AU646467B2 - Method containing a biological system comprising bacterial cells, recombinant plasmid, recombinant bacterial cells and a vaccine comprising a population of such cells - Google Patents
Method containing a biological system comprising bacterial cells, recombinant plasmid, recombinant bacterial cells and a vaccine comprising a population of such cells Download PDFInfo
- Publication number
- AU646467B2 AU646467B2 AU78183/91A AU7818391A AU646467B2 AU 646467 B2 AU646467 B2 AU 646467B2 AU 78183/91 A AU78183/91 A AU 78183/91A AU 7818391 A AU7818391 A AU 7818391A AU 646467 B2 AU646467 B2 AU 646467B2
- Authority
- AU
- Australia
- Prior art keywords
- cell
- bacterial
- plasmid
- cells
- promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
1 M& n6t c jcnI lA^r\ M b6MoQ'VCC\ S-errk Cr-O-rit'AZ OCA-t-(ZCAA CltS 0, P 1oGi\c-<?n Cf 53uc-V ce\s The present invention relates to a method of biologically containing an organism or a replicon under certain conditions, and a replicon used in the method, as well as a cell containing said replicon.
TECHNICAL BACKGROUND The techniques employing the in vitro recombination of DNA molecules which techniques are populerly termed "genetic engineering" have made it possible to isolate specific genes and express such genes in a S* variety of host cells, including host cells in which the genes in question are not found or expressed in nature. A recombinant DNA molecule typically consists of a vector which is able to replicate autonomously in the host cells harbouring it or which is integrated into the host cell genome, one or more genes coding for one or more desired biosynthetic products and DNA sequences required for expression of the gene or genes in the host cell. The recombinant DNA techniques have become important for industrial applications such as large-scale fermentation of genetically engineered organisms such as bacteria, yeasts or animal cells, to produce one or more desired .biosynthetic products such as peptide hormones, e.g. insulin and growth hormone, or enzymes such as plasminogen activators; another 5*.
important area of application is the controlled release of genetically engineered microorganisms or viruses into the environment, for instance bacteria or viruses capable of killing larvae of insects which are harmful to certain plants, bacteria degrading certain pollutants, such as oil, or bacteria which reduce the cold sensitivity of certain crops.
From the earliest stage of development of recombinant DNA techniques in the 1970s, the scientific community has been highly aware of the possible biological hazards associated with genetic engineering. As a result, the National Institutes of Health, Bethesda, USA, proposed a S set of "Guidelines for Recombinant DNA Research" which set the standard for most other countries. Since 1978, the Guidelines have been revised regularly on the basis of accumulated experimental evidence KBMIKPJ/55/PA25983D/23.03 87 concerning the possible biological hazards associated with recombinant DNA work, Despite a tendency to relax the NIH regulations, public opinion remains greatly concerned about the possible biological hazards associated with genetic engineering. Public concern has mainly been directed towards possible effects of experiments involving the controlled release of genetically engineered organisms to the environment. However, in many countries the large-scale production of biosynthetic substances to be used in connection with therapy and the like has also been questioned with respect to its safety, especially S* with respect to the effect of the accidental release of the recombinant organisms producing such substances from the fermentors to the environment. Therefore, it is not possible to exploit the industrial 15 potential of genetic engineering fully, before the safety aspects have been resolved.
0* In order to avoid or at least reduce the risks associated with experiments or large-scale applications of genetic engineering, such as the release of recombinant organisms to the environment, measures have been taken to limit the number of such organisms released under ordinary operating conditions as well as in the case of certain types of accident by means of a suitable physical design of laboratories and production facilities.
Such measures are termed "physical containment" by which is meant any design feature of laboratories or production facilities which is intended to confine the recombinant organisms to a specific, predetermined, restricted area. Different levels of physical containment are required for different types of recombinant DNA work according to NIH regulations. Thus, work with potential pathogens requires stricter physical conditions in the laboratory or production facility where the work is carried out.
Physical containment measures are feasible within a laboratory or production facility, while no such measures are possible in the case of applications involving controlled release of genetically engineered microorganisms to the environment.
KBMIKPJIS5IPA25983/23 03.87 3 Alternatively or concomitantly, the continued survival of accidentally released recombinant organisms or the spread of recombinant DNA molecules in the environment may be limited by "biological containment". This term is meant to indicate any feature of the host cell or replicon employed in the production of a specific biosynthetic product or employed for its ability to bring about a desired event, which feature serves to limit the growth potential of the host cell outside a specific, restricted environment where specific conditions prevail (in the following termed "defined environment") and/or any feature of a replicon harboured in the host cell, which feature serves to limit the spread of the replicon (as well as any inserted foreign nucleotide sequence, i.e. a nucleotide sequence which is not naturally related to the replicon in question) to other organisms than those for *rose:which it has been intended. Biological containment may also be ob- Ce 15 tained through a combination of specific features of both host cell and replicon, wh ich features limit the survival of the cell. In the present context, such organisms which are provided with specific genetic information in the form of a replicon carrying this information to exhibit specific phenotypical traits, are termed "primary host cells".
One conventional way of ensuring the biological containment of a specific organism harbouring a recombinant DNA molecule is to limit its ability to propagate outside a defined environment. Typically, host organisms are used which have been attenuated by introducing a number of independent mutations resulting in well-defined requirements for one or more growth factors which are not usually found in the natural environment (defined as the environment outside the defined environment of for instance a laboratory or production facility [in the following occasionally termed the "outside environment"); the term "natural environment" is intended to include the intestinal tract] and/or a generally decreased competitiveness relative to wildtype organisms of the same species. For instance, E. coil K-12 is an attenuated bacterial strain which is commonly used in experiments and productions involving genetic engineering as this attenuated strain is unable to propagate and establish itself outside the defined conditions of the laboratory or production facility in which it is employed, Furthermore, this E. coli strain is unable to adhere to the K8MtKPJ/55/PA2S9S3D123.03 87 epithelial cells of the mammalian intestinal tract which is the normal environment of E. coil which means that colonization of the natural habitat of E. coil by genetically engineered E. coil R-12 is highly unlikely to take place.
It should be noted, however, that even though E. coil K-12 is unable to compete with natural organisms, it will still survive for a period of time in a natural environment.
When the experiment or actual production involves the controlled release of a genetically engineered organism to the natural environog **ment (as defined above), it is not feasible to obtain biological containment by using an attenuated host cell as described above. Obviously, microorganisms which are released to the environment in orepe* 15 der to function there have to be able to compete favourably with the gos** wild-type organisms in the same environment either of the same species or other species in order to establish themselves, at least transiently, in a suitable ecological niche.
Another area of biological containment is concerned with limiting the spread of genetic information present on a replicon (optionally including inserted foreign DNA), which replicon may for instance be a '00* bacterial plasmid, from a primary host cell used for experimentation *or industrial production to other cells of either the same species but lacking the attenuating mutations of the primary host cells imposed as a part of a biological containment system or to cells of a different species which are able to propagate outside the defined Ise environment required for the growth of the primary host cells, which defined environment is part of a biological containment system.
Genetic information can be transmitted among organisms by several means. In the case of bacteria and bacterial plasmids, these may be transferred by bacterial conjugation, where a physical bridge is formed between two mating bacteria so that the plasmid passes from one bacterium to another -via this bridge. Bacteria of different species may exchange plasmids by conjugation, and certain plasmids are in fact transmissible between such distantly related gram-negative bacteria as E. coi and Pseudomonas spp. As the ability of bacteria KBM/KPJ[SS/PA259a30/23 03 87 to conjugate and the ability of plasmids to be transferred are properties which are associated with plasmid-borne DNA sequences, it is required that vectors to be used in industrial production involving genetically engineered bacteria lack the DNA sequences responsible for bacterial conjugation and plasmid transfer. This requirement constitutes the major biological containment measure taken with respect to bacterial plasmids.
However, genetic information, which may for instance be present on a bacterial plasmid, may also be spread by other means which are not counteracted by the removal of said genetic information coding for bacterial conjugation and plasmid transfer.
*0 e Primary host cells (attenuated by the proper mutations to ensure 9 *15 long-term survival under defined environmental conditions only) har- 15 bouring a recombinant DNA plasmid may occasionally be infected by one or more naturally occurring bacteriophages. Some bacteriophages are known to possess the ability to take up plasmids or other DNA molecules at random and transmit them to secondary host cells (cells not intended for the production of biosynthetic products or other purposes, i.e. typically wild-type strains found in the natural en- 'e vironment) which have not been attenuated and which are therefore capable of propagating outside the defined environment employed for growing the primary host cells.
A similar situation may occur if a bacterium harbouring one of the 'naturally occurring plasmids coding for bacterial conjugation and capable of being transferred on conjugation, conjugates with a primary host cell already harbouring a recombinant plasmid. Homologous recombination may then take place between the two plas.mids resulting in the transfer of the recombinant plasmid to another host cell.
A further way of spreading genetic information to cells which lack the attenuating mutations performed on primary host cells is the passive uptake of free DNA by the cells, the so-called transformation. Many naturally occurring microorganisms are able to take up free DNA. The DNA may then be integrated into the chromosome of the novel, secondary host cell or may replicate autonomously in the host KBM/KPJ/551PA259B3D3203.67 cells which, due to the absence of attenuating mutations, may multiply and establish themselves outside the defined environment of the laboratory or production facility. There is some evidence to suggest that substantial amounts of bacterial plasmid DNA are released in biologically active form from, for instance, E. coil cells during growth in a fermentor. This would indicate that the fermentation mediumn from which the cells have been harvested presents a major source of plasmid DNA which may potentially be taken up by a secondary host cell by transformation, albeit at a low frequency, if the fermentation medium is released to the environment. The currently employed methods of biological containment do not propose any solua*a tion to this probiem.
ft 0 In case of experiments or practical applications involving the con- Osage: a 15 trolled release of genetically engineered microorganisms to the na- 'tural environment (as defined above), the spread of the replicon too (optionally including inserted foreign nucleotide sequence(s)) by conjugation may be limited if the genes or nucleotide sequences responsible for conjugation are not located in the vector, cf. the discussion above. However, this method of biological containment does ago***not suggest any measures against the spread of, for instance, a bacterial plasmid to novel, secondary host cells by transduction, by recombination with transmissible plasmids or by transformation of .~.recombinant DNA released from lysed recombinant organisms.
Although attempts have been made to design strains with increased COB, biological containment properties, most if not all of thesn suffer from the disadvantage that they considerably affect the growth properties of the cells even under preferential conditions in the laboratory or production facility, and most often growth inhibition rather than cell killing is obtained outside the defined environment.
The outline given above of the problems concerning the containment of recombinant organisms has mainly been concerned with bacteria; it should be emphasized that similar arguments apply to eucaryotic organisms and viruses.
KBM/KPJIS5/PA259830(23 03 87 wv~r 7 DISCLOSURE OF THE INVENTION The present invention presents a novel approa6h to the concept of biological containment by making use of an active containment factor, namely cell killing function which is expressed if primary host cells harbouring a recombinant DNA molecule are subjected to novel environmental conditions or as a result of a random event, or if a secondary host cell receives the recombinant DNA molecule originally harboured in the primary host cell.
In some cases, the secondary host cell is only killed under conditions inducing the expression of the cell killing function.
In a first aspect the present invention consists in a method of containing a biological system comprising bacterial cells, the containment comprising confining bacterial cells to a particular environment, or confining recombinant DNA molecules or viruses to specific bacterial host cells, or confining in time and space environmentally released recombinant bacterial cells, the method comprising introducing into the bacterial cells, the recombinant DNA molecules, or the viruses, a conditionally lethal gene encoding a bacterial cell-killing gene product which is regulatably expressed, "..the reg Ation being a regulation adapted to express the cell killing product 0* under environmental conditions different from the conditions of the particular environment to which the S" recombinant bacterial cells are to be confined, or (ii) when the recombinant DNA molecules or viruses enter secondary bacterial host cells different from the specific S" primary bacterial host cells to which the DNA molecules or viruses are to be confined, or (iii) stochastically in such a manner that the 7a ervironmentally released recombinant bacterial cells will become eliminated at a predetermined rate as a result of an expression activating event occurring at random, the event being occasioned by periodic inversions of a region carrying a promoter regulating the expression or by reccmbinational excision of a sequence carrying a negatively regulatory element.
In the present context, the term "replicon" denotes a segment of nucleic acid, e.g. a bacterial plasmid, a bacterial chromosome, a procaryotic virus, a eucaryotic plasmid, a eucaryotic virus, a eucaryotic chromosome, eucaryotic mitochondria or eucaryotic chloroplasts.
In the present context, the term "cell" is intended to indicate bacteria and eucaryotic organisms such as unicellular organisms, e.g. yeasts of fungi, as well as multicellular organisms such as plants, animals or fungi, and cells derived from the tissues of multicellular eucaryotic organisms such as plants, animals or fungi.
It should be noted that the replicon may be so designed that it is able to bring about containment of primary host cells inside a defined environment as well as the replicon itself. When the replicon is harboured in one type of host cell, namely the primary host cells, the S' nucleotide sequence encoding the cell killing function 0* a should be regulatably expressed; this implies that when the primary host cell is subjected to certain conditions, e~g. as present with~,n a defined environment where its presence in ired either for reasons involving the production of a specific product or because it has other functions such as degradation of a pollutant, the nucleotide sequence encoding the cell killing function is not expressed, and the host cells remain viable and able to fulfil their function. However, when the primary host cells are subjected to a specific change in environmental conditions, the cell killing function is expressed to kill the primary host cells harbouring the replicon.
It may also be possible, as part of the process of manufazturing a *.specific product, deliberately to 'til the primary host cells present in, a fermentation vessel, by providing conditions under which the cell killing function is expressed. This procedure would be in 00 accordance with the requirements stipulated by certain health autho- ****rities that genetically engineered organisms must be killed before leaving the fermentation vessel.
princidle of the present invention of obtaining biological containnient by introducing a replicon carrying a nucleotide sequence encoding a cell killinS function in a primary host cell may make it possible to use a wild-type strain as the primary host cells, e.g.
.00.cells used in the industrial production of a biosynthetic product.
Goo* Thi; has the important advantage over the use of mutated, attenuated strains which have hitherto been employed as a safety precaution as 6:00 indicated above that it is not necessary to use specific growth con- 60#0 ditions such as specific media containing one or more particular growth factors required by the mutated organism for growth, thus reducirig the cost of the media employed and allowing a wider range of media components to be employed. Furthermore, the wild-type organisms may be better suited fo,: genetic manipulations or show improved fermentation properties, or they may be ones which produce a specific, desired biosynthetic product, but which have hitherto not been permitted for use in large-scale production.
Should the replicon become taken up by another type of host cell, the secondary host cell, which is usually a wild-type organism found in the natural environment to which the primary host cells or optionally KBM/KPJ/55/PA259B3D123 03 87 a medium in which the primary host cells have been grown are released, the nucleotide sequence encoding the cell killing function may be regulatably or constitutively expressed; in either case, the secondary host cell will be killed when expression of the cell killing function is no longer repressed or inhibited.
In some cases, the size of the DNA fragment comprising the nucleotide sequence coding for the cell killing function is not significant for its use according to the invention. However, it is often preferred 1C that the nucleotide sequence coding for the cell killing function is present on a small DNA fragment which is advantageous in view of the fact that the copy number of the replicon usually becomes lower when the total size of the replicon is increased. Accordingly, insertion of the DNA fragment coding for the cell killing function with the S 15 purpose of obtaining a biological containment does not lead to any substantial decrease in the yield of a desired biosynthetic product also encoded by the replicon when the DNA fragment encoding the cell killing function only comprises a short sequence. Advantageous nucleotide sequences coding for a cell killing function have a size of 1500 nucleotides or less, preferably 1000 nucleotides or less, such as 500-200 nucleotides or less.
One way according to the invention in which the expression of the cell killing function may be regulated is by providing a replicon in which the expression of the cell killing function is regulated at the level of transcription. The regulation at the level of transcription may be carried out in various ways, but the regulation preferably takes place by means of a promoter regulated by one or more factors.
These factors may either be ones which by their presence ensure expression of the nucleotide sequence encoding the cell killing function or may, alternatively, be ones which suppress the expression of said nucleotide sequence so that their absence causes the cell killing function to be expressed. Thus, when a primary host cell is released to the surrounding environment or when a recombinant DNA molecule is taken up by a secondary host cell, i.e. outside the defined environment of experiment or production or a specific restricted environment to which an organism has been released for a specific KBM/KPJ/5/PA25983D/23.03.87 purpose, the promoter and optionally its associated regulatory sequence is activated by the presence or absence of one or more of these factors to effect transcription of the nucleotide sequence encoding the cell killing function whereby a cell killing product is produced and the host cells are killed.
Factors regulating promoter activity may be selected from a wide variety of factors. Principally, the expression of the gene encoding the cell killing function may be determined by the environmental conditions or the physiological state of the cells, or by a cyclical or stochastic event. In the present context, the term "cyclical event" is understood to mean a cyclically recurring event causing changes in certain factors known to be factors useful in influencing the expression of the cell killing function such as temperature con- 15 ditions, changes in light intensity or hormonal changes. The term "physiological state of the cells" denotes factors such as cell density or growth phase of the cells.
Advantageous factors according to the invention, since these are most easily regulatable, are the presence or absence of a certain chemical in the environment or the physical conditions in the environment such as the temperature prevailing in the environment or other physical characteristics the intensity of the light in the environment).
Thus, it is possible to envisage containment systems in which the nucleotide sequence coding for the cell killing function is expressed when a certain chemical present in the fermentation medium of the •:00 primary host organism is not present in the environment to which the primary host cell is released, i.e. when primary host cells are accidentally released from, fermentation tanks to the surrounding environment, a factor required for the growth or survival of the cells is no longer present, or the factor may be exhausted from the medium with the same effect. The promoter regulating the transcription of the nucleotide sequence coding for the cell killing function may also be activated by a chemical which is not present in the fermentation medium of the primary host organism, but which is present in the environment in sufficient quantities to activate the promoter.
Similarly, the promoter may be one which is activated by a shift in temperature, which, in the containment principle involving the KBM IKPJ55/PA259 83DI2303.87 replicons of the invention, usually implies a shift from a higher temperature in a fermentation vessel or the intestinal tract to a lower temperature prevailing in the outside environment, or the intensity of light in that the promoter may be a promoter which is activated in the presence of light of a sufficient intensity, but inactive in the darkness prevailing in the fermentation vessel which is the defined environment of the primary host.
Where primary host organisms are ones which are released to the natural environment in a controlled fashion, e.g. to a restricted area of land or to the intestinal tract of an animal, the regulatable promoter may be one which is regulated by chemical means, i.e. by the presence or absence of a certain chemical in the environment of the *cells, but is most advantageously a promoter which is activated cyc- 15 lically, e.g. by changes in temperature, or by a stochastic event.
o The term "stochastic event" is intended to indicate an event which es ,occurs at random with a certain frequency per cell per generation or frequency per time unit which, according to the invention, results in the killing of the cells in which the activation of expression of the killing function occurs. The stochastic event may be occasioned by periodic inversions of the region carrying the promoter or excision of a sequence carrying a negative regulatory element. The effect of establishing cell killing by stochastic events is that the population of host cells will have a decreased competitiveness compared to populations of naturally occurring organisms.
It should be noted that the promoter used to initiate transcription too* of the nucleotide sequence coding for the cell killing function is preferably a promoter which is able to cause expression of the nucleotide sequence coding for the cell killing function in a wide range of host organisms in order to ensure a general applicability of the principle of the invention.
In case of a regulatable transcription of the cell killing function, the regulatory sequences may, for instance, be isolated from the bacterial operons involved in the biosynthesis of amino acids or from bacterial genes, the transcription of which is activated late in the KBM/KPJ[55IPA259B3Df23,0387 12 stationary growth phase or from bacterial genes involved in the synthesis of surface structures (fimbriae). Examples of suitable promoters are E. coll trp which is activated in the absence of tryptophan, the bacteriophage A PR and PL promoters controlled by temperature-sensitive regulating factors, the B. subtilis sporulation gene promoters which are activated during sporulation, and the E. coll and Salmonella fimbriae gene promoters which are activated stochastically.
