AU722016B2 - Biosensors - Google Patents

Description

WO 98/04716 PCT/AU97/00473 1 Biosensors Technical Field The invention relates to the use of biosensors for detecting environmental signals based on the measurement of genetic responses of cells to those signals.

Background Art The standard approach for biosensor measurements "based on genetic responses" is to attach reporter genes to the relevant promoters and to measure the signal (which consists of the activity of the enzyme encoded by the reporter gene) in response to the analyte of interest. The first publication dealing with the use of the bacterial luciferase operon to achieve such measurements appeared in 1984 (Baldwin et al., 1984). Since that time many more publications detailing the use of this reporter to probe the activity of promoters have appeared. Today there are probably several thousand publications on this subject. Most of these publications rely on the use of luxAB fusions or of entire lux cassettes. The more restricted goal of measuring the concentration of pollutants with such constructs was first proposed and demonstrated by Gary Sayler's group at the University of Tennessee in the USA (King et al., 1990). Burlage Kuo (1994) recently reviewed the application of such biosensors with respect to environmental monitoring applications.

Practically all of the constructs described utilise either the entire lux operon for activity measurement or the luciferase part of it (lux AB, in this case the activity is measured by external addition of the aldehyde substrate).

The major disadvantage of using the entire lux operon is that production of the enzyme responsible for generating the substrate of luciferase (the fatty acid reductase encoded by lux CDE) occurs simultaneously with the synthesis of luciferase. It is therefore probable that the amount of substrate produced by the cell will be insufficient for saturation of luciferase. The present inventors have introduced modifications into constructs suitable for biosensors in an attempt to address this disadvantage thereby allowing maximal light output as soon as luciferase is synthesised.

WO 98/04716 PCT/AU97/00473 2 Disclosure of the Invention In a first aspect, the present invention consists in a genetic construct for use in a biosensor comprising: a first nucleic acid molecule including a sequence encoding a reporter molecule having a detectable activity; and a second nucleic acid molecule including a sequence encoding an enzyme which produces a substrate for the reporter molecule, the first sequence being under the control of a first inducible promoter and the second sequence being under the control of a second inducible promoter.

In a preferred embodiment, the first nucleic acid molecule encodes bacterial luciferase Lux AB or a functional equivalent thereof and the second nucleic acid molecule encodes Lux CDE enzyme fatty acid reductase or a functional equivalent thereof. These genes may be obtained from any of the Jux operons of bioluminescent microorganisms, most of which belong to the genera Vibrio, Xenorhabdus, Photorhabdus and Photobacterium (Meighen, 1994). The detectible activity in this system is the generation of light.

It will be appreciated that any inducible promoters will be suitable for the present invention. Examples of some promoters that are suitable are listed in Appendix 2. This list, however, is not an exhaustive list but is provided to demonstrate the large number of possible promoters. The choice of the first promoter is often dependent on the environmental signal to which the biosensor is adapted to react. In particular, when the biosensor is used to detect xylene, the Pu promoter is especially suitable as the first promoter.

A further preferred embodiment of the first aspect of the present invention is the genetic construct adapted for the detection of xylene set out in Fig. 14.

The distinct advantage of the genetic construct of the present invention is that when in a cell, expression of the enzyme can be induced separately from the expression of the reporter molecule. This allows the cell to be loaded with substrate produced by the enzyme. The substrate is immediately available for use by the reporter molecule when it is produced, thereby giving a quick response to the signal detected. When the reporter molecule is made in response to an environmental signal, it can react maximally to give a detectable activity. Preferably the first promoter is inducible by exposure to an environmental signal to be tested. Induction can WO 98/04716 PCT/AU97/00473 3 be achieved directly by the signal or indirectly by activating one or more separate pathways in the cell containing the construct.

The genetic construct can include further nucleic acid molecules encoding auxiliary element or elements required for activation of the reporter molecule via its promoter. Examples include regulatory genes or nucleic acid molecules expressing "second message" molecules to activate the first promoter.

The effector specificities of existing promoters which depend on an indirect activation pathway by regulatory genes can be altered by mutation of the signal binding site of the regulatory protein (Ramos et al., Proc. Natl.

Acad. Sci. USA, 83, 8467-8471, 1986). New promoters can be identified using promoterless promoter-probe vectors based on transposons such as those described by deLorenzo et al. (deLorenzo, Herrero, Jakubzik, U.

Timmis, K. N. J. Bact., 172, 6568-6572, 1990) or Sohaskey et al. (Sohaskey, C. Im, H. Schauer, A. J. Bact., 1674, 367-376, 1992).

In a second aspect, the present invention consists in a biosensor for measuring an environmental signal comprising a cell including the genetic construct of the first aspect of the present invention and a means for measuring the activity of the reporter molecule in the cell when the cell has been exposed to the environmental signal.

The cell can be any cell including bacterial, yeast, fungal and other plant cells and animal. Preferably the cell is a bacterial cell. The environmental signal can be pollutants, toxins, temperature, irradiation, biological, and chemical.

When the bacterial luciferase system is used, the basic genetic units of the sensor are the second nucleic acid molecule encoding the production of the fatty acid reductase (unit the first nucleic acid molecule encoding the reporter element containing the luciferase genes and the first promoter (unit 1) as well as in some instances a third unit which would supply auxiliary elements for activation of the sensor element such as regulatory genes (unit In commercial sensors all elements would be ideally inserted in the chromosome of the host organism. Alternatively, all units may be placed on plasmids, or a combination of chromosomally inserted elements and plasmid-borne constructs may be used. For example, where three units are used, unit 2 and unit 3 may be inserted in the chromosome whilst unit 1 is located on a plasmid.

