AU763827B2

AU763827B2 - Human G-protein coupled receptor (HETGQ23)

Info

Publication number: AU763827B2
Application number: AU35352/00A
Authority: AU
Inventors: Craig A Rosen; Steven M. Ruben; Daniel R Soppet; Li Yi
Original assignee: Human Genome Sciences Inc
Current assignee: Human Genome Sciences Inc
Priority date: 1995-06-05
Filing date: 2000-05-17
Publication date: 2003-07-31
Anticipated expiration: 2015-06-05
Also published as: AU3535200A

Description

P/00/011 28/5/91 Regulation 3.2

AUSTRALIA

Patents Act 1990

ORIGINAL

COMPLETE SPECIFICATION STANDARD PATENT *9 0 0t 0 0 .0.0 Name of Applicant: Actual Inventors: Human Genome Sciences, Inc.

Daniel R SOPPET Yi LI Craig A ROSEN Steven M RUBEN Address for service is: WRAY ASSOCIATES 239 Adelaide Terrace Perth, WA 6000 Attorney code: WR Invention Title: "Human G-Protein Coupled Receptor (HETGQ23)" This application is a divisional application by virtue of Section 39 of Australian Patent Application 29431/95.

The following statement is a full description of this invention, including the best method of performing it known to me:- 1/1 HUMAN G-PROTEIN COUPLED RECEPTOR (HETGQ23) This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention are human 7transmembrane receptors. The invention also relates to inhibiting the action of such polypeptides.

It is well established that many medically signifi-ant biological processes are mediated by proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, cAMP (Lefkowitz, Nature, 351:353-354 (1991)). Herein these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins. Some examples of these proteins include the GPC receptors, such as those for acrenergic agents and dopamine (Kobilka, et al., PNAS, 84:46-50 (1987); Kobilka, B.K., et al., Science, 238:650-656 (1987); Bunzow, et al., Nature, 336:783-787 (1988)), G-proteins themselves, effector protei.ns, phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, protein kinase A and protein kinase C (Simon, et ai., Science, 252:802-8 (1991)).

For example, in one form of signal transduction, the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP, and GTP also influences hormone binding. A G-protein connects the hormone receptors to adenylate cyclase. Gprotein was shown to exchange GTP for bound GDP when activated by hormone receptors. The GTP-carrying form then binds to an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the Gprotein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.

The membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane a-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth factor and neuroreceptors.

G-protein coupled receptors have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. The G-protein family of coupled receptors includes dopamine receptors which bind to neuroleptic drugs used for treating psychotic and neurological disorders. Other examples of members of this family include calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1 receptor, rhodopsins, odorant, cytomegalovirus receptors, etc.

Most G-protein coupled receptors have single conserved cysteine residues in each of the first two extracellular -2loops which form disulfide bonds that are believed to stabilize functional protein structure. The 7 transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction.

Phosphorylation and lipidation (palmitylation or farnesylation) of cysteine residues can influence signal transduction of some G-protein coupled receptors. Most Gprotein coupled receptors contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus. For several G-protein coupled receptors, such as the 0-adrenoreceptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.

For some receptors, the ligand binding sites of Gprotein coupled receptors are believed to comprise a hydrophilic socket formed by several G-protein coupled receptors transmembrane domains, which socket is surrounded by hydrophobic residues of the G-protein coupled receptors.

The hydrophilic side of each G-protein coupled receptor transmembrane helix is postulated to face inward and form the e' polar ligand binding site. TM3 has been implicated in several G-protein coupled receptors as having a ligand binding site, such as including the TM3 aspartate residue.

o* Additionally, TM5 serines, a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding.

G-protein coupled receptors can be intracellularly coupled by heterotrimeric G-proteins to various intracellular enzymes, ion channels and transporters (see, Johnson et al., Endoc., Rev., 10:317-331 (1989)). Different G-protein a- .ubunits preferentially stimulate particular effectors to modulate various biological functions in a cell.

Phosphorylation of cytoplasmic residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G-protein coupling of some G-protein -3coupled receptors. G-protein coupled receptors are found in numerous sites within a mammalian host.

In accordance with one aspect of the present invention, there are provided novel polypeptides as well as biologically active and diagnostically or therapeutically useful fragments and derivatives thereof. The polypeptides of the present invention are of human origin.

In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the polypeptide of the present invention including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.

In accordance with a further aspect of the present S. invention, there is provided a process for producing such polypeptides by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention under conditions promoting expression of said polypeptide and subsequent recovery of said polypeptide.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.

In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit activation of the receptor polypeptides of the present invention and for receptor ligands.

In accordance with still another embodiment of the present invention there is provided a process of using such activating compounds to stimulate the receptor polypeptide of the present invention for the treatment of conditions related to the under-expression of the G-protein coupled receptors.

In accordance with another aspect of the present invention there is provided a process of using such inhibiting compounds for treating conditions associated with over-expression of the G-protein coupled receptors.

In accordance with yet another aspect of the present invention there is provided non-naturally occurring synthetic, isolated and/or recombinant G-protein coupled receptor polypeptides which are fragments, consensus fragments and/or sequences having conservative amino acid substitutions, of at least one transmembrane domain of the Gprotein coupled receptor of the present invention, such that the receptor may bind G-protein coupled receptor ligands, or which may also modulate, quantitatively or qualitatively, Gprotein coupled receptor ligand binding.

In accordance with still another aspect of the present invention there are provided synthetic or recombinant Gprotein coupled receptor polypeptides, conservative substitution and derivatives thereof, antibodies, antiidiotype antibodies, compositions and methods that can be useful as potential modulators of G-protein coupled receptor function, by binding to ligands or modulating ligand binding, due to their expected biological 'properties, which may be used in diagnostic, therapeutic and/or research applications.

