AU725236B2 - Novel prodrugs and system including such prodrugs - Google Patents

Description

I

F

AUSTRALIA

Patents Act COMPLETE SPECIFICATION

(ORIGINAL)

Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: 0r 0* 0 .4 4 *c

V.

Name of Applicant: Cancer Research Campaign Technology Limited Actual Inventor(s): Gillian Anlezark Roger Melton Roger Sherwood Thomas Connors Frank Friedlos Michael Jarman Richard Knox Anthony Mauger Caroline Joy Springer Address for Service: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: NOVEL PRODRUGS AND SYSTEM INCLUDING SUCH PRODRUGS Our Ref 501260 POF Code: 1324/226640 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): -1la NOVEL PRODRUGS AND SYSTEM INCLUDING SUCH PRODRUGS The present application is a divsional application of accepted patent application 27769/92, the entire contents of which are herein incorporated by reference.

This invention relates to the control of neoplastic tissue growth and is particularly concerned with the provision of new prodrugs that can be converted into antitumour agents.

Accepted application 27769/92 describes a novel nitroreductase enzyme and method for the production of this enzyme. Throughout this application, accepted application 27769/92 shall be referred to as the "parent application" and the invention claimed in the "parent application" shall be referred to as the "parent invention".

The alkylating agent 5-(aziridin-l-yl)-2, 4-dinitrobenzamide (hereinafter designated CB 1954) has been known, almost for 20 years, as an interesting experimental compound of unique selectivity. Although CB 1954 is structurally quite closely Srelated to numerous other known alkylating agents which have a relatively broad 20 range of activity, CB 1954 exhibits considerable activity against the Walker tumour cells in vivo or in vitro but was thought to be virtually inactive against other tumours.

It was recently discovered that the selectivity of CB 1954 arose from the fact that it was not an anti-tumour agent per se but was a prodrug for an anti-tumour agent generated from CB 1954 by a nitroreductase enzyme fround in the Walker cell.

This nitroreductase from the Walker cell was subsequently shown to be an enzyme know from other sources which was an NAD(P)H dehydrogenase (quinone) classified as EC.1.6.99.2, see Robertson et al, J. Biol. Chem. 261, 15794-15799 (1986).

In the course of the previous investigations with CB 1954, it was found that the Walker cell enzyme EC.1.6.99.2 had the ability to reduce the 4-nitro group of CB C:\WINWORDOJANELLE\SPECIl7769DIV.DOC lb 1954 to the corresponding hydroxylamine and that it was the resulting 1-yl)-2-nitro-4-hydroxylamino-benzamide that was the active anti-tumour agent.

The use of prodrugs represents a clinically very valuable concept in cancer therapy since, particularly where the prodrug concept in cancer therapy since, particularly where the prodrug is to be converted to an anti-tumour agent under the influence of an enzyme that is linkable to a monoclonal antibody that will bind to a tumour associated antigen, the combination of such a prodrug with such an enzyme monoclonal/antibody conjugate represents a very powerful clinical agent.

THE PARENT INVENTION By way of providing background to the invention of this application, we provide the following discussion of the parent invention. The parent application discloses new nitroreductase, obtainable from bacterial sources, that are of interest in that not only are they capable of converting CB 1954 into an active anti-tumour agent, but also, unlike EC.1.6.99.2, capable of converting CB 1954 analogues which are also prodrugs into active anti-tumour agents.

20 DESCRIPTION OF THE DRAWINGS Figure 1 shows the results of an experiment in which CB 1954 (100uM) and reduced cofactor (500p.M) were incubated with enzyme (2mg/ml) E. coli nitroreductase or 25pg/ml Walker DT diaphorase in 10mM sodium phosphate buffer (pH7) in air at 370C. At various times aliquots (10pl) were injected onto a Partisil SCX (240 x 4.7mm) HPLC column and eluted isocratically (2ml/min) with 100mM NaH 2

PO

4 The eluate was continously monitored for absorption at 320, 260 and 360 nm and the concentration of CB 1954 calculated by integration of the peak corresponding to this compound on the HPLC trace.

Figure 2 shows the formation of actinomycin D (AMD) during incubation of an AMD prodrug with a nitroreductase of the parent invention.

C:\WINWORDJANELLE\SPECI2776901V DOC Figure 3 shows the formation of mitomycin C (MC) during incubation of an MC prodrug with a nitroreducatase of the parent invention.

Figure 4 shows the binding in vitro of an antibody-enzyme conjugate according to the invention to cells.

The parent invention provides a nitroreductase, obtainable from a bacterium having the following characteristics as exemplified by examples isolated from Escherichia coli B and Bacillus amyloliguifaciens: 1. It is a flavoprotein having a molecular weight in the range 20-60 kilodaltons; 2. It requires either NADH or NAD(P)H or analogues thereof as a cofactor.

3. It has a Km for NADH or NAD(P)H in the range 1- 1 00pM.

4. It is capable of reducing either or both nitro groups of CB 1954 and analogues thereof to a cytotoxic form eg the hydroxylamine.

The nitroreductase of the parent invention occur naturally within the cells of E. coli B, E. coli C and other E. coli strains eg K12 type as well as other gram negative organisms eg Thermus aquaticus, and gram positive bacteria such as Bacillus amyloliquifaciens and Bacillus caldotenax. They can be recovered from such cells by disrupting the cells and subjecting the cell contents to chromatographic separation and isolating the nitroreductase.

C

For example, the nitroreductase of the parent invention from E. coli B has been purified to homogeneity see Table 1 and has been subjected to amino acid sequence analysis with the results set out in Table 2. The upper sequence shows the deduced amino acid sequence of the 219-mer nitroreductase obtained from Salmonella typhimurium as described by Watanabe et al, Nucl. Acids, Res.

CCkWINWORDQANELLESpECIV7769DIV.DOC 18, 1059 (1990). The lower sequence in bold type shows the sequence of the cyanogen bromide fragments of the E. coli B nitroreductase as an example of the parent invention showing a certain degree of homogeneity but sufficient differences to confirm that it is nitroreductase that is different from that of Watanabe et al and the recently described Enterobacter cloacae nitroreductases, see Bryant et al, J. Biol Chem. 266, 4126 (1991) or the Walker cell nitroreductase and is a previously unreported enzyme.

The amino acid sequence of the E. coli B nitroreductase of the parent invention can also been derived from sequencing the nucleotides in the nitroreductase gene and these sequences are set out below in Table 3. The nucleotide sequence of Table 3 has been used to prepare the attached sequence listings.

Using the information in Table 3, a nitroreductase according to the parent invention may be prepared by expressing DNA encoding the nitroreductase in a suitable expression vector contained in a host cell and recovering the nitroreductase. The expression vector may be, for example, a bacterial, yeast, insect or mammalian expression vector and the host cell will be selected to be compatible with the vector.

S: 20 As disclosed in the parent application, the new enzymes of the parent invention The interest in the present approach resides in the fact that the cytotoxicity of are capable of reducing a nitro group in various substrate molecules and we have found that the enzymes are particularly useful in their ability to reduce the nitro group of various p-nitrobenzyloxycarbonyl derivatives of cytotoxic compounds to give "self-immolative" compounds that automatically decompose to release cytotoxic compounds.

The interest in the present approach resides in the fact that the cytotoxicity of various cytotoxic compounds containing amino or hydroxy substituents, particularly aromatic amino or hydroxy substituents give rise to pnitrobenzyloxycarbonyl derivatives of the amino or hydroxy group which exhibit considerably less cytotoxicity than the amino or hydroxy parent compound. Thus, it is possible to use the p-nitro-benzyloxycarbonyl derivatives as prodrugs in a C:\WINWORDUANELLE\SPECI7 7 j 6 BIV DOC system of the type discussed above where the prodrug is converted into an anittumour agent under the influence of an enzyme that is linkable to a monoclonal antibody that will bind to the tumour associated antigen.

THE PRESENT INVENTION Accordingly, the present invention provides new compounds of the general formula: 10 R -NH-CO.O.CH2- 2 N O 2

I

and: C:kWINWORDJANELLESPECIU7769DIV 93/08288 VCF/1GI92/O 19417

R

2 CO.Q. N02 where R' and R 2 are groups such that the compound

R'NH

2 and R 2 0H are cytOtOXic compounds.

It is preferred that compounds

R'NH

2 and R 2 OH are aromatic Cytotoxic compounds and the compounds

R'NH

2 can be any one of the well known nitrogen mustard compounds, for example based on P-phenylene diamine. Thus, the compound R'NHi 2 can be: (ClCH 2

CH

2 2N NE2

III

or analogues of this compound with the general structure

IV

(ClCH 2

CH

2 2 N

NH

2 I where R' and R" are H, F or CH 3 and particularly where R. H and R"

=CH

3 20 -or R' CHI and R=H;_ or R' Hand R"

=F;

or =C F and R"

=H.

A further type of amino cytotoxic compound that can be used in accordance with the present invention are compounds such as actinomycin D, doxorubicin, daunomycin and mitomycin C. The structure of the pro-drugs derived from actinomycin

D,

doxorubicin and mitomycin C are shown below as V, VI and VII respectively.

93/08288 l'ClI/(. 1192/0) 19417 6- -MeVa L.

Sar P ro D-VaI Thr

CO

0 3 D-V'a I 71r, (0) NliCO0CH

G

0 Ori q a 2 NO2 tH2 C H 3 14COOCH. NO2 7 Similar p-nitrobenzyloxy derivatives can be made at the amino substituent of other actinomycins and of the other cytotoxic compounds of the type mentioned above.