WO 98/04716 PCT/AU97/00473 4 A functional biosensor unit using the bacterial luciferase system consists of a device where the sample to be tested is contacted with biosensor cells which include a genetic construct according to the first aspect of the present invention (in a cuvette for example) and an instrument capable of measuring the light output of the cells. Any light measuring device would in principle be applicable, but the most appropriate systems are photomultipliers, charge coupled devices, luminometers, photometers, fiberoptic cables or liquid scintillation counters. These systems can be portable or laboratory based, they can be adapted for single analysis or high throughput devices for multiple analyses. A survey of more than commercially available systems suitable for the present invention has been published by Stanley in J. Bioluminesc. Chemiluminescence, 7, 77-108, 1992 and regular updates have appeared since.

Analytes can be measured by the biosensor when adsorbed to surfaces, dissolved in liquid media or when present in the gasphase.

Condition for measurement is that sufficient moisture be available to ensure the function of the biosensor cells which include a genetic construct.

Ideally, samples are diluted with a buffer of appropriate composition prior to analysis and incubated in this solution. Alternatively, analytes of interest may be separated from the sample prior to analysis using means such as solvents or selectively permeable barriers such as membranes. Analytes may also be concentrated prior to analysis by, for example, passing a gas sample through a liquid or through a suitable solid adsorbent.

The biosensors can be used to detect organic or inorganic chemical or environmental signal which elicits a genetic response in an organism.

Microbial systems are targeted primarily, but mammalian, plant or fungal promoters can also be used. In addition, the biosensors can be used to detect physiological responses such as starvation, toxicity or sporulation by inserting the luciferase genes behind promoters suitable for physiological measurements. The biosensors can be used to detect pollutants attached to particles, dissolved in aquatic samples or dispersed in the gas phase. The measurements usually need, however, to be performed in the liquid phase.

In a third aspect, the present invention consists in a method of detecting an environmental signal comprising exposing a biosensor according to the second aspect of the present invention to the signal such that the signal induces the expression of the reporter molecule of the cells in the WO 98/04716 PCT/AU97/00473 biosensor, prior to or during exposure the cells being induced to produce the enzyme such that substrate is formed in the cells, allowing the reporter molecule to react with the pre-formed substrate to form a detectable reaction, and detecting the reaction.

In order that the present invention may be more clearly understood, preferred forms will be described with reference to the following drawings.

Brief Description of the Drawings Figure 1 is a diagram of the lux operon; Figure 2 is a diagram of clone designated pLuxAB; Figure 3 is a diagram of clone designated pLuxCDE; Figure 4 is a diagram of clone designated pTlux; Figure 5 is a diagram of the two operons controlling the genes encoding the degradation of toluene, the Tol operon; Figure 6 is a diagram of pXlacR/S; Figure 7 is a diagram of the features of construct designated pXylR; Figure 8 is a diagram of the construct designated pTU/M; Figure 9 is a diagram showing the respective positions of the components in pTLU/M; Figure 10 is a diagram of a representative of the transformant designated plu-x; Figure 11 is a diagram of a representative of the transformant designated pLEU; Figure 12 shows the time course of bioluminescence of the new sensor construct (Leu-lacR) with addition of xylene (full squares) and without addition of xylene (open squares) as well as the corresponding data for the control construct (Lux-lacR) where closed and open circles represent the response in the presence of xylene and in the absence of xylene, respectively; Figure 13 shows a calibration curve obtained with the new sensor construct (Leu-lacR). The organisms were inoculated from a glycerol stock and grown overnight at 30°C with minimal agitation; and Figure 14 shows a map pf plasmid pLEU.

WO 98/04716 PCT/AU97/00473 6 Detailed Description of the Invention All components used in this invention are readily available to the public (except for the different constructs generated specifically for this work).

MATERIALS METHODS Culture conditions Recombinant strains of Escherichia coli were routinely cultured aerobically at 37°C in Luria broth (LB) tryptone 10 g/L, NaCl 10 g/L and yeast extract 5 g/L. Media was solidified by the addition of 15 g/L Kobe agar.

Filter sterilised antibiotics were added as required. Ampicillin at 100 mg/ml was used to maintain constructs based on the following vectors: pSP72, pUC18, pTrc 99A and pPL-L; and tetracycline at 10 mg/ml for constructs based on pRK404. The different carbon sources used were glucose w/v) and lactose w/v).

General recombinant DNA procedures Restriction enzymes and other DNA modifying enzymes were used under the conditions specified by the suppliers. Standard procedures as described by Sambrook et al (1989) were used for manipulating and cloning DNA. Isolation of plasmid DNA from E. coli was performed according to the method described by Morelle (1989), for rapid screening of plasmid-bearing clones.

