in E. coli BL21 by IPTG induction (Fig. After the GST-hSK fusion protein was partially purified using glutathione Sepharose 4B, and the GST removed by thrombin cleavage, the hSK was further purified by subsequent elutions from calmodulin Sepharose and Mono-Q anion exchange columns. This resulted in high recovery of sphingosine kinase activity (greater than 70% of the originally induced activity), and an electrophoretically pure sphingosine kinase (Fig. 10). However, only low protein yields of the recombinant enzyme could be obtained since a large proportion of the IPTG induced, thrombin-cleaved hSK protein did not bind to the calmodulin Sepharose column (Fig. 11). This non-binding form of hSK had no demonstrable catalytic activity, suggesting that it was incorrectly folded.
EXAMPLE POST-TRANSLATIONAL MODIFICATION REQUIREMENT FOR SPHINGOSINE KINASE FUNCTIONAL ACTIVITY To determine if post-translational modifications are required for activity of the native sphingosine kinase, the native molecule has been compared to the recombinant enzyme produced in E. coli where such modifications would not occur. Specifically, the enzymes have been examined for differences in substrate affinity and accessibility. The premise for this study was that post-translational modifications may cause conformational changes in the structure of sphingosine kinase which may result in detectable changes in the physicochemical or catalytic properties of the enzyme. In summary, it was determined that WO 00/70028 PCT/AU00/00457 -53 recombinantly produced sphingosine kinase retains its functional activity even in the absence of post-translational modification.
METHODS
Substrate specificity of the native and recombinant sphingosine kinases Relative rates of phosphorylation of sphingosine by the native and recombinant sphingosine kinases were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU of the native and recombinant sphingosine kinases, respective. The substrates examined were added to a final concentration of 100piM in 0.25% Triton X-100, and assayed under the standard assay conditions outlined earlier.
Substrate and inhibitor kinetics of the native and recombinant sphingosine kinases Substrate kinetics were determined by supplying substrates over the concentration range of 0.5 to 200uM for sphingosine analogues, and 5 to 1000piM for ATP. Inhibition kinetics were determined by the use of inhibitors over a concentration range of 2 to 50p.M (Table In both cases the data were analysed by non-linear regression.
Thermal stabilities of the native and recombinant sphingosine kinases Thermal stabilities of the native and recombinant sphingosine kinases were determined by assaying the residual activity remaining after preincubation of the enzymes at various temperatures (4 to 80°C) for 30 min at pH 7.4 (50mM Tris/HCl containing 10% glycerol, NaCI and 0.05% Triton X-100). The original activities of the native and recombinant sphingosine kinases were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU, respectively.
pH stabilities of the native and recombinant sphingosine kinases pH stabilities of the native and recombinant sphingosine kinases were determined by assaying the residual activity remaining after preincubation of the enzymes at various pH's at 4 C for 5 hr. The original activities of the native and recombinant sphingosine kinases were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU, respectively.
