AU7378194A - Tick antigen - Google Patents

Description

TICK ANTIGEN

TECHNICAL FIELD

This invention relates to protective antigens derived from parasitic ticks, insects and nematodes. The protective antigens can be used in a vaccine to vaccinate an individual against infestation by parasitic ticks, insects and nematodes. BACKGROUND ART

A number of recent experiments have reported possible success in the vaccination of animals against ticks using crude extracts of adult ticks. These antigenic preparations include gut material from adult Boophilus microplus (Opdebeeck et al., 1988b), midgut extract from adult Rhlpicephalus append±culatus (Jongejan et al. , 1989; Nyindo et al. , 1989), detergent solubilized adult tick tissue from Rhipicephalus appendiculat s (Dhadialla,1990) and midgut membrane antigens from adult Boophilus microplus (Jackson and Opdebeeck, 1989; Lee and Opdebeeck, 1991) . In addition, there have been reports of the vaccination of animals using tick larval material (Wong and Opdebeeck, 1990; Varma et al. , 1990; Opdebeeck et al, 1989). In one example guinea-pigs were vaccinated successfully against adult Rhipicephalus appendiculatus with homogenates of larvae from Rhipicephalus appendiculatus (Varma et al., 1990). In another example cattle were vaccinated against adult ticks using larval extracts from Boophilus microplus (Wong and Opdebeeck, 1990; Opdebeeck et al, 1989). However, in.all instances the fractions used were very complex and individual protective antigens were not identified. The practical exploitation of such preliminary vaccination information requires the identification of individual protective antigens which can then be made in much larger quantities (eg by genetic engineering) suitable for inclusion into a commercial vaccine. Immunoblots are often used to identify immunoreactive proteins in these crude antigen fractions (eg Lee and Opdebeeck, 1991). However, apart from providing quite complex patterns, it is unlikely that individual protective antigens can be identified directly from these immunoreactive antigens in an immunoblot unless a vaccination trial using a single antigen is performed.

The concept of vaccinating cattle against ticks using "concealed antigens" from ticks has been discussed (Willadsen and Kemp, 1988). "Concealed antigens" are ones that are not normally presented to the host immune system when the host is infested with ticks. They are different from antigens such as those in tick saliva which are normally exposed to the host immune system and which probably contribute to naturally acquired immunity

(Jongejan et al. , 1989). However, the latter form of immunity is not sufficient to prevent economically important losses to the cattle industry. Therefore, efforts to duplicate naturally acquired immunity, for example by vaccination with salivary antigens, are unlikely to be successful.

A recent patent application (PCT/AU87/00401) and associated publications have defined the purification of one protective- antigen, Bm86, (the antigen, Bm86, is identified as WGL+ in PCT/AU87/00401) from adult Boophilus microplus (Willadsen et al., 1989), the gene sequence of the antigen and the method for expressing relatively large quantities of this antigen artificially in bacteria (Rand et al., 1989). The work described in the description and background art sections of PCT/AU87/00401 is incorporated herein by way of reference.

Recent investigations by the present applicants isolated and characterised a further protective antigen, a tick carboxypeptidase (termed Bm91), from crude tick homogenates of B. microplus. Surprisingly, tick carboxypeptidase was found to have extensive sequence similarity, including stretches of sequence identity, with mammalian angiotensin converting enzyme (ACE) . It has now been determined that Bm91 is a carboxypeptidase (specifically a carboxydipeptidase) with many of the characteristics of the mammalian angiotensin converting enzymes. Most recently, the present applicants have isolated and characterised further protective antigens from crude insect and nematode homogenates which are homologous to tick carboxypeptidase. These protective antigens are also carboxypeptidases.

DESCRIPTION OF THE INVENTION Definitions

The term "adjuvant" as used throughout the specification refers to an agent or agents used to enhance the immune response of an immunised individual.

The term "parenteral" as used throughout the specification includes subcutaneous injections, intraperitoneal injections, intramuscular injections and infusion techniques. It is well known that populations worldwide are genetically diverse. Each individual of a population differs subtly from the others in the population and these differences are a consequence of differences in the sequence of the DNA which each individual inherits from its parents. Random mutational events are a further source of genetic variation. Thus for each gene encoding a particular protein, there are likely to be differences in the sequence among the population of individuals.

It is also well known that variation in amino acid and nucleotide sequences can and do occur between different allelic forms of a particular protein and the gene(s) encoding the protein. Thus for each gene encoding a particular protein, there are likely to be differences in the sequence among different species of individuals. Further, once the sequence of a particular gene or protein is known, it is possible, using available techniques, to manipulate and alter the sequence. These molecules are referred to herein as "homologues" .

For purposes of the present invention, "homology" between two sequences connotes a likeness short of identity indicative of a derivation of one sequence from the other. In particular, a protein is "homologous" to tick carboxypeptidase if a comparison of amino acid sequences between the protein and tick carboxypeptidase reveals an identity of at least 70% over 20 amino aqids. Homologous DNA will have at least 50% homology over 60 nucleotides to the DNA encoding tick carboxypeptidase. Such sequence comparisons can be performed via known algorithms, such as the one described by Lipman and Pearson (1985), which are readily implemented by computer. Homologues of tick carboxypeptidase can be produced by conventional site-directed mutagenesis, which is one avenue for routinely identifying residues of the molecule that can be modified without rendering the resulting polypeptide biologically inactive. Preferably, oligonucleotide-directed mutagenesis, comprising [i] synthesis of an oligonucleotide with a sequence that contains the desired nucleotide substitution (mutation) , [ii] hybridizing the oligonucleotide to a template comprising a structural sequence coding for an antigen of the invention and [iii] using T4 DNA polymerase to extend the oligonucleotide as a primer, is used because of its ready utility in determining the effects of particular changes to the antigen structural sequence.

The term homologue, as used throughout the specification in relation to proteins and DNA, refers to proteins and DNA which are related in sequence to the protective antigen, tick carboxypeptidase, or its encoding DNA. For the purposes of the present invention, a homologous protein will have at least 70% homology over 20 amino acids to the tick carboxypeptidase amino acid sequence, and homologous DNA will have at least 50% homology over 60 nucleotides to the DNA encoding tick carboxypeptidase.

Homologues of tick carboxypeptidase have now been identified in populations of ticks, insects and nematodes. In the context of the present invention, DNA from B. microplus encoding tick carboxypeptidase has been used to identify specific DNA sequences in other species of parasitic ticks, insects and nematodes. The conditions used for hybridisation indicate the approximate % homology of the DNA sequences hybridising to the tick carboxypeptidase DNA. Typically, the conditions are such that the DNA sequences hybridising to the tick carboxypeptidase DNA are at least 50% homologous in nucleotide sequence. The DNA hybridising to the tick carboxypeptidase DNA encodes antigens which are homologous in amino acid sequence to the protective antigen tick carboxypeptidase. The homologous antigens can be used in vaccines to protect individuals against infestation by of ticks, insects or nematodes.

The term "derived" as used throughout the specification in relation to the protective antigens of the present invention, encompasses antigens obtained by isolation and purification from a tick, insect or nematode life stage expressing the antigen, as well as antigens obtained by manipulation and expression of nucleotide sequences prepared from ticks, insects or nematodes, the nucleotide sequences including genomic DNA, mRNA, cDNA synthesized from mRNA and synthetic oligonucleotides having sequences corresponding to the nucleotide sequences. It also encompasses synthetic peptide antigens prepared on the basis of the known amino acid sequences of the protective antigens of the present invention.

It is known that it is possible to generate molecules which are not related to the protective antigens of the present invention by evolution or necessarily by structure but which may serve as immunogens to generate an immune response against epitopes of the protective antigens of , the present invention and thereby act as effective vaccines. These molecules are referred to herein as "analogues". Such analogues include chemically synthesized oligopeptide molecules with sequences corresponding to portions of the amino acid backbone of the antigens of the present invention and anti-idiotype antibodies raised against the variable region of antibodies which recognise epitope(s) of the protective antigens of the present invention.

The term expression product as used throughout the specification refers to recombinantly produced tick carboxypeptidase, homologues of tick carboxypeptidase, parts of tick carboxypeptidase or parts of homologues of tick carboxypeptidase.

The term individual as used throughout the specification refers to any organism capable of mounting an immune response to an immunogen. Description

The protective antigens characterised in the current work are derived from the tick, Boophilus microplus , and the buffalo fly, Haematobia irritans, but it is recognised that homologous antigens can be derived from the same or other species of parasitic ticks, insects and nematodes, or can be generated in vitro from the sequences disclosed herein.

The protective antigens of the present invention can be derived from: (i) species of parasitic ticks , such as,

Haemaphysalis spp, Otobius spp, Rhipicephalus spp, Amblyomma spp, Dermacentor spp, Ixodes spp and Hyalomma spp and Boophilus spp. Preferred tick species include B. microplus, B. annulatus , B. decoloratus, Otobius megnini , Rhipicephalus appendiculatus, Dermacentor andersoni , D. variabilis, Haemaphysalis longicorniε, Amblyomma variegatum, Ixodes holocycluε , I. dammini and I. ricinuε. (ii) species of nematodes , such as, Trichinella spp, Ancylostoma spp, Strongylus spp, Trichostrongylus spp, Haemonchus spp, Ostertagia spp, Ascaris spp, Toxascaris spp, Uncinaria spp, Trichuris spp, Dirofilaria spp, Toxocara spp, Necator spp, Enterobius spp, Strongyloides spp and Wuchereria spp. Preferred nematode species include Trichinella spiraliε, Ancylostoma caninu , Strongylus vulgaris,

Trichostrongylus colubriformis , Haemonchus contortus, Ostertagia ostertagi , Ascaris suum, Toxascaris leonina, Uncinaria stenocephala , Trichuris vulpis, Dirofilaria immitiε, Necator americanus, Ancylostoma duodenale, Ascaris lumbricoides, Trichuris trichiura, Enterobius vermicularuε, Strongyloides stercoralis and Wuchereria bancrofti .; or

(iii) species of insects , such as, Ctenocephalides spp, Haematobia spp, Hypoderma spp, Dermatobia spp, Anopheles spp, Lucilia spp, Chrysomya spp,

Gasterophilus spp, Culicoides spp, Stomoxys spp, Haematopinus spp, Linognathus spp, Solenoptes spp, Melophagus spp, Aedes spp, Culex spp, Phlebotomus spp. Glossina spp, Oestrus spp, Rhinoestrus spp and Cochliomia spp. Preferred insect species include Haematobia irritans irritanε, Haematobia irritanε exigua, Hypoderma bovis, Hypoderma linneatum, Dermatobia hominus, Lucilia cuprina, Lucilia serricata, Ctenocephalides felis, Ctenocephalides canis, Chrysomya bezziana, Gasterophilus intestinalis, Culicoides brevitarsus, Stomoxys calcitrans , Linognathuε ovilluε, Linognathus pedalis, Linognathus vituli , Solenoptes capillatus, Haematopinus suis, Haematopinus eurysternum, Haematopinuε tubercilatum, Haematopinus asini, Melophaguε ovinus, Aedes aegypti and Aedes albopictus .

The invention provides products and processes suitable for the protection of individuals against ticks, insects or nematodes. For example, animals such as cattle, horses, deer, goats, sheep, dogs, cats and pigs can be protected.

Accordingly in a first aspect the present invention consists in an antigenic preparation for use in raising antibodies in an organism, the antigenic preparation comprising a tick carboxypeptidase having substantially the amino acid sequence recited in Figure 6, or a homologue thereof or an active fragment thereof.

Tick carboxypeptidase isolated and' urified from crude tick homogenates (native tick carboxypeptidase) has an apparent Mr of approximately 86,000 daltons as determined by non-reducing SDS-PAGE and is glycosylated.

Preferably, the tick carboxypeptidase is substantially free of other tick proteins, peptides and carbohydrates.

Most preferably, the tick carboxypeptidase is at least 90% pure. That is, tick carboxypeptidase constitutes at least 90% of the total protein present in a given sample. This level of purity is demonstrated with respect to the cleanliness of the preparations used in amino acid sequencing.

Where the tick carboxypeptidase is produced recombinantly, however, it is not necessary to purify it to this level for use in the antigenic preparation of the present invention and therefore recombinant tick carboxypeptidase in impure form is also within the scope of the present invention. It may be desirable to use tick carboxypeptidase with at least one other tick antigen such as Bm86 (PCT/AU87/00401) , for enhanced immunizing efficacy. Such antigens may be individually purified and combined with tick carboxypeptidase or alternatively coexpressed in an appropriate host.

The invention encompasses tick carboxypeptidase in both glycosylated and non-glycosylated forms. The antigenic preparation, when used as a vaccine, provides protection to a vaccinated individual from infestation by at least one parasitic tick, insect or nematode species.

Protection is provided against tick species such as: Haemaphysalis spp, Otobius spp, Rhipicephalus spp,

Amblyomma spp, Dermacentor spp, Ixodes spp and Hyalomma spp and Boophilus spp. Preferably, protection is afforded against the tick species B. microplus , B. annulatus , B. decoloratuε , Otobius megnini , Rhipicephalus appendiculatus, Dermacentor andersoni , D. variabilis, Haemaphysaliε longicornis, Amblyomma variegatum, Ixodes holocyclus, I. dammini and J. ricinus; nematodes species such as: Trichinella spp, Ancylostoma spp, Strongylus spp, Trichostrongylus spp, Haemonchus spp, Ostertagia spp, Ascaris spp, Toxascaris spp, Uncinaria spp, Trichuris spp, Dirofilaria spp, Toxocara spp, Necator spp, Enterobius spp, Strongyloides spp and Wuchereria spp. Preferred nematode species include Trichinella εpiraliε, Ancyloεtoma caninum, Strongylus vulgariε, Trichoεtrongyluε colubriformiε , Haemonchuε contortu , Oεtertagia oεtertagi , Aεcariε suum, Toxascariε leonina , Uncinaria εtenocephala, Trichuriε vulpiε, Dirofilaria immitiε, Necator americanuε, Ancylostoma duodenale, Ascaris lumbricoides , Trichuris trichiura, Enterobius vermicularuε , Strongyloides stercoraliε and Wuchereria bancrofti . ; and insect species such as: Ctenocephalides spp, Haematobia spp, Hypoderma spp, Dermatobia spp. Anopheles spp, Lucilia spp, Chrysomya spp, Gasterophilus spp, Culicoides spp, Stomoxys spp, Haematopinus spp, Linognathus spp, Solenoptes spp, Melophagus spp, Aedes spp, Culex spp, Phlebotomus spp,

Glossina spp. Oestrus spp, Rhinoestrus spp and Cochliomia spp. Preferred insectaspecies include Haematobia irritanε irritanε, Haematobia irritanε exigua, Hypoderma boviε, Hypoderma linneatum, Dermatobia hominuε, Lucilia cuprina, Lucilia εerricata, Ctenocephalideε feliε, Ctenocephalideε caniε, Chrysomya bezziana, Gaεterophiluε inteεtinaliε , Culicoideε brevitarεus , Stomoxys calcitrans, Linognathus ovilluε, Linognathuε pedaliε, Linognathuε vituli , Solenopteε capillatuε, Haematopinuε suiε, Haematopinuε euryεternum, Haematopinuε tubercilatum, Haematopinus aεini , Melophaguε ovinuε, Aedeε aegypti and Aedeε albopictuε.

In particular, tick carboxypeptidase, when used in a vaccine to vaccinate cattle against tick infestation, induces an immune response in the vaccinated cattle that protects the cattle from tick infestation. The immune response kills ticks feeding on the vaccinated cattle or is manifest in reduced egg production by ticks feeding on the cattle and reduced viability of larvae hatching from those eggs. The immune response generated by vaccination with a vaccine containing tick carboxypeptidase not only protects cattle from infestation by B. micropluε,. but also protects against infestation by other tick species.

Homologues of tick carboxypeptidase may be derived from tick, insect and nematode species such as those species listed above.

Homologues of the antigen tick carboxypeptidase have at least 70% homology over 20 amino acids to the tick carboxypeptidase amino acid sequence.

Also, encompassed by the present invention are synthetic polypeptides that (i) correspond to a contiguous portion of the amino acid sequence of the antigens of the present invention and (ii) retain an immunological activity characteristic of the antigens of the present invention. Such synthetic polypeptides are at least 6 amino acids in length, and preferably are between 6 and 30 amino acids in length. Whether a synthetic polypeptide meeting criterion (i) also satisfies criterion (ii) can be routinely determined by assaying for protective activity, in an appropriate host. The active fragment is at least six amino acids in length and corresponds to a contiguous portion of the amino acid sequence of tick carboxypeptidase or a homologue of tick carboxypeptidase. The fragment is further characterised in that, when administered to an individual in a vaccine, it induces protective immunity in the vaccinated individual against infestation by at least one parasitic tick, insect or nematode species.

In a second aspect the present invention consists in an antigenic preparation for use in raising antibodies in an organism, the antigenic preparation comprising an antigen, wherein the antigen reacts with an antibody raised against a parasite carboxypeptidase, preferably a tick carboxypeptidase.

In a preferred embodiment of the present invention the tick carboxypeptidase has an amino acid sequence ^* substantially as shown in Figure 6.

In a third aspect the present invention consists in a polynucleotide molecule, the polynucleotide encoding the tick carboxypeptidase, homologue therof or active fragment thereof present in the antigenic preparation of the first aspect of the present invention.

Typically the polynucleotide molecule is a DNA molecule.

Preferably the polynucleotide molecule is a cDNA molecule.

Most preferably, the polynucleotide molecule is a cDNA molecule comprising a substantial part of the sequence illustrated in Figure 6.

The invention includes within its scope polynucleotide molecules (homologues) having at least 50% homology over 60 nucleotides with.-DNA encoding tick carboxypeptidase.

Preferably, a polynucleotide molecule encoding a homologue of tick carboxypeptidase comprises the nucleotide sequence illustrated in Figure 9.

