AU718197B2 - DNA encoding human alpha 1 adrenergic receptors and methods therefor - Google Patents
DNA encoding human alpha 1 adrenergic receptors and methods therefor Download PDFInfo
- Publication number
- AU718197B2 AU718197B2 AU34207/97A AU3420797A AU718197B2 AU 718197 B2 AU718197 B2 AU 718197B2 AU 34207/97 A AU34207/97 A AU 34207/97A AU 3420797 A AU3420797 A AU 3420797A AU 718197 B2 AU718197 B2 AU 718197B2
- Authority
- AU
- Australia
- Prior art keywords
- human
- adrenergic receptor
- compound
- chemical compound
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Description
AUSTRALIA
PATENTS ACT 1990
ORIGINAL
COMPLETE SPECIFICATION
S.
*r S *5 Name of Applicant: Address of Applicant: Actual Inventor(s): Synaptic Pharmaceutical Corporation 215 College Road, Paramus, New Jersey 07652-1410, United States of America Jonathan A. BARD Carlos FORRAY Richard L. WEINSHANK DAVIES COLLISON CAVE, Patent Attorneys, 1 Little Collins Street, Melbourne, 3000.
Address for Service: Complete Specification for the invention entitled: DNA encoding human alpha 1 adrenergic receptors and methods therefor The following statement is a full description of this invention, including the best method of performing it known to us: '7/ P:\OPER\MRO\AU677968.DIV 14/8/97
A-
DNA ENCODING HUMAN ALPHA 1 ADRENERGIC RECEPTORS AND METHODS THEREFOR Background of the Invention Throughout this application various publications are referred to by partial citations within parenthesis. Full citations for these publications may be found at the end of the specification immediately preceding the claims. The disclosures of these publications, in their entireties, are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.
Throughout the specification and the claims that follow, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements of integers.
Although adrenergic receptors (ARs) bind the same endogenous catecholamines (epinephrine and norepinephrine, NE) their physiological as well as pharmacological specificity is markedly diverse. This diversity is due primarily to the existence of at least nine different proteins 20 encoding three distinct adrenergic receptors types ct, and These proteins belong to the super-family of G-protein coupled receptors, and are characterized by a single polypeptide chain which span the plasma membrane seven times, with an extracellular amino terminus, and a cytoplasmic carboxyl terminus. The molecular cloning of three genes encoding a,-ARs supports the existence of pharmacologically and anatomically distinct a,-receptor subtypes. The 25 alb-receptor was originally cloned from a hamster smooth muscle cell line cDNA library, and encodes a 515 a.a. peptide that shows 42-47% homology with other ARs. The message for the alb- receptor is abundant in rat liver, heart, cerebral cortex and kidney, and its gene was localized to human chromosome 5 A second cDNA clone from a bovine brain library was found which encoded a 466-residue polypeptide with 72% homology to the alb-AR gene. It was further distinguished from alb by the finding that its expression was restricted to human hippocampus, and t 6 -2by its localization to human chromosome 8 and it has been designated as the ai,-AR The cloning of an a,,-AR has been reported recently. This gene, isolated from a rat brain cDNA library, encodes a 560-residue polypeptide that shows 73% homology with the hamster alb-receptor. The message for this subtype is abundant in rat vas deferens, aorta, cerebral cortex and hippocampus, and its gene has been localized to human chromosome 5 (12).
Pharmacological studies have demonstrated the existence of two a,-adrenergic receptor subtypes. The studies of a,-AR-mediated responses in vascular tissue suggested the possible existence of receptor subtypes, based on the potency and efficacy of adrenergic agonists, as well as differential sensitivity of al receptormediated responses to extracellular calcium and calcium channel blockers 24). Although radioligand binding studies of brain a,-ARs with either [3H]WB4101 and 20 [3H]prazosin showed good agreement with the potency of a-adrenergic antagonists on vascular responses (23, subsequent binding studies of rat brain a,-ARs provided strong evidence for the existence of receptor heterogeneity, based on the relative affinities for prazosin and WB4101 These observations were supported by the finding that chloroethylclonidine (CEC) inactivated 50% of the a, sites from rat cerebral cortex and 80% of the binding sites from liver or spleen (alb), but did not inactivate a,-receptors from S 30 the hippocampus or vas deferens (aa) Taken together, these results suggested a classification of the ala-subtype as high affinity for WB4101 and insensitive to alkylation by CEC, and alb-subtype as to 20 fold lower affinity for WB4101, but sensitive to inactivation by CEC. Consistent with this evidence the transfection of the hamster al gene into COS-7 cells induced the expression of an al-receptor with high -3affinity for WB4101, 95% of which could be inactivated by CEC. Conversely, upon expression of the rat a, receptor gene in COS-7 cells, it showed a higher affinity for WB4101 than the alb-receptor, and the binding site was resistant to inactivation by CEC.
The existence of the al receptor was not predicted from pharmacological data and upon expression it showed 16 and 30 fold higher affinity for WB4101 and phentolamine respectively, than the alb-receptor and was partially inactivated by CEC.
Molecular cloning and pharmacological studies have demonstrated the existence of at least three a 1 adrenergic receptor subtypes. However, it is not clear whether the pharmacological properties of these three cognates might be due also to species differences.
This caveat is particularly relevant in the case of the bovine a,1 receptor, due to its restricted species and tissue expression. The cloning and expression of the 20 human a, adrenergic receptors will allow the further characterization of the pharmacology of the individual Shuman a, receptor subtypes.
*e -4summary of the Invention This invention provides and isolated nucleic acid molecule encoding a human a, adrenergic receptor.
This invention further provides an isolated nucleic acid molecule encoding a human receptor. In one embodiment of this invention, the nucleic acid molecule comprises a plasmid pcEXV-a,,. This invention also provides an isolated nucleic acid molecule encoding a human alb receptor. In one embodiment of this invention, the nucleic acid molecule comprises a plasmid pcEXV-ab This invention further provides an isolated nucleic acid molecule encoding a human a receptor. In one embodiment of this invention, the nucleic acid molecule comprises a plasmid pcEXV-ac" This invention also provides vectors such as plasmids comprising a DNA molecule encoding a human a, receptor, adapted for expression in a bacterial, a yeast cell, or r 20 a mammalian cell which additionally comprise regulatory elements necessary for expression of the DNA in the bacteria, yeast or mammalian cells so located relative to the DNA encoding the human receptor as to permit expression thereof. This invention also provides vectors such as plasmids comprising a DNA molecule encoding a human alb receptor, adapted for expression in a bacterial, a yeast cell, or a mammalian cell which additionally comprise regulatory elements necessary for expression of the DNA in the bacteria, yeast or mammalian cells so located relative to the DNA encoding the human alb receptor as to permit expression thereof.
This invention also provides vectors such as plasmids comprising a DNA molecule encoding a human a 1 c receptor, adapted for expression in a bacterial, a yeast cell, or a mammalian cell which additionally comprise regulatory elements necessary for expression of the DNA in the bacteria, yeast or mammalian cells so located relative P:\OPER\MRO\AU677968.DIV 14/8/97 to the DNA encoding the human receptor as to permit expression thereof.
This invention provides a mammalian cell comprising a DNA molecule encoding a human ca receptor, in particular cells expressing said receptor on their surface and membrane fractions derived therefrom. This invention also provides a mammalian cell comprising a DNA molecule encoding a human alb receptor in particular cells expressing said receptor on their surface and membrane fractions derived therefrom. This invention also provides a mammalian cell comprising a DNA molecule encoding a human receptor in particular cells expressing said receptor on their surface and membrane fractions derived therefrom.
This invention provides a nucleic acid probe comprising a nucleic acid molecule of at least nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human aia receptor. This invention provides a nucleic acid probe comprising a nucleic acid molecule of at least 15 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human receptor. This invention provides a nucleic acid probe comprising a nucleic acid molecule of at least 15 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human alb receptor. This invention provides a nucleic acid probe comprising a nucleic acid molecule of at least 15 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human a 1 receptor.
This invention provides an antisense oligonucleotide having a sequence capable of specifically binding to any sequences of an mRNA molecule encoding a human aca receptor so as to prevent translation of the mRNA molecule. This invention provides an antisense oligonucleotide having a sequence capable of specifically binding to any sequences of an mRNA molecule encoding a human alb receptor so as to prevent translation of the mRNA molecule. This invention provides an antisense oligonucleotide having a sequence capable of specifically binding to any sequences of an -6mRNA molecule encoding a human are receptor so as to prevent translation of the mRNA molecule.
This invention provides method for detecting expression of a specific human a, adrenergic receptor, which comprises obtaining RNA from cells or tissue, contacting the RNA so obtained with a nucleic acid probe comprising a nucleic acid molecule of at least nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human a, receptor under hybridizing conditions, detecting the presence of any mRNA hybridized to the probe, the presence of mRNA hybridized to the probe indicating expression of the specific human a, adrenergic receptor, and thereby detecting the expression of the specific human a, adrenergic receptor. 3 This invention provides a method for detecting the 20 expression of a specific human al adrenergic receptor .in a cell or tissue by in situ hybridization which comprises, contacting the cell or tissue with a nucleic acid probe comprising a nucleic acid molecule of at least 15 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human a, receptor under hybridizing conditions, detecting the presence of any mRNA hybridized to the probe, the presence of mRNA hybridized to the probe indicating 30 expression of the specific human a, adrenergic receptor, and thereby detecting the expression of the specific human a, adrenergic receptor.
This invention provides a method for isolating a nucleic acid molecule encoding a receptor by nucleic acid sequence homology using a nucleic acid probe, the sequence of which is derived from the nucleic acid -7sequence encoding a human al adrenergic receptor.
This invention provides a method for isolating a nucleic acid molecule encoding a human a, adrenergic receptor which comprises the use of the polymerase chain reaction and oligonucleotide primers, the sequence of which are derived from the nucleic acid sequence encoding a human al adrenergic receptor.
This invention provides a method for isolating a human a, adrenergic receptor protein which comprises inducing cells to express the human a, adrenergic receptor protein, recovering the human a, adrenergic receptor from the resulting cells, and purifying the human a, adrenergic receptor so recovered.
This invention provides an antibody to the human ala adrenergic receptor. This invention also provides an ~antibody to the human alb adrenergic receptor. This invention also provides an antibody to the human a c adrenergic receptor.
A pharmaceutical composition comprising an amount of a substance effective to alleviate the abnormalities resulting from overexpression of a human a adrenergic receptor and a pharmaceutically acceptable carrier is provided by this invention. A pharmaceutical composition comprising an amount of a substance effective to alleviate the abnormalities resulting from 30 overexpression of a human alb adrenergic receptor and a pharmaceutically acceptable carrier is provided by this invention. A pharmaceutical composition comprising an amount of a substance effective to alleviate the abnormalities resulting from overexpression of a human a1, adrenergic receptor and a pharmaceutically acceptable carrier is provided by this invention.
A pharmaceutical composition comprising an amount of a substance effective to alleviate abnormalities resulting from underexpression of a human al, adrenergic receptor and a pharmaceutically acceptable carrier is provided by this invention. A pharmaceutical composition comprising an amount of a substance effective to alleviate abnormalities resulting from underexpression of a human alb adrenergic receptor and a pharmaceutically acceptable carrier is provided by this invention. A pharmaceutical composition comprising an amount of a substance effective to alleviate abnormalities resulting from underexpression of a human acr adrenergic receptor and a pharmaceutically acceptable carrier is provided by this invention.
This invention provides a transgenic non-human mammal whose genome comprises a nucleic acid molecule encoding a human al adrenergic receptor, the DNA molecule so 20 placed as to be transcribed into antisense mRNA complementary to mRNA encoding a human a, adrenergic receptor and which hybridizes to mRNA encoding a human l adrenergic receptor thereby reducing its o translation.
This invention provides a method for determining the physiological effects of varying the levels of expression of a specific human al adrenergic receptor which comprises producing a transgenic non-human mammal S 30 whose levels of expression of a human a, adrenergic receptor can be varied by use of an inducible promoter.
This invention provides method for determining the physiological effects of expressing varying levels of a specific human a. adrenergic receptor which comprises producing a panel of transgenic non-human mammals each -9expressing a dif ferent amount of the human al adrenergic receptor.
This invention provides a method for determining whether a ligand not known to be capable of specifically binding to a human a, adrenergic receptor can bind to a human a, adrenergic receptor, which comprises contacting a mammalian cell comprising a plasmid adapted for expression in a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor on the cell surface with the ligand under conditions permitting binding of ligands known to bind to a human a, adrenergic receptor, detecting the presence of any ligand bound to the human a, adrenergic receptor, the presence of bound ligand thereby determining that the ligand binds to the human a, adrenergic receptor.
This invention provides a method for screening drugs to 20 identify drugs which interact with, and -specifically bind to, a human aI adrenergic receptor on the surface a cell, which comprises contacting a mammalian cell comprises a plasmid adapted for expression in a :..manmalian cell- which further comprises a DNA molecule 25 which expresses a human a, adrenergic receptor on [.the cell surface with a plurality of drugs, determining those drugs which bind to the human al adrenergic receptor expressed on the cell surface of the mammalian :'"cell, and thereby identifying drugs which interact !30 with, and bind to, the human aI adrenergic receptor.
This invention provides a method for identifying a ligand which binds to and activates or blocks the activation of, a human a, adrenergic receptor expressed on the surface of a cell, which comprises contacting a mammalian cell which comprises a plasmid adapted for expression in a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor on the cell surface with the ligand, determining whether the ligand binds to and activates or blocks the activation of the receptor using a bioassay such as a second messenger assays.
This invention also provides a method for identifying a ligand which is capable of binding to and activating or inhibiting a human a, adrenergic receptor, which comprises contacting a mammalian cell, wherein the membrane lipids have been labelled by prior incubation with a labelled lipid precursor molecule, the mammalian cell comprising a plasmid adapted for expression in a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor with the ligand and identifying an inositol phosphate metabolite released from the membrane lipid as a result of ligand binding to and activating an a, adrenergic receptor.
This invention also provides a method for identifying a ligand that is capable of binding to and activating or inhibiting a human a, adrenergic receptor, wherein the binding of ligand to the adrenergic receptor results in a physiological response, which comprises contacting a mammalian cell which comprises a plasmid adapted for expression in a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor with a calcium sensitive 30 fluorescent indicator, removing the indicator that has not been taken up by the cell, contacting the cells with the ligand and identifying an increase or decrease in intracellular Ca* 2 as a result of ligand binding to and activating or inhibiting a, adrenergic receptor activity.
P:\OPER\MRO\AU677968.DIV 15/8/97 This invention further provides a method of determining whether a compound is capable of binding or activating or inhibiting a human a, adrenergic receptor comprising incubating a recombinant human a, adrenergic receptor with said chemical compound for a time and under conditions suitable for binding or activation or inhibition to occur and detecting said binding or activation or inhibition of the recombinant human a, adrenergic receptor.
The step of detecting binding or activation or inhibition of the a, adrenergic receptor by the chemical compound may be performed directly, for example wherein the chemical compound is labeled with a suitable reporter molecule such as a fluorescent or other chemical tag or alternatively, wherein the activated or inhibited recombinant human a, adrenergic receptor activity is assayed. Alternatively, binding or activation or inhibition of the recombinant human a, adrenergic receptor may be assayed by indirect means, by measuring a second messenger response.
15 In an alternative embodiment, binding or activation or inhibition of the recombinant human a, adrenergic receptor is performed in a competitive assay format.
9 9 Accordingly, the invention further provides a process, involving competitive binding, for identifying a chemical compound which specifically binds to a human a, adrenergic receptor, 20 which comprises separately incubating recombinant human a, adrenergic receptor, preferably expressed on the cell surface of a non-neuronal cell, with the both the chemical compound and a second chemical compound known to bind to the human a, adrenergic receptor, and with only the second chemical compound, under conditions suitable for binding to occur, and detecting specific binding of the chemical compound to the human a, adrenergic receptor, a 25 decrease in binding of the second chemical compound to the human a, adrenergic receptor in the presence of the chemical compound indicating that the chemical compound binds to the human a, adrenergic receptor.
P:\OPER\MRO\AU677968.DIV 15/8/97 -0lB- The invention further provides a process, involving competitive binding, for identifying a chemical compound which specifically binds to a human a, adrenergic receptor, which comprises separately incubating a membrane fraction from a cell extract of nonneuronal cells expressing on their cell surface recombinant human a, adrenergic receptor with both the chemical compound and a second chemical compound known to bind to the human a, adrenergic receptor, and with only the second chemical compound, under conditions suitable for binding to occur, and detecting specific binding of the chemical compound to the human a, adrenergic receptor, a decrease in binding of the second chemical compound to the human a, adrenergic receptor in the presence of the chemical compound indicating that the chemical compound binds to the human a, adrenergic receptor.
The invention further provides a process for determining whether a chemical compounc.t specifically binds to and/or activates a human a, adrenergic receptor, which comprises incubating recombinant human a, adrenergic receptor, preferably expressed on the surface of a nonneuronal cell producing a second messenger response, with the chemical compound .i !under conditions suitable for activation of the human a, adrenergic receptor, and measuring activation of said receptor, preferably by measuring the second messenger response, in the presence and in the absence of the chemical compound, a change in receptor activation in the presence of the chemical compound indicating that the chemical compound activates the human a, adrenergic receptor.
The invention further provides a process for determining whether a chemical compound specifically binds to and/or activates a human a, adrenergic receptor, which comprises incubating a membrane fraction from a cell extract of nonneuronal cells, preferably producing a second messenger response and expressing on their cell surface a recombinant human i 1 adrenergic receptor, with the chemical compound under conditions suitable for activation of the human a, adrenergic receptor, and measuring activation of said receptor preferably by measuring the second messenger response, in the presence and in the absence of the chemical compound, a change in receptor activation in the presence of the chemical compound indicating that the chemical compound activates the human a, adrenergic receptor.
P:\OPER\MRO\AU677968.DIV 15/8/97 10C The invention further provides a process for determining whether a chemical compound specifically binds to and/or inhibits activation of a human ca, adrenergic receptor, which comprises separately incubating recombinant human a, adrenergic receptor, preferably expressed on the surface of a nonneuronal cell producing a second messenger response, with both the chemical compound and a second chemical compound known to activate the human a, adrenergic receptor, and with only the second chemical compound, under conditions suitable for activation of the human a, adrenergic receptor, and measuring receptor activation and/or the second messenger response in the presence of only the second chemical compound and in the presence of both the second chemical compound and the chemical compound, a smaller change in the activation of the receptor in the presence of both the chemical compound and the second chemical compound than in the presence of only the second chemical compound indicating that the chemical compound inhibits the activation of the human a, adrenergic receptor.
.15 The invention further provides a process for determining whether a chemical compound .I specifically binds to and inhibits activation of a human a, adrenergic receptor, which comprises separately contacting a membrane fraction, preferably derived from a cell extract of nonneuronal cells producing a second messenger response and expressing on their cell surface a recombinant human a, adrenergic receptor, with both the chemical compound and a second chemical compound known to activate the human a, adrenergic receptor, and with only the second chemical compound, under conditions suitable for activation of the human a, adrenergic receptor, and measuring receptor activation, preferably via the second messenger response, in the presence of only the second chemical compound and in the presence of both the second chemical compound and the chemical compound, a smaller i 25 change in receptor activation in the presence of both the chemical compound and the second chemical compound than in the presence of only the second chemical compound indicating that the chemical compound inhibits the activation of the human cc 1 adrenergic receptor.
P:\OPER\MRO\AU677968.DIV 15/8/97 Wherein the receptor activation is determined by measuring a second messenger response, it is particularly preferred that the second messenger response comprise activation of phosphatidyl inositol specific phospholipase C and further, that any change in second messenger response is determined by measuring an increase in phosphatidyl inositol lipid metabolism. Alternatively, the second messenger response may comprise intracellular calcium levels and the change in second messenger response be determined by measuring an increase in intracellular calcium levels.
For assays of inhibitors of receptor activation, the desired change in second messenger response is a smaller increase in the second messenger response in the presence of both the chemical compound and the second chemical compound than in the presence of only the second chemical compound. More particularly, the desired change in second messenger response is a smaller increase in the level of intracellular calcium or alternatively, a smaller activation of phosphatidyl inositol specific phospholipase C, in the presence of both the 15 chemical compound and the second chemical compound than in the presence of only the second chemical compound.
