AU6928200A - A transmembrane trap for isolating membrane bound proteins - Google Patents

Description

WO 01/14542 PCTIUSOO/23112 -1 A TRANSMEMBRANE TRAP FOR ISOLATING MEMBRANE BOUND PROTEINS RELATED APPLICATION This application claims the benefit of U.S. Provisional Application Serial 5 Number 60/150,747, filed August 25, 1999, the entire teachings of which are incorporated herein by reference. BACKGROUND OF THE INVENTION The ability of cells to respond to extracellular signaling molecules by altering physiological pathways is critical to the survival of a cell and homeostasis 10 of an organism. Many of the molecules which transduce extracellular signals into intracellular responses are located in the plasma membrane of cells. The plasma membrane is hydrophobic and generally impermeable to extracellular ions, small organic molecules and polypeptides, such as hormones, neurotransmitters and cytokines. To enter or influence a cell an extracellular 15 signaling molecule, such as an ion, small organic molecule or polypeptide, can interact with a membrane-spanning protein, such as a G-protein coupled receptor or ion-channel. Membrane-spanning proteins are characterized by transmembrane domains which share some common structural features including stretches of hydrophobic amino acids. 20 The identification of membrane-spanning proteins can be important in providing a means to alter the interaction between an extracellular signaling molecule and a cellular response. Thus, due to their potential importance in cellular processes, there is a need to identify membrane-spanning proteins to elucidate a clearer understanding of their role in cell signaling and biological processes, and to 25 design effective means to facilitate or perturb signaling transduction pathways resulting from the interaction of a target molecule, such as an extracellular ion, hormone, or cytokine, and a membrane-spanning protein.

WO 01/14542 PCT/USOO/23112 -2 SUMMARY OF THE INVENTION The invention relates to a method of identifying a transmembrane domain of a membrane-spanning protein. The method comprises the steps of modifying a nucleic acid encoding a death domain-lacking membrane-spanning protein, wherein 5 the modification comprises replacing the nucleic acid encoding the transmembrane domain of the death domain-lacking membrane-spanning protein with a candidate nucleic acid sequence, thereby producing a modified nucleic acid encoding a modified death domain-lacking membrane-spanning protein; transfecting the modified nucleic acid into a host cell, wherein the host cell expresses a death 10 domain-containing receptor; maintaining the host cell under conditions suitable to express the modified nucleic acid; exposing the host cell to an apoptosis-inducing ligand; and determining the presence or absence of apoptosis. The absence of apoptosis indicates that the candidate nucleic acid sequence encodes a transmembrane domain of a membrane-spanning protein. The modified nucleic acid 15 encoding the modified death domain-lacking membrane-spanning protein can further include a nucleic acid sequence encoding a epitope tag. In a preferred embodiment the epitope tag is a FLAG-epitope tag. In a more preferred embodiment, the FLAG-epitope tag is DYKDDDDK (SEQ ID NO: 1). In one embodiment, the methods of the invention identify a transmembrane 20 domain of a membrane-spanning protein with an odd number of transmembrane domains. In another embodiment, the methods of the invention identify a transmembrane domain of a membrane-spanning protein with an even number of transmembrane domains. In a particular embodiment, the death domain-lacking membrane-spanning 25 protein is selected from the group consisting of TRID, TRUNDD and GITR; and the death domain-containing receptor expressed by the host cell is selected from the group consisting of DR1, DR2, DR3, DR4, DR5, DR6, TNFR-1, FAS and TNFR-2. In a particular embodiment, the apoptosis-inducing ligand is selected from the group consisting of TRAIL, TNF, FasL, TRADD, FADD and RIP. 30 The transmembrane domain identified by the method of the invention is a transmembrane domain of a membrane-spanning protein selected from the group WO 01/14542 PCT/USOO/23112 -3 consisting of a Group I transmembrane protein, Group II transmembrane protein, and a transmembrane protein with multiple membrane-spanning regions. In a preferred embodiment, the transmembrane domain identified is a transmembrane domain of a protein selected from the group consisting of a tyrosine kinase receptor, 5 G-protein coupled receptor, ion channel protein, integrin receptor and disintegrin receptor. The invention also relates to the novel membrane-spanning proteins with the transmembrane domains identified by the methods described herein. The invention further relates to a target molecule for the membrane-spanning 10 proteins and a composition comprising the target molecules and a pharmaceutically acceptable carrier. The invention also encompasses a method for preventing, treating or ameliorating a medical condition which comprises administering to a mammal a therapeutically effective amount of a composition comprising the membrane 15 spanning protein. In a particular embodiment, the invention pertains to a method of identifying a transmembrane domain of a membrane-spanning protein comprising the steps of modifying a nucleic acid sequence encoding a TRID protein or a TRID-like protein, wherein the modification comprises replacing the nucleic acid encoding the 20 transmembrane domain of the TRID protein or the TRID-like protein with a candidate nucleic acid sequence, thereby producing a modified nucleic acid encoding a modified TRID protein or the TRID-like protein; transfecting the modified nucleic acid encoding the modified TRID protein or the TRID-like protein into a host cell, wherein the host cell expresses a death domain-containing receptor; 25 maintaining the host cell under conditions suitable to express the modified nucleic acid encoding the modified TRID protein or the TRID-like protein; exposing the host cell to a TRAIL protein or a TRAIL-like protein; and determining the presence or absence of apoptosis. The absence of apoptosis in host cells indicates that the candidate nucleic acid sequence encodes a transmembrane domain of a membrane 30 spanning protein. The methods of the invention also encompass vectors comprising a nucleic acid sequence encoding a death domain-lacking membrane-spanning protein which WO 01/14542 PCT/USOO/23112 -4 has its transmembrane domain replaced with a cloning site. In a particular embodiment, a candidate nucleic acid sequence is inserted in the cloning site. The invention further relates to host cells containing the modified death domain- lacking membrane-spanning proteins used in the methods described herein. 5 The invention also relates to a method of identifying a substance which alters the interaction between a membrane-spanning protein identified by the methods described herein and a target molecule for the membrane-spanning protein, comprising the steps of expressing the membrane-spanning protein in a host cell; providing the host cell with the target molecule under conditions suitable to for a 10 combination between the target molecule and the membrane-spanning protein; exposing the combination to a test substance; determining the amount of interaction in the combination; and comparing the amount of interaction in the presence of the test substance with the amount of interaction in the absence of the test substance. A difference in the interaction indicates that the test substance alters the interaction 15 between the target molecule and membrane-spanning protein. In one embodiment, the test substance is an agonist. In another embodiment, the test substance is an antagonist. The invention described herein provides convenient methods for identifying the transmembrane domain of membrane-spanning proteins. The claimed invention 20 permits the detection of candidate nucleic acid sequences encoding transmembrane domains of membrane-spanning proteins by monitoring the presence or absence of apoptosis in a host cell. The claimed methods provide an efficient way to dissect and alter cellular signaling pathways to further understand cellular processes and the basis for disease, for example, in neoplasms, cardiovascular disease and 25 inflammatory disease. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is the nucleic acid (SEQ ID NO: 2) and amino acid (SEQ ID NO: 3) sequence of a FLAG-TRID clone containing its transmembrane domain. Figure 2 is the nucleic acid (SEQ ID NO: 4) and amino acid (SEQ ID NO: 5) 30 sequence of a FLAG-TRID clone with a deleted transmembrane domain. Figure 3 is a representation of the pIG-12 vector.

