AU768422B2 - G-protein fusion receptors and chimeric GABAb receptors - Google Patents

Description

1 G-PROTEIN FUSION RECEPTORS AND CHIMERIC GABAB

RECEPTORS

Field of the Invention The present invention relates to a G-protein fusion receptors, chimeric GABA, (y-aminobutyric acid) receptors nucleic acid encoding such receptors, and uses of such receptors and nucleic acid encoding such receptors.

BACKGROUND

The references cited herein are not admitted to be prior art to the claimed invention.

Chimeric receptors made up of peptide segments from different receptors have different uses such as being used to assess the functions of different sequence regions and to assess the activity of different compounds at a particular receptor.

Examples of using chimeric receptors to assess the activity of different compounds are provided by Dull et al., U.S. Patent No.

4,859,609, Dull et al., U.S. Patent No. 5,030,576, and Fuller et al., International Application No. PCT/US96/12336, International Publication No. WO 97/05252.

Dull et al. U.S. Patent No. 4,859,609, and Dull et al. U.S.

00000: S 20 Patent No. 5,030,576, indicate the production and use of chimeric feeo o receptors comprising a ligand binding domain of a predetermined 00 receptor and a heterologous reporter polypeptide. The Dull et al. patents provide as examples of chimerics: a chimeric receptor made up of the insulin receptor extracellular a chain, and the EGF receptor transmembrane and cytoplasmic domains without any HIR B-chain sequence; and a hybrid receptor made safe 0 *050 06 [R:\LIBFF66383spec.doc:gcc up of the v-erB oncogene product intracellular domain fused to the EGF receptor extracellular and transmembrane domains.

Fuller et al. International Publication No. WO 97/05252 feature chimeric receptors made up of metabotropic glutamate receptor (mGluR) domains and calcium receptor (CaR) domains. The chimeric receptors allow the coupling of functional aspects of a mGluR with a CaR.

An example of the use of chimeric receptors to assess the functions of different sequence regions receptors are found in studies identifying regions of different guanine nucleotide-binding protein coupled receptors important for guanine nucleotide-binding o0 protein coupling. (See, Kobilka et al., Science 240:1310-1316, 1988; Wess et al., FEBS Lett. 258:133-136, 1989; Cotecchia et al., Proc. Natl. Acad. Sci. USA 87:2896-2900, 1990; Lechleiter et al., EMBO J. 9:4381-4390, 1990; Wess et al., Mol. Pharmacol.

38:517-523, 1990; and Pin et al., EMBO J. 13:342-348, 1994.) Summary of the Invention According to a first embodiment of the invention, there is provided a G-protein fusion receptor comprising a) an extracellular domain comprising an extracellular domain amino acid sequence substantially similar to either an extracellular CaR amino acid sequence, an extracellular mGluR amino acid sequence, or an extracellular GABAB receptor amino acid sequence; b) a transmembrane domain joined to the carboxy terminus of said extracellular domain, said transmembrane domain comprising a transmembrane domain amino acid sequence substantially similar to either a transmembrane CaR amino acid sequence, a transmembrane mGluR amino acid sequence, or a transmembrane GABAB receptor amino acid sequence; c) an intracellular domain joined to the carboxy terminus of said transmcmbrane domain comprising all or a portion of an intracellular amino acid sequence substantially similar to either an intracellular CaR amino acid sequence, an intracellular mGluR amino *acid sequence, or an intracellular GABAB receptor amino acid sequence, provided that S 30 said portion is at least 10 amino acids; [R:\LIBFF]66383spec.doc:gcc S 27. OCT. 2003 18:52 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 6/18 2a d) an optionally present linker joined to the carboxy terminus of said intracellular domain; and e) a G-protein joined either to said intracellular domain or to said optionally present linker, provided that said G-protein is joined to said optionally present linker s when said optionally present linker is present, wherein said intracellular domain when present in a wild type receptor does not interact with said G-protein.

According to a second embodiment of the invention, there is provided a G-protein fusion receptor comprising to a) an extracellular domain comprising an extracellular domain amino acid sequence at least 90% identical to an extracellular mGluR amino acid sequence; b) a transmembrane domain joined to the carboxy terminus of said extracellular domain, said transmembrane domain comprising a transmembrane domain amino acid sequence at least 90% identical to a transmembrane mGluR amino acid sequence, or a is transmembrane CaR amino acid sequence; c) an intracellular domain joined to the carboxy terminus of said transmembrane domain comprising all or a portion of an intracellular amino acid sequence at least identical to an intracellular CaR amino acid sequence, provided that said portion is at least amino acids; d) an optionally present linker joined to the carboxy terminus of said intracellular domain; and Se) a G-protein joined either to said intracellular domain or to said optionally present linker, provided that said G-protein is joined to said optionally present linker when said optionally present linker is present.

According to a third embodiment of the invention, there is provided a G-protein fusion receptor comprising a) an extracellular domain comprising an extracellular domain amino acid sequence at least 90% identical to an extracellular GABAa receptor amino acid sequence; b) a transmembrane domain joined to the carboxy terminus of said extracellular domain, said transmembrane domain comprising a transmembrane domain amino acid sequence at least 90% identical to either a transmembrane CaR amino acid sequence, or a transmembrane GABA 5 receptor amino acid sequence; [I:\DayLibLIBFF86552spec.doc:gcc COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 S 27. OCT. 2003 18:52 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 7/18 2b c) an intracellular domain joined to the carboxy terminus of said transmembrane domain comprising all or a portion of an intracellular amino acid sequence at least identical to an intracellular CaR amino acid sequence, provided that said portion is at least amino acids; d) an optionally present linker joined to the carboxy terminus of said intracellular domain; and e) a G-protein joined either to said intracellular domain or to said optionally present linker, provided that said G-protein is joined to said optionally present linker when said optionally present linker is present.

According to a fourth embodiment of the invention, there is provided a nucleic acid comprising a nucleotide sequence encoding for the G-protein fusion in accordance with the first to third embodiments of the present invention.

According to a fifth embodiment of the invention, there is provided an expression vector comprising a nucleotide sequence encoding for the G-protein fusion in accordance is with the first to third embodiments of the present invention, transcriptionally coupled to a promoter.

According to a sixth embodiment of the invention, there is provided a recombinant cell comprising the expression vector in accordance with the fifth embodiment of the present invention, and a cell wherein the G-protein fusion receptor is expressed and is functional.

According to a seventh embodiment of the invention, there is provided a process for "the production of a G-protein fusion receptor comprising: growing procaryotic or eukaryotic host cells comprising a nucleic acid sequence expressing the G-protein fusion receptor in accordance with the first to third embodiments 25 of the present invention, under suitable nutrient conditions allowing for cell growth.

According to an eighth embodiment of the invention, there is provided a method of measuring the ability of a compound to effect G-protein fusion activity comprising the steps of: a) providing said compound to a cell expressing the G-protein fusion receptor in 0 accordance with the first to third embodiments of the present invention, and b) measuring the ability of said compound to affect the activity of said receptor as an indication of the ability of said compound to effect G-protein fusion receptor activity.

S, According to a ninth embodiment of the invention, there is provided a chimeric 35 receptor comprising: [I:\DayLb\.IBFF]B6552pec.doc:gcc COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 S 27. OCT. 2003 18:53 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 8/18 2c an extracellular domain comprising an extracellular domain amino acid sequence substantially similar to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO;2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID a transmembrane domain comprising a transmembrane domain amino acid sequence substantially similar to a sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and an intracellular cytoplasmic domain comprising an intracellular domain amino acid sequence substantially similar to a sequence selected from the group consisting of SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID wherein at least one domain is present which comprises an amino acid sequence substantially similar to a sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14; and at least one domain is present which comprises an amino acid sequence substantially similar to a sequence selected from the group consisting of: SEQ ID NO:l, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID According to a tenth embodiment of the invention, there is provided a nucleic acid comprising a nucleotide sequence encoding for the chimeric receptor in accordance with the ninth embodiment of the present invention.

According to an eleventh embodiment of the invention, there is provided an expression vector comprising a nucleotide sequence encoding for the chimeric receptor in accordance with the ninth embodiment of the present invention, transcriptionally coupled to a promoter.

According to a twelfth embodiment of the invention, there is provided a 225 recombinant cell comprising the expression vector in accordance with the eleventh embodiment of the present invention, and a cell wherein the chimeric receptor is expressed and is functional.

According to a thirteenth embodiment of the invention, there is provided a recombinant cell produced by combining a vector comprising the nucleic acid in accordance with the tenth embodiment of the present invention, and elements for introducing heterologous nucleic acid into a cell wherein the chimeric receptor is expressed, and said cell.

According to a fourteenth embodiment of the invention, there is provided a process for the production of a chimeric receptor comprising: S\DaLibFF862sec.d* r:\DayLib\LBFF]86552spec.doc:gCC COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 27, OCT: 2003 18:53 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 9/18 2d growing procaryotic or eukaryotic host cells comprising a nucleic acid sequence expressing the chimeric receptor in accordance with the ninth embodiment of the present invention, under suitable nutrient conditions allowing for cell growth.

According to a fifteenth embodiment of the invention, there is provided a method of s measuring the ability of a compound to effect GABABR or mGluR activity comprising the steps of: a) providing said compound to a cell expressing the chimeric receptor in accordance with the ninth embodiment of the present invention, and b) measuring the ability of said compound to affect the activity of said receptor as an indication of the ability of said compound to effect CABABR or mGluR activity.

The present invention features G-protein fusion receptors and chimeric GABA 8 receptors (GABABRs), nucleic acid encoding such receptors, and the use of such receptors and nucleic acid. G-protein fusion receptors comprise at least one domain from a CaR, a mGluR, and/or a GABA 3 receptor fused directly or through a linker to a guanine is nucleotide-binding protein (G-protein). Chimeric GABABRs comprise at least one of a GABABR extracellular domain, a GABA R transmembrane domain, or a GABA 3

R

intracellular domain and one or more domains from a mGluR subtype 8 (mGluRS) and/or a CaR.

G-proteins are peripheral membrane proteins made up of an c subunit, a P subunit, and a y subunit. G-proteins interconvert between a GDP bound and a GTP bound form, Different types of G-proteins can affect different enzymes, such as adenylate cyclase and phospholipase-C.

There is disclosed herein a G-protein fusion receptor comprising: a. a* [I:\Dayf~b\LIBFF]86552spec.doc:gce COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 PCT/US99/07 3 3 3 WO 99/51641 an extracellular domain comprising an extracellular domain amino acid sequence substantially similar to either an extracellular CaR amino acid sequence, an extracellular mGluR amino acid sequence, or an extracellular GABAB receptor amino acid sequence; a transmembrane domain joined to the carboxy terminus of said extracellular domain, said transmembrane domain comprising a transmembrane domain amino acid sequence substantially similar to either a transmembrane CaR amino acid sequence, a transmembrane mGluR amino acid sequence, or a transmembrane GABAe receptor amino acid sequence; an intracellular domain joined to the carboxy terminus of said transmembrane domain comprising all or a portion of an intracellular amino acid sequence substantially similar to either an intracellular CaR amino acid sequence, an intracellular mGluR amino acid sequence, or an intracellular GABAB receptor amino acid sequence, provided that said portion is at least about 10 amino acids; a an optionally present linker joined to the carboxy terminus of said intracellular domain; and a G-protein joined either to said intracellular domain or to said optionally present linker, provided that said G-protein is joined to said optionally present linker when said optionally present linker is present.equence Substantially similar" refers t at least 40% sequence similarity between respective polypeptide regions making up a domain. In preferred embodiments, substantially similar refers to at least 50%, at least 75%, at least 90%, at least sequence similarity, or 100% (the same sequence), between polypeptide domains. The degree to which two polypeptide domains are substantially similar is determined by comparing the amino acid sequences located in corresponding domains. Sequence similarity is preferably determined using BLASTN (Altschul et al., J. Mol. Biol. 215:403-410, 1990).

The different receptor components of the G-protein receptor can come from the same receptor protein or from a chimeric receptor made up of different receptor domains. By swapping different domains compounds able to effect different domains of a WO 99/516 4 1 PCT/US99/0 7 3 3 3 4 particular receptor can be identified and the activity of different compounds at different domains can be measured.

In different embodiments the CaR region(s) present in the Gprotein fusion are substantially similar to, comprise, or consist of portion(s) of the human CaR; mGluR region(s) present in the Gprotein fusion are substantially similar to, comprise, or consist of portion(s) of a human mGluR; and GABABR region(s) present in the G-protein fusion are substantially similar to, comprise, or consist of portion(s) of a human GABABR receptor.

In preferred embodiments concerning GABApR regions that are present: the GABABR extracellular domain is substantially similar to a GABABR extracellular domain provided in SEQ. ID. NOs. 2-4; the GABABR transmembrane domain is substantially similar to the GABAR transmembrane domain provided in SEQ. ID. NOs. 7-9; and the GABAR intracellular domain is substantially similar to a GABAR intracellular domain provided in SEQ. ID. NOs. 12-14.

In preferred embodiments concerning CaR regions that are present: the CaR extracellular domain is substantially similar to the CaR extracellular provided in SEQ. ID. NO. 1; the CaR transmembrane domain is substantially similar to the CaR transmembrane domain provided in SEQ. ID. NO. 6; and the CaR intracellular domain is substantially similar to the CaR intracellular domain such as that provided in SEQ. ID. NO. 11.

Various different mGluR subtypes present in different organisms, including humans, are described in different patent publications as follows: mGluR1 WO 94/29449, EP 569 240 Al, WO 92/10583 and U.S. Patent No. 5,385,831; mGluR WO 94/29449,

WO

96/06167, and EP 711 832 A2; mGluR 3 WO 94/29449, and

WO

95/22609; mGluR, WO 95/08627, WO 95/22609, and WO 96/29404; mGluR, WO 94/29449; mGluR, WO 95/08627; mGluR 7 U.S. Patent No.

5,831,047, WO 95/08627 and WO 96/29404; and mGluR8 WO 97/4724 and EP 816 498 A2. (Each of these references are hereby incorporated by reference herein.) In preferred embodiments concerning mGluR regions that are present: the mGluR extracellular domain is substantially similar to either human mGluR i, human mGluR 2, human mGluR 3, human mGluR 4, human mGluR 5, human mGluR 6, human mGluR 7, or human mGluR 8; the mGluR transmembrane domain is substantially similar to either human mGluR 1, human mGluR 2, human mGluR 3, human mGluR 4, human mGluR 5, human mGluR 6, human mGluR 7, or human mGluR 8; and the mGluR intracellular domain is substantially similar to either human mGluR 1, human mGluR 2, human mGluR 3, human mGluR 4, human mGluR 5, human mGluR 6, human mGluR 7, or human mGluR 8.

There is further disclosed herein a nucleic acid comprising a nucleotide sequence encoding for a G-protein fusion receptor.

There is further disclosed herein a recombinant cell comprising an expression vector encoding for a G-protein fusion receptor, and a cell where the G-protein fusion receptor is expressed. Preferably, the G-protein fusion receptor is functional in the cell.

There is further disclosed herein a recombinant cell produced by combining a cell where a G-protein fusion receptor is expressed, and a vector comprising nucleic acid encoding a G-protein fusion receptor and elements for introducing heterologous nucleic acid into the cell. Preferably, the G-protein fusion receptor is functional in the cell.

There is further disclosed herein a process for the production of a G-protein fusion receptor. The process is performed by growing host cells comprising a G-protein fusion receptor.

There is further disclosed herein a method of measuring the ability of a compound to affect G-protein fusion receptor activity.

There is further disclosed herein a chimeric CABABR comprising an extracellular S* domain, a transmembrane domain and an intracellular domain, wherein at least one domain is from a CABABR and at least one domain is from CaR or mGluR8. The extracellular domain comprises an amino acid sequence substantially similar to a CaR 25 extracellular domain (SEQ. ID. NO.

[R:\LIBFF]66383spec.doc:gcc WO 99/516 4 1 PCT/US99/07 3 3 3 6 a GABABR la extracellular domain (SEQ. ID. NO. a GABABRlb extracellular domain (SEQ. ID. NO. a GABABR2 extracellular domain (SEQ. ID. NO. or a mGluR8 extracellular domain

(SEQ.

ID. NO. The transmembrane domain comprises an amino acid sequence substantially similar to a CaR transmembrane domain (SEQ. ID. NO.

a GABA R l a transmembrane domain (SEQ. ID. NO. a GABABRlb transmembrane domain (SEQ. ID. NO. a GABABR2 transmembrane domain (SEQ. ID. NO. or a mGluR8 transmembrane domain

(SEQ.

ID. NO. The intracellular domain comprises an amino acid sequence substantially similar to a CaR intracellular domain (SEQ. ID. NO.

11), a GABA 8 Rla intracellular domain (SEQ. ID. NO. 12), a GABARIb intracellular domain (SEQ. ID. NO. 13), a GABAsR2 intracellular domain (SEQ. ID. NO. 14), or a mGluR8 intracellular domain

(SEQ.

ID. NO. preferred chimeric GABARs contain at least one mGluR8 intracellular, transmembrane or extracellular domain, or at least one CaR intracellular, transmembrane or extracellular domain.

More preferably, the chimeric GABAR contains at least one CaR domain.

In preferred embodiments concerning mGluR8 regions that are present: the mGluR8 extracellular domain is substantially similar to the mGluR8 extracellular domain provided in SEQ. ID. NO. the mGluR8 transmembrane domain is substantially similar to the mGluR8 transmembrane domain provided in SEQ. ID. NO. 10; and the mGluR8 intracellular domain is substantially similar to the mGluR8 receptor intracellular provided in SEQ. ID. NO. Preferably, the domains are functionally coupled such that a signal from the binding of an extracellular ligand is transduced to the intracellular domain when the chimeric receptor is present in a suitable host cell. A suitable host cell contains the elements for functional signal transduction for receptors coupled to a G-protein.

7 There is also disclosed herein a nucleic acid comprising a nucleotide sequence encoding for a chimeric CABABR.

There is also disclosed herein a recombinant cell comprising an expression vector encoding for a chimeric GABABR, and a cell where the chimeric CABABR is expressed.

Preferably, the chimeric CABABR is functional in the cell.

There is also disclosed herein a recombinant cell produced by combining a cell where a chimeric CABABR is expressed, and a vector comprising nucleic acid encoding the chimeric CABABR and elements for introducing heterologous nucleic acid into the cell. Preferably, the chimeric CABABR is functional in the cell.

There is also disclosed herein a process for the production of a chimeric receptor.

The process is performed by growing host cells comprising a chimeric CABABR.

There is also disclosed herein a method of measuring the ability of a compound to affect CABABR or mGluR activity. The method is performed by measuring the ability of a compound to affect chimeric CABABR or mGluR activity.

There is also disclosed herein a fusion receptor polypeptide comprising a receptor and a G-protein a subunit, wherein said G-protein a subunit is fused to the intracellular domain of said receptor, provided that the receptor is not an adrenoreceptor.

Various examples are described herein. These examples are not intended in any way to limit the claimed invention.

Other features and advantages of the invention will be apparent from the following drawings, the description of the invention, the examples, and the claims.

C

*o e* *ee e* *o [R:\LIBFF]66383specdoc:gcc WO 99/51 PCT/US99/07 3 3 3 1641 8 BRIEF DESCRIPTION OF DRAWINGS Figures la-Id illustrate the amino acid sequences of a human NO. t -,ABARaa CaR extracellular domain (SEQ.

I

extracellular domain (SEQ. ID. 1 extracellular domain (SEQ. ID. I extracellular domain (SEQ.

ID.

extracellular domain (SEQ.

ID.

Figures 2a-2b illustrate t CaR transmembrane domain

(SEQ.

transmembrane domain (SEQ.

ID.

transmembrane domain (SEQ.

ID.

transmembrane domain (SEQ.

ID.

transmembrane domain (SEQ.

ID.

Figures 3a-3b illustrate CaR intracellular domain

(SEQ.

intracellular domain (SEQ.

ID.

intracellular domain (SEQ.

ID.

intracellular domain (SEQ.

ID.

intracellular domain (SEQ.

ID.

ID. NO. a i-u GA3 O0. a human GABAgRlb NO. a human

GABA

9 R2 NO. and a human mGluR8 NO. -he amino acid sequences of a human ID. NO. a human GABARla NO. a human GABARlb NO. a human GABAR2 NO. and a human mGluR8 NO. the amino acid sequences of a human

ID.

NO.

NO.

NO.

NO.

NO. 11), a human GABARla 12), a human GABARlb 13), a human GABABR2 14), and a human mGluR8 Figures 4a-4b illustrate the amino acid sequence of Gcs.

(SEQ. ID. NO. 16) and Goc 6 (SEQ. ID. NO. 17).

Figures 5a-5r illustrate the cDNA sequences encoding for human CaR (SEQ. ID. NO. 18), human GABARla (SEQ. ID. NO. 19), human GABABRlb (SEQ. ID. NO. 20), and human GABAR2 (SEQ. ID. NO.

21).

Figures 6a-6h illustrate the cDNA sequence for rat GABAR1a (SEQ. ID. NO. 22) and rat GABABRIb (SEQ. ID. NO. 23).

Figures 7a-7c illustrate the amino sequence for rat GABARIa (SEQ. ID. NO. 24) and rat GABARlb (SEQ. ID. NO. Figure 8 illustrates the ability of a chimeric CaR/GABAR 2 (CaR extracellular and transmembrane domains, and intracellular GABA.R2 domain) to transduce a signal. Signal production was measured by detecting an increase in the calcium-activated chloride current. The line in the middle of the increase signifies a wash step. for huan Figures 9a-9p illustrate the cDNA sequence for human mGluR2 PCTIUS99/073 3 3 WO 99/51641 (SEQ. ID. NO. 26), chimeric hCAR/hmGluR 2 (SEQ. ID. NO. chimeric hmGluR2/hCaR (SEQ. ID. NO. 34), and chimeric hmGluR8/hCaR (SEQ. ID. NO. 38) Figures 10a-10f illustrate the amino acid sequence for human mGluR2 (SEQ. ID. NO. 27), chimeric hCAR/hmGluR 2 (SEQ. ID. NO.

31), chimeric hmGluR2/hCaR (SEQ. ID. NO. 35), chimeric hmGluR8/hCaR (SEQ. ID. NO. 39).

Figures lla-llv illustrate the cDNA sequence for the fusion construct (SEQ. ID. NO. 32), pmGluR2//CaR*Gqi5 fusion construct (SEQ. ID. NO. 36), pmGluR2//CaR*Gai5+3Ala linker fusion construct (SEQ. ID. NO.

46), and the mGluR8//CaR*Gai5 fusion construct (SEQ. ID.

NO.

Figures 12a-12h illustrate the amino acid sequence for the phCaR/hmGluR2*Gqi5 fusion construct (SEQ. ID. NO. 33), fusion construct (SEQ. ID. NO. 37), 3 Ala linker fusion construct (SEQ. ID. NO.

47), and the mGluR8//CaR*Gaqi5 fusion construct (SEQ. ID.

NO.

41).

Figures 13a-13m illustrate the cDNA sequence for the GABAfusion construct (SEQ. ID. NO. 42) and the fusion construct (SEQ. ID. NO. 44).

Figures 14a-14e illustrates the amino acid sequence for the fusion construct (SEQ. ID. NO. 43) and the GABA- Ba*Gqo5 fusion construct (SEQ. ID. NO. Figure 15 illustrates the ability of different G-protein fusions to transduce signal resulting from ligand binding.

ID NO. 37, CaR/mGluR2'Gql is is shown by SEQ. ID. NO. 37, a/mGlu2Gqi is shown by SEQ. ID. NO. 33, mGluR8//CaR'Gqi5 is shown by SEQ.

ID.

NO. 41.

DETAILED ESRIPTION OF THE INVENTIN The CaR, mGluR, and the GABABR are structurally similar in that they are each a single subunit membrane protein possessing an extracellular domain, a transmembrane domain comprising seven putative membrane spanning helices connected by three intracellular and three extracellular loops, and an intracellular WO 99/516 4 1 PCT/US99/073 3 3 carboxy-terminal domain. Signal transduction is activated by the extracellular binding of an agonist. The signal is transduced to the intracellular components of the receptor causing an intracellular effect.

Signal transduction from agonist binding to an extracellular region can be modulated by compounds acting at a downstream transmembrane domain or the intracellular domain. Downstream effects include antagonist actions of compounds and allosteric actions of compounds.

The transmembrane domain provides different types of target sites for compounds modulating receptor activity in different environments. As noted above, the transmembrane domain contains extracellular, transmembrane, and intracellular components.

Compounds modulating GABAR, CaR, or mGluR activity can be obtained, for example, by screening a group or library of compounds to identify those compounds having the desired activity and then synthesizing such compound. Thus, included in the present invention is a method of making a GABABR, CaR, or mGluR active compound by first screening for a compound having desired properties and then chemically synthesizing that compound.

Metabotropic Glutamate Receptors (mGluRs) mGluRs are G protein-coupled receptors capable of activating a variety of intracellular secondary messenger systems following the binding of glutamate (Schoepp et al., Trends Pharmacol. Sci.

11:508, 1990; Schoepp and Conn, Trends Pharmacol. Sci. 14:13, 1993, hereby incorporated by reference herein).

Activation of different mGluR subtypes in situ elicits one or more of the following responses: activation of phospholipase

C,

increases in phosphoinositide (PI) hydrolysis, intracellular calcium release, activation of phospholipase D, activation or inhibition of adenylyl cyclase, increases and decreases in the formation of cyclic adenosine monophosphate (cAMP), activation of guanylyl cyclase, increases in the formation of cyclic guanosine monophosphate (cGMP), activation of phospholipase

A

2 increases in WO 99/51641 PCT/US99/07 3 3 3 arachidonic acid release, and increases or decreases in the activity of voltage- and ligand-gated ion channels (Schoepp and Conn, Trends pharmacol. Sci. 14:13, 1993; Schoepp, Neurochem.

Int. 24:439, 1994; Pin and Duvoisin, Neuropharmacology 34:1, 1995, hereby incorporated by reference herein).

Eight distinct mGluR subtypes have been isolated. (Nakanishi, Neuron 13:1031, 1994; Pin and Duvoisin, Neuropharmacology 34:1, 1995; Knopfel et al., Med. Chem. 38:1417; Eur. J. Neuroscience 7:622-629, 1995, each of these references is hereby incorporated by reference herein.) The different mGluRs possess a large aminoterminal extracellular domain (ECD) followed by seven putative transmembrane domain (7TMD) comprising seven putative membrane spanning helices connected by three intracellular and three extracellular loops, and an intracellular carboxy-terminal domain of variable length (cytoplasmic tail).

Human mGluR8 is described by Stormann et al., International Application Number PCT/US97/0 9025 International Publication Number WO 97/48724, and mouse mGluRS is described by Duvoisin et al., J. Neurosci. 15:3075-3083, 1995, (both of these references are hereby incorporated by reference herein). mGluR8 couples to Gi. Agonists of mGluR8 include L-glutamate and L-2-amino-4phosphonobutyrate.

mGluR8 activity can be measured using standard techniques.

For example, Gi negatively couples to adenylate cyclase to inhibit intracellular cAMP accumulation in a pertussis toxin-sensitive fashion. Thus, mGluR8 activity can be measured, for example, by measuring inhibition of forskolin-stimulated cAMP production as described by Duvoisin et al., j. Neurosci. 15:3075-3083, 1995.

mGluRs have been implicated in a variety of neurological pathologies. Examples of such pathologies include stroke, head trauma, spinal cord injury, epilepsy, ischemia, hypoglycemia, anoxia, and neurodegenerative diseases such as Alzheimers disease (Schoepp and Conn, Trends Pharmacol. Sci. 14:13, 1993; Cunningham et al., Life Sci. 54: 135, 1994; Pin et al., Neuropharmacology 34:1, 1995; Knopfel et al., J. Med. Chem.

WO 99/51641 PCT/US99/073 33 12 38:1417, 1995, each of which is hereby incorporated by reference herein).

Calcium Receptor The CaR responds to changes of extracellular calcium concentration and also responds to other divalent and trivalent cations. The CaR is a G-protein coupled receptor containing an extracellular Ca 2 binding domain. Activation of the CaR, descriptions of CaRs isolated from different sources, and examples of CaR active compound are provided in Nemeth NIPS 10:1- 1995, Brown et al. U.S. Patent No. 5,688,938, Van Wagenen et al., International Application Number PCT/US97/0555 8 International Publication Number WO 97/37967, Brown E.M. et al., Nature 366:575, 1993, Riccardi et al., Proc. Nat'l. Acad.

Sci. USA 92:131-135, 1995, and Garrett et al., J. Biol.

Chem. 31:12919-12925, 1995. (Each of these references are hereby incorporated by reference herein.) Brown et al. U.S. Patent No.

5,688,938 and Van Wagenen et al., International Application Number PCT/US97/05 558 International Publication Number

WO

97/37967, describe different types of compounds active at the CaR including compounds which appear to be allosteric modulators and CaR antagonists.

The CaR can be targeted to achieve therapeutic effects.

Examples of target diseases are provided in Brown et al. U.S.

Patent No. 5,688,938, and Van Wagenen et al., International Application Number PCT/US97/05558 International Publication Number WO 97/37967, and include hyperparathyroidism and osteoporosis.

-Aminobutvric acid Recetors (GABARs) GABARs are G-protein coupled metabotropic receptors.

GABARs modulate synaptic transmission by inhibiting presynaptic transmitter release and by increasing K' conductance responsible for long-lasting inhibitory postsynaptic potentials. (See, WO 99/51641 PCT/US99/07333 Kaupmann et al., Nature 386:239-246, 1997, hereby incorporated by reference herein.) GABAgRs are found in the mammalian brain, in locations outside of the brain, and in lower species. Outside of the brain, GABARs have been identified on axon terminals and ganglion cell bodies of the autonomic nervous system, on fallopian tube and uterine intestinal smooth muscle cells, in the kidney cortex, urinary bladder muscle and on testicular interstitial cells.

(See, Bowery, Annu. Rev. Pharmacol. Toxicol. 33:109-147, 1993, hereby incorporated by reference herein.) Different GABARs subtypes exist. Kaupmann et al., Nature 386:239-246, 1997, indicate that they cloned GABARs. Nucleic acid encoding two GABAR proteins were indicated to be cloned from rat brain: GABABRla and GABABRlb. GABARla differs from GABARlb in that the N-terminal 147 residues are replaced by 18 amino acids. GABARla and GABARlb appear to be splice variants. The cloned GABARs were indicated to negatively couple adenylyl cyclases and show sequence similarity to the metabotropic receptors for L-glutamate (mGluR). Northern blot analysis indicated that GABARla and GABARIb is present in brain and testis, but not in kidney, skeletal muscle, liver, lung, spleen, or heart.

Kaupmann et al., International Application Number PCT/EP97/01 3 7 0, International Publication Number WO 97/46675, indicate that they have obtained rat GABAR clones,

GABA

8 Rla and GABARIb; and humans GABABR clones, GABARla/b (representing a partial receptor clone) and GABARlb (representing a full-length receptor clone). Amino acid sequence information, and encoding cDNA sequence information, is provided for the different

GABAR

clones.

Another GABABR subtype is GABABR2. Northern blot analysis reveals than an approximately 6.3 Kb human GABAR2 transcript is abundantly expressed in the human brain. Expression is not detected in the heart, placenta, lung, liver, skeletal muscle, kidney and pancreas under conditions where GABAR2 transcript was WO 99/51641 PCT/US99/0733 3 identified in the human brain. Within the human brain GABABR2 is broadly expressed at variable levels.

GABAaR functions as a heterodimer of the subunits GABABRl or GABAaR2. (Jones et al. Nature 396:674-679, 1998, hereby S incorporated by reference herein.) GABARs have been targeted to achieve therapeutic effects.

Kerr and Ong, DDT 1:371-380, 1996, describe different compounds indicated to be GABAR agonists and GABAR antagonists. Kerr and Ong also review therapeutic implications of affecting

GABAR

activity including, spasticity and motor control, analgesia, epilepsy, cognitive effects, psychiatric disorders, alcohol dependence and withdrawal, feeding behavior, cardiovascular and respiratory functions, and peripheral functions.

Bittiger et al., Tips 4:391-394, 1993, review therapeutic applications of GABAR antagonists. Potential therapeutic applications noted by Bittiger et al. include cognitive processes, epilepsy, and depression.

G-Protein Fusion Receptors Examples of some different types of G-protein fusion receptors, and advantages of some receptors, are provided below.

Using the present application as guide additional G-protein receptors fusion can be constructed.

G-protein fusion receptors contain an intracellular domain of a receptor fused to a G-protein a subunit Ga fusions to adrenoreceptors have been reported by Bertin et al., Receptors and Channels 5:41-51, 1997; Wise and Milligan, Journal of Biological Chemistry 39:24673-24678, 1997; and Bertin et al., Proc. Natl. Acad. Sci. USA 91:8827-8831, 1994 (each of which are hereby incorporated by reference herein). These studies were indicated to produce a functional chimeric by fusing the a, 2 adrenoreceptor to the Gia, or the P,-adrenoreceptor to the Gsa.

The G-protein fusion receptors described by the present invention include a G-protein fused to an intracellular domain, where the intracellular domain when present in a wild type WO 99/51641 PCT/US99/07333 receptor does not interact with that type of G-protein. Thus, the present invention also describes swapping of signals by fusing an intracellular domain to a Ga normally not coupled to that intracellular domain. The use of such fusion proteins, while applicable to chimeric GABAgRs, is not limited to chimeric GABARs. Indeed, such technology can be applied to receptors containing an extracellular domain, transmembrane domain and intracellular domain of a wild type receptor.

Preferred G-proteins fusion receptors contain an intracellular domain fused to a promiscuous Ga that couples to phospholipase C resulting in the mobilization of intracellular calcium. Increases in intracellular calcium can be conveniently measured through the use of dyes. Such techniques are well known in the art and are described, for example by Brown et al. U.S.

Patent No. 5,688,938.

In an embodiment G-proteins fusions can also be used to decrease receptor desensitization.

Examples of promiscuous Ga's coupling to phospholipase

C

include naturally occurring G-proteins such as Gais and Ga1s, and chimeric G-protein such as Gqo5 and Gqi5. Gqo5 and Gqi5 are made of a Gq portion where the five amino acids at the C-terminal are from either Go or respectively (Conklin et al., Nature 363:274- 277, 1993, hereby incorporated by reference herein). The Gq portion of such chimeric receptors provides for phospholipase

C

coupling while the terminal Go or Gi portion allows the chimeric G-protein to couple to different receptor proteins that are normally involved in inhibitor effects on adenylate cyclase.

In an embodiment of the present invention the employed

G-

protein is from a human source or is made up of different

G-

protein components each from a human source.

G-proteins fusions can be created, for example, by fusing directly or indirectly the intracellular domain of a receptor protein to a polypeptide having an amino acid sequence substantially similar to Gais. Gcs, Gqo5 or Gqi5. In different embodiments, the receptor is fused directly or indirectly to a G- WO 99/51641 16 PCT/US99/073 3 3 16 protein consisting of the amino acid sequence of Gats, G( 16 or The intracellular domain portion of a receptor protein fused directly or indirectly to a G-protein should be at least about amino acids in length. In different embodiments the portion is at least about 50 amino acids, at least about 100 amino acids, or the full length of an intracellular domain.

The intracellular domain can be directly linked to a Gprotein or can be indirectly linked through an optionally present linker. Optionally present linkers are preferably about 3 to about 30 amino acids in length. Preferred linkers are made up of alanine, glycine, or a combination thereof.

Chimeric Receptors Examples of some different types of chimeric receptors, and advantages of some receptors, are provided below. Using the present application as guide additional chimeric receptors can be constructed.

Chimeric GABAR Extracellular Domain Chimeric GABARs containing a GABABR extracellular domain are particularly useful for studying the importance of the GABABR extracellular domain and assaying for compounds active at the extracellular domain. Preferably chimeric GABARs containing a GABAR extracellular domain also contain a CaR intracellular domain.

A variety of different activities have been generally attributed to GABABR subtypes. Kerr and Ong, DDT 1:371- 380, 1996.) Kaupmann et al., Nature 386:239-246, 1997, report that in preliminary experiments involving GABARla they did not detect positive coupling to the adenylyl cyclase or coupling to the phospholipase effector system.

An intracellular CaR domain can be used to couple with Gproteins which activate phospholipase C and mobilize intracellular calcium. Mobilization of intracellular calcium is WO 99/51641 PCT/US99/07333 readily detected, for example, by fluorescent indicators of intracellular Ca2' An additional advantage of using the intracellular CaR domain is that CaR G-protein activation is not rapidly desensitized. Thus, the intracellular CaR domain can be used to produce a stronger intracellular signal than a signal produced from a receptor which is desensitized rapidity.

More preferably, the chimeric GABAR contains an intracellular CaR domain, and also contains either a CaR or a GABAR transmembrane domain. Advantages of using a CaR transmembrane domain include separating the effects occurring at a GABAR extracellular domain from effects occurring at a transmembrane domain; and providing additional intracellular elements, present on transmembrane intracellular loops, useful for coupling to G-protein.

A GABAR transmembrane domain is useful for examining whether the transmembrane

GABA

9 R can be targeted to affect GABAR activity, and obtaining compounds active at the GABABR transmembrane domain. For example, a transmembrane GABAR can be used to screen for transmembrane allosteric modulators and antagonists.

Chimeric GABAR Transmembrane Domain Chimeric GABARs containing a GABAR transmembrane are particularly useful for studying the importance of the GABAR transmembrane domain and assaying for compounds active at the transmembrane domain. Preferably Chimeric GABARs containing a GABAR transmembrane domain contain an extracellular domain which is either mGluR8 or CaR, and an intracellular CaR domain.

More preferably, the chimeric GABAR contains an extracellular domain from either mGluR8 or CaR, a GABAR transmembrane, and an intracellular CaR domain. A chimeric

GABAR

containing extracellular mGluR8 or CaR domains can readily be stimulated using mGluR8 or CaR ligands.

WO 99/51641 PCT/US99/07333 18 Chimeric GABABR Intracellular Domain Chimeric GABABRs containing a GABAR intracellular domain are particularly useful for studying the importance of the GABAR intracellular domain and assaying for compounds active at the intracellular domain. Preferably, the chimeric receptors contain an extracellular domain from either mGluR8 or CaR. The extracellular mGluR8 or CaR domains can readily be activated using mGluR8 or CaR ligands.

Receptor Domains Domains of a G-protein fusion receptor, a chimeric receptor, and Ga, substantially similar to a particular sequence can be readily produced using the disclosure provided herein in conjunction with information well known in the art.

Substantially similar sequences can be obtained taking into account sequence information for a particular type of receptor obtained from different sources, different types of amino acids which are to some extent interchangeable, and the ease of experimentation with which functional receptor activity can be assayed.

Substantially similar sequences includes amino acid alterations such as deletions, substitutions, additions, and amino acid modifications. A "deletion" refers to the absence of one or more amino acid residue(s) in the related polypeptide. An "addition" refers to the presence of one or more amino acid residue(s) in the related polypeptide. Additions and deletions to a polypeptide may be at the amino terminus, the carboxy terminus, and/or internal. Amino acid "modification" refers to the alteration of a naturally occurring amino acid to produce a non-naturally occurring amino acid. A "substitution" refers to the replacement of one or more amino acid residue(s) by another amino acid residue(s) in the polypeptide. Derivatives can contain different combinations of alterations including more than one alteration and different types of alterations.

WO 99/51641 PCT/US99/07333 19 The sequences of polypeptides can be compared from different sources to help identify variable amino acids not essential for receptor activity. For example, Figure 7 provides the rat GABARIa and GABA.RIb amino acid sequences. The rat GABABRla and GABARIb amino acid sequences can be compared with the human GABARIa and GABARlb sequences to identify conserved and variable amino acids. Derivatives can then be produced where a variable amino acid is changed, and receptor activity can be readily tested.

Similarly, the amino acid sequences for CaR, mGluR8, and Gproteins from different sources are either known in the art or can readily be obtained. Examples of such references are provided above.

While the effect of an amino acid change varies depending upon factors such as phosphorylation, glycosylation, intra-chain linkages, tertiary structure, and the role of the amino acid in the active site or a possible allosteric site, it is generally preferred that a substituted amino acid is from the same group as the amino acid being replaced. To some extent the following groups contain amino acids which are interchangeable: the basic amino acids lysine, arginine, and histidine; the acidic amino acids aspartic and glutamic acids; the neutral polar amino acids serine, threonine, cysteine, glutamine, asparagine and, to a lesser extent, methionine; the nonpolar aliphatic amino acids glycine, alanine, valine, isoleucine, and leucine (however, because of size, glycine and alanine are more closely related and valine, isoleucine and leucine are more closely related); and the aromatic amino acids phenylalanine, tryptophan, and tyrosine. In addition, although classified in different categories, alanine, glycine, and serine seem to be interchangeable to some extent, and cysteine additionally fits into this group, or may be classified with the polar neutral amino acids.

While proline is a nonpolar neutral amino acid, its replacement represents difficulties because of its effects on conformation. Thus, substitutions by or for proline are not WO 99/51641 PCTIUS99/07333 preferred, except when the same or similar conformational results can be obtained. The conformation conferring properties of proline residues may be obtained if one or more of these is substituted by hydroxyproline (Hyp).

Examples of modified amino acids include the following: altered neutral nonpolar amino acids such as -amino acids of the formula HN(CH 2 )nCOOH where n is 2-6, sarcosine (Sar), tbutylalanine (t-BuAla), t-butylglycine (t-BuGly), N-methyl isoleucine (N-MeIle), and norleucine (Nleu); altered neutral aromatic amino acids such as phenylglycine; altered polar, but neutral amino acids such as citrulline (Cit) and methionine sulfoxide (MSO); altered neutral and nonpolar amino acids such as cyclohexyl alanine (Cha); altered acidic amino acids such as cysteic acid (Cya); and altered basic amino acids such as ornithine (Orn) Preferred derivatives have one or more amino acid alteration(s) which do not significantly affect the receptor activity of the related receptor protein. In regions of receptor domains not necessary for receptor activity, amino acids may be deleted, added or substituted with less risk of affecting activity. In regions required for receptor activity, amino acid alterations are less preferred as there is a greater risk of affecting receptor activity.

Derivatives can be produced using standard chemical techniques and recombinant nucleic acid techniques.

Modifications to a specific polypeptide may be deliberate, as through site-directed mutagenesis and amino acid substitution during solid-phase synthesis, or may be accidental such as through mutations in hosts which produce the polypeptide.

Polypeptides including derivatives can be obtained using standard techniques such as those described by Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989). For example, Chapter 15 of Sambrook describes procedures for sitedirected mutagenesis of cloned DNA.

WO 99/51641 PCT/US99/07333 21 Receptor Nucleic Acid G-protein fusion and chimeric receptor nucleic acid can be produced based on the information provided herein along with standard recombinant nucleic acid techniques. Examples of references describing recombinant nucleic acid techniques include Molecular Cloning, Sambrook et al., Cold Spring Harbor Laboratory Press (1989); and Current Protocols in Molecular Biology, Frederick et al., John Wiley Sons, Inc. (1995).

Due to the degeneracy of the genetic code different nucleic acid sequences can encode for a particular polypeptide. Thus, a large number of nucleic acids encoding for a receptor having the same amino acid sequence can be produced.