According to a fourth aspect of the present invention there is provided a recombinant DNA molecule comprising a polynucleotide molecule of the third aspect and vector DNA. Typically the vector DNA comprises plasmid, phage or viral DNA.

Preferred vectors include lambda gtll, pUR290, pUR291, pUR282, pUK270, pUC8, pUC9, pZipNeo, lambda gtlO, an EMBL vector, pBR327, pBR329, pBR329 containing a par locus, baculovirus, vaccinia virus and SV40 based vectors.

According to a fifth aspect of the present invention there is provided a transformed host transformed with at least one recombinant DNA molecule according to the fourth aspect. Typically the host is selected from bacteria, yeasts, other fungi, insect, plant and mammalian cell lines.

Preferred host cells are E. coli K12 derivatives.

According to a sixth aspect of the present invention there is provided a synthetic polypeptide corresponding to all or part of tick carboxypeptidase or a homologue of tick carboxypeptidase which synthetic polypeptide, when administered to an individual in a vaccine, induces protective immunity in the vaccinated individual against infestation by at least one parasitic tick, insect or nematode species.

According to a seventh aspect of the present invention, there is provided a vaccine comprising an effective amount of tick carboxypeptidase, homologue thereof, active fragment thereof, or synthetic polypeptide of the sixth aspect, together with at least one pharmaceutically or veterinarally acceptable carrier, diluent, excipient or adjuvant.

The transformed host of the fifth aspect may be used in a whole cell vaccine comprising the transformed hosts together with a pharmaceutically and/or veterinarally acceptable carrier, diluent, excipient or adjuvant. The cells may be live or killed. The transformed hosts include those capable of expressing an expression product of the seventh aspect for mucosal presentation to an individual to be vaccinated, such as a cell surface fusion product.

According to an eighth aspect of the present invention there is provided a process for the preparation of tick carboxypeptidase, which process-comprises: homogenising young adult ticks to produce a homogenate; centrifuging the homogenate to obtain a membrane pellet; extracting the membrane pellet with detergent, such as with NP40 to provide a pellet extract; chromatographing the pellet extract on a size exclusion column such as a Sephacryl S 300 column to produce a high molecular weight fraction; extraction of that material with a detergent such as Zwittergent 3-14 to provide a detergent extract; fractionation of the detergent extract by preparative isoelectric focussing and collecting material with a pi of between 4.8 and 5.7; fractionation of the material by HPLC gel filtration and collecting material eluting with similar elution times to ferritin and bovine serum albumin under the conditions described; fractionation of the extracts on a lectin affinity column, such as a lentil lectin or wheat germ lectin affinity column, to extract lectin binding glycoproteins; and optionally, further purifying the antigens of interest by applying the eluted antigens to HPLC gel filtration columns in a detergent such as CHAPS or SDS to obtain size fractionated antigens. According to a ninth aspect of the present invention, there is provided a process for the preparation of a vaccine of the seventh aspect which process comprises: admixing an effective amount of tick carboxypeptidase, homologue thereof, active fragment thereof, synthetic polypeptide of the sixth aspect, or transformed host of the fifth aspect with at least one pharmaceutically or veterinarally acceptable carrier, diluent, excipient or adjuvant.

According to a tenth aspect of the present invention, there is provided a method of protecting an individual against infestation by at least one parasitic tick, insect or nematode species which method comprises administering an effective amount of the vaccine of the seventh aspect to the individual.

According to an eleventh aspect of. the present invention, there is provided an antibody raised against tick carboxypeptidase, homologue thereof, or an active fragment thereof.

The antibodies of the invention may be monoclonal or polyclonal. The invention also provides other compounds which behave in a similar manner to the antibodies of the eleventh aspect.

According to a twelfth aspect of the present invention, there is provided an antibody composition comprising admixing at least one antibody of the eleventh aspect together with at least one pharmaceutically or veterinarally acceptable carrier, diluent or excipient. According to a thirteenth aspect of the present invention, there is provided a process for the preparation of an antibody of the eleventh aspect which process comprises vaccinating an immunoresponsive individual with tick carboxypeptidase, homologue thereof, or an active fragment thereof.

According to a fourteenth aspect of the present invention, there is provided a process for the preparation of an antibody composition of the twelfth aspect which process comprises admixing an effective amount of at least one antibody of the eleventh aspect with at least one pharmaceutically or veterinarally acceptable carrier, diluent, or excipient. According to a fifteenth aspect of the present invention, there is provided a method of passively vaccinating an individual in need of such treatment against a parasitic tick, insect or nematode species, which method comprises administering an effective amount at least one of an antibody of the eleventh aspect or an antibody composition of the twelfth aspect to the individual.

According to an sixteenth aspect of the present invention there is provided a process for the preparation of a recombinant DNA molecule of the fourth aspect which process comprises inserting at least one polynucleotide molecule of the third aspect into vector DNA.

According to a seventeenth aspect of the present invention there is provided a process for the preparation of a transformed host of the fifth aspect which process comprises making a host competent for transformation and transforming the competent host with at least one recombinant DNA molecule of the fourth aspect.

According to an eighteenth aspect of the present invention, there is provided a process for the biosynthesis of a tick carboxypeptidase, homologue thereof, or an active fragment thereof which comprises providing a transformed host of the fifth aspect, culturing the host under suitable conditions to obtain expression of the tick carboxypeptidase, homologue thereof, or active fragment thereof, and collecting the tick carboxypeptidase, homologue thereof, or active fragment thereof from the transformed host.

According to a nineteenth aspect of the present invention there is provided an antiidiotype antibody corresponding to a portion of tick carboxypeptidase. homologue thereof, or active fragment thereof. The antidiotype antibody, when used in a vaccine, is capable of protecting a vaccinated individual from infestation by at least one parasitic tick, insect or nematode species. The amount of antigen, homologue, part, expression product, synthetic polypeptide or analogue to be combined with carrier, diluent, excipient or adjuvant to produce a single vaccine dosage form will vary depending upon the infestation being vaccinated against, the individual to be treated and the particular mode of administration.

It is also understood that the specific dose level for any particular individual will depend upon a variety of factors including the protective activity of the specific antigen, homologue, part, expression product, synthetic polypeptide or analogue employed, the age, body weight, general health, sex, diet of the individual, time of administration, route of administration, rate of excretion, drug combination and the particular infestation state being prevented, as well as stresses to the individual such as nutritional status, heat, pregnancy status and concurrent infections or infestations. The vaccines of the present invention may be administered parenterally or potentially via mucosal routes in dosage unit formulations containing at least one conventional, non-toxic, pharmaceutically or veterinarally acceptable carrier, diluent, adjuvant or excipient as desired.

Injectable preparations, for example, sterile injectable aqueous or oleagenous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, such as for example, in solution with 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water. Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectable preparations.

At present alum is the only registered adjuvant for human use, however, experimental work is being conducted on other adjuvants for human use and it is anticipated that these other adjuvants would be suitable for use in preparing compositions for human vaccination in accordance with this invention. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic representation of the partial purification of GF5,6 from Boophilus microplus which is enriched in tick carboxypeptidase and the further fractionation of glycoproteins leading to purification of tick carboxypeptidase. Figures 2a, 2b and 2c are schematic representations of alternate approaches which could be adopted for the purification of fractions which are enriched in tick carboxypeptidase from GF4, and GF 5,6 from Boophilus microplus for vaccination trials. Figure 2a shows a variation of the approach represented in Figure 1 for partially purifying fractions containing tick carboxypeptidase. Figure 2b shows an approach for further purifying fractions containing tick carboxypeptidase from GF5,6 for vaccination. Figure 2c shows an approach for further purifying fractions containing tick carboxypeptidase from GF4 for vaccination.

Figure 3 shows an approach for purifying tick carboxypeptidase for peptide sequencing and for vaccination with highly purified antigen. Figure 4 shows the DNA sequence of PCR fragment generated following amplification with two PCR probes designed from the amino acid sequence of peptide T9118. Bm0= DNA sequence from insert in pBTAHOO flanked by the EcoRl and BamHl cloning sites. Overlined sequences are the primers used in the PCR. BmA= translation of the DNA sequence BmO. T9118= tick carboxypeptidase peptide sequence from Table 11.

Figure 5 shows a schematic diagram representing the relative orientation of the PCR fragments generated from cDNA with a variety of PCR probes designed from the peptide sequences from the tick carboxypeptidase antigen. B= BamHl site; E= EcoRl site; H= Hindlll site. Thick lines indicate region of each cloned fragment sequenced.

Figure 6 shows the partial DNA sequence of the PCR fragments shown in Figure 5. Positions of the PCR primers are indicated by single underlining.

Figure 7 is a representation of a Southern Autoradiogram. Markers are lambda Hindlll. Bm= B. microplus DNA. Cf= C. felis DNA. Dm= D. melanogaεter DNA. Hc= H. contortuε DNA. Hi= H. irritanε DNA. Lc= L. cuprinaONA. Oc= O. circumcincta DNA. Tc= T. colubriformiε DNA. Probe used = tick carboxypeptidase cDNA. Washing conditions were 0.5xSSC/0.1%SDS at 50-550C for 10 min. Exposure was for 4 days at -7θOc with intensifying screen. Figure 8 is a representation of a Northern

Autoradiogram. 1 = B. micropluε DNA. 2 = H. irritanε DNA. 3 = H. contortuε DNA. 4 = BRL RNA size markers. Probe used = tick carboxypeptidase cDNA. Washing conditions were 0.5xSSC/0.1%SDS at room temperature. Exposure overnight. Figure 9 is a comparison of H. irritanε (buffalo fly) and B. micropluε (cattle tick) tick carboxypeptidase sequences. Hil: buffalo fly cDNA sequence from PCR clone pBTA1104. Hi2: buffalo fly predicted amino acid sequence. Bm2: tick predicted amino acid sequence (from Fig. 6). Amino acids that are identical between Hi2 & Bm2 are underlined. Overlined bases at either end of the Hil sequence are from the primers_^used in the PCR to generate the fragment.

Figure 10 shows the construction of recombinant plasmid pBTAl077 for the expression of tick carboxypeptidase amino acid residues 229-621 in E. coli expression vector pBTA954.

Figure 11 shows the construction of recombinant plasmid pBTA1078 for the expression of tick carboxypeptidase amino acid residues 59-621 in E. coli expression vector pTrcHisA.

Figure 12a shows the assembly of a hybrid tick carboxypeptidase gene for expression in E. coli .

Figure 12b shows the ligation of tick carboxypeptidase coding sequence into E. coli expression vector.

Figure 12c shows the linker sequence with Sall- Hindlll compatible ends inserted into pPLc245 (Sall- Hindlll sites) to create pBTA724.

Figure 13a shows the assembly of a hybrid tick carboxypeptidase gene for expression in baculovirus infected insect cells.

Figure 13b shows the tick carboxypeptidase coding sequence minus anchor expression in the baculovirus system. Figure 14: A schematic outline of the purification of Hie70 from whole fly extracts. Carboxydipeptidase activity was monitored using the HGG assay of Ryan et al . 1977.

Figure 15: SDS-PAGE analysis of purified Hie70 and the tick carboxydipeptidase, tick carboxypeptidase.

Tracks (a-f) are from silver stained gels of 150ng Hie70, non-reduced (a), reduced (b); 150ng Hie70 incubated at 37°C without N-glycanase (c) and with 0.2 units N- glycanase (d); 600ng tick carboxypeptidase incubated at 37°C without N-glycanase (e) and with 0.2 units of N- glycanase (f). A Western blot of 1.5μg tick carboxypeptidase (g), 0.005 units (approx. 2μg) rabbit lung ACE (h) and 200ng Hie70 (i) was probed with the ovine antiserum to Hie70.

Figure 16: N-terminal amino acid sequences of Hie70 and sequences of two peptides (Hie#6 and Hie#8) derived from an endo-Lys-C digest of purified Hie70. The sequence peptide Hie#6 is compared to similar sequences in the testicular ACE of rabbit (Kumar et al . 1989), mouse (Howard et al. 1988), human (Lattion et al . 1988) and tick carboxypeptidase. The bracketed numbers indicate the position of the first residue in the protein.

Figure 17: Design of PCR primers used to amplify fragments of DNA from Hie70 cDNA or Hie70 111 clones. A map of the estimated sites of the PCR primers on the putative Hie70 cDNA is also presented.

Figure 18: Agarose gel electrophoresis of fragments of DNA generated from PCR reactions 1, 2 and 3 performed on adult buffalo fly cDNA.

Figure 19: (A) DNA sequence and protein translation of the PCR 1 fragment. (B) Alignment of the putative fragment 1 polypeptide with ACE testicular proteins and tick carboxypeptidase. The bracketed numbers indicate the position of the first residue in the protein.

Figure 20: Agarose gel electrophoresis of fragments of DNA generated from PCRs 1, 2 and 3 performed on the 3 lgtll clones (2, H3 and H5).

Figure 21: DNA sequence and protein translation of the PCR 2 fragment.

Figure 22: Alignment of the PCR 2 predicted polypeptide with ACE testicular proteins and tick carboxypeptidase. The bracketed numbers indicate the position of the first residue in the protein.

Figure 23: Antibody titres of the Hie70 vaccinates measured at week 0, week 5 and week 13 of the vaccination trial. Figure 24: Is a titre-effect correlation and shows the effect of tick carboxypeptidase on the effect of the Bm86 vaccine. The x-axis shows the anti-Bm86 titre (logio) and the y-axis shows the daily weight of eggs (g) . The circles represent the results obtained from vaccination with Bm86 alone and the upper line is the regression line calculated from these results. The squares represent the results obtained from vaccination with Bm86 and the tick carboxypeptidase (Bm91) and the lower line is the regression line calculated from these results. STATEMENT OF DEPOSIT

BTA 2321 which contains plasmid pBTA 1093 and BTA 2246 which contains plasmid pBTA 1029 have been deposited under the provisions of the Budapest Treaty with Australian Government Analytical Laboratories, PO Box 385, Pymble 2073, New South Wales, Australia on 9 August 1994 and have been accorded accession Nos N94/36065 and N94/36066, respectively. Samples of these deposits may be obtained from this depository in accordance with the rules of the Budapest Treaty.

In order that the nature of the present invention may be more clearly understood preferred forms thereof will now be described with reference to the following examples. It has now been demonstrated repeatedly that it is possible to vaccinate cattle against the tick Boophiluε micropluε using extract of semi-engorged adult female ticks (Johnston et al., 1986; Kemp et al., 1986; Opdebeeck et al.,1988 a,b.). Such observations are of little practical relevance to the development of a commercial vaccine against the tick, since this requires the identification and detailed characterisation of individual protective antigens as a prelude to their industrial-scale production using, for example, recombinant DNA technology. Partial purification of a protective antigenic fraction has been described in Australian Patent 598445 and in the scientific literature (Willadsen et al. , 1988). From this fraction, a single protective antigen was isolated, the Bm86 antigen, whose detailed characterisation has been the subject of International Patent PCT/AU87/00401 and further scientific publications (Willadsen et al., 1989; Rand et al., 1989).

Production of an effective vaccine against ticks is likely to require the presence of more than one protective antigen in the vaccine formulation. Moreover, it is a requirement of a multi-antigen vaccine that the components act immunologically in an additive or synergistic manner to produce an enhanced effect.

The following experiments present evidence that:

1. The most highly purified antigenic fraction described by Australian Patent 598445 and Willadsen et al. (1988), contains protective antigenic material in addition to the Bm86 antigen.

2. A protein can be isolated from this antigenic fraction, used to vaccinate cattle and be shown to induce a protective immunological response against subsequent tick infestation. This protective immunological response occurs in the absence of detectible Bm86 and without producing a detectible antibody response to Bm86.

3. The protective immunological response induced by this newly identified antigen will also enhance the effects of the immunological response induced by Bm86.

4. The protein identified in 2 above is a carboxypeptidase and also induces a protective immunological response against insect or nematode infestation.

TRADE NAMES SUPPLIER

Zwittergent 3-14 Calbiochem. As an alternative to

Zwittergent 3-14, N-tetradecyl-N,N dimethyl 3-ammonio-l-propanesulfonate from Boehringer was used in some experiments. IEF-Sephadex Pharmacia Triton X-114 Sigma DEAE-Sepharose Pharmacia Mono Q Sepharose Pharmacia Tris Sigma Sepharose 4B Pharmacia CNBr-activated Sepharose Pharmacia Centricon Amicon

TSK G400SW Waters TSK G300SW Waters Aquapore RP-300 C-8 Brownlee Aquapore AX-300 Brownlee Rota vac Savant

Tween 20 Sigma

Methyl -D-mannopyranoside Sigma N-acetyl glucosamine Sigma SDS BioRad

Peroxidase labelled goat Kirkegaard and Perry, anti-bovine IgG (H+L) Gaithesburg, Maryland Biotinylated donkey anti-rabbit IgG Amersham International U.K.

Peroxidase coupled Streptavidin Amersham International U.K.

ABBREVIATIONS HEPES N-2-Hydroxyethylpiperazine -Nl-2- ethane-sulfonic acid

DEAE+ Material binding to DEAE (dimethylaminoethyl) ion exchange columns under specified conditions of pH and salt concentration

EDTA Ethylenediamine tetraacetic acid ELISA Enzyme-linked immunosorbent assay KELA Kinetic-linked immunosorbent assay Bm86 A previously identified gut- associated antigen from ticks (Rand et al. , 1989) Tick carboxypeptidase The antigen of the present invention

GF Gel Filtration BTA A prefix for an in-house numbering system for recombinant organisms from Biotech Australia pBTA A prefix for an in-house numbering system for plasmids from Biotech Australia

S.d. Standard deviation bp Base pairs of DNA p.f.u. Plaque forming units

HPLC High performance liquid chromatography

IEF Isoelectric focussing LL+ Proteins which bind to a lentil lectin affinity column

LL- Proteins which do not bind to a lentil lectin affinity column

PBS Phosphate-buffered saline PCR Polymerase chain reaction PMS Phenylmethylsulfonyl fluoride SB 3-14 Zwittergent 3-14 or the equivalent from Boehringer

SDS Sodium dodecylsulfate SDS-PAGE Sodium dodecylsulfate- polyacrylamide gel electrophoresis

Tris Tris(hydroxy ethyl)aminomethane WGL+ Proteins which bind to a wheat germ lectin affinity column

WGL- Proteins which do not bind to a wheat germ lectin affinity column

DTT Dithiothreitol TE lOmM Tris-HCl, ImM EDTA; pH7.6 The recombinant DNA molecules and transformed host cells of the invention are prepared using standard techniques of molecular biology.