In case of chemically regulatable promoters, the chemical, the presence or absence of which determines the activation of the promoter, may suitably be selected from carbon or nitrogen sources, metabolites, amino acids, nucleosides, purine or pyrimidine bases or metal ions. When the chemical is one which, when present, suppresses pro- 15 moter activity, it should preferably be one which rarely occurs in the natural environment in such concentrations that the promoter would not be activated when the host organisms are released to the natural environment. One example of a suitable promoter in, an organism such as E. coli is the trp promoter which is repressed in the presence of a sufficient concentration of tryptophan in the cell environment, but which is derepressed in the absence of sufficient quantities of tryptophan in the environment. A containment system using the trp promoter might therefore comprise a quantity of tryptophan in, a fermentation vessel to repress the promoter which is derepressed when the host organisms are released from the fermentation vessel to the environment which usually contains very low concentrations or no tryptophan at all.
Promoters which are activated stochastically, by periodic inversions of the promoter region (in the present context, this is also termed an "invertible promoter" and "inversional switch promoter") and which are useful for the purposes of the present invention, also include the hin, cin and gin promoters Plasterk et al., Proc. Natl.
Acad. Sci. USA 80, 1983, pp. 5355-5358; G. Mertens et al., EHBO J. 3, 1984, pp. 2415-2421; J. Zieg and M.I. Simon, Proc. Natl. Acad. Sci.
USA 77, 1980, pp. 4196-4200). One invertible promoter which has been found to be particularly useful due to its relatively small size is KBMIK")J155IPA5983D123.03 87 13 the fimA promoter which is one E. coli fimbriae gene promoter having the following sequence:
IRL
TTGGGGCCATTTTGACTCATAGAGGAAAGCACGCGAACAAACTTTTTCAGTTTATTGTTGGCTTAATA
TTCTATTGTTATCTTTATTTATAGATGTTTATATTGCATGAGGTGGTTTTGGAGAGAAGAATGAGGAA
GATGCGTCGAGCCACAGAAACGTTAGCTTTACATATAGCGGAGGTGATGTGAAATTAATTTACAATAG
AAATAATTTACATATCAAACAGTTAGATGCTTTTTGTCGTTTTTTAATATTTTTATGCTTGAGAAAAA
IRR
9
ATACGTAACTTATTTATGATATGGACAGTTTGGCCCCAAA
where the direction of transcription is from left to right and the 9 0 15 proposed promoter consensus sequences are indicated at -35 and Klemm, EMBO J. 5, 1986, pp. 1389-1393).
0 The activation (inversional switch) of this promoter is regulated by the gene products of two genes which for the present purposes have been termed the "on" gene and the "off" gene, the on gene product inducing a switch from off (inactive) to on (active), and the off gene 1 product inducing a switch from on to off. In a wild-type E. coli cell where the fimAgene and its associated promoter is present in one copy on the chromosome, the inversional switch occurs with a switching frequency of one cell/1000 cells/generation. It is, however, possible to regulate the frequency of the inversional switch (substantially) according to need/as required by regulating the dosage of expression of the on and off genes This may, for instance, be effected by means of suitable promoters inserted to transcribe into the on and off genes. The frequency of transcription initiation by these promoters will then determine the relative dosage levels of the on and off genes formed. Thus, when relatively large amounts of the off gene product are formed, the frequency of the inversional switch to the "on" position is lower than when relatively larger amounts of the on gene product are formed.
An alternative way of obtaining host cell containment according to the invention is to regulate the expression of the nucleotide sequence coding for the cell killing function at the level of translation.
KBM/KPJ,551PA25983D/23 03 87
I
14 This may be done by providing an antisense R.NA which inhibits the translation of the messenger RNA (mR1NA) specifying the cell killing function in the primary host cell. The expression of the nucleotide sequence coding for the antisense RNA may be either constitutive or regulated, for instance to allow for an increase in the copy number of the replicon carrying the cell killing function, the only requirement being that the strength of the promoter is such that sufficient quantities of antisense RNA are produced per unit time to completely inhibit the translation in the primary host cell of the mRNA specifying the cell killing function. When such a replicon is transferred to any type of secondary host cell in which the nucleo- O tide sequence coding for the cell killing function is transcribed and in which the product of that nucleotide sequence exerts a cell killing function, the absence in the secondary host cell of the nucleo- 0. 15 tide sequence coding for the inhibitory antisense RJNA results in a. translation of the mRNA specifying the cell killing function which in turn causes the death of the secondary host cell. For all practical purposes, this means that the expression of the nucleotide sequence coding for the cell killing function is regulated by the presence of the antisense RNA, the gene sequence of which is suitably present on a. :oanother replicon in the primary host cell.
In accordance with the invention, the expression of the antisense RNA may be regulated as described above for the promoter initiating transcription of the nucleotide sequence coding for the cell killing function by a defined environmental factor influencing the activity Sao* of the promoter from which the nucleotide sequence coding for the antisense RNA is transcribed. These environmental factors may be the same as those mentioned above, and comprise the presence or absence of a certain chemical in the environment, the temperature of the environment or the intensity of light in the environment of the primary host cell. Suitable promoters may, for instance, be isolated from bacterial operons involved in various catabolic pathways, in osmoregulation or in heavy metal resistance. Suitable promoters activated by a chemical are the Inc, ara and deo promoters which are activated by the presence of lactose, arabinose and pyrimidine nucleosides, respectively, and osrA which is induced in the presence of high concentrations of and the promoter for the mercury resistance gene K3M/KPJ155[PA259B3D[23.D3 V? of Tn501 which is induced by heavy metal ions. When the antisense RNA is present in the primary host cell, translation of the mRNA specifying the cell killing function is inhibited through interaction between the two RNA species. However, if the primary host cell is released from its intended environment, the environmental conditions determining the promoter activity will be changed so that the nucleotide sequence coding for the antisense RNA which has been dezigned to be expressed in a certain environment, will no longer be expressed, and the primary host cells will die. Similarly, if the S recombinant DNA molecule carrying the nucleotide sequence coding for the cell killing function is taken up by a secondary host mechanism, 0 no antisense RNA will be present to prevent production of the cell 0o killing product, and the secondary host cells will also die.
o 15 If the nucleotide sequence encoding all or part of the antisense RNA is inserted between directly repeated nucleotide sequences of a suf- Srt* ficient size, recombination between :he repeats will occur in recombinationally proficient cells with a frequency which to some extent can be experimentally determined by varying the lengths of the repeats and/or the distance between the repeats, leading to death of the cell when recombinational excision of the negatively acting regue o9 latory element takes place. Apart from this, expression of the anti- A sense RNA may also be regulated stochastically, for instance from an invertible promoter to bring about an inversional switch so that the antisense RNA is no longer expressed. This promoter may advano:0 tageously be the E. coli fimA promoter.
Nucleotide sequences encoding a cell killing function to be inserted in a replicon of the invention may be derived from a wide variety of sources such as bacterial plasmids, bacterial chromosomes, procaryotic viruses, eucaryotic plasmids, eucaryotic chromosomes, eucaryotic viruses, eucaryotic mitochondria or eucaryotic chloroplasts; they may also be produced synthetically according to standard preoedures. One example of a nucleotide sequence expressing a cell killing function is the hok gene from the parB region of the plasmid Rl, a region which has previously been shown to be involved in the stable maintenance of R1 within a bacterial population, cf. the disclosure of International Patent Application No. PCT/DK83/00086, Publication No.
KBM/KPJ155/PA25g83Df23 03 87 i 16 WO 84/01172. An important feature of plasmid stabilization by parB has been found to be the toxic effect of the hok gene product which is exerted if the translation of hok mRNA transcribed from the parB region of R1 is no longer suppressed by a hok mRNA hybridizing antisense RNA, sok, which is also transcribed from the parB region.
Loss of the R1 plasmid from a bacterial cell presumably leads to a change in the ratio between hok mRNA and sok RNA in the plasmid-free cell, presumably due to differences in the half-life of the two RNqA species, and ultimately to translation of hok mRA when insufficient concentrations of the inhibitory sok RA are present in the cell, 0 "which causes the death of the plasmid-free cell.
The nucleotide sequence coding, for a cell killing function may be 0~9009 •combined with promoter sequences such as those described above or 09 15 combined within the primary host cell with a sequence coding for an •antisense RNA as described above. These sequences may be derived from natural sources such as those mentioned above for the cell killing function, or may be produced synthetically.
This natural system is utilized in accordance with the principles of the present invention to design a system of biological containment o° utilizing the hok gene from R1 to confine recombinant organisms to a defined environment such as a fermentation vessel, to confine recombinant DNA molecules or viruses to specific host cells or host cells in a defined environment and finally to confine, in time and space, environmentally released recombinant organisms or vectors carrying recombinant genetic information.
In accordance with the present invention, host cell containment, such as containment of an E. coll host containing a recombinant DNA molecule such as a bacterial plasmid, may be obtained if the hok gene is inserted by standard recombinant DNA techniques together with DNA sequences containing a suitable promoter/regulatory region in such a way that the transcription of the hok gene is, at least partially, controlled by the promoter/regulatory sequences; if specific environmental conditions determined by the nature of the promoter/ regulatory sequences used are not met, the promoter/regulatory region is derepressed, resulting in transcription of the hok gene which in turn leads to cell death. Alternatively, it may be possible to use KBM/KPJ/55/PA25983D123.03 87 17 another form of regulation, for instance translational control as described above by using an antisense RNA inhibition of hok mRNA translation. Such a system may be devised so that the hok gene is constitutively expressed from the plasmid-borne gene while the translation of hok mRNA is counteracted by the synthesis of a properly designed antisense RNA, the gene coding for which is expressed from a regulated promoter as described above whose activity depends on the presence of one or more specific environmental factors. When these factors are no longer present, the promoter will no lo-nger be active, and therefore antisense RNA will no longer be expressed and no longer inhibit the translation of hok mRNA so that the toxic product is formed and the host cells are killed.
As described above, the presence of the parB region (containing the 5 15 hok and sok genes) on a plasmid stabilizes plasmid inheritance. This basic stabilization principle may be utilized according to the present invention by inserting a regulatable, preferably strong promoter upstream of the hok and sok genes in such a way that transcription from the promoter results in synthesis of the Hok protcin, because the hok m.RNA is expressed in excess relative to the inhibitory ,sok antisense RNA. Thus, under conditions where no transcription from the •inserted promoter takes place, the plasmids are stably maintained in the growing population of cells, while under different conditions, e.g. in the outside environment or in a secondary host cell, transcription of the inserted promoter takes place, and the cells are killed.
In accordance with the present invention, it is contemplated, in host organisms in which the R1 hok gene product will not be toxic, to employ sequences which are homologous to or related to the R1 hok gene from other organisms which will be active in those organisms according to the same principles as those established for the R1 hok gene product. The term "homology" is used here to denote the presence of any degree of complementarity between a given probe and the nucleic acid species being analyzed. The "degree of homology" is expressed as the fraction of complementary bases in a duplex nucleic acid molecule formed between a given probe and the nucleic acid species being analyzed. The minimum degree of homology which is detectable is a KBM/KPJ/55/PA25983D/23.03,87 18 function of the experimental conditions employed during hybridization and of characteristics of the probe and the nucleic acid species being analyzed. Such homologous sequences have been found within the chromosomal DNA of a large number of bacterial species (including gram-positive bacteria), within the mitochondrial DNA of the yeast, Tetrahymena pyriformis and within human cells as well as within pea chloroplast DNA, all of which have a DNA sequence related to the R1 parB sequence as determined 1h DNA/DNA hybridization. Thus, the invention also relates to replicons which carry a nucleotide sequence which is homologous to the hok gene.
j The present invention also relates to a primary host cell which harbours a replicon as described above. The cell may also comprise a nucleotide sequence coding for an antisense RNA inserted in the cell 15 genome as described above. The primary host cell may be selected from a wide variety of cells such as bacteria or eucaryotic organisms such as unicellular organisms, e.g. yeasts or fungi, cells derived from the tissues of multicellular organisms such as plants, animals or fungi.
S In a further aspect, the present invention relates to a nucl&otide 0** sequence which encodes a cell killing function. The nucleotide sequence may further comprise a sequence regulating the transcription *00 of a sequence encoding the cell killing function. The regulatory sequence may be a promoter with the features and the functions described above.
The invention further relates to a iucleotide sequence which encodes an antisense RNA capable of ini..oiting the translation of an mRNA specifying a cell killing function. As described above, this nucleotide sequence is preferably inserted into the cell on another replicon. The nucleotide sequence coding for the antisense RNA may either be expressed constitutively, or its transcription may be regulated from another nucleotide sequence which, for instance, may be a promoter regulated by one or more factors is described above.
In an important aspect, the present invention relates to a method of containing a biological system, which comprises introducing into the biological system a nucleotide sequence encoding a cell killing KBMIKPJ155/PA259830123.3 87 function which sequence is regulatably expressed under certain conditions, and which is regulatably or constitutively expressed under different conditions under which the biological system is maintained.
In the present context, the term "biological system" refers to any structured biological material capable of reproduction such as nucleic acid (DNA or R.NA) sequences, infectious agents such aE viruses, bacteria or unicellular eucaryotic organisms, e.g. yeasts or fungi, or multicellular organisms such as plants, insects, etc., as well as cells derived fromi the tissues of multicellular organisms.
The term "containment" indicates that the spread of the biological system from a specific restricted environment where specific conditions prevail and where its presence is desired, is limited or that *ago.:the existence of the biological system is limited to a certain period 15 of time.
.,*The containment is performed by maintaining the biological systems under certain conditions which ensure that the cell killing function is not expressed. These conditions may be intra- or extracellular, and may comprise the phenotype and physiological state of the host organisms, host-vector relationships, the environmental conditions prevailing for the biological system, or a cyclical event. When any one of these conditions is changed, the cell killing function may be regulatably or constitutively expressed so as to kill the host organism carrying the nucleotide sequence encoding the cell killing function. Additionally, the conditions comprise stochastic events.
When the biological system comprises cells, these may be contained under defined environmental conditions by inserting into the cells a nucleotide sequence containing a sequence encoding a cell killing function and a sequence regulating the transcription of the sequence coding for the cell killing function, or, separately, a nucleotide sequence encoding a cell killing function and a nucleotide sequence encoding an antisense RNA inhibiting, when expressed, the traxrslation of the mRNA specifying the cell killing function, as described above.
In accordance with the principles of the present invention, the nucleotide sequence coding for the cell killing function is preferably carriod on a replicon. The nucleotide sequence coding for the KBMIKPJ155/PA259B3Dt23 03.87 8*1 antisense RNA may be inserted in the cell on another replicon. The cells contained according to the method of the invention may be selected from bacteria or eukaryotic organisms.
Apart from providing containment of host organisms to exist only under defined conditions, the containment method according to the present invention also provides containment of a replicon to a primary host cell by inserting into the replicon a nucleotide sequence encoding a cell killing function, the nucleotide sequence being regulatably transcribed from a regulatory sequence which is regulated by one or more factors, at least one of which is encoded by a nucleotide sequence present exclusively in the genome of the primary host cell.
15 Alternatively, the replicon may be contained to a primary host cell by inserting into a replicon a DNA fragment from which is constitutively expressed an mRNA encoding a cell killing function, the translation of which is inhibited by an antisense RNA transcribed from another nucleotide sequence inserted into the primary host cell, the nucleotide sequence coding for the antisense RNA being constitu- St.ively expressed or expressed from a promoter regulated by one or 0 more factors such as one of the factors described above. The replicon may also be so designed that, apart from being contained to a primary host cell, it is also contained to cells of the same species and a definable range of secondary host cells, i.e. cells in which the factors responsible for regulating the expression of the cell killing function are also present, As will be apparent from the above disclosure, the biological containment method of the present invention is a highly versatile method which is applicable to a wide range of host cells and replicons to allow an active biological containment not only of attenuated organisms but also of wild-type strains intended either for production of a specific biosynthetic product or for release to the natural environment (the outside environment or the intestinal tract of an animal); furthermore, by the present method, active containment of a given replicon to a specific host is obtained.
KBM/KPJl55tPA259830[23 03.87 21 It is further contemplated that the principle of the present invention involving a replicon carrying a nucleotide sequence encoding a cell killing function which is expressed under certain predefined conditions, may be utilized in the preparation of live vaccines. Such vaccines, based on non-pathogenic attenuated) strains of otherwise pathogenic microorganisms or viruses have been known for a long time. Prominent examples of agents used in live vaccines are the vaccinia virus, the attenuated poliovirus (derived by Jonas Salk) and the Bacille Calmette-Guerin (attenuated Mycobacterium tuberculosis).
Live vaccines are advantageous in that they confer a prolonged, if not lifelong, immunity against the pathogenic agent in question.
.o Furthermore, they are generally cheaper and easier to administer than vaccines based on inactivated (killed) pathogens or purified pro- Streins.
*0 However, the use of live vaccines has been limited since it is often difficult to obtain the right combination of attenuation, viability and relevant immune response. Furthermore, the deliberate release of genetically engineer,,d bacteria to the environment, whether external S 20 or internal, is currently not allowed in any country for reasons of public concern as to the possible long-term environmental impact, especially the risk of permanent establishment of the genetically engineered bacteria in the environment, The present invention has made it possible to circumvent the problems associated with the use of live vaccines by introducing in a suitable host organism (a primary host cell as defined above) a nucleotide sequence encoding a cell killing function, the expression of which is determined by a stochastic event; a nucleotide sequence encoding a desired epitope for immunization (antigenic determinant) from a pathogenic ag:nt; as well as means for transporting the epitope, when expressed, to the outer surface of the cell, i.e. translocating it across the cellular membrane systems. The nucleotide sequence encoding the cell killing function and the nucleotide sequence encoding the epitope may be present on the same replicon or on separate replicons. In this connection, the cell killing function may any one of those indicated above. A currently preferred cell killing function is the one encoded by the R1 hok gene.
KBM1KPJ/55IPA2593D/23 03 87 S22 The host cell may be any organism which is suited for being administered to a mammal, e.g. a human being, to be immunized by the vaccine. Conveniently, the host cell is provided with genetic information for the expression of adhesins, for instance a bacterium which, in nature, expresses adhesins by means of which they adhere to the surface of epithelial tissue. (An adhesin may be defined as a structure responsible for adhesion of the bacteria to receptors present on epithelial surfaces.) This is an important property of the host cell since it enables it to establish itself in a specific environment particularly advantageous for immunization purposes, e.g. where the type of the immune response is optimal, i.e. secretory IgG and IgA, thus providing a superior protection of epithelial surfaces. It should be noted that, in this context, the term "environment" defined above as a specific, restricted environment where specific conditions 15 prevail should be understood to include tissues and epithelial surfaces in the body as well as cavities defined by such surfaces, such as the gastrointestinal tract, oral and nasal cavities, respiratory tract, urinary tract and reproductive organs. It is interesting to note that these areas coincide with those first exposed to infectious 20 20** (pathogenic) agents. It is at present contemplated that the vaccine may most conveniently be administered as an oral vaccine, and consequently the host cell should in this case be one which is able to I establish itself in the intestines and compete successfully with the numerous organisms already present in it.
Thus, examples of suitable primary host cells may be selected from Encerobacceriaceae, e.g. E. coll, or lactic acid bacteria, e.g. Lacrobacillus acidophilus, Vibrionaceae and Pseudomonades. The organism, however, need not necessarily be one which is inherently capable of establishing itself in the intestines. One may also select a host organism according to other criteria such as its suitability for being subjected to recombination techniques or fermentation procedures, and provide it, by standard DNA recombination techniques, with genes expressing adhesins, should the organism so selected lack such functions enabling it to adhere to epithelial tissue.
The epitope for immunization may be introduced in the primary host cells by inserting a nucleotide sequence encoding the epitope into a KBMIKPJf55/PA259a30/23.C0Y87 replicon in accordance with standard recombination techniques which are well known in the art (as described in e.g. Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, 1982).