The present invention clearly extends to any chemical compounds identified as binding and/or activating and/or reducing activation of a human ct adrenergic receptor using the inventive 20 method and pharmaceutical compositions comprising same.
This invention provides a method for detecting the -11presence of a human ala adrenergic receptor on the surface of a cell, which comprises contacting the cell with an antibody to human adrenergic receptor under conditions which permit binding of the antibody to the receptor, detecting the presence of any of the antibody bound to the human ala adrenergic receptor and thereby the presence of a human ala adrenergic receptor on the surface of the cell.
This invention provides a method for detecting the presence of a human ab adrenergic receptor on the surface of a cell, which comprises contacting the cell with an antibody to human alb adrenergic receptor under conditions which permit binding of the antibody to the receptor, detecting the presence of any of the antibody bound to the human alb adrenergic receptor and thereby the presence of a human alb adrenergic receptor on the surface of the cell.
20 This invention provides a method for detecting the .presence of a human alc adrenergic receptor on the :i surface of a cell, which comprises contacting the cell with an antibody to human al adrenergic receptor under conditions which permit binding of the antibody to the 25 receptor, detecting the presence of any of the antibody bound to the human al adrenergic receptor and thereby the presence of a human ae, adrenergic receptor on the surface of the cell.
30 This invention provides a method of treating an abnormal condition related to an excess of activity of a human a, adrenergic receptor subtype, which comprises administering an amount of a pharmaceutical composition effective to reduce a, adrenergic activity as a result of naturally occurring substrate binding to and activating a specific al adrenergic receptor.
-12- This invention provides a method for treating abnormalities which are alleviated by an increase in the activity of a specific human a, adrenergic receptor, which comprises administering a patient an amount of a pharmaceutical composition effective to increase the activity of the specific human a, adrenergic receptor thereby alleviating abnormalities resulting from abnormally low receptor activity.
This invention provides a method for diagnosing a disorder or a predisposition to a disorder associated with the expression of a specific human a, adrenergic receptor allele which comprises: obtaining DNA from subjects suffering from a disorder; performing a restriction digest of the DNA with a panel of restriction enzymes; electrophoretically separating the resulting DNA fragments on a sizing gel; d.) contacting the gel with a nucleic acid probe labelled with a detectable marker and which hybridizes to the 20 nucleic acid encoding a specific human a, adrenergic receptor; detecting the labelled bands which have hybridized to the DNA encoding the specific a, adrenergic receptor labelled with the detectable marker to create a unique band pattern specific to the DNA of 25 subjects suffering with the disorder; preparing DNA for diagnosis by steps a- e; g.)comparing the unique band pattern specific to the DNA of patients suffering from the disorder from step e and DNA obtained for diagnosis from step f to determine whether the patterns are the same or different and to diagnose thereby predisposition to the disorder if the patterns are the same.
This invention provides a method for identifying a substance capable of alleviating the abnormalities resulting from overexpression of a specific human a, adrenergic receptor which comprises administering a -13substance to the transgenic non-human mammal comprising the DNA encoding a specific a, adrenergic receptor and determining whether the substance alleviates the physical and behavioral abnormalities displayed by the transgenic nonhuman mammal as a result of overexpression of the human oa adrenergic receptor subtype.
This invention provides a method for identifying a substance capable of alleviating the abnormalities resulting from underexpression of a human al adrenergic receptor subtype, which comprises administering a substance to a non-human transgenic mammal which is expressing a human a, adrenergic receptor incapable of receptor activity or is underexpressing the human a, adrenergic receptor subtype, and determining whether the substance alleviates the physical and behavioral abnormalities displayed by the transgenic nonhuman mammal as a result of underexpression of a human a, adrenergic receptor subtype.
This invention provides a method "of treating S• abnormalities in a subject, wherein the abnormality is alleviated by the reduced expression of a human a, adrenergic receptor subtype which comprises administering to a subject an effective amount of the pharmaceutical composition effective to reduce expression of a specific a .adrenergic receptor subtype.
This invention provides a method of treating abnormalities resulting from underexpression of a human a, adrenergic receptor which comprises administering to a subject an amount of a pharmaceutical composition effective to alleviate abnormalities resulting from underexpression of the specific human a, adrenergic receptor.
-14- Brief Description of the Figures Figures 1A-I. Nucleotide Sequence and Deduced Amino Acid Sequence of Novel Human Alpha-la Adrenergic Receptor.
Nucleotides are presented in the 5' to 3'orientation and the coding region is numbered starting from the initiating methionine and ending in the termination codon. Deduced amino acid sequence by translation of a long open reading frame is shown, along with the and 3' untranslated regions. Numbers in the left and right margins represent nucleotide (top line) and amino acid (bottom line) numberings, starting with the first position as the adenosine and the initiating methionine respectively.
Figures 2A-H. Nucleotide Sequence and Deduced Amino Acid Sequence of Novel Human Alpha-lb Adrenergic Receptor. Nucleotides are presented in the 5' to 3' 20 orientation and the coding region is numbered starting from the initiating methionine and ending in the :*termination codon. Deduced amino acid sequence by translation of a long open reading frame is shown, along with the 5' and 3' untranslated regions. Numbers 25 in the left and right margins represent nucleotide (top line) and amino acid (bottom line) numberings, starting with the first position as the adenosine and the .initiating methionine respectively.
30 Figures 3A-G. Nucleotide Sequence and Deduced Amino Acid Sequence of Novel Human Alpha-lc Adrenergic Receptor.
Nucleotides are presented in the 5' to 3' orientation and the coding region is numbered starting from the initiating methionine and ending in the termination codon. Deduced amino acid sequence by translation of a long open reading frame is shown, along with the 5' and 3' untranslated regions. Numbers in the left and right margins represent nucleotide (top line) and amino acid (bottom line) numberings, starting with the first position as the adenosine and the initiating methionine respectively.
Figures 4A-D. Alignment of the Human Alpha-la, H318/3 Alpha-la, and Rat Alpha-la Adrenergic Receptors.
The deduced amino acid sequence of the human ala receptor (first line), from the starting methionine (M) to the stop codon is aligned with the previously published human "ala" adrenergic receptor clone, H318/3 (second line) and with the rat alphala (12)(third line). Also shown is a consensus amino acid sequence (fourth line), containing a hyphen at a particular position, when all receptors have the same amino acid or an amino acid at this position, when there is disparity in the three receptors. Dots indicate spaces corresponding to no amino acid at this position. Note that the human and rat a. receptors have greater homology in the amino (positions 1-90) and carboxyl (positions 440-598) termini than do the previously published "ala" (H318/3) and rat al receptors (see text). Dots indicate spaces corresponding to no amino 25 acid at this position. Numbers above amino acid sequences correspond to amino acid positions, starting with the initiating methionine and ending with the termination codon S. 30 Figures 5A-D. Alignment of the Human Alpha-lb, Hamster Alpha-lb, and Rat Alpha-lb Adrenergic Receptors.
The deduced amino acid sequence of the human alb receptor (third line), from the starting methionine (M) to the stop codon is aligned with the previously published rat a b adrenergic receptor clone line) and with the hamster alpha-lb (4)(second line).
Also shown is a consensus amino acid sequence (fourth -16line), containing a hyphen at a particular position, when all receptors have the same amino acid or an amino acid at this position, when there is disparity in the three receptors. Dots indicate spaces corresponding to no amino acid at this position. Numbers above amino acid sequences correspond to amino acid position, starting with the initiating methionine and ending with the termination codon Figures 6A-C. Alignment of the Human Alpha-lc and Bovine Alpha-lc Adrenergic Receptors.
The deduced amino acid sequence of the human a,, receptor (first line), from the starting methionine (M) to the stop codon is aligned with the previously published bovine ab adrenergic receptor clone (13) (first line). Also shown is a consensus amino acid sequence (third line), containing a hyphen at a particular position, when all receptors have the same 4• amino acid or an amino acid at this position, when 20 there is disparity in the three receptors. Dots :i indicate spaces corresponding to no amino acid at this position. Numbers above amino acid sequences correspond to amino acid position, starting with the initiating methionine and ending with the 25 termination codon -17- Figure 7. Illustrates the correlation of inhibition constants for a series of a, antagonists at the cloned human alA, a 1 and agl receptors with efficiency of blocking contraction of human prostate tissue (pA 2 ee e -18- Detailed Description of the Invention This invention provides an isolated nucleic acid molecule encoding a human a, adrenergic receptor. This invention also provides an isolated nucleic acid molecule encoding a human al, adrenergic receptor. This invention also provides an isolated nucleic acid molecule encoding a human alb adrenergic receptor. This invention also provides an isolated nucleic acid molecule encoding a human a1c adrenergic receptor. As used herein, the term "isolated nucleic acid molecule" means a non-naturally occurring nucleic acid molecule that is, a molecule in a form which does not occur in nature. Examples of such an isolated nucleic acid molecule are an RNA, cDNA, or an isolated genomic DNA molecule encoding a human human ab or human alc adrenergic receptor. As used herein, the term "ala receptor", "alb receptor" or al receptor" means a molecule which is a distinct member of a class of a, adrenergic receptor molecules which under physiologic conditions, is substantially specific for the catecholamines epinephrine and norepinephrine, is saturable, and having high affinity for the catecholamines epinephrine and norepinephrine. The 25 term adrenergic receptor subtype" refers to a distinct member of the class of human a, adrenergic receptors, which may be any one of the human a,l, alb or .I alc adrenergic receptors. The term "specific a, adrenergic receptor" refers to a distinct member of the group or class of human a, adrenergic receptors, which may be any one of the human ala, alb or a c adrenergic receptors. One embodiment of this invention is an isolated human nucleic acid molecule encoding a human ala adrenergic receptor. Such a molecule may have coding sequences substantially the same as the coding sequence in Figures 1A-1I. The DNA molecule of Figures 1A-1I encodes the sequence of the human adrenergic -19receptor. Another, preferred embodiment is an isolated human nucleic acid molecule encoding a human a1b adrenergic receptor. Such a molecule may have coding sequences substantially the same as the coding sequence in Figures 2A-2H. The DNA molecule of Figures 2A-2H encodes the sequence of the human alb adrenergic receptor. Another, preferred embodiment is an isolated human nucleic acid molecule encoding a human alc adrenergic receptor. Such a molecule may have coding sequences substantially the same as the coding sequence in Figures 3A-3G. The DNA molecule of Figures 3A-3G encodes the sequence of the human aIc adrenergic receptor. One means of isolating a nucleic acid molecule encoding a a, adrenergic receptor is to screen a genomic DNA or cDNA library with a natural or artificially designed DNA probe, using methods well known in the art. In the preferreedembodiment of this invention, a, adrenergic receptors include the human la,, human alb and human ac, adrenergic receptors and the nucleic acid molecules encoding them were isolated by screening a human genomic DNA library and by further screening of a human cDNA library to obtain the sequence of the entire human ala, human a 0 b or human a1c adrenergic receptor. To obtain a single nucleic acid 25 molecule encoding the entire human alb or a1c adrenergic receptor two or more DNA clones encoding portions of the same receptor were digested with DNA restriction endonuleases and ligated together with DNA ligase in the proper orientation using techniques known to one of skill in the art. DNA or cDNA molecules which encode a human ala, alb or aic adrenergic receptor are used to obtain complementary genomic DNA, cDNA or RNA from human, mammalian or other animal sources, or to isolate related cDNA or genomic DNA clones by the screening of cDNA or genomic DNA libraries, by methods described in more detail below. Transcriptional regulatory elements from the 5' untranslated region of the isolated clone, and other stability, processing, transcription, translation, and tissue specificity determining regions from the 3' and 5' untranslated regions of the isolated gene are thereby obtained.
This invention provides an isolated nucleic acid molecule which has been so mutated as to be incapable of encoding a molecule having normal human a, adrenergic receptor activity, and not expressing native human a, adrenergic receptor. An example of a mutated nucleic acid molecule provided by this invention is an isolated nucleic acid molecule which has an in-frame stop codon inserted into the coding sequence such that the transcribed RNA is not translated into protein.
This invention provides a cDNA molecule encoding a human adrenergic receptor, wherein the cDNA molecule has a coding sequence substantially the same as the coding sequence shown in Figures 1A-1I. This invention also provides a cDNA molecule encoding a human alb adrenergic receptor, wherein the cDNA molecule has a coding sequence substantially the same as the coding sequence shown in Figures 2A-2H. This invention also provides a cDNA molecule encoding a human adrenergic receptor, wherein the cDNA molecule has a coding sequence substantially the same as the coding sequence shown in Figures 3A-3G. These molecules and their equivalents were obtained by the means further described below.
This invention provides an isolated protein which is a human a, adrenergic receptor. In one embodiment of this invention, the protein is a human adrenergic receptor having an amino acid sequence substantially similar to the amino acid sequence shown in Figures 1A- IH. In another embodiment of this invention, the protein is a human alb adrenergic receptor having an -21amino acid sequence substantially similar to the amino acid sequence shown in Figures 2A-2H. In another embodiment of this invention, the protein is a human a, adrenergic receptor having an amino acid sequence substantially similar to the amino acid sequence shown in Figures 3A-3G. As used herein, the term "isolated protein" is intended to encompass a protein molecule free of other cellular components. One means for obtaining an isolated human a, adrenergic receptor is to express DNA encoding the a, adrenergic receptor in a suitable host, such as a bacterial, yeast, or mammalian cell, using methods well known to those skilled in the art, and recovering the human a adrenergic receptor after it has been expressed in such a host, again using methods well known in the art. The human a, adrenergic receptor may also be isolated from 0. cells which express it, in particular from cells which have been transfected with the expression vectors described below in more detail.
This invention also provides a vector comprising an isolated nucleic acid molecule such as DNA, RNA, or ScDNA, encoding a human ala receptor. This invention also provides a vector comprising an isolated nucleic 25 acid molecule such as DNA, RNA, or cDNA, encoding a human human alb adrenergic receptor. This invention also provides a vector comprising an isolated nucleic acid molecule such as DNA, RNA, or cDNA, encoding a human a, 1 adrenergic receptor. Examples of vectors are viruses such as bacteriophages (such as phage lambda), cosmids, plasmids (such as pUC18, available from Pharmacia, Piscataway, NJ), and other recombination vectors. Nucleic acid molecules are inserted into vector genomes by methods well known to those skilled in the art. Examples of such plasmids are plasmids comprising cDNA having a coding sequence substantially the same as: the coding sequence shown in Figures 1A- -22- II, 2A-2H, and 3A-3G. Alternatively, to obtain these vectors, insert and vector DNA can both be exposed to a restriction enzyme to create complementary ends on both molecules which base pair with each other and are then ligated together with a ligase. Alternatively, linkers can be ligated to the insert DNA which correspond to a restriction site in the vector DNA, which is then digested with the restriction enzyme which cuts at that site. Other means are also available.
This invention also provides vectors comprising a DNA molecule encoding a human vectors comprising a DNA molecule encoding a human alb adrenergic receptor and vectors comprising a DNA molecule encoding a human al, adrenergic receptor adapted for expression in a bacterial cell, a yeast cell, or a mammalian cell which .:additionally comprise the regulatory elements necessary for expression of the DNA in the bacterial, yeast, or mammalian cells so located relative to the DNA encoding a human a, adrenergic receptor as to permit expression thereof. DNA having coding sequences substantially the same as the coding sequence shown in Figures 1A-1I may be inserted into the vectors to express a human a, 25 adrenergic receptor. DNA having coding sequences substantially the same as the coding sequence shown in Figures 2A-2H may be inserted into the vectors to to .o express a human alb adrenergic receptor. DNA having coding sequences substantially the same as the coding sequence shown in Figures 3A-3G may be inserted into the vectors to express a human adrenergic receptor.
Regulatory elements required for expression include promoter sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding. For example, a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine-Dalgarno sequence -23and the start codon AUG (Maniatis, et al., Molecular Cloning, Cold Spring Harbor Laboratory, 1982).
Similarly, a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polynerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome. Such vectors may be obtained commercially or assembled from the sequences described by methods well known in the art, for example the methods described above for constructing vectors in general. Expression vectors are useful to produce cells that express a human a, adrenergic receptor.
Certain uses for such cells are described in more detail below.
In one embodiment of this invention a plasmid is :adapted for expression in a bacterial, yeast, or, in particular, a mammalian cell wherein the plasmid comprises a DNA molecule encoding a human adrenergic receptor, a DNA molecule encoding a human alb adrenergic receptor or a DNA molecule encoding a human ai1 adrenergic receptor and the regulatory elements necessary for expression of the DNA in the bacterial, yeast, or mammalian cell so located relative to the DNA 25 encoding a human a, adrenergic receptor as to permit expression thereof. Suitable plasmids may include, but are not limited to plasmids adapted for expression in a mammalian cell, pCEXV-3 derived expression vector. Examples of such plasmids adapted for expression in a mammalian cell are plasmids comprising cDNA having coding sequences substantially the same as the coding sequence shown in Figures 1A-1I, 2A-2H, and 3A-3G and the regulatory elements necessary for expression of the DNA in the mammalian cell. These plasmids have been designated pcEXV-al, deposited under ATCC Accession No. 75319, pcEXV-alb deposited under ATCC Accession No. 75318, and pcEXV-ac deposited under ATCC P:\OPER\MRO\AU677968.DIV 14/8/97 -24- Accession No. 75317, respectively. Those skilled in the art will readily appreciate that numerous plasmids adapted for expression in a mammalian cell which comprise DNA encoding human a, adrenergic receptors and the regulatory elements necessary to express such DNA in the mammalian cell may be constructed utilizing existing plasmids and adapted as appropriate to contain the regulatory elements necessary to express the DNA in the mammalian cell. The plasmids may be constructed by the methods described above for expression vectors and vectors in general, and by other methods well known in the art.
The deposits discussed supra were made for the purposes of Australian Patent No. 677968 dated 24 September, 1993, the complete deposit details in respect of which are incorporated herein by reference.
This invention provides a mammalian cell comprising a DNA molecule encoding a human a, adrenergic receptor, such as a mammalian cell comprising a plasmid adapted for expression 15 in a mammalian cell, which comprises a DNA molecule encoding a human a, adrenergic receptor and the regulatory elements necessary for expression of the DNA in the mammalian cell so located relative to the DNA encoding a human a 1 adrenergic receptor as to permit expression thereof. Numerous mammalian cells may be used as hosts, including, but not limited to, the mouse fibroblast cell NIH3T3, CHO cells, HeLa cells, Ltk cells, human embryonic kidney cells, Cos cells, etc. Expression plasmids such as that described supra may be used to transfect mammalian cells by methods well known in the art such as calcium phosphate precipitation, or DNA encoding these human a, adrenergic receptors may be otherwise introduced into mammalian cells, by microinjection, to obtain mammalian cells which comprise DNA, cDNA or a plasmid, encoding a human a, adrenergic receptor.
This invention provides a nucleic acid probe comprising a nucleic acid molecule of at least 15 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human al, adrenergic receptor, for example with a coding sequence included within the sequence shown in Figures 1A-1I. This invention also provides a nucleic acid probe comprising a nucleic acid molecule of at least 15 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human alb adrenergic receptor, for example with a coding sequence included within the sequence shown in Figures 2A-2H.
*This invention also provides a nucleic acid probe comprising a nucleic acid molecule of at least nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human a 1 c adrenergic receptor, for example with a coding sequence included within the sequence shown in Figures 3A-3G. As used herein, the 25 phrase "specifically hybridizing" means the ability of a nucleic acid molecule to recognize a nucleic acid sequence complementary to its own and to form doublehelical segments through hydrogen bonding between complementary base pairs. Nucleic acid probe technology is well known to those skilled in the art who will readily appreciate that such probes may vary greatly in length and may be labeled with a detectable label, such as a radioisotope or fluorescent dye, to facilitate detection of the probe. Detection of nucleic acid encoding a human a, adrenergic receptor is useful as a diagnostic test for any disease process in which levels of expression of the corresponding human -26ala, alb or a1c adrenergic receptor are altered. DNA probe molecules are produced by insertion of a DNA molecule which encodes a human human alb, or human aic adrenergic receptor or fragments thereof into suitable vectors, such as plasmids or bacteriophages, followed by insertion into suitable bacterial host cells and replication and harvesting of the DNA probes, all using methods well known in the art. For example, the DNA may be extracted from a cell lysate using phenol and ethanol, digested with restriction enzymes corresponding to the insertion sites of the DNA into the vector (discussed above), electrophoresed, and cut out of the resulting gel. Examples of such DNA molecules are shown in Figures 1A-1I, 2A-2H, and 3A-3G.