WO 98/04716 WO 9804716PCT/AU97/00473 7 Table 1: Description of clones constructed during this study Constructs pxylac-R pXylR pTer pTu pluxAB pTLU pluxCDE pluxCDABE pTluxCDABE pLu-x pLEU Vector pRK404 pRK4O4 pRK404 pSP72 pSP72 PUC18 pSP72 pTrc 99A pTrc 99 pSP72 pSP72 pTrc 99A Comments/description XylR ORF fused to lacZ promoter XyIR gene including Pr cloned into the PstI!BarnH site of Contains both rrnbTlT2April 96 terminators Pu cloned into the EcoRI/SiaI site of pTer luxAB genes fused to lacZ promoter luxAB genes fused to Pu pro;-ioter in pTu luxCDE genes fused to trc promoter IuxCDABE genes fused to trc promoter luxCDABE genes cloned into pTer li.xCDABE genes fused to Pu promoter in pTu Pu-iLuxAB detection cassette cloned into the BamFlIPstI site of pluxCDE WO 98/04716 PCT/AU97/00473 8 Table 2: Description of clones constructed during this study Constructs Vector Date constructed pxylac-R pRK404 pRK404 available in Aug 1994 pXylR pTer pTu pSP72 pSP72 pUC18 pluxAB pTLU pluxCDE pSP72 pTrc 99A constructed 21.4.96 (page 6, Karen Jury's labbook) confirmed 26.4.96 (page 8, Karen Jury's labbook) available in Aug 1994 available in Aug 1994 constructed 3/7/95 (page 28121, Tony Vancov labbook 1) confirmed 6/7/95 (page 28125, Tony Vancov labbook 1) constructed 25/7/95 (page 28141, Tony Vancov labbook 1) confirmed 1/8/95 (page 28146, Tony Vancov labbook 1) constructed 25/7/95 (page 28141, Tony Vancov labbook 1) confirmed 9/8/95 (page 28153, Tony Vancov labbook 1) confirmed aldehyde producer 10/8/95 (page 28154, Tony Vancov labbook 1) constructed 13/11/95 (page 9122, Tony Vancov labbook 2) confirmed 17/11/95 (page 9124, Tony Vancov labbook 2) constructed 16/5/96 (page 33417, Tony Vancov labbook 3) confirmed 17/5/96 (page 15, Karen Jury's labbook) pluxCDABE pTluxCDABE pTrc 99 pSP72 WO 98/04716 PCT/AU97/00473 Table 2, continued Constructs pLu-x Vector pSP72 labbook) Date constructed constructed 21/4/96 confirmed 21/4/96 luciferase assay (page 5, Karen Jury's confirmed 21/4/96 (gel digest, page 6 Karen Jury's labbook) constructed 8/12/95 (page 9142, Tony Vancov labbook 2) confirmed 13/12/95 (page 9143, Tony Vancov labbook 2) confirmed 14/12/95 (plate assay, page 9144, Tony Vancov labbook 2) pLEU pTrc 99A i-- WO 98/04716 PCT/AU97/00473 Recombinant E. coli strains Table 3 Code Tlu-lacR E. coli strain Constructs* Date obtained NM522 pTLU pxylac-R Leu-lacR NM522 pLEU pxylac-R Leu-R NM522 pLEU pXylR constructed 7/8/95 (page 29151, Tony Vancov labbook 1) confirmed 10/8/95 (page 28154, Tony Vancov labbook 2) constructed 16/4/96 (page 33404, Tony Vancov labbook 3) confirmed 20/4/96 (pages 33407 and 33408 Tony Vancov labbook 3) constructed 10/5/96 (clone (i)e in Karen Jury's labbook) confirmed 11/5/96 (luminometer readings and gels, page 13 Karen Jury's labbook) constructed 17/5/96 (page 33418, Tony Vancov labbook 3) confirmed 18/5//86 (pages 14-16, Karen July's labbook) constructed 10/5/96 (clone (ii)g in Karen Jury's labbook) confirmed 11/5/96 (luminometer readings and gels, page 13 Karen Jury's labbook) Lux-LacR NM522 pLu-x pxylac-R Lux-R NM522 pLu-x pXylR *note that constructs carrying the XylR regulatory gene (pXylR or pxylac-R) are located on the pRK 404 plasmid whilst the actual light generating elements of the sensor are inserted in the plasmids pSP72 (pLu-x) or pTrc 99A (pLEU).

WO 98/04716 PCT/AU97/00473 11 Bioluminescence Assays preparation of culture Unless otherwise stated, E. coli clones were inoculated from a fresh agar plate into a flask containing 40 ml of LB media with the appropriate antibiotics and grown aerobically (with shaking) at 37 OC for approximately 2-3 hr. The culture was harvested at an OD600 of approximately 0.8-1.2, washed twice and resuspended in a buffer containing: 100 mM Phosphate buffer pH 7.5, 1/lOth diluted LB broth and 0.1% glucose In some cases, specified in the text, inducers and/or effectors such as IPTG and m-xylene (1 mM) were added. The optical density of the culture was adjusted to 1.6 and assayed as follows: Ten ml of cell suspension were poured into in a 100 ml tightly sealed bottle (Schott bottle) which was placed on a magnetic stirrer at room temperature for the duration of the experiment. Sampling was performed at either 20 min or 30 min intervals. An aliquot of 100 ml of culture was removed and the optical density of the culture was measured at 600 nm to measure biomass content. The light production (bioluminescence in Lumi Counts Per Second, LCPS) was measured with a MicroBeta scintillation counter using microtiter plates. Twenty /l of 20 glucose were added to each well of the micro-titre plate (glucose acts as an electron donor). In each sample, luminescence activity was recorded with and without the addition of tetradecyl aldehyde. Specific activity is determined by dividing the LCPS by the OD600.

Aldehyde indicator plates Mixtures of pararosaniline and bisulfite are often referred to as Schiffreagent and have been widely used to detect aldehydes (Lillie 1977).

These components have been incorporated into a solid medium which can be used to identify clones expressing enzymes that produce aldehydes.

Indicator plates were prepared by adding 8 ml of pararosaniline (2.5 mg/ml of ethanol) and 100 mg of sodium bisulfite to precooled Luria agar. The plates were stored at room temperature, away from fumes containing aldehydes and light, both of which promote increased background colour.

WO 98/04716 PCT/AU97/00473 12

RESULTS

Cloning of luciferase components a) Background The luxAB gene products fromX. luminescens are thermally more stable (up to 45 0 C) than those of other bacteria (only up to 30 0 C Szittner and Meighen, 1990). The lux genes of this species were therefore used in the construction of this invention. The order of the lux structural genes in this organism is luxCDABE, with the luciferase genes flanked by the luxCD and luxE genes (see Fig. 1).

b) Cloning of lux AB genes In the absence of a commercially available promoter detecting lux system, work was undertaken to develop such a system. The promoterless luxAB gene cassette is designed to contain unique cloning sites (EcoRV, ClaI and EcoRI) situated immediately upstream from the ribosomal binding site (RBS) of the luxA gene, flanking transcriptional terminators (rrnbTIT2), and at minimum two unique enzyme sites (BamHI and XloI or Sal I or Pst I) which would facilitate its cloning into other vectors. Promoter sequences inserted at the EcoRV, ClaI and EcoRI sites and in the correct orientation, have the potential to express the luxAB genes.