Thus, the replicon carrying the nucleotide sequence which codes for the epitope should further be provided with a suitable promoter, ribosomal binding site, translational initiation codon (ATG), to ensure expression of the epitope on the surface of the host cell. An essential feature of the vaccine according to the present invention is that the epitope should be presented on the surface of the host cell in order to provoke an appropriate immune response in the mammal to be immunized. If the epitope is not naturally transported to the surface of the host cell, tl-e nucleotide sequence encoding the epi- 6e "tope may be inserted into a gene coding for a naturally occurring cell surface protein, such as a fimbrillin (the structural subunit of S fimbriae), to express a fusion protein which is translccated to the O o, cell surface.
As indicated above, expression of the cell killing function is, in the case of a vaccine according to the invention, determined by a stochastic event which, as explained above, will typically be brought about by a periodic inversional switch vf a promoter to transcribe into the nucleotide sequence encoding the cell killing function, i.e.
a promoter subjected to an inversional switch from inactive to active o" "'with a frequency which may, for instance, be regulated by the respec- *5oo tive levels of expression of an on and off gene, as explained above with reference to the fimA promoter. It may be expected that similar promoters are regulated by similar mechanisms. This makes it possible to adjust the frequency of the inversional switch so as to cause maintenance of a sufficient dosage level of the epitope in question for the period of time required to obtain a satisfactory immunization of the animal to which the vaccine is administered. Alternatively, the stochastic event may be brought about by a periodic inversional switch of a promoter transcribing a nucleotide sequence encoding an antisense RNA inhibiting the translation of the mRNA specifying the cell killing function, as explained above. A currently preferred promoter is the E. coli limA promoter. Apart from this, expression of the cell killing function may be achieved by recombinational excision of the antisense RNA, as explained above. The genes encoding the KBM/KPJ'55/PA25983D/23,03 87 stochastic transcription mechanism the promoter and optionally the on and off genes) of the cell killing function are conveniently inserted in the host cell chromosome rather than on a plasmid, for instance by means of bacteriophages, in order to avoid loss of said genes as a result of loss of the plasmid from the cell. By regulating the frequency of the inversional switch, a certain predetermined percentage of the host cells will be killed in each generation. This ensures that the cell population cannot compete with the natural bacterial flora of, the intestines over a longer period of time.
*a SBy allowing the organism to become established in the intestinal environment for such a predetermined period of time before the cell killing function is expressed, it is possible to ensure that the 15 dosage of the epitope to which the body to be immunized is exposed a will be sufficiently large and last for a sufficient period of time to provide an adequate immunization. It is estimated that a satisfactory immunization may be obtained if the host cells are present in sufficient amounts in the defined environment for a period in the 20 range of 15-30 days, dependent on the nature and activity of the 4 I epitope expressed from the host cell.
In principle, the epitope expressed by the primary host cell may be an epitope from any pathogenic agent against which it is desired to obtain immunity. Such pathogenic agents comprise viruses, bacteria or eukaryotic organisms such as fungi or protozoans. Examples of viruses from which epitopes to be used in connection with the live vaccine of the invention may be obtained, are viruses belonging to the families adenoviruses, herpetoviruses, papovaviruses, myxoviruses, orthomyxoviruses, paramyxoviruses, poxviruses, rhabdoviruses, arboviruses, or reoviruses. Other virus families of interest in this connection are the picornaviruses and retroviruses. Specific examples of viruses are influenza virus, parainfluenza virus, measles virus, mumps virus, rubella virus, rhinovirus, rabies virus, HTLV I and II virus, HIV viruses, hepatitis B virus and other viruses causing hepatitis, poliovirus, rotavirus, reovirus, Epstein-Barr virus, Herpes simplex I and II virus, cytomegalovirus, human papilloma viruses of various types, etc.
KBM/KPJ/55/PA25983D/23 03.87 Examples of bacteria from which epitopes to be used in connection with the live vaccine of the invention may be derived, are enteric bacteria, e.g. pathogenic strains of Escherichila coll, Salmonella spp. such as S. typhlmurium, S. typhi, S. schotrmallerl and S.
choleraesuis, Vibrio cholerae, Shigella dysencerlae; Corynebacterium diphreriae; Mycobacterium tuberculosis; Nelsseria spp. such as N. gonorrhoeae, N. meningidiris and N. cararrhalis; Pseudomonas app. such as P. neruginosa; Yersinia spp. such as Y. pestis; loraxella spp.
such as H. bovis; Staphylococcus spp. such as S. aureus; Streptococcus spp. such as S. pneumoniae and S. pyogenes; Bordecella spp.
such as B. pertussis and B. bronchiseptica; Hemophilus influenzae; 9 Treponema pallidum; and Clostridium spp. such as C. botulinum and C.
4.4. tetani.
*44444
A
Examples of pathogenic eukaryotic organisms, epitopes of which may be used in connection with the live vaccine of the invention, are fungi, 04 e.g. Blascomyces dermacitidis, Histoplasma capsulaum, Coccidioides immicis, "ryptococcus neoformans and Candida albicans; protozoans, e.g. Giardia lamblia; Trypanosoma spp. such as T. gambiense, T.
rhodesiense and T. cruzi; Leishmania spp. such as L. donovani and L.
Stropica; Entamoeba histolytica; Naegleria spp.; Plasmodium spp. such .4.4 as P. falciparum, P. vivax, P. malariae and P. ovale; and Isospora spp. such as I. belli and I. huminis.
*4.
It is further contemplated that it will be possible to provide a combination vaccine against a variety of pathogenic agents by introducing, in the host cell, two or more nucleotide sequences encoding epitopes from different pathogenic agents in such a way that the epitopes are expressed as fusion proteins together with a fimbrillin, substantially as described above or transported to the cell surface by other means, e.g. due to the presence of a signal peptide, to provide a combination vaccine. In this case, too, the epitopes will be exposed on the surface of the host cell as parts of different fimbriae. An important advantage of this embodiment of the invention is that immunization may be effected simultaneously against a variety of pathogens, only a single administration of the vaccine being required.
KBMIKPJ/55/PA259830/2303.87 In order to avoid any risk of contaminating the outside environment the environment outside the animal to be immunized with the vaccine of the invention) with live primary host cells which pass from the defined environment in the animal in question where their presence is desired to the outside environment, for instance with the faeces in case of an oral vaccine, it should be possible to kill the host cells once they have passed into the outside environment. This may be accomplished by inserting an additional promoter (apart from the stochastic promoter) into the host cell, which promoter, when activated, transcribes into a nucleotide sequence encoding a cell 00 S.killing function, thereby causing death of the host cell or any other S* cell (secondary host cell) which comes to harbour a replicon carrying the nucleotide sequence which codes for the cell killing function. In one embodiment, the additional promoter, when activated, transcribes into the same nucleotide sequence encoding a cell killing function as the one the expression of which is determined by a stochastic event.
It would also be possible to insert this additional promoter to transcribe, when activated, into another nucleotide sequence encoding a second cell killing function (which may be identical to the first 20 2 0 one) inserted on the same or another replicon as the nucleotide sequence coding for the first cell killing function. Activation of this additional promoter advantageously occurs as a result of, for '.instance, a decrease in temperature to below body temperature (about 37"C) or by chemical induction, as explained above.
*In this way, the non-viability in the outside environment of genetically engineered bacteria used in the live vaccine of the invention is ensured. In cases where the nucleotide sequence encoding the cell killing function and the gene coding for the epitope are present on the same replicon, the accidental spread of the recombinant replicon to secondary host cells, in this case usually wild-type organisms found in the outside environment, is substantially prevented. The presence of the nucleotide sequence coding for the cell killing function and the gene encoding the epitope on the same replicon therefore constitutes a preferred embodiment of the vaccine of the invention.
KBM1KPJ55/PA259B3D123.D3.87 I I I 27 Apart from being useful in the preparation of live vaccines as described above, the principle of the present invention is further contemplated to be applicable to the development of vaccines based on killed pathogens. Until now, such vaccines (in the following also termed "killed vaccines") have been known to be less efficient than live vaccines. Without wishing to be limited to any particular theory, the present inventors believe that the diminished efficiency of killed vaccines may be ascribable to the way in which the pathogenic agents used in the vaccines are inactivated, which is usually by heat treatment or chemical inactivation with formaldehyde. This is thought o. 6e to denature the antigen structures of the pathogen in question, giving rise to a less adequate immune response when the vaccine is administered and hence a less thorough immunization.
3 15 This problem may be circumvented by utilizing the measures of the present invention. Accordingly, it may become possible to produce a killed vaccine which comprises a pathogenic agent carrying one or more nucleotide sequences encoding a cell killing function, which pathogenic agent has been killed by the expression of one or more of 20 said nucleotide sequences. In this way, the antigen structures of the pathogen will remain intact so that, theoretically, a more efficient immunization of the mammal to which the killed vaccine is administered will be obtained. The pathogen employed in the killed vaccine may be any one (or a combination) of those listed above as providing the genes coding for epitopes to be introduced in live non-pathogenic Shost cells for use as live vaccines.
Because of a low but definite risk of mutations affecting the killing function, this type of vaccine may only be of practical relevance in the field of veterinary medicine.
The expression of the cell killing function may be regulated at the level of transcription, e.g. by means of a regulatable promoter. Any one of the promoters discussed above may be employed. Alternatively, the expression of the cell killing function may be regulated at the level of translation as discussed above, e.g. by means of an antisense RNA inhibiting the translation of the mRNA specifying the cell killing function.
KBM/KPJIS5/PA259830123 03 87 In a specific embodiment of the killed vaccine of the invention, the vaccine, when administered, comprises live pathogenic agents into which has been inserted a cell killing function which is activated in the body as a result of the environmental changes to which the pathogens are subjected, e.g. changes in temperature, pH or the presence of certain chemicals.
The vaccines of the invention (live or killed) may be formulated for oral or parenteral administration in accordance with usual practice in the field of human and veterinary medicine together with a pharmaceutically or veterinarily acceptable carrier or vehicle.
For oral administration of a live vaccine, it is preferred to protect the host cells against the gastric environment which tends to be de- 15 trimental to the viability of, many bacteria contemplated to be useful for the present purpose. This protection may, for instance, be Sprovided in the form of an enteric coating.
1. Gramnegative and grampositive bacteria 20 Suitable replicons for genetic engineering in bacterial host cells may for example be plasmids capable of replicating in Enterobacceriaceae, e.g. pBR322 or R1 runaway replication plasmids (European Patent Application No. 83305438.0, Publication No. 0 109 150), or capable of replicating in gramnegative bacteria in general, e.g.
plasmids derived from RSF1010 (Bagdasarian et al., Gene 16, 1981, pp.
237-242), or plasmids capable of replicating in grampositive bacteria such as B. subtilis, e.g pC194 and pUB110 (Lovett and Keggins, Mech.
in Enzymol. 68, 1979, pp. 342-357). In order to biologically contain such bacterial plasmids or cells containing such plasmids according to the invention, the DNA fragment or DNA fragments comprising the R1 hok region can be inserted into the replicon in such a way that the R1 hok expression is governed by regulatable promoter(s) known to be recognized in the host cell in question, such promoters being either natural promoters or synthetic promoters, such as the E. coli trp promoter or the B. subcilis promoters governing expression of certain genes in stationary phase cells. As shown in the Examples, the R1 hok gene product is toxic in a wide range of gramnegative bacteria as well as in B. subtilis (cf. Example 16) and hence probably in all KBM/KPJ/55/PA25983D/23 03.87 1 29 grampositive bacteria. If the R1 hok gene product is not lethal to the host cell in question a definite requirement in order to establish the biological containment system an RI hok homologous sequence can be isolated from either the genome of the host cell in question (or a closely related bacterial species), from a plasmid naturally occurring in the host cell in question (or a closely related bacterial species), or from a bacterial virus and subsequently tested for hok-like activity in a manner similar to that described in the Examples for one E. coli chromosomal homologue of R1 hok.
Establishment of a biological containment system for, fermentase 0 ,tion purposes involving the use of R1 hok or a nucleotide sequence homologous to the hok in bacteria thus includes: selection of replicon and host cell; insertion into the replicon of the proper sequence comprising R1 hok or a nucleotide sequence homologous to the hok which is not expressed in the selected host cell under defined con- 44 *O ditions; insertion into the replicon of a gene or genes encoding the useful product(s) to be produced in large quantities; introduction of the recombinant replicon into the bacterial host cell by standard techniques of bacterial transformation; cultivation of the replicon- Scontaining host cells in a culture medium supplemented with the necessary nutrients including any exogeneous factor required for the containment system in question for the number of generations required see* to reach the desired cell concentration; and finally, harvesting of the cells and the medium from either of which the product in question can be isolated. If the cells are accidentally released to the out- 4.4.
side environment, the promoter regulating the transcription of the hok or hok-like sequence will be activated, and the cells will be killed as a result of the expression of the hok or hok-like product or the promoter regulating the transcription of the antisense RNA is inactivated. Similarly, if DNA from the cells is transferred to other cells (secondary hosts), the promoter regulating the transcription of the hok or hok-like sequence is activated, and the cells are killed, which is also the case when the hok or hok-like sequence is regulated by an antisense RNA, in cells lacking a nucleotide sequence coding for the antisense RNA.
KBMIKPJ/551PA259B3023 03 87 2. Yeast cells The technical exploitation of recombinant DNA techniques in eucaryotic systems may be desired to obtain such post-translational modifications (specific proteolytic cleavages, glycosylation, etc.) of primary (eucaryotic) gene products that are not carried out in bacteria or are, at best carried out in a suboptimal manner. A widely used eucaryotic organism is the yeast Saccharomyces cerevisiae in which a naturally occurring plasmid, the 2v replicon, has been adapted as a vector for expression of genes not naturally related to the 2U replicon in S. cerevisiae. As described above, it is possible to isolate or construct a sequence to be inserted into a yeast S"replicon, e.g. the 2p replicon, utilizing the principle of the R1 hok biological containment mechanism for containing yeast cells and 15 plasmids.
Although the native promoters of R1 hok are not likely to be utilized in S. cerevisiae cells, the conservation of hok-like sequences in organisms which are only distantly related and the toxicity of R1 Hok to grampositive as well as gramnegative bacteria makes it reasonable to assume that the product of the R1 hok gene and of genes related to R1 hok relB-orf3 or parl or other genes originating from bacterial genomes which show a homology at the sequence and functional level to R1 hok or similar genes isolated from bacterial plasmids) 2 should be tested for their ability to kill yeast cells, such as S.
cerevisiae. In practice, this will entail isolating the coding region a# of the hok gene or hok-like gene and linking the coding region to a suitable regulatable yeast cell promoter, the resulting replicon being finally introduced, by standard methods, into yeast cells, and the effect of expression of the hok or hok-like gene is investigated.
If cell death ensues, a usable hok or hok-like gene has been identified.
Alternatively, sequences identified in DNA from yeast cells with homology to parB or relB-orf3 can be isolated, linked to v proper yeast cell promoter, inserted into the 2p replicon and foll'wing introduction of the recombinant replicon into S. cerevisiae, tested for their ability to kill the cell. From a hok gene or a hok-like gene shown to be toxic upon expression for e.g. S. cerevisiae, a KBMIKPJ(551PA25983Dt23 03 87 biological containment system identical to or analogous with the Rl hok system can be generated by imposing a regulatory loop (a regulatable promoter or a gene encoding an antisense RNA regulated by a proper yeast promoter) as previously discussed in the description of the general strategy. The resulting regulatable yeast hok sequence or hok-like sequence can be inserted in any yeast replicon, e.g. the 2p replicon or derivatives thereof into which genes not naturally related to 2p have been inserted with the intention of obtaining expression of the inserted genes, with the purpose of biologically containing cells and/or recombinant replicons. The replicon can be introduced into yeast cells, e.g. S. cerevisiae cells, by transformation or protoplast fusion, and following selection of cells carrying the replicon, these can be further grown into a large-scale culture in the appropriate culture medium supplemented with the neces- .U 15 sary nutrients as well as any exogeneous factor(s) required for the containment system in question. The culture of cells harbouring the replicon in question is then harvested, and any useful product expresed from the replicon can be isolated from either the yeast cells or the culture medium, depending on the gene and the gene product in 20 question. If the cells are accidentally released to the outside en- *oe vironment, the promoter regulating the transcription of the hok or hok-like sequence will be activated, and the cells will be killed as a result of the expression of the hok or hok-like product or the promoter regulating the transcription of the antisense RNA is inactivated. Similarly, if DNA from the cells is transferred to other o: cells (secondary hosts), the promoter regulating the transcription of the hok or hok-like sequence is activated, and the cells are killed, which is also the case when the hok or hok-like sequence is regulated by an antisense RNA, in cells lacking a nucleotide sequence coding for the antisense RNA.
3. Mammalian cells The requirement for specific post-translational modifications may necessitate the expression of certain eucaryotic genes in mammalian cells, i.e. of human or animal origin, rather than in bacteria or yeast cells. Replicons that can be used as cloning vectors in eucaryotic cells are derived from chromosomes (ars replicons) from DNA KBM/KPJ/55/PA25983D/23 03 87 viruses, e.g. SV40 and bovine papilloma virus, or from RNA viruses, e.g. retroviruses. The two DNA viruses mentioned can be maintained in a plasmid state in infected cells while most retroviruses (RNA-containing viruses) need to be genetically modified in order to exist as freely replicating DNA molecules rather than as chromosomally integrated copies of the viral DNA genome. It may be anticipated that large-scale cultures of cells containing the above-mentioned replicons into which a gene or genes not naturally related to the replicon has been inserted with the aim of obtaining expression of a useful product, will need to be contained as discussed in the section on *a S procaryotic vectors.
In a manner similar to that described under the yeast cell system, a S• sequence containing a regulatably expresed R1 hok gene or a nucleo- 15 tide sequence homologous to hok can be constructed, once a gene has been identified that exerts a hok or a hok-like effect in the host cell in question. A first step would thus be to insert the coding sequence of known hok or hok-like genes, irrespective of their origin, from bacterial plasmids, bacterial genomes or yeast cell 20 genomes, into a replicon capable of replicating in the host cell in question in such a way that expression of the hok gene is obtained upon induction of expression, i.e. supplemented with all necessary regulatory sequences as is required for expression of a gene in the host cell in question. A promoter sequence suitable for insertion 25 upstream of the hok or hok-like gene would be the mouse mammary tumor 0* virus LTR (long terminal repeat sequence) which is inducible with steroid hormones or the region controlling the expression of the metallothionein gene which is inducible with metal ions. If cell death ensues upon induction of transcription, a hok gene or a hok-like gene has been identified for the host cell in question, and from this hok or hok-like gene, a replicon biological containment system can be constructed by a regulatory loop at the transcriptional/translational level as described above.
S If none of the available hok or hok-like genes of bacterial or yeast origin exert a toxic effect in the r mmalian host cells in question, novel hok-like sequences may be isolated from a mammalian ge'nome the sequences discovered in Terrahymena mitochondrial DNA and KBM!KPJISS/PA25983D/23 03 87 in human cellular DNA) and subsequently tested for hok-like activity when properly expressed. The recommended strategy for the detection of novel hok-like sequences has been outlined above.
The use of the hok-like containment mechanism in mammalian cells will thus include: selection of replicon, e.g. a retroviral vector and selection of host cells which will depend upon the actual sequences governing the expression of the inserted hok-like nucleotide sequences; insertion into the replicon of such foreign genes which code for S. 10 the useful product(s) to be produced into the replicon; introduction of the recombinant replicon into the mammalian cell type in question by standard techniques of DNA transfection or micro-injection; selection of cells containing the replicon in question; growth of the cells in a culture medium adapted for the cell type in question by 15 the addition of necessary nutrients and growth factors as well as any exogeneous factor required for the containment system in question with the intention of obtaining a large-scale culture of cells expressing the gene encoding the useful product; and, finally, the culture can be harvested and the useful product isolated. If the 20 cells are accidentally released to the outside environment, the pro- *o 0 moter regulating the transcription of the hok or hok-like sequence o will be activated, and the cells will be killed as a result of the expression of the hok or hok-like product or the promoter regulating the transcription of the antisense RNA is inactivated. Similarly, if 25 DNA from the cells is transferred to other cells (secondary hosts), the promoter regulating the transcription of the hok or hok-like sequence is activated, and the cells are killed, which is also the case when the hok or hok-like sequence is regulated by an antisense RNA, in cells lacking a nucleotide sequence coding for the antisense
RNA.