It is still another object of the present invention to provide synthetic, isolated or recombinant polypeptides which are designed to inhibit or mimic various G-protein coupled receptors or fragments thereof, as receptor types and subtypes.

In accordance with yet a further aspect of the present invention, there is also provided diagnostic probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the nucleic acid sequences of the present invention.

In accordance with yet another object of the present invention, there is provided a diagnostic assay for detecting a disease or susceptibility to a disease related to a mutation in a nucleic acid sequence of the present invention.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the G-protein coupled receptor of the present invention. The standard one-letter abbreviation for amino acids are used. Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.).

Figure 2 is an illustration of the amino acid homology between the polypeptide of the present invention (top line) and human endothelial differentiation protein (edg-l) gene mRNA (bottom line).

S:'Figure 3 is an illustration of the secondary structural features of the G-protein coupled receptor. The first 7 illustrations set forth the regions of the amino acid sequence which are alpha helices, beta sheets, turn regions or coiled regions. The boxed areas are the areas which correspond to the region indicated. The second set of figures illustrate areas of the amino acid sequence which are exposed to intracellular, cytoplasmic or are membranespanning. The hydrophilicity part illustrates areas of the protein sequence which are in the lipid bilayer of the membrane and are, therefore, hydrophobic, and areas outside the lipid bilayer membrane which are hydrophilic. The antigenic index corresponds to the hydrophilicity plot, since antigenic areas are areas outside the lipid bilayer membrane and are capable of binding antigens. The surface probability plot further corresponds to the antigenic index and the hydrophilicity plot. The amphipathic plots show those regions of the 13 sequences which are polar and non-polar.

The flexible regions correspond to the second set of illustrations in the sense that flexible regions are those which are outside the membrane and inflexible regions are transmembrane regions.

In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides) which encode for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97,130 on 4-28-95.

A polynucleotide encoding the polypeptide of the present invention was isolated from a cDNA library derived from human endometrial tumor tissue. It is structurally related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 364 amino acid residues.

The protein exhibits the highest degree of homology to a human EDG-1 protein with 36 identity and 61 similarity over a 364 amino acid stretch. Potential ligands to the receptor polypeptide of the present invention include but are not limited to anandamide, serotonin, adrenalin and noradrenalin, platelet activating factor, thrombin, C5a and bradykinin, chemokine, and platelet activating factor.

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be doublestranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NO:1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1) or the deposited cDNA.

The polynucleotides which encode for the mature polypeptides of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.

The variants of the polynucleotides may be a naturally occurring allelic variant of the polynucleotides or a nonnaturally occurring variant of the polynucleotides.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variar-s, substitution variants and addition or insertion variants.

As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID NO:1) or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptides.

The polynucleotides may also encode for a soluble form of the receptor polypeptide of the present invention which is the extracellular portion of the polypeptide which has been cleaved from the TM and intracellular domain of the fulllength polypeptide of the present invention.

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention. The marker sequence may be a hexahistidine tag supplied by a pQE-9 vector to provide for Spurification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian Shost, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein S (Wilson, et al., Cell, 37:767 (1984)).

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).

q Fragments of the full length gene of the present invention may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 20 or 30 bases and may contain, for example, or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene of the present invention including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the -9coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will .o occur only if there is at least 95% and prefe:ably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:1) or the deposited cDNA(s).

Alternatively, the polynucleotide may have at least bases, preferably at least 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

Thus, the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least or 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.

The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the Internaticnal Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112.

The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to a G-protein coupled receptor polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.

S. The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which either retains substantially the same biological function or activity as such polypeptide, i.e. functions as a G-protein coupled receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein coupled receptor, for example, a soluble form of the receptor. An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptides of the present invention may be recombinant polypeptides, a natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

-11- The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA may be one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to rhe mature polypeptide which is employed for purification of the mature polypeptide or one in which a fragment of the polypeptide is soluble, i.e. not membrane bound, yet still binds ligands to the membrane bound receptor. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment the natural environment if it is naturally occurring). For example, a naturallyoccurring polynucleotide or pol.2eptide present in a livng animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector anc/or such polynucleotides or polypeptides could be part of C composition, and still be isolated in that such vector or composition is not part of its natural environment.

The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature -12polypeptide) as well as polypeptides which have at least similarity (preferably at least a 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least a similarity (more preferably at least a 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least a 95% similarity (still more preferably at least a identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.

As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.

Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of th.

invention and the production of polypeptides of the inventi'by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the G- -13protein coupled receptor genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.

However, any other vector may be used as long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within th scope of those skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or promoter, the E. coli. lac or trD, the phage lambda P: •promoter and other promoters known to control expression of genes ;n prokaryotic or eukaryotic cells or their viruses.

The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.

The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic -14trait for selection of transformed host cells such as dihydrofolata reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses; plant cells, etc. The selection of an approp..ate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are i commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223- 3, pKK233-3, pDR540, pRITS (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other piasmid or vector may be used as long as they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda P. and trp.

Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates.

to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast S cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, Battey, Basic Methods in Molecular Biology, (1986)) The constructs in hr cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of Soo. the invention can be synthetically produced by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.

Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, (1989), the disclosure of which is hereby incorporated by reference.

-16- Transcription of the DNA encoding the polypeptides of e present invention by higher eukaryotes is increased by .serting an enhancer sequence into the vector. Enhancers e cis-acting elements of DNA, usually about from 10 to 300 Sthat act on a promoter to increase its transcription.

:amples including the SV40 enhancer on the late side of the Iplication origin bp 100 to 270, a icytomegalovirus early -omoter enhancer, the polyoma enhancer on the late side of ie replication origin, and adenovirus enhancers.