WO 01/14542 PCTUSOO/23112 -5 DETAILED DESCRIPTION OF THE INVENTION The present invention relates to the discovery that the transmembrane domain of a membrane-spanning protein can be identified by transfecting a host cell and expressing a death domain-containing receptor, with a modified death domain 5 lacking membrane-spanning protein. A death domain-lacking membrane-spanning protein is modified to replace its transmembrane domain with a cloning site for insertion of a candidate nucleic acid sequence. The absence of apoptosis of the host cell is determined following exposure of the transfected cell to an apoptosis inducing ligand. Candidate nucleic acid sequences encoding transmembrane 10 domains prevent apoptosis of the host cell. The nucleic acid sequence encoding the transmembrane domain is characterized by, for example, direct sequencing of the nucleic acid sequence using specific primers flanking the site of the insert in the vector. Alternatively, or additionally, the nucleic acid sequence encoding the transmembrane domain can be removed by restriction enzyme digestion from the 15 cloning site of the modified death domain-lacking membrane-spanning protein for analysis (e.g., nucleic acid sequencing). The term "membrane-spanning" as used herein refers to a protein (also referred to herein as a polypeptide) which associates with the plasma membrane of a cell and extends from the intracellular or cytoplasmic domain to the extracellular or 20 outer domain of the cell. Additionally, or alternatively, "membrane-spanning" refers to a protein which associates with the nuclear membrane of a cell and extends from the cytoplasmic domain to the nuclear matrix domain of a cell. The term "integral membrane protein" is used interchangeably with membrane-spanning protein. "Transmembrane domain", as the term is used herein, includes any part of 25 the membrane-spanning protein which resides, is located, or positioned in the plasma or nuclear membrane of a cell or a plasma or nuclear membrane preparation. The transmembrane domain of proteins identified by the invention share common structural features, for example, an o-helical stretch of 21-26 hydrophobic amino acids, such as isoleucine, valine, phenylalanine, tryptophan, methionine. 30 The transmembrane domains identified by the methods of the invention can be the transmembrane domains of membrane-spanning proteins of Group I transmembrane proteins, Group II transmembrane proteins and proteins with WO 01/14542 PCT/USOO/23112 -6 multiple transmembrane domains. Multiple refers to at least two or more transmembrane domains. In one embodiment, the membrane-spanning proteins have an odd number of transmembrane domains (e.g., one, three, five). In another embodiment, the membrane-spanning proteins have an even number of 5 transmembrane domains (e.g., two, four, six). Membrane-spanning proteins identified by methods of the present invention include novel tyrosine kinase receptors, G-protein coupled receptors, ion channels (e.g., gap junction, ligand gated, voltage-gated and second messenger-gated ion channels), integrin receptors and disintegrin receptors. 10 The methods of the invention employ cellular plasma membrane receptors which do and do not induce apoptosis following exposure to an apoptosis-inducing ligand. Receptors which result in apoptosis following interaction with a suitable apoptosis-inducing ligand (e.g., TRAIL, TNF, FasL, TRADD, FADD, RIP) contain "death domains", and are also referred to herein as "death domain-containing" 15 receptors. Receptors of the invention which do not induce apoptosis, following exposure to an apoptosis-inducing ligand do not contain "death domains", are also referred to herein as "death domain-lacking" receptors (e.g., TRID, GITR). The term "death domain" refers to a region of a membrane-spanning protein receptor near the C(carboxy)-terminus or cytoplasmic domain of the receptor which, 20 when activated by an apoptosis-inducing ligand, can cause apoptosis by accessing enzymes associated with apoptosis (e.g., caspase). (Ashkenazi, A. et al., Science 281:1305-1308 (1998)). Death domain-containing receptors belong to the TNF (Tumor Necrosis Factor) receptor gene superfamily and can be characterized by conserved, cysteine-rich extracellular domains. (Smith, C.A. et al., Blood 85:3378 25 (1995)). Examples of death domain-containing receptors are Death Receptor 2 (DR2); DR3 (also referred to as Apo3, WSL-1, TRAMP or LARD); DR4; DR5 (also referred to as Apo2, TR7, TRAIL-R2, TRICK 2 or KILLER); DR6; TNFR-1 (Tumor Necrosis Factor Receptor-1); TNRF-2 (Tumor Necrosis Factor Receptor-2) and FAS (also referred to as Apo-1 or CD95). (Ashkenazi, A. et al., Science 30 281:1305-1308 (1998); Tschopp, J., WO 99/12963 (1999); Alnemri, E.S., WO 99/09165 (1999); Pan, G., et al., FEBS Letters 431:351-356 (1998); Chinnaiyan, A.M., et al. Science 274:990 (1996); Pan, G., et al., Science 276:111 (1997)). The WO 01/14542 PCT/US00/23112 -7 nucleic acid and amino acid sequence of many death domain-containing receptors are known. (See, for example, Alnemri, E. WO 99/09165 (1999); Tschopp, J. WO 99/12963 (1999); Ni, J. et al., WO 98/41629 (1998); Gentz, R.L., et al., WO 98/32856 (1998); Yu, G-L. et al., WO 97/33904 (1997); Rauch, C., et al. WO 5 98/35986 (1998), the teachings of all of which are incorporated herein in their entirety). The methods of the invention also employ membrane-spanning plasma membrane receptors which lack death domains, referred to herein as "death domain lacking receptors." Unlike their death domain-containing counterpart receptors the 10 death domain-lacking receptors do not result in programmed cell death (apoptosis) when exposed to an apoptosis-inducing ligand (e.g., TRAIL) because the death domain-lacking receptors do not contain death domains in their cytoplasmic or C tenninus. Examples of death domain-lacking receptors include TRID (Trail Receptor without Intracellular Domain, also referred to as DcRl/TRAIL-R3/LIT, 15 TR5); TRUNDD (Irail Receptor with a trUNcated Death Domain); TR10; and GITR (Glucocorticoid Induced TNFR-family Related protein). Death domain lacking membrane-spanning protein receptors are decoy receptors which interact with apoptosis-inducing ligands to antagonize the apoptosis inducing effect. (Pan, G., et al., Science 277:815-818 (1997); Wei, Y-F, et al., W098/30693 (1998); Pan, 20 G., et al., FEBS Letters 424:41-45 (1998), the teachings of all of which are incorporated herein in their entirety). The nucleic acid and amino acid sequences of several death domain-lacking membrane-spanning proteins are known. (See, for example, Riccardi, C., W098/24895 (1998); Wei, Y-F., et al., W098/30693 (1998); Pan, G., et al., FEBS Letter, 424:41 (1998), the teachings of all of which are 25 incorporated herein in their entirety). Death domain-lacking receptors are detectable in normal cells, tissues and organs, but not in many tumor or cancer cells. The term "normal" as used herein refers to a cell, tissue or organ which is not a cancerous or tumor cell, or does not contain a cancerous or tumor cell. A normal cell is also referred to as a healthy cell. 30 "Tumor" or "cancerous" cell refers to a collection of cells or a cell, respectively, indicating a neoplasm. A "neoplasm" is an abnormal tissue or cell that grows