An embodiment of the present invention uses human nucleic acid encoding for the domains from CaR, GABARIA, GABARIB, GABA.R2 and/or mGluR8. The amino acid sequences of different domains is provided in Figures 1-3.

Recombinant Cells Nucleic acid expressing a functional G-Protein fusion or a chimeric receptor can be used to create transfected cells lines expressing such receptors. Such cell lines have a variety of uses such as being used for high-throughput screening for compounds modulating receptcr activity; being used to assay binding to the receptor; and as factories to produce large amounts of a receptor.

A variety of cell lines can couple exogenously expressed receptors to endogenous functional responses. Cell lines such as NIH-3T3, HeLa, NG115, CHO, HEK 293 and COS7 which are expected to lack CaR, mGluR8, and GABAR can be tested to confirm that they lack these receptors.

Production of stable transfectants can be accomplished by transfection of an appropriate cell line with, for example, an expression vector such as pMSG vector, in which the coding sequence for the G-protein fusion or chimeric GABAR cDNA has been cloned. Expression vectors containing a promoter region, such as WO 99/51641 PCT/S99/07333 22 the mouse mammary tumor virus promoter (MMTV), drive high-level transcription of cDNAs in a variety of mammalian cells. In addition, these vectors contain genes for selecting cells stably expressing cDNA of interest. The selectable marker in the pMSG vectors encode an enzyme, xanthine-guanine phosphoribosyl transferase (XGPRT), conferring resistance to a metabolic inhibitor that is added to the culture to kill nontransfected cells.

The most effective method for transfection of eukaryotic cell lines with plasmid DNA varies with the given cell type. The expression construct will be introduced into cultured cells by the appropriate technique, such as Ca 2 phosphate precipitation, DEAE-dextran transfection, lipofection or electroporation.

Expression of the receptor cDNA in cell lines can be assessed by solution hybridization and Northern blot analysis.

Binding Assays The present invention also includes using G-protein fusion receptors or chimeric GABAR in a binding assay. G-protein fusion receptors or chimeric GABABRs having a particular GABAR domain can be used, for example to facilitate obtaining compounds able to bind to that particular receptor domain; and to determine whether a compound which binds to a particular domain. For example, in a complete chimeric GABAR containing extracellular, transmembrane, and intracellular domains, the presence of one or more domains from CaR or mGluR are useful to present GABAR domain(s) to a binding agent in a form more like the GABAR domain(s) in the wild type receptor compared to an incomplete GABABR receptor fragment lacking one or more domains.

Binding assays can be carried out using techniques well known in the art. Binding assays preferably employ radiolabeled binding agents.

An example of a binding procedure is carried out by first attaching chimeric GABABR to a solid-phase support to create an affinity matrix. The affinity matrix is then contacted with WO 99/51641 PCT/UlS99/07333 23 potential GABABR binding agents. A large library of compounds may be used to determine those compounds binding to the affinity matrix. Bound compounds can be eluted from the column.

Therapeutic Modulation As pointed out above, different types of diseases and disorders can be treated using compounds modulating CaR, mGluR, or GABAR activity. Additionally, such compounds can be used prophylactically. Compounds modulating GABAR2 activity can be administered to patients who would benefit from such treatment.

Patients are mammals, preferably humans.

Modulators of CaR, mGluR, or GABAR activity can be administered to a patient using standard techniques. Techniques and formulations generally may be found in Remington's Pharmaceutical Sciences, 1 8 1h ed., Mack Publishing Co., Easton, PA, 1990 (hereby incorporated by reference herein) Suitable dosage forms, in part, depend upon the use or the route of entry, for example, oral, transdermal, transmucosal, or by injection (parenteral). Such dosage forms should allow the therapeutic agent to reach a target cell whether the target cell is present in a multicellular host or in culture. For example, pharmacological compounds or compositions injected into the blood stream should be soluble. Other factors are well known in the art, and include considerations such as toxicity and dosage forms which retard the therapeutic agent from exerting its effect.

Therapeutic compounds can be formulated as pharmaceutically acceptable salts and complexes thereof. Pharmaceutically acceptable salts are non-toxic salts in the amounts and concentrations at which they are administered. The preparation of such salts can facilitate the pharmacological use by altering the physical characteristics of the compound without preventing it from exerting its physiological effect. Useful alterations in physical properties include lowering the melting point to facilitate transmucosal administration and increasing the WO 99/51641 PCT/US99/07333 24 solubility to facilitate administering higher concentrations of the drug.

The pharmaceutically acceptable salt of a compound may be present as a complex. Examples of complexes include an 8chlorotheophylline complex (analogous to, e.g., dimenhydrinate:diphenhydramine 8-chlorotheophylline (1:1) complex; Dramamine) and various cyclodextrin inclusion complexes.

Pharmaceutically acceptable salts include acid addition salts such as those containing sulfate, hydrochloride, fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, ptoluenesulfonate, cyclohexylsulfamate and quinate.

Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclohexylsulfamic acid, fumaric acid, and quinic acid.

Pharmaceutically acceptable salts also include basic addition salts such as those containing benzathine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, sodium, ammonium, alkylamine, and zinc, when acidic functional groups, such as carboxylic acid or phenol are present.

For example, see Remington's Pharmaceutical Sciences, 18 th ed., Mack Publishing Co., Easton, PA, p. 1445, 1990. Such salts can be prepared using the appropriate corresponding bases.

Carriers or excipients can also be used to facilitate administration of therapeutic agents. Examples of carriers include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose, or sucrose, or types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile solutions of water for injection (WFI), saline solution and dextrose.

WO 99/51641 PCT/US99/07333 GABAR modulating compounds can be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, topical (transdermal), or transmucosal administration. For systemic administration, oral administration is preferred. For oral administration, for example, the compounds can be formulated into conventional oral dosage forms such as capsules, tablets, and liquid preparations such as syrups, elixirs, and concentrated drops.

Alternatively, injection (parenteral administration) may be used, intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, compounds are formulated in liquid solutions, preferably, in physiologically compatible buffers or solutions, such as saline solution, Hank's solution, or Ringer's solution. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use.

Lyophilized forms can also be produced.

Systemic administration can be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are well known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation.

Transmucosal administration, for example, may be through nasal sprays, rectal suppositories, or vaginal suppositories.

For topical administration, compounds can be formulated into ointments, salves, gels, or creams, as is well known in the art.

The amounts of various GABA 8 R modulating compounds to be administered can be determined by standard procedures taking into account factors such as the compound IC5 0

EC

0 the biological half-life of the compound, the age, size and weight of the patient, and the disease or disorder associated with the patient.

The importance of these and other factors to be considered are well known to those of ordinary skill in the art. Generally, the WO 99/51641 PCT/US99/07333 26 amount is expected to preferably be between about 0.01 and mg/kg of the animal to be treated.

EXAMPLES

Examples are provided below illustrating different aspects and embodiments of the present invention. The examples include techniques that can be used to produce and use G-protein fusion receptors and chimeric receptors. These examples are not intended to limit the claimed invention.

Example 1: Construction of G-Protein Fusions This example illustrates different G-protein fusion receptor constructs and techniques used to produce different G-protein fusion receptor constructs. Numbering of nucleotide position for all the following constructs is such that nucleotide number 1 corresponds to the A of the ATG start codon of the nucleotide sequence encoding the designated protein.

I. FULL-LENGTH CONSTRUCTS A. phCaR The cDNA encoding the human CaR (Garrett et al., (1995) J.

Biol. Chem.270:12919) is harbored in the Bluescript plasmid (Stratagene). This construct is referred to as phCaR.

B. phmGluR2 A full length human mGluR2 cDNA was amplified from human cerebellum MarathonReady cDNA (Clontech) using PCR primers based on the human mGluR2 cDNA sequence (Genbank Accession 4504136).

The obtained PCR fragment was subcloned into the pT7Blue TA vector (Novagen). A Hind III-Not I fragment containing the human mGluR2 cDNA was then subcloned into the Bluescript SKII(-) plasmid (Stratagene). This construct is referred to as phmGluR2.

C. phGaL A full length human Gaq cDNA was amplified from human cerebral cortex Quick-Clone cDNA (Clontech) using PCR primers based on the human GXq cDNA sequence (Genbank Accession 4504044). The obtained PCR fragment was subcloned into the WO 99/51641 PCTIUS99/07333 27 Bluescript SKII(-) plasmid (Stratagene). This construct is referred to as phGaq.

D. phmGluR8 The cDNA encoding the full length human mGluR8 cDNA (Stormann et al., International Publication No. W097/48724) is harbored in the Bluescript SKII(-) plasmid (Stratagene). This construct is referred to as phmGluR8.

II. The cDNA encoding the human Gaqi5 cDNA (Conklin et al (1993) Nature 363:274-77) is harbored in the Bluescript SKII(-) plasmid (Stratagene). This construct is referred to as GXqi5. The nucleic acid and amino acid sequences for Gcqi5 are provided by SEQ. ID. NOs. 28 and 29 respectively.

III. phCaR/hmGluR2 This chimera contains the extracellular domain of the human CaR and transmembrane domain and intracellular cytoplasmic tail of human mGluR2. The chimeric junction between the CaR and hmGluR2 was created using a recombinant PCR strategy similar to those described above.

The first reaction used two primers, CA1156 (sense 19-mer, corresponding to nucleotides 1156-1174 of human CaR), and the hybrid primer CA/2 (antisense 42-mer, containing 21 nucleotides complementary to nucleotides 1774-1794 of human CaR and 21 nucleotides complementary to nucleotides 1660-1680 of the human mGluR2). These primers were used to amplify a 659 bp PCR fragment of human CaR.

In a separate PCR reaction using phmGluR2 as template, a 692 bp fragment of the human mGluR2 was amplified using a hybrid primer 2/CA (sense 42-mer, exactly complementary to primer CA/2) and oligo 2-2330m, (antisense 23-mer, complementary to nucleotides 2309-2331 of the human mGluR2 cDNA). The two PCR products generated from the above two reactions were annealed together in equimolar ratios in the presence of the external primers CA1156 and 2-2330m, and the Pfu DNA polymerase (Stratagene).

WO 99/51641 PCT/US99/07333 28 The resulting chimeric PCR product was digested with SexAl (Boehringer Mannheim) and BamHI (New England Biolabs) and subcloned into phCaR digested with the same two restriction enzymes. In the final cloning step, the 3' end of human mGluR2 was subcloned into this construct using the restriction enzymes BsrGI and BamHI (both New England Biolabs). The sequence of the resultant chimeric construct, phCaR/hmGluR2, was verified by ABI automated DNA sequence analysis.

IV. This construct contains the phCaR/hmGluR2 chimeric receptor fused to human Gaqi5. A HindIII-BamHI fragment containing the phCaR/hmGluR2 construct was subcloned into pcDNA3.1/Hygro(+) (Invitrogen) to aid in constructing this fusion protein. The chimeric junction between the C-terminus of phCaR/hmGluR2 and the N-terminus of Gaqi5 was created using a recombinant PCR strategy similar to those described above.

The first reaction used two primers, 2-1713 (sense 21-mer, corresponding to nucleotides 1710-1730 of human mGluR2) and the hybrid primer 2/Q (antisense 42-mer, containing 21 nucleotides complementary to nucleotides 2596-2616 of human mGluR2, and 21 nucleotides complementary to nucleotides 1-21 of pGaqi5). These primers were used to amplify a 927 bp PCR fragment of phCaR/hmGluR2. In a separate PCR reaction all of Gaqi5 was amplified using a hybrid primer Q/2 (sense 42-mer, exactly complementary to primer 2/Q) and the and the T3 primer commercially available from Stratagene.

These two PCR products generated from the above two reactions were annealed together in equimolar ratios in the presence of the external primers 2-1713 and T3, and the Pfu DNA polymerase (Stratagene). The resulting chimeric PCR product was digested with Bsu361 and BamHI (New England Biolabs) and subcloned into phCaR/hmGluR2 digested with the same two restriction enzymes. The sequence of the resultant chimeric fusion construct, phCaR/hmGluR2*G(qi5, was verified by DNA sequence analysis.

WO 99/51641 PCT/US99/07333 29 V. phmGluR2//CaR Construct This chimera contains the extracellular and transmembrane domains of human mGluR2 linked to the intracellular cytoplasmic tail domain of the human CaR. The chimeric junction was created using three separate PCR reactions.

The first reaction used two primers, 2-1713 (sense 21-mer, corresponding to nucleotides 1710-1730 of human mGluR2, Genbank Accession 4504136) and the hybrid primer 2/CT (antisense 42mer, containing 21 nucleotides complementary to nucleotides 2452 2472 of human mGluR2 and 21 nucleotides complementary to nucleotides 2602-2622 of the human CaR). These primers were used to amplify a 783 bp PCR fragment of human mGluR2. In a separate PCR reaction using phCaR in the BlueScript SK plasmid as template, a 750 bp fragment of the human CaR was amplified using a hybrid primer CT/2 (sense 42-mer, exactly complementary to primer 2/CT) and the T3 primer commercially available from Stratagene.

The two PCR products generated from the above two reactions were annealed together in equimolar ratios in the presence of the external primers 2-1713 and T3, and the Pfu DNA polymerase (Stratagene). The resulting chimeric PCR product was digested with BsrG I and Not I (New England Biolabs) and subcloned into pmGluR2 digested with the same two restriction enzymes. The sequence of the resultant chimeric construct, pmGluR2//CaR, was verified by ABI automated DNA sequence analysis.

VI. pmGluR2//CaR*Gqi5 Construct This construct contains the hmGluR2//CaR chimeric receptor fused to human G(cqi5. The chimeric junction between the Cterminus of hmGluR2//CaR and the N-terminus of G(qi5 was created using a recombinant PCR strategy similar to that described above for the construction of phmGluR2//CaR.

The first reaction used two primers, CRP10A (sense 18-mer, corresponding to nucleotides 2812-2829 of phCaR) and the hybrid primer CaRQ (antisense 42-mer, containing 21 nucleotides complementary to nucleotides 3214- 3234 phCaR, and 21 nucleotides complementary to nucleotides 1-21 of pGaqi5). These primers were used to amplify a 443 bp PCR fragment of hmGluR2//CaR. In a WO 99/51641 PCTIUS99/07333 separate PCR reaction, all of Gaqi5 was amplified using a hybrid primer QCaR (sense 42-mer, exactly complementary to primer CaRQ) and the T3 primer commercially available from Stratagene.

The two PCR products generated from the above two reactions were annealed together in equimolar ratios in the presence of the external primers CRP10A and T3, and the Pfu DNA polymerase (Stratagene). The resulting chimeric PCR product was digested with BstE II and Not I (New England Biolabs) and subcloned into pmGluR2//CaR digested with the same two restriction enzymes. The sequence of the resultant chimeric fusion construct, was verified by ABI automated DNA sequence analysis.

VII. Fusion Receptor Protein Linker Addition Constructs A. A linker encoding three alanine residues was incorporated into the phmGluR2//CaR*Gqqi5 construct by mutagenesis (Stratagene QuickChange Mutagenesis Kit). A sense 40-mer, 2CQ+LP, contained 16 nucleotides corresponding to 3219-3234 of human CaR, followed by the 9 nucleotide sequence (GCGGCCGCC) encoding three alanine residues and a NotI restriction enzyme site, and then nucleotides corresponding to nucleotides 1-15 of Gai5. 2CQ+LP was annealed to an antisense 40-mer, 2CQ+LM, the exact complement of 2CQ+LP. These oligos were used in the mutagenesis reaction according to the manufacturer's protocol. Restriction enzyme analysis and DNA sequence analysis confirmed the insertion of the 9 nucleotide linker (GCGGCCGCC) between the C-terminus of phmGluR2//CaR and the N-terminus of Gaqi5. This construct was designated B. Human GABABR2*AAA*Gaqo5 and human These constructs contain the human GABABR2 (hGABAsR2: Genbank Accession AJ 012188) and human GABABRla (hGABAR1Ia: Genbank Accession AJ 012185) fused at their C-terminus to the N-terminus of human G(Xqo5 (hG(qO5: Nature 363:274-276, 1993).

Human GABABR2, hGABABRla, and hG(cqO5 were cloned into the plasmid pcDNA3.1/Hygro+ (Invitrogen) and are designated phGABABR2, WO 99/51641 PCTIUS99/07333 31 phGABABR1a, and phGtqo5. The first reaction used two primers, XcmI-R2 (sense 20-mer, corresponding to nucleotides 2650-2669 of phGABABR2) and the hybrid primer R2/Go5(-) (antisense containing 18 nucleotides complementary to nucleotides 2806-2823 of phGABABR2 and 18 nucleotides complementary to nucleotides 1-18 of hGao5). These two complementary areas flank a 9 nucleotide sequence coding for 3 alanine sequences with a unique NotI restriction site. These primers were used to amplify a 200 basepair PCR fragment.

In a separate PCR reaction, part of hGcXqo5 was amplified using a hybrid primer R2/GcXqo5(+) (sense 45-mer), exactly complementary to R2/Go5(-) and XbaI-Go5 primer (22-mer containing 22 nucleotides complementary to nucleotides 873-895 of These primers were used to amplify a 914 base-pair PCR product.

The two PCR products generated from the above two reactions were annealed together in equimolar ratios in the presence of the external primers; XcmI-R2 and XbaI-Go5, and Pfu polymerase (Stratagene).

The resulting chimeric PCR product was digested with the restriction endonucleases XcmI and XbaI (New England Biolabs) and subcloned into phGABABR2 digested with the same two restriction enzymes. The resulting clone was then digested with HindIII and XbaI and subcloned into phGaqo5 cut with HindIII and XbaI resulting in the chimeric hGABABR*AAA*GaqO5. The chimeric junction between the C-terminus hGABABRIa, the Ala linker, and the N-terminus of hGaqo5 was created using a recombinant PCR strategy similar to those described above.

To construct hGABABRla*AAA*Gqo5, the first reaction used a commercially available T7 primer (Novagen) and the NtI hGBR1 primer (CAGAGTCATGGCGGCCGCCTTATAAAGCAAATGCACTCG) corresponding to nucleotide numbers 1-9 of hGaqo5 and nucleotide numbers 2863-2883 of hGABABRla.

VIII. phmGluR8//CaR Construct This chimera contains the extracellular and transmembrane domains of human mGluR8 linked to the intracellular cytoplasmic tail domain of the human CaR. The chimeric junction between hmGluR8 and the CaR was created using a recombinant PCR strategy WO 99/51641 PCTIUS99/07333 32 similar to those described above.

The first reaction used two primers, CH5A (sense 19-mer, corresponding to nucleotides 2187-2205 of human mGluR8, Stormann et al., International Publication Number W097/48724) and the hybrid primer CH5B (antisense 40-mer, containing 22 nucleotides complementary to nucleotides 2523 2544 of human mGluR8, and 18 nucleotides complementary to nucleotides 2602-2619 of the human CaR). These primers were used to amplify a 375 bp PCR fragment of human mGluR8. In a separate PCR reaction using phCaR in the BlueScript plasmid as template, a 750 bp fragment of the human CaR was amplified using a hybrid primer CH5C (sense exactly complementary to primer CH5B) and the T3 primer commercially available from Stratagene.

The two PCR products generated from the above two reactions were annealed together in equimolar ratios in the presence of the external primers CH5A and T3, and the Pfu DNA polymerase (Stratagene). The resulting chimeric PCR product was digested with BsrG I and Xba I (New-England Biolabs) and subcloned into pmGluR8 digested with the same two restriction enzymes. The sequence of the resultant chimeric construct, pmGluR8//CaR, was verified by DNA sequence analysis.

IX. mGluR8//CaR*Gai5 Construct This construct contains the hmGluR8//CaR chimeric receptor fused to human Gaqi5. The chimeric junction between the Cterminus of hmGluR8//CaR and the N-terminus of Gaqi5 was created using a recombinant PCR strategy similar to that described above for the construction of The first reaction used two primers, CRP10A (sense 18-mer, corresponding to nucleotides 2812-2829 of phCaR) and the hybrid primer Gqi5/CaR (antisense 40-mer, containing 21 nucleotides complementary to nucleotides 3214-3234 phCaR, and 19 nucleotides complementary to nucleotides 1-19 of pGaqi5). These primers were used to amplify a 441 bp PCR fragment of hmGluR8//CaR.

In a separate PCR reaction all of Gcqi5 was amplified using a hybrid primer CaR/Gqi5 (sense 40-mer, exactly complementary to primer Gqi5/CaR) and the Apa I-mut primer (20-mer). The two PCR products generated from the above two reactions were annealed WO 99/51641 PCT/US99/07333 33 together in equimolar ratios in the presence of the external primers CRP10A and Apa I-mut, and the Pfu DNA polymerase (Stratagene).

The resulting chimeric PCR product was digested with BstE II and Apa I (New England Biolabs) and subcloned into pmGluR8//CaR digested with the same two restriction enzymes. The sequence of the resultant chimeric fusion construct, pmGluR8//CaR*Gaqi5, was verified by DNA sequence analysis.

Example 2: Functional Expression of CaR/GABAR2 In vitro transcribed RNA (7 ng) encoding a chimeric CaR/GABAR2 (CaR extracellular and transmembrane domains, and intracellular GABAR2 domain) was co-injected with in vitro transcribed RNA (2 ng) encoding Gal5 into Xenopus oocytes.

Following a 72-hour incubation, the oocytes were voltage-clamped using standard electrophysiological techniques (Hille, Ionic Channels of Exictable Membranes, pp.30-33, Sinauer Associates, Inc., Sunderland, Ma., 1992). Activation of the chimeric receptor was detected by increases in the calcium-activated chloride current.

Application of the CaR activator 100 gM Gd", resulted in reversible, oscillatory increases in the calcium-activated chloride current as shown in Figure 8. These data demonstrate the functional response of the chimeric CaR/GABAR2 receptor upon activation via a site within the CaR extracellular domain. In this assay, the G(l 5 subunit acts to promote signal transduction through intracellular pathways that mobilize intracellular Ca".

Example 3: Expression of Different G-Protein Fusion Receptors The ability of different G-protein fusions to transduce signal resulting from ligand binding is shown in Figure 15. The different G-protein fusion receptors used in this example were as follows: mGluR2//CaR'Gqi5 (SEQ. ID. NO. 37), CaR/mGluR2'Gqi5 (SEQ.

ID. NO. 33), and mGluR8//CaR'Gqi5 SEQ. ID. NO. 41.

Oocytes suitable for injection were obtained from adult female Xenopus laevis toads using procedures described in C. J.

WO 99/51641 PCT/US99/07333 34 Marcus-Sekura and M. J. M. Hitchcock, Methods in Enzymology, Vol.

152 (1987).

Receptor fusion cRNAs were dissolved in water and 50 nl (12.5 ng/oocyte) were injected into individual oocytes.

Following injection, oocytes were incubated at 16 0 C in MBS containing 1 mM CaCl2 for 2 to 7 days prior to electrophysiological recording.

Test substances were applied by superfusion at a flow rate of about 5 ml/min. Receptor fusion activation was determined by measuring the increase in calcium-activated chloride current Increases in ICl were quantified by measuring the peak inward current stimulated by activating agent, relative to the holding current at -60 mV. Application of 100 lM L-glutamate elicited a response from the mGluR2//CaR*GaqiS and mGluR8//CaR*Gaqi5. Application of 100 .M Gd 3 activated the Other embodiments are within the following claims. Thus, while several embodiments have been shown and described, various modifications may be made, without departing from the spirit and scope of the present invention.

EDITORIAL NOTE APPLICATION NUMBER 33801/99 The following Sequence Listing pages 1 to 96 are part of the description. The claims pages follow on pages 35 to 43.

WO 99/51641 PCT/US99/07333 1 SEQUENCE LISTING <110> NPS PHARMACEUTICALS, INC.

<120> G-PROTEIN FUSION RECEPTORS AND CHIMERIC GABA, RECEPTORS <130> 241/086-PCT <140> TO BE ASSIGNED <141> HEREWITH <150> US 60/080,671 <151> 1998-04-03 <160> 47 <170> FastSEQ for Windows Version <210> 1 <211> 612 <212> PRT <213> Human <400> 1 Met Ala Phe Tyr Ser Cys Cys Trp Val Leu Leu Ala Leu Thr Trp His 1 5 10 Thr Ser Ala Tyr Gly Pro Asp Gin Arg Ala Gin Lys Lys Gly Asp Ile 25 Ile Leu Gly Gly Leu Phe Pro Ile His Phe Gly Val Ala Ala Lys Asp 40 Gin Asp Leu Lys Ser Arg Pro Glu Ser Val Glu Cys Ile Arg Tyr Asn 55 Phe Arg Gly Phe Arg Trp Leu Gin Ala Met Ile Phe Ala Ile Glu Glu 70 75 Ile Asn Ser Ser Pro Ala Leu Leu Pro Asn Leu Thr Leu Gly Tyr Arg 90 Ile Phe Asp Thr Cys Asn Thr Val Ser Lys Ala Leu Glu Ala Thr Leu 100 105 110 WO 99/51641 WO 99/1 641PCT/US99/07333 Ser Cys Thr 145 Tyr Lys Gin Val Lys 225 Glu Giu Gly Thr Ile 305 Al a Vai Glu Pro Ser 38 5- Phe Asn 130 Gi y Ile Asn Aia Giy 210 Phe Leu Vali Pro Giy 290 Aia Leu His Giu Vali 370 As n Vai 115 Cys Ser Pro Gin Thr 195 Thr Arg Ile Ile Asp 275 Lys Met Lys Pro Thr 355 Asp Ser Ala Ser Giy Gin Phe 180 Aila Ile Giu Ser Gin 260 Leu Ile Pro Aila Ar g 340 Phe Thr Ser Gin Giu Val1 Val1 165 Lys Met Al a Glu Gin 245 Asn Glu Trp Gin Gly 325 Lys Asn Phe Thr As n His Ser 150 Ser Ser Ala Aia Ala 230 Tyr Ser Pro Leu T yr 310 Gin Ser Cys Leu Ala 390 Lys Ile 135 Thr Tyr Phe Asp Asp 215 Giu Ser Thr Leu Al a 295 Phe Ile Val His Arg 375 Phe Ile 120 Pro Ala Al a Le u Ile 200 Asp Glu Asp Al a Ile 280 Ser His Pro His Leu 360 Gly Arg Asp Ser Val1 Ser Arg 185 Ile Asp Arg Glu Lys 265 Lys Glu Val Gly Asn 345 Gln His Pro Ser Thr Ala Ser 170 Thr Glu Tyr Asp Glu 250 Val1 Glu Ala Val Phe 330 Gi y Giu Giu Leu Leu Ile Asn 155 Ser Ile Tyr Gi y Ile 235 Giu Ile Ile Trp, Gly 315 Arg Phe Gly Giu Cys 395 Asn Ala 140 Le u Ar g Pro Phe Arq 220 Cys Ile Val1 Val1 Al a 300 Gi y Glu Ala Al a Ser 380 Thr Leu 125 Val Leu Leu Asn Arg 205 Pro Ile Gin Val Arg 285 Ser Thr Phe Lys Lys 365 Gly Gly Asp Val1 Gi y Le u Asp 190 T rp Gly Asp His Phe 270 Arg Ser Ile Leu Giu 350 Gly Asp Asp Giu Gly Le u Ser 175 Glu Asn Ile Phe Vali 255 Ser Asn Ser Gly Lys 335 Phe Pro Arg Glu Phe Ala Phe 160 As n His Trp Giu Ser 240 Val1 Ser Ile Leu Phe 320 Lys T rp Leu Phe As n 400 WO 99/51641 W099/1641PCTIUS99/07333 Ile Ser Asp Cys Arg 465 Glu Ser Val1 Leu Asp 545 Cys Thr Giu Thr Ser Tyr Ile Al a 450 His Cys Pro Tyr Trp 530 Cys Cys Asp Asn Glu 610 Ser Asn T yr 435 Asp Leu Gly Giu Al a 515 Ser Leu Phe Ala His 595 Pro Val Val 420 Thr Ile Asn Asp Asp 500 Lys Gly Al a Glu Ser 580 Thr Phe Glu 405 Tyr Cys Lys Phe Leu 485 Gly Lys Phe Gly Cys 565 Al a Ser Thr Leu Leu Lys Thr 470 Val Ser Gly Ser Thr 550 Val Cys Cys Pro Ala Pro Val 455 Asn Gly Ile Glu Arg 535 Arg Glu Asn Ile Ile Tyr 425 Arg Ala Met Tyr Phe 505 Leu Val Gly Pro Cys 585 Lys 3 Asp 410 Ser Gly Trp Gly Se r 490 Lys Phe Pro Ile Asp 570 Pro Glu Tyr Ile Le u Gin Glu 475 Ile Gi u Ile Phe Ile 555 Gi y Asp Ile Thr Al a Phe Val1 460 Gin Ile Val1 Asn Ser 540 Giu Giu Asp Giu His His Thr 445 Leu Val As n Giy Giu 525 As n Gly Tyr Phe Phe 605 Arg 415 Leu Gi y His Phe His 495 Tyr Lys Se r Pro Asp 575 Se r Ser <210> 2 <211> 590 <212> PRT <213> Human <400> 2 Met Leu Leu Leu Leu Leu Leu Ala Pro Leu Phe Leu Arq Pro Pro Gly 1 5 10 WO 99/51641 PCT/US99/07333 4 Ala Gly Gly Ala Gin Thr Pro Asn Ala Thr Ser Glu Gly Cys Gin Ile 25 Ile His Pro Pro Trp Glu Gly Gly Ile Arg Tyr Arg Gly Leu Thr Arg 40 Asp Gin Val Lys Ala Ile Asn Phe Leu Pro Val Asp Tyr Glu Ile Glu 55 Tyr Val Cys Arg Gly Glu Arg Glu Val Val Gly Pro Lys Val Arg Lys 70 75 Cys Leu Ala Asn Gly Ser Trp Thr Asp Met Asp Thr Pro Ser Arg Cys 90 Val Arg Ile Cys Ser Lys Ser Tyr Leu Thr Leu Glu Asn Gly Lys Val 100 105 110 Phe Leu Thr Gly Gly Asp Leu Pro Ala Leu Asp Gly Ala Arg Val Asp 115 120 125 Phe Arg Cys Asp Pro Asp Phe His Leu Val Gly Ser Ser Arg Ser Ile 130 135 140 Cys Ser Gin Gly Gin Trp Ser Thr Pro Lys Pro His Cys Gin Val Asn 145 150 155 160 Arg Thr Pro His Ser Glu Arg Arg Ala Val Tyr Ile Gly Ala Leu Phe 165 170 175 Pro Met Ser Gly Gly Trp Pro Gly Gly Gin Ala Cys Gin Pro Ala Val 180 185 190 Glu Met Ala Leu Glu Asp Val Asn Ser Arg Arg Asp Ile Leu Pro Asp 195 200 205 Tyr Glu Leu Lys Leu Ile His His Asp Ser Lys Cys Asp Pro Gly Gin 210 215 220 Ala Thr Lys Tyr Leu Tyr Glu Leu Leu Tyr Asn Asp Pro Ile Lys Ile 225 230 235 240 Ile Leu Met Pro Gly Cys Ser Ser Val Ser Thr Leu Val Ala Glu Ala 245 250 255 Ala Arg Met Trp Asn Leu Ile Val Leu Ser Tyr Gly Ser Ser Ser Pro 260 265 270 Ala Leu Ser Asn Arg Gin Arg Phe Pro Thr Phe Phe Arg Thr His Pro 275 280 285 Ser Ala Thr Leu His Asn Pro Thr Arg Val Lys Leu Phe Glu Lys Trp 290 295 300 PCT/US99/07333 WO 99/51641 Gly TI 305 Ser TI Ile 'I AsnI Thr Gly 385 Phe Glu Ala.

Lys Gin 465 Leu Asp Met Ala Gly 545 Ser rp 'hr hr ,eu 3lu 370 Lys Lys Al a As n Leu 450 Glu Asr Phe Asr Se 3 Se: T r Lys L Leu I Phe Lys 355 Ala Lys Ile Val1 Thr 435 Thr *Ala Lys -Asn Ser 515 -Gly 0 r Tyr p Ser ~ysI ~sp krg C 340 krg C %.rg Tyr Tyr Giu 420 Arg Lys Pro Thr T yr 500 Ser Ser Lys Lys le ~sp lin in ,ys Val1 A\sp 405 Gly Ser Arg Leu Sex 485 Asr Sei Arc Ly: Th: 56 Ala TI 310 Leu G Ser E Asp I Val Trp 390 Pro His Ile Leu Ala 470 Gly 1Asn Phe SMet Ile 550 Asp 5 hr ;iu 'he l a ?he 375 Phe Ser Ile Ser Lys 455 Tyr Gly Gin Giu Aila 535 Giy Lys Ile Giu Phe Arg 360 Cys Leu Ile Thr Asn 440 Arg Asp Giy Thr Gl 520 Trr Ty Tr Gin G Arg V Ser 7 345 Glu Ile Asn Thr 425 Met His Ala Gly Ile 505 Val Thr -Tyr ?le ,ln T 3 'al L 130 ~sp F [le V~ lal TI 31y 1 Cys 410 Glu Thr Pro Ile Arg 490 Thr Ser Leu Asp Giy 570 hr i5 ~ys 1 ro 'ai 'yr rp 395 Phr Ile Ser Giu Trp 475 Sen Asp Giy I le Sei 55~ GlI Thr G Giu T Ala Gly I Lys 380 Tyr Val Val Gin Giu 460 Al a Gly Gin His Giu 540 Thr y Ser *iu l a ~al e u 365 .,lu kl a D'sp Git' 445 Thr Leu Val Ile Val 525 Gir Lys Pr Val Giy Pro 350 Phe Arg Asp Git' Let' 430 Phe Gly Ala Arq Tyr 510 Val Leu 3Asp )Pro ?he Ile 335 la 1 ryr Let' PAsn Met 415 As n Vai Gly Leu Let' 495 Arc Phe Gir As~ Al 57~ Thr 320 Git' Lys Git' Phe Trp 400 Thr Pro Git' Phe Ala 480 Giu Ala Asp *Gly 3Let' 560 a Asp Gin Thr Leu Ile Lys Thr Phe Arg 585 Phe Let' Ser Gin Lys 590 WO 99/51641 PCT/US99/0 7 33 3 6 <210> 3 <211> 473 <212> PRT <213> Human <400> 3 Met Gly Pro Gly Ala Pro Phe Ala Arg Val Gly Trp Pro Leu Pro Leu 1 5 10 Leu Val Val Met Ala Ala Gly Val Ala Pro Val Trp Ala Ser His Ser 25 Pro His Leu Pro Arg Pro His Ser Arg Val Pro Pro His Pro Ser Ser 40 Glu Arg Arg Ala Val Tyr Ile Gly Ala Leu Phe Pro Met Ser Gly Gly 55 Trp Pro Gly Gly Gin Ala Cys Gin Pro Ala Val Glu Met Ala Leu Glu 70 75 Asp Val Asn Ser Arg Arg Asp Ile Leu Pro Asp Tyr Glu Leu Lys Leu 90 Ile His His Asp Ser Lys Cys Asp Pro Gly Gin Ala Thr Lys Tyr Leu 100 105 110 Tyr Glu Leu Leu Tyr Asn Asp Pro Ile Lys Ile Ile Leu Met Pro Gly 115 120 125 Cys Ser Ser Val Ser Thr Leu Val Ala Glu Ala Ala Arg Met Trp Asn 130 135 140 Leu Ile Val Leu Ser Tyr Gly Ser Ser Ser Pro Ala Leu Ser Asn Arg 145 150 155 160 Gin Arg Phe Pro Thr Phe Phe Arg Thr His Pro Ser Ala Thr Leu His 165 170 175 Asn Pro Thr Arg Val Lys Leu Phe Glu Lys Trp Gly Trp Lys Lys Ile 180 185 190 Ala Thr Ile Gin Gin Thr Thr Glu Val Phe Thr Ser Thr Leu Asp Asp 195 200 205 Leu Glu Glu Arg Val Lys Glu Ala Gly Ile Glu Ile Thr Phe Arg Gin 210 215 220 Ser Phe Phe Ser Asp Pro Ala Val Pro Vai Lys Asn Leu Lys Arg Gin 225 230 235 240 Asp Ala Arg Ile Ile Val Gly Leu Phe Tyr Glu Thr Glu Ala Arg Lys 245 250 255 PCT/US99/073 33 WO 99/51641 Val P Trp P Pro S 2 His I 305 Ile Leu Ala Gly Asn 385 Phe Met Ile Asp Lys 465 he C he L 2 er I 90 lie 9 ~er2 Tyr Gly 370 Gin Giu Ala Gly Lys 450 Thr ys e u :75 1ie ~hr %.sn Ar q A.sp 355 Giy Thr GiN T r Ty~ 4 3 T r Ph Giu V 260 Ile G Asn C Thr G Met T1 His 340 Ala Gly Ile Vai Thr 420 r Tyr 5 p Ile e Arg al ly ys ;iu ~hr ?ro Ilie Arg Thr Ser 405 Le Asi Gi Ph Tyr L Trp T Thr V2 2 Ile V~ 310 Ser C Giu Trp Ser Asp 390 Gly SIle Ser y Gly e Leu 470 ys yr al1 :95 ~al ;in 3iu Al a Gly 375 Gir Hi Gil Th.

Se 45 Se Glu A 2 Ala A 280 Asp G Met L Giu I Thr Leu 360 Val Ile Vai u Gin r Lys 440 r Pro 5 r Gin rg L 65 .sp lu 1 ~eu ?he 345 %l a Arg Tyr Val1 Leu 425 Asp Pro Lys ,eu snf ~et k.sn JTal 330 Giy Leu Leu Arc Phe 410 Gir As~ Al Phe G Trp P Thr G Pro T 315 Giu I Phe Ala Giu Ala 395 Asp SGiy pLeu a Asp ly 'he ;iu ~00 lia -ys 31n Leu Aksp 380 Met Ala2 G15 Se~ Gli 46' Lys L 2 Lys I 285 Ala V Asn Ti LeuI Glu2 Asn 365 Phe Asn Ser Ser r Trp 445 ni Thr 0 ys le al1 ~hr 'hr kl a 350 Lys Asn Ser Gl) Ty~ 4 3 Se: Le Tyr Tyr I Glu Arg Lys 335 Pro Thr Tyr Ser Ser 415 r Lys 0 r Lys u Val al1 .sp Ser 320 Arg Leu Ser Asn Ser 400 Arg Lys Thr Ile <210> 4 <211> 480 <212> PRT <213> Human <400> 4 Met Ala Ser Pro Arg Ser Ser Gly Gin Pro Gly Pro Xaa Pro Pro Pro 1 5 10 PCTIUS99/073 3 3 WO 99/51641 Pro Leu Pro Thr Val Tyr Gly Met Se2 141 Pr Pr( Ty Se Gi 22 Ly Gl

TI

T1 3 Pro Pro Pro Al Pro Leu Ala Pi Pro Pro Ser SE Lys Glu Val A: Glu Leu Ala I: 8.

Phe Leu Asp L 100 Leu Lys Ala P 115 Val Phe Gly G 130 Leu Gin Gly T Val Leu Ala Z o Ser Asp Asn I 180 r Gln Trp Lys 195 r Glu Val Arg 210 u Ile Ser Asp 5 's Lys Leu Lys -n Asn Met Ala 260 {r Gly Ser Lys 275 rp Trp Glu Gln 290 vs Asn Leu Leu .a Arg Le o Gly Al ?r Pro P2 5! La Lys G 70 le Glu G: 5 eu Arg L he Tyr A ly Val C a 'rp Asn L 150 ~sp Lys I kla Val I krg Val Asn Asp Thr Glu 230 Gly Asn 245 Ala Lys Tyr Gin Val His Ala Ala 310 uu aa :0 ly in eu sp .Ys .35 ,et 31' Le' 21 Se As Va

TI

M2 Me Leu Leu Le 25 Trp Gly Ti 40 Leu Ser I) Ser Ile G lie Arg AI 9' Tyr Asp TI 105 Ala Ile L 120 Pro Ser V Val Gin L Lys Tyr P 1 a Pro Ala 1 185 y Thr Leu 200 u Thr Gly 5 r Phe Ser .p Val Arg Li Phe Cys 265 .p Ile Ile 280 ar Giu Ala 95 et Giu Gly u Le 7p A) .e ME Ly A: .7 sn G hr G ys T al T eu S 'ro .70 le I rhr Val Asn Ile 250 Cys Pro Asn Tyr uu aa at rg 5 lu lu yr hr elr .5E lyl 31: Le As 23

I

Al

G]

I;

3 Leu Le Arg Gl Gly Le Gly V; Ser L Cys A! Gly P 1: Ser I 140 Phe A Phe P 1 Lys I n Asp I u Tyr 220 p Pro 5 .e Leu .a Tyr Ly Trp er Ser 300 le Gly 15 ii yy uu 11 sp ro le .la 'h jel Ja 0 31~ Cy Gl Gl 2E

A:

V

Pro Ala Met Leu Leu Asn 110 Asn Ile Ali a Arc a Le' 19 1 Gi y Gi 's Th .y C] .u G) 27 rr G1 rg C' al A Leu LE Pro A Pro L Pro A: 8 Arg P Ala L His L Ala G i Thr I Thr N 175 u Lys I 0 n Arg u Asp .r Ser .n Phe 255 .u As Lu Pro 's Leu so Phe uu :g eu la 0 ro ys .eu Ilu hr Tal iis Phe Ile Val 240 Asp Met Ser Arg Glu 320 05 PCTIUS99/07333 WO 99/51641 Pro Gin Lys Leu Ile 385 Asn Phe Asp Leu.

Lys 465 Leu Tyr Phe Gin 370 Gin Ala Arg Ser Giu.

450 Asp 3er Glu H-i s 355 Arg Asp Met Asfl Arg 435 Ile Lys Ser Arg 340 Gly Ala Phe Asn Gly 420 Giu Ile Thr 325 Giu Tyr Met Asn Glu 405 Giu Vai Asn Ile Gin Tyr Ala Giu Tyr 390 Thr Arg Lys Asp le 470 Ile Lys Asn Asn Tyr Asp 360 Thr Leu 375 Thr Asp Asn Phe Met Giy Val. Gly 440 Thr Ile 455 Leu Giu rhr Lys 345 Gly His His Phe Thr 425 Giu Arg Gin Ile 330 Arg Ile Ala Thr Gly 410 Ile Tyr Phe Leu Ser Ser Trp Ser Leu 395 Val.

Lys Asfl Gin Arg 475 Giy Vai Ser 380 Gly Thr Phe Aia Gly 460 Lys Lys VJai Ile 365 Arg Arg Gly Thr Val 445 Ser I1E Thr Pro 335 Giy Pro 350 Ala Lys His Gin Ile Ile Gin Vai 415 Gin Phe 430 Aia Asp Giu Pro Ser Leu Gin Ser Thr Arg Leu 400 Vai Gin Thr Pro Pro 480 Met 1 Leu Ser Gly c y 63 <210> <211> <212> <213> <400> Val Cys Thr Aia Gin Glu Glv Leu Giu Gly 5 Lys Phe Tyr Ala Phe Pro Lys Tyr His Val1 Glu 70 Arg Trp Ser His 55 Lys Ser Ile Ile 40 Ala Gly Ala Ser 10 Leu Thr 25 Arg Val Lys Gly Ile His Cys Met Asp Glu Arq 75 Pro Met Gly Arg Leu 583

PRT

Human Cys Phe Phe Gin Arq Thr Asp Ile Ile Gly Val Pro Glu Ala Met Leu His Leu Cys Leu Glu Leu Lys Lys PCTIUS99/0733 3 WO 99/51641 Tyr Ala Ile Asp Gin Ile Asn Lys Asp Pro Asp Leu Leu Ser Asn Ile 90 7 Z) Thr L Leu G Ser I Asp I 145 Met Ala Ser Ile Giy 225 Glu Pro Pro Arg Trp 305 e u 1lu ~sp ~ys la 1 Ser Arg Val1 210 Asn Ile Arc Asr 11l 2 9 11' Gly V 1 Gin S 115 Vai L.