Expression products of the invention are obtained by culturing transformed host cells of the invention under standard conditions as appropriate to the particular host cell and separating the expression product from the culture by standard techniques. The expression product may be used in impure form or may be purified by standard techniques as appropriate to the expression product being produced.

Where appropriate, whole cells may be used in vaccines.

Synthetic polypeptides of the invention are prepared by standard techniques of peptide synthesis based on the known sequences of antigens, homologues and expression products of the invention.

The homologues, expression products, parts, analogues and synthetic polypeptides can be tested for protective activity as described in the following examples.

Recombinant DNA technology can be used to provide a large amount of the protective antigen, homologues or parts described herein. The DNA segment coding for the protective antigen, homologue or part can be inserted into any of a number of recombinant plasmid systems to enable the molecule to be synthesised in large amounts. The recombinant systems include E. coli , yeast, baculovirus systems and viruses such as vaccinia. The recombinant organisms can be grown in large volumes in fermenters and the recombinant antigens purified by standard methods - solubilisation in solutions containing urea and reducing agents such as DTT (dithiothreitol) or β-mercaptoethanol, refolding in the presence of reagents such as reduced and oxidised glutathione, purification by ion exchange, filtration and/or gel permeation chromatography. terminally sterilised by filtration and adjuvanted in any of a number of adjuvants including oils.

The vaccine is prepared by mixing, preferably homogeneously mixing, at least one antigen, homologue, part, expression product, synthetic polypeptide, transformed host, antiidiotype antibody or analogue of the invention with at least one pharmaceutically or veterinarally acceptable carrier, diluent, excipient or adjuvant using standard methods of pharmaceutical or veterinary preparation.

The vaccine may be administered parenterally in unit dosage formulations containing at least one conventional, non-toxic, pharmaceutically or veterinarally acceptable carrier, diluent, excipient or adjuvant as desired. Antiidiotype antibodies are raised by vaccinating a suitable individual with at least one antigen, expression product, part, homologue, synthetic polypeptide or analogue of the present invention and using the resulting antibodies as immunogens to raise antibodies against the antigen binding region of the antibodies raised in the first vaccination.

Antibodies of the present invention are raised using standard vaccination regimes in an appropriate individual. The individual is vaccinated with at least one antigen, homologue, part, expression product, synthetic polypeptide, vaccine or analogue of the present invention. An immune response is generated as a result of vaccination. The immune response may be monitored, for example, by measurement of the levels of antibodies produced.

The antibody composition is prepared by mixing, preferably homogeneously mixing, at least one antibody with at least one pharmaceutically or veterinarally acceptable carrier, diluent, or excipient using standard methods of pharmaceutical or veterinary preparation. The amount of antibody required to produce a single dosage form will vary depending upon the tick, insect or nematode species being vaccinated against, individual to be treated and the particular mode of administration. The specific dose level for any particular individual will depend upon a variety of factors including the age, body weight, general health, sex, and diet of the individual, time of administration, route of administration, rate of excretion, drug combination and the severity of the infestation undergoing treatment.

The antibody composition may be administered parenterally, in unit dosage formulations containing at least one conventional, non-toxic, pharmaceutically or veterinarally acceptable carrier, diluent, or excipient as desired, to passively protect individuals against tick, insect or nematode infestation.

Diagnostic kits are prepared by formulating expression product, antibody, antigen, homologue, part, analogue or synthetic polypeptide at appropriate concentrations to the substance(s) to be detected with at least one pharmaceutically or veterinarally acceptable carrier,diluent or excipient. A positive control standard of a known concentration of the substance to be detected is prepared similarly. The negative standard comprises at least one carrier, diluent or excipient alone. GENERAL EXPERIMENTAL PROCEDURES

Most purification procedures were carried out at 4θc. Sodium dodecylsulfate-polyacrylamide gradient gel electrophoresis (SDS-PAGE) with silver staining of proteins was routinely performed at each step in the purification scheme (Willadsen et al., 1988; Willadsen et al., 1989). In addition, at each step in the purification scheme there was a vaccination trial carried out in cattle to identify protein fractions which protected vaccinated cattle from tick infestation as described below. PREPARATION OF TICKS AND TICK MEMBRANE MATERIAL Adult and larval ticks used for the...preparation of antigen and in the cattle challenge experiments respectively were cultured from the Yeerongpilly strain of Boophiluε micropluε . The homogenization of adult female ticks and the preparation of crude membrane material was as described previously (Willadsen et al.., 1988). Membrane material was stored frozen until required. ANTISERA

Sera were obtained from cattle before vaccination and immediately before tick infestation. The cattle were 12 to 18 month old female Hereford ( Boε tauruε) animals raised in a tick free area of New South Wales. Rabbit antisera to both native and recombinant Bm86 were raised with an initial injection in Freund's Complete adjuvant, followed by booster injections in Freund's Incomplete adjuvant. PROTEIN DETERMINATION

Protein concentrations were determined by one of the following methods as appropriate, considering the amount of protein available and the presence of substances potentially interfering with particular methods of determination:

1. Biuret method, according to Thome (1978)

2. Pierce BCA protein determination according to the manufacturer's instructions.

3. By measuring the absorbance at 280 and 260 nm, and calculating concentrations according to Layne (1957)

4. Using the BioRad dye binding assay, according to the manu acturer's instructions. 5. By reaction with o-phthaldehyde and measurement of total fluorescence of high molecular weight material on HPLC gel filtration (Willadsen et al., 1988; Viets et al., 1978; Goodno et al. , 1981). 6. From the absorbance of a purified protein at 280nm, assuming a solution of 1 mg/ml had an absorbance of 1.0 in a cell with a 1 cm path length. ELISA AND WESTERN BLOTTING PROTOCOLS

Antibody concentrations were estimated using a direct, non-competitive ELISA. Antigens were diluted in carbonate/bicarbonate buffer pH 9.6 to a final concentration of 1 μg/ml. Aliquots of 200 μl were added to each well of a microtitre plate. Following overnight incubation at 4°C, plates were washed with PBS containing 0.05% (w/v) Tween 20 and blocked with gelatin. The same buffer was used for subsequent coupling and washing steps. Primary antibody was diluted in PBS-Tween 20 and allowed to react for 1 h at 37°C. For the assays with bovine sera, this was followed by incubation with a 1:500 dilution of 0.5 mg/ml peroxidase labelled goat anti-bovine IgG (H+L) . For assays of rabbit antisera, reaction with the primary antiserum was followed by a 45 min reaction with a 1:1200 dilution of biotinylated donkey anti-rabbit IgG, then 45 min with 1:1200 peroxidase coupled streptavidin.

Peroxidase activity was measured with 1 mg/ml 5- aminosalicylic acid and 1.7 mM hydrogen peroxide in 20 mM phosphate buffer pH 6.7. Absorbance values were measured using a Titertek Multiscan Plus Mk II ELISA reader interfaced with an IBM compatible personal computer. Data were processed using the Kinetic Linked Immunosorbent Assay (KELA) to yield a kinetic estimate of the peroxidase activity.

ELISA reactions were analyzed from serial dilutions of antisera. The reciprocal of the serum dilution giving a KELA rate of 0.05 Abs / min, obtained by regression analysis, was used as a measure of relative antibody concentration. In the measurement of the antibody titre against recombinant Bm86, a pool of reference antisera prepared against the antigen purified from recombinant E. coli was routinely used in each assay. The titre of this pool was given the value of 50,000 which is approximately equivalent to a KELA rate of 0.05 Abs/min in the standard assay. Other titres are relative to this value.

Western blots were obtained from antigen preparations separated by SDS-PAGE on 4% to 18% gradient gels and transferred to nitrocellulose in an LKB Multiphor II

Novablot semi-dry system according to the manufacturer's instructions, using a transfer buffer containing 0.025 M ethanolamine, 0.04 M glycine and 20% (v/v) methanol. After blocking in 2% gelatin in Tris buffered saline, the blots were developed using either bovine or rabbit sera essentially as described for the ELISAs. Peroxidase label was detected with a solution of 4 mg luminol, 10 mg iodophenol and 50 μl of 30% hydrogen peroxide in 100 ml Tris buffered saline using Kodak X-Omat film. ANTIBODY TO Bm86 AND AFFINITY ABSORPTION

Antisera raised in cattle to recombinant Bm86 antigen expressed in bacteria (see PCT/AU87/00401) were used as a source of antibody. This antiserum was affinity purified on a column containing a near native form of the Bm86 antigen as follows. Spodoptera frugiperda cells were infected with recombinant baculovirus expressing the Bm86 molecule without the C-terminal hydrophobic region. The antigen was expressed as a soluble molecule secreted into the culture supernatant. The antigen was coupled to Sepharose CL-6B beads (Pharmacia) at approximately 0.5 mg total protein per mg of gel following activativation with carboxyl-diimidazole in dioxan (0.4 g per ml of gel). Coupling was carried out in 0.5M Na2C03, 0.5M NaCl pH9.5 at OOC over two nights. After incubation, the gel was washed alternatively in 0.1M NaHCθ3 , 0.1M NaCl pH 8.0 and 0.1M CH3.COONa.3H2O, 0.1M glycine HC1 pH 4.5 and finally washed with ice-cold 0.1M glycine HCl pH 2.5. The gel was then neutralised and stored in 0.01M Tris, 0.15M NaCl pH 8.0. The antibodies against the bacterial antigen were bound to the antigen column in Tris-saline buffer pH 8.0 and specifically eluted with 0.1 M glycine-HCl buffer pH 2.5. Following elution, the eluant was adjusted to pH 8.0 using 2 M Tris.

Antibody purified in this way was concentrated on a YM30 filter and then dialysed into water. Precipitating fats etc were removed by centrifugation. The dialysed antibody solution was then made adjusted to 0.1 M NaHC03,

0.5 M NaCl pH 8.3 and incubated overnight at 4°C with CNBr-activated Sepharose. Unreacted groups were blocked with 1.0 M ethanolamine pH 8.0 overnight at 4°C. The

Sepharose beads were then washed with 0.1 M NaHCθ3, 0.5 M

NaCl pH 8.3 buffer followed by 0.1 M sodium acetate buffer and stored in Tris-saline buffer pH 8.0 containing 0.001% sodium azide as a preservative. The columns were washed with ice-cold 0.1 M glycine-HCl buffer pH 2.5 immediately prior to use to remove any weakly bound antibody. EXAMPLE 1 Demonstration that antigenic material described in Australian Patent 598445 and Willadsen et al., (1988) contained antigens other than Bm86. The most highly purified antigenic fractions described in the above publication were purified by a succession of steps, ending with gel filtration chromatography using an HPLC system. The most protective material was contained in fractions designated GF4, GF5 and GF6. Table 1 shows the effect of vaccination with these fractions on the average number of ticks maturing per day on vaccinated cattle subjected to a standard tick challenge. Also shown are the results of vaccination with purified, native Bm86 and the ELISA titres of antibodies, measured against recombinant Bm86 as test antigen (Willadsen and McKenna, 1991).

Several of the animals listed in Table 1 were able to strikingly reduce the number of ticks engorging on them in the absence of high antibody titres to Bm86. This is most obvious with animal 904 in the group GF4. Animals 915, 908 and 919 in groups GF5 and GF6 respectively possess significant, though not particularly high, titres, yet nevertheless suppress the number of ticks engorging by 88% to 97%. The results of experiment 2 in Table 1, in which cattle were vaccinated with purified, native Bm86, show that the effects on tick numbers were not as great, despite higher anti-Bm86 titres.

Though inconclusive, the results in Table 1 suggest that the fractions designated GF4, GF5 and GF6 may contain effective antigenic material in addition to Bm86. EXAMPLE 2 Demonstration of protective antigenic material other than Bm86 in fractions GF5 and GF6 combined.

The preparation of GF5 and GF6 was essentially as described previously (Willadsen et al., 1988). Briefly it is described below. Semi-engorged adult female Boophilus micropluε were extracted and crude membrane and particulate fractions sedimenting at 20,000g and 100,000g were prepared (Willadsen et al., 1988). These fractions were stored frozen until required. The combined membrane fractions from 508g of ticks were thawed in a buffer containing 0.05 M Tris, 0.025M acetic acid, 0.1M sodium chloride pH 8.0 and the protein concentration adjusted to 25mg/ml by dilution with buffer and Nonidet P-40. The final concentration of Nonidet P-40 was 50mg/ml. The suspension was stirred for 90 mins at 330 - 37θc and then centifuged for 20 minutes at 2000g.

Supernatant material from this extraction was then chromatographed on a column of Sephacryl S-300 equilibrated in a buffer containing 0.05M Tris, 0.1M sodium chloride, 0.1% Nonidet P-40 adjusted to pH7.7 with hydrocholoric acid. Measurement of the absorbance of eluted material at 280nm showed two broad peaks of ultraviolet absorbing material, consistently separated by a minimum in absorbance. The earlier-eluting peak of material was pooled. For the preparation being described, this extended from the void volume of the column (Vo) to I.6V0. The pooled material > as brought to 45% saturation with ammonium sulphate, centrifuged, the preciptate resuspended and dialysed against 0.025M Tris, 0.0125M acetic acid at 4θC. The protein concentration after dialysis was 14 mg/ml. The material was extracted in 2% Zwittergent 3-14 at 35°C for 1 hour, centrifuged at 2000g for 30 minutes at 4θc and the supernatant collected.

The solubilised material was subjected to preparative isoelectric focussing in IEF Sephadex using Pharmalyte 3- 10 according to the manufacturer's instructions.

Focussing was at 4θc. pH values of fractions after completion of the separation were measured with fractions held on an ice/water bath. Material focussing between pH's of 4.9 and 7.0 was eluted, pooled .and concentrated in a Centriprep 30 membrane concentrator. The product was then further fractionated by narrow range isoelectric focussing at 100c in 1% 3-14, using Pharmalyte in the pi range 4 - 8 according to the manufacturer's instructions. Material focussing between pH values of 4.8 to 5.7 was eluted, pooled, brought to a neutral pH and concentrated with a Centriprep 30 as before.

HPLC gel filtration chromotography was performed using Water TSK G400SW and G300SW columns in series (both columns 7.8mm x 30cm) at 3θOC. The elution buffer contained 0.025M Tris, 0.1M ammonium thiocyanate, 1% Zwittergent 3-14 adjusted to pH 7.5 with hydrochloric acid. The flow rate was 1.0 ml/min. In this system, ferritin eluted at 13.00min (range 12.97 to 13.05 min) and bovine serum albumin at 15.59 min (range 15.57 - 15.62 min). The fractions collected were GF4, 12.00 - 13.00 min, GF5, 13.00 - 14.25 min and GF6, 14.25 - 15.25 min, with individual variation of no more than 0.05 min in multiple repeated injections.

In order to determine whether there were antigens in these fractions other than Bm86 which were capable of providing effects against ticks, the Bm86 was removed from these fractions and the Bm86-depleted preparation was used to vacinate cattle. The GF5 and GF6 fractions were pooled, concentrated on a Centriprep 30 and passed through a column of antibody to Bm86 bound to Sepharose. Protein material which passed through the column unbound was shown to be free of detectible Bm86 antigen by Western blotting using an antibody to recombinant Bm86 as a primary antibody and a luminol detection system.

The pooled, Bm86-depleted material was then passed through a column of wheat germ lectin bound to Sepharose, WGL Sepharose, prepared as described previously (Willadsen et al., 1989). The column was washed with buffer containing 0.05M Tris, 0.1% Zwittergent 3-14 pH 7.5 and then bound material eluted in the same buffer to which had been added lOOmg/ml N-acetylglucosamine. Fractions were analysed by SDS PAGE and pools made of bound (WGL+) and unbound (WGL-) material. The procedure is shown diagramatically in Figure 1.

Groups of three cattle were immunized with WGL- and WGL+ antigens, using three equal injections of antigen, four weeks apart. The first two injections were in Freund's Complete Adjuvant, the third in Freund's Incomplete Adjuvant. Cattle were challenged with ticks subsequently. The amount of protein injected per animal and per vaccination was 6μg for the WGL+ group and 35μg for the WGL- group.

The first tick challenge was with Yeerongpilly strain ticks, 1000 larvae a day. It was known that a number of the cattle had been treated immediately before purchase with Bayticol, to which Yeerongpilly strain ticks are susceptible. Despite a delay of approximately 3 months between acaricide treatment and initial infestation with ticks, the results showed the effect of residual chemical toxicity on the parasites. Therefore, at the termination of the Yeerongpilly infestation the same cattle were each given a single infestation with 5000 Lamington strain ticks, which are resistant to Bayticol.

The results from the first challenge infestation are shown in Table 2 as the means and standard deviations of the number of ticks engorging per day and their mean weight. The results of the Lamington infestation are shown in Table 3. Because this was from a single infestation with larvae, the total numbers of ticks engorging over the five days of maximum tick drop are shown rather than a mean daily drop. The mean tick weights are calculated from the results of the 5 days. Tick engorgement with the Lamington strain occurred 7 weeks after the final vaccination. From both challenge infestations, there is an indication that there has been a reduction in the number of ticks engorging on the vaccinates compared with non-vaccinated control animals and possibly some small reduction in the average weight of the ticks and their subsequent egg production. EXAMPLE 3 Further purification of protective antigenic material from the GF4, GF5 and GF6 fractions.