Generally, recombinant expression vectors will include rigins of replication and selectable markers permitting :ansformation of the host cell, the ampicillin sistance gene of E. coli and S. cerevisiae TRP1 gene, and promoter derived from a highly-expressed gene to direct ranscription of a downstream structural sequence. Such romoters can be derived from operons encoding glycolytic nzymes such as 3-phosphoglycerate kinase (PGK), a-factor, cid phosphatase, or heat shock proteins, among others. The eterologous structural sequence is assembled in appropriate hase with translation initiation and termination sequences.

ptionally, the heterologous sequence can encode a fusion rotein including an N-terminal identification peptide e mparting desired characteristics, stabilization or .implified purification of expressed recombinant product.

Useful expression vectors for bacterial use are :onstructed by inserting a structural DNA sequence encoding *desired protein together with suitable translation .nitiation and termination signals in operable reading phase iith a functional promoter. The vector will comprise one or nore phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if lesirable, provide amplification within the host. Suitable ?rokaryotic hosts for transformation include E. coli, 3acillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and -17- Staphylococcus, although others may also be employed as a matter of choice.

As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.

Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHOHS293, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, -18transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

The G-protein coupled receptor polypeptide of' the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, S affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature S protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated.

Polypeptides of the invention mayalso include an initial methionine amino acid residue.

The G-protein coupled receptors of the present invention may be employed in a process for screening for compounds which activate (agonists) or inhibit activation (antagonists) of the receptor polypeptide of the present invention In general, such screening procedures involve providing appropriate cells which express the receptor polypeptide of the present invention on the surface thereof. Such cells include cells from mammals, yeast, drosophila or E. Coli. In particular, a polynucleotide encoding the receptor of the present invention is employed to transfect cells to thereby -19express the G-protein coupled receptor. The expressed receptor is then contacted with a test compound to observe binding, stimulation or inhibition of a functional response.

One such screening procedure involves the use of melanophores which are transfected to express the G-protein coupled receptor of the present invention. Such a screening technique is described in PCT WO 92/01810 published February 6, 1992.

Thus, for example, such assay may be employed for screening for a compound which inhibits activation of the S receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the S receptor ligand and a compound to be screened. Inhibition of S the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, inhibits activation of the receptor.

The screen may be employed for determining a compound which activates the receptor by contacting such cells with compounds to be screened and determining whether such compound generates a signal, activates the receptor.

Other screening techniques include the use of cells which express the G-protein coupled receptor (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science, volume 246, pages 181-296 (October 1989). For example, compounds may be contacted with a cell which expresses the receptor polypeptide of the present invention and a second messenger response, e.g.

signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.

Another such screening technique involves introducing RNA encoding the G-protein coupled. receptor into Xenopus oocytes to transiently express the receptor. The receptor docytes may then be contacted with the receptor ligand and a )ound to be screened, followed by detection of inhibition activation of a calcium signal in the case of screening compounds which are thought to inhibit activation of the aptor.

Another screening technique involves expressing the G- :ein coupled receptor in which the receptor is linked to hospholipase C or D. As representative examples of such Is, there may be mentioned endothelial cells, smooth cle cells, embryonic kidney cells, etc. The screening may accomplished as hereinabove described by detecting ivation of the receptor or inhibition of activacion of the eptor from the phospholipase second signal.

Anoth-r method involves screening for compounds which ibit activation of the receptor polypeptide of the present ention antagonists by determining inhibition of binding of )eled ligand to cells which have the receptor on the face thereof. Such a method involves transfecting a :aryotic cell with DNA encoding the G-protein coupled :eptor such that the cell expresses the receptor on its -face and contacting the cell with a compound in the isence of a labeled form of a known ligand. The ligand can labeled, by radioactivity. The amount of labeled and bound to the receptors is measured, by measuring iioactivity of the receptors. If the compound binds to the :eptor as determined by a reduction of labeled ligand which ads to the receptors, the binding of labeled ligand to the ceptor is inhibited.

G-protein coupled receptors are, ubiquitous in the mmalian host and are responsible for many biological nctions, including many pathologies. Accordingly, it is sirous to find compounds and drugs which stimulate the Gotein coupled receptor on the one hand and which can hibit the function of a G-protein coupled receptor on the her hand.

-21- For example, compounds which activate the G-protein coupled receptor may be employed for therapeutic purposes, such as the treatment of asthma, Parkinson's disease, acute heart failure, hypotension, urinary retention, and osteoporosis.

In general, compounds whic', inhibit activation of the Gprotein coupled receptor may be employed for a variety of therapeutic purposes, for example, for the treatment of hypertension, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy and psychotic and neurological disorders, including schizophrenia, manic excitement, depression, delirium, dementia or severe mental retardation, dyskinesias, such as Huntington's disease or Gilles dela Tourett's syndrome, among others. Compounds which inhibit G-protein coupled receptors have also been useful in reversing endogenous anorexia and in the control of bulimia.

An antibody may antagonize a G-protein coupled receptor of the present invention, or in some cases an oligopeptide, which bind to the G-protein coupled receptor but does not S elicit a second messenger response such that the activity of the G-protein coupled receptors is prevented. Antibodies include anti-idiotypic antibodies which recognize unique determinants generally associated with the antigen-binding site of an antibody. Potential antagonist compounds also include proteins which are closely related to the ligand of the G-protein coupled receptors, i.e. a fragment of the ligand, which have lost biological function and when binding to the G-protein coupled receptor, elicit no response.

An antisense construct prepared through the use of antisense technology, may be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature -22polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of G-protein coupled receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of mRNA molecules into G-protein coupled receptor (antisense Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of G-protein coupled receptor.

A small molecule which binds to the G-protein coupled receptor, making it inaccessible to ligands such that normal biological activity is prevented, for example small peptides or peptide-like molecules, may also be used to inhibit activation of the receptor polypeptide of the present invention.