WO 00/70028 PCT/AU00/00457 54 The effect of pH on activity of the native and recombinant sphingosine kinases The effect of pH on the activity of the native and recombinant sphingosine kinases were determined by assaying the activity over the pH range of 4 to 1 in 50mM buffers (sodium acetate, pH 4.0-5.0; Mes, pH 6.0-7.0; Hepes, pH 7.0-8.2; Tris, pH 8.2-10.0; Caps, pH 10.0- 11.0). The maximum activities of the native and recombinant sphingosine kinases were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU, respectively.
Effect of metal ions on the activity of the native and recombinant sphingosine kinases The effect of metal ions on the activity of the native and recombinant sphingosine kinases were determined by assaying the activity under standard conditions in the presence of various metal ions or EDTA at 10mM. The maximum activities of the native and recombinant sphingosine kinases were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU, respectively.
Effect of phospholipids on the activity of the native and recombinant sphingosine kinases The effect of various phospolipids on the activity of the native and recombinant sphingosine kinases were determined by assaying the activity under standard conditions in the presence of these phospholipids at 10 mol% of Triton X-100. The activities of the native and recombinant sphingosine kinases in the absence of phospholipids were arbitrarily set at 100% and correspond to 2.65 kU and 7.43 kU, respectively. PC, phosphatidylcholine; PS phosphatidylserine; PE, phosphatidylethanolamine; PI, rhosphatidylinositol.
RESULTS
Maximum activity of the native and recombinant sphingosine kinases were observed at pH 7.4, with both enzymes showing greater than 60% of maximum activity in the pH range 6.8 to 7.4 (Fig. 12). Both sphingosine kinases retained more than 90% of the original activity after 5 h incubation at 4°C in the pH range 6 to 7.8 (Fig. 12), and at pH 7.4 in the presence of 10% glycerol, 0.5M NaCl and 0.05% Triton X-100, both enzymes were stable for WO 00/70028 PCT/AU00/00457 55 min at temperatures up to 37 0 C (Fig. 12). The enzymes were much less stable in buffers lacking glycerol, NaC 1 and Triton X-100 (data not shown), consistent with previous observations of the bovine brain and rat kidney sphingosine kinases (Louie el al., 1976; Olivera et al., 1998). Both human sphingosine kinases showed a requirment for divalent metal ions since the presence of EDTA in assays elimated activity (Fig. 12). Like other sphingosine kinases examined (Louie el al., 1976; Buehrer Bell, 1992; 1993; Olivera et al., 1998; Nagiec et al., 1998), both human enzymes showed highest activity with Mg 2 somewhat lower activity with Mn and only very low activity with Ca'. Other divalent metal ions examined, including ZN>, Cu'- and Fe did not support sphingosine kinase activity (Fig. 12).
The native and recombinant sphingosine kinases have very similar, and narrow, substrate specificites (Fig. 13), with both showing greatest activity with the naturally occuring mammalian substrate D-erythro-sphingosine as well as D-erhthro-dihydrosphingosine.
Low activity was also detected for both enzymes against phytosphingosine, while a range of other sphingosine derivatives and related molecules where not phosphorylated. These included DL-threo-dihydrosphingosine, N,N-dimethylsphingosine, N,N,Ntrimethylsphingosine, N-acetylsphingosine (C,-ceramide), diacylglycerol (1,2-dioctanoylsn-glycerol and 1,2-dioleoyl-sn-glycerol), and phosphatidylinositol. Further analysis of the human sphingosine kinases with D-erythro-sphingosine as well as D-erhthrodihydrosphingosine revealed Michaelis-Menten kinetics over the concentration range used (Fig. 13), with both isolated native and recombinant sphingosine kinases showing very similar kinetic properties and slightly higher affinity for D-erythro-sphingosine