AU779314B2 - Method for typing a photoperiodic animal for a seasonal physiological function by gene typing - Google Patents

Description

METHOD FOR TYPING A PHOTOPERIODIC ANIMAL FOR A SEASONAL PHYSIOLOGICAL FUNCTION BY GENE TYPING The invention relates to the genotyping of the melatonin receptor in photoperiodic animals. By photoperiodic animal is meant an animal whose physiological function is subject to annual variations in daylength time. The melatonin receptor is a compulsory passageway between the period of light and several seasonal physiological functions, such as reproduction for example in sheep or goats, or of hair growth in these same species. Therefore, the invention more particularly concerns a method facilitating the reproduction of domestic animals throughout the whole year. In particular, the invention concerns a method for typing a photoperiodic animal allowing an early choice of male or female reproducers, based on the identification of a new allele of the melatonin Melia receptor.

The reproduction of several domestic species is seasonal, which means that the periods of sexual activity alternate with periods of inactivity occurring on the same dates each year. These natural reproduction rhythms hinder breeding as they lead to seasonal variations in the production of milk or young with corresponding price changes. Several methods have therefore been put forward to induce counter-seasonal reproduction (Malpaux et al., 1992, in Melatonin biosynthesis, physiological effects and applications", Yu and Reiter Eds., 253-287, CRC Press, Boca Raton, USA; Chemineau et Malpaux, 1998, Th6rapie, 53, 445-452). In reproductive males, appropriate photoperiodic treatments are able to trigger sexual activity at will but involve heavy investment using closed buildings. In ewes, several solutions are used to initiate a short sexual season during which females can be fertilized, but each of these methods has its advantages and disadvantages: treatments which involve the use of progestagens and serum gonadotrophin (PMSG) are effective, but fears concerning the use of synthesis products limit their use; treatments which combine the use of a simple photoperiodic treatment, in an open sheepfold, with a melatonin implant are also effective, but are neglected on account of reservations made by some groups of breeders in respect of the use of hormones, even natural hormones, hormone-free breeding practises based on overfeeding and the introduction of males into the female folds, hitherto separated, are effective but their efficacy varies from one breed to another.

In addition to these different methods quick to introduce, a selection method could be considered with indexing of male reproducers, but this method is very difficult, even impossible, to carry out on breeding farms on account of the seasonal cycle. Direct measurement of spontaneous, counter-seasonal sexual activity is difficult since: it is only expressed if the female gave birth more than three months previously, it is modulated by local conditions such as feed, it requires measurements to be made over several consecutive years in the same females, it requires fairly heavy logistics for progesterone dosing.

Research work conducted in this area over the last forty or so years has therefore concentrated either on treatments to induce counter-seasonal sexual activity, or selection systems for the improvement of breeds at the request of breeding professionals. Also, physiologists have continually been conducting fundamental examination of the mode of action of the light regimen, which is the major cause behind the synchronisation of sexual activity.

This research led to identifying the melatonin released by the pineal gland as a major factor acting as relay between annual, circadian photoperiodic information and the hypothalamic GnRH system which is the sole command system for reproduction. Two pathways have been investigated: the incidence of melatonin levels. This hormone is secreted at night-time but shows largely varying levels from one individual to another, between 20 and 1000 pg/ml on average during the middle of the nocturnal phase. This character has been shown to be highly inheritable (Zarazaga et al. 1998, Am. J. Physiol 274, E607-E610) but it has not yet been possible to evidence any link with reproduction itself. At the present time, it is acknowledged that melatonin acts through its nocturnal secretion mode, adjusted to the duration of night-time and informing the animal on reproduction time. Melatonin is therefore involved in the seasonality of reproduction.

The incidence of melatonin receptors recently identified in mammals (Reppert et al., 1994, Neuron, 13, 1177-1185). These receptors form the link immediately downstream from melatonin and, in mammals, three receptors have been identified: Melia (Reppert et al., 1994, Neuron, 13, 1177-1185), Mellap (Barrett et al., 1997, Biochim. Biophys. Acta, 1356, 299-307), Melib (Reppert et al., 1995, Proc. Natl. Acad. Sci.

USA, 92, 8734-8738).

