AU648272B2 - Recombinant growth factors - Google Patents

Description

_1~1 I WO 91/05863 PCT/AU90/00477 1 RECOMBINANT GROWTH FACTORS Field of the Invention This invention relates to recombinant growth factors, and to methods of synthesis thereof. In particular, the invention relates to recombinant molecules which have the biological activity of epidermal growth factors.

Background of the Invention A variety of polypeptide growth factors has been isolated from various mammalian sources, and shown to have a wide range of activities. Amongst many others, epidermal growth factor (EGF) and transforming growth factor (TGF9) have been extensively studied.

I WO 91/05863 PCT/AU90/00477 -2 EGF has been implicated in a number of activities, growth in young animals, and wound healing.

EGF has also been found by Moore and colleagues (1982a,b; 1983) to show considerable promise as an agent for defleecing of sheep.

I! Mouse epidermal growth factor (mEGF) is effective in weakening the wool fibres of sheep, following parenteral administration, to a degree sufficient for the whole fleece to i; 10 be removed quickly and easily by hand (Moore et al, 1983).

Using such methods it is expected that the high labour costs and risk of trauma to sheep entailed in traditional sheep shearing methods can be avoided. However, EGF purified from mouse salivary glands is available only in very limited amounts, and is prohibitively expensive.

Subsequently, a method for producing mEGF by recombinant means in Escherichia coli, in quantities sufficient for trial work in sheep to be carried forward, has Sbeen devised (Allen et al, 1985; 1987).

This process for preparation of recombinant mEGF Ssuffers from a number of limitations. Firstly, in order to I obtain high levels of expression of a stable intracellular product, mEGF was made as part of a large fusion protein. As a result, the product contained only about 15% mEGF, the rest |i 25 being non-EGF carrier protein. Accordingly, attempts were made to express fusion proteins in which the non-EGF portion was reduced. Met EGF and constructs with 6 or 7 N-terminal extensions over EGF were prepared, under the control of the tac promoter-operator and with TrpE ribosome binding sites.

However, no expression was detected, and this was attributed to rapid proteolysis within the host bacterium (Allen, personal communication). Secondly, the fusion protein had to.

be cleaved by a specific enzymic or chemical technique.

Despite considerable efforts, in which sequences susceptible to a variety of cleavage agents were incorporated next to the EGF sequence (Allen, personal communication), the only WO 91/05863 PCT/AU90/00477 -3 fi 2

IC

*E C i* i*C 4* i. technique which was sufficiently effective and specific, and did not chemically alter the mEGF itself, was the use of a lysine-specific protease. This proved to be very expensive, and the enzyme was in unreliable supply.

The need for cleavage of the fusion protein has been demonstrated by showing that the TrpE-EGF fusion is biologically inactive (see Table 3 of this specification).

Published work shows that the related growth factor TGFd is produced in the body as a large precursor molecule, about 3 times the size of TGFK.1. In this form, the TGFA oiological activity is only 1-2% of that of the free growth factor. This suggests by analogy that large fusions will probably be biologically relatively inactive. (Brachmann et al. 1989).

The cost of production of recombinant or plasmid-derived mEGF (rec-mEGF) by this method is far too high to permit the development of a marketable product for the routine de-fleecing of sheep. Many:other workers have developed methods for production of recombinant epidermal growth factors, Oka et al, 1985; Smith et al, 1982; Urdea et al, 1983; Sumi et al, 1985). However, these are also expensive, and are generally more suitable for products which can command substantially higher prices per unit of EGF, than can EGF for defleeging sheep.

We know of only one exception to the above which claims high levels of expression.

However, a report in the literature of an apparently similar system (Oka et al, 1985) discloses only low levels of expression. Therefore it appears that the alleged high expression may be only partially successful.

The uses of epidermal growth factors are not limited to defleecing of sheep. They may also be used for de-hairing applications in other animals; for example, harvesting hair from goats And rabbits, harvesting fleece from camelid animals such' as alpacas, llamas, dr vicuna and removing hair or bristles, before slaughter, from cattle, deer and pigs.

as *CC I WO 91/05863 PCT/AU90/00477 -4- Epidermal growth factor is conveyed to young mammals from the mother in the milk and has a role in promoting the physiological maturation of the gut. Administration of epidermal growth factors to young animals may accelerate this maturation and therefore permit rapid early growth and early weaning in piglets and other animals. In medicine, human epidermal growth factor promotes healing of peptic ulcers, and may also be useful in healing wounds of the skin and eyes. In the field of animal health, similar applications are contemplated; for example accelerated healing of the wound caused by mulesing of lambs, and healing of ulcers and injuries particularly in horses or dogs. Growth factors are also useful in synthetic or semi-synthetic cell and tissue culture medium formulations, particularly those containing little or no serum.

The present invention provides molecules related to, but structurally different from, epidermal growth factors, which have essentially similar biological activities but which can be produced readily at low cost and on a large scale.

These features make such molecules particularly appropriate for certain animal health applications, where widespread use but low unit cost are to be anticipated. Furthermore, the invention provides a means of overcoming the problems of previously known methods of synthesis, while continuing to achieve high levels of production in recombinant host cells.

Although the invention is described with particular reference to EGF, the strong sequence homology between EGF and TGF indicates that the invention will also be applicable to TGF, which is to be understood to be within its scope.

Surprisingly, we have found that EGF can be produced as a tandemly repeated molecule, and that this product is biologically active without any necessity to cleave fusion proteins or to release native EGF. Moreover, the product can be produced as inclusion bodies in E~coli.

0{IW 7 Summary of the Invention According to one aspect of the present invention, ~i there is provided a recombinant DNA molecule which Iencodes a fusion protein having the biological activity i 5 of an animal growth factor selected from the group consisting of epidermal growth factor (EGF) and transforming growth factor a (TGFu) without cleavage of the fusion protein, the recombinant DNA molecule comprising a leader sequence joined to at least one 10 sequence encoding the growth factor.