Ile Ala Thr Vai 195 Thr Tyr Gly Pro i Aia 275 e Leu e Giy 'a i 00 e r ~ys 3er ksn Al a 180 Val1 Al a Gly Giy Gi 260 Arc Gli Se: Arg I Leu T Cys I~ Giy I Ile 165 Pro Pro Leu Glu Val 245 Giu Aia 2i Ala r Asp le 'hr l.ia Ia 1 150 3iu Pro Gly Ser 230 Cys Phe Val Al Se~ Leu A Phe V Asn G 135 Ile C Arg Leu Asp Trp 215 Gly Ile Glu Ile i Lys 295 r Trp ~sp 'a 1 .20 ly ;iy ,eu Ser Ser 200 Asn Val1 Al a Lys Mel 28( Ly Gi1 Thr C 105 Gin I Asp Ala Phe Asp 185 Tyr Tyr Giu Gin Ile 265 Phe 0 s Leu y Ser a Val :ys lia ?ro kl a Lys 170 tAsn Gin Val Ala Ser 2 50 I1 Al As Ly Th Ser A~ Leu I Pro I 1 Ala S 155 Ile Thr Ala Ser Phe 235 Gin Lys a. Asn ni Gin s Ile 315 r Ile .rg le le er ?ro %rg Glm rhr 220 Thr Lys Arg Gil Se] Al Lei Asp Giu 125 Phe Ser Gin Tyr Al a 205 Leu Gin Ile Leu Asr 28 Gb' Pr Pr' Thr Tr 110 Lys A Thr I Val E Ile Asp 190 Met Al a Ile Pro Leu 270 Asp ,His o Val o Lys yr ~ys 3er 3er 175 Phe Val1 Ser Ser Arg 255 Gil Ile Ph( Ty Ar Al a Ala Pro Ile 160 Tyr Phe Asp Giu Arg 240 Giu Thr Arg Leu r Gin 320 g Ala Gin Ser Glu Ile Giu Asp Ile Giy Ala 325 Phe Giu Asp Gly Arg Al 330 335 340 Tyr Ala 360 Phe Arg Ser Arg Thr Leu Ala Asfl 345 350 Asn Arq Arg 355 Asn Val Trp Phe Giu Phe Trp Giu Asn Phe Gly pCT/uS99/073 3 3 WO 99/51641 Cys L 3 Thr G 385 Lys V His 7 Arg Val Gly 465 Lys Le u Ala Val1 Asn 545 Arg Leu ys Li 70 ly L ral G ~sn M 4et S 4 Asn 1 450 Asp Ser Lys Ser Lys 530 Tyr Pro Glu eu in [et er .35 ~he kla Thr Val ValI Gl~ G1i As Tr Giy S Glu A Phe V 4 His L 420 ThrI Asn Pro Giu *Giu 500 -Cys y Val ni Val n Met p His 580 er H.

rg I 3 ai I 05 ~ys A lie P Gly Tyr 485 Asp Ser Pro Asp As n 565 Ser is le 90 le .sp isp er k.rg 470 Lys Met Let: Cy~ Gli 55' Ar Pr Gly L 375 Ala A Asp A Leu C Gly L 4 Ala C 455 Tyr1 Val Gin Pro 3Cys 535 u Leu 0 g Thr o Trp ys rg ia ,ys ~ys 40 ily ksp Ile Trp Cys 52( Tr~ Se: G1 Arg Asp Vai Pro 425 Giu Thr Ile Giy Aia 505 Lys )Hi.

r Cy~ y Cy Asn Ser His I 380 Ser Ser Tyr G 395 Tyr Ser Met 7 410 Giy Tyr Ile Leu Leu Gly Pro Val Thr 460 Phe Gin Tyr 475 His Trp Thr 490 His Arg Giu Pro Giy Giu Cys Giu Arg 540 Giu Leu Cys .555 Gin Leu Ile 570 le ;iu l a 3iY Tyr 445 Phe Gin Asn His Arc 52E Cy~ Prc Pr' Lys Gin T yr Leu 430 Ile Asn Ile Gin Thr 510 Lys 3 il o Let.

0 Il Lys C Giu G 4 Ala I 415 Cys Arg Giu Thr Le u 495 His Lys IGly Asp e Ile 575 ys ay 00 ~eu ?ro kla As n Asn 480 His Pro Thr Tyr Gin 560 Lys <210> 6 <211> 250 <212> PRT <213> Human <400> 6 Gly Ile Ala Leu Thr Leu Phe Ala Val Leu Giy Ile Phe Leu Thr Ala 1 5 10 PCT/US99/073 3 3 WO 99/51641 Phe Val Leu Gly Val Phe Ile Lys Phe Arg Asn Thr Pro Ile Val Lys 1) C Ala Cys Cys Ser Lys Phe Ile Giu 145 Leu Phe Lys Phe [hr The PArg Cys Ile Leu Trp 130 Asp Gly PhE Ph~ Il Asn T Ser Leu Ile Pro Leu 115 Leu Giu Phe Ala Ile 195 e Pro ~rg ~er krg Leu I'hr 100 Val Tyr Ile Leu Phe 180 Thr Ala Glu L Ser I Gin Val Ser Phe Thr Ile Ile 165 Lys Phe Tyr ,eu ~eu ?ro 70 ys Phe Leu Ala Phe 150 Giy Ser Sei Al Ser TI 4 Phe E 55 Ala Thr2 His Cys Pro 135 Ile Tyr Arg Met a Ser 215 yrI 'he ?he %sn A.rg Thr 120 Pro Thr Thr Lys Leu 200 Thr e u Ile 1ly Arg Lys 105 Phe Ser Cys Cys Lei.

18~ 11* Ty: Leu 1 GiyC Ile Val 90 Trp Met Ser His Leu 170 aPro SPhe r Giy ~eu E ;lu 3erI 75 Leu Trp Gin Tyr Glu 155 Leu Giu Phe Lys 'he ?ro The Leu Giy Ile Arg 140 Gly Al a Asn Ser Gln Val1 Val Leu Val 125 Asn Ser Ala Phe Leu Asp Leu Phe Asn 110 Ile Gin Leu Ile Asn Leu rrp Cys Giu Leu Cys Giu Met Cys 175 Glu Cys Thr Ile Ala Gin Val Leu Ala 160 Phe Ala 190 Ile Phe Val 205 Val T rp Ser Ile Ala Ser Val 220 Giu 225 Phe Val Phe Ala Lys Leu 230 T yr Ala Ile Ala Ile Ser Leu Phe Gly 235 Phe 250 Leu Leu Ala Cys Ile 240 <210> 7 <211> 267 <212> PRT <213> Human PCTIIJS99/07333 WO 99/51641 <400> 7 Leu Phe Ile Ser Val Ser Val Val V Gin A Leu T Gly 1 Trp Lys Giy Hius 145 Asp Asn Leu Ile Leu 225 Asp ali s n lia ~rg ,eu la i rhr M4et 130 Arg Val Thr Giy Asr 210 Cys Al Gys Ser Leu As n Giy His Leu 115 Asp Thr Sex Trp Ile 191 Asi Le~ Al Leu Ser 1 Gin Pro Ala Aia Gin Phe Phe Ser Thr Vai 100 Giu Pro Val Leu Ile Glu Ile Leu 165 Leu Giy 180 Phe Leu )His Arg a Ile Thr a Phe Ala 245 ?he P k.sn I Jai ProI 70 Leu Phe Trp Thr Thr 150 Pro Ile Ala Al a Al a 230 Phe ~sn ~eu ?he ?he rhr Lys Leu 135 Phe Gin Phe Tyi Val 21~ Pr Al Leu Ser SerI 10 Ile Tyr Asn Asn Asn Leu 40 Pro Leu Gly Val Cys Gin Tyr Gly Ser 90 Lys Lys Giu 105 Leu Tyr Ala 120 Ala Ile Trp Ala Lys Giu Leu Glu His 170 Tyr Gly Tyr 185 Giu Thr Lys 200 Gly Met Ala 5 oVal Thr Met a Ser Leu Ala jeuC 3er rhr Leu A~la 75 Met Giu Thr Gin Giu 155 Cys Lys Sex Ile Ile 235 Ile -'is ki a Asp Arg Phe Lys Val Ile 140 Pro Ser Gly Val 220 Le.

Val Ile 1v Val I~ Val C Gly Leu Thr Lys Gly 125 Val Lys Sex Leu Sex 205 Asn 1Sex Phe al1 ~rq ryr Trp Lys G1u 110 Leu Asp Glu Arq Leu 190 Thr Val Sex Sex Leu 1 Tyr Cys His Leu Ile Trp Leu Pro Asp Lys 175 Leu Glu Ala Gin Ser 255 lia Ile 3er Ile Leu Trp Ar g Val1 Leu Ile 160 Met Leu Lys Val Gin 240 Tyr 250 Ile Thr Leu Val 260 Val Leu Phe Val Pro Lys Met 265 WO 99/51641 WO 9951641PCT/US99/07333 <210> 8 <211> 267 <212> PRT <213> Human <400> 8 Leu Val Gin Leu Gly Gly Trp Lys Gly His 145 Asp Asn.

Leu Ile Leu 225 Phe Val Asn Ala Arg Leu Val Thr Met 130 Arg Val Thr Gly Asn 210 [le 'Y3 Se r Leu l:s Gly His Leu 115 Asp Thr Ser Trp Ile 195 Asp Ser Leu Gin Ala Gin Phe Thr 100 Giu Val Ile Ile Leu 180 Phe His Val Ser V Ser Phe A Pro Asn L Ala Vai P 5 Phe Pro P 70 Ser Leu G Vai Phe T Pro Trp L Leu Thr L 1 Giu Thr P 150 Leu Pro C 165 Gly Ile Leu Ala Arg Ala al Leu Ser Ser Leu Gly Ile Val Leu Ala 10 sn eu he 5 he ly hr ,ys ,eu .35 ~he ;ln ?he Cyr Ia 1 215 Ile Asn 40 Pro Val1 Tyr Lys Leu 120 Al a Ala Leu Tyr Giu 200 Gly Tyr 25 Asn Leu Cys Gly Lys 105 Tyr Ile Lys Glu Sly 185 Thr Met Asn Leu Gi y Gin Ser 90 Glu Ala Trp Glu His 170 T yr Lys Ala Ser Thr Leu Al a 75 Met Glu Thr Gin Glu 155 Cys Lys Ser Ile His Ala Asp Arg Phe Lys Val1 Ile 140 Pro Ser Gly Val1 Tyr 220 Val Val Gly Leu Thr Lys Gly 125 Val Lys Ser Leu Ser 205 Asn Arg Sly Tyr Trp Lys Giu 110 Leu Asp Giu Arg Leu 190 Thr Val Tyr Cys His Leu Ile Trp Leu Pro Asp Lys 175 Leu Giu Al a Ile Ser Ile Le u T rp Ar g Val1 Leu Ile 160 Met Leu Lys Val1 Cys Leu Ile Thr Ala Pro Val Thr Met Ile Leu Ser Ser Gin Gin 230 235 240 WO 99/51641 PCT/US99/07333 Asp Ala Ala Phe Ala Phe Ala Ser Leu Ala Ile Val Phe Ser Ser Tyr 245 250 255 Ile Thr Leu Val Val Leu Phe Val Pro Lys Met 260 265 <210> 9 <211> 264 <212> PRT <213> Human <400> 9 Leu Tyr Ser Ile Leu Ser Ala Leu Thr Ile Leu Gly Met Ile Met Ala 1 5 10 Ser Ala Phe Leu Phe Phe Asn Ile Lys Asn Arg Asn Gin Lys Leu Ile 25 Lys Met Ser Ser Pro Tyr Met Asn Asn Leu Ile Ile Leu Gly Gly Met 40 Leu Ser Tyr Ala Ser Ile Phe Leu Phe Gly Leu Asp Gly Ser Phe Val 55 Ser Glu Lys Thr Phe Glu Thr Leu Cys Thr Val Arg Thr Trp Ile Leu 70 75 Thr Val Gly Tyr Thr Thr Ala Phe Gly Ala Met Phe Ala Lys Thr Trp 90 Arg Val His Ala Ile Phe Lys Asn Val Lys Met Lys Lys Lys Ile Ile 100 105 110 Lys Asp Gin Lys Leu Leu Val Ile Val Gly Gly Met Leu Leu Ile Asp 115 120 125 Leu Cys Ile Leu Ile Cys Trp Gin Ala Val Asp Pro Leu Arg Arg Thr 130 135 140 Val Glu Lys Tyr Ser Met Glu Pro Asp Pro Ala Gly Arg Asp Ile Ser 145 150 155 160 Ile Arg Pro Leu Leu Glu His Cys Glu Asn Thr His Met Thr Ile Trp 165 170 175 Leu Gly Ile Val Tyr Ala Tyr Lys Gly Leu Leu Met Leu Phe Gly Cys 180 185 190 Phe Leu Ala Trp Glu Thr Arg Asn Val Ser Ile Pro Ala Leu Asn Asp 195 200 205 WO 99/51641 WO 9951641PCT/US99/07333 Ser Ile 225 Phe Cys Al a 1 Phe Ala Cys Cys Ala Gly Leu Val1 Gin 145 Lys 210 Gly Cys Leu 16 Ile Gly Met Ser Val Tyr Asn Val Gly Ile Met Cys Ile 215 220 Ala Val Ser Phe Leu Thr Arq Asp Gin Pro Asn Val Gin 230 235 240 Val Ala Leu Val Ile Ile Phe Cys Ser Thr Ile Thr Leu 245 250 255 Phe Val Pro Lys Leu 260 <210> <211> <212> <213> <400> Val Val Val Ile Ser Gly Tyr Ser Ser Phe Ala Leu Lys Lys Val Ile 115 Trp Phe 130 Arg Thr 260

PRT

Human Pro Vi Val TI Arq G.

Ile TI Arq A: Leu T1 Ser Vi 100 Thr P1 Val V Leu A: Phe Vai Aia Ile Leu Gly Ile Ile Ala Thr Thr Phe Leu Phe Val 70 Lys Thr Ser Asp Pro 150 Arg Tyr Met Leu Asn Pro Ile 120 Pro Lys Asn Leu Ala Leu Ile Phe Val Ile Arg Asp Leu Al a Gly His Ile Gin Ile Gly 155 Thr Thr Pro Met Arg Ser Leu Ile 140 Vali Ile Ile Thr Phe Phe Al a 110 Gly Tyr Lys Val1 Phe Ile Ser Giu Ser Val1 Gly Cys Ile Ser Asp Leu Ser Leu Ile Cys Ser Leu Giy Tyr Ser Ile Leu Leu WO 99/51641 WO 9951641PCTIUS99/07333 Met Thr Ile Al a 225 Leu Ile Lys His Ser Ser Pro Gin Gin Phe As n Val1 Phe Ile 210 Giu Ser Ile Cys 180 Giu Leu Met Ser Phe 260 <210> <211> <212> <213> <400> Pro Ser Aia Phe Arg Lys Ser Ser Giu Arg Gin Gin Pro Arg Ser Leu 115 Ser Thr 130 11 216

PRT

Human 11 Arg Asn Lys Val Arg Ser Ile Ser Gin Lys Gin Pro Cys Lys 100 Ser Phe His Gin Vai Lys Phe Ile 230 Ser Thr Ala Ser Ser Gin 70 Leu Gin Asp As n Tyr Pro Ile 215 Gin Leu Ile Al a Ser Lys 55 Gin Thr Lys Glu Ser 135 Al a Ile 200 Pro Thr Gly Glu Arg Leu 40 Ser Gin Leu Val1 Pro 120 Leu Ile 185 Gly Ile Thr Met Giu Ala 25 Gly Asn Pro Pro Ile 105 Gin Giu 17 Lys Phe Phe Thr Leu 250 Val1 10 Thr Gi y Ser Leu Gin 90 Phe Lys Ala Thr Thr Phe Leu 235 Tyr Arg Leu Ser Giu Ala 75 Gin Gly Asn Gin Arg Met Gly 220 Thr Met Cys Arg Thr Asp Leu Gin Ser Al a Lys 140 Gi y Tyr 205 Thr Val Pro Ser Arg Gly Pro Thr Arg Gly Met 125 Ser Val1 190 Thr Ala Ser Lys Thr Ser Ser Phe Gin Ser Thr 110 Al a Ser Pro Thr Gin Met Val 255 Al a Asn Thr Pro Gin Gin Val His Asp Glu Cys Ser Ser 240 Tyr Al a Val1 Pro Gin Glu Gin Thr Gi y Thr WO 99/51641 WO 99/164 1PCTIUS99/07333 18 Leu Thr Arg His Gin Pro Leu Leu Pro Leu Gin Cys Gly Giu Thr Asp 145 150 155 160 Leu Asp Leu Thr Val Gin Giu Thr Giy Leu Gin Giy Pro Val Gly Gly 165 170 175 Asp Gin Arg Pro Giu Val Giu Asp Pro Giu Giu Leu Ser Pro Ala Leu 180 185 190 Val Val Ser Ser Ser Gin Ser Phe Val Ile Ser Gly Giy Giy Ser Thr 195 200 205 Val Thr Giu Asn Vai Vai Asn Ser 210 215 <210> 12 <211l> 104 <212> PRT '213> Human <400> 12 Arg Arg Leu Ile Thr Arg Giy Giu Trp Gin Ser Giu Ala Gin Asp Thr 1 5 10 Met Lys Thr Gly Ser Ser Thr Asn Asn Asn Giu Giu Giu Lys Ser Arg 25 Leu Leu Giu Lys Giu Asn Arg Giu Leu Giu Lys Ile Ile Ala Glu Lys 40 Giu Giu Arg Vai Ser Giu Leu Arg His Gin Leu Gin Ser Arg Gin Gin 55 Leu Arg Ser Arg Arg His Pro Pro Thr Pro Pro Giu Pro Ser Gly Gly 70 75 Leu Pro Arg Gly Pro Pro Glu Pro Pro Asp Arg Leu Ser Cys Asp Gly 90 Ser Arg Vai His Leu Leu Tyr Lys 100 <210> 13 <211> 104 <212> PRT <213> Human WO 99/51641 WO 9951641PCT/US99/07333 Arg Met Leu Glu Leu Le u Ser Ile Gin Vai Ser Leu Tyr Giy <400> Arg Leu Lys Thr Leu Giu Giu Arg Arg Ser Pro Arg Arg Val <210> <211> <212> <213> <400> Thr Leu Phe Thr Thr Ser Giu Asn Giu Giu Ile Lys Asn Phe Thr Ser Giu Ser Arg Pro Le u 14 197

PRT

Human 14 Arg Thr Gin Asn Val Asn His Arg Val Thr Gin Asn Thr Giu 100 Arg Ser Asn Giu His 70 Pro Leu Asn Gin Gin Leu Met 70 His Ser Gly Thr Arg Leu 55 Pro Giu Tyr Pro Lys Aila Arg 55 Gin Tyr Thr Giu Asn Giu 40 Arg Pro Pro Lys Asp Lys Ser 40 Met Leu.

Gin Asp Trp Asn Leu His Thr Pro Al a Glu 25 Thr Lys Gin Glu Gi y 105 Gin Asn Giu Gin Pro Asp Ala Asp Ser Ile Asp Leu Gly Ser Giu Lys Leu Pro 75 Arg Thr Ser Arg Thr Thr 75 Asn Lys Giu Giu Ile Gin Giu Leu Gin Lys Leu Glu Pro Asp Ala Ala Glu Ile Ser Pro Ser Asn Thr Giu Leu Giu Ile Ile Gin Lys Ala Arg Ser Cys Arg Se r Gly Asp Lys Le u Leu 110 Thr Arg Lys Gin Gly Gly Phe Ser Gin Asp Thr Leu Asn WO 99/51641 WO 9951641PCT/US99/07333 His Arg Gin 145 Pro Pro Met Leu Thr 130 Arg Ser Thr Val1 Asp 115 Cys Arg Ile Ala Ser 195 Gin Lys Leu Gly Ser 180 Gly Asn Asp Ser Gi y 165 Pro Leu Pro Pro Leu 150 Val1 Arg Gin Ile 135 Gin Asp His Leu 120 Glu Leu Al a Arg Gin Asp Pro Ser His 185 Trp Ile Ile Cys 170 Val Asn As n Leu 155 Val Pro Thr Ser 140 His Ser Pro Glu Glu Al a Cys Phe 190 Pro His Tyr Val1 175 Arg Ser Ile Leu 160 Ser Val1 <210> <211> <212> <213> <400> His Pro Giu 1 Vai Thr Ala Arg Pro Asn Asn Ser Lys Ser

PRT

Human Gin Asn Val Gin Lys Arg Lys Arg Ser Phe Lys Ala Val 5 10 Ala Thr Met Gin Ser Lys Leu Ile Gin Lys Gly Asn Asp 25 Gly Glu Val Lys Ser Giu Leu Cys Glu Ser Leu Glu Thr 40 Ser Ser Val Giu Phe Pro Met Val Lys Ser Gly Ser Thr 55 <210> 16 <211> 374 <212> PRT <213> Human <400> 16 Met Ala Arg Ser Leu Thr Trp Gly Gys Cys Pro Trp Cys Leu Thr Glu 1 5 10 WO 99/51641 PCT/US99/07333 Glu Leu Gly Ile Leu Met Ala Lys Arg 145 Val Pro Asn Val Asn 225 Cys Leu Ile Glu Glu Pro His Ile Asp Ser Pro 130 Ala Tyr Thr Glu Gly 210 Val Leu Phe Leu Lys Gin Gly Gly Tyr Arg Leu 115 Tyr Cys Tyr Ala Tyr 195 Gly Ile Glu Ser Phe 275 21 Thr Ala Ala Arg Ile Asp Gin Glu Ile Asn Arg Ile Leu Lys Glu Val Gln Leu 100 Val Ala Tyr Leu Gin 180 Cys Gln Ala Glu Thr 260 Leu Lys Ser Gly Asn Gin Met Val Glu Ser 165 Asp Phe Arg Leu Asn 245 Ile Asn Gin Gly Tyr 70 Ile Ile Thr Ala Arg 150 His Val Ser Ser Ile 230 Asp Leu Lys Glu Lys 55 Ser Phe Pro Gin Met 135 Arg Leu Leu Val Glu 215 Tyr Gln Glu Thr Phe 295 Arg 40 Ser Glu Val Phe Asp 120 Gin Arg Glu Arg Lys 200 Arg Leu Glu Leu Asp 280 25 Glu Thr Glu Ser Ser 105 Pro Tyr Glu Arg Ser 185 Lys Arg Ala Asn Pro 265 Ile Glu Leu Phe Ile Asp Arg 75 Met Gin 90 Arg Pro Tyr Lys Leu Trp Phe His 155 Ile Ser 170 Arg Met Thr Lys Lys Trp Ser Leu 235 Arg Met 250 Trp Phe Leu Glu Lys Lys Arg Ala Asp Val Arg 140 Leu Glu Pro Leu Ile 220 Ser Glu Lys Asp Gly 300 Leu Gin Ala Met Ser Ser 125 Asp Leu Asp Thr Arg 205 His Glu Glu Ser Lys 285 Leu Met Phe Ile Lys 110 Thr Ala Asp Ser Thr 190 Ile Cys Tyr Ser Thr 270 Ile Leu Arg Arg Asp Gln Phe Gly Ser Tyr 175 Gly Val Phe Asp Leu 255 Ser His Leu Ile Leu Ala His Glu Ile Ala 160 Ile Ile Asp Glu Gin 240 Ala Val Thr Ser His Leu Ala Thr Tyr 290 Pro Ser Phe Gin Pro Arg Arg Asp WO 99/51641 PCT/US99/07333 22 Ala Glu Ala Ala Lys Ser Phe Ile Leu Asp Met Tyr Ala Arg Val Tyr 305 310 315 320 Ala Ser Cys Ala Glu Pro Gin Asp Gly Gly Arg Lys Gly Ser Arg Ala 325 330 335 Arg Arg Phe Phe Ala His Phe Thr Cys Ala Thr Asp Thr Gln Ser Val 340 345 350 Arg Ser Val Phe Lys Asp Val Arg Asp Ser Val Leu Ala Arg Tyr Leu 355 360 365 Asp Glu Ile Asn Leu Leu 370 <210> 17 <211> 374 <212> PRT <213> Human <400> 17 Met Ala Arg Ser Leu Thr Trp Arg Cys Cys Pro Trp Cys Leu Thr Glu 1 5 10 Asp Glu Lys Ala Ala Ala Arg Val Asp Gin Glu Ile Asn Arg Ile Leu 25 Leu Glu Gin Lys Lys Gin Asp Arg Gly Glu Leu Lys Leu Leu Leu Leu 40 Gly Pro Gly Glu Ser Gly Lys Ser Thr Phe Ile Lys Gin Met Arg Ile 55 Ile His Gly Ala Gly Tyr Ser Glu Glu Glu Arg Lys Gly Phe Arg Pro 70 75 Leu Val Tyr Gin Asn Ile Phe Val Ser Met Arg Ala Met Ile Glu Ala 90 Met Glu Arg Leu Gin Ile Pro Phe Ser Arg Pro Glu Ser Lys His His 100 105 110 Ala Ser Leu Val Met Ser Gin Asp Pro Tyr Lys Val Thr Thr Phe Glu 115 120 125 Lys Arg Tyr Ala Ala Ala Met Gin Trp Leu Trp Arg Asp Ala Gly Ile 130 135 140 Arg Ala Cys Tyr Glu Arg Arg Arg Glu Phe His Leu Leu Asp Ser Ala 145 150 155 160 WO 99/51641 WO 9951641PCTIUS99/07333 23 Vai Tyr Tyr Leu Ser His Leu Glu Arg Ile Thr Giu Giu Gly Tyr Val 165 170 175 Pro Thr Ala Gin Asp Val Leu Arg Ser Arg Met Pro Thr Thr Gly Ile 180 185 190 Asn Giu Tyr Cys Phe Ser Val Gin Lys Thr Asn Leu Ar Ile Val Asp 195 200 205 Val Gly Gly Gin Lys Ser Giu Arg Lys Lys Trp Ile His Cys Phe Glu 210 215 220 Asn Val Ile Ala Leu Ile Tyr Leu Ala Ser Leu Ser Giu Tyr Asp Gin 225 230 235 240 Cys Leu Glu Giu Asn Asn Gin Glu Asn Arg Met Lys Giu Ser Leu Ala 245 250 255 Leu Phe Gly Thr Ile Leu Glu Leu Pro Trp Phe Lys Ser Thr Ser Val 260 265 270 Ile Leu Phe Leu Asn Lys Thr Asp Ile Leu Glu Glu Lys Ile Pro Thr 275 280 285 Ser His Leu Ala Thr Tyr Phe Pro Ser Phe Gin Giy Pro Lys Gin Asp 290 295 300 Ala Glu Ala Ala Lys Arg Phe Ile Leu Asp Met Tyr Thr Arg Met Tyr 305 310 315 320 Thr Gly Cys Val Asp Gly Pro Giu Gly Ser Lys Lys Gly Ala Arg Ser 325 330 335 Arg Arg Leu Phe Ser His Tyr Thr Cys Ala Thr Asp Thr Gin Asn Ile 340 345 350 Arg Lys Val Phe Lys Asp Val Arq Asp Ser Val Leu Ala Arg Tyr Leu 355 360 365 Asp Glu Ile Asn Leu Leu 370 <210> 18 <211> 3234 <212> DNA <213> Human <400> 18 atggcatttt atagctgctg ctgqgtcctc ttggcactca cctggcacac ctctgcctac gggccagacc agcgagccca aaaqaagggq gacattatcc ttgggggqct ctttcctatt 120 cattttqqag taqcagctaa aqatcaagat ctcaaatcaa ggccggagtc tgtggaatgt 180 WO 99/51641 WO 9951641PCT/US99/07333 atcaggtata ataaacagca tgcaacaccg gattctttga gtggtgggag tacattcccc aagtctttcc atcgagtatt ccggggattg gaact cat ct aattccacgg aaggaqattq agctcctccc gctctqaagg aagtctgtcc caagaaggtg ggcgacaqgt atcagcagtg tacttaqcag agagggctct ctgaagcacc gagtgtggtg ggctccatcg ctcttcatca aactgcagcc tgctgctttg gcctgtaaca aaggagatcg gtgctgqgca cccattqt ca tgcttctcca caqccggcct cgtgtcctcc ctcaacctgc atctggctct atcttcatca tgcctgctgg ttcaatgaag ttcattccag atcctggcag ctcttcaagc ttcaaggtgq agccttggag gaagacccat caagagcagc agatgcaagc gagcctcaga cagaaaagca acggacttag cggccagagg agctttqtca atttccgtgg gcccagccct tttctaaggc accttgatga caactggctc aggtcagtta tccgaaccat tccgctqgaa agaaattccg cccagtactc ccaaagtcat tccggcgcaa tgatcgccat ctgggcagat acaatggttt caaaaggacc ttagcaacag tcqagacccc tctactccat tcaccaatgg tacggcatct acctqgtgg tgtttaagga acgagqagaa gagactqcct agtgtgtgga agtgcccaqa agtttctgtc ttttcctgac aggccaccaa gctccctgtt ttggcatcag tggtgtttga agttcctgct acaccgcgcc cgtgccacga ctgccatctg ccaagttcat cctatgccag ccagctttgg catcccqcaa ctgcccqggc gctccacggg tcccacagcc agcagcagcc agaagqtcat agaacgccat gcgatacgct atctgaccgt tggaqgaccc tcagtggtgg gtttcgctgg ttacaggcta tgatatttgc catagaggag tcttcccaac cttggaagcc gttctgcaac aggcgtctcc tgcctcctcc ccccaatqat ctgggtgggc agaggaagct tgatgaggaa cgtggttttc tatcacgggc gcctcagtac cccaggcttc tgccaaggag tttacctgtg ctcgacaqcc ttacatagat tgcccacgcc ctcctgtgca aaactttaca qaactattcc agtcgggtat aatcctgtgg ggcagggacc gtgtcctgat tgacttctgg gtggacggaq agcctttgtg ccgagagctc cttcat cggg cttcgtgctc ggccaagatc ggttttcctc cccctcaaqc gggctccctc cttcttcttt caccttcagc cacctatggc cttgctggcg caccatcgag cacgctgcgc atccaccccc cgagaggcag cctgaccctc ctttggcagc ggcccacggg gacccgacac ccaggaaaca tgaagagttg aggcagcact ttgacgctgg accctgagtt tgctcagagc acggcagtgg agcagactcc gagcaccagg acaattqcag gaggaaagqg gagatccagc tccagtggcc aagatct qgc ttccacgtgg cgggaattcc ttttgggaag gacacctttc ttccgacccc tacacgcatt ttgcaagata gacatcaaga aacaatatgg atcatcaact tacaacgtct agtggqttct agqaaaggga ggggagtata tccaatgaga ccctttggga ctgqtgtgt tcctacctcc gagccccagg tgcatctcat cccaccagct tgcaccttca taccgcaac atggccctgg gccttcaagt atgctcatct aagtttgtct tgcatcttct gaggtgcgtt cgcaqcaacq tcctcctcca aagcagcagc ccacagcaqc qqcacqgt ca aattctacgc cagccattac ggtctgcaag tccccagcac gttacagaaa gatacaggat ttgttgctca acattccctc caaatctgct tcagcaacaa ccactgccat ctgatqacqa atatctgcat atgtggtaga cagatcttga tggccaqcga ttggcggcac t gaagaaggt aaacatttaa tgagaggtca tctgtacagq tacggatatc tatatacctg aagttgaggc gggagcaggt ggcacctctc atgccaaqaa ccagggaggt tcattgaqggg gtgatgagac accacacctc tcgcactcac ttatcaagtt tcctcttctc actggacgtg gcatcctggt tccaccgcaa tgcagattgt aggagctgga gcttcctgat cccggaagct tcttcatcgt ctgccgtaga tcaacaagat gcagcaccgc tctcccgcaa tcagcagcaa agccgctggc aacgatctca ccttctcact accagaactc tcccgctgca gacctgtggg ttgtagtgtc acgtagtgaa atttgacact aaacaaaatt tacgattgct ggggctcttc gaatcaattc ggcagacatc ctatgggcgg cqacttcagt ggtgattcaa gcccctcatc ggcctgqgcc cattggattc ccatcccagq ctgccacctc cgaagaaagt ggatgagaac ctacaatgtq cttacctggg gtggcaggtc qacctttgat cccagaggat gggagaaaga gcccttctcc ggagcccac agatgccagt ctgcattgcc cctctttgcc ccgcaacaca cctgctctgc ccgcctgcqc gaaaaccaac gtggtggggg catctgtgtg qgatgagatc cggctacacc gccgqagaac ctggatctc ggtgattgcc ctacatcatt agctcacgct gcggtccagc qagcaacagc cctaacccag gcagcaqccc gagctttgat cctggaggcc gtgcgqqgaa tggagaccag cagttcacag t tca 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3234 WO 99/51641 WO 9951641PCT/US99/07333 <210> 19 <211> 3464 <212> DNA <213> Human <400> 19 atgttgctgc caqaccocca atcaggtacc tatgagattq tqcctgqcca tccaagtctt qctctggacg t cccggagca cgaacgccac qgctggccag agccqcaggg gatccaggcc atccttatqc aacctcattg cccactttct tttgaaaagt tcgactctgg cagagtttct atcatcgtgg gagcgtctct ttcaagatct gqccacatca atqacatccc acaggaqqct ctgaacaaqa aacaaccaga gtctctqgcc cagcttcagg tcctggtcca atcaaqacat ctgggcattg tatatccaga ttagctgctg ttcgtctgcc atgttcacca tggaggaaga gatgtcctca tttgccaagg tgcagctcca ctgctgctqg gatcaccggg cctgtcacca atagttttct atcacccgag aacaacaacg atcattgctg caqctccgct ggaccccctg tgctgctact acqccacctc ggggcctgac agtatgtgtg acggctcctg atttgaccct gagcccgggt tctgtagtca actcagaacg ggggccaggc acatcctgcc aagccaccaa ctgqctgcaq tgctttccta tccgaacgca ggggctggaa acgacctqga tctcaqatcc gacttttcta ttgqaagaa acgacccttc caactgagat agqaatttgt tccaggaggc catctggagg ccattaccga atgtggtgtt gtggcagct a aaacagataa tccgcttcct tcctagctgt actcacagcc tcttccccct aggcccqcct agatttggtg ctctggaacc ctctcgccat aggaacctaa ggaagatgaa gaatcttcct ctgtgqgcat tgattctgt c cctcctatat gggaatqgca aggaggagaa agaaagaqga cccggcgcca agccccccga ggcgccactc agaaggttgc tcgggaccag ccggggggag gacagatatg ggaaaatggg ggatttccgg gggccagtgg gcgcgcagtg ctgccagccc ggactatgag gtacctatat ctctqtctcc tggctccagc cccatcagcc gaagattgct ggaacgagtg agctgtgccc tgagactqaa gtacgtctgg tatcaactgc tgtcatgctg ggagaaacta accqctggcc aggcggccgt ccaaatctac tgatgccagc caagaagatt atggattgqa gt cacagaaa tgtctgtctg caacctgaac ggggctcgat ctggctcctg ggtccacacg ctgqaagctq ctggcagatc ggaagatatt tacatggctt tgcttatgag ggctatctac cagccagcag cactcttgtt gtcggaggcq gtcccggctg qcgtgtctct cccaccgaca ccggcttagc tt cctccgcc cagatcatac gtgaaggcta cgcgaggtgg gacacaccca aaggttttcc tgtgaccccg agcaccccca tacatcgggg gcggtggaga ctcaagctca gagctqctct acgctggtgg tcaccagccc acactccaca accatccagc aaggaggctg gtcaaaaacc gcccggaaag ttcctcattg acagtqgatg aatcctgcca accaaqcga c tatgatgcca tctggtgtqc cgggcaatga ggctctcgga ggctactatg gggtcccccc ctctttatct tcctttaaca aacctqactg ggttaccaca ggcctqggct gtcttcacaa tatgccacag gtggaccctc gacgtctcta ggcattttct accaagagtg aatgtggcag gatgcagcct gtgctctttg caggacacca ttggagaagg gaactgcgcc cccccagaac tgtgatggga ccccgggcgc acccgccctg tcaacttcct tggggcccaa gccgctgtgt tgacgggtgg acttccatct agccccactg cactgtttcc tggcgctgga tccaccacga acaacgaccc ctgaggctgc tgtcaaaccg accctacccg agaccactga gaattgagat tqaaqcgcca ttttttgtga ggtggtatgc agatgactga atacccgcag tgaaaagaca t ctgggcctt gcctggagga actcttcqtc tqgcatggac acagcaccaa cagctgacca ccgtctcagt tctacaactc ctgtgggctg ttgggaggaa ttagtctggg agaaggaaga tgqgcctgct tgcaccggac ttctgcccca atggttacaa tgtccactqa tcctgtgcct ttgcctttgc tgcccaagat tqaagacagg agaaccgtga atcagctcca cctctqggg gtcgagtgca gqgcgggqcg ggaagggqgc gccagtggac ggtccgcaag ccgaatctqc ggacctccca qgtgggcagc ccaqgtgaat catgagcggg ggacgtgaat cagcaagtgt tatcaagatc taggatgtqg qcagcgtttc cgtgaaactc ggtcttcact tactttccgc ggatgcccga ggtgtacaag tqacaattgg gqcggtggag catttccaac ccctgaggag qgcactggcc ct tca acta c ctttgagggt gcttatcgag ggatgatctt ga ccct ggt c tctctccagc acatgtccgt ctcactggct ccagtttcct ctacggttcc aaagaaggag ggtgggcatg cattgagaca gctggaqcat ggggctgctg qaagatcaat catcactgct ctctcttgcc gcgcaggctg gtcatcgacc actggaaaag qtct cggcaq cctgcccaqg tttgctttat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 WO 99/51641 WO 9951641PCTIUS99/07333 aagtgagggt gcaggggact ctcatctctt ctctgggaaa caatttagtt ctcactqcat agctcctctg ccaccccaaa cttctatact ntttcgccaa <210)' <211D <212, <213, agggtgaggg caggaagcag gtaaatacat cagacctttt cgtacctggc ctttctcttc cctttgtgct ggggcctctc ttctcacatg ggntcacatg aggacagqcc ggggtccca qtccccctgt tctctcttac ttgaagctqc ccatgcaaca ctgttcctgt cttttctcca tggctcccc ctcccttgc agt aggggga tccccagctg gagttctggg tgcttcatgt tcactgctca ccctcttcta ccagcagggg ctgtcataat tgaattttgc tctggctccg gggaaagqga ggaagaacat ctqatttggg aattttgtat cacgctgcct gttaccacgg tctcccaaca ctct t tccat ttcctttggg tqca gaggggaagg gctatccaat tctctcatac cacctcttca cctcagcagc caacccctgc agtgctcttt cttacttgcc gagctcattc 2940 3000 3060 3120 3180 3240 3300 3360 3420 3464 2887