A soluble form of the G-protein coupled receptor, e.g.

a fragment of the receptors, may be used to inhibit activation of the receptor by binding to the ligand to a polypeptide of the present invention and preventing the ligand from interacting with membrane bound G-protein coupled receptors.

This invention additionally provides a method of treating an abnormal condition related to an excess of Gprotein coupled receptor activity which comprises administering to a subject the inhibitor compounds as hereinabove described along with a pharmaceutically acceptable carrier in an amount effective to inhibit -23ictivation by blocking binding of ligands to the G-protein :oupled receptors, or by inhibiting a second signal, and hereby alleviating the abnormal conditions.

The invention also provides a method of treating tbnormal conditions related to an under-expression of G- ,rotein coupled receptor activity which comprises idministering to a subject a therapeutically effective amount )f a compound which activates the receptor polypeptide of the )resent invention as described above in combination with a )harmaceutically acceptable carrier, to thereby alleviate the Lbnormal conditions.

The soluble form of the G-protein coupled receptor, and :ompounds which activate or inhibit such receptor, may be mployed in combination with a suitable pharmaceutical arrier. Such compositions comprise a therapeutically affective amount of the polypeptide or compound, and a )harmaceutically acceptable carrier or excipient. Such a :arrier includes but is not limited to saline, buffered ;aline, dextrose, water, glycerol, ethanol, and combinations :hereof. The formulation should suit the mode of idministration.

The invention also provides a pharmaceutical pack or kit S:omprising one or more containers filled with one or more of :he ingredients of the pharmaceutical compositions of the nvention. Associated with such container(s) can be a notice Ln the form prescribed by a governmental agency regulating :he manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of nanufacture, use or sale for human administration. In iddition, the pharmaceutical compositions may be employed in :onjunction with other therapeutic compounds.

The pharmaceutical compositions may be administered in i convenient manner such as by the topical, intravenous, Lntraperitoneal, intramuscular, subcutaneous, intranasal or Lntradermal routes. The pharmaceutical compositions are -24administered in an amount which is effective for treating and/or propnylaxis of the specific indication. In general, the pharmaceutical compositions will be administered in an amount of at least about 10 pg/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 pg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.

The G-protein coupled receptor polypeptides, and compounds which activate or inhibit which are also compounds S may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy." Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.

Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.

Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.

In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.

The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniues, Vol. 7, No. 9, 980-990 (1989), or any other promoter cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and 0-actin promoters) Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; numan globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs -26- (including the modified retroviral LTRs hereinabove described); the 0-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the genes encoding the polypeptides.

The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, V-2, -AM, PAl2, T19-14X, VT-19-17-H2, OCRE, OCRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pg.

5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO, precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.

The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

The present invention also provides a method for determining whether a ligand not known to be capable of binding to a G-protein coupled recepcor of the present invention can bind to such receptor which comprises contacting a mammalian cell which expresses a G-protein coupled receptor with the ligand under conditions permitting binding of ligands to the G-protein coupled receptor, -27detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the G-protein coupled receptor.

This invention further provides a method of screening drugs to identify drugs which specifically interact with, and bind to, the human G-protein coupled receptors on the surface of a cell which comprises contacting a mammalian cell comprising an isolated DNA molecule encoding the G-protein coupled receptor with a plurality of drugs, determining those drugs which bind to the mammalian cell, and thereby identifying drugs which specifically interact with and bind 0. to a human G-protein coupled receptor of the present invention. Such drugs may then be used therapeutically to either activate or inhibit activation of the receptors of the V.o* present invention.

This invention also provides a method of detecting expression of the G-protein coupled receptor on the surface of a cell by detecting the presence of mRNA coding for a Gprotein coupled receptor which comprises obtaining total mRNA from the cell and contacting the mRNA so obtained with a nucleic acid probe of the present invention capable of sees *ass specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human G- *protein coupled receptor under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the G-protein coupled receptor by the cell.

This invention is also related to the use of the Gprotein coupled receptor genes as part of a diagnostic assay for detecting diseases or susceptibility to diseases related to the presence of mutations in the nucleic acid sequences with encode the receptor polypeptides of the present invention. Such diseases, by way of example, are related to cell transformation, such as tumors and cancers.

-28- Individuals carrying mutations in the human G-protein coupled receptor gene may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid encoding the G-protein coupled receptor S proteins can be used to identify and analyze G-protein S: coupled receptor mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.

Point mutations can be identified by hybridizing amplified DNA to radiolabeled G-protein coupled receptor RNA or alternatively, radiolabeled G-protein coupled receptor S: antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.

Sequence differences between the reference gene and gene having mutations may be revealed by the direct DNA sequencing method. In addition, cloned DNA segments may be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.

Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA -29fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, Myers et al., Science, 230:1242 (1985)).

Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method Cotton et al., PNAS, USA, 85:4397-4401 (1985)).

Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic DNA.

In addition to more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

The present invention also relates to a diagnostic assay for detecting altered levels of soluble forms of the receptor polypeptides of the present invention in various tissues.

Assays used to detect levels of the soluble receptor polypeptides in a sample derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive-binding assays, Western blot analysis and preferably as ELISA assay.

An ELISA assay initially comprises preparing an antibody specific to antigens of the receptor polypeptide, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a nonspecific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies a- :ach to any receptor polypeptides of the present invention attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to o0 receptor proteins. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is oe a measurement of the amount of receptor proteins present in a given volume of patient sample when compared against a standard curve.

The se-,ences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on

S..

an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated with disease.

Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA.

Computer analysis of the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process.

These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

-31- PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.

Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.

.Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.

For a review of this technique, see Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusic Mendelian SInheritance in Man (available on line through Johns Hopkins University Welch Medical Library) The relationship between genes and diseases that have been mapped to the same .hromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be ;the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one -32of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per kb).