The TGFas are structurally and functionally homologous to EGFs; like EGF the TGFas have three intrachain disulphide bonds (Marquardt et al., 1983 1984; Massague, 1983a; Smith et al., 1985; Lee et al., 1985). In several in vitro assays the TGFas are functionally interchangeable with the EGFs (Pike et al., 1983; Massague, 1983b; Derynck et al., 1984; Tam et al., 1984). Throughout this specification the term TGF is to i- be taken to mean TGFu.

When more than one sequence encoding the growth factor is present, these are adjacent to each other. The Sgrowth factor is preferably of mammalian origin, more preferably from sheep, mouse, human or pig.

Preferably the number of sequences encoding the growth factor is 1 to 30, more preferably 1 to 10, even U more preferably 1 to 5, and most preferably 1 to 2.

The leader sequence may be derived from a variety of sources; for example it may be from a plasmid or another organism, or it may be synthetic. The leader sequence is preferably from 1 to 50 amino acids long, more preferably 12 to 50, even more preferably 15 to 30, and most preferably 21.

For the purpose of this specification, 'g.'owth factor sequence' is defined to mean a DNA sequence .encoding a protein having the biological activity of that growth factor, of mouse, other mammalian, or avian origin. This sequence may be of natural or synthetic origin. The growth factor is to be understood to comprehend allelic, Smutant, abbreviated, extended, or other variant forms.

4 SUBSTITUTE

S-EET

~I

Standard methods are available to the art for obtaining such variants; for example Bin I I S' BSTI" TE i xd~ LSl~hb S WO 91/05863 PCT/AU90/00477.

6 site-directed mutagens; restriction enzymes; ligases; oligonucleotide synthesis. See for example Maniatis et al (1982).

According to a second aspect of the invention, there is provided a plasmid comprising a recombinant DNA molecule as described above.

Preferably the plasmid is pCW9-RI, as hereinafter defined.

According to a third aspect of the invention, there is provided a host cell transformed by a plasmid comprising a recombinant DNA molecule as described above.

The host cell may be prokaryotic or eukaryotic, but is preferably a bacterial, yeast, mammalian or insect cell.

More preferably the host cell is Escherichia coli. Most preferably, and surprisingly so, the host cell is Escherichia coll of a lac 1 strain; for example BL21, HB101, N5151.

Certain strains have been shown to be unsuitable, for example SG936, DH5. A person skilled in the art would readily be able to identify suitable host strains by using routine screening methods.

According to a fourth aspect of the invention, there is provided a method of synthesis of a protein having the biological activity of an animal growth factor selected from EGF and TGEB comprising culturing a microorganism or cell line bearing recombinant DNA as described above in the presence of assimilable sources of nutrients, isolating growth factor produced by the microorganism or cell line, and recovering the growth factor in an act've form.

According to a fifth aspect of the invention, there is provided a method of synthesis of a plasmid as described above, comprising the steps of cleaving a DNA sequence comprising a sequence encoding a protein having the biological activity of an animal growth factor selected from EGF and TGFo(growth factor sequence) with a restriction endonuclease to excise said growth factor sequence; I s WO 91/05863 PCT/AU90/00477 i -7 cleaving an expression plasmid with the same restriction endonuclease; inserting at least one growth factor sequence VI into the cleaved expression plasmid using a DNA ligase to form a recombinant plasmid; and recovering the recombinant plasmid.

Preferably the DNA sequcnce in step is a plasmid, more preferably pEGF3.

Preferably the method comprises the steps of: digesting a plasmid comprising a DNA sequence K encoding an EGF or TGF with a restriction endonuclease to i excise a sequence encoding EGF or TGFo or a biologically K active fragment thereof; I digesting an expression plasmid with the same restriction endonuclease; j(c) purifying the products of steps and mixing and ligating the products; transforming a microorganism with the ligated mixture; identifying transformants in which the sequence encoding EGF or TGFx is present in correct orientation; digesting a plasmid comprising a DNA sequence encoding EGF or TGFa with a restriction endonuclease to excise a sequence encoding EGF or TGF9. or a biologically active fragment thereof; digesting the product of step with the same restriction endonuclease; mixing the products of steps and and ligating to form a plasmid encoding one or more tandem copies of EGF or TGFo, or a biologically active fragment, thereof, flanked by a short extra sequence at the N-terminal and/or the C-terminal; recovering the plasmid thus formed.

WO 91/05863 PCT/AU90/00477.

8 More preferably the plasmid in step is pEGF3; the plasmid in step is pUC19; the products of steps (a) and are ligated in step using a DNA ligase; the microorganism in step is E.coli; and the plasmid in step is pWRL525.

In a particularly preferred embodiment, the method of synthesis of the plasmid comprises the steps of: subjecting plasmid pEGF3 to digestion with a restriction endonuclease to excise the EGF coding fragment; subjecting plasmid pUC19 to digestion with the same restriction endonuclease; purifying said EGF coding fragment arnI diges ,ed, 5'-phosphate cleaved pUC19; mixing the purified products and subjecting them to ligation with a DNA ligase; transforming a microorganism host with the ligated mixture; identifying recombinant plasmids having the EGF fragment in correct orientation (pUC19-EGF); subjecting plasmid pWRL525 to digestion with a restriction endonuclease and purifying the EGF fragment thus produced; subjecting pUC19-EGF to digestion with the same restriction endonuclease as in step and purifying the thus-produced fragments; mixing the EGF fragment and pUC19-EGF and ligating with T4 DNA ligase to produce plasmid PCW9; and recovering plasmid pCW9.

Preferably the restriction endonuclease in steps (a) and is EcoRI.