as well as D-erhthro-dihydrosphingosine (Table Both enzymes also displayed similar kinetics when sphingosine was supplied as a sphingosine-BSA complex, although presentation of the substrate in this manner resulted in a lower values for both enzymes (28 and 39 s 'for the native and recombinant sphingosine kinases, respectively) compared to its presentation in Triton X-100 mixed micelles, as used for all the other assays performed in this study. Sphingosine supplied as a BSA complex Km values of 16 4 mM and 17 2 mM for the native and recombinant sphingosine kinases, respectively. Both the native and WO 00/70028 PCT/AU00/00457 -56recombinant sphingosine kinases had the same affinity for ATP of approx. 80 mM (Table Both the native and recombinant sphingosine kinase were inhibited by DL-lhreodihydrosphingosine, N,N-dimethylsphingosine and N, N-trimethylsphingosine (Fig. 13), with all three of these molecules displaying competitive inhibition with respect to sphingosine. Although the inhibition constants for these molecules were quite similar, N,NN-trimethylsphingosine gave slightly more efficient inhibition than DL-threodihydrosphingosine, which was a marginally more efficient inhibitor than N,Ndimethylsphingosine (Table ADP also showed weak competitive inhibition, with respect to ATP (Table In all cases remarkably similar inhibition constants were observed for the native and recombinant sphingosine kinases (Table No inhibition was seen with N-acetylsphingosine or Fumosin B1, a ceramide synthase inhibitor.
The effect of calcium/calmodulin on sphingosine kinase activity was examined. Under the assay conditions used, calcium/calmodulin had no effect on the activity of either the native or recombinant human sphingosine kinases (data not shown). While this result indicates a lack of sphingosine kinase activity regulation by calmodulin, the possibility remains that calmodulin may be involved in some other function with sphingosine kinase, such as regulating ists subcellular localisation.
Stimulation of sphingosine kinase activity by acidic phospholipids was examined. The addition of the neutral phospholipids phosphatidylcholine and phosphatidylethanolamine to the enzyme assay mixture did not result in any detectable differences in human sphingosine kinase activity, however, marked increases in activity (1.6 to 2-fold) were observed with the acidic phospholipids physphatidylserine, phosphatidylinositol and phosphatidic acid (Fig. 14). Both the native and recombinant sphingosine kinases were activated in a similar manner by these acidic phospholipids, with kinetic analyses revealing that all three WO 00/70028 PCT/AU00/00457 -57phospholipids caused an increase in the enzymes K, while the Km values remained unchanged.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
WO 00/70028 PCT/AU00/00457 58 Table 3 Comparison of sphingosine kinase activity in human placenta with various animal tissues Fresh animal tissues were washed and homogenized as described for the human placenta.
The proportion of cytosolic sphingosine kinase activity was determined by comparison of the total activity in the homogenate to that from the ultracentrifugation supernatant (100,000 x g, 60 min). The specific activity of sphingosine kinase is expressed as pmol of S1P formed per minute per g tissue.
Specific activity Cytosolic (U/g tissue) Human placenta 13 51 Rat kidney 28 63 Rat liver 19 37 Rat brain 13 52 Sheep kidney 38 58 Sheep liver 17 31 Sheep brain 16 63 Sheep spleen 9 34 WO 00/70028 WO 0070028PCT/AUOO/00457 9 Table 4 P~urification of sphingosine kinase from human placenta Sphingosine kinase was purified from 1240 L, of fresh human placenta (4 placentas). One unit of sphingosine kinase activity is defined as 1 pmiol of SlIP formed from sphingosine and ATP per minute.