The purpose of the rrnbTIT2 terminators upstream of the EcoRV site is to prohibit transcription from other promoters into continuing into the lux genes, while those distal to the lux genes assist in preventing the destabilisation of the host-vector system.

To facilitate the cloning of the rrnbTiT2 terminators in the different positions on pSP72, two sets of PCR primers were designed. Initially the rear terminator was amplified from the vector pKK232-8 (Brosius, 1984) and cloned into the BamHI/XbaI site of pSP72, resulting in pT2. BglII and BamHI produce compatible cohesive ends, however the religated ends cannot be recleaved by either enzyme. Hence, the original BamHI and BglII restriction sites in pSP72 and the rrnbTIT2 PCR product respectively do not exist in pT2. The forward transcriptional terminator was similarly amplified and cloned into the Bglll/EcoRV site of pT2. A positive clone (designated pTER) was isolated, characterised and retained for further study.

The luxAB genes fromX. luminescens were amplified and cloned into the EcoRl/SmaI site pUC18, resulting in a transcriptional fusion between the vector's lacZ promoter and the luxAB genes. Bioluminescence of colonies WO 98/04716 PCT/AU97/00473 13 carrying this construct were easily visualised in the dark with the naked eye, on addition of exogenous aldehyde. Characterisation of constructs isolated from ten randomly picked colonies were found to be identical to each other and genuine. One clone, designated pluxAB, was retained (see Fig. 2).

c) Cloning the Aldehyde synthase genes The luxCDE genes were placed under the transcriptional control of the trc promoter which contains the trp region and the lac UV5(-10) region separated by 17 base pairs (Amann et al., 1988). The PCR fragment generated by the luxCD primers was restricted with Eco RI/Kpn I and ligated to the Kpn I/Barn HI restricted luxE PCR product. Unique restriction enzyme sites were incorporated and positioned at the 5' termini of each primer. The nucleotide sequence of the primers and the conditions of amplification are listed in the appendix. The resulting ligation mixture was subjected to an additional 25 rounds of amplification with the luxCD forward and luxE reverse primers. The final product comprising luxCDE (approx. 3.7 Kb) was cloned into the EcoRI/BamHI sites of the expression vector pTrc 99A and transformed into NM522. Positive aldehyde producing clones were isolated by patching transformants onto aldehyde indicator plates. Subsequent PCR and RE analysis of randomly picked clones, verified the authenticity of the constructs. A clone designated pLuxCDE (see Fig. was retained for additional work.

The plasmid pTrc 99A contains the strong trc promoter which is inducible by IPTG. Furthermore, the vector contains the lacZ ribosomal binding site and the lacIq repressor, which controls the promoter. The trc promoter, however, is a very strong promoter and has been shown to initiate transcription at a low level even in an uninduced state (Amann et al., 1988).

d) Control Construct Luciferase operon Constructs encoding the entire lux operon as a single unit, were to serve as a control. The entire lux operon (CDABE genes) was amplified from X. luminescens with the luxCD forward and luxE reverse primers, using Boerhinger's expandTM Long Template PCR kit. Following EcoRI and BamHI restriction, the PCR fragment was cloned into the EcoRI/BamHI site of pTrc 99A, resulting in a transcriptional fusion between the trc promoter and the lux operon. Visual examination of the resulting recombinant clones failed to yield bioluminescence in the absence or presence of exogenous aldehyde. However, luminescence was detected with the aid of the WO 98/04716 PCT/AU97/00473 14 scintillation counter in the absence of exogenous aldehyde. Characterisation of these transformants via RE and PCR analysis, confirmed that the entire lux operon had been cloned. A representative of the transformants, designated pluxCDABE, was retained for additional work.

To rule out the possibility of an internal promoter activating transcription of the lux operon, the PCR fragment was cloned into the EcoRI/Smal sites of pTER. Examination with the naked eye and the scintillation counter, of the resulting recombinant clones (designated pTlux), failed to yield bioluminescence in the absence or presence of exogenous aldehyde. pTlux contains the luxCDABE genes flanked two transcriptional terminators (outlined in the Fig. 4).

Construction of BTEX sensor a) Background The Tol plasmid of Pseudomonas putida encodes for enzymes required in the complete degradation of toluene, m-xylene and p-xylene (Wang Dunn, 1974; Worsey Williams, 1975). The genes encoding the degradation of toluene are organised in two operons (see Fig. The 'upper' pathway is responsible for the oxidation of toluene and xylenes to aromatic carboxylic acids (Franklin et al, 1983). In addition to the genes for catabolic enzymes, the Tol plasmid encodes for the XylR regulatory protein which in concert with upper pathway effectors (such as toluene) triggers expression from the pathway operon promoter (Pu, Abril et al., 1989).

b) Cloning the regulatory genes The xylR gene was amplified (via PCR) from the archetypal Tol plasinid, and individually cloned into the Pstl/BamHI site of the broad host range vector pRK404 (Ditta et al, 1985). The resulting constructs are under the transcriptional control of the inducible lacZ promoter, as shown in Fig. 6.

Since the xylR gene contains an internal PstI site, an Nsil restriction site was introduced at the 5' end of the xylR gene product via the forward PCR primer. This primer contains a recognition site for NsiI. Cleavage with NsiI produces compatible cohesive ends with PstI, thus facilitating ligation.

The resulting construct, designated pxylac-R, contains the open reading frame (ORF) of the xydR gene.