The Melib receptor is disqualified from being involved in seasonality phenomena since the natural inactivation of the gene of this receptor in the golden hamster and Siberian hamster brings no change in the seasonality of reproduction in these species (Weaver et al., 1996, Mol.

Endo., 10, 1478-1487).

The Melia receptor, and its potential variants, is found in the entire body and is well represented in the brain and hypothalamus where melatonin acts specifically to control reproduction (Malpaux et al., 1998, Endocrinology, 139, 1508-1516). The Melia receptor is currently the most serious candidate for transmitting the melatonin effect to the GnRH system.

The nucleotide sequence corresponding to the Melia receptor is formed of 2 exons separated from a voluminous intron (>10 kb) and the coding sequence contains 1101 nucleotides, i.e. 367 amino acids of which 78 and 298 amino acids for exons I and II respectively. The existence has recently been demonstrated of variants of the exon II sequence of the Melia receptor in sheep: Eight point mutations of the sequence of Reppert et al. (1994, Neuron, 13, 1177-1185) used as reference, were described by Barrett et al. (Barrett et al., 1997, Biochim. Biophys. Acta, 1356, 299-307) who assimilated this variant to Meliap. However, no variation in binding to the receptor or in the secretion of cyclic AMP was observed after in vitro expression of this receptor in mice L cells, Two mutations at position 606 and 612 were shown as respectively causing the loss of RsaI and MnlI enzyme cleavage sites (Messer et al., Mammalian Genome, 1997, 8, 368-370) in different ovine and bovine species.

The importance of these sequence changes on the physiology of reproduction was not known up until the conducting of the work which led to the present invention.

Yet, modification by directed mutagenesis of the amino acid sequence in the 5 th transmembrane passage of the Melia receptor, reduces the binding affinity of melatonin (Conway et al., 1997, Biochem. Biophys., Res. Comm., 239, 418-423).

The inventors have now evidenced a connection between the structure of the gene of the Melia receptor and a physiological function in relation to the role normally played by melatonin, in particular in the seasonality of reproduction. More particularly, the research work carried out under the present invention has shown a highly specific relationship between a genotype defined by a fraction of the nucleotide sequence of exon II of the melatonin Melia receptor, and the expression of seasonal anoestrus in reproduction.

The subject matter of the present invention is therefore a method for typing a photoperiodic animal for a seasonal physiological function and/or its capacity to transmit this seasonal physiological function to its descendants, characterized in that the genotype of a polymorphous MnlI restriction site is identified present in Exon II of the melatonin Melia receptor, a mutation at the recognition site of said enzyme allowing the selection of animals able to show a seasonal physiological function and/or to transmit this ability to its descendants. The identification of said genotype may be made by any molecular biology technique known to man, such as in particular the analysis of digestion products by said enzyme.

More particularly, the invention concerns the typing of a photoperiodic animal for its counter-seasonal reproduction capacity and/or its ability to transmit this capacity to its descendants, characterized in that the genotype of a polymorphous MnlI restriction site is identified present in Exon II of the melatonin Melia receptor, a mutation at the recognition site of said enzyme making it possible to select those animals able to show a capacity for counter-seasonal reproduction and/or to transmit this capacity to its descendants.

In surprising manner, the inventors have now shown that the presence of a special mutation, defining a allele, on the two parent chromosomes is associated with the seasonality of reproduction. The Exon II sequence of the melatonin Melia receptor in sheep forming the reference sequence is the one given by Reppert et al. (1994, Neuron, 13, 1177-1185) shown in appended figure i. Figure 1 shows in bold print the mutations characteristic of the allele located at the nucleotides at positions 612, 453, 706 and 891, the mutation at 612 causing loss of the MnlI cleavage site. The underlined sequences in figure 1 correspond to the primer sequences used in the PCR protocols described in the experimental section of the invention.

The genotyping work on Exon II of the Melia receptor, using the MnlI restriction enzyme, conducted for the invention using blood samples taken from animals which may or may not be likely to show spontaneous counter-seasonal sexual activity, has demonstrated that the recognition site at the nucleotides at positions 612-615 in figure 1 may be affected by mutation of the nucleotide at position 612, consisting of replacement of a G nucleotide by an A nucleotide, causing loss of the cleavage site at the nucleotide at position 605.