The probes are useful for "in situ" hybridization or in order to identify tissues which express this gene family, or for other hybridization assays for the presence of these genes or their mRNA in various biological tissues. In addition, synthesized oligonucleotides (produced by a DNA synthesizer) complementary to the sequence of a DNA molecule which encodes a human ala adrenergic receptor, or complementary to the sequence of a DNA molecule which encodes a human alb adrenergic receptor or, omplementary 25 to the sequence of a DNA molecule which encodes a human aC adrenergic receptor are useful as probes for these genes, for their associated mRNA, or for the isolation of related genes by homology screening of genomic or cDNA libraries, or by the use of amplification techniques such as the Polymerase Chain Reaction.
This invention also provides a method for detecting expression of a human adrenergic receptor on the surface of a cell by detecting the presence of mRNA coding for a human al adrenergic receptor. This invention also provides a method for detecting expression of a human aib adrenergic receptor on the -27surface of a cell by detecting the presence of mRNA coding for a human alb adrenergic receptor. This invention also provides a method for detecting expression of a human ae adrenergic receptor on the surface of a cell by detecting the presence of mRNA coding for a human acg adrenergic receptor. These methods comprise obtaining total mRNA from the cell using methods well known in the art and contacting the mRNA so obtained with a nucleic acid probe as described hereinabove, under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of a specific human a, adrenergic receptor by the cell. Hybridization of probes to target nucleic acid molecules such as mRNA molecules employs techniques well known in the art.
However, in one embodiment of this invention, nucleic acids are extracted by precipitation from lysed cells and the mRNA is isolated from the extract using a column which binds the poly-A tails of the mRNA 20 molecules (Maniatis, T. et al., Molecular Cloning; Cold Spring Harbor Laboratory, pp.197-98 (1982)). The mRNA is then exposed to radioactively labelled probe on a nitrocellulose membrane, and the probe hybridizes to and thereby labels complementary mRNA sequences.
Binding may be detected by autoradiography or scintillation counting. However, other methods for performing these steps are well known to those skilled in the art, and the discussion above is merely an example.
This invention provides an antisense oligonucleotide having a sequence capable of specifically binding with any sequences of an mRNA molecule which encodes a human a,,a adrenergic receptor so as to prevent translation of the human adrenergic receptor. This invention also provides an antisense oligonucleotide having a sequence capable of specifically binding with any sequences of n 1 -28an mRNA molecule which encodes a human a 0 b adrenergic receptor so as to prevent translation of the human alb adrenergic receptor. This invention also provides an antisense oligonucleotide having a sequence capable of specifically binding with any sequences of an mRNA molecule which encodes a human a1c adrenergic receptor so as to prevent translation of the human alc adrenergic receptor. As used herein, the phrase "specifically binding" means the ability of an antisense oligonucleotide to recognize a nucleic acid sequence complementary to its own and to form double-helical segments through hydrogen bonding between complementary base pairs. The antisense oligonucleotide may have a sequence capable of specifically binding with any 15 sequences of the cDNA molecules whose sequences are shown in Figures 1A-1I, 2A-2H or 3A-3G. A particular example of an antisense oligonucleotide is an antisense oligonucleotide comprising chemical analogues of nucleotides which are known to one of skill in the art.
This invention, also provides a pharmaceutical composition comprising an effective amount of the oligonucleotide described above effective to reduce expression of a human al adrenergic receptor, by 25 passing through a cell membrane and specifically binding with mRNA encoding the human ala adrenergic receptor in the cell so as to prevent its translation and a pharmaceutically acceptable hydrophobic carrier capable of passing through a cell membrane. This invention also provides a pharmaceutical composition comprising an effective amount of the oligonucleotide described above effective to reduce expression of a human alb adrenergic receptor in the cell so as to prevent its translation and a pharmaceutically acceptable hydrophobic carrier capable of passing through a cell membrane. This invention further provides a pharmaceutical composition comprising an -29effective amount of the oligonucleotide described above effective to reduce expression of a human a 1 c adrenergic receptor in the cell so as to prevent its translation and a pharmaceutically acceptable hydrophobic carrier capable of passing through a cell membrane. As used herein, the term "pharmaceutically acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents. The oligonucleotide may be coupled to a substance which inactivates mRNA, such as a ribozyme. The pharmaceutically acceptable hydrophobic carrier capable on of passing through cell membranes may also comprise a 15 structure which binds to a transporter specific for a selected cell type and is thereby taken up by cells of the selected cell type. The structure may be part of a protein known to bind a cell-type specific transporter, for example an insulin molecule, which would target pancreatic cells. DNA molecules having coding sequences substantially the same as the coding sequence shown in Figures 1A-1I, 2A-2H, or 3A-3G may be used as the oligonucleotides of the pharmaceutical composition.
This invention also provides a method of treating abnormalities which are alleviated by reduction of expression of a human a, adrenergic receptor. This method comprises administering to a subject an effective amount of the pharmaceutical composition described above effective to reduce expression of the human a, adrenergic receptor by the subject. This invention further provides a method of treating an abnormal condition related to a, adrenergic receptor activity which comprises administering to a subject an amount of the pharmaceutical composition described above effective to reduce expression of the human al adrenergic receptor by the subject. Examples of such an abnormal condition include but are not limited to benign prostatic hypertrophy, coronary heart disease, hypertension, urinary retention, insulin resistance, atherosclerosis, sympathetic dystrophy syndrome, glaucoma, cardiac arrythymias erectile dysfunction, and Renaud's syndrome.
Antisense oligonucleotide drugs inhibit translation of mRNA encoding the human ala, human alb or human alc adrenergic receptors. Synthetic antisense oligonucleotides, or other antisense chemical 8structures are designed to bind to mRNA encoding the Shuman ala adrenergic receptor, to mRNA encoding the 15 human alb adrenergic receptor or to mRNA encoding the human alc adrenergic receptor and inhibit translation of mRNA and are useful as drugs to:inhibit expression of the human ala adrenergic receptor, the human alb adrenergic receptor or the human al, adrenergic receptor in patients. This invention provides a means to therapeutically alter levels of expression of the human aa adrenergic receptor, the human alb adrenergic receptor or the human adrenergic receptor by the use of a synthetic antisense oligonucleotide drug (SAOD) 25 which inhibits translation of mRNA encoding these a, adrenergic receptors. Synthetic antisense oligonucleotides, or other antisense chemical structures designed to recognize and selectively bind to mRNA, are constructed to be complementary to portions of the nucleotide sequences shown in Figures 1A-1I, 2A-2H, or 3A-3G of DNA, RNA or of chemically modified, artificial nucleic acids. The SAOD is designed to be stable in the blood stream for administration to patients by injection, or in laboratory cell culture conditions, for administration to cells removed from the patient. The SAOD is designed to be capable of passing through cell t n -31membranes in order to enter the cytoplasm of the cell by virtue of physical nd chemical properties of the SAOD which render it capable of passing through cell membranes by designing small, hydrophobic SAOD chemical structures) or by virtue of specific transport systems in the cell which recognize and transport the SAOD into the cell. In addition, the SAOD can be designed for administration only to certain selected cell populations by targeting the SAOD to be recognized by specific cellular uptake mechanisms which bind and take up the SAOD only within certain selected cell populations. For example, the SAOD may be designed to bind to a transporter found only in a certain cell type, as discussed above. The SAOD is also designed to 15 recognize and selectively bind to the target mRNA sequence, which may correspond to a sequence contained within the sequences shown in Figures 1AO1I, 2A-2H, or 3A-3G by virtue of complementary base pairing to the mRNA. Finally, the SAOD is designed to inactivate the target mRNA sequence by any of three mechanisms: 2) by binding to the target mRNA and thus inducing degradation of the mRNA by intrinsic cellular mechanisms such as mRNA target by interfering with the binding of translation-regulating factors or of other chemical structures, such as ribozyme sequences or reactive chemical groups. which either degrade or chemically modify the target mRNA. Synthetic antisense oligonucleotide drugs have been shown to be capable of the properties described above when directed against mRNA targets Cohen, Trends in Pharm. Sci 10, 435 (1989); H.M. Weintraub, Sci. AM. January (1990) p. In addition, coupling of ribozymes to antisense oligonucleotides is a promising strategy for inactivating target mRNA Sarver et al., Science 247, 1222 (1990)). An SAOD serves as an effective therapeutic agent if it is designed to be administered to a patient by injection, or if the patient's target P Io -32cells are removed, treated with the SAOD in the laboratory, and replaced in the patient. In this manner, an SAOD serves as a therapy to reduce human a, adrenergic receptor expression in particular target cells of a patient, in any clinical condition which may benefit from reduced expression of a specific human a, adrenergic receptor.
This invention provides an antibody directed to a human ala adrenergic receptor. This antibody may comprise, for example, a monoclonal antibody directed to an epitope of a human aa adrenergic receptor present on S. the surface of a cell, the epitope having an amino acid sequence substantially the same as an amino acid 15 sequence for a cell surface epitope of the human a,, adrenergic receptor included in the amino acid sequence shown in Figures lA-1I. This invention also provides an antibody directed to a human aob adrenergic receptor.
This antibody may comprise, for example, a monoclonal antibody directed to an epitope of a human alb adrenergic receptor present on the surface of a cell, the epitope having an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of the human alb adrenergic receptor included in 25 the amino acid sequence shown in Figures 2A-2H. This invention also provides an antibody directed to a human a 1 adrenergic receptor. This antibody may comprise, for example, a monoclonal antibody directed to an epitope of a human alc adrenergic receptor present on the surface of a cell, the epitope having an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of the human alc adrenergic receptor included in the amino acid sequence shown in Figures 3A-3G. Amino acid sequences may be analyzed by methods well known to those skilled in the art to determine whether they produce hydrophobic or hydrophilic regions in the proteins which they build.
-33- In the case of cell membrane proteins, hydrophobic regions are well known to form the part of the protein that is inserted into the lipid bilayer which forms the cell membrane, while hydrophilic regions are located on the cell surface, in an aqueous environment.
Therefore antibodies to the hydrophilic amino acid sequences shown in Figures 1A-1I will bind to a surface epitope of the human ala adrenergic receptor, antibodies to the hydrophilic amino acid sequences shown in Figures 2A-2H will bind to a surface epitope of a human alb adrenergic receptor, and antibodies to the hydrophilic amino acid sequences shown in Figures 3A-3G will bind to a surface epitope of a human alc adrenergic receptor as described. Antibodies directed to human al adrenergic receptors may be serum-derived or monoclonal and are prepared using methods well known in the art. For example, monoclonal antibodies are prepared using hybridoma technology by fusing antibody producing B cells from immunized animals with myeloma cells and selecting the resulting hybridoma cell line producing the desired antibody. Cells such as NIH3T3 cells or Ltk' cells may be used as immunogens to raise such an antibody. Alternatively, synthetic peptides may be prepared using commercially available machines 25 and the amino acid sequence shown in Figures 1A-1I, 2A- 2H, and 3A-3G. As a still further alternative DNA, such as a cDNA or a fragment thereof, may be cloned and expressed and the resulting polypeptide recovered and used as an immunogen. These antibodies are useful to detect the presence of human al adrenergic receptors encoded by the isolated DNA, or to inhibit the function of al adrenergic receptors in living animals, in humans, or in biological tissues or fluids isolated from animals or humans.
This invention provides a pharmaceutical composition which comprises an effective amount of an antibody -34directed to an epitope of a human al, adrenergic receptor and a pharmaceutically acceptable carrier. A monoclonal antibody directed to an epitope of a human la adrenergic receptor present on the surface of a cell which has an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of the human al, adrenergic receptor present on the surface of a cell which has an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of the human adrenergic receptor included in the amino acid sequence shown in Figures lA-1I is useful for this purpose. This invention also provides a pharmaceutical composition which comprises an effective amount of an antibody directed to an epitope of a human lb adrenergic receptor, effective to block binding of naturally occurring substrates to the human alb adrenergic receptor and a pharmaceutically acceptable carrier. A Smonoclonal antibody directed to an epitope of a human 20 alb adrenergic receptor present on the surface of a cell which has an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of the human ab adrenergic receptor included in the amino acid sequence shown in Figures 2A-2H is useful for this purpose. This invention provides a pharmaceutical composition which comprises an effective amount of an antibody directed to an epitope of a human a adrenergic receptor effective to block binding of naturally occurring substrates to the human ai adrenergic receptor and a pharmaceutically acceptable carrier. A monoclonal antibody directed to an epitope of a human ac adrenergic receptor present on the surface of the cell which has an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of the human al adrenergic receptor included in the amino acid sequence shown in Figures 3A-3G is useful for this purpose.
1 This invention also provides a method of treating abnormalities in a subject which are alleviated by reduction of expression of a specific human a, adrenergic receptor. The method comprises administering to the subject an effective amount of the pharmaceutical composition described above effective to block binding of naturally occurring substrates to the human a, adrenergic receptor and thereby alleviate abnormalities resulting from overexpression of the human a, adrenergic receptor. Binding of the antibody to the human a, adrenergic receptor from functioning, thereby neutralizing the effects of overexpression.
,*The monoclonal antibodies described above are useful for this purpose. This invention additionally provides 15 a method of treating an abnormal condition related to an excess of a specific human a, adrenergic receptor activity which comprises administering to a subject an amount of the pharmaceutical composition described above effective to block binding of naturally occurring substrates to the human al adrenergic receptor and thereby alleviate the abnormal.condition. Examples of such an abnormal condition include but are not limited to benign prostatic hypertrophy, coronary heart disease, insulin resistance, atherosclerosis, sympathetic dystrophy syndrome, glaucoma, cardiac arrythymias, hypertension, urinary retention, erectile dysfunction, and Renaud's syndrome.
This invention provides methods of detecting the presence of a specific human al adrenergic receptor on the surface of a cell which comprises contacting the cell with an antibody directed to a specific human al adrenergic receptor, under conditions permitting binding of the antibody to the human al adrenergic receptor, under conditions permitting binding of the antibody to the human al adrenergic receptor, detecting the presence of any antibody bound to the al adrenergic -36receptor, and thereby the presence of the specific human al adrenergic receptor on the surface of the cell. Such methods are useful for determining whether a given cell is defective in expression of a specific human al adrenergic receptor. Bound antibodies are detected by methods well known in the art, for example by binding fluorescent markers to the antibodies and examining the cell sample under a fluorescence microscope to detect fluorescence on a cell indicative of antibody binding. The monoclonal antibodies described above are useful for this purpose.
This invention provides a transgenic nonhuman mammal comprising DNA encoding DNA encoding a human aa, adrenergic receptor. This invention also provides a transgenic nonhuman mammal comprising DNA encoding a human ab adrenergic receptor. This invention also provides a transgenic nonhuman mammal comprising DNA encoding a human a, 1 adrenergic receptor.
This invention also provides a transgenic nonhuman mammal comprising DNA encoding a human ala adrenergic receptor so mutated as to be incapable of normal human al adrenergic receptor activity, and not expressing native human ala adrenergic receptor activity, and not expressing native human ala adrenergic receptor. This invention also provides a transgenic nonhuman mammal comprising DNA encoding a human aib adrenergic receptor so mutated as to be incapable of normal human alb adrenergic receptor activity, and not expressing native human alb adrenergic receptor. This invention also provides a transgenic nonhuman mammal comprising DNA encoding a human a 1 c adrenergic receptor so mutated as to be incapable of normal human alc adrenergic receptor activity, and not expressing native human alc adrenergic receptor.
W. i, -37- This invention provides a transgenic non-human animal whose genome comprises DNA encoding a human a,, adrenergic receptor so placed as to be transcribed into antisense mRNA which is complementary to mRNA encoding a human aa adrenergic receptor thereby reducing its translation. This invention also provides a transgenic nonhuman mammal whose genome-comprises DNA encoding a human ab adrenergic receptor so placed as to be transcribed into antisense mRNA which is complementary to mRNA encoding the human alb adrenergic receptor and which hybridizes to mRNA encoding a human alb adrenergic receptor thereby reducing its translation. This invention provides a transgenic non-human animal whose genome comprises DNA encoding a human adrenergic receptor so placed as to be transcribed into antisense mRNA which is complementary to mRNA encoding a human a, adrenergic receptor and which hybridizes to mRNA encoding the human a 1 c adrenergic receptor thereby reducing its translation. The DNA may additionally comprise an inducible promoter or additionally comprise tissue specific regulatory elements, so that expression can be induced, or restricted to specific cell types.
Examples of DNA are DNA or cDNA molecules having a coding sequence substantially the same as the coding 25 sequences shown in Figures 1A-1I, 2A-2H, or 3A-3G. An example of a transgenic animal is a transgenic mouse.
Examples of tissue specificity-determining regions are the metallothionein promoter (Low, Lechan, R.M., Hammer, R.E. et al. Science 231:1002-1004 (1986) and the L7 promoter (Oberdick, Smeyne, Mann, Jackson, S. and Morgan, J.I. Science 248:223-226 (1990)).
Animal model systems which elucidate the physiological and behavioral roles of human a, adrenergic receptors are produced by creating transgenic animals in which the increased or decreased, or the amino acid sequence -38of the expressed a, adrenergic receptor is altered, by a variety of techniques. Examples of these techniques include, but are not limited to: 1) Insertion of normal or mutant versions of DNA encoding a human a, adrenergic receptor or homologous animal versions of these genes, by microinjection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos in order to produce a transgenic animal (Hogan B et al., Manipulating the Mouse Embryo, A Laboratory Manual, Cold Spring Harbor Laboratory (1986)) or, 2) Homologous recombination (Capecchi M.R. Science 244:1288-1292 (1989); Zimmer, A.
and Gruss, P. Nature 338:150-153 (1989)) of mutant or normal, human or animal version of the genes encoding 15 al adrenergic receptors with the native gene locus in Stransgenic animals to alter the regulation of expression or the structure al of these al adrenergic receptors. The technique of homologous a, adrenergic receptors. The technique of homologous recombination is well known in the art. It replaces the native gene S.2 with the inserted gene and so is useful for producing an animal that cannot express native a, adrenergic :receptor but does express, for example an inserted mutant human a, adrenergic receptor, which has replaced the native a, adrenergic receptor in the animal's genome by recombination, resulting in underexpression of the a, adrenergic receptor. Microinjection adds genes to the genome, but does not remove them, and so is useful for producing an animal which expresses its own and added a, adrenergic receptors, resulting in overexpression of the a, adrenergic receptor.
One means available for producing a transgenic animal, with a mouse as an example, is as follows: Female mice are mated, and the resulting fertilized eggs are dissected out of their oviducts. The eggs are stored in an appropriate medium such as M2 medium (Hogan B et 1? .1 -39al., Manipulating the Mouse Embryo, A Laboratory Manual, Cold Spring Harbor Laboratory (1986)). DNA or cDNA encoding a human a, adrenergic receptor is purified from a vector (such as plasmids pCEXV-alb, or pCEXV-a lc described above) by methods well known in the art. Inducible promoters may be fused with the coding region of the DNA to provide an experimental means to regulate expression of the trans-gene. Alternatively or in addition, tissue specific regulatory elements may be fused with the coding region to permit tissuespecific expression of the trans-gene. The DNA, in an appropriately buffered solution, is put into a microinjection needle (which may be made from capillary tubing using a pipet puller) and the egg to be injected 15 is put in a depression slide. The needle is inserted into the pronucleus of the egg, and the DNA solution is injected. The injected egg is then transferred into the oviduct of a pseudopregnant mouse (a mouse stimulated by the appropriate hormones to maintain pregnancy but which is not actually pregnant), where it proceeds to the uterus, implants, and develops to term.
As noted above, microinjection is not the only method for inserting DNA into the egg cell, and is used here only for exemplary purposes.
Since the normal action of a, adrenergic-specific drugs is to activate or to inhibit the al adrenergic receptor, the transgenic animal model systems described above are useful for testing the biological activity of drugs directed against specific human a, adrenergic receptors even before such drugs become available.