The entire xylR gene (including its promoter Pr was also cloned.

The rationale for creating this construct was to demonstrate that strains containing heterologous genes would respond to BTX compounds more WO 98/04716 PCT/AU97/00473 rapidly than strains harbouring archetype genes. The entire xylR gene (2.1 kb) was amplified (via PCR) from the Tol plasmid, and cloned into the PstI/BamHI site of pRK404. To rule out transcriptional interference from the lacZ promoter, the xylR gene was cloned in the opposite orientation. This was assisted by exchanging the restriction sites of the forward and reverse PCR primers. Thus, the forward primer contains a BmnHI recognition site at the 5' end and similarly the reverse primer contains an NsiI site. A diagram illustrating the features of the resulting construct pXylR, is depicted in Fig. 7.

c) Fusing the catabolic promoters to the lux detection system The next step of this objective was to clone the promoter of the upper pathway of the Tol plasmid into pTER. The promoter was amplified from the Tol plasmid, individually ligated into the EcoRV/EcoRI sites of pTER and transformed into E.coli HB101. Following PCR and restriction endonuclease analysis, two clones were isolated and retained for future work. The construct harbouring the Pu promoter is designated pTU (refer to Fig. 8).

Having established that the luxAB genes from X. luminescens were functionally transcribed in E.coli, the genes were subsequently cloned into pTU. The luxAB PCR fragment was restricted with Eco RI following blunting, and individually ligated into the Eco RV/ Eco RI site of pTU, generating pTLU. Visual examination of the resulting recombinant clones failed to yield bioluminescence in the presence of exogenous aldehyde. Luminescence, however, was detected with the aid of the scintillation counter. A loop full of cells were scraped of the agar plate and resuspended in an eppendorf tube containing 100 ml of Luria broth plus 1%/o tetradecyl aldehyde. The culture was transferred to polystyrene micro-titre plates and scanned for light production using the scintillation counter. Characterisation of these transformants via RE and PCR analysis, verified that the constructs were authentic.

A diagram illustrating the respective position of the construct's components is shown in Fig. 9.

d) Transcription of Pu promoter constructs To confirm the potential usefulness of pTLU, luciferase activity of these clones was examined in response to the known effector m-xylene.

E.coli strains containing the clone and its specific regulator (pxylacR) were also examined (see Table In E.coli NM522 containing pTLU a relatively low level of luminescence was detected. These results are in agreement with WO 98/04716 PCT/AU97/00473 16 previous findings (Hugouvieux-Cotte-Pattatet al., 1990), which have shown that Pu can initiate transcription in the absence of its regulator.

Expectedly, XylR-dependent expression of the Pu promoter increased from 40 to 470 fold, depending on the type of sugar and/or IPTG present. A to 10 fold decrease in light output was observed in the absence of the effector molecule (m-xylene), for all organisms except for those grown with glucose.

The highest xylene-induced luciferase activity was recorded with cells grown in the presence of glucose (7.5 x 10 5 LCPS). Some caution must be exercised in interpreting these results, since glucose is known to repress transcription from the lacZ promoter (XylR is transcribed from the lacZ promoter).

WO 98/04716 PCT/AU97/00473 17 Table 4: Luminescence activities of recombinant E.coli (NM522) strains containing the TOL xylR regulators and the 'upper' 'promoter luxAB construct.

Constructs Supplements LCPM pLuxAB pLuxAB pxylacR pxylacR pTLU pTLU pxylacR-pTLU pxylacR-pTLU pxylacR-pTLU pxylacR-pTLU pxylacR-pTLU pxylacR-pTLU pxylacR-pTLU pxylacR-pTLU

IPTG

IPTG

+IPTG, xylene +IPTG, xylene +IPTG, xylene +IPTG, xylene xylene xylene +IPTG, xylene +IPTG, xylene glucose, xylene glucose, xylene lactose, xylene lactose, xylene 6.2 x 106 8.9 x 105 a a 1.6 x 103 2.3 x 103 6.6 x 104 1.8 x 104 4.3 x 105 8.6 x 104 7.5 x 10 4.2 x 105 3.4 x 105 4.8 x 104 Overnight cultures of the recombinant strains were diluted 100-fold into LB broth containing ampicillin and tetracycline at a concentration of 100 and 10 mg/ml, respectively. The carbon source, glucose and lactose was provided at a concentration of 1 To induce expression of the regulatory gene XylR, IPTG was added at a concentration of 1 mnM. Luminescence activities (Luminescence Counts Per Second) were determined after 5 hr in the presence of the effector m-xylene (1 mM) and the addition of 2 ml of tetradecylaldehyde. Cultures were grown at 300C.

Not detected WO 98/04716 PCT/AU97/00473 18 e) BTEX sensor control constructs The lux operon (control construct) was placed under the control of the Pu promoter. As previously mentioned, the entire lux operon (CDABE genes) was amplified fromX. luminescens using Boerhinger's expandTM Long Template PCR kit. The PCR fragment, restricted with EcoRI at the end and blunt at the 3' end, was ligated into the EcoRI/Smal sites of pTu.

Following transformation into NM522, positive bioluminating clones were identified in the absence of exogenous aldehyde with the scintillation counter. Restriction endonulease and PCR analysis was used to determine their authenticity. A representative of the transformants, designated pLu-x, was retained for additional work (see Fig. 10). An attempt was made to determine the background luminescence activity. pLu-x was cultured in Luria broth and assayed according to the protocol described in the method and materials section. No luminescence was detected in the presence or absence of exogenous m-xylene.

f) Construction of complete BTEX sensor The Pu-luxAB cassette was isolated from pTLU via agarose gel electrophoresis following restriction with BamHI/PstI, and cloned into the similarly restricted sites of pluxCDE. Characterisation of these transformants via RE and PCR analysis, confirmed that the Pu-luxAB cassette was fused to the luxCDE genes. A representative of the transformants, designated pLEU, was retained for additional work. The relative position of the Pu-luxAB cassette in pLEU is outlined in Fig. 11. In order to determine the background luminescence activity, pLEU was cultured in Luria broth and assayed according to the protocol described in the materials and methods section.

