AU775228B2 - P. gingivalis antigenic composition - Google Patents
P. gingivalis antigenic composition Download PDFInfo
- Publication number
- AU775228B2 AU775228B2 AU23314/01A AU2331401A AU775228B2 AU 775228 B2 AU775228 B2 AU 775228B2 AU 23314/01 A AU23314/01 A AU 23314/01A AU 2331401 A AU2331401 A AU 2331401A AU 775228 B2 AU775228 B2 AU 775228B2
- Authority
- AU
- Australia
- Prior art keywords
- seq
- residues
- recombinant
- rgpa44
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Cosmetics (AREA)
Description
II
WO 01/47961 PCT/AU00/01588 1 P. gingivalis antigenic composition FIELD OF THE INVENTION This invention provides an oral composition and an antigenic composition for use in the suppression of the pathogenic effects of the intra-oral bacterium Porphyromonas gingivalis associated with periodontal disease based on recombinant protein and antibodies. It also provides diagnostic tests for the presence of P. gingivalis in subgingival plaque samples and specific anti-P. gingivalis antibodies in sera. Related thereto and disclosed is a method for preparing r-RgpA44 and r-Kgp39 and derivatives thereof using recombinant DNA techniques. Also disclosed are host cells transformed with recombinant vectors capable of expressing the recombinant proteins. The recombinant proteins are useful as immunogens in a vaccine formulation for active immunization and can be used to generate protein-specific antisera useful for passive immunization and as reagents for diagnostic assays.
BACKGROUND OF THE INVENTION This invention relates generally to recombinant proteins of Porphyromonas gingivalis, r-RgpA44 and r-Kgp39. The invention also relates to pharmaceutical compositions and associated agents based on these recombinant proteins and derivatives for the detection, prevention and treatment of periodontal disease associated with P. gingivalis.
Periodontal diseases are bacterial-associated inflammatory diseases of the supporting tissues of the teeth and range from the relatively mild form of gingivitis, the non-specific, reversible inflammation of gingival tissue to the more aggressive forms of periodontitis which are characterised by the destruction of the tooth's supporting structures. Periodontitis is associated with a subgingival infection of a consortium of specific Gram-negative bacteria that leads to the destruction of the periodontium and is a major public health problem. One bacterium that has attracted considerable interest is P. gingivalis as the recovery of this microorganism from adult periodontitis lesions can be up to 50% of the subgingival anaerobically cultivable flora, whereas P. gingivalis is rarely recovered, and then in low numbers, from healthy sites. A proportional increase in the level of P. gingivalis in subgingival plaque has been associated with an increased severity of periodontitis and eradication of the Received 15 November 2001 2 microorganism from the cultivable subgingival microbial population is accompanied by resolution of the disease. The progression of periodontitis lesions in non-human primates has been demonstrated with the subgingival implantation of P. gingivalis. These findings in both animals and humans suggest a major role for P. gingivalis in the development of adult periodontitis.
More recently there has been increasing linkage of priodontal disease and cardiovascular disease and therefore a link between P. gingivalis infection and cardiovascular disease. More information regarding this linkage can be found in Beck JD et al Ann Periodontol 3: 127-141, 1998 and Beck J, et al.
J. Periodontol. 67; 1123-37, 1996.
P. gingivalis expresses a range of proteins on its cell surface that are potential candidates for the development of a vaccine or diagnostic. A major group of cell surface proteins expressed by P. gingivalis is a group of proteinases and associated adhesins. One proteinase designated Arg-gingipain has been disclosed previously by Travis et al. (PCT Patent No. WO 95/07286). These investigators also reported a high molecular mass form of Arg-gingipain that is encoded by the gene rgp also disclosed in WO 95/07286. The high molecular mass form of Arg-gingipain consists of the proteinase and several other proteins proposed to be adhesins. Cell-surface complexes of P. gingivalis consisting of Arg- and Lys-spceific proteinases and adhesins have also been disclosed by Reynolds et al. (PCT/AU96/00673). Neither of these disclosures provide teaching regarding the utility of a particular adhesin as a recombinant in the protection of P. gingivalis infection.
SUMMARY OF THE INVENTION In a first aspect the present invention consists in an antigenic composition, the composition comprising at least one recombinant protein having a molecular weight of less than or equal to 44 kDa as estimated by SDS- PAGE, wherein the recombinant protein comprises at least one epitope, the epitope being reactive with an antibody wherein the antibody is reactive with a polypeptide having the sequence set out in SEQ. ID. NO. 3 or SEQ. ID. NO. In a further preferred embodiment the antigenic composition comprises a recombinant protein having a sequence selected from the group consisting of SEQ. ID. NO. 3, residues 1-184 of SEQ. ID. NO. 3, residues 1-290 of SEQ. ID.
NO. 3, residues 65-184 of SEQ. ID. NO. 3, residues 65-290 of SEQ. ID. NO. 3, residues 65-419 of SEQ. ID. NO. 3, residues 192-290 of SEQ. ID. NO. 3, residues Received 15 November 2001 3 192-419 of SEQ. ID. NO. 3, residues 147-419 of SEQ. ID. NO. 3, SEQ. ID. NO. and SEQ. ID. NO. 6.
As will be noted from a comparison of SEQ. ID. NO. 3 and SEQ. ID. NO.
these polypeptides are identical over a substantial portion of their sequence.
In another preferred embodiment the antigenic composition further comprises an adjuvant.
In yet another preferred embodiment the recombinant protein is a chimeric or a fusion protein. Where the recombinant protein is a chimeric or a fusion protein it is preferred that protein include a sequence selected from the group consisting of SEQ. ID. NO. 3, residues 1-184 of SEQ. ID. NO. 3, residues 1-290 of SEQ. ID. NO. 3, residues 65-184 of SEQ. ID. NO. 3, residues 65-290 of SEQ. ID. NO. 3, residues 65-419 of SEQ. ID. NO. 3, residues 192-290 of SEQ.
ID. NO. 3, residues 192-419 of SEQ. ID. NO. 3, residues 147-419 of SEQ. ID.
NO. 3, SEQ. ID. NO. 5 and SEQ. ID. NO. 6. An example of such a chimeric or a fusion protein is set out in SEQ. ID. NO. 4.
In a second aspect the present invention consists in a composition, the composition comprising at least one antibody, the antibody being raised against the antigenic composition of the first aspect of the present invention.
In a third aspect the present invention consists in a recombinant prokaryotic or eukaryotic cell, the recombinant cell comprising an introduced DNA sequence selected from the group consisting of SEQ. ID. NO. 1, nucleotides 1-1257 of SEQ. ID. NO. 1, nucleotides 1-552 of SEQ. ID. NO. 1, nucleotides 1-870 of SEQ. ID. NO. 1, nucleotides 193-552 of SEQ. ID. NO. 1, nucleotides 193-870 of SEQ. ID. NO. 1, nucleotides 193-1257 of SEQ. ID. NO. 1, nucleotides 574-870 of SEQ. ID. NO. 1, nucleotides 574-1257 of SEQ. ID. NO. 1, nucleotides 439-1257 of SEQ. ID. NO. 1, SEQ. ID NO. 7, SEQ. ID. NO. 8 and sequences which hybridise thereto under stringent conditions operatively linked to at least one regulatory element, such that said recombinant cell is capable of expressing a recombinant protein having a molecular weight of less than or equal to 44 kDa as estimated by SDS-PAGE, wherein the recombinant protein comprises at least one epitope, the epitope being reactive with an antibody wherein the antibody is reactive with a polypeptide having the sequence set out in SEQ ID NO: 3 or SEQ ID NO: As used herein, stringent conditions are those that employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% NaDodSO, at 50 0 C; employ during hybridisation a AM.: Received 15 November 2001 3A denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, mM sodium phosphate buffer at pH 6.5 with 750 mM NaCI, 75 mM sodium citrate at 42 0 C; or employ 50% formamide, 5 x SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 0.1% sodium Z ''Z7 PCTIAU00/01588 WO 01/47961 4 pyrophosphate, 5 x Denhardts solution, sonicated salmon sperm DNA gml), 0.1%/o SDS and 10% dextran sulfate at 42 0 C in 0.2 x SSC and 0.1%
SDS.
In a further aspect the present invention consists in a method of preventing or reducing the incidence or severity of P. gingivalis infection in a subject, the method comprising administering to the subject the antigenic composition of the first aspect of the present invention.
Given the increasing linkage of periodontal disease with cardiovascular disease (CVD) and the possible link therefore of P. gingivalis infection and CVI the antigenic composition of the first aspect of the present invention may also be used in a prophylactic therapy to reduce the incidence or severity of CVI or as an adjunct in treating
CVD.
An important form of the invention is a vaccine based on the r-RgpA4 4 and/or r-Kgp3 9 proteins or peptides and suitable adjuvant delivered by nasal spray, orally or by injection to produce a specific immune response against the RgpA44 and/or r-Kgp39 protein. A vaccine can also be based upon a recombinant component of the RgpA4 4 and/or Kgp39 gene segment incorporated into an appropriate vector and expressed in a suitable transformed host (eg. E. coli, Bacillus subtiis, Saccharomyces cerevisiae, COS cells,
CHO
oligopeptides with immunogenic epitopes from the RgpA44 and/or Kgp39 protein, can be used as immunogens in various vaccine formulations in the prevention of periodontal diseases. Additionally, according to the present invention, the RgpA44 and/or Kgp3 9 proteins and related peptides or chimeras produced may be used to generate P. gingivalis antisera useful for passive immunization against periodontal disease and infections caused by P. gingivalis.
According to one embodiment of the present invention, using recombinant DNA techniques the gene segment encoding RgpA4 4 and/or Kgp39, or gene fragments encoding one or more peptides or chimeras having immunogenic epitopes, is incorporated into an expression vector, and the recombinant vector is introduced into an appropriate host cell thereby directing the expression of these sequences in that particular host cell. The expression system, comprising the recombinant vector introduced into the host cell, can be used to produce r-RgpA44 and/or r-Kgp3 9 proteins, related peptides, oligopeptides or chimeras which can be purified for use as an immunogen in vaccine formulations; to produce RgpA44 and/or Kgp3 9 protein, related PCT/AUOO/01 5 88 WO 01/47961 peptides, oligopeptides and chimeras to be used as an antigen for diagnostic imnunoassays or for generating P. gingivalis-specific antisera of therapeutic and/or diagnostic value; or if the recombinant expression vector is a live virus such as vaccinia virus, the vector itself may be used as a live or inactivated vaccine preparation to be introduced into the hosts cells for expression of RgpA44 and/or Kgp39 or immunogenic peptides or oligopeptides or chimeric peptides; for introduction into live attenuated bacterial cells or genetically engineered commensal intra-oral bacteria which are used to express RgpA44 and/or Kgp39 protein, related peptides or oligopeptides or chimeras to vaccinate individuals; or for introduction directly into an individual to immunize against the encoded and expressed RgpA44 protein, related peptides, or oligopeptides or chimeras. In particular the recombinant bacterial vaccine can be based on a comnnensal inhabitant of the human oral cavity or animal if the vaccine is to prevent periodontal disease in animals. The recombinant bacterial vaccine expressing P. gingivalis RgpA44 and/or Kgp39 can be used to colonise the oral cavity, supragingival or subgingival plaque. The intra-oral bacterium can be isolated from the patient with periodontitis and genetically engineered to express the r-RgpA44 and/or r-Kgp39, components, peptides or chimeras. The r-RgpA4 4 and/or r-Kgp39 protein will stimulate the mucosal-associated lymphoid tissues (MALT) to produce specific antibody to P. gingivalis.
RgpA44 and/or Kgp39 proteins, peptides, oligopeptides, chimeric peptides and constructs containing epitopes can be used as immunogens in prophylactic and/or therapeutic vaccine formulations against pathogenic strains of P. gingivalis, whether the immunogen is chemically synthesized, purified from P. gingivalis, or purified from a recombinant expression vector system.
Alternatively, the gene segment encoding RgpA44 and/or Kgp39, or one or more gene fragments encoding peptides or oligopeptides or chimeric peptides, may be incorporated into a bacterial or viral vaccine comprising recombinant bacteria or virus which is engineered to produce one or more specific immunogenic epitopes of RgpA44 and/or Kgp39, or in combination with immunogenic epitopes of other pathogenic microorganisms. In addition, the gene encoding RgpA44 and/or Kgp39 or one or more gene fragments encoding RgpA44 and/or Kgp39 peptides or oligopeptides or chimeric peptides, operatively linked to one or more regulatory elements, can be introduced directly into humans to express protein, peptide, oligopeptides or chimeric PCT/AUOOIOlSS 8 PCT/AU00/01588 WO 01/47961 6 peptides relating to the RgpA44 and/or Kgp39 to elicit a protective immune response. A vaccine can also be based upon a recombinant component of normal or mutated RgpA44 and/or Kgp3 9 incorporated into an appropriate vector and expressed in a suitable transformed host (eg. E. coli, Bacillus subtilis, Saccharomyces cerevisiae, COS cells, CHO cells and HeLa cells) containing the vector. The vaccine can be based on an intra-oral recombinant bacterial vaccine, where the recombinant bacterium expressing the P. gingivalis RgpA44 and/or Kgp39 is a commensal inhabitant of the oral cavity.
In another aspect, the invention provides nucleotide sequences coding jo for the recombinant protein and functional equivalents of said nucleotide sequences and nucleic acid probes for said nucleotide sequences The invention also includes within its scope various applications and uses of the above nucleotides and recombinant products including chimeric recombinant polypeptides. In particular, the invention provides antibodies raised against the r-RgpA44 or r-Kgp3 9 herein called anti- r-gpA4 4 antibodies and anti-r-Kgp 39 antibodies, respectively;nd antibodies to the polypeptides, oligopeptides and chimeric peptides. The antibodies may be polyclonal or monoclonal. The antibodies may be blended into oral compositions such as toothpaste, mouthwash, toothpowders and liquid dentifrices, mouthwashes, troches, chewing gums, dental pastes, gingival massage creams, gargle tablets, dairy products and other foodstuffs. The recombinant polypeptides, oligopeptides and chimeric peptides may also be used as immunogens in prophylactic and/or therapeutic vaccine formulations.
In another aspect the invention provides a method of diagnosis for the presence of P. gingivalis characterised by the use of any one or a combination of an antibody, antigen or nucleic acid probe as hereinbefore defined comprising the application of known techniques including for example, enzyme linked immunosorbent assay.
The invention also provides diagnostic kits comprising antibodies, antigens and/or nucleic acid probes as hereinbefore defined.