uncontrollably by cellular proliferation, usually forming a distinct mass of tissue WO 01/14542 PCT/USOO/23112 -8 which can be either benign or malignant. Thus, the transmembrane domains identified by methods of the invention can be important in identifying membrane spanning proteins involved in normal cell growth which can, in turn, be important for regulating and understanding nonral cell growth and uncontrollable cellular 5 proliferation in neoplasms. The methods of the invention identify nucleic acid sequences encoding transmembrane domains by their ability to prevent a host cell from undergoing apoptosis following exposure to an apoptosis-inducing ligand. "Apoptosis" is a process of programmed cell death. Apoptosis provides a critical control over 10 cellular processes. Cells can be programmed to die for many reasons. Programmed cell death occurs during normal developmental processes, for example, in the formation of organs and separation of digits in the hands and feet. Programmed cell death can also occur to eliminate structures that once served a function, but no longer are 15 needed, such as the tail of a tadpole after the tadpole undergoes metamorphosis to a frog. Apoptosis can occur when a cell is exposed to stress, such as UV light, radiation or toxic drugs. (Raff, Nature 396:119-122 (1998)). A cell can be triggered to undergo apoptosis, for example, by activating death domain-containing receptors (e.g., DR 3, DR4, DR5), withdrawing cytokines, 20 treating with glucocorticoids and y-irradiation. Apoptosis is characterization by distinct cytological features such as chromatin condensation, DNA fi-agmentation, heteropycnotic nuclei and blebbing at the nuclear and cytoplasmic membrane. (Lewin, B. "Genes VI", Chapter 36, pages 1089-1129 Oxford University Press, New York (1997)). Cellular changes indicative of apoptosis can be observed 25 visually by microscopic examination of cells or by the presence of fragmentation patterns (DNA ladders) in gels using established methods well known to one of skill in the art. Thus, the methods of the invention readily permit the identification of transmembrane domains by visual or biochemical inspection of host cells transfected with candidate nucleic acid sequences. 30 An "apoptosis-inducing ligand" is any molecule (e.g., polypeptide, peptide, lipid, carbohydrate, ion, small organic molecule) that triggers, activates or otherwise directs or results in a cell dying by undergoing apoptosis. The apoptosis-inducing WO 01/14542 PCT/USOO/23112 -9 ligand can bind to a membrane-spanning protein receptor, preferably with high affinity (e.g., an equilibrium constant of 10-6 or lower). Examples of apoptosis inducing ligands are TRAIL (INF-Related Apoptosis-Inducing Ligand); TNF; FasL (Fas-Ligand); TRADD (INF Receptor-1 Associated Death Domain); FADD (Eas 5 Association protein with a novel Death Domain); or RIP (Receptor Interacting Protein). The nucleic acid and amino acid sequence several apoptosis-inducing ligands are known. (See, for example, Goeddel, D. V., et al., U.S. Patent No. 5,563,039 (1996); Dixit, V.M., et al., WO 96/31603 (1996); Wiley, S.R., et al., W097/01633 (1997); Baichwal, V. R., et al., WO 97/15586 (1997),Wiley, S.R., et 10 al., U.S. Patent No. 5,763,223 (1998), the teachings of all of which are incorporated herein in their entirety.) The methods of the invention relate to the construction and use of nucleic acid constructs encoding death domain-lacking membrane-spanning proteins which have their transmembrane domains replaced with a cloning site, referred to herein as 15 "modified death domain-lacking membrane-spanning" protein receptors. "Modification" as used herein refers to a death domain-lacking membrane-spanning protein with a deletion of a portion or the entire transmembrane domain of the death lacking protein. A "portion" is meant to refer to at least one amino acid in the protein or at least one nucleotide encoding the protein. 20 The nucleic acid constructs encoding the modified death domain-lacking membrane-spanning can be further modified to include a nucleic acid sequence encoding an epitope tag 5' to the transmembrane domain. A "epitope tag" refers to a sequence of amino acids (e.g., about 5-15) and/or a nucleotide sequence encoding a sequence of amino acids which is used to identify a recombinant protein for 25 purification and characterization. Preferably, the epitope tag is small in size, does not affect the structure or biological activity (e.g., ligand binding) of the recombinant protein, is cleavable by enzymatic digestion (e.g., enterokinase), and permits purification of the recombinant protein on an appropriate matrix which interacts (e.g., binds) with the epitope tag. "Biological activity" is defined herein as 30 an activity characteristic of a naturally occurring protein or protein without an epitope tag. For example, a FLAG-TRID protein would prevent apoptosis in a manner similar to a TRID protein without a FLAG-epitope and, thus, the FLAG- WO 01/14542 PCTUSOO/23112 -10 epitope would not alter the biological activity of TRID. In a preferred embodiment, the epitope tag is a FLAG-epitope tag (See Hopp, T.P., et al., U.S. Patent No. 4,782,137 (1988) and U.S. Patent No. 4,703,004 (1987); Hopp, T.P., et al., Bio/Technology 6:1204 (1988), the teachings of both of which are incorporated 5 herein in their entirety) and/or a HA (influenza hemagglutinin) -epitope tag (e.g.,YPYDVPDYA, SEQ ID NO: 6, See Field, J., et al., Mol. Cell. Biol., 8:2159 2165 (1988); Bosshart, H., et al., J. Cell. Biol., 126: 1157-1172 (1994)). In a particular embodiment, the FLAG-epitope encodes an amino acid sequence comprising DYKDDDDK (SEQ ID NO: 1). The FLAG-epitope is a useful 10 marker to purify proteins encoded by the modified death domain-lacking membrane spanning protein. The use of a FLAG-epitope (e.g., DYKDDDDK (SEQ ID NO: 1) to identify a recombinant protein and for subsequent purification of the protein has been previously described. (See Hopp, T.P., et al., U.S. Patent No. 4,782,137 (1988) and U.S. Patent No. 4,703,004 (1987); Hopp, T.P., et al., Bio/Technology 15 6:1204 (1988), the teachings of both of which are incorporated herein in their entirety). Methods to delete regions of nucleotides in nucleic acid constructs are well known and routine. Exemplary techniques can be found, for example, in Ausubel, et al. "Current Methods in Molecular Biology" J. Wiley & Sons (1999). Likewise, 20 protocols for the selection and insertion of suitable cloning sites (e.g., BglII, HpaI, MfeI, NarI) into the deleted transmembrane domain and appropriate vectors (e.g., pIG-12) are well-known methods to one of skill in the art. In a particular embodiment of the invention, the death domain-lacking plasma membrane receptor is a TRID protein. The TRID protein is modified to 25 replace its transmembrane domain with a cloning site, thereby producing a "modified TRID protein". The nucleotide and amino acid sequence of TRID, including the transmembrane domain, are known. (See, for example, Wei, Y-F. et al., WO 98/30693 (1998), the teachings of which are incorporated herein by reference). The terms "TNFR-5" and "TR5" are used interchangeably with the term 30 "TRID." (Wei, Y-F et al., WO 98/30693 (1998), the teachings of which are incorporated herein in its entirety).