SPreferably the restriction endonuclease in steps (g) and i& BstEII.

Optionally in step the digest is treated with alkaline phosphatase to prevent religation.

WO91/05863 PCT/AU90/00477 9 According to a sixth aspect of the invention there is provided a method of removing wool or hair from an animal Dearing same, comprising the step of administering to said animal'an effective wool- or hair-removing dose of the novel recombinant EGF produced as described above, or of EGF produced therefrom.

Detailed Description of the Invention For convenience, the following description refers specifically to mouse EGF (mEGF). However, it is to be clearly understood that the invention applies equally to other EGFs and to TGFos.

In brief, mEGF is produced as a tandem dimer, in which two mEGF sequences are preceded by a short sequence of amino acids encoded by a bacterial plasmid DNA. Contrary to the results achieved with many other short fusion proteins, this product is efficiently produced in E. coli, and is quite stable. Furthermore, it consists predominantly of mEGF sequence, so that little of the product is waste.

Unexpectedly, the product is active biologically, at a level approximately molecule-for-molecule the same as mEGF itself, so that cleavage of the fused dimer mEGF to release native mEGF is not required. It should be noted that conventional fusion proteins with EGF are not biologically active.

TrpE-EGF and glutathione-S-transferase-EGF were shown to be inactive in bioassays see Tables 3 and 6 respectively.

Finally, this product is found almost exclusively in highly insoluble inclusion bodies in the bacterial cell. This permits efficient harvesting and facilitates the early stages of purification.

The discovery of the tandem dimer of mEGF, which is provisionally named "protein-pCW9", was unexpected.

Experiments were carried out to produce unfused mEGF, other short fusion polypeptides containing mEGF, and long fusion proteins containing multiple tandem copies of mEGF. Levels of expression in E. coli varied widely between the different WO 91/05863 PCT/AU90/00477 10 products, but did not relate in any systematic way to molecular weight or to number of mEGF copies. The preferred product, "protein-pCW9", was selected on the basis of high level of expression coinciding with low molecular weight, and was subsequently shown to be biologically active without being subjected to any cleavage.

The invention will now be illustrated by way of K reference only to the following non-limiting examples, and to the figures, in which: Figure 1 represents the construction of plasmid pCW9-RI from pWRL525 and pEGF3; Figure 2 illustrates the structure of plasmid pWRL500, which was the starting material for pWRL525; Figure 3 represents the construction of plasmid pWRL525; and Figure 4 represents the construction of plasmids pET3b-l and pET3b-2.

Example 1 Preparation of Plasmid pCW9 from plasmids pEGF3 pWRL525.

Starting genetic materials were plasmids pEGF3, i pWRL500, and pWRL525 obtained from Wellcome Biotechnology Ltd., and plasmid pUC19 (Yanisch-Perron et al, 1985), obtained from Pharmacia South Seas Pty. Ltd..

All other materials including restriction enzymes and other enzymes were obtained from the usual commercial suppliers; analytical grade reagents were used wherever t available.

Genetic manipulation procedures were essentially as described by Maniatis ut al. (1982).

pEGF3 was prepared by Wellcome Biotechnology Ltd., as described by G. Allen et al. Biotechnology 5 (1987) 93-114, p.102). pEGF3 is identical to pEGF6 except for a single base change. The codon TGC coding for Cys42 in pEGF6 is altered to TGT in pEGF3. No change in the amino acid encoded resulted from this alteration.

WO 91/05863 PCT/AU90/00477 11 pWRL500 was prepared by Wellcom "iotechnology Ltd.

as described by G. Allen et al. Cell tci. Suppl. 3. (1985) 29-38). This plasmid was designed to direct the expression of a TrpE-lys-EGF fusion protein (see Fig. 2).

All of these starting materials are either K commercially available or are fully described in the references cited herein.

pWRL525 was prepared from pWRL500 as shown in Fig.

3. Essentially, this involved synthesizing oligonucleotides which when ligated together with the BstEII/EcoRI fragment of pWRL500 formed a sequence coding for the C-terminal portion of EGF, ending with Lys 3 in place of Arg53, followed by the N-terminal remainder of the EGF sequence. This sequence was bounded by the BstEII restriction sites and may be labelled B-E-B(EGF). It was reinserted in from 1-4 copies into pWRL500 cut with BstEII. The final constructs thus contained from tandem copies of EGF, of which one is (Arg53) and the remainder (Lys53). The 5 copy construct is designated by us as pCW9-RI was prepared from the Wellcome materials as follows (see Fig. 1).

1. pEGF3 was digested with EcoRI and the EGF fragment was purified by excision from an agarose electrophoresis gel, and treatment with GenecleanTM 2. pUC19 was cut with EcoRI, treated with calf intestinal alkaline pho- hatase to remove phosphate groups and thus prevent religation, and purified in the same manner.

3. The two fragments were mixed and ligated with T4DNA ligase, and the ligated mixture was used to transform E. coli strain JM101.

4. Recombinant plasmids with the EGF fragment inserted in the correct orientation (pUC19-EGF) were identified by mapping the positions of the internal SphI and Bst EII sites relative to the restriction sites in the polylinker region derived from pUC19.

WO 91/05863 PCT/AU90/00477 Vi 12 pWRL525 was cut with BstEII, and the B-E-B(EGF) fragment was purified.

6. pUC19-EGF was cut with BstEII and purified in the same manner.

7. The two fragments were mixed and ligated with T4DNA ligase, to produce the plasmid which we designate as pCW9-RI.

All of these steps were carried out using standard conventional methods and conditions (see Maniatis, op cit), which will be familiar to persons skilled in the art.

Example 2 Production of protein pCW9 The plasmid pCW9-RI was transfcrmed into E. coli Sstrain JM101, JM109, or XL-lBlue.

i Expression was driven by the lac promoter derived from pUC19, induced by the addition of isopropyl I beta-D-thiogalactopyranoside (IPTG).