The invention also provides a method of treatment of a patient either suffering from P. gingivalis infection comprising active vaccination of said patient with a vaccine as hereinbefore defined and/or passive vaccination of said patient with an antibody as hereinbefore defined.
WO 01/47961 PCT/AU00/01588 7 DETAILED DESCRIPTION OF THE INVENTION Figure Legends Figure 1 shows the results obtained in Example 1 Figure 2 shows the results of the full length recombinant 44kD protein, 2 fragments of the 44kD protein (Fragment 4; residues 65-290 and fragment 6; residues 192-290), a control recombinant protein R2 and Formalin killed whole P. gingivalis (FK-33277)in the mouse abscess model.
Figure 3. Flow cytometric analysis of P.gingivalis cells reacted with PBS/FA, normal mouse serum, P.gingivalis whole cell antisera, (D) recombinant Pg44 antisera, Fragment 4 antisera (r-44kDa residues 65-290) Fragment 6 antisera (r-44kDa residues 192-290) Chimeric r-44-Pg33 protein antisera.
Figure 4: Binding of the RgpA-Kgp specific anti-sera to recombinant proteins. The recombinant proteins were coated at 5pg/ml and probed with anti-RgpA-Kgp specific anti-sera: recombinant Kgp39 protein recombinant Kgp39 fragment RgpA-Kgp complex and control Bound antibody was detected using a 1:4000 dilution of Goat anti- Rabbit HRP, and ELISA plates were read using a Labsystems iEMS microplate reader at 415nm.
Figure 5: Binding of recombinant Kgp39 protein to a variety of matrix proteins. The matrix proteins were coated at Sgg/ml and probed with recombinant protein which was then probed with anti-RgpA-Kgp complex specific anti-sera: Collagen type V Fibrinogen Hemoglobin and control Bound antibody was detected using a 1:4000 dilution of Goat anti-Rabbit HRP conjugate, and ELISA plates were read using a Labsystems iEMS reader at 415nm.
Figure 6: Binding of recombinant Kgp39 protein fragment to a variety of matrix proteins. The matrix proteins were coated at 5pg/ml and probed with recombinant protein which was then probed with anti-RgpA-Kgp complex specific anti-sera: Collagen type Fibrinogen Hemoglobin and control Bound antibody was detected using a 1:4000 dilution of Goat anti-Rabbit HRP conjugate, and ELISA plates were read using a Labsystems iEMS reader at 415nm.
PCT/AUOO/01SSS PCT/AU00/01588 WO 01/47961 8 In order that the nature of the present invention may be more clearly understood preferred forms thereof will be described with reference to the following Examples.
The intra-oral bacterium porphyromons gingivalis contains on its surface a proteinase-ades complex encoded by the genes rgpA and kgp The recombinant 44 kDa adhesin (r-RgpA44) of this proteinase-adhesin complex protects against P. gingivalis challenge in a mouse abscess model whereas other recombinant proteins from the rgpA gene do not. The gene segment encoding the 44 kDa adhesin domain RgpA44 or Kgp39 can be cloned into an appropriate expression system to produce the recombinant protein, r-RgpA4 4 or r-Kgp3 9 The purified r-RgpA44 or r-Kgp39 protein can then be used to generate antibodies using standard techniques. The animals used for antibody generation can be rabbits, goats, chickens, sheep, horses, cows etc. When a high antibody titre against the r-RgpA4 4 or r-Kgp39 protein is detected by immunoassay the animals are bled or eggs or milk are collected and the serum prepared andlor antibody purified using standard techniques or monoclonal antibodies produced by fusing spleen cells with myeloma cells using standard techniques. The antibody (immunoglobulin fraction) may be separated from the culture or ascites fluid, serum, milk or egg by salting out, gel filtration, ion exchange and/or affinity chromatography, and the like, with salting out being preferred. In the salting out method the antiserum or the milk is saturated with ammonium sulphate to produce a precipitate, followed by dialyzing the precipitate against physiological saline to obtain the purified immunoglobulin fraction with the specific anti-r-RgpA 4 4 or anti-r-Kgp 39 The preferred antibody is obtained from the equine antiserum and the bovine antiserum and milk. In this invention the antibody contained in-the antiserum and milk obtained by immunising the animal with the r-RgpA4 4 or r-Kgp3 9 protein or peptide is blended into the oral composition. In this case the antiserum and milk as well as the antibody separated and purified fromthe antiserum and milk may be used. Each of these materials may be used alone or in combination of two or more. Antibodies against the r-RgpA4 4 or r-Kgp3 9 can be used in oral compositions such as toothpaste and mouthwash. The anti-r-RgpA44 or anti-r- Kgp39 antibodies can also be used for the early detection of P. gingivalis in subgingival plaque samples by a chairside Enzyme Linked Immunosorbent Assay
(ELISA).
PCTIAU00101588 WO 01/47961 9 For oral compositions it is preferred that the amount of the above antibodies administered is 0.0001 -50 g/kglday and that the content of the above antibodies is 0.0002 10% by weight preferably 0.002 by weight of the composition. The oral composition of this invention which contains the above-mentioned serum or milk antibody may be prepared and used in various forms applicable to the mouth such as dentifrice including toothpastes, toothpowders and liquid dentifrices, mouthwashes, troches, periodontal pocket irrigating devices, chewing gums, dental pastes, gingival massage creams, gargle tablets, dairy products and other foodstuffs. The oral composition according to this invention may further include additional well known ingredients depending on the type and form of a particular oral composition.
In certain highly preferred forms of the invention the oral composition may be substantially liquid in character, such as a mouthwash or rinse. In such a preparation the vehicle is typically a water-alcohol mixture desirably including a humectant as described below. Generally, the weight ratio of water to alcohol is in the range of from about 1:1 to about 20:1. The total amount of water-alcohol mixture in this type of preparation is typically in the range of from about 70 to about 99.9% by weight of the preparation. The alcohol is typically ethanol or isopropanol. Ethanol is preferred.
The pH of such liquid and other preparations of the invention is generally in the range of from about 4.5 to about 9 and typically from about to 8. The pH is preferably in the range of from about 6 to about 8.0, preferably 7.4. The pH can be controlled with acid citric acid or benzoic acid) or base sodium hydroxide) or buffered (as with sodium citrate, benzoate, carbonate, or bicarbonate, disodium hydrogen phosphate sodium dihydrogen phosphate, etc).
Other desirable forms of this invention, the oral composition may be substantially solid or pasty in character, such as toothpowder, a dental tablet or a dentifrice, that is a toothpaste (dental cream) or gel dentifrice. The vehicle of such solid or pasty oral preparations generally contains dentally acceptable polishing material. Examples of polishing materials are water-insoluble sodium metaphosphate, potassium metaphosphate, tricalcium phosphate, dihydrated calcium phosphate, anhydrous dicalcium phosphate, calcium pyrophosphate, magnesium orthophosphate, trimagnesium phosphate, calcium carbonate, hydrated alumina, calcined alumina, aluminum silicate, zirconium silicate, silica, bentonite, and mixtures thereof. Other suitable polishing material WO 01/47961 PCT/AUOO/0 158 8 include the particulate thermosetting resins such as melamnine-, phenolic, and urea-formaldehydes, and cross-linked polyepoxides and polyesters. Preferred polishing materials include crystalline silica having particle size of up to about microns, a mean particle size of up to about 1.1 microns, and a surface area of up to about 50,000 cnl/g n l, silica gel or colloidal silica, and complex amorphous alkali metal aluninosilicate.
When visually clear gels are employed, a polishing agent of colloidal silica, such as those sold under the trademark SYLOID as Syloid 72 and Syloid 74 or under the trademark SANTOCEL as Santocel 100, alkali metal alumino-silicate complexes are particularly useful since they have refractive indices close to the refractive indices of gelling agent-liquid (including water and/or humectant) systems commonly used in dentifices.
Many of the so-called "water insoluble" polishing materials are anionic in character and also include small amounts of soluble material. Thus, insoluble sodium metaphosphate may be formed in any suitable manner as illustrated by Thorpe's Dictionary of Applied Chemistry, [Volume 9, 4th Edition, pp. 510-5111. The forms of insoluble sodium metaphosphate known as Madrell's salt and Kurrol's salt are further examples of suitable materials. These metaphosphate salts exhibit only a minute solubility in water, and therefore are commonly referred to as insoluble metaphosphates (IMP). There is present therein a minor amount of soluble phosphate material as impurities, usually a few percent such as up to 4% by weight The amount of soluble phosphate material, which is believed to include a soluble sodium trimetaphosphate in the case of insoluble metaphosphate, may be reduced or eliminated by washing with water if desired. The insoluble alkali metal metaphosphate is typically employed in powder form of a particle size such that no more than 1% of the material is larger than 37 microns.
The polishing material is generally present in the solid or pasty compositions in weight concentrations of about 10% to about 99%. Preferably, it is present in amounts from about 10% to about 75% in toothpaste, and from about 70% to about 99% in toothpowder. In toothpastes, when the polishing material is silicious in nature, it is generally present in amount of about 10-30% by weight. Other polishing materials are typically present in amount of about 30-75% by weight In a toothpaste, the liquid vehicle may comprise water and humectant typically in an amount ranging from about 10% to about 80% by weight of the
PCTIAUOO/OISSS
WO 01/47961 PCT/AU00/01588 WO 01/47961 11 preparation. Glycerine, propylene glycol, sorbitol and polypropylene glyc es exemplify suitable humectants/carriers. Also advantageous are liquid mixtures of water, glycerine and sorbitol. In clear gels where the refractive index is an important consideration, about 2.5 30% w/w of water, 0 to about 70% w/w of glycerine and about 20-80% w/w of sorbitol are preferably employed.
Toothpaste, creams and gels typically contain a natural or synthetic thickener or gelling agent in proportions of about 0.1 to about 10, preferably about 0.5 to about 5% w/w. A suitable thickener is synthetic hectorite, a synthetic colloidal magnesium alkali metal silicate complex clay available for example as Laponite CP, SP 2002, D) marketed by Laporte Industries Limited. Laponite D is, approximately by weight 58.00% SiO, 25.40 MgO, 3.05% NazO, 0.98% LizO, and some water and trace metals. Its true specific gravity is 2.53 and it has an apparent bulk density of 1.0 g/ml at 8% moisture.
Other suitable thickeners include Irish moss, iota carrageenan, gum tragacanth, starch, polyvinylpyrrolidone, hydroxyethylpropylcellulose, hydroxybutyl methyl cellulose, hydroxypropyl methyl cellulose, hydroxyethyl cellulose available as Natrosol), sodium carboxymethyl cellulose, and colloidal silica such as finely ground Syloid 244). Solubilizing agents may also be included such as humectant polyols such propylene glycol, dipropylene glycol and hexylene glycol, cellosolves such as methyl cellosolve and ethyl cellosolve, vegetable oils and waxes containing at least about 12 carbons in a straight chain such as olive oil, castor oil and petrolatum and esters such as amyl acetate, ethyl acetate and benzyl benzoate.
It will be understood that, as is conventional, the oral preparations are to be sold or otherwise distributed in suitable labelled packages. Thus, a jar of mouthrinse will have a label describing it, in substance, as a mouthrinse or mouthwash and having directions for its use; and a toothpaste, cream or gel will usually be in a collapsible tube, typically aluminium, lined lead or plastic, or other squeeze, pump or pressurized dispenser for metering out the contents, having a label describing it, in substance, as a toothpaste, gel or dental cream.
Organic surface-active agents are used in the compositions of the present invention to achieve increased prophylactic action, assist in achieving thorough and complete dispersion of the active agent throughout the oral cavity, and render the instant compositions more cosmetically acceptable. The organic surface-active material is preferably anionic, nonionic or ampholytic in nature which does not denature the antibody of the invention, and it is PCTIAUOO/0l S88 WO 04/47961 PCT/AU00/01588 12 preferred to employ as the surface-active agent a detersive material which imparts to the composition detersive and foaming properties while not denaturing the antibody. Suitable examples of anionic surfactants are water-soluble salts of higher fatty acid monoglyceride monosulfates, such as the sodium salt of the monosulfated monoglyceride of hydrogenated coconut oil fatty acids, higher alkyl sulfates such as sodium lauryl sulfate, alkyl aryl sulfonates such as sodium dodecyl benzene sulfonate, higher alkylsulfo-acetates, higher fatty acid esters of 1,2-dihydroxy propane sulfonate, and the substantially saturated higher aliphatic acyl amides of lower aliphatic amino carboxylic acid compounds, such as those having 12 to 16 carbons in the fatty acid, alkyl or acyl radicals, and the like. Examples of the last mentioned amides are N-lauroyl sarcosine, and the sodium, potassium, and ethanolamine salts of N-lauroyl, N-myristoyl, or N-palmitoyl sarcosine which should be substantially free from soap or similar higher fatty acid material. The use of these sarconite compounds in the oral compositions of the present invention is particularly advantageous since these materials exhibit a prolonged marked effect in the inhibition of acid formation in the oral cavity due to carbohydrates breakdown in addition to exerting some reduction in the solubility of tooth enamel in acid solutions. Examples of water-soluble nonionic surfactants suitable for use with antibodies are condensation products of ethylene oxide with various reactive hydrogen-containing compounds reactive therewith having long hydrophobic chains aliphatic chains of about 12 to 20 carbon atoms), which condensation products ("ethoxamers") contain hydrophilic polyoxyethylene moieties, such as condensation products of poly (ethylene oxide) with fatty acids, fatty alcohols, fatty amides, polyhydric alcohols (e.g.
sorbitan monostearate) and polypropyleneoxide Pluronic materials).
Surface active agent is typically present in amount of about 0.1-5% by weight It is noteworthy, that the surface active agent may assist in the dissolving of the antibody of the invention and thereby diminish the amount of solubilizing humectant needed.
Various other materials may be incorporated in the oral preparations of this invention such as whitening agents, preservatives, silicones, chlorophyll compounds and/or ammoniated material such as urea, diammonium phosphate, and mixtures thereof. These adjuvants, where present, are incorporated in the preparations in amounts which do not substantially adversely affect the properties and characteristics desired.
PCTIAU 00/0 1588 WO 01/47961 PCTIAU00/01588 13 Any suitable flavoring or sweetening material may also be employed.
Examples of suitable flavoring constituents are flavoring oils, e.g. oil of spearmint, peppermint, wintergreen, sassafras, clove, sage, eucalyptus, marjoram, cinnamon, lemon, and orange, and methyl salicylate. Suitable sweetening agents include sucrose, lactose, maltose, sorbitol, xylitol, sodium cyclamate, perillartine, AMP (aspartyl phenyl alanine, methyl ester), saccharine, and the like. Suitably, flavor and sweetening agents may each or together comprise from about 0.1% to 5% more of the preparation.