In addition to forming p-nitrobenzyloxycarbonyl derivatives at an amino group on a cytotoxic compound, similar derivatives can be made at a hydroxy group, particularly a phenolic hydroxy group of a cytotoxic compound. Here, attention is directed at the phenolic nitrogen mustard compounds, and a specific compound of the invention of ths type is of the formula:

(CICH

2

CH

2 2 N -O.CO.O.CH 2

N

2

VII

As disclosed in the parent application, the new enzymes of the parent invention are capable not only of reducing at least one of the nitro groups of CB 1954 but also at least one the the nitro groups of certain CB 1954 analogues, eg descarboxamido CB 1954 (1-aziridin-1-yl-2,4- dinitrobenzamide known as CB 1837) and N, N-dimethyl CB 1954 [N,N-dimethyl-(5-aziridin-1-yl-2,4dinitrobenzamide also known as CB 10-107]. The new enzymes of the parent invention are also capable of reducing the nitro groups of other aromatic nitro 20 compounds such as 5-chloro-2,4-dinitrobenzamide, 3,5-dinitrobenzamide, 3nitrobenzamide, 4-nitrobenzamide and 5-nitro-2-furaldehydesemicarbazone (nitrofurazone).

The present invention also provides hydroxylamino derivatives of the general 25 formula X:

X

Y

x 2

X

X

X

C \WINWORDUANELLE 5PECI7769OIV DOC -8wherein X 1 and X 2 which may be the same or different, are each NHOR 5 or NO 2 with the proviso that X 1 and X 2 are not both NO 2 where R 5 is H or a carboxylic acid or hydrocarbyl group containing up to 6 carbon atoms. By acyl group, we mean a carboxylic acyl group R4CO where R 4 is a hydrocarbyl group containing 1 to 6 carbon atoms, e.g. an alkyl, alkenyl or phenyl group. The hydrocarbyl group

R

5 can be a C 1 6 alkyl, alkenyl or phenyl group. Y is H or CON(CH 3 2 In the compounds of formula X containing two hydroxylamino groups, the group R can be the same or different but will normally be the same.

As mentioned above, the new p-nitrophenylbenzyloxy compounds of the invention of formulae I and II are of interest in that they have a reduced cytotoxicity compared to that of the cytotoxic compound R'NH 2 or R 2 OH from which they are derived and they are o.

t oo ft 1I ln- 9 cabable of acting as a substrate for the nitroreductase of the parent invention. It is believed that the nitro group of the p-nitrophenyl-benzyloxy-carbonyl residue is converted to the corresponding amino or hydroxylamino group and that the resulting p-aminobenzyloxy-carbonyl or p-hydroxyl-aminobenzyloxycarbonyl compound automatically degrades under the reaction conditions used for the enzymatic reduction to release the cytotoxic compound and form p-aminobenzyl alcohol or p-hydroxylaminobenzyl alcohol and carbon dioxide as by products in accordance with the following reaction shceme:

R-NH-CO..CHNO

2 nitroreductase Rt NH-CO.O.CH z-NH 2 1

NH

2

+CO

2 +HO.CH2-

NO

2 The p-nitrobenzyloxycarbonyl compounds of the invention are conveniently prepared by methods of chemcial synthesis known per se. For example, the amine or hydroxy cytotoxic compounds can be reacted with 4-nitrobenzyl chloroformate under anhydrous conditions in the presence of a hydrogen chloride 20 aceptor, particularly an alkylamine such as triethylamine. This reaction can be carried out in a dry organic solvent such as chloroform and the resulting compound of the invention of formula I or formula II isolated from the organic sovent by conventnal meds such as chromatography solvent by conventional methods such as chromatography.

-9a The new compounds of the present invention X will normally be prepared by subjecting the corresponding dinitro compound wherein X 1 and X 2 which may be the same or different, are each NHOR 5 or NO 2 with the proviso that X 1 and X 2 are not both NHOR 5 to the action of the new nitroreductase of the parent invention. It is, of course, also possible to produce the new compounds of the present invention X by chemical synthesis, using selective reducing agents followed by conversion of the resulting *0 W:\finAll\Spccies\35215.doc hydroxylamine to its corresponding ester or ether. The esters and ethers are more conveniently prepared semi-synthetically by carrying out the reduction of the nitro group with the nitroreductase of the parent invention to give the corresponding hydroxylamine that is then converted by known chemical methods to the corresponding ester or ether.

As disclosed in the parent application, in order to bring about the enzymatic reduction of CB 1954 and its analogues with the new enzymes of the parent invention, it is necessary to have a cofactor present in the reaction system. The ability of the enzyme of the parent invention to bring about this reduction can be demonstrated experimentally by the use of NADH or NAD(P)H as the cofactor but the use of such cofactors in clinical practice may be problematic in view of the ease with which NAD(P)H particularly is oxidised by other enzymes present in the body and the lack of selectivity of the cofactors between the various mammalian and non-mammalian enzymes. We have now found that the riboside of 1,4dihydro-nicotinic acid is as least as effective as a cofactor in the nitroreductase reduction of CB 1954 and analogues thereof and moreover, because of its selectivity to the E. coli nitroreductase of the parent invention, is more suited to clinical use which makes its incorporation in a multi-component system of the type 9. 20 described below particularly valuable.

The riboside of 1,4-dihydro-nicotinic acid which can be used in the present invention as a cofactor is a new compound and forms part of the present invention. It can be prepared from commercially available nicotinic acid ribotide which is first converted to the corresponding riboside by enzymatic dephosphorylation eg using an alkaline phosphatase. The riboside, obtained by such enzymatic dephosphorylation, or by chemical synthesis, using the method described by Jarman, J. Chem. Soc. 918-920 (1969) can then be reduced, eg using an alkali metal hydrosulphite, to give 1,4-dihydro-nicotinic acid riboside.

C: WINWOROUANELLE\SPECI(776 90 IVOC -11 One of the most important practical applications of the new prodrugs and nitroprecursor of the parent invention is that they can be used in association with a conjugate of a targeting agent for a tumour and a nitroreductase enzyme and so provide a system of cancer chemotherapy where the extent of exposure of the patient to the cytotoxic agent is limited, so far as possible, to those regions where there is the interaction between the prodrug and the nitroreductase. Thus, one aspect of the present invention is to provide a method of chemotherapy and a system of chemotherapy involving the conjoint use of a system including a conjugate of a targeting agent for a tumour and a nitroreductase enzyme, and (ii) a prodrug'of this invention or a composition of this invention; or a nitro-precursor of a compound of this invention or a pharmaceutical composition comprising such a compound in association with a pharmaceutically acceptable carrier or diluent.

Thus, one aspect of the present invention is to provide a method of chemotherapy and a system for chemotherapy involving the conjoint use of the nitroreductase of the present invention in association with a nitro compound which is a prodrug for a cytotoxic compound.

The most or one of the most convenient ways of utilising the system of the 20 present invention is to conjugate the nitroreductase to a targeting agent such as a monoclonal antibody that will bond with a tumour-associated antigen.

i As used herein, the term "monoclonal antibody" will be understood by those of skill in the art not simply to refer to antibodies produced by traditional hybridoma 25 techniques, but also to cover antibodies and variants thereof produced by recombinant means. These include, for example, humanised antibodies such as those with a constant region from a human antibody grafted onto a non-human antibody variable region (see for example EP-A-0 120 694), chimeric antibodies such as those with non-human complementarity determining regions (CDRs) grafted into a human variable region framework (see for example EP-A- 0 239 400) and single chain antibodies. Fragments of such monoclonal antibodies which W:\ninl;l\Spccics\3521 .doc 12 retain their target binding activity are also included by the general term "monoclonal antibody". This includes Fab' and F(ab') 2 fragments.

The selection of monclonal antibody will clearly be influenced by the nature of the target tumour but for the purposes of illustrating the present invention, reference may be made to the anti-CEA antibody AsB 7 As an alternative to the use of a monoclonal antibody, it is also envisaged that other targeting agents to which the nitroreductase is conjugated may be used.

For example, it is known that certain soluble macromolecules can be used for passive tumour targeting of certain tumour types. Many solid tumours possess vasculature that is hyperpermeable to macromolecules. Although the reasons for this are not clearly understood, the result is that such tumours can selectively accumulate circulating macromolecules. The enhanced permeability and retention effect (EPR effect) is thought to constitute the mechanism of action of SMANCS (styrene/maleic-anhydride-neocarzinostatin), now in regular clinical use in Japan-for the treatment of hepatoma. Another class of conjugates under investigation for anticancer activity is N-(2-hydroxypropyl) methacrylamide copolymer-anthracycline conjugates Seymour, Critical Reviews in Therapeutic 20 Drug Carrier Systems, 9(2) 135-187 (1992)). Thus, conjugates of a polymer, including styrene/maleic-anhydride or N-(2-hydroxy-propyl) methacrylamide copolymer, and the nitroreductase can be used in place of conjugates of a monoclonal antibody and enzyme.

With this system, it is possible in a course of cancer chemotherapy to administer to the patient requiring the treatment the nitro compound which is the prodrug for the cytotoxic compound and the enzyme/targeting agent conjugate. The prodrug and the conjugate can be administered simultaneously but it is often found preferable, in clinical practice, to administer the enzyme/agent conjugate before CAXWINWORDUANELLE SPECI7 6 9DIVDC 13 the prodrug, eg up to 72 hours before, in order to give the enzyme/agent conjugate an opportunity to localise in the region of the tumour target. By operating in this way, when the prodrug is administered, conversion of the prodrug to the cytotoxic agent tends to be confined to the regions where the enzyme/agent conjugate is localised, ie the region of the target tumour and damage to healthy cells caused by the premature release of the cytotoxic agent is minimised.

The degree of localisation of the enzyme/agent conjugate (in terms of the ration of localised to freely circulating active conjugate) can be further enhanced using the clearance and/or inactivation systems described in W089/10140. This invloves, usually following administration of the conjugate and before administration of the prodrug, the administration of a component (a "second component") which is able to bind to the such part of the conjugate so as to inactivate the enzyme and/or accelerate the clearance of the conjugate from the blood. Such a component may include an antibody to the nitroreductase which is capable of inactivating the enzyme.

The second component may be linked to a macromolecule such as dextran, a 20 liposome, albumin, macroglobulin or a blood group O erythrocyte so -that the second component is restrained from leaving the vascular compartment. In

S

o. addition or as an alternative, the second component may include a sufficient o number of covalently bound galactose residues, or residues of other sugars such 0. as lactose or mannose, so that it can bind the conjugate in plasma but be 25 removed together with the conjugate for plasma by receptors for galactose or other sugars in the liver. The second component should be administered and designed for use such that it will not, to any appreciable extent, enter the extravascular space of the tumour where it could inactivate localised conjugate prior to and during administration of the prodrug.