DNA

Human <400> atqgggcccg gcgqcagggg cgggtccccc atgagcgggq gacgtgaata agcaagtgtg atcaagatca aggatgtgga cagcgtttcc gtgaaactct gtcttcactt actttccgcc gatgcccgaa gtgtacaagg gacaattggt gcggtggagg atttccaaca cctgaggaga gcactggccc ttcaactaca tttqagggtg cttatcgagc gatgatcttt accctggtca ctctccagcc catgtccgtt tcactggctt cagtttcctt tacggttcca aagaaggaqt gtgggcatgg attgagacat ctggagcatt gggctgctgc aagatcaatg gggccccttt tggctccggt cgcacccctc gctggccagg gccgcagqga atccagqcca tccttatgcc acctcattgt ccactttctt ttgaaaagtg cqactctgga agagtttctt tcatcgtggg agcgtctctt tcaagatcta gccacatcac tgacatccca caggaggctt tgaacaagac acaaccagac tctctggcca agcttcaggg cctggtccaa tcaagacatt tgggcattgt atatccagaa taqctgctgt tcgtctgcca tgttcaccaa ggaggaagac atgtcctcac ttgccaagga gcagctccag tgctgctggg atcaccgggc tgcccgggtg gtgggcctcc ctcagaacgg gggccaggcc catcctgccg agccaccaag tggctgcagc gctttcctat ccgaacgcac gggctggaag cgacctggag ctcagatcca acttttctat tgggaagaag cgacccttct aactgagatt ggaatttgtg ccaggaggca atctggagga cattaccgac tgtggtgttt tggcagctac aacagataaa ccgcttcctg cctagctgtt ctcacagccc cttccccctq ggcccgcctc gatttggtgg tctggaaccc tctcgccatc ggaacctaag gaagatgaat aatcttcctt tgtgggcatg gggtggccac cactcccccc cgcgcagtgt tgccagcccg gactatgagc tacctatatg tctgtctcca ggctccagct ccatcagcca aagattgcta gaacgagtga gctgtgcccg gagactgaag tacgtctggt atcaactgca gtcatgctga gagaaactaa ccgctggcct gqcgqccgtt caaatctacc gatgccagcq aagaagattg tgqattggag tcacagaaac gtctqtctgt aacctqaaca gggctcgatg tgqctcctgg gtccacacgg tggaagctgt tggcagatcg qaagatattg acatggcttg gcttatgaga qctatctaca tgccgcttct atctcccgcg acatcgggqc cggtggagat tcaagctcat agctgctcta cgctggtggc caccagccct cactccacaa ccatccagca aggagqctgg tcaaaaacct cccggaaagt tcctcattgg cagtggatga atcctgccaa ccaagcgact atqatgccat ctggtgtgcg gggcaatgaa qctctcggat gctactatga ggtccccccc tctttatctc cctttaacat acctgactgc gttaccacat gcctgggctt tcttcacaaa atgccacagt tggaccctct acgtctctat gcattttcta ccaagagtgt atgtggcagt ggttgtgatg gcctcactcg actgtttccc ggcgctggag ccaccacgac caacgaccct tgaqqctgct gtcaaaccgg ccctacccgc gaccactgag aattgagatt gaagcgccag t t tt tgt gag gtggtatgct gatgactgag tacccgcagc gaaaagacac ctgggccttg cctggaggac ctcttcgtc ggcatggacg cagcaccaag agctgaccag cgtctcagtt ctacaactca tgtgggctgc tgggaggaac tagtctggqc gaaggaagaa gggcctgctg gcaccggacc tctgccccag tggttacaag gtccactqag cctqtgcctc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 WO 99/51641 WO 9951641PCTIUS99/07333 attgagacat ctqgagaatt gggctgctga aagatcaatq atcactqctc tctcttgca agcaggctga tcatagacca ctggaaaaga tatcggaagc atgcacaggg ttgatttata agqggaaggg ctatcaaatc ctctcatacc aactcttcac ctcagcagaa aacccct ttgacaagga gcagatccag tgctgatggg atcaccggga ctgtcaacat tagttttata tcaaacgagg acaacaacga tcattgctga aqatccgata gacacctga agtgagggta cagggaata tcatatattg tctggqaaaa aatttaqtta tcatgcatc ggaacataag gaagatgaat aatattcatt tgtgggcatg gattatgtaa atcatatatc ggaatggaag ggaggagaag gaaagaggag ccgqcgacac gcccccqgac gggtgaggga aggaagcagg taaataaatg aqaccttttt gtacctggat tttctcttca gaagatattg acatggcttg gattatgaga gatatataca agccagcagg actcttgttg taggagqcgc taccggctgt cgtgtctatg ccaccgaa aggcttagct ggacaggca gggtacacat tccatgtg ctctcttact tgaagctgct catgcaaa acgtatctat qcattttata ccaagagtgt atgtggcagt atgcagactt tgatctttgt aggacaccat tggagaagga aactgcgca cccaagaacc gtgatgggag gtagqgggag ccccagatgg agttctgggc gcttcatgta cactgctcac catcttctag tctgccccag tggttacaag gtcactgag cctgtgcctc tgcctttgca gcccaagatg gaagacaggg gaaccgtgaa tcaactccag atct gggggc tcgagtqaat ggaaaggqag gaagaacatg tgatttgggt attttgtatc acgctgcctc ttaccacggc 1920 1990 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2887 <210> 21 <211> 3144 <212> DNA <213> Human <400> 21 atggcttcc gcgcgcctgc ggatggga ctcatgccgc gtggaactgg ctgcggctct ataaaatacg atcattgcag cctgttctaq gcggtgaatc ctgacgcaag ggcgaggaa aaaaagctga gcaaaagtgt attccgggct cgctgcctcc cccctgagct gagtaaaaa ggcatctggg cggcaccagc aatgccatga gagagaatgg gagtacaaag tccgaacac ctctacaga ttcttcaaa aaccttata agaggagctc tactgctact gggacgaaac tcaccaagga ccatcgaga atgacacgga ggccgaacca agtccctcca aagataagaa cagccattat acqttcagag ttqagatttc aggggaatga tatgttgtga ggtacgagaa ggaagaatct ccaagcagat acaagcggtc tcatcgcaa ggatccagga acgagaccaa ggaccattaa ctgtggccga caaaagacaa tactctctgc tcaagaaccg tccttggagg cgggaagaaa gatgct gccg caggccgcag ggtggccaag gatccgcaac gtgcgaaaa cttgatggtg aggatggaat aaaataccct gaagttgctc gttctctgag agacacagag tgtgcggatc atacgaggag ttcttggtgg gcttgctqcc caagaccatc aggagt gggg gacactgcag cttcaactaa Cttcttcggg atttactaa aacaatggag gacaataatc catcaccatc gaatcagaag gatgatctcc gggccgcngc ctgctgctgc aacagcagac ggcagcatag gagtcactcc gcaaaagggt tttggagqg ctggtgcagc tatttctttc aagcactaca gtgcggaatg aqcttctcca atccttggca aacatgtatg gagaaggt ga atggagggct taaggaaaga cccagcaagt agggcaatgg acggaccaca gtcacgggta tttcaagaa atcatcaatg ctggagcagc ctcgggatga ctcataaaga tatgcttaca cgccgcagaa ctctggagcc cgccgctctc ggagcggtgt tgcgccccta tgaaagcctt tctgtccatc tttcttttgc ggaaagtacc agtggaagag acctgactgg aagat aactg agtttgacca gtagtaaata acacggaaga acattggcgt ctcacagca tcagggta agaatgca cgctgggcag aagttgtatt gcagggaggt acaccatcag tgaggaagat tcatggccag tgtagagtcc tatttctctt accgccgccc aggggcctgg aataatgggc gatcccagcc cttcatcgac ctacgatgca cgtcacatcc tgaaaacg ataagacaat cgtgggcaag agttctgtat taccagtgtc gaatatggca tcagtggatc caactcatca ggatttcgag gtatgagaga cgcctacgat tgccagcagc gatcatactc ccggaatggg gaaggtggga gttccaagga ctccctacct t gatt ttat a atacatgaac tqgaattgat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 WO 99/51641 WO 9951641PCTIUS99/07333 tatgcctaca gtcagcatcc atcatgtgca ttctgcatcg gtgccgaagc cagttcactc aaccaagcca.

aagatcacag gaaaagacca ggaaacttca aatccccagc gatataaact cacgcctacc cccaccgcca ctgtaagggt ggggtctgct cctctcagga.

acctgacctc tgggacgtct aaaaaaaaaa <210,' <211- <212,' <21 3, agggacttct ccgcactcaa tcatcggggc tggctctggt tcatcaccct agaatcagaa.

gcacatcccg agctggataa cctacattaa ctgagagcac tacagtggaa.

ctccagaaca tcccatccat gcccccgcca gggaggcctg gcagaaacac ccactcggat.

gagccttatt.

tccttaacat catgttgttc cgacagcaag cgctgtctcc catcatcttc gagaacaaac gaaagaagat cctggagggc agacttggaa acagaaccac agatggagga cacaacagag cat ccagcgt cggaggcgtg cagacatgtg 9gcccggggc tgtcggctct ggcactcagg tgtgaagtcc ctgcaaacaa ggttgtttct tacatcggga ttcctgaccc tgcagcacca ccagatgcag tctaaaacgt ctacagtcag gaggtcacca taccaagagc aaggccattt ccctctcgaa cggctgt ccc gacgccagct ccaccctcct ctcccccgtg ggctgcggag tggacaggac ttatttcttc ggaggcgctg tagcttggga tgagtgtcta gggaccagcc tcaccctctg caacgcagaa ccacctcggt aaaaccatcg tgcagctgca tcaatgacat taaaaaatca catgcaaaga tccagctccc gtgtcagccc tccgagtcat acagaaccac aagctgggca ggggcagggg acaaagaaga ggatatcaaa.

gacccgcaac caacgtgggg caatgtgcag cctggtattc caggcgattc caccagtgtg cctgcgaatg ggacacacca.

cctcaacctg cctcgatcaa.

tcctatagaa catcctccac ctgcgtcagc ggtctcgggc actgggcaga ccatggctgg gagacttggc ggaacggaaa cttgcaaaaa 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3144 aaaaaaaaaa aaaa 22 2880

DNA

Rat <400> 22 atgctgctgc acccccaacg aggtaccgtq gagatcgaat ctggccaacg aagtcttatt ctggatggaq cqgagcgtct acgccacact tggccqggggg cgcagaqaca ccagggcaag ctcatgcctg cttattgtgc acgttcttcc gaaaagtggg acgctggatg atttcttct atcgtgggac aggct ctttg aagacctatg cacatcacca acqtcacagg gqagqctt cc aacaagacgt aaccagacca tgctgctqgt ccacctcgga gcttgactcg atgtgtgccg gctcctggac tgaccctgga cccgggtgga gtagtcag cagaacggcg gccaggcctg tcctgccgga ccaccaagta gctgtaqttc tctcatatgg ggacgcatcc gctggaagaa acctggagga cggatccagc ttttctatga ggaagaagta acccgtcaat cqgagattgt aatttgtqga aggaggcacc ctqgaggaqg ttacaqacca qcctctcttc aggttgccag cqaccaggtg aggggagcgc gqatatggac aaatgggaag gttccgatgt ccagtggagc tgcagtatac ccagcccgcg ctacgagctc cttgtacgaa tgtctccaca ctccagttca atccgccaca gatcgctacc gcgaqtgaaa tgtgcctgtt gacggaagcc cgtctggttc caattgtaca catgctgaac gaaactaacc actggcctat tggtcgttcc gatctaccgg ctccgccccc attatacatc aaggccatca gaggtqgt gg acacccagcc gttttcctga gaccccgact acccccaagc atcggggcgc gtggagatgg aagcttat cc ctactctaca cttgtagctg ccagccttgt ctccacaat c atccaacaga gaggctggga aaaaacct ga cgqaaagttt ctcatcgggt gtggaagaaa cctgccaaca aagcggctga gatgctatct qgcgtgcgcc gccatgaact tgqgcgctgg cgccctggga acttcctgcc ggcccaaggt gctgtgtccg cqggt gggga tccatctggt cccactgcca tgtttcccat cgctggagga accacgacag atgaccccat aggctgcccg caaaccgaca ccacccgggt ccaccgaggt t cgagatcac agcgtcaaga tttgtqaggt ggtatgctga tgaccgaggc cccgaagcat aaagacaccc gggccttgqc tggagqactt cctcctcctt cggggcgcag aggtggcatc tgtggactat gcgcaaatgc aatctgctcc cctcccagct gggcagctcc ggtgaatcga gagcgggggc cgttaacagc caagtqtgac caagatcatt gatgtgqaac gcggtttcc gaaactcttc cttcacctca tttccgacag tgctcqaatc ctataaggaa caactqgttc ggqtgagggc ttccaacatg cgaqgagact tttggccttg taactacaac tgagggcgtt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 WO 99/51641 WO 9951641PCT/US99/07333 tctggccatg ctacagggcg tggtccaaaa aagacattcc ggcattgttc atccagaact gctgctgtct gtctqccagg ttcaccaaga aggaagaccc gtcctgactc qccaaggag agctccaaga ct gctqggaa cacagggccg gtgaccatga gtgttctctt acccgaqgggg aacaacgagg atcgctgaga ctccqctcac ccctctgagc tggtctttga gcagctacaa cggacaagtg gtttcctgtc ttqctgttgt cccagcccaa tccctctcgg cccqcctttg tctggtgggt tagagccctg ttgccatctg aaccaaagga agatgaatac tctttcttgc tgggcatggc tcctttccag cctacat cac aatggcagtc aagagaagtc aagaggagcg ggcgccaccc cccctgaccg tgccagcggc gaaqatcggc gattggaqggg tcagaaactc ctgtctgtcc cctgaacaat gctggatggt gctcttgqgc ccacacagtc gaaactctat gcaqattqtg agacatcgat gtggcttqgc ttacgaaacc tatctacaat tcagcaqgac tctggttgtg tgaaacgcag ccqactgttg cgtctctgaa cccaacaccc gcttagctgt tcccggatqg tactacgaca tctcccccag tttatctccq tttaacatct ctgactgctg taccacatag ttgggcttta ttcacqaaga gccactgtgg gaccccttqc gtctccattc attttctatg aagagcgtgt.

gtcgcggtcc gcagcctttg ctctttgtgc gacaccatga qagaaggaaa ctgcgccatc ccagatccct gatgqgagtc catggacact gcaccaagga ctgaccagac tctcagttct acaactccca tgggctgctc ggagaagcca gtctgggcta aggaggagaa gcctgctggt accgaaccat tgccccagtt.

gttacaaggg ccactgaaaa tgtgtctcat cctttgcctc ccaagatgcg aaacaggatc accgagaact agctccagtc ctgggggcct gagtacattt tatcgagcag tgatctttcc cttggtcatc ctccagcctg cgttcgttat actggcactg gttcccgttt tgqctctatg gaagqagtqg gggcatggat tgagactttt ggagcactgc gctgctgctg gatcaatgac cactgctcct tctggccatc caggctgatc atccaccaac ggaaaagatc tcggcagcaa tcccagggga gctttacaag 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 <210> 23 <211> 2532 <212> DNA <213> Rat <400 23 atgggcccgg gcggctgggg agggtccccc atgagcgggg gacgttaaca agcaagtgtg atcaagatca cggatgtgga cagcggtttc gtgaaactct gtcttcacct actttccgac gatgctcgaa gtctataagg gacaactggt gcggtggagg atttccaaca cccgaggaga gctttggcct tttaactaca tttgagggcg cttatcgagc ggggaccctg tggctccggt cgcacccct c gctggccgg gccgcagaga acccagggca ttctcatgcc accttattgt ccacgttctt.

tcgaaaagtg caacgctgga agagtttctt tcatcgtgq aaaggctctt tcaagaccta gccacatcac tgacgtcaca ctggaggctt tgaacaagac acaaccaqaC tttctggcca agctacaggg taccccagtg gtgqgcctct ctcagaacgg gggccaggcc catcctgccg agccaccaag tqgctgtagt qctctcatat ccggacgcat gggctggaag tgacctqgag ctcggatcca acttttctat tgggaagaag tgacccgtca cacggagatt qgaatttgtg ccaqgaqgca gtctgqagga cattacagac tgtggtcttt cggcagctac gggtggccgc cactcccctc cgtgcagtat tgccagcccg gactacqagc tacttgtacq tctgtctcca ggctccagtt ccatccgcca aagatcgcta gagcgagtqa gctgtgcctg gagacggaag tacgtctggt at caat tgt a gtcatgctga gagaaactaa ccactggcct ggtggtcgtt cagatctacc gatqccagcg aagaagat cg tgcCtcttct atctcccgcg acatcgggqc cggtggagat tcaagcttat aactactcta cacttgtagc caccagcctt cactccacaa ccatccaaca aagaggctgg ttaaaaacct cccggaaagt tcctcatcgg cagtggaaga accctgccaa ccaagcggct atgatgctat ccggcgtqcg gggCcat gaa gctcccggat qctactacqa gctggtgatg gcctcacccg gctgtttccc ggcgctggag ccaccacgac caatgacccc t ga ggct gc c gtcaaaccga tcccacccgq gaccaccgag gatcgagatc gaagcgtcaa tttttgtgag gtggtatgct aatgaccgag cacccgaagc gaaaagacaC ctgggccttg cctgqaqgac ctcctcctcc ggcatggaca cagcaccaag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 WO 99/51641 WO 9951641PCTIUS99/07333 gatgatcttt cctggtccaa accttggtca tcaagacatt ctctccagcc tqqgcattgt cacgttcgtt atatccagaa tcactggcac tggctgctgt cagttcccgt ttgtctgcca tatggctcta tqttcaccaa aagaaggagt gqaggaagac qtgggcatgg atgtcctgac attgagactt ttgccaagga ttgqagcact gcagctccaa qggctgctgc tgctgctggg aagatcaatg accacagggc atcactgctc ctgtqaccat tctctggcca tcqtgttctc cgcaggctga tcacccgagg tcatccacca acaacaacga ctggaaaaga tcatcgctga tctcggcaqc aactccgctc cttcccaggg gaccctctga ttgctttaca ag aacggacaag ccgtttcctg tcttqcztqtt ctcccagccc cttccctctc qgcccgcctt gatctggtg cctagagccc tcttgccatc ggaaccaaag gaagatgaat aatctttctt cgtgqgcatg gatcctttcc ttcctacatc ggaatggcag qgaagagaag gaaagaggag acggcgccac gccccctgac tggattggag tctcagaaac gtctgtctqt aacctgaaca gggctggatg tqgctcttgg gtccacacag tgqaaactct tggcagattg gaagacatcg acgtggcttq gcttacgaaa gctatctaca agtcaqcagg actctggttg tctgaaacqc tcccgactgt cgcgtctctg cccccaacac cggcttagct ggtctccccc tctttatctc cctttaacat atctgactgc gttaccacat gcttgggctt tcttcacgaa atgccactgt tggacccctt atgtctccat gcattttcta ccaagagcgt atgtcgcggt acgcagcctt tqCtctttgt aggacaccat tggagaagga aactgcgcca ccccagatcc gtgatgggag aqctgaccag cgtctcagtt ctacaactcc tgtgggctgc agggagaagc tagtctgggc gaaggaggag gggcctgctg gcaccgaacc tctgccccag tggttacaag gtccactgaa cctgtgtCtc tgcctttgcc gcccaagatg gaaaacagga aaaccgagaa tcagctccag tt ct ggggq c tcgagtacat 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2532 <210> <211> <212> <213> 24 960

PRT

Rat <400> 24 Met 1 Leu Leu Leu Leu Val Pro Leu Leu Arg Pro Leu Gly Ala Gly Gly Ala His Pro Pro Gin Thr Pro Asn Ala Ser Glu Gly Cys Gin Ile Ile Thr Arg Asp Trp Glu Gly Gly Ile Arg Tyr Arg Giy Gin Val Lys Ala Ile Asn Leu Pro Val Asp Tyr Glu Ile Giu Tyr Val Cys Arg Gly Giu Arg 70 Giu Val Val Gly Pro Lys Val Arg Lys Leu Ala Asn Gly Trp Thr Asp Met Asp Thr Pro Ser Arg Cys Vai Arg Ile Cys Leu Thr Gly 115 Ser 100 Lys Ser Tyr Leu Thr 105 Leu Giu Asn Gly Lys Vai Phe 110 Val Giu Phe Gly Asp Leu Pro Al a 120 Leu Asp Gly Ala Arg 125 WO 99/51641 PCT/US99/07333 31 Arg Cys Asp Pro Asp Phe His Leu Val Gly Ser Ser Arg Ser Val Cys 130 135 140 Ser Gin Gly Gin Trp Ser Thr Pro Lys Pro His Cys Gin Val Asn Arg 145 150 155 160 Thr Pro His Ser Glu Arg Arg Ala Val Tyr Ile Gly Ala Leu Phe Pro 165 170 175 Met Ser Gly Gly Trp Pro Gly Gly Gin Ala Cys Gin Pro Ala Val Glu 180 185 190 Met Ala Leu Glu Asp Val Asn Ser Arg Arg Asp Ile Leu Pro Asp Tyr 195 200 205 Glu Leu Lys Leu Ile His His Asp Ser Lys Cys Asp Pro Gly Gin Ala 210 215 220 Thr Lys Tyr Leu Tyr Glu Leu Leu Tyr Asn Asp Pro Ile Lys Ile Ile 225 230 235 240 Leu Met Pro Gly Cys Ser Ser Val Ser Thr Leu Val Ala Glu Ala Ala 245 250 255 Arg Met Trp Asn Leu Ile Val Leu Ser Tyr Gly Ser Ser Ser Pro Ala 260 265 270 Leu Ser Asn Arg Gin Arg Phe Pro Thr Phe Phe Arg Thr His Pro Ser 275 280 285 Ala Thr Leu His Asn Pro Thr Arg Val Lys Leu Phe Glu Lys Trp Gly 290 295 300 Trp Lys Lys Ile Ala Thr Ile Gln Gin Thr Thr Glu Val Phe Thr Ser 305 310 315 320 Thr Leu Asp Asp Leu Glu Glu Arg Val Lys Glu Ala Gly Ile Glu Ile 325 330 335 Thr Phe Arg Gin Ser Phe Phe Ser Asp Pro Ala Val Pro Val Lys Asn 340 345 350 Leu Lys Arg Gin Asp Ala Arg Ile Ile Val Gly Leu Phe Tyr Glu Thr 355 360 365 Glu Ala Arg Lys Val Phe Cys Glu Val Tyr Lys Glu Arg Leu Phe Gly 370 375 380 Lys Lys Tyr Val Trp Phe Leu Ile Gly Trp Tyr Ala Asp Asn Trp Phe 385 390 395 400 Lys Thr Tyr Asp Pro Ser Ile Asn Cys Thr Val Glu Glu Met Thr Glu 410 415 WO 99/51641 PCT/US99/07333 32 Ala Val Glu Gly His Ile Thr Thr Glu Ile Val Met Leu Asn Pro Ala 420 425 430 Asn Thr Arg Ser Ile Ser Asn Met Thr Ser Gin Glu Phe Val Glu Lys 435 440 445 Leu Thr Lys Arg Leu Lys Arg His Pro Glu Glu Thr Gly Gly Phe Gin 450 455 460 Glu Ala Pro Leu Ala Tyr Asp Ala Ile Trp Ala Leu Ala Leu Ala Leu 465 470 475 480 Asn Lys Thr Ser Gly Gly Gly Gly Arg Ser Gly Val Arg Leu Glu Asp 485 490 495 Phe Asn Tyr Asn Asn Gin Thr Ile Thr Asp Gin Ile Tyr Arg Ala Met 500 505 510 Asn Ser Ser Ser Phe Glu Gly Val Ser Gly His Val Val Phe Asp Ala 515 520 525 Ser Gly Ser Arg Met Ala Trp Thr Leu Ile Glu Gin Leu Gin Gly Gly 530 535 540 Ser Tyr Lys Lys Ile Gly Tyr Tyr Asp Ser Thr Lys Asp Asp Leu Ser 545 550 555 560 Trp Ser Lys Thr Asp Lys Trp Ile Gly Gly Ser Pro Pro Ala Asp Gin 565 570 575 Ile Leu Val Ile Lys Thr Phe Arg Phe Leu Ser Gin Lys Leu Phe Ile 580 585 590 Ser Val Ser Val Leu Ser Ser Leu Gly Ile Val Leu Ala Val Val Cys 595 600 605 Leu Ser Phe Asn Ile Tyr Asn Ser His Val Arg Tyr Ile Gin Asn Ser 610 615 620 Gin Pro Asn Leu Asn Asn Leu Thr Ala Val Gly Cys Ser Leu Ala Leu 625 630 635 640 Ala Ala Val Phe Pro Leu Gly Leu Asp Gly Tyr His Ile Gly Arg Ser 645 650 655 Gin Phe Pro Phe Val Cys Gin Ala Arg Leu Trp Leu Leu Gly Leu Gly 660 665 670 Phe Ser Leu Gly Tyr Gly Ser Met Phe Thr Lys Ile Trp Trp Val His 675 680 685 Thr Val Phe Thr Lys Lys Glu Glu Lys Lys Glu Trp Arg Lys Thr Leu 690 695 700 WO 99/51641 WO 9951641PCTIUS99/07333 Giu 705 Vai Ile Ile Leu Phe 785 His Ile Phe Val Trp 865 As n Leu His Thr Pro Leu Giu Leu Gly 770 Leu Arg Thr Ala Val 850 Gin As n Giu Gin Pro 930 Trp Thr Thr Pro 755 Ile Aila Aia Ala Phe 835 Leu Ser Glu Lys Leu 915 Pro Lys Leu Tyr Ala Thr Val Gly Leu Leu Vai Gly Met Asp Leu Phe 740 Gin Phe T yr Val Pro 820 Ala Phe Giu Giu Ile 900 Gin Asp Ala 725 Al a Leu Tyr Giu Giy 805 Val Ser Vai Thr Giu 885 Ile Ser Pro 710 Ile Lys Giu Gly Thr 790 Met Thr Leu Pro Gin 870 Lys Aia Arg Ser T rp Giu His Tyr 775 Lys Al a Met Al a Lys 855 Asp Ser Giu Gin Gly 935 Gin Giu Cys 760 Lys Se r Ile Ile Ile 840 Met Thr Arg Lys Gin 920 Giy Ile Pro 745 Ser Gly Vai Tyr Leu 825 Val Arg Met Leu Giu 905 Leu Leu Val1 730 Lys Ser Leu Ser Asn 810 Ser Phe Arg Lys Leu 890 Giu Arg Pro 715 Asp Giu Lys Leu Thr 795 Val1 Ser Ser Leu Thr 875 Giu Arg Ser Arq Pro Asp Lys Leu 780 Giu Ala Gin Ser Ile 860 Gly Lys Val Arq Gly 940 Leu Ile Met 765 Leu Lys Vai Gin Tyr 845 Thr Ser Giu Ser Arg 925 Pro His Asp 750 As n Leu Ile Leu Asp 830 Ile Arg Ser As n Giu 910 His Ser Arg 735 Val1 Thr Gly Asn Cys 815 Al a Thr Gly Thr Arg 895 Leu Pro Glu 720 Thr Se r Trp Ile Asp 800 Leu Ala Leu Giu Asn 880 Giu Arg Pro Pro Pro Asp Arg Leu Ser Cys Asp Gly Ser Arg Val His Leu Leu Tyr Lys <210> <211> 844 <212> PRT <213> Rat WO 99/51641 PCT/US99/07333 34 <400> Met Gly Pro Gly Gly Pro Cys Thr Pro Val Gly Trp Pro Leu Pro Leu 1 5 10 Leu Leu Val Met Ala Ala Gly Val Ala Pro Val Trp Ala Ser His Ser 25 Pro His Leu Pro Arg Pro His Pro Arg Val Pro Pro His Pro Ser Ser 40 Glu Arg Arg Ala Val Tyr Ile Gly Ala Leu Phe Pro Met Ser Gly Gly 55 Trp Pro Gly Gly Gin Ala Cys Gin Pro Ala Val Glu Met Ala Leu Glu 70 75 Asp Val Asn Ser Arg Arg Asp Ile Leu Pro Asp Tyr Glu Leu Lys Leu 90 Ile His His Asp Ser Lys Cys Asp Pro Gly Gin Ala Thr Lys Tyr Leu 100 105 110 Tyr Glu Leu Leu Tyr Asn Asp Pro Ile Lys Ile Ile Leu Met Pro Gly 115 120 125 Cys Ser Ser Val Ser Thr Leu Val Ala Glu Ala Ala Arg Met Trp Asn 130 135 140 Leu Ile Val Leu Ser Tyr Gly Ser Ser Ser Pro Ala Leu Ser Asn Arg 145 150 155 160 Gin Arg Phe Pro Thr Phe Phe Arg Thr His Pro Ser Ala Thr Leu His 165 170 175 Asn Pro Thr Arg Val Lys Leu Phe Glu Lys Trp Gly Trp Lys Lys Ile 180 185 190 Ala Thr Ile Gin Gin Thr Thr Glu Val Phe Thr Ser Thr Leu Asp Asp 195 200 205 Leu Glu Glu Arg Val Lys Glu Ala Gly Ile Glu Ile Thr Phe Arg Gin 210 215 220 Ser Phe Phe Ser Asp Pro Ala Val Pro Val Lys Asn Leu Lys Arg Gin 225 230 235 240 Asp Ala Arg Ile Ile Val Gly Leu Phe Tyr Glu Thr Glu Ala Arg Lys 245 250 255 Val Phe Cys Glu Val Tyr Lys Glu Arg Leu Phe Gly Lys Lys Tyr Val 260 265 270 WO 99/51641 WO 9951641PCT/US99/07333 Trp Pro His 305 Ile Leu Ala Gly Asn 385 Phe Met Ile Asp Lys 465 Leu Ile As n Pro Val 545 Phe Ser 290 Ile Ser Lys Tyr.

Gly 370 Gin Giu Ala Giy Lys 450 Thr Ser T yr Asn Leu 530 Cys Leu Ile 275 Ile Asn Thr Thr Asn Met Arg His 340 Asp Ala 355 GlIy Gly Thr Ile Gly Vai Trp Thr 420 Tyr Tyr 435 Trp Ile Phe Arg Ser Leu Asn Ser 500 Leu Thr 515 Gly Leu Gin Ala Gly Cys Giu Thr 325 Pro Ile Ar q Thr Ser 405 Leu Asp Gly Phe Gly 485 His Ala Asp Arg Trp Thr Ile 310 Ser Giu Trp Ser Asp 390 Gly Ile Ser Gly Leu 470 Ile Val1 Val Gly Leu 550 Tyr Val1 295 Val Gin Giu Ala Gly 375 Gin His Giu Thr Ser 455 Ser Val Arg Gly Tyr 535 T rp Aila 280 Giu Met Giu Thr Leu 360 Vali Ile ValI Gin Lys 440 Pro Gin Leu Tyr Cys 520 His Leu Asp Giu Leu Phe Gly 345 Al a Arq Tyr Val1 Leu 425 Asp Pro Lys Aila Ile 505 Ser Ile Leu Asn Trp Met Thr Asn Pro 315 Val Giu 330 Gly Phe Leu Ala Leu Giu Arg Ala 395 Phe Asp 410 Gin Gly Asp Leu Ala Asp Leu Phe 475 Val Val 490 Gin Asn Leu Ala Gly Arg Gly Leu 555 Phe Giu 300 Ala Lys Gin Leu Asp 380 Met Al a Gly Ser Gin 460 Ile Cys Ser Leu Ser 540 Gly Lys 285 Ala Asn Leu Glu Asn 365 Phe Asn Ser Ser Trp 445 Ile Ser Leu Gin Ala 525 Gin Phe T yr Glu Arg Lys 335 Pro Thr T yr Ser Ser 415 Lys Lys Val Ser Phe 495 Asn Val Pro Leu Asp Gly Se r 320 Arg Leu Ser As n Ser 400 Arg Lys Thr Ile Val 480 Asn Leu Phe Phe Gly 560 WO 99/51641 WO 9951641PCTIUS99/07333 Tyr Lys Leu Al a Ala 625 Leu Tyr Glu Gi y Val 705 Ser Val Thr Giu Ile 785 Ser Pro Ser Gly Lys Tyr Ile 610 Lys Glu Gly Thr Met 690 Thr Leu Pro Gin Lys 770 Ala Arg Ser Gys Ser Glu Al a 595 Trp Giu His Tyr Lys 675 Ala Met Ala Lys Asp 755 Ser Giu Gin Gi y Asp 835 Met Giu 580 Thr Gin Giu Cys Lys 660 Ser Ile Ile Ile Met 740 Thr Arq Lys Gin Gly 820 Gly Phe 565 Lys Val1 Ile Pro Ser 645 Gly Val1 Tyr Leu Vai 725 Arg Met Leu Glu Leu 805 Leu Ser Lys Glu Leu Asp 615 Giu Lys Leu Thr Val1 695 Ser Ser Leu Thr Giu 775 Arg Ser Arg Val1 Ile Trp Leu 600 Pro Asp Lys Leu Giu 680 Al a Gin Ser Ile Gi y 760 Lys Val1 Arg Gi y His 840 Trp Arg 585 Val Leu Ile Met Leu 665 Lys Vai Gin Tyr Thr 745 Ser Glu Ser Arq Pro 825 Leu Trp 570 Lys Gly His Asp Asn 650 Leu Ile Leu Asp Ile 730 Arg Ser Asn Giu His 810 Ser Leu Val Thr Met Arg Val 635 Thr Giy Asn Cys Al a 715 Thr Gly Thr Arg Leu 795 Pro Giu T yr His Leu Asp Thr 620 Ser T rp Ile Asp Leu 700 Ala Leu Glu As n Giu 780 Arg Pro Pro Lys Thr Glu Val 605 Ile Ile Leu Phe His 685 Ile Phe Vali Trp Asn 765 Leu His Thr Pro Val1 Pro 590 Leu Glu Leu Giy Leu 670 Arg Thr Al a Val1 Gin 750 Asn Giu Gin Pro Asp 830 Phe 575 Trp Thr Thr Pro Ile 655 Aia Ala Ala Phe Leu 735 Ser Giu Lys Leu Pro 815 Arg Thr Lys Leu Phe Gin 640 Phe Tyr Val1 Pro Al a 720 Phe Giu Giu Ile Gin 800 Asp Leu WO 99/51641 WO 9951641PCTIUS99/07333 <210> 26 <211> 2616 <212> DNA <213> Human <400> 26 atgggatcgc ccagccaaga caccagaagg cgcctgqagg ggcgtgcgcc cagqcactgg tgccccgacg ggcggttcct ccacagatta tttgcccgca ttcttcaact attgaqgcct gtgggccgtg cccagtgccc gccagccagc gaqagtgtgg tcctacccca cggaacccct gactgcgcag gtggtcaatg cccaacacca gactttgtgc gtccgctttg gcagqcagtg gacaccagcc agtgaqccct ctctgcattc ggcctgggct atccgctggg gccaccctqt tcaggtcggg ttcatcttca actgccttct ttcggtgggg gccatctqcc qaggcaccgg tgcaaccacc ctctgcacgc ttcattggct tatqtcacct agcggctccg ccgcagaaga agggccagct ggccgtgagg tgcttgcgct aggtgctgac gcggcccagc ccatgctttt tgggtgcaca actttgtgcg gctcttatgc acagtgatgt gctacgcctc cagtgcctcc ggacctatgt ttgagctaga ccatgagccg gcgtggctgt gcctcaatgc tggcaggcaq t cagtgactt ggttccgtqa cccactctct cagtgtacgc cccggctctg tcaacgtcaa accgctttgg ggcgctatcg tcatcccatg gcctccagaa cgtgccagcc actggcccaa gcgat gcct g ttgtgctggg agctctgcta ttgccaaqcc ctgtctgcta cccgggaggg tggcacttat gcacaggcaa gcgatgcaag tttatgcctt tcaccatgta ccagtgacta tggtgcttgq acgtggttag ccagccttgg tggtggactc cctggcactg cctggaggga agaggactgt tgcactggac catcctcgac tgcctcactc gacccatgqt ctccatccag taccagtgcc tgacttcttc gtccactgag ggctcgtgcc cgcggccttt cctgttcacc cagcttcacc tgagggggct tgcctcctac attctgggag ccgggctgtg catggcccat tgacgcgatg gtttgatgcc tgatggtatt ctaccagaaq ggcctcaccg tgaggtgaag ctatgaqtac tgccagcctg qgctgtggga tgtctttgtg catcctgctq atccacggca ctcagccctg tgcccagcgg ctcgggccag ggagacagcc tatgttgggc caatactcgc caccacctgc ccgqtacag ctgcctcttt ccaccgggca ccaagggtct gacaacgtca ctgccgctgt gacttggtgc ggtcctgtca cgcatcaacc agttgctcca agccgtggtg gatgctccca gtqgccaacc aagctgagtg caagccaagg gcctctgagg cgcaacatct gagggtgtgg cgttctgagg tgggtqqcca gctqagggtg ttccagagcc cagaggttcc ccctttgaac gcgctccaca cggccagtta ccctttcgcc ggccgctaca gtgggctact tcagccggcc agtgtgcagc cgattggacg actqgctgct cctgtcacca cggcacaatg ggtggtgtct gtgtgtacct ctcaccaaga ccacqcttca ctgctcatcg cccgaacggc tcgctggcct aagtgccccg atcatctggc accaccacca gcgcccaagc cccaccagcc ggctcccaqt t cqct t ggtgctgt tgggtqggct atgagcaccg qtgacccgca aggacacaca ctgatggatc ctgccatcac tcttqaggct acaagtcccg ccatggctga gcgactatgq qtgtggccac tgcgagccct atgcccggga gtgatggttg ctatcaccat tggacccttg gctgcagctt aggagtccaa acatgcaccg acgggcgccg cagctgacac acatcttcac gggcagaagg ccctqgccgc cgggcgaagt aattcacttg tcgaactgcc tcgcctgcct ccacaccagt tcctctgcta tacggcgtct ccaaccgcat tcagtcctgc tggtcgcctg ggqaggtqgt acaatgtgct aaaacttcaa tggcattgtt tgtgcgtgtc tgcacatcat gctttggcag ttgtccccac ggctgagggc gttcccagtg tggcatccag cctgctgcct tgcgctggag acgccacatc tggtgttatt atttcagatc ctatgactac gattctccgc cgagacaggc ctcggagaaa gctgcagaag gctgct tgct gggggccctg cgagctggcc gaacaacagc ccggcagcga gatcatgttt tgccctctgc cctctacaag ccacaatgaq ctatctgcgt cttgactctg ctctcgctgc ctgctgctqg cgctgat tgt ccaggagtac cggtgccctq ggtcaaggcc ctgcatgacc tggtttgggc tgcacgcatc ctcacaggtg gctggtggtg gacactgcgc cctcatcgcg cgaggccaag gcccatcttc agtcagcctc cctcttccag tgctgctgcc tgtttgcaat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2616 WO 99/51641 PCT/US99/07333 38 <210> 27 <211> 824 <212> PRT <213> Human <400> 27 Met Gly Ser Leu Leu Ala Leu Leu Ala Leu Leu Pro Leu Trp Gly Ala 1 5 10 Val Ala Glu Gly Pro Ala Lys Lys Val Leu Thr Leu Glu Gly Asp Leu 25 Val Leu Gly Gly Leu Phe Pro Val His Gin Lys Gly Gly Pro Ala Glu 40 Asp Cys Gly Pro Val Asn Glu His Arg Gly Ile Gin Arg Leu Glu Ala 55 Met Leu Phe Ala Leu Asp Arg Ile Asn Arg Asp Pro His Leu Leu Pro 70 75 Gly Val Arg Leu Gly Ala His Ile Leu Asp Ser Cys Ser Lys Asp Thr 90 His Ala Leu Glu Gin Ala Leu Asp Phe Val Arg Ala Ser Leu Ser Arg 100 105 110 Gly Ala Asp Gly Ser Arg His Ile Cys Pro Asp Gly Ser Tyr Ala Thr 115 120 125 His Gly Asp Ala Pro Thr Ala Ile Thr Gly Val Ile Gly Gly Ser Tyr 130 135 140 Ser Asp Val Ser Ile Gin Val Ala Asn Leu Leu Arg Leu Phe Gin Ile 145 150 155 160 Pro Gin Ile Ser Tyr Ala Ser Thr Ser Ala Lys Leu Ser Asp Lys Ser 165 170 175 Arg Tyr Asp Tyr Phe Ala Arg Thr Val Pro Pro Asp Phe Phe Gin Ala 180 185 190 Lys Ala Met Ala Glu Ile Leu Arg Phe Phe Asn Trp Thr Tyr Val Ser 195 200 205 Thr Glu Ala Ser Glu Gly Asp Tyr Gly Glu Thr Gly Ile Glu Ala Phe 210 215 220 Glu Leu Glu Ala Arg Ala Arg Asn Ile Cys Val Ala Thr Ser Glu Lys 225 230 235 240 Val Gly Arg Ala Met Ser Arg Ala Ala Phe Glu Gly Val Val Arg Ala 245 250 255 WO 99/5164 1 PTU9/7 PCT/US99/07333 Leu Glu Phe Al a 305 Ser Trp Phe Ala Val1 385 Pro Arg Arg Gly Arg 465 Asp Al a Gin Glu Leu Asp Thr 290 Gly Tyr Asn Arg Val 370 T yr Asn Leu Pro Ile 450 Tyr Thr Ser Pro T yr 530 Gin Al a 275 Trp Ser Pro Asn Cys 355 Pro Al a Thr Tyr Ala 435 Gly Arg Ser Arq Gly 515 Arg Lys 260 Arg Val1 Giu Ile Ser 340 Ser Phe Met Thr Lys 420 Asp Arg Tyr Leu Cys 500 Giu Leu Pro Glu Ala Giy Ser 325 Arg Phe Glu Ala Ar g 405 Asp Thr Tyr Gin Ile 485 Ser Val Asp Ser Leu Ser Al a 310 Asp Asn Arg Gin His 390 Leu Phe His Asn Lys 470 Pro Glu Cys Glu Al a Leu Asp 295 Ala Phe Pro Gin Glu 375 Al a Cys Val1 Asn Ile 455 Val Trp Pro Cys Phe 535 Arg Al a 280 Gi y Glu Al a Trp Arg 360 Ser Leu Asp Leu Glu 440 Phe Gly Ala Cys Trp 520 Thr Val1 265 Ala Trp Gly Ser Phe 345 Asp Lys His Ala Asn 425 Val Thr T yr Ser Leu 505 Leu Cys 39 Ala Ser Gly Ala Tyr 330 Arg Cys Ile Asn Met 410 Val Arg Tyr Trp Pro 490 Gin Cys Ala Val Gin Ala Ile 315 Phe Giu Al a Met Met 395 Arg Lys Phe Leu Ala 475 Ser As n Ile Asp Leu Arg Leu 300 Thr Gin Phe Ala Phe 380 His Pro Phe Asp Arg 460 Glu Ala Glu Pro Cys 540 Phe Leu 285 Glu Ile Ser Trp His 365 Val Arg Val1 Asp Arg 445 Ala Gly Gly Val Cys 525 Gly Thr 270 Asn Ser Glu Leu Glu 350 Ser Val1 Al a As n Al a 430 Phe Gly Leu Pro Lys 510 Gin Leu Arg Ala Val Leu Asp 335 Gin Leu As n Leu Gly 415 Pro Gi y Ser Thr Leu 495 Ser Pro Gly Ser Ser Val1 Ala 320 Pro Ar g Arq Al a Cys 400 Arg Phe Asp Gly Leu 480 Al a Val1 Tyr Tyr WO 99/51641 WO 9951641PCTILJS99/07333 Ala Ser Leu Thr Gly Cys Phe Giu Leu Pro Gin Glu Tyr Trp 545 Ile Leu Asn Leu Al a 625 Thr Ile Phe Gly Thr 705 Cys Leu Pro Thr Ser 785 Ser Pro Arg Gly Ala Leu 610 Lys Ala Al a Ile Gin 690 Gly As n Leu Giu Cys 770 Asp Gly Asn Trp Ala Thr 595 Giy Pro Phe Arg Ser 675 Leu Lys His Ile Asn 755 Ile Tyr Ser Gly Asp 565 Leu Ala 580 Pro Val Gly Vai Ser Thr Ser Vai 645 Ile Phe 660 Pro Ala Leu Ile Giu Thr Arq Asp 725 Ala Leu 740 Phe Asn Ile Trp Arq Val Val Val 805 550 Ala Trp Thr Leu Val Lys Phe Leu 615 Ala Vai 630 Cys Tyr Giy Giy Ser Gin Val Val 695 Ala Pro 710 Ala Ser Cys Thr Glu Ala Leu Ala 775 Gin Thr 790 Leu Gly Al a Phe Al a 600 Cys Cys Se r Ala Val 680 Ala Glu Met Leu Lys 760 Leu Thr Cys Val1 Val 585 Ser T yr Thr Al a Arg 665 Al a Trp Arg Leu Tyr 745 Phe Leu Thr 555 Gly Pro Vai 570 Leu Giy Val Gly Arg Glu Cys Met Thr 620 Leu Arg Arq 635 Leu Leu Thr 650 Giu Gly Ala Ile Cys Leu Leu Val Val 700 Arg Giu Val 715 Gly Ser Leu 730 Ala Phe Asn Ile Giy Phe Pro Ile Phe 780 Met Cys Val 795 Thr Phe Leu 605 Phe Leu Lys Gin Ala 685 Giu Val Ala Thr Thr 765 Tyr Ser Ile Val 590 Cys Ile Gly Thr Arg 670 Leu Al a Thr Tyr Arg 750 Met Val Val1 Al a 575 Arg T yr Phe Leu Asn 655 Pro Ile Pro Leu As n 735 Lys Tyr Thr Ser Cys His Ile Ile Gly 640 Arg Arg Ser Gly Arg 720 Val Cys Thr Ser Leu 800 Leu Phe Ala Pro Lys Leu His Ile Ile Leu Phe lie Lu Phe Pro Gin Lys Asri WO 99/51641 WO 9951641PCT/US99/07333 <210> 28 <211> 1077 <212> DNA <213> Artificial Sequence <220> <223> Chimeric <400> 28 atgactctgg atcaacgacg aagctgctgc atcatccatg cagaacatct tacaaqtatg gtgtctgctt atccaggaat cttaatgact agagttcgag ttcagaatqg gaaaatgtca gagtcagaca tacccctggt gagaaaat ca gatgcccagg gacaaaatta tttgctgccg agtccatcat agatcgagcg tgct cgggac ggtcaggata tcacggccat agcacaataa ttgagaatcc qctatgatag tgqaccgcgt tccccaccac tcgatgtagg cctctatcat atgagaaccg tccagaactc tgtattccca cagcccqaga tctactccca tcaaggacac ggcgtgctgc gcagctccgc aggagagagt ctctgatgaa gcaggccatg qgctcatgca atatgtagat acgacgagaa agctgaccct agggatcatc gggccaaagg gtttctagta aatggaggaa ctcgqttatt tctagtcgac attcattctg cttcacgtgc catcctccag ctqagcgagg agggacaagc ggcaagagta gataaaaggg atcagagcca caattagttc gcaataaaga tatcaattat gcctacctqc gaatacccct t cagaqaqaa gcgcttagtg agcaaggctc ctgttcttaa tacttcccag aagatqttcg gccacagaca ttgaacctga aggccaagga gggacgcccg cgtttatcaa gcttcaccaa tggacacact gagaaqttga gtttatggaa ctgactctac ctacgcaaca ttgacttaca gaaaatggat aatatgatca tctttaqaac acaaqaaaga aatatgatqg tggacctgaa ccgagaatat aggactgcgg agcccqgcgg ccgggagctc gcagatgaga qctqgtgtat caagatccca tgtggagaag tgatcctgga caaatactat agatgtgctt aagtqtcatt acactgcttt agttctcgtq aattatcaca tcttctagag accccagaga cccagacagt ccgctttgtc t ct gt tc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1077 <210> 29 <211> 359 <212> PRT <213> Artificial Sequence <220> <223> Chimeric <400> 29 Met 1 Thr Leu Giu Ile Met Ala Cys Cys 10 Leu Ser Glu Glu Ala Lys Giu Ala Arg Lys Arg Asp Arg Ile Asn Asp Glu Glu Arg Gin Leu Arg Arg Asp Gly Thr Gly Ala Arq Arg Giu Leu 40 Lys Leu Leu Leu Leu Giu Ser Gly Lys Ser Thr Phe 55 Ile Lys Gln Met Arg Ile Ile His Gly Thr Lys Leu Val Tyr Ser Gly Tyr Ser Asp Glu Asp Lys Arg Gly Phe 70 75 WO 99/51641 PCT/US99/07333 Gin Leu Val Val Tyr 145 Leu Gin Pro Gin Ser 225 Glu Thr Leu Val Ala 305 Asp Ile Asn Lys Arg Asp 130 Asp Asn Asp Phe Arg 210 Ile Ser Ile Asn Asp 290 Arg Lys Arg Ile Phe Thr Ala Met Gin Ala Met Ile Arg Ala Met Asp Thr 90 Ile Pro Tyr Lys Tyr Glu His Asn Lys Ala His Ala Gin Leu 100 105 110 Glu Val Asp Val Glu Lys Val Ser Ala Phe Glu Asn Pro Tyr 115 120 125 Ala Ile Lys Ser Leu Trp Asn Asp Pro Gly Ile Gin Glu Cys 135 140 Arg Arg Arg Glu Tyr Gin Leu Ser Asp Ser Thr Lys Tyr Tyr 150 155 160 Asp Leu Asp Arg Val Ala Asp Pro Ala Tyr Leu Pro Thr Gin 165 170 175 Val Leu Arg Val Arg Val Pro Thr Thr Gly Ile Ile Glu Tyr 180 185 190 Asp Leu Gin Ser Val Ile Phe Arg Met Val Asp Val Gly Gly 195 200 205 Ser Glu Arg Arg Lys Trp Ile His Cys Phe Glu Asn Val Thr 215 220 Met Phe Leu Val Ala Leu Ser Glu Tyr Asp Gin Val Leu Val 230 235 240 Asp Asn Glu Asn Arg Met Glu Glu Ser Lys Ala Leu Phe Arg 245 250 255 Ile Thr Tyr Pro Trp Phe Gin Asn Ser Ser Val Ile Leu Phe 260 265 270 Lys Lys Asp Leu Leu Glu Glu Lys Ile Met Tyr Ser His Leu 275 280 285 Tyr Phe Pro Glu Tyr Asp Gly Pro Gin Arg Asp Ala Gin Ala 295 300 Glu Phe Ile Leu Lys Met Phe Val Asp Leu Asn Pro Asp Ser 310 315 32C Ile Ile Tyr Ser His Phe Thr Cys Ala Thr Asp Thr Glu Asr 325 330 335 Phe Val Phe Ala Ala Val Lys Asp Thr Ile Leu Gin Leu Asr 340 345 350 Leu Lys Asp Cys Gly Leu Phe 355 WO 99/51641 WO 9951641PCT/US99/07333 <210> <211> 2751 <212> DNA <213> Artificial Sequence <220> <223> Chimeric hCAR/hmGluR2 <400> atggcatttt gqgccagacc cattttggag atcaggtata ataaacaqca tgcaacaccg gattctttga gtggtgggag tacattcccc aagtctttcc atcgagtatt ccggggattg gaactcatct aattccacgg aaqgaqattg agctcctccc gctctgaagg aagtctgtcc caaqaaggtg ggcgacaggt atcaqcagtg tacttagcag agagggctct ctgaagcacc gagtgtggtg qgctccatcg ctcttcatca aactgcagcc tgctgctttg qcctgtaaca ctqccccagg tgcctcggtg ccagtggtca tgctactqca cgtcttqgtt cgcattgcac cctgcctcac gcctgqctgg gtggtgacac gtgctcctca ttcaacgagg ttgttgccca gtgtcagtca atcatcctct atagctgctg agcgagccca tagcagctaa atttccgtgg gcccagccct tttctaaggc accttgatga caactggctc aggtcagtta tccgaaccat tccgctggaa agaaattccg cccagtactc ccaaagtcat tccggcgcaa tgatcgccat ctgggcagat acaatggttt caaaaggacc ttagcaacag tcgaqacccc tctactccat tcaccaatgg tacggcatct acctqqtggg tgtttaagga acgaggagaa gaqactgcct aqtgtgtgga agtgcccaga agtacatccg ccctgqccac aggcctcagg tgaccttcat tgggcactgc gcatcttcgg aggtggccat tggtgqaggc tqcgctgcaa tcgcgctctg ccaagttcat tcttctatgt gcctcagcgg tccagccqca ctgggtcctc aaagaagggg agatcaagat gtttcgctqq tcttcccaac cttqgaagcc gttctgcaac aggcgtctcc tqcctcctcc ccccaatgat ctggqtgggc agaggaagct tgatgaggaa cgtggttttc tatcacgggc gcctcagtac cccaggcttc tgccaaggag tttacctgtg ctcgacagcc ttacatagat tgcccacgcc ctcctgtgca aaactttaca gaactattcc agtcgggtat aatcctgtgg ggcagggacc gtgtcctgat tqacttctgg ctggggcgat cctgtttgtg tcgggagctc cttcattqcc cttctctgtc tggggcccg ctgcctggca accgggcaca ccaccgcgat cacgctttat tggcttcacc cacctccagt ctccgtggtg gaagaacgtg ttggcactca gacattatcc ctcaaatcaa ttacaggcta ttgacgctgg accctgagtt tgctcagagc acggcagtgg aqcagactcc qagcaccagq acaattgcag gaggaaaggg gagatccagc tccagtggcc aagatctggc ttccacgtgq cgggaattcc ttttgggaag gacacctttc ttccgacccc tacacgcatt ttgcaagata gacatcaaga aacaatatgg atcatcaact tacaacgtct agtgggttct aggaaaggga ggggagtata tccaatgaga gcctgggctg ctgqgtgtct tgctacatcc aagccatcca tgctactcag gagggtgccc cttatctcgg gqcaaggaga gcaagtatgt gccttcaata atgtacacca gactaccggg cttggctgcc gttagccacc cctgqcacac ttggqqqgct ggccggagtc tgatatttgc gatacaggat ttgttgctca acattccctc caaatctgct tcagcaacaa ccactgccat ctgatgacga atatctgcat atgtggtaga cagatcttga tggccagcga ttgqcqgcac tgaagaaggt aaacatttaa tgagaggtca tctgtacagg t a cgga tat c tatatacctg aagttgaggc gqgagcaggt ggcacctctc atgccaagaa ccagggaggt tcattgaggg gtgatgagac accacacctc tgggacctgt ttgtgcggca tgctgggtgg cggcagtqtg ccctgctcac agcggccacg qccagctgct cagcccccga tgggctcqct ctcgcaagtg cctqcat cat tacagaccac tctttgcgcc gggcacccac ctctgcctac ctttcctatt tgtggaatgt catagaggag atttgacact aaacaaaatt tacgattgct ggggctcttc gaatcaattc ggcagacatc ctatgggcgg cgacttcagt ggtgattcaa gcccctcatc ggcctgggcc cattggattc ccatcccagg ctgccacctc cgaagaaagt ggatgagaac ctacaatgtg cttacctggg gtggcaggtc gacctttgat cccagaggat gggagaaaga gcccttctcc gqagcccacc agatgccagt ctgcttcgaa caccatcgcc caatgccaca tgtcttcctc taccttacgg caagaccaac cttcatcagt catcgtggtc acggcgggag ggcctacaat ccccgaaaac ctggctggca caccatgtgc caagctgcac cagccgcttt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 WO 99/51641 WO 9951641PCT/US99/07333 qgcagtgctg ctgccagggc cagctccagc cttgqccaag gqtctggctc ccagtttgtc cccactgttt qcaatggccg tgaggtggtq gactcgacaa cgtcatcgct t 2700 2751 Met Thr Ile Gin Phe Ile Ile Ser Cys Thr 145 Tyr Lys <210> <211> <212> <213> <220> <223> <400> Ala Phe Ser Ala Leu Gly Asp Leu Arg Gly Asn Ser Phe Asp Phe Val 115 Asn Cys 130 Gly Ser Ile Pro Ash Gin Tyr Tyr Gly Lys Phe Ser Thr 100 Ala Ser Giy Gin Phe 180 Ser Gly Leu Ser Arg Pro Cys Gin Glu Val Val1 165 Lys Cys Pro Phe Arg Trp 70 Al a Asn As n His Ser 150 S e r Ser Trp Gin Ile Giu Gin Leu Val Ile 120 Pro Al a Aila Leu 31 917