Step Activity Protein Specific Recovery Purification (U x 1O') (mg) Activity %)Fold Soluble fraction of homogenate 7943 123600 58 100 Ammonium sulphate (25-35%) 7723 35 27 1966 97 3 3 Q Sepharose anion exchange 4048 1098 4597 63 79 Calmodulin Sepharose 3197 18.23 1.75 x 10' 40 3.O X 103 Mono Q anion exchange 1706 2.921 5.84 x 10' 21.5 1.0OX ATiP- Mono Qanion exchange 1133 10.419 2.70 x 106 14.3 4.6 x Superdex 75 gel filtration 549 ]0.008 6.64 x 107 6.9 1.1 X 106 WO 00/70028 WO 0070028PCT/AUOO/00457 60 Table 5 Substrate and inhibition kinetics of the native and recombinant sphingosine kinases Substrate kinetics were determined by supplying substrates over the concentration range of 0.5 to 200[iM (0.0125 to 5 mol for sphingosine analogues, and 5 to I OOOPiM for ATP. Inhibition kinetics were determined by the use of inhibitors over a concentration range of 2 to 50piM (0.05 to 1 .25 mol for sphingosine analogues and 0. 1 to 5mM for ADP. For comparison to previous studies, all and Ki values for sphingosine and its derivatives are expressed as both bulk solution concentrations and i-ol of Triton X- 100. where Triton X- 100 was present in all assays at a final concentration of 0.25% All kinetic values and standard errors (Duggleby, 1981) were obtained from non-linear regression analysis (Easterby. 1996).
Native SK Recombinant SK SUBSTRATE KINETICS: Sphingasine K.m(rnlI%) 0.35 ±0.05 0.30±0.07 (riM) 14 ±2 12 3 Ice., 50 /Km (10's" 36 71 Dihydrasphingosine Km (mol 0.50 ±0.05 0.48 ±0.05 Km (pM) 20±2 19±2 k, 35 76 K (10' s' 18 39
ATP
K.m(pM) 77 ±11 86 ±12 INHIBITOR KINETICS: N,N-dimethylsphingosine
K
1 (mol 0.20 ±0.03 0.19 ±0.02 K, (pM) 7.8 ±1 7.5±1I DL-threo-dihydrosphingosine K, (mol
K
2 (gM) 0.15 ±0.02 0.14±k0.03 5.9 ±1 5.7±1I N, N, N-trimethylsphingosine K, (mol Ki (pM) 0.12 ±0.03 0.10 ±0.02 4.6 ±1 3.8±1I
ADP
K, (mM) 1.1 ±0.3 0.9 0.2 5 .5 WO 00/70028 WO 0070028PCT/AUOO/00457 61-
BIBLIOGRAPHY
Altschul, Gish, Miller, WV.. Meyer, and Lipman. (1990) J Mci. Biol.
215:403-4 Alessenko, (1998) Biochemi.'ajy 63:62-68 Bonner et al., (197 Mol. Biol. 81:123 Bradford, (1976) Anal. Biochem. 72:248-254 Buebrer, and Bell, (1992) J1 Bio. Chern. 267:3 154-3159 Buefirer, and Bell, (1993) Adi'. Lipid Res. 26:59-67 Buehrer, Bardes, and Bell, (1996) Biochim. Biophyis. Acta 1303:233-242 Culliver, Pirianov, Kleuser, Vanek, Coso, Gutkind, and Spiegel, (1996) Nature 381:800-803 Doujillard and Hoffman, Basic facts about hybridomas in Compendium of Immunology, Vol lIed. Schwartz (198 1) Duggleby, (198 1) Anal Biochem. 110:9-18 Easterby, (1996) Hyper 1. Is: Hyperbolic Regression Analysis of Enzyme Kinetic Data.
Liverpool University, Liverpool Graham, and van der Eb, (1973) Virology 54:536-539 Hanks, Quinn, and Hunter, (1988) Science 241:42-52 WO 00/70028 WO 0070028PC1'IAUOO/00457 62 Igarashi, (1997) J. Biochem. 122:1080-1087 Kohama. Olivera, Edsall. Nagiec. Dickson, R. and Spiegel, (1998) J1 Biol.
Chenm. 273:23722-23728 Kohler and Milstein., (1975) Nature 256:495-499 Laemmli, (1970) Nature 227:680-685 Louie, Kisic. and Schroepfer. (1976) J Biol. Chem. 251 :45 57-4564 Masai, Okazaki, Hosoya, and Hotta, (1993) Proc. Nal. Acad Sci. USA 90:11157- 11161 Melendez, Floto, Gillooly, Harrett, M.M. and Allen, (1998) J1 Bio. Chem.
273:9393-9402 Meyer zu Heringdorf, van Koppen. C.J. and Jakobs, (1997) FEBSLett 410:34-38 Nagiec, Skrzypek, Nagiec, Lester, and Dickson, (1998) J1 Biol.
Chem. 273:19437-19442 Olivera, A. and Spiegel, (1993) Nature 365:5 57-560 Olivera, Kohama, Tu, Milstein, and Spiegel, (1998) J Biol. Chem.