While particular types of replicons adapted for particular types of cells have been discussed in the detailed sections above, the general principle of utilizing the containment mechanism of the invention is the same, irrespective of the type of replicon and cell harbouring the replicon: the establishment of a host killing function and a regulatory function adapted to regulate the expression of the cell killing function in cells harbouring the replicon so that, under KBMKPJ[551PA25983D/23.03 87
S
34 conditions where the cell killing function is expressed, the host cell is killed.
S DESCRIPTION OF THE DRAWINGS Reference is now made to the drawings, where Fig. 1 shows a deletion mapping of the parB+ region. The localization of the yarA+ region and the parB+ region within the EcoRI-A fragment of plasmid R1 are shown as black boxes. Restriction enzyme sites in the EcoRI-A fragment are as described in International Patent Application No. PCT/DK83/00086, Publication No. WO 84/01172. The parB region is located within the 1.9 kb PsrI fragment bordered by coordinates 15.0 to 16.9. The parB+ region was furthei mapped to the right- 15 hand 580 bp of an 880 bp Rsal fragment. The cross-hatched region ina" dicates the minimal parB+ region. The position of the hok and sok genes within the 580 bp parB+ region is also shown. A Bglll-SalI fragment containing the XpR promoter and the c1857 allele of the X repressor gene was inserted into pBR322 derivatives carrying various 20 parts of the parB fragment. The position of the inserted fragments and the direction of transcription from ApR are shown below the map of the parB region (arrows). The XpR promoters In pKG633, pKG634 and 9* pKG341 read from left to right into the parB+ region whereas the XpR promoter in pKG171 reads from right to left. Restriction enzyme sites are shown as E (EcoRI), B (Ball), B 2 (BglII), S (Sall), R (RsaI), and a P (Psrl).
Fig. 2 shows a map of plasmid pPR95 (13 kb). copA, copB represents replication control genes of plasmid R1; repA represents a gene required for R1 replication; ori is the origin of replication; bla denotes a gene conferring ampicillin resistance on plasmid-carrying cells; parB represents the R1 derived maintenance function encoding the hok and sok genes; deo-lacZ denotes a translational fusion between the deoC gene and the lacZ gene. lacZ,Y,A represent the lac operon; c1857 represents a gene which codes for a temperature sensitive A repressor controlling XpR promoter activity. Arrows denote direction of transcription. The black bars denote the extension of KBM/KPJ/55jPA25983D,'23 03 87 1 the various genes. Restriction enzyme sites are shown as Sail BglIlI (B 2 BamHI and EcoRl Fig. 3a and 3b shows the nucleotide sequence of the parB+ region. The 5' end of the upper DNA strand is positioned at right. The numbering of the bases are in accordance with the coordinates of the parB+ region in Fig. 1. Ter denotes the stop codons of the only three open reading fr:uf- present in the nucleotide sequence consisting of more than 50 fet corresponds to the start codons of the same three open reading frames. The amino acid sequence of the hok gene a ,product, starting at position +304, is shown below the DNA sequence a aa amino acid abbreviations are standard nomenclature. The L.derlined sequences designated and is the promoter structure for the sok gene.
Lo S a Fig. 4. shows host cell killing after XpR induced activation of the hok gene. Strain JC411 containing either pKG634 (closed symbols) or pKG171 (open symbols) was grown exponentially in A+B minimal medium supplemented with casamino acids at 30*C. At time zero, the temperature was shifted to 42'C and growth of the cultures was followed as 20 a 0D 450 and viable counts on selective medium (LB plates contaiaing u g/ml ampicillin).
S* a.
OIL Fig. 5 is a photograph of cells sampled 1 hour after shift of strain JC411 (pKG634) to 42°C. Arrows point at cells with clearly changed 25 morphology. Cells with a normal morphology are also seen. Magnificamorphology. Cells with a normal morphology are also seen. Magnifica- Sa tion x 2000.
Fig. 6 shows the suppression of host cell killing. Strain JC411 containing either pF634 alone (closed symbols) or pF634 plus pPR633 (open symbols) was grown exponentially in A+B minimal medium supplemented with casamino acids at 30"C. At time zero, the temperature was shifted to 42*C and growth of the cultures was followed by measuring the optical density (OD 4 50 and viable counts on selective aedium (LB plates containing 100 ug/ml kanamycin).
Fig. 7a is a comparison of the amino acid sequences of the hok gene product and the relB-orf3 gene product. Conserved amino acids are KBM'KPJ/551PA259B3D/23 03.87 with bold face types; amino acids representing conservative changes are underlined.
Fig. 7b shows the alignment of the nucleotide sequences of parB and orf3 of the E. coll relB operon (Bech et al., The EMBO Journal 4, 1985, pp. 1059-1066). The parB sequence is the upper strand, relBorf3 the lower, coordinates as in Fig. 3. Vertical bars indicate conserved nucleotides. Numbers in brackets are coordinates of the relB nucleotide sequence as given by Bech et al. The two sequences are aligned so that the start codons of the two reading frames are at the same position this is indicated with Met at position +304. The *e termination codons of the two reading frames are indicated with Ter at position +460.
0 0 15 Fig. 8a shows 0.75 ug of EcoRI-restricted total DNA from strains of o 15 E. coli analyzed by filter hybridization using the R1 parB probe.
Lane 1: Rldrd-19; lane 2: R100; lane 3: R386. These lanes were exposed for 30 minutes. Lane 4: RP1; lane 5: R6-K; lane 6: plasmid-free E. coll. These lanes were exposed for 5 hours. Sizes of relevant 0 20 fragments are given in kilobases.
e* Fig. 8b shows 0.75 ug of EcoRI-restricted total DNA from strains of So" E. coli analyzed by filter hybridization using the relB-orf3 probe.
Lane 1: R100; lane 2: R386; lane 3: plasmid-free E. coli. Time of exposure: 3.5 hours. Sizes of relevant fragments are given in kilo- S 25 bases.
Fig. 9 shows 0.5-0.75 Pg of EcoRI-restricted total DNA from various bacteria analyzed by filter hybridization using the R1 parB probe.
The autoradiogram was exposed for 17 hours. Two different photographic exposures of the same autoradiogram are shown: Lane 1: Salmonella cyphimurium (not discussed in the text); lane 2: Serratia marcescens; lane 3: Pseudomonas fluorescens; lane 4: Pseudomonas putida; lane 5: Proteus vulgaris (not discussed in the text); lane 6: Escherichia coll; lane 7: Bacillus subtills; lane 8: Bacillus circulans PL236. Sizes of radioactively labelled marker (A restricted with HindIII) are given in kilobases.
KBM!KPJ/551PA259830/23 03.87
I
37 Fig. 10 shows 0.5-0.75 pg of EcoRI-restricted total DNA from various bacteria analyzed by filter hybridization using the relB-orf3 probe.
The autoradiogram was exposed for 17 hours (lane 19) and 72 hours (lanes Lane 1: Serratia marcescens; lane 2: Pseudomonas fluorescens; lane 3: Pseudomonas purida; lane 4: Bacillus subtills; lane Bacillus circulans PL236; lanes 6, 7: Laccobacillus. Sizes of radioactively labelled marker (A restricted with HindIIl) are given in kilobases.
Fig. 11 shows filter hybridization analyses of DNA from eucaryotic cells using the relB-orf3 probe (lanes 1-4) as well as the R1 parB probe (lanes The DNA was cleaved with EcoRI (lanes 1-3 and 5-6) or with PsrI (lane Lane 1: 5 pg of macronuclear DNA from Terrahymena chermophila; lane 2: 5 pg of total DNA from Tetrahymena ther- 0 15 mophila; lane 3: 0.25 pg of chloroplast DNA from Pisum sarivum; lane 5: 5 pg of total cellular DNA from neuroblastoma; lane 6: 10 pg of total cellular DNA from embryonic liver. Sizes of fragments are given in kilobases.
Fig. 12 shows a partial map of plasmid p341-1. The region presented here is the fusion between the hok gene and the promoter region from the rrp operon of E. coli K-12 (obtained from plasmid pSGS8). In addition to the trp promoter (indicated by the arrow), the NH 2 terminal end of the crpE gene is also present (indicated as crpE). The broken lines represent pBR322 sequences from which the ApR gene and the origin of replication are indicated. Restriction enzyme sites are shown as El (EcoRI), B 1
-E
5 (fusion of BamHI (filled in by DNA polymerase I) with EcoRV) and X-S (fusion of XhoI and Sail).
Fig. 13 shows growth curves for MC1000 (p341-1) (circles) and MC1000 (triangles) grown in A+B minimal medium supplemented with 0.2% glucose and 1% casamino acids at 37*C. The cell density is measured spectrophotometrically as OD 450 Fig. 14 is a graph showing viable counts (OD 600 of E. coli HB101 harbouring pNL7 (circles) or pBR322 (triangles), as a function of time. No exogenous tryptophan was added to the MA+B culture medium.
KBM/KPJ,55/PA259830D23 03 87 38 Fig. 15 is a graph showing viable counts (OD 600 of E. coli HB101 harbouring pNL7 (circles) and pBR322 (squares), as a function of time. 5 vg/ml tryptophan was added to the MA+B culture medium.
Fig. 16a shows a deletion map of the minimal parB region. The numbering is in accordance with the coordinates of the parB region shown in Fig. 1. The hok and sok genes within the region are indicated with filled-in and open areas, respectively. The presume sok promoter is indicated as q- and the putative hok Shine-Dalgarno sequence is shown as The plasmids pPR341 and pPR345 are pBR322 derivatives, which contain the parB region from +268 to +580 and +303 to +580, respectively. The plasmid pPR341 carries the hok Shine-Dalgarno *o sequence and the hok reading frame, whereas pPR345 only carries the hok reading frame. Both plasmids are devoid of the sok gene.
Restriction enzyme sites are shown as B 1 (BamHI) and E (EcoRI).
Fig. 16b shows the physical and genetic map of the plasmid pKG345 used for the induction of the cro'-hok gene fusion. Plasmid pKG345 is a pPR345 derivative in which a BglIl-Sall fragment containing the XpR promoter and the cl857 allele of the A repressor gene was inserted into pPR345 restricted with BamHI and Sail. This construction placed the transcription and translation of the hok gene under the control of the ApR promoter and cro Shine-Dalgarno sequence, respectively.
The gene fusion is indicated as an open area for the cro' gene and as a cross-hatched area for hok. The bla gene, the X repressor (filledin areas) and the origin of replication are also indicated. The XpR promoter is shown as t- and the cro Shine-Dalgarno sequence as Restriction enzyme sites are shown as R (RsaI), S (Sail), E (EcoRI), B (BamHI) and B 2 (BglII).
Fig. 17 shows host cell killing after XpR induced expression of the hok gene and the cro'-hok+ gene fusion. E. coli strain MC1000 was grown exponentially in A+B minimal medium supplemented with 0.2% glucose and 1% casamino acids at 30*C containing either pKG341 (open symbols) or pKG345 (filled-in symbols). At time zero, the temperature was shifted to 42*C and growth of the cultures was followed as D0 450 and viable counts on selective medium (LB plates containing 100 pg/ml ampicillin).
KBM/KPJ1355PA259a3D/23,03.87 39 Fig. 18 is a map of plasmid pLK26. The filled-in areas denote structural genes; the insert shows the spacI promoter followed by a synthetic ribosomal binding site and a polylinker; ori denotes the origin of replication from pBR322 and pUB110, respectively; lac o denotes the lac operator.
Fig. 19 is a graph showing viable counts (OD 600 of B. subtilis BD170 containing pSI-1 (circles) or pLK26 (squares), as a function of time.
The cells were grown exponentially in LB medium with 5 ug/ml chloramphenicol at 37*C.
O0 S Fig. 20 is a graph showing the killing kinetics after induction of hok with 2 mM IPTG. B. subcilis BD170 containing pSI-1 (circles) or pLK26 (squares) were grown in LB medium with 5 pg/ml chloramphenicol.
15 Viable counts were monitored on LB plates with 5 pg/ml chloramphe- 15 nicol.
Fig. 21 shows a map of plasmid pPKL8 (5.5 kb). The position of the fimB, fimE and the truncated fimA gene is indicated. The box with double arrows denotes the invertible 300 bp region containing the 20 promoter of the fimA gene. The hatched area indicates pBR322 DNA.
Fig. 22 shows a map of plasmid pPR341 (4.3 kb). The hatched area indicates pBR322 DNA.
Fig. 23 shows a map of plasmid pPKL100 (7.5 kb). See Figs. 14 and for details.
Figs. 24a and 24b show microphotographs of E. coli K-12 strain MC1000 cells harbouring plasmid pPKL100. The arrows indicate killed ghost cells.
Fig. 25 shows digestions with SacII and SnaBI of plasmids pPKL100 (lane A) and pPKL8 (lane Lane C is a HindIII digest of bacteriophage lambda used as a molecular weight marker showing the following sizes: 23.1 kb, 9.4 kb, 6.6 kb, 4.4 kb, 2.3 kb, 2.0 kb and 0.56 kb.
The arrows indicate fragments affected by the inversion of the 300 bp segment.
KBM/KPJ155/PA25983123 03.87 I Fig. 26 shows maps of plasmids pLP4 pLP5 and pLP6 The hatched boxes represent pACYC184 DNA. Relevant restriction sites as well as the positions of the fimB and fimE genes are shown.
MATERIALS AND METHODS Bacterial strains and plasmids The bacteria and plasmids are listed in Table 1.
The experimental techniques used were standard techniques employed in the fields of microbial genetics Miller: Experiments in Molecular Genetics, Cold Spring Harbor, New York, 1972) and genetic manipulation (Davis, Bothstein and Roth: A Manual for Genetic Engineering; 15 Advanced Bacterial Genetics, Cold Spring Harbor, New York, 1980, and Maniatis, Fritsch and Sambrook: Molecular Cloning, Cold Spring Harbor, New York, 1982.
All cells were grown in LB medium (Bertani, J. Bact 62, 1951, p. 293) with 0.2% of glucose and 1 pg/ml of thiamin, or A+B minimal medium 20 20 (Clark and Maaloe, J. Mol. Biol. 23, 1967, p. 99) supplemented with 0.2% of glucose and 1% casamino acids. The plates used were LA plates containing LB medium and 1.5% of agar.
Clear lysates were prepared according to the method described by 25 Clewell and Helinski, Proc. Natl. Acad. Sci. USA 62, 1969, pp. 1159-
*XI*
66.
Small scale preparation of plasmid DNA was performed by the method of Birnboim et al., Nucl. Acids Res. 7, 1979, pp. 1513-23.
Large-scale preparation and analysis of plasmid DNA was performed using dye boyant density gradient centrifugation according to Stougaard and Molin, Anal. Biochem. 118, 1981, p. 181.
The restriction endonucleases were used in accordance with the prescriptions provided by the manufacturer (Boehringer, Mannheim or KBM/KPJIS5/PA25983D/23.03.87 41 Biolabs, New England) at 37°C. Double and triple digests were performed by starting with the enzyme requiring the lowest salt concentration and then adjusting with additional buffer before adding the next enzyme.
Treatment with the exonuclease Bal31 was performed as follows: 0.1 unit of Bal31 was added to 50 pg linear DNA and samples were taken out at 16', 32' and 60' to 60 mM EDTA, extracted with phenol, ethanol precipitated and resuspended in 20 pl TE buffer. Half of the 20 pl was digested with the appropriate restriction enzyme subjected to agarose gel electrophoresis to determine the average size of the deleted DNA deletions. To the other half, the appropriate linker was added and the mixture ligated for 48 hours with an excess of T4 DNA ligase.
.Ligation of restricted plasmid DNA was performed as recommended by the manufacturer with the exception of blunt end ligation, where an excess of T4 DNA ligase and ATP was added.
pKG633: The Sall-BglllII fragment of pOU82 containing the c1857 temperature sensitive allele of the X repressor gene and the XpR promoter was inserted into pPR633 in front of the parB+ region so that the XpR promoter reads into the region from left to right (Fig. 1).
In an analogous way, the Sall-BglII fragment of pOU82 was inserted into pPR634 and pPR341, which are Bal31 deletion derivatives of 25 25 pPR633, resulting in pKG634 and pKG341. pKG171: In pPR171, the Sall- BglII fragment of pOU82 was inserted in the opposite orientation, resulting in pKG171. The positions and orientations of the inserted ApR promoters relative to the hok and sok genes are shown in Fig. 1.
pF634: The EcoRI-Sall fragment of pKG634 containing the right 390 bp of the parB+ region and the X cl857-pR inducible promoter system was inserted into the unique Sail site in the kanamycin resistance (aphA fragment of pML31 by blunt end ligation (S1 nuclease was used to make the restricted DNA fragments blunt-ended).
The DNA was cleaved with the appropriate restriction endonucleases according to the recommendations given by the manufacturers. For cellular DNA, 10 units per microgram of DNA was used. The incubation time was 3 hours at 37"C. The generated DNA fragments were separated KBM/KPJ/55/PA2593D/23.03.87 42 by electrophoresis through 0.7% or 1% agarose gels in a Tris-acetate buffer at 0.8 volt per cm for 18 hours and visualized by ethidiun bromide staining.
Mobilization of plasmids E. cold. S 17.1 is capable of mobilizing plasmids like RSF1010 due to auL inserted conjugative plasmid (RP1 derivative) in the chromosome.
The plasmids in question were transformed to S 17.1 which then represented the donors.
One drop of donor cells and recipient cells were mixed on an LB plate (no selection) and incubated overnight. From the resulting cell mass, a liquid suspension was made from which dilutions were spread on double-selection plates.
Table 1 Bacteria and plasmids a. a a
A
a. a U *8 a a a, a
SO
S.
U S 55U Bacterium Relevant phenotype 0 OS S~
SO
S. 5
S.
a a *09* E. coi K-12, MC1000 1 Leu-, Lac-, StrR E. cold. K-12, S 17.12) Pro-, StrR, Mob+ E. cold. K-12, 10053) Met-, NalR Sez-ratia marcescens TcR Pseudomonas pucida RifR Bacillus subtilis BD170 4 trpC2, K5M/KPJ/55/*PA25983D/23.03.87 Plasmid Relevant phenotype Coordinates of parE insert (cf. Fig. 1) mm me
B
0 p.
'9 0
C*
C
*e SC@* 0 0b 9. 6 *6 0e
B.
.0*
S
@00000 o *0 p 0, C C 0000 Rldrd-19 pSGS8 5 pBOE93 p PR3 11 10 pPR633 pPR634 pPR341 pPR171 pPR154 15 pKG634 pKG341 pKG171 pPKL1OO pPKL8 20 pJK3 -1 6 pSI_1 7 pBR322-, Trp+, APR RSF1O1O, KanR R1, (hok+, sok+) R1, (hok+, sok+) pBR322, (hok+, sok+) pBR322, (hok+) pBR322, (hok+) pBR322, pBR322, (sok+) pBR322, (hok 4 pBR322, -(hokt) pBR322, pBR322, APR, Tet 5 pBR322,
APR
pBC16, pBR322, Tet pUB1lO, pBR322, Cat -300 +1 +1 +194 +268 -300 -300 +194 +268 -300 +268 +580 +580 +580 +580 +580 +288 +330 +580 +580 +288 +5 .i op.
Ce..
25 1) M.J. Casabadan, S.N. Cohen, J. Moliec. Biol. 138, 1980, p. 179.
2) R. Simon, Biotechnology, November 1983.
3) J. Grinsted, J.R. Saunders, L.C. Ingram, R.B. Sykes, M.N. Richmond, J. Bacteriol. 110, 1972, p. 529.
4) Dubnan Cirigliano, J. Bacterial. 117, 1974, p. 488 C. Skogman, J. Nilsson, P. Gustafsson, Gene 23, 1983, p. 105.
6) Kreft et in Molecular- Cloning and Gene Regulation in Bacilli, eds. A.T. Canesan et Academic Press, 1982, p. 145.