PRT

Artificial Sequence Chimeric hCAR/hmGiuR2 31 Val1 Arg 25 His Ser Ala Pro Ser 105 Asp Ser Val Ser Arg 185 Leu Al a Phe Val Met As n Lys Ser Thr Ala Ser 170 Thr Leu Gin Gly Glu Ile 75 Leu Ala Leu Ile Asn 155 Ser Ile Al a Lys Val1 Cys Phe Thr Leu As n Ala 140 Leu Arg Pro Thr Gly Ala Arg Ile Gly Ala 110 Asp Val Gly Leu Asp 190 His Ile Asp Asn Giu Arg Leu Phe Al a Phe 160 As n His Gin Ala Thr Ala Met Ala Asp Ile Ile Giu Tyr Phe Arg Trp Asn Trp 195 200 205 WO 99/51641 WO 9951641PCT/US99/07333 Val1 Lys 225 Giu Glu Gly Thr Ile 305 Ala Val1 Giu Pro Ser 385 Ile Ser Asp Cys Arg 465 Glu Gly 210 Phe Leu Val1 Pro Gly 290 Al a Leu His Giu Val1 370 Asn Ser Tyr Ile Al a 450 His Cys Thr Arg Ile Ile Asp 275 Lys Met Lys Pro Thr 355 Asp Ser Ser Asn Tyr 435 Asp Leu Gly Ile Glu Ser Gln 260 Le u Ile Pro Al a Arg 340 Phe Thr Ser Val Val 420 Thr Ile Asn Asp Ala Ala Glu Ala 230 Gin Tyr 245 Asn Ser Glu Pro Trp Leu Gin Tyr 310 Gly Gin 325 Lys Ser Asn Cys Phe Leu Thr Ala 390 Giu Thr 405 Tyr Leu Cys Leu Lys Lys Phe Thr 470 Leu Val 485 Asp Asp 215 Glu Giu Ser Asp Thr Ala Leu Ile 280 Ala Ser 295 Phe His Ile Pro Val His His Leu 360 Arq Gly 375 Phe Arg Pro Tyr Ala Val Pro Gly 440 Val Glu 455 Asn Asn Gly Asn Asp Tyr Arg Asp Glu Glu 250 Lys Val 265 Lys Glu Glu Ala Val Val Gly Phe 330 Asn Gly 345 Gin Glu His Glu Pro Leu Ile Asp 410 Tyr Ser 425 Arg Gly Ala Trp Met Gly Tyr Ser 490 Gly Ile 235 Giu Ile Ile T rp Gly 315 Arg Phe Gly Glu Cys 395 Tyr Ile Leu Gin Giu 475 Ile Arq 220 Cys Ile Val1 Val Al a 300 Gly Glu Ala Al a Ser 380 Thr Thr Ala Phe Val 460 Gin Ile Pro Ile Gin Val Arg 285 Ser Thr Phe Lys Lys 365 Gly Gly His His Thr 445 Leu Val Asn Gly Asp His Phe 270 Arg Ser Ile Leu Glu 350 Gly Asp Asp Leu Al a 430 Asn Lys Thr Trp Ile Phe Val 255 Ser Asn Ser Gly Lys 335 Phe Pro Arq Glu Arg 415 Leu Gly His Phe His 495 Glu Ser 240 Val Ser Ile Leu Phe 320 Lys Trp Leu Phe Asn 400 Ile Gin Ser Leu Asp 480 Leu WO 99/51641 WO 9951641PCT/US99/07333 46 Gly Ser Ile Val Phe Lys Glu Val Gly Tyr Tyr Asn Ser Val1 Le u Asp 545 Cys Th r Glu Gly Le u 625 Pro Gly Se r Ser Ile 705 Pro Leu Giu Pro Tyr T rp 530 Cys Cys Asp Asn Asp 610 Ala Val1 Val1 Thr Val1 690 Ph e Al a I le Thr Glu Al a 515 Ser Leu Phe Ala His 595 Ala Thr Val1 Phe Al a 675 Cys Gly Ser Val Al a

S

Asp 500 Lys Gly Ala Glu Ser 580 Thr Trp Le u Lys Leu 660 Val Tyr Gly Gin Val 740 Pro Lys Phe Gly Cys 565 Ala Ser Ala Phe Ala 645 Cys Cys Ser Al a Val 725 Al a Glu Gly Ser Thr 550 Val1 Cys Cys Val1 Val1 630 Ser T yr Thr Ala Arg 710 Al a Trp Arg Gi u Arg 535 Arg Giu Asn Phe Gly 615 Leu Gly Cys Leu Leu 695 Glu Ile Leu Arg Gly 775 Arg 520 Glu Lys Cys Lys Glu 600 Pro Gly Arg Met Arg 680 Leu Gly Cys Val Glu 760 505 Leu Val Giy Pro Cys 585 Leu Val Val Glu Thr 665 Arg Thr Al a Leu Val 745 Val Phe Pro I le Asp 570 Pro Pro Thr Phe Leu 650 Phe Leu Lys Gin Ala 730 Giu Val Ile Phe Ile 555 Gly Asp Gin Ile Val 635 Cys Ile Giy Thr Arg 715 Leu Ala Thr As n Ser 540 Glu Giu Asp Glu Al a 620 Arg Tyr Phe Leu As n 700 Pro Ile Pro Leu Asn 780 Glu 525 Asn Giy Tyr Phe Tyr 605 Cys His Ile Ile Gly 685 Arg Arg Ser Gi y Arg 765 510 Giu Cys Giu Ser Trp 590 Ile Leu Asn Leu Ala 670 Thr Ile Phe Gly Thr 750 Cys Lys Ser Pro Asp 575 Ser Arg Gly Aia Leu 655 Lys Al a Al a Ile Gin 735 Gi y Asn Ile Arg Thr 560 Giu Asn Trp Ala Thr 640 Gly Pro Ph e Arg Ser 720 Leu Lys His Arg Asp 770 Ala Ser Met Leu Ser Leu Ala Tyr Val Leu Leu Ile WO 99/51641 WO 9951641PCT/US99/07333 Al a 785 Leu Cys Thr Leu Tyr 790 Ala Phe Asn Thr Arg 795 Lys Cys Pro Giu Asn 800 Phe Asn Giu Ala Lys 805 Phe Ile Gly Phe Thr 810 Met Tyr Thr Thr Cys Ile 815 Ile Trp Leu Arg Val Gin 835 Leu Leu Pro Ile Phe 825 Tyr Val Thr Ser Ser Asp Tyr 830 Ser Gly Ser Thr Thr Thr Met Cys 840 Val Ser Val Ser Vai Val 850 Leu Giy Cys Leu Ala Pro Lys Leu. Ile Ile Leu Phe Gin 865 Pro Gin Lys Asn Vai Ser His1 Arq Aia 875 Pro Thr Ser Arg Phe 880 Gly Ser Ala Ala Ala 885 Arg Ala Ser Ser Leu Gly Gin Gly Ser Gly 895 Ser Gin Phe Vai 900 Pro Thr Val Cys As n 905 Gly Arg Giu Vai Val Asp Ser 910 Thr Thr Ser Ser Leu 915 <210> <211> <212> <213> <220> <223> 32 3831

DNA

Artificial Sequence Chimeric <400> 32 atggcatttt gccagacc cattttggag atcaggtata ataaacagca tgcaacaccg gattctttga gtqgtggag tacattcccc aagtctttcc atcgagtatt ccggggattg gaactcatct aattccacgg aaggagattg atagctgctg agcgagccca tagcagctaa at t tccgt gg qcccagccct tttctaaggc accttgatga caactggctc aggtcagtta tccgaaccat t ccgct ggaa agaaattccg cccagtactc ccaaagtcat tccgqcgcaa ctgggtcctc aaagaagggq agatcaagat gtttcgctgg tcttcccaac cttggaagcc gttctgcaac aggcgtctcc tgcctcctcc ccccaatgat ctgggtgggc agaggaagct tgatgaggaa cgtgttttc tatcacgggc ttgqcactca gacattatcc ctcaaatcaa ttacaggcta ttgacgctgg accctgagtt tgctcagagc acggcagtqg aqcagactcc gagcaccagg acaattgcaq gaqgaaaggg gagatccagc tccagtggcc aagatctqgc cctggcacac ttggggggct ggccggagt c tgatatttgc gatacaggat ttqttgctca acattccctc caaatctgct tcagcaacaa ccactgccat ctgatgacga atatctgcat atgtggtaga caqatcttga tggccagcga ctctgcctac ctttcctatt tgtggaatgt catagaggag atttgacact aaacaaaatt tacgattgct ggggctcttc gaatcaattc ggcagacatc ctatggqcqg cgacttcagt ggtgattcaa gcccctcatc ggcctgggcc WO 99/51641 WO 9951641PCTIUS99/07333 agctcctccc gctctgaagg aagtctgtcc caagaaggtg ggcgacaggt atcagcagtg tacttagcag agagggctct ctgaagcacc gagtgtggtg ggctccatcg ctcttcatca aactgcagcc tgctgctttg gcctgtaaca ctgccccag tgcctcggtq ccagtggtca tgctactgca cgtcttggtt cgcattgcac cctqcctcac gcctggctgg gtggtgacac gtgctcct ca ttcaacgagg ttgttgccca gtgtcagt ca atcatcctct ggcagtqctg cccactgttt gagtccatca gagat cgagc ctgctcggga gggtcaggat ttcacggcca gagcacaata tttgagaatc tgctatgata ttggaccgcg gtccccacca gtcgatqtag acctctatca aatgagaacc ttccaqaact atgtattccc gcagcccgag atctactccc gtcaaggaca tqatcgccat ctgqgcagat acaatgqttt caaaaggacc ttagcaacag tcgagacccc tctactccat tcaccaatgg tacqgcatct acctggtggg tgtttaagga acgaggagaa gagactgcct agtgtgtgga agtgcccaga agtacatccq ccctqgccac agqcctcag tgaccttcat tgggcactqc qcatcttcgg aggtgqccat tggtggaggc tgcgctgcaa tcgcgctctg ccaagttcat tcttctatgt gcctcagcgg t ccagccqca ctgccagqgc gcaatggccg tggcgtgctg ggcagctccg caggagagag actctgatga tgcaggccat aggctcatgc catatgtaga gacqacgaga tagctgaccc cagggatcat ggggccaaag tgtttctagt gaatggagga cctcggttat atctagtcga aattcattct acttcacgtg ccatcctcca gcctcagtac cccaggcttc tgccaaggag tttacctgtg ctcgacagcc ttacatagat tgcccacgcc ctcctgtgca a aact t ta ca qaactattcc agtcgggtat aatcctgtgg qgcagggacc qtgtcctgat tgacttctgg ctggggcgat cctgtttgtg tcgggagctc cttcattgcc cttctctgtc tggggcccgg ctgcctggca accgggcaca ccaccgcgat cacgctttat tggcttcacc cacctccagt ctccgtggtg gaagaacgtg cagctccagc tgaggtggtg cctgagcgag cagggacaag tggcaagagt agataaaagg gatcagagcc acaattagtt t gcaat aaa g atatcaatta tgcctacctg cgaatacccc gt cagagaga agcgcttagt aagcaaggct tctgttctta ctacttccca qaagatgtt c cgccacagac gttgaacctg ttccacgtqg cgggaattcc ttttgggaaq gacacctttc ttccgacccc tacacgcatt ttgcaagata gacatcaaga aacaatatgg atcatcaact tacaacgtct agtgqgttct aggaaaggga ggggagtata tccaatgaga gcctgggctg ctggqtgtct tgctacatcc aagccatcca tgctactcag gagggtgccc cttatctcgg ggcaaggaga qcaagtatgt gccttcaata atgtacacca gactaccggg cttggctgcc gttagccacc cttggccaag qactcgacaa gaggccaagg cgggacgccc acgtttatca ggcttcacca atggacacac cqagaagttg agtttatgga tctqactcta cctacgcaac tttgacttac agaaaatgga gaatatgatc ctctttagaa aacaagaaaq gaatatgatg gtgqacctga accgagaata aaggactgcg ttqgcggcac tgaagaaggt aaacatttaa tgagaggtca tctgtacag tacggatatc tat at acct g aagttgaggc gggagcaggt ggcacctctc atgccaagaa ccagggagqt tcattgaggg gtgatgagac accacacctc tgggacctgt ttgtqcggca tgctgggtgg cggcagtgtg ccctgctcac agcggccacg gccagctgct cagcccccga tgggctcgct ctcgcaagtg cctgcatcat tacagaccac tctttgcgcc gggcacccac ggtctggctc cgtcatcgct aagcccqgcg gccgggagct agcagatgag agctggtgta tcaagatccc atgtggagaa atgatcctgg ccaaatacta aagatgtgct aaagtgtcat tacactgctt aagttctcgt caattatcac atcttctaga gaccccagag acccagacag tccgctttgt gtctgttcta cattggattc ccatcccagg ctgccacctc cgaagaaagt ggatgagaac ctacaatgtg cttacctggg gtggcaggtc gacctttgat cccagaggat gggagaaaga gcccttctcc ggagcccacc agatgccagt ctgcttcgaa caccatcgcc caatgccaca tgtcttcctc taccttacgg caagaccaac cttcatcagt catcgtggtc acggcgqgag ggcctacaat ccccgaaaac ctggctggca caccatgtgc caagctgcac cagccgcttt ccagtttgtc tatgactctg gatcaacgac caagctgctg aatcatccat tcagaacat c atacaagtat ggtgtctgct aatccaggaa tcttaatgac tagagttcga tttcagaatg tqaaaatgtc ggagtcagac atacccctgg ggagaaaat c aqatgcccag tgacaaaatt ctttgctgcc 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1*740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 27 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3831 WO 99/51641 WO 9951641PCT/US99/07333 Met Thr Ile Gin Phe Ile Ile Ser Cys Thr 145 Tyr Lys Gin Vali Lys 225 <210> <211> <212> <213> <220> <223> <400> Aia Phe Ser Aia Leu Giy Asp Leu Arg Gly Asn Ser Phe Asp Phe Vai 115 Asn Cys 130 Gly Ser Ile Pro Asn Gin Aia Thr 195 Giy Thr 210 Tyr Tyr Gly Lys Phe Ser Thr 100 Aila Ser Gly Gin Phe 180 Al a Ile Ser Gi y Leu Ser Arg Pro Gys Gin Glu Val Val1 165 Lys Met Al a Cys Pro Phe Arg Trp 70 Ala Asn Asn His Ser 150 Ser Ser Ala Al a Cys Asp Pro Pro 55 Leu Leu Thr Lys Ile 135 Thr Tyr Phe Asp Asp 215 Trp Val Gin Arg 25 Ile His 40 Giu Ser Gin Ala Leu Pro Val Ser 105 Ile Asp 120 Pro Ser Ala Val Ala Ser Leu Arg 185 Ile Ile 200 Asp Asp Leu 10 Ala Phe Val Met Asn 90 Lys Ser Thr Al a Ser 170 Thr Giu Tyr Leu Gin Gly Glu Ile 75 Leu Al a Leu Ile As n 155 Ser Ile T yr Gly Al a Lys Val1 Cys Phe Thr Leu Asn Al a 140 Leu Arg Pro Phe Arg 220 Leu Lys Ala Ile Al a Leu Giu Leu 125 Val Leu Leu Asn Arg 205 Pro Thr Gly Ala Arq Ile Gly Ala 110 Asp Val Gly Leu Asp 190 T rp Gly Trp Asp Lys Tyr Glu Tyr Thr Giu Gly Leu Ser 175 Giu As n Ile 33 1276

PRT

Artificial Sequence Chimeric 33 His Ile Asp As n Giu Arg Leu Phe Al a Phe 160 As n His T rp Glu Ser 240 Phe Arg Glu Glu Ala Glu Glu Arg Asp Ile Cys Ile Asp Phe 230 235 WO 99151641 WO 9951641PCT/US99/07333 Giu Leu Glu Vai Giy Pro Thr Gly 290 Ile Ala 305 Ala Leu Val His Giu Giu Pro Val 370 Ser Asn 385 Ile Ser Ser Tyr Asp Ile Cys Ala 450 Arg His 465 Glu Cys Ser Pro Ile Ilie Asp 275 Lys Met Lys Pro Thr 355 Asp Ser Ser Asn Tyr 435 Asp Leu Gly Giu Ser Gin Tyr Ser Asp Giu Giu Giu Ile Gin His Vai Val Gin 260 Leu Ilie Pro Al a Arg 340 Phe Thr Ser Val1 Val1 420 Thr Ile Asn Asp Asp 500 245 Asn Giu Trp Gin Gly 325 Lys Asn Phe Thr Giu 405 Tyr Cys Lys Phe Leu 485 Gly Ser Pro Leu Tyr 310 Gin Ser Cys Leu Al a 390 Thr Leu Leu Lys Thr 470 Vai Ser Thr Le u Ala 295 Phe Ile Val1 His Arg 375 Phe Pro Ala Pro Val 455 Asn Gly Ile Aila Ile 280 Ser His Pro His Leu 360 Gly Arg Tyr Val Giy 440 Giu As n As n Vali Lys 265 Lys Giu Val1 Giy Asn 345 Gin His Pro Ile Tyr 425 Arg Ala Met Tyr Phe 505 250 Val Giu Al a Vai Phe 330 Gi y Glu Giu Leu Asp 410 Ser Gly Trp Giy Ser 490 Lys Ile Ile Trp Giy 315 Arg Phe Gly Giu Cys 395 Tyr Ile Leu Gin Giu 475 Ile Glu Val Val1 Al a 300 Gly Glu Al a Ala Ser 380 Thr Thr Ala Phe Val 460 Gin Ile Val Val1 Arg 285 Ser Thr Phe Lys Lys 365 Gly Gly His His Thr 445 Leu Vai Asn Gly Phe 270 Arg Ser Ile Leu Giu 350 Gly Asp Asp Leu Ala 430 As n Lys Thr Trp Tyr 510 255 Ser Asn Ser Gly Lys 335 Phe Pro Arq Giu Arg 415 Leu Gly His Phe His 495 Tyr Ser Ile Leu Phe 320 Lys Trp Leu Phe Asn 400 Ile Gin Ser Leu Asp 480 Leu Asn Val Tyr Ala Lys Lys Gly Glu Arg Leu Phe Ile Asn Glu Giu Lys Ile 515 520 525 WO 99/51641 WO 9951641PCT/US99/07333 Leu Asp 545 Cys Thr Giu Gi y Leu 625 Pro Gly Ser Ser Ile 705 Pro Leu Gi u Arg Al a 785 Trp 530 Cys Cys Asp Asn Asp 610 Al a Val Val1 Thr Val1 690 Phe Ala Ile Thr Asp 770 Leu Ser Le u Ph e Al a His 595 Al a Thr Val Phe Al a 675 Cys Gly Ser Val1 Ala 755 Al a Cys Gly Phe Ser Arg Giu Vai Pro Phe Ser Asn Cys Ser 535 Ala Giu Ser 580 Thr T rp Leu Lys Leu 660 Val Tyr Gly Gin Val1 740 Pro Ser Thr Gly Cys 565 Al a Ser Ala Phe Ala 645 Cys Cys Ser Ala Val 725 Ala Giu Met Leu Thr 550 Val1 Cys Cys Val1 Val 630 Ser Tyr Thr Al a Arg 710 Al a Trp Arg Leu Tyr 790 Arg Giu Asn Phe Gly 615 Leu Giy Cys Leu Leu 695 Giu Ile Leu Arg Gly 775 Ala Lys Cys Lys Glu 600 Pro Gly Arg Met Arg 680 Leu Gly Cys Val Glu 760 Ser Phe Gly Pro Cys 585 Leu Val Val Glu Thr 665 Arg Thr Al a Leu Val1 745 Val1 Leu.

As n Ile Asp 570 Pro Pro Thr Phe Leu 650 Phe Leu Lys Gin Al a 730 Glu Val1 Al a Thr Ile 555 Gly Asp Gin Ile Val1 635 Cys Ile Gly Thr Arg 715 Leu Al a Thr Tyr Arg 795 540 Giu Giu Asp Glu Ala 620 Arg Tyr Phe Leu Asn 700 Pro Ile Pro Leu Asn 780 Lys Giy Tyr Phe Tyr 605 Cys His Ile Ile Gly 685 Arg Arg Ser Gly Arg 765 Val Cys Glu Ser Trp 590 Ile Leu Asn Leu Al a 670 Thr Ile Phe Gly Thr 750 Cys Leu Pro *Pro Asp 575 Ser Arg Gly Ala Leu 655 Lys Al a Al a Ile Gin 735 Gly Asn Leu Glu *Arg Thr 560 Giu Asn T rp Ala Thr.

640 Gi y Pro Phe Arg Ser 720 Leu Lys His Ile Asn 800 Phe Asn Giu Ala Lys 805 Phe Ile Gly Phe Thr Met Tyr Thr Thr Cys Ile 810 815 WO 99/51641 PCT/US99/07333 Ile Trp Leu Arg Val Gin 835 Val Val Leu 850 Gin Pro Gin 865 Gly Ser Ala Ser Gin Phe Thr Thr Ser 915 Ser Glu Glu 930 Gin Leu Arg 945 Leu Leu Gly Arg Ile Ile Thr Lys Leu 995 Arg Ala Met 1010 Ala His Ala 1025 Phe Glu Asn Gly Ile Gin Ser Thr Lys 1075 Ala Leu Leu Pro Ile Phe Tyr Val Thr Ser Ser Asp Tyr 820 825 830 Thr Thr Thr Met Cys Val Ser Val Ser Leu Ser Gly Ser 840 845 Gly Cys Leu Phe Ala Pro Lys Leu His Ile Ile Leu Phe 855 860 Lys Asn Val Val Ser His Arg Ala Pro Thr Ser Arg Phe 870 875 880 Ala Ala Arg Ala Ser Ser Ser Leu Gly Gin Gly Ser Gly 885 890 895 Val Pro Thr Val Cys Asn Gly Arg Glu Val Val Asp Ser 900 905 910 Ser Leu Met Thr Leu Glu Ser Ile Met Ala Cys Cys Leu 920 925 Ala Lys Glu Ala Arg Arg Ile Asn Asp Glu Ile Glu Arg 935 940 Arg Asp Lys Arg Asp Ala Arg Arg Glu Leu Lys Leu Leu 950 955 960 Thr Gly Glu Ser Gly Lys Ser Thr Phe Ile Lys Gin Met 965 970 975 His Gly Ser Gly Tyr Ser Asp Glu Asp Lys Arg Gly Phe 980 985 990 Val Tyr Gin Asn Ile Phe Thr Ala Met Gin Ala Met Ile 1000 1005 Asp Thr Leu Lys Ile Pro Tyr Lys Tyr Glu His Asn Lys 1015 1020 Gin Leu Val Arg Glu Val Asp Val Glu Lys Val Ser Ala 1030 1035 1040 Pro Tyr Val Asp Ala Ile Lys Ser Leu Trp Asn Asp Pro 1045 1050 1055 Glu Cys Tyr Asp Arg Arg Arg Glu Tyr Gin Leu Ser Asp 1060 1065 1070 Tyr Tyr Leu Asn Asp Leu Asp Arg Val Ala Asp Pro Ala 1080 1085 Tyr Leu Pro Thr Gin Gin Asp Val Leu Arg Val Arg Val Pro Thr Thr 1090 1095 1100 WO 99/51641 WO 9951641PCT/US99/07333 Gly Ile 1105 Ile Giu Tyr Pro Phe 1110 Asp Leu Gin Ser Val Ile Phe Arg Met 1115 1120 Val Asp Val Gly Gly Gin Arg Ser Giu Arg Arg Lys Trp Ile His Cys 1125 1130 1135 Phe Giu Asn Vai Thr Ser Ile Met Phe Leu Val Ala Leu Ser Giu Tyr 1140 1145 1150 Asp Gin Val Leu Val Giu Ser Asp Asn Giu Asn Arg Met Glu Giu Ser 1155 1160 1165 Lys Ala Leu Phe Arg Thr Ile Ile Thr Tyr Pro Trp Phe Gin Asn Ser 1170 1175 1180 Ser Vai Ile Leu Phe Leu Asn Lys Lys Asp Leu Leu Giu Giu Lys Ile 1185 1190 1195 1200 Met Tyr Ser His Leu Vai Asp Tyr Phe Pro Giu Tyr Asp Giy Pro Gin 1205 1210 1215 Arg Asp Aia Gin Aia Ala Arg Glu Phe Ile Leu Lys Met Phe Val Asp 1220 1225 1230 Leu Asn Pro Asp Ser Asp Lys Ile Ile 1235 1240 Tyr Ser His Phe Thr Cys Ala 1245 Thr Asp Thr 1250 Ile Leu Gin 1265 <210> <211> <212> <213> <220> <223> Giu Asn Ile Arg Phe 1255 Val Phe Ala Aia Val Lys Asp Thr 1260 Leu Asn Leu Lys Asp Cys Gly Leu Phe 1270 1275 34 3105

DNA

Artificial Sequence Chimeric hxGiuR2/hCaR <400> 34 atgqgatcgc ccagccaaga caccagaagg cgcctggagq ggcgtgcgcc caggcactgg tgccccgacg ggcggttcct ccacagatta tgcttgcqct aggtgctqac gcggcccagc ccatgctttt tgggtgcaca actttqtgcg gctcttatgc acagtgatgt qctacgcctc cccggcactg cctggaggga agaggactgt tgcactggac catcctcgac tgcctcactc gacccatggt ctccatccag taccagtgcc ctgctgctgt qacttggtgc ggtcctgtca cgcatcaacc agttgctcca agccgtggtg gatgctccca gtggccaacc aagctqagtq ggggtgctqt tgggtgggct atgagcaccg gtgacccgca aggacacaca ctqatggctc ctgccatcac tcttgaggct acaagtcccg ggctgagggc gttcccagtg tggcatccag cctgctgcct tgcgctggag acgccacatc tggtgttatt atttcagatc ctatqactac WO 99/51641 WO 9951641PCTIUS99/07333 tttgcccgca ttcttcaact attgaqgcct gtgggccgtg cccagtgccc gccaqccagc gagagtgtgg tcctacccca cggaacccct gactgcgcag gtggtcaatg cccaacacca gactttqtgc gtccgctttg gcaggcagtg gacaccagcc agtgagccct ctctgcattc ggcctgggct atccgctggg gccaccctct tcaggtcggg ttcatcttca actgccttct ttcggtgggg gccatctgcc gaggcaccgg tgcaaccacc ctctgcacgc ttcattgqct tatgtcacct agcgqctccg ccgcagaaga gctgcccggg ggctccacgg ttcccacagc cagcaqcagc cagaaggtca aagaacgcca agcgatacgc gatctgaccg gtggaqgacc atcagtggtg cagtgcctcc ggacctatgt ttgaqctaqa ccatgagccg gcgtggctgt gcctcaatgc tggcaggcag tcagtgactt ggttccgtga cccactctct cagtgtacgc cccqgctctq tcaacgtcaa accgctttgg ggcgctatcg tcatcccatg gcctccagaa cgtgccaqcc actggcccaa gcqatgcctq ttgtgctggg agctctgcta ttgccaagcc ctqtctgcta cccgggaggg tqgcacttat gcacaggcaa gcqatgcaag tttatgcctt tcaccatgta ccagtgacta tqgtqcttgg acaccatoga ccacgctgcq gatccacccc ccgagaqgca ccctgaccct tctttggcag tggcccacgg tgacccqaca tccaggaaac ctgaagagtt gaggcagcac tgacttcttc gtccactgtg ggctcqtgcc cgcggccttt cctgttcacc cagcttcacc tgagggggct tgcctcctac attctgggag ccgggctgtg catqgcccat tgacgcgatg gtttgatgcc tgatggtatt ctaccagaaq gqcctcaccc tgaggtgaag ctatqagtac tgccaqcctq ggctgt ggga tgtctttgtq catcctgctg atccacggca ctcagccctg tgcccagcg ctcgggccag ggagacagcc tatgttgggc caagactcgc caccacctgc ccgggtacaq ctgcctcttt ggagqtgcqt ccgcagcaac ctcctcctcc gaagcagcag cccacagcag cggcacggt c gaattctacg ccagccatta aqgtctgcaa gtccccagca tgttacagaa caagccaagg gcgtctgagg cgcaacatct gagggtgtgg cgttctgagg tgggtggcca gctgagggtg ttccagagcc cagaggttcc ccctttgagc qcgctccaca cggccagtta ccctttcgcc ggccqctaca gtgggctact tcagccggcc agtgtgcagc cgattggacg actggctgct cctgtcacca cggcacaatq ggtgqtgtct gtgtgtacct ctcaccaaga ccacgcttca ctgctcatcg cccgaacggc tcgctggcct aagtgccccg atcatctggc accaccacca gcgcccaaqc tgcagcaccg gtctcccqca atcagcagca cagccgctgg caacgatctc accttctcac caccagaact ctcccgctgc ggacctgtqg cttgtagtqt aacgtagtqa ccatgqctga gcgactatgg gtgtggccac tgcgagccct atgcccggga gtgatggttg ctatcaccat tggacccttg gctgcagctt agqagtccaa acatgcaccg acgggcgccg cagctgacac acatcttcac gggcagaagg ccctqcccgc cgggcgaagt aattcacttg tcgaactgcc tcgcctgcct ccacaccagt tcctctgcta tacggcgtct ccaaccgcat tcagtcctgc tggtcgcctg gggaggtggt acaatgtgct aaaacttcaa tggcattcct t gt gcgt gt c tgcacatcat cagctcacgc agcggtccag agagcaacag ccctaaccca agcagcagcc tgagctttga ccctggaggc agtgcgggga gtggagacca ccagttcaca attca gattctccgc cgagacaggc ctcggagaaa gctgcagaag gctgcttgct gggggccctg cgagctqgcc gaacaacagc ccgqcagcga gatcatgttt tgccctctgc cctctacaag ccacaatgag ctatctgcgt cttgactctg ctctcgctgc ctgctgctgg cgctgattgt ccaggagtac cggtgccctg ggtcaaggcc ctqcatgacc tggtttgggc tgcacgcatc ctcacaggtg gctggtggtg gacactgcgc cctcatcgcg cgaggccaag gcccatcttc agtcaqcctc cctcttccag tttcaaggtg cagccttgga cgaagaccca gcaagaqcag cagatgcaag tgagcctcag ccagaaaagc aacggactta gcgqccagag gagctttqtc 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3105 <210> <211> 1035 <212> PRT <213> Artificial Sequence <220> <223> Chimeric hmGluR2/hCaR WO 99/51641 PCT/US99/07333 <400> Met Gly Ser Leu Leu Ala Leu Pro Ala Leu Leu Leu Leu Trp Gly Ala 1 5 10 Val Ala Glu Gly Pro Ala Lys Lys Val Leu Thr Leu Glu Gly Asp Leu 25 Val Leu Gly Gly Leu Phe Pro Val His Gin Lys Gly Gly Pro Ala Glu 40 Asp Cys Gly Pro Val Asn Glu His Arg Gly Ile Gin Arg Leu Glu Ala 55 Met Leu Phe Ala Leu Asp Arg Ile Asn Arg Asp Pro His Leu Leu Pro 70 75 Gly Val Arg Leu Gly Ala His Ile Leu Asp Ser Cys Ser Lys Asp Thr 90 His Ala Leu Glu Gin Ala Leu Asp Phe Val Arg Ala Ser Leu Ser Arg 100 105 110 Gly Ala Asp Gly Ser Arg His Ile Cys Pro Asp Gly Ser Tyr Ala Thr 115 120 125 His Gly Asp Ala Pro Thr Ala Ile Thr Gly Val Ile Gly Gly Ser Tyr 130 135 140 Ser Asp Val Ser Ile Gin Val Ala Asn Leu Leu Arg Leu Phe Gin Ile 145 150 155 160 Pro Gin Ile Ser Tyr Ala Ser Thr Ser Ala Lys Leu Ser Asp Lys Ser 165 170 175 Arg Tyr Asp Tyr Phe Ala Arg Thr Val Pro Pro Asp Phe Phe Gin Ala 180 185 190 Lys Ala Met Ala Glu Ile Leu Arg Phe Phe Asn Trp Thr Tyr Val Ser 195 200 205 Thr Val Ala Ser Glu Gly Asp Tyr Gly Glu Thr Gly Ile Glu Ala Phe 210 215 220 Glu Leu Glu Ala Arg Ala Arg Asn Ile Cys Val Ala Thr Ser Glu Lys 225 230 235 240 Val Gly Arg Ala Met Ser Arg Ala Ala Phe Glu Gly Val Val Arg Ala 245 250 255 Leu Leu Gin Lys Pro Ser Ala Arg Val Ala Val Leu Phe Thr Arg Ser WO 99/51641 PCT/US99/07333 Glu Asp Phe Thr 290 Ala Gly 305 Ser Tyr Trp Asn Phe Arg Ala Val 370 Val Tyr 385 Pro Asn Arg Leu Arg Pro Gly Ile 450 Arg Tyr 465 Asp Thr Ala Ser Gin Pro Glu Tyr 530 Ala 275 Trp Ser Pro Asn Cys 355 Pro Ala Thr Tyr Ala 435 Gly Arg Ser Arg Gly 515 Arg Arg Glu Leu Leu Ala Ala Ser Gin Arg Leu Asn Ala Ser Val Glu Ile Ser 340 Ser Phe Met Thr Lys 420 Asp Arg Tyr Leu Cys 500 Glu Leu Ala Gly Ser 325 Arg Phe Glu Ala Arg 405 Asp Thr Tyr Gin Ile 485 Ser Val Asp Ser Ala 310 Asp Asn Arg Gin His 390 Leu Phe His Asn Lys 470 Pro Glu Cys Glu Asp 295 Ala Phe Pro Gin Glu 375 Ala Cys Val Asn Ile 455 Val Trp Pro Cys Phe 535 280 Gly Glu Ala Trp Arg 360 Ser Leu Asp Leu Glu 440 Phe Gly Ala Cys Trp 520 Thr Trp Gly Ser Phe 345 Asp Lys His Ala Asn 425 Val Thr Tyr Ser Leu 505 Leu Cys Gly Ala Tyr 330 Arg Cys Ile Asn Met 410 Val Arg Tyr Trp Pro 490 Gin Cys Ala Ala Ile 315 Phe Glu Ala Met Met 395 Arg Lys Phe Leu Ala 475 Ser Asn Ile Asp Leu 300 Thr Gin Phe Ala Phe 380 His Pro Phe Asp Arg 460 Glu Ala Glu Pro Cys 540 285 Glu Ile Ser Trp His 365 Val Arg Val Asp Arg 445 Ala Gly Gly Val Cys 525 Gly Ser Glu Leu Glu 350 Ser Val Ala Asn Ala 430 Phe Gly Leu Pro Lys 510 Gin Leu Val Leu Asp 335 Gin Leu Asn Leu Gly 415 Pro Gly Ser Thr Leu 495 Ser Pro Gly Val Ala 320 Pro Arg Arg Ala Cys 400 Arg Phe Asp Gly Leu 480 Pro Val Tyr Tyr Trp Pro Asn Ala Ser Leu Thr Gly Cys Phe Glu Leu Pro Gin Glu Tyr 550 555 560 WO 99/51641 WO 99/1 641PCT[US991O7333 Ile Leu Asn Leu Ala 625 Thr Ile Phe Gly Thr 705 Cys Leu Pro Thr Ser 785 Ser Ile Thr Trp Ala Thr 595 Gly Pro Phe Ar g Ser 675 Leu Lys His Ile Asn 755 Ile Tyr Ser Phe Al a 835 Gly Leu 580 Pro Gly Ser Ser Ile 660 Pro Leu Glu Ar g Al a 740 Phe Ile Arg Val Gin 820 His Asp 565 Ala Val Val1 Thr Val1 645 Phe Al a Ile Thr Asp 725 Leu Asn T rp Val1 Val 805 Pro Ala Ala Trp Ala Val Gly Pro Val Thr Ile Ala Cys Thr Val1 Phe Ala 630 Cys Gly Se r Val1 Al a 710 Ala Cys Glu Leu Gin 790 Leu Gin Phe Leu Lys Leu 615 Val Tyr Gly Gin Val 695 Pro Ser Thr Al a Ala 775 Thr Gly Lys Lys Phe Ala 600 Cys Cys Ser Ala Val1 680 Al a Glu Met Leu Lys 760 Phe Thr Cys Asn Val 840 570 Leu Gly Cys Leu Le u 650 Giu Ile Leu Arg Gly 730 Al a Ile Pro Met Phe 810 Ile Ala Gly Arg Met Arg 635 Leu Gly Cys Val Glu 715 Ser Phe Gly Ile Cys 795 Al a Glu Arg Val Giu Thr 620 Arg Thr Al a Leu Val1 700 Val Leu Lys Phe Phe 780 Val Pro Glu Al a Phe Leu 605 Phe Leu Lys Gin Al a 685 Giu Val Ala Thr Thr 765 Tyr Ser Lys Val Thr 845 Val1 590 Cys Ile Gly Thr Arq 670 Leu Al a Thr Tyr Arg 750 Met Val1 Val Leu Arg 830 Leu 575 Arg Tyr Phe Leu Asn 655 Pro Ile Pro Leu Asn 735 Lys Tyr Thr Ser His 815 Cys Arg His Ile Ile Gly 640 Arg Arg Ser Gly Arg 720 Val1 Cys Thr Ser Leu 800 Ile Ser Arg WO 99/51641 WO 9951641PCT/US99/07333 Ser Asn 250 Vai Ser Arg Lys Arq 855 Ser Ser Ser Leu Gly 860 Giy Ser Thr Giy Ser 865 Thr Pro Ser Ser Ile Ser Ser Lys Ser 875 Asn Ser Giu Asp Phe Pro Gin Pro Arg Gin Lys Gin Gin 890 Gin Pro Leu Ala Leu Thr 895 Gin Gin Giu Ser Gin Gin 91 5 Gin 900 Gin Gin Gin Pro Thr Leu Pro Gin Gin Gin Arg 910 Giy Ser Giy Gin Pro Arg Cys Lys 920 Gin Lys Vai Ile Thr Val 930 Thr Phe Ser Leu Ser 935 Phe Asp Giu Pro Gin 940 Lys Asn Aia Met Ala 945 Ser His Giy Asn Ser Asp Thr Leu Thr 965 Thr 950 His Gin Asn Ser Leu 955 Giu Aia Gin Lys Arg His Gin Pro Leu Pro Leu Gin Cys Giy 975 Giu Thr Asp Vai Gly Giy 995 Pro Ala Leu 1010 Giy Ser Thr 1025 <210> <211> <212> <213> Leu 980 Asp Leu Thr Val Gin 985 Giu Thr Giy Leu Asp Gin Arg Pro Giu Vai 1000 Giu Asp Pro Giu 1005 Gin Giy Pro 990 Giu Leu Ser Ser Giy Giy Val Vai Ser Ser Ser Gin Ser Phe 1015 Vai Ile 1020 Val Thr Giu Asn Vai Val Asn Ser 1030 1035 36 4185