The sequencing of Exon II has shown that this mutation is associated with a set of three other mutations at the nucleotides at positions 453, 706 and 891 in figure i, defining an allele designated relative to a set of alleles in which the MnlI site is present: alleles However, on account of the binding between these mutations, the absence of the MnlI recognition site is sufficient to establish the presence of the allele.

The results obtained show that the frequency distribution of genotypes and is different according to whether or not the animals show spontaneous, counter-seasonal sexual activity. In particular, the genotype was only found in animals that were sexually inactive out of season, but not in those which showed spontaneous, sexual activity during this period.

With these results it is now possible to set aside, at a very early stage, those animals which carry this genotype and are therefore capable of transmitting this trait to their descendants, so as only to maintain those animals having natural non-seasonality, that is to say with spontaneous counter-seasonal reproduction capacity, without having to carry out heavy, costly descendant tests.

The typing method of the invention has several important advantages: it only requires a simple operation, a blood test, to be carried out by the animal breeder, the method can easily become a routine laboratory test and the results of the diagnosis may be obtained in a short time, in less than 48 hours.

lastly and more importantly, the results can be used for genomic DNA testing as early as the weaning stage, thereby avoiding the costly rearing of potential reproducers of which some would at all events be subsequently removed but only after diffusing the alleles that are unfavourable for the character under consideration.

In addition, the results given above provide major teaching on the understanding of molecular mechanisms in animals whose seasonality is dependent upon photoperiodic control involving the melatonin Melia receptor, in particular: the fact that one of the mutations associated with the allele, the mutation at 706, alters the protein sequence of the receptor leading to possible functional change, unlike the mutation at the nucleotide at position 612 which is silent. It is to be noted that it is located in the 5 th transmembrane passage of the receptor (isoleucine 220 replacing a valine), close to histidine 211 whose mutation modifies melatonin bonding affinity (Conway et al., 1997).

Studies on melatonin binding to membranes of pars tuberalis, derived from animals genotyped for the presence of the MnlI site, show that this binding is greater in animals of genotype than in animals of genotype This observation shows a difference in hormone-receptor relations depending upon genotype.

The Exon II sequence of the Mella receptor used as reference, is the one given by Reppert et al. (1994, Neuron, 13, 1177-1185) which is shown in appended figure 1. Below, reference will be made to the sequence in figure 1 which corresponds to SEQ ID No1 given in the appended list of sequences, identical to the one in figure 1 but whose nucleotide numbering is staggered so as to start at nucleotide N1l and consequently in which more particularly: position N' 453 of figure 1 corresponds to position

N

0 171 in SEQ ID Nol, position No 603 in figure 1 corresponds to position No 321 in SEQ ID NO 1, position N' 605 in figure 1 corresponds to position No 323 in SEQ ID NO 1, position N* 609 in figure 1 corresponds to position No 327 in SEQ ID NO 1, position No 612 in figure 1 corresponds to position No 330 in SEQ ID NO 1, position No 620 in figure 1 corresponds to position No 338 in SEQ ID NO 1, position N' 706 in figure 1 corresponds to position No 424 in SEQ ID NO 1, position No 891 in figure 1 corresponds to position No 609 in SEQ ID NO.1.

The subject matter of the invention is therefore more especially a method for typing a photoperiodic animal preferably for its counter-seasonal reproductive capacity and/or its ability transmit this capacity to its descendants, characterized in that the genotype of the polymorphous MnlI restriction site is identified present in the Exon II portion of the Melia receptor located between the nucleotides at position 321 and 338 in sequence SEQ ID NO 1 in ovine species, or in a homologous sequence in other species.

This region appears to be substantially conserved in numerous species, in particular among those cited above.

The method of the invention concerns for example the animals chosen from among the following species: ovine, porcine, bovine and caprine. The method of the invention advantageously applies to animals whose seasonality depends upon photoperiodic control involving the melatonin receptor, and among them, ovine and caprine species more particularly.