K Other strains of E. coli in which expression was constitutive were also used: BL21, BL21(DE3), BL21(DE3)plysE, BL21(DE3)plysS, U 20 All of these E. coli strains are readily available to the person skilled in the art.

Example 3 Culture of transformed bacteria E. coli strain JM109 transformed by plasmid pCW9-RI (JM109 (pCW9-RI)) was grown in a fermenter in a suitable medium, such as that set out in Table 1. Dissolved oxygen was maintained above 25% of air saturation, and pH was maintained at 6.8 by addition of 2M NaOH as required. Glucose was fed in response to base demand.

*ft

I

LI WO 91/05863 PCr/AU90/00477 U -13- TABLE 1 11~L Example of Defined medium suitable for growth of E. coli strain JM109 expressing protein pCW9 per L Li(NH 4 2 S0 4 20 g KH 2 PO0 4 3 g Trisodium citrate Li Plus Trace element solution* 2m1 MgSO 4 7H120 3m1 Glucose 2 Oml 0.2g/ml Ampicillin lml 715 *Trace element solution (g/L) CaCl 2 .6H 2 0 FeC1.

2 6H10 22.5 VCaC1 2 .6H102.

MnSO 4 .nH 0 ZnSO 4 .7H 0 (NH 4 6 M0 7 0 24 4H 2 0 AlCl. 6H1205

CUSO

4 .4H 0 1 IH HBO Synthesis of pCW9 protein wyas induced by the j addition of IPTG to a final concentration of 0.2mM at 5 hours before harvesting. The protein produced was highly insoluble, and almost entirely confined to the cells, in the form of inclusion bodies. Cells were harvested after 24 hours, homogenized in 0.03M phosphate buffered saline p117.2 (8g/L WO 91/05863 PCT/AU90/00477 14 NaCi, 0.8g/L KC1, 1.15g/L Na 2

HPO

4 0.2g/L KH 2 P04), and resuspended in water. Urea was added to the suspension to give a final concentration of 8M.

The suspension was centrifuged, the pellet discarded and the supernatant applied to a Q-Sepharose column (Pharmacia). The column was subjected to step elution with NaCi (0 to 2.0M) in 8M urea, buffered to pH6.0 with 20mM Tris HC1, and the fractions containing pCW9 protein (identified by SDS-PAGE) were concentrated and applied to a Sephadex column (Pharmacia) equilibrated in a buffer containing 8M urea. The peak fractions were combined, and the urea slowly removed by diafiltration.

Example 4 Alternative Method of Extraction and Purification of Protein pCW9 Cells were harvested and disrupted by a variety of methods known to the art, including use of a mechanical homogenizer or ball mill, or endogenous production of lysozyme.

Depending on which cell breakage method was used, treatment with DNase was necessary to reduce viscosity. The homogenate was incubated at 370C with 2mM MgCl 2 and 0.2pg/ml DNase for 2 to 3 hours.

The cell paste, containing inclusion bodies, was harvested by centrifugation. The cell paste was washed with 2 volumes of buffer B (10mM EDTA, 0.2M NaH 2

PO

4 pH 7.5) and then dissolved in 40 times the inclusion weight of buffer C (6M urea, 5mM cysteine, 25mM sodium bicarbonate, 21mM sodium carbonate pH The inclusion pellet was completely dispersed using a mechanical blender.

The solution was gently stirred at room temperature for 3 hours. It was then diluted with a half volume of CB buffer (25mM sodium bicarbonate, 21mM sodium carbonate pH The protein was oxidized by stirring gently at room temperature for 24 hours.

WO 91/05863 PCT/AU90/00477 The solution was further diluted by the addition of ethanolamine pH 9.0 buffer (same volume as that of buffer This was followed by ultrafiltration through a 100,000 nominal molecular weight cut-off (NMWC) filter and then by concentration on a 10,000 NMWC filter.

Optionally, the semi-purified, concentrated pCW9 protein can be further purified by a variety of standard chromatographic methods, for example ion-exchange chromatography.

It is to be clearly understood that the method used for extraction and purification of pCW9 is not critical to the invention, and many possible ways to achieve this are available to the art.

SOne of the advantages of protein pCW9, which facilitates purification, is its low solubility in the host cell, where it is substantially confined to inclusion biodies.

Example 5 Biological Activity of pCW9 Protein in vitro Biological activity of the pCW9 protein was compared with that of rec-m EGF (Wellcome Biotechnology Ltd.).

Each substance under test was assayed for its effect in stimulating DNA synthesis in resting Swiss Albino 3T3 fibroblasts (Commonwealth Serum Laboratories).

Briefly, cells were subcultured into tissue culture wells in 3ml Dulbecco's modification of Eagles' medium (DMEM) with 10% foetal calf serum. After 24h, the medium was diluted with fresh DMEM to give a final serum concentration of 1%.