273:12576-12583 Ponting, Schultz, Milpetz.. and Bark, (1999) Nucleic Acids Res. 27:229-232 Ren, Mayer, Cicchetti, and Baltimore, D. (1993) Science 259:115 7-1161 WO 00/70028 WO 0070028PCT/AUOO/00457 63 Rhoads. and Friedberg, (1997) FA SEB J. 11:331-340 Sakane. Lai, Wada. Imai, and Kohoh. (1996) Biocheni. J 318:583-590 Saraste, Sibbald. and Wittinghofer, (1990) Trends Biochem. Sci. 15:430-434 Schaap, van der Wal, and van Blitterswijk, (1994) Biochein. J. 304:661-662 Schultz, Milpetz, Bork, and Ponting. (1998) Proc. Nati, Acad Sci. USA 95:5857-5864 Smith, Krohn, Hermanson. Mallia, A.K, Gartner, Provenzano, M.D., Fujimoto, Goeke, Olson, and Kienk, (1985) Anal. Biocheni. 150:76-85 Spiegel, Culliver, Edsall, Kohania, Menzeleev, Olivera, Thomas, Tu, Van Brocklyn, J. and Wang, (1998). Biochemistry (Mosc) 63:69-73 Walker, Saraste, Runswick. and Gray, (1982) EMBO]. 8:945-951 Wall, Harker, Quadracci. and Striker, (1978) J1. Cell Physiol. 96:203- 213 Wessel, and FlUgge, (1984) Anal. Biochem. 138:141-143 Xia, Gamble, Rye, Wang, Ru., Cockerill, Khew-Goodall, Y., Bert, Barter, P.J. and Vadas, (1998) Proc. Natl. Acad Sci. USA 95:14 196-14201 Yu, Chen, Feng, Dalgarno, Brauer, and Schreiber, (1994) Cell 76:933-945 EDITORIAL NOTE APPLICATION NUMBER 45239/00 The following sequence listing pages 1 5 are part of the description. The claims pages follow on pages 64 66.
wo oon0028 WO 0070028PCT/AUOO/00457
I-
SEQUENCE LISTING <110> MEDVET SCIENCE PTY LTD <120> NOVEL THERAPEUTIC MOLECULES AND USES THEREOF <130> 2293027/TDO <140> <141> <150> PQ0339 <151> 1999-05-13 <150> PQ1504 <151> 1999-07-08 <160> <170> Patentln Ver. <210> <211> <212> <213> 1 1205
DNA
mammalian <220> <221> CDS <222> (33) (1184) <400> 1 gaattcggca cgaggagccg cgggtcgagg tt atg gat cca gcg ggc ggc ccc.
Met Asp Pro Ala Gly Gly Pro cgg ggc gtg ctc ccg cgg ccc Arg Gly Val Leu Pro Arg Pro tsc Cys cgc gtg ctg gtg Arg Val Leu Val ctg aac ccg Leu Asn Pro cgc ggc Arg Gly ggc aag ggc aag Gly Lys Gly Lys ttg cag ctc Leu Gin Leu ttc cgg Phe Arg acg ctg Thr Leu 50 agt cac gtg cag Ser His Val Gin ccc Pro ctt ttg gct. gag Leu Leu Ala Glu gaa atc tcc ttc Glu Ile Ser Phe atg ctc act Met Leu Thr gag Glu 197 245 cgg cgg aac cac Arg Arg Asn His gcg Ala cgg gag ctg gtg cgg tcg gag gag Arg Glu Leu Val Arg Ser Glu Glu 65 ctg ggc cgc Leu Gly Arg tgg 'gac gct ctg gtg gtc atg tct gga gac -ggg ctg atg cac gag gtg Trp Asp Ala Leu Val Val Met Ser Gly Asp Gly Leu Met His Glu Val 293 WO 00/70028 WO 0070028PCT/AUOO/00457 ate cag aag Ile Gin Lys gtg aac ggg Vai Asn Giy cte atg gag egg Leu Met Giu Arg cct Pro gac tgg gag acc Aso Trp Glu Thr ccc ctg Pro Leu 105 tgt age cte eca Cys Ser Leu Pro gca Aila 110 ggc tet ggc aac Giy Ser Gly Asn geg Ala 11~5 etg gea get tee Leu Aia Aia Ser ttg Leu 12 0 aac cat tat gct Asn His Tyr Ala tat gag eag gte Tyr Giu Gin Val aec Thr 130 aat gaa gae etc Asn Glu Asp Leu etg Leu 135 389 437 485 ace aac tgc acg Thr Asn Cys Thr cta Leu 140 ttg ctg tgc ege Leu Leu Cys Arg ctg etg tea ccc Leu Leu Ser Pro atg aac Met Asn 150 ctg etg tct Leu Leu Ser age-etg gee Ser Leu Ala 170 etg Leu 155 cac aeg get teg His Thr Aia Ser ctg cgc etc tte Leu Arg Leu Phe tet gtg etc Ser Vai Leu 165 agt gag aag Ser Giu Lys tgg ggc ttc att Trp Gly Phe Ilie get Aila 175 gat gtg gac cta Asp Val Asp Leu tat egg Tyr Arg 1 85 egt ctg ggg gag Arg Leu Giy Giu ege ttc act ctg Arg Phe Thr Leu gge Gly 195 act ttc ctg egt Thr Phe Leu Arg ctg Leu 200 gga Giy gca gee ttg ege Aia Aia Leu Arg aga gtg ggt tee Arg Vai Giy Ser 220 aet Thr 205 tac ege ggc ega Tyr Arg Gly Arg get tac etc ect Ala Tyr Leu Pro gta Val1 215 629 677 725 aag aca cet gee Lys Thr Pro Ala cee gtt gtg