Material from 967g of ticks was used to prepare 34g of crude membrane protein. This was then processed as described in the previous example to give fractions GF4, GF5 and GF6 by HPLC gel filtration. The GF5 and GF6 fractions were then pooled. The pooled material is referred to as GF5,6. GF5,6 was concentrated on a Centriprep 30 membrane concentrator to give 1620μg of protein. Bm86 was removed from this material by passage through a column of rabbit anti-Bm86 IgG bound to Sepharose. The material was then further separated on a column of wheat germ lectin Sepharose to give bound (WGL+) and unbound (WGL-) material as described in Example 2 above.

The WGL- material was concentrated on a Centriprep 30 concentrator and washed with a buffer containing 0.05M Tris, 0.1M sodium thiocyanate, 0.5% Chaps pH 7.5. The concentrated material was then fractionated by HPLC gel filtration chromatography using two Waters Protein Pak 300SW columns in series, eluting in the same buffer at a flow rate of 0.5% ml/min at 3θOc. The material with elution times from 21.5 min to 24.5 min was collected and is referred to as GF5,6 pool 1. In the same system, bovine seruiti albumin eluted after 29.3 min, bovine serum albumin dimer after 25.4 min.

Similarly, the GF4 fraction was passed through, a column of rabbit anti-Bm86 IgG bound to Sepharose to remove Bm86, then through wheat germ lectin Sepharose as described for the GF5,6. The WGL- pool was concentrated on a Centriprep 30 membrane filter and washed with a buffer containing 0.05 M Tris, 0.1% SDS, 0.1M sodium thiocyanate adjusted to pH 7.5 with hydrochloric acid. The concentrated material was then separated by HPLC gel filtration chromatography using two Waters PP300SW columns in series and the Tris/thiocyanate/SDS buffer. The most abundant protein species eluting during chromatography had an apparent molecular weight of approximately 86 kD, judged by SDS PAGE. Fractions containing this protein in greatest quantity and best purity were pooled, reconcentrated and rechromatographed on a single PP300SW column in the same buffer system before finally pooling fractions containing the target protein.

The purification of all fractions subsequently used for vaccination trials in cattle is summarised in Figures 2a, 2b and 2c.

Cattle were vaccinated using two injections of antigen, one month apart, each injection being of 2 ml containing 4 mg of Quil A. Injections were subcutanaeous in the neck. The amounts of antigen injected per animal and per dose were: GF5,6 pool 1, 30μg; and GF4 WGL- fraction, 45μg. Two weeks after the second vaccination, cattle were challenged with 1000 Boophilus microplus larvae per day. The results are shown in Table 4 and summarized in Table 5. Vaccination with both fractions resulted in fewer ticks engorging, those which did engorge were lighter and had a decreased egg conversion compared with ticks from non-vaccinated controls. Overall there was up to a 76% reduction in the weight of eggs produced by ticks from vaccinated animals.

EXAMPLE 4 Evidence that the protective antigen in GF5,6 will enhance the effect of Bm86 vaccination.

The protective effect of the vaccination with GF5,6 pool 1 and GF4 WGL- fraction was not due to the production of antibodies cross-reactive with Bm86. ELISA titres of antisera before and after vaccination showed no detectible titre to recombinant Bm86 (Table 6). Control positive sera from cattle vaccinated with recombinant Bm86 gave titres of greater than 20,000 in the same series of assays.

It was important to determine whether antibody to the GF5,6 pool 1 antigen would enhance the effect of anti-Bm86 antibody. Freshly moulted adult Boophiluε microplus cultured on non-vaccinated cattle were fed in vitro on serum from non-vaccinated cattle, cattle vaccinated with recombinant Bm86, cattle vaccinated with GF5,6 pool 1 and mixtures of antisera.

Damage to' the feeding ticks was assessed visually by the leakage of Evans Blue dye (which binds to serum albumin) into the ticks' haemocoel. All assays were carried out in triplicate. The results are shown in Table 7. The antiserum to Bm86 was diluted with an equal volume of control serum before feeding to ticks and that to GF5,6 pool 1 was treated similarly. The final group received equal parts of anti-Bm86 and anti-GF5,6 pool 1 antisera. Thus the concentrations of specific antibodies were comparable between groups. The results suggest that the combined antisera were more effective in damaging ticks than either separately. EXAMPLE 5 Comparison of different species of the 86kD target protein.

The predominant protein species in the fractions GF5,6 pool 1 WGL-; GF5,6 pool 1 WGL+; GF4 WGL- and GF4 WGL+ appeared to be identical in electrophoretic mobility on SDS PAGE. In addition, the separation of the fractions designated GF4 and GF5,6 on HPLC gel filtration was based on prior empirical fractionation conditions which were not reflected in a discrete distribution of the 86kD target protein. Finally, even the separation of WGL+ and WGL- species by lectin affinity chromatography was not clear cut, since material originally bound to wheat germ lectin- Sepharose eluted slowly on continued washing with buffer that did not contain the specific eluting sugar N- acetylglucosamine.

To clarify the relationships between the predominant protein species in the fractions GF5,6 WGL-, GF4 WGL- and GF4 WGL+, thus were compared in the following ways:

1. SDS PAGE under non-reducing conditions. The mobility of all species was the same.

2. SDS PAGE after reduction.

Samples were reduced with 25 mM DTT before electrophoresis. All species showed the same slight decrease in mobility. 3. Deglycosylation with glycopeptidase F.

Samples at a final concentration of approximately 5μg/ml were incubated in Tris buffer pH 7.5, 0.75% Triton X-100, 0.1% SDS, 100 mM EDTA with 0.1 unit of glycopeptidase F (Boehringer) at 24θc overnight. SDS PAGE showed identical increases in mobility for all three species corresponding to a molecular weight decrease as judged by SDS PAGE in a non-reducing system of 17 kD. 4. Digestion with endoproteinase glu-C. After reduction in 4.5mM DTT for 20 min. at 56θc, followed by alkylation with iodoacetic acid, the protein samples were digested at a final concentration of 5μg/ml with endoproteinase glu-C, using one aliquot of enzyme at a weight ratio of 10:1 protein:enzyme for two hours at 24θc, followed by a second aliquot overnight. SDS PAGE showed loss of all three samples and production of a number of diffuse bands of lower molecular weight. These appeared to be the same in each case.

The procedure was repeated using a ratio of protein to endoproteinase glu-C of 40:1. Under these conditions, little degradation of any sample occurred.

On a basis of the similarity in properties described in 1. to 4. above, it is tentatively concluded that GF5,6 WGL-; GF4 WGL- and GF4 WGL+ are essentially the same protein, probably with minor differences in glycosylation. It is likely that GF5,6 WGL+ is also the same as the other three species tested.

EXAMPLE 6 Preparation of Tick carboxypeptidase for vaccination and sequencing:

On the basis of the probable identity of the predominant protein species in the GF5,6 Pool 1 and GF4 fractions, and the probable identity of this with the protective antigenic activity, this protein was given a single designation, the tick carboxypeptidase antigen.

Membrane material from 862 grams of ticks, comprising 19500 mg total, was extracted with 2g Nonidet P-40 per gram of tick protein at 37θc for 1.5 hr in 0.05MTris, 0.025M acetic acid, 0.1M NaCl ph 8.0. It was then centrifuged for 30 min at 20000g and 2θ c. The supernatant was loaded on a column of Sephacryl S300 73cm x 8.8cm and eluted in 0.05M Tris chloride buffer containing 0.1% Nonidet P-40 and 0.1M NaCl. High molecular weight material was pooled as described previously. The material was concentrated with ammonium sulphate at 50% final concentration, using additions of salt of 220 g/1 and 88 g/1. All proteinaceous material was precipitated after the first salt addition.

Following dialysis and equilibration with 0.025M Tris 0.0125M acetic acid, the protein, 4000mg, was extracted with Zwittergent 3-14 at a ratio of 2 g detergent / g protein, at a final detergent concentration of 2% (w/v) . Extraction was for 1 hr at 37θc. Solubilized material was collected after centrifugation at 2θOc and 20000g for 30 min. The solubilized protein was subjected to isoelectric focussing at 100c in the range pi 3-10 using Pharmalyte ampholines and Ultradex gel according to the manufacturers' instructions. Material focussing in the range 4.8 to 5.9 was pooled, eluted and. again subjected to isoelectric focussing, this time in the range pi 4-8 for approximately 9000 Vhr. Fractions were eluted individually and analyzed by SDS PAGE. Fractions containing the required antigen were concentrated in the pi range 4.8 to 5.2. These fractions were pooled, diluted with Tris buffer to give a pH of approximately 7.5, then passed through a column 22 cm x 0.5cm of lentil lectin-Sepharose. Bound material was washed consecutatively with Tris buffer, Tris buffer containing 0.1% SDS, then finally eluted with Tris buffer containing 0.1% SDS and 50mg/ml methyl a-D- mannopyranoside. Fractions containing the target protein were concentrated using a Centricon 30 membrane concentrator, then further purified using HPLC gel filtration. The HPLC gel filtration used two Waters PP300 SW columns in series, with an eluting buffer of 0.05M Tris chloride, 0.1M sodium thiocyanate, 0.1% SDS, pH 7.5 at 3θOc and a flow rate of 0.5 ml/min. In this system, bovine serum albumin monomer and dimer had retention times of 22.95 and 20.46 min respectively. Fractions eluting between 21.33 and 22.33 min were pooled, with peak elution times of 21.75 and 21.81 min in two consecutive injections. The final yield of protein was 265 μg as judged by the orthophthaldehyde method, using bovine serum albumin as a standard. The protein was homogeneous as judged by SDS PAGE in either reducing or non-reducing conditions. The isolation procedure is summarized schematically in Figure 3.

Three cattle were each vaccinated with 21 μg of tick carboxypeptidase in Freund's Complete Adjuvant sub- cutaneously in the neck, followed four weeks later with the same dose emulsified in Freund's Incomplete Adjuvant. The cattle and three control, unvaccinated cattle, were infested with larvae two weeks later. The results of the infestations are shown in Tables 8 and 9. The effect of vaccination was not due to the production of antibodies cross-reactive with the previously characterized Bm86 antigen as significant antibody titre to this antigen was not produced as a result of vaccination (Table 10). Example 7 Peptide sequencing of antigen Tick carboxypeptidase

Purified tick carboxypeptidase antigen, 63μg, in a volume of 320 μl containing 0.1% SDS, 5mM EDTA and 0.8% Triton X-100 was mixed with 5 μl of glycopeptidase F (Boehringer Mannheim, 200 U/ml) and incubated for 6 hours at 37θc. The protein was then precipitated with methanol, dried, resuspended in 150 μl of 0.1M Tris chloride buffer pH8.3 containing 0.1% SDS then reduced with lOmM DTT at 56°C for 1 hour. A further addition of DTT to a final concentration of 20mM was made and the solution incubated for another hour to ensure reduction. The mixture was then alkylated with iodoacetic acid and again methanol precipitated. The tick carboxypeptidase protein was digested in 0.1M Tris chloride buffer pH 8.5 containing 2M urea and 0.02% Tween 20 (V/V) using 1.2μg of endoproteinase lys C (Boehringer Mannheim) and incubated 24 hours at 37θc. Peptides were separated by HPLC reverse phase chromatography on Aquapore C-8 columns as described previously (Willadsen et al. , 1989). Gas phase sequencing gave the peptide sequences listed in Table 11. EXAMPLE 8 Molecular cloning of the gene coding for tick carboxypeptidase

(a) Oligonucleotide Synthesis

From the amino acid sequences described in Example 7, Table 11, oligonucleotides were prepared that could be used in the polymerase chain reaction (Saiki et al . , 1985) to amplify DNA fragments of the gene encoding these peptides or to screen cDNA and genomic DNA libraries to identify the gene(s) encoding tick carboxypeptidase.

Degenerate primers, including those shown in Table 12 were designed and synthesized on an Applied Biosystems Model 380A automated DNA synthesizer. Nucleotides additional to those necessary to encode the required amino acid sequences were included on the 5' ends of the oligonucleotides. These sequences encode sites for the restriction enzymes, Eco RI, ifii2dIII or SajπHI in order to assist in the subsequent ligation of PCR amplified DNA into appropriate vectors. b RNA Isolation

Total RNA was isolated from 0.5 g (wet weight) of adult or larval stage B. micropluε (Yeerongpilly strain) using an RNA extraction kit purchased from Pharmacia (

Cat. # XY-016-00-01) . The method used was essentially as described by the manufacturer. Larvae were collected immediately after hatching from in vitro cultured tick eggs, snap frozen in liquid nitrogen and stored at -70 C until required. Adult ticks were collected, snap frozen and stored at -70 C.

In order to extract RNA, frozen adults or larvae were pulverized under liquid nitrogen, added to 7 ml of extraction solution, mixed using an ultraturrax homogenizer and then layered over 2 x 1.25 ml cushions of caesium trifluoroacetate (CsTFA) in 13 x 51 mm polyallomer tubes. Extraction solution and CsTFA were provided by the manufacturer as part of the RNA extraction kit. The gradients were spun at 31,000 rpm for 16 h at 15° C using an SW 50.1 rotor in a Beckman L8-70 ultracentrifuge. After centrifugation, pellets of RNA were dissolved in TE buffer and reprecipitated from ethanol at - 20° C. The sedimented RNA was then dissolved again in TE and further purified by centrifugation through an oligo (dT)-cellulose column (Pharmacia mRNA Purification Kit, Cat. # XY-012-00- 02) as described by the manufacturer. The resulting purified poly(A)⁺ RNA was used to construct a cDNA library. (c) cDNA Library Construction cDNA libraries were prepared using a Pharmacia cDNA Synthesis Kit (Cat. # XY-003-00-03) . Briefly, polyadenylated RNA purified from 80 μg total RNA was reverse transcribed using Moloney Murine Leukemia Virus Reverse Transcriptase and oligo dT primers. Second strand synthesis was accomplished using RNase H and E. coli DNA polymerase I. The double stranded cDNA was blunt-ended with the Klenow fragment of DNA polymerase and ligated to Eco RI/ Not I adaptors. The cDNA was then phosphorylated using T4 polynucleotide kinase. 1 % of this was ligated into Eco Rl-digested, dephosphorylated lambda gtlO arms and packaged in vitro into infectious bacteriophage particles. The remainder was stored at - 20° C. Lambda gtlO arms and packaging mixes were obtained from Promega (Protoclone lambda gtlO Plus Packagene System; Cat. # T3610) . Methods used were as described by the manufacturer. Packaged cDNA was transfected into E. coli C600Hfl and plated on Luria agar plates using Luria top agar containing 10 mM MgSθ4. The larval stage library contained a total of 5 x 106 p.f.u of which 99% were recombinants with an average insert size of 3000 bp. The adult library contained 6 x 105 p.f.u. with an average insert size of 2000 bp. (d) Isolation of Geno ic DNA

Total DNA was isolated from adult ticks (Yeerongpilly strain) that had been stored at -70° C. Approximately 1 g of frozen ticks was ground into a fine powder under liquid nitrogen using a mortar and pestle. This powder was suspended in 5 ml DNA extracting solution which consisted of 10 mM Tris-HCl (pH 8.0), 100 mM EDTA, 100 mM NaCl and 1 % SDS. The suspension was mixed gently and then incubated at 60° C for 15 min. RNase A was then added to a final concentration of 50 μg/ml and the mixture was incubated for a further 1 h but at 37° C. After this incubation, Proteinase K was added to a final concentration of 100 μg/ml. The DNA was then digested at 50° C for 1 h after which it was extracted with an equal volume of phenol that had been equilibrated with 100 mM Tris-HCl (pH 8.0). The aqueous phase was then extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1). The aqueous phase from this extraction was extracted twice with an equal volume of chloroform:isoamyl alcohol (24:1). DNA was precipitated by adding two volumes of ethanol to the aqueous phase of this final extraction. The precipitated DNA was washed once with 70% ethanol, dried briefly under vacuum, resuspended in 1.0 ml sterile TE and stored at 4° C. The DNA concentration was determined by measuring the absorbance at 260 nm and assuming that a 50 μg/ml solution has an absorbance of 1.0. (e^ Preparation of Probe for cDNA Library Screening

A tick carboxypeptidase-specific double stranded DNA probe was prepared using the polymerase chain reaction. The procedure used was based on that described by Saiki et al . (1985) and used a recombinant form of Tag DNA polymerase obtained from Perkin Elmer Cetus (AmpliTaq, Cat. # N801-0060) .

The first experiment was designed to amplify a small region of the tick carboxypeptidase gene encoding peptide T9118 using two primers (A033/503 and A033/511) from the extremes of the peptide coding sequence. The polymerase chain reaction was performed on first strand cDNA that had been synthesised as described above in section (c). The reaction mixture contained first strand cDNA, 0.75 μM of each of the oligonucleotide primers A033/503 and A033/511, 50 μM of each dNTP, 50 mM KC1, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, and 2.5 units of Tag DNA polymerase in a total volume of 100 μl. After a denaturation step of 95°C for 8 min. amplification was carried out over 30 cycles: cycles 1 - 4 consisted of denaturation for 1 min. at 95° C, annealing for 1 sec. at 34° C and extension for 1 min. at 72 C; cycles 5 - 30 consisted of denaturation for 1 min. at 95° C, annealing for 30 sec. at 50° C and extension for 1 min. at 72° C. Appropriate controls, as described by Saiki et al . (1985), were also included.

Samples of each amplification reaction were analysed on 8.0 % polyacrylamide gels. In the reaction containing the two tick carboxypeptidase oligonucleotide primers, a band of the predicted size (~70 bp) was seen (Table 13, Expt 1). This PCR product was gel purified, digested with Eco RI and Bam HI, ligated into pGEMUZf(-) (Promega) and transformed into E. coli using conventional techniques. The recombinant plasmid so generated, termed pBTAHOO, was partially sequenced using the dideoxy chain termination procedure (Amersham Microtitre Plate Sequencing Kit, Cat.# RPN 1590). The sequence obtained is shown in Fig. 4. Analysis of the sequence confirmed that it contained the sequence of primer A033/503 at one end and A033/511 at the other end. Translation of the sequence in one of the three possible frames revealed the sequence of peptide T9118.