The polypeptides, their fragments or other derivatives or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.

The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments or the S. product of an Fab expression library. Various procedures nown in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, Preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples .nclude the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBVhybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

Techniques described for the production of single chain antibodies Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to -33express humanized antibodies to immunogenic polypeptide products of this invention.

The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published Sprocedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the oe ~ordinarily skilled artisan.

o* "Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other require-ents were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 Ag of plasmid or DNA S" fragment is used with about 2 units of enzyme in about 20 Al of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 Ag of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37"C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is -34electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D.

et al., Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, et al., Id., p. 146). Unless 'otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase") per 0.5 pg of approximately equimolar amounts of the DNA fragments to be ligated.

Unless otherwise stated, transformation was performed as S described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

Example 1 Bacterial Expression and Purification of the G-Protein Coupled Receptor (GPRC) polypeptide The DNA sequence encoding GPRC, ATCC 97,130, is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the processed GPRC nucleotide sequence. Additional nucleotides corresponding to the GPRC nucleotide sequence are added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' CACAGGATCCCGTGGCTGCCATCTCTACTTC 3' (SEQ ID NO:3) contains a BamHT restriction enzyme site followed by 17 nucleotides of GPRC coding sequence starting from the presumed second amino acid of the processed protein.

The 3' sequence; 5' TCTCAGGTACCGTTCTCTiAACCACAGAGTGGTCA

(SEQ

ID NO:4 contains complementary sequences to an ASP718 site and is followed by 19 nucleotides of GPRC coding sequence.

The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-31 (Qiagen, Inc. Chatsworth, CA). pQE-31 encodes antibiotic resistance a bacterial origin of replication (ori), an IPTG-regulatable promoter 'operator a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites.

pQE-31 is then digested with BamHT and ASP718. The amplified Ssequences are ligated into pQE-31 and are inserted in frame with the sequence Enccding for the histidine tag and the RBS.

The ligation mixture -s then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboy-a-ory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREi-, which expresses the lacI repressor and also confers kanamycin resistance (Kan).

Transformants are identified by their ability to grow on LB .plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is, isolated and confirmed by restriction analysis.

Clones containing the desired constructs are grown overnight in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D.

600 of between 0.4 and 0.6. IPTG ("Isopropyl-B-Dthiogalacto pyranoside") is then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression. Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation. The cell pellet is -36solubilized in the chaotropic agent 6 Molar Guanidine HC1.

After clarification, solubilized GPRC is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J.

Chromatography 411:177-184 (1984)). GPRC is eluted from the column in 6 molar guanidine HC1 pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HC1, 100mM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in this solution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate.

*e Example 2 Expression of Recombinant GPCR in COS7 cells The expression of plasmid, GPRC HA was derived from a vector pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire GPRC precursor and a HA tag fused in frame to ins 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression was directed under the CMV promoter. The HA tag *9 correspond to an epitope derived from the influenza hemagglutinin protein as previously described Wilson, H.

Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy was desc: oed as follows: The DNA sequence encoding GPRC, ATCC 97,130, was constructed by PCR using two primers: the 5' primer CAACCACAGGGATCCCATGGCTGCCATCTCTACTTCCATCCCTGTA 3' (SEQ ID 10:5) contains a BamHI site (bold) followed by 27 nucleotides )f GPRC coding sequence starting from the initiation codon; :he 3' sequence 5' CCCCTCGAGCTAAACCACAGAGTGGTCATTGCT 3TGAACTCCAGCC 3' (SEQ ID NO:6) contains complementary sequences to an XhoI site, translation stop codon, HA tag and che last 24 nucleotides of the GPRC coding sequence (not including the stop codon). Therefore, the PCR product contains a HindIII site, GPRC coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an XhoI site. The PCR amplified DNA fragment and the vector, pcDNA3/Amp, were digested with HindIII and XhoI restriction enzymes and ligated. The ligation mixture was transformed into E. coli strain the transformed cultur was plated on ampicillin media plates S and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For S expression of the recombinant GPRC, COS7 cells were transfected with the expression vector by DEAE-DEXTRAN method Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)) The expression of the GPRC HA protein was detected by radiolabeling and immunoprecipitation method Harlow, D.

Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with "S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaC1, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, Tris, pH (Wilson, I. et al., Id. 37:767 (1984)).

Both cell lysate and culture media were precipitated with a HA specific monoclonal antibody. Proteins precipitated were analyzed on 15% SDS-PAGE gels.

Example 3 -38- Clonin and exresion of GPRC using the baculovirus expression system The DNA sequence encoding the full length GPRC protein, ATCC 97,130, was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene: The 5' primer has the sequence 5' TTCACCACCTACCTGGATCC ACAGAGCTGTCATGGCTGCC 3' (SEQ ID NO:7) and contains a BamHI restriction enzyme site (in bold) followed by 11 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, J. Mol. Biol., 196:947-950 (1987) which was just behind the first 9 nucleotides of the GPRC gene (the initiation codon for translation "ATG" is underlined).

The 3' primer has the sequence 5' CCTCATCTCAGGTACCGTT CTAAACCACAGAGTGG 3' (SEQ ID NO:8) and contains the cleavage site for the ASP718 restriction endonuclease and nucleotides complementary to the 3' non-translated sequence of the GPRC gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, The fragment was then digested with the endonuclease BamHI and then purified again on a 1% agarose gel. This fragment was designated F2.

The vector pA2 (modification of pVL941 vector, discussed below) was used for the expression of the GPRC protein using the baculovirus expression system (for review see: Summers M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI. The polyadenylation site of the simian virus (SV)40 was used for efficient polyadenylation. For an easy selection of recombinant virus the beta-galactosidase gene from E.coli was inserted in the -39same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences were flanked at both sides by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pA2 such as pAc373, pVL941, PRG1 and pAcIMl (Luckow, V.A. and Summers, Virology, 170:31-39).