C.\WINORDANELLE\.SPEC I\27)IV oCo 14 The exact dosage regime will, of course, need to be determined by individual clinicians for individual patients and this, in turn, will be controlled by the exact nature of the prodrug and the cytotoxic agent to be released from the prodrug but some general guidance can be given. Chemotherapy of this type will normally involve parenteral adminstration of both the prodrug and the enzyme/agent conjugate and administration by the intravenous route is frequently found to be the most practical.

The present invention also extends to pharmaceutical compositions comprising one or more of the p-nitro-benzyloxycarbonyl compounds of the present invention of formula I, formula II, formual V, formula VI or formula VII in association with a pharmaceutically acceptable carrier or diluent, normally one for parenteral administration.

*r 0 0 00 S

S

0 The present invention further extends to pharmaceutical compositions comprising the hydroxylamino anti-tumour agents of the present invention of formula formula X in association with a pharmaceutically acceptable carrier or diluent, normally one for parenteral administration.

20 The present invention also provides a system for use in the control of neoplasia in 00 *0 :a human or animal subject comprising a nitroreductase, preferably a nitroreductase of the parent invention, preferably conjugated with a targeting agent such as monoclonal antibody that will bind to a tumour-associated antigen, in association with at least one of a p-nitrobenzyloxycarbnyl compound of Formula I, II, V, VI or VII which is a produg for an anti-agent tumour agent and preferably a riboside or ribotide of nicotinic acid or nicotinamide to act as a cofactor for the enzyme. The present invention extends to a method of treating S neoplasia in a human or animal host requiring such treatment which comprises K7 administering to the host an effective amound of a p-nitrobenzyloxycarbonyl %WINWORO'JANELLEEC IQ 7769DIV DOC compound of Formual I, II, V, VI or VII which is a prodrug for a anti-tuour agent and a nitroreductase enzyme, preferably a nitroreductase enzyme of the parent invention, preferably conjugated with a targeting agent such as a monoclonal antibody that will bind to a tumour-association antigen, the enzyme preferably being used in association with an ribotide or riboside of nicotinic acid or nicotinamide as cofactor for the enzyme.

The present invention further provide a system for use in the control of neoplasia in a human or animal subject comprising a nitroreductase preferably a nitroreductase of the parent invention, preferably conjugated with a targeting agent such as a monoclonal antibody that will bind to a tumour-associated antigen, in association with a nitro compound which is a prodrug for an antitumour agents of the formula X and preferaby a riboside or ribotide of nicotinic acid or nicotinamide to act as a cofactor for the enzyme. The present invention also provides a method of treating neoplasia in a human or animal host requiring such treatment which comprises administering to the host an effective amount of a nitro compount which is a prodrug for an anti-tumour agents of the formula X and a nitroreductase enzyme, preferably a nitroreductase enzyme of the parent invention, preferably conjugated with a targeting agent such as a 20 monoclonal antibody that will bind to a tumour-associated antigen, the enzyme .0o• preferably being used in association with an ribotide or riboside of nicotinic acid or nicotinamide as cofactor for the enzyme.

The various systems for use in the treatment of neoplasia described above 25 optionally include the "second component' for accelerated clearance described above. Likewise, the methods of treatment of neoplasia described above optionally include as part of that method the use of the second component, an effective amount of which is administered after administration of the enzyme, in S order to increase the ratio of localised to freely circulating enzyme. Reference ELL E\SPECI2776901V DOC 16 such details can be incorporated for use in the present invention.

Throughout the description and claims of the specification the word "comprise" and variations of the word, such as "comprising" and "comprises" is not intended to exclude other additives, components, integers or steps.

The present invention is further illustrated by the following Examples.

C:\W1NWORD\FIONASJJ\NODELETE\35215.DOC WO 93/08288X PC'/(;Ci92/01947 17 EXAMPLE I Isolation and purification of a nitroreductase enzyme from E. coli B.

200 grams of E. cli B cell paste were resuspended to a total volume of 1 litre of 20mM potassium phosphate buffer, pH 7, containing 0.3M ammonium sulphate. The cells were broken ultrasonically using an MSE Soniprep 150 disintegrator (3 x seconds on full power with 60 second intervals to allow heat to dissipate). To aid clarification of the extract, DNase (23,000 Kunitz units/L) and RNase (2,400 Kunitz units/L) were added prior to centrifugation at 8 ,000g for 30 minutes to remove cell debris. The clear yellowish supernatant was passed through a 0.454m filter prior to chromatography.

The filtered extract was applied to a column (25 x 5 cm) of Phenyl-Sepharose CL-6B (Pharmacia) in potassium phosphate buffer, pH 7, containing 0.3M ammonium sulphate. After washing with 2 column volumes of starting buffer, the column was eluted with 10mM Tris-HCl buffer, pH 7.6. Active fractions were pooled and dialysed for 18 hours :*20 against 20mM Tris-HCl, pH 7.6, to remove traces of ammonium sulphate. -The dialysed fractions were applied in 50 ml aliquots to Q-Sepharose-High Performance in 20mM Tris-HCl, pH at a flow rate of 4 ml per minute. Elution was by a 0- 0.2M gradient of KC1, the nitroreductase eluting at 0.1-0.12M KC1. Active fractions were pooled and desalted into 20mM Bis Tris propane, pH 7, using a column (32 x 6 cm) of Sephadex medium. These fractions were applied to Q-Sepharose High Performance (Hi-Load 26/10 column, Pharmacia) equilibrated in 20mM Bis Tris propane, pH7. Elution was by a 0-0.1M gradient of KC1. Nitroreductase eluted as the first major peak at 0.07- 0.09M KC1.

Homogeneity of the final product was ascertained using precast 8-25% gradient gels for native polyacrylamide gel electrophoresis (Pharmacia Phastsystem). Electrophoresis was performed for W) 93/)828 I>C G 1192/01947 18 The nitroreductase in crude and partially purified fractions was routinely assayed by its quinone reductase activity using menadione as substrate, NADH as co-factor and cytochrome C as terminal electron acceptor.

DeterMination of Isoelectric Point The isoelectric point of nitroreductase was determined by isoelectric focusing (Pharmacia Phastsystem, focusing for 400 vh) and chromatofocusing using a Mono P column (Pharmacia Mono P HR5/20, 20mM Bis-Tris pH 6.3 and polybuffer 74, pH The E. coli nitroreductase was isolated as a pure protein with a molecular weight of 24kDa (as determined by both SDSpolyacrylamide gel electrophoresis and gel filtration chromatography). A second protein, which had quinone reductase activity but was inactive as a nitroreductase against CB 1954, partially co-elutes from Phenyl Sepharose and can be fully separated from the active enzyme by the ion exchange chromatography step on Q-Sepharose high performance (see Table 1) at pH 7.6. The two enzymes differ in molecular weight (inactive 55KDa; active 24KDa) and isoelectric point (inactive 20 5.2; active The active protein has a yellow coloration suggesting the presence of a flavin coenzyme. After heating at for 20 minutes this flavin could be separated from the apoenzyme by ultrafiltration and shown to be FMN, rather than FAD, using

HPLC.

go* TABLE 1I- The purification of a nitroreductase from E. coli B. The en zyme activity was assayed, at 37 0

C,

by its quinone reductase activity using menadione (10piM) as substrate, NADH (500pM) as cofactor and cytochrome C (70pM) as terminal electron acceptor. A unit was defined as lpmole of cytochrome C reduced per minute.

FRACT ION TOTAL ACTIVITY SPECIFIC ACTIVITY

YIELD

(Units) (Units/mg protein)() Crude 3784* 0.34 100 Phenyl Sepharose 2371* 1.6 63 CB 1954 CB1954 CB 1954 CR 1954 ACTIVE INACTIVE ACTIVE

INACTIVE

1109 1262 30 33 Q-Sepharose (Tris, pH7.6) 666 -79 18 Q-Sepharose (Bis-Tris propane, PH7) 310 130 8 *This includes activity from enzymes not active against CB 1954 WO 93/0828H I>C[r/(I92/01947 20 Fragments suitable for sequence analysis were produced by digestion of the enzyme with cyanogen bromide. The peptides which resulted from these digests were purified by reversephase HPLC, using a RP 300 column (25 x 4.6 mm) (Brownlee) and a solvent gradient of 10-60% acetonitrile in water with 0.06% trifluoroacetic aid in each solvent. Sequence analysis was performed by automated Edman degradation using an Applied Biosystems 470A gas phase protein sequencer (Kelvin Close, Warrington, Amino acid sequence analysis of the nitroreductase The E. coli nitroreductase as isolated above was subject to amino acid sequence analysis. In contrast to the enzyme isolated from the Walker tumour, EC.1.6.99.2, the nitroreductase of the present invention was not blocked at the N-terminus and gave a clear N-terminal sequence of 31 amino acid residues and a peptide, generated by digestion with S cyanogen bromide, of a further 41 residues. These partial sequences are given in Table 2.

.i WO) 93/0)8288 lVC[IG 92/I) 947, -21 TABLE 2 Amnino acid sequences of the N-terminus of the E. coli B nitroreductasE and of a Peptide obtained after digestion of th rirrduts wit cyanogen bromide (bold type) arnd a comparison with the deduced protein sequence of the nitroreductase from alonella tyrphiMnr-ium (Watanabe et All 1990).

1 10 20 M D IV SV AL QR YS T KAFDPSKKLT A E EA D K IK TL M D I I S V A L K R H S T K A F D A S K L T E Q A Q I K 50 E A 80 VV C90 100 A D G RF A TP E A K A AN D K G R 130 HRVSLK 140 150 160 170 M Y LN V GN FL LGVA A MG LD AV PI EGFDAEVL A K Q V Y L N V G N F L L G V A A L G L D A V P I E C F D A A I L 'f180 190 200 :C:I A E F C L K E K G Y T S L V V V P V G H H S V E D F N A C L P K S R IA E F G L K I *:i0 219 P L E T T L T E V NUcleotide seque-nce of the nitroreductase ene >T*'he nitroreductase gene of E. coli has been cloned and its nucleotide *..seqfuence deter-mined by dideoxy sequence analysis of both strands. In Table 3 is shown the nucleotide sequence of 1167 base NruI/Ps t ***rag-ment which contains an open reading frame of 651 nucleotides ****Incoding the nitroreductase. Putative sequence of Shine-Delgarno and transcriptional termination signal are indicated.