DNA

Artificial Sequence <220> <223> Chimeric <400> 36 atggqatcqc ccagccaaga caccagaagq cgcctggagg ggcgtgcqcc cacjgcactgg tgcttgcgct aggtgctgac gcgqcccaqc ccatqctttt tqqgtgcaca actttgtgcg cccggcactg cctggaggga agaggactgt tgcactggac catcctcgac tgcctcactc ctgctgctgt gacttgqtgc gqtcctgtca cgcatcaacc aqttgctcca agccgtgqtg ggggtgctgt tgggtgggct atgagcaccg gtgacccgca aggacacaca ctgatggctc ggctgagggc gttcccagtg tggcatccag cctgctgcct tgcgctggag acgccacatc WO 99/51641 WO 9951641PCT/US99/07333 tgccccgacg ggcggttcct ccacagatta tttgcccqca ttcttcaact attgaggcct gtgggccgtg cccagtgccc gccagccagc gagagtgtgg tcctacccca cggaacccct gactgcgcaq gtqgtcaatg cccaacacca gactttgtgc gtccgctttg gcaggcagtg gacaccagc agtgagccct ctctgcattc ggcctgggct atccgctggg gccaccctct tcaggtcggg ttcatcttca actgccttct ttcggtgggg gccatctgcc gaggcaccgg tgcaaccacc ctctgcacgc ttcattqgct tatgtcacct agcggctccg ccgcagaaga gctgcccggg ggctccacgg ttcccacagc cagcagcagc cagaaggtca aagaacgcca agcqatacgc gatctgaccg gtggaggacc atcagtggtg atcatggcgt gagcggcagc gqgacaggag ggatactctg gccatgcagg aataaggctc aatccatatq gatagacgac cgcgtagctg gctcttatgc acagtgatgt gctacgcctc cagtgcctcc ggacctatgt ttgagctaga ccatgagccg gcgtggctgt gcctcaatgc tggcaggcag tcagtgactt ggttccgtga cccactctct cagtgtacgc cccggctctg tcaacgtcaa accgctttgg ggcgctatcg tcatcccatg gcctccagaa cgtgccagcc actggcccaa qcgatgcctg ttgtgctqggg agctctgcta ttgccaagcc ctgtctgcta cccgggaggg tggcacttat gcacaggcaa gcgatgcaag tttatgcctt tcaccatgta ccagtgacta tggtgcttgg acaccatcga ccacgctgcg gatccacccc ccgagaggca ccctgaccct tctttggcag tggcccacgg tgacccgaca tccaggaaac ctgaagagtt gaggcaqcac gctgcctgag tccgcaggga agagtggcaa atgaagataa ccatqatcag atgcacaatt tagatgcaat gagaatatca accctgccta gacccatggt ctccatccag taccagtgcc tgacttcttc gt ccactgtg ggctcgtgcc cgcggccttt cctgttcacc caqcttcacc tgaggqggct tgcctcctac attctgggag ccgggctgtg catggcccat tqacgcgatg gtttgatgcc tgatggtatt ctaccagaag ggcctcaccc tgaggtgaag ctatgagtac tgccaqcctg ggctgtggga tgtctttgtg catcctgctg atccacggca ctcagccctg tgcccagcgg ctcgggccag ggagacagcc tatgttgggc caagactcgc caccacctgc ccgggtacag ctgcctcttt ggaggtgcgt ccqcagcaac ctcctcctcc gaagcagcag cccacagcag cggcacggtc gaattctacg ccagccatta aggtctgcaa gtccccagca tgttacagaa cgaggaggcc caaqcqggac gagtacgttt aaggggcttc agccatggac agttcgagaa aaagagttta attatctgac cctgcctacg gatqctccca gtggccaacc aagctgagtg caagccaag gcgtctgagg cgcaa cat ct gagggtgtgg cgttctgagg tgggtggcca gctgagggtg ttccagagcc caqaggttcc ccctttgagc gcgctccaca cggccagtta ccctttcgcc ggccgctaca gtgggctact tcagccgqcc agtgtgcagc cgattggacg actqgctgct cctgtcacca cggcacaatg ggtggtgt ct gtgtgtacct ctcaccaaqa ccacgcttca ctgctcatcg cccgaacggc tcgctggcct aagtgccccg atcatctqgc accaccacca gcgcccaagc tqcagcaccg gtctcccgca atcagcagca cagccgctgg caacgatctc accttctcac caccagaact ctcccgctgc ggacctgtgg cttgtagtgt aacgtagtga aaggaagccc gcccgccgqg atcaagcaga accaagctgg acactcaaga gttqatgtgg tggaatgatc t ctaccaaat caacaagatg ctgccatcac tcttgaggct acaagtcccg ccatggctga gcgactatgq gtgtggccac tgcgagccct atgcccggga gtgatggttg ctatcaccat tggacccttg gctqcagctt aggagtccaa acatgcaccg acgggcgccg cagctgacac acatcttcac gggcagaagg ccctgcccgc cgggcgaagt aattcacttg tcgaactgcc tcgcctqcct ccacaccagt tcctctgcta tacggcgtct ccaaccgcat tcagtcctgc tggtcgcctg gggaggtqgt acaatgtqct aaaacttcaa tggcattcct tgtgcgtgtc tgcacatcat cagctcacgc agcggtccag agagcaacag ccctaaccca agcagcagcc tgagctttga ccctggaggc agtqcgggga gtggagacca ccagttcaca attcaatgac ggcggatcaa agct caagct tgagaatcat tgtatcagaa tcccatacaa agaaggtgtc ctggaatcca actatcttaa tgcttagagt tggtgttatt atttcagatc ctatgactac gattctccgc cgagacaggc ctcggagaaa gctgcagaaq gctgcttgct gggggccctg cgagctggcc gaacaacagc ccggcagcqa gatcatgttt tgccctctgc cctctacaag ccacaatgag ctatctgcqt cttgactctg ctctcgctgc ctgctgctqg cgctgattgt ccaggagtac cggtgccctg ggtcaaggcc ctgcatgacc tggtttgqgc tgcacgcatc ctcacaggtg gctggtggtg gacactgcgc cctcatcgcg cgaggccaag gcccatcttc agtcagcctc cctcttccag tttcaaggtg cagccttgga cgaagaccca gcaaqagcag cagatqcaag tgagcctcag ccagaaaagc aacggactta gcggccagaq gagctttgtc tctggagtcc cgacgagatc gctqctgctc ccatgggtca catcttcacg gtatgaqcac tgcttttgag ggaatgctat tgacttggac tcgagtcccc 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 WO 99/51641 WO 9951641PCT/US99/07333 accacaggga gtagggggcc atcatgtttc aaccgaatgg aactcctcgg tcccatctag cqagaattca tcccacttca gacaccatc tcatcgaata aaaggtcaga tagtagcgct aggaaagcaa ttattctgtt tcgactactt ttctgaagat cgtgcgccac tccagttgaa cccctttgac gagaagaaaa tagtgaatat gqctctcttt cttaaacaag cccagaatat gttcgtggac agacaccgag cctgaaggac ttacaaagtg tggatacact gatcaaqttc agaacaatta aaagatcttc gatggacccc ctgaacccag aatatccqct tgcggtctgt tcattttcag gctttgaaaa tcgtggagtc tcacataccc tagaqgagaa agagaqatgc acagtgacaa ttgtctttgc tctaa aatqgtcgat tgtcacctct aqacaatgag ctgqttccag aatcatgtat ccaggcagcc aattatctac tgccgtcaag 3720 3780 3840 3900 3960 4020 4080 4140 4185 <210> <211> <212> <213> <220> <223> 37 1394

PRT

Artificial Sequence Chimeric <400> 37 Gly Ser Leu Leu Ala Leu Pro Ala Leu 10 Leu Leu Leu Trp Gly Ala Val Ala Glu Val Leu Gly Gly Pro Ala Lys Lys Val 25 Leu Thr Leu Glu Gly Asp Leu Pro Ala Glu Gly Leu Phe Pro His Gin Lys Gly Asp Cys Gly Pro Val Asn Glu 55 His Arg Gly Ile Gin Arg Leu Giu Ala Met Leu Phe Ala Leu Arg Ile Asn Arg Asp 75 Pro His Leu Leu Pro Gly Val Arg Leu Gly Ala His Ile Leu Ser Cys Ser Lys Asp Thr His Ala Leu Gly Ala Asp 115 Glu 100 Gin Ala Leu Asp Phe 105 Val Arg Ala Ser Leu Ser Arg 110 Tyr Ala Thr Gly Ser Arg His Cys Pro Asp Gly Ser 125 His Gly 130 Asp Ala Pro Thr Ala 135 Ile Thr Gly Val Ile 140 Gly Gly Ser Tyr Asp Val Ser Ile Gin 150 Vai Ala Asn Leu Leu Arg Leu Phe Gin Ile 160 PCTIUS99/07333 WO 99/51641 Pro Gin Ile Ser Tyr Ala Ser Thr Ser Ala Lys Leu Ser Asp Lys Ser Arg TI Lys I Thr Giu 225 Val Leu Giu Phe Ala 305 Ser T rp Phe Al a Val 385 Pro 'yr lia Tal eu 31y Leu A\sp Thr 290 Gly Tyr As n Arc Val 37 C Ty Asi Asp TI 1 Met P~ 195 Ala S Glu Arg2 Gin Ala 275 Trp Ser Pro Asn Cys 355 -Pro -Ala ni Thr yr .80 la ~er U a kla Lays 260 Arg Vai Giu Ile Ser 340 Ser Ph( Met Th 165 Phe P.

Giu I Giu C Arg Met 245 Pro Glu Al a Gly Ser 325 *Arg *Phe Giu -Aia r Arg 405 la le ;ly U a DO0 3er Se r Leu Ser Ala 310 Asp Asr Arc Gir Hi~ 39( Lei Arg T Leu A 2 Asp TI 215 Arq *r Arg I Ala2 Leu Asp 295 Ala Phe Pro Gin Giu 375 sAla 0 u Cys e Val 'hr ~rg :00 yr ~sn Ula krg Dd a 280 Gly Glu Al a Trp Arg 360 Ser Le.

Asj Let Val P 185 Phe P Gly C Ile C Ala Val 265 Ala Trp Giy Ser Phe 345 IAsp Lys 1His SAla ui Asn ~ro ~he ;lu :ys ?he 250 kl a Ser Gly Al a Tyr 33C Arc Cys I l( Asi Me' 41' Va P1

TI

2:

G.

V.

G

A

I

3

P

0 1 -o Asp Phe P 1 ~n Trp Thr T 205 ir Gly Ile G 220 al Ala Thr S 35 iu Gly Val al Leu Phe in Arg Leu2 285 la Leu Glu 300 ie Thr Ile 15 he Gin Ser ;lu Phe Trp ~la Ala His 365 'let Phe Val 380 Met His Arq 395 AXrg Pro Val Lys Phe Asp 'he yr iu ;er (al rhr %.sn Ser Glu Leu Giu 350 Ser Val Ala Asr Al 43( Gin A Val S Ala I Giu I Arg 255 Arg Ala Val Leu Asp 335 Gin *Leu *Asn Leu iGly 415 a Pro 0 lia er ~he .ys kla Ser Ser Val1 Al a 320 Pro Arg Arg Ala Cys 400 Arg Phe Arg Leu Tyr Lys Asp Ph 420 425 Arg Pro Ala 435 Asp Thr His Asn Giu 440 Val Arg Phe Asp Arg 445 Phe Gly Asp WO 99/51641 WO 9951641PCT/US99/07333 Gly Arg 465 Asp Ala Gin Glu T rp 545 Ile Leu As n Leu Ala 625 Thr Ile Phe Gly Thr 705 Ile 450 Tyr Thr Ser Pro Tyr 530 Pro Arq Gly Ala Leu 610 Lys Ala Al a Ile Gin 690 Gly Gly Arg Ser Arg Gly 515 Arq As n Trp Ala Thr 595 Gly Pro Phe Arg Ser 675 Leu Lys Arg Tyr Asn Ile Phe Thr Tyr Leu Arg Ala Gly Ser Giy Tyr Leu Cys 500 Giu Leu Ala Gly Leu 580 Pro Gly Ser Ser Ile 660 Pro Leu Giu Gin Ile 485 Ser Val1 Asp Ser Asp 565 Al a Val Vali Thr Val 645 Phe Ala Ile Thr Lys.

470 Pro Glu Cys Glu Leu 550 Al a Thr Val Phe Al a 630 Cys Gly Ser Val1 Ala 710 455 Val1 Trp Pro Cys Phe 535 Thr Trp Leu Lys Leu 615 Val1 Tyr Giy Gin Val 695 Pro Gi y Al a Cys T rp 520 Thr Gly Ala Phe Ala 600 Cys Cys Se r Ala Val 680 Ala Glu Tyr Ser Le u 505 Leu Cys Cys Val1 Val 585 Ser T yr Thr Al a Arg 665 Al a T rp Arg Trp Pro 490 Gin Cys Al a Phe Gly 570 Leu Gly Cys Leu Leu 650 Giu Ile Leu Arg Gly 730 Al a 475 Ser As n Ile Asp Glu 555 Pro Gly Arg M'et Arg 635 Leu Gly Cys Val Glu 715 460 Giu Ala Glu Pro Cys 540 Leu Val Val1 Glu Thr 620 Arg Thr Al a Leu Val 700 Val Gly .Gly Val1 Cys 525 Gly Pro Thr Phe Leu 605 Phe Leu Lys Gin Al a 685 Giu Val Leu Pro Lys 510 Gin Leu Gin Ile Val 590 Cys Ile Gi y Thr Arg 670 Leu Al a Thr Thr Leu 495 Ser Pro C-iy Glu Al a 575 Arg Tyr Phe Leu Asn 655 Pro Ile Pro Leu Leu 480 Pro Val Tyr Tyr Tyr 560 Cys His Ile Ile Gly 640 Arg Arg Ser Gly Arg 720 Cys Asn His Arg Asp 725 Ala Ser Met Leu Ser Leu Ala Tyr Asn Val 735 WO 99/51641 WO 9951641PCTIUS99/07333 Leu Pro Thr Ser 785 Ser Ile Thr Ser Ser 865 Phe Gin Ser Thr Aila 945 Ser Giu Val Leu Giu Cys 770 Asp Giy Leu Aia Asn 850 Thr Pro Gin Gin Vai 930 His Asp Thr Giy Ile Ala 740 Asn Phe 755 Ile Ile Tyr Arg Ser Vai Phe Gin 820 Ala His 835 Vai Ser Pro Ser Gin Pro Giu Gin 900 Gin Gin 915 Thr Phe Gly Asn Thr Leu Asp Leu 980 Gly Asp 995 Leu Cys Thr Leu Tyr Aia Phe Lys Thr Arg Lys Cys Asn Trp Val Val 805 Pro Ala Arg Ser Glu 885 Gin Pro Ser Ser Thr 965 Asp Gin Giu Ala Leu Ala 775 Gin Thr 790 Leu Giy Gin Lys Phe Lys Lys Arg 855 Ser Ile 870 Arg Gin Gin Gin Arg Cys Leu Ser 935 Thr His 950 Arq His Leu Thr Arg Pro Lys 760 Phe Thr Cys Asn Val1 840 Ser Ser Lys Pro Lys 920 Phe Gin Gin Val Giu 100' 745 Phe Ile Leu Pro Thr Met Leu Phe 810 Thr Ile 825 Ala Ala Ser Ser Ser Lys Gin Gin 890 Leu Thr 905 Gin Lys Asp Giu Asn Ser Pro Leu 970 Gin Giu 985 Val Glu 0 Giy Ile Cys 795 Al a Glu Arg Leu Ser 875 Gin Leu Val Pro Leu 955 Leu Thr Asp Phe Phe 780 Val Pro Giu Al a Giy 860 Asn Pro Pro Ile Gin 940 Giu Pro Gly Pro 750 Thr Met 765 Tyr Val Ser Val Lys Leu Val Arg 830 Thr Leu 845 Gly Ser Ser Giu Leu Aia Gin Gin 910 Phe Gly 925 Lys Asn Ala Gin Leu Gin Leu Gin 990 Glu Giu 1005 Tyr Thr Ser His 815 Cys Arg Thr Asp Leu 895 Gin Ser Al a Lys Cys 975 Gly Leu Thr Ser Leu 800 Ile Ser Arg Gly Pro 880 Thr Arg Gly Met Ser 960 Gly Pro Ser Pro Ala Leu Val Val Ser Ser Ser Gin Ser Phe Val Ile Ser Gly Gly 1010 0101015 1020 WO 99/51641 PCT/US99/07333 64 Gly Ser Thr Val Thr Glu Asn Val Val Asn Ser Met Thr Leu Glu Ser 1025 1030 1035 1040 Ile Met Ala Cys Cys Leu Ser Glu Glu Ala Lys Glu Ala Arg Arg Ile 1045 1050 1055 Asn Asp Glu Ile Glu Arg Gin Leu Arg Arg Asp Lys Arg Asp Ala Arg 1060 1065 1070 Arg Glu Leu Lys Leu Leu Leu Leu Gly Thr Gly Glu Ser Gly Lys Ser 1075 1080 1085 Thr Phe Ile Lys Gin Met Arg Ile Ile His Gly Ser Gly Tyr Ser Asp 1090 1095 1100 Glu Asp Lys Arg Gly Phe Thr Lys Leu Val Tyr Gin Asn Ile Phe Thr 1105 1110 1115 1120 Ala Met Gin Ala Met Ile Arg Ala Met Asp Thr Leu Lys Ile Pro Tyr 1125 1130 1135 Lys Tyr Glu His Asn Lys Ala His Ala Gin Leu Val Arg Glu Val Asp 1140 1145 1150 Val Glu Lys Val Ser Ala Phe Glu Asn Pro Tyr Val Asp Ala Ile Lys 1155 1160 1165 Ser Leu Trp Asn Asp Pro Gly Ile Gin Glu Cys Tyr Asp Arg Arg Arg 1170 1175 1180 Glu Tyr Gin Leu Ser Asp Ser Thr Lys Tyr Tyr Leu Asn Asp Leu Asp 1185 1190 1195 1200 Arg Val Ala Asp Pro Ala Tyr Leu Pro Thr Gin Gin Asp Val Leu Arg 1205 1210 1215 Val Arg Val Pro Thr Thr Gly Ile Ile Glu Tyr Pro Phe Asp Leu Gin 1220 1225 1230 Ser Val Ile Phe Arg Met Val Asp Val Gly Gly Gin Arg Ser Glu Arg 1235 1240 1245 Arg Lys Trp Ile His Cys Phe Glu Asn Val Thr Ser Ile Met Phe Leu 1250 1255 1260 Val Ala Leu Ser Glu Tyr Asp Gin Val Leu Val Glu Ser Asp Asn Glu 1265 1270 1275 1280 Asn Arg Met Glu Glu Ser Lys Ala Leu Phe Arg Thr Ile Ile Thr Tyr 1285 1290 1295 Pro Trp Phe Gin Asn Ser Ser Val Ile Leu Phe Leu Asn Lys Lys Asp 1300 1305 1310 WO 99/51641 PCT/US99/07333 Leu Leu Giu Giu Lys Ile Met Tyr Ser His Leu Vai Asp Tyr Phe Pro 1315 1320 1325 Giu Tyr Asp 1330 Leu Lys Met 1345 Giy Pro Gin Arg Asp Aia Gin Aia Aia Arg 1335 1340 Giu Phe Ile Phe Val Asp Leu 1350 Asn Pro Asp Ser Asp Lys Ile Ile Tyr 1355 1360 Ser His Phe Thr Cys Aia Thr 1365 Ala Aia Val Lys Asp Thr Ile 1380 Leu Phe Asp Thr Giu Asri 1370 Leu Gin Leu Asn 1385 Ile Arg Phe Val Phe 1375 Leu Lys Asp Cys Gly 1390 <210> 38 <211> 3177 <212> DNA <213> Artificial Sequence <220> <223> Chimneric hmGiuR8/hCaR <400> 38 atggtatqcg ttctactgga cgggtggatq ggggtgcctt tatgcaattg cgcatcctcg caggcattaa ttcaccaagc atggttgcta ccagagctaa taccaagccc ctqgcttctg gagattggtg gaatttgaaa tttgccaatg gggcattttc caagaggaga tttgatcgat gaattctggg ataaagaaat aaggtccaat aaagatctct gagctacttg tttaatqaaa aaaagcacaq agggaaagcg tcctcacaat gggacattat gtggggagct accagattaa acacgtgctc tagagaaaga ccgacaagat acattttaag gtgataacac aagccatggt aggggaacta gtgtttgcat aaattatcaa aggatgacat tctggattgg ttqcagaagg actttaqaag aggagaattt qcacagggct ttgtaattga gccctqgata gttatattcg acggagatgc agtacaaaqt atcagcctct gatgcaaaga tttggggggt gaagaaggaa caaggaccct tagggacacc tqcttcggat ttctggcgtc actttttaag caggtatgac ggacatcgtg tggtgagagc tgctcagtca acgcctqcta caggaggata ct cagatagt gqctgtgaca ccgaactctt tggctgcaag ggagcgaatt tgctgtatat cattggcctt ggctgtaaat tcctggacgt catcggccac tgcccttgtt.

act cacagcc ctcttccctg aaggggattc: gatctccttt.

tatgctttgg gtgaagtgtg ataggtgctg atacctcaaa tttttctctc acagcactgg ggtgtggagg cagaaaatcc gaaacaccta ttggaagcag tqgggatcca attttgccca gccaataatc ttaggatcac: gctcggqatt tccatggctt tgtccacgaa tttaatggca tatgatatct tggaccaatc tcttcctctt aggagtatgc tccacgcaaa acagactgga ccaacatcac agcagtctct ctaatggaga cagcaagctc tcagctatgc gagtggttc gatggaatta ccttcaccca cacgtgaacc atgctcgagc caaaaaaact aaatagcacc aacgagcatc qaaqaaatgt atgggaaaag catcttatga acgccctgca tgagtaccat gtgctggcac tccagtatca aqcttcatct gaccgccaaq ccattccata gggagagaga ggccatgctt tctgggtgtc aacattcqtg tccacccatt cgtgtccatc atccacagcc gcctgactcC tgtttcgaca gatctcgag aagacctgga agtgattatg aaaccaaagt tqtctatcag aattgatgga gtggtttgca gaacagtcat acaggaagga caatatgcac tgatgggaaa tcctgtcact aataaccaac aaaagtggaa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 PCT/US9910733 3 WO 99/51641 gacatqcagt aagccagggg tgtqaaggtt agacccaaca tctccctggg gtgatcgtga cttaqttacg gcagcaccag ttcagctatg aaqaaatctg agcctcatct atcatcattg aagtgtgaca gtcacttgta aaacctattg ttttttggta tccatgaqtt ataatttttc gctttcaagg agcaqccttg aqcgaagacc caqcaagagc cccagatgca gatgagcctc gcccaqaaaa gaaacggact cagcggccac cagagctttc qggctcatag agaggaagaa acaactacca tgaaccgcac ctgtggtgCC cctttgtCCg tgctcctaac atacaatcat cagcccttct tcacagcgc ccgtccagct act atggaga tttctgatct ctgtttatgc gatttaccat cagcccagtc taagtgcttc atccagaaca tggctgCCCq qaggctccac cattcccaca agcagcagca agcagaaggt agaagaacgc cagcgatac *tagatctgac aggtggagga tcatcagtgg agaacatact aacggtgaaa ggtggatgaq aggctccaq tqtgtttgtt ctataatgac ggggattttt atgctccttc gaccaaaaca caagttcatt ccttqgagtg gcagcggaca ctcactcatt cattaaaacg gtataccacc agcaqaaaag agtatctctg gaataccatc qgccacqctg gggatccacc gcccgagagg gcccctgacc catCtttggC catggcccac gctgacccga cgtccaggaa ccctgaagag tggaggcagc cacccggcgt gggqt ccctt ctgtcctgtg cttatcccca qcaatattgg acacctatcg ctctgttatt cgacgggtct aaccgtatcc agtccagcat tttgtctggt ctagatccag tqttcacttg agaggtgtcc tgcatcattt atgtacatcc ggcatgctct gaggaggtgc cgccgcagca ccctcctcct cagaagcaqc ctcccacagc agcggcacgg gggaattcta caccagccat acaggtctgc ttgtccccag actgttacag ctgtctgcag gctqctggca aactttgccc tcatcaaatt gaatcatcgc tgaqggcttc caatcacgtt tcctaggact accgaatatt ctcagctggt ttgttqtgga agaaggccag gatacagtat cagagacttt gqttagcttt agacaacaac atatgcccaa gttgcagcac acgtctcccq ccatcagcag agcaqccgct agcaacqatc tcaccttctc cgcaccagaa tactcccgct aaggacctgt cacttgtagt faaaacgtagt cctgccgtgt ctgtgaacgc tctggatcaq ggagtggcat caccaccttt aggacgcgaa tttaatgatt tggcatgtgt tgagcagggg gatcaccttc tcccccccac gggagtgctc cctcttgatg caatgaagcc catccccatc acttactgtc ggtttatatt cgcagctcac caagcggtcc caagagcaac ggccctaac tcagcaqcag actgagcttt ctccctgqag gcagtgcggg gggtggagac gtccagttca qaattca 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3177 <210> 39 <211> 1059 <212> PRT <213> Artificial Sequence <220> <223> Chimeric hmGiuR8/hCaR <400> 39 Val Cys Glu Gly Lys Arg Ser Ala 5 Met 1 Ser 10 Cys Pro Cys Phe Phe Leu Leu Thr Ala Lys Phe Tyr Trp Ile Leu 25 Ser Gin Glu Tyr Ala His Ser Ile Arg 40 Gly Gly Leu Phe Pro Val His Ala Lys Thr Met Met Gin Arg Thr His Ile Ile Leu Val Asp Gly Asp Gly Giu Arg Gly Val Pro Cys PCT/US99/07333 WO 99/51641 Giv Glu Leu Lys Lys Giu Lys Gly Ile His Arg Leu Glu Ala Met Leu Tyr A Thr I Leu C Ser Asp 145 Met Ala Ser Ile Gly 225 Glu Pro Pro Arg Trp 305 Gin la ~eu lu ksp 130 Lys Val1 Ser Arq Val 210 Asn Ile Arc As 11( 2 9 11' Gi' Ile P Gly Gin 115 Val Ile Ala Thr Val1 195 Thr Tyr Gly Pro i Ala 275 e Leu 0 e Gly u Glu ~sp al1 .00 ~er i ys Ser pAsn Al.a 180 Val Ala Gly Giy Gi) 2 6( Ar Gli Se: Ii Gin I Arg I Leu I] Cys Gly Ile 165 Pro Pro Leu Giu Val 245 pGlu ;Ala u Ala r Asp e Ala le ie 'hr .l a la 1 150 Leu G1u Pro Giy Sex 23C Cys PhE Va~ Al Asn Leu Phe Asn 135 Ile Arg Leu Asp Trp 215 Gly Ile Glu LI le a Lys Lys A Asp TI 1 Val G 120 Gly I Giy Leu Ser Ser 200 Asn Vai Ala Lys Met 280 Lys Gly y Ala .sp hr .05 ;ln ~sp ki a ?he 1.85 Tyr Tyr Giu Gin Ile 265 PhE Lei Pro Asp Cys Ser2 Ala Leu Pro Pro Ala Ala 155 Lys Ile 170 Asn Thr Gin Ala Val Ser Ala Phe 235 Ser Gin 250 Ile Lys Ala Asn I Asn Gin r Lys Ile 315 1 Thr Ile euI %.rg1 Ile Ile 140 Ser Pro Arg Gin Thr 220 Thr Lys Arg Glu Ser 300 Al a .eu ksp 1lu 125 Phe Ser Gin Tyr Ala 205 Leu Gin Ile Leu Asp 285 Giy Prc Ser Thr 110 Lys Thr Val Ile Asp 190 Met Al a Ile Pro Leu 270 Asp His Val ryr Asp Lys Ser Ser 175 Phe Val1 Ser Ser Arg 255 Glu IlE Ph( Tyi Ile Al a Al a Pro Ile 160 Tyr Phe Asp Glu Arg 240 Giu Thr Arq Leu r Gin 320 2 91 Ser 310 Glu T r Gi' Leu Pro Lys Arg Ala 325 Ser Ile Asp Phe Asp Arg Tyr Phe 345 Arg Ser Arg Thr Leu Ala Asn 350 WO 99/51641 WO 9951641PCTIUS99/07333 68 Asn Arg Arg Asn Val Trp Phe Ala Glu Phe Trp Giu Giu Asn Phe Gly 355 Cys Thr 385 Lys1 His Arg Val Gly 465 Lys Leu Al a Val1 Asn 545 Arg Leu Leu As n ys 370 31Y Val1 As n M4et As n 450 Asp Ser Lys Ser Lys 530 Tyr Pro Glu Gly Asp 610C Leu Leu Gin Met S er 435 Phe Ala Thr Val1 Val1 515 Gly Gin Asn Trp Ile 595 Thr 31Y Glu Phe Hius 420 Thr As n Pro Giu Giu 500 Cys Val1 Val1 Met His 580 Ile Pro Ser Arg Val 405 Lys Ile Giy Gly Tyr 485 Asp Ser Pro Asp Asn 565 Ser Al a Ile H'is Ilie 390 Ile Asp Asp Ser Arg 470 Lys Met Leu Cys Giu 550 Arg Prc Thr Val Gly 375 Ala Asp Leu Gly Ala 455 Tyr Val1 Gin Pro Cys 535 Leu Thr Trp Thr Arc 615 360 Lys Arg Asn Arg Asp Ser Ala Val Tyr 410 Cys Pro Gly 425 Lys Giu Leu 440 Gly Thr Pro Asp Ile Phe Ile Giy His 490 Trp Ala His 505 Cys Lys Pro 520 Trp His Cys Ser Cys Giu Giy Cys Gin 570 *Ala Val Val 585 *Phe Val Ile 600 Ala Ser Gly 365 Ser Ser 395 Ser Tyr Leu Val1 Gin 475 T rp Arg Gly Giu Leu 555 Leu Pro Vai Arg His 380 Tyr Met Ile Gly Thr 460 Tyr Thr Giu Giu Arg 540 Cys Ile Val1 Thr Giu 620 Ile Glu Ala Giy T yr 445 Phe Gin Asn His Arg 525 Cys Pro Pro Phe Phe 605 Leu Lys Gin Tyr Leu 430 Ile Asn Ile Gin Thr 510 Lys Giu Leu Ile Val1 590 Val Ser Lys Giu Al a 415 Cys Arg Glu Thr Leu 495 His Lys Gly Asp Ile 575 Al a Arg Tyr Cys Gly 400 Leu Pro Al a As n Asn 480 His Pro Thr Tyr Gin 560 Lys Ile Tyr Val1 Leu Leu Thr Gly Ile Phe Leu Cys Tyr Ser Ile Thr Phe Leu Met Ile A21; 630 635 640 WO 99/51641 WO 99/164 1PCT/US99/07333 Al a Leu Ile Phe Val 705 Ile Arg Leu Lys Phe 785 Phe Thr Leu Thr Al a 865 Ser Ser Al a Gly His Ile 690 Gin Ile Gi y Gly Thr 770 Thr Phe Leu Tyr Ile 850 Al a Ser Lys Pro Met Arg 675 Ser Leu Ile Val1 Tyr 755 Arg Met Gly Thr Met 835 Glu Arg Leu Ser Asp Thr Ile Ile Cys Ser Phe Arg Arg Val Phe Leu Gly Cys 660 Ile Pro Leu Asp Leu 740 Ser Gly Tyr Thr Val1 820 Pro Giu Al a Gly Asn 900 645 Phe Phe Al a Gly T yr 725 Lys Ile Val1 Thr Ala 805 Ser Lys Val Thr Gly 885 Ser Ser Glu Ser Val 710 Gly Cys Leu Pro Thr 790 Gin Met Vali Arg Leu 870 Ser Glu Tyr Gin Gin 695 Phe Giu Asp Leu Glu 775 Cys Ser Ser Tyr Cys 855 Arg Thr Asp Aia Gly 680 Leu Vali Gin Ile Met 760 Thr Ile Ala Leu Ile 840 Ser Arg Gly Pro Al a 665 Lys Val1 Trp Arg Ser 745 Val Phe Ile Giu Ser 825 Ile Thr Ser Ser Phe 905 650 Leu Lys Ile Phe Thr 730 Asp Thr Asn Trp Lys 810 Ala Ile Al a Asn Thr 890 Pro Leu Ser Thr Val 715 Leu Leu Cys Giu Leu 795 Met Ser Phe Al a Val 875 Pro Gin Thr Val1 Phe 700 Val1 Asp Ser Thr Ala 780 Ala Tyr Val His His 860 Ser Ser Pro Lys Thr 685 Ser Asp Pro Leu Val1 765 Lys Phe Ile Ser Pro 845 Ala Arg Se r Glu 655 Asn Pro Ile Pro Lys 735 Cys Al a Ile Pro Thr 815 Gly Gin Lys Arg Ile 895 Gin Gin Gin Gin Pro Leu Ala Leu Thr Gin Gin Giu Gin Gin Gin Gin Pro 915 920 925 WO 99/51641 WO 9951641PCT[US99/07333 Leu Thr 930 Leu Pro Gin Gin Arg Ser Gin Gin Gin 940 Pro Arg Cys Lys Gin Lys Val Ile Phe 945 Asp Giu Pro Gin Lys 965 Ser Giy Thr Vai Phe Ser Leu Ser Asn Ala Met Ala His 970 Gly Asn Ser Thr His Gin 975 Asn Ser Leu Pro Leu Leu 995 Ala Gin Lys Ser Ser 985 Asp Thr Leu Thr Arg His Gin 990 Asp Leu Thr Vai 1005 Pro Leu Gin Cys Gly Giu Thr Asp Leu 1000 Gin Giu Thr Giy Leu Gin 1010 Giy Pro Val Giy Gly 1015 Asp Gin Arg Pro Giu 1020 Val Giu Asp Pro Giu 1025 Giu Leu Ser Pro Ala Leu Val Val Ser Ser 1030 1035 Ser 1040 Gin Ser Phe Val Ile Ser Giy Gly Gly 1045 Ser Thr Val Thr Glu 1050 Asn Val 1055 Val Asn Ser <210> <211> <212> <213> <220> <223> 4257

DNA

Artificial Sequence Chimeric <400> atggtatgcg ttctactgga cgggtggatg ggqgtgcctt tatqcaattg cgcatcctcg caggcattaa ttcaccaagc atggttgcta ccagagctaa taccaagccc ctggcttctg gagattggtg qaatttgaaa tttgccaatg gggcattttc agggaaagcg tcctcacaat gggacattat gtggqgagct accaqattaa acacgtgctc tagagaaaga ccgacaagat acattttaag gtgataacac aagccatggt aggggaacta gtgtttgcat aaattatcaa aggatgacat tctggattgg atcagcctct gatgcaaaga tttggggggt gaagaaggaa caaggaccct tagggacacc tgcttcggat ttctggcgtc actttttaag caggtatgac ggacatcgtq tggtgagagc tqctcagtca acgcctgcta caggaggat a ctcagatagt tgcccttgtt actcacagcc: ctcttccctg aaggggattc gatctccttt.

tatgctttgg gtgaagtgtg ataggtgctq atacctcaaa tttttctctc acagcactg ggtgtggagg cagaaaatcc: gaaacaccta ttggaagcag tggggatcca tcttcctctt aggagtatgc tccacgcaaa acagactgga ccaacatcac agcagtctct ctaatggaga cagcaagctc tcagctatgc gagtggttcc gatggaatta ccttcaccca cacgtgaacc atgctcgagc caaaaaaact aaatagcacc qaccgccaag ccattccata gggagagaga ggccatgctt tctgggtgtc aacattcgtg tccacccatt cgtgtccatc atccacagcc gcctgactcc tgtttcgaca gatctcgagg aagacctgga agtgattatg aaaccaaagt tgtctatcag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 WO 99/51641 WO 99/1 641PCT/US99/07333 caagaggaga tttqatcgat gaattctggg ataaagaaat aaggtccaat aaagatctct gagctacttg tttaatgaaa aaaagcacag gacatgcagt aagccagggg tqtgaaggtt agacccaaca tctccctggg gtgatcgtga cttaqttacg gcagcaccag ttcagctatg aagaaatctg agcctcatct atcatcattg aagtgtgaca gtcacttgta aaacctattq ttttttgqta tccatgagtt ataatttttc gctttcaagg agcagccttg agcgaagacc cagcaagagc cccagatgca gatgagcctc gcccagaaaa gaaacqgact cagcggccag cagagctttg actctgqagt aacgacgaga ctgctgctgc atccatgggt aacatcttca aagtatgagc tctgcttttg caggaatgct aatgacttgg gttcgagtcc agaatggtcg aatgtcacct tcagacaatg ccctggttcc aaaatcatgt gcccaqgcag aaaattatct gctgccgtca ttgcagaagq actttagaag aggagaattt gcacagggct ttgtaattga qccctggata gttatattcg acggagatqc agtacaaaqt gggctcatag agaggaagaa acaactacca tgaaccgcac ctgtggtgcc cctttgtccg tgctcctaac atacaatcat cagcccttct tcacagcgcc ccgtccagct actatggaga tttctgatct ctgtttatgc gatttaccat cagcccagt c taagtgcttc atccaqaaca tggctgcccg gagqctccac cattcccaca agcagcagca agcagaaggt agaagaacgc gcagcgatac tagatctgac aggtggagga tcatcagtgg ccatcatggc tcgagcggca tcggqacag caggatactc cggccatgca acaataaggc agaatccata atgatagacg accgcgtagc ccaccacagg atgtaggggg ctatcatgtt agaaccgaat agaactcctc attcccatct cccgagaatt actcccactt aggacaccat ggctgtgaca ccgaactctt tggctgcaag ggagcgaatt tqctgtatat cattggcctt ggctgtaaat tcctggacgt catcggccac agaacatact aacggtgaaa ggtggatgaq aggctgccag tgtgtttgtt ctataatgac ggggattttt atgctccttc gaccaaaaca caagttcatt ccttggagtg gcagcqgaca ctcactcatt cattaaaacg gtataccacc agcagaaaag agtatctctg gaataccatc ggccacgctg gggatccacc gcccgagagg gcccctgacc catctttggc catggcccac gctgacccga cgtccaggaa ccctgaagag tggaggcagc gtgctgcctg gctccgcagg agagagtggc tgatgaagat ggccatgatc tcatgcacaa tgtagatgca acgagaatat tgaccctqcc gatcatcgaa ccaaaggtca tctagtagcg ggaggaaagc ggttattctg agi cgactac cattctgaag cacgtgcgcc cctccagttg attttgccca gccaataatc ttaggatcac gctcgggatt tccatggctt tgtccacgaa tttaatggca tatgatatct tggaccaatc cacccggcgt ggggtccctt ctgtcctgtg cttatcccca gcaatattgg acacctatcg ctctgttatt cgacgggtct aaccgtatcc agtccagcat tttgtctggt ctagatccag tgttcacttg a ga ggt gt cc tgcatcattt atgtacatcc ggcatgctct gaggaggtgc cgccgcagca ccctcctcct cagaaqcagc ctcccacagc agcggcacgg gggaattcta caccagccat acaggtctgc ttgtccccag actgttacag agcgaggagg gacaagcggg aagagtacgt aaaaqgggct agagccatgg ttagttcgag ataaagagtt caattatctg tacctgccta tacccctttg gagagaagaa cttagtgaat aaggctctct ttcttaaaca ttcccagaat atgttcqtgg acagacaccg aacctgaag aacgagcatc gaagaaatgt atgggaaaag catcttatga acgccctgca tgagtaccat gtgctggcac tccagtatca agcttcatct ctgtctgcag gct gctggca aactttgccc tcatcaaatt qaatcatcgc tgaggqcttc caatcacgtt tcctaggact accgaatatt ctcagctggt ttgttgtgga agaaggccag gatacagtat cagagacttt ggttagcttt agacaacaac atatgcccaa gttgcagcac acgtctcccg ccatcagcag agcagccgct agcaacgatc tcaccttctc cgcaccagaa tactcccqct aaggacctgt cacttgtagt aaaacgtagt ccaaggaagc acgcccgccg ttatcaagca tcaccaagct acacactcaa aagttgatgt tatggaatga actctaccaa cgcaacaaga acttacaaag aatggataca atgatcaagt ttagaacaat aqaaagatct atgatggacc acctgaaccc agaatatccg actgcqgtct aattgatqqa gtggtttgca gaacagtcat acaggaaqga caatatgcac tgatgggaaa tcctgtcact aataaccaac aaaagtggaa cctgccgtgt ctgtgaacgc tctggatcaq ggagtggcat caccaccttt aggacgcgaa tttaatgatt tggcatgtgt tgagcagggg gatcaccttc tcccccccac gggagtgctc cctcttgatg caatgaagcc catccccatc acttactgtc ggtttatatt cgcagctcac caagcggtcc caagagcaac ggccctaacc tcagcagcag actgagcttt ctccctggag gcagtgcggg gggtggagac gtccagttca gaattcaatg ccggcggatc ggagctcaag gatgagaatc ggtgtatcag gatcccatac ggagaaggtg tcctggaatc atactatctt tgtgcttaga tgtcattttc ctgctttgaa tctcgtggag tatcacatac tctagaqqag ccagagagat agacagtgac ctttgtcttt qttctaa 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4257 WO 99/51641 WO 9951641PCT/US99/07333 Met Leu Ser Gly Gly Tyr Thr Leu Ser Asp 145 Met Al a Ser Ile <210> 41 <211> 14 <212> PR <213> Ar <220> <223> Ch <400> 41 Val Cys Gi Thr Ala Ly Gin Giu Ty Gly Leu Ph.