gte Pro Val Val Val eag eag Gin Gin 230 ggc ceg gta Giy Pro Vai cac tgg aca His Trp Thr 250 gca eac ett gtg Ala His Leu Val ctg gag gag eca Leu Glu Glu Pro gtg ccc tet Val Pro Ser 245 gtg gtg ccc gac Vai Val Pro Asp gag Giu 255 gac ttt gtg eta gte etg gea etg Asp Phe Val Leu Val Leu Ala Leu 260 etg eac Leu His 265 teg eac ctg gge Ser His Leu Gly agt Ser 270 gag atg ttt get Giu Met Phe Ala gea Aila 275 ccc atg gge ege Pro Met Gly Arg tgt gea get gge gte atg cat etg tte tac gtg egg geg gga gtg tet Cys Ala Ala Giy Val Met His Leu Phe Tyr Val Arg Ala Giy Vai Ser WO 00/70028 PCT/AU00/00457 280 285 290 295 cgt gcc atg ctg ctg cgc ctc ttc ctg gcc atg gag aag ggc agg cat 965 Arg Ala Met Leu Leu Arg Leu Phe Leu Ala Met Glu Lys Gly Arg His 300 305 310 atg gag tat gaa tgc ccc tac ttg gta tat gtg ccc gtg gtc gcc ttc 1013 Met Glu Tyr Glu Cys Pro Tyr Leu Val Tyr Val Pro Val Val Ala Phe 315 320 325 cgc ttg gag ccc aag gat ggg aaa ggt atg ttt gca gtg gat ggg gaa 1061 Arg Leu Glu Pro Lys Asp Gly Lys Gly Met Phe Ala Val Asp Gly Glu 330 335 340 ttg atg gtt agc gag gcc gtg cag ggc cag gtg cac cca aac tac ttc 1109 Leu Met Val Ser Glu Ala Val Gin Gly Gin Val His Pro Asn Tyr Phe 345 350 355 tgg atg gtc agc ggt tgc gtg gag ccc ccg ccc age tgg aag ccc cag 1157 Trp Met Val Ser Gly Cys Val Glu Pro Pro Pro Ser Trp Lys Pro Gin 360 365 370 375 cag_atg cca ccg cca gaa gag ccc tta tgatctagag tcgacctgca g 1205 Gin Met Pro Pro Pro Glu Glu Pro Leu 380 <210> 2 <211> 384 <212> PRT <213> mammalian <400> 2 Met Asp Pro Ala Gly Gly Pro Arg Gly Val Leu Pro Arg Pro Cys Arg 1 5 10 Val Leu Val Leu Leu Asn Pro Arg Gly Gly Lys Gly Lys Ala Leu Gin 25 Leu Phe Arg Ser His Val Gin Pro Leu Leu Ala Glu Ala Glu Ile Ser 40 Phe Thr Leu Met Leu Thr Glu Arg Arg Asn His Ala Arg Glu Leu Val 55 Arg Ser Glu Glu Leu Gly Arg Trp Asp Ala Leu Val Val Met Ser Gly 70 75 Asp Gly Leu Met His Glu Val Val Asn Gly Leu Met Glu Arg Pro Asp 90 Trp Glu Thr Ala Ile Gin Lys Pro Leu Cys Ser Leu Pro Ala Gly Ser WO 00/70028 WO 0070028PCT/AUOO/00457 Gly Asn Val Thr 130 Arg Leu 145 Leu Arg Val Asp Thr Leu Arg Leu 210 Ser Pro 225 Leu Glu Phe Val Phe Ala Tyr Val 290 Ala Met 305 Tyr Val Met Phe Gin Val Ala 115 Asn Leu Leu Leu Gly 195 Al a Val1 Glu Leu Ala 275 Arg G lu Pro Ala His 355 100 Leu G lu Ser Phe Glu 180 Thr Tyr Val1 Pro Val 260 Pro Ala Lys Val1 Val1 340 Pro Ala Asp Pro Ser 165 Ser Phe Leu Val Val1 245 Leu Met Gly Gly Val1 325 Asp Asfl Al a Leu Met 150 Val Glu Leu Pro Gin 230 Pro Ala Gly Val Arg 310 Ala Gly Tyr Ser Leu 135 As n Leu Lys Arg Val1 215 Gln Ser Leu Arg Ser 295 His Phe Glu Phe Leu 120 Thr Leu Ser Tyr Leu 200 G ly Gly His Leu Cys 280 Arg Met Arg Leu Trp 360 105 As n Asn Leu Leu Arg 185 Ala Arg Pro Trp His 265 Al a Al a G lu Leu Met 345 Met His Cys Ser Ala 170 Arg Al a Val1 Val Thr 250 Ser Ala Met Tyr Glu 330 Val Val Tyr Thr Leu 155 Trp Leu Leu Gly Asp 235 Val1 His Gly Leu G1u 315 Pro Ser Ser Ala Leu 140 His Gly Gly Arg Ser 220 Al a Val1 Leu V al Leu 300 Cys Lys Glu Gly Gly 125 Leu Thr Phe Glu Thr 205 Lys His Pro Gly Met 285 Arg Pro Asp Al a Cys 365 Tyr Leu Al a I le Met 190 Tyr Thr Leu Asp Ser 270 His Leu Tyr Gly Val 350 Val Glu Cys Se r Ala 175 Arg Arg Pro Val1 Glu 255 Glu Leu Phe Leu Lys 335 Gln Glu Gin Arg Gly 160 Asp Phe Gly Al a Pro 240 Asp Met Phe Leu Val 320 Gly Gly Pro Pro Pro Ser Trp Lys Pro Gin Gln Met Pro Pro Pro Glu Glu Pro Leu 370 375 380 WO 00/70028 WO 0070028PCT/AUOO/00457 <210> 3 <211> 24 <212> DNA <213> mammalian <400> 3 cggaattccc agtcggccgc ggta 24 <210> 4 <211> 26 <212> DNA <213> mammalian <400> 4 tagaattcta ccgcggccga ctggct 26 <210> <211> 52 <212> DNA <213> mammalian <400> tagaattcac ttgtcatcgt cgtccttgta gtctaagggc tcttctggcg gt 52