Repeated assays failed to show luminescence, even in the presence of mxylene. These results clearly indicate lack of induction of Pu in the absence of the regulatory protein Xyl R.

The test strain Leu-lacR was created by transforming both pLEU and pxylac-R into NM522 and selecting for resistance to ampicillin and tetracycline. Similarly, Leu-R, Lux-lacR and Lux-R were produced by transforming the respective constructs (refer to Tables 1 and 2) into NM522.

Assay results of these strains are presented in Fig. 12. and Fig. 13.

The functionality of the novel sensor of the present invention is demonstrated in Figs. 12 and 13. The response of the new sensor was clearly superior to that obtained with the reference construct based on the native lux WO 98/04716 PCT/AU97/00473 19 gene cassette. The induction of the light signal was faster and much more intensive in the new sensor. Fig. 13 clearly shows that linear calibration curves can be obtained with such sensors down to sub-ppm levels in the case of xylene. Sensor responses are therefore significantly improved by splitting of lux genes as achieved in the novel sensor constructs.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

WO 98/04716 WO 9804716PCT/AU97/00473 References Abril, Mv. Michan, Timmis, K. and Ramos, J. L. (1989) J. Bacteriol.

171: 6782-6790.

Arnann, Ochs, 13. Abel, K.-J.(1988) Gene 69: 301-3 Brosius, J. (1984) Gene, 27: 151-160.

Burlage, R. S. Kuo, (1994) Annu. Rev. Microbiol. 48, 291-309.

Ditta, Schrnidhauser, Yakobson, Lu, Liang, Finlay, D.R., Guiney, D. and Helinski, D.R. (1985) Plasmid 13: 149-153.

Franklin, Lelirbach, Lurz, Rureckert, Bagdasarian, Mv. and Tiniinis, K.N. (1983) J. Bacteriol. 154: 676-685.

Hugouvieux-Cotte-Pattat, N.,Kohler, Rekik,. Mv., and Harayama, S. (1990) J. Bacteriol. 172: 665 1-6660.

King, DiGrazia, Applegate, Burlage, Sanseverino, J., Dunbar, Larimer, F. and Sayler, G.S. (1990) Scienice 249: 778-781.

Lillie, R.D. (1977) Conn's biological stains, 9th ed., p. 259-2 6. The Williams Wilkins Co. Baltimore.

Meighen E. A. Ann. Rev. Genetics, 28, 117-139, (1994).

Morelle, G. (1989) A plasmid extraction procedure on a miniprep scale.

Focus (BRL, USA) 11.1: 7-8.

Sambrook, Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

Szittner, R. and lveighen, E. (1990) Biol. Chiem. 265: 16581-16587 Worsey, M.J. and Williams, P.A. (1975) Bacteriol. 124: 7-13.

Baldwin, T. Berends, Bunch, T. Holzmnan, T. Rausch, S. K.; Shamansky, Treat, Mv. L. and Ziegler, Mv. Mv. (1984) Biochemistry 23, 3663- 3667.

Wang, C. L. Dunn, N. W. (1974) Genetical Research 23, 227-232.

WO 98/04716 WO 9804716PCT/AU97/00473 21 Appendix 1: PCR of the XyIJR gene from the TOL plasmid in Psuedom on as putida.

According to computer analysis (PCRpriiner and Amplify) the following primers were used: XvJR gene XyIR ORF: Forward primer 30 mnei 3'

CCAATGCATTGTGGATCATCCCGATAAAAA

Nsi I rfm 52.OOG G.C. Reverse primer 28 iner 3T

CGGGATCCCGCCCGTTTTCACACAACCT

Barn HI Tm -60.9 OC G.G. PCR conditions: primers annealed for 30 secs. at 46 oC. extention time of mins. for 30 cycles.

Resulting product size: Approx. 1963 bps WO 98/04716 WO 9804716PCT/AU97/00473 22 XyJ3 entire gene: Forward primer (XylRN.for): 29 mer 51 31

CGGGATCCCGGATGTGCGTTGAGGTGGAT

Bamifl Tm -62.4 0 C G.G. 62% Reverse primer (XylRn.rev): 29 mer 51 3'

CCAATGCATTGCCCGTTTTCACACAACGT

NsiI Tm -60.9 OC G.C. 48% PCR conditions: primers annealed for 30 secs. at 450C, extention time of mins. for 30 cycles.

Resulting product size: Approx. 2111 bps Terminators PCR the Esclierichia coli 5s ribosomal RNA terminators (rrnbTjT2) from the vector pkk232-8. According to computer analysis (PCRprim-er and Amplify) the following primers were designed: Forward Terminator Forward primer (Friib.F): 36 mer 3' GAAGATUFJ7CGGGATCCTCAGAAGTGAAACGCCGTA BglHII Bam 1H Tm 59.1 OCGC-50 G.C WO 98/04716 WO 9804716PCT/AU97/00473 23 R everse primer (Frlnb.R): 27 mier 3'

CGGATATGGTGATGCAAAAACGAGGCT

Eco RV Tin- 62 OC G. Product size: Approx. 390 bps Rear Terminator Forward primer (Rrnb.F): 26 mer 3'

GAAGATCTCAGAAGTGAAACGCCGTA

Bgl II Tm 59.1 OC G.C Reverse primer (Rrnib.R): 29 mer 3'

GCTCTAGAGCGTGATGCAAAAACGAGGTC

Xba I Tin- 62 OC G.C Product size: Approx. 380bps PCR conditions for both products: primers annealed for 10 secs. at 63 0

C,

extention time of 30 secs. for 20 cycles.