7) A slight modification of pAIQ25 described in Yansura and 1-enner, Proc. Natl. Acad. Sci. 81, 1984, p. 439; obtained from Henner.
KBM/KPJ/55/PA25983D/23.D3.87 I 1 I 44 Purification of chromosomal DNA lotal DNA was extracted from bacteria as follows. Cells were harvested by centrifugation, washed twice in 1 x TEN buffer (TEN 10 mM TRIS (pH 1 mM EDTA, 0.1 M NaCl) and resuspended in 1/lOth volume of TEN containing 1 mg/ml lysozyme. Following incubation at 37°C for 30 minutes, the protoplasts were lysed by addition of sodium dodecyl sulphate to a final concentration of and proteinase K was added to 0.25 mg/ml. The lysate was incubated at 37°C for 2 hours and S* subsequently extracted twice with buffered phenol and three times with chloroform. Sodium acetate was added to 0.3 M and the DNA was precipitated by addition of 1 volume isopropanol. The precipitate was ,washed several times in 96% and 80% ethanol. Finally, the DNA was S* 15 dissolved in ImM TRIS, 1mM EDTA.
S*B
Total DNA from Tecrahymena thermophila BVII was prepared according to Nielsen, H. and Engberg, Biochim. Biophys. Acca 825, 1985, pp.
30-38. Macronuclei from Tecrahymena thermophila BVII were isolated 20 (Cech, T.R. et al.: Cell 27, 1981, pp. 487-496) and DNA extracted (Maniatis et al., 1982, op.cic., pp. 280-281). rDNA from Tecrahymena
S
chermophila BVII was prepared as described by Engberg, J. et al.: J.
Mol. Biol. 104, 1976, pp. 455-470.
Chloroplast DNA from Pisum sativum was isolated according to Book- 25 25. jans, G. et al.: Analyc. Biochem. 141, 1984, pp. 244-247.
Embryonic liver tissue from a 7-weeks legal abcrtion was minced in physiological saline and the DNA was prepared according to Maniatis et al., 1982, op.cit., pp. 280-281. In a similar manner, DNA was isolated from a tumor biopsy from a case of neuroblastoma; the isolated DNA was found to contain a several hundred-fold amplified chromosomal region and, correspondingly, the tumor cells were found to contain numerous extrachromosomal mini-chromosomes by microscopy of mitotic cells.
Isolation of DNA fragments for radioactive labelling 100 micrograms of pPR95 and pBD2724 DNA were digested with EcoRI and EcoRI and HindIII, respectively. The fragments were separated by KBMIKPJ/55/PA25983E/23.03 87 electrophoresis through a 1% agarose gel in Tris-borate buffer at volts per cm for 3 hours. The desired fragments were isolated by electroelution onto an NA45 membrane (Schleicher Schall) according to the manufacturer's recommendations. Following recovery of the fragments by elution of the filter in 1.5M NaCI at 65*C, the fragments were again subjected to purification by agarose gel electrophoresis and NA45 membrane recovery from the gel.
Agarose gel electrophoresis The DNA was cleaved with the appropriate restriction endonucleases according to the recommendations given by the manufacturers. For cellular DNA, 10 units per microgram of DNA was used. The incubation time was 3 hours at 37°C. The generated DNA fragments were separated *o d, 0 15 by electrophoresis through 0.7% or 1% agarose gels in a Tris-acetate buffer at 0.8 volt per cm for 18 hours and visualized by ethidium bromide staining.
A molecular weight marker was prepared as follows: wt A DNA was restricted with Hindlll and end-labelled by means of the Klenow poly- 20 merase from Boehringer, Mannheim, as recommended by the manufacturer, in the presence of a-32P-dCTP plus non-radioactive dATP and dGTP.
When used as a molecular weight marker, an amount of Terrahymena macronuclear DNA was added corresponding to the DNA load of the test lanes.
Transfer of DNA fragments from gel to nitrocellulose filter Following partial depurination in 0.25 N HC1 for 15 minutes at room temperature, denaturation of DNA in the gel, neutralization and subsequent transfer of DNA from gel to a BA85 (Schleicher Schull) nitrocellulose filter was carried out as described in Maniatis et al., 1982, op.cit., pp. 280-281. Completeness of transfer was assured by ethidium bromide staining of the gel after transfer.
Preparation of radioactively labelled probe 0.3 microgram of the 900 bp parB fragment and 0.3 microgram of the 300 I.p relB-orf3 fragment were radioactively labelled by nick-translation (Maniatis et al., 1982, op.cit.) using 0.25 micromolar a-32P- KBMIKPJISS/PA25983E/23.03 87 ~t 46 deoxycytidine triphosphate (3000 Ci per ,mol). The unincorporated radioactive precursor was removed by means of repeated ethanol precipitations. To each preparation were added 100 micrograms of E. col! tRNA as carrier.
The specific activities of the probes were 2-3 x 108 and 4-5 x 107 dpm per microgram of parB and relB-orf3 fragment, respectively.
Hybridization Filters containing DNA transferred from agarose gels were preincu- *0 00 bated in plastic bags with the hybridization solution (10 ml per o 120 cm 2 for 18 hours at 37°C with constant shaking. The hybridization solution was modified from Wahl et al., Proc. Natl. Acad. Sci.
0 76, 1979, pp. 3683-3687 and contained 38% deionized formamide, 0.75M 15 15 NaCI, 50mM sodium phosphate and 10 x Denhardt's solution (50 x Den- 000 hardt's solution is 0.2% bovine serum albumin, 0.2% polyvinylpyrrolidone and 0.2% Ficoll).
Following preincubation, the denatured radioactively labelled probes
S
20 were added to appropriate filters. In experiments employing the parB probe, the concentration of fragment during hybridization was 3 ng/ml while the relB-orf3 probe was used at a concentration of 1.3 ng/ml to
S.
obtain equimolar concentrations of complementary sequences in the two situations.
Hybridization was carried out at 37°C with gentle shaking for 19
B<*
hours.
The hybridized filters were washed once for 20 minutes at room temperature in 0.4 x washing buffer, and finally twice for 30 minutes at 60°C in 4 x washing buffer. The washing buffer contained 0.6M NaCI, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH Autoradiography was performed using X-ray films and intensifying screens. Exposure times are indicated in the description of the figures.
KBM/KPJ/S5/PA25983E/23,03 87 47 The term "filter hybridization analysis" is used in the Examples to denote the following sequence of operations: agarose gel electrophoresis of DNA fragmients, transfer of the fragments to nitrocellulose filters, hybridization with the appropriate radioactively labelied probe, filter washing, and autoradiography of the filter following washing. The data shown in the Examples represent autoradjograms obtained by filter hybridization analysis.
The term homology is used here to denote the presence of any degree of complementarity between a given probe and the nucleic acid species being analyzed.
The degree of hornology is expressed as the fraction of complementary bases in a duplex nucleic acid molecule formed between a given probe and the nucleic acid species being analyzed.
4 seeThe minimum degree of homology which is detectable is a function of the experimental conditions exployed during hybridization and of characteristics of the probe and the nucleic acid species being 2 analyzed.
C S The degree of homology between the probe DNA and a filterbonDN species was estimated from the intensity of the actual hybridization signal compared tc the signal irieens 4 ty observed for a 100% homologous filter-bound sequence under the same conditions.
25 oboe The intensity of the hybridization signal depends primarily on the rate of hybridization and the number of filter-bound DNA molecules present in the specifically hybridizing band. The rate of hybridization is mainly determined by the concentration of complementary sequences during hybridization, the ionic conditions, the temperature and the degree of homology between the probe DNA and the filter-bound molecules. The rate of hybridization decreases by the presence of non-complementary sequences (Bonner, T. I. et al., J. Hal. Biol. 81, 1973, p. 123) which decreases the thermal stability of the duplex DNA; 1% mismatch between probe and filter-bound DNA r~tsults in a decrease in thermal stability of 1 degree (Mz-.iatis et al., 1982, o;.cit., p. 388). The hybridization conditions therefore determine which level of mismatch will still yield a detectable signal. It KBM/KPJ/55/PA25983E/23 03.87 t* 48 should be noted that the conditions employed in the present work did not lead to saturation of the filter-bound DNA with probe.
The present set of conditions for hybridization and filter subjects DNA duplexes to a temperature which is 40°C below the mean melting temperature of perfectly matched duplex DNA in the same ionic environment, i.e. the conditions allow the detection of signals from duplexes containing a high degree of non-pairing bases. The formula used in these calculations is discussed in Beltz, G. A. et al., Mech.
Enzymol. 100, 1983, pp. 266-285.
6C 0* 6 It is estimated that the conditions employed detect 100% of the 6' @6 maximum hybridization signal obtained from duplexes with from 100% "down to 80% homology while the signal from a 60% homologous duplex is 50% of the above maximum intensity, cf. ebove. Duplexes with lower 15 homology than 60% will yield still weaker signals.
For duplexes with extensive mismatch, a signal may be detectable if the exposure time of the autoradiogram can be proloi or if the number of copies of filter-bound complementary molecu. cen be 2 0 increased.
<L
0* .*>-EXAMPLE 1 Deletion mapping of the parB region (cf. Fig. 1) 6: 25 Construction of pPR95 (Fig. 2) 06 The construction of pPR95 was done in the following way: plasmid pOU93 (Gerdes et al., J. Bacceriol. 161, 1985, pp. 292-98) is a pBR322 derivative containing the parB PstI fragment derived from the EcoRI-A fragment of plasmid Ri (Fig. The PstI fragment is conveniently divided into smaller fragments by the restriction enzyme Rsal as shown in Fig. 1. By conventional cloning procedures, the largest Rsal fragment (880 bp) was inserted into the Smal site of the pBR322 derived cloning vector pHP34 (Prentki et al., Gene 17, 1982, pp. 189-96), resulting in pPR13. The SisaI site of pHP34 is flanked by two EcoRI sites and therefore the inserted 880 bp RsaI fragment was converted to a 900 bp EcoRI fragment. The so generated 900 bp EcoRI fragment of pPR13 was cloned into the unique EcoRl site of the miniRl KBM/IKPJ551PA25983E/23.03.B7 derivative pOU82 ('nternational Patent Application No. PCT/DK83/ 00086, Publication No. WO 84/01172), resulting in pPR95. A drawing of is presented in Fig. 2.
Plasmid pOU82 is unstably inherited due to the lack of any partitioning function (International Patent Application No. PCT/DK83/ 00086, Publication No. WO 84/01172), and has a loss frequency on the order of 10-2 per cell per generation.
On the other hand, pPR95 is very rarely lost and is characterized by having a loss frequency of less than 10' 4 per cell per generation C* (measured as described in International Patent Application No. PCT/ DK83/00086, Publication No. WO 84/01172), which is the characteristic 96*00 loss frequency of parB+ miniRl derivatives. Thus, it may be concluded 00 15 that the complete parB region is located on the 880 bp Rsal fragment as judged by the ability of the fragment to stabilize miniRl replicons.
The fine mapping of the parB region was carried out as follows: was restricted with BamHI, treated with exonuclease Bal31, and li- 20 gated. Before ligation, BamHI oligonucleotide linkers were added.
S SThis treatment resulted in a series of deletion derivatives covering the left-hand part of the parB region. The extension of the deletions was determined by size fractionation of DNA fragments on agarose gels after the DNA had been treated with the restriction enzymes EcoRI and 25 25 BamHI. Subsequently, the precise insertion of the BamHI oligonucleotide linkers was determined by nucleotide sequencing as described by Maxam and Gilbert (Hech. Enzymol. 65, 1980, pp. 499-566). In this way, a very detailed mapping of the region was obtained. Furthermore, the ParB phenotype (determined as described in Materials and Methods) for each plasmid derivative was analyzed. Deletion from pPR95 of the sequence extending from -320 to 0 (cf. Fig.l) resulting in pPR311 did not change the ParB phenotype. Thus, the remaining 580 bp BamHI-EcoRI fragment in pPR311 must contain the complete parB region.
Deletion from left further into the region completely abolishes the stabilizing activity.
KBM/KPJ155/PA25983E/23.D3.87 Deletions into the right part of the 580 bp parB fragment of pPR311 (cf. Fig.l) resulted in loss of ParB+ phenotype, so the parB region extends to a position close to this end of the fragment.
EXAMPLE 2 Nucleocide sequence of the parB region (cf. Fig. 3) The nucleotide sequence of the minimal parB region, which is pres- 10 ented in Fig. 3, was obtained using the chemical degradation method as described by Maxam and Gilbert (Mech. Enzymol. 65, 1980, pp. 499- 566). In the following, a detailed description of the essential bio- *e*eo* logical information in the nucleotide sequence of the parB region is presented.
a.
The sequence of the minimal parB region of 580 bp as defined in Example 1 (cf. Fig.l) is depicted in Fig. 3. The central and left-hand parts of the region are very rich in dyad symmetries. The 580 bp contains three open reading frames consisting of more than 50 codons.
The start and stop codons of these reading frames are indicated in •Fig. 3. The reading frame starting at position +304 and ending at +460 is preceded by a DNA sequence (5'-AGGA-3') resembling the E.
coll ribosome binding site (Shine and Dalgarno, Nature (London) 1975, pp. 34-38), which is known to act as recog'aition site for ribosomes initiating translation of mRNA. The polypeptide product of this reading frame is shown below the DNA sequence in Fig. 3.
EXAMPLE 3 Functions expressed from the parB region (cf. Figs. 4 and A series of plasmids was constructed from which conditional expression of the putative genes (as indicated from the sequence) in the parB region was obtained through insertion of a fragment carrying the ApR promoter and the XcI857 gene. The positions of these insertions are indicated in Fig. 1. The XpR temperature inducible promoter system was chosen because the regulator gene for the ApR promoter (the c1857 gene) as well as XpR are located on a single BglII-SalI KBM/KPJ/55/PA25983E/23 03 87 51 restriction fragment; furthermore, the ci857 allele of the A repressor gene makes the inserted promoter inducible at high temperature but silent or near silent at low temperature The BglII-SalI fragment of pOU82 was inserted into plasmids pPR634 and pPR341 by conventional cloning procedures yielding plasmids pKG634 and pKG341, respectively (cf. Materials and Methods).
At 30°C, cells harbouring pKG634 and pKG341 grow normally; however, induction of XpR (at 42"C) results in rapid killing of the host 10 cells.
66 66 0O 6
S
Fig. 4 shows the killing kinetics (viable counts) and growth measured as OD450 after a shift to 42°C of strain JC411(pKC634). Viable counts decrease rapidly (half life of 2.5 minutes) and the increase of OD450 6 06 15 stops. The presence of a XpR promoter transcribing the parB region in the opposite direction (pKG17I) has no effect on cell growth and viability (Fig. 4, control).
Microscopic examination (phase contrast) of the cells (JC411/pKG634) after heat induction of the XPR promoter showed that the cells changed morphology: Most of the material apparently condensed in zones, leaving the rest of the cell transparent. An illustration of this is shown in Fig. 5, in which both normal and changed cells are present. The cells having the characteristic parB induced appearance are termed "ghost" cells in the following.
Since the XpR-promoter fragment was inserted immediately upstream of the start of a 52 amino acids open reading frame (cf. Example 2), this strongly suggests that the 52 amino acids polypeptide encoded by the open reading frame starting at position +304 (Fig. 3) is responsible for the cell killing, and consequently, this gene is termed hok (host killing) in the following.
EXAMPLE 4 Suppression of the host killing effect expressed by hok (cf. Fig. 6) A gene from which a highly toxic product is expressed must obviously be regulated. Therefore, it was assumed that the regulator of hok was KBMIKPJ/55/PA25983E/23 03.87 0 52 also encoded by the parB+ region. In a first attempt to characterize this regulatory loop, the fragment of pKG634 containing XcI857 upstream of the hok gene was inserted into a mini-F plasmid, resulting in pF634. Fig. 6 represents the induction of killing of JC411 (pF634) which shows that the killing occurs somewhat slower and less efficiently than in the case of pKG634 in accordance with the low copy number of F compared to pBR322.
A second parB+ plasmid (pPR633) was subsequently transformed into strain JC411 (pF634) and the induction experiment repeated with this double plasmid strain. As seen in Fig. 6, the parB region present in trans fully suppresses the transcriptional activation of the hok gene. Thus, the parB region encodes a suppressor of host killing (the sok gene).
Employing this experimental design as an assay, the sok gene was omapped in the following way: Double plasmid strains containing pF634 and one of the deletion derivatives pPR634, pPR341, pPR154, or pPR171, respectively, were constructed, and by following the growth pattern of these strains at 42°C, the Sok phenotype of the deletion derivatives was determined by measuring growth after the temperature 2 shift. The analysis of these deletion derivatives showed that the plasmids pPR634 and pPR154 express Sok activity, whereas the plasmids pPR341 and pPR171 express non-detectable levels of Sok activity.
The plasmids were also tested for the incompability phenotype characteristic for parB+ (cf. International Patent Application No.
PCT/DK83/00086, Publication No. WO 84/01172), and it was found that plasmids expressing Sok activity also exert parB specific incompatibility, whereas plasmids which are Sok" as described above do not exert incompatibility. Thus, the parB incompatibility reaction represents an assay for Sok activity.
In a manner similar to that described for the hok gene, the region required for sok gene activity has been further narrowed down. One of the sok' derivatives used in the mapping procedure, pPR171, contains the parB region extending from coordinate -300 to +288 (Figs. 1 and A restriction fragment containing the XcI857 and ApR was inserted into pPR171 in such a way that the XpR promoter reads into the sok KBM/KPJ/55/PA25983E/23.03.87 53 region of the plasmid, resulting in pKG171 (cf. Materials and Methods).
Plasmid pKG171 was transformed to strain CSH50 containing pOU94.
Plasmid pOU94 is a lac parB p15 derivative which is completely stably inherited due to the presence of the parB+ region on the plasmid. Introduction of other parB+ plasmids into that strain results in destabilization of pOU9 4 due to the incompatibility expressed from parB+. At 30*C, the presence of pKG171 did not result in destabilization of pOU94 to any significant extent, whereas a clear destabilization was detected at 42°C. Therefore, transcription from 6 right to left into the parB region of pKG171 results in activation of the incB region the sok gene).
d 0 15 The results described here further narrows down the sok gene which 15 0* must therefore be located between +194 (pPR634) and +288 (pPR171).
Also, it is indicated that the sok gene promoter reads from right to left (opposite of hok gene transcription) and is located at least partly in the region between +288 (pPR171) and +336 (pPR154). A 20 putative -10 sequence (TATCCT) is located at position +262 and a sequence (TTGCGC) is located at position +285 (Fig. 3) (Hawley and McClure, Nucleic Acids Res. 11, 1983, pp. 2237-2255). It is assumed that these sequences constitute the promoter of the sok gene.
a8o* EXAMPLE cre.
Discovery of an E. coli chromosomal homologue of Ri parB (cf. Fig.
8a) Since plasmid evolution has involved an extensive exchange of genetic information between bacterial chromosomes and freely replicating DNA molecules, the chromosomal DNA of E. coli was analyzed for possible ancestral sequences to the R1 parB sequences.
In lane 6 in Fig. 8a, total EcoRI-restricted DNA from plasmid-free E.
coli JC411 was analyzed by filter hybridization to a parB probe, cf.
Materials and Methods. A fragment of 20 kb is seen to yield a rather weak, but definite signal which can also be detected in other lanes containing E. coli DNA if exposed for the same time (lanes 4, The KBM/KPJ/55/PA25983E/23 03.87 54 chromosomal sequence is estimated to be approximately 55% homologous to parE. The chromosomal sequence is named panl in the following.
A major question is of course to which extent the finding of homology at the level of the nucleotide sequence also reflects similarity in function of the products encoded by the homologous regions, an aspect which will be further dealt with in Example 6.
EXAMPLE 6 Genetic organization of an E. coli chromosomal homologue of RI parB and its functional relationship to R1 parB (cf. Fig. 7) The hok gene of plasmid Rl, defined in Example 3, codes for a poly- 15 peptide of 52 amino acids. The amino acid sequence of the hok gene product was compared to a large number of known protein sequences.