These animal model systems are useful for predicting or evaluating possible therapeutic applications of drugs which activate or inhibit these human a, adrenergic receptors by inducing or inhibiting expression of the native or transgene and thus increasing or decreasing expression of normal or mutant human a, adrenergic receptor in the living animal. Thus, a model system is produced in which the biological activity of drugs directed against these human a, adrenergic receptors are evaluated before such drugs become available. The transgenic animals which over or under produce a specific human a, adrenergic over or under produce a specific human a, adrenergic over or under produce a specific human a, adrenergic receptor indicate by their physiological state whether over or under production of the human a, adrenergic receptor is therapeutically useful. It is therefore useful to evaluate drug action based on the transgenic model system. One use is based on the fact that it is well known in the art that a drug such as an antidepressant acts by blocking 15 neurotransmitter uptake, and thereby increases- the amount of neurotransmitter in the synaptic cleft. The physiological result of this action is to stimulate the production of less human a, adrenergic receptor by the affected cells, leading eventually to underexpression.
20 Therefore, an animal which underexpresses human a, adrenergic receptor is useful. as a test system to investigate whether the actions of such drugs which result in under expression are in fact therapeutic.
Another use is that if overexpression is found to lead abnormalities, then a drug which down-regulates or acts as an antagonist to the human a, adrenergic receptor is indicated as worth developing, and if a promising therapeutic application is uncovered by these animal model systems, activation or inhibition of the specific human a. adrenergic receptor or antagonist drugs directed against these human a, adrenergic receptors or by any method which increases or decreases the expression of these a, adrenergic receptors in man.
Further provided by this invention is a method of determining the physiological effects of expressing varying levels of a human a, adrenergic receptor which -41comprises producing a transgenic nonhuman animal whose levels of a, adrenergic receptor expression are varied by use of an inducible promoter which regulates human a, adrenergic receptor expression. This invention also provides a method for determining the physiological effects of expressing varying levels of human a, adrenergic receptors which comprise producing a panel of transgenic nonhuman animals each expressing a different amount of a human a, adrenergic receptor.
Such animals may be produced by introducing different amounts of DNA encoding a human a, adrenergic receptor into the oocytes from which the transgenic animals are S. developed.
15 This invention also provides a method for identifying a substance capable of alleviating abnormalities resulting from overexpression of a human a, adrenergic receptor comprising administering the substance to a transgenic nonhuman mammal expressing at least one artificially introduced DNA molecule encoding a human a, adrenergic receptor and determining whether the substance alleviates the physical and behavioral abnormalities displayed by the transgenic nonhuman mammal as a result of overexpression of a human a, 25 adrenergic receptor. As used herein, the term "substance" means a compound or composition which may be natural, synthetic, or a product derived from screening. Examples of DNA molecules are DNA or cDNA molecules having a coding sequence substantially the same as the coding sequences shown in Figures 1A-1I, 2A-2H, or 3A-3G.
This invention provides a pharmaceutical composition comprising an amount of the substance described supra effective to alleviate the abnormalities resulting from overexpression of a human ala adrenergic receptor and a pharmaceutically acceptable carrier. This invention 0 4 4 -42provides a pharmaceutical composition comprising an amount of the substance described supra effective to alleviate the abnormalities resulting from overexpression of a human alb adrenergic receptor and a pharmaceutically acceptable carrier. This invention also provides a pharmaceutical composition comprising an amount of the substance described supra effective to alleviate the abnormalities resulting from overexpression of a human a 1 l adrenergic receptor and a pharmaceutically acceptable carrier.
This invention further provides a method for treating the abnormalities resulting from overexpression of.a human a, adrenergic receptor which comprises 15 administering to a subject an amount of the Spharmaceutical composition described above effective to alleviate the abnormalities resulting from overexpression of the human a, adrenergic receptor.
20 This invention provides a method for identifying a substance capable of alleviating the abnormalities resulting from underexpression of a human ao adrenergic receptor comprising administering the substance to the transgenic nonhuman mammal described above which expresses only a nonfunctional human a, adrenergic receptor and determining whether the substance alleviates the physical and behavioral abnormalities displayed by the transgenic nonhuman mammal as a result of underexpression of the human a, adrenergic receptor.
This invention also provides a pharmaceutical composition comprising an amount of a substance effective to alleviate abnormalities resulting from underexpression of a human a, adrenergic receptor and a pharmaceutically acceptable carrier.
This invention also provides a method for treating the -43abnormalities resulting from underexpression of a human a, adrenergic receptor which comprises administering to a subject an amount of the pharmaceutical composition described above effective to alleviate the abnormalities resulting from underexpression of a human a, adrenergic receptor.
This invention provides a method for diagnosing a predisposition to a disorder associated with the expression of a specific human a, adrenergic receptor allele which comprises: a) obtaining DNA of subjects suffering from the disorder; b) performing a restriction digest of the DNA with a panel of restriction enzymes; c) electrophoretically separating the resulting DNA fragments on a sizing gel; d) contacting the resulting gel with a nucleic acid probe capable of specifically hybridizing to DNA encoding a human a, adrenergic receptor and labelled bands which have hybridized to the DNA encoding a human al adrenergic receptor labelled with a detectable marker to create a unique band pattern specific to the DNA of a. subjects suffering from the disorder; f) preparing DNA obtained for diagnosis by steps a-e; and g) comparing the unique band pattern specific to the DNA of subjects 25 suffering from the disorder from step e and the DNA obtained for diagnosis from step f to determine whether the patterns are the same or different and thereby to diagnose predisposition to the disorder if the patterns are the same. This method may also be used to diagnose a disorder associated with the expression of a specific human a, adrenergic receptor allele.
This invention provides a method of preparing an isolated human a, adrenergic receptor which comprises inducing cells to express the human a, adrenergic receptor, recovering the a, adrenergic receptor from the resulting cells, and purifying the a, adrenergic -44receptor so recovered. An example of an isolated human ala adrenergic receptor is an isolated protein having substantially the same amino acid sequence as the anino acid sequence shown in Figures 1A-1I. An example of an isolated human alb adrenergic receptor is an isolated protein having substantially the same amino acid sequence as the amino acid sequence shown in Figures 1A-lI. An example of an isolated human alb adrenergic receptor is an isolated protein having substantially the same amino acid sequence shown in Figure 2A-2H. An example of an isolated human alc adrenergic receptor is an isolated protein having substantially the same amino acid sequence shown in Figure 3A-3G. For example, cells can be induced to express human a. adrenergic 15 receptor by exposure to substances such as hormones.
The cells can then be homogenized and the human a, adrenergic receptor isolated from the homogenate using an affinity column comprising, for example, epinephrine, norepinephrine, or another substance which 20 is known to bind to the human a, adrenergic receptor.
The resulting fractions can then be purified by contacting them with an ion exchange column, and determining which fraction contains human a, adrenergic receptor activity or binds anti-human a, adrenergic receptor activity or binds anti-human al adrenergic receptor antibodies.
This invention provides a method of preparing the isolated human al, adrenergic receptor which comprises inserting nucleic acid encoding the human al, adrenergic receptor in a suitable vector, inserting the resulting vector in a suitable host cell, recovering the aa adrenergic receptor produced by the resulting cell, and purifying the al, adrenergic receptor so recovered. An example of an isolated human aa adrenergic receptor is an isolated protein having substantially the same amino acid sequence as the amino acid sequence shown in i'> Figures 1A-1I. This invention also provides a method of preparing the isolated human alb adrenergic receptor which comprises inserting nucleic acid encoding the human alb adrenergic receptor in a suitable vector, inserting the resulting vector in a suitable host, recovering the alb adrenergic receptor produced by the resulting cell, and purifying the aI adrenergic receptor so recovered. These methods for preparing human a, adrenergic receptor uses recombinant DNA technology methods well known in the art. For example, isolated nucleic acid encoding a human a, adrenergic receptor is inserted in a suitable vector, such as an expression vector. A suitable host cell, such as a bacterial cell, or a eukaryotic cell such as a yeast 15 cell is transfected with the vector. The human a, adrenergic receptor is isolated from the culture medium by affinity purification or by chromatography or by other methods well known in the art.
0 This invention provides a method of determining whether a ligand not known to be capable of binding to a human a, adrenergic receptor can bind to a human a, adrenergic receptor, which comprises contacting a mammalian cell comprising a plasmid adapted for I 25 expression in a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor on the cell surface with the ligand under conditions permitting binding of ligands known to bind to the human a, adrenergic receptor, detecting the presence of any ligand bound to the human a, adrenergic receptor. The DNA in the cell may have a coding sequence substantially the same as the coding sequences shown in Figures 1A-1I, 2A-2h, or 3A-3G, preferably, the mammalian cell is nonneuronal in origin. An example of a nonneuronal mammalian cell is a Cos7 cell.
The preferred method for determining whether a ligand is capable of binding to the human a, adrenergic -46receptor comprises contacting a transfected nonneuronal mammalian cell a cell that does not naturally express any type of human a, adrenergic receptor, thus will only express such human a, adrenergic receptor if it is transfected into the cell) expressing a human a, adrenergic receptor on it surface, or contacting a membrane preparation derived from such a transfected cell, with the ligand under conditions which are known to prevail, and thus be associated with in vivo binding of the substrates to a human a, adrenergic receptor, detecting the presence of any of the ligand being tested bound to the human a, adrenergic receptor on the surface of the cell, and thereby determining whether the ligand binds to the human a, adrenergic receptor.
This response system is obtained by transfection of isolated DNA into a suitable host cell. Such a host system might be isolated from pre-existing cell lines, or can be generated by inserting appropriate components into existing cell lines. Such a transfection system S: 20 provides a complete response system for investigation or assay of the functional activity of human a, adrenergic receptors with ligands as described above.
Transfection systems are useful as living cell cultures for competitive binding assays between known or 25 candidate drugs and substrates which bind to the human a adrenergic receptor and which are labeled by radioactive, spectroscopic or other reagents. Membrane preparations containing the transporter isolated from transfected cells are also useful for these competitive binding assays. A transfection system constitutes a "drug discovery system" useful for the identification of natural or synthetic compounds with potential for drug development that can be further modified or used directly as therapeutic compounds to activate or inhibit the natural functions of a specific human a, adrenergic receptor. The transfection system is also useful for determining the affinity and efficacy of V i, e -47known drugs at human a, adrenergic receptor binding sites.
This invention provides a method for identifying a ligand which interacts with, and activates or blocks the activation of, a human a, adrenergic receptor on the surface of the cell, which comprises contacting a mammalian cell which comprises a plasmid adapted for expression in a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor on the cell surface with the ligand, determining whether the ligand activates or blocks the activation of the receptor using a bioassay such as a second messenger assays, and thereby identifying a ligand which interacts with, and activates or blocks the activation of, a human a, adrenergic receptor.
This invention provides functional assays for identifying ligands and drugs which bind to and 20 activate or inhibit a specific human al adrenergic receptor activity.
This invention provides a method for identifying a ligand which is capable of binding to and activating or inhibiting a human a, adrenergic receptor, which comprises contacting a mammalian cell, wherein the membrane lipids have been labelled by prior incubation with a labelled myo-inositol phosphate molecule, the mammalian cell comprising a plasmid adapted for expression in a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor with the ligand and identifying an inositol phosphate metabolite released from the membrane lipid as a result of ligand binding to and activating an a, adrenergic receptor.
This invention provides method for identifying a ligand 4, 1. A -48that is capable of binding to and activating or inhibiting a human a, adrenergic receptor, where in the binding of ligand to the adrenergic receptor results in a physiological response, which comprises contacting a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor with a calcium sensitive fluorescent indicator, removing the indicator that has not been taken up by the cell, contacting the cells with the ligand and identifying an increase or decrease in intracellular Ca+ 2 as a result of ligand binding to and activating receptors.
Transformed mammalian cells for identifying the ligands and drugs that affect the functional properties of the human a adrenergic receptor include 292-alo-10, C-alb-6 and C-alc-7.
This invention also provides a method of screening i. drugs to identify drugs which interact with, and bind to, a human a, adrenergic receptor on the surface of a cell, which comprises contacting a mammalian cell which comprises a plasmid adapted for expression in a mammalian cell which further comprises a DNA molecule which expresses a human a, adrenergic receptor on the 25 cell surface with a plurality of drugs, determining those drugs which bind to the human a, adrenergic receptor expressed on the cell surface of the mammalian cell, and thereby identifying drugs which interact with, and bind to, the human a, adrenergic receptor.
Various methods of detection may be employed. The drugs may be "labeled" by association with a detectable marker substance radiolabel or a non-isotopic label such as biotin). The DNA in the cell may have a coding sequence substantially the same as the coding sequences shown in Figures 1A-1I, 2A-2H or 3A-3G.
Preferably, the mammalian cell is nonneuronal in origin. An example of a nonneuronal mammalian cell is -49a Cos7 cell. Drug, candidates are identified by choosing chemical compounds which bind with high affinity to the human a, adrenergic receptor expressed on the cell surface in transfected cells, using radioligand binding methods well known in the art, examples of which are shown in the binding assays described herein. Drug candidates are also screened for selectivity by identifying compounds which bind with high affinity to one particular human al adrenergic receptor subtype but do not bind with high affinity to any other human al adrenergic receptor subtype or to any other known receptor site. Because selective, high affinity compounds interact primarily with the target human a, adrenergic site after administration to the patient, the chances of producing a drug with unwanted side effects are minimized by this approach. This invention provides a pharmaceutical composition comprising a drug identified by the method described above and a pharmaceutically acceptable 20 carrier. As used herein, the term "pharmaceutically acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of 25 wetting agents. Once the candidate drug has been shown to be adequately bio-available following a particular route of administration, for example orally or by injection (adequate therapeutic concentrations must be maintained at the site of action for an adequate period to gain the desired therapeutic benefit), and has been shown to be non-toxic and therapeutically effective in appropriate disease models, the drug may be administered to patients by that route of administration determined to make the drug bioavailable, in an appropriate solid or solution formulation, to gain the desired therapeutic benefit.
This invention also provides a method for treating an abnormal condition related to an excess of activity of a human a, adrenergic receptor subtype, which comprises administering a patient an amount of a pharmaceutical composition described above, effective to reduce a, adrenergic activity as a result of naturally occurring substrate binding to and activating a specific a, adrenergic receptor. Examples of such abnormalities related to an excess of activity of a human a, adrenergic receptor subtype include but are limited to benign prostatic hypertrophy, coronary heart disease, hypertension, urinary retention, insulin resistance, atherosclerosis, sympathetic dystrophy syndrome, glaucoma, cardiac arrythymias erectile dysfunction, and 15 Renaud's syndrome.
This invention also provides a method of treating abnormalities which are alleviated by an increase in the activity of a specific human a, adrenergic 20 receptor, which comprises administering a patient an amount of a pharmaceutical composition described above, effective to increase the activity of the specific human a, adrenergic receptor thereby alleviating abnormalities resulting from abnormally low receptor activity. Examples of such abnormalities related to a decrease in the activity of a specific human a adrenergic receptor include but are not limited to congestive heart failure, urinary incontinence, nasal congestion and hypotension.
Applicants have identified individual human a l adrenergic receptor subtypes and have described methods for the identification of pharmacological compounds for therapeutic treatments. Pharmacological compounds which are directed against a specific human adrenergic receptor subtype provide effective new therapies with minimal side effects.
-51- Elucidation of the molecular structures of the neuronal human a, adrenergic receptors transporters is an important step in the understanding of a-adrenergic neurotransmission. This disclosure reports the isolation, the nucleic acid sequence, and functional expression of DNA clones isolated from human brain which encode human a, adrenergic receptor. The identification of these human a, adrenergic receptor will play a pivotal role in elucidating the molecular mechanisms underlying a-adrenergic transmission, and should also aid in the development of novel therapeutic agents.
DNA clones encoding human a, adrenergic receptor have been isolated from human brain, and their functional properties have been examined in mammalian cells.
This invention identifies for the first time three new human a adrenergic receptor, their amino acid 20 sequences, and their human genes. The information and experimental tools provided by this discovery are useful to generate new therapeutic agents, and new therapeutic or diagnostic assays for these new human receptors, their associated mRNA molecules or their associated genomic DNAs. The information and experimental tools provided by this discovery will be useful to generate new therapeutic agents, and new therapeutic or diagnostic assays for these new human receptors, their associates mRNA molecules, or their associated genomic DNAs.
Specifically, this invention relates to the first isolation of human DNA clones encoding three a,adrenergic receptor. In addition, the human aI adrenergic receptor have been expressed in mammalian cells by transfecting the cells with the plasmids pCEXV-al, pcEXV-alc. The pharmacological binding -52properties of these receptor proteins have been determined, and these binding properties classify these receptor proteins as a, adrenergic receptor. Mammalian cell lines expressing the human a, adrenergic receptor on the cell surface have been constructed, thus establishing the first well-defined, cultured cell lines with which to study human al adrenergic receptor.
Examples of transformed mammalian cells, expressing human a, adrenergic receptor are L-a-la, expressing a human ala adrenergic receptor, L-alb expressing a human alb adrenergic receptor, and L-alc expressing a human alc adrenergic receptor. These cells are suitable for studying the pharmacological properties of the human al adrenergic receptor and for the screening of ligands 15 and drugs that specifically bind to human al adrenergic receptor subtypes.
The invention will be better understood by reference to the Experimental Details which follow, but those 20 skilled in the art will readily appreciate that the specific experiments detailed are only illustrative, and are not meant to limit the invention as described herein, which is defined by the claims which follow thereafter.
-53- MATERIALS AND METHODS Cloning and Sequencing ala: A human lymphocyte genomic library in C dash II (1.5 x 106 total recombinants; Stratagene, LaJolla, CA.) was screened using a cloned rat PCR fragment (RBNC2) as a probe. RBNC2 was obtained by amplifying randomly primed rat brain cDNA with degenerate primers designed to conserved regions of transmembrane (Tm) regions 2 and 6 of serotonin receptors. The sequence of one PCR product, RBNC2, exhibited strong homology to the al AR family.
The probe was labeled with [32 P] by the method of random priming (Prime-It Random Primer kit, SStrategene, LaJolla, Hybridization was performed at 40*C. in a solution containing 50% formamide, dextran sulfate, 5x SSC (IX SSC is 0.15M sodium choloride, 0.015M sodium citrate), Ix Denhardt's 20 solution (0.02% polyvinylpyrrolidone, 0.02% Ficoll, 0.02% bovine serum albumin), and 200 Ag/pl sonicated salmon sperm DNA. The filters were washed at 50*C. in 0.1x SSC containing 0.5% sodium dodecyl sulfate and exposed at -70"C to Kodak XAR film in the presence of an intensifying screen. Lambda phage clones hybridizing with the probe were plaque purified and DNA was prepared for Southern blot analysis (22, 17). For subcloning and further Southern blot analysis, DNA was cloned into pUC18 (Pharnacia, Piscataway, NJ) or pBluescript (Stratagene, LaJolla, Nucleotide sequence analysis was accomplished by the Sanger dideoxy nucleotide chain termination method (18) on denatured double-stranded plasmid templates, using Sequenase (US Biochemcial Corp., Cleveland, OH), Bst DNA sequencing kit (Bio-Rad Laboratories, Richmond, or TaqTrack sequencing kit (Promega Corporation, Madison, WI.).
II I I rr -54- In order to isolate a full-length clone, human cDNA libraries were screened by polymerase chain reaction (PCR) with lM each of specific oligonucleotide primers designed off the isolated genomic clone: from the sense strand (nucleotide 598-626), CACTCAAGTACCCAGCCATCATGAC 3' and from the antisense stand (nucleotide 979-1003), CGGAGAGCGAGCTGCGGAAGGTGTG 3' (see Figures 1A01I). The primers were from non-conserved portions of the receptor gene, specifically in the Tm3-Tm3 loop and in the Tm5-Tm6 loop regions for the upstream and downstream primers, respectively. One to 2 il of phage DNA from cDNA libraries (C ZapII; Stratagene, LaJolla, CA.),representing =106-107 pfu, were amplified in 15 Tris-HCl, pH 8.3, 50mM KC1, 1.5mM MgCl 2 0.01% gelatin, 200 jM each dATP, dCTP, dTTP, 2.5 units of Thermus aquaticus DNA polymerase (Taq polymerase; Perkin-Elmer- Cetus, Norwalk, The amplification profile was
S
run for 30 cycles: a 5 min. initial 1 cycle denaturation at 95C., followed by 2 min. at 94'C., 2 min at 68*C., and 3 min at 72'C., with a 3 sec.
extension, followed by a final 10 min. extension at 72'C. PCR products were analyzed by ethidium bromide (EtBr) stained agarose gels and any sample exhibiting a band on the EtBr stained gel was considered positive.