WO 98/04716 WO 9804716PCT/AU97/00473 24 Xenor-habdus luntinescens Lux CDABE genes PCR the Jux operon (CDABE) genes including the ribosomal binding site) from X lLuminescefls.. The following gene(s) were amplified as a single unit: lux CD -Jlux AB lux E entire operon lux GDABE According to computer analysis (PCRprimer and Amplify) the following primers were used: Lux CD: Forward primer (luxGD.F): 26 mner 31

GGAATTCCCCCCGATTAAATGGATGGC

Eco RI Tm 62.2 OC G.C. 53%/ Reverse primer (luxCD.R): 32mer 3'

GGGGTACCCCGCAAAAAGTTTCCAAATTTCAT

KpnI Tin- 57.4 OC G.C. 27% PCR conditions: primers annealed for 30 secs. at 52 OC, extention time of mins. for 25 cycles.

Resulting product size: Approx. 2483 bps WO 98/04716 WO 9804716PCT/AU97/00473 Lux AB: Forward primer (Iux.F): 32 mer 3'

GGGAATTCCGAAGGACTGTCTATGAAATTTGG

Eco RI Tm 54.4 0 C G.C. 36% Reverse prinier (lux.R): 18 iner 3'

CCTGTGCAACTCGAAAT

Tm 61.5 OC G.C. 53% PCR conditions: primers annealed for 30 secs. at 50 0 C, extention time of mins, for 25 cycles.

Resulting product size: Approx. 2114 bps WO 98/04716 WO 9804716PCT/AU97/00473 Lux E: Forward primer (luxE.F): 32 mer

GGGGTACCCCCTTGAGGAGTAAAACAGGTATG

KpnI Tm 53.4 0 C G.C. 41% Reverse primer (luxE.R): 30 mier GCAAGGGATCCACTTACAATTrAGGCAAAGG Bain HI Tm 58.3 0 C G.G. 41% PCR conditions: primers annealed for 30 secs. at 45 0 C, extention tine of m~ins. for 25 cycles.

Resulting product size: Approx. 1205bps WO 98/04716 WO 9804716PCT/AU97/00473 27 Lux operon; Forward primer (lu-xCD.F): 25 mer 3'

GTTGGAATTCCCCCGATTAAATGG

Eco RI Tm 62.2 0 C G.C. 53% Reverse primer (luxE.R): 30 mer 51 31

GCAAGGGATCCACTFACAATT-AGGCAAAGG

Barn HI Tm 58.3 OC G.C. 41% PCR conditions: Used the Boerhinger expanldTM Long Template PCR kit.

Essentually the first 10 cycles were as follows: denature 940C for 10 secs.

anneal at 520C for 30 secs.

elongation at 680C for 5 mins.

Then 15 cycles as follows: denature 940C for 10 secs.

anneal at 52 0 C for 30 secs.

elongation at 68 0 C for 5 mnins. with a 20 sec incremental increase in each elongation step.

Resulting product size: Approx. 583 1 bps WO 98/04716 WO 9804716PCTIAU97/00473 28 Upper toluate catabolic pathway promoter region PCR the upper toluate catabolic pathway promoter including the ribosomal binding site) from the TOL plasinid in Pseudom on as putida. According to computer analysis (PCRprimer and Amplify) the following primers are to be used: Forward primer 19 mer 51 3'

GGAAAGCGCGATGAACCTT

Tm 62.6 0 G G.G. 53%/ Reverse primer 28 mer 51 31

GCGAATTCCTGAAGGGTCACCACTATTT

Eco RI Tmn 61.5 OC G.C. 53% PCR conditions: primers annealed for 10 secs. at 58 OC, extention time of secs. for 25 cycles.

Resulting product size: Approx. 246bps WO 98/04716 WO 9804716PCT/AU97/00473 29 Appendix 2: Examples of promoters which may be used as sensor elements: Promoter Signal Reference inei Psal heavy metals (particularly mercury) naphthalene, salicylate aluininiunm fliC arsB arsenic cadmium cadA Selinofova, Burlage, R. and- Barkay, Appi. Env. Microbiol., 59, 3083-3090, 1993.

Heitzer, Webb, 0. F.; Thonnard, J. E. Sayler, G.

Appl. Env. Microbiol,, 58, 1839-1846, 1992.

Guzzo, J.;Guzzo, A. DuBow, M. S. Toxicol. Lett. 64/65, 687- 693, 1992.

Corbisier, Ji, Nuyts, G.; Mergeay, M. Silver, S. FEMS Microbiol. Lett., 110, 231-238, 1993.

Corbisier, Ji, Nuyts, G.; Mvergeay, M. Silver, S. FEMS Microbiol. Lett., 110, 231-238, 1993.

Abril, M. Michan, Timmis, K. and Ramos, J. L. J.

Bacteriol. 171, 6782-6790, 1989.

van der Meer, J. deVos, W.

Harayama, S. Zehnder, A. Microbiol. Rev., 56, 677-694, 1992.

van der Meer, J. deVos, W.

Harayama, S. Zehnder, A. Microbiol. Rev., 56, 677-694, 1992.

Pm and Ps aromatic hydrocarbons chlorobenzenes chlorobenzoates dCI WO 98/04716 WO 9804716PCT/AU97/00473 bpli deVos, W.

polychlorinated biphenyls van der Meer, J. I Mv., Harayama, S. Zehnder, A. Microbiol. Rev., 56, 677-694, 1992.

cat catechol dinpR phenols lac ara lactose arabinose rhamnose melibiose van der Meer, J. deVos, W.

Harayama, S. Zehnder, A. Microbiol. Rev., 56, 677-694, 1992.