The plasmid was digested with the restriction enzymes ASP718 and BamHT then dephos..orylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) This vector DNA was designated V2.

Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli DH5a cells were then transformed and bacteria identified that contained the plasmid (pBacGPRC) with the GPRC gene using the enzymes BamHI. The sequence of the cloned fragment was confirmed by DNA sequencing.

pg of the plasmid pBacGPRC was cotransfected with ig of a commercially available linearized baculovirus ("BaculoGold" baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al. Proc. Natl.

Acad. Sci. USA, 84:7413-7417 (1987)).

lpg of BaculoGold" virus DNA and 5 jg of the plasmid pBacGPRC were mixed in a sterile well of a microtiter plate containing 50 Al of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 il Lipofectin plus 90 il Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27°C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27 0 C for four days.

After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- Four days after the serial dilution, the virus were added to the cells and blue stained plaques were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 il of Grace's medium. The agar was removed by S a brief centrifugation and the supernatant containing the recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these S culture dishes were harvested and then stored at 4°C.

Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells were infected with the recombinant baculovirus V-GPRC at a multiplicity of infection (MOI) of 2. Six hours later thei medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg) 42 hours later 5 pCi of "S-methionine and 5 ACi "S cysteine (Amersham) were added.

The cells were further incubated for 72 hours before they were harvested by cell lysis in hypotonic phosphate buffer and centrifuged to collect the cell membranes and the labelled proteins visualized by SDS-PAGE and autoradiography.

-41- Examole 4 Expression via Gene Therapy Fibroblasts are obtained from a subject by skin biopsy.

The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added.

This is then incubated at 37 0 C for approximately one week.

At this time, fresh media is added and subsequently changed S every several days. After an additional two weeks in culture, a monolayer of fibrcblasts emerge. The monolayer is trypsinized and scaled into larger flasks.

pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.

The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer contains an EcoRI site and the 3' primer further includes a HindIII site.

Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindIII fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.

-42- The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).

Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.

The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.

Numerous modifications and variations of the present invention were possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

Throughout the specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

-43- EDITORIAL NOTE APPLICATION NUMBER 35352/00 The following Sequence Listing pages 44 to 48 are part of the description. The claims pages follow on pages 49 to 51.

SEQUENCE LISTING GENERAL INFORMATION: APPLICANT: LI, ET AL.

(ii) TITLE OF INVENTION: Human G Protein Coupled Receptor (iii) NUMBER OF SEQUENCES: 8 (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI, STEWART OLSTEIN STREET: 6 BECKER FARM ROAD CITY: ROSELAND STATE: NEW JERSEY COUNTRY: USA S(F) ZIP: 07068 COMPUTER READABLE FORM: MEDIUM TYPE: 3.5 INCH DISKETTE COMPUTER: IBM PS/2 OPERATING SYSTEM: MS-DOS SOFTWARE: WORD PERFECT 5.1 (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: FILING DATE:

CLASSIFICATION:

(vii) PRIOR APPLICATION DATA: APPLICATION NUMBER: FILING DATE: (viii) ATTORNEY/AGENT INFORMATION: NAME: FERRARO, GREGORY D.

REGISTRATION NUMBER: 36,134 REFERENCE/DOCKET NUMBER: 325800-358 (ix) TELECOMMUNICATION

INFORMATION:

TELEPHONE: 201-994-1700 TELEFAX: 201-994-1744 INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS LENGTH: 2456 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: cDNA -44- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

S

*5

S.