WO 93/08288 3/OX28XI CrI/GB92/Oi')47 22 TABLE 3 N ruT TCGCGATCTGATCAACGATTCGTGGA-TCTGGTGGTTGATGGTCTGGCTAAACGCGATCA AAAAAGAGTGCGTCCAGGCTAGCCGAGTCTATAGCGCATTTTCTCGCTTACCATTT 120 S.D0.

CTCGTTGAACCTTrGTAATCTGCTGGCACGCAATTACTTCACATGGAGTCTTTATGGA 180 dn TATCATTTCTGTCGCCTTAGCGTCATCCACTrAAGG CATTTGATGCCAG CAAAAAACT 240 i i s v a 1. k r h s t k a if d a s k k 1 TACCGAAGCACGTAACGTCGATCGCACACCA 300 t p e q a e q i k t 1 1 g y s pS sst nl CTCACGGCTTATTGCGAGAAAGTAGGGGTCA 360 s q p w h if i v a st e e g k a r v a k ATCCGCGATAGGTACAGGAATCTAGCCCCTG 420 S a a g n y v if n e r k mn 1 d a s h vv GGTGTTCTGTGCAAACCGCGATGGACGATGTCTGG CTGAAGCTGGTTGTTGACCAGGA 480 vf c a k t a m d d v w 1 k 1iv v d q e AGTCG:GCGTTGCCCCGACA:GCCAAGTAAGTGA 540 da d g r if a t p e a k a a nd k g r k :GTTCTTCGCTGATATGCACT GTTCAGTAGAAT CArG~~C 600 if if a d mn h r k d 1 h d d a e w mn a k q GGTACC :TGT CTCGCCGdGGGCCGGTTGCCGGT 660 v y 2. n v g nfl1 1 gj v a a 1 g 1ida v P e g if d a a i1 d a e if g 1 k e k g CTACACCAGTCTGGTGGTTGTTCCGGTAGGTCATCACAGCGTTGAGATTTCGCTAC 780 Y t s 1v v v p v g h h s v e d if n a t 2. p k s r p qn it i t e v termina tor *:*:CGGGCATCTGCCCGGCTATTTCCTCTCAGATTCTCCTGAT=

GCATA

4 CCCTGTTTCAG C 900 CGTCATCATAGGCTGCTGTTGTATAGGAGACGTTATGCAGGATTTAATATCCCAGGTT 960 GA.AGATTTAG CGGGTATTGAGATCGATCACACCACCTCGATGGTGATGATTTTCGGTATT 1020 ATTTTTCTGACCC CCGTCGTGGTGCATATTATTTTG CATTGGGTGGTACTC CGGACCTTC 1080 GAAAkACGTGCCATCGCCAGTTCACGGCTTTGGTTGCATCATTACCCAGATAACTC 1140 PstI TTCCACCGTTTAGCTTTACCCTGCAG 1167 WO 93/0)8288 I'CI'/ 1192/01947 23 EXAMPLE 2 Enzymatic reduction of CB 1954. CB 1954 (100 M and also containing

[U-

3 H] CB 1954 at 1.6 x 105 dpm per nmole), NADH or NAD(P)H (500 uM) were incubated with the active enzyme obtained as described in Example 1, (generally 2gg/ml L. coli nitroreductase or 354g/ml Walker NAD(P)H dehydrogenase (quinone) EC 1.6.99.2) in 10 mM sodium phosphate buffer (pH 7) under either air or helium. At various times aliquots (101) were injected onto a Partisphere SCX (110 x 4.7 mm) HPLC column and eluted isocratically (2 ml/min) with 100mM NaH 2

PO

4 The eluate was continuously monitored for adsorption at 310, 260 and 360 nm and the spectra of eluting components recorded using a diode-array detector. Samples (0.5 ml) were collected and the tritium activity of each determined by liquid scintillation counting. This separation system could resolve all the expected reduction products.

To confirm further the identity of any reduction products, the above reduction mixture was also injected onto an ODS-5 reverse phase HPLC column and eluted (1 ml/min) with a methanol :23 gradient (0-30% linear over 30 min, 30-100% linear over r min.) in 0.1 M sodium phosphate buffer (pH 7).

Reduction of CB 1954 by the E. cl nitroreductase resulted in Sthe formation of two products, shown to be, by comparison of Sretention times and spectral characteristics with known standards, 5-(aziridin-l-yl)-4-hydroxylamino-2-nitrobenzamide and 5-(aziridin-l-yl)-2-hydroxylamino-4-nitrobenzamide. No other CB 1954 metabolites were found. In further confirmation of the formation of both the 2 and the 4-hydroxylamines by the nitroreductase of the invention, 33M of 4-hydroxylamine was formed when 67gM of CB 1954 was reduced by the nitroreductase.

In contrast 504M of 4-hydroxylamine was formed by the reduction of 50gM of CB 1954 by the Walker NAD(P)H dehydrogenase (quinone). Based on initial rates of 4-hydroxylamine formation nitroreductase is 31.2 fold more active per mg protein than NAD(P)H dehydrogenase (quinone) (or 62 fold more active by CB 1954 reduction) under the standard conditions used.

WO 93/8288 24CI-/; B92/01947 24 The rate of reduction of CB 1954 or product formation was the same when the co-factor was either NAD(P)H or NADH and when the reduction was performed under helium.

To show that the nitroreductase was producing a cytotoxic species, the reduction of CB 1954 was carried out in the presence of V79 cells, which are insensitive to CB 1954. As shown in Table 4, a dramatic cytotoxic effect was observed in Hamster V79 cells but only under those conditions in which the nitroreductase reduced CB 1954.

o e a.

6% 0* so* 0. i. TABLE 4 The effect of CB 1954 *on the survival of V79,cells in the presence of the E. coi B nitroreductase. All treatments were for 2 hours at 37 0 C and the cells were then plated out for their resulting colony-forming ablity. The nitroreductase concentration was 21sg/ml and NADH was used as a cofactor.

TREATMENT %SURVIVAL %DRUG REDUCTION CONTROL 100 500 MM NADH 100 50 MM CB 1954 100 o 14ADH CB 195 41 Nitroreductase (NR) 94 u- NR 50 MM CB 1954 99 NR CB 1954 500 MM NADH 0.024 72 NVO 93/08288 B92/0 1947 26 EXAMPLE 3 Subsrat s~eifiityof te E c1i nitroreductase enzymre The ability of the E. coli nitroreductase of th.= vcti to reduce nitro-compounds other than CB 1954 was determined by HPLC by following the decrease in the peak area of NADH resulting from its oxidation. The experiments were carried out as above but the aliquots were injected onto a Partisphere

SAX

(110 x 4.7 mm) HPLC column and eluted isocratically (1 mi/min) with 75mM NaH,PO,. The results are shown in Table TALELF The relative rates of reduction of various nitrobenzamides and nitrobenZenes with E. col nitroreductase enzyme. Reduction rates were determined by the resulting oxidation of NADH. All reactions were carried out at 370C in air, with NADH (500g.M) as electron donor, at an initial substrate concentration of 1004M.

SU*RT RELATIVE ATE OF NADH OXIDATION CB 1954- 2 4 -dinitro-5-(2hydroxy-.

ethylamino)benzamide 0.04 2 -amino-5- (aziridin-1-yl) 4 -nitrobenzamide <0.01 4 -amino--5- (aziridin-1-yl) 4 -nitrobenzamide 01 25 5-chloro-2, 4-dinitrobenzamide 22.4 3 -dinitrobenzamide 75.5 2 -nitrobenzamide 0. 06 3 -nitrobenzamide 1. 8 4 -nitrobenzamide 5.1 2 ,4-dinitrophenol <0.01 2-f ura ldehydesemicarba zone 3 .6 (nitrofurazone) WO 93/08288 PCI/Gl92/01947 27 EXAMPLE 4 Enzyme Kinetic and Inhibition Studies Quinone reductase activities were assayed by a spectrophotometric method using menadione as a substrate and cytochrome c as a terminal electron acceptor as described in Knox et al, Biochem. Pharmacol., 37, 4671-4677, 1988. Initial rates of reaction were determined by linear regression analysis (r>0.995) and kinetic parameters determined from the resulting plots as described by Roberts et al, Biochem. Pharmacol. 38, 4137-4143, 1989. Protein concentration was determined using the a conventional protein assay (Bio-Rad) calibrated against bovine serum albumin.

Kinetic parameters for the E. coli nitroreductase and Walker NAD(P)H, dehydrogenase (quinone) EC. 1.6.99.2, are given in Table 6. Although both enzymes have comparable Km's for CB 1954, the Km of the nitroreductase for NADH is about 10 fold less than the Walker enzyme. The absolute rates of reduction of CB 1954 under saturating conditions) by the two enzymes is their k.t values and this is. 90 fold higher for the E. coli nitroreductase. Menadione was also a substrate for both enzymes with little difference in their respective k.'s although the Km of nitroreductase for this substrate was fold higher.

S Dicoumarol was an inhibitor of the nitroreductase. No kinetic parameters could be measured with respect to NADH. With .respect to menadione, dicoumarol was an uncompetitive inhibitor with a Ki' of 1.90 0.384M.

WO) 93/018288C V C1/G h92/0)1947 28 TABLE 6 Kinetic parameters for the E. coli B nitroreductase and Walker NAD(P)H dehydrogenase (quinone).

WALKER

C0M POUND

NADH

CB 1954

MENADIONE

-6M 862 ±145M 3 60min-1 4. 2xl0~min-' 82 6 ±46M 4min-' 1.3,M 6. 5x1O 4 mjn-1 0 EXAMPLE The ability of the E. coli B nitroreductase to activate compounds other than CB 1954 to a cytotoxic species.