Surprisingly, a polypeptide of 51 amino acids encoded by the relBorf3 gene of the E. coli relE operon (Bech et al., The EM1BO Journal 4, 1985, pp. 1059-1066) showed significant homology to the hok pro- 06000: 20 duct. The amino acid sequences of the two homologous proteins are 0 presented in Fig. 7, which shows that 42% (22) of the amino acids are identical in the two proteins. For 17% of the amino acids the changes are conservative, meaning that one amino acid has been replaced with an amino acid of similar chemical characteristics (i.e.
hydrophobicity, charge, etc.), resulting in an overall homology of 61%. Especially the charged amino acids are well conserved as are the cysteine residues at positions 16 and 31 (Fig. 7).
The DNA sequences of the hok gene and of relB-orfj were also compared as shown in Fig. 7. The coordinates used in the following are parB+ sequence coordinates as in Fig. 3. From coordinates +290 to +460, there is 55% homology between the two sequences. It appears from Fig.
7 that the conserved region includes nucleotides upstream and downstream of the protein coding sequence located from +304 to +460. The conservation of bases outside the coding region indicates that regulatory features of the two genes have also been at least partly conserved.
KBM/KPJ/55/PA25983E/23.02.87 To show that the sequence homology reflects similarity in function, a plasmid carrying the £pR promoter fragment upstream of the relB-orf3 gene was constructed (cf. the description of an analogous type of construction used in mapping the hok gene in Example 3).
When ApR mediated transcription into relB-orf3 is induced, a rapid killing of the cells is observed with a kinetics similar to that observed for bacteria containing plasmid pKG341 as described in Example 3. Simultaneously, all the cells in the culture are transformed into the hok characteristic "ghost" cells (cf. Fig. *0 u@ S.Thus, there is a striking homology between the hok gene of plasmid R1 and the relB-orf3 of the E. coli relB operon both at the structural and functional level.
EXAMPLE 7 parB homologous sequences on various plasmids (cf. Fig. 8a) Filter hybridization analysis of total, EcoRI-restricted DNA from a 20 number of strains of E. coli harbouring various plasmids was carried out using the parB probe (lanes 1-5 in Fig. 8a).
*O Os The plasmid R.drd-19 is a member of the R1 plasmid family from which the parB probe was originally cloned. Rldrd-19 is present at two copies per bacterial genome. EcoRI-restricted total DNA from E. coli 1005/Rldrd-19 is analyzed in lane 1. A strongly hybridizing fragment of 19.5 kb is seen, the size of which is consistent with the genetic mapping of the parB function to the 19.5 kb R1 plasmid (International Patent Application No. PCT/DK83/00086, Publication No. WO 84/01172).
The plasmid R100 is closely related to R1 carrying a transposable element, TnlO, within the region equivalent to the 19.5 kb EcoRI-A fragment of R1. The transposon contains the recognition sequence for EcoRI and, consequently, a further EcoRI site is introduced into the Rl-like EcoRI-A fragment splitting this into the two EcoRI-A and EcoRI-D fragments of R100 (Miki et al., J. Bacteriol. 144, 1980, pp.
87-99). These two EcoRI fragments of R100 both contain sequences found by heteroduplex mapping to be homologous to sequences present KBM/KPJ/55/PA25983E/23,03,87 II 1 56 of the F factor (Sharp et al., J. Mol. Biol. 75, 1973, p. 235). A strongly hybridizing fragment of 12.8 kb is seen in lane 2, Fig. 8a, thereby mapping the parB region of R100 to the EcoRI-D fragment of R100, within the center of the region of homology between R1 and R100, and F.
This localization of parB within the F homology region of R100 prompted the search for parB-like sequences on plasmids belonging to the incompatibility group, IncFI.
EcoRI-restricted, total DNA from B210/R386, an E. coli strain harbouring the IncFI plasmid R386, was analyzed by filter hybridization
S
using the parB probe (lane 3, Fig. 8a).
o The plasmid R386 which belongs to the same incompatibility group as F o °o 15 was found to give a parB hybridization signal corresponding to an 0S 1* EcoRI fragment of 19.5 kb. Since this plasmid is present at 0.5-1 copies per genome, the finding of a signal of approximately one third of the R100 signal (lane 2, Fig. 8a) suggests that the degree of homology between R1 parB and the R386 parB-like sequences is 55-60%.
The search for parB-related sequences was extended to other incompatibility groups. The plasmid RP1, which belongs to the incompatibility group IncP, was analyzed.
With the parB probe, total, EcoRI-restricted DNA from 1005 (RP1) yields a hybridization signal corresponding to the EcoRI-linearized 000 plasmid (lane 4, Fig. 8a). In addition, a hybridizing band of 20 kb corresponding to parl is seen, which was discussed in Example Since RP1 is adapted to stable maintenance in a broad range of gramnegative bacterial hosts, the finding of parB-related sequences on RP1 opens the possibility that maintenance systems analogous to the R1 parB system, which is operative in E. coli as well as in Pseudomonas putida (Example 11), may function in a multitude of bacterial hosts.
KBM/KPJ/55/PA25983E/23 03 87 *4 57 Yet another plasmid, R6-K (IncX incompatibility group), was found to carry sequences with approximately the same hybridization characteristics as RP1 as evidenced by the presence of a 25 kb EcoRI fragment of R6-K hybridizing the parB probe (lane 5, Fig. 8a).
The low copy number plasmid F has been analysed in some detail in order to determine whether the presence of R1 parB hybridizing sequences reflect the existence of a stabilization mechanism related to that of Ri parB.
Two plasmid stabilization functions have been identified within the genome of F and the corresponding genes (sop (Ogura and Hiraga, Cell 32, 1983, pp. 351-360) and ccd (Ogura and Hiraga, Proc. Natl. Acad.
Sci. USA 80, 1983, pp. 4784-4788)) have been located to the EcoRI fragment spanning the map positions 40.3 to 49.5.
15 Filter hybridization analysis of total DNA from E. coli 1005 harbouring F showed that R1 parB-related sequences were present on a 10.7 kb EcoRI fragment of F (map position 49.5 to 60.2) and further hybridization analyses of 1005(F) DNA digested with EcoRI and/or 20 BamHI mapped these sequences to a 4.5 kb BamHI-EcoRI fragment extending from map position 55.7 to 60.2. This indicates the existence of a third plasmid stabilizing function within F.
*S
The region of F hybridizing the R1 parB probe was subsequently cloned into a bacteriophage X vector. EcoRI-digested DNA from 1005(F) was size-fractionated by preparative agarose gel electrophoresis and fragments of 9.5 to 12 kb were recovered by electroelution from the gel. The fragments were ligated to the EcoRI sites of the left and right arms of )L147 and packaged in vitro to yield infectious phages (cf. Maniatis et al., Molecular Cloning, Cold Spring Harbor, New York, 1982, p. 256) which were then used to infect E. coli LE392.
Recombinant phages carrying the R1 parB-related sequences were identified by plaque hybridization.
From a recombinant phage carrying the 10.7 kb EcoRI fragment which includes the R1 parB-related sequences, the fragment was isolated and inserted into pUC8 at the EcoRI site. In one resulting p3 %mid, pNL1, K8M/KPJ155/PA25983E/23.03.87 58 the insert is so oriented that cleavage of pNL1 DNA with BamHI results in excision of a 4.5 kb fragment carrying the R1 parB hybridizing sequences.
The 4.5 kb BamHI fragment from pNLI was isolated and the region hybridizing the R1 parB probe was mapped to an Rsal fragment of 870 bp by filter hybridization analysis. The 870 bp Rsal fragment was isolated and inserted into the Smal site of M13mp9. A number of recombinant phages carrying the R1 parB related sequences on a 870 bp insert was identified by plaque hybridization. The nucleotide sequence of the inserted DNA was analysed according to Sanger et al., Proc.
Natl. Acad. Sci. USA 74, pp. 5463-5467.
The nucleotide sequence of part of one of the recombinant phages, 15 mpNL12, comprises 402 bases extending from the Rsal site and this 0* sequence is 90% homologous to the region from +178 to +580 of the Rl 0° .parB sequence (Fig. All essential features of the Rl pare region are also found in the F-derived sequence: an open rezding frame encoding a protein of 50 amino acids is present corresponding to the R1 hok gene, the ribosome binding site of R1 hok is conserved, the region corresponding to the 3' non-translated part of Rl parB 0* .mRNA, which is believed to be essential for hok mRNA stability, is highly conserved (90% homology), and the putative -10 and O .0 0regions of R1 sok are also conserved.
The open reading frame within the F-derived sequence codes for a 0000 protein of 50 amino acids which differs only slightly from the R1specified hok protein. Firstly, two codons in R1 hok have been deleted, namely val-15 and ser-29. Secondly, two conservative substitutions have occurred, namely leu-16 to val and his-39 to tyr.
Evidently, the R1 hok gene and the related sequences on F derive from a common ancestral sequence and, furthermore, the conservation of a coding region corresponding to Rl hok strongly suggests that the encoded protein is involved in the stabilization of F.
To test for plasmid stabilizing properties of the F-derived sequence, the 4,5 kb BamHI fragment from pNL1 which carries the F hok-like sequences was inserted into pJEL82, a low copy number plasmid with a KBM/'KPJ155/PA25983E/23.03,87
'A
p 59 loss frequency of 10- 2 per generation (cf. PCT/DK83/00084, Publication No. W084/01171). The resulting plasmid, pJEL82/F, as well as pJEL82 was transformed into E. coli HB101. Cultures of the two strains were grown for 16 hours without selection pressure and the fraction of plasmid-containing cells (ApR) was determined. The result was as follows: plasmid %ApR cells pJEL82 36.5 pJEL82/F 98.4 It was therefore concluded that the 4.5 kb BamHI fragment carrying R1 parB related sequences exerts a plasmid stabilizing effect. If the Sstabilization is due to the presence of the hok-like gene within the 15 F fragment, the emergence of ghost cells would be expected in cula* tures of cells harbouring pJEL82/F grown without selection pressure, cf. Example 3. An overnight culture of cells containing pJEL82/F was found to contain approx. 5% ghost cells indistinguishable from R1 hok induced ghost cells.
0 In case of F, the demonstration of sequences related to R1 parB by filter hybridization thus reflects the existence of a functionally similar plasmid stabilization mechanism.
p.
EXAMPLE 8 Stepwise hybridization as a strategy for the detection of replicon stabilizing sequences homologous to parB related sequences (cf. Fig.
8b) The conditions of hybridization determine the level of homology between a probe and a filter-bound DNA species required to yielo a detectable signal, cf. the discussion in Materials and Methods. Consequently, filter-bound sequences may exist which remain undetectable with the given probe under the given set of hybridization conditions but which may nevertheless encode a hok-like activity, cf. the discussion of homology versus function in Materials and Methods. This is illustrated in the following experiment.
KRMIKPJI5/PA25983E/23 03.37 As described in Example 6, the relB-orf3 represents a chromosomal homologue of R1 parB based on the sequence comparison data and the functional similarity of hok and relB-orf3. The relB-orf3 and flanking sequences, as present in plasmid pBD2724, was used as probe in a filter hybridization analysis of E. coli chromosomal DNA.
Plasmid pBD2724 is a pBR322 derivative containing a HincIl-Mlul fragment from the relB operon of E. coli comprising the relB-orf3 coding sequence (coordinates 1070-1350 according to Bech et al., op.
cic.).
In lane 3, Fig. 8b, total EcoRI-restricted DNA from plasmid-free E.
coli is analyzed by filter hybridization using the relB-orf3 probe.
*In addition to the 20 kb hybridizing fragment likely to represent the 15 above-identified parl sequence (Example yet another hybridizing 00 fragment of 16 kb is detected. Since the intensity of the latter is greater than the intensity of the 20 kb signal, the 16 kb EcoRI 0.o fragment must span the E. coli relB-orf3 gene used as hybridization probe, i.e. the intensity of the 16 kb signal provides a reference from which degrees of homology can be estimated. The intensity of the parl hybridization signal, which is approximately 3/4 of the relBorf3 signal, suggests that parl is approximately 65-70% homologous to relB-orf3. Since the 16 kb relB-orf3-carrying fragment is not detected with the parB probe (lane 6, Fig. 8a), R1 parB is 50% or less homologous to relB-orf3.
In Example 5 it was found that the parB probe detects the 20 kbp basechromosomal homologue but not the 16 kbp homologue representing the relB-orf3 according to the above data. Since, as described in Example 6, the latter exerts hok-like activity when expressed, it can be assumed that the parl will also express hok-like activity or sok-like activity and/or both activities when properly expressed.
The relB-orf3 fragment was used as a probe in filter hybridization analysis of E. coli harbouring plasmid R100, and R386, both of which contain R1 parB-like sequences (Fig. 8a, lanes 1 and Under the present set of hybridization conditions, the relB-orf3 probe did not detect these sequences (Fig. 8b, lanes 1 and 2) since only the 20 kb parl and the 16 kb relB-orf3 carrying fragment are seen to hybridize KBM/KPJ/55/PA25983E/23.03.87 'a 61 the probe, thereby indicating that the absence of hybridization between a probe from a region expressing hok or hok-like activity and a given DNA-species does not preclude that the DNA-species in question can exert hok-like activity if properly expressed. Consequently, the finding of homology between the DNA-species in question and a region expressing hok or hok-like activity strongly suggests that the DNAspecies in question will exert hok or hok-like activity if properly expressed.
The above data therefore reveal a useful strategy in searching for regions exerting hok/sok-like activities: A probe representing a region of nucleic acid comprising hok or hok-like genes R1 parB) r* is used to detect homologous sequences parl) within the gencze in question chromosomal or plasmid DNA) which are subsequently
S
0 15 tested for hok or hok-like activity (as done for the relB-orf3 g region) in the proper experimental settings, and if shown to encode such activity or activities are next used themselves as probes in a secn:'. round of hybridizations to define novel homologous sequences which may or may not be related to the probes used in the first round 20 of hybridizations R1 parB). This stepwise procedure combining 49900e nucleic acid hybridization and functional assays of the isolated nucleic acid sequences may be adapted as a general strategy to search ,for genes expressing hok or hok-like activities in genomes increas- S* ingly separated from E. coli on the evolutionary scale.
EXAMPLE 9 **o Detection of parB related sequences in bacteria (cf. Figs. 9 and In the previous Examples, it was demonstrated 1) that sequences related to R1 parB are widely distributed among bacterial plasmids isolated from gram-negative bacteria, and 2) that sequences related to R1 parB are present in the chromosomal DNA of E. coll. These findings prompted a search for sequences related to either R1 parB or one of the chromosomal counterparts coli relB-orf3) in DNA from a variety of bacteria, as part of either their chromosomal DNA or of plasmids naturally present in these organisms.
KBMIKPJ/55/PA25983E/23.03.87 ii r' 1 62 Filter hybridization analysis of EcoRI-restricted DNA from Serracia marcescens with the Ri parB .probe shows intense hybridization to 3 fragments of 4.1, 2.9 and 2.5 kb (lane 2, Fig. Only the 4.1 kb fragment also hybridizes the relB-orf3 probe (lane 1, Fig. 10). The parB probe hybridizes an additional 6 fragments. Two of these signals are stronger than the parB signal derived from the relB-orf3-carrying 16 kb fragment in E. coli DNA (lane 6, Fig. Hybridization of Serratia marcescens DNA with the E. coli relB-orf3 probe yields a number of weak hybridization signals. It is possible that the strongly hybridizing bands of 2.5, 2.9 and 4.1 kb are derived from plasmid(s) although the agarose gel electrophoresis did not reveal any high copy number plasmids.
0* Pseudomonas fluoresce.. was analyzed as a plasmid-free member of this 15 species. Hybridiza n of DNA from Pseudomonas fluorescens with R1 *o parB (lane 3, Fig. 9) shows 8-10 hybridizing fragments, 4 of which exhibit signals with intensities of approximately 33% of the chromosomal counterpart of R1 parB (lane 6, Fig. A single of these fragments, of approximately 13 kb, probably also hybridizes the E.
S 20 coli relB-orf3 probe (lane 2, Fig. 10). In addition, the relB-orf3 o probe identifies 5 fragments specifically, although at low signal intensity; two of these, of 5.5 and 5.6 kb, are also seen in DNA from Pseudomcnas putida when this DNA is analyzed using the relB-orf3 probe (lane 3, Fig. 10). The relB-orf3 probe hybridizes to an additional 5 fragments in Pseudomonas putida DNA, bt none of these fragments are recognized by the R1 parB probe (_ane 4, Fig. In Pseudomonas putida DNA, the parB probe detects approximately fragments of low signal intensity and a single quite strongly hybridizing fragment of approximately 7.3 kb.
Ajmong gram-positive bacter-.a, B. subcilis, B. circulans PL236 and two strains of Lactobacillus were analyzed for the presence of sequences related to either R1 parB or E. coli relB-orf3.
In case of the parB probe, a single quite strongly hybridizing fragment of 5.2 kb was found in DNA from B. circulans (lane 8, Fig. 9).
Very weak signals were obtained from a few additional fragments of B.
circulans DNA. With the relB-orf3 probe, a limited number of hybridizing fragments was seen in DNA from B. subtilis (lane 4, Fig. KBM/KPJ155/PA25983E/23.03.87 B. circulans (lane 5, Fig. 10), and Laccobacillus (lanes 6 and 7, Fig. 10). The number of relB-orf3-hybridizing fragments ranged from 6 to 11, and all have approximately the same signal intensity. In the Lactobacilli, agarose gel electrophoresis has demonstrated the presence of plasmids suggesting the possibility that at least some of the hybridizing sequences are of plasmid origin. A search for plasmids in B. circulans PL 236 has been negative suggesting that the sequence of B. circulans DNA hybridizing the R1 parB probe (lane 8, Fig. 9) may be of chromosomal origin.
The above experiments indicate that sequences related to RI parB and/or to E. coli relB-orf3 are widely distributed among bacterial species, not only the Enterobacceriaceae from which the probes were 0 0 derived, but also the gram-positive bacteria.
e o0 EXAMPLE Detection of parB related sequences in eukaryotic cells (cf. Fig. 11) A unicellular organism was investigated, namely the ciliate protozoan Tetrahymena Chermophila, Fig. 11. This organism is characterized by 1) a high number of mitochondrial DNA molecules per cell and 2) approximately 12,000 copies of ribosomal RNA genes located on selfreplicating rDNA molecules. Neither the RI parB probe nor the E. coli relB-orf3 probe detect any fragments in DNA prepared from isolated macronuclei (lane 1, fig. 11). Nor did the probes hybridize to the two EcoRI fragments of isolated rDNA (lane 3, Fig. 11). Total EcoRIrestricted DNA from Tetrahymena thermophila, which includes mitochondrial DNA, s1- ;ed two hybridizing fragments, of 6.6 kb and 3.3 kb (lane 2, Fig. 11), with the relB-orf3 probe while the parB probe did not yield any signals. The hybridizing fragments co-migrated with two EcoRI fragments of mitochondrial DNA that were readily detectable by ethidium bromide staining of the gel prior to DNA transfer.
Chloroplast DNA from pea (Pisum sativum) was cleaved with the restriction endonuclease PsrI, and 0.125 microgram was analyzed by filter hybridization using the parB and the relB-orf3 probes (lane 4, Fig. 11). The latter probe hybridizes to a fragment of approximately 16 kb.
KBM/KPJ/55/PA25983E/23 03.87
IP
64 Finally, two samples of human cellular DNA were analyzed by filter hybridization following EcoRI restriction. The R1 parB probe yielded a (weak) hybridization signal to the neuroblastoma DNA (lane 5, Fig.
11) as well as to the embryonic liver DNA (lane 6, Fig. 11). The high mitochondrial content of liver tissue may indicate that the observed signal in lane 6, Fig. 11, is derived from human mitochondria. The neuroblastoma DNA was analyzed since other hybridization analyses had indicated selective amplification of a .mall chromosomal region leading to the presence of extrachromosomal mini-chromosomes ("double minutes"); the origin of the hybridization signal in lane 5, Fig. 11, is unknown.