The sequence obtained from the intrapeptide PCR experiment above allowed us to design two non-degenerate oligonucleotide primers specific for peptide T9118 (one sense - A049/501, and one antisense - A049/502 - see Table 12). As described in section (a) these oligonucleotides encode sites for the restriction enzymes, Eco RI or BamHl in order to assist in the subsequent ligation of PCR amplified DNA into appropriate vectors. Further PCRs were performed using various combinations of sense and antisense, degenerate and non- degenerate primers on first strand cDNA. Reaction conditions for the amplification were as described above except that the volume was halved to 50 μl and there were 30 cycles each of which consisted of denaturation for 1 min. at 94_ C, annealing for 1 min. at 50_ C and extension for 1 min. at 72_ C. The results of this experiment are summarized in Table 13 (Expt. 2a). Four DNA fragments were amplified: 75, 150, 750 and 1200 bp. A second round of amplification was carried out using the 1200 bp fragment as template with primers A033/501 and A033/517. This generated a 450 bp fragment (Table 13, Expt. 2b). The 150, 750, 1200 and 450 bp PCR amplified fragments were subcloned into pGEMHZf(-) and partially sequenced as described above. This sequencing (data not shown) showed that the PCR amplified fragments overlapped and allowed them to be aligned as shown in Fig. 5. A translation of the partial DNA sequences (not shown) revealed the presence of several of the tick carboxypeptidase peptides listed in Table 11. This suggested that the PCR amplified fragments are part of the tick carboxypeptidase gene. The 750bp DNA fragment was subsequently used as a hybridization probe to screen the adult and hatching tick cDNA libraries described in (c) above. The recombinant plasmid containing the 1200bp PCR amplified fragment in the Eco RI-Bam HI sites of pGEMHZf(-) is termed pBTA1102. Sequence differences between the 1200 bp insert in pBTA1102 and the cDNA clones isolated below is summarised in Table 14. (f) Isolation of cDNA clones coding for tick carboxypeptidase Approximately 3 x 105 p.f.u. of the hatching tick cDNA library and 3 x 105 p.f.u. of the adult tick cDNA library were screened by hybridization of nitrocellulose filter replicas of the library in a solution containing 1 x 105 cpm / ml probe, 6 x SSC, 0.1% (w/v) BSA, 0.1% (w/v) ficoll, 0.1% (w/v) polyvinyl pyrrolidone, 0.1 % (w/v) SDS, 100 ug/ml sheared, denatured herring sperm DNA at 55_ C . After washing at 55_ C in 2 x SSC, 0.1 % SDS, 2 positive plaques were identified in the hatching library and one from an adult library (named H9 and A5 respectively) . These were picked for subsequent purification and analysis. The cDNA fragments were isolated from the purified phage DNA by digestion with Eco RI and subcloned into pGEM7Zf(-) (Promega) for DNA sequence analysis. Recombinant plasmid pBTA1093 contains the cDNA insert from clone A5, and pBTA1103 contains the cDNA insert from clone H9.

To facilitate sequencing, a nested series of Exonuclease III deletion clones was prepared for each cDNA using the Erase-a-base kit (Promega) . The deletion clones were sequenced using the dideoxy chain termination procedure (Amersham Microtitre Plate Sequencing Kit, Cat.f RPN 1590). The insert from the adult cDNA clone A5 (pBTA1093) was 4116 bp long. An open reading frame extended for the first 1807 bases from the 5 end of the sequence suggesting that the initiating methionine codon was not present in this clone. The sequence of clone H9 (pBTA1103) was also determined. It was homologous to the 2925 bp from the 3 end of clone A5 and was also missing the 5 end of the tick carboxypeptidase gene.

To generate a clone of tick carboxypeptidase extending to the 5 end of the mRNA two new cDNA libraries were constructed. The two new cDNA libraries were constructed as described above except that the poly(A)+ RNA was extracted from the larval stage of B. micropluε

(Calliope strain) . One of the libraries was generated from random hexamer primed poly(A)+ RNA and the other from oligo dT primed poly(A)+ RNA. The libraries were screened with a radiolabelled 257bp Eco RI -Hind III fragment from the 5 end of clone A5 (ρBTA1093). Three positive plaques were identified in the oligo- dT primed library. The cDNA inserts from these clones (named tick carboxypeptidase-3UI, -4UI and -5UI), all approximately 4 kb in length, were isolated from the purified phage DNA by digestion with EcoRl and subcloned into pGEM3Z (Promega) . The recombinant plasmids generated are named pBTA1028, pBTA1029 and pBTA1030 respectively. The coding regions of clones 3UI, 4UI and 5UI were completely sequenced, using oligonucleotide primers, on the Model 373A DNA Sequencer using the PRISM Dye Deoxy Terminator Cycle Sequencing Kit (Part No. 401384; Applied Biosystems Inc. ) . Clones 3UI and 4UI contained a short 5 non-coding region, the initiating methionine codon, the entire tick carboxypeptidase coding sequence and about 2 kb of 3 untranslated sequence (not sequenced) . Clone 5UI was missing the initiating methionine and next 7 codons but contained the rest of the coding sequence and about 2 kb of 3 untranslated sequence (also not sequenced).

When the random hexamer primed cDNA library was screened 2 positive plaques (named tick carboxypeptidase- 611 and -711) were identified and purified. The phage DNA was sequenced directly using the Applied Biosystems Cycle Sequencing Kit as described above. Only the 5 end sequences of the tick carboxypeptidase cDNA in clones 611 and 711 were determined. For both clones the sequence was homologous to that in clone 4UI and included the initiating methionine codon and varying lengths of 5 untranslated sequence.

The tick carboxypeptidase coding sequence plus short segments of the 5 and 3 untranslated sequence is shown in Fig. 6. This sequence is a hybrid of sequences from cDNA clones 4UI (nucleotides 1 - 966 & 1747 - 2074) and A5 (nucleotides 967 - 1746). In the .coding region there are 16 positions at which substitutions occur between the various tick carboxypeptidase cDNA sequences (A5, H9, 3UI, 4UI, 5UI and 711) that result in changes to the amino acid sequence. In addition, clone 4UI has a single base insertion at position 1611 and clone 3UI has a single base deleted at position 867. These are frame-shift mutations that result in premature termination of translation. It is not clear whether the frame-shift mutations are cloning artefacts or whether they occur naturally in the tick population. There are another 26 bases in the coding sequence at which point mutations occur in one or more of the tick carboxypeptidase cDNA sequences that do not alter the encoded amino acid (i.e. silent changes). The point mutations are likely to reflect natural variation in the tick population. The known differences between the various tick carboxypeptidase sequences that result in amino acid changes are summarised in Table 14.

The translation of the tick carboxypeptidase cDNA sequence is shown below the nucleotide sequence in Fig. 6. All the native tick carboxypeptidase peptide sequences listed in Table 11 are found within the translation as indicated in Fig. 6. The predicted amino acid sequence agrees with the peptide sequence for all peptides with 2 exceptions. These differences are Asp for Glnl4 in peptide T9126, and Asn for Aspl2 in peptide T9118. Tick carboxypeptidase is 660 amino acid residues in length (before cleavage of the signal peptide) and has a molecular weight of 75172. The features of the tick carboxypeptidase amino acid sequence include an N-terminal signal peptide (residues 1 - 29), 8 potential N-linked glycosylation sites, a putative C-terminal transmembrane domain (residues 639 - 655) and a potential glycosylphosphatidyl inositol anchor sequence similar to that found in Bm86 [PCT/AU87/00107, Williams et al (1992) Todays Life Science Nov, p50-60]. The tick carboxypeptidase sequence was compared to the protein sequence database and was found to have significant homology with zinc dependent dipeptidyl carboxypeptidases from mammals. The homology around the active site zinc binding domain is about 63% (over 115 residues).

(g^ Identification of Tick Carboxypeptidase Homologues in Other Invertebrate Species

Genomic DNA (lOug) (extracted as described in (d) above) from several parasitic invertebrate species including Boophiluε micropluε, Haemonchuε contortuε,

Trichoεtongyluε colubriformiε, Oεtertagia circumcincta, Ctenocephalideε feliε, Haematobia irritanε, and Lucilia cuprina were digested with Eco RI, electrophoresed through a 1% agarose gel and blotted onto a nitrocellulose filter [Maniatis et al]. The filter was hydridised with a ^2p radiolabelled fragment encompassing nucleotides 225 - 1798 of the tick carboxypeptidase cDNA (Fig. 6) prepared using a Random Primed DNA Labelling Kit (Boehringer-Mannheim, Cat. #1004 760). Hybridization was carried out at 55°C in 6 x SSC, 0.1% (w/v) BSA, 0.1% (w/v) ficoll, 0.1% (w/v) polyvinyl pyrrolidone, 0.1% SDS, 100 mg/ml sheared, denatured herring sperm DNA plus probe for 18 hrs. The filter was washed in 2 x SSC, 0.1% SDS at room temperature for 15 min. then at 50 - 55°C for 20 min. Finally the filter was exposed to X-ray film at -70°C for 18 hrs. A pictorial representation of the autoradiograph is shown in Fig. 7. The filter was subsequently washed at a higher stringency in 0.5 x SSC, 0.1% SDS at 55°C for 10 min. then reexposed to X-ray film. This experiment has demonstrated the presence of tick carboxypeptidase homologous sequences in a variety of parasitic invertebrate species. Multiple hybridisation bands were observed in the B. micropluε, H. contortuε, T. colubriformiε, O. circumcincta, C feliε, H. irritanε, and L. cuprina DNA samples. These bands ranged in size between 1 kb and 10 kb. Total RNA was extracted as described above (b) from B. micropluε, H. contortuε and H. irritanε denatured, electrophoresed through a 1.2% agarose gel containing formaldehyde in MOPS buffer [Maniatis et al] and transferred onto a Hybond N+ nylon membrane using 20 x SSC (Amersham) . The filter was hybridised with a radiolabelled tick carboxypeptidase cDNA probe at 60°C using standard conditions. After washing in 0.5 x SSC, 0.1% SDS at room temperature the filter was exposed to X-ray film overnight. A representation of the autoradiograph is shown in Fig. 8. Bands were present in the B. micropluε, H. contortuε and H. irritans RNAs. The band in the B. microplus track is about 5 kb in size whilst those bands in the other species are about 2 kb. The 5kb B. micropluε specific RNA band was still present after more stringent washing of the filter (0.5 x SSC, 0.1% SDS at 60°C) while the other bands washed off.

To investigate further the presence of tick carboxypeptidase homologous sequences in other parasitic insect species the following experiment was performed with the aim of cloning a gene encoding the tick carboxypeptidase homologue from the parasitic buffalo fly H. irritanε . Two oligonucleotide primers (A055/501 and A055/502) were designed to amplify a fragment of the H. irritanε gene using the polymerase chain reaction. Both the oligonucleotide primers contain a restriction enzyme site at their 5 end (to facilitate subcloning) followed by tick carboxypeptidase specific sequences with degeneracy at the third base of some codons (Table 15). Total RNA was extracted from adult buffalo flies as described in (b) above. First strand cDNA was made in a 100 ml reaction containing 10 mg total RNA, 1 mg oligo dT primer, 1 mM each dNTP, 1 x first strand synthesis reaction buffer (Amersham), 10 mM dithiothreitol, 40 units RNasin (Promega) and 100 units MLV reverse transcriptase (BRL) incubated at 37°C for 1 hr. The polymerase chain reaction was performed on a 5 ml aliquot of the first strand cDNA. The reaction mixture contained first strand cDNA, 0.75 μM of each of the oligonucleotide primers A055/501 and A055/502, 50 μM of each dNTP, 50 mM KC1, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, and 2.5 units of Taq

DNA polymerase in a total volume of 100 μl. After a denaturation step of 95° C for 5 min. amplification was carried out over 35 cycles: denaturation for 1 min. at 95° C, annealing for lmin. at 55° C and extension for 1.min. at 72° C. Aliquots of the reactions were analysed by polyacrylamide gel electrophoresis. This analysis showed that a 360 bp fragment had been amplified. The amplified fragment was digested with Eco RI and Bam HI and subcloned into the vector pGEMHZf(-) (Promega) creating recombinant plasmid pBTA1104. The insert in pBTA1104 was sequenced using the dideoxy chain termination procedure (Amersham Microtitre Plate Sequencing Kit, Cat.# RPN 1590). The sequence is shown in Fig. 9. When compared to the tick tick carboxypeptidase cDNA sequence (Fig. 6) there was 54% homology between the sequences. The predicted amino acid sequence of the buffalo fly (H. irritanε) tick carboxypeptidase homologue is shown below the DNA sequence in Fig. 9. There is 47% homology between the amino acid sequences of tick carboxypeptidase and the buffalo fly homologue. fh^ Expression of Recombinant Tick Carboxypeptidase in E. coli and Baculovirus Systems

The tick carboxypeptidase gene can be expressed in any number of different recombinant DNA expression systems to generate large amounts of tick carboxypeptidase which can be purified and used to vaccinate animals to provide protection against infestation with ticks.

In the first example, a section of the tick carboxypeptidase gene encoding amino acid residues 229 - 621 (nucleotides 734 - 1914, Fig. 6) was subcloned into the E. coli expression vector pBTA954 as outlined in Fig. 10. Plasmid pBTA954 is equivalent to pDS56/RBSII,6xHis(-l) in which cloned DNA is expressed with a short leader peptide containing six His residues (Stiiber et al 1990 [in Immunological Methods(Lefkovits & Pernis, eds) vol IV, 121-152]). Plasmid pBTA1102 was digested with Eco RI, end-filled using Klenow and dNTPs then partially digested with Hind III. The 1200 bp fragment was separated from the plasmid by gel electrophoresis and ligated to Hinc II - Hind III digested pBTA954. The recombinant plasmid, termed pBTAl077, was transformed into E. coli strain BTA2014 (E. coli strain SG13009 carrying plasmid pUHAl - Stiiber et al, 1990) creating strain BTA2303 for expression. Cells were grown to an A550 of about 1, induced with 2 mM IPTG and grown at 37° C for a further 3 hr at which time they were harvested and analysed by SDS PAGE. A novel 49 kDa band could be seen on SDS PAGE analysis of homogenates of IPTG induced bacteria. This product was not present in uninduced cells.

In a second example, a longer segment of the tick carboxypeptidase gene encoding amino acid residues 59 - 621 (Fig. 6) was subcloned into the E. coli expression vector pTrcHisA (Invitrogen) as described in Fig. 11. The tick carboxypeptidase gene sequences were from pBTA1097. pBTA1097 is an exonuclease III deletion plasmid derived from pBTA1093 as follows. pBTA1093 was digested with Sac I and Bam HI, incubated with exonuclease III and blunt-ended with SI nuclease and Klenow as described in the Erase-A- Base Kit manual (Promega) . Ligated plasmids were transformed into E. coli strain TOP10F (Invitrogen) and analysed by sequencing. In plasmid pBTAl097 all the 3 untranslated sequence plus 117 bp from the 3 end of the coding sequence are deleted from the tick carboxypeptidase cDNA. This results in a plasmid which encodes tick carboxypeptidase amino acid residues 59 - 621. The 1.7 kb insert was isolated from this plasmid as a Xba I - Nεi I fragment and ligated into pTrcHisA. The recombinant plasmid, named pBTA1078 was transformed into E. coli TOP10F (Invitrogen) creating strain BTA2304 for expression. Cells expressing recombinant tick carboxypeptidase were grown at 37°C to mid log phase and then induced by the addition of 2 mM IPTG. A protein which migrated at approximately 70 kDa in SDS PAGE was observed in induced but not in uninduced culture cell homogenates. This protein was purified for a vaccination trial as described below.

In a third example, a segment of the tick carboxypeptidase cDNA encoding the mature tick carboxypeptidase excluding the putative C-terminal hydrophobic transmembrane anchor (i.e. amino acid residues 30 - 640) was cloned into the E. coli expression vector pBTA724 as outlined in Fig. 12a and 12b. Modifications were required at the 5 and 3 ends of the tick carboxypeptidase coding sequence to introduce restriction enzyme sites to facilitate cloning. These modifications were made utilising the polymerase chain reaction as follows.

To modify the 5 end of the tick carboxypeptidase gene PCR was performed on template pBTA1029 using oligonucleotide primers A089/505 and A061/502 (Table 16). Primer A089/505 has a Bam HI and Sal I site at the 5 end to facilitate cloning. The reaction mixture contained 100 pg pBTA1029 DNA, 0.5 mM of each primer, 50 mM of each dNTP, 50 mM KC1, 10 mM Tris-HCl (pH9.0), 1.5 mM MgCl2, 0.1% Triton X-100 and 2.5 units Taq DNA polymerase in a total volume of 100 ml. Amplification took place over 25 cycles. The first cycle consisted of denaturation at 94°C for 5 min., annealing at 55°C for 1 min. and extension at 72°C for 1 min. Cycles 2 - 25 each consisted of denaturation at 94°C for 1 min., annealing at 55°C for 1 min. and extension at 72°C for 1 min. The amplified product was digested with Sal I and Hind III and a 330 bp fragment isolated for ligation to the mid section of the tick carboxypeptidase gene as shown in Fig. 12a.

To modify the 3 end of the tick carboxypeptidase gene PCR was performed on template pBTA1029 using oligonucleotide primers A089/503 and A089/504 (Table 16). Reverse primer A089/504 encodes a stop codon and has a Bam HI site at its 5 end to facilitate subcloning. The reaction mixture contained 100 pg pBTA1029 DNA, 0.5 mM of each primer, 50 mM of each dNTP, 50 mM KCl, 10 mM Tris-HCl (pH9.0), 1.5 mM MgCl2, 0.1% Triton X-100 and 2.5 units Taq

DNA polymerase (Perkin-Elmer) in a total volume of 100 ml. Amplification took place over 25 cycles. The first cycle consisted of denaturation at 94°C for 5. min., annealing at 55°C for 1 min. and extension at 72°C for 1 min. Cycles 2 - 25 each consisted of denaturation at 94°C for 1 min., annealing at 55°C for 1 min. and extension at 72°C for 1 min. The amplified product was digested with Aat II and Bam HI and a 230 bp fragment isolated for ligation to the mid section of the tick carboxypeptidase gene as shown in Fig. 12a.