As shown in Table 7, a large cytotoxic effect was observed in human MAWI cells by the prodrugs CB 1837 and CB 10-107-but-only under those conditions when the prodrug was reduced by the nitroreductase enzyme.

9 C

C..

C

C

C..

CC C

OC

CC

WO 93/()8288 1C01'/G 192/01947 29 TABLE 7 The effect of enzyme-activated prodrugs on the survival of MAWI cells. 1 ml volumes of MAWI cells (2 x 10 /ml) were incubated with 50 MM prodrug, 500 AM NADH, and 10 Ag/ml the enzyme of Example 1. After a 2 hour incubation at 37 0 C,the cells were harvested and assayed for their colony forming ability, and the supernatant assayed for the concentration of remaining prodrug by HPLC.

TREATMET SURVIVAL DRUG REDUCTION CONTROL 100 500M NADH 100 50MM CB 1837 97.4 NADH CB 1837 97.4 50M CB 10-107 85.6 NADH CB 10-107 87.9 NR CB 1837 5004M NADH 1.56 NR CB 10-107 NADH 5.0 zo EXAMPLE 6 S PREPARATION OF 1,4-DIHYDRO-NICOTINIC ACID RIBOSIDE FROM EITHER NICOTINIC ACID RIBOSIDE OR NICOTINIC ACID RIBOTIDE Preparation of nicotinic acid riboside from nicotinic acid ribotide.

S.

A solution of nicotinic acid ribotide (nicotinic acid mononucleotide) (Sigma, Poole, (25 mg) in aqueous buffer (tris 100 mM; pH 8.5; MgCl 2 2.5 ml), was treated with 2000 units of alkaline phosphatase, type VII-S (100l; 20,000 units/ml) (Sigma) at 37"C for 1 hour. The alkaline phosphatase was separated from the digest by centrifugal molecular filtration (10,000 molecular weight limit; "Centricon Amicon, High Wycombe, Dilutions (1:100) of the solution were analysed both before and after digestion with alkaline phosphatase by anion exchange high performance liquid chromatography (Partisphere 5-SAX column, eluted isocratically WO 93/0828~ I>CF/G(;92/01947 30 with 0.1M NaHPO., pH5, 1.5 ml/min, 104l injection volume, monitored by UV absorbance at 260 nm). The parent compound eluted with a retention time of 1.18 minutes. Post digestion examination indicated that a complete conversion had occurred to give the novel title compound eluting with a retention time of 0.63 minutes, taken to be indicative of dephosphorylation, yielding the riboside.

(ii) Reduction of nicotinic acid riboside to 1,4-dihydronicotinic acid riboside.

The method of Jarman and Searle (1972) was adopted. The method was applied both to nicotinic acid riboside as produced above, and also to chemically synthesised material (Jarman 1969).

Identical results were obtained with starting compound from either source of origin.

To an aqueous solution of nicotinic acid riboside (5 ml; 4 mg/ml) was added 50 mg sodium carbonate, 50 mg sodium i: bicarbonate, and 50 mg sodium hydrosulphite. The stoppered Ssolution was incubated at 37 0 C for 1 hour and the reduction product separated by preparative reverse phase HPLC. The 5 ml 0 was injected onto a microsorb 5pm C18 (10 x 250 mm) reversephase column (Rainin) and eluted by a gradient of methanol in water (0-100% over 30 minutes) buffered at pH 5 by

NH

4

CH

3 COO at 4 ml/min. The eluate was continuously monitored both by UV absorbance and by fluorescence and the reduction product, (chromatographing with baseline resolution at a retention time of 12-13 minutes), was characterised by both its absorbance maximum at 326 nm (at pH5; 340 nm at pH7) and by its fluorescence (Gilson 121 fluorometer with wide band glass filters; excitation centred at 350 nm; emission at 450 nm), neither of which properties are displayed by the parent compound. Eluates of 4 ml. of a 2mM solution (assuming an of 6200 the same as NADH) were typical, indicating a yield of 2.7 mg i.e. approximately 13%. Prior to experimental usage, the preparations were analysed by analytical HPLC and confirmed to be essentially pure.

References:- WO) 93/0X288 31 PJ/ 9/ Mi Jar-man and F. Searle, Potential Coenzyme Inhibito.s-v, Biochem. Pharmacol. Vol 21, pp. 455-464, 1972.

(ii) M. Jar-man, 4 -Substjtuted Nicotinic acids and Nicotinamides. Part III. Preparation of 4 -Methylnjcotinic acid Riboside. J. Chem. Soc. 918-920, 1969.

Theabiityof l 4 Ihvdro nicotinic acid riboside to act as a coator orthe E ointoeuts The ability of the nitroreductase enzyme to be able to use a synthetic cofactor in place of NADH. or NADPH for the reduction of CB 1954 is shown in Figure 1. The nitroreductase enzyme can use both l, 4 -dihydro-.nicotini acid riboside and NADH with equal efficiency as cofactors for the reduction of CB 1954. In 4j- contrast Walker DT diaphorase cannot utilise this synthetic cofactor. Therefore li 4 -dihydro-.nicotinic acid riboside is a :::selective cof actor for the E. coli nitroreductase enzyme and cannot be used by mammalian DT diaphorase.

In the following Examples B-12, "Silica gel" refers to Merck silica gel 60, 70-230 mesh and Proton NM'R spectra were obtained at 300 1-iz in CDC13. Temperatures are in 0

C.

4 l' 'I st h y g i n o i e n y c a r b m j c a c i d 4 To a stirred solution of 4 -nitrobenzyl chloroformate (295 mg) in dry CHcl, (5 ml) a solution of 4 bis (2 chooty)amn)aiiehydrochloride (367 mg and NEt 3 (377 41) in dry CHC1 3 (5 ml) was added over 5 min. After 1 hr the solution was kept at 200 for 18 hr, then evaporated. The residue was chromatographed on a column of silica gel with CHlC13 to give the title product as a yellow solid which recrystallized from benzene/petroleum ether as prisms,

M.P.

111-112o. Yield, 361 mg (641). Chemical ionization mass WO 93/08288 PC/ 11G92/01947 32 spectrum with CH,: ion at m/z 412 (M 1, relative intensity 1.00) indicates M 411. C,,H,,N0 4 ,C1, requires M 411 (for Cl" isotope). NMR: 63.57 4H, CH,C1 or CH 2 3.69 4H, CHC1 or CH,N), 5.28 2H, ArCH,), 6.65 4H, ArH), 7.51 2H, ArH) and 8.23 2H, ArH).

4-riL(2-ch1oroethyvlaminolDhenvl 4'-nitrobenzvl carbonate A solution of 4-nitrobenzyl chloroformate (58 mg) in dry CHCl 3 ml) was added to a stirred, ice-cooled solution of 4- [bis(2-chloroethyl)amino]-phenol hydrochloride (72 mg) and NEt 3 (74 ul) in dry CHC1 3 (2 ml). After 18 hr at 210, the solution was evaporated and the residue chromatographed on a column of silica gel with CHCl3/petroleum ether to give the title compound which crystallized from ETOAc/petroleum ether as pale yellow prisms, m.p. 77-790 (yield, 102 mg). FAB MS: ion at m/z 413 indicates M 412 requires M 412). NMR (CDC1 3 6 3.62 NCH, or C1CH,), 3.69 NCH, or CICH,), 5.33 ArCH,), 6.64 ArH), 7.05 ArH), 7.59 ArH) and 8.25 ArH).

EXAMPL

N-4-Nitrobenzyloxycarbonyl-actinomycin

D:

Actinomycin D (AMD, 41 mg) in MeOH (5 ml) was hydrogenated over Pd/C for 2 hr, then evaporated in vacuo. The residue under N, was dissolved in a solution of 4-nitrobenzyl chloroformate (18 mg) in dry CHC1 3 (1.5 ml) and a solution of NEt 3 (10 41) in S CHC1, (1.5 ml) was then added. After stirring under N, for 24 hr, the catalyst was filtered off and the solution, after dilution with MeOH (200 ml), was aerated for 3 days. The solution was evaporated and the product was purified to remove AMD by semi-preparative HPLC twice on a 1 cm diameter column of reversed-phased C,,-bonded silica with a 50-100% gradient of MeCN in H,0. The title compound was crystallised from ethyl acetate/petroleum ether as red prisms. Yield, 31 mg Electrospray mass spectrum: ions at m/z 1434.5

(M

H) and 1456.4 (M Na) indicates M 1433.5. CANo3020 WO 93/08288 33- I'CFIGB92/0)194:7 (lowest mass isotope) requires mi 1433.65. NXR gave the same signals as AM.D plus S6.71 1H, ArCH 2 7.09 1H, ArCH 2 and additional signals in the aromatic region.

t~.ltrobenz vca:b dxrbcnVI Doxorubicin hydrochloride (2.25 mg) was dissolved in dimethylfor-amide (DMF) (0.3 ml) containing triethylamine (NEt 3 (0.55 Al) and a solution of 4 -nitrobenzyl-4..

n itroph enyl carbonate (1.4 ml) in DMB' (0.1 ml) was added. After stirring in the dark for 3 days, the mixture was separated by IiPLC on a column (1 cm. diam.) of reversed-phase silica with a gradient of 25 to 100% MeCN in 0.Ol1M f ormate buf fer (pH 4. 0). The principal red fraction was concentrated and rechromatographed with

H

2 0 in place of the iformate buffer.

Evaporation in vLacuo afforded the product (2.1 mg) as an amorphous red powder. Electrospray MS: ion at 723

(M+H)

indicates M 722.

C

35

H,

4

N

2 0 15 requires M 722.

N-4-Nitrobenz 1ocrl

C

A souinof mitomycin C (36 mg) in dimethyl formamide

(DMB')

(2 ml) containing NEt 3 14 /11) was added to 4 -nitrobenzyl chlorofformate (30 mg) and the mixture was stirred at 21' for 4 hr. After evaporation in vacuo, the residue was *chromatographed on a column of silica gel with EtOAc to give the title compound as a dark red solid (49 mg). Electrospray MS: ion at 514 indicates M =513.