The method of the invention applied to sheep or goats consists of identifying the genotype of the polymorphous MnlI restriction site located between the nucleotides at positions 330 to 333 in SEQ ID N0.1 of Exon II of the Melia receptor. The method of the invention then consists of detecting the presence of a mutation at the nucleotide at position 330 in the SEQ ID NO.1 sequence, consisting of the replacement of a G nucleotide by an A nucleotide.

Advantageously, in ovines, and in species whose Exon II portion of the Melia receptor containing a polymorphous MnlI site is homologous to the one located between the nucleotides at positions 321 and 328 in sequence SEQ ID NO.1- such as in caprines, the method of the invention also consists of identifying mutations associated with the genotype of said polymorphous MnlI restriction site, and more particularly at least one of those located at the nucleotides at positions 171, 424 and 609 in sequence SEQ ID N0.1 and which, together with the mutation located at the nucleotide at position 330 in sequence SEQ ID NO.1, defines a new allele previously called allele Therefore, with the genotyping of animals, it is possible to eliminate carriers of genotype which are not able to reproduce in counter-season, even carriers in order to eliminate the allele.

The method of the invention can therefore consist of identifying, on one or both parental chromosomes, a mutation at the nucleotide at position 330 in sequence SEQ ID NO.1 characterizing loss of the polymorphous MnlI restriction site present in Exon II of the Melia receptor, and optionally at least one of the mutations located at the nucleotides at position 171, 424 and 609 in sequence SEQ ID NO.1. An animal with a genotype will therefore have lost the polymorphous MnlI site of Exon II of the Mella receptor gene on these two chromosomes, and may be removed since it does not have the capacity for counterseasonal reproduction. An animal with a genotype will therefore have lost the polymorphous MnlI site of Exon II of the Mela,, receptor gene on one of these chromosomes, and may possibly be removed since it is likely to be unable to transmit the capacity for counterseasonal reproduction to some of its descendants. However, not all animals of genotype may be eliminated right at the start since they may represent 50% of the population. On the other hand, over the longer term, such gradual elimination is advisable in order to avoid the reconstitution of genotypes in descendants of parents with genotype In ovines, the inventors have shown that the mutation of the nucleotide at position 330 in sequence SEQ ID NO.1 modifies the recognition site of the MnlI enzyme, and therefore allows selection of animals likely to show the capacity for counter-seasonal reproduction or to transmit this capacity to their descendants. In other words, the method of the invention consists of evidencing, by any appropriate technique, the presence or absence of this mutation at the nucleotide at position 330 in SEQ ID NO.1.

Among these methods, one preferred technique consists of analysing the digestion profile by the MnlI enzyme of a DNA sample obtained from the animal to be tested. The presence or absence of one or more MnlI digestion products indicates the presence or absence of the corresponding site, and it can therefore be determined if the animal has the capacity for counter-seasonal reproduction.

One preferred embodiment of the method of the invention is characterized in that: a DNA sample obtained from an animal, and containing all or part of Exon II of the Mel,,ia receptor gene carrying a polymorphous MnlI restriction site, is subjected to the action of the MnlI enzyme, the genotype of said animal is determined by analysis of the digestion products by the MnlI enzyme.

The DNA sample must contain a polymorphous MnlI restriction site present in Exon II of the melatonin Melia receptor gene as indicated above. Preferably it is the Exon II portion of the Melia receptor gene located between the nucleotides at position 321 and 328 of the SEQ ID NO.1 sequence in ovines, or in a homologous sequence in other species.

The DNA of the sample is advantageously genomic DNA obtained, for example, from nucleated blood components, following the method such as the one described by Miller et al., (Nucleic Acids Research, 1996, 16, 8).

The Exon II portion of the Melia receptor gene carrying a polymorphous MnlI restriction site, is advantageously amplified, preferably PCR amplified.

The evidencing of the region of interest may be reduced to a portion of 600 nucleotides of Exon II including the polymorphous MnlI site and, advantageously in ovines, the 4 mutations located at the nucleotides at position 330, 171, 424 and 609 in the SEQ ID NO.1 sequence. This portion of Exon II, after genotyping by MnlI can be used to conduct optional verification of the nucleotide composition by sequencing.