A positive library was then plated and screened with overlapping 45-mer oligonucleotide probes, filled-in using (a- 3 2 P]dCTP and [a- 3 P]dATP and Klenow fragment of DNA polymerase. This probe was internal to the amplification primers discussed above from the sense strand (nucleotide 890 934) GCAAGGCCTCCGAGGTGGTGCTGCGCATCCACTGTCGCGGCGCGG and from the anti-sense strand (nucleotide 915-961), TGCCGTGCGCCCCGTCGGCGCCCGTGGCCGCGCCGCGACAGTGGATG 3' (see Figures 1A-1I). Positive cDNA phage clones were plaque certified and pBluescript recombinant DNAs were 41 d' I.
excision-rescued from C Zap II using helper phage R408, as described by manufacturer's protocol (Stratagene, LaJolla, Insert size was confirmed by restriction enzyme digest analysis and recombinants were sequences as described above.
alb: A human placenta genomic library in A dash II x 106 total recombinants; Stratagene, LaJolla, CA.) was screened using overlapping oligonucleotides radiolabeled as described above and directed to the third, fifth and sixth transmembrane regions of serotonin 5HT1DP receptor gene.
Hybridization and washing conditions were identical. to that described for ala above except lower stringency hybridization nd washes were conducted; specifically, hybridization in 25% formamide and washes at 9* Positive-hybridizing I phage clones were plaquepurified, analyzed by Southern blot analysis, subcloned and sequenced, as described above for ala. In order to isolate full-length clones, human cDNA libraries in X Zap II (Strategene, LaJolla, CA.) were screened by polymerase chain reaction as described above. The upstream and downstream PCR primers used were from the 25 Tm40Tm5 loop and the Tm5-Tm6 loop, respectively: from the sense strand (nucleotide 567-593), S. CAACGATGACAAGGA GTGCGGGGTCAC and from the antisense strand (nucleotide 8 2 2-847 TTTGACAGCTATGGAACTCCTGGGG 3' (see Fig. PCR, library screen, plaque purification excision-rescue from A Zap II, restriction digestions and sequencing were accomplished as described above for ala. The internal probe was: from the sense strand (nucleotide 745-789), ACGAGGAC and from the anti-sense strand (nucleotide 770-814), 5' CCTTGGCCTTGGTACTGCTAAGGGTGTCCTCGTGAAA GTTCTTGG 3' (see Figures 2A-2H).
-56alc: A human lymphocyte genomic library in A dash II (=1.5x10 6 total recombinants; Stratagene, LaJolla, CA.) was screened using overlapping 45-mer oligonucleotides radiolabeled as described for ala and directed to the third, fifth and sixth transmembrane regions of serotonin 5HT1A receptor gene. Hybridization and washing conditions were identical to that described for alb. Positive-hybridizing A phage clones were plaquepurified, analyzed by Southern blot analysis, subcloned and sequenced, as. described above for ala.
Identification and isolation of full=length clones by PCR and screening cDNA libraries were accomplished as described for alb. The upstream and downstream PCR primers used were from the Tm3-Tm4 loop and the Tm5-Tm6 15 loop, respectively: from the sense strand (nucleotide 403-425), 5' CCAACCATCGTCACCCAGAGGAG and from the antisense strand (nucleotide 775-802), 5' TCTCCCGGG AGAACTTGAGGAGCCTCAC 3' (see Figures 3A-3G) The *o *9 internal probe was: from the sense strand (nucleotide 711-745), 5' TCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGC AGCGGGATGG and from the anti-sense strand (nucleotide 726-771), 5' GAAGTGCGTCTTGGTCTTGGCGCT GGCCATCCCGCTGCCTCCTGCC 3' (see Figures 3A-3G). PCR, library screen, plaque purification excision-rescue from A Zap II, restriction digestions and sequencing were accomplished as described above for ala.
Expression ala: The entire coding region of ala (1719 bp), including 150 basepairs of 5' untranslated sequence UT) and 300 bp of 3' untranslated sequence UT), was cloned into the BamHI and Clal sites of the polylinkermodified eukaryotic expression vector pCEXV-3 (13), called EXJ.HR (unpublished data). The construct involved the ligation of partial overlapping human lymphocyte genomic and hippocamppal cDNA clones: sequences were contained on a 1.2 kb SmaI-XhoI genomic t -57fragment (the vector-derived BamHI site was used for subcloning instead of the internal insert-derived SmaI site) and 3' sequences were contained on an 1.3 kb XhoI-ClaI cDNA fragment (the Clal site was from the vector polylinker). Stable cell lines were obtained by cotransfection with the plasmid ala/EXJ (expression vector containing the ala receptor gene) and the plasmid pGCcos3neo (plasmid containing the aminoglycoside transferase gene) into LM(tk'), CHO, NIH3T3 cells, and 293 cells using calcium phosphate technique. The cells were grown, in a controlled environment 5% CO 2 as monolayers in Dulbecco's modified Eagle's Medium (GIBCO, Grand Island, NY) containing 25mM glucose and supplemented with 10% bovine calf serum, 100 units/ml penicillin G, and 100 mg/ml streptomycin sulfate. Stable clones were o then selected for resistance to the antibiotic G-418 (1 mg/ml) as described previously (26) and membranes were harvested and assayed for their ability to bind 3 Hprazosin as described below (see "Radioligand Binding Assays").
alb: The entire coding region of alb (1563 bp), including 200 basepairs of 5' untranslated sequence 25 UT) and 600 bp of 3' untranslated sequence UT), was cloned into the EcoRI site of pCEXV-3 eukaryotic expression vector The construct involved ligating the full-length containing EcoRI brainstem cDNA fragment from I Zap II into the expression vector.
Stable cell lines were selected as described above.
alc: The entire coding region of alc (1401 bp), including 400 basepairs of 5' untranslated sequence UT) and 200 bp of 3' untranslated sequence UT), was cloned into the KpnI site of the polylinker-modified pCEXV-3-derived (13) eukaryotic expression vector, EXJ.RH (unpublished data). The construct involved Vt -58ligating three partial overlapping fragments: a 0.6kb HincII genomic clone, a central 1.8 EcoRI hippocamppal cDNA clone, and a 3' 0.6kb PstI genomic clone. The hippocamppal cDNA fragment overlaps with the 5' and 3' genomic clones so that the HincI and PstI sites at the 5' and 3' ends of the cDNA clones, respectively, were utilized for ligation. This fulllength clone was cloned into the KpnI sites of the fragment, derived from vector (ie pBluescript) and 3' untranslated sequences, respectively. Stable cell lines were selected as described above.
RadioliQand Binding Assays Transfected cells from culture flasks were scraped into 15 5ml of 5mM tris-HCl, 5mM EDTA, pH 7.5, and lysed by sonication. The cell lysates were centrifuged at 1000 rpm for 5 min at 4'C. The pellet was suspended in Tris-HCl, 1mM MgCl 2 and 0.1% ascorbic acid at pH Binding of the al antagonist [H]prazosin (0.5 nM, 20 specific activity 76.2 Ci/mmol) to membrane preparations of LM(tk-) cells was done in a final volume of 0.25 ml and incubated at 37'C for 20 min.
Nonspecific binding was determined in the presence of 10 pM phentolamine. The reaction was stopped by filtration through GF/B filters using a cell harvester.
Data were analyzed by a computerized non-linear regression program.
Measurement of 3 H]Inositol Phosphates (IP) Formation Cells were suspended in Dulbecco's phosphate buffered saline (PBS), and incubated with 5MCi/ml [3H]m-inositol for 60 min at 37'C, the reaction was stopped by adding CHCl 3 :Methanol: HC1 (2/1/0.01 Total [3H]IP were separated by ion exchange chromatography and quantified as described by Forray and El-Fakahany Calcium Measurements Intracellular calcium levels ([Ca 2 were determined 0 t. I, 1 -59with the calcium-sensitive dye fura-2, and microspectrofluorometry, essentially as previously described Briefly, cells were plated into polylysine-coated coverslip bottom dishes (MatTek Corporation, Ashland MA). To lead with fura-2, cells were washed 3x with HEPES-buffered saline (HBS, in mM: HEPES, 20; NaC1, 150; KC1, 5; CaCl 2 1; MgCl 2 1; glucose, 10; pH 7.4) and incubated for 30 minutes at room temperature with fura-2 loading solution fura-2/AM, 0.03% pluronic F-127, and 2% heatinactivated fetal calf serum, in HBS). After loading, cells were washed 3x with HBS, 1ml of HBS was added, and the dish was placed on the microscope for determination of [Ca 2 [Ca 2 was measured with a Leitz Fluovert microscope equipped for UV-transmission *ag epifluorescence. Fura-2 fluorescence was alternately excited at 340 and 380nm (0.25 sec), and a pair of readings (500nm long pass) was taken every two seconds, and recorded by a personal computer interfaced to a data acquisition and control unit from Kinetek (Yonkers, NY). To determine (Ca i from the experimental data the background fluorescence was subtracted, and the corrected ratios were converted to [Ca 2 by comparison with buffers containing saturating 25 and low free calcium, assuming a K, of 400 nM 5 0
S
S, a B
RESULTS
ala: We screened a human genomic lymphocyte library with a rat PCR fragment that exhibited homology with the al-AR family. A total of six clones were isolated and characterized by Southern blot analysis. One clone, h13, contained a 4.0kb Xbal fragment which hybridized with the radiolabeled rat PCR fragment and was subsequently subcloned into pUC vector. DNA sequence analysis indicated greatest homology to human ala and rat ala ARs. This clone contained the initiating methionine through Tm6 with =1.0-1.5kb 5' UT region. Subsequent Southern blot, analysis, subcloning and sequencing analysis indicated the presence of a Smal site =150nts. 5' to the initiating methionine codon. The homology between h13 and rat ala adrenergic gene breaks just downstream of Tm6, indicating an intron which is located in an analogous region in the alb- and alc-AR genes In order to obtain a full-length clone, aliquots of human cDNA libraries S 20 totaling =1.5xl06 recombinants was screened by polymerase chain reaction using specific oligonucleotide primers from sequence determined off the genomic clone (see Materials and Methods). A positive- containing human hippocamppal cDNA library (Stratagene, LaJolla, CA.) in 1 Zap II (=1.5x106 recombinants) was screened using traditional plaque hybridization with an internal probe (see Materials and Methods) and resulted in the isolation of two positive cDNA clones, one containing the upstream sequences 30 (from 5' UT through the 5-6 loop; hH22) and the other containing downstream sequences (from within through =200 nts. with a common XhoI site being present within this common region.
The complete full-length gene was constructed by splicing together two restriction fragments, one being the 3' cDNA (hH14) and the other being the 5' genomic S" I -61clone (h13), using a unique restriction site (Xhol) present in the overlapping region. In addition, another construct was accomplished by ligating the two cDNA clones (hH14 and hH22), using the overlapping XhoI site; however, since this construct produced the same pharmacology as the genomic/cDNA construct, we will not discuss this recombinant (unpublished observation).
The genomic/cDNA construct contains an open reading frame of 1719 bp and encoding a protein of 572 aa in length, having a relative molecular mass of =63,000 daltons. Hydropathy analysis of the protein is consistent with a putative topography of seven transmembrane domains, indicative of the G proteincoupled receptor family. Initial sequence analysis revealed that clone ala/EXJ was most related to an AR since it contained a number of conserved structural features/residues found among the members of the adrenergic receptor family, including conserve cysteines in the second and third extracellular loops, 20 a conserved glycine residue in Tml, aspartic acid residues in Tm. regions II and III, conserved valine residues in TmIII, the DRY sequence at the end of TmIII, the conserved proline residues of Tm regions II, IV, V, VI and VII, and the consensus D-V-L-X-X-T-X-S-I- 25 X-X-L-C IN Tm3 and the consensus G-Y-X-N-S-X-X-N-P-X-I- Y in the Tm VII, both consensus unique to the adrenergic receptor family Other features of this human ala receptor gene are the presence of two potential sites for N-linked glycosylation in the amino 30 terminus (asparagine residues 65 and 82; Figures la-1I) and the presence of several serines and threonines in the carboxyl terminus and intracellular loops, which may serve as sites for potential phosphorylation by protein kinases.
ab: We screened a human genomic placenta library with probes derived from Tm3, 5 and 6 regions of serotonin 1 -62- 5HT1D, under low stringency. Out of several hundred positive clones pursued by Southern blot analysis, subcloning and sequencing, one resembled the a adrenergic family of receptors. This genomic fragment contained Tm3 through Tm6 of a receptor which was most closely related to rat and hamster alb receptors. In order to obtain a full-length clone, several human cDNA libraries were screened by PCR using primers derived from the 5-6 loop region of the genomic clone (see Materials and Methods). A positive-containing human brainstem cDNA library (Stratagene, LaJolla, CA) in A ZAPII x 106 recombinants) was screened using traditional plaque hybridization with an internal probe, resulting in the isolation of two identical cDNA clones, containing an insert size of 2.4 kb. Upon sequencing, this clone was found to contain the initiating MET aa, Tml through Tm7, and 5' and 3' UT sequences, suggesting a full-length clone on a single EcoRI fragment. This cDNA clone contains an open 20 reading frame of 1563 bp and encodes a protein of 520 aa in length, having a relative molecular mass of =57,000 daltons. Hydropathy analysis of the protein is consistent with a putative topography of seven transmembrane domains, indicative of the G proteincoupled receptor family.
Sequence analysis revealed that clone al/pCEXV was most related to adrenergic receptor since it contained a number of conserved structural features found among the 30 adrenergic receptor family, as described for al receptor (see above). This human alb receptor contains potential sites for N-linked glycosylation in the amino terminus (asparagine residues 10, 24, 29, 34 in Fig.
2A-2H), consistent with the finding that the al AR is glycosylated (4,19).
Ric: We screened a human genomic lymphocyte library -63with probes derived from the third, fifth and sixth transmembrane regions of serotonin 5HT1A under low stringency. Out of several hundred positive clones analyzed by Southern blot analysis, subcloning and sequencing (see Materials and Methods), one phage clone resembled a novel a, AR. This genomic fragment contained Tml through Tm6 of a receptor with high homology to the bovine 1c receptor and thus suggesting the presence of an intron downstream of Tm6, as shown for the a, receptor family (4,12,20). In order to obtain a full-length clone, several human cDNA libraries were screened by PCR, as described for a b (also see Materials and Methods). A positivecontaining human hippocamppal cDNA library (Stratagene, LaJolla, CA) in A ZAPII x 106 recombinants) was screened, as described for alb. A positive clone (hH was identified which contained a 1.7kb EcoRI cDNA fragment insert. However, this cDNA clone lacked both the amino end of the receptor (the 5' end of the clone 20 terminated at the 5' end of Tm2) and part of the carboxyl tail (the 3' end of the clone corresponded to 40 aa upstream from the "putative" stop codon). Since an alternative genomic subclone which contained the initiating MET codon in addition to Tml through Tm6 was 25 available, we needed to obtain the complete 3' carboxyl tail in order to complete the construct of the full- .length clone. This was accomplished by using overlapping 45-mer oligonucleotide primers (corresponding to nts. 1142-1212 in Fig. designed 30 within the carboxyl tail of the receptor (at the 3' end of the hH20 cDNA clone), to screen a human lymphocyte genomic library in order to isolate a genomic clone containing the carboxyl tail that includes the termination codon. Two identical positive human lymphocyte genomic clones were isolated from this library. A 0.6 kb PstI fragment was subcloned and shown to contain most of the carboxyl tail (220 aa downstream -64of Tm7) through the termination codon and =200 bp of 3' UT sequence.
The complete full-length gene was constructed by splicing together three restriction fragments: A 0.6 kb HincII fragment from the genomic clone, containing =0.4 kb of 5' UT sequence and the initiating MET codon through Tm2; the 0.8 kb HincII-PstI fragment from the hH cDNA clone, which contains Tm2 through part of the carboxyl tail, overlapping with the 5' genomic clone by nts. (sharing the unique HincIl site at position 196 in Fig. and a 0.6 kb PstI fragment from the second hl genomic clone, which contains the carboxyl tail, the stop codon and =0.2 kb of 3' UT sequence, and overlapping with the hH cDNA clone (sharing the unique Pst I site within the carboxyl tail at position 1038 in Figures 3A-3G).
The resulting genomic/cDNA/genomic construct contains 20 an open reading frame of 1401 bp and encoding a protein of 466 aa in length, having a molecular weight of =51,000 daltons. Hydropathy analysis of the protein is consistent with a putative topography of seven transmembrane domains, as indicated for the previously described human and alb receptors and indicative of the G protein-coupled receptor family. Sequence S* analysis revealed that clone alc/EXJ was most related to adrenergic receptor because it contained the structural features commonly found among the adrenergic receptor 30 family of receptors, as described for the receptor above. Other features of this human aec receptor gene is the presence of three potential sites for N-linked glycosylation in the amino terminus, at the same position described for the bovine receptor (asparagine residues 7, 13 and 22 in Figure 3A-3G) Several threonines and serines exist in the second and third cytoplasmic loops of this al receptor, which may 11 4 serve as potential sites for protein kinases arnd phosphorylation.
Table 1. Competition of adrenergic agonists and antagonists for the binding of 3 H)prazosin to membranes prepared from LH(tk-) cells expressing the human atla' albF and ac 1 -adrenergic receptor cDNA.
Membrane preparations from stabily transfected cell lines increasing concentrations of various agonists or antagonists as described under "Materials and Methods".
Data is shown as the mean S.E.M. of the binding parameters estimated by a computerized non-linear regression analysis obtained in three independent experiments each performed in triplicate.
phi ale alb ale
AGONISTS
Norepinephrine 6.633 0.12 5.614 0.09 5.747 0.18 Epinephrine 6.245 0.10 5.297 ±-0.15 5.511 0.13 Oxymetazoline 5.903 0.16 5.919 0.07 7.691 0.10 Naphazoline 6.647 0.18 6.155 0.04 6.705 0.22 Xylometazoline 5.913 0.20 6.096 0.30 7.499 0.19 AUTAGONI STS a.
C*O~
4 4@*e e.g.
4* 6 C S
C.
*C CS C C Cd.
C S *4 C
C
4O** 0 0c S C CS. S
S
Prazos in WB-4 101 Niguldipine Indoramin Urapidil, 9.479 0.19 8.828 0.12 6.643 ±0.10 6.629 ±0.09 7.795 ±0.15 7.857 ±0.13 6.509 ±0.18 9. 260 0.23 7.909 0.13 6.937 ±0.12 7.347 ±0.17 6.603 ±0.09 8.474 ±0.10 9.234 13 9.080± 0.09 8.693 ±0.18 8.341 ±0.25 8.160 ±0.11 8.617 ±0.10 HEAT Urapidil 30 rapdil5.932 0.11 6.987 0.14 r i -66- Rauwolscine 5.274 0.12 4.852 0.08 4.527 0.11 Pharmacological Analysis: To further assess the functional identity of the cloned cDNA the coding regions were subcloned into the pCEXV-3 expression vector, and LM(tk-) cell lines stably expressing the human cDNA encoding each of the three a-ARs were established. Membrane preparations of these cell lines showed high affinity binding of 3 H]prazosin, with Kd values of 0.21 0.03 nM (Bmax= 0.72 0.04 pmol/mg prot), 0.88 0.1 nM (Bmax= 4.59 0.21 pmol/mg prot) and 0.39 0.08 nM (Bmax= 1.9 0.04 pmol/mg prot) for the cells expressing the ala, ab, and alc-ARs respectively. In contrast in competition binding 15 experiments rauwolscine showed extremely low affinity at the three cloned receptors (Table consistent with their identity as a,-AR. The a-adrenergic agonists NE and epinephrine were found to be 6 and *9 respectively, more potent at the human ala-AR, conversely the imidazoline derivatives such as oxymetazoline and xylometazoline showed 52-fold higher potency at the a 1 c-AR. Similarly, several antagonists showed marked differences in their potency to inhibit [3H]prazosin binding from the cloned human a, receptors subtypes. The selective antagonists WB-4101 and methyl-urapidil showed high affinity for the human alc subtype (0.8 and 7 nM respectively), followed by less than 2-fold lower potency at the human and at least an order of magnitude (15 and 36-fold respectively) lower potency at the human ab-AR. Similarly, indoramin was 50 and 10-fold more potent at the alc than at the al, and alb respectively. The calcium channel blocker (+)-niguldipine showed the highest selectivity for the three a,-AR subtypes, displacing 3 H]prazosin 112 and 57-fold more potently from the a 1 e than from al and alb transfected cells respectively.