Simultaneously, all the cells in the culture are transformed into the hok characteristic "ghost" cells (cf. Fig. Thus, there is a striking homology between the hok gene of plasmid R1 and the relB-orf3 of the E. coll relB operon both at the structural and functional level.
20 EXAMPLE 11 Construction of a trp-hok fusion Plasmid pPR341 carries the hok gene from the parB region without its natural promoter (cf. Table 1 and Fig. Plasmid pSGS8 carries the trp operon on an EcoRI fragment inserted in pBR322. An Xhol-EcoRV fragment (ca. 700 bp) from pSGS8 carrying the trp promoter was inserted by ligation in pPR341 digested first with BamHI (this site was made blunt-ended through a filling-in reaction with Klenow polymerase) and then with Sail. This insertion placed the crp promoter fragment in such an orientation that transcription would enter the hok gene. After transformation to MC1000 colonies were selected on LB plates containing ampicillin and subsequently, the colonies were tested for growth on A+B minimal plates containing leucine and ampicillin. In the absence of tryptophan, the crp promoter is induced, and transcription into the hok gene was assumed to be lethal. Therefore, screening was for clones that did not grow on the minimal plates. One such clone harbouring a plasmid, p341-I, which was shown KBM/KPJ/551PA25983E/23 03.87 by restriction enzyme mapping to have the correct insertion, was chosen for further analysis (cf. Fig. 12).
S EXAMPLE 12 Growth of cells harbouring p341-1 MC1000 (p341-1) was grown in A+B minimal medium supplied with 0.2% glucose and 1% casamino acids. Casamino acids contain very little tryptophan, so it was expected that at a certain cell density, the medium would be depleted of tryptophan. This situation mimics growth in a natural environment with a limited supply of tryptophan which is a rare amino acid. As seen in Fig. 13, the initial growth rate of the S**4 plasmid carrying strain (hok+) is identical to that of a plasmid-free 15 MC1000 strain. However, at a cell density of approximately OD 450 0.8, growth of MC1000 (p341-1) stops abruptly, indicating induction of the hok gene (verified by microscopic examination of the cells, cf. Fig. whereas the plasmid-free strain keeps growing. Viable counts from MC1000 (p341-1) at this point and one hour later show a dramatic reduction in viability (less than 104 In conclusion, the S presence of p341-1 in an E. coli K-12 strain makes growth and viability dependent on the presence of tryptophan in the growth medium.
When this amino acid is exhausted from the environment, growth stops immediately and the cells are killed.
EXAMPLE 13 Use of an RI hok homologue in the construction of a biological containment system The F hok gene (cf. Example 7) and the trp promoter were combined to generate a biological containment system. From pNL1 described in Example 7, the 850 bp Rsal fragment hybridizing the R1 parB probe was cloned into SmaI-restricted M13mpll. A recombinant, mpNL4, was identified in which the ribosomal binding site of F hok as well as the coding region of F hok could be excised as an approximately 300 bp FspI-EcoRI fragment. This approximately 300 bp fragment, the 550 bp EcoRV-Xhol fragment of pSGS8 containing the Crp promoter as well as KBM/KPJ/55/PA25983E/23.03.87
''I
I
66 the initial portion of CrpE, and the 3.7 kb SalI-EcoRI fragment of pBR322 carrying the bla gene were ligated to generate pNL7. In this construct, the crp promoter will transcribe into F hok. The plasmid pNL7 has the correct restriction enzyme pattern, and E. coll HB101 cells transformed with pNL7 show growth inhibition on plates without tryptophan as described for p341-1 transformants in Example 12.
The maximum inducible cell death caused by the expression of the F hok gene on pNL7 was determined for E. coli HB101 transformed with pNL7, HB101(pNL7). The cells were grown in Modified A+B (MA+B) which comprises A+B medium supplemented with thiamine, leucine, proline, 0.4% glucose, 1% casamino acids, and ampicillin (50 ug/ml) with fur- 0e ther addition of tryptophan at varying concentrations (0-200 ug/ml).
r. The cells were grown to the early exponential phase at which time 9 a 15 100 pg/ml of indolyl acrylic acid (IAA) was added which substance competes with tryptophan for binding to the repressor, thus leading to inactivation of the repressor. The number of viable cells per ml was determined by plating samples of the IAA-treated cultures onto LB plates with 50 pg/ml ampicillin at 30 minutes following IAA induc- S 20 tion. E. coli HB101(pBR322) served as a control in these experiments.
The maximum killing effect on IAA addition was observed at 5-10 pg/ml tryptophan, the surviving fraction of HB101(pNL7) being 1.4x104. The control cells were unaffected by IAA addition.
The kinetics of IAA-induced killing of HB101(pNL7) grown in the above medium with 5 ug/ml tryptophan is biphasic with an exponential compo- 0.4. nent from 0 to 15 minutes at which time the surviving fraction comprises less than 10- 3 and a second linear phase extending beyond minutes which further reduces the surviving fraction by a factor of 10 or more.
Simulated release experiments were carried out by growing E. coli HB101(pNL7) under conditions leading to depletion of tryptophan and hence to activation of the Crp promoter. The cells were grown in MA+B medium with either no added tryptophan or supplemented with 5 pg/ml tryptophan. OD 600 and viable cells per ml was followed. The control was HB101(pBR322).
KBMIKPJ/55/PA25983E/23 03 87 67 In one experiment, no tryptophan was present in the growth medium, and as shown in Fig. 14, the OD 600 of HB101(pNL7) increased exponentially for several hours, albeit at a slower rate than the control culture, but no corresponding increase in cell number was seen. Microscopically, the cell size of pNL7-transformed cells increased during this phase. Since viable counts did not drop, it is assumed that a low, but tolerable expression of F hok took place. Upon depletion of tryptophan, killing of HB101(pNL7) was observed, the surviving fraction being 2xlO" 3 In a second experiment, HB101(pNL7) and HB101(pBR322) were grown in S* MA+B supplemented with 5 pg/ml tryptophan. As appears from Fig. two strains had identical generation times during the first phase of the experiment as determined by OD 600 and in this experiment the a S 15 increase in OD 600 in the HB101(pNL7) culture reflected an exponential 0 increase in cell number. Thus, the mere presence of the F hok system 0? 0 within E. coli does not affect cell growth as long as tryptophan is present in the growth medium. At the time of tryptophan depletion, the F hok is expressed due to derepression of the crp promoter resulting in killing of the cells so that the surviving fraction is reduced to 10 3 within one hour.
o 0 *0 U Using the above construction with F hok, a substantial fraction of "cells survive induction of expression of the killing function. This might in principle be due to one or a combination of several factors: structural instability of pNL7, adaptation of HB101(pNL7) to the 0096 toxic effect of the hok protein, selection of plasmid-free cells in the population, or insufficient expression of F hok in individual cells due to the combined effect of a relatively low level of transcription even in the induced state as the Crp attenuator is present and selection of cells with low copy numbers.
To approach this question, E. coli HB101(pNL7) surviving either minutes of IAA induced F hok expression or induction of hok expression due to trypcophan depletion following growth with or without exogenously added tryptophan was analysed. The survivors from the depletion experiments were sampled 1 hour following the deflection of the OD 600 curves in Figs. 14 and 15. In these three cases, all surviving colonies tested were resistant to 50 pg/ml ampicillin, but KBM/KPJI55/PA25983E/23 03 87 survivors from the depletion experiment in which no exogenous tryptophan had been added (Fig. 14) showed a 50% decrease in cells resistant to 500 pg/ml ampicillin. Thus, a continued low-level expression of a hok protein may lead to selection of cells with a low plasmid copy number. 12 ampicillin-resistant colonies from each of the three induction experiments were grown in LB medium with 50 pg/ml ampicillin to the early exponential phase at which time IAA was added to 100 pg/ml. The number of viable cells per ml was determined minutes after IAA addition. In all 36 experiments, the expected killing was observed, the surviving fraction varying between 10- 3 and 10- 4 It is therefore concluded that the survival of HB1O1(pNL7) on
S
induction of the F hok system is due to selection of cells in which the level of expression of hok protein does not exceed a threshold value, e.g. due to selection of cells with a low plasmid copy number.
15 5 The efficiency of hok-based biological containment systems may therefore be further improved by substituting a stronger promoter Dee and/or by increasing the translational efficiency of the hok mRNA.
EXAMPLE 14 0 The effect of a XPR promoter on the expression of the hok gene e. Treatment of pPR633 with the exonuclease BaI31 resulted in a series of deletions in the 5' end of the coding strand of the parB region, two of which are shown in Fig. 16a. The plasmid pPR341 is described in Example 3. Plasmid pPR345 covers the +303 +580 region of parB, which only contains the reading frame of the hok gene (see Fig. 3).
The deletion offers neither a promoter nor a Shine-Dalgarno sequence to express the hok gene. Cloning of the BglII-SalI fragment containing the PR promoter and the X repressor (cI857) into pPR345 restricted with Sail and BamHI resulted in plasmid pKG345 (Fig. 16b).
Induction of XPR (at 42°C) resulted in rapid host killing, which showed that pKG345 showed the hok+ phenotype when induced, and that the effect was increased compared with previous constructions.
On closer analysis, the construction showed that the cro' gene of the X fragment had fused to the hok gene. This resulted in a fusion in which the hok gene was expressed from the XPR promoter and the cro' KBM/KPJ/55/PA25983E/23.03.87 Shine-Dalgarno sequence. The increased host killing effect is therefore due to a more efficient translation from the cro Shine-Dalgarno compared with the natural ribosomal binding site of hok.
Fig. 17 shows the increased killing effect expressed by the cro'-hok fusion. The killing kinetics (viable counts) and growth (OD 450 is shown after a shift to 42*C of E. coli strain MC1000 containing either pKG341 or pKG345. Increase in OD4 50 stops and viable counts decrease rapidly in both cultures, but the host killing effect of the 10 cro'-hok fusion is more distinct compared with hok alone (half life for pKG345 of 1 minute).
*0 EXAMPLE 15 Biological containment of a plasmid carrying the trp-hok containment system Plasmid transfer in natural environments is a highly uncertain risk factor in connection with recombinant DNA applications. Plasmids 2 would therefore be safer to use if they carried functions that after 20 ttransfer would induce killing of the new host cell. In an attempt to investigate the potential of the hok gene product as a killing factor for other bacterial species, a fusion plasmid of p341-1 and a kanamycin resistant derivative of the mobilizable broad-host-range plasmid RSF1010, pBOE93, was constructed. This hybrid (EcoRI-EcoRI fusion) was transformed to E. coli S 17.1, which harbours a conjugative plasmid RP1 derivative inserted in the chromosome. In a series of mobilization experiments, p341-1-RSF1010 was transferred from S 17.1 to E. coli 1005, Serratia marcescens and Pseudomonas putida, respectively. Transfers of pBOE93 and pBOE93 fused with pBR322 were performed as controls.
The results indicated in Table 2 show that all plasmids were transferred with equal frequencies from S 17.1 to 1005 (it was shown that the 1005 (p341-1-RSF1010) transconjugants were killed in the absence of tryptophan).
The vector plasmids were transferred to S. marcescens and P. pucida with very high frequencies, whereas p341-1-RSF1010 was transferred KBM/KPJf55/PA25903E/23.03.87 with less than a 10 4 fold lower frequency to both of these bacteria, even if tryptophan was present all the time. Thus, the hok gene product is lethal even for the very distantly related P. putida species, and in both organisms, the E. coli regulatory system for the trp promoter is missing, although S. marcescens is closely related to E.
coll. This makes it likely that the great majority of bacteria in the natural environment which have a possibility of receiving E. coli plasmids will be killed independently of the external concentration of tryptophan when the crp-hok fusion is present.
Table 2 9 Transfer of p341-crp RSF1010 Donor Recipient Selection Transfer 5, 15 G frequency *00 006* 999099 *s e 0 0 *s .9 S S 17.1 (pBOE93) E. coli 1005 Kan Nal 10' 1 (control) S. marcescens Kan Tc 10-1 P. putida Kan Rif 10-1 S 17.1 E. coli 1005 Kan Nal 10-1 (p341-crp RSF1010) S. marcescens Kan Tc 10-5 P. putida Kan Rif 10" EXAMPLE 16 Construction of biological containment systems for grampositive bacteria: identification of hok as a suitable killing function In the previous Examples, the use of R1 hok as well as homologous genes for the construction of containment systems has been described for a wide range of gramnegative bacteria. However, the widespread use of grampositive bacteria in fermentation and the indications that grampositive bacteria have a potential use in deliberate release productions call for the development of biological containment systems for grampositive bacteria. A prerequisite for constructing containment systems similar to those described above for gramnegative KBM/KPJI55/PA25983E/23.0387
C
I 'C 71 bacteria is that a cell killing function affecting grampositive bacteria can be identified. Since the R1 Hok protein is toxic in a wide range of gramnegative bacteria, possible toxic effects of the Hok protein in grampositive bacteria were investigated.
Preliminary experiments showed that the native promoter and ribosomal binding site from the R1 hok gene does not promote the expression of hok in B. subtilis.
In order to obtain expression ,of hok in B. subtilis, the coding sequence for Hok was inserted into an expression vector containing a promoter as well as a ribosomal binding site known to be functional in B. subtilis. The plasmid pSI-1 is a modification of pAIQ25 (Yanzu-
*S
ra and Henner, Proc. Natl. Acad. Sci. USA 81, January 1984, pp. 439- 15 443) in which the Ppac-I promoter and the penicillase gene have been 15 P replaced by a spac-I promoter followed by a synthetic ribosomal binding site (AAGGAGGTGATC) and a polylinker. A gene inserted into the polylinker of pSI-1 will be expressed if IPTG is added to the growth medium due to the present of the lac operator and the lacI gene on 20 the plasmid (Yanzura and Henner, op.cit.). Before cloning R1 hok into the pSI-1 vector, the hok gene was modified as follows. A doublestranded oligonucleotide corresponding to the N-terminal Hok coding region and with overhangs corresponding to Xbal and SauIIA cleavages was synthesized by means of a Cyclonem DNA synthesizer (available from Biosearch Inc., New Brunswick, USA) using the $-LINK cyanoethyl phosphoramidite synthesis method. The oligonucleotide differed from the R1 hok sequences at three positions, one effect being the formation of a HindIII recognition site.
A ligation reaction consisting of the oligonucleotide, a 250 bp SauIIIA-PstI fragment corresponding to the C-terminal portion of the Hok coding sequence (derived from a pUC9 recombinant from which the hok gene can be excised with various restriction enzymes), and pUC18 restricted with Xbal and Pslt was used to transform E. coli (available from Bethesda Research Laboratories, USA), selecting on LB plates containing 50 ug/ml ampicillin, 0.004% X-Gal and 1 mM IPTG.
From one of the white colonies, the plasmid pLK24 was isolated. This plasmid has the expected physical map as determined by restriction KBM/KPJ/55/PA25983E/23 03 87 enzyme analysis. The region of pLK24 derived from the synthetic oligonucleotide was sequenced in order to verify the reestablishment of the coding region of the hok gene.
To insert the modified hok gene into pSI-1, the 300 bp hok-carrying Xbal-PscI fragment from pLK2 4 was isolated and ligated to XbaI and PstI restricted pSI-1, and the ligation reaction was used to transform competent B. subtilis BD170 cells according to the procedure described in Sadaie and Kada, J. Bacc. 153, February 1983, pp. 813- 821, with subsequent selection on LB plates containing chloramphenicol (5 pg/ml). Since this construction positions the ATG start codon of hok at a distance of 11 bp from the synthetic ribosomal binding site of pSI-1, chloramphenicol-resistant colonies were further analysed for inhibition of growth, the expected phenotype if hok is ac- 15 tive in B. subtilis, by plating the transformants on LB plates containing 1 mM IPTG. Growth inhibition was observed for approximately e half of the transformants tested. One such transformant, BD170(pLK26), was further analysed.
Plasmid DNA isolated from BD170(pLK26) showed the expected physical map (Fig. 18) and thus appeared to be structurally stable.
B
In order to test the toxicity of the R1 hok gene product in B. subcilis, BD170(pLK26) and BD170(pSI-1) were grown in LB medium to the early exponential phase (OD 600 at which time IPTG was added to 2 mM.
This induces the spac-I promoter of pSI-1. The OD 600 and viable cells per ml were determined during the experiment. As can be seen from Fig. 19, the growth rates of the two cultures were identical prior to the addition of IPTG, i.e. the mere presence of the hok gene within B. subcilis does not affect cell growth. Following addition of IPTG, the OD 600 of the BD170(pLK26) culture was doubled during the first hour of IPTG treatment followed by a period with no increase in
OD
600 this corresponds to the pattern observed for the Hok effect in E. coli. Viable counts decreased immediately upon addition of IPTG to the BD170(pLK26) culture (Fig. 20), the surviving fraction being 0.25. No effect of IPTG addition was seen on the control culture.
Phase contrast microscopy of BD170(pLK26) one hour after the addition of IPTG showed the appearance of approximately 5% of ghost cells.
KBM IKPJ/55/PA25983E/23.0387 Cells surviving 1.5 hours of IPTG induction of hok expression were tested for their sensitivity to re-induction with IPTG. All 25 colonies from surviving cells showed growth inhibition on LB plates containing 1 mM IPTG.
It is concluded from these results that the hok gene product is toxic to grampositive bacteria, and hence it can be used to design biological containment systems according to the principles described in the present specification. The finding that the surviving fraction constitutes 0.25 does not invalidate this statement since survival seems to be due mainly to insufficient expression of the hok gene, a feature which may be modified by, for instance, using a stronger promoter or other standard procedures.
15 S* EXAMPLE 17 A stochastic killing effect obtained by combination of the fim and hok systems A stochastic killing effect in E. coli K-12 was obtained by a recombinant plasmid which carried the hok gene in connection with the part of the fim gene cluster that specifies the periodic expression of type 1 fimbriae in E. coli.
4 Plasmid pPKL8 (Fig. 21) carries the 300 bp inver-ible DNA fragment which harbours the promoter for the fimA gene. The plasmid further contains the two regulatory genes fimB and fimE (the "on" and "off" genes, respectively, cf. Klemm et al., Mol. Gen. Genet. 199, 1985, pp. 410 414; Klemm, Embo J. 5, 1986, pp. 1389-1393). Plasnid pPR341 (Fig. 22) has previously been described (Gerdes et al., Proc. Nacl.
Acad. Sci. USA 83, 1986, pp. 3116-3120).
pPKL8 was restricted with BglII and Dcll. The 3.3 kb BgII-BclI fragment containing the fimB and fimE genes and the invertible promoter region was inserted into the BamHI site of pPR341 resulting in plasmid pPKL100 (Fig. 23) which was transformed to E. coli K-12 strain MC1000. E. coli K-12 cells harbouring this construct grew normally in LB-medium. However, cultures of such cells showed the presence of 1- 2% of ghost cells, many of which were abnormally long (Fig. 24a and KBMIKPJ1S5/PA2593E123.03.87 74 This is indicative of a periodic transcription of the hok gene with ensuing killing of the host.
In order to determine the orientation of the invertible promoter segment, plasmid pPKL100 was digested with the restriction enzymes SnaBI and SacII. The invertible promoter segment contains a unique site for SnaBI, and by studying the sizes of the resulting fragments, the configuration of the promoter-containing segment was estimated: A 650 bp Sacll-SnaBI fragment results from the "on" configuration and a 350 bp fragment indicates the "off" configuration (see Fig. 23). In the absence of selection pressure, a 50/50 distribution of plasmids containing the segment in the "on" and "off" configuration, rspectively, is to be expected as exemplified by pPKL8 (lane B in Fig.
25). However, the same pattern was not seen in the case of plasmid 0 15 pPKL100 where only the "off" configuration was evident (lane A in Fig. 25). This indicates that cells containing plasmid pPKL100 in 0 which the inversional switch is in the "on" configuration are not viable.