The amplification products are digested by the MnlI enzyme, the digestion products are denatured and separated by electrophoresis on agarose gel for example, and the genotype of the animal is determined on the basis of size analysis of the digestion products.

Full MnlI digestion of the amplification product, approximately 1 gg, is achieved with 1-2 units of enzyme for 2 or 3 hours, even overnight for practicality reasons.

The digestion products are then denatured and separated by electrophoresis on agarose gel.

The genotype of the animal is determined from analysis of the digestion products with the MnlI enzyme.

The digestion products may be evidenced by several methods of which one, easy to implement, uses ethidium bromide fixing and development under UV. A photograph is taken for record purposes. Under UV, as in the photograph, the size of the digestion products is evaluated in comparison with a marker scale.

For ovines, and in accordance with the examples detailed in the experimental section below, the presence of the MnlI site corresponds to a band of 236 nucleotides located just above a non-polymorphic band of 216 nucleotides; it is associated with a band of 67 nucleotides that is often non-visible under usual experimental conditions. The loss of the site corresponds to the sum of the two preceding bands, i.e. 303 nucleotides, well visible as it is the only of this size.

Analysis of the digestion products using the method of the invention is therefore based on the identification of three possible types of results observed by the Inventors: the presence of a band of 236 nucleotides (and nothing at 303) corresponds to genotype (ii) the presence of a band of 303 nucleotides (and nothing at 236) corresponds to genotype (iii) the presence of a band of 236 nucleotides and another of 303 nucleotides reveals genotype Other advantages and characteristics of the invention will become apparent from the following examples describing the genotyping of the Melia receptor in sheep and the application of the method of the invention to select animals intended for reproduction.

Example 1: Genotypinq and spontaneous counter-seasonal sexual activity 1) Test 1 Animals studied: Sheep. 933 Merinos d'Arles ewes are tested for the presence or absence of spontaneous, cyclic, ovulating activity in the Spring. During the first half of April, two blood samples are taken at 8-18 days interval and plasma progesterone is measured by radio-immunology.

The presence of progesterone levels higher than 1 ng/ml in one of the two samples reveals the presence of an ovarian corpus luteum and hence the presence of cyclicity. This procedure was conducted for three consecutive years between April 1995 and April 1997 on the majority of ewes.

A total of 71 animals was selected for genotyping, 35 with no sexual activity during the experimental period and 36 showing sexual activity.

Genotyping detected a distribution of genotype incidence which differed highly significantly according to whether the animals were in anoestrus or spontaneously cyclic (P<0.001). In particular, the genotype was not observed in any cyclic animal whereas it represented 28.5 of non-cyclic animals (P<0.001).

2) Test 2 Animals studied: Sheep. The frequency of genotype "was tested in a breed considered to be much more seasonal than the Merinos d'Arles breed: the species Ilede-France (Thimonier et Maul6on, 1969, Ann. Biol. anim., Biochim., Biophys., 9, 233-250). Twenty-nine ewes were selected among the daughters of rams who had previously been genotyped in order to avoid any bias due to special conditions within the flock. The expected hypothesis that this more seasonal breed would show a higher frequency of the allele was verified by the presence of 38 of ewes with the genotype.

3) Checking Sequencing (n=48) of Exon II between the nucleotides at positions 2 to 827 in sequence ID NO.1, i.e.

practically all Exon II, after cloning or directly after PCR on a smaller portion between the nucleotides at positions 70 to 665 of sequence ID NO.1 in homozygote genotypes, verified the accuracy of the data obtained by genotyping with the MnlI enzyme.

In addition, this sequencing was able to determine that, within the limits of the sequence examined, the allele represented a single set of the same 4 mutations (n=18).

Example II. Determination of genotype 1) Preparation of aenomic DNA Genomic DNA is prepared from a 10 ml blood sample collected on EDTA from the jugular vein and frozen to break down the anuclear red corpuscles. After unfreezing, the sample is transferred to a 40-50 ml tube and the volume completed with buffer (10 mM Tris HC1 pH 7.6, 5 mM MgCl 2 10 mM NaCI). After initial centrifuging at 1200 r.p.m. for 10 mn, the aqueous phase is decanted and the white corpuscles are replaced in solution in the previous buffer. Centrifuging is again carried out at 1000 r.p.m.

for 7 mn. Identical washing is again carried out.