After 3 days of culture, the test substances were added to measure the rate of incorporation into DNA. The pCW9 protein was at least as effective as EGF in stimulating thymidine incorporation. Thymidine incorporation was completely inhibited by hydroxyurea (Steinert, 1969), confirming that incorporation was a measure of DNA synthesis. The results are summarized in Tables 2 to I _I _~rln-LI- WO 91/05863 PCT/AU90/00477 16 TABLE 2 Biological Activity of protein pCW9 in cells in vitro (Swiss Albino 3T3 cell line, in DMEM 1% foetal calf serum) H-Thymidine Incorporation Stimulation P Treatment (total cpm) Index (Lord's range test) Controls 1. No addition 13,966 1.00 2. Urea control 13,936 1.00 rec-m EGF 1. 10 ng/ml 24,059 1.72 0.05 protein pCW9 1. impure preparation 26,353 1.89 0.01 IWF"I WO 91/05863 PCT/AU90/00477 17 TABLE 3 LACK OF BIOLOGICAL ACTIVITY OF FUSION PROTEIN TrpE-EGF IN CELLS IN VITRO (Swiss Albino 3T3 cell line, in DMEM 1% foetal calf serum) H-Thymidine Incorporation Stimulation Treatment (total cpm) Index Controls 12,632 EGF (10ng) 34,495 2.73 TrpE-EGF (10ng) 12,228 TrpE-EGF (100ng) 13,317 f :i

I

WO 91/05863 PCr/AU9O/0047 18 TABLE 4 Biological Activity of protein pCW9 in cells in vitro (Swiss Albino 3T3 cell line, in DMEM 1% foetal calf serum) 3 H-Thymidine Incorporation Stimulation Treatment (inhibitable by hydroxyurea) index Controls 1. No addition 6,938 (1.00) 2. Control bacterial product 4,046 0.58 3. Control bacterial product 4,044 0.58 rec-m EGF 1. 10 ng/ml 12,417 1.79 2. 1000 ng/ml 5,690 0.82 protein pCW9 1. 250 ng/ml 15,754 2.27 Fusion protein comprising beta-galactosidase and cattle-tick protein sequence.

Recombinant beta-galactosidase.

I. iL i- -CI-lrrrtrrai ar*lr~ WO 91/05863 PCT/AU90/00477 19 TABLE Biological Activity of protein pCW9 in cells in vitro (Swiss Albino 3T3 cell line, in DMEM 0.25% conditioned foetal calf serum) H-Thymidine Incorporation Stimulation Treatment (inhibitable by hydroxyurea) index Controls Buffer addition 1,850 1.00 rec-m EGF 1 ng/ml 3,667 1.98 0.3 ng/ml 3,430 1.85 0.1 ng/ml 2,343 1.27 protein pCW9 Batch 14 1 ng/ml 3,004 1.62 0.3 ng/ml 3,609 1.95 0.1 ng/ml 3,439 1.86 Batch 2, 28/5 1 ng/ml 4,465 2.4 0.3 ng/ml 2,685 1.45 0.1 ng/ml 1,725 0.93 I WO 91/05863 PCT/AU90/00477 20 Example 6 Activity of pCW9 protein in Mice EGF induces a number of physiological responses in young mice. The most striking are an acceleration of tooth eruption and eye-opening; more variable but usually recognizable are changes in skin and hair. Scurfiness of skin, and curling of hair and reduced hair growth are characteristic. All of these effects have been noted with protein pCW9, and the early eye-opening and tooth eruption are consistently similar to those elicited by rec-mEGF. The results are presented in Tables 6 and 7.

For administration to sheep the EGF derivatives were formulated in a Methocel A-15 vehicle. The bulk vehicle was prepared as follows: 1. 18.375g of Methocel A-15 was dispersed in 120ml of hot water (80-900C).

2. 240ml of cold water was added and the solution was cooled down to 5 C.

3. 10ml of benzyl alcohol added and mixed in.

4. Volume made up to 500ml with H 2 0, mixed.

Freeze-dried EGF derivative protein pCW9) was added to the bulk vehicle to give a final concentration of The material was dispersed by treating with an Ultra Turrax homogeniser for 3 minutes.

WO 91/05863 PCT/AU90/00477 21 TABLE 6 Biological activity of prctein pCW9 in new-born mice Litter Group Day Day Other Doses 1 Teeth Eyes Erupted Opened 3 Control no treatment 10 13/14 1 pCW9-a 12 pg x 4 9 10/11 dosed at 3, 2 pCW9-b 12 pg x 4 9 10/11 4, 5, 6 days 3 pCW9-c 12 pg x 4 9 9/10 of age 4 pCW9-d 12 pg x 4 9 Control no treatment 11/12 14/16 1 beta-galactosidase 10/12 14/16 2 dosed at 3, 2 large EGF fusion-a. 11 14/16 4, 5, 6 days 3 large EGF fusion-b 11/12 14/16 of age 4 control for large fusion 3 11/12 14/16 21 Control no treatment 3' 14 dosed at 1, rer-mEGF 12 pg x 4 7 9/10 2, 3, 4, days of age 1 Estimates only (impure preparations) pCW9-a,-b,-c,-d are different batches of protein pCW9.

Beta-galactosidase is produced in bacteria using pUR288.

2 Large EGF fusions -a,b are fusion proteins comprising glutathione-S-transferase fused with EGF sequence(s).

3 The control for large fusion is a fusion protein comprising glutathione-S-transferase fused with a cattle tick protein sequence.

i T i_ i Q i I Table 7 Biological Activity or Protein-pws in Mice Litter Group Doses n Day Teeth Day Eyes Coat Other Erupted Opened Control (no treatment) 3 11 13/14 protein-pCW9(a) 12g x 4 3 8/9 10 2 slight scarring protein-pcW9(a) 1.2g x 4 3 10/11 14 very slight scarring dosed at 2,3,4,5 protein-pCW9(a) 0.36gx 4 3 11 14 very slight scarring days of age protein pCW9(b) 12g x 4 3 10/11 14/15 2 very slight scarring 7 Control 3 11 14/15 dosed at 1,2,3,4 protein-pCW9(a) 36g x 4 3 2 very stunted, all died days of age rec-mEGF 12g x 4 3 8/9 10 2 rec-mEGF 3.6g x 4 3 9/10 12 1 rec-mEGF 1.2g x 4 3 12 13 1 Control 3 10/11 13/14 dosed at 1,2,3,4 protein-pCW9(a) 3.6g x 4 3 10/11 13 2 very slightly stun'ed days of age rec-mEGF* 0.36gx 4 3 12 14/15 1 very slightly stunted protein-pCW9(c) 12g x 4 3 12 14 2 very slightly stunted, 1 died protein-pCW9(c) 1.2g x 4 3 12 15 1 very slightly stunted 1 died normal preparations of protein decreasing purity (a,b,c) pCW9 are in order of Coat:- 1 slightly affected 2 distinctly affected 'affected' means coat disorder and reduced growth 6r- WO 91/05863 PCT/AU90/00477 -23- Example 7 Biological activity of protein pCW9 in sheep.