'i *l -67- Table 2. Receptor-mediated formation of 3 H]IP in cell lines transfected with the human a-adrenergic receptors cDNA.
Cell lines stably expressing the human al-adrenergic receptors were obtained and the IP formation was measured in the absence or presence of norepinephrine (NE) in the presence of 10 mM LiCI as described under."Material and Methods". Data are shown as mean S.E.M. ,of three independent experiments performed in triplicate.
*o e Cell Line 3 H]IP Fold Receptor Stimulation a Density dpm/dish pmol/mg Prot 293 aQ, 3.30 Control 288 29 NE 3646 144 13 CHO a1b 0.49 Control 1069 26 NE 5934 309 6 NIH3T3 ale 0.24 Control 722 61 NE 13929 1226 19 SDetermined by [H]Prazosin binding.
The formation of 3 H]IP was measured in 293, CHO, and p I B -68- NIH3T3 cell stably expressing the cloned human ala, alb, oic-ARs respectively, to assess the functional coupling of these receptors with the activation of phosphatidylinositol specific phospholipase C (PI-PLC). As shown in Table 2, the adrenergic agonist NE (10MM) activated the formation of IP by 13-fold in cells expressing the a,l receptor, and by 5 and 15-fold in cells expressing the ala,alb and alc receptors respectively. Furthermore, when cells expressing alb and ae receptors were incubated in the presence of 10pM NE, a rapid increase of cytosolic calcium was observed. The response was characterized by an early peak, followed by a plateau that slowly declined towards resting calcium levels (Fig The concentration of [Ca 2 was increased by 15 172 33 170 48 and 224 79 nM in cell lines transfected with the a, aG and a 1 c receptors S: respectively. The changes in [Ca induced by NE were suppressed by preincubation of the cells with 10 nM prazosin, indicating that the calcium response was mediated by a,-ARs.
We have cloned DNA representing three a -ARs subtypes (ala, aib and alc) from human brain cDNA and genomic DNA.
Of all known G protein-coupled receptor sequences 25 (EMBL/Genbank Data Base), the greatest homology was found between ala/EXJ and the rat ala AR rat aid AR (16) and a previously reported putative human "ala" adrenergic receptor (H318/3)(2). Comparison of the human ala deduced aa sequence with known ala ARs indicates the greatest concentration of identical aa to be in the transmembrane domains. In these Tm regions, the percentage of identity for the human a AR is 98% compared to rat ala AR (12) (this is approximately the same for rat aid since rat ald AR is the same as rat ala AR, except for two amino acid differences), 100% with the previously reported H318/3, 78% with the human alb receptor (see below), and 69% with the human ac P L -69receptor (see below), which is typical among subtypes.
When considering the full-length proteins, the percent identity drops and is only 50% for the human alb and 49% for the human a 1 c receptor. Both the alignment (see Fig. 4) and percent identity of this human ala sequence, relative to other members of the AR family strongly suggest that this is a new receptor and is the human species homolog of the rat receptor.
Figure 4 shows a comparison between the deduced aa sequence of a,/EXJ and the sequences of rat and HAR. An overall homology of 83.5% aa identity with rat ala and 86.5% aa identity with the previously published H318/3 clone was observed, suggesting that our human ala receptor is not any more related to the previously published putative human "ala" than it is to the rat ala receptor. In fact, in support of this conclusion, is the fact that the overall aa homology of rat a, receptor with our human ar, receptor is 83.5% but is 20 only 72% compared to the H318/3 receptor. The main differences between our human a receptor and the previously reported "ala," receptor in relation to the rat a, are indicated in Fig. 4. Most notably are the differences observed at both the amino and carboxyl 25 ends of the receptor. Specifically, both our human ala and rat ala use the starting MET aa at position 1 (see Fig. 4) whereas the previously published H318/3 uses the starting MET 48 aa downstream. Also, the amino .:...terminus of the H318/3 clone is completely divergent from either rat al or our human receptor until about 12 aa upstream of Tml where significant homology begins. Similarly, in the carboxyl tail, the homology of H318/3 diverges =90 aa upstream from the stop codon of either rat or our human a 1 3 receptor and instead, uses a stop codon 30 aa upstream from the stop codon on either of these receptors. Finally, the H318/3 clone has an amino terminal extracellular region that does not contain potential sites for N-linked glycosylation in contrast to the rat or our human ala receptor, which contains two potential sites (12, see also Fig. 1 and above). Thus, these data strongly suggest that our human aa, receptor is different in sequence from the previously reported putative human "aa" (H318/3) but is more related to the previously published rat a 8 receptor. Interestingly, the rat ala aa sequence diverges from both human ala receptors for =65 aa in the carboxyl tail (position 434-508 in Fig.
however, homology is seen again in our human a, receptor but not with H318/3, downstream from thisregion.
15 The cloning of different a, receptor subtypes permits analysis of both the pharmacological and functional properties of adrenergic receptors. The human a 1 /pcEXV clone exhibited the greatest homology with the rat and hamster alb receptors, out of all known G proteincoupled receptor clones (EMBL/Genbank Data Bank).
Comparison of the human alb deduced aa sequence with known a, ARs indicates the greatest homology in the transmembrane regions. In these Tm regions, the percent identity for the human ab AR is 99% compared to 25 either rat (25) or hamster ab receptor, 78% with human al receptor and 75% with human al receptor, which is typical among subtypes. When analyzing the full-length proteins, the percent identity slightly drops and is 94.5% compared to rat alb, 95.5% compared to hamster alb receptor, 50% compared to human al and 51% compared to human a~c receptor. Both the alignment (see Fig. 5) and percent identity of this human alb sequence, relative to other members of the AR family, strongly suggest that this clone represents a new receptor and is the human species homologue of the rat/hamster ab receptor. Figure 5 shows a comparison between the deduced amino acid sequence of a,/pcEXV and -71the aa sequence of rat alb and hamster alb receptors.
A third human adrenergic receptor clone, alc/EXJ, showed the greatest homology with the bovine aIc AR gene from all known G protein-coupled receptor sequences (EMBL/Genbank Data Bank). Comparison of the human al deduced aa sequence with' the a, ARs indicates the greatest homology to be in the transmembrane regions.
In these Tm regions, the percent identity for the human al AR is 97% compared to the bovine alc AR with human alb receptor and 69% with human ala receptor, which is typical among subtypes. When one examines the full-length proteins, the percent identity drops and is only 51% compared to either the human alb or human a, receptor. Figure 6 shows a comparison between the deduced amino acid sequence of alc/EXJ and the aa sequence of bovine alc. An overall homology of 92% aa identity with bovine a receptor was observed. Both the alignment (see Fig. 6) and percent identity of this 20 human aip sequence, relative to other members of the AR family, strongly suggest that this clone represents a new receptor and is the human species homologue of the bovine aec receptor.
25 The stable expression of the three cloned human a, receptors enabled the characterization of their pharmacological as well as their functional properties and allowed identification of certain unique features of the human receptors, not predicted from previous data. The rank-order of potency of known a-adrenergic agonists and antagonists to compete with 3 H]prazosin in binding assays, confirmed that the cloned cDNAs encode three human receptors of the ai-AR family.
Moreover, the potencies of selective antagonists such as WB-4101 and 5-methyl-urapidil at the three human a l receptors were found to be in close agreement with the potencies of these antagonists at the cloned rat a,, -72hamster ab' and bovine al, 12, 20). These results suggest that the sequence homology between the three mammalian a, receptors resulted in a conservation of their pharmacological properties across different species. In the past the pharmacological characterization of a,-adrenergic receptors took advantage of the existence of selective antagonists such as WB-4101 and 5-methyl-urapidil that bind with high affinity to a subset of a,-receptors classified as al, 15). Our results using these selective antagonists indicate that these antagonists bind with similar affinity to both human ala and alc-receptors, and that they can only discriminate between either of these two subtypes and the alb receptor. The calcium channel blocker (+)-niguldipine was found to bind with high affinity to a subset of a,-receptors also labeled by 3 H] 5-methyl-urapidil in rat brain, thus defining this antagonist as a1a selective The high affinity of the human a 1 e receptor for (+)-niguldipine and the fact that it binds to the human ala and alb subtypes, with at least an order of magnitude lower affinity, strongly supports the notion that the human ale gene encodes the pharmacological a,,-receptor subtype. The possibility that this also holds true in the rat, is 25 suggested by the fact that the potency of (+)niguldipine for the rat ala clone is also at least an order of magnitude lower than that found for this *"-antagonist in rat tissues. Moreover in spite of the earlier reports on the absence of the bovine are cognate in rat tissues (24,21) pharmacological evidence suggests that this species express an a, receptor similar to the cloned a c receptor. These data altogether indicate that in trying to match the pharmacological subclassification of the a 1 -ARs with the evidence from molecular cloning studies, the initial assignment of the cloned rat ala receptor with the a,l receptor subtype was inadequate. Recently, a rat 1 I -73cDNA clone 99.8% homologous to the rat la -receptor, was described as a novel ald subtype however, this incorrect classification was due to the poor correlation between the affinities of a -selective antagonists in tissue preparations versus the cloned rat al receptor.
The three human a, receptor subtypes were able to induce the formation of IP, consistent with the known functional coupling of a,-ARs, through a GTP-dependent protein to the activation of PI-PLC. In addition we demonstrated that upon receptor activation by adrenergic agonists, the human a, subtypes induced transient changes three in [Ca 2 Consistent with the mobilization of calcium from intracellular stores by inositol-1,3,5 triphosphate, released by the receptormediated activation of PI-PLC.
We have cloned and expressed three human cDNA that 20 encode functional a 1 -ARs. These three transcripts display significant pharmacologic as well as molecular features to constitute distinct ao-AR subtypes. In [.sharp contrast with the restricted expression of the rat and bovine transcripts, our findings indicate that 25 species homologs of the three a,-ARs are expressed in human tissues. These findings together with recent reports on the dissimilar tissue distribution of the alb and a 1 c receptor cognates between animal species such as rat and rabbit commonly used in the development of novel a,-adrenergic agents, emphasize the need to study the pharmacological properties of the human a 1 receptors. In this regard, the results from this study on the selectivity of clinically effective antihypertensives such as indoramin, as well as vasoconstrictors such as oxymetazoline and xylometazoline for the human alc-AR, suggest a potential role for this a,-receptor subtype in the physiological pP -74control of vascular tone in the human. Thus, the availability of cell lines expressing each of the human al-receptor subtypes constitute a unique tool in the design of subtype specific agonists and antagonists, that can be targeted to selective therapeutic applications. Of specific interest for therapeutics are subtype selective alpha-1 antagonists for the treatment of Benign Prostatic Hypertrophy, coronary heart disease, insulin resistance, atherosclerosis, sympathetic dystrophy syndrome, glaucoma, cardiac arrythymias, erectile dysfunction, Reynaud's syndrome, hypertension and urinary retention (44,27,31,32,33,34,35,48). Further interest exists for subtype selective alpha-1 agonists for the treatment of congestive heart failure, nasal congestion, urinary incontinence and hypotension(45,46,47,48). In each case, a more selective drug is expected to reduce the side effects which presently limit this avenue of therapy.
The following compounds were synthesized in order to evaluate their ability to act as antagonists of a l receptor function in human prostrate. The synthetic methods used to synthesize are provided herein.
The following Experimental Details are set forth to aid S" in an understanding of the invention, and are not intended, and should not be construed, to limit in any way the invention set forth in the claims which follow thereafter.
Experimental Details.
Prazosin and 5-methylurapidil were obtained from Research Biochemicals, Inc. A30360 (4-fluoro-4-(8fluoro-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indol-2yl)butyrophenone hydrochloride) was obtained from Aldrich Chemical Co. Other compounds were prepared according to the examples which follow.
Example 1 Synthesis of Terazosin Hydrochloride N-(2-Furoyl)piperazine This compound and its preparation has been described in Great Britain Patents 1,390,014 and 1,390,015.
Piperazine hexahydrate (194 g, 1 mole) was dissolved in 250 ml H 2 O. The solution was acidified to pH 4.5 with 6 N HC1. Furoyl chloride (130.5 g, 1 mole, Aldrich) was added along with 10% NaOH solution at such a rate that the pH was maintained at 4.5. After 1 hour, the solution was made basic (pH 8.5) with NaOH solution.
20 The reaction mixture was continuously extracted with chloroform for 36 hours. The CHC1 3 extract was dried over MgSO 4 and filtered. Distillation gave 108.2 g S*.'product b.p. 132' 138" C/0.6 mm Hg, m.p. 69'
*C.
S: N-(Tetrahydro-2-furoyl)piperazine The furoylpiperazine of Example 1 was converted to the hydrobromide salt 173' 175' This salt (39.0 g) in 250 ml methyl alcohol and 9.0 g Raney nickel was hydrogenated at 3 atm. After uptake of H 2 ceased, the catalyst was filtered, the solvent concentrated, and the residue crystallized from isopropyl alcohol to give 35.2 g.
tetrahydrofuroylpiperazine HBr, m.p. 152' 156 *C.
This was suspended in 20 ml H 2 0. Then 10.5 g 50%, NaOH solution was added slowly followed by 2.0 g solid Na 2 CO. This was extracted with 4 x 100 ml portions of -76warm CHC1. The CHC1 3 extractions were distilled to give 22.5 g tetrahydrofurolylpiperazine, b.p. 120, 125*C/0.2 imn Hg.
2 (Tetrahydro-2-furoyl)piperazinyl]-4-amino-6 7dinethoxyquinazol ine hydrochloride To 7.00 g 2 -chl oro- 4-amino- 6, 7-dimethoxyquina zol ine (Lancaster Synthesis) in 50 ml methoxyethanol was added 10.8 g, tetrahydrofurolylpiperazine, and the mixture refluxed 3 hours. The clear solution was concentrated and an aqueous solution of potassium bicarbonate was added. The resultant solid that formed was filtered and washed with water. It was then added to methanol and the resulting suspension was acidified with a solution of hydrogen chloride in isopropyl alcohol.
17: The resulting solution was concentrated and the residue crystallized from isopropyl alcohol giving 8.12 g. of product, m.p. 278' 279*C.
Example 2 Preparation of Indoramin 4-Benzamido-l- (3-indolyl) ethylpyridinium Bromide A solution of 4-benzamidopyridine (1.98 g) and 3-(2bromoethyl) indole (2.24 g) in EtOH (15 ml) was ref luxed for 2 hours, and the crystallized product (3.13 g, up 264 266*C) was collected by filtration from the hot :reaction mixture. Recyrstallization gave the hydrate.
3- [2-4-Benzamidopiperid-l-yl) ethyl] indole (Indoramin) 4-Berizamido-1-(2- (3-indolyl) ethyl ]pyridinium bromide in 91% EtOH (300 ml) containing Et 3 N (0.8 g) was hydrog enated in the presence of freshly prepared W-7 Raney Ni catalyst (ca. 3 g) at 28.12 kg/cm 2 and 509 for 4 hours. After filtering of f the catalyst, the filtrate was evaporated and the residue was shaken with CHC1 3 and 2 N NaOH. The resulting insoluble material -77- (1.61 g, mp 203 2060C) was collected and dried.
Recrystallization from EtOH gave the product (1.34 g), as colorless needles.
Example 3 Preparation of 1-(3-benzoylpropyl)-4benzamidopiperidine (Compound 9) A mixture of 4-chlorobutyrophenone (447 mg, 2.45 mmol), 4-benzamidopiperidine (500 mg, 2.45 mmol) and KCO 3 (338 mg, 2.45 mmol) was heated up in boiling water bath for 1 hour. The reaction mixture was portioned between water and CHC1 3 The organic layer was separated and dried over Na 2 SO.. After filtration and removal of solvent, the residue was purified by chromatography (SiO 2 MeOH:CHC1 3 5:95). Recrystallization from AcOEt/hexane gave a white powder (78 mg, mp 143- 144*C; 'H NMR (CD30D, 400MH) 6 1.65 (dq, J 1 =3.16 Hz,
J
2 =11.9 Hz, 2H), 1.90-2.00 4H), 2.18 J=11.9 Hz, 2 28), 2.48 2H), 3.00-3.10 4H), 3.88 1H), 20 7.40-8.00 10H); Mass spectrum at m/z 351.
Example 4 Preparation of 1-[3-(4-chlorobenzoyl)propyl]-4benzamidopiperidine (Compound 7) A mixture of 3-(4-chlorobenzol)propyl bromide (640 mg, 2.45 mmol), 4-benzamidopiperidine (500 mg, 2.45 mmol) and K 2 C0 3 O (1.01 g, 7.34 mmol) in 50 ml of acetone was heated up to refluxing condition for 48 hours. The i solid was removed by filtration. Concentration of filtrate in vacuo gave a yellowish solid, which was purified by chromatography (SiO 2 MeOH:CHC1 3 5:95).
320 mg of white powder was obtained 'H NMR (CDC13, 300 mHz) 6 1.46 (dq, J,=1.0 Hz, J 2 =8.4 Hz, 2H), 1.90-2.10 4H), 2.16 2H), 2.43 J=6.9 Hz, 2H), 2.80-2.90 2H), 2.97 J=6.9 Hz, 2H), 3.97 1H), 5.92 J=7.8 Hz, 1H, 7.40-8.00 (m, 9H); Product was converted to HC1 salt and 0 L. I -78recrystallized with MeOH/EtzO, mp 243-244'C; Calcd for
C
22
H
25 CINgO 2 0HC1 H 2 0: C 60.15, H 6.37, N 6.37; Found: C 60.18, H 6.34, N6.29.
Example Preparation of SKF-104856 1-[(4-Chlorophenyl)thio)-2-propanone Chloroacetone (32.3 g, 0.347 mol) was added to a mixture of 4-chlorothiophenol (50 g, 0.347 mmol) and sodium hydroxide (14 g, 0.347 mol) in water (400 ml) and the mixture was stirred at 25"C for 1 hour. The mixture was extracted with ethyl ether and the organic phase was washed with water, dried with magnesium sulfate and concentrated to give 69 g of 15 chlorophenyl)thio]-2-propanone.
5-Chloro-3-methylbenzo(b)thiophene (4-Cholorophenyl)thio)-2-propanone (50 g, 0.25 mol) was added to polyphosphoric acid (300 g) and the mixture was stirred as the temperature was gradually raised to 120'C as an exotherm started. The mixture was stirred at 130'C for 1 hour, diluted with water, extracted with ethyl ether and the organic phase was dried and concentrated. The residue was stirred in 25 methanol (200 ml), filtered and the filtrate concentrated to give 17.5 g of 5-chloro-3methylbenzo(b)thiophene: bp 120'C (0.6 mm Hg).
Ethyl 5-chloro-3-methylbenzo (b)thiophene-2-carboxylate n-Butyllithium in hexane (2.6 M, 2.3 ml) was added to a solution of 5-chloro-3-methylbenzo(b)thiophene g, 6 mmol) in ethyl ether (20 ml) stirred at 0"C under argon. The mixture was stirred for 30 minutes and transferred slowly under argon pressure to a stirred solution of ethyl chloroformate (0.63 g, 6 mmol) in ethyl ether (20 ml). The mixture was stirred at 0'C for 30 minutes and at 25*C for 1.5 hours. The mixture 4. 1.
-79was treated with water and the organic phase was dried, concentrated and triturated with hexane to give 1.0 g of ethyl 5-chloro-3-methylbeflzo(b)thiophefle-2 carboxylate: mp, 92.5 94 *C.
Ethyl 3-bromomethyl-5-chlorobelZO thiophene-2carboxylate A mixture of ethyl 5-chloro-3-methylbenzo(b)thiophele- 2-carboxylate (9.0 g, 0.035 mol) N-bromosuccinimide (6.53 g, 0. 037 mol) and benzoyl peroxide (130 mg) in carbon tetrachloride (150 ml) was ref luxed and illuminated with sunlamp for 2 hours. The resulting suspension was cooled, filtered and the filter cake was triturated with methanol to give 9.9 g, of the methanol-insoluble ethyl chl orobenz o thiophene-2 -carboxy late: mp 148-150'C.