After decanting, the white corpuscles are collected with two times 1.25 ml 10 mM Tris-HCl buffer pH 7.6, 0.1 EDTA, to which are added 100 p. K proteinease (10 mg/ml), 250 p4 0.5 M EDTA pH 8 and 250 4l 10 SDS.

Gentle stirring for 2 h at 50 0

C.

Addition of 2.15 ml 6M NaCl and centrifuging at 3800 r.p.m. for 20 mn. To the liquid phase, which contains the nucleic acids, are added 2.5 vol absolute ethanol and the DNA precipitates in the form of filaments. After 3 washings in 700 alcohol, the precipitate is briefly airdried and then transferred into 1 ml of the aboveindicated Tris/EDTA buffer. The optic density at 260 nM is read off on a 20 4l sample after overnight extraction. The concentration usually lies between 50 and 150 ng/Jl. This DNA can be kept at 4 0 C for several years.

2) Polymerase Chain Reaction (PCR) The primers used are the following: Sense primer 5' <GCGTCTATAGTTAACAATGG 3' Antisense primer 5' GCCATATAGTAACTAGCCAC 3' PCR conditions are the following using standard, good quality reagents (Boehringer, Pharmacia, Biolabs, Promega) genomic DNA quantity 100-150 ng, #1-2 pl, 2 4l dNTP solution (dATP, dCTP, dGTP, dTTP, each at mM), 1 pg sense primer and 1 pl antisense primer (each at pmole/il), p4 50 mM Tris buffer, 75 mM KC1, 3 mM MgCl 2 1.5 pg 25 mM MgCl 2 (final concentration 3 mM), p4 10 X PCR buffer(supplied with enzyme), 0.2 p4 Taq Polymerase enzyme 1 U), up to final volume of 50 p1.

The enzyme buffer and the enzyme itself are mixed together and the mixture is added to the other reagents previously pipetted into a PCR tube.

The whole is overlayed with 80 4l mineral oil.

Actual PCR consists of 35 cycles in accordance with the following programme: Cycle 1: denaturing 3 mn at 95 0 C annealing 1 mn at 62 0 C extension 2 mn at 72 0

C,

Cycles 2-35: denaturing 1 mn at 95°C annealing 1 mn at 62°C extension 2 mn at 720C.

PCR ends with final extension for 10 mn at 72 0

C.

3) Enzymatic digestion The reagents are added in the following order: 39 L4

H

2 0 32 pg PCR product 8 4L buffer supplied with the enzyme 0.8 g1 BSA (10 mg/ml) 0.2 .l MnlI enzyme Digestion is conducted overnight for practicality at 37 0

C.

The sample is then concentrated in a dry hot-water bath at 0 C to be reduced to approximately 25 pl (speedvac concentration is also possible).

4)Identification of digestion products on agarose gel 3 agarose gel (NuSieve, FMC Bioproducts) is prepared in a 45 mM Tris-borate buffer, 1mM EDTA (0.5 X buffer). To the samples are added 1 4l bromophenol blue solution (2.5 mg bromophenol blue, 40 saccharose, 10 mM EDTA pH 8, 20 mM NaOH up to final volume of 1 ml) followed by heating at 65 0 C for 5-7 min, with a 5 il sample of DNA molecular weight marker calibrated per 100 base pairs up to 1 kb (InVitrogene). The samples are subjected to 100 V electrophoresis and after approximately 6 cm migration of bromophenol blue, the agarose gel is stained with ethidium bromide (10 gg/ml) for 5-10 mn.

The gel is photographed under UV showing the presence of digestion bands.

The method of the invention leads to eliminating those animals whose genomic DNA only shows the 303 bp band in the reproductive animal batch (genotype During a second phase, it is possible to eliminate animals carrying the genotype (bands of 303 and 236 bp simultaneously present).

EDITORIAL NOTE APPLICATION NUMBER 62883/00 The following Sequence Listing page 1-2 is part of the description.