WO 01/14542 PCT/USOO/23112 -11 A candidate nucleic acid is inserted into the cloning site of the modified death domain-lacking membrane-spanning protein (e.g., TRID). A "candidate nucleic acid" sequence is a sequence of contiguous nucleic acids (also referred to herein as nucleotides) which can encode a transmembrane domain or any portion 5 (e.g., at least one amino acid less than the entire transmembrane domain) of a membrane-spanning protein. The nucleic acid sequence can be, for example, genomic DNA or cDNA. Host cells are transfected with a nucleic acid sequence encoding the modified death domain-lacking membrane-spanning protein (e.g., modified TRID protein) 10 whose transmembrane domain has been replaced with a candidate nucleic acid sequence. Methods to transfect host cells, and insert a nucleic acid sequence into the cloning sites created in the modified death domain-lacking membrane-spanning protein are routine and art recognized. (See, for example, Ausubel et al. "Current Protocols in Molecular Biology", John Wiley & Sons (1998), the teachings of which 15 are incorporated herein in its entirety). The host cell can be a eukaryotic or prokaryotic cell and includes, for example, yeast (such as Pichia pastorius or Saccharomyces cerevisa), bacteria (such as Escherichia or Bacillus) expression systems; animal cells or tissue, including insect (such as baculoviruses)or mammalian cells (such as somatic or embryonic cells, MCF7, Chinese hamster 20 ovary cells, HeLa cells, human 293 cells, monkey COS-7 cells, K562 cells). The selection and growth requirements of a suitable host cell is within the skill of an artisan practicing the invention. Host cells are grown under conditions suitable for expressing the modified death domain-lacking membrane-spanning protein (e.g., modified TRID protein) and 25 exposed to one or more apoptosis-inducing ligands, such as TRAIL. When a candidate nucleic acid sequence encodes a transmembrane domain of a membrane spanning protein, which is expressed and localized (e.g. properly folded) in the plasma membrane, the host cell does not undergo apoptosis. Likewise, when a candidate nucleic acid sequence does not encode a transmembrane domain the host 30 cell undergoes apoptosis. Apoptosis can be determined by visual inspection of cells (e.g., light microscopic examination) or by gel electrophoresis to observe DNA ladders indicative of DNA and chromatin fragmentation.

