AU638207B2 - Isoforms of trophoblastine - Google Patents

Description

OPI DATE 05/10/89 AOJP DATE 02/11/89 APPLN. I D 32953 89 PCT NUMBER PCT/FR89/00116

PCI?

ORGANISATION MONDIALE DE LA PROPRIETE [NTELLECTUELLE Bureau international DEMANDE INTERNATIONALE PUBLIEE EN VERTU DU TRAITE DE COOPERATION EN MATIERE DE BREVETS (PCT) (51) Classification internationale des brevets 4 (11) Nutnero de publication internationale: WO 89/ 08706, C12Q 1/68, C12P 2/62 Al (43) Date de publication internationale: AOlN 1/02 21 septembre 1989 (21.09.899 (21) Numiro de In demnande intemtidonale: PCT/FR89/00l 16 Re6sidence du CNRS, Bit. E, F-91 190 Gif-sur-Yvette (FR).

1 jHlUET. Jean-Claude ;15, all~e de I'Or6e, F-78340 Les (22) Date de dip6t international: 17 mars 1989 (17.03.89) Clayes-sous-Bois (FR).'R.E1NAUD, Pierrette :25, avenue dle la R~publique, F-92320 Chltillon HUE, Domnini- (31) Nun ros des demandes prioritaires: 88/03591 bue 34, rue Hcnri-die-Rkgnier, F-78000 Versailles (FR).

304,209 PHENE, N-icole 13, avenue Hetui-Grellou, F-91370 Verires-le-Buisson (FR).T~A BONNARDIERE, Claude 29, (32) Dates de prioriti: 18 mars 1988 (18.03.88) place dle Gascogne, F-78310 Maurepas (FR1).

31 janvier 1989 (31.01.89) (74) Mandataires: ORES, lr~ne etc.; Cabinc, Oris. 6, avenue de (33) Pays de prioriti: FR Messine, F-75008 Paris (FR).

us (81) Etats d~signis: AT (brevet europ~en), AU, BE (brevet euro- (71) Diposant: INSTITUT NATIONAL DE LA RECHERCHE pien), CH (brevet europ~en), DE (brevet europ~en1, FR AGRONOMIQUE (INRA) [FR/FR]: 147, rue de l'Universi- (brevet europ~ei:., GB (brevet europ~en), IT (brevet euroti, F-75341 Paris C~dex 07 p~en), JP, LU (brevet europ~en), NL (brevet europ~en), SE (72) Inventeurs: MARTAL, Jacques 6. 'alle du Josas, F-78350 (rvterpe) JouN-en-Josas CHARPIGNY, Gilles :l55, rue de Publiie Bourgogne, F-45000 Orlkans GAYE, Pierre 51, rue A vec rapport de recherche internationale, Caulaincourt, F-75018 Paris PERNOLLET, Jean- Avant I'expiration du dilai privu pour la modif/ication des re- Claude Residence Notre-Dame. 1, impasse de Toulouse, F- vendicaiions, sera republihe si de telles modifications sont re- 78000 Versailles CHARLIER, Madia 44, rue Sarrette, frues.

F-75014 Paris GUILLOMOT, A US R A LAI 63 826%07 PATENT aTil (54) Title: ISOFORMS OF TROPHOBLASTINE, NEW INTERFERONS COMPOSED OF SAID ISOFORMS, THEIX MANNER OF PRODUCTION AND APPLICATIONS (54) Titre: ISOFORMES DE LA TROPHQBLASTINE, NOUVEAUX INTERFERONS CONSTITUES PAR LES- DITES ISOFORMES, LEURS PROCEDES D'OBTENTION ET LEURS APPLICATIONS (57) Abstract The invention is characterised by a sequence of N-terminal amino acids which complies with a common general formula in which X5 is: Glu or Gin; U12 is Arg or Lys; Y35 is Lys or Asp and Z44 is Glu or Asp. W48 is Asp or Leu, V49 is Leu or Gin.

Application for detecting an embryo signal.

(57) Abreg6 La pr~sente invention est relative A des isoformes de la trophoblastine. Elie se caract~rise par une siquence d'amninoacides N-terminale qui r~pond i une formule -&n~rale commune dans laquelle repr~sente: Glu ou Gin: U12 repr~sente Arg ou Lys; Y35 repr~sente Lys ou Asp et Z44 repr~sente Olu ou Asp. W48 repr~sente Asp ou Leu: V49 repr~sente Leu ou GIn.

Application A la detection d'un signal embrvonnaire.

600 20 140 Ekok d~lLicnmi4 Cys-Tyr-Leu--Ser- (X )-Arg-Leu-Het,-Leu-Asp-Ala- -Gllu-Asn-Leu 1 5 2.0 12 Lys-Leu-Lou-Asp-Arg-Met-Asn-Ax9g-Lu-Ser-Pro-His-Ser-Cys-Leu 20 25 Gln-Asp-Arg-Ly6- Y)-Phe-Gly-Loui-Pro-Glu-Glu-lHet-Val-( Z )-Gly 35 40 Asp-Gln-W-V-Lys-Asp-Gln-Ala-Phfa-Pro 50 1 The present invention relates to isoforms of trophoblastin corresponding to class II a-interferons possessing, inter alia, antiviral properties.