Giu Leu Ly Ala Ile As] Leu Gly Va, Glu Gin Se: 115 Asp Val Ly 130 Lys Ile Se: Val Ala As, Ser Thr Al 18 Arg Val Va.

195 Val Thr Al 210 u r e p 1 0 r s a 18

T

tificial Sequence imeric mGluR8//CaR*Gtqis Gly Phe Ala Pro Lys Gin Arg Leu Cys Gly Ile 165 Pro Pro Leu Lys Tyr His Val1 Giu 70 Ile Ile Thr Al a Val1 150 Leu Giu Pro Gi y Arg Trp Ser His 55 Lys Asn Leu Phe As n 135 Ile Arg Leu Asp Trp 215 Al a Leu 25 Arg Lys Ile Asp Thr 105 Gin Asp Al a Phe Asp 185 Tyr T yr Ser 10 Thr Vai Gly His Pro 90 Cys Ala Pro Ala Lys 170 As n Gin Val Cys Met Asp Giu Arg 75 Asp Ser Leu Pro Al a 155 Ile Thr Ala Ser Pro Met Gly Arg Leu Leu Arg Ile Ile 140 Ser Pro Arg Gin Thr 220 Cys Gin Asp Gly Glu Leu Asp Giu 125 Phe Ser Gin Tyr Ala 205 Leu Phe Arg Ile Vali Al a Ser Thr 110 Lys Thr Val Ile Asp 190 Met Ala Phe Thr Ile Pro Met Asn Tyr Asp Lys Ser Ser 175 Phe Val Ser Leu His Leu Cys Leu Ile Ala Ala Pro Ile 160 Tyr Phe Asp Glu WO 99/51641 WO 9951641PCT/US99/07333 Giy 225 Giu Pro Pro Arg T rp 305 Gin Ser Asn Cys Thr 385 Lys His Arg Val Gly 465 Lys Asn Ile Arg Asn Ile 290 Ile Giu Ile Arg Lys 370 Giy Vali As n Met Asn 450 Asp Ser Tyr Gly Pro Aila 275 Leu Giy Giu Asp Arg 355 Leu Leu Gin Met Ser 435 Phe Aia Thr Giy Giu Ser Giy Val Giu Aia Phe Thr Gin Ile Ser Arg Giy Giy 260 Arg Giu Ser Ile Giy 340 Asn Gly Glu Phe His 420 Thr Asn Pro Giu Val1 245 Giu Aia Aia Asp Aia 325 Phe Vai Ser Arg Vai 405 Lys Ile Giy Gly Tyr 485 230 Gys Phe Vai Aila Ser 310 Giu Asp Trp His Ile 390 Ile Asp Asp Ser Arg 470 Lys Ile Giu Ile Lys 295 Trp Giy Arg Phe Gly 375 Aia Asp Leu Giy Aila 455 Tyr Val Aia Lys Met 280 Lys Giy Aila Tyr Aila 360 Lys Arg Al a Cys Lys 440 Gly Asp Ile Gin Ile 265 Phe Leu Ser Vai Phe 345 Giu Arg Asp Vai Pro 425 Glu Thr Ile Giy Ser 250 Ile Aia As n Lys Thr 330 Arg Phe Asn Ser Tyr 410 Giy Leu Pro Phe His 490 235 Gin Lys Asn Gin Ile 315 Ile Ser Trp Ser Ser 395 Ser Tyr Leu Val1 Gin 475 Trp Lys Arg Giu Ser 300 Aila Leu Ar g Giu His 380 Tyr Met Ile Giy Thr 460 Tyr Thr Ile Leu Asp 285 Giy Pro Pro Thr Giu 365 Ile Giu Aia Giy Tyr 445 Phe Gin Asn Pro Leu 270 Asp His Val Lys Leu 350 Asn Lys Gin Tyr Leu 430 Ile Asn Ile Gin Arg 255 Giu Ile Phe T yr Arg 335 Ala Phe Lys Giu Aila 415 C ys Arg Giu Thr Leu 495 Leu Lys Vai Glu Asp Met Gin Trp Ala His Arg Giu His Thr His Pro 500 505 WO 99/51641 WO 9951641PCT/US99/07333 Ala Val Asn 545 Arg Le u be u As n Le u 625 Ala Le u Ile Phe Val1 705 Ile Arg Leu Lys Phe 785 Ser Lys 530 T yr Pro Giu Gly Asp 610 Le u Ala Gly His Ile 690 Gin Ile Giy Gly Thr 770 Thr Val1 515 Gly Gin Asn Trp Ile 595 Thr Thr Pro Met Arg 675 Ser Leu Ile Vai Tyr 755 Arg Met Cys Val1 Vai Met His 580 Ile Pro Gly Asp Cys 660 Ile Pro Leu Asp Leu 740 Ser Giy Tyr Ser Pro Asp Asn 565 Ser Ala Ile Ile Thr 645 Phe Phe Al a Gly T yr 725 Lys Ile Val Thr Leu Cys Glu 550 Arg Pro Thr Vai Phe 630 Ile Ser Giu Ser Val1 710 Gly Cys Leu Pro Thr 790 Pro Cys 535 Leu Thr T rp Thr Arg 615 Leu Ile Tyr Gin Gin 695 Phe Glu Asp Leu Giu 775 Cys Cys 520 Trp Ser Gi y Ala Phe 600 Al a Cys Cys Al a Gly 680 Leu Val Gin Ile Met 760 Thr Ile Lys His Cys Cys Val 585 Val1 Ser Tyr Ser Ala 665 Lys Val Trp Arg Ser 745 Val Phe Ile 74 Pro Cys Glu Gin 570 Val1 Ile Gly Ser Phe 650 Leu Lys Ile Phe Thr 730 Asp Thr Asn T rp Gi y Giu Leu 555 Leu Pro Val Arg Ile 635 Arg Leu Ser Thr Val 715 Leu Leu Cys Giu Leu 795 Giu Arg 540 Cys Ile Val Thr Giu 620 Thr Arg Thr Val Phe 700 Val Asp Ser Thr Ala 780 Ala Arg 525 Cys Pro Pro Phe Phe 605 Leu Phe Val1 Lys Thr 685 Ser Asp Pro Leu Val 765 Lys Phe Lys Giu Leu Ile Val1 590 Val1 Ser Leu Phe Thr 670 Al a Leu Pro Giu Ile 750 Tyr Pro Ile Lys Gly Asp Ile 575 Al a Arg Tyr Met Leu 655 As n Pro Ile Pro Lys 735 Cys Al a Ile Pro Thr Tyr Gin 560 Lys Ile Tyr Val1 Ile 640 Gly Arg Lys Ser His 720 Ala Ser Ile Gly Ile 800 WO 99/51641 PCT/US99/07333 Phe Phe Gly Thr Leu Thr Leu Tyr Met 835 Thr Ile Glu 850 Ala Ala Arg 865 Ser Ser Leu Ser Lys Ser Gin Gin Gin 915 Leu Thr Leu 930 Gin Lys Val 945 Asp Glu Pro Asn Ser Leu Pro Leu Leu 995 Gin Glu Thr 1010 Val Glu Asp 1025 Gin Ser Phe Val Asn Ser Thr Ala Gin Ser Ala Glu Lys Met Tyr Ile Gin Thr Thr 805 810 815 Val Ser Met Ser Leu Ser Ala Ser Val Ser Leu Gly Met 820 825 830 Pro Lys Val Tyr Ile Ile Ile Phe His Pro Glu Gin Asn 840 845 Glu Val Arg Cys Ser Thr Ala Ala His Ala Phe Lys Val 855 860 Ala Thr Leu Arg Arg Ser Asn Val Ser Arg Lys Arg Ser 870 875 880 Gly Gly Ser Thr Gly Ser Thr Pro Ser Ser Ser Ile Ser 885 890 895 Asn Ser Glu Asp Pro Phe Pro Gin Pro Glu Arg Gin Lys 900 905 910 Pro Leu Ala Leu Thr Gin Gin Glu Gin Gin Gin Gin Pro 920 925 Pro Gin Gin Gin Arg Ser Gin Gin Gin Pro Arg Cys Lys 935 940 Ile Phe Gly Ser Gly Thr Val Thr Phe Ser Leu Ser Phe 950 955 960 Gin Lys Asn Ala Met Ala His Gly Asn Ser Thr His Gin 965 970 975 Glu Ala Gin Lys Ser Ser Asp Thr Leu Thr Arg His Gin 980 985 990 Pro Leu Gin Cys Gly Glu Thr Asp Leu Asp Leu Thr Val 1000 1005 Gly Leu Gin Gly Pro Val Gly Gly Asp Gin Arg Pro Glu 1015 1020 Pro Glu Glu Leu Ser Pro Ala Leu Val Val Ser Ser Ser 1030 1035 1040 Val Ile Ser Gly Gly Gly Ser Thr Val Thr Glu Asn Val 1045 1050 1055 Met Thr Leu Glu Ser Ile Met Ala Cys Cys Leu Ser Glu 1060 1065 1070 Glu Ala Lys Glu Ala Arg Arg Ile Asn Asp Glu Ile Glu Arg Gin Leu 1075 1080 1085 WO 99/51641 PCT/US99/07333 76 Arg Arg Asp Lys Arg Asp Ala Arg Arg Glu Leu Lys Leu Leu Leu Leu 1090 1095 1100 Gly Thr Gly Glu Ser Gly Lys Ser Thr Phe Ile Lys Gin Met Arg Ile 1105 1110 1115 1120 Ile His Gly Ser Gly Tyr Ser Asp Glu Asp Lys Arg Gly Phe Thr Lys 1125 1130 1135 Leu Val Tyr Gin Asn Ile Phe Thr Ala Met Gin Ala Met Ile Arg Ala 1140 1145 1150 Met Asp Thr Leu Lys Ile Pro Tyr Lys Tyr Glu His Asn Lys Ala His 1155 1160 1165 Ala Gin Leu Val Arg Glu Val Asp Val Glu Lys Val Ser Ala Phe Glu 1170 1175 1180 Asn Pro Tyr Val Asp Ala Ile Lys Ser Leu Trp Asn Asp Pro Gly Ile 1185 1190 1195 1200 Gin Glu Cys Tyr Asp Arg Arg Arg Glu Tyr Gin Leu Ser Asp Ser Thr 1205 1210 1215 Lys Tyr Tyr Leu Asn Asp Leu Asp Arg Val Ala Asp Pro Ala Tyr Leu 1220 1225 1230 Pro Thr Gin Gin Asp Val Leu Arg Val Arg Val Pro Thr Thr Gly Ile 1235 1240 1245 Ile Glu Tyr Pro Phe Asp Leu Gin Ser Val Ile Phe Arg Met Val Asp 1250 1255 1260 Val Gly Gly Gin Arg Ser Glu Arg Arg Lys Trp Ile His Cys Phe Glu 1265 1270 1275 1280 Asn Val Thr Ser Ile Met Phe Leu Val Ala Leu Ser Glu Tyr Asp Gin 1285 1290 1295 Val Leu Val Glu Ser Asp Asn Glu Asn Arg Met Glu Glu Ser Lys Ala 1300 1305 1310 Leu Phe Arg Thr Ile Ile Thr Tyr Pro Trp Phe Gin Asn Ser Ser Val 1315 1320 1325 Ile Leu Phe Leu Asn Lys Lys Asp Leu Leu Glu Glu Lys Ile Met Tyr 1330 1335 1340 Ser His Leu Val Asp Tyr Phe Pro Glu Tyr Asp Gly Pro Gin Arg Asp 1345 1350 1355 1360 Ala Gin Ala Ala Arg Glu Phe Ile Leu Lys Met Phe Val Asp Leu Asn 1365 1370 1375 WO 99/51641 WO 9951641PCT/US99/07333 Pro Asp Ser Asp Lys 1380 Thr Glu Asn Ile Arg 1395 Gin Leu Asn Leu Lys 1410 Ile Ile Tyr Ser His Phe Thr Cys Ala Thr Asp 1385 1390 Phe Val Phe Ala 1400 Ala Val Lys Asp Thr Ile Leu 1405 Asp Cys Gly Leu Phe 1415 <210> 42 <211> 3909 <212> DNA <213> Artificial Sequence <220> <223> Chimeric <400> 42 atggcttccc gcgcgcct gc ggctgggcgc ctcatgccqc gtggaactg ctgcggctct ataaaatacg atcattgcag cctgttctag gcggtgaatc ctgacgcaag gqcgaggaca aaaaagctga.

gcaaaagtgt attccgggct cgctgcctcc cccctqagct qagtacaaca ggcatctggg cggcaccagc aatgccatga gagagaatgg gagtacaacg tccqaaccac ctctacagca ttcttcaaca aaccttatca ggatcctttg accgtgqgct atcttcaaaa gtggggggca ctgcgaagga atccgccctc tatgcctaca cgcqqagctc tactgctact ggggcgcccc tcaccaagga ccatcgagca atgacacgga ggccgaacca agtccctcca ccgataagaa cagccattct acgttcagag ttgagatttc aggggaatga tctgttgtgc ggtacqagcc ggaagaatct ccaagcagat acaagcggtc tcatcgccaa ggatccaqga acgagaccaa ggaccattaa ctgtggccga caaaagacaa tcctctctqc tcaagaaccg tccttggagg tctctgaaaa acacqaccgc atgtgaaaat tgctgctgat cagtggagaa tcctggagca agggacttct cqggcagccc gctgctgccg ccggccgccg qgtggccaag qatccgcaac gtgcgacaac cttgatggtg aggctgqaat aaaataccct gaagttgctc gttctctgag agacaccgag tgtgcggatc atacgaggag ttcttggtgg gcttgctgcc: caagaccatc aggcgtgggg gacactgcag cttcaactac cttcttcggg atttactcaa.

cacactgqag gaccatcatc cctcaccatc gaatcagaaq gatgctctcc gacctttgaa ttttgqqgcc gaagaagaag cgacctgtqt.

qtacagcatg ctgtgagaac catgttgttc gqqccgccgc ctgctgctgC cccagcagcc ggcagcat cg gagtcactcc gcaaaagggt tttgqaqqcg ctggtgcagc tatttctttc aagcactacc gtqcggaatg agctt ctcca atccttggcc aacatgtatg gagcaggtgc atgqagggct tcaggaaaga cccagcaagt agggccatgg acggaccaca gtcacggqt c tttcaagaca atcatcaatg ctggagcagc ctcgggatga ctcataaaqa tatgcttcca acactttgca atgtttgcaa atcatcaagg atcctgatct gagccggacc acccatatga ggttgtttct cgccgccgcc ctctggcgcc cgccgctctc ggcgcggtgt tgcgccctta tgaaagcctt tct qtccatc ttt cttttqc ggaccgtccc agtggaagcg acctgactgg acgatccctg agtttgacca gtagtaaata acacggaagc acattggcgt ctccacagca tccacgqgta agacactqca cgctgggcag aagttgtatt qcagggaggt acaccatcag tgcggaagat tcatqgccag tgtcgagtcc tatttctctt ccgtcaggac agacctqgag accagaaact gct ggcaggc cagcaggacg ccatctggct tagcttggqa accqccgccc cggggcctgg catcatgqc gctccccgcc cttcctcgac ctacgatqca cgtcacatcc tgcaaccacg atcagacaat cgtgggcacg agttctgtat taccagtgtc gaatatggca tcagtggatc caactcat cc ggatttcgag gtatgagaga cgcctacgat tgccagcagc gatcatcctc ccggaatggg qaaggtggga gttccaagga ctccctacct tgcttttctc atacatgaac tggccttqat ctggattctc agtccacgcc gcttgtgatc tgtggacccc ggatatctcc tggcatcgtc gacccgcaac 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 WO 99/51641 WO 9951641PCTIUS99/07333 gtcagcatcc atcatgtgca ttctgcatcg gtgccgaagc cagttcactc aaccaagcca aagatcacag gaaaagacca ggaaacttca aatccccagc gatataaact cacgcctacc cccaccgcca ctggcggccg gaagcccggc cgccgggagc aagcaqatga aagctggtgt ctcaagatcc gatgtggaga aatgatcctg accaaatact caagatgtgc caaagtgtca atacactgct caagttctgg acaattatca gatcttctag ggaccccaga aacccagaca atccgctttq ggtctgtac ccgcactcaa tcatcggggc tggctctggt tcatcaccct agaatcagaa gcacatcccq agctggataa cctacattaa ctgagagcac tacagtggaa ctccagaaca tcccatccat gcccccgcca ccatgactct ggatcaacga tcaagctgct gaatcatcca atcagaacat catacaaqta aggtgtctgc qaatccagga atcttaatga ttagagttcg ttttcagaat ttgaaaatgt tggagtcaga catacccctg aggagaaaat gagatgccca gtgacaaaat tctttgctgc cgacagcaag cgctgtctcc catcatcttc gagaacaaac gaaagaagat cctggagggc agacttggaa acagaaccac agatggagga cacaacagaq catccagcgt cggaggcqtg cagacatgtg qgagtccatc cgagatcgag gctqctcggg tgqqtcagqa cttcacggcc tgagcacaat ttttgagaat atgctatgat cttggaccgc agtccccacc ggtcqatgta cacctctatc caatgagaac gttccagaac catgtattcc ggcagcccga taactactcc cgtcaagqac tacatcggga ttcctgaccc tgcagcacca ccagatgcag tctaaaacgt ctacagtcag qaggtcacca taccaagagc: aaggccattt ccctctcgaa cggctgtccc: gacgccagct ccaccctcct atggcgtgct cggcaqctcc: acaggagaga tactctqatg atgcaggcca aaggctcatg ccatatqtag agacgacgag gtagctgacc: acagggatca gggggccaaa atgtttctag cgaatggagg tcctcggtta catctagtcg gaattcattc cacttcacgt accatcctcc tgagtgtcta gqgaccagcc tcaccctctg caacqcagaa ccacctcggt aaaaccatcg tgcagctgca tcaatgacat taaaaaatca catgcaaaga tccagctccc gtgtcagccc tccgagtcat gcctgagcqa gcagggacaa gtggcaagag aagataaaag tgatcagagc cacaattagt atgcaataaa aatatcaatt ctgcctapcct tcgaataccc ggtcagagag tagcgcttag aaagjcaaggc ttctgttctt actacttccc tgaagatgtt gcgccacaga agttqaacct caacgtqgggg caatgtgcag cctggtattc caggcgattc caccagtgtg cctgcgaatg ggacacacca cctcaacctg cctcgatcaa tcctatagaa catcctccac ctgcgtcagc ggtctcgggc ggaggccaag gcgggacgcc tacgtttatc gggcttcacc catggacaca tcgagaagtt gagtttatgg atctgactct gcctacgcaa ctttgactta aagaaaatqg tgaatatqat t ct ct ttaga aaacaagaaa agaatatgat cgtggacctg caccgagaat gaagggctgc 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3909 <210> 43 <211> 1303 <212> PRT <213> Artificial Sequence <220> <223> Chimeric <400> 43 Met Ala Ser Pro Arg Ser Ser Gly Gin Pro Gly Pro Pro Pro Pro Pro Pro Pro Pro Pro Ala Arg Leu Leu Leu 25 Leu Leu Leu Leu Trp Ala Arg Gly Pro Leu Leu Ala Pro Arg Leu Pro Leu Ala Pro Gly Ala Trp Gly 40 WO 99/51641 WO 9951641PCT/US99/07333 Pro Thr Val Tyr Gly Met Ser 145 Pro Pro Tyr Ser Giu 225 Lys Gin Tyr T rp Lys 305 Pro Pro Giu Leu Leu Lys 115 Phe Gin Leu Asp Trp 195 Val Ser Leu Met Ser 275 Giu Leu Ser Pro Lys 70 Giu Arg Tyr Val1 As n 150 Lys Val1 Val1 Asp Giu 230 Asn Lys Gin His Ala 310 Gin Pro Gly Gin Leu Asp Cys 135 Leu Lys Asn Gly Leu 215 Ser Asp Val Trp Thr 295 Met Ile Leu Ser Ile Tyr Al a 120 Pro Val1 Lys Pro Thr 200 Thr Phe Val Phe Ile 280 Glu Giu Lys Ser Ile Arg Asp 105 Ile Ser Gin Tyr Aila 185 Leu Gi y Ser Arg Cys 265 Ile Aia Gly Thr 79 Ile Giy Asn Thr Lys Val1 Le u Pro 170 Ile Thr Val1 As n Ile 250 Cys Pro As n Tyr Ile 330 Met Arg 75 Giu Giu Tyr Thr Ser 155 T yr Leu Gin Leu Asp 235 Ile Al a Giy Ser Ile 315 Ser Gi y Gly Ser Cys Gly Ser 140 Phe Phe Lys Asp Tyr 220 Pro Leu Tyr Trp Ser 300 Gly Gly Leu Val Leu Asp Pro 125 Ile Aia Phe Leu Vali 205 Giy Cys Gi y Giu Tyr 285 Arq Val1 Lys Met Leu Leu Asn 110 Asn Ile Al a Arg Leu 190 Gin Giu Thr Gin Giu 270 Giu Cys Asp Thr Pro Pro Arg Aila His Aila Thr Thr 175 Lys Arg Asp Ser Phe 255 As n Pro Leu Phe Pro 335 Leu Ala Pro Lys Leu Giu Thr 160 Val His Phe Ile Vai 240 Asp Met Ser Arg Giu 320 Gin WO 99/51 641 PTU9/73 PCT/US99/07333 Gin Lys Leu Ile 385 Asn Phe Asp Leu Lys 465 Leu Ser Lys Leu Ser 545 Thr Arg Lys Tyr Phe Gin 370 Gin Ala Arq Ser Giu 450 Asp Tyr Ala Met Ser 530 Glu Val1 Val1 Asp Giu His 355 Arg Asp Met Asn Arq 435 Ile Lys Ser Phe Ser 515 Tyr Lys Gly His Gin 595 Arg Glu Tyr Asn Asn Lys Arg Ser Gly Val Giy Pro Ser 340 Gly Al a Phe Asn Gly 420 Glu Ile Thr Ile Leu 500 Ser Al a Thr Tyr Ala 580 Lys Tyr Ala Met Giu Asn Tyr 390 Glu Thr 405 Giu Arg Val Lys Asn Asp Ile Ile 470 Leu Ser 485 Phe Phe Pro Tyr Ser Ile Phe Giu 550 Thr Thr 565 Ile Phe Leu Leu Tyr Thr 375 Thr Asn Met Val1 Thr 455 Leu Al a Asn Met Phe 535 Thr Ala Lys Val Asp 360 Leu Asp Phe Gly Gi y 440 Ile Giu Leu Ile As n 520 Leu Leu Phe Asn Ile 600 345 Gly His His Phe Thr 425 Giu Arg Gin Thr Lys 505 Asn Phe Cys Gly Val 585 Val1 Ile Trp Ala Ser Thr Leu 395 Gly Val 410 Ile Lys Tyr Asn Phe Gin Leu Arq 475 Ile Leu 490 Asn Arg Leu Ile Gly Leu Thr Val 555 Ala Met 570 Lys Met Gly Gly Val1 Ser 380 Gly Thr Phe Al a Gly 460 Lys Gly Asn Ile Asp 540 Arg Phe Lys Met Ile 365 Arg Arg Giy Thr Val1 445 Ser Ile Met Gin Leu 525 Gly Thr Al a Lys Leu 605 350 Ala His Ile Gin Gin 430 Al a Giu Ser Ile Lys 510 Giy Ser Trp Lys Lys 590 Leu Lys Gin Ile Val1 415 Phe Asp Pro Leu Met 495 Leu Giy Phe Ile Thr 575 Ile Ile Thr Arg Leu 400 Val1 Gin Thr Pro Pro 480 Ala Ile Met Val Le u 560 Trp Ile Asp Leu Cys Ilie Leu Ile Gys Trp Gin Ala Val Asp Pro Leu Arg Arg Thr tl 615 620 WO 99/51641 W099/1641PCT/US99/07333 Val1 625 Ile Le u Phe Ser Ile 705 Phe Cys Ala Glu Thr 785 Lys Gin Glu Gi y Gin 865 Asp Pro Giu Arg Gly Leu Lys 690 Gly Cys Le u Al a Asp 770 Ser Ile Asp Leu Gly 850 Trp Ile Ile Lys Pro Ile Ala 675 Tyr Al a Ile Val Th r 755 Ser Arg Thr Thr Asn 835 Lys Asn Asn Leu Tyr Leu Val1 660 Trp Ile Ala Val1 Phe 740 Gin Lys Le u Giu Pro 820 Asp Ala Thr Ser His 900 Ser Leu 645 Tyr Gi u Gly Val Al a 725 Val1 Asn Thr Glu Leu 805 Glu Ile Ile Thr Pro 885 His Met 630 Giu Al a Thr Met Ser 710 Leu Pro Arg Ser Gly 790 Asp Lys Leu Leu Glu 870 Giu Al a Giu His Tyr Arg Ser 695 Phe Val1 Lys Arg Thr 775 Leu Lys Thr Asn Lys 855 Pro His Tyr Pro Cys Lys Asn 680 Val Leu Ile Leu Phe 760 Ser Gin Asp Thr Leu 840 Asn Ser Ile Leu Asp Giu Gly 665 Val Tyr Thr Ile Ile 745 Gin Val1 Ser Leu Tyr 825 Gly His Arg Gin Pro 905 81 Pro Asn 650 Leu Ser Asn Arg Phe 730 Thr Phe Thr Glu Glu 810 Ile Asn Leu Thr Arg 890 Ser Ala 635 Thr Leu Ile Val1 Asp 715 Cys Leu Thr Ser Asn 795 Giu Lys Phe Asp Cys 875 Arg Ile Gly His Met Pro Gly 700 Gin Ser Arg Gin Vai 780 His Val1 Gin Thr Gin 860 Lys Leu Gly Arg Met Leu Ala 685 Ile Pro Thr Thr As n 765 As n Arg Thr Asn Giu 845 Asn Asp Ser Gly Asp Thr Phe 670 Leu Met As n Ile Asn 750 Gin Gin Leu Met His 830 Ser Pro Pro Leu Val1 910 Ile Ile 655 Giy Asn Cys ValI Thr 735 Pro Lys Aila Arg Gin 815 Tyr Thr Gin Ile Gin 895 Asp Ser 640 Trp Gys Asp Ile Gin 720 Leu Asp Lys Ser Met 800 Leu Gin Asp Le u Giu 880 Le u Al a WO 99/51641 PCT/US99/07333 82 Ser Cys Val Ser Pro Cys Val Ser Pro Thr Ala Ser Pro Arg His Arg 915 920 925 His Val Pro Pro Ser Phe Arg Val Met Val Ser Gly Leu Ala Ala Ala 930 935 940 Met Thr Leu Glu Ser Ile Met Ala Cys Cys Leu Ser Glu Glu Ala Lys 945 950 955 960 Glu Ala Arg Arg Ile Asn Asp Glu Ile Glu Arg Gin Leu Arg Arg Asp 965 970 975 Lys Arg Asp Ala Arg Arg Glu Leu Lys Leu Leu Leu Leu Gly Thr Gly 980 985 990 Glu Ser Gly Lys Ser Thr Phe Ile Lys Gin Met Arg Ile Ile His Gly 995 1000 1005 Ser Gly Tyr Ser Asp Glu Asp Lys Arg Gly Phe Thr Lys Leu Val Tyr 1010 1015 1020 Gin Asn Ile Phe Thr Ala Met Gin Ala Met Ile Arg Ala Met Asp Thr 1025 1030 1035 1040 Leu Lys Ile Pro Tyr Lys Tyr Glu His Asn Lys Ala His Ala Gin Leu 1045 1050 1055 Val Arg Glu Val Asp Val Glu Lys Val Ser Ala Phe Glu Asn Pro Tyr 1060 1065 1070 Val Asp Ala Ile Lys Ser Leu Trp Asn Asp Pro Gly Ile Gin Glu Cys 1075 1080 1085 Tyr Asp Arg Arg Arg Glu Tyr Gin Leu Ser Asp Ser Thr Lys Tyr Tyr 1090 1095 1100 Leu Asn Asp Leu Asp Arg Val Ala Asp Pro Ala Tyr Leu Pro Thr Gin 1105 1110 1115 1120 Gin Asp Val Leu Arg Val Arg Val Pro Thr Thr Gly Ile Ile Glu Tyr 1125 1130 1135 Pro Phe Asp Leu Gin Ser Val Ile Phe Arg Met Val Asp Val Gly Gly 1140 1145 1150 Gin Arg Ser Glu Arg Arg Lys Trp Ile His Cys Phe Glu Asn Val Thr 1155 1160 1165 Ser Ile Met Phe Leu Val Ala Leu Ser Glu Tyr Asp Gin Val Leu Val 1170 1175 1180 Glu Ser Asp Asn Glu Asn Arg Met Glu Glu Ser Lys Ala Leu Phe Arg 1185 1190 1195 1200 WO 99/51641 WO 9951641PCT/US99/07333 83 Thr Ile Ile Thr Tyr Pro Trp Phe Gin Asn Ser Ser Val Ile Leu Phe 1205 1210 1215 Leu Asn Lys Lys Asp Leu Leu Giu Giu Lys Ile Met Tyr Ser His Leu 1220 1225 1230 Val Asp Tyr Phe Pro Giu Tyr Asp Gly Pro Gin 1235 1240 Arq Asp Ala Gin Ala 1245 Aia Arg Giu 1250 Phe Ile Leu Lys Met 1255 Phe Val Asp Leu Asn 1260 Pro Asp Ser Asp Lys Ile Asn Tyr Ser His Phe Thr 1265 1270 Cys Aia Thr Asp Thr Giu Asn 1275 1280 Ile Arg Phe Leu Lys Gly <210> <211> <212> <213> <220> <223> Val Phe Ala Ala Val Lys Asp Thr 1285 1290 Ile Leu Gin Leu Asn 1295 Cys Giy Leu Tyr 1300 44 3969

DNA

Artificiai Sequence Chimeric <400> 44 atgttgctgc cagaccccca atcaggtacc tatgagattq tgcctggcca tccaagtctt gctctggacg tcccggagca cgaacgccac ggctgqccag agccgcagqg gatccaggcc atccttatgc aacctcattg cccactttct tttgaaaagt tcgactctgg cagagtttct atcatcgtgg gaqcgtctct ttcaagatct tgctgctact acgccacctc ggggcctgac agtatgtgtg acggctcctg atttgaccct gagcccgggt tctgtagtca actcagaacg ggggccaggc acatcctgcc aagccaccaa ctggctgcag tgctttccta tccgaacgca ggggctgqaa acgacctgga t ctcagatcc gacttttcta ttgggaagaa acgacccttc ggcgccactc aqaaqqttqc tcgggaccag ccggggqgaq qacagatatg ggaaaatggg ggatttccgg gggccagtgg gcgcgcagt g ctgccagccc ggactatgag gtacctatat ctctqtctcc tggctccaqc cccatcagcc gaagattgct ggaacgagtg agctgtgccc tgagactgaa gtacgtctgq tatcaactgc ttcctccgcc cagatcatac gtgaaggcta cgcgaggtgg gacacaccca aaggttttcc tgtgaccccg agcaccccca tacatcgggg gcggtggaga ctcaagctca gagctgctct acgctggtgg tcaccaqccc acactccaca accatccagc aaggaqqctg gtcaaaaacc gcccggaaag ttcctcattg acagtggatg ccccgggcgc acccgccctg tcaacttcct tggggcccaa gccgct gtgt tgacgggtgg acttccatct agccccactg cactgtttcc tggcgctgga tccaccacga acaacgaccc ctgaggctgc tgtcaaaccg accctacccg agaccactga gaattgagat tgaagcgcca ttttttgtga ggtggtatqc agatgactga gggcggggcq gqaagggggc gccagtggac ggtccqcaag ccgaatctgc ggacctccca ggtgggcagc ccaggtgaat catgagcggg ggacgtgaat cagcaagtgt tatcaagatc t agga tgt gg gcagcgtttc cgtgaaactc ggtcttcact tactttccgc ggatgcccga gqtgtacaag tgacaattgg ggcggtggag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 WO 99/51641 W099/1641PCT/US99/07333 ggccaatca atgacataaa acaggaggct ctgaacaaga aacaaccaga gtctctggCC cagcttcagg tcctggtcca atcaagacat ctgggcattg tatatccaga ttagctgctg ttcgtctgac atgttcacca tggaggaaga gatgtccta tttgccaagg tgaagatca ctqctgatgg gatcaccggg cctqtcaa atagttttat atcaaagag aacaaaag atcattgctg cagctacgct ggaccccctg aaggagcg gaagcccggc cgccgggagc aagaagatga aagctggtgt atcaagat cc gatgtggaga aatgatcctg accaaatact caagatqtgc caaagtgta atacatgct caagttctcg acaattata gatcttctag ggaccaga aacccagaa atccgctttg ggtctgtac caactgagat aggaatttgt tccaggaggc catctqgagg ccattaccga atgtggtgtt gtggcagcta aaacagataa tccgcttcct tcctagctgt actcaagcc tcttccccct aggccgcct agatttggtg ctctggaacc at at agcat aggaacctaa ggaagatgaa gaatcttact ctgtgggat tgattctgtc cctcctatat ggqaatgga aqgaggagaa agaaagagga cccggcgcaa agcccaga ccatgactct ggatcaaaga tcaagctgct gaatcatcca atcagaacat catacaagta aggtgtctgc gaat acagga atcttaatga ttagagttcg ttttcagaat ttgaaaatgt tggagtcaga catacccctg aggagaaaat gagatgccca gtgacaaaat tctttgctgC tgtcatgctg ggagaaacta accgctggcc aggcggccgt ccaaatctac tgatgccagc caagaagatt atggattgga gtcacagaaa tgtctgtctg caacctgaac gggqctcgat ctggctcctg ggtccacacg ctggaagctg ctggcagatc ggaagatatt tacatggctt tgcttatgag ggctatctac cagccagcaq cactcttgtt gt cggaggcg gtcccggctg gagtgtctct cccaccgaca ccggcttagc ggagtccatc cgagatcqag gctgctcggg tgggtcagga cttcacggcc tgagcacaat ttttgagaat atgctatgat cttqgaccgc agtacccacc ggtagatgta cacctctatc caatgagaac gttccagaac catgtattcc ggcagcccga tatctactcc cgtcaaggac aatcctgcca accaagcgac tatgatgcca tctqgtgtgC agggcaatga ggatctcgga ggatactatg gggtcccccc at ctt ta tat tcatttaaca aaaatgaatg gqttacaa ggaatgggat gtcttaaa tatgcaaag gtggaaaata gaagtatata ggaattttat acaaagagtg aatgtggaag gatgaagaat gtgatatttg aaggaaa ttggagaagg gaaatgagaa caaaaagaaa tgtgatggga atggagtgat aggaagataa acaggagaga taatatgatg atgaaggca aaggataatg aaatatgtag agaagaagag gtagatgaaa aaagggata gggggaaaa atgtttatag agaatggagg taataggtta aatatagtag gaattaatta aattaagt aaaataataa ataaccgaag tgaaaagaa tatgggaatt gaatggagga aatattagta tggaatgqaa aaagaaa aagatgaca aagtataagt tataaaatc atgtggatg ttgggaggaa ttagtatggg agaaggaaga tgggaatgat tgaaaggaa ttctgaaca atggttaaa tgtacaatga tactgtgaat ttgaatttga tgacaaaat tgaagaaagg agaaaagtga ataaaatca catatggggg gtcgagtga gaatgaqaga gaagggaaa gtggaaagag aagataaaag tgataagaga caaaattagt atgaaataaa aatataaatt atgaataaat tagaataaaa ggtaagagag tagagattag aaagaaagga ttatgttatt aataattaaa tgaagatgtt gagcaaaga agttgaaaat aatttcaaa aaatgaggag ggcatggaa attcaataa ctttgagggt gattatagag ggatgatatt gacaatggta tatataaaga aaatgtaagt ataactggat aaagtttcat ataaggttaa aaagaaggag ggtgggaatq aattgagaa gatggagaat ggggatgatg gaagataaat aatatgct atatattgac gagaaggatg gtaatagaaa aatggaaaag gtataggaag aatgaaaagg tttgatttat ggaggaaaag gcgggaagc taagtttata ggacttaa aatggaaaa tagagaagtt gagtttatgg atatgaatat gaataagaa atttgaatta aagaaaatgg tgaatatgat tatatttaga aaacaagaaa agaatatgat agtggaaatg aaagagaat gaagggctgc 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 3969 <210> <211> 1323 <212> PRT <213> Artificial Sequence WO 99/51641 WO 9951641PCT/US99/07333 Met Al a Ie Asp Tyr Cys Val1 Phe Phe Gys 145 Arg Pro Glu <210> <211> 13: <212> PR' <213> Ar' <220> <223> Ch.

<400> Leu Leu Lel Gly Gly Al His Pro Pr Gin Val Ly Val Gys Ar Leu Ala As: Arg Ile Cy Leu Thr Gi 115 Arg Cys As: 130 Ser Gin Gi Thr Pro Hi Met Ser Gi 18 Met Ala Le

S

0 y p y 5 y 0 u Leu Gin T rp Aila Gly Gly Ser Gly Pro Gin Ser 165 Gly Glu Leu Thr Giu Ile Giu 70 Ser Lys Asp Asp Trp 150 Glu Trp Asp Leu Pro Gly Asn 55 Arg Trp Ser Leu Phe 135 Ser Arg Pro Val1 Ala Asn Gly 40 Phe Glu Thr Tyr Pro 120 His Thr Arg Gly Asn 200 Pro Ala 25 Ile Leu Val Asp Leu 105 Ala Leu Pro Al a Gly 185 Ser 23 r tificial Sequence imeric Leu 10 Thr Arq Pro Val Met 90 Thr Leu Val Lys Val 170 Gin Arg Phe Ser Tyr Val Gly 75 Asp Leu Asp Gly Pro 155 Tyr Ala Arq Leu Giu Arg Asp Pro Thr Glu Gly Ser 140 His Ile Cys Asp Cys 220 Arg Gly Gly T yr Lys Pro Asn Ala 125 Ser Cys Gly Gin Ile 205 Pro Cys Leu Giu ValI Ser Gly 110 Arg Arg Gin Al a Pro 190 Leu Pro Gin Thr Ile Arg Arg Lys Val Ser Val1 Leu 175 Ala Pro Gl y Ile Arg Glu Lys Cys Val Asp Ile As n 160 Phe Val Asp 195 Tyr Giu Leu Lys Leu Ile His His Asp Ser Lys 210 .215 Asp Pro Gly Gin WO 99/51641 WO 9951641PCT/US99/07333 Ala 225 Ile Al a Ala Ser Gi y 305 Ser Ile Asn Thr Gi y 385 Phe Giu Ala Lys Gin 465 Leu Asp Thr Leu Arg Leu Ala 290 Trp Thr Thr Leu Giu 370 Lys Lys Ala Asn Leu 450 Glu Asn Phe Lys Met Met Ser 275 Thr Lys Leu Phe Lys 355 Ala Lys Ile Val Thr 435 Thr Ala Lys Asn Tyr Pro Trp 260 As n Leu Lys Asp Arg 340 Arg Arg Tyr Tyr Glu 420 Arg Lys Pro Thr T yr 500 Leu Gly 245 Asn Arg His I le Asp 325 Gin Gin Lys Val Asp 405 Gly Ser Arg Leu Ser 485 As n Tyr 230 Cys Leu Gin Asn Ala 310 Leu Ser Asp Val T rp 390 Pro His Ile Leu Ala 470 Gly As n Glu Ser Ile Arg Pro 295 Thr Giu Phe Ala Phe 375 Phe Ser Ile Ser Lys 455 Tyr Gly Gin Leu Ser Val1 Phe 280 Thr Ile Gl u Phe Arg 360 Cys Leu Ile Thr Asn 440 Arg Asp Giy Thr Leu Val1 Leu 265 Pro Arg Gin Arg Ser 345 Ile Giu Ile As n Thr 425 Met His Al a Gly Ile 505 86 Tyr Ser 250 Ser Thr Val1 Gin Val1 330 Asp Ile Val Giy Cys 410 Giu Thr Pro Ile Arg 490 Thr Asn 235 Thr Tyr Phe Lys Thr 315 Lys Pro Val Tyr T rp 395 Thr Ile Ser Giu Trp 475 Ser Asp Asp Leu Gly Phe Leu 300 Thr Giu Ala Gi y Lys 380 Tyr Val Vai Gin Glu 460 Al a Gly Gin Pro Val1 Ser Arg 285 Phe Giu Ala Vai Leu 365 Giu Ala Asp Met Giu 445 Thr Leu ValI Ile Ile Al a Ser 270 Thr Glu Val1 Giy Pro 350 Phe Arg Asp Glu Leu 430 Phe Gly Ala Arg Tyr 510 Lys Glu 255 Ser His Lys Phe Ile 335 Val1 Tyr Leu Asn Met 415 As n Val Gly Leu Leu 495 Arg Ile 240 Aia Pro Pro Trp Thr 320 Giu.