WO 01/14542 PCT/US00/23112 -12 The nucleic acid sequence encoding a modified death domain-lacking membrane-spanning protein, which contains a candidate nucleic acid sequence encoding a transmembrane domain, can be excised using suitable restriction enzymes (e.g., HindIII, EcoRI), depending upon the restriction sites of the vector 5 used (e.g., pIG-12, Figure 3). The candidate nucleic sequence can also be excised by restriction digestion with enzymes (e.g., BglII, HpaI, MfeI, NarI) appropriate for the cloning site in the modified death domain-lacking membrane-spanning protein. Alternatively, or additionally, when the modified death domain-lacking membrane spanning protein is 10 constructed with an epitope tag, such as a FLAG-epitope tag (e.g., DYKDDDDK, SEQ ID NO: 1) or a HA-epitope tag (e.g., YPYDVPDYA, SEQ ID NO: 6)the recombinant protein can be purified by affinity chromatography using an immobilized ligand specific to the antigenic portion of the epitope tag. For example, protocols to purify FLAG-epitope containing recombinant proteins are established. 15 (See, for example, Hopp, T.P. et al., U.S. Patent Nos. 4,703,004 (1987) and 4,782,137 (1988), Hopp, T.P., et al., Bio/Technology 6:1204 (1988), the teachings of both of which are incorporated herein in their entirety). In a preferred embodiment, a XhoI-EcoRI fragment containing TRID is PCR amplified from human bone marrow cDNA and cloned into XhoI-EcoRI sites of 20 pIG-12. A FLAG-TRID clone (Figure 1) is constructed with a FLAG epitope (DYKDDDDK, SEQ ID NO: 1) after the third amino acid of the mature TRID peptide by PCR amplifying the clone in two halves. The first half of the FLAG TRID clone is cloned into pIG-12 on a Xhol-HindIII fragment with the FLAG epitope and a HindIll site inserted, by PCR amplification, 3' to the nucleic acid 25 sequence encoding the third amino acid of the mature peptide to generate the pSAD95-3 clone. The second half of the FLAG-TRID clone is cloned into pIG-12 on a HindIII-EcoRI fragment by inserting the HindIII site, by PCR amplification, 5' to the nucleic acid sequence encoding the fourth amino acid of the mature peptide to generate the pSAD97-1 clone (0.6 kb in length). The HindIII-EcoRl fragments 30 from the pSAD 97-1 clone is ligated to the HindIII-EcoRl site of pSAD to generate the FLAG-TRID pSAD100-1 clone (Figure 2). Four FLAG-TRID clones lacking the transmembrane domain of TRID (pSAD102-1, pSAD104-1 and pSAD105-1) are WO 01/14542 PCT/USOO/23112 -13 constructed from the FLAG-TRID clone (pSAD100-1) by PCR amplifying a unique restriction site (e..g, Bg[II, HpaI, MfeI, NarI) in place of the transmembrane domain as described in the Exemplification. In a particular embodiment, TRAIL is used to induce apoptosis of cells 5 expressing a death domain-lacking protein modified to replace its transmembrane domain with a cloning site. The term Apo-2L (Apo-2 Ligand) is used interchangeably with the term TRAIL. It is understood that the methods of the invention can utilize any modified death domain-lacking membrane-spanning protein, any death domain-containing 10 membrane-spanning protein and any apoptosis-inducing ligand. Examples of suitable proteins for use in the invention described herein are listed in Table 1. TABLE 1. Death domain-lacking receptors, counterpart death domain containing receptors and apoptosis-inducing ligands. Apoptosis- Death-Domain Death-Domain 15 Inducing Containing Lacking Ligand Receptor Receptor TRAIL DR2, DR4, DR5 TRID Fas L Fas TRADD FADD FIN- 1 FLICE TRUDD The invention also relates to the use of TRID-like and TRAIL-like proteins 20 in the methods. A "TRID-like" or "TRAIL-like" protein is a protein which shares a functional, physical or structural similarity with the TRID or TRAIL proteins described herein. (See, for example, Pitti, R.M. et al., J. Biol. Chem. 271:12687 WO 01/14542 PCT/USOO/23112 -14 (1996); Wiley, S.R., et al., WO 97/01633 (1997); Wei, Y-F et al., WO 98/30693 (1998); Wiley, S.R. et al., U.S. Patent No. 5,763,223 (1998); Degli-Esposti, M., WO 99/03992 (1999), the teachings of all of which are incorporated herein in their entirety). 5 Functional identity of a "TRID-like" protein can be determined by assessing the ability of the "TRID-like" protein to divert a counterpart death domain containing membrane-spanning protein (e.g., DR2, DR4, DR5) from interacting with an apoptosis-inducing ligand (e.g., TRAIL). Such a diversion prevents the cell from undergoing apoptosis. An example of a TRID-like protein can be TRIO. (Ni, J. et 10 al., WO 98/54202 (1998), the teachings of which are incorporated herein by reference in their entirety). Similarly, functional identity of a TRAIL-like protein can be assessed by determining the ability to induce apoptosis in a cell expressing a death domain-containing receptor. Methods to induce and assess the presence or absence of apoptosis in cells bearing TRID-like or TRAIL-like membrane-spanning 15 proteins are well-known. (Raff, Nature 396:119-122 (1998); Wrighton, N.C., et al., Science, 273:458-463 (1996); Lowman, H.B., Ann. Rev. Biophys. Biom7ol. Struct., 26:401-424 (1997)). Sequence and structural identity of TRID-like and TRAIL-like proteins can be determined using database search strategies well known in the art including, for 20 example, Basic Local Alignment Search Tool (BLAST) (Altschul, S.F., et al., J Mol. Biol. 215:403-410 (1990)) and FASTA (Pearson, W.R., et al., Proc. Natl. A cad. Sci. U.S.A. 85:2444-2448 (1988)) algorithms, the teachings of both of which are incorporated herein in their entirety. In one embodiment, the BLAST parameters are set such that they yield a sequence having at least about 60% sequence identity 25 with the corresponding known TRID or TRAIL sequence, preferably, at least about 70% sequence. In another embodiment, the percent sequence identity is at least about 85%, and in yet another embodiment, at least about 95%. The nucleic acid and amino acid sequence of TRID and TRAIL are known and readily available in public databases. 30 (See, for example, Wei, Y-F et al., WO 98/30693 (1998); Rauch, C. etal., WO 98/35986 (1998); Pitti, R.M. et al., J. Biol. Chem. 271:12687 (1996); Wiley, S.R., WO 01/14542 PCT/USOO/23112 -15 et al., WO 97/01633 (1997); Wiley, S.R. et al., U.S. Patent No. 5,763,223 (1998); Degli-Esposti, M., WO 99/03992 (1999), the teachings of all of which are incorporated herein in their entirety). It is also envisioned that nucleic acid sequences which hybridize (e.g., under 5 high or moderate stringency conditions) to TRID or TRIAL share structural similarity and are within the scope of the methods of the invention. "Stringency conditions" for hybridization is a term of art which refers to the conditions of temperature and buffer concentration which permit hybridization of a particular nucleic acid to a second nucleic acid in which the first nucleic acid may be perfectly 10 complementary to the second, or the first and second may share some degree of complementarity which is less than perfect. "High stringency conditions" and "moderate stringency conditions" for nucleic acid hybridizations are explained on pages 2. 10. 1-2. 10. 16 in Current Protocols in Molecular Biology (Ausubel, F. M. et al., eds., John Wiley & Sons, (1999), the teachings of which are incorporated 15 herein in their entirety). The exact conditions which determine the stringency of hybridization depend, for example, on ionic strength, temperature and the concentration of destabilizing agents such as formamide , the length of the nucleic acid sequence and base composition. Thus, high or moderate stringency conditions can be determined empirically. 20 By varying hybridization conditions from a level of stringency at which no hybridization occurs to a level at which hybridization is first observed, conditions which will allow a given sequence to hybridize (e.g., selectively) with the most similar sequences in the sample can be determined. Washing is the step in which conditions are usually set so as to determine a minimum level of complementarity of 25 the hybrids. Generally, starting from the lowest temperature at which only homologous hybridization occurs, each 'C by which the final wash temperature is reduced (holding sodium chloride/sodium citrate (SSC) concentration constant) allows an increase by 1% in the maximum extent of mismatching among the sequences that hybridize. Generally, doubling the concentration of SSC results in an 30 increase in TM of ~17 0 C. Using these guidelines, the washing temperature can be determined empirically for high, moderate or low stringency, depending on the level WO 01/14542 PCT/USOO/23112 -16 of mismatch sought. (Ausubel, et al., "Current Protocols in Molecular Biology", John Wiley & Sons, (1999)). Thus, molecules which share functional, structural, or sequence identity with the TRID or TRAIL proteins described herein, are referred to as "TRID-like" or 5 "TRAIL-like" proteins. Accordingly, it is also envisioned that any TRID protein or TRAIL protein functionally equivalent to the molecules described herein is within the scope of the invention. It is also envisioned that fragments of the TRID, TRID-like, TRAIL and TRAIL-like proteins can be used in the methods of the invention. "Fragments" of 10 TRID or TRID-like proteins, as used herein, refer to any part of the TRID or TRID like proteins capable of diverting or antagonizing an apoptosis-inducing ligand from binding or otherwise interacting with a death domain-containing receptor to induce apoptosis of a cell. "Fragments" of TRAIL or TRAIL-like proteins, as used herein, refers to any part of the TRAIL or TRAIL-like proteins capable of inducing or 15 leading to apoptosis in a cell with a death domain-containing receptor. The invention also relates to the transmembrane domains identified by the methods described herein and the membrane-spanning proteins comprising the identified transmembrane domains. The transmembrane domains and membrane spanning proteins identified refer to novel transmembrane and membrane-spanning 20 proteins. The invention further relates to target molecules for the membrane-spanning proteins identified by the methods of the invention. The term "target molecule" refers to any molecule (e.g., polypeptide, carbohydrate, lipid, ion, inorganic molecule, small organic molecule) which interacts (e.g., binds to form a 25 combination) with the membrane-spanning protein to affect a response (e.g., alter the function or conformation of the membrane-spanning protein; trigger internalization of a ligand/ membrane-spanning protein combination by endocytosis; open or close ion channels; result in apoptosis; prevent apoptosis). A target molecule can be a ligand for the membrane-spanning protein. A ligand binds to a 30 membrane-spanning protein, preferably with high affinity (an equilibrium constant of 10' or lower) and specificity. The target molecule can interact with the WO 01/14542 PCTUSOO/23112 -17 membrane-spanning protein to activate signal transduction pathways, such as G protein coupled receptor pathways, ion channels, inositol triphosphate, diacylglycerol, or any combination thereof The identification of transmembrane domains of membrane-spanning 5 proteins can lead to important and useful information in defining pathways which lead to carcinogenesis and to the development of novel, specific and more effective treatment regimens. For example, apoptosis is a process of programmed cell death fundamental to normal development and homeostasis of an organism. Deregulation or perturbations in apoptotic pathways can result in disease states, including cancer, 10 neurodegenerative disease and acquired immunodeficiency syndrome (Steller, H. Science 267:1445 (1995); Nagata, S. Cell 88:355 (1997)). Thus, the transmembrane domains and membrane-spanning proteins identified by the methods of the invention can be useful in defining processes involved in cell suicide and tissue homeostasis. The present invention also provides methods of identifying a substance that 15 alters the interaction between the transmembrane domains of the membrane spanning domains identified by the methods of the invention comprising the steps of expressing the membrane-spanning protein in a host cell; providing the host cell with the target molecule under conditions suitable to form a combination; exposing the combination to a test substance; maintaining the test substances and the target 20 molecule-membrane-spanning protein under conditions suitable for interaction; and determining the amount of interaction between the test substance and target molecule membrane-spanning protein combination and comparing the interaction in the presence and absence of the test substance. A difference in the interaction in the presence of the test substance indicates that the test substance alters the interaction 25 between the target molecule and membrane-spanning protein. One or more test substances can be evaluated simultaneously or sequentially. The test substances identified by the method of the invention can be used to treat disease conditions resulting from altered membrane-spanning protein target molecule interactions. The tenn "alter" or "altered", in regard to interaction, is defined herein as an 30 interaction or activity different from that of the target molecule and membrane spanning protein in the absence of the test substance.