The claims pages follow on pages 20-23 SEQUENCE LISTING <110> Institut national de la recherche Agronomique IN <120> Method for typing a photoperiodic animal for a seasonal physiological function like its conter-seasonal reproduction capacity.

<130> 5l6Opct-juin2000 <140> wo2000-xxxxx <141> 2000-06-28 <150> FR99/08238 <151> 1999-06-28 <160> 2 <170> Patentln Ver. 2.1 <210> <211> <212> <213> <220> <221> <222> <223> 1 867

DNA

ovines bovines caprines misc feature (867) Exon II of the melatonin Mella receptor <400> 1 aatgtgtttg ttggcgctgg agtggcttcc atcaaccgct aattccctct ctgtgtgtgg gtcagctcag gtcatcttct ccggacaaca gtttttgtcc tcggaccctg atggcatatt aggcaggaat agctccaatc aacctaataa tggtgagcct cgtctatagt tgatgggctt attgctgcat gctacgtgtt ggaccctgca cctacacgat gttacctgag aaccgaaact tctttgccat ccagcatggc tcaacagctg acagaaaaat atgtagcaga aggtggactc ggcagttgca taacaatggg gagcgtcatc ctgccacagc cctgatctgg gtacgaccca cgccgtggtg aatctgggcc gaagccccaq ttgctgggct acccaggatc cctcaatgcg tatagtctca tagaattaaa cgtttaa gacctgctgg tggagcctga gggtccgttt ctcagatacg acgctgacgc aggatctatt gtgttccatt ctggttcttc gacttcagga cctctgaact cccgagtggc atcatatatg ttgtgtacca cgcaaaccct tggccgtgta gctccctgca tcagcatcac gcaagctgta tcgtggcgat cctgtacctt tcatagttcc aggtcagatg attttgtcac tcattggtct tgtttgtggc gactactgaa ccaagatgtt ctccattaat tccgtacccc ttgccaactt tggaattgcc tagcggcacg cgtgcccaac cacgcagtcc gatgctcgta gaaggtgaaa catgtttgtg cgttgtggcc tagttactat ccaaaatttc ctttgtggat agccaaccat <210> 2 <211> 867 <212> DNA <213> ovines <220> <223> Position No. 453 of figure SEQ ID No.1 <220> <223> Position No. 603 of figure SEQ ID No.1 1 corresponds to position No. 171 in 1 corresponds to position No. 321 in <220> <223> <220> <223> <220> <223> <220> <223> <220> <223> <220> <223> <220> <221> <222> Position No.

SEQ ID No.1 Position No.

SEQ ID No.1 Position No.

SEQ ID No.1 Position No.

SEQ ID No.1 Position No.

SEQ ID No.1 Position No.

SEQ ID No.1 misc feature 605 of figure 1 corresponds to position No. 323 in 609 of figure 1 corresponds to position No. 327 in 612 of figure 1 corresponds to position No. 330 in 620 of figure 1 corresponds to position No. 338 in 706 of figure 1 corresponds to position No. 424 in 891 of figure 1 corresponds to position No. 609 in <223> Sequence corresponding to the one between nucleotides 283 and 1149 of the exon II of the melatonin Mella receptor in sheep and shown in appended figure 1 <300> <303> Neuron <304> 13 <306> 1177-1185 <307> November 1994 <400> 2 aatgtgtttg ttggcgctgg agtggcttcc atcaaccgct aattccctct ctgtgtgtgg gtcagctcag gtcatcttct ccggacaaca gtttttgtcc tcggaccctg atggcatatt aggcaggaat agctccaatc aacctaataa tggtgagcct cgtctatagt tgatgggctt attgctgcat gctacgtgtt ggaccctgca cctacacgat gttacctgag aaccgaaact tctttgccat ccagcatggc tcaacagctg acagaaaaat atgtagcaga aggtggactc ggcagttqca taacaatggg gagcgtcatc ctgccacagc cctgatctgg gtacgaccca cgccgtggtg aatctgggcc gaagccccag ttgctgggct acccaggatc cctcaatgcg tatagtctca tagaattaaa cgtttaa gacctgctgg tggagcctga gggtccgttt ctcagatacg acgctgacgc aggatctatt gtgttccatt ctggttcttc gacttcagga cctctgaact cccgagtggc atcatatatg ttgtgtacca cgcaaaccct tggccgtgta gctccctgca tcagcatcac gcaagctgta tcgtggcgat cctgtacctt tcatagttcc aggtcagatg attttgtcac tcattggtct tgtttgtggc gactactgaa ccaagatgtt ctccattaat tccgtacccc ttgccaactt tggaattgcc tagcggcacg cgtgcccaac cacgcagtcc gatgctcgta gaaggtgaaa catgtttgtg cgttgtggcc tagttactat ccaaaatttc ctttgtggat agccaaccat