In the preferred practice of this invention an oral composition io according to this invention such as mouthwash or dentifrice containing the composition of the present invention is preferably applied regularly to the gums and teeth, such as every day or every second or third day or preferably from 1 to 3 times daily, at a pH of about 4.5 to about 9, generally about 5.5 to about 8, preferably about 6 to 8, for at least 2 weeks up to 8 weeks or more up to a lifetime.
life The compositions of this invention can be incorporated in lozenges, or in chewing gum or other products, e.g. by stirring into a warm gum base or coating the outer surface of a gum base, illustrative of which may be mentioned jelutong, rubber latex, vinylite resins, etc., desirably with conventional plasticizers or softeners, sugar or other sweeteners or such as glucose, sorbitol and the like.
The composition of this invention also includes targeted delivery vehicles such as periodontal pocket irrigation devices, collagen, elastin, or synthetic sponges, membranes or fibres placed in the periodontal pocket or used as a barrier membrane or applied directly to the tooth root.
The following examples are further illustrative of the nature of the present invention, but it is understood that the invention is not limited thereto All amounts and proportions referred to herein and in the appended claims are by weight unless otherwise indicated.
PCT/AUOOIOIS
8
S
WO 01/47961 14 EXAMPLE 1 Cloning, and expression of the P. gin givalis proteinase and adhesin domains RgpA45, RgpA44, RgpA27 and RgpAl5 in E. coli and testing of the recombinant proteins as a vaccine in the murine abscess model.
Table 1. Oligonucleotide primers used for the amplification of the nucleotide sequences encoding RgpA45, RgpA44, RgpA27 anid Recombinant Primers Protein Forward 5 9-GCGCAGATCTAACACGAGAGG-3 Reverse 5 ,-GCGGTCGACTAGCGAAGAGflCGGG- 3 1 RgpA44 Forward 5,GCG CATATGAGCGGTAATGA
G
3 Reverse 5 ,-GCCCTGAGGCGTG CACC~
GATCFC-
3 RgpA27 Forward 5 I-GCGCTAGC
ATACATGACCG~
3 Reverse 3 Forward 51GGGTGGAAAGGAA (-CGAC~C3 Reverse 5'G ACG1CG3 Each of the protainase and adhesin domains of the gene rgpA were amplified using the primers listed in Table 1, P. gin givalis W50 genomiC
DNA
with Elongase® (Gibco BRI) DNA polymerase and a PC-960 thermal cycler (Corbett Research Technologies). Using the oligonucleotide primers a PCR was performed essentially as described in the Elongase instruction protocol using the following conditions: 25 cycles of denaturation (94*C, 30 sec), annealing (50 0 C, 45 sec), and extension (701C, 1.5 min). The PCR product was pu rified using PCR Spinclean® (Progen) and ligated into plasmid vector pGEMT-easy (Promega) and transformed into competent E. coli JM109 (Promega) following the manufacturers protocols. All procedures were similar for the preparation of the four recombinants so the detailed process for the RgpA44 only will be described. Recombinant plasmid pGEMT-easy-RgPA44 DNA was digested with Ndel and XhoI to release the insert DNA. Insert DNA was isolated by agarose gel electrophoresis; and purified using the Qiafilter gel extraction it (Qiagen). Purified insert DNA was ligated into Qiafilter purified plasmid expression vector pET28a (Novagen) that had been previously digested with NdeI and Xhol, and the PCT/AU00/01588 WO 01/47961 ligation products were transformed into the non-expression host, E. coi JM109. The recombinant pET28-RgpA 4 4 plasmid was then transformed into the E. coli expression host, HMS174(DE3) and selected on LB containing g kanamycin. The r-RgpA44 expressed from pET28a contains a hexahistidine tag fused to the N-terminus of the expressed recombinant protein. r-RgpA4 4 expression was induced by addition of IPTG and purified by nickel-affinity chromatography. The integrity of the insert of pET28-RgpA4 4 was confirmed by DNA sequence analysis.
Expression of recombinant E. coli A single colony transformant was used to inoculate 10 mis of Luria-Bertani broth containing 50 cg/ml kanamycin at 37C until the optical density (ODoo) was 1.0. This inoculum was then used to inoculate 500 ml of Terrific broth (containing potassium phosphates and 50 g/ml kanamycin).
The ODo 0 of this culture was allowed to reach 2.0 before inducing with 0.1 mM IPTG. After a 4.5 hour induction period at 37 0 C the culture was harvested by centrifuging at 4000 rpm for 20 min at 4C and the pellet was stored at -700C for the extraction of inclusion bodies.
Isolation and solubilisation of inclusion bodies The bacterial pellet was thawed on ice and resuspended in binding buffer (5 mM imidazole, 500 nM NaCl, 20 mM Tris-HC1, pH then sonicated and centrifuged at 20,000 x g to collect the inclusion bodies. The pellet was resuspended in binding buffer and the process of sonication and centrifugation repeated twice more to release further protein The pellet was then resuspended in binding buffer containing 6 M urea and incubated on ice for 2-3 hrs stirring to completely dissolve proteins. Any remaining insoluble material was removed by centrifuging at 39,000 x g for 20 min. The supernatant was filtered through a 0.45 pm membrane before column purification.
Nickel-nitrilotriaectic acid (Ni-NTA) purification and refolding of solubilised inclusions Ni-NTA metal affinity chromatography was used to purify the recombinant proteins via the He tag. Briefly, proteins were batch bound to the equilibrated Ni-NTA resin (Qiagen) which was poured into a small column and unbound proteins were eluted under gravity. The column was PCTIAUOO/01588 WO 01/47961 PCT/AU00/01588 16 then washed with 10 volumes of binding buffer followed by 5 column volumes of wash buffer (60 mM imidazole, 500 mM Nacl, 20 mM Tris-HC1, 6 M urea, pH The bound protein was then eluted in buffer containing 1M imidazole, 500 mM NaC1, 20 mM Tris-HCl, 6M urea, pH 7.9).
Renaturation of recombinant protein Fractions eluted off the NI-NTA resin were pooled and refolded by the step-wise dialysis from 6 M to 3 M to 1.5 M to 0 M Urea contained in the following buffer 0.5 M Tris-HC1, 50 mM NaCI and 8% Glycerol.
1 Polyacrylamide Gel Electrophoresis and Western Blotting SDS-PAGE was performed as described by Laemmli. Samples were mixed with an equal volume of 2 x sample reducing buffer, boiled for 10 min at 95 0 C and ran on Tris-glycine 12% gels (Novex). Molecular weight standards (SeeBlue
T
were also purchased from Novex. Western blots were prepared by electroblotting proteins onto nitrocellulose for 1 hr at 100 volts.
Membranes were blocked with 1% casein solution before incubating with primary antibody diluted to 1/1000, washed and incubated with an goat anti-rabbit-HRP conjugate (KPL) washed and developed with TMB membrane peroxidase substrate
(KPL).
Antisera Polyclonal antiserum was raised to the purified recombinant proteins by dosing BALB/c mice with 2 X 20 tg of recombinant protein in Freunds incomplete adjuvant (Sigma) three weeks apart. Mice were bled one week after the second dose and the antiserum generated was used to screen Western blots of whole cell P. gingivalis W50 run under denaturing, reducing conditions.
The purity of the recombinant proteins was confirmed using MALDI-TOF mass spectrometry and N-terminal sequence analysis.
Murine lesion model Groups of 10 female BALB/c mice (6-8 weeks old) were immunized subcutaneously with each recombinant protein, r-RgpA45, r-RgpA44, r-RgpA27 and r-RgpA15 as well as formalin-killed P. gingivalis cells and E. coli; all emulsified in Incomplete Freunds Adjuvant. The immunizations were given at the base of the tail and occurred four weeks and one week prior WO 01/47961 PCT/AU00/01588 17 to challenge with P. gingivalis. Two days prior to challenge mice were bled from the retrobulbar plexus. BALB/c mice were challenged with 7.5 x viable cells of P. gingivalis 33277 subcutaneously in the abdomen. Following challenge, mice were examined daily for the number and size of lesions over a period of seven days. Lesions developed on the abdomen of the mice and the maximum lesion size in mm 2 is presented in Fig. 1. Significant reductions in lesion size were obtained only with vaccination using formalin-killed whole P. gingivalis cells and the recombinant adhesin r-RgpA44. The other recombinant proteins from the rgpA gene did not significantly reduce lesion size.
This example demonstrates the superiority of r-RgpA44 over the other recombinant proteins from the rgpA gene in protection against P. gingivalis challenge.
EXAMPLE 2 In the previous example it was demonstrated that the recombinant 44kDa adhesin protected against challenge with P. gingivalis in the mouse lesion model. However the full length 44 kDa adhesin when expressed in E. coli was found as inclusion bodies that were only soluble in denaturing solvents. A series of fragments from the 44kDa adhesin were generated in order to improve the solublility of the protein and enhance the correct folding of the recombinant protein. The oligonucleotide primers used to construct fragments of the 44kDa adhesin recombinant protein are shown in Table 2.
WO 01/47961 PCT/AU00/01588 18 Table 2. Oligonucleotide primers used for construction of the r-protein vectors Recombinant Direction Primers protein Fragment 1 F 5' GGGAAITCCATGGGTCAGGCCGAGATTG!T 3' ragment 1 R 5' TCCCTCGAGCTTAACITCCACGCAATACTC 3' Fragment 2 F 5' GGGAAITCCATGGGTCAGGCCGAGATTGTT 3' Fragment 2 R 5' GGTCAATTGGACCGAGATATACACAACCATTGCT 3' Fragment 3 F 5' GAGGAATrCAGATCCTCTTGTTCCCCTAC 3' Fragment 3 R 5' TCCGTCGAGCTTAACICCACGCAATACTC 3' Fragment 4 F 5' GAGGAATTCAGATCCTTCTGITCCCCCAC 3' Fragment 4 R 5' GGTCAATIGGACTCGAGATATACACAACCATIGCT 3' Fragment 5 F 5' GAGGAATTCAGATCCITCTITGTCCCCTAC 3' Fragment 5 R 5' AGGAATTCTCGACCT'GCCGTIGGCCTGAT 3' Fragment 6 F 5' GGGAATrCCATGGCGAAGGTATGTAAAGACGT 3' Fragment 6 R 5' GGTCAATIGGACTCGAGATATACACAACCAIGCT 3' Fragment 7 F 5' GGGAATTCCATGGCGAAGGTATGTAAAGACGTT 3' Fragment 7 R 5' AGGAATITCTCGAGCTTGCCGTTGGCCTTGAT 3' Using similar methods as described in Example 1, fragments of the 44kDa adhesin were cloned into pET24b plasmids (Novagen) and expressed in E. coli strain BL21(DE3) (Novagen). Expression levels and the amount of soluble r-44kDa protein produced were assessed for the different fragments.
This was done following IPTG induction, where by a 1.5ml cell culture of the recombinant E. coli cell culture was pelleted by centrifugation and resuspended in 150ul of binding buffer. Cells were then sonicated for 10 sec using a microprobe at a setting of 5 (Virosonic Digital 475 ultrasonic cell disruptor, The Virtis Company, NY). Following centrifugation for 3 minutes (10,000 rpm) the supernatant was collected, which represented the soluble fraction. The pellet was then washed and the resuspended in binding buffer, which represented the insoluble fraction. Analysis of the various fractions was carried out using Western blot analysis and SDS-PAGE. The results of these experiments are shown in Table 3. The stability of the r-44kDa protein WO 01/47961 PCT/AU00/01588 19 or fragments thereof may also be further enhanced by the site directed mutagenisis of all or selected cysteine residues to serine or alanine residues.
The 44kDa adhesin contains six Cys residues that form disulphides when oxidized which may result in incorrect folding and possibly lead to the formation of insoluble protein. The stability of the r-44kDa protein or fragments of the r-44kDa protein may therefore be further enhanced by the site directed mutagenisis of all or selected cysteine residues to serine or alanine residues.
Table 3. Expression levels and solubility of r-44kD proteins 44kD Residues Size Expression Solubility construct (amino acids) levels Full length 1-419 419 Fragment 1 2-184 183 Fragment 2 2-290 289 Fragment 3 65-184 120 Fragment 4 65-290 226 Fragment 5 65-418 352 Fragment 6 192-290 99 Fragment 7 192-418 227 The amino acid numbering is derived from SEQ ID NO 3.
Figure 2 shows the results of the full length recombinant 44kD protein, 2 fragments of the 44kD protein (Fragment 4; residues 65-290 and fragment 6; residues 192-290) and a control recombinant protein R2 in the mouse abscess model as described in Example 1. Mice were given 2 doses of of r-protein 3 weeks apart as in Example 1. Both the full length and the fragment forms of the 44kD protein showed statistically significant protection (p<0.05) compared to the control recombinant protein Formalin killed whole P. gingivalis (FK-33277) gave complete protection from challenge.
WO 01/47961 PCT/AU00/01588 EXAMPLE 3 In addition to using fragments of the 44kDa adhesin, chimeric proteins may be constructed using one or more fragments of the 44kDa adhesin with other proteins or protein fragments from other P. gingivalis proteins. Sequence ID 2 and 4 give one such example of a chimeric recombinant protein derived from a fragment of the 44kDa adhesin (Fragment 6 residues 192-290) linked to another P. gingivalis protein fragment derived from PG33 (Genbank accession number AF175715) a 95 residue C terminal fragment (residues 286-380). In total this chimeric protein has a total of 194 residues.
This chimeric recombinant fusion protein of fragments from the 44kDa and PG33 proteins was produced by amplifying the PG33 C-terminal fragment by PCR as described in Example 1 using the following primers: Forward: 5 'GGCCCATGGTCGACAATAGTGCAAAGATTGAT 3' Reverse: 5'CTATCCGGCCGCTTCCGCTGCAGTCATTACTACAA 3' This PCR product was subcloned into the SalI and NotI sites of pET24b to generate pET24b::PG33C. The 44kDa fragment 6 PCR product (see example 2 for primers) was then subcloned into the EcoRI and SalI of the pET24b::PG33C plasmid to generate a fusion construct of 44kDa/PG33 ie pET24b::PG44f6-PG33C. When this plasmid was transformed into E. coli strain BL21(DE3) and expression studies performed as outlined in Examples 1 and 2, high levels of the chimeric 44kDa/PG33 recombinant protein were obtained which was soluble when tested as in Example 2.
EXAMPLE 4 Mouse antisera raised to the recombinant 44kDa or recombinant fragments of the 44kDa protein react with paraformaldehyde fixed whole P. gingivalis cells indicating that immuno-reactive epitopes are conserved in the recombinant proteins.