S S

S

*5*S

GGAACCGCCC

TTCGGCACGA

CTAGAAACGT

TGCAGGGCGG

AAGAGAGGCC

TGGGAAGAGG

CCAGCTGTCC

GTACC1'GACT CTrCGATCTG

CCTACAACCA

CCCAG'zrCAC

ATAACCGAAG

GACTTGCGAAT

TCTATGTCAA

CAGACTTCTT

GGAGACTGAC

CATCTGTGGC

AGCTCCACAC

TGGCCATCGT

ATTGTTCCAA

ACT1'GTGAC

AGAGGACTAT

TGAGTCTTCT

GATGGTT

AATrTrCCT

GCGACAAAGA

CCACCGGCCC

CTGGAGTTCA

CCGTCCTCTC

GTGAGAGAGG

C'rGGACCCCA

ATCCCCATCC

TCTGGAGTGT

GCAAGTCAGA

TI'A=1

TGTGATGGAT

TAGGAAAACT

GCAGCATGCC

AACCTAGACT

ATAT1'AACTG

CCAAAGTGAT

CACCGTGGTG

GCAGACACAC

ATGCACC

CGCTGGGAGA

ACA=~CCGG

AGAGCGACAA

GGCGCTGGGG

TCTCAGGACT

ATCAGCAAAC

CAGAGCTGTC

GCGGCCGCCC

TTGCTTTGGT

CTrAGCAGCAA

AACTTTGCGC

GGT=~GCGG

CGTGAAAATG

TGGACGTCTG

GACACCTACA

AAGAAAATT

ATGGCTGCCA

AGCCATGAAT GAACCACAGT TGGAAAGC-AT CTrGCCACAG CACTGI-rrGT ATCTrCATCA :CGCCGCTrC CATT~rrCCTrA TGCTGGGTTG GCCrACTrCT TGTTAGCACA TGGCrCCTI'C CAACTTACTG GCrTTGCAA ACGGATGAGC AACCGGCGGG TATGGGTGCT ATACCCAGTG CATGGCACCC CTCTACAGTG CTTGTGGTA ATrGTGGTTC GAGAATGTCT CGGCATAGT GAAGACTGTG GTCATTGTGC GTTACTTCTA GACGTGTGCT TCTCCTTGCT GAAI-rCAACT AATGAGCGCC ACCTTTAGGC CACAGAAGGC TCAGACCGCT CAGCAATGAC CACTCTGTGG 7rGTAGGATA AACAGCCTCC AGAAAAGTCA ACTCATGTAC CAAGACT1'GA TATATATrGA TCTGAAAG TAGGAAGTITG PGAACTAGTG GATCCCCCGG GCTGCAGGAA TrACAGATCC AGTGAAGTGA AAAATCAGAA AGCCGCTCT GCGTT CG CAGCCTCCAG T" TCZAAA GTTTAGAA-AG TGAGCCACGA GCCCCGCGAT GTICCAGA GCTII-CGAG CCCCGTGCCG GGGCGTCCAC CGG-AGTCCTG ATTTATGAAG CTCCCCATCC ACCTATCTGA GCATCAGGTA CACAGCTTCT CCTAGCATGA GTCTCCCGTA GTTCTGGGGC GTGTTCACCA rTCTTACTTC CATCCCTGTA ATI-rCACAGC GCTTCTACAA CGAGTCCATT GCCTrCITTT AATGGAACAC AGTCAGCAAG CTGGTGATGG TGTTGGCCAA CCTArrGGTC ATGGTGGCAA =rATACCT AATGGCTAAT CTGGCTGCI'G ATCTCATGTI' CAACACAGGA CCCAATACTC GTCAGGGCCTCA'rGACACC AGCCTGACGG TCGAGAGGCA CATTACGGTZ' 7rCCGCATGC TAGTGGTGGT CATI'GTGGTC ATCTGGACTA TGGGCTGGAA CrGTATCTGT GATATTGAAA ACTCT1'AC7I' AGTCTTCTGG GCCATI=CA TCTATGCTCA CATCTFI'GGC TATGTTCGCC CTGGACCCCG GCGGAATCGG GATACCATGA TTrGGGGCCTT TATCATICTGC TGGACTCCTG GTCCACAGTG CGACGTGCTG GCCT1ATGAGA CTGCCATGAA CCCCATCAT TACTCCTACC AGATCCTrCTG CTGCCAGCGC AGTGAGAACC CGGCTTCCrC CCTCAACCAC ACCATC=GG ~AGAACGG AAACTGAGAT GAGGAACCAG CCCTACCCAA 11'GCCAGGGC AAGGTGGGGT 7rAAACACTA ACCA.ATGACA GTATG~rC AAATTAGCT ATGTGACAAC CCTCATC7I'G GAGCTCTTGC AATGGAATC AAGAACAGAC AGACIT1IAA AAGAT1'GTGT GTGGTTTGGT TCCACAACTT CA'ITTATATA CAGGCTI'CCC AATAAACACG TTTATGCCTA TCAGCATGT AACTACCATA ATTCCATIT TrCC ACA GGTrAGAAAG CATGCATOTA ATGTATGTAT GATACTAATG TAAATCTTC TAGGAAATAG GGTCATGAAG CAAACAATGC TCTAATCACA AAGTATAAAA.CAGGGAATGT AAGrATTA TAGAAGATGA CAGCAACTATA ATATTG 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2456

CCATI'TAGAC

ATAAATTCTG

T1'AAAGGATA

GAGACTATGG

GTAAGTTGGA

TTACTTAAAA

TCAAAGCCAG

=AATTAAA

ATGTATL'CCA

TACACTAACT

GCTAG7]GAA CG7T1CAC

ACTGCXTITA

ATTATCTIT1 AGArrAAAAG TATTTG=rIA

ATGTTGTAAC

AAAAAGGTCA

INFORMATION FOR SEQ ID NO:2: Wi SEQUENCE CHARACTERISTICS LENGTH: 364 AMINO ACIDS TYPE: AMINO ACID

STRANDEDNESS:

TOPOLOGY: LINEAR (ii) MOLECULE TYPE: PROTEIN (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Ala Ala Ile Ser Thr Ser Ile Pro Val Ile Phe Thr Ala Met Asn Giu Pro Gin Cys Phe Tyr 25 Ala Phe Phe Tyr Asn Arg Ser Gly Lys His Leu 40 Ser Gin Pro Asn Giu Ser Ala Thr Glu Gin Ile Trp Asn Thr Val Ser Ile Phe Ile Met Vai Asn Arg Arg 4 a a a.

a.

a a 0* a a a.

a Leu Met Trp Val1 Phe Val1 Ile Ser Ala Ala Arg Leu Ti-p Gin Giu Lys Ser Ser Ala Ala Phe Asn Leu Leu Ala Asn Arg Met Vai Ile Pro Ser Asn Met Ile Phe His Ile His Ser Leu Lys Thr Pro Cys Asp Phe Asn Glu Met Giu Asn Ser Leu Aia Thr Arg Leu Gin Val1 Val1 Aia As n Phe Ser Thr Giy Val1 Ser Ser Pro Asn Lys Leu Leu Ala Phe His Asp Phe Giy Pro 110 Gin Gly 125 Leu Ala 140 Leu His 155 Val Ile 170 Gly Ti-p 185 Pro Leu 200 Leu Val 215 Gly Tyr 230 Gly Pro 245 Val Val 260 Leu Val 275 Leu Ala 290 Ala Met 305 Ala Thr 320 Thr Gly 335 His Thr 350 Val.