Claims (24)

1. An isolated polynucleotide encoding a sphingosine kinase, the polynucleotide comprising the sequence of SEQ ID No: or a Tucleotide sequence complementary thereto.
2. An isolated polynucleotide sequence that hybridiscs to the sequence of claim 1 under high stringency conditions.
3. An isolated polynucleotide sequence that hybridises to the nucleotide sequence of claim 1 or 2 under high stringency conditions of from about 40'C to 65"C and about 31% v/v to 50% v/v formamide and about 0.01M to 0.15M salt.
4. An isolated polynucleotide according to claim 1, the polynuclcotide encoding a polypeptide having the sequence of SEQ ID No:2.
5. An isolated polypeptide encoded by the nucleotide sequence of SEQ ID No: or capable of hybridising io SEQ ID No:l under high stringency conditions.
6. An isolated polypeptide according to claim 5, the polypeptide comprising the sequence of SEQ ID No:2.
7. A method of modulating expression of sphingosine kinase in a subject, said method S. comprising contacting the sphingosine kinase gene with an effective amount of an agent selected from the.group consisting of antisense nucleic acids,. RNA, DNAzymes and RNA aptamers specific to sphingosine kinasc having the sequence of SEQ ID No:i, for a time and under conditions sufficient to modulate expression of said sphingosine kinase.
8. A method of modulating the functional activity of sphingosine kinase in a mammal, said method comprising administering to said mammal a modulating effective amount of an agent selected from the group consisting of agonists and antagonists specific to sphingosine kinase having the sequence of SEQ ID No:2, for a time and under conditions sufficient to increase or u decrease the functional activity of said sphingosine kirase.
9. A method of modulating cellular functional activity in a mammal, said method comprising administering to said mammal an effective amount of a polypeptide according to claim 5 or 6 for a time and under conditions sufficient to modulate the functional activity of said cell. 141728301 COMS ID No: SBMI-01131867 Received by IP Australia: Time 12:10 Date 2005-02-22 0396793111 Blake Dawson Waldron 12:11:31 p.m. 22-02-2005 8/9 A method of modulating cellular functional activity in a mammal, said method comprising administering to said mammal an effective amount of a polynucleotide according to any one of claims I to 4 for a time and under conditions sufficient to modulate the functional activity of said cell.
11. A method of treating a mammal, said method comprising administering to said mammal an effective amount of a polypcptide according to claim 5 or 6 for a time and under conditions sufficient to modulate cellular functional activity.
12. A method of treating a mammal, said method comprising administering to said mammal an effective amount of a polynucleotide according to any one of claims 1 to 4 for a time and under Sconditions sufficient to modulate cellular functional activity.
13. Use of an agent specific to sphingosine kinase having the sequence of SEQ ID No:2 *t selected from the group consisting of antisense nucleic acids, RNA, DNAzymes and RNA S aptamers capable of modulating the expression of said sphingosine kinase in the manufacture of a medicament for the modulation of cellular functional activity.
14. Use of an agent selected from the group consisting of agonists and antagonists specific to sphingosine kinase having the sequence of SEQ ID) No:2, capable of modulating the activity of said sphingosine kinase in the manufacture of a medicament for the modulation of cellular functional activity.. 6 0
15. Use of a polypeptide according to claim 5 or 6 in the manufacture of a medicament for the modulation of cellular functional activity.
16. Use of polynucleotide according to any one of claims 1 to 4 in the manufacture of a medicament for the modulation of cellular functional activity.
17. Use according to claim 15 or 16, wherein modulation of cellular functional activity is selected from the group consisting of modulation of chemokine production, cytokine production, nitric oxide synthesase, adhesion molecule expression and production of other inflammatory modulators. 141728301 COMS ID No: SBMI-01131867 Received by IP Australia: Time 12:10 Date 2005-02-22 039679 3111 Blake Dawson Waldron 12:11:48 p.m. 22-02-2005 9/9 66
18. A pharmaceutical composition comprising the polynucleotide according to claim 1 or the polypeptide according to claim 5 or 6 together with one or more pharmaceutically acceptable carriers or diluents.
19. An isolated antibody or antibody fragment thereof directed to the polypcptide according to any one of claims 5 to 7. An isolated antibody or antibody fragment thereof directed to the polynucleotide according to any one of claims 1 to 4.
21. An antibody according to claim 19 or 20 wherein said antibody is a monoclonal antibody.
22. An antibody according to claim 19 or 20 wherein said antibody is a polyclonal antibody. S**
23. Use or a polypeptide according to claim 5 or 6 or a polynucleotide according to any one of claims I to 4 or an antibody according to claim 19 or 20 as a screening target for use in the S: diagnosis of disorders which are regulated by sphingosine kinase.
24. An isolated expression system comprising the polynucleotide according to claim 1.
25. An isolated expression system according to claim 24 capable of producing a sphingosine kinase comprising the polypeptide sequence of SEQ ID No:2 when the expression system is in a compatible host cell. 4
26. An isolated recombinant host cell, the host cell comprising the expression system A accordinrg to claim Dated: 22 February 2005 Johnson Johnson Pharmaceutical Research and Development LLC Patent Attorneys for the Applicant: BLAKE DAWSON WALDRON PATENT SERVICES 141728301 COMS ID No: SBMI-01131867 Received by IP Australia: Time 12:10 Date 2005-02-22
AU45239/00A 1999-05-13 2000-05-12 Sphingosine kinase enzyme Ceased AU780746B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU45239/00A AU780746B2 (en) 1999-05-13 2000-05-12 Sphingosine kinase enzyme