The tick carboxypeptidase coding sequence expressing amino acid residues 30 - 640 was assembled by ligating the following fragments: the 330 bp Sal I - Hind III PCR product, a 500 bp Hind III - Eco RV fragment of pBTA1029, a 782 bp Eco RV - Aat II fragment of pBTA1093 and the 230 bp Aat II - Bam HI PCR amplified fragment (Fig. 12a). (It was necessary to make a hybrid gene so that a frame-shift mutation (a single base insertion) found in clone 4UI did not end up in the expression vector.) The assembled tick carboxypeptidase gene was subcloned into the E. coli expression vector pBTA724. pBTA724 was derived from the expresssion vector pPLc245 [Remaut, E. Nucleic Acids Res., 11. 4677-4688, 1983] by replacing the Sal I - Hind III multiple cloning site in pPLc245 with the linker sequence shown in Fig. 12c. The assembled tick carboxypeptidase gene was ligated into the Sal I-;-- Bam HI sites of pBTA724 (Fig 12b) and the recombinant plasmid, named pBTA1092 was transformed into E. coli strain pop2136 [strain 12825 from The National Collections of Industrial and Marine Bacteria] creating strain BTA2320. Cells expressing recombinant tick carboxypeptidase were grown at 28°C to mid log phase and then induced by shifting the culture to 42°C. A protein which migrated at approximately 72 kDa in SDS PAGE was observed in induced but not in uninduced culture cell homogenates. This protein was purified for a vaccination trial as described below.

In a fourth example, a segment of the tick carboxypeptidase cDNA encoding the mature tick carboxypeptidase including the N-terminal secretion signal and excluding the putative C-terminal hydrophobic transmembrane anchor (i.e. amino acid residues 1 - 640) was cloned into the baculovirus transfer vector pBlueBac2 (Invitrogen Corp.) as outlined in Fig.13a and 13b. Modifications were required at the 5 and 3 ends of the tick carboxypeptidase coding sequence to introduce restriction enzyme sites to facilitate cloning. These modifications were made utilising the polymerase chain reaction as follows.

To modify the 5 end of the tick carboxypeptidase gene for baculovirus expression, PCR was performed on template tick carboxypeptidase clone 711 using oligonucleotide primers A089/501 and A061/502 (Table 16). Primer A089/501 contains the baculovirus polyhedrin initiating sequence immediately upsteam of the initiating methionine and an Nhe I site at the 5 end to facilitate cloning. The reaction mixture contained 100 ng of purified 1 phage DNA 711, 100 pmoles of each primer, 50 mM of each dNTP, 50 mM KCl, 10 mM Tris-HCl (pH9.0), 1.5 mM MgCl2,

0.1% Triton X-100 and 0.5 units ofTag DNA polymerase (Perkin-Elmer) in a total volume of 20 ml. Amplification took place over 30 cycles. The first cycle consisted of denaturation at 94°C for 4 min., annealing at 55°C for 30 sec. and extension at 72°C for 1 min. Cycles 2 - 30 each consisted of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec. and extension at 72°C for 1 min. The amplified product was digested with Nhe I and Hind III and a 429 bp fragment isolated for ligation to the mid section of the tick carboxypeptidase gene as shown in Fig. 13a.

The 3 end of the tick carboxypeptidase gene was modified as described above and a 230 bp Aat II - Bam HI fragment was isolated for ligation to the mid section of the tick carboxypeptidase gene as shown in Fig. 13a.

The tick carboxypeptidase coding sequence expressing amino acid residues 1 - 640 was assembled by ligating the following fragments: the 429 bp Nhe I - Hind III PCR product, a 60 bp Hind III - Bεt EII fragment of pBTAl029, a 1222 bp Bεt EII - Aat II fragment of pBTAl093 and the 230 bp Aat II - Bam HI PCR amplified fragment (Fig 13a) . (It was necessary to make a hybrid gene so that a frame- shift mutation (a single base insertion) found in clone 4UI did not end up in the expression vector.) The assembled tick carboxypeptidase gene was ligated into the Nhe I - Bam HI sites of the baculovirus transfer vector pBlueBac2 (Fig. 13b) . The recombinant plasmid generated, named pBTA1084, was used along with linear AcMNPV baculovirus DNA in a cationic-lipid mediated co- transfection of Sf9 insect cells [Groebe, D.R. et al. 1990 Cationic lipid-mediated co-transfection of insect cells. Nucleic Acid Res. .18., 4033]. The culture medium of the transfected cells was taken after 48 hours and plaque assayed for recombinant virus [Summers, M.D. and Smith,

G.E. 1987. A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures . Texas Agricultural Experiment Station] . Single recombinant viral plaques obtained in this assay were further purified through a second plaque assay. Four single pure recombinant plaques were tested for expression and one was selected^J*to be the stock virus (BTA2334).

4.2 litres of Sf9 insect cell suspension in Gibco Sf900II serum-free medium was grown at 27_C to a cell density of approximately 1.2 x 10^ cells/ml. The culture was then infected with the virus BTA2334 at a multiplicity of infection of 0.5 pfu/cell.

The culture medium supernatant was harvested at 72 hours post-infection by centrifugation at 1000 x g to pellet the cells. The cell-free supernatant was then passed trough a 0.45 μm cellulose acetate filter. The filtrate was then ultrafiltered through an A/G Technology Corp. 500 kDa NMW cutoff hollow fibre cartridge to remove virus. The cartridge was then washed with 3 litres of 50 mM TrisHCl pH 8.0. The 7 litres of filtrate was then concentrated to 200 ml on a Sartorius 20 kDa NMW cutoff tangential-flow filter. The filter was then washed with 700 ml of 50 mM TrisHCl pH 8.0. The 900 ml of concentrate was frozen at -20°C. EXAMPLE: 9 Purification of recombinant antigens for trials (a) Purification of antigen derived from BTA 2303

The recombinant antigen was expressed by BTA2303 as intracellular inclusion bodies which can be purified from the bacterial -cells by several methods. The following methods are described by means of example.

Three litres of BTA 2303 were grown in shake flasks and the cells collected by centrifugation. Cell pellets were resuspended in 500 ml of lysis buffer (100 mM Tris pH 7.8, 20 mM EDTA, 1 mM PMSF) and homogenised by 5 passes through a Martin-Gaulin homogeniser at 8000 psi while maintaining the homogenate on ice.

The homogenate was centrifuged at 17,700 x g max for 15 mins at 4°C. The pellet containing the partially purified inclusion bodies were then resuspended in 300 ml 100 mM Tris, 1 mM PMSF pH 8.0 and centrifuged again at

17,700 x g max for 15 mins at 4°C. This wash was repeated and then followed by a further wash in 300 ml of 100 mM Tris containing 2 M urea, pH 8.0. The washed inclusion body pellet was frozen at -80°C.

4.9 g (wet weight.) of washed inclusion body pellet was solubilised in a solution containing 20 ml of 6 M guanidine hydrochloride, 0.1 M NaH2P04 pH 8, 100 mM β- mercaptoethanol for 2h at 37 C on a rolling shaker. The solubilised inclusion bodies were then centrifuged for 15 minutes at 12,100 x g max and the supernatant was then diluted to 100 ml with a solution of 6 M guanidine hydrochloride, 0.1 M NaH2P04 pH 8 giving a final concentration of 20 mM β-mercaptoethanol.

The supernatant containing the solubilised antigen was applied to a 2.5 cm diameter (13 ml.resin) NTA-Ni ⁺⁺- agarose column (Diagen, Cat. No. 30250, Lot No. R90005) at a flow rate of lml/min. The column was then washed with a solution containing 6 M guanidine hydrochloride, 0.1 M NaH2P04 pH 8, 20 mM β-mercaptoethanol until the absorbance at OD280 reached base line. The column was then washed in sequence with four solutions each containing 8 M urea, 0.1 M NaH2P04, 0.01 M Tris HC1 but adjusted to a different pH

(the first was at pH 8.0, the second pH 6.3, third pH 5.9 and fourth pH 4.5) and the various elutions collected. The column was finally washed with a solution of 6 M guanidine hydrochloride, 0.2 M acetic acid pH 2 and then re- equilibrated with the initial buffer for later use.

SDS-PAGE analysis demonstrated that the majority of the PCR tick carboxypeptidase fragment protein, eluted in the pH 4.5 buffer with only minor amounts present in the earlier elutions. In an attempt to renature the antigen into a conformation which more closely resembled the native antigen, it was incubated under conditions which would enable disulphide bond reshuffling as follows.

Two methods were used, one by dilution (a) and the other by dialysis (b) . (a) The pH 4.5 elution from the Ni-NTA column (at 620μg.ml^{~ 1}) was diluted 1:10 (62μg/ml^{~ λ} final) into a refold buffer containing 0.1M Tris pH 8.5, 5mM EDTA 0.075% Brij 35, 5mM GSH, 0.5mM GSSG and held with stirring at 4°C for lOOh.

(b) The pH 4.5 elution from the NTA-Ni ⁺⁺- agarose column was diluted 1:5 (~ 120μg.ml~ ^ final) with 8M urea elution buffer without β-mercapto ethanol, Brij 35 (0.025%) and then placed in a 12-14Kd cut off dialysis bag and dialysed against 800 mis refold buffer as above for 3 hours then against 3 L refold buffer for a further 97 hours.

After the refold each was dialysed against TS pH 8.0 0.25% Brij 35 with two buffer changes and then dilution material concentrated two fold on Amicon YM10 stirred cells. Both samples were centrifuged for 15' at 12,400 x g max. to remove any large aggregated material. Protein concentration was determined using Biorad Bradford assay with BSA as standard. For the dilution refold, protein recovery was 73% and for dialysis refold 77%. Both refold samples were virtually identical on SDS PAGE with both showing increased amounts of large aggregates compared to monomers when run non reduced compared to reduced. Further concentration of dialysis refold on YM10 to 370 μg/ml was done prior to formulation of vaccines. In order to prepare vaccines for administration to cattle, the tick carboxypeptidase PCR fragment antigen was diluted to an appropriate concentration in saline and Thimerosal was added to give a final concentration of 0.01%. The solution was then added slowly to the oil phase (Montanide 888 (Seppic) : Marcol 52 (Esso) 1:9 w/w) in the ratio of 45:55 v/v aqueous phase:oil phase while mixing with an Ultraturrax homogeniser. The final concentration of each antigen used in the trials was 200ug per 2 ml. The vaccines were mixed and monitored for quality of emulsion as outlined in the Seppic handbook. Purification of tick carboxypeptidase antigen expressed by BTA 2304

This construct was expressed in E. coli as inclusion bodies. The cells were broken in the Martin Gaulin homogenizer (6 passes 8,000 psi) in 0.IM Tris-HCl, 20mM EDTA ImM PMSF, pH 7.8. Inclusion bodies were recovered by centrifugation and the pellet resuspended and washed once in Tris buffer followed by two further washes in 2M urea, 0.1M Tris-HCl pH 8.0, ImM PMSF. Washed inclusion bodies were stored -80°C prior to use. Inclusion bodies were solubilized in 6M guanidine hydrochloride, 0.1M NaH2P04 pH 8.0, 0.1M Tris pH 8.0, 200mM β-mercapto ethanol and then centrifuged and diluted 1:10 with buffer minus β- mercapto ethanol prior to loading on NTA-Ni ⁺⁺- agarose affinity column. The column was washed with 8M urea, 0.IM NaH2P04, 0.0IM Tris pH 8.0, 20mM β-mercapto ethanol then eluted sequentially with this buffer adjusted to pH 6.3, 5.9, 4.5 respectively and then finally washed with 6M guanidine hydrochloride, 0.1M acetic acid pH 3. The bulk of the Bm 91 material eluted at pH 4.5 while some further material was removed by the 6M guanidine hydrochloride/acetic acid wash. A number of breakdown products are also purified on the NTA-Ni ⁺⁺- agarose column suggesting C-terminal cleavages; the main short product is approximately 70 Kd in size.

The tick carboxypeptidase material (lmg/ ml ) was assessed for solubility and refolded for 5 days at 4°C in lOOmM Tris pH 8.5, ImM ZnCl, 0.02% Brij 35, 5mM GSH, 2mM GSSG after a dilution of 1:15 from 8M urea 20mM β-mercapto ethanol.

S-carboxymethylation with iodo-acetic acid followed by amino acid analysis showed that all cysteines were fully oxidised compared to reduced controls.

After dialysis into tris saline and concentration, this material was used for the vaccination trial at 200μg/dose. Purification of tick carboxypeptidaseantigen from BTA 2320.

The tick carboxypeptidase all appeared in the inclusion body fraction and inclusion bodies were prepared as described above and washed with 0.IM Tris and 2M urea without EDTA present. Inclusion bodies were stored at - 80°C, washed inclusion bodies were solubilised in 8M urea, 50mM Tris pH 8.5, 20mM DTT, ImM PMSF. Solubilisation gave a yield of 370 mg protein per lire of cells with very little material remaining in the pellet (~17mg/L cells). Solubilisation in the absence of DTT gave a very low yield. Tick carboxypeptidase at this stage is ~90% pure by commassie stain and appears as two major immunoreactive bands. Inclusion bodies solubilised in presence of 20mM DTT had a protein concentration of 8.2mg/ml (Fig. 3). These were diluted 164-fold into refold buffer to give a protein concentration of 50μg/ml with residual DTT of 0.12mM. Refold buffer was 50mM Tris pH 8.5, 0.05% Brij, 5mM: 0.62mM GSH:GSSG, 0.02% Azide.

Two refolds were carried out, one in the presence of 50μm Zn⁺⁺, and allowed to refold for 75 hours. This material was then dialysed into tris saline and concentrated over Amicon YM 30 membranes. Post concentration material was again dialysed to remove azide. tick carboxypeptidase refolded in the presence of Zn⁺⁺ had 50μm Zn⁺⁺ added to all dialysis buffers. Final concentrations of material were tick carboxypeptidase (+Zn) 1.1 mg/ml and tick carboxypeptidase (-Zn) 2.1mg/ml. Negligible material was lost during dialysis and concentration. No activity as a carboxy dipeptidase was detected in the hippuryl gly gly enzyme assay.

The Zn⁺⁺ material after 0.2μm filtration was formulated as described previously for vaccination into cattle at lOOμg per 2ml dose. Purification of tick carboxypeptidase antigen expressed by insect cells infected with (BTA 2334^

Spodoptera frugiperda cells (S49) were grown in serum free medium Sf9000II and infected with virus containing the tick carboxypeptidase full length gene except for removal of the putative GPI anchor coding region at the C- terminus (BTA 2334).

The cells from 4L of spinner culture flasks were removed by centrifugation and the supernatant containing the tick carboxypeptidase was then diafiltered on a 500Kd cut off ultrafiltration cartridge to remove free virus and to buffer exchange into 50mM Tris pH 8.0. The filtrate was then concentrated to 900ml on a 20 kD cut-off membrane. A 300ml aliquot of this concentrated material was adjusted to pH8.5 with NaOH then applied to a 17.5ml Q

Sepharose (Pharmacia) ion exchange column at 2ml/min and washed to baseline. A 0 - IM NaCl in 50mM Tris pH 8.5 salt gradient was used to elute the column and fractions were collected. The tick carboxypeptidase baculovirus secreted material eluted between approximately 0:1 and

0.2M NaCl.

The tick carboxypeptidase baculovirus at this stage was in excess of 80% pure as estimated from SDS PAGE and showed carboxydipeptidase activity in the hippuryl-gly gly assay.

The fractions containing this material were pooled and after centrifugation at 100,000 x g to remove residual virus and 0.2μ filtration was formulated as described previously for vaccination into cattle at lOOμg per 2ml dose.

Following purification to an acceptable degree (which is generally in excess of 50% of the total protein) , the antigen can then be administered to cattle in the form of a vaccine. It is customary to include in the vaccine any of a number of different substances referred to as adjuvants which are known to stimulate the appropriate portion of the immune system of the vaccinated animal. Suitable adjuvants for the vaccination of animals include but are not limited to oil emulsions such a Freund's complete or incomplete adjuvant (not suitable for livestock use), Marcol 52:Montanide 888 (Marcol is a Trademark of Esso. Montanide is a Trademark of SEPPIC, Paris), squalane or squalene. Adjuvant 65 (containing peanut oil, mannide monooleate and aluminium monostearate) , mineral gels such as aluminium hydroxide, aluminium phosphate, calcium phosphate and alum, surfactants such a hexadecylamine, octadecylamine, lysolecithin, dimethyldioctadecylammonium bromide, N,N- dioctadecyl-N,N'-bis(2-hydroxyethyl)-propanediamine, methoxyhexadecylglycerol and pluronic polyols, polyanions such as pyran, dextran sulfate, polyacrylic acid and carbopol, peptides and amino acids such as muramyl dipeptide, dimethylglycine, tuftsin and trehalose dimycolate. The antigens, expression products and/or synthetic polypeptides of the present invention can also be administered following incorporation into liposomes or other micro-carriers, or after conjugation to polysaccharides, proteins or polymers or in combination with Quil-A to form "Isocoms" (Immunostimulating complexes). Other adjuvants suitable for use in the present invention include conjugates comprising the immunogen together with an integral membrane protein of prokaryotic origin, such as TraT (see PCT/AU87/00107) .

Routes of administration, dosages to be administered as well as frequency of injections are all factors which can be optimised using ordinary skill in the art. Typically, the initial vaccination is followed some weeks later by one or more "booster" vaccinations, the net effect of which is the production of vigorous immune response both cellular and humoral. The cattle would generally require two vaccinations 4-18 weeks apart in the first instance and additional vaccinations annually or more frequently as required which can be determined and optimised by standard procedures known in the art.