Protein pCW9 has been administered to sheep in the same manner as rec-mEGF at a range of dose rates. At doses equivalent to those used for rec-mEGF, the same overal Seffects are seen a transitory reduction in feed intake, and weakening of the wool fibre which is maximal within a week and permits easy removal of the fleece by hand.

The results are shown in Tables 8 and 9.

i il i, J-49 Table 8 Biological Activity of Protein-pCW9 in Sheep Sheep dose Depilation force (mean of 5 readings I N/ktex.

no. pCW9(.g/kg) day -13 day -1 day +4 day +8 day +14 Notes 190 151 195 300*b 150 a 150 b 13.72+1.62 11.18+1.27 7.72+0.39 10.76+1.52 13.90+1.17 14.93+2.17 12.91+1.75 12.54+2.76 9.92+0.79 9.87+1.07 11.39+0.84 12.07+1.71 15.40+1.62 12.02+3.08 7.56+0.85 3.81 035 8.06±0.51 9.52±0;75 9,.79±0.62 11.90+1.11 12.28+1.10 2.2710.36 -1.50+0 .22 2.01±0,41 6.4-240.61 6.-66C-1 I2 10.43+1.30 11.55+2.25 2.12+0.61 0.33+0.14 2.8740. :43 8.56+0.84 8.'2311.42 10.98+0.77 10.00+0.43 Transitory reduction in feed Intake Easily shorn by hand.

(Feed intake low/variable throughout trial).

Transitory reduction in feed intake.

84 110 b 204 214 181 80 b 50 a 50 b Preparations a and b variation in method of renaturation; believed to be more fully renatured. Degree of purity and therefore real dose not fully defined; dose represents assay of total protein.

N.B. Established dose range for EGF is 100-150ug/kg to achieve easy hand-shearing.

i '1 I WO 91/05863 PUF/AU90/00477 25 TABLE 9 Biological activity of protein pCW9 in sheep Sheep No.

Treatment* Dose pg/kg Depilation force (average of 5 readings) N/ktex Days -4 0 +6 from Dosing +10 +14 121 650 647 669 666 646 645 659 658 677 668 679 663 674 654 657 676 665 667 1-120 1-150 1-300 2-150 3-120 3-150 3-300 4-120 4-150 4-300 8.81 7.67 10.85 11.78 9.52 13.62 2.01 3.57 4.38 2.19 2.72 2.16 0.85 1.99 0.75 0.37 Fleece Removed 0.63 0.21 Fleece Removed 7.38 7.21 2.02 0.93 0.39 0.72 6.86 7.68 7.52 6.29 14.79 6.31 6.29 7.95 8.77 7.92 13.51 6.40 1.88 1.72 1.97 0.91 2.08 1.70 0.68 1.79 1,56 0.20 1.01 0.97 0.31 1.38 0.88 Fleece 0.24 0.63 Fleece Removed 1.06 Fleece Removed Fleece Removed Removed Fleece Removed 0.61 5-150 11.86 15.95 4.83 1.73 1.31 2.09 6-136 11.19 10.56 0.55 0.70 Fleece Removed 7-120 7-150 7-300 8-120 8-150 8-300 14.54 7.94 7.49 7.47 6.86 9.94 15.88 6.70 7.06 8.62 6.89 11.29 14.17 7.20 5.89 1.68 2.85 '2.21 21.33 6.96 6.02 0.81 1.48 1.51 16.59 20.61 8.09 8.68 5.32 6.00 Fleece Removed 0.77 0.31 0.53 Fleece Removed The numeral before the hyphen refers to the preparation of protein pCW9 used (see text).

I_ WO 91/05863 PC/AU90/00477 26 The protein pCW9 preparations in treatments 1 to 8 have all been prepared using different purification protocols. All show good activity except preparation 7. It was noted that a heavy precipitate formed in preparation 7 during formulation.

Thus according to bioassay tests both in vitro and in vivo, the recombinant EGF of this invention is fully comparable in activity to rec-mEGF of the prior art. This, in turn, is comparable to mEGF of natural origin.

Example 8 Preparation of metEGF and met EGF Dimer Constructs While protein pCW9 was expressed well in E. coli, shorter analogues, such as proteins comprising 3 amino acids from plasmid pUC18 linked to two tandem copies of EGF, were very poorly expressed. Furthermole, previous attempts to express metEGF using the tac promoter system had been unsuccessful. Therefore it was surprising that, as part of the present invention, a way was found to express the protein comprising methionine linked to two tandem copies of EGF ("metEGF dimer"), with high efficiency in E. coli.

The successful result derives from two separate factors. In the first place the choice of promoter plays a part. Use of the T7 expression system (Rosenberg, et al. 1987) resulted in significant expression of metEGF in E.

coli. In the second place, metEGF dimer was expressed at substantially higher levels than metEGF in the same system.

The starting genetic materials, pEGF3 and pUC19, have been described in Example 1. The pUC18 is from the same source as pUC19.

The pUC19 vector was modified by cloning in a small synthetic segment of DNA. pUC19 DNA was digested with EcoRI 30 and SacI, and then electrophoresed on an agarose gel. The large fragment was excised from the gel and purified with GenecleanTM. Synthetic DNA having the following sequence I Ci WO 91/05863 PCT/AU90/00477 27

CCATGGCTAGCCATATG

3 3,TCGAGGTACCGATCGGTATACTTAA 5 was mixed and ligated to the cut pUC19 vector fragment using T4 DNA ligase under appropriate conditions (Maniatis, op.