Mouse antisera were obtained by immunising BALB/c mice with the recombinant full length 44kDa protein or with a recombinant fragment of the 44kDa protein as described in Examples 1 and 2. P.gingivalis (strain was anaerobically grown to log phase in brain heart infusion broth (Oxoid) WO 01/47961 PCT/AU00/01588 21 supplemented with 5ug/ml hemin and lug/ml vitamin K and Cysteine. Cells were sedimented by centrifugation for 15min at 10,000rpm at 4 0 C and resuspended in phosphate-buffered saline (PBS) containing 1% (wt/vol) paraformaldehyde. Bacteria were placed at 4 0 C overnight, then washed and resuspended in PBS to an optical density of 0.25 at OD600 (1 x Killed bacteria were then mixed in 10pl aliquots with pooled mouse polyclonal sera at a dilution of 1:100 in 0.22um filtered FBS+0.01% Azide (PBS/FA) for 15 min at room temperature. The cells were washed with PBS/FA and were subsequently incubated 15min with 11 of FITC-labelled anti-mouse Immunoglobulin (Silenus) at a dilution of 1:100 in PBS/FA. The cells were then washed and resuspended in iml of PBS/FA.
The fluorescence intensity of stained P.gingivalis cells was quantified using a FACS Calibur-activated fluorescence cell sorter (Becton Dickinson) using the 488nm wavelength band generated from a 15mW argon ion laser.
Filtered PBS/FA was used as the sheath fluid. FITC emission signals were collected for each analysis which consisted of 20,000 gated events that were collected on the basis of size and granularity using CELLQuest software (Becton Dickinson).
The results are shown in Figure 3. The marked on each panel indicates the percentage of P. gingivalis cells staining positively ie. with a fluorescence intensity above the background levels seen with no antisera or with sera from normal mice. All of the recombinant proteins produced antisera that reacted with the majority of P. gingivalis cells although antisera to Fragment 4 showed a reduced reactivity compared to the other r-44kDa antisera.
WO 01/47961 PCT/AU00/01588 22 EXAMPLE Cloning and expression of the P. gingivalis Kgp39 (Kgp39) and Kgp39 fragment (Kgp39frag) adhesin domains in E. coli and testing of the recombinant proteins by ELISA Table 4. Oligonucleotide primers used for the amplification of the nucleotide sequences encoding Kgp39 Recombinant Primers Protein Kgp39 Forward 5'-GCAGCAGTCGACGCCAACGAAGCCAAGGTTG-3' Reverse 5'-GCAGCACTCGAGGCGCI'TGCCATIGGCC-3' Kgp39frag Forward 5'-GCAGCAGTCGACTTCTTGTTGGATGCCGATCAC-3' Reverse 5'-GCAGCACTCGAGGAATGATTCGGAAAGTGTTG-3' Kgp 39 and Kgp39 fragment adhesin domains were amplified using the primers listed in Table 4. The primers consist of a 6 nucleotide buffer followed by a restriction enzyme site (Sall orXhol) and sequence specific for Kgp39. PCR was performed using Taq DNA Polymerase (Promega) under the following conditions: 25 cycles of denaturation (94 0 C, 45 sec), annealing (52C, 30 sec), and extension (72°C, 60 sec). The PCR product was ligated into plasmid vector pGEMT-easy (Promega) and transformed into competent E. coli JM109 (Promega) as previously described. All procedures were identical for the preparation of both Kgp39 and Kgp39 fragment recombinants and are essentially as described above for recombinant Rgp44 fragments.
Recombinant plasmid pGEMT-easy-Kgp39 DNA was digested with SaI and XhoI and the purified insert DNA was ligated into purified plasmid expression vector pET28b (Novagen) that had been previously digested with SaII and XhoI. Ligation products were transformed into the non-expression host, E. coli JM109 and then transformed into the E. coli expression host, HMS174(DE3) as previously described. r-Kgp39 expression was induced by addition of IPTG and purified by nickel-affinity chromatography. The integrity of the insert of pET28b-Kgp39 was confirmed by DNA sequence analysis.
WO 01/47961 PCT/AU00/01588 23 Expression of recombinant E. coli Recombinant Kgp39 and Kgp39 fragment proteins were expressed by induction with IPTG using similar methodology as that described for rRgp44 fragments. Briefly, single colony transformants were used to inoculate 5 ml LB containing 50lg/ml kanamycin at 37 0 C on an orbital shaker overnight.
This culture was then used to inoculate 100ml of fresh medium and grown to mid-log growth phase (ODoo=0.6-1.0) before inducing with 0.5mM IPTG for 6 hours. Cells were then harvested by centrifugation at 6500 x g and stored at 0 C overnight for the extraction of inclusion bodies.
Isolation and solubilisation of inclusion bodies The bacterial pellet was thawed on ice and resuspended in 10 mis of buffer B (20mM Na 2
HPO
4 0.5M NaCI, 8M urea). The redissolved cell pellet was sonicated on ice for 3 x 30 second bursts at 30 second intervals using a Branson Sonifier® 250 Cell disruptor (Branson Ultrasonics Corporation, Danbury, CT) with the microtip on setting 3. Insoluble cellular debris was removed by centrifugation at 39000 x g for 30 minutes at 4 0 C and the supernatant collected. The insoluble cellular fraction was resuspended in of Buffer B. Sodium azide (0.001% v/v) was added to all samples prior to storage at 4°C. Samples were then analysed by SDS-PAGE Nickel-nitrilotriaectic acid (Ni-NTA) purification and refolding of solubilised inclusions Proteins were purified using Pharmacia Biotech HiTrap affinity columns (lml) (Amersham Pharmacia Biotech) connected to a Pharmacia Fast Protein Liquid Chromatography (FPLC) instrument. The column was coated with 5 column volumes of 0.1M NiSO 4 then equilibrated with 10 column volumes of Start Buffer (20mM NaHPO,, 0.5M NaC1, 20mM imidazole, 8M urea) at a flow rate of 1 ml/min. Samples were loaded onto the column at a flow rate of 0.5 ml/min, then washed with 10 volumes of Start Buffer at a rate of Iml/min. Protein was eluted over a linear gradient of 10 volumes of Elution Buffer (20mM Na 2
HPO
4 0.5M NaC1, 200mM imidazole, 8M urea) at a ii WO 01/47961 PCT/AU00/01588 24 flow rate of Iml/min. Elution fractions were collected and samples of each fraction were analysed on SDS-PAGE gels as previously described.
Renaturation of recombinant protein Removal of 8M urea from the recombinant protein samples was achieved using Spectrum-Por® Float-A-Lyzer (Alltech, Australia). The molarity of urea in the samples was taken from 8M initially to OM over a period of 4 days. rKgp39 proteins were refolded by step-wise dialysis from 8 M to 7 M to 6 M to 5 M to 4 M to 3 M to 2 M to 1M to 0.5 M to 0 M Urea contained in the following buffer: 20mM Na 2
HPO
4 0.5M NaC1.
Enzyme-linked immunosorbent assay (ELISA) ELISAs were performed to investigate the binding of RgpA-Kgp specific antisera to rKgp39 and rKgp39 fragment and the binding of rKgp39 and rKgp38 fragment to periodontal matrices and host proteins.
Wells of flat-bottomed polyvinyl microtitre plates (Microtitre, Dynatech Laboratories, VA, USA) were coated with 5[ig/ml of either rKgp39 or rKgp39 fragment in 0.1M PBS [0.01M Na 2 HPO,, 0.15M NaCl, 1.5mM KH1 2 PO, KC1, pH 7.4] overnight at room temperature The coating solution was removed and wells were blocked with 1% BSA in 0.1M PBST (PBS containing 0.1% Tween 20), for lhr at RT and plates washed 4 x with 0.1M PBST. Serial dilutions of rabbit antisera directed against the P. gingivalis W50 RgpA-Kgp proteinase-adhesin complex (Bhogal et al., 1997) was added to each well and incubated overnight at RT and then washed with 6 x PBST. Bound antibody was detected by incubation with horseradish peroxidase-conjugated goat immunoglobulin directed against mouse immunoglobulin (1:4000 dilution) (Sigma, NSW, Australia) in BSA in 0.1M PBS for 1.5 hr at RT. The plates were then washed (6x PBST) and substrate [0.9mM ABTS (2,2'-azino-bis(3-ethylbenz-thiazoline-6-) sulfonic acid], and 0.005% HIO, in ABTS buffer (0.1M Na 2 HPO,, 0.08 M citric acid monohydrate) (100pl/well) was added. The optical density at 415nm
(O.D
41 5 was measured by using a Bio-Rad microplate reader (model 450, Bio- Rad, NSW, Australia).
The results are shown in Figure 4.
WO 01/47961 PCT/AU00/01588 Binding of rKgp39 and rKgp39 fragment to periodontal matrices and host proteins.
ELISAs were also performed to investigate the binding characteristics of rKgp39 and rKgp39 fragment proteins to the host matrix proteins fibrinogen and collagen type V and to haemoglobin. Microtitre plates were coated with 10g/ml of either fibrinogen, collagen type V or haemoglobin in 0.1M PBS overnight at RT. The coating solution was removed and remaining uncoated plastic was blocked with 2% Skim milk in 0.1M PBST for lhr at RT. The blocking solution was removed and 5pg/ml of either rKgp39 or rKgp39 fragment protein in 0.1M PBS was added to wells and incubated for 2hr at RT. Wells were washed 4 x with 0.1M PBST, then serial dilutions of rabbit anti-RgpA-Kgp complex anti-sera in 1% Skim milk in 0.1M PBST was added to each well and incubated overnight at RT. Bound antibody was detected, after washing 6 x PBST, by incubation with horseradish peroxidaseconjugated goat immunoglobulin directed against rabbit immunoglobulin (1:4000 dilution) (Sigma, NSW, Australia) in Skim milk in 0.1M PBST for Ihr at RT. The plates were developed as described above.
The results are shown in Figures 5 and 6.
EXAMPLE 6 This example illustrates that nucleotide sequences encoding RgpA44 or Kgp39 or portions thereof, can be inserted into, and expressed by various vectors including phage vectors and plasmids. Successful expression of the protein and peptides requires that either the insert comprising the gene or gene fragment, or the vector itself, contain the necessary elements for transcription and translation which is compatible with, and recognized by the particular host system used for expression. DNA encoding the RgpA44 or Kgp39 or fragments thereof (eg. Example or related peptides or oligopeptides or chimeric peptides can be synthesized or isolated and sequenced using the methods and sequences as illustrated herein. A variety of host systems may be utilized to express the RgpA44 or Kgp39 or fragments thereof, related peptides or oligopeptides or chimeras, which include, but are not limited to bacteria transformed with a bacteriophage vector, plasmid vector, or cosmid DNA; yeast WO 01/47961 PCT/AU00/01588 26 containing yeast vectors; fungi containing fungal vectors; insect cell lines infected with virus baculovirus); and mammalian cell lines transfected with plasmid or viral expression vectors, or infected with recombinant virus vaccinia virus, adenovirus, adeno-associated virus, retrovirus, etc.).
Using methods known in the art of molecular biology, including methods described above, various promoters and enhancers can be incorporated into the vector or the DNA sequence encoding RgpA44 or Kgp39 amino acid sequences, related peptides or oligopeptide or chimeras, to increase the expression of the RgpA44 or Kgp39 amino acid sequences, provided that the increased expression of the amino acid sequences is compatible with (for example, non-toxic to) the particular host cell system used.
Thus and importantly, the DNA sequence can consist of the genes segment encoding the RgpA44 or Kgp39 or fragments thereof, or any other segment or combined segments of the domain which encode functional and specific epitopes of the protein. Further, the DNA can be fused to DNA encoding other antigens, such as other bacterial outer membrane proteins, or other bacterial, fungal, parasitic, or viral antigens to create a genetically fused (sharing a common peptide backbone) multivalent antigen for use as an improved vaccine composition.
The selection of the promoter will depend on the expression system used. Promoters vary in strength, i.e. ability to facilitate transcription.
Generally, for the purpose of expressing a cloned gene, it is desirable to use a strong promoter in order to obtain a high level of transcription of the gene and expression into gene product. For example, bacterial, phage, or plasmid promoters known in the art from which a high level of transcription have been observed in a host cell system comprising E. coli include the lac promoter, trp promoter, recA promoter, ribosomal RNA promoter, the Pg and P. promoters, ompF, bla, Ipp, and the like, may be used to provide transcription of the inserted DNA sequence encoding amino acid sequences.
Additionally, if protein, related peptides or oligopeptides or chimeras may be lethal or detrimental to the host cells, the host cell strain/line and expression vectors may be chosen such that the action of the promoter is inhibited until specifically induced. For example, in certain operons the addition of specific inducers is necessary for efficient transcription of the inserted DNA the lac operon is induced by the addition of lactose or isopropylthio-beta-D-galactoside). A variety of operons such as the trp operon, WO 01/47961 PCT/AU00/01588 27 are under different control mechanisms. The trp operon is induced when tryptophan is absent in the growth media. The pL promoter can be induced by an increase in temperature of host cells containing a temperature sensitive lambda repressor. In this way, greater than 95% of the promoter-directed transcription may be inhibited in uninduced cells. Thus, expression of recombinant RgpA44 protein, related peptides, or oligopeptides or chimeras may be controlled by culturing transformed or transfected cells under conditions such that the promoter controlling the expression from the inserted DNA encoding RgpA44 amino acid sequences is not induced, and when the cells reach a suitable density in the growth medium, the promoter can be induced for expression from the inserted DNA.
Other control elements for efficient gene transcription or message translation include enchancers, and regulatory signals. Enhancer sequences are DNA elements that appear to increase transcriptional efficiency in a manner relatively independent of their position and orientation with respect to a nearby gene. Thus, depending on the host cell expression vector system used, an enhancer may be placed either upstream or downstream from the inserted DNA sequences encoding RgpA44 or Kgp39 amino acid sequences to increase transcriptional efficiency. As illustrated previously in this example, other specific regulatory sequences have been identified which may effect the expression from the gene segment encoding RgpA44 or Kgp39 and related peptides or chimeras. These or other regulatory sites, such as transcription or translation initiation signals, can be used to regulate the expression of the gene encoding RgpA44 or Kgp39, or gene fragments thereof. Such regulatory elements may be inserted into DNA sequences encoding RgpA44 or Kgp39 amino acid sequences or nearby vector DNA sequences using recombinant DNA methods described herin for insertion of DNA sequences.