C,

3 N~o 9 requires

M-

513.

EXAMPLE 3 Formation of act'myi D ytea t o h irrdcase upo rodr u V(100 A'M) and cofactor (500 i'M NADH) were incubated with enzyme (2 4g/ml L. coli B fitroreductase of Example 1 in 10 mM sodium phosphate buffer (pH7) in air at 37 0 C. At various WO 93/082X I'PCrI/G92/l1947 34 times, aliquots (20 pi) were injected onto a Microsorb C18 reverse-phase (240 x 4.7 mm) HPLC column and eluted isocratically (1 ml/min) with 80% acetonitrile in water. The eluate was continuously monitored for absorption at 280 nm and the concentration of drug calculated by integration of the peak corresponding to this compound on the HPLC trace. Only when the enzyme was present was actinomycin D released from the prodrug.

Disappearance of the prodrug N-4-nitro-benzyloxycarbonylactinomycin D and formation of actinomycin D during incubation with the E. coli B nitroreductase of Example 1 is shown in Figure 2.

EXAMPLE 14 The formation of mitomycin c by the action of the nitroreductase enzyme upon prodrug VII Prodrug VI (100M) and cofactor (500M NADH) were incubated with enzyme (5gg/ml E. coli B nitroreductase of Example 1) in 10mM sodium phosphate buffer (pH7) in air at 37 0 C. At various times aliquots (10g1) were injected onto a Partisphere C18 reverse-phase (150x4.7mm) HPLC column and eluted isocratically 2 .0ml/min) with 50% methanol in water. The eluate was continuously monitored for absorption at 260 and 340 nm and the concentration of the drugs calculated by integration of the Sp..eak corresponding to the compound on the HPLC trace.

Disappearance of prodrug VII and the formation of mitomycin

C

during this incubation is shown in Figure 3. Only in the presence of the enzyme is mitomycin C released from the prodrug.

EXAMPLE Activation of prodruq I where RNH, III and prodrug V by the nitroreductase: Generation of cytotoxicity by the action of the E. coi nitroreductase of Example 1 upon the prodrugs WO 93/08288XZXX IPCF/GI92/01947 35 4-(bis(2-chloroethyl)amino]phenylcarbamic acid 41 -nitrobenzyl ester (I where R'NH, IU) and N-4nitrobenzyloxy-carbonyl-actinomycin D are shown in Table 8.

TABLE 8 The effect of enzyme-activated prodrugs on the survival of V79 cells. 1 ml volumes of V79 cells (2 x 10/ml) were incubated with prodrug, 500 MM NADH, and 10 Mg/ml enzyme. After a 2 hour incubation at 37 0 C,the cells were harvested and assayed for their colony forming ability, and the supernatant assayed for the concentration of remaining prodrug by HPLC.

TIamEfL T suRVIVAL CONTROL 100 5 00 MM NADH 100 50OM (I where

R'NH

2 27.1 NR 50gM (I where R'NH,=IU) 500AM NADH .0.001 14M V 98.3 10MM V 39.3 NR lMM V 500 MM NADH 27.4 NR 10oM V 0 0 4M NADH .0.0001 NR CB 10-107 NADH 5.0 I DRUG REDUCTION 90.5 93 EAPLaiE and bndng of Antibod16: Enzme Conjugate Preparatin A binding of Antibody:_ Enzye Conluc ate Antibody:enzyme conjugate of A5B7 nitroreductase was prepared using the heterobifuncitional agents succinimidyl 4- (P-maleimidophenyl)butyrate (SMPB) to insert active maleimide groups into the immunoglobulin, and 2 -mercapto-[S-acetyl]acetic acid N-hydroxysuccinimide (SATA) to thiolate the E. coli nitroreductase. On mixing the proteins the maleimide groups react with thiols to form a thioether bond. The molar ratio of SMPB:immunoglobulin used was 10:1 and the molar ratio of WO(93/0828 PI'CT/GC I92/I9()47 36 SATA:nitroreductase was 4:1. Antibody:enzyme conjugate thus prepared was isolated from high molecular weight aggregates and uncoupled components by gel filtration chromatography using a calibrated column (16 x 700mm) of Superdex G200. The column was equilibrated in phosphate buffered saline (PBS) and eluted with the same buffer at a flow rate of l.Oml/min. Fractions containing material corresponding in molecular weight to 2:1 and 1:1 conjugate (316KDa and 2 33KDa respectively) were pooled and rechromatographed on the same column and samples from pooled fractions were run on 4-15% SDS-PAGE gels (Pharmacia Phastgels, run for 60vh) under non-reducing conditions together with calibration proteins. The conjugate was present as material with Mr 125 KDa (corresponding to 1:1 F(ab')2:nitroreductase and higher molecular weight conjugates together with less amounts of free and nitroreductase.

The enzymic activity of the conjugate was established by the routine assay using CB1954 as substrate. The conjugate was shown to bind to plates coated with lyg/ml CEA antigen and to contain binding sites for both rabbit anti-mouse immunoglobulin 20 and rabbit anti-nitroreductase secondary antibodies (Figure 4) Samples of uncoupled and nitroreductase were -used -to confirm the specificity of the secondary antibody binding.

The antibody binding was determined using a standard horse radish peroxidase (HRP) colorimetric ELISA assay, with the results being read at 4 05nm. The inverted open triangles on Figure 4 show that bound A5B7 F(ab'),-nitroreductase conjugate can be detected with a goat anti-mouse immunoglobulin antibody, and the closed inverted triangles show that the conjugate is also detected by a rabbit anti-NR antibody (the anti-NR antibody being detected via the use of a goat anti-rabbit immunoglobulin antibody. The controls shown in Figure 4 are: closed circles binding of unconjugated A5B7 open squares A5B7 F(ab'),-NR conjugate detected with goat antirabbit immunoglobulin; closed squares NR only detected with rabbit anti-NR; open triangles NR only detected with goat anti-mouse immunoglobulin.

WO 93/08288 vcr/GR92/01W 37 EXAMPLE 17 In vivo toxicity of prodrug.

The actinomycin D prodrug (AMDPD) of formula V was tested for toxicity in mice. Groups of 3 mice were given 1, 10 or 100 mg/kg body weight i.p. of AMPD, and two further groups of 3 mice were given 1 and 10 mg/kg body weight i.p. of actinomycin D (AMD) dissolved in arachis oil. A further group of 3 mice were untreated, and a final group of 3 mice were given arachis oil i.p. only.

The body weight of the mice were monitored over 9 days. The results are shown on Table 9. All mice treated with 10mg/kg of AMD were dead by day 1. A similar result was obtained with a dose of 5mg/kg. These data indicate that AMDPD is at least Sto 100 fold less toxic than AMD. In practice, the toxicity of AMDPD is likely to be even lower, since the preparation of AMDPD used contains about 1% unconverted AMD.

T* e Toxicity -of AMD and AMDPD 4* Active DrugProdrug Weight as of Day 0 Day 3 Day 7 Dose 100 96.4 (1 dead) 109 102 95.6 105 101 95 108 101 Day 9 96 110 103 All dead on day 1.

98.6 104 95 103 101.6 106 103 106 Control Oil 99 99 101 102 WO 93/08288 PCT/-G 92/01947 38 SEQUENCE LISTING GENERAL INFORMATION:

APPLICANT:

NAME: Cancer Research Campaign Technology Limited STREET: Cambridge House, 6-10 Cambridge Terrace Regent's Park CITY: LONDON, GB POSTAL CODE: NW1 4JL (ii) TITLE OF INVENTION: Improvements Relating to Drug Delivery Systems (iii) NUMBER OF SEQUENCES: 2 (iv) COMPUTER READABLE FORM: Not Applicable CURRENT APPLICATION DATA: APPLICATION NUMBER: PCT/GB92/...

INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 1167 base pairs S(B) TYPE: nucleic acid STRANDEDNESS: double S(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE: ORGANISM: Escherichia coli (ix) FEATURE: NAME/KEY: CDS LOCATION: 176..829 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: TCGCGATCTG ATCAACGATT CGTGGAATCT GGTGGTTGAT GGTCTGGCTA AACGCGATCA AAAAAGAGTG CGTCCAGGCT AAAGCGGAAA TCTATAGCGC ATTTTTCTCG CTTACCATTT 120 CTCGTTGAAC CTTGTAATCT GCTGGCACGC AAAATTACTT TCACATGGAG TCTTT ATG 178 Met 1 GAT ATC ATT TCT GTC GCC TTA AAG CCT CAT TCC ACT AAG GCA TTT GAT 226 Asp Ile Ile Ser Val Ala Leu Lys Arg His Ser Thr Lys Ala Phe Asp 10 GCC AGC AAA AAA CTT ACC CCG GAA CAG GCC GAG CAG ATC AAA ACG CTA 274 Ala Ser Lys Lys Leu Thr Pro Glu Gin Ala Glu Gin Ile Lys Thr Leu 25 93/08288 ~9/)14 icr/GI192/01947 39 GTG GAA TAG AGC GGA TCC AGC ACC X-AC TCC GAG GCG TGG CAT T= ATT Leu

GTT

Val

GGT

Gly

GTG

Val Val1

AAA

Ly s 130 AA C Asn

GTA

V a).