20 20 EXAMPLE 18 4 00* Biological containment based on competition between cells with and without a fimA-hok containment system In order further to elucidate whether the invertible DNA segment in plasmid pPKL100 (cf. Example 17) could be influenced in trans by the gene dosage of fimB and fimE, the following constructs were made to complement this plasmid in trans: since plasmid pPKL100 was based on the pBR322 replicon, three plasmids based on the compatible vector pACYC184 were constructed, pLP5 carrying the fimB and fimE genes, pLP4 containing the fimB gene only, and pLP6 containing the fimE gene only.
Plasmid pLP4 was constructed by inserting a 2300 bp Blll-StuI fragment from pPKL10 (Klemm, 1986, op.ci.) into BamHI and EcoRV digested plasmid pACYC184 (see Fig. 26). Plasmid pLP5 was constructed by inserting a 2650 bp Bg.II-SnabI fragment into BamHI and EcoRV digested plasmid pACYC184. Plasmid pLP6 was a HinclI deletion derivative of (see Fig. 26).
KBMIKPJ/55PA2S9S3E/23.C3.87 i Plasmids pLP4, pLP5 and pLP6 were transformed into E. coli MC1000 host cells already containing pPKL100, which were grown on 0.2% glycerol A+B medium supplemented with 10 pg/ml proline, threonine, isoleucine and leucine, 20 ug/ml chloramphenicol and 100 ug/ml ampicillin. The growth rates, as measured by the increase in the optical density of the three combinations, were as shown in Table 3. The copy number ratio of pBR322 to pACYC184 is roughly 4:1, and consequently hosts harbouring the plasmid combination pLP4 pPKL100 have a corresponding 25% increase in the gene dosage of fimB (which mediates an "off" to "on" configuration of the invertible DNA fragment containing the fimA promoter in pPKL00), as compared to cells harbouring pPKL100 only. On the other hand, cells containing the plasmid combination pLP6 pPKL100 have a roughly 25% increase in the amount of the fimE gene (which mediates an "on" to "off" configuration of the 15 15 invertible DNA fragment).
A clear indication of a more frequent activation of the fimA promoter and ensuing killing of the host in the case of the pLP4 pPKL100 combination appeared from a generation time of 140 minutes for the 20 corresponding host as compared to 110 minutes for hosts containing 000* the pLP6 pPKL100 combination (Table Furthermore, the former 6 *0 showed the presence of approximately 12% of ghost cells and the latter to have virtually none, when the cells were inspected microscopically.
TABLE 3 0*0 Generation time Plasmids (population doubling time) pPKL100 pLP4 140 min.
pPKL100 pLPS 120 min.
pPKL100 pLP6 110 min.
KBM/KPJ/55/PA25983 E23.03.87 76 Deposit of microorganisms Pursuunt to the provisions of the Budapest Treaty on the International Recognition of Microorganisms for the Purposes of Patent Procedures, samples of the following microorganisms were deposited on March 25, 1987, in Deutsche Saimmlung von Mikroorganismen, Grisebachstrasse 8, 3400 G~ttingen, Federal Republic of Germany: 9 9 9 09 0 9 99 99.99 9 *9 9 9 99 99 9 99., 9 9999.9 9 *9 99 9 99 9 9 9999 1C
B.
E.
E.
E.
E.
15
E.
E.
Strain subtilis BD170 (pLK26) coil HB101 (pNL7) coi. K-12 MC1000 (pKG345) coli K-12 MC1000 (pPKL100) coli K-12 MC1000 (pPKL100 pLP4) coil K-12 lIC1000 (pPKL100 pLP5) coli K-12 MC1000 (pPKL100 pLP6) Accession No.
DSM 4037 DSM 4034 DSM 4036 DSM 4035 DSM 4031 DSM 4C32 DSM 4033 KB M/K PJ /55 PA25 983 E/23.03.87
Claims (34)
- 2. A method according to claim 1, in which bacterial cells are confined to a particular environment by introducing into the cells a lethal gene encoding a bacterial cell-killing gene product the expression of which is determined by the temperature prevailing in the environment of said cells or the presence or absence in said environment of a chemical.
- 3. A method according to claim 1, in which a recombinant DNA molecule or virus is confined to a specific primary host cell by inserting into the DNA molecule or the virus a lethal gene from which a bacterial cell-killing gene product is regula- tably transcribed, the transcription being regulated by one or more gene products, at least one of which is encoded by a gene present exclusively in the genome of the primary host cell. 20 4. A method according to claim 1, in which a recombinant DNA molecule or virus is confined to a specific primary host cell by inserting into the recombinant DNA molecule or virus a lethal gene encoding a bacterial cell-killing gene product, from which is constitutively expressed a mRNA encoding the cell killing gene product, the translation of which is inhibited by an antisense RNA transcribed from a nucleotide sequence inserted into the specific primary host cell, the nucleotide sequence coding for the antisense RNA being constitutively expressed or expressed from a promoter 30 regulated by the temperature prevailing in the environment of the host cell, the presence or absence of a chemical in said environment, or by a stochastic event. 9 A method according to claim 1, in which a recombinant DNA molecule or virus is confined to a specific primary bacterial S 829428CL.001/HS/SA/199306 79 host cell, bacterial host cells of the same species, and a definable range of secondary bacterial host cells different from the specific primary host cells, by inserting into the recombinant DNA molecule or virus a lethal gene from which a bacterial cell-killing gene product is regulatably transcribed, the transcription being regulated by one or more gene products, at least one of which is encoded by a gene present in the genome of the primary bacterial host cell, bacterial cells of the same species and a definable range of secondary bacterial host cells different from the specific primary host cells.
- 6. A method according to claim 1, in which a recombinant DNA molecule or virus is confined to a specific primary bacterial host cell, bacterial host cells of the same species, and a definable range of secondary bacterial host cells different from the specific primary host cells, by inserting into the recombinant DNA molecule or virus a nuclectide sequence comprising a lethal gene encoding a bacterial cell-killing gene product, from which gene a mRNA encoding a cell killing gene product is constitutively expressed, the translation of said mRNA being inhibited by an antisense RNA transcribed from a nucleotide sequence encoding an antisense RNA present cn a replicon different from the DNA recombinant molecule or virus, the nucleotide sequence coding for the antisense RNA being constitutively expressed or expressed from a promoter regulated by one or more gene products in the primary .bacterial host cell, at least one of which is encoded by a gene present in the genome of the primary bacterial host cell, bacterial cells of the same species and a definable 30 range of secondary bacterial host cells different from the specific primary host cells.
- 7. A method according to claim 1, in which environmentally released bacterial cells harbouring a recombinant DNA molecule or virus are confined in time and space by inserting into the recombinant DNA molecule or virus a lethal gene encoding a bacterial cell-killing gene product, the 'I8 9428CL,00I/HS/SA/199306 expression of the cell killing gene product being regulated stochastically by a stochastic event.
- 8. A method according to claim 7, in which the stochastic event is mediated by an inversional switch of a promoter.
- 9. A method according to claim 8, in which the promoter is the E. coli fimA promoter. A method according'to claim 1, in which environmentally released bacterial cells harbouring a recombinant DNA molecule or virus are confined in time and space by inserting into the recombinant DNA molecule or virus a lethal gene encoding a bacterial cell-killing gene product, from which the expression of the cell killing gene product is a cyclical event.
- 11. A recombinant plasmid for use in a method of containing a biological system comprising bacterial cells as defined in claim 1, the plasmid comprising a lethal gene encoding a bacterial cell-killing gene product which is regulatably expressed, the regulation being a regulation adapted to express the cell killing gene product in the recombinant 20 bacterial cells under environmental conditions different from the condi- tions of the particular environment to which the recombinant i bacterial cells are to be confined, or when the recombinant plasmid enters a secondary bacterial 25 host cell different from the specific primary bacterial host cells to which the recombinant plasmids are to be confined, or stochastically in such a manner that the environmentally released recombinant bacterial cells will become eliminated at a predetermined rate as a result of an expression ac- tivating event occurring at random, the event being occa- 829428CL.001/HS/SA/19930625 81 sioned by periodic inversions of a region carrying a promoter regulating the expression or by excision of a sequence carrying a negatively regulatory element, excluding plasmids as defined under in which the expression of the lethal gene, when it is the hok gene from the parB region of plasmid R1 or the relB-orf3 gene from E. coli, is regulated by a X PR promoter under the control of the A c1857 repressor, and plasmid pSI-1 with an inserted hok gene regulated by the SP01 promoter under the control of the lac operator of said plasmid.
- 12. A plasmid according to claim 11, in which the expression of the bacterial cell-killing gene product is regulated at the level of transcription by means of a promoter regulated by the temperature prevailing in the environment of a host cells harbouring the plasmid, the presence or absence of a chemical in the environment of a host cell, or by a stochastic event.
- 13. A plasmid according to claim 12, in which the chemical is selected from carbon or nitrogen sources, metabolites, amino 20 acids, nucleosides, purine or pyrimidine bases, or metal ions.
- 14. A plasmid according to claim 13, in which the chemical is tryptophan. A plasmid according to claim 12, in which the stochastic 25 event is occasioned by a periodic inversional switch of a promoter.
- 16. A plasmid according to claim 15, in which the promoter is the E. coli fimA promoter. *i 829428CL.001/HS/SA/199306
- 17. A plasmid according to claim 11 in which the expression of the lethal gene coding for a bacterial cell-killing gene product is regulated by inhibiting the translation of the mRNA specifying the cell-killing gene product by an antisense RNA capable of hybridizing to said mRNA.
- 18. A plasmid according to any one of claims 11-17, in which the lethal gene encoding a cell killing gene product is derived from a bacterial plasmid, a bacterial chromosome, a procaryotic virus, a eukaryotic plasmid, a eukaryotic virus, a eukaryotic chromosome, eukaryotic mitochondria or eukaryo- tic chloroplasts, or is a synthetic sequence.
- 19. A plasmid according to claim 18, in which the lethal gene is the hok gene from the parB region of plasmid R1 or a DNA sequence which is homologous to the R1 hok gene.
- 20. A plasmid according to any one of claims 11-19, in which a nucleotide sequence regulating the transcription of the gene encoding the cell killing gene product is derived from a bacterial plasmid, a bacterial chromosome, a procaryotic virus, a eukaryotic plasmid, a eukaryotic virus, a eukaryotic chromosome, eukaryotic mitochondria or eukaryotic chloroplasts, or is a synthetic sequence.
- 21. A plasmid according to any one of claims 11-20 which further comprises a DNA sequence not naturally related to the replicon, said DNA sequence being selected from sequences coding for a biosynthetic product, for an epitope for immunization and for means for transporting said epitope, when expressed, to the outer surface of a bacterial cell harbouring the plasmid. o
- 22. A recombinant bacterial cell transformed with a plasmid 30 according to any one of claims 11-21.
- 23. A bacterial cell according to claim 22 which harbours a plasmid according to claim 17 and which further comprises a 829428CL.001/HS/SA/199306 83 nucleotide sequence coding for an antisense RNA which is capable of inhibiting the translation of the mRNA specifying the cell-killing gene product, said nucleotide sequence being present on the plasmid or another replicon in the cell.
- 24. A bacterial cell according to claim 23, in which the nucleotide sequence coding for the antisense RNA is constitutively expressed or expressed from a regulatable promoter. A bacterial cell according to claim 24, in which the expression of the nucleotide sequence coding for the anti- sense RNA is determined by the temperature in the environment of a host cell harbouring the plasmid, the presence or absence of a chemical in the environment of a host cell, or by a stochastic event.
- 26. A bacterial cell according to claim 25, in which the stochastic event is brought about by a periodic inversional switch of a promoter, or by recombinational excision of the nucleotide sequence encoding said antisense RNA.
- 27. A bacterial cell according to claim 26, in which the the promoter is the E. coli fimA promoter. S: l 28. A bacterial cell according to claim 25, in which the *:expression of the nucleotide sequence coding for the antisense RNA is determined by a chemical selected from carbon or nitrogen sources, metabolites, amino acids, nucleosides, purine or pyrimidine bases, or metal ions. 0 0
- 29. A bacterial cell according to claim 28, in which the S- nucleotide sequence coding for the antisense RNA is trans- cribed from the lac promoter.
- 30. A bacterial cell according to any one of claims 22-29, in 30 which the nucleotide sequence encoding the antisense RNA is derived from a bacterial plasmid, a bacterial chromosome, a S. 829428CL.001/HS/SA/199306 84 procaryotic virus, a eukaryotic plasmid, a eukaryotic virus, a eukaryotic chromosome, eukaryotic mitochondria or eukaryo- tic chloroplasts, or is a synthetic sequence.
- 31. A bacterial cell according to any one 6(claims 22-29, in which a nucleotide sequence regulating the transcription of the antisense RNA is derived from a bacterial plasmid, a bac- terial chromosome, a procaryotic virus, a eukaryotic plasmid, a eukaryotic virus, a eukaryotic chromosome, eukaryotic mitochondria or eukaryotic chloroplasts, or is a synthetic sequence.
- 32. A vaccine comprising a population of recombinant bacterial cells as defined in claim 22, said recombinant bacterial cells being confinable to an animal or human body environment to which they are released, the bacterial cells carrying a lethal gene encoding a bacterial cell-killing gene product, the expression of which is regulated stochastically in such a manner that the environmentally released recombinant bacterial cells will become eliminated at a predetermined rate as a result of an expression activating event occurring at random, the event being occasioned by periodic inversions of a region carrying a promoter regulating the expression or by excision of a sequence i* carrying a negatively regulatory element, the bacterial cells S: further comprising a nucleotide sequence encoding an epitope 25 for immunization derived from a pathogenic agent; and a gene coding for a naturally occurring cell surface protein for i. transporting the epitope, when expressed, to the outer surface of the host cell, the rate of elimination of the bacterial cells from the animal or human body being 30 determined so as to provide an adequate immunization against the pathogenic agent from which the epitope is derived. 0
- 33. A vaccine according to claim 32, in which the naturally occurring cell surface protein whereby the epitope is transported to the outer surface of the host cell, is an ad- hesin. 829428CL.001/HS/SA/199306
- 34. A vaccine according to claim 33, in which the nucleotide sequence encoding the epitope is inserted into the gene coding for a naturally occurring cell surface protein to express a fusion protein which is translocated to the cell surface. A vaccine according to claim 34, in which the gene coding for a naturally occurring cell surface protein is a gene coding for a fimbrillin.
- 36. A vaccine according to claim 32, in which the recombinant bacterial cells are selected from Enterobacteriaceae, lactic acid bacteria, Vibrionaceae and Pseudomonades.
- 37. A vaccine according to claim 32, in which the stochastic event determining the expression of the cell killing gene product is brought about by a periodic inversional switch of a promoter transcribing into the nucleotide sequence comprising the gene encoding the bacterial cell-killing gene product.
- 38. A vaccine according to claim 32, in which the stochastic event determining the expression of the cell killing gene product is brought about by a periodic inversional switch of a promoter transcribing into a nucleotide sequence encoding an antisense RNA inhibiting the translation of the mRNA specifying the cell killing gene product, or by recombina- tional excision of said nucleotide sequence encoding the 'o 25 antisense RNA.
- 39. A vaccine according to claim 37 or 38, in which the promoter is the E. coli fimA promoter.
- 40. A vaccine according to claim 32, in which the pathogenic agent from which the epitope is derived is selected from a 30 virus, bacterium or eukaryotic organism such as a fungus or protozoan. 829428CL.001/HS/SA 199306 86
- 41. A vaccine according to claim 34, in which the recombinant bacterial cell carries two or more nucleotide sequences coding for epitopes from different pathogenic agents, each of the epitopes being expressed as a fusion protein.
- 42. A vaccine according to claim 32, in which the recombinant bacterial cell carries an additional promoter which, when activated, transcribes into a further nucleotide sequence comprising a lethal gene encoding a bacterial cell-killing gene product, the nucleotide sequence encoding the bacterial cell-killing gene product being the same as, or different from the one the expression of which is regulated sto- chastically. DATED this 2nd day of November 1993 GENEXPRESS ApS Patent Attorneys for the Applicant: F.B. RICE CO. 0 a a a a a a. a a a a a C o: go ooo oooo *1 B\j 829428CL.001/fIS/SA/199306 BIOLOGICAL CONTAINMENT ABSTRACT A replicon, in which a nucleotide sequence encoding a cell killing function is regulatably expressed when the replicon is harboured in one type of host cell (primary host cell), so that cells harbouring the replicon are killed under conditions under which the cell killing function is expressed, and the nucleotide sequence encoding the cell killing function is regulatably or constitutively expressed when the replicon is harboured in another type of host cell (secondary host cell), so that cells harbouring the replicon are invariably killed or killed under conditions under which the cell killing function is ex- pressed, may be used in a method of active biological containment of cells under defined environmental conditions. The biological containment principle may be utilized in the indu- strial production of a biosynthetic product by recombinant DNA tech niques, when deliberately releasing a genetically engineered micro- organism to the natural environment or in the preparation of a live vaccine. The expression of the cell killing function may be regulated by means of a promoter.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DK1455/86 | 1986-03-26 | ||
DK145586A DK145586D0 (en) | 1986-03-26 | 1986-03-26 | BIOLOGICAL INCLUSION |
DK6294/86 | 1986-12-23 |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU72320/87A Division AU7232087A (en) | 1986-03-26 | 1987-03-25 | Biological containment |
Publications (2)
Publication Number | Publication Date |
---|---|
AU7818391A AU7818391A (en) | 1991-11-14 |
AU646467B2 true AU646467B2 (en) | 1994-02-24 |
Family
ID=8105010
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU78183/91A Ceased AU646467B2 (en) | 1986-03-26 | 1991-06-04 | Method containing a biological system comprising bacterial cells, recombinant plasmid, recombinant bacterial cells and a vaccine comprising a population of such cells |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU646467B2 (en) |
DK (1) | DK145586D0 (en) |
-
1986
- 1986-03-26 DK DK145586A patent/DK145586D0/en not_active IP Right Cessation
-
1991
- 1991-06-04 AU AU78183/91A patent/AU646467B2/en not_active Ceased
Also Published As
Publication number | Publication date |
---|---|
AU7818391A (en) | 1991-11-14 |
DK145586D0 (en) | 1986-03-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5853718A (en) | Method of immunization using biologically contained bacterial cells | |
AU766257B2 (en) | Cytotoxin-based biological containment | |
FI86439C (en) | STABILIZER SPASMIDER. | |
Beall et al. | Nucleotide sequence and insertional inactivation of a Bacillus subtilis gene that affects cell division, sporulation, and temperature sensitivity | |
NO169242B (en) | EXTERNALIZATION OF BACTERIAL PRODUCTS | |
US5702916A (en) | Biological Containment | |
US5545541A (en) | Stabilization of unstably inherited replicons | |
US6017730A (en) | Method of limiting the survival of genetically engineered microorganisms in their environment | |
Levine et al. | Recombinant DNA risk assessment studies in humans: efficacy of poorly mobilizable plasmids in biologic containment | |
AU646467B2 (en) | Method containing a biological system comprising bacterial cells, recombinant plasmid, recombinant bacterial cells and a vaccine comprising a population of such cells | |
WO1995010614A1 (en) | Recombinant staphylococcal nucleases and their use in limiting the survival of genetically engineered microorganisms | |
Thompson | Plasmid and phage M13 cloning vectors | |
EP0635061B1 (en) | A method of limiting the survival of genetically engineered microorganisms in their environment | |
DK2180050T3 (en) | Cytotoxin-based biological containment | |
Weber | Dynamics of plasmid-containing cells in a chemostat under transient conditions | |
Wright | High level gene expression in E. coli: Effects of point mutations within the coding sequence | |
Wachira | Regulation of the Pseudomonas aeruginosa amidase operon by transcription antitermination | |
Chen | The specificity of attenuation control of the expression of theilvGMEDA operon in Escherichia coli K-12 | |
Huang | Regulation of gene expression in Escherichia coliilvGMEDA cluster | |
NO870630L (en) | STABILIZATION OF UNTABLY DEDICATED REPLICATIONS. |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PC | Assignment registered |
Owner name: APOVIA AG Free format text: FORMER OWNER WAS: GX BIOSYSTEMS A/S |
|
MK14 | Patent ceased section 143(a) (annual fees not paid) or expired |