Accordingly, P. gingivalis nucleotide sequences containing regions encoding for RgpA44 or Kgp39, related peptides, or oligopeptides or chimeras can be ligated into an expression vector at a specific site in relation to the vector's promoter, control, and regulatory elements so that when the recombinant vector is introduced into the host cell the P. gingivalis-specific DNA sequences can be expressed in the host cell. For example, the RgpA44 or Kgp39 specific DNA sequence containing its own regulatory elements can be ligated into an expression vector in a relation or orientation to the vector promoter and control elements which will allow for expression of the RgpA44 WO 01/47961 PCT/AU00/01588 28 or Kgp39 or derivatives. The recombinant vector is then introduced into the appropriate host cells, and the host cells are selected, and screened for those cells containing the recombinant vector. Selection and screening may be accomplished by methods known in the art including detecting the expression of a marker gene drug resistance marker) present in the plasmid, immunoscreening for production of RgpA44 or Kgp39 specific epitopes using antisera generated to RgpA44 or Kgp39 specific epitopes, and probing the DNA of the hosts cells for RgpA44 or Kgp39 specific nucleotide sequence using one or more oligonucleotide sequences and methods described herein.
Genetic engineering techniques may also be used to characterize, modify and/or adapt the encoded RgpA44 or Kgp39 recombinant or protein.
For example, site-directed mutagenesis of RgpA44 or Kgp39 or fragments thereof to modify one or all Cys residues to Ser or Ala residues may be desirable to increase the stability and solubility of the recombinant protein to allow for easier purification and folding. Further, genetic engineering techniques can be used to generate DNA sequences encoding a portion of the amino acid sequence of RgpA44 or Kgp39 in particular, soluble, hydrophilic sequences corresponding to protective epitopes. Restriction enzyme selection may be done so as not to destroy the immunopotency of the resultant peptide or oligopeptide or chimera. Antigenic sites of a protein may vary in size but can consist of from about 7 to about 14 amino acids. Thus, RgpA44 or Kgp39 will contain many discrete antigenic sites; therefore, many partial gene sequences could encode antigenic epitopes of RgpA44 or Kgp39. These sequences can be constructed and used in an expression system to generate highly antigenic chimeric peptides or oligopeptides or proteins. Combinations of two or more peptides may result in increased immunogenicity. When using combinations of antigens these antigens may be related (ie from the same gene sequence or from a closely related gene from the same organism). The antigens may be generated from a related organism (ie another oral bacterium present in subgingival plaque), or from a more distantly-related organism. In particular the host organism for the vector containing the RgpA44 or Kgp39 related genes and constructs can be a commensal inhabitant of the oral cavity; for example an inhabitant of subgingival plaque, supragingival plaque or a bacterium associated with the oral mucosa. Examples of commensal intra-oral bacteria would be Streptococcus species and Actinomyces species, eg. Streptococcus salivarius, Streptococcus sanguis, Actinomyces naeslundii. These organisms can WO 01/47961 PCT/AU00/01588 29 be isolated from the periodontitis patient and then genetically engineered to express the RgpA44 or Kgp39 or components, peptides or chimeras. The DNA encoding the RgpA44 or Kgp39, peptides or chimeras could be linked with DNA encoding leader sequences of extracellular proteins of these commensal intra-oral bacteria. The DNA encoding the RgpA44 or Kgp39 or derivatives could also be linked with, or inserted into, the DNA encoding extracellular proteins to produce secreted fusion proteins. Examples of extracellular proteins that could be used to produce fusion proteins with the RgpA44 or Kgp39, components, peptides or chimeras could be the glucosyltranferases (GTF) or fructosyltransferases (FTF). The recombinant organism would be then re-introduced into the patients oral cavity and once colonised the oral mucosa or teeth would express the RgpA44 or Kgp39, component, peptide, chimera or fusion to stimulate the mucosal associated lymphoid tissue to produce neutralising antibodies.
The DNA fragment encoding an antigen may be fused to other DNA sequences to allow for improved expression and/or purification procedures (ie DNA sequences cloned into the vector pTrxFus, are expressed as fusions to the E. coli protein thioredoxin). This linkage imparts the characteristics of thioredoxin to the fusion protein which offers soluble expression of normally insoluble or difficult to express proteins. After purification, the native protein is released by removal of the entire thioredoxin by digestion with enterokinase.
Furthermore, the antigen may be used as a hapten by fusion to other sequences which may increase immunogenicity, if the expressed protein or peptide is not immunogenic.
Another plasmid expression system involves the pUC-derived pTrcHis expression vector from Invitrogen. This vector allows high-level expression of DNA sequences by the presence of the Trc promoter (containing the -35 region of the 'rp promoter together with the -10 region of the lac promoter) and an rrnB anti-terminator element The pTrcHis vectors also contain a copy of the lacPl gene which encodes the lac repressor protein. Therefore, expression of the recombinant protein/peptide is induced by addition of 1mM IPTG (de-repression) to E. coli grown to mid-log phase. The DNA fragment is inserted into the multiple cloning site which is positioned downstream and in frame with a sequence that encodes an N-terminal fusion peptide. The N-terminal fusion peptide encodes (from 5' to an ATG translation initiation codon, a series of 6 histidine residues that function as a metal-binding domain in the WO 01/47961 PCT/AUOO/01588 translated protein, a transcript stabilising the sequence from gene 10 of phage T7, and an enterokinase cleavage recognition sequence. Cell culture lysates of cells harbouring the recombinant plasmid are purified by high-affinity binding to Probond' resin (Invitrogen). Probond™ is a nickel-charged sepharose resin that is used to purify recombinant proteins containing a poly-histidine binding domain. Bound proteins ae eluted from the Probond"' resin with either low pH buffer or by competition with imidazole or histidine. The poly-histidine leader peptide may be subsequently removed by digestion of the recombinant expressed protein with Enterokinase. Enterokinase recognises the endopeptidase recognition sequence that is engineered between the poly-his affinity tag and the multiple cloning site in the vector to allow for cleavage of the poly-His tail away from the protein of interest. The purified, recombinant protein may then be used in the generation of antibodies, vaccines and the formulation of diagnostic assays as discussed.
EXAMPLE 7 Methods for using RgpA44 or Kgp39 specific nucleotide sequences in molecular diagnostic assays for the detection of P. gingivalis. The nucleic acid sequences of the present invention can be used in molecular diagnostic assays for detecting P. gingivalis genetic material. In particular, RgpA44 or Kgp39 sequence-specific oligonucleotides can be synthesized for use as primers and/or probes in amplifying, and detecting amplified, nucleic acids from P. gingivalis.
Recent advances in molecular biology have provided several means for enzymatically amplifying nucleic acid sequences. Currently the most commonly used method, PCR T (polymerase chain reaction Cetus Corporation) involved the use of Taq Polymerase, known sequences as primers, and heating cycles which separate the replicating deoxyribonucleic acid (DNA) strands and exponentially amplify a gene of interest Other amplification methods currently under development include LCR T (ligase chain reaction, BioTechnica International) which utilizes DNA ligase, and a probe consisting of two halves of a DNA segment that is complementary to the sequence of the DNA to be amplified; enzyme QB replicase (Gene-Trak Systems) and a ribonucleic acid (RNA) sequence template attached to a probe complementary to the DNA to be copied which is used to make a DNA template for exponential production of complementary RNA; and NASBA' (nucleic acid sequence-based
II
WO 01/47961 PCT/AU00/01588 31 amplification, Cangene Corporation) which can be performed on RNA or DNA as the nucleic acid sequence to be amplified.
Nucleic acid probes that are capable of hybridization with specific gene sequences have been used successfully to detect specific pathogens in biological specimens at levels of sensitivity approaching 103 10' organisms per specimen [1990, Gene Probes for Bacteria, eds. Macario and deMacario, Academic Press]. Coupled with a method that allows for amplification of specific target DNA sequences, species-specific nucleic acid probes can greatly increase the level of sensitivity in detecting organisms in a clinical specimen.
Use of these probes may allow direct detection without relying on prior culture and/or conventional biochemical identification techniques. This embodiment of the present invention is directed to primers which amplify species-specific sequences of the gene encoding RgpA44 or Kgp39 of P. gingivalis, and to probes which specifically hybridize with these amplified DNA fragments. By using the nucleic acid sequences of the present invention and according to the methods of the present invention, as few as one P. gingivalis organism maybe detected in the presence of 10 ug/ml extraneous DNA.
This embodiment is directed to species-specific oligonucleotides which can be used to amplify sequences of P. gingivalis DNA, if present, from DNA extracted from clinical specimens including subgingival plaque, sputum, blood, abscess and other fluids to subsequently determine if amplification has occurred. In one embodiment of the present invention, a pair of P. gingivalis-specific DNA oligonucleotide primers are used to hybridize to P. gingivalis genomic DNA that may be present in DNA extracted from a clinical specimen, and to amplify the specific segment of genomic DNA between the two flanking primers using enzymatic synthesis and temperature cycling. Each pair of primers are designed to hybridize only to the P. gingivalis nucleotide sequences of the present invention to which they have been synthesized to complement; one to each strand of the double-stranded DNA. Thus, the reaction is specific even in the presence of microgram quantities of heterologous DNA. For the purposes of this description, the primer derived from the sequence of the positive (gene) strand of DNA will be referred to as the "positive primer", and the primer derived from the sequence of the negative (complementary) strand will be referred to as the "negative primer".
Amplification of DNA may be accomplished by any one of the methods commercially available. For example, the polymerase chain reaction may be WO 01/47961 PCT/AU00/01588 32 used to amplify the DNA. Once the primers have hybridized to opposite strands of the target DNA, the temperature is raised to permit replication of the specific segment of DNA across the region between the two primers by a thermostable DNA polymerase. Then the reaction is thermocycled so that at each cycle the amount of DNA representing the sequences between the two primers is doubled, and specific amplification of the P. gingivalis DNA sequences, if present, results. Further identification of the amplified DNA fragment, as being derived from P. gingvalis DNA, may be accomplished by liquid hybridization. This test utilizes one or more labelled oligonucleotides as probes to specifically hybridize to the amplified segment of P. gingivalis DNA.
Detection of the presence of sequence-specific amplified DNA may be accomplished using any one of several methods known in the art such as a gel retardation assay with autoradiography. Thus, the nucleotide sequences of the present invention provide basis for the synthesis of oligonucleotides which have commercial applications in diagnostic kits for the detection of P. gingivalis.
In a related embodiment, the oligonucleotides used as primers may be labeled directly, or synthesized to incorporate label. Depending on the label used, the amplification products can then be detected, after binding onto an affinity matrix, using isotopic or colorimetric detection.
DNA may be extracted from clinical specimens which may contain P. gingivalis using methods known in the art. For example, cells contained in the specimen may be washed in TE buffer and pelleted by centrifugation. The cells then may be resuspended in 100 ul of amplification reaction buffer containing detergents and proteinase K. Using the polymerase chain reaction, the resultant sample may be composed of the cells in 10mM Tris pH 8.3, KC1, 1.5mM MgCl,, 0.01% gelatin, 0.45% NP40 T M 0.045% Tween 20
M
and ug/ml proteinase K. The sample is incubated in a 55 0 C water bath for 1 hour.
Following the incubation, the sample is incubated at 95°C for 10 minutes to heat-inactivate the proteinase K The sample may then be amplified in accordance with the protocol for the polymerase chain reaction as set forth below.
The P. gingivalis DNA may be amplified using any one of several protocols for amplifying nucleic acids by the polymerase chain reaction. In one mode of this embodiment, the gene encoding the RgpA44 or Kgp39 may be amplified from clinical isolates of P. gingvalis using the following conditions.
DNA to be amplified (1 mg ofgenomic DNA) is distributed to 0.5 ml microfuge WO 01/47961 PCT/AU00/01588 33 tubes and the volume adjusted to 50 ul by adding a reaction mixture comprising 0.2 mM dNTPs (dATP, dCTP dGTP, dTrP), 0.25 ug of each positive and negative oligonucleotide primer, 1 unit of TaqI polymerase, TaqI 10x buffer rmM MgCl 2 (final concentration), and sterile distilled water to achieve the total volume. The TaqI polymerase is added to the reaction mixture just before use and is gently mixed, not vortexed. A layer of mineral oil, approximatley 2 drops, is added to each tube and then the tubes are placed in the thermal cycler.
Thirty to thirty-five cycles are general sufficient for bacterial DNA amplification. One cycle consists of 1 minute at 95°C, 1 minute at 37C, and 1 minute at 72 0 C. The first cycle includes a 1/2 minute incubation at 95 0 C to assure complete denaturation.
Oligonucleotides useful as primers or probes which specifically hybridize to the gene encoding the RgpA44 or Kgp39 of P. gignvalis and used in DNA amplification and/or detection can be biochemically synthesized, using methods known in the art, from the nucleotide sequences in the Sequence ID listings herein. For detection purposes, the oligonucleotides of the present invention may be end-labeled with a radioisotope. Probe sequences, internal to the two primers used for amplification of the gene sequence, may be end-labeled using T4 polynucleotide kinase and gamma 3 P ATP. Twenty pMols of probe DNA in kinase buffer (50mM Tris, pH 7.6 10mM MgCl z dithiothreitol, 0.1mM spermidine-HC1, 0.1mM EDTA, pH 8.0) is mixed with 120 uCi of gamma 2 P ATP and incubated at 37°C for 1 hour. Labeled probe is separated from unincorporated label on an 8% acrylamide gel run for 1 hour at 200 volts in Tris Borate EDTA (TBE) buffer at room temperature. Labeled probe is first located by exposing the acrylamide gel to x-ray film for three minutes.
The resulting autoradiogram is then positioned under the gel, and the band containing the labeled probe was excised from the gel. The gel slice is pulverized in one milliliter of sterile distilled water, and the probe is eluted by shaker incubation overnight at 37C. The eluted probe is separated from the gel fragments by centrifugation using a chromatography prep column.
Radioactivity of the probe is determined, by counting one microliter of the labeled probe on a glass fibre filter, by liquid scintillation. Such probe sequences may be chosen from any of the sequences disclosed herein provided the probe sequence is internal to the two primers used for amplification of the desired nucleotide sequence disclosed in the present invention.
WO 01/47961 PCT/AU00/01588 34 Alternative methods known in the art may be used to improve the detection of amplified target sequences in accordance with the compositions and methods of the present invention. The sensitivity of detection of the amplified DNA sequences can be improved by subjecting the sequences to liquid hybridization. Alternative methods of detection known in the art, in addition to gel electrophoresis and gel electrophoresis with Southern hybridization and autoradiography, that may be used with the compositions and methods of the present invention include: testriction enzyme digestion with gel electrophoresis; slot-blot hybridization with a labelled oligonucleotide probe; amplification with a radiolabeled oligonucleotide probe; amplification with a radiolabeled primer with gel electrophoresis, Southern hybridization and autoradiography; amplification with a radiolabeled primer with dot blot and autoradiography; amplification with oligonucleotides containing affinity tags (ex. biotin, or one primer incorporating biotin and the other primer with a sequence specific for a DNA binding protein) followed by detection in an affinity-based assay (ex. ELISA); and amplification with oligonucleotides containing fluorophores followed by fluorescence detection.