Example 10. Vaccination trials with purified recombinant tick carboxypeptidase

Preliminary vaccination and tick challenge trials demonstrate that the presence of the tick carboxypeptidase together with another antigen such as antigen Bm86 does increase the efficacy of the Bm86 vaccine by at least two¬ fold.

The tick carboxypeptidase expressed in BTA 2320, BTA 2304 or insect cells infected with recombinant baculovirus coding for the tick carboxypeptidase has been purified and used in these initial trials. There is considerable variation among the trial results due to the small number of animals which have been used to date; the antibody titres which have been generated against the recombinant tick carboxypeptidase have been very low and there is some evidence that the presence of the tick carboxypeptidase can decrease the immune response to the Bm86 which complicates comprehensive interpretation of the data. However, it is_, apparent that the co-presentation of both antigens does increase the protective effect of the Bm86 vaccine alone. This is best illustrated by the data in Fig 24 where the decrease in the average weight of eggs produced per animal per day is plotted against the Bm86 antibody titre of the individual cattle. For any given level of Bm86 antibodies, the presence of antibodies against the tick carboxypeptidase further decrease the average weight of eggs produced per tick.

It is obvious that presentation of the recombinant tick carboxypeptidase to the immune system is not yet optimal as the native tick carboxypeptidase provided protection whereas the recombinant tick carboxypeptidases have, not done so. The sera from cattle vaccinated with the recombinant tick carboxypeptidase has not inhibited the carboxypeptidase activity of the native enzyme. Therefore it is obvious that it is possible to further improve upon the effects observed in these preliminary trials by increasing the magnitude and the specificity of the immune response generated following vaccination with the recombinant forms of the tick carboxypeptidase.

Further routine work is necessary in order to optimise these effects of vaccination with both antigens. For example it is obvious that the low antibody responses to the tick carboxypeptidase which have been generated following vaccination limit the effects which can be anticipated. There are many means which are known in the art by which the efficacy of the recombinant tick carboxypeptidase can be further enhanced. These means include the optimisation of the conformation of the recombinant tick carboxypeptidase by optimising means to refold the antigen, further investigating the expression of the tick carboxypeptidase in other recombinant host cells including live viruses and bacteria, optimising the relative doses of the two antigens to minimise the antigen competition which is clearly apparent in these preliminary experiments, screening the range of adjuvants which are available to identify those which stimulate high levels of the appropriate immune response to the two antigens. These means are highly likely to increase the level of the immune responses to the two antigens and to increase the specificity of that immune response so that the native antigen is optimally recognised by that immune response and by that means increase the effects against ticks.

It is clear from these preliminary experiments that the inclusion of tick carboxypeptidase in a vaccine together with another antigen such as Bm86 will increase the efficacy of a vaccine containing that single antigen alone. These increased effects will result in greater utility of the tick vaccine in the field by further reducing the number of vaccinations required throughout the season, further reducing the requirement for application of acaricides to control the tick population and enhance the commercial utility of any tick vaccine.

Example 11 Carboxydipeptidase of Buffalo Fly as a Vaccine Candidate

A regime for the purification of such an enzyme from adult Buffalo Fly extracts was based on the hippuryl glycylglycine (HGG) assay of Ryan et al . 1977 , which is a routine means of detecting and measuring the activity of this class of carboxydipeptidase. Using this assay, it was apparent that unlike tick carboxypeptidase and the related mammalian ACEs, the buffalo fly activity was almost entirely soluble in the absence of detergents (94.5%), with the remainder of the activity detected in the membrane pellet of whole fly homogenates (Table 18). The purification procedure for this protein is schematically outlined in Figure 14, and was performed as described below.

Adult flies reared in the buffalo fly colony at the CSIRO Long Pocket Laboratories were collected into tubes and stored at -70°C until required. Prior to homogenisation, the frozen flies (100-120g) were placed into a sieve and washed in 70% ethanol (-20°C), distilled water (4°C) and lOOmM HEPES (pH 7.2). The mass of flies was deposited in 1200ml lOOmM HEPES (pH7.2) containing a cocktail of protease inhibitors (lμg/ml leupeptin, lμg/ml pepstatin and ImM phenylmethylsulphonyl fluoride) .

(Unless otherwise stated, all reagents were purchased from Sigma and chromatographic supports and equipment were supplied by Pharmacia) . The suspension was homogenised for 3 minutes (Ultra-Turrax, Janke and Kunkel, Staufen, Germany) and the resulting crude homogenate passed through nylon mesh to remove cuticular material. The homogenate was clarified by low speed centrifugation (900g, 20 minutes, 4°C), the supernatant decanted and the pellets re-extracted in 250ml HEPES buffer by further homogenisation. This material was also clarified by low speed centrifugation.

The supernatants of both centrifugation runs were pooled (1500ml), filtered through tissue paper to remove debris, and subjected to ultracentrifugation (235,000g, 30 minutes, 4°C) in 100ml heat-sealable tubes (Beckman) . The resulting solution was adjusted to contain 0.1% Brij 35, 2mM MnCl2 and 2mM CaCl2• Due to precipitation of some proteins caused by addition of the cations, the solution was clarified by filtration through a 0.8μ filter and immediately loaded onto a pre-equilibrated 5ml wheat germ lectin-Sepharose column which acted as a precolumn for a 20ml Concanavalin A (Con A)- Sepharose column. The solution was gravity fed onto the columns overnight (4°C) after which the Con A-Sepharose column was washed with 400ml HEPES buffer (lOOmM HEPES (pH 7.2) containing 0.1% Brij 35, cations and the protease inhibitor cocktail). Elution of this column was achieved overnight (4°C) with 0.5M a-methyl mannopyranoside in the HEPES buffer (lml/min) and the eluting material was immediately delivered onto a pre-equilibrated 20ml DEAE Sepharose column. Subsequently the DEAE Sepharose column was extensively washed with 400ml Tris buffer (50mM Tris (pH 7.5) containing 0.1% Brij 35 and the protease inhibitor cocktail) and 400 ml 0.1M NaCl in Tris buffer. The enzyme was eluted in 120ml of 0.2M NaCl in Tris buffer. Finally the column was washed in 1.0M NaCl in Tris buffer. The fractions were assayed for carboxydipeptidase activity using the HGG assay.

Fractions shown to contain this activity were pooled, concentrated and buffer exchanged into 50mM Tris (pH 8.5), 0.1% Brij 35 (Buffer A) using 15ml Centricon 30 devices

(Amicon) . The concentrate was loaded by FPLC onto a Mono Q column pre-equilibrated in Buffer A and the column subjected to a discontinuous gradient of lOmmol NaCl/min till 20% Buffer B (B = A + 1.0M NaCl) and 5mmol NaCl/min to 50% Buffer B. Protein elution was monitored at 280nm. Fractions (0.5ml) were assayed for enzyme activity and analysed by SDS-PAGE. Fractions containing a high level- of activity and a dominant protein species of 70kD were pooled, concentrated and buffer exchanged into 50mM Tris (pH 7.0). The concentrate was loaded onto a 30mm AX300 cartridge (Applied Biosystems Inc. , Foster City, CA) by FPLC. Elution was monitored at 280nm as the FPLC delivered a continuous gradient (5mmol/min) to 0.5M Nal in 50mM Tris (pH 7.0). Fractions (0.5ml) were collected and analysed as described above. Only those fractions containing high activity and limited protein complexity were pooled and refractionated. With these constraints, typically, 150-2OOμg carboxydipeptidase was isolated from 100-120g frozen whole flies.

Non-reducing SDS-PAGE analysis of the purified protein revealed a closely migrating doublet of 67kD, where the two components appeared to have a l-2kD size difference but were approximately equimolar according to staining intensity (Figure 15, track a). In reducing conditions the doublet migrated more slowly at approximately 70kD suggesting internal disulphide bonding (Figure 15, track b) and the 2 components were more difficult to resolve. Due to its apparent size in reducing SDS-PAGE, the enzyme was termed Hie70. To determine the extent of N-linked glycosylation, the reduced and denatured glycoproteins were digested with N- glycanase. Tick carboxypeptidase was similarly treated for the purposes of comparison. While the tick glycoprotein lost approximately 17kD (Figure 15, tracks e and f) as anticipated (Jarmey et al . 1994, Riding et al . 1994), the putative buffalo fly homologue was only reduced in size by 2.5 - 3kD. The deglycosylated buffalo fly carboxydipeptidase appeared to-Ae a slightly larger polypeptide than the tick counterpart.

To confirm the relationship of Hie70 to mammalian ACE and the arthropod carboxydipeptidase, a Western blot using ovine antiserum to Hie70 was performed on all three enzymes. As noted in Figure 15 (tracks g and h) , the antisera reacted strongly with the homologous antigen and tick carboxypeptidase and a weak reaction to the rabbit lung ACE was discernible. For further comparison of Hie70 to the ACE family of carboxypeptidases, the effect of classic inhibitors of this family on Hie70 activity was analysed. Hie70 was found to be susceptible to the three reagents tested: EDTA, ACE inhibitor peptide (pGlu-Trp- Arg-Pro-Gln-Ile-Pro-Pro) and captopril.- Activity was completely ablated at inhibitor:enzyme molar ratios of 1000:1, 50:1 and 1:1 respectively, demonstrating the efficiency of captopril as an inhibitor of this enzyme.

The exact relationship between Hie70 and its putative homologues can only be ascertained by comparison of their primary sequences. The N-terminal sequence of Hie70 was determined by direct microsequencing of the purified protein. Two sequences were obtained in near equimolar amounts and are clearly related to each other: Sequence 2 lacks the initial three residues of Sequence 1 (Figure 16). This sequence did not exhibit obvious similarity to the N-terminal sequences of its putative mammalian and tick counterparts. To obtain internal sequences, 50μg Hie70 was carboxyamidomethylated in 8M urea and digested with endo-Lys-C (Stone et al . 1989). Digestion products were resolved as described by Willadsen et al . (1989) and two of the peptides were amino acid sequenced.

Given the sequence ambiguity of peptide Hie#8, a similar region in the putative Hie70 homologues was not identified (Figure 16). However, the sequence of peptide Hie#6 could be aligned to a region near the N-termini of the mammalian ACE testicular sequences although there is little homology to tick carboxypeptidase at this site (Figure 16). The region is approximately 200 residues from the N-termini of the mature mammalian testicular polypeptides and 174 residues upstream of the tick carboxypeptidase N-terminus. The human and mouse endothelial ACE contain the same region of sequence beginning at residue 771 in the second catalytic domain of these enzymes (Soubrier et al . 1988; Bernstein et al . 1988). Reverse and forward PCR primers, primers 2 and 4 respectively, were made to this sequence (Figure 17). A forward PCR primer was also designed for the Hie70 N- terminal sequence (primer 3: Figure 17). A third site, highly conserved in all the ACE proteins including tick carboxypeptidase was selected as a second reverse primer site (Figure 17). In the single domain ACE polypeptides, this site is 75 residues upstream of the region exhibiting homology to peptide Hie#6. Primers were synthesized by a Oligo 100 DNA Synthesizer (Beckman Instruments, Fullerton, CA) to cover all degeneracies (Figure 17).

PCR was conducted on lOOng adult buffalo fly cDNA (prepared by Elvin et al . (1993)) in the presence of 0.5mM of each dNTP, lμg of forward and reverse primers, 4mM MgCl2 and 2.5 units of Amplitaq Tag polymerase (Cetus) taken to final volume of lOOμl with lOmM Tris-HCl (pH 8.3) containing 50mM KCl. The reactions were performed by a Bartelt GM10 temperature cycler (Bartelt Instruments, Melbourne, Australia) with 40 cycles of the following temperatures: 94°C (2.5 minutes), 60°C (2.5 minutes), 72°C(2.5 minutes). As outlined in Figure 17, PCR 1 incorporated primers 1 and 4, PCR 2 used primers 1 and 3 whereas PCR 3 required primers 2 and 3. The reaction products were resolved by agarose gel electrophoresis using 2% agarose (Pharmacia) dissolved in TBE (90mM Tris- borate, 2mM EDTA pH 8.0) containing 0.5μg/ml ethidium bromide. All the PCRs on the buffalo fly cDNA gave rise to at least one product. PCR 1 generated a single dominant species of approximately 250bp, PCR 2 produced many species with two dominant products of 180bp and 750bp while PCR 3 yielded a major species of 500bp (Figure 18). Due to the apparent specificity and product of anticipated size, the PCR 1 fragment (250bp) was resolved on a 2% agarose gel in TAE buffer, visualised and excised. The DNA fragment was purified with the Gene Clean II kit (BIO 101 Inc., La Jolla, CA) as per the manufacturer's instructions and ligated into the pGEM T vector (Promega) using T4 DNA ligase (Boehringer) as per the manufacturer's instructions. Processing of recombinant clones and subsequent DNA sequencing was conducted as described by Elvin et al . (1993). The DNA sequence and its translation are presented in Figure 19A and the homology of the predicted protein sequence to other ACE molecules is highlighted in Figure 19B. This region of the predicted Hie70 polypeptide has similarity to the testicular mammalian ACEs with 45-47% amino acid identity whereas there is 34% identity with tick carboxypeptidase. Having verified the PCR 1 product was most likely to have arisen from a Hie70 cDNA, the fragment was used to screen a buffalo fly Igtll cDNA library. The cDNA library was prepared from adult buffalo fly cDNA (Elvin et al . (1993) and cloned into Igtll using the Amersham Igtll cloning system. The library contained 10^ independent clones before being amplified to 10^ pfu.

The PCR 1 fragment was labelled with digoxigenin (DIG) by incorporation of DIG-dUTP (Boehringer) in a PCR 1 conducted through 40 cycles of 94°C (2.5min), 55°C

(2.5min) and 72°C (2.5min) by an Omnigene Temperature Cycler (Hybaid, Middlesex, UK). An aliquot (5 x 10⁵) of the Igtll cDNA library was plated out and duplicate nylon filter (Amersham) lifts prepared from each plate. The filters were prehybridised for 4 hours at 40°C in 50% formamide, 2% blocking agent (Boehringer), 0.1% N-lauryl sarcosine, 0.02% SDS in 5xSSC. Hybridisation was conducted overnight in the same conditions with the solution containing preboiled DIG labelled PCR 1 fragment. Subsequently the filters were briefly rinsed at RT in 2xSSC (0.1% SDS) and subjected to 15 minute washes at 68°C in O.lxSSC (0.1% SDS) followed by a blocking step in 0.1M maleic acid (pH 7.5) containing 1% Boehringer blocking agent and 0.3% Tween 20. The filters were probed with anti-DIG alkaline phosphatase conjugate (Boehringer) diluted 1:10,000 in the blocking solution at RT (30 minutes), briefly rinsed and then reacted with a filtered solution of 0.2% Fast Violet, 0.1% naphthol AS phosphate in 50mM Tris (pH 8.5). The primary screen detected 150 positive plaques and 30 were picked for further screening. Five clones were continued to tertiary screening and purified phage DNA prepared from three of these clones (H2, H3 and H5) .

Attempts to excise the insert from the EcoRl cloning site failed and similarly attempts to amplify the insert using primers flanking the cloning sites did not yield any product. To ascertain that these clones did contain cDNA encoding the Hie70 polypeptide, the three Hie70 PCRs were conducted on the clones. All three clones gave rise to products of predicted size in each reaction (Figure 20). As anticipated, PCR 1 produced fragments of 250bp from each clone and it is likely that this DNA is very similar if not identical to the fragment used to screen the library. PCR 2 generated a 750bp fragment from all 3 Igtll clones and in concordance with the first two reactions, PCR 3 produced 500bp fragments from the clones (Figure 20). The PCR 2 fragment of the H2 clone was purified (as described above) and ligated into pGEM T vector to allow DNA sequencing. The DNA sequence encodes a polypeptide commencing at the N-terminus of the mature Hie70 protein (Figure 17) to the site of peptide Hie#6

(Figure 21) confirming the specificity of the PCR primer set (Hie70 primers 1 and 3). Comparison of the predicted amino acid sequence to the Hie70 homologues are presented in Figure 22. As with tick carboxypeptidase, conservation to the mammalian ACEs is very limited in this region with only 23-25% identity with the testicular forms and likewise identity with tick carboxypeptidase is a low 20%. The sequence of the Hie#8 peptide is also located in this fragment, its alignment commencing at residue 57 (Figure 22). Having demonstrated that the carboxydipeptidase activity detected in buffalo fly preparations was due to a tick carboxypeptidase related enzyme, its efficacy as a vaccine antigen against buffalo flies was assessed in a trial conducted in sheep. A group of 6 merino wethers were immunised (i.m.) with 20μg Hie70 in Freund's Complete adjuvant (FCA, Sigma) and 4 and 12 weeks later boosted (i.m.) with 25 and 15μg Hie70 respectively in Incomplete FCA (Sigma). A second group of control animals were similarly treated with immunisations of PBS. ELISAs were conducted to follow development of antibody to Hie70. The assay was performed as described by Wijffels et al . 1994 using Hie70 at lμg/ml as the antigen. The antibody titres of sera collected from controls and Hie70 vaccinates at week 0, (prebleed) , week 5 (1 week post-boost) and week 13 were assessed (Figure 23). The data indicates that all vaccinates responded to immunisation and the first boost however response to the second boost at week 12 was variable. Only two animals maintained high titres whereas the titres of the remaining 4 sheep all dropped by week 13 (Figure 23). The anti-fly effects of antibody raised to Hie70 was determined by an in vitro feeding assay (Allingham et al . 1994). At week 13 (1 week after the final boost), 200ml blood was collected from each animal by venipuncture into Schott bottles containing 2000 units heparin (CSL) . Gentamycin (Sigma) was added later at

15mg/dl blood and the blood stored at 4°C. Samples of the bloods were dispensed daily (over 12 days) to quadruplicate containers of twenty female flies. At the end of this period the % mortality and egg output of the flies was recorded (Table 19). The data has shown a small increment (5%) in average fly mortality (%) and a decrease in average egg output of the flies fed on the Hie70 vaccinate blood. The egg output has fallen by 27% (3.7mg) compared to the egg output achieved from flies feed on the blood of the control animals. EXAMPLE 11 Industrial Scale

The process for the culture of the recombinant organisms in fermenters and for the purification of the tick carboxypeptidase expressed by those organisms can be carried out at large scale to provide many millions of doses of the vaccine for widespread use within the tick endemic areas of the world. INDUSTRIAL APPLICABILITY

The present invention has application in the generation of vaccines for providing protection against tick infestation and diseases transmitted as a result thereof.