CTG

Leu GA C His

CAA

Gin

GCC

Ala

AAT

Asn

GTG

Val1

GTT

Val1

GCG

Ala 115

GAT

Asp

GTC

Val1

CCC

Pro

AAA

Lys

AGCC

Ser 195

A.AC

Tyr Ser Pro Ser Ser Thr As

AGC

Ser

TAG

Tyr

TTC

Phe

GAG

Asp 100 C CG Ala

CG

Leu

GCT

Gly

ATC

Ile

GAG

Glu 180

GTT

Val1

ATC

ACC

Thr

GTG

Val

TGT

Cys

GAG

Gin AA C Asn

CAT

His AA C Asn

CAA

*C 1u 165

AAA

Ly s

GAA

Ciu

ACC

GA.A

Giu

TTC

Phe

CA

Ala

GAA

G iu

CAT

Asp

GAT

Asp Phe 150

GCT

Gly

GC

Gly

CAT

Asp

GA.A

Ciu 55

AAC

Asn

AA

Lys

CAT

Asp Ly s

CAT

Asp 135

GC

Leu

TTT

Phe

TAC

Tyr Phe

ACC

40

GGT

C iy

GAG

C lu

ACC

Thr

GCC

Ala

GCT

Cly 120

GCCA

Ala GT r_ Leu

CAC

Asp

ACC

Thr

AAC

Asn 200

CA.A

AAA

Lys

CCT

Arg

GC

Ala

CAT

Asp 105

CC

Arg

GAG

Clu

GCC

Cly

GCC

Ala

ACT

Ser 185

GCT

Ala

GTG

n Ser Gin Pro Trp His Phe Ile C COT GTT CCC AAA TCC GGT GC a Arg Val Ala Lys Ser Ala Ala 60 A ATO CT7 CAT CCC TCCG C TG s Met Leu Asp Ala Ser His Val 75 C CAC CAT CTC TCC GTG AAG G .t Asp Asp Val Trp Leu Lys Leu 0 C CCC T= CC ACC CCC CAA CC .y Arg Phe Ala Thr Pro Glu Ala 110 C TTC TTC CCT CAT ATGCGAG GT s Phe Phe Ala Asp Met His Arg 125 C ATC CCA AAA GAG CTT TAT CTC p Met Ala Lys Gin Val Tyr Leu 140 145 C GC CCT GTG GGT CTG GACG C 1 Ala Ala Leu Gly Leu Asp Ala 155 160 C ATC CTC CAT CCA CAA TTTCCT a Ile Leu Asp Ala Ciu Phe Cly 0 175 C CTG CTT CTT CCC CTA CCT CAT u Val. Val Val Pro Val. Gly His 190 C CTC CCC AAA TCT GT CTG CCC .r Leu Pro Lys Ser Arg Leu Pro 205 .ATTCTGTC TTGCCCGGCA TCTCCCCGGC 322 370 418 466 514 562 610 658 706 754 802 856 a.

Gin Asn Ile Thr Leu Thr Giu Va).

210 201

TATTTCCTCT

TCTTGTATAA

TTGAGATCCA

TCCTCCTG GA

CCAGTTCACG

CAGATTCTCC TCATrTCAT AACCCTGTTT ACGACACCTT ATCCACCATT TA.ATATCCCA TCACACGAGC TCCATCCTCA TCATTTTCGG TATTATT'TTG GATTGCCTCC TACGCGGAG CCTTTGGTTG CAAATCATTA CCCAGAATA\ GAGCCGTCAT CATAGGCTGC GGTTGAAGAT TTACGGGTA TATTATTTTT CGACCGGGG GTTCGAAAA.A CGTGCCATCG ACTCTTCCAC CGTTTAGCTT 916 976 1036 1096 1156 WO 93/08288 WO 9308288ICT/G H921t)1947 40 TTACCCTGCA

G

INFORMATION FOR SEQ ID NO: 2: SEQUENCE

CHARACTERISTICS:

LENGTH: 217 amino acids TYPE: amino acid TOPOLOGY: linear (iMOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: 1167 Met Asp Ile Ile Ser Val Ala Leu Lys

S.

S S

S

S

S

S.

S. S .5 S. Asp Ala Leu Leu Ile Val 50 Ala Gly Val Val Leu Val Ala Lys Arg Lys 130 Leu Asn 145 Ala Val Gly Leu His His Pro Gin 210 Ser Lys Gin Tyr Ala Ser Asn Tyr Val Phe Val Asp 100 Ala Ala 115 Asp Leu Val Gly Pro Ile Lys Glu 180 Ser Val 195 Asn Ile Lys Ser Thr Val1 Cys 85 Gin Asn His Asn Glu 165 Ly s Glu Th r Leu Pro Giu Ph e 70 Ala Giu Asp Asp Ph e 150 Gly Gly Asp Leu Thr Pro Glu 25 Ser Ser Thr 40 Giu Gly Lys 55 Asn Glu Arg Lys Thr Ala Asp Ala. Asp 105 Lys Gly Arg 12C Asp Ala Glu 135 Leu Leu Gly Phe Asp Ala Tyr Thr Ser 185 Phe Asn Ala 200 Thr Glu Val 215 A~rg Gin Asn Ala Ly s Met 90 G ly Ly s Trp Val1 Ala 170 Leu His Ser Thr Lys Ala Phe Ala S er Arg Met 75 Asp Arg Phe Met Ala 155 Ile Val G lu Gin Val Leu Asp Phe Phe Ala 140 Ala Leu Val Gin Pro Ala Asp Val Ala Ala 125 Ly s Leu Asp Val1 Ile Trp Ly s Ala Tr-p Thr 110 Asp Gin Gly Ala Pro 190 Lys His Ser Ser Leu Met Val1 Leu Giu 175 Val1 Thr Phe Ala His Lys G lu His Tyr Asp 160 Ph e Gly Thr Leu Pro Lys Ser Arg Leu 205

Claims (7)