One embodiment of non-isotopic detection involves incorporating biotin into the oligonucleotide primers of the present invention. The 5' -amino group of the primers may be biotinylated with sulfo-NHS-biotin, or biotin may be incorporated directly into the primer by synthesizing the primer in the presence of biotin-labeled dNTPs. The non-isotopic labeled primers are then used in amplifying DNA from a clinical specimen. The detection for the presence or absence of amplified target sequences may be accomplished by capturing the amplified target sequences using an affinity matrix having avidin bound thereto, followed by incubation with an avidin conjugate containing an enzyme which can be used to visualize the complex with subsequent substrate development Alternatively, the amplified target sequences may be immobilized by hybridization to the corresponding probes of the target sequence wherein the probes have been affixed onto a matrix. Detection may be accomplished using an avidin conjugate containing an enzyme which can be used to visualize the complex with subsequent substrate development EXAMPLE 8 Methods for using RgpA44 or Kgp39, peptides or chimeric peptides in diagnostic immunoassays.
WO 01/47961 PCT/AU00/01588 The RgpA44 or Kgp39 protein, related peptides, oligopeptides or chimeras can be purified for use as immunogens in vaccine formulations; and as antigens for diagnostic assays or for generating P. gingivalis-specific antisera of therapeutic and/or diagnostic value. The RgpA44 or Kgp39 from P. gingivalis or oligopeptides or peptides or chimeras thereof, or recombinant protein, recombinant peptides, or recombinant oligopeptides produced from an expression vector system, can be purified with methods known in the art including detergent extraction, chromatography ion exchange, affinity, immunoaffinity, or ultrafiltration and sizing columns), differential centrifugation, differential solubility, or other standard techniques for the purification of proteins.
As used throughout the specification, RgpA44 or Kgp39 oligopeptides are defined herein as a series of peptides corresponding to a portion of the amino acid sequence of the RgpA44 or Kgp39 respectively as disclosed in the enclosed sequences that are synthesized as one or chemically-linked. Such peptides or oligopeptides can be synthesized using one of the several methods of peptide synthesis known in the art including standard solid phase peptide synthesis using tertbutyloxycarbonyl amino acids [Mitchell et al., 1978, 1 Org Chem 43:2845-2852], using 9-fluorenylmethyloxycarbonyl amino acids on a polyamide support [Dryland et al., 1986, J Chem So Perkin Trans I, 125-137]; by pepscan synthesis [Geysen et al., 1987, JImmunol Methods 03:259; 1984, Proc.
Natl. Acad. Sci. USA 81:3998]; by standard liquid phase peptide synthesis; or by recombinant expression vector systems. Modification of the peptides or oligopeptides, such as by deletion and substitution of amino acids (and including extensions and additions to amino acids) and in other ways, may be made so as to not substantially detract from the immunological properties of the peptide or oligopeptide. In particular, the amino acid sequences of the RgpA44 or Kgp39, or peptide or oligopeptide or chimera thereof, may be altered by replacing one or more amino acids with functionally equivalent amino acids resulting in an alteration which is silent in terms of an observed difference in the physicochemical behaviour of the protein, peptide, or oligopeptide or chimera. Functionally equivalent amino acids are known in the art as amino acids which are related and/or have similar polarity or charge. Thus, an amino acid sequence which is substantially that of the amino acid sequences depicted in the Sequence Listing herein, refers to an amino acid sequence that contains WO 01/47961 PCT/AU00/01588 36 substitutions with functionally equivalent amino acids without changing the primary biological function of protein, peptide, or oligopeptide or chimera.
Purified RgpA44 or Kgp39 protein, peptides, oligopeptides and chimeras may be used as antigens in immunoassays for the detection of P. gingivalis-specific antisera present in the body fluid of an individual suspected of having an infection caused by P. gingivalis. The detection of RgpA44 or related peptides as an antigen in immunoassays, includes any immunoassay known in the art including, but not limited to, radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), "sandwich" assay, precipitin reaction, agglutination assay, fluorescent immunoassay, and chemiluminescence-based immunoassay.
EXAMPLE 9 Methods and compounds for vaccine formulations related to RgpA44 or Kgp39 and related peptides and chimeras.
This embodiment of the present invention is to provide recombinant RgpA44 or Kgp39 protein and/or peptides or oligopeptides or chimeras thereof, to be used in as immunogens in a prophylactic and/or therapeutic vaccine for active immunization to protect against or treat infections caused by P. gingivalis. For vaccine purposes, an antigen of P. gingivalis comprising a bacterial protein should be immunogenic, and induce functional antibodies directed to one or more surface-exposed epitopes on intact bacteria, wherein the epitope(s) are conserved amongst strains of P. gingivalis.
For vaccine development, RgpA44 or Kgp39 specific amino acid sequences may be purified from a host containing a recombinant vector which expresses RgpA44 or Kgp39 or related peptides or chimeras. Such hosts include, but are not limited to, bacterial transformants, yeast transformants, filamentous fungal transformants, and cultured cells that have been either infected or transfected with a vector which encodes RgpA44 or Kgp39 amino acid sequences. The recombinant protein, peptide, or oligopeptide or chimera immunogen is included as the relevant immunogenic material in the vaccine formulation, and in therapeutically effective amounts, to induce an immune response. Many methods are known for the introduction of a vaccine formulation into the human or animal to be vaccinated. These include, but are WO 01/47961 PCT/AU00/01588 37 not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, ocular, intranasal, and oral administration. The vaccine may further comprise a physiological carrier such as a solution, a polymer or liposomes; and an adjuvant, or a combination thereof.
Various adjuvants are used in conjunction with vaccine formulations.
The adjuvants aid by modulating the immune response and in attaining a more durable and higher level of immunity using smaller amounts of vaccine antigen or fewer doses than if the vaccine antigen were administered alone. Examples of adjuvants include incomplete Freund's adjuvant (IFA), Adjuvant (containing peanut oil, mannide monooleate and aluminum monostrearate), oil emulsions, Ribi adjuvant, the pluronic polyols, polyamines, Avridine, Quil A, saponin, MPL, QS-21, and mineral gels such as aluminium salts. Other examples include oil in water emulsions such as SAF-1, SAF-0, MF59, Seppic ISA720, and other particulate adjuvants such as ISCOMs T M and ISCOM matrix T M An extensive but not exhaustive list of other examples of adjuvants are listed in Cox and Coulter 1992 [In Wong WK Animals parasite control utilising technonolgy. Bocca Raton; CRC press, 1992; 49-112]. In addition to the adjuvant the vaccine may include conventional pharmaceutically acceptable carriers, excipients, fillers, buffers or diluents as appropriate. One or more doses of the vaccine containing adjuvant may be administered prophylactically to prevent periodontitis or therapeutically to treat already present periodontitis.
In another preferred composition the preparation is combined with a mucosal adjuvant and administered via the oral route. Examples of mucosal adjuvants are cholera toxin and heat labile E. coli toxin, the non-toxic B subunits of these toxins, genetic mutants of these toxins which have a reduced toxicity. Other methods which may be utilised to deliver RgpA44 orally include incorporation of the protein into particles of biodegradable polymers (such as acrylates or polyesters) by microencapsulation to aid uptake of the microspheres from the gastrointestinal tract and to protect degradation of the proteins. Liposomes, ISCOMs', hydrogels are examples of other potential methods which may be further enhanced by the incorporation of targetting molecules such as LTB, CTB or lectins for delivery of the RgpA44 protein or peptide to the mucosal immune system. In addition to the vaccine and the mucosal adjuvant or delivery system the vaccine may include conventional pharmaceutically acceptable carriers, excipients, fillers, WO 01/47961 PCT/AU00/01588 38 coatings, dispersion media, antibacterial and antifungal agents, buffers or diluents as appropriate.
Another embodiment of this mode of the invention involves the production of recombinant RgpA44 or Kgp39 specific amino acid sequences as a hapten, i.e. a molecule which cannot by itself elicit an immune response. In such case, the hapten may be covalently bound to a carrier or other immunogenic molecule which will confer immunogenicity to the coupled hapten when exposed to the immune system. Thus, such a RgpA44 or Kgp39 specific hapten linked to a carrier molecule may be the immunogen in a vaccine formulation.
Another mode of this embodiment provides for either a live recombinant viral vaccine, recombinant bacterial vaccine, recombinant attenuated bacterial vaccine, or an inactivated recombinant viral vaccine which is used to protect against infections caused by P. gingivalis. Vaccinia virus is the best known example, in the art, of an infectious virus that is engineered to express vaccine antigens derived from other organisms. The recombinant live vaccinia virus, which is attenuated or otherwise treated so that it does not cause disease by itself, is used to immunize the host. Subsequent replication of the recombinant virus within the host provides a continual stimulation of the immune system with the vaccine antigens such as recombinant RgpA44 or Kgp39 protein, related peptides or chimeras, thereby providing long lasting immunity.
Other live vaccine vectors include: adenovirus, cytomegalovirus, and preferably the poxviruses such as vaccinia [Paoletti and Panicali, U.S. Patent No. 4,603,112] and attenuated Salmonella strains [Stocker et al., U.S. Patent Nos. 5,210,035; 4,837,151; and 4,735,801; and Curtiss et al., 1988, Vaccine 6:155-160]. Live vaccines are particularly advantageous because they continually stimulate the immune system which can confer substantially long-lasting immunity. When the immune response is protective against subsequent P. gingivalis infection, the live vaccine itself may be used in a preventive vaccine against P. gingivalis. In particular, the live vaccine can be based on a bacterium that is a commensal inhabitant of the oral cavity. This bacterium can be transformed with a vector carrying a recombinant RgpA44 or Kgp39, peptides, oligopeptides or chimeric peptides and then used to colonise the oral cavity, in particular the oral mucosa. Once colonised the oral mucosa, the expression of the recombinant protein, peptide or chimera will stimulate the WO 01/47961 PCT/AU00/01588 39 mucosal associated lymphoid tissue to produce neutralising antibodies. To further illustrate this mode of the embodiment, using molecular biological techniques such as those illustrated in Example 8, the genes encoding the RgpA44 or Kgp39 or gene fragments encoding one or more peptides or chimeras may be inserted into the vaccinia virus genomic DNA at a site which allows for expression of epitopes but does not negatively affect the growth or replication of the vaccinia virus vector. The resultant recombinant virus can be used as the immunogen in a vaccine formulation. The same methods can be used to construct an inactivated recombinant viral vaccine formulation except that the recombinant virus is inactivated, such as by chemical means known in the art, prior to use as an immunogen and without substantially affecting the immunogenicity of the expressed immunogen. A mixture of inactivated viruses which express different epitopes may be used in the formulation of a multivalent inactivated vaccine. In either case, the inactivated recombinant vaccine or mixture of inactivated viruses may be formulated with a suitable adjuvant in order to enhance the immunological response to the vaccine antigens.
In another variation of this embodiment, genetic material is used directly as the vaccine formulation. Nucleic acid (DNA or RNA) containing sequences encoding the RgpA44 or Kgp39 protein, related peptides or oligopeptides or chimeras, operatively linked to one or more regulatory elements can be introduced directly to vaccinate the individual ("direct gene transfer") against pathogenic strains of P. gingivalis. Direct gene transfer into a vaccinated individual, resulting in expression of the genetic material by the vaccinated individual's cells such as vascular endothelial cells as well as the tissue of the major organs, has been demonstrated by techniques in the art such as by injecting intravenously an expression plasmid:cationic liposome complex [Zhu et al., 1993, Science 261:209-211]. Other effective methods for delivering vector DNA into a target cell are known in the art. In one example, purified recombinant plasmid DNA containing viral genes has been used to inoculate (whether parentally, mucosally, or via gene-gun immunization) vaccines to induce a protective immune response [Fynan et al. 1993, Proc NatlAcad Sci USA 90:11478-11482]. In another example, cells removed from an individual can be transfected or electroporated by standard procedures known in the art, resulting in the introduction of the recombinant vector DNA into the target cell.
Cells containing the recombinant vector DNA may then be selected for using WO 01/47961 PCT/AU00/01588 methods known in the art such as via a selection marker expressed in the vector, and the selected cells may then be re-introduced into the individual to express the RgpA44 or Kgp39 protein, related peptides or oligopeptides or chimeras.
One preferred method of vaccination with genetic material comprises the step of administering to the individual the nucleic acid molecule that comprises a nucleic acid sequence that encodes the RgpA44 or Kgp39 protein, related peptides, or oligopeptides or chimeras, wherein the nucleic acid molecule is operatively linked to one or more regulatory sequences necessary for expression. The nucleic acid molecule can be administered directly, or first introduced into a viral vector and administered via the vector. The nucleic acid molecule can be administered in a pharmaceutically acceptable carrier or diluent and may contain compounds that can enhance the effectiveness of the vaccine. These additional compounds include, but are not limited to, adjuvants that enhance the immune response, and compounds that are directed to modulate the immune response, e.g. cytokines, collectively referred to as "immune modulators"; or other compounds which increase the uptake of nucleic acid by the cells, referred to as "nucleic acid uptake enhancers". The immunization with the nucleic acid molecule can be through any parental route (intravenous, intraperitoneal, intradermal, subcutaneous, or intramuscular), or via contact with mucosal surfaces of the nasopharynx, trachea, or gastrointestinal tract As an alternative to active immunization, immunization may be passive, i.e. immunization comprising administration of purified immunoglobulin containing antibody against RgpA44 or Kgp39 epitopes.
WO 01/47961 WO 0147961PCT/AUOO/01588 41 EXAMPLE The following is a proposed example of a toothpaste formulation containing ariti-RgpA44 or anti-Kgp39 antibodies.
Ingredien %w/ Dicalciuxn phosphate dihydrate 50.0 Glycerol 20.0 Sodium carboxymethyl cellulose Sodium lauryl sulphate Sodium lauroyl sarconisate Flavoutr Sodium saccharin 0.1 Chiorhexidine gluconate 0.01 Dextr~anase 0.01 Goat serum containing anti- RgpA44 0.2 or anti-Kgp3g Water balance EXAMPLE 11 The following is another proposed example of a toothpaste formulation.