TABLE 1. VACCINATION WITH PARTIALLY PURIFIED ANTIGENS AND PURIFIED, NATIVE Bm86.

TABLE 2. VACCINATION OF CATTLE WITH GF5,6 WGL+ AND WGL-.

Results the means of 10 days' counts. The egg ratio was the mean of 3 estimates.

TABLE 3. VACCINATION OF CATTLE WITH GF5,6 AND CHALLENGE WITH LAMINGTON TICKS.

SUBSτrrUTE SHEET (Rule 26) TABLE 4.VACCINATION OF CATTLE WITH GF 5,6 WGL- AND GF 4 WGL-.

TABLE 5.VACCINATION OF CATTLE WITH GF 5,6 WGL- AND GF 4 WGL-.

TABLE 6. ANTIBODY TITRES TO PLFL Bm86 BEFORE AND AFTER VACCINATION.

N.D. = not done. A titre of less than 100 was considered negative.

TABLE 7. DAMAGE TO ΗCKS BY ANTIBODY TO Bm86, GF5,6 POOL 1 AND COMBINATIONS OF THE ANTIBODY.

TABLE 8.VACCINATION OF CATTLE WITH ANTIGEN Bm91

SUBSTITUTE SHEET (Rule 2b TABLE 9. VACCINATION OF CATTLE WITH ANTIGEN Bm91

TABLE 10. ANTIBODY TITRES TO THE PLFL Bm86 ANTIGEN

Reference serum 50.000 a Serum before first vaccination b Serum immediately prior to firs: tick infestation c Serum 25 days after first larval infestation Serum after termination of adult female tick drop

TABLE 11. SEQUENCES OF Bm91 PEPTIDES

T9126 (K)XRXTIFTGETPFQK

T9131 (K)LREIYPG

T9118 (K)SAWLSDYETEDMTEIVDK

T91251 (K)LLQTWLAHNAVG^'PAIX

- T9109 (K)NEVVGWDK

T9119 (K)LWEDLSPLYK

T91141 (K)QYYIPYIK

T91081 (K) Y Y E P L E K

T9129 (K)YNAVDFGYMSDK

(K)IAFLPLLLLLALD

The (K) in brackets are assumed, based on the specificitv of endoproteinase lvs C.

In the positions marked X, a residue could not be assigned with confidence.

Peptide T9129 gave two sequences in approximately equimolar propoπions. so all positions are ambiguous.

TABLE 12.

Oligonucleotides Primers Used in PCR Experiments

§

LEGEND: IUPΛC code used for nucleotides, I = inosine

TABLE 13.

Fragments Amplified in PCR Experiments

SUBSTTΠJIΈ SHEET (Rule 26) Table 14. Differences Between Bm91 DNA and Amino Acid Sequences from Various Tick Clones.

Note* : U numbers correspond to' the sequence in Fig. 6

: * Iramβ-shllt mutations that prevent translation ol the complete Bm91 protein

: 7 the sequence of the clone was not determined in this region

: © the extra nucleotide In clone 4UI occurs between bases 1611 and 1612 in the sequence on Fig. 6

: • nucleotide not present In this clone

: nt nucleotide

: aa amino acid encoded by codon at this site

: nucleotides & amino adds shown in bold type differ from the sequence presented In Fig. 6

Table 15. Oligonucleotide Primers For Buf falo Fly PCR Experiment

Primer Sequence Strand

A055/501 5' - GCGAATTCCTGYTRGGGAACATGTGGGC - 3' sense

A055/502 5' - GCGGATCCGTGGCCCATYTCRTGGTG antisense

IϋPAC code used for degenerate positions in the primers. Restriction sites to facilitate cloning are underlined.

CΛ Bm91 specific sequences are overlined.

§ CΛ vo o

Table 16. Oligonucleotide Primers for Generation of Fragments for Expression of Bm91

A089/501

Nhθl 5' TCGTAGCTAGCATATAATAATgGCTGCTCGACCGGGATCG

A089/505

BamHl Sail 5¹ GAAGGATCCGTCGACAACTTCGACACCTAC 3'

A061 /502

5' TGAGACTGGTCGCATTCT 3 '

A089/503

5' GAATGCGACATTTACGGAGAGAAGAACGC 3 '

A089/5Q4

BamHl 5' GATTGGATCCTCATTATGAAAAATCAACCTTGTTGGC 3 '

A089/502

BamHl

5' GTCAGGATCCTΓAIQATAACGAGATGTΠTTCCAGC 3* Table 17. List of Plasmlds arid Strains

Table 18. Monitoring the enrichment of Hie 70 in the early preparative steps of the purification procedure (see text). Activity was assessed by the HGG assay of Ryan et al. 1977. The material eluted from the DEAE column with the 0.2M NaCl buffer was further fractionated by anion exchange.

Controls

Table 19. Average %fly moπality and average egg output (mg) of adult female buffalo flies fed on the blood of individual sheep collected 7 days post-boost with PBS in FICA (controls) or 15μg Hie70 in FICA (vaccinates). Four (4) pots of 20 female flies were set up for each animal. The in vitro assay was performed as described by Allingham et al. 1994.

SUBSTTTUTΈ SHEET (Rule 26) References;

Opdebeeck, J.P., Wong, J.Y.M., Jackson, L.A. and Dobson, C. (1988a). Vaccines to protect Hereford cattle against the cattle tick Boophiluε micropluε . Immunology 63, 363- 367.

Opdebeeck, J.P., Wong, J.Y.M., Jackson, L.A. & Dobson, C. (1988). Hereford cattle immunized and protected against Boophilus microplus with soluble and membrane-associated antigens from the midgut of ticks. Parasite Immunology 10, 405-410.

Rand K.N., Moore T., Sriskantha A., Spring K., Tellam R. , Willadsen P. & Cobon G.S. (1989) Cloning and expression of a protective antigen from the cattle tick Boophiluε micropluε . Proceedingε of the National Academy of Scienceε U. S.A. 86, 9657.

Willadsen P. & Kemp D.H. (1988) Vaccination with 'concealed' antigens for tick control. Paraεitology Today 4, 196. Willadsen P., McKenna R.V. & Riding G.A. (1988) Isolation from the cattle tick, Boophiluε micropluε , of antigenic material capable of eliciting a protective immunological response in the bovine host International Journal for Paraεitology 18, 183. Willadsen P., Riding G.A., McKenna R.V., Kemp D.H., Tellam R.L., Nielsen J.N., Lahnstein J., Cobon G.S. & Gough

J.M.(1989). Immunologic control of a parasitic arthropod. Identification of a protective antigen from Boophilus microplus Journal of Immunology 143, 1346. Dhadialla, T.S., Rutti, B. and Brossard, M. (1990) Parasitol . Res . 7JL, 536-539.

Goodno, C.C., Swaisgood, H.E. and Catignani, G.L. (1981) A fluorometric assay for available lysine in proteins. Analytical Biochemistry 115, 203-211. Jackson, L.A. and Opdebeeck, J.P. (1989) Immunology 68. 272-276. Johnston, L. A. Y. , Kemp, D. H. and Pearson, R.D. (1986) Immunisation of cattle against Boophiluε microplus using extracts derived from adult female ticks: effects of induced immunity on tick populations. Int . J. Paraεitol . 16, 27.

Jongejan, F., Pegram, R.G., Zivkovic, D., Hensen, E.J., Mwase, E.T., Thielemans, M.J.C, Cosse, A., Niewold, T.A., El Said, A., and Uilenberg, G. (1989) Monitoring of naturally acquired and artificially induced immunity to Amblyomma variegatum and Rhipicephaluε appendiculatuε ticks under field and laboratory conditions. Exp. and App. Acarology 7, 181-199.

Layne, E. (1957) Spectrophotometric and turbidimetric methods for measuring proteins. Methods in Enzymology 3., 447-454.

Lee, R.P. and Opdebeeck, J.P. (1991) Immunology 22, 121-

126.

Lipman, D. J., and Pearson, (1985) Science, 227. 14351-

441. Nyindo, M., Essuman, S. and Dhadialla, T.S. (1989) Immunization against ticks: Use of salivary gland antigens and infestations with Rhipicephaluε appendiculatuε . J. Med. Entomol . 26, 430. Opdebeeck, J.P., Wong, J.Y.M. and Dobson, C. (1989). Immunol . £7, 388.

Saichi, R.K., Gelfand D.H., Stoffel S. Scarf S.J., Higuchi R., Home, G.T., Mullis, K.B., and Erlich, H.A. , (1988) Science 239: 487-491. Thorne, C.J.R. (1978) Techniques for determining protein concentration in Techniques in Protein and Enzyme Biochemistry B104, pp 1-18, Elsevier/North Holland, Amsterdam.

Varma, M.G.R., Heller-Haupt, A., Trinder P.K.E., and Langi, A.O. (1990) Immunology 21, 133-138. Viets, J.W. , Deen, W.M., Troy, J.L. and Bremner, B.M. (1978) Determination of serum protein concentration in nanoliter blood samples using fluorescamine or o- phthaldehyde. Analytical Biochemistry 88, 513-521.

Willadsen, P. and McKenna, R.V. (1991) Parasite

Immunology. In press. Wong, J.Y.M. and Opdebeeck, J.P. (1990) Paraεite

Immunology 12., 75-83.

Allingham, P.G., Muller, M.J., Kerlin, R.L. and Standfast,

H.A. (1994). Optimisation of survival of the buffalo fly

(Haematobia irritanε exigua) in in vitro and in vivo assays. Med, Vet . Entomol . (submitted).

Bernstein, K.E., Martin, B.M., Edwards, A.S. and Bernstein

E.A. (1988). Mouse angiotensin-converting enzyme is a protein composed of two homologous domains. J. Biol . Chem. 161, 11945-11951. Elvin, CM., Whan, V. and Riddles, P.W. (1993). A family of serine protease genes expressed in adult buffalo fly

(Haematobia Irritanε exigua) . Mol . Gen . Genet . 240, 132-

139.

Howard, T.E., Shai, S.Y., Langford, K.G., Martin, B.M. and Bernstein, K.E. (1988).. Transcription of testicular angiotensin-converting enzyme (ACE) is initiated within the 12th intron of the somatic ACE gene. Mol . Cell . Biol .

10., 4294-4302.

Kumar, R.S., Kusari. J. , Roy, S.N., Soffer, R.L. and Sen, G.C (1989). Structure of testicular angiotensin- converting enzyme. A segmental mosaic isozyme. J. Biol .

Chem. 2_64_, 16754-16758.

Lattion, A.L., Soubrier, Allegrini, J., Hubert, C,

Corvol, P. and Alhenc-Gelas, F. (1988). The testicular transcript of the angiotensin I-converting enzyme encodes for the ancestral, non-duplicated form of the enzyme.

FEBS Lett . 2_5_2., 99-104.

Ryan, J.W. , Chung A., Ammons, C. and Carlton, M.L. (1977).

A simple radioassay for angiotensin-converting enzyme. Biochem. J. 167., 501-504. Soubrier, F., Alhenc-Gelas, F., Hubert, C, Allegrini, J., John, M. , Tregear, G. and Corvol, P., (1988). Two putative active site centres in human angiotensin I- converting enzyme revealed by molecular cloning. P. N.A. S. £5_, 9386-9390.

Stone, L.S., LoPresti, M.B., Crawford, J.M. , DeAngelis, R. and Williams, K.R. (1989). Enzymatic digestion of proteins and HPLC peptide isolation in A" practical guide to protein and peptide purification for microsequencing" (Ed. P.T. Matsudaira) . Academic Press Inc., New York, pp 42-43.

Wijffels, G., Salvatore, L., Dosen, M. , Waddington, J., Wilson, L., Thompson, C, Campbell, N., Sexton, J., Wicker, J., Bowen, F., Friedel, T. and Spithill, T.W. (1994). Vaccination of sheep with purified cysteine proteinases of Fasciola hepatica decreases worm fecundity. Exp. Paraεitol . JL, 132-148.

PCT/AU87/00401: WO 87/06590 Bioenterprises Pty. Ltd PCT/AU87/00107. Biotechnology Australia Pty. Ltd and CSIRO.

Claims (25)

CLAIMS : -

1. An antigenic preparation for use in raising antibodies in an organism, the antigenic preparation comprising a carboxypeptidase having substantially the

5 amino acid sequence recited in Figure 6, or a homologue thereof or an active fragment thereof.

2. An antigenic preparation as claimed in claim 1 in which the preparation comprises tick carboxypeptidase derived from B. micropluε .

10 3. An antigenic preparation as claimed in claim 1 or claim 2 in which the tick carboxypeptidase is substantially free of other tick proteins, peptides and carbohydrates.

4. An antigenic preparation as claimed in claim 1 in 15. which the tick carboxypeptidase, a homologue thereof or active fragment thereof is produced recombinantly.

5. An antigenic preparation for use in raising antibodies in an organism, the antigenic preparation comprising an antigen, wherein the antigen reacts with an

20 antibody raised against a parasite carboxypeptidase.

6. An antigenic preparation as claimed in claim 5 in which the parasite carboxypeptidase is tick carboxypeptidase.

7. An antigenic preparation as claimed in claim 6 in

25 which the tick carboxypeptidase has an amino acid sequence substantially as shown in Figure 6.

8. An antigenic preparation as claimed in any one of claims 1 to 7 in which the preparation further includes tick antigen Bm86. 0

9. A polynucleotide molecule, the polynucleotide encoding tick carboxypeptidase, a homologue thereof or an active fragment thereof.

10. A polynucleotide as claimed in claim 8 in which the polynucleotide is DNA. 35

11. A polynucleotide as claimed in claim 8 or claim 9 in which the polynucleotide is cDNA.

12. A polynucleotide as claimed in claim 8 in which the polynucleotide encodes a tick carboxypeptidase homologue, the nucleotide having a sequence as shown in Figure 9.

13. A recombinant DNA molecule comprising the polynucleotide as claimed in any one of claims 8 to 12 and vector DNA.

14. A transformed host cell, the transformed host cell containing at least one recombinant DNA molecule as claimed in claim 13.

15. A synthetic polypeptide, the synthetic polypeptide corresponding to all or part of tick carboxypeptidase or a homologue of tick carboxypeptidase, which synthetic polypeptide, when administered to an individual in a vaccine, induces protective immunity in the vaccinated individual against infestation by at least one parasitic tick, insect or nematode species.

16. A vaccine comprising the antigenic preparation as claimed in any one of claims 1 to 8 or a transformed host cell as claimed in claim 14 or a synthetic polypeptide as claimed in claim 15 together with at least one pharmaceutically or veterinarily acceptable carrier, diluent, excipient or adjuvant.

17. A process for the preparation of tick carboxypeptidase, which process comprises: homogenising young adult ticks to produce a homogenate; centrifuging the homogenate to obtain a membrane pellet; extracting the membrane pellet with detergent, such as with NP40 to provide a pellet extract; chromatographing the pellet extract on a size exclusion column such as a Sephacryl S 300 column to produce a high molecular weight fraction; extraction of that material with a detergent such as Zwittergent 3-14 to provide a detergent extract; fractionation of the detergent extract by preparative isoelectric focussing and collecting material with a pi of between 4.8 and 5.7; fractionation of the material by HPLC gel filtration and collecting material eluting with similar elution times to ferritin and bovine serum albumin under the conditions described; fractionation of the extracts on a lectin affinity column, such as a lentil lectin or wheat germ lectin affinity column, to extract lectin binding glycoproteins; and optionally, further purifying the antigens of interest by applying the eluted antigens to HPLC gel filtration columns in a detergent such as CHAPS or SDS to obtain size fractionated antigens.

18. A process for the preparation of a vaccine as claimed in claim 16, the process comprising admixing an antigenic preparation as claimed in any one of claims 1 to 8, or a recombinant host cell as claimed in claim 14, or a synthetic polypeptide as claimed in claim 15, with at least one pharmaceutically or veterinarily acceptable carrier, diluent, excipient or adjuvant.

19. A method of protecting an individual against infestation by at least one parasitic tick, insect or nematode species, the method comprising administering to the individual an effective amount of the vaccine as claimed in claim 16.

20. An antibody directed against the antigenic preparation as claimed in any one of claims 1 to 8.

21. An antibody composition comprising at least one antibody as claimed in claim 20 admixed with at least one pharmaceutically or veterinarily acceptable carrier, diluent or excipient.

22. A method of passively vaccinating an individual in need of such treatment against a parasitic tick, insect or nematode species, the method comprising administering to the individual an effective amount of at least one antibody as claimed in claim 20 or an effective amount of the antibody composition as claimed in claim 21.

23. A process for the preparation of a recombinant DNA molecule as claimed in claim 13, the process comprising inserting at least one polynucleotide molecule as claimed in claim 8 into vector DNA.

24. A process for the preparation of a transformed host cell as claimed in claim 14 in which the process comprises making a host competent for transformation and transforming the competent host with at least one recombinant DNA molecule as claimed in claim 13.

25. A process for the biosynthesis of a tick carboxypeptidase, homologue thereof or an active fragment thereof, the process comprising providing a transformed host as claimed in claim 14, culturing the host under suitable conditions to obtain an expression of the tick carboxypeptidase, homologue thereof, or active fragment thereof and collecting the tick carboxypeptidase, homologue thereof, or active fragment thereof from the transformed host.