Ethyl S-Chloro-3-(N- (2 ,2-dimethoxyethyl) -N-methyl Caminomethyl) benzol thiophene-2-carboxylatS A mixture of ethyl chlorobenzo(b) thiophene-2-carboxylate (11 g, 0.033 mol) methylaminoacetaldehyde dimethyl acetal (4.76 g, 0.04 mol) and potassium carbonate (11.4 g, 0.8 mol) in dry acetone (200 ml) was stirred for 48 hours, filtered and the filtrate concentrated to give 11.8 g, of U..ethyl 5-hoo3(-,-dmtoyty)N methyl (aminomethyl) benzol thiophene-2-carboxylate.
Ethyl 7-chloro-3,4-dihydro-4-UOtbylthieflO[4,3, 2 "Of]- [3]bsnzazepine-2-carbozylatO Ethyl 5-hoo3[-22dntoyty)N methyl (aminomethyl) benzo thiophene-2-carbo)yl ate g, 8.1 mmol) was added in portions to trifluoromethanesulfonic acid (10 ml) stirred at. 0C under argon. The mixture was stirred at 25*C for minutes and diluted with water. The mixture was basified with aqueous sodium hydroxide and extracted with ethyl ether to give ethyl 7-chloro-3,4-dihydro-4methylthieno-(4, 3, 2-ef] [3)benzazepine-2-carboxylate.
Ethyl 7-ahloro-3 6-tetrahydro-4-methylthieno (4,3,2- Sf] (3]benzaaepine-2-carbozylate Diborane in tetrahydrofuaran (1 M, 40 ml) was added to a solution of ethyl 7-chloro-3,4-dihydro-4methyithieno 2-ef)[3 ]benzazepine-2-carboxylate (2.8 g) in tetrahydrofuran (30 ml) stirred at 0*C. The mixture was refluxed for 3 hours and stirred at for 18 hours, cooled, treated with methanol (50 ml) ref luxed for 18 hours and concentrated. The residue was triturated with ethyl ether-hexane to give 1.6 g of ethyl 7-chloro-3,4,5,6-tetrahydro-4methylthieno[C4, 3, 2-ef] (3 benzazepine-2-carboxylate: mp, *138-140 The free base was treated with hydrogen :chloride to give ethyl 7-chloro-3, 4,5, 6-tetrahydro-4methylthieno[4,3,2-ef] [3]benzazepine-2-carboxylate hydrochloride: mp 240*C.
7-Chloro-3,4,5,6-tetrahydro-4-methylthieno(4,3,2of]J[3] benzazepine-2-zethanol A solution of ethyl 7-chloro-3,4,5,6-tetrahydro-4methylthieno( 4.3. 2-ef) (3 benzazepine-2-carboxylate g, 12.9 umol), in ethyl ether (48 ml) was treated with lithium aluminum hydride (0.53 g, 14 mmol). The mixture was stirred for 1.5 hours, cooled and treated carefully with water (2.0 ml) 10% sodium hydroxide ml) and water (2.0 ml). The resulting mixture was.
filtered and the solvent evaporated to give 1.9 g (57%) of 7-chloro-3, 4,5, 6-tetrahydro-4-methylthieno(4, 3,2ef] (3]benzazepine-2-methanol: mp 184-1850C.
7-Chloro-3,4,5,6-tetrahydro-4-methylthieno-4,3,2ef benhazepine-2-carboxaldehyde A solution of 7-chloro-3,4,5,6-tetrahydro-4methylthieno[4, 3, 2-ef) (3]benzazepine-2-methanol (1.6 g, V i, i 6 mmol) in dichioromethane (150 ml) was stirred under argon with activated manganese dioxide 3 g) f or 2 hours. The mixture was filtered through Celite- and the filtrate was dried with magnesium sulfate and concentrated to give a 63% yield of 7-chloro-3,4,5,6tetrahydro-4-methylthieno(4 2-ef( (3jbenzazepine-2carboxaldehyde.
7-Chloro-2-ethenyl-3,4,5,6-tetrahdyro-4iethylthieno[4,3,2-ef]I[3]benzazepile CBKF-104856) Sodium hydride (60 dispersion in mineral oil. 3.8 mmol) was added to a stirred solution of methyltriphenylphosphonium bromide (1.35 g, 3.8 mmol) in dry tetrahydrofuran (30 ml) and stirred for minutes. The mixture was treated with a solution of 7chloro-3, 4, 5, 6-tetrahydro-4 -methylthieno[C4, 3, 2 -ef] 3] benzazepine-2-carboxaldehyde, prepared as in Example 3, g, 1.9 mmol) in dimethylformamide (4 ml) stirred at 25*C for 16 hours, quenched with ice and extracted 20 with ethyl acetate. The organic phase. was washed, dried and concentrated and the residue was g~e. chromatographed on silica gel eluted with a gradient of ~methylene chloride to methanol-methylene chloride The product was treated with hydrogen chloride to give 0.2 g of 7-chloro-2-ethenyl- C 3,4,5, 6-tetrahydro-4 -methyithieno (4,3,2ef] (3jbenzazepine hydrochloride: rap 234-2360C.
C The following is an example of the use of the cloned Human al 1 adrenergic receptors to identify the relevant al -Receptor subtype f or the therapy of Benign Prostatic Hypertrophy.
ExamRle 6 Protocol for the Determination of the Potency of al Antagonists The activity of compounds at the different human -n I' -82receptors was determined in vitro using cultured cell lines that selectively express the receptor of interest. These cell lines were prepared by transfecting the cloned cDNA or cloned genomic DNA or constructs containing both genomic DNA and cDNA encoding the human a-adrenergic, serotonin, histamine, and dopamine receptors as follows: a1A Human Adrenergic Receptor: The entire coding region of alA (1719 bp), including 150 basepairs of untranslated sequence UT) and 300 bp of 3' untranslated sequence UT), was cloned into the BamHI and Clal sites of the polylinker-modified eukarybtic expression vector pCEXV-3, called EXJ.HR.
15 The construct involved the ligation of partial overlapping human lymphocyte genomic and hippocampal :cDNA clones: 5' sequence were contained on a 1.2 kb SmaI-XhoI genomic fragment (the vector-derived BamHI site was used for subcloning instead of the internal insert-derived SmaI site) and 3' sequences were contained on an 1.3 kb XhoI-ClaI cDNA fragment (the Clal site was from the vector polylinker). Stable cell lines were obtained by cotransfection with the plasmid alA/EXJ (expression vector containing the alA receptor S. 25 gene) and the plasmid pGCcos3neo (plasmid containing the aminoglycoside transferase gene) into LM(tk'),
CHO,
and NIH3T3 cells, using calcium phosphate technique.
The cells were grown, in a controlled environment 5% C0 2 as monolayers in Dulbecco's modified Eagle's Medium (GIBCO, Grand Island, NY) containing glucose and supplemented with 10% bovine calf serum, 100 units/ml penicillin g, and 100 Mg/ml streptomycin sulfate. Stable clones were then selected for resistance to the antibiotic G-418 (1 mg/ml), and membranes were harvested and assayed for their ability to bind 3 H]prazosin as described below (see "Radioligand Binding assays").
-83o, Human Adrenergic Receptor: The entire coding region of alB (1563 bp), including 200 basepairs and untranslated sequence UT) and 600 bp of 3' untranslated sequence UT), was cloned into the EcoRI site of pCEXV-3 eukaryotic expression vector.
The construct involved ligating the full-length containing EcoRI brainstem cDNA fragment from I ZapII into the expression vector. Stable cell lines were selected as described above.
al Human Adrenergic Receptor: The entire coding region of alC (1401 bp), including 400 basepairs of untranslated sequence UT) and 200 bp of .3' untranslated sequence UT), was cloned into the KpnI site of the polylinker-modified pCEXV-3-derived eukaryotic expression vector, EXJ.RH. The construct involved ligating three partial overlapping fragments: a 5' 0.6kb HincII genomic clone, a central 1.8 EcoRI hippocampal cDNA clone, and a 3' 0.6Kb PstI genomic 20 clone. The hippocampal cDNA fragment overlaps with the and 3' genomic clones so that the HincII and PstI sites at the 5' and 3' ends of the cDNA clone, respectively, were utilized for ligation. This fulllength clone was cloned into the KpnI site of the 25 expression vector, using the 5' and 3' KpnI sites of "the fragment, derived from vector pBluescript) and 3'-untranslated sequences, respectively. Stable cell lines were selected as described above.
Radioligand Binding Assays: Transfected cells from culture flasks were scraped into 5ml of 5mM Tris-HCl, EDTA, pH 7.5, and lysed by sonication. The cell lysates. were centrifuged at 1000 rpm for 5 min at 4*C, and the supernatant was centrifuged at 30,000 x g for 20 min at 4'C. The pellet was suspended in 50mM Tris- HC1, lmM MgCl 2 and 0.1% ascorbic acid at pH Binding of the al antagonist [(H]prazosin (0.5 nM, -84specific activity 76.2 Ci/mmol) to membrane preparations of LM(tk-) cells was done in a final volume of 0.25 ml and incubated at 37"C for 20 min.
Nonspecific binding was determined in the presence of 10 pM phentolamine. The reaction was stopped by filtration through GF/B filters using a cell harvester.
Inhibition experiments, routinely consisting of 7 concentrations of the tested compounds, were analyzed using a non-linear regression curve-fitting computer program to obtain Ki values.
Exanple 7 Functional Properties of a, Antagonists in the Human Prostate 15 The efficacy of a adrenergic antagonists for the treatment of benign prostatic hyperplasia (BPH) is related to their ability to elicit relaxation of prostate smooth muscle. An index of this efficacy can be obtained by determining the potency of a antagonists to antagonize the contraction of human prostatic tissue induced by an a agonist "in vitro".
Furthermore, by comparing the potency of subtype selective a, antagonists in binding assays using human ai receptors with their potency to inhibit agonist- 25 induced smooth muscle contraction, it is possible to determine which of the a, adrenergic receptor subtypes is involved in the contraction of prostate smooth muscle.
Methods: Prostatic adenomas were obtained at the time of surgery from patients with symptomatic BPH. These were cut into longitudinal strips of 15mm long and 2-4 mm wide, and suspended in 5ml organ baths containing Krebs buffer (pH The baths were maintained at 37'C and continuously oxygenated with 5% CO 2 and 95% 02.
Isometric tension was measured with a Grass Instrument FT03 force transducer interfaced with a computer.
P:\OPER\MRO\AU677968.DIV 12/8/97 Tissue strips were contracted with varying concentrations ofphenylephrine after incubating for minutes in the absence and presence of at least three different concentrations of antagonist.
Dose-response curves for phenylephrine were constructed, and the antagonist potency (pA 2 was estimated by the dose-ratio method. The concentration of some antagonists in the tissue bath was assessed by measuring the displacement of [3H]prazosin by aliquots of the bath medium, using membrane preparations of the cloned human a 1 c receptor. This control was necessary to account for losses of antagonist due to absorption to the tissue bath and/or metabolism during the time the antagonists were equilibrated with the prostate tissue.
Results: Table 3 shows that the pA 2 values measured for a series of ac antagonists in human prostate 'OSS* tissue correlate closely (r=0.76) with the corresponding pK, values measured in the alc receptor assays. In contrast, the human prostate pA 2 values correlate poorly with the pK, values 15 measured at the alA and oa adrenergic receptors. (See Figure Thus, antagonists which are more potent at blocking the ale adrenergic receptor are more effective at blocking the contraction of the human prostate than antagonists which are more potent at the (aA or aIB adrenergic receptors. In addition, antagonists which are selective for the aic receptor will have a better therapeutic ratio than nonselective a antagonists.
EQUIVALENTS
Those skilled in the art will appreciate that the invention described herein is susceptible to see**: variations and modifications other than those specifically described. It is understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification individually or collectively, and any and all combinations of any two or more of said steps or features.
4** S S S 0 Table 3.
COMPARISON OF TNE BINDING POTENCY OF ALPNA-1 ANTAGONISTS IN CLONED N1KM RECEPTORS AND INEIR PROTENCT (pk) TO 11111111 PR00TATE 310011 MMSCE ONTRCTION Conpound Hun Alpha-I Humn Adreierglc Prostate (PA) MlA ale sic I Prazovln 9.43 .9.26 9.23 9.00 3 A-30360 7.49 7.6 8.52 S. .72 4 5-Methyl-Urspidil 7.79 6a7m.3 a38 Indoramin 6.74 7.39 6.35 7.6 6 SKF-104a56 8.48 7.50 7.60 76" 7 Conpound 7 6.82 7.1a4 7.63 .9 Coaw d 9 6.12 6.76 78a3 7.41 Terazosin 8.46 I 1 1 73 ±L -T.1673 -87- References Borden, Maxfield, Goldman, and Shelanski, Neurobiol. Aging., 13, 33-38, 1991.
Bruno, J. J. Whittaker, J. Song, and M.
Berelowitz. Biochem. Biophys. Res. Comm. 179, 1485-1490 (1991).
Bush, Borden, Greene, and Maxfield, Neurochem. 57, 562-574, 1991.
Cotecchia, Schwinn, Randall, R.R., Lefkowitz, Caron, and Kobilka, B.K., Proc. Natl. Acad. Sci. USA, 85, 7159-7163, 1988.
Feinberg, A. and B. Vogeistein. Anal.
*Biochem. 132, 6-13 (1983).
Flavahan, N.A. and Varihoutte, In: The Alpha- 1lAdrenergic Receptors, (ed. by R. R. Ruff olo, Jr., Humana Press, Clifton NJ) pp. 351-403, 1987.
Forray, and El-Fakahaly, Mol.
Pharmacol., 37, 893-902, 1990.
Graziadei, Zernig, Boer, and Glossman, Eur. J. Pharinacol. 172, 329-337, 1989.
Gross, Harift, arnd Rugevics, Eur. J.
Pharmacol., 151,333-335, 1989.
Hieble, Sarau, Foley, DeMarinis, and Pendleton, Naunyn-Schlniedeberg's Arch. Pharmacol., 318, 267-273, 1982.
-88-
*S
S.
S
11.- Langer, Pharmacol. Rev., 32, 377-360, 1980.
12.- Lomasney, J. Cotecchia, Lorenz, Leung, Schwinn, Yang-Feng, Brownstein, M4., Lefkowitz, -and Caron, J. Biol.
Chem., 266, 6365-6369, 1991.
13.- Miller, J. and R. N. Germain. J. Exp. Med. 164, 1478-1489 (1986).
14.- Minneman, Pharmacol. Rev., 40, 87-119, 1988.
Morrow, A. L. and Creese, I, Hal. Pharinacol.,. 29, 321-330, 1986.
16.- Perez, D. M4., M. T. Piascik, and R. M. Graham.
Mol. Pharmacol. 40, 876-883 (1991).
17.- Sambrook, Fritsch, and Maniatis, In: Molecular Cloning: A Laboratory Manual, 2 lid Edition (Cold Spring Harbor Lab., Cold Spring Harbor, 1989.
18.- Saniger, S. Proc. Natl. Acad. Sci. USA 74, 5463- 5467 (1977).
19.- Sawutz, D. S. M. Lanier, C. D. Warren, and R.
M. Graham. 14o1. Pharmacol. 32, 565-571 (1987).
S
I5555*
S
20.- 21.- Schwinn, Lomasney, Lorenz, Szklut, Fremeau, Yarig-Feng, Caron,
M.G.,
Lefkowitz, R.J. and Cotecchia, S, J. Biol. Chem., 265, 8183-8189, 1990.
Schwinn, Page, Middleton, Lorenz, Liggett, Yamamoto, Lapetina, E. Caron, M. G. Lefkowjtz, R. J. and Cotecchja, 1 1 -89- Mol. Pharmacol. 40, 619-626, 1991.
0 0* S.
S *1
S
S.
I.
1t 0 22.- Southern, E. M. J. Mol. Biol. 98,503-505 (1975).Starke, Rev. Physiol. Biochem.
Pharmacol., 88, 199-236, 1981.
23.- TimmermanS, Karamat Ali, Kwa, H.Y.,Schoop, Slothorst-Grisdijk, and van Zwieten, Mol. Pharmacol., 20, 295-301, 1981.
.0 24.- Tixnmermans, P.B.14.W.M., and Thoolen. In: The Alpha-i Adrenergic Receptors, (ed. by R.R.
Ruff olo, Jr., Humana Press, Clifton NJ) pp. 113- 187, 1987.
25.- Voigt, M. J. Kispert, and H. Chin. Nucleic Acid Res. 18, 1053 (1990).
26.- Weinshanc, Zgombick, Macchi, M., 0 Adhan, Lichtblau, Branchek, and Hartig, P.R. Mbi. OPharinacol. 38, 681-688, 1990.
27.- Cohen, (1993) J. Clin. Pharmaol., 33, 272- 278.
28.- Manning, A.S. and Hearse, (1984) J. Kol.
Cell Cardiol., 16: 497-518.
29.- Benfey, (1992) Can. J. Physiol. Pbarmacol., 71: 103-111.
Cubeddu, L. (1984) American Heart Journal, 116: 133-161.
3 5 31. Nishimura, Kuwayama, Matsugi, Sun, N., and Shirasawa, (1993) Investigative Ophthal.
Visual Sci., 34: 1761-1765.
I,
32.- Kinicaid-Smith, (1989) Journal Of Human Hypertension,,2743: 75-83.
33.- Ames, R. P. and Kiyasu, (1989) J7. Clin.
Pharmacol., 29: 123-127.
34.- Pool, (1991) Am. Heart J7., 121: 251-260.
Christ, Schwartz, Stone, Parker, Janis, Gondre, Valcic, and Meiuan, (1992) Amer. Physiological Soc., H15-H20.
36.- Rosenthal, (1989) Hypertension, 3: 85-91.
Journal of Human 4
S
S S 37.- Kowala, M.C. and Nicolosi, (1989) Journal of Cardiovascular Pharm., 13: 545-549.
38.- Nash, (1990) Clin. Cardiol., 13: 764-772.
39.- Waite, (1991) Journal of Internal Medicine, 229: 113-117.
Achari, R. and Laddu, (1992) J7. Clin. Pharm., 32: 520-523.
41.- Kowala, Nunnari, -Durham, and Nicolosi, (1991) Athersclerosis, 91: 35-39.
42.- Krupp, MN., Hoover, and Valentine, J.J., (1989) Journal of Cardiovascular Pharm., 13: 511- 519.
43.- Jansen, Lammers, Baggen, and Birkerah&ger, (1989) Journal of Cardiovascular Pharn., 13: -91- 44. Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure, (1993) Archives of Internal medicine, 163: 164-183.
45.- Sourander, (1990) Gerontology, 36: 19-25.
46.- Empey, D.W. and Medder, (1988) Drugs, 438-443.
47.- Andersson, (1988) Drugs, 35: 477-494.
48.- MacDonald, Ruskoaho, Scheinen, M. and Virtanen, (1988) Annals of Clin. Res., 298-310.
49.- Lepor, R. Tan, S. Meretyk, and E. Shapiro.
*Alpha 1 adrenoceptor subtypes in the human :prostate. J. Urol. 149:640-642 (1993).
Lepor, S. Auerbach, A Puras-Baez, P. Narayan, M. Soloway, F. Lowe, T. Moon, G. Leif er, and P.
Madsen. A randomized, placebo-controlled multicenter study of the efficacy and safety of teazosin in the treatment of benign porstatic hyperplasia. J. Urol. 148:1467-4174 (1992).
51.- Price, R.J. Lefkowitz, M.G. Caron, and D.A.
?.:Schwinn. Alpha 1 -adrenergic receptor mRNA expression in human tissues. FASEB J. 7:A141 (1993).
Claims (53)
1. A process for identifying a chemical compound which specifically binds to a human a, adrenergic receptor, the process comprising contacting cells that express on their surface the human al adrenergic receptor with a candidate compound under conditions suitable for binding of a known compound to the human a, adrenergic receptor, and detecting specific binding of the candidate compound to the human a adrenergic receptor, wherein such cells express the human ao adrenergic receptor by virtue of the introduction and expression of DNA encoding same.