WO 01/14542 PCTIUSOO/23112 -18 The test substance (e.g., an inhibitor or stimulator) can be added to the membrane-spanning protein either before or following the addition of the target molecule under conditions suitable for maintaining the membrane-spanning protein and target molecule in a conformation appropriate for formation of a combination. 5 Experimental conditions for evaluating test substances, such as buffer or media, concentration and temperature requirements, can be determined empirically depending upon the biochemical nature of the test substance, target molecule and membrane-spanning protein. The concentration at which the test substance can be evaluated can be similar, more, or less than concentrations employed by the target 10 molecule to interact with the membrane-spanning proteins. The membrane spanning protein can be expressed in a suitable cell (e.g., a mammalian cell such as COS or CHO cells) using established techniques. (See, for example, Ausubel et al., "Current Protocols in Molecular Biology", J. Wiley & Sons, (1999)). The substances which alter the interaction of the target molecules and 15 membrane-spanning proteins or transmembrane domains of the invention can be agonists (e.g., stimulators/enhancers) or antagonists (e.g., inhibitors). The substances can be polypeptides (including post-translationally modified polypeptides), peptides, or small molecules (including carbohydrates, steroids, lipids, other organic molecules, anions or cations). 20 The term "antagonist", as used herein, refers to a substance which blocks, diminishes, inhibits, hinders, limits, decreases, reduces, restricts or interferes with interactions between the target molecule and membrane-spanning protein by, for example, preventing or impeding the binding of the target molecule to the membrane-spanning protein, thereby preventing the target molecule or membrane 25 spanning protein from mediating their effects on cells. The tern "agonist" as used herein, refers to a substance which agonizes, augments, enhances, increases, stimulates, intensifies or strengthens the interaction between a target molecule and a membrane-spanning protein, or alternatively and additionally, mimics or enhances the effect of the interaction (e.g., binding) of the 30 target molecule to the membrane-spanning protein. For example, an antagonist of a novel G-protein coupled receptor identified by the methods of the invention can WO 01/14542 PCT/USOO/23112 -19 increase the binding of the receptor to its ligand beyond that observed in the absence of the agonist substance. It is further envisioned that the transmembrane domains and membrane spanning proteins identified by the methods of the present invention and substances 5 which alter their interaction can be used to evaluate, interfere and treat events, such as cell proliferation and cell-cell signaling pathways. The inhibitors or stimulators of interactions between the transmembrane domains and membrane-spanning proteins identified by methods of the present invention can be used to interfere with eukaryotic cell growth and to treat 10 hyperplastic and neoplastic disorders in mammals. Eukaryotic cells can be unicellular, multicellular vertebrate, and/or multicellular nonvertebrate cells. As defined herein, mammals include rodents (such as rats, mice or guinea pigs), domesticated animals (such as dogs or cats), ruminant animals (such as goats, sheep, cows) and primates (such as monkeys or humans). For example, the identification 15 of a membrane-spanning protein which mediates cell proliferation or apoptosis, can be useful in anti-neoplastic therapies for the treatment of diseases. For example, certain neoplasms have been attributed to an inability of the cell to regulate programmed cell death or ligand-receptor signaling pathways. Identification of the transmembrane domains of cellular receptors involved in these processes could lead 20 to mechanisms to mediate cell signaling pathways to turn off or control the unregulated cellular growth or pathway by interfering with receptor activation, ligand binding or both. Neoplastic and hyperplastic disorders which could benefit from identifying novel transmembrane-spanning proteins can include malignancies, leukemias and benign tumor growth. 25 The present invention includes compositions comprising the membrane spanning proteins, target molecules or agents which alter the interaction between the membrane-spanning proteins and target molecules identified by the methods described herein. The compositions can be used to prevent, treat or ameliorate a medical condition (e.g., neoplasm) in a mammal. 30 The compositions of the present invention can be administered to a mammal with or without a pharmacetutically acceptable carrier. The terms "pharmaceutically WO 01/14542 PCT/USOO/23112 -20 acceptable carrier" or a "carrier" refer to any generally acceptable excipient or drug delivery composition that is relatively inert and non-toxic. Exemplary carriers include sterile water, salt solutions (such as Ringer's solution), alcohols, gelatin, talc, viscous paraffin, fatty acid esters, hydroxymethylcellulose, polyvinyl 5 pyrolidone, calcium carbonate, carbohydrates such as lactose, sucrose, dextrose, mannose, albumin, starch, cellulose, silica gel, polyethylene glycol (PEG), dried skim milk, rice flour, magnesium stearate, and the like. Suitable fonnulations and additional carriers are described in Remington's Pharmaceutical Sciences, (1 7 th Ed., Mack Pub. Co., Easton, PA), the teachings of which are incorporated herein by 10 reference in their entirety. Such preparations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like which do not deleteriously react with the active compounds. They can also be combined where desired with other active substances, e.g., enzyme 15 inhibitors, to reduce metabolic degradation. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, or preservatives. Typical preservatives can include, potassium sorbate, sodium metabisulfite, methyl paraben, propyl paraben, or thimerosal. A carrier (e.g., a pharmaceutically acceptable carrier) is preferred, but not necessary to administer the 20 compositions of the invention. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The method of administration can dictate how the composition will be formulated. For example, the composition can be formulated as a suppository, with traditional binders and carriers such as 25 triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose or magnesium carbonate. The compositions of the invention can be administered intravenously, parenterally, intramuscular, subcutaneously, orally, nasally, topically, by inhalation, 30 by implant, by injection, or by suppository. The composition can be administered in a single dose or in more than one dose (e.g., boosted) over a period of time to confer WO 01/14542 PCT/USOO/23112 -21 the desired effect. For enteral or mucosal application (including via oral and nasal mucosa), particularly suitable are tablets, liquids, drops, suppositories or capsules. A syrup, elixir or the like can be used wherein a sweetened vehicle is employed. Methods of administration will vary in accordance with the type of disorder, 5 disease or neoplasm sought to be controlled, eradicated or manipulated by the composition of a membrane-spanning protein, target molecule, agonist or antagonist of the invention. The actual effective amounts of the compositions can vary according to the specific composition being utilized, the mode of administration and the age, weight and condition of the patient, for example. 10 The compositions of the invention can be administered to a mammal to prevent, treat or ameliorate a medical condition in a mammal by administering a therapeutically effective amount of the composition. As used herein, a "therapeutically effective amount" of a composition is an amount of the composition which elicits a desired response specific for the particular composition. For 15 example, when the desired effect is to activate a specific signal transduction pathway mediated by binding of a target molecule to a novel G-protein coupled receptor identified by the methods of the invention, a "therapeutically effective amount" would be an amount that would activate the specific cellular response (e.g., phosphorylation or dephosphorylation of a intracellular protein; disassociation of the 20 alpha subunit of the G-protein from the beta and gamma subunits of the G-protein; or elevated or decreased cAMP levels). As another example, a "therapeutically effective amount" of a membrane-spanning protein, identified by the methods of the invention, which mediates cell proliferation or apoptosis, would be an amount that would result in cell proliferation or programmed cell death, respectively. 25 Dosages of the compositions for a particular mammal can be determined by one of ordinary skill in the art using conventional considerations (e.g. by means of an appropriate, conventional pharmacological protocol). The present compositions are intended for use of human mammalians as well as veterinarian use for nonhuman mammals. "Nonhuman mammals" are any mammal that is not human (Homo 30 sapien).