Claims (11)

1. Method for typing a photoperiodic animal for a seasonal physiological function and/or its ability to transmit this seasonal physiological function to its descendants, characterized in that the genotype of a polymorphous MnlI restriction site is identified present in Exon II of the melatonin Melia receptor, a mutation at the recognition site of said enzyme making it possible to select those animals likely to show the seasonal physiological function and/or to transmit this capacity to its descendants.

2. Method for typing a photoperiodic animal for a seasonal physiological function and/or its ability to transmit this seasonal physiological function to its descendants, according to claim 1, characterized in that said seasonal physiological function is the capacity for counter- seasonal reproduction.

3. Typing method according to either of claims 1 or 2, characterized in that the genotype of the polymorphous MnlI restriction site is identified present in the Exon II portion of the Melia receptor located between the nucleotides at position 321 and 338 in sequence SEQ ID NO.1 in ovines, or in a homologous sequence in other species.

4. Typing method according to any of claims 1 to 3, characterized in that the animal belongs to one of the following species: ovines, caprines, porcines and bovines. r 21 Typing method according to any of claims 1 to 4, characterized in that the animal is chosen from among ovines and caprines, and in that the genotype of the polymorphous MnlI restriction site is identified, located between the nucleotides at positions 330 to 333 in sequence SEQ ID NO.1 of Exon II of the Melia receptor.

6. Typing method according to claim 5, characterized in that the presence of a mutation is identified at the nucleotide at position 330 in sequence SEQ ID NO.1 consisting of the replacement of a G nucleotide by an A nucleotide.

7. Typing method according to either of claims 5 or 6, characterized in that in addition at least one mutation is identified located at the nucleotides at position 171, 424 and 609 in sequence SEQ ID NO.1 and which, together with the mutation located at the nucleotide at position 330, defines the allele.

8. Typing method according to any of claims 5 to 7, characterized in that the presence of one of said mutations is identified on one or both parental chromosomes.

9. Typing method according to any of claims 1 to 8, characterized in that: a DNA sample, obtained from said animal and containing all or part of Exon II of the Melia receptor gene carrying a polymorphous MnlI restriction site, is subjected to the action of the MnlI enzyme, 22 the genotype of said animal is determined by analysis of the digestion products with the MnlI enzyme. Typing method according to claim 9, characterized in that the DNA sample contains the Exon II portion of the Melia receptor gene located between the nucleotides at position 321 and 338 in sequence SEQ ID NO.1 in ovines, or in a homologous sequence in other species, advantageously PCR amplified.

11. Typing method according to either of claims 9 to characterized in that the DNA sample contains a portion of 600 nucleotides of Exon II including the polymorphous MnlI site, advantageously PCR amplified.

12. Typing method according to either of claims 9 to characterized in that the DNA of the advantageously amplified sample is digested by the MnlI enzyme, then the digestion products are denatured and separated by electrophoresis on agarose gel for example, and the genotype of the animal is determined by size analysis of the digestion products.

13. Typing method according to claim 12, characterized in that the animal is an ovine and in that the analysis consists of identifying one of the three following digestion profiles: the presence of a band with 236 nucleotides (and nothing at 303) corresponds to the genotype, (ii) the presence of band with 303 nucleotides (and nothing at 236) corresponds to the genotype, 23 (iii) the presence of a band of 236 nucleotides and another of 303 nucleotides reveals the genotype. from the DNA of the PCR-amplified sample using the sense primer 5' GCGTCTATAGTTAACAATGG 3' and the antisense primer 5' GCCATATAGTAACTAGCCAC 3'.