Lys Giu Phe Trp 400 Thr Pro Giu Phe Ala 480 Giu Aila WO 99/51641 WO 9951641PCTIUS99/07333 Met Al a Gly 545 Ser Gin Ile Cys Ser 625 Leu Asn Gly His Leu 705 Asp Thr Ser Trp As n Ser 530 Ser Trp Thr Se r Leu 610 Gin Al a Gin Phe Thr 690 Glu Val1 Ile Ile Leu 770 Ser 515 Gly Tyr Ser Leu Val1 595 Ser Pro Al a Phe Ser 675 Val1 Pro Leu Glu Leu 755 Gi y Ser Ser Lys Lys Val 580 Ser Phe As n Val1 Pro 660 Leu Phe T rp Thr Thr 740 Pro Ile Ser Arg Lys Thr 565 Ile Val1 Asn Leu Phe 645 Phe Gly Thr Lys Leu 725 Phe Gin Phe Phe Met Ile 550 Asp Lys Leu Ile Asn 630 Pro Val Tyr Lys Leu 710 Al a Al a Leu Tyr Giu Ala 535 Gly Lys Thr Ser T yr 615 Asn Leu Cys Gly Lys 695 T yr Ile Lys Glu Gly 775 Gly 520 Trp, Tyr Trp Phe Ser 600 Asn Leu Gi y Gin Ser 680 Glu Al a T rp Glu His 760 Tyr Val1 Thr Tyr I le Arg 585 Leu Ser Thr Leu Al a 665 Met Glu Thr Gin Glu 745 Cys Lys Ser Leu Asp Gly 570 Phe Gly His Ala Asp 650 Arg Phe Lys Val1 Ile 730 Pro Ser Gly Gly His Val Val Phe Asp 525 Ile Ser 555 Gly Leu Ile Val1 Val1 635 Gly Leu Thr Lys Gly 715 Val Lys Ser Leu Glu 540 Thr Ser Ser Val Arg 620 Gly Tyr T rp, Lys Giu 700 Leu Asp Glu Arg Leu 780 Gin Lys Pro Gin Leu 605 Tyr Cys His Leu Ile 685 Trp Leu Pro Asp Lys 765 Leu Leu Asp Pro Lys 590 Al a Ile Ser Ile Leu 670 Trp Arg Val Leu Ile 750 Met Leu Gin Asp Al a 575 Leu Val1 Gin Leu Giy 655 Gly Trp Lys Gly His 735 Asp Asn Leu Gly Leu 560 Asp Phe Val As n Al a 640 Arg Leu Val1 Thr Met 720 Arg Val1 Thr Gly Ile Phe Leu Ala Tyr Giu Thr Lys Ser Val Ser Thr Giu Lys Ile Asn 785 790 795 WO 99/51641 PCTIUS99/07333 Asp His Arg Leu Ile Thr Ala Phe Ala 835 Leu Val Val 850 Glu Trp Gin 865 Asn Asn Asn Glu Leu Glu Arg His Gin 915 Pro Thr Pro 930 Pro Pro Asp 945 Lys Ala Ala Glu Glu Ala Leu Arg Arg 995 Leu Gly Thr 1010 Ile Ile His 1025 Lys Leu Val Ala Met Asp Ala Val Gly Met Ala Ile Tyr Asn Val Ala Val Leu Cys 805 810 815 Ala Pro Val Thr Met Ile Leu Ser Ser Gin Gin Asp Ala 820 825 830 Phe Ala Ser Leu Ala Ile Val Phe Ser Ser Tyr Ile Thr 840 845 Leu Phe Val Pro Lys Met Arg Arg Leu Ile Thr Arg Gly 855 860 Ser Glu Ala Gin Asp Thr Met Lys Thr Gly Ser Ser Thr 870 875 880 Glu Glu Glu Lys Ser Arg Leu Leu Glu Lys Glu Asn Arg 885 890 895 Lys Ile Ile Ala Glu Lys Glu Glu Arg Val Ser Glu Leu 900 905 910 Leu Gin Ser Arg Gin Gin Leu Arg Ser Arg Arg His Pro 920 925 Pro Glu Pro Ser Gly Gly Leu Pro Arg Gly Pro Pro Glu 935 940 Arg Leu Ser Cys Asp Gly Ser Arg Val His Leu Leu Tyr 950 955 960 Ala Met Thr Leu Glu Ser Ile Met Ala Cys Cys Leu Ser 965 970 975 Lys Glu Ala Arg Arg Ile Asn Asp Glu Ile Glu Arg Gin 980 985 990 Asp Lys Arg Asp Ala Arg Arg Glu Leu Lys Leu Leu Leu 1000 1005 Gly Glu Ser Gly Lys Ser Thr Phe Ile Lys Gin Met Arg 1015 1020 Gly Ser Gly Tyr Ser Asp Glu Asp Lys Arg Gly Phe Thr 1030 1035 1040 Tyr Gin Asn Ile Phe Thr Ala Met Gin Ala Met Ile Arg 1045 1050 1055 Thr Leu Lys Ile Pro Tyr Lys Tyr Glu His Asn Lys Ala 1060 1065 1070 His Ala Gin Leu Val Arg Glu Val Asp Val Glu Lys Val Ser Ala Phe 1075 1080 1085 WO 99/51641 PCT/US99/07333 89 Glu Asn Pro Tyr Val Asp Ala Ile Lys Ser Leu Trp Asn Asp Pro Gly 1090 1095 1100 Ile Gin Glu Cys Tyr Asp Arg Arg Arg Glu Tyr Gin Leu Ser Asp Ser 1105 1110 1115 1120 Thr Lys Tyr Tyr Leu Asn Asp Leu Asp Arg Val Ala Asp Pro Ala Tyr 1125 1130 1135 Leu Pro Thr Gin Gin Asp Val Leu Arg Val Arg Val Pro Thr Thr Gly 1140 1145 1150 Ile Ile Glu Tyr Pro Phe Asp Leu Gin Ser Val Ile Phe Arg Met Val 1155 1160 1165 Asp Val Gly Gly Gin Arg Ser Glu Arg Arg Lys Trp Ile His Cys Phe 1170 1175 1180 Glu Asn Val Thr Ser Ile Met Phe Leu Val Ala Leu Ser Glu Tyr Asp 1185 1190 1195 1200 Gin Val Leu Val Glu Ser Asp Asn Glu Asn Arg Met Glu Glu Ser Lys 1205 1210 1215 Ala Leu Phe Arg Thr Ile Ile Thr Tyr Pro Trp Phe Gin Asn Ser Ser 1220 1225 1230 Val Ile Leu Phe Leu Asn Lys Lys Asp Leu Leu Glu Glu Lys Ile Met 1235 1240 1245 Tyr Ser His Leu Val Asp Tyr Phe Pro Glu Tyr Asp Gly Pro Gin Arg 1250 1255 1260 Asp Ala Gin Ala Ala Arg Glu Phe Ile Leu Lys Met Phe Val Asp Leu 1265 1270 1275 1280 Asn Pro Asp Ser Asp Lys Ile Ile Tyr Ser His Phe Thr Cys Ala Thr 1285 1290 1295 Asp Thr Glu Asn Ile Arg Phe Val Phe Ala Ala Val Lys Asp Thr Ile 1300 1305 1310 Leu Gin Leu Asn Leu Lys Gly Cys Gly Leu Tyr 1315 1320 <210> 46 <211> 4231 <212> DNA <213> Artificial Sequence <220> <223> Chimeric pmGluR2//CaR*Gai5+3Ala WO 99/51641 WO 99/1 641PCT/US99/07333 <400> 46 atgggatcgc ccaqccaaga caccagaagg cgcct ggaggr gqcgtgcgcc caggcactgg tgccccgacg gqcggttcct coacagatta tttgcccgca ttcttcaact attgaggcct gtgggccgtg cccagtgccc gccagccagc gagagtgtgg tcctacccca cggaacccct gactgcgcag gtggtcaatg cccaacacca gactttgtgc gtccgctttg gcaggcaqtg gacaccagc agtgagccct ctctgcattc gqcctggqct atccgctggg gccaccctct tcaggtcggg ttcatcttca actgccttct ttcggtgggg gccatctgcc gaggcaccgg tgcaaccacc ctctgcacgc ttcattggct tatgtcacct agcggctccg ccgcagaaga gctgcccggg ggctccacgg ttcccacagc cagcagcagc caqaaggtca aagaacgcca agcgatacgc gatctgaccg gtggaggacc atcagtggtg ctggagtcca tgcttgcgct aggtgctgac gcggcccagc ccatgctttt tgggtgcaca actttgtgcg gctcttatgc acagtgatqt gctacgcctc cagtqcctcc ggacctatqt ttgagctaga ccatgagccg gcgt ggct gt gcctcaatgc tggcaggcag tcagtgactt ggttccgtga cccactctct cagtgtacgc cccggctctg tcaacqtcaa accqctttgg ggcgctatcg tcatcccatg gcctccagaa cgtgccagcc actggcccaa gcgatgcctg ttgtgctggg agctctgcta ttgccaagcc ctgtctgcta cccgggaggg tggcacttat gcacaggcaa gcgatgcaag tttatgcctt tcaccatgta ccagtgacta tggtgcttg acaccatcqa ccacgctgcg gatccacccc ccgagaggca ccctgaccct tctttggcag tggcccacgg tgacccgaca tccaggaaac ctgaagagtt gaggcagcac tcatggcgtg cccggcactg cctggaggga agaggactgt tgcactggac catcctcgac tgcctcactc gacccatggt ctccatccag taccaqtgcc tgacttcttc gtccactgtg ggctcgtgcc cgcggccttt cctgttcacc cagcttcacc tgagggggct tgcctcctac attctgggag ccgggctgtg catggcccat tgacgcgatg gtttgatgcc tgatggtatt ctaccagaag ggcctcaccc tgaggtgaag ctatgagtac tgccaqcctg ggctgtggga tgtctttgtg catcctgctg at ccacggca ctcagccctg tgcccagcgg ctcgggccag ggagacagcc tatgttgggc caagactcgc caccacctgc ccgggtacag ctgcctcttt ggaggtgcgt ccgcagcaac ctcctcctcc gaagcagcag cccacagcag cggcacggtc gaattctacg ccagccatta aggtctgcaa gtccccaqca tgttacagaa ctgcctgagc ctgctgctgt gacttqgtqc ggtcctgtca cgcatcaacc agttgctcca agccgtggtg gatgctccca gtggccaacc aagctgagtq caagccaagg gcgtctgagg cgcaacatct gagggtgtgg cgttctgagg tgggtggcca qctqaqggtg ttccagagcc cagaggttcc ccctttgagc gcgctccaca cggccagtta ccctttcgcc ggccgctaca qtgggctact tcagccggcc agtgtgcagc cgattggacg actggctgct cctgtcacca cggcacaatg ggtggtgtct gtgtgtacct ctcaccaaga ccacgcttca ctgctcatcg cccgaacggc tcgctggcct aagtgccccg atcatctggc accaccacca gcgcccaagc tgcagcaccg gtctcccgca at cagcagca cagccgctgg caacgatctc accttctcac caccagaact ctcccgctgc ggacctgtgg cttgtagtgt aacgtagtga gaqgaggcca ggggtgctgt tgggtgggct atgagcaccg gtgacccgca aggacacaca ctgatggctc ctgccatcac tcttgaggct acaagtcccg ccatggctga gcgactatgg gtgtggccac tgcqagccct atgcccggga gtgatggttg ctatcaccat tggacccttg gctgcagctt aggagtccaa acatgcaccg acqggcgccg ca gct gaca c acatcttcac gggcagaagg ccctgcccgc cgggcgaagt aattcacttg tcgaactgcc tcgcctqcct ccacaccagt tcctctgcta tacggcgtct ccaaccqcat tcagtcctgc tggtcgcctg gggaggtggt acaatgtgct aaaacttcaa tqgcattcct tgtgcgtqtc tgcacatcat cagctcacgc agcggtccag agagcaacag ccctaaccca agcagcagcc tgagctttga ccctggaggc agtgcgggga gtggagacca ccagttcaca attcagcggc aqgaagcccg ggctgagggc gttcccagtg tggcatccag cctgctgcct tgcqctggag acgccacatc tggtgttatt atttcagatc ctatgactac gattctccgc cgagacaggc ctcggagaaa gctgcagaag gctgcttgct gggggccct g cgagctqgcc gaacaacagc ccggcagcga gat cat gtt t tgccctctgc cctctacaag ccacaatgag ctatctgcgt cttgactctg ctctcgctqc ctqctgct gg cgctgattgt ccaggagtac cggtgccctg ggtcaaggcc ctgcatgacc tggtttgggc tgcacgcat c ctcacaggtg gctggtggtg gacactgcgc cctcatcgcg cgaggccaag gcccatcttc agtcagcctc cctcttccag tttcaaggtg cagccttgga cgaagaccca gcaagagcag cagatgcaag tgagcctcag ccagaaaagc aacggactta gcggccagag gagctttgtc cgccatgact gcggatcaac 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 WO 99/51641 WO 9951641PCT/US99/07333 gacgagatcg ctgctgctcg catgqqtcag atcttcacgg tatgagcaca gcttttgaga gaatgctatq gacttggacc cgagtcccca atggtcgatg gtcacctcta gacaatgaga tggttccaga atcatgtatt cagqcagccc attatctact gccgtcaagg ctcctagaca agcggcagct qgacaggaga gatactctga ccatqcaggc ataaggctca atccatatgt atagacqacg gcgtagctga ccacagggat tagggggcca tcatgtttct accgaatgga actcctcggt cccatctagt gagaattcat cccacttcac acaccatcct cccgccctgc ccgcagggac gagtggcaag tgaagataaa catgatcaga tgcacaatta agatgcaata agaatatcaa ccctgcctac catcgaatac aaggtcagag agtagcgctt ggaaagcaag tattctgttc cgactacttc tctgaagatg gtgcgccaca ccagttgaac ccttccctgg aagcgggacg agtacgttta aggggcttca gccatggaca qttcgagaag aagagtttat ttatctgact ctgcctacgc ccctttgact agaagaaaat agtgaatatg gctctcttta ttaaacaaga ccagaatatq ttcgtggacc gacaccgaga ctgaaggact cccgccggga tcaagcagat ccaagctggt cactcaagat ttgatgtgga ggaatgatcc ctaccaaata aacaagatgt tacaaagtgt ggatacactg atcaagttct qaacaattat aagatcttct atggacccca tgaacccaga atatccgctt gcggtctgtt gctcaagctg gagaatcatc gtatcagaac cccatacaag gaaggtgtct tggaatccag ctatcttaat gcttagagtt cattttcaga ctttqaaaat cgtggagtca cacatacccc agaggagaaa gagagatgcc cagtgacaaa tgtctttgct ctaattgtgc 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4231 <210> 47 <211> 1397 <212> PRT <213> Artificial Sequence <220> <223> Chimeric pmGluR2//CaR*Gaqi5+3Ala <400> 47 Gly Ser Leu Leu Ala Leu Pro Ala Leu Leu Leu Leu Trp Met

I

Gly Ala Val Ala Glu Val Leu Gly Gly Pro Ala Lys Lys Val1 25 Leu Thr Leu Glu Gly Asp Leu Pro Ala Glu Gly Leu Phe Pro His Gln Lys Gly Gly Asp Cys Gly Pro Val Asn Glu 55 His Arg Gly Ile Gln Arg Leu Glu Pro His Leu Leu Ala Pro Met Leu Phe Ala Leu Arg Ile Asn Arg Asp 75 Gly Val Arg Leu Gly Ala His Ile Leu Ser Cys Ser Lys Asp Thr His Ala Leu Gln Ala Leu Asp Phe 105 Val Arg Ala Ser Leu Ser Arg 110 WO 99/51641 WO 9951641PCTIUS99/07333 Gly His Ser 145 Pro Arg Lys Thr Glu 225 Val Leu Giu Phe Al a 305 Ser Trp Phe Ala Val 385 Al a Gly 130 Asp Gin Tyr Ala Val 210 Leu Gly Leu Asp Thr 290 Gly Tyr Asn Arg Val 370 Tyr Asp 115 Asp Val Ile Asp Met 195 Ala Giu Arg Gin Ala 275 Trp Ser Pro As n Cys 355 Pro Al a Gi y Al a Ser Ser Tyr 180 Ala Ser Ala Ala Lys 260 Arg Val1 Glu Ile Ser 340 Ser Phe Met Ser Pro Ile Tyr 165 Phe Giu Giu Arg Met 245 Pro Giu Al a Giy Ser 325 Arg Phe Glu Al a Arg Thr Gin 150 Al a Al a Ile Gly Ala 230 Ser Ser Leu Ser Al a 310 Asp Asn Arg Gin His 390 His Ala 135 Val Ser Arg Leu Asp 215 Arg Arg Ala Leu Asp 295 Al a Phe Pro Gin Glu 375 Al a Ile 120 Ile Al a Thr Thr Arg 200 Tyr Asn Al a Arg Ala 280 Giy Glu Al a Trp Arg 360 Ser Leu Cys Thr Asn Ser Val1 185 Phe Gly Ile Ala Val 265 Al a Trp Gly Ser Phe 345 Asp Lys His Pro Gi y Le u Al a 170 Pro Phe Giu Cys Phe 250 Ala Ser Gly Al a Tyr 330 Arg Cys Ile Asn Asp Val1 Leu 155 Lys Pro As n Thr Val 235 Giu Val1 Gin Al a Ile 315 Phe Giu Al a Met Met 395 Gi y Ile 140 Arg Leu Asp Trp Gi y 220 Al a Gly Leu Arg Leu 300 Thr Gin Phe Al a Phe 380 His Ser 125 Gly Leu Ser Phe Thr 205 Ile Thr Val1 Phe Leu 285 Giu Ile Ser Trp His 365 Val Arg Tyr Gly Phe Asp Phe 190 Tyr Giu Ser Val Thr 270 Asn Ser Glu Leu Glu 350 Ser Val Al a Thr Tyr Ile 160 Ser Al a Ser Phe Lys 240 Al a Ser Ser Val Ala 320 Pro Arg Arg Al a Cys 400 WO 99/51641 WO 9951641PCT/US99/07333 Pro Arg Arg Gly Arg 465 Asp Ala Gin Giu Trp 545 Ile Leu Asn Leu Ala 625 Thr Ile Phe Asn Leu Pro Ile 450 Tyr Thr Ser Pro Tyr 530 Pro Arg Giy Ala Leu 610 Lys Al a Ala Ile Thr Tyr Al a 435 Gly Arg Ser Arq Gly 515 Arg Asn Trp Al a Thr 595 Gly Pro Phe Arg Ser 675 Thr Lys 420 Asp Arg Tyr Le u Cys 500 Glu Leu Al a Gly Leu 580 Pro Gly Ser Ser Ile 660 Pro Arg 405 Asp Thr Tyr Gin Ile 485 Se r Val Asp Ser Asp 565 Ala Val Val Thr Val1 645 Phe Ala Leu Phe His Asn Lys 470 Pro Glu Cys Glu Leu 550 Ala Thr Val Phe Ala 630 Cys Gly Ser Cys Val Asn Ile 455 Val T rp Pro Cys Phe 535 Thr Trp Leu Lys Leu 615 Val1 T yr Gly Gin Asp Leu Giu 440 Phe Gly Al a Cys T rp 520 Thr Gly Ala Phe Al a 600 Cys Cys Ser Ala Val1 680 Al a Asn 425 Val Thr Tyr Ser Leu 505 Leu Cys Cys Val1 Val1 585 Ser Tyr Thr Ala Arg 665 Al a Met 410 Val1 Arg Tyr Trp Pro 490 Gin Cys Al a Phe Gly 570 Leu Gly Cys Leu Leu 650 Glu Ile Arg Lys Phe Leu Al a 475 Ser Asn Ile Asp Glu 555 Pro Gly Arg Met Arg 635 Leu Gly Cys Pro Phe Asp Arg 460 Glu Al a Glu Pro Cys 540 Leu Val Val Glu Thr 620 Arg Thr Ala Leu Val Asp Arq 445 Al a Gly Gly Val Cys 525 Gly Pro Thr Phe Leu 605 Phe Leu Lys Gin Ala 685 As n Ala 430 Phe Gly Leu Pro Lys 510 Gln Leu Gin Ile Val 590 Cys Ile Gly Thr Arg 670 Leu Gly 415 Pro Gly Ser Thr Leu 495 Ser Pro Gly Giu Ala 575 Arg Tyr Phe Leu Asn 655 Pro Ile Arg Phe Asp Gl y Leu 480 Pro Val2 Tyr Tyr Tyr 560 Cys His Ile Ile Gi y 640 Arg Arg Ser WO 99/51641 WO 9951641PCTIUS99/07333 Gly Thr 705 Gys Leu Pro Thr Ser 785 Ser Ile Thr Ser Ser 865 Phe Gin Ser Thr Al a 945 Gin 690 Gly As n Leu Giu Cys 770 Asp Gly Leu Ala Asn 850 Thr Pro Gin Gin Val 930 His Leu Lys His Ile Asn 755 Ile Tyr Ser Phe Al a 835 Val1 Pro Gin Glu Gin 915 Thr Gly Leu Ile Vai Val Ala Trp Leu Val Val Glu Ala Pro Gly Giu Arg Al a 740 Phe Ile Arg Val Gin 820 His Se r Ser Pro Gin 900 Gin Phe Asn Thr Asp 725 Leu Asn Trp Val Val1 805 Pro Ala Arg Ser Glu 885 Gin Pro Ser Ser Ala 710 Al a Cys Glu Leu Gin 790 Leu Gin Phe Lys Ser 870 Arg Gin Arg Leu Thr 950 695 Pro Ser Thr Al a Al a 775 Thr Gly Lys Lys Arg 855 Ile Gin Gin Cys Ser 935 His Glu Met Leu Lys 760 Phe Thr Cys Asn Val1 840 Ser Ser Lys Pro Lys 920 Phe Gin Arg Leu Tyr 745 Phe Leu Thr Leu Thr 825 Al a Ser Ser Gin Leu 905 Gin Asp Asn Arq Gi y 730 Ala Ile Pro Met Phe 810 Ile Al a Ser Lys Gin 890 Thr Lys Giu Ser Glu 715 Ser Phe Gly Ile Cys 795 Al a Glu Arg Leu Ser 875 Gin Leu Val Pro Leu 955 700 Val1 Leu Lys Phe Phe 780 Val1 Pro Glu Al a Gly 860 Asn Pro Pro Ile Gin 940 Glu Val1 Al a Thr Thr 765 Tyr Ser Lys Val Thr 845 Gly Ser Leu Gin Phe 925 Lys Al a Thr Tyr Arg 750 Met Val Val1 Leu Arg 830 Leu Ser Glu Al a Gin 910 Gly Asn Gin Leu As n 735 Lys Tyr Thr Ser His 815 Cys Arg Thr Asp Leu 895 Gin Ser Ala Lys Arg 720 Val Cys Thr Ser Leu 800 Ile Ser Arg Gly Pro 880 Thr Arg Gly Met Ser 960 Ser Asp Thr Leu Thr Arg His Gin Pro Leu Leu Pro Leu Gin Cys Gly WO 99/51641 PCT/US99/07333 Glu Thr Asp Leu Asp Leu Thr Val Gin Glu Thr Gly Leu Gin Gly Pro 980 985 990 Val Gly Gly Asp Gin Arg Pro Glu Val Glu Asp Pro Glu Glu Leu Ser 995 1000 1005 Pro Ala Leu Val Val Ser Ser Ser Gin Ser Phe Val Ile Ser Gly Gly 1010 1015 1020 Gly Ser Thr Val Thr Glu Asn Val Val Asn Ser Ala Ala Ala Met Thr 1025 1030 1035 1040 Leu Glu Ser Ile Met Ala Cys Cys Leu Ser Glu Glu Ala Lys Glu Ala 1045 1050 1055 Arg Arg Ile Asn Asp Glu Ile Glu Arg Gin Leu Arg Arg Asp Lys Arg 1060 1065 1070 Asp Ala Arg Arg Glu Leu Lys Leu Leu Leu Leu Gly Thr Gly Glu Ser 1075 1080 1085 Gly Lys Ser Thr Phe Ile Lys Gin Met Arg Ile Ile His Gly Ser Gly 1090 1095 1100 Tyr Ser Asp Glu Asp Lys Arg Gly Phe Thr Lys Leu Val Tyr Gin Asn 1105 1110 1115 1120 Ile Phe Thr Ala Met Gin Ala Met Ile Arg Ala Met Asp Thr Leu Lys 1125 1130 1135 Ile Pro Tyr Lys Tyr Glu His Asn Lys Ala His Ala Gin Leu Val Arg 1140 1145 1150 Glu Val Asp Val Glu Lys Val Ser Ala Phe Glu Asn Pro Tyr Val Asp 1155 1160 1165 Ala Ile Lys Ser Leu Trp Asn Asp Pro Gly Ile Gin Glu Cys Tyr Asp 1170 1175 1180 Arg Arg Arg Glu Tyr Gin Leu Ser Asp Ser Thr Lys Tyr Tyr Leu Asn 1185 1190 1195 1200 Asp Leu Asp Arg Val Ala Asp Pro Ala Tyr Leu Pro Thr Gin Gin Asp 1205 1210 1215 Val Leu Arg Val Arg Val Pro Thr Thr Gly Ile Ile Glu Tyr Pro Phe 1220 1225 1230 Asp Leu Gin Ser Val Ile Phe Arg Met Val Asp Val Gly Gly Gin Arg 1235 1240 1245 Ser Glu Arg Arg Lys Trp Ile His Cys Phe Glu Asn Val Thr Ser Ile 1250 1255 1260 WO 99/51641 WO 9951641PCT/US99/07333 96 Met Phe Leu Val Ala Leu Ser Giu Tyr Asp Gin Val Leu Val Giu Ser 1265 1270 1275 1280 Asp Asn Giu Asn Arg Met Giu Glu Ser Lys Ala Leu Phe Arg Thr Ile 1285 1290 1295 Ile Thr Tyr Pro Trp Phe Gin Asn Ser Ser Val Ile Leu Phe Leu Asn 1300 1305 1310 Lys Lys Asp Leu Leu Glu Giu Lys Ile Met Tyr Ser His Leu Vai Asp 1315 1320 1325 Tyr Phe Pro Giu Tyr Asp Gly Pro Gin Arg Asp Ala Gin Ala Aia Arg 1330 1335 1340 Giu Phe Ile Leu Lys Met Phe Vai Asp Leu Asn Pro Asp Ser Asp Lys 1345 1350 1355 1360 Ile Ile Tyr Ser His Phe Thr Cys Ala Thr Asp Thr Giu Asn Ile Arq 1365 1370 1375 Phe Val Phe Ala Ala Val Lys Asp Thr Ile Leu Gin Leu Asn Leu Lys 1380 1385 1390 Asp Cys Gly Leu Phe 1395

Claims (40)

1. 27. OCT. 2003 18:53 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 10/18 The claims defining the invention are as follows: 1. A G-protein fusion receptor comprising a) an extracellular domain comprising an extracellular domain amino acid sequence substantially similar to either an extracellular CaR amino acid sequence, an s extracellular mGluR amino acid sequence, or an extracellular GABAB receptor amino acid sequence; b) a transmembrane domain joined to the carboxy terminus of said extracellular domain, said transmembrane domain comprising a transmembrane domain amino acid sequence substantially, similar to either a transmembrane CaR amino acid sequence, a transmembrane mGluR amino acid sequence, or a transmembrane GABA receptor amino acid sequence; c) an intracellular domain joined to the carboxy terminus of said transmembrane domain comprising all or a portion of an intracellular amino acid sequence substantially similar to either an intracellular CaR amino acid sequence, an intracellular mGluR amino acid sequence, or an intracellular GABAe receptor amino acid sequence, provided that said portion is at least 10 amino acids; d) an optionally present linker joined to the carboxy terminus of said intracellular domain; and e) a G-protein joined either to said intracellular domain or to said optionally present linker, provided that said G-protein is joined to said optionally present linker when said optionally present linker is present, wherein said intracellular domain when present in a wild type receptor does not interact with said G-protein. 2. The G-protein fusion receptor of claim 1, wherein said extracellular domain consists of said extracellular domain amino acid sequence, said transmembrane domain consists of said transmembrane domain amino acid sequence; and said intracellular domain consists of said intracellular domain amino acid sequence. 3. The G-protein fusion receptor of claim 2, wherein said optionally present linker is present and is a polypeptide 3 to 30 amino acids in length. 4. The G-protein fusion receptor of claim 2, wherein said optionally present S linker is not present. The G-protein fusion receptor of claim 3 or 4, wherein said G-protein is selected from the group consisting of: Gas1, Gal6, GqoS and Dayb FF86552spe.doc: [l:\Dayib\ULFFI86552s5pedoc:gvc COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 S 27. OCT. 2003 18:53 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 11/18 36 6. The G-protein fusion receptor of claim 5, wherein any of said CaR sequence present is a human CaR sequence, any of said mGluR sequence present is from a human mGluR, and any of said GABAB receptor sequence present is from human GABAa receptor. 7. The G-protein fusion receptor of claim 1, wherein said extracellular domain and said transmembrane domain have at least 75% sequence identity with an mGluR extracellular domain and transmembrane domain or a GABAB receptor extracellular domain and transmembrane domain, said intracellular domain has at least 75% sequence identity with a CaR. intracellular amino acid sequence, and said G-protein couples to in phospholipase C. 8. The G-protein fusion receptor of claim 7, wherein said extracellular domain and said transmembrane domain are from a Type 2 mGluR. 9. The G-protein fusion receptor of claim 7, wherein said extracellular domain and said transmembrane domain are from a Type 3 mGluR. is 10. The G-protein fusion receptor of claim 7, wherein said extracellular domain and said transmembrane domain are from a Type 4 mGluR, 11. The G-protein fusion receptor of claim 7, wherein said extracellular domain and said transmembrane domain are from a Type 6 mGluR. 12. The G-protein fusion receptor of claim 7, wherein said extracellular domain and said transmembrane domain are from a Type 7 mGluR, 13. The G-protein fusion receptor of claim 7, wherein said extracellular domain *o and said transmembrane domain are from a Type 8 mGluR, '14. The G-protein fusion receptor of claim 7, wherein said extracellular domain and said transmembrane domain are from a GABAB receptor. S 25 15. The G-protein fusion receptor of claim 1, wherein said G-protein is a chimeric S G-protein. 16. The G-protein fusion receptor of claim 7, wherein said G-protein is a chimeric G-protein. 17. A G-protein fusion receptor comprising a) an extracellular domain comprising an extracellular domain amino acid S sequence at least 90% identical to an extracellular mGluR amino acid sequence; b) a transmembrane domain joined to the carboxy terminus of said extracellular domain, said transmembrane domain comprising a transmembrane domain amino acid sequence at least 90% identical to a transmembrane mGluR amino acid sequence, or a transmembrane CaR amino acid sequence; [I:\DayLib\.IBFF]86552spec.doc:gcc COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 p 27. OCT. 2003 18:54 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 12/18 37 c) an intracellular domain joined to the carboxy terminus of said transmembrane domain comprising all or a portion of an intracellular amino acid sequence at least 90% identical to an intracellular CaR amino acid sequence, provided that said portion is at least 10 amino acids; s d) an optionally present linker joined to the carboxy terminus of said intracellular domain; and e) a G-protein joined either to said intracellular domain or to said optionally present linker, provided that said G-protein is joined to said optionally present linker when said optionally present linker is present. 18. The fusion receptor of claim 17, wherein said transmembrane domain comprises a transmembrane domain amino acid sequence at least 90% identical to a transmembrane mGluR amino acid sequence. 19. The fusion receptor of claim 17, wherein said transmembrane domain comprises a transmembrane domain amino acid sequence at least 90% identical to a transmembrane CaR amino acid sequence. A G-protein fusion receptor comprising a) an extracellular domain comprising an extracellular domain amino acid sequence at least 90% identical to an extracellular GABAB receptor amino acid sequence; b) a transmembrane domain joined to the carboxy terminus of said extracellular domain, said transmembrane domain comprising a transmembrane domain amino acid sequence at least 90% identical to either a transmembrane CaR amino acid sequence, or a transmembrane GABAn receptor amino acid sequence; c) an intracellular domain joined to the carboxy terminus of said transmembrane domain comprising all or a portion of an intracellular amino acid sequence at least 90% identical to an intracellular CaR amino acid sequence, provided Sthat said portion is at least 10 amino acids; d) an optionally present linker joined to the carboxy terminus of said intracellular domain; and e) a G-protein joined either to said intracellular domain or to said optionally present linker, provided that said G-protein is joined to said optionally present linker when said optionally present linker is present. 21. The fusion receptor of claim 20, wherein said transmembrane domain comprises a transmembrane domain amino acid sequence at least 90% identical to a transmembrane GABAB receptor amino acid sequence, [I:\DayLib\LIBFP)8655Zspec.doc:gcc COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 OCT. 2003 18:43 SPRUSON AND FERGUSON 61292615486 NO. 1203 P. 4/4 38 22. The fusion receptor of claim 20, wherein said transmembrane domain comprises a transmembrane domain amino acid sequence at least 90% identical to a transmembrane CaR amino acid sequence. 23. A nucleic acid comprising a nucleotide sequence encoding for the G-protein s fusion of any one of claims 1-22. 24. An expression vector comprising a nucleotide sequence encoding for the G-protein fusion of any one of claims 1-22 transcriptionally coupled to a promoter, A recombinant cell comprising the expression vector of claim 24 and a cell wherein the G-protein fusion receptor is expressed and is functional. o0 26. A recombinant cell produced by combining a vector of claim 24, wherein said vector comprises the nucleic acid of claim 23 and elements for introducing heterologous nucleic acid into a cell wherein the G-protein fusion receptor is expressed, and said cell. 27. A process for the production of a G-protein fusion receptor comprising: growing procaryotic or eukaryotic host cells comprising a nucleic acid sequence expressing the G-protein fusion receptor of any one of claims 1-22, under suitable nutrient conditions allowing for cell growth.
2. 28. A method of measuring the ability of a compound to effect G-protein fusion activity comprising the steps of: a) providing said compound to a cell expressing the G-protein fusion receptor of any one of claims 1-22, and b) measuring the ability of said compound to affect the activity of said receptor as an indication of the ability of said compound to effect G-protein fusion "receptor activity.
3. 29. A chimeric receptor comprising 25 an extracellular domain comprising an extracellular domain amino acid sequence substantially similar to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID a transmembrane domain comprising a transmembrane domain amino acid sequence substantially similar to a sequence selected from the group consisting of SEQ 0o ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and an intracellular cytoplasmic domain comprising an intracellular domain amino acid sequence substantially similar to a sequence selected from the group consisting of SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID wherein at least one domain is present which comprises an amino acid sequence substantially similar to a sequence selected from the group consisting of: SEQ [I:\DayLib\IBFFj86552specdoc:gcc COMS ID No: SMBI-00475200 Received by IP Australia: Time 18:44 Date 2003-10-30 S 27. OCT. 2003 18:54 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 14/18 39 ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14; and at least one domain is present which comprises an amino acid sequence substantially similar to a sequence selected from the group consisting of: SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:6, SEQ s ID NO:10, SEQ ID NO:11, and SEQ ID The chimeric receptor of claim 29 wherein said extracellular domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group consisting of SEQ ID NOs:2, 3, and 4; said transmembrane domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group consisting of SEQ ID NOs:6, 7, 8, 9, and 10; and said intracellular domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group consisting of SEQ ID NOs:11 and
4. 31. The chimeric receptor of claim 30, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:2; said is transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence SEQ ID NO:7; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 11.
5. 32. The chimeric receptor of claim 30, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:3; said transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:8; and said intracellular domain has a sequence similarity of at o* least 90% with the amino acid sequence of SEQ ID NO:1 I.
6. 33. The chimeric receptor of claim 30, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence SEQ ID NO:4; said 25 transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:9; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 11.
7. 34. The chimeric receptor of claim 29, wherein said extracellular domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group 30 consisting of SEQ ID NOs: 1, 2, 3, 4 and 5; said transmembrane domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group consisting of SEQ ID NOs:7, 8, and 9; and said intracellular domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group consisting of SEQ ID NOs:ll, 12, 13, 14, and *ayLibLIBFF552spcd:g (I:\nayLib\LIBFS 6552spec.doc:gcc COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 S 27. OCT. 2003 18:55 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 15/18 The chimeric receptor of claim 34, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: I; said transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:7; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 11.
8. 36. The chimeric receptor of claim 34, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 1; said transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:8; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 1.
9. 37. The chimeric receptor of claim 34, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:1; said transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:9; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 11.
10. 38. The chimeric receptor of claim 29, wherein said extracellular domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group consisting of SEQ ID NOs:l, 2, 3, 4, and 5; said transmembrane domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group consisting of SEQ ID NOs:6, 7, 8, 9, and 10; and said intracellular domain has a sequence similarity of at least 90% with an amino acid sequence selected from the group consisting of SEQ ID NOs:12, 13, and 14.
11. 39. The chimeric receptor of claim 38, wherein said extracellular domain has a S"sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 1; said transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:6; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:12. The chimeric receptor of claim 38, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:1; said transmembrane domain has a sequence similarity of at least 90% with the amino acid V. sequence of SEQ ID NO:7; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 12. S.
12. 41. The chimeric receptor of claim 38, wherein said extracellular domain has a S. sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 1; said 35 transmembrane domain has a sequence similarity of at least 90% with the amino acid l bL FP 65 spc.d COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 O 27. OCT. 2003 18:55 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 16/18 41 sequence of SEQ ID NO:8; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:13.
13. 42. The chimeric receptor of claim 38, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 1; said transrnembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:6; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 13.
14. 43. The chimeric receptor of claim 38, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:1; said i0 transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:9; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: 14.
15. 44. The chimeric receptor of claim 38, wherein said extracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO: I; said transmembrane domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:6; and said intracellular domain has a sequence similarity of at least 90% with the amino acid sequence of SEQ ID NO:14. The chimeric receptor of any one of claims 29-44, wherein said receptor functional couples to a G-protein.
16. 46. The chimeric receptor of any one of claims 29-44, wherein said chimeric Sreceptor consists of said extracellular domain, said transmembrane domain, said S• intracellular domain, and an optionally present G-protein a subunit covalently joined to said intracellular domain.
17. 47. The chimeric receptor of claim 46, wherein said chimeric receptor consists of 25 said extracellular domain, said transmembrane domain, and said intracellular domain.
18. 48. The chimeric receptor of claim 46, wherein said G-protein a subunit consists of the amino acid sequence of SEQ ID NOs:16 or 17.
19. 49. A nucleic acid comprising a nucleotide sequence encoding for the chimeric receptor of any one of claims 29-48. 30
20. 50. An expression vector comprising a nucleotide sequence encoding for the 0 0chimneric receptor of any one of claims 29-48 transcriptionally coupled to a promoter,
21. 51. A recombinant cell comprising the expression vector of claim 50 and a cell "0 wherein the chimeric receptor is expressed and is functional. 00o0o0 000 0 @0 00« go [):\DayLib\LlBFF] 86552spcc.doc:gcc COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 27. OCT. 2003 18:55 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 17/18 42
22. 52. A recombinant cell produced by combining a vector comprising the nucleic acid of claim 49 and elements for introducing heterologous nucleic acid into a cell wherein the chimeric receptor is expressed, and said cell.
23. 53. A process for the production of a chimeric receptor comprising: s growing procaryotic or eukaryotic host cells comprising a nucleic acid sequence expressing the chimeric receptor of any one of claims 29-48, under suitable nutrient conditions allowing for cell growth.
24. 54. A method of measuring the ability of a compound to effect GABAnR or mGluR activity comprising the steps of: a) providing said compound to a cell expressing the chimeric receptor of any one of claims 29-48, and b) measuring the ability of said compound to affect the activity of said receptor as an indication of the ability of said compound to effect GABAER or mGluR activity.
25. 55. The method of claim 54, wherein said method measures activity at a GABAeR.
26. 56. The method of claim 54, wherein said method measures activity at a mGluR.
27. 57. The G-protein fusion receptor of claim 1, wherein said intracellular domain has at least 90% sequence identity with a portion of a CaR intracellular domain sequence at least 50 amino acids in length.
28. 58. The G-protein fusion receptor of claim 1, wherein said intracellular domain has at least 90% sequence identity with a portion of a mGluR intracellular domain sequence at least 50 amino acids in length.
29. 59. The G-protein fusion receptor of claim 1, wherein said intracellular domain 25 has at least 90% sequence identity with a portion of a GABA 8 receptor intracellular domain sequence at least 50 amino acids in length. A G-protein fusion receptor, substantially as hereinbefore described with reference to any one of the examples.
30. 61. A nucleic acid comprising a nucleotide sequence encoding the G-protein fusion of claim
31. 62. An expression vector comprising the nucleic acid sequence of claim 61.
32. 63. A recombinant cell comprising the expression vector of claim 62. Pe*
33. 64. A process for the production of a G-protein fusion receptor, substantially as hereinbefore described with reference to any one of the examples. DayL 5 ptcdc:gc COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27 S 27. OCT. 2003 18:56 SPRUSON FERGUSON 61 2 92615486 NO. 0001 P. 18/18 43 A G-protein iusion receptor prepared in accordance with the process of claim 27 or 64.
34. 66. A method of measuring the ability of a compound to effect G-protein fusion activity, substantially as hereinbefore described with reference to any one of the s examples.
35. 67. A chimeric receptor, substantially as hereinbefore described with reference to any one of the examples.
36. 68. A nucleic acid comprising a nucleotide sequence encoding for the chimeric receptor of claim 67.
37. 69. An expression vector comprising the nucleic acid sequence of claim 67. A recombinant cell comprising the expression vector of claim 67.
38. 71. A process for the production of a chimeric receptor, substantially as hereinbefore described with reference to any one of the examples.
39. 72. A chimeric receptor produced in accordance with the process of claim 54 or 71.
40. 73. A method of measuring the ability of a compound to effect GABAsR or mGluR activity, substantially as hereinbefore described with reference to any one of the examples. Dated 23 October 2003 NPS Pharmaceuticals, Inc. 0 Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON S 0 S COMS ID No: SMBI-00469343 Received by IP Australia: Time 19:00 Date 2003-10-27