Sze, C. M~oore, T. Shingler, V. Appi. Env. Microbiol., 178, 3727-3735, 1996.

Engebrecht Simon.. M. Silverman, M. Science, 227, 1345-1347, 1985.

Engebrecht Simon, M. Silverman, Mv. Science, 227, 1345-1347, 1985.

Ramnos, J. Rojo, F. Timmis, K. N. Nucleic Acids Res. 18, 2149-2152, 1990.

Ramos, J. Rojo, F. Timmis, K. N. Nucleic Acids Res. 18, 2149-2152, 1990.

Ramos, J. Rojo, F. Timmis, K. N. Nucleic Acids Res. 18, 2149-2152, 1990.

Ramos, J. Rojo, F. Timmis, K. N. Nucleic Acids Res. 18, 2149-2152, 1990.

Fisher, S. Rohrer, K. Ferson, A. E. J. Bact., 178, 3779-3784, 1996.

Shingler, V. Mol. Miocrobiol. 19, 409-416, 1996.

Shingler, V. Mol. Miocrobiol. 19, 409-416, 1996.

me] xylose sorbose hut histidine nifA ntrC nitrogen assimilation nitrogen-assimilation WO 98/04716 WO 9804716PCT/AU97/00473 expression of lateral flagella in E. coli, induced in response to surfaces proU osmolarity csiA starvation sigB, ctc, gsiB, gspA, katE, gspB, gtaB, csbA stress response of Bacillus subtilis Engebrecht Simon, M. Silverman, M. Science, 227, 1345-134 7, 1985 Zhang, Fletcher, S. A. Csonka, L. N. J. Bact. 178, 3377-3379, 1996.

Kjelleberg, Albertson, N.

Flirdh, Holmquist, L.; jouper-Jaan, A; Marouga, R.; Ostling, Svenblad. B. Weichart, D. Antonie van Leeuwenhoek, 63, 3/4, 333-342, 1993.

Hecker, NM.; Schumann, W. Vblker, U. Mol. Microbiol., 19, 417-428, 1996.

Van Dyk, T. Majarian, W. R.; Konstantinov. K. Young, R.

Mv.; Dhurjati, P. S. LaRossa, R.

A. Appl. Env. Microbiol., 1414-1420, 1994.

Van Dyk, T. Majarian, W. R.; Konstantinov, K. Young, R.

Mv.; Dhurjati, P. S. LaRossa, R.

A. Appl. Env. Microbiol., 1414-1420, 1994.

Shingler, V. Mol. Miocrobiol. 19, 409-416, 1996.

Nakashima, Kanamaru, K.; Mizuno, T. Horikoshi, K. J.

Bact. 178, 2994-2997, 1996.

Shingler, V. Mol. Miocrobiol.- 19, 409-416, 1996.

dn aK heat shock heat shock grpE algB cspA lirpS alginate biosynthesis cold shock virulence determinants

Claims (5)

1. A genetic construct for use in a biosensor comprising: a first nucleic acid molecule including a sequence encoding a reporter molecule having a detectable activity; and a second nucleic acid molecule including a sequence encoding an enzyme which produces a substrate for the reporter molecule, the first sequence being under the control of a first inducible promoter and the second sequence being under the control of a second inducible promoter.

2. The construct according to claim 1 such that the first nucleic acid molecule encodes bacterial luciferase Lux AB or a functional equivalent thereof, and the second nucleic acid molecule encodes Lux CDE enzyme fatty acid reductase or a functional equivalent thereof.

3. The construct according to claim 2 such that the nucleic acid molecules encoding Lux are obtained from any of the lux operons of bioluminescent microorganisms which belong to the genera Vibrio, Xenorhabdus, Photorhabdus and Photobacterium.

4. The construct according to any one of claims 1 to 3 for use to detect xylene wherein Pu promoter is the first promoter. The construct according to claim 4 substantially as set out in Figure

14. 6. The construct according to any one of claims 1 to 5 such that the first promoter is inducible by exposure to an environmental signal, wherein induction being achieved directly by the signal or indirectly by activating one or more separate pathways in a cell containing the construct. 7. The construct according to any one of claims 1 to 6 further including nucleic acid molecules encoding auxiliary element or elements required for activation of the reporter molecule via its promoter. 8. A biosensor for measuring an environmental signal comprising a cell including the genetic construct according to any one of claims 1 to 7 and a means for measuring the activity of the reporter molecule in the cell when the cell has been exposed to the environmental signal. 9. The biosensor according to claim 8 wherein the cell is selected from the group consisting of bacterial, yeast, fungal and other plant cells, and animal. 10. The biosensor according to claim 9 wherein the cell is a bacterial cell. WO 98/04716 PCT/AU97/00473 33 11. The biosensor according to claim 10 wherein the bacterial cell is Escherichia coli. 12. The biosensor according to any one of claims 8 to 11 wherein the environmental signal is selected from the group consisting of pollutants, toxins, temperature, irradiation, biological, and chemical. 13. The biosensor according to any one of claims 8 to 12 wherein the means for measuring the activity of the reporter molecule in the cell is an instrument capable of measuring light output of the cells. 14. The biosensor according to claim 13 wherein the instrument capable of measuring the light output of the cells is selected from the group consisting of photomultipliers, charge coupled devices, luminometers, photometers, fiber-optic cables, and liquid scintillation counters. A method of detecting an environmental signal comprising: exposing a biosensor according to any one of claims 8 to 14 to the signal such that the signal induces the expression of the reporter molecule of the cells in the biosensor, wherein prior to or during exposure the cells are induced to produce an enzyme such that substrate is formed in the cells; allowing the reporter molecule to react with the pre-formed substrate to form a detectable reaction; and detecting the reaction. SUBSTITTE SHEET (RULE 26)