2. A process for identifying a chemical compound which specifically binds to a human al adrenergic receptor, the process comprising contacting a membrane fraction from cells that express on their surface the human a, adrenergic receptor with a candidate compound under conditions suitable for binding of a known compound to the human ac adrenergic receptor, and detecting specific binding of the candidate compound to the human ac adrenergic receptor, wherein such cells express the human al adrenergic receptor by virtue of the introduction and expression of DNA encoding same.
3. A process for determining whether a chemical compound is a human a, adrenergic receptor agonist which comprises contacting cells transfected with and expressing DNA encoding the human ao adrenergic receptor with the compound under conditions permitting the activation of the human ao adrenergic receptor, and detecting an increase in a, adrenergic receptor activity, so as to thereby determine whether the compound is a human ai adrenergic receptor agonist. -93- 15 @0 20 S
4. A process for determining whether a chemical compound is a human a, adrenergic receptor agonist which comprises contacting a membrane fraction from cells transfected with and expressing DNA encoding the human al adrenergic receptor, with the compound under conditions permitting the activation of the al adrenergic receptor, and detecting an increase in human a, adrenergic receptor activity, so as to thereby determine whether the compound is a human ac adrenergic receptor agonist.
A process for determining whether a chemical compound is a human a, adrenergic receptor antagonist which comprises contacting cells transfected with and expressing DNA encoding the human a, adrenergic receptor with the compound in the presence of a known human ai adrenergic receptor agonist, under conditions permitting the activation of the human al adrenergic receptor, and detecting a decrease in a, adrenergic receptor activity, so as to thereby determine whether the compound is a human a, adrenergic receptor antagonist.
6. A process for determining whether a chemical compound is a human ai adrenergic receptor antagonist which comprises contacting a membrane fraction from cells transfected with and expressing DNA encoding the human a 1 adrenergic receptor, with the compound under conditions permitting the activation of the human a, adrenergic receptor, and detecting a decrease in al adrenergic receptor activity, so as to thereby determine whether the compound is a human a, adrenergic receptor antagonist.
7. The process of any one of claims 1, 2, 3, 4, 5, or 6, -93a- wherein the human a, adrenergic receptor is a human a,, adrenergic receptor, a human alh adrenergic receptor, or a human al, adrenergic receptor. -94-
8. The process of claim 7, wherein the cells are mammalian cells.
9. The process of claim 8, wherein the mammalian cells are nonneuronal in origin.
The process of claim 9, wherein the nonneuronal cells are COS-7 cells, 293 human embryonic kidney cells, CHO cells, NIH-3T3 cells or LM(tk-) cells.
11. The process of claim 3 or 5, wherein the human a, adrenergic receptor is a human Ula adrenergic receptor, a human alb adrenergic receptor, or a human aec adrenergic receptor.
12. The process of claim 11, wherein activation of the human ola adrenergic receptor, the human ilb adrenergic receptor, or the human ac adrenergic receptor is determined by a second messenger response.
13. The process of claim 12, wherein the second messenger is intracellular calcium or an inositol phospholipid.
14. A process involving competitive binding for identifying a chemical compound which specifically binds to a human a, adrenergic receptor which comprises contacting cells expressing on their cell surface the human ca adrenergic receptor, wherein such cells do not normally express the human a, adrenergic receptor, with both the chemical compound and a second chemical compound known to bind to the receptor, and separately with only the second chemical compound, under conditions suitable for binding of both compounds, and detecting specific binding of the chemical compound to the human al adrenergic receptor, a decrease in the a 25 a a a. a S30 a a a a a 9 S binding of the second chemical compound to the human a, adrenergic receptor in the presence of the chemical compound indicating that the chemical compound binds to the human ac adrenergic receptor.
A process involving competitive binding for identifying a chemical compound which specifically binds to a human a, adrenergic receptor which comprises contacting a membrane fraction from cells expressing on their cell surface the human a, adrenergic receptor, wherein such cells do not normally express the human a, adrenergic receptor, with both the chemical compound and a second chemical compound known to bind to the receptor, and separately with only the second chemical compound, under conditions suitable for binding of both compounds, and detecting specific binding of the chemical compound to the human ao adrenergic receptor, a decrease in the binding of the second chemical compound to the human ac adrenergic receptor in the presence of the chemical compound indicating that the chemical compound binds to the human ao adrenergic receptor.
16. The process of claim 14 or 15, wherein the human oa adrenergic receptor is a human ola adrenergic receptor, a human alb adrenergic receptor, or a human a 1 c adrenergic receptor.
17. A process for determining whether a chemical compound specifically binds to and activates a human a, adrenergic receptor, which comprises contacting cells producing a second messenger response and expressing on their cell surface the human a, adrenergic receptor, wherein such cells do not normally express the human, a, adrenergic receptor, with the chemical compound a S S. *a S S S S 25 -96- under conditions suitable for activation of the human a, adrenergic receptor, and measuring the second messenger response in the presence and in the absence of the chemical compound, a change in the second messenger response in the presence of the chemical compound indicating that the compound activates the human cx adrenergic receptor.
18. A process for determining whether a chemical compound specifically binds to and activates a human a, adrenergic receptor, which comprises contacting a membrane fraction from cells producing a second messenger response and expressing on their cell surface the human a, adrenergic receptor, wherein such cells do not normally express the human a~ adrenergic receptor, with the chemical compound under conditions suitable for activation of the human a, adrenergic receptor, and measuring the second messenger response in the presence and in the absence of the chemical compound, a change in the second messenger response in the presence of the chemical compound indicating that the compound activates the human al adrenergic receptor.
19. A process for determining whether a chemical compound specifically binds to and inhibits activation of a human al adrenergic receptor which comprises contacting cells producing a second messenger response and expressing on their cell surface the human a 1 adrenergic receptor, wherein such cells do not normally express the human ca adrenergic receptor, with both the chemical compound and a second chemical compound known to activate the human ac adrenergic receptor, and separately with only the second chemical compound, under conditions suitable for activation of 9999 9 99*c 9* 9 9 9 -97- o*a 2 a« ooo S a. a a a a. a a 25 the human a, adrenergic receptor, and measuring the second messenger response in the presence of only the second chemical compound and in the presence of both the second chemical compound and the chemical compound, a smaller change in the second messenger response in the presence of both the chemical compound and the second chemical compound than in the presence of only the second chemical compound indicating that the chemical compound inhibits activation of the human al adrenergic receptor.
A process for determining whether a chemical compound specifically binds to and inhibits activation of a human c adrenergic receptor which comprises contacting a membrane fraction from cells producing a second messenger response and expressing on their cell surface the human a, adrenergic receptor, wherein such cells do not normally express the human a, adrenergic receptor, with both the chemical compound and a second chemical compound known to activate the human ci adrenergic receptor, and separately with only the second chemical compound, under conditions suitable for activation of the human al adrenergic receptor, and measuring the second messenger response in the presence of only the second chemical compound and in the presence of both the second chemical compound and the chemical compound, a smaller change in the second messenger response in the presence of both the chemical compound and the second chemical compound than in the presence of only the second chemical compound indicating that the chemical compound inhibits activation of the human a, adrenergic receptor.
21. The process of claim 17 or 18, wherein the human ai *a a a a a a a o S a. a. a a -98- adrenergic receptor is a human ca adrenergic receptor, a human alb adrenergic receptor, or a human alc adrenergic receptor.
22. The process of claim 17, wherein the second messenger response comprises intracellular calcium levels and the change in second messenger response is an increase in intracellular calcium levels.
23. The process of claim 21, wherein the second messenger response comprises inositol phospholipid hydrolysis and the change in second messenger response is an increase in inositol phospholipid hydrolysis.
24. The process of claim 19 or 20, wherein the human a, adrenergic receptor is a human ala adrenergic receptor, a human a b adrenergic receptor, or a human a,, adrenergic receptor.
25. The process of claim 19, wherein the second messenger response comprises intracellular calcium levels, and the change in second messenger response is a smaller increase in the intracellular calcium levels in the presence of both the chemical compound and the second 25 chemical compound than in the presence of only the second chemical compound.
26. The process of claim 24, wherein the second messenger response comprises inositol phospholipid hydrolysis, and the change in second messenger response is a smaller increase in inositol phospholipid hydrolysis in the presence of both the chemical compound and the second chemical compound than in the presence of only the second chemical compound. 9* -99- 0.0 a *::25 .0 0
27. A method of screening a plurality of chemical compounds not known to bind to a human a, adrenergic receptor to identify a compound which specifically binds to the human al adrenergic receptor, which comprises contacting cells transfected with and expressing DNA encoding the human a, adrenergic receptor with a compound known to bind specifically to the human ac adrenergic receptor; contacting the preparation of step with the plurality of compounds not known to bind specifically to the human a, adrenergic receptor, under conditions permitting binding of compounds known to bind the human a, adrenergic receptor; determining whether the binding of the compound known to bind to the human al adrenergic receptor is reduced in the presence of the compounds, relative to the binding of the compound in the absence of the plurality of compounds; and if so separately determining the binding to the human a, adrenergic receptor of each compound included in the plurality of compounds, so as to thereby identify the compound which specifically binds to the human ac adrenergic receptor. *545 *4r S@r 05 055* 0 S 4 0 0 0 30
28. A method of screening a plurality of chemical compounds not known to bind to a human a( adrenergic receptor to identify a compound which specifically binds to the human a, adrenergic receptor, which comprises -100- *o* 25 660 r contacting a membrane fraction from cells transfected with and expressing DNA encoding the human a, adrenergic receptor, with a compound known to bind specifically to the human ca adrenergic receptor; contacting the preparation of step with the plurality of compounds not known to bind specifically to the human a, adrenergic receptor, under conditions permitting binding of compounds known to bind the human a, adrenergic receptor; determining whether the binding of the compound known to bind to the human ai adrenergic receptor is reduced in the presence of the compounds, relative to the binding of the compound in the absence of the plurality of compounds; and if so separately determining the binding to the human ai adrenergic receptor of each compound included in the plurality of compounds, so as to thereby identify the compound which specifically binds to the human al adrenergic receptor.
29. A method of screening a plurality of chemical compounds not known to activate a human a, adrenergic receptor to identify a compound which activates the human ca adrenergic receptor which comprises contacting cells transfected with and expressing the human al adrenergic receptor with the plurality of compounds not known to activate the human ca adrenergic receptor, under conditions permitting activation of the human a, adrenergic receptor; 8,. :0 so t to S 4 S S S ~F-L L- 'I i. -101- determining whether the activity of the human ac adrenergic receptor is increased in the presence of the compounds; and if so separately determining whether the activation of the human a, adrenergic receptor is increased by each compound included in the plurality of compounds, so as to thereby identify the compound which activates the human ao adrenergic receptor.
A method of screening a plurality of chemical compounds not known to activate a human a, adrenergic receptor to identify a compound which activates the human a, adrenergic receptor which comprises contacting a membrane fraction from cells transfected with and expressing DNA encoding the human a, adrenergic receptor with the plurality of compounds not known to activate the human a, adrenergic receptor, under conditions permitting activation of the human ac adrenergic receptor; determining whether the activity of the human ca adrenergic receptor is increased in the presence of the compounds; and if so separately determining whether the activation of the human al adrenergic receptor is increased by each compound included in the plurality of compounds, so as to thereby identify the compound which activates the human ac adrenergic receptor.
31. A method of screening a plurality of chemical compounds not known to inhibit the activation of a human a, adrenergic receptor to identify a compound 0 25 *s 0 0 *0 0. 0 0 0 -102- which inhibits the activation of the human a, adrenergic receptor, which comprises: contacting cells transfected with and expressing the human a, adrenergic receptor with the plurality of compounds in the presence of a known human al adrenergic receptor agonist, under conditions permitting activation of the human a, adrenergic receptor; determining whether the activation of the human a, adrenergic receptor is reduced in the presence of the plurality of compounds, relative to the activation of the human oa adrenergic receptor in the absence of the plurality of compounds; and if so separately determining the inhibition of activation of the human a, adrenergic receptor for each compound included in the plurality of compounds, so as to thereby identify the compound which inhibits the activation of the human a, adrenergic receptor.
32. A method of screening a plurality of chemical compounds not known to inhibit the activation of a human a, adrenergic receptor to identify a compound which inhibits the activation of the human al adrenergic receptor, which comprises: contacting a membrane fraction from cells transfected with and expressing DNA encoding the human a, adrenergic receptor with the plurality of compounds in the presence of a known human al adrenergic receptor. agonist, under conditions 9 *0 -103- permitting activation of the human ca adrenergic receptor; determining whether the activation of the human ao adrenergic receptor is reduced in the presence of the plurality of compounds, relative to the activation of the human ci adrenergic receptor in the absence of the plurality of compounds; and if so separately determining the inhibition of activation of the human ac adrenergic receptor for each compound included in the plurality of compounds, so as to thereby identify the compound which inhibits the activation of the human ac adrenergic receptor.
33. The method of claim 27 or 28, wherein the human a, adrenergic receptor is a human c1a adrenergic receptor, a human alb adrenergic receptor, or a human alc adrenergic receptor.
34. The method of claim 29, 30, 31 or 32, wherein the human a, adrenergic receptor is a human ala adrenergic receptor, a human aeb adrenergic receptor, or a human ac adrenergic receptor.
35. The method of claim 34, wherein activation of the human ala adrenergic receptor, the human aib adrenergic receptor, or the human adrenergic receptor is determined by a second messenger assay.
36. The method of claim 35, wherein the second messenger is an inositol phospholipid. 9a .9 9 25 99 *r 9 .9 9. 9* 9 9 -104-
37. The method of claim 33 or 34, wherein the cells are mammalian cells.
38. The method of claim 37, wherein the mammalian cells are non-neuronal in origin.
39. The method of claim 38, wherein the non-neuronal cells are COS-7 cells, 293 human embryonic kidney cells, CHO cells, LM(tk-) cells or NIH-3T3 cells.
A pharmaceutical composition comprising a compound identified by the method of claim 29 and a pharmaceutically acceptable carrier.
41. A pharmaceutical composition comprising a compound identified by the method of claim 31 and a pharmaceutically acceptable carrier. ta. S S 3
42. A method of preparing a pharmaceutical composition which comprises determining whether a compound is a human ai adrenergic receptor agonist or antagonist using the method of any of claims 3-10 and admixing said compound with a pharmaceutically acceptable carrier.
43. A method of determining whether a ligand not known to be capable of specifically binding to a human ac, adrenergic receptor subtype can specifically bind to a human ac adrenergic receptor subtype which comprises: separately contacting the ligand, under conditions permitting binding to the human alc adrenergic receptor subtype by a ligand known to bind thereto, with each of a plurality of mammalian cells, wherein each a a -105- 9***r 25 9 9. 30 9 U 9 9 mammalian cell comprises a plasmid adapted for expression in the cell, wherein the plasmid comprises DNA which expresses the human ola adrenergic receptor; a plurality of mammalian cells, wherein each mammalian cell comprises a plasmid adapted for expression in the cell, wherein the plasmid comprises DNA which expresses the human alb adrenergic receptor; and a plurality of mammalian cells, wherein each mammalian cell comprises a plasmid adapted for expression in the cell, wherein the plasmid comprises DNA which expresses the human alc adrenergic receptor; and determining whether the ligand specifically binds to only the human ac adrenergic receptor subtype, but not to the human ala or alb adrenergic receptor subtype, so as to determine that the ligand is capable of specifically binding to the human alc adrenergic receptor subtype.
44. A method of determining whether a ligand not known to be capable of specifically binding to the human xal adrenergic receptor subtype can specifically bind to the human alc adrenergic receptor subtype which comprises: separately preparing a membrane fraction from each of a plurality of mammalian cells, wherein each mammalian cell comprises a plasmid adapted for expression in the cell, wherein the plasmid comprises DNA which expresses the human 0la adrenergic receptor; a plurality of mammalian cells, wherein each mammalian cell comprises -106- 9 e **9 25 9 a plasmid adapted for expression in the cell, wherein the plasmid comprises DNA which expresses the human Ulb adrenergic receptor; and a plurality of mammalian cells, wherein each mammalian cell comprises a plasmid adapted for expression in the cell, wherein the plasmid comprises- DNA which expresses the human al adrenergic receptor; and separately incubating the ligand with each of the membrane fractions prepared in step under conditions permitting binding to a human ca adrenergic receptor subtype by a ligand known to bind thereto; and determining whether the ligand specifically binds to the membrane-bound human a1c adrenergic receptor subtype, but not to the membrane-bound human ala or aib adrenergic receptor subtype, so as to determine whether the ligand is capable of specifically binding to the human alc adrenergic receptor subtype.
A chemical compound which is capable of specifically binding and/or activating or inhibiting a human a, adrenergic receptor when identified to possess said property by the method according to any one of claims 1 to 44.
46. The chemical compound according to claim 45, wherein the human a, adrenergic receptor is a human ala adrenergic receptor, a human alb adrenergic receptor, or a human alc adrenergic receptor.
47. A pharmaceutical composition comprising the chemical 9 9 -107- compound according to claim 45 or 46 in combination with a pharmaceutica-lly acceptable carrier -and/or diluent.
48. An isolated membrane fraction derived from a mammalian cell which expresses a recombinant human ac adrenergic receptor on its cell surface.
49. The isolated membrane fraction according to claim 48, wherein the recombinant human a, adrenergic receptor is a recombinant human aGl adrenergic receptor, a recombinant human alb adrenergic receptor, or a recombinant human alc adrenergic receptor.
50. The isolated membrane fraction according to claim 48 or 49 wherein the cell is a nonneuronal cell.
51. The isolated membrane fraction according to any one of claims 48 to 50, wherein the cell is capable of producing a second messenger response.
52. The isolated membrane fraction according to claim 51, wherein the second messenger response comprises phospholipase C-dependent phosphatidylinositol lipid 25 metabolism. 9
53. The isolated membrane fraction according to claim 51, wherein the second messenger response comprises Sintracellular calcium levels. DATED this 29th day of March, 1999 Synaptic Pharmaceutical Corporation By DAVIES COLLISON CAVE SPatent Attorneys for the Applicants
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US95279892A | 1992-09-25 | 1992-09-25 | |
US952798 | 1992-09-25 | ||
AU51656/93A AU677968B2 (en) | 1992-09-25 | 1993-09-24 | DNA encoding human alpha 1 adrenergic receptors and uses thereof |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU51656/93A Division AU677968B2 (en) | 1992-09-25 | 1993-09-24 | DNA encoding human alpha 1 adrenergic receptors and uses thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
AU3420797A AU3420797A (en) | 1998-01-29 |
AU718197B2 true AU718197B2 (en) | 2000-04-06 |
Family
ID=25629300
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU34207/97A Expired AU718197B2 (en) | 1992-09-25 | 1997-08-15 | DNA encoding human alpha 1 adrenergic receptors and methods therefor |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU718197B2 (en) |
-
1997
- 1997-08-15 AU AU34207/97A patent/AU718197B2/en not_active Expired
Also Published As
Publication number | Publication date |
---|---|
AU3420797A (en) | 1998-01-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5861309A (en) | DNA endoding human alpha 1 adrenergic receptors | |
WO1994008040A1 (en) | Dna encoding human alpha 1 adrenergic receptors and uses thereof | |
AU685076B2 (en) | DNA encoding 5-HT4 serotonin receptors and uses thereof | |
US5652113A (en) | DNA encoding a human 5-HT 1F receptor and uses thereof | |
US7371535B2 (en) | Processes for determining compounds that interact with snorf33 receptor | |
CA2101162A1 (en) | Dna encoding a human 5-ht1e receptor and uses thereof | |
EP0624100B1 (en) | Dna encoding a human serotonin receptor (5-ht 4b) and uses thereof | |
AU718197B2 (en) | DNA encoding human alpha 1 adrenergic receptors and methods therefor | |
US6300087B1 (en) | DNA encoding a human serotonin receptor (5-HT4B) and uses thereof | |
US20030166066A1 (en) | DNA encoding a human serotonin receptor (5-HT4B) and uses thereof | |
US20020081661A1 (en) | DNA encoding 5-HT4 serotonin receptors and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FGA | Letters patent sealed or granted (standard patent) | ||
PC | Assignment registered |
Owner name: H. LUNDBECK A/S Free format text: FORMER OWNER WAS: SYNAPTIC PHARMACEUTICAL CORPORATION |