WO 01/14542 PCT/US00/23112 -22 EXEMPLIFICATION CONSTRUCTION OF THE MODIFIED TRID A XhoI-EcoRI fragment containing the full length nucleic acid sequence of TRID was PCR amplified from human bone marrow cDNA using the following 5 primers and cloned into the XhoI-EcoRI sites of pIG-12 (Figure 3). Forward: 5'-CACCCTCGAGCACGAACTCAGCCAACGATTTC (SEQ ID NO: 7) XhoI Reverse: 5'-CACGGAATTCTCTGTGGGAACACAGCAGAG (SEQ ID NO: 8) 10 EcoRI A FLAG-TRID clone (Figure 1) was constructed with a nucleic acid sequence encoding a FLAG-epitope (DYKDDDDK, SEQ ID NO: 1) immediately 3' to the nucleic acid sequence encoding the third amino acid of the mature TRID protein by PCR amplifying the clone in two halves. The first half was cloned into 15 pIG- 12 on a XhoI-HindIII fragment with the FLAG-epitope and a HindIII site inserted (by PCR amplification using the primers listed below) immediately 3' to the nucleotide sequence encoding the third amino of the mature TRID protein. This clone was designated pSAD95-3. First half PCR primers 20 Forward: 5'-CACCCTCGAGCACGAACTCAGCCAACGATTC (SEQ ID NO: 7) Reverse: 5' CACGAAGCTTATCGTCATCGTCCTTGTAATCGGCAGAGTAAGCTAGGACT GG FLAG-epitope 25 (SEQ ID NO: 9) The second half of the FLAG-TRID was cloned into pIG-12 on a HindIII EcoRI fragment by inserting the HindIII site (by PCR amplification using the WO 01/14542 PCT/USOO/23112 -23 primers listed below) immediately 5' to the nucleotide sequence encoding the forth amino acid of the mature TRID protein. This clone was designated pSAD97-1. Second half PCR primers Forward: 5'-CAACAAGCTTACCACTGCCCGGCAGGAG (SEQ ID NO: 10) 5 Reverse: 5'-CACGGAATTCTCTGTGGGAACACAGCAGAG (SEQ ID NO: 8) The 0.6 kb HindIII-EcoRI fragment of the pSAD97-1 clone, containing the second half of the FLAG-TRID clone, was ligated into the HindIII-EcoRIl sites of pSAD95-3 clone to create a complete FLAG-TRID clone, designated pSAD100-1. Details of protocols to construct FLAG-epitope labeled clones are provided, for 10 example, in Hopp, M.P., et al., BioTechnology 6:1204-1210 (1988); U.S. Patent No. 4,703,004 (1987); and U.S. Patent No. 4,782,137 (1988). Four different FLAG-TRID clones were constructed from the FLAG-TRID clone (pSAD100-1) by PCR amplifying a unique restriction site in place of the transmembrane region (Figure 2). The restriction sites BglII, HpaI, MfeI and NarI 15 were engineered into the FLAG-TRID clone to construct the pSAD102-1, pSAD103-2, pSAD104-1 and pSAD105-1 clones, respectively. (Table 2).