1. 24. JUL. 20OU 12:23 NC. 3688 P. 6/24 The claims defininq the invention are as follows: A. method of treatment of a tuimour comprising administering to a patient, simultaneously or sequentially: a bacterial nitroreductase having the following characteristics: it is a fa'voprotein having a molecular weight in the range 20-60 Kilodaltons; it requires either NA014 or NAD(P)H or analogues thereof as a cofactor; it has a Km for NADH or NAD(P)H in the range l-2.O0pM; and, it is capable of reducing either or both nitro groups Qf CB 1954 and analogues thereof to a cytotoxic form; and, (ii) a compound selected from: compounds of the formula R 1 -NH-C0.O0. CH 2 -0 N0 2 wherein R1 is selected so that the compound R N~4 2 is a nitrogen mustard compound; compounds of the formula (II): RW-0-CO-OCH 2 0 N0 2 I wherein R 2 is selected 5o that the compound R 2 0H is a phenolic nitrogen mustard compound;
2. 41. 24/07 '00 MON 12:25 [TX/RX NO 9974] 24. JUL. 201O 12:23 NO. 3688 P. 7/24 a MeVa1 Pro D-Val Thr compound of the formnula Me-Val- Str Pro D-Val T~r Co a compound of the formula (VI), 0 OH Y, 0i HOCOaCH 2 -0 NO 2 a compound of the formula (VII)* vii *NCOOCH 2 N 2 42 24/07 '00 MON 12:25 [TX/RX NO 9974] 24. JUL. 2000 12:23 NC. 3688 P. 8/24 compounds of the formnula 0 *0 S S. S SS** 5 S.. S S *5 wherein: Xi and X 2 which may be the same or different, are each NHOR 5 Or NO 2 with the proviso that X1 and X 2 are not both NHOR where R5 is H or a carboxylic acyl or hydrocarby. group; and, Y is H or CON(CH 3 2 2. A method according to claim wherein the nitroreductase is obtained from the cells of E. coi B, E. coli C, Thernius aquaticus, Bascillus aryloliquifaciens or Bacillus caidotenax. 3. A method according to claim 1, wherein the nitroreductase is obtained from the cells of E. coli B. 4. A method according to claim 1, wherein the nitroreductase has the amino acid sequence of Seq. ID No. 2. A method according to claim 1, wherein the compound is selected from compounds of the formula 6- A method according to claim 5, wherein R' is selected so that the compound R'NH 2 is a nitrogen mustard compound of the formula (IV): (ClCH, 7 2 N wherein R' and R' are Hl, F or CH 3 -43 24/07 '00 MON 12:25 [TX/RX NO 99741 24. JUL. 2000 12:24 NO. 3688 P. 9/24 I. A mnethod according to clarim 6, wherein R' is selected so that the compound R' NH 2 is a nitrogeri mustard compound of the formula (III): (CCiCI 2 2 N 0 NH;,II 8. A method according to claim 1, wherein the compound is selected from compounds of the formula and (VII) 9. A method acrigto claim 1, wherein the compound is selcte frm cmpond3of the formula (11). A method according to claim 9, wherein the compound is of :the formula (VIII): .(Cl'C! 2 I 22 \n-O oo 2 0 /R-D 140, Vill :11. A method according to claim 1, wherein the compound is selected from compounds of formul.a *12. A method according to any preceding claim, wherein the compound is provided as a pharmaceutical composition 99 comprising the compound and a pharmaceutically acceptable carrier or diluent. 13. A method according to any preceding claim, wherein the nitroreductase is conjugated to A targeting agent for a tumour. 14. A method according to claim 13, wherein the targeting agent is a monoclonal antibody which will bind a tumour-associated antigen. ,~T~2N 44- 24/07 '00 MON 12:25 [TX/RX NO 99741 24. JUL. 2000 12:24 NQ. 3688 P. 10/24 A method according to claim 13, wherein the nitroreductase i5 covalently linked to the targeting agent.- 16. A compound of the formula p L-NH-CO.0. CH 2 N0 2 wherein Rl 1 is selected so that the compound R 1 NH 2 is a nitrogen mustard compound of the formula .(IV) (ClC1WCH.) N NH,, IV wherein R' and R" are H, F or CH3- 17. A cormpound according to claim 16, wherein R' is selected so that the compound R 1 NH 2 is a nitrogen mustard compound of the formula (III): 0 0* 0 0* (C1CHCH,) 2 N NH 2 III 18. A compound of the formula or (VII1): meVal MQa1a S r Pro Pro I I D-Val D-'Jal Thr UU Co N NRCO0CH-0 N021 0 0 CI 45 24/07 '00 MON 12:25 [TX/RX NO 9974] 24. JUL. 2000-12: 24 NO. 3688 P. 11/24 V I HoC0OCH 2 NOZ 0' S f S S S C 04 0* U A. 0 S 0*4 SO OS C 4 0 C U '.44 A A no. 0I 08 C 0 0@0 S C 0* 04 4 VII :NCOOCH~/ N0 2 19. A compound of the formula (11); R 2 CO.O0.-CH2 N02 wherein R 2 is selected so that the compound R 2 OH i S a phenolic nitrogen mustard compound. A compound according to claim 19 of the formula (VIII): (CICH 2 C2) 2 N O.CO.OCH 2 -G NO2 VIII 21. A pharmaceutical composition comprising a compound according to any one of claims 16 to 20 and a pharmaceutically acceptable carrier or diluient. 22. A process for the preparation of a compouand of the formula as defined in claim 16, which comprises' 46 24/07 '00 MON 12:25 ITX/RX NO 9974] 24. JUL. 20OC 12:24 NO. 3688 P. 12/24 reacting a nitrogen mustard of the formula (IV) as defined in claim 16, with 4-ni.trobenzyl chloroformate under anhydrous conditions- 23. A process for the preparati.on of a compound of the formula or (VII) as defined in claim 18 which comprises reacting actinomycin D, doxorubicin, or mitomycin C, respectively, with 4-nitrobenzyl chioroformate under anhydrous conditions. 24. A process for the preparation of a compound of the formula (II) as defined in claim 19 which comprises reacting a phenolic nitrogen mustard with 4-nitrobenzyl chioroformate under anihydrous conditions. A compound of the formula N x 2 x p C wherein: Xand Xwhich may be the same or different, are each NHOR5 or N02 with the prov~iso that X 1 and X 2 are not both N0 2 where R 5 is H or a carboxylic acyl or hydrocarbyl group; and, Y is H- or CON (CH 3 2 26. A pharmaceutical composition comprising a compound according to claim 25 and a pharmaceutically acceptable carrier or diluent. 27. A process for making a compound of the formula (X) according to claim 25 which includes subjecting the corresponding dinitro compound to the action of a -47- 24/07 '00 MON 12:25 [TX/RX NO 9974] 24. JUL. 2000 .12 :2 4 NO. 3688 P. 13/24 bacterial nitroreductase, said nitroreductase having the f~ollowing characteristics: it is a flavoprotein tiaving a molecular weight i~n the range 20-60 Kilodaiton3- it requires either NaDH or NAD(P)H or analogues thereof as a cofactor; it has a Km for NADH of NAD(P)H in the range l-).00Vpm; and, it is capable of reducing either or tboth nitro groups of GB 1954 and analogues thereof to a cytotoxic form. 28. A process according to claim 27 wherein the nitroreductase is obtained from the cells of E. cali B3, .:too:E. coi C, Thermus aquaticus, Bacillus aiyioiiquifaciens or Bacillus caldotenax. 29. A process according to claim 27 wherein the nitroreductase is obtained from the cells of E. coi B. A method of reducing the nitro group of a p-nitrophenyl- benzyloxycarbonyi residue of a compound of formula 1 defined in any one of claims 5 to 11, which method comprises: bringing said compound into contact with a bacterial nitroreductase enzyme which has the following characteristics; 1- it is a flavoprotein having a molecular weight in the range 20-60 2 it requires either NADH or NAD(P)- or analogues thereof as a cofactor; 3 it has a Km. for NADH or NAD(P)H in the range of~ l-lO0pM; and it is capable of reducing either or both nitro groups of CB1954 and analogues thereof to a cytotoxic form; (QRA/ -48 24/07 '00 MON 12:25 [TX/RX NO 9974] 24. JUL. 2000 12:24 NO. 3688 P. 14/24 under conditions in which the nitro group of said p-nitrophenyl-benzyioxycarboflyl residue is reduced by the action of said enzyme. 31. A method according to claim 30 which is performed in vivo such that reduction of said p-nitrophenyl- benzyloxycarbonyl residue conve rts the compound comprising said residue into a cytotoxic compound. 32.- A method according to claim 30 or 31 wherein the nitroreductase is obtained from the cells of E. cola. B, E. coli C, Therinus aquaticus, Bacillus amyloliquifacie2s or Bacillus caldotenax. 33. A method according to any one of claims 30 to 32 wherein the nitroreductase is obtained from the cells of a34. A method according to any one of claims 30 to 32 wherein the nitroreductase has the amino acid sequence of Seq. ID No- 2- A kit for chemotherapy comprising a nitroreductase and a compound, wherein said nitroreductase is capable of reducing said compound, thereby yielding a nitrogen mustard R NH wherein said nitroreductase is: a bacterial nitroreductase having the following characteristics: it is a flavoprotein having a molecular weight in the range 20-60 Kilodaltons; it requires either NADH or NAD(P)H- or analogues thereof as a cofactor; it has a Km for NAD- or NAD(P)H in the range 1-l00paM; and, it is capable of reducing either or both nitro groups of CB 1954 and analogues thereof to a cytotoxic form.- and, -49 24/07 '00 MON 12:25 [TX/RX NO 9974] 24. JUL. 2000 12:25 NO. 3688 P. 15/24 and wherein said compound is: (ii) a compound selected from: compounds of the formula R'-NH--CO.O.CH 2 NOZ wherein R' is selected so that the compound R'NH. a nitrogen mustard compound; a compound of the formula MeVal MeVai I I Sir Str Pro Pro I I V D-Val D-Va2. I I iIis Thr (o) COU Co p CC a C C. a C C. i.e. C *CC* CC a compound of the formula (VI): ,COCH 2 OH OH I NH o COaCH 2 N 2 50 24/07 '00 MON 12:25 [TX/RX NO 99741 -24. JUL. 2000 12:25 NO. 3688 P. 16/24 a compound of the formula (VII): 0 H 2 CHO2CONH 2 SlOCH VII CH3 CH II NCOOCH NO 2 O 36. A kit for chemotherapy comprising a nitroreductase and a compound, wherein said nitroreductase is capable of reducing said compound, thereby yielding a phenolic nitrogen mustard R -OH; wherein said nitroreductase is: a bacterial nitroreductase having the following characteristics: it is a flavoprotein having a molecular S.weight in the range 20-60 Kilodaltons; it requires either NADH or NAD(P)H or analogues thereof as a cofactor; it has a Km for NADH or NAD(P)H in the range 1-100M; and, it is capable of reducing either or both **9 nitro groups of CB 1954 and analogues thereof to a cytotoxic form; and, and wherein said compound is: (ii) a compound selected from: compounds of the formula (II): R 2 -O.CO.O.CH 2 NO 2 II wherein R 2 is selected so that the compound R OH is a phenolic nitrogen mustard compound. 37. A kit for chemotherapy comprising a nitroreductase and a compound, wherein said nitroreductase is capable of reducing said compound, thereby yielding the corresponding hydroxylamine compound; 51 24/07 '00 MON 12:25 [TX/RX NO 9974] 24. UL. 2O00 12:25 N'O. 3688 P. 17/24 wherein said nitroreductase is: a bacterial nitroreductase having the following characteristics: it is a flavoprotein having a molecular weight in the range 20-60 Kilodaltons; it requires either NADH or NAD(P)H or analogues thereof as a cofactor;, it has a Km. for NADH or NAD(P)H in the range 1-1O0pM; and, it is capable of reducing either or both nitro groups of CB 1954 and analogues thereof to a cytotoxic form; and, and wherein said compound is: (ii) a compound selected from: compounds of the formula N x wherein; X1 and X 2 which may be the same or different, are each NHOR 5 or N0 2 with the proviso that X1 and X; are not both NHOR, wh ere i H or a carboxylic acyl or hydrocarbyl group; and, Y is H or CON 38. A kit according to any one of claims 35 to 37, wherein the nitroreductase is obtained from the cells of E. coli 13, E. c~li Q, Thermus aqua ticus, Bacillus amayloliquiffaciens or Bacillus caldotenax. 39. A kit according to any one of claims 35 to 37, wherein the nitroreductase is obtained from the cells of E- coi B. -52- 24/07 '00 MON 12:25 [TX/RX NO 99741 24. JUL. 2000 12:25 NO. 3688 P. 18/24 A kit according to any one of claims 35 to 37, wherein the nitroreductase has the amino acid sequence of Seq. ID No. 2. 41. A kit according to claim 35, wherein the compound i~s selected from compounds of the formula
3. 42. A kit according to clai~m 41, wherein is selected so that the compound R'NH 2 is a nitrogen mustard compou~nd of t~he formula (IV): (C~H 2 /~HIV wherein R' and R" are F or CH 3
4. 43. A kit according to claim 41, wherein R 1 is selected so that the compound RI N1- 2 is a nitrogen mustard compound of the formula (111)7 (C1CH CH.) 2 N NHII
5. 44. A kit according to claim 35, wherein the compound is selected from compounds of the formula (VI) and (VII), A kit according to claim 36, wherein the compound is of the formula (VIII): (ClC1-I,CH ZN Q -CO. 0. CH 2 N0 2 Vill
6. 53- 24/07 '00 MON 12:25 [TX/RX NO 9974] 24. JUL 2000 12:25 NO. 3688 P. 19/24 46. A kit according to any one of claims 35 to 45, wherein the compound is provided as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable carrier or diluent. 47. A kit according to any one of claims 35 to 45, wherein the nitroreductase is conjugated to a targeting agent for a tumour. 48. A kit according to claim 47, wherein the targeting agent is a monoclonal antibody which will bind a tumour-associated antigen. 49 A kit according to claim 47, wherein the nitroreductase is covalently linked to the targeting agent. 50. A kit according to any one of claims 35 to 49, for use in a method of chemotherapy of the human or animal body. 51. A compound according to claim 17 substantially as hereinbefore described with reference to Example 8. 52. A compound according to claim 20 substantially as S. hereinbefore described with reference to Example 9. 53. A compound according to claim 18 substantially as hereinbefore described with reference to any one of Examples 10, 11, and 12.
7. 54. A process according to claim 30 substantially as hereinbefore described with reference to any one of Examples 13, 14, or DATED: 21 July 2000 PHILLIPS ORMONDE FITZPATRICK Attorneys for: CANCER RESEARCH CAMPAIGN TECHNOLOGY LIMITED 54 I 24/07 '00 MON 12:25 [TX/RX NO 9974]