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
AUPQ0339A AUPQ033999A0 (en) 1999-05-13 1999-05-13 Novel therapeutic molecules and uses thereof
AUPQ0339 1999-05-13
AUPQ1504A AUPQ150499A0 (en) 1999-07-08 1999-07-08 Novel therapeutic molecules and uses thereof-II
AUPQ1504 1999-07-08
PCT/AU2000/000457 WO2000070028A1 (en) 1999-05-13 2000-05-12 Sphingosine kinase enzyme
AU45239/00A AU780746B2 (en) 1999-05-13 2000-05-12 Sphingosine kinase enzyme

Publications (2)

Publication Number Publication Date
AU4523900A AU4523900A (en) 2000-12-05
AU780746B2 true AU780746B2 (en) 2005-04-14

Family

ID=27154314

Family Applications (1)

Application Number Title Priority Date Filing Date
AU45239/00A Ceased AU780746B2 (en) 1999-05-13 2000-05-12 Sphingosine kinase enzyme

Country Status (1)

Country Link
AU (1) AU780746B2 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4097999A (en) * 1998-05-26 1999-12-13 Sarah Spiegel Sphingosine kinase, cloning, expression and methods of use

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4097999A (en) * 1998-05-26 1999-12-13 Sarah Spiegel Sphingosine kinase, cloning, expression and methods of use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
J.BIOCHEM 273(37): 23722-28 *

Also Published As

Publication number Publication date
AU4523900A (en) 2000-12-05

Similar Documents

Publication Publication Date Title
US20070071752A1 (en) Sphingosine kinase enzyme
US6479274B1 (en) DNA molecules encoding human HELA2 or testisin serine proteinases
AU726383B2 (en) Stimulus-inducible I (KAPPA)B kinase (IKK) signalsome
AU780746B2 (en) Sphingosine kinase enzyme
NZ529983A (en) Sphingosine kinase interacts with TRAF2 and modulates tumor necrosis factor-induced cellular activity
AU2009201639A1 (en) A method of modulating cellular activity
Xia 2. An isolated polynucleotide according to claim 1, the polynucleotide comprising a sequence at least 95% identical to SEQ ID NO: 1. 3. An isolated polynucleotide sequence that hybridizes to the nucleotide sequence of claim 2 stringency conditions of about 65 C C. and about 50% v/v formamide and about 0.15 M salt. 4. An isolated polynucleotide according to claim 1, the polynucleotide encoding a polypeptide having the sequence of SEQ ID NO: 2. 5. An isolated polynucleotide according to claim 1, the polynucleotide comprising the sequence of SEQ ID NO: 1. 6. An expression system comprising a polynucleotide according to claim 1.
CA2612644A1 (en) Modulation of sphingosine kinase signalling
US20080279841A1 (en) Novel Therapeutic Molecular Variants And Uses Thereof
AU2005253643B2 (en) Methods of modulating cellular activity involving sphingosine kinase and agents for same, and sphingosine kinase variants
AU2001265699B2 (en) Novel therapeutic molecular variants and uses thereof
AU774591B2 (en) Novel molecules
NZ530543A (en) A ligand of the protein &#34;beacon&#34;
AU5973498A (en) Novel molecules
CA2569687A1 (en) Methods of modulating cellular activity involving sphingosine kinase and agents for same, and sphingosine kinase variants
ZA200300214B (en) Novel therapeutic molecular variants and uses thereof.
WO2003031468A1 (en) Therapeutic and diagnostic molecules that are capable of interacting with socs proteins
AU2001265699A1 (en) Novel therapeutic molecular variants and uses thereof
AU2006261583A1 (en) Modulation of sphingosine kinase signalling
AU7253800A (en) Novel molecules

Legal Events

Date Code Title Description
MK6 Application lapsed section 142(2)(f)/reg. 8.3(3) - pct applic. not entering national phase
TH Corrigenda

Free format text: IN VOL 15, NO 10, PAGE(S) 1850-1853 UNDER THE HEADING APPLICATIONS LAPSED, REFUSED OR WITHDRAWN PLEASE DELETE ALL REFERENCE TO APPLICATION NO. 45239/00

PC1 Assignment before grant (sect. 113)

Owner name: JOHNSON AND JOHNSON PHARMACEUTICAL RESEARCH AND DE

Free format text: THE FORMER OWNER WAS: JOHNSON AND JOHNSON RESEARCH PTY LIMITED

MK14 Patent ceased section 143(a) (annual fees not paid) or expired