WO 01/14542 PCT/USOO/23112 -24 TABLE 2. Modified FLAG-TRID clones lacking transmembrane domains. Insertion Restriction Site Plasmid/Clone AGA TCT BgJII pSAD102-1 R S 5 GTT AAC HpaI pSAD103-2 V N CAA TTG MfeI pSAD104-1 Q L GGC GCC NarI pSAD105-1 10 G A While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without 15 departing from the spirit and scope of the invention as defined by the appended claims.

Claims (33)

1. A method of identifying a transmembrane domain of a membrane-spanning protein, comprising the steps of: 5 a) modifying a nucleic acid encoding a death domain-lacking membrane-spanning protein, wherein the modification comprises replacing the nucleic acid encoding the transmembrane domain of the death domain-lacking membrane-spanning protein with a candidate nucleic acid 10 sequence, thereby producing a modified nucleic acid encoding a modified death-domain lacking membrane spanning protein; b) transfecting said modified nucleic acid into a host cell, wherein said host cell expresses a death domain-containing receptor; 15 c) maintaining said host cell under conditions suitable to express said modified nucleic acid; d) exposing said host cell to an apoptosis-inducing ligand; and e) determining the presence or absence of apoptosis, wherein the absence of apoptosis indicates that said candidate nucleic acid 20 sequence encodes said transmembrane domain of said membrane-spanning protein.

2. The method of Claim 1, wherein the modified nucleic acid encoding the modified death-domain lacking membrane-spanning protein further includes an epitope tag. 25

3. The method of Claim 1, wherein the modified nucleic acid encoding the modified death domain-lacking membrane-spanning protein further includes an epitope tag selected from the group consisting of a FLAG-epitope tag and a HA-epitope tag. WO 01/14542 PCTUSOO/23112 -26

4. The method of Claim 3, wherein the FLAG-epitope tag is DYKDDDDK.

5. The method of Claim 1, wherein the membrane-spanning protein identified has an odd number of transmembrane domains.

6. The method of Claim 1, wherein the membrane-spanning protein identified 5 has an even number of transmembrane domains.

7. The method of Claim 1, wherein said death domain-lacking membrane spanning protein is selected from the group consisting of TRID, TRUNDD, and GITR.

8. The method of Claim 1, wherein said death domain-containing receptor 10 expressed by said host cell is selected from the group consisting of DRI, DR2, DR3, DR4, DR5, DR6, TNFR-1, FAS, and TNFR-2.

9. The method of Claim 1, wherein said apoptosis-inducing ligand is selected from the group consisting of TRAIL, TNF, FasL, TRADD, FADD, and RIP.

10. The method of Claim 1, wherein said transmembrane domain identified is a 15 transmembrane domain of a membrane-spanning protein selected from the group consisting of a Group I transmembrane protein, Group II transmembrane protein, and a transmembrane protein with multiple membrane-spanning regions.

11. The method of Claim 1, wherein the host cell is a mammalian cell. 20

12. The method of Claim 11, wherein said mammalian cell is selected from the group consisting of COS-1, CHO, MCF 7 and K562 cells. WO 01/14542 PCT/USOO/23112 -27

13. The method of Claim 1, wherein said transmembrane domain identified is a transmembrane domain of a protein selected from the group consisting of a tyrosine kinase receptor, a G-protein coupled receptor, an ion channel protein, an integrin receptor, and a disintegrin receptor. 5

14. A transmembrane domain of a membrane-spanning protein identified according to the method of Claim 1.

15. A membrane-spanning protein with said transmembrane domain of Claim 1.

16. A target molecule for said membrane-spanning protein of Claim 15. 10

17. A composition comprising said target molecule of Claim 16 and a pharmaceutically acceptable carrier.

18. A method for preventing, treating or ameliorating a medical condition which comprises administering to a mammal a therapeutically effective amount of said composition of Claim 17. 15

19. A method of identifying a transmembrane domain of a membrane-spanning protein, comprising the steps of: a) modifying a nucleic acid sequence encoding a TRID protein or a TRID-like protein, wherein the modification comprises replacing the nucleic acid encoding the transmembrane 20 domain of the TRID protein or the TRID-like protein with a candidate nucleic acid sequence, thereby producing a modified nucleic acid encoding a modified TRID protein or the TRID-like protein; b) transfecting said modified nucleic acid into a host cell, 25 wherein said host cell expresses a death domain-containing receptor; WO 01/14542 PCTUSOO/23112 -28 c) maintaining said host cell under conditions suitable to express said modified nucleic acid; d) exposing said host cell to a TRAIL protein or a TRAIL-like protein; and 5 e) deterining the presence or absence of apoptosis, wherein the absence of apoptosis indicates that said candidate nucleic acid sequence encodes said transmembrane domain of said membrane-spanning protein.

20. The method of Claim 19, wherein the modified nucleic acid encoding the 10 modified death-domain lacking membrane-spanning protein further includes an epitope tag.

21. The method of Claim 19, wherein the modified nucleic acid encoding the modified death domain-lacking membrane-spanning protein further includes an epitope tag selected from the group consisting of a FLAG-epitope tag and 15 a HA-epitope tag.

22. The method of Claim 21, wherein the FLAG-epitope tag is DYKDDDDK.

23. The method of Claim 19, wherein said membrane-spanning protein has an odd number of transmembrane domains.

24. The method of Claim 19, wherein said membrane-spanning protein has an 20 even number of transmembrane domains.

25. The method of Claim 19, wherein the death domain-containing receptor is selected from the group consisting of DR2, DR4, and DR5. WO 01/14542 PCT/USOO/23112 -29

26. A vector comprising a nucleic acid sequence encoding a membrane-spanning protein which lacks a death domain and which has a transmembrane domain replaced with a cloning site.

27. The vector of Claim 26, wherein a candidate nucleic acid is inserted in said 5 cloning site.

28. The vector of Claim 26, wherein the membrane-spanning protein is selected from the group consisting of TRID, TRUNDD, and GITR.

29. A vector comprising a nucleic acid sequence encoding a TRID or a TRID like protein, wherein a transmembrane domain of the TRID or the TRID-like 10 protein is replaced with a cloning site.

30. The vector of Claim 29, wherein a candidate nucleic acid is inserted in said cloning site.

31. A method of identifying a substance which alters the interaction between said membrane-spanning protein of Claim 15 and said target molecule of 15 Claim 16, comprising the steps of: a) expressing said membrane-spanning protein in a host cell; b) providing said host cell with said target molecule under conditions suitable to form a combination between the target molecule and the membrane-spanning protein; 20 c) exposing the combination of step b) to a test substance; d) detennining the amount of interaction in the combination; and e) comparing the amount of interaction detennined in step d) with the amount of interaction in the absence of the test substance, wherein a difference in the interaction indicates that the test substance alters 25 the interaction between the target molecule and membrane-spanning protein. WO 01/14542 PCT/US00/23112 -30

32. A method of Claim 31, wherein the agent is an agonist.

33. A method of Claim 31, wherein the agent is an antagonist.