I cit.). Transformants were recovered in E. coli strain JM101.

The resulting plasmid, pUC19-L, was digested with EcoRI and the EcoRI fragment from pEGF3 containing the EGF gene was cloned in. DNA from transformants was analysed and a clone in which the EGF fragment was inserted in the correct orientation for expression from the pUC19 Lac promoter was selected (pUC19-2-1).

A similar construct was made in pUC18. The EGF EcoRI fragment was inserted into pUC18 in the correct orientation for expression from the Lac promoter, to give the plasmid pUCl8-8b.

Both pUC19-L-1 and pUCl8-8b were digested with Eco 01091 and Bst EII. The small fragment from pUCl8-8b was ligated to the large fragment from pUC19-L-1 to give the plasmid pUC19-L-1-2. A fragment containing the EGF gene was then excised from pUC19-L-1-2 with the enzymes NdeI and BamHI, and ligated into the plasmid pET3b which had been digested with the same enzymes. The ligation yielded the plasmid pET3b-l which can express met-EGF. A plasmid expressing met-EGF dimer (pET3b-2) was constructed by digesting pET3b-l with Bst EII and ligating in the Bst EII fragment from pWPL525 containing the EGF gene (as in the construction of pCW9-RI in Example The construction of plasmids pET3b-l and pET3b-2 is illustrated in Figure 4.

Example 9 Expression, Extraction and Purification of met-EGF and met-EGF dimer In pET3b-l and pET3b-2 the expression of, respectively, met-EGF and met-EGF dimer is under the control of a promoter transcribed by T7 RNA polymerase. Therefore, for the proteins to be expressed, the plasmid have to be used in a hcit cell WO 91/05863 PCT/AU90/00477 28 capable of producing the T7 RNA polymerase. The host we have chosen to use is BL21 (DE3) (Rosenberg et. al., 1987 op.

cit.). 2n this strain expression from the T7 promoter occurs when the expression of T7 RNA polymerase is induced by the addition of IPTG.

The extraction and purification of met-EGF and met-EGF dimer was achieved using the same methods as those used to purify protein pCW9 (see Example The biological activity of the met-EGF was tested as in Example 7, and found to be comparable to that of protein pCW9.

Example In view of the efficient expression of dimeric EGF analogues and their unexpected biological activity, further analogues with greater numbers of EGF tandem repeats were constructed and studied.

Plasmids expressing proteins equivalent to protein pCW9 but with 3, 4 and 5 copies of EGF can be constructed in a similar way to plasmid pCW9-RI (Example The only difference is that instead of digesting pWRL525 to completion with Bst EII, a partial digest is performed. In this way fragments containing 2, 3 and 4 tandem copies of the EGF gene can be isolated and cloned into Bst EII cleaved pUC19-EGF to yield plasmids with 3, 4 and 5 copies of the EGF gene (pUCl9-ll-4, pUC19-11-5 and pUC19-11-6).

The EGF-trimer protein expressed by pUC19-ll-4 has been extracted and purified in essentially the same way as protein pCW9 (See Example This protein was also active in sheep.

SIt will be apparent to the person skilled in the art that recombinant growth factors according to the invention can be produced using a variety of recombinant and synthetic DNA constructs, and that the recombinant growth factors produced can accordingly have a variety of amino-acid sequences, wo I |i 91/05863 2 9 depending on the number of repeats of the growth factor and on the length and nature of the N-terminal additional (leader) sequence.

Although we have not found any predictable effect on biological activity either cf :he precise number of repeats or of the length or nature of the leader sequence, it is a simple matter to test whether any particular amino-acid sequence will enable production of active growth factor. For example, the quantity of desired protein can readily be assessed by immunoassay, and its biological activity can be assessed by bioassay; the simplest, most rapid such test is the cell mitogenic assay, such as that used in Example 5 above.

Hierarchical screening for level of expression, in vitro activity, and in vivo activity may be used. Suitable methods will be known to the person skilled in the art, who will be able to identify 'active' sequences without any need for undue experimentation.

It will be clearly understood that the invention in its general aspects is not limited to the specific details referred to hereinabove.

Publications referred to herein are identified on the following page.

PC/AU90/00477 WO 91/05863 PCT/AU90/00477

REFERENCES

Allen et al. (1985) J. Cell Sci. Suppl. 3 29-39.

Allen et al. (1987) J. Biotechnol. 5 93-114 Brachmann, R. et al (1989) Cell 56 691-700 Derynck et al (1984) Cell 38 287-297 Kishimoto et al. (1986) Gene 45 311-6 Lee et al (1985) Nature 313 489-491 Maniatis et al. (1982) Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory).

Marquardt et al (1983) Proc. Natl. Acad. Sci. USA 4684-4688 Marquardt et al (1984) Science 223 1079-1082 Massague (1983a) J. Biol. Chem. 258 13606-13613 Massague (1983b) J. Biol. Chem. 258 13614-13620 Moore et al. (1982a) Aust. J. Biol. Sci. 35 163-72.

Moore et al. (1982b) Proc. 2nd Nat. Conf. Wool Harvesting Research and Development (Hudson PRW ed.) 57-65.

Moore et al. (1983) Outlook for Australia's Natural Fibres Symp. Aust. Acad. Technol. Sci. 1983 85-96.

WO 91/05863 PTA9/07 PCr/AU90/00477 -31 Oka et al. (1985) Proc. Natl. Acad. Sci. USA 82 7212-6.

Rosenberg, et al. (1987) Gene 56 125-135.