As n Phe Phe As n Leu Ile Thi- Ti-p As n Tyr Thi- Val1 Arg Ile Leu Tyr As n Phe Pro Ile Met Gly Leu Gl 55 Leu Leu Val Met 70 Pro Ile Tyr Tyz 85 Ala Giy Leu Ala 100 Thr Arg Arg Lei .115 Ile Asp Thi- Ser .130 Ala Ile Glu Arg 145 Arg Met Ser Asn 160 Thr Met Ala Ile -175 Cys Ile Cys Asp 190 Ser Asp Ser Tyr 205 Phe Val Vai Met 220 Arg Gin Arg Thr 235 Arg Asn Arg Asp 250 Val Leu Gly Ala 265 Leu Leu-Leu Asp .280 Giu Lys Phe Phe 295 Pro Ile Ile Tyr 310 Arg Gin Ile Leu 325 Thi- Giu Gly Ser 340 Leu Ala Gly Val 355 Sle Val -Leu Tyr iThi- *Leu *His Arg Val Ile Leu Val Thi- Val Ala Ile Met Ala Phe Tyr Val Ser Thi- Ala Ile Thi- Arg Val Met Gly Giu Asn Val Phe Val Leu Cys Tyr Asn Leu 105 Thi- 120 Ser 135 Val.

150 Val.

165 Ala 180 Cys 195 Ti-p 210 Tyr

S.

a. a a Met Arg Thi- Met Phe Ile Val Cys Leu Leu Ser Tyr Cys Cys Asp Arg His Ser Met Ser 240 Met Ser 255 Ile Cys 270 Cys Pro 285 Leu Ala 300 Arg Asp 315 Gin Arg 330 Ser Ala 345 Asn Asp 360 His Ser Val Val 2) INFORMATION FOR SEQ ID NO:3: SEQUENCE

CHARACTERISTICS

LENGTH: BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS:

SINGLE

TOPOLOGY:

LINEAR

MOLECULE TYPE: Oligonucleotide -46- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS LENGTH: BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS LENGTH: 46 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID CAACCACAGG GATCCCATGG CTGCCATCTC TACTTCCATC CCTGTA 46 0-00 *s*e INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS :1 1. LENGTH: 46 BASE PAIRS 0.0 TYPE: NUCLEIC ACID *60..0 STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: ?ligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CCCCTCGAGC TAAACCACAG AGTGGTCATT GCTGTGAACT CCAGCC 46 INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS LENGTH: 40 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS:

SINGLE

TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: -47- -ACCACCT ACCTGGATCC ACAGAGCTGT CATGGCTGCC INFORMATION FOR SEQ ID NO:8: i) SEQUENCE CHARACTERISTICS LENGTH: 35 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR i) MOLECULE TYPE: Oligonucleotide xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: TCATCTCA GGTACCGTTC TAAACCACAG AGTGG -48-

Claims

1. An isolated antibody or fragment thereof that specifically binds to a protein selected from the group consisting of: a protein consisting of amino acid residues 1 to 364 of SEQ ID NO:2; a protein consisting of a portion of SEQ ID NO:2, wherein said portion comprises at least 30 contiguous amino acid residues of SEQ ID NO:2; and a protein consisting of a portion of SEQ ID NO:2, wherein said portion comprises at least 50 contiguous amino acid residues of SEQ ID NO:2; wherein said antibody is attached to a detectable reagent.

2. The antibody or fragment thereof of claim 1 that specifically binds protein

3. The antibody or fragment thereof of claim 1 that specifically binds protein

4. The antibody or fragment thereof of claim 1 that specifically binds protein *i

5. The antibody or fragment thereof of claim 1 wherein said detectable reagent is selected from the group consisting of: an enzyme; a fluorescent label; and a radioactive label.

6. The antibody or fragment thereof of claim 5 wherein said enzyme is horseradish peroxidase.

7. The antibody or fragment thereof of claim 1 which is a monoclonal *antibody.

8. The antibody or fragment thereof of claim 1 which is a polyclonal antibody.

9. The antibody or fragment thereof of claim 1 wherein said antibody or fragment thereof specifically binds a protein expressed on the surface of a cell comprising a polynucleotide that encodes amino acids 1 to 364 of SEQ ID NO:2 and is operably associated with a regulatory sequence that controls the expression of said polynucleotide.

An isolated antibody or fragment thereof that specifically binds to a protein selected from the group consisting of: a protein consisting of the polypeptide encoded by the cDNA contained in ATCC Deposit Number 97130; a protein consisting of a portion of the polypeptide encoded by the cDNA contained in ATCC Deposit Number 97130, wherein said portion comprises at least 30 contiguous amino acid residues of the polypeptide encoded by the cDNA contained in ATCC Deposit Number 97130; and a protein consisting of a portion of the polypeptide encoded by the cDNA contained in ATCC Deposit Number 97130, wherein said portion comprises at least 50 contiguous amino acid residues of the polypeptide encoded by the cDNA contained in ATCC Deposit Number 97130; wherein said antibody is attached to a detectable reagent.

11. The antibody or fragment thereof of claim 10 that specifically binds protein

12. The antibody or fragment thereof of claim 10 that specifically binds protein

13. The antibody or fragment thereof of claim 10 that specifically binds protein 30

14. The antibody or fragment thereof of claim 10 wherein said detectable reagent is selected from the group consisting of: reagent is selected from the group consisting of: *o -51 an enzyme; a fluorescent label; and a radioactive label.

The antibody or fragment thereof of claim 14 wherein said enzyme is horseradish peroxidase.

16. The antibody or fragment thereof of claim 10 which is a monoclonal antibody.

17. The antibody or fragment thereof of claim 10 which is a polyclonal antibody.

18. The antibody or fragment thereof of claim 10 wherein said antibody or fragment thereof specifically binds a protein expressed on the surface of a cell comprising a polynucleotide that encodes amino acids 1 to 364 of SEQ ID NO:2 and is operably associated with a regulatory sequence that controls the expression of said polynucleotide. Dated this SEVENTH day of MAY 2003. Human Genome Sciences. Inc. Applicant Wray Associates Perth, Western Australia Patent Attorneys for the Applicant o* S 0* 0 o° *oo o