Ingredient %w/ Dicalcium phosphate dihydrate 50.0 Sorbitol 10.0 Glycerol 10.0 Sodium carboxyrnethyl cellulose Sodium lauryl sulphate, Sodium lauroyl sarconisate Flavour Sodium saccharin 0.1 Sodium monofluorophosphate, 0.3 Chiorhexidine gluconate 0.01 Dextranase 0.01 Bovine serum containing anti- 0.2 RgpA1788-1004) Water balance WO 01/47961 PCT/AU00/01588 42 EXAMPLE 12 The following is another proposed example of a toothpaste formulation.
Ingredient %w/w Dicalcium phosphate dihydrate 50.0 Sorbitol 10.0 Glycerol 10.0 Sodium carboxymethyl cellulose Lauroyl diethanolamide Sucrose monolaurate Flavour Sodium saccharin 0.1 Sodium monofluorophosphate 0.3 Chlorhexidine gluconate 0.01 Dextranase 0.01 Bovine milk Ig containing anti- 0.1 RgpA44 Water balance EXAMPLE 13 The following is another proposed example of a toothpaste formulation.
Ingredient %w/w Sorbitol 22.0 Irish moss Sodium Hydroxide Gantrez 19.0 Water (deionised) 2.69 Sodium Monofluorophosphate 0.76 Sodium saccharine 0.3 Pyrophosphate Hydrated alumina 48.0 Flavour oil 0.95 anti- RgpA44 mononoclonal 0.3 sodium lauryl sulphate 2.00 WO 01/47961 WO 01/796 1PCT/AUOO/01 588 43 EXAMPLE 14 The following is a proposed example of a liquid toothpaste formulation.
Ingredien w/ Sodium polyacrylate 50.0 Sorbitol 10.0 Glycerol 20.0 Flavour i.o Sodium saccharin 0.1 Sodium monofluorophosphate 0.3 Chiorhexidine gluconate 0.01 Ethanol Equine Ig containing 0.2 anti-RgpA(788-1004) Linolic acid 0.05 Water balance EXAMPLE The following is a proposed example of a mouthwash formulation.
Ingredient 0/ Ethanol 20.0 Flavour Sodium saccharin 0.1 Sodium monofluorophosphate 0.3 Chiorhexidine gluconate 0.01 Lauroyl diethanolaniide 0.3 Rabbit Ig containing anti-RgpA44 0.2 Water balance WO 01/47961 WO 0147961PCT/AUOO/01 588 44 EXAMPLE 16 The following is a proposed example of a mouthwash formulation.
Ingredient %wl Gantrez S-97 Glycerine 10.0 Flavour oil 0.4 Sodium monofluorophosphate 0.05 Chiorhexidine gluconate, 0.01 Lauroyl diethanolamide 0.2 Mouse anti- RgpA44 monoclonal 0.3 Water balance EXAMPLE 17 The following is a proposed example of a lozenge formulation.
Ingredient %wl Sugar 75-80 Corn syrup 1-20 Flavour oil 1-2 NaF 0.01-0.05 Mouse anti- RgpA44 monoclonal 0.3 Mg stearate Water balance WO 01/47961 PCT/AU00/01588 EXAMPLE 18 The following is a proposed example of a gingival massage cream formulation.
Ingredient %w/w White petrolatum Propylene glycol Stearyl alcohol Polyethylene Glycol 4000 25.0 Polyethylene Glycol 400 37.0 Sucrose monostearate Chlorohexidine gluconate 0.1 Mouse anti- RgpA44 monoclonal 0.3 Water balance EXAMPLE 19 The following is a proposed example of a chewing gum formulation.
Ingredient %w/w Gum base 30.0 Calcium carbonate Crystalline sorbitol 53.0 Glycerine Flavour oil 0.1 Rabbit anti- RgpA(788-1004) 0.3 monoclonal Water balance Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
EDITORIAL NOTE APPLICATION NUMBER 23314/01 The following Sequence Listing pages 1 to 7 are part of the description. The claims pages follow on pages 46 to 47.
WO 01/47961 SEQUENCE LISTING <110> CSL Limited The University of Melbourne <120> P. gingivalis antigenic composition <160> 8 <170> Patentln Ver. 2.1 <210> 1 <211> 1257 <212> DNA <213> Porphyromonas gingivalis PCT/AUOO/01588 <400> 1 agcggtcagg cagattcttt actctttggc ccggaaaatg gttaatatac atttggattg aaataccatt gaaggtggtg ggtctgacgg gtggaagtta ggatccaatg acgcttaagt ccgaatcccg aagacgatcg gctggctaca gttcttaccc ttgactttct gcatcttcga acggcaaaag cagaagacgg acggatatgt ccgagattgt tggatgcaga cgaactgtag cagatccttc cggccggaac ccggacaagg tccttatgaa gaagcgatta ctacgacatt agtacacagc aatttgctcc gggatgcacc gaacaactac atgcagacgg atagcaatgg ctgacaacta gggtatgcgc ccggtaacga gtgttcgctc t agacct tcc tctacatcga tcttgaagct ccatgatcaa tgtCccggcc ttgttcccct ttatgacttt accgacgaaa gaagatgggt cacctatact cgaagaagac cggcgtatet tgtacagaac taatggtacc actttccga tgacgggcat ttgtgtatat tctgataaca acaggatgct tgcatccaac gccggaagct cgcaggtacg ccttgatgag cacgatgttt tatggacagg aatctgttcg accaatatga gcaattgctg gaagatgatt agcggtgatg gtctatcgtg ggtgtagctg ccgaaggtat ctgaccgg-ta ccgaatccaa tcattcgaaa ggctggaagc tcagagtcat ccggcattgg aattatgcat ttcacgaatg attcgtggtc aaatatgttg gttgagatca ggaatgatgg atccggttat ttatacccag tgatacccat.
ctccgttcga atatacggtt taatggatgg tactgcatcc ctcctcaagc aaatgcaaag atgtatttga agccggtaaa gaactgaatt gactataagc acggcacgaa gatcaaggaa caggcaatca tgagtattgc gtaaagacgt tacggtagaa gtgcagtcgg ccagaaagta atccaaatcc gaatccaaat atggtattcc tgcctcatgg ctggaaatgc tcccggaatc tcggtcttgg tggtatagga atttgcctaa cggaggtaag ccgagcacta tgcggtgtat ctttgttgga agagacgatt gtatacaggg tacttggcgc ctttccgtca cttccaaagc aggccaatgg caagcgc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1257 <210> 2 <211> 588 <212> DNA <213> Porphyromonas gingivalis <400> 2 aaggtatgta accggtagtg aatccaaatc ttcgaaaatg tggaagcctg gacaatagtg gcgaagacca gcggcctata aagtatggtg aagacgttac cagtcggcca caaatccgaa gtattcctgc gaaatgctcc caaagattga acaacgcacc acatgaagct tttctgcgga ggtagaagga gaaagtaacg tccaaatccg ctcatggaag.
cggaatcgct tcgtaatcaa gatcaaggta ttcagagcgt tcgcattaca tccaatgaat cttaagtggg aatcccggaa acgatcgatg ggctacaata gaaatcaatg gtaggttacg cgtgcaaaag attgaatgga ttgctcctgt atgcacctaa caactacact cagacggtga gcaatggttg tttacaatac ctgacgaaaa cggtagccaa agggctcatc acagaacctg tggtaccccg ttccgaatca cgggcatggc tgtatatctc agctgaatat aaccggtact gatgcttgaa agagcaaatc
PCT/AUOO/
0 1 58 8 WO 01/47961 2 58 tatgaagaga acgcttggaa tcgtattgta gtaatgactg cagcggaa <210> 3 <211> 419 <212> PRT <213> Porphyromonas gingivalis <400> 3 Ser Gly Gin Ala Glu Ile Val Leu Glu Ala His Asp Val Trp Asi Asp 15 10 is Gly Ser Gly Tyr Gin Ile Leu Leu Asp Ala Asp His Asp Gin Tyr Gly 20 25 Gin Val Ile Pro Ser Asp Thr His Thr Leu Trp Pro Asn Cys Ser Vai 35 40 Pro Ala Asn Leu Phe Ala Pro Phe Glu Tyr Thr Val Pro Glu Asn Ala 50 55 Asp Pro Ser Cys Ser Pro ThE Asi Met Ile Met Asp Gly Thr Ala Ser 70 75 Val Asn lie Pro Ala Gly Thr Tyr Asp Phe Ala Ile Ala Ala Pro Gin 85 90 Ala Asn Ala Lys lie Trp Ile Ala Gly Gin Gly Pro Thr Lys Glu Asp 100 105 110 Asp Tyr Val Phe Glu Ala Gly Lys Lys Tyr His Phe Leu Met Lys Lys 115 120 125 Met Gly Ser Gly Asp Gly Thr Giu Leu Thr Ile SeE Glu Gly Gly Gly 130 135 140 SeE Asp Tyr Thr Tyr ThE Val Tyr Arg Asp Gly Thr Lys lie Lys Glu 145 150 155 160 Gly Leu Thr Ala Thr Thr Phe Giu Glu Asp Gly Val Ala Ala Gly Asf 165. 170 175 His Giu Tyr Cys Vai Glu Val Lys Tyr Thr Ala Gly Val Ser Pro Lys 180 185 190 Val Cys Lys Asp Val Thr Val Giu Gly Ser Asf Giu Phe Ala Pro Val 195 200 205 Gin Asn Leu Thr Gly SeE Ala Val Gly Gin Lys Val Thr Leu Lys Trp 210 215 220 Asp Ala Pro Asn Gly Thr Pro Asn Pro Asn Pro Asf Pro Asfi Pro Asfl 225 230 235 240 Pro Asn Pro Gly ThE Thr Thr Leu Ser G1u Ser Phe Glu Asn Gly Ile 245 250 255 PCT/AUOO/O 1588 WO 01/47961 3 pro Ala S Lys Pro Val Tyr.
290 Asp Asn~ 305 Leu Thr Tyr Ala Asn Ala Giu Ala 37 0 Asp Leu 385 Thr Asp Gly Lys er Tip Lys Thr 260 31y Asn Ala Pro 275 Ser Giu Ser Phe Tyr Leu Ile Thr 310 Phe Trp Val Cys 325 Val Tyr Ala set 340 Leu Leu Giu Glu 355 Ile Arg Gly Arg Pro Ala Gly Thi 39C Met Phe Tyr Il( 405 Arg Ile Asp Ala Asp 265 Giy Ile Ala Gly 280 Gly Leu Gly Gly 295 Pro Ala Leu Asp Ala Gin Asp Ala 330 Ser Thr Gly Asn 345 Thr Ile Thr Ala 360 Ile Gin Gly Thi 375 Lys Tyr Val Al Asp Leu Asp Gli 411 Giy Asp Gly I Tyr Asn Ser2 285 Ile Giy Val 300 Leu Pro Asn 315 Asn Tyr Ala Asp Ala Ser Lys Gly Val 365 Tip, Arg Gin 380 iPhe Arg His 395 i Val Giu Ile is kLsnf Leu Gly Ser As n 350 Aig Lys Phe Lys Gly T Gly Thr Gly Glu 335 Phe Ser Thr Gin Ala 415 rp
:YS
P ro Lys 320 His Thr Pro Val Ser 400 Asn <210> 4 <211> 196 <212> PRT <213> PorphyromolaS gingivalis <400> 4 Lys Val Cys Lys Asp Val Thr Val Glu 1 5 Val Gin Asn Leu Thr Gly Ser Ala Val Trp Asp Ala Pro Asn Gly Thr Pro Asn 40 Asn Pro Asn Pro Gly Thr Thr Thi Leu 55 Ile Pro Ala Ser Tip Lys Th Ile Asp 65 70 Trp Lys Pro Giy Asn Ala Pro Gly Ile Gly Ser Asn Glu 10 Gly Gin Lys Val Pro Asri Pro Asn Ser Giu Ser Phe Ala Asp Gly ASP 75 Ala Gly Tyr Asn Ala Pro Leu Lys Asn Pro Asn Gly His Gly Asfi Giy WO 01/47961 PCT/AUOO/01588 4 90 Cys Val Tyr Leu Asp ASri Ser Ala Lys Ile Asp Arg Asn Gin Giu Ile 100 105 110 Asn Vai Tyr Asn Thr Ala Giu Tyr Ala Lys Thr Asn Asn Ala Pro Ile 115 120 125 Lys Val Val Gly Tyr Ala Asp Glu Lys Thr Gly Thr Ala Ala Tyr Asn 130 135 140 Met Lys Leu Ser Giu Arg Arg Ala Lys Ala Val Ala Lys Met Leu Giu 145 150 155 160 Lys Tyr Giy Val Ser Ala Asp Arg Ile Thr Ile Glu Trp Lys Gly Ser 165 170 175 Ser Glu Gin Ile Tyr Giu Glu Asn Ala Trp Asn Arg Ile Val Vai Met 180 185 190 Thr Ala Ala Giu 195 <210> <211> 419 <212> PRT <213> Porphyrornonas gingivalis <400> Ala Asn Glu Ala Lys Val Val Leu Ala Ala Asp Asn Val Trp, Gly Asp 1 5 10 Asn Thr Gly Tyr Gin Phe Leu Leu Asp Ala Asp His Asn Thr Phe Gly 25 Ser Val Ile Pro Ala Thz Gly Pro Leu Phe Thr Gly Thr Ala Ser Ser 40 Asn Leu Tyr Ser Ala Asn Phe Giu Tyr Leu Ile Pro Ala Asn Ala Asp 55 Pro Val Val Thr Thr Gin Asn Ile Ile Val Thr Gly Gin Gly Giu Val 65 70 75 Val Ile Pro Gly Gly Val Tyr Asp Tyr Cys Ile Thr Asn Pro Giu Pro 90 Ala Ser Gly Lys Met Trp Ile Ala Giy Asp Gly Gly Asn Gin Pro Ala 100 105 110 Arg Tyr Asp Asp Phe Thr Phe Giu Ala Gly Lys Lys Tyr Thr Phe Thr 115 120 125 Met Arg Arg Ala Gly Met Gly Asp Gly Thr Asp Met Glu Val Giu Asp 130 135 140 PCT/AUOO/01588 WO 01/47961 Asp 145 Ile Ala Pro Ala Glu Gly Asn His Tyr Thr Thr Thr Val Glu Arg Asp Glu Asp Tyr Thr Gly Thr Gly Val 175 Ala Gly 190 180 Ser Pro Lys Val 195 Ala Pro Val Gin 210 Leu Lys Trp Asp 225 Asn Pro Asn Pro Pro Ala Ser Trp 260 Lys Pro Gly Asn 275 Val Tyr Ser Glu 290 Asp Asn Tyr Let 305 Leu Thr Phe Trp Tyr Ala Val Tyi 34( Asn Ala Leu Le 355 Lys Ala Ile Ar 370 Cys Lys Asp Val Thr Val Giu Gly Sex Asn Glu Phe
L