Smith et al. (1982) Nucleic Acids Research 10 4467-82.

Smith et al (1985) Nature 315 515-516 Steinert (1969) FEBS Letters 5 291.

Suini et al. (1985) J. Biotechnol. 2 59-74.

Tam et al (1984) Nature 309 376-378 Urdea et al. (1983) Proc. Natl. Acad. Sci. USA 7461-5.

Yanisch-Perron et al. (1985) Gene 33 103-119.

Claims (24)

1. A recombinant DNA molecule which encodes a fusion protein having the biological activity of an animal growth factor selected from the group consisting of epidermal growth factor (EGF) and transforming growth factor a (TGFa) without cleavage of the fusion protein, the recombinant DNA molecule comprising a leader sequence joined to at least one sequence encoding the growth factor.

2. A recombinant DNA molecule according to Claim 1, comprising two or more sequence encoding the growth factor protein, said sequences being adjacent to one another.

3. A recombinant DNA molecule according to claim 1 or Claim 2 comprising 1 to 30 growth factor sequences.

4. A recombinant DNA molecule according to any one of Claims 1 to 3, wherein the leader sequence is 1 to amino acids long. A recombinant DNA molecule according to any one of Claim 1 to 4, wherein the growth factor is of mammalian origin.

6. A recombinant DNA molecule according to any one of Claims 1 to 5, wherein the growth factor is EGF.

7. An autonomous unit of DNA replication in vivo or in vitro comprising a recombinant DNA molecule according to any one of Claims 1 to 6.

8. An autonomous unit of DNA replication according to Claim 7 selected from the group consisting of plasmids, cosmids, expression vectors and viruses.

9. A plasmid comprising a recombinant DNA molecule according to any one of Claims 1 to 6. Plasmid pCW9-RI as hereinbefore defined.

11. A prokaryotic or eukaryotic host cell transformed by an autonomous unit of DNA replication according to Claim 8 or by a plasmid according to Claim 9 or Claim

12. A host cell according to Claim 11 which is a bacterial, yeast, mammalian or insect cell.

13. A host cell according to Claim 11 which is Escherichia coli. I i F-1- ~~lbYYCIIUI---*n Swo 91/0 863. PCT/AU90/00477 33 if a ir i~ I ri 1~ oi rri r oii I rJln i' ns:r

14. A host cell according to Claim 12 which is Escherichia coli of a lac strain. A method of synthesis of a protein having the biological activity of an animal growth factor selected from EGF and TGF, comprising culturing a microorganism or cell line bearing recombinant DNA as defined in any one of Claims 1 to 6 in the presence of assimilable sources of nutrients, isolating growth factor produced by the microorganism or cell line, and recovering the growth factor in an active form.

16. A growth factor produced by the method of Claim

17. A growth factor according to Claim 16 which is EGF.

18. A growth-factor according to Claim 16 which is TGF.

19. A method of removing wool, hair or bristles from an animal bearing same, comprising the step of administering to said animal an effective wool-, hair- or bristle-removing dose of the EGF according to Claim 16 or Claim 17, or of EGF produced therefrom. A method according to Claim 19, wherein the animal is selected from the group consisting of sheep, goats, rabbits, cattle, deer, and pigs.

21. A method according to Claim 19, wherein the animal is selected from the group consisting of alpacas, llamas and vicunas.

22. A method of promoting healing of a wound, ulcer or injury, comprising the step of administering to a mammal in need of such treatment an effective amount of a growth factor according to any one of Claims 16 to 18.

23. A method of promoting gut maturation in an infant animal, comprising administering to said mammal an effective dose of a growth.factor according to Claim 17 or Claim 18.

24. A method-of synthesis of.an autonomous unit of DNA replication as defined in Claim 8, wherein said autonomous unit is a plasmid and the method comprises'the steps of ~I~~I_-LIIIYl~lslCL*-1~311 WO 91/05863 PCT/AU90/00477 34 cleaving a DNA sequence comprising a sequence encoding a protein having the biological activity of an animal growth factor selected from EGF and TGFX (growth factor sequence) with a restriction endonuclease to excise said growth factor sequence; cleaving an expression plasmid with the same restriction endonuclease; inserting at least one growth factor sequence into the cleaved expression plasmid using a DNA ligase to form a recombinant plasmid; and recovering the recombinant plasmid. A method according to Claim 24 comprising the steps of: digesting a plasmid comprising a DNA sequence encoding an EGF or TGFAwith a restriction endonuclease to excise a sequence encoding *GF or TGF( or a biologically active fragment thereof; digesting an expression plasmid with the same restriction endonuclease; purifying the products of steps and mixing and ligating the products; transforming a microorganism with the ligated mixture; identifying transformants in which the sequence encoding EGF or TGFc< is present in correct orientation; digesting a plasmid comprising a DNA sequence encoding EGF or TGF< with a restriction endonuclease to excise a sequence encoding EGF or TGFo, or a biologically active fragment thereof; digesting the product of step with the same restriction endonuclease; WO 91/05863 PCT/AU90/00477 35 mixing the products of steps and and ligating to form a plasmid encoding one or more tandem copies of EGF or TGF<, or a biologically active fragment thereof, flanked by a short extra sequence at the N-terminal and/or the C-termtinal; recovering the plasmid thus formed.

26. A plasmid produced by the method of Claim 24 or Claim

27. A pharmaceutical composition comprising a growth factor according to any one of Claims 16 to 18, together with a pharmaceutically acceptable diluent, carrier or excipient.

28. A synthetic or semi-synthetic cell or tissue culture medium, comprising a growth factor according to any one of Claims 16 to 18, together "ith a non-toxic diluent or carrier.

29. A wool, hair or bristle removing composition comprising EGF according to Claim 16 or Claim 17, together I with a veterinary acceptable carrier, diluent or excipient. i d I