1 3 Asn Ala G1y 245 Lys Ala Ser Ile Val 325 Ala Leu Pro 230 Thr Thr Pro Phe Thr 310 Cys Ser Thr 215 Asn Thr Ile Gly Gly 295 Pro Ala Ser 200 Gly Gly Leu Asp Ile 280 Leu Ala Gin Thr Ser rhr Ser Ala 265 Ala Gly Leu Asp Gly 345 Ser Pro Glu 250 Asp Gly Gly Asp Ala 330 Asn Asn 235 Ser Gly Tyr Ile Leu 315 Asn Asp Gly 220 Pro Phe Asp Asn Gly 300 Pro Tyr Ala 205 Gin Asn Glu Gly Ser 285 Val Asn Ala Ser Lys Pro Asn His 270 Asn Leu Gly Ser Asn 350 Val Asn Gly 255 Gly Gly Thr Gly Glu 335 Phe rhr Pro 240 Ile Trp Cys Pro Lys 320 His Thr Glu Giu Thr Ile Thr Ala Lys Gly Val 360 365 Gly Arg Ile Gin Gly Thr Trp Arg Gin 375 380 Gly Thr Lys Tyr Val Ala Phe Arg His 390 395 Arg Ser Pro Asp 385 Leu Pro Ala Thr Val Gin Ser 400 Ala Asn 415 Thr Gly Asp Met Phe Tyr 405 Lys Arg Ile Asp Leu Asp Glu Vai 410 Glu Ile Lys WO 01/47961PCAU/O18 PCT/AUOO/01588 <210> 6 <211> 231 <212> PRT <213> Porphyromonas gingivalis <400> 6 Phe Leu Leu Asp Ala Asp His Asn Thr Phe Gly Ser Val Ile Pro Ala 1 Thr Gly Asn Phe Gin Asn Val Tyr 65 Trp Ile Thr Phe Met Gly Tyr Thr 130 Thr Ala 145 Tyr Cys Lys Asp Leu Thr Pro Asn 210 Pro Gi u Ile Asp Ala Glu Asp 115 Tyr Thr Val Val Gly 195 Gly 5 Phe Leu Val Cys Asp Gly Thr Val Phe Val 165 Val Ser Pro Gly Pro Gly 55 Thr Gly Lys Met Arg 135 Giu Tyr Gly Gly Pro 215 Ala Asn Gly Pro Gin Thr 105 Val cGiy Gly Ala Asn 185 Lys Pro Ser Asn Asp Pro Val Vai Pro Ala 75 Ala Arg Thr Met Asp Asp Lys Ile 140 Ala Ala 155 Val Ser Phe Ala Thr Leu Pro Asn 220 Leu Tyr Val Val Ile Pro Sexr Gly Tyr Asp Arg Arg 110 Ser Pro 125 Lys Giu Gly Asn Pro Lys Pro Val 190 Lys Trp 205 Pro Asn Ser Ala Thr Thr Gly Gly Lys Met Asp Phe Ala Giy Ala Ser Gly Leu His Giu 160 Val Cys 175 Gin Asn Asp Ala Pro Gly Thr Thr Leu Ser Giu Ser Phe 225 230 <210> 7 <211> 1257 <212> DNA <213> :Porphyzrmonas gingivalis PCT/AU00101588 WO 01/47961 <400> 7 gccaacgaag cagttcttgt ctctttaccg gccaatgccg gtaatccccg atgtggatcg gcaggcaaga gaagtcgaag atcaaggaag gagtattgcg acggtagaag cagaaagtaa aatccgaatc aagacgatcg gctggctaca gttctta ccc ttgactttct gcatcttcga acggcaaaag cagaagacgg acggatatgt ccaaggttgt tggatgccga gaacagcttc atcctgttgt gtggtgttta caggagatgg agtacacctt acgattcacc gtctgacagc tggaagttaa gatccaatga cgcttaagtg cgggaacaac atgcagacgg atagcaatgg ctgacaacta gggtatgcgc ccggtaacga gtgttcgctc tagaccttc tctacatcga gcttgcggca tcacaataca ttccaatctt tactacacag cgactattgc aggcaaccag cacgatgcgt tgcaagctat tacgacattc gtacacagcc atttgctcct ggatgcacct actttccgaa tgacgggcat ttgtgtatat tctgataaca acaggatgct tgcatccaac gccgaaagct cgcaggtacg ccttgatgag gacaacgtat ttcggaagtg tacagtgcga aatattatcg attacgaacc cctgcacgtt cgcgccggaa acctaCacgg gaagaagacg ggcgta tctc gtaca gaac c aatggtacc t Cat tcgaaa ggctggaaac tcagagtcat ccggcattgg aattatgcat ttcacgaatg attcgtggtc aaatatgttg gttgagatca ggggagacaa tcattccggc acttcgagta ttacaggaca cggaacctgc atgacgattt tgggagatgg tgtatcgtga gtgtagctgc cgaaggtatg tgaccggtag cgaatccgaa atggtattcc ctggaaatgC tcggtcttgg atttgcctaa ccgagcacta ctttgttgga gtatacaggg ctttccgtoa aggccaatgg tacgggttac aaccggtcct 120 tttgatcccg 180 gggtgaagtt 240 atccggaaag 300 cacattcgaa 360 aactgatatg 420 cggcacgaag 480 aggcaatcat 540 taaagacgtt 600 ttcagtaggt 660 tccaaatccg 720 ggcatcttgg 780 tcccggaatc 840 tggtatagga 900 cggaggtaag 960 tgcggtgtat 1020 agagacgatt 1080 tacttggcgc 1140 cttccaaagc 1200 caagcgc 1257 <210> 8 <211> 693 <212> DNA <2 13> Porphyromonas girigivalis <400> 8 ttcttgttgg tttaccggaa aatgccgatC atccczggtg tggatcgcag ggcaagaagt gtcgaagaCg aaggaaggtc tattgcgtgg gtagaaggat aaagtaacgC ccgaatccgg atgccgatca cagct tctt c otgttgttac gtgtttacga gagatqgagg acaccttcac attCacctgC tgacagctac aagttaagta ccaatgaatt ttaagtggga gaacaacact caatacattc caatctttac tacacagaat ctattgcatt caaccagcct gatgcgtcgc aagctatacC gacattcgaa caCagccggC tgctcctgta tgcacctaat tt ccgaat Ca ggaagtgtca agtgcgaact attatcgtta acgaacccgg gcacgttatg gccggaatgg tacacggtgt gaagacggtg gtatctccga cagaacctga ggtaCCCCga ttc ttccggcaac tcgagtattt caggacaggg aacctgcatc acgatttcac gagatggaac atcgtgacgg tagctgcagg aggtatgtaa ccggtagttc atccgaatcc cggtcctctc gatcccggcc tgaagttgta cggaaagatg attcgaagca tgatatggaa cacgaagatc caatcatgag agacgttacg agtaggtcag aaatccgaat 220 180 240 300 360 420 480 540 600 660 693
Claims (4)
1. An antigenic composition, the composition comprising at least one recombinant protein having a molecular weight of less than or equal to 44 kDa as estimated by SDS-PAGE, wherein the recombinant protein comprises at least one epitope, the epitope being reactive with an antibody wherein the antibody is reactive with a polypeptide having the sequence set out in SEQ. ID. NO. 3 or SEQ. ID. NO.
2. An antigenic composition as claimed in claim 1 in which the recombinant protein has a sequence selected from the group consisting of SEQ. ID. NO. 3, residues 1-184 of SEQ. ID. NO. 3, residues 1-290 of SEQ. ID. NO. 3, residues 65-184 of SEQ. ID. NO. 3, residues 65-290 of SEQ. ID. NO. 3, residues
65-419 of SEQ. ID. NO. 3, residues 192-290 of SEQ. ID. NO. 3, residues 192-419 of SEQ. ID. NO. 3, residues 147-419 of SEQ. ID. NO. 3, SEQ. ID. NO. 5 and SEQ. ID. NO. 6. 3. An antigenic composition as claimed in claim 1 in which the recombinant protein is soluble in non-denaturing solvents. 4. An antigenic composition as claimed in claim 1 in which the recombinant protein has a sequence selected from the group consisting of residues 65-184 of SEQ ID NO: 3, residues 65-290 of SEQ ID NO: 3 and residues
192-290 of SEQ ID NO: 3. An antigenic composition as claimed in any one of claims 1 to 4 in which the antigenic composition further comprises an adjuvant. 6. An antigenic composition as claimed in claim 1 in which the recombinant protein is a chimeric or a fusion protein. 7. An antigenic composition as claimed in claim 6 in which the chimeric or fusion protein comprises a sequence selected from the group consisting of SEQ. ID. NO. 3, residues 1-184 of SEQ. ID. NO. 3, residues 1-290 of SEQ. ID. NO. 3, residues 65-184 of SEQ. ID. NO. 3, residues 65-290 of SEQ. ID. NO. 3, residues 65-419 of SEQ. ID. NO. 3, residues 192-290 of SEQ. ID. NO. 3, residues 192-419 of SEQ. ID. NO. 3, residues 147-419 of SEQ. ID. NO. 3, SEQ. ID. NO. and SEQ. ID. NO. 6. 8. An antigenic composition as claimed in claim 6 in which the chimeric or fusion protein is soluble in non-denaturing solvents. 9. An antigenic composition as claimed in claim 8 in which the chimeric or fusion protein comprises a sequence selected from the group consisting of Received 15 November 2001 47 residues 65-184 of SEQ ID NO: 3, residues 65-290 of SEQ ID NO: 3 and residues 192-290 of SEQ ID NO: 3. An antigenic composition as claimed in claim 6 in which the chimeric or fusion protein has the sequence set out in SEQ. ID. NO. 4. 11. An antibody composition, the composition comprising at least one antibody, the antibody being raised against the antigenic composition as claimed any one of claims 1 to 12. An antibody composition as claimed in claim 11 in which the antibody binds a polypeptide, the polypeptide having a sequence selected from the group consisting of SEQ. ID. NO. 3, residues 1-184 of SEQ. ID. NO. 3, residues 1-290 of SEQ. ID. NO. 3, residues 65-184 of SEQ. ID. NO. 3, residues 65-290 of SEQ. ID. NO. 3, residues 65-419 of SEQ. ID. NO. 3, residues 192-290 of SEQ. ID. NO. 3, residues 192-419 of SEQ. ID. NO. 3, residues 147-419 of SEQ. ID. NO. 3, SEQ. ID. NO. 5 and SEQ. ID. NO. 6. 13. A recombinant prokaryotic or eukaryotic cell, the recombinant cell comprising an introduced DNA sequence selected from the group consisting of SEQ. ID. NO. 1, nucleotides 1-1257 of SEQ. ID. NO. 1, nucleotides 1-552 of SEQ. ID. NO. 1, nucleotides 1-870 of SEQ. ID. NO. 1, nucleotides 193-552 of SEQ. ID. NO. 1, nucleotides 193-870 of SEQ. ID. NO. 1, nucleotides 193-1257 of SEQ. ID. NO. 1, nucleotides 574-870 of SEQ. ID. NO. 1, nucleotides 574-1257 of SEQ. ID. NO. 1, nucleotides 439-1257 of SEQ. ID. NO. 1, SEQ. ID NO. 7, SEQ. ID. NO. 8 and sequences which hybridise thereto under stringent conditions operatively linked to at least one regulatory element, such that said recombinant cell is capable of expressing a recombinant protein having a molecular weight of less than or equal to 44 kDa as estimated by SDS-PAGE, wherein the recombinant protein comprises at least one epitope, the epitope being reactive with an antibody wherein the antibody is reactive.with a polypeptide having the sequence set out in SEQ ID NO: 3 or SEQ ID NO: 14. A method of preventing or reducing the incidence or severity of P. gingivalis infection in a subject, the method comprising administering to the subject the antigenic composition as claimed in any one of claims 1 to A method of preventing or reducing the incidence or severity of P. gingivalis infection in a subject, the method comprising administering to the subject the antibody composition as claimed in claim 11 or claim 12.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU23314/01A AU775228B2 (en) | 1999-12-24 | 2000-12-21 | P. gingivalis antigenic composition |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AUPQ4859 | 1999-12-24 | ||
AUPQ4859A AUPQ485999A0 (en) | 1999-12-24 | 1999-12-24 | P. gingivalis antigenic composition |
PCT/AU2000/001588 WO2001047961A1 (en) | 1999-12-24 | 2000-12-21 | P. gingivalis antigenic composition |
AU23314/01A AU775228B2 (en) | 1999-12-24 | 2000-12-21 | P. gingivalis antigenic composition |
Publications (2)
Publication Number | Publication Date |
---|---|
AU2331401A AU2331401A (en) | 2001-07-09 |
AU775228B2 true AU775228B2 (en) | 2004-07-22 |
Family
ID=25618906
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU23314/01A Ceased AU775228B2 (en) | 1999-12-24 | 2000-12-21 | P. gingivalis antigenic composition |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU775228B2 (en) |
-
2000
- 2000-12-21 AU AU23314/01A patent/AU775228B2/en not_active Ceased
Non-Patent Citations (3)
Title |
---|
INFECTION AND IMMUNITY, VOL.63, NO.12, PP.4744-54 * |
JOURNAL OF BACTERIOLOGY, VOL.178, NO.10, PP.2743-2741 * |
THE J. OF BIOL. CHEM., VOL.274, NO.8, PP.5012-20 * |
Also Published As
Publication number | Publication date |
---|---|
AU2331401A (en) | 2001-07-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8282933B2 (en) | P. gingivalis antigenic composition | |
US20110213129A1 (en) | Diagnostics and treatments of periodontal disease | |
EP0954529B1 (en) | Porphyromonas gingivalis antigens for the diagnosis and treatment of periodontitis | |
CA2407603C (en) | Porphyromonas gingivalis recombinant proteins and truncations | |
AU775228B2 (en) | P. gingivalis antigenic composition | |
AU713844B2 (en) | Porphyromonas gingivalis antigens for the diagnosis and treatment of periodontitis | |
AU2001252042B2 (en) | Porphyromonas gingivalis recombinant proteins and truncations | |
CA2235224C (en) | Diagnostics and treatments of periodontal disease |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
DA3 | Amendments made section 104 |
Free format text: THE NATURE OF THE AMENDMENT IS: AMEND APPLICANTS TO INCLUDE THE UNIVERSITY OF MELBOURNE |