An Article published in J. REPROD. FERT. (1979) 56, P. 63-73, in the names of J. MARTAL, M.C. LACROIX, C. IOUDES, M. SAUNIER and S. WINTENBERGER-TORRES, described the identification of an antiluteolytic component, called trophoblastin, secreted by the ovine embryo; it also established the protein nature of trophoblastin, which is thermolabile and sensitive to proteases; it further established that the period for which trophoblastin is secreted is very restricted since its presence seems to be critical only as from day 12 of gestation and is no longer detectable after days 21-23.

Furthermore, the said article put forward two hypotheses concerning the mechanism of action of trophoblastin, expressing a preference for the one which seemed to be confirmed by the experiments performed, namely the hypothesis that the action of trophoblastin is essentially local.

An article by GODKIN, BAZER, TATCHER and ROBERTS, published in J. REPROD. FERT. (1984) 11, p. 57-64, studies proteins released by the conceptus during culture of the latter and not, as in the case of MARTAL et al., extracts of homogenates of conceptus tissues. The ovine trophoblast protein identified by ROBERTS et al., namely oTP-1, secreted by the ovine conceptus between days 13 and 21 of gestation, was purified and then injected into the uterine tract and an experiment was carried out in order to determine whether it is actually involved in the luteal function during:the early stage of gestation.

After referring to a previous publication in which they described the identification, by two-dimensional polyacrylamide gel electrophoresis, of proteins produced in vitro by the ovine conceptus between days 13 and 23 of gestation and the purification of the two major polypeptides secreted, the authors endeavored to determine, in the work reported in the said publication, whether the oTP-1 released into the incubation medium by the conceptus on days 15-18 is capable of prolonging the functional life of the CL when it is injected into the uterine lumen of sheep during their cycle. They thereby established that this oTP-1 of ovine origin is not as active as the total conceptus proteins and that it only "prolongs" the cycle by 4 days on average. They further suggested that oTP-1 was capable of prolonging the functional life of the CL by acting in conjunction with the uterine endometrium.

In an article published in THERIOGENOLCGY, January 1985, vol. 23, no. 1, p. 129-143, ROBERTS et al. studied the proteins secreted by the bovine conceptus (CSP) in the culture medium: they established that the intrauterine administration of CSP to cows during their cycle prolongs the CL function by 8 days beyond that of 53-P 3-ol-20-one) and of control cows. The principal polypeptides produced in the 16-day conceptus culture medium were identified by two-dimensional electrophoresis as having molecular weights of 22 to 26 kDa (by electrophoretic mobility in the presence of SDS) and a migration within a range of isoelectric points from 6.8 to 5.6; minor polypeptides of MW 40 50 and isoelectric points 6.2 to 7.4 were also identified in the medium. The said publication also reports the hypothesis put forward, namely that a study, after purification, of the proteins produced by the bovine conceptus ought to make it possible to elucidate their respective roles in the process of maintaining the CL and to demonstrate that similar proteins produced by the ovine conceptus could be active in cattle. To prove this hypothesis, eanti-oTP-1 rabbit serum was used for the immunological characterization of proteins secreted by the bovine conceptus. Analysis by double immunodiffusion using Ouchterlony's method, with anti-oTP-1 serum, produced a double band against the nonfractionated proteins secreted by the bovine conceptus.

One of these two bands has a partial identity both with the purified oTP-1 and with the non-fractionated proteins secreted by the ovine conceptus. Other experiments, performed in the presence of a radioactive amino acid, confirm the partial homology between the proteins produced by the ovine and bovine conceptus and confirm the work of MARTAL et al. on the transfers of interspecific trophoblastic vesicles in sheep and cows, reported in J. REPROD.

FERT. (1984) 70, p. 533-540, and Proc. 10th Intern. Congr.

on Anim. Reprod. and Urbana-Champaign, USA Ill., no.

510, 3 p. ROBERTS et al. (ENDOCRINOLOGY (1984) 114, 120- 130) show that oTP-1 can selectively stimulate some proteins of the endometrium and they formulate the hypothesis that certain proteins might inhibit the biosynthesis of prustaglandin F2a in the endometrium, although such a hypothesis has not been proven either as regards the proteins secreted by the bovine conceptus or as regards the proteins secreted by the ovine conceptus. In an article published in ENDOCRINOLOGY (1985) 117, no. 4, p.

1424-1430, ROBERTS et al. describe the translation of mRNA of 16-day ovine conceptus with the aid of a cell-free lyzate of wheatgerm. Immunoprecipitation of the oTP-1 from the translation mixture with the aid of a specific rabbit antiserum shows that the oTP-1 synthesized has a molecular weight of 21 kDa, whereas, according to the authors, the oTP-1 secreted by the intact conceptus in culture medium seems to have a molecular weight of 17 kDa.

In an article published in LIVESTOCK PRODUCTION SCIENCE (1987) 11, p. 193-210, MARTAL et al. take stock of the knowledge on trophoblastin, which they show to be identical to the oTP-1, that is secreted by the trophectoderm and has been found solely in sheep and cows. The said publication establishes that trophoblastin inhibits luteolysis by direct action on the endometrium, affecting the CL not directly but via either small peptides which it induces or endometrial luteotrophic prostaglandins.

An abstract published in J. CELL. BIOL. 1IQ5 (4) PART 2 (1987), under the signature of ROBERS et al., reports the establishing of a nucleotide sequence of a series of clones of oTP-1 cDNA from a library of lambda gtll cDNA built from poly(A) mRNA of 16-day conceptus. The primary structure which is deduced from the cDNA of oTP-1 has a homology of the order of 50% with the class I ainterferons of humans, cattle, pigs, mice and rats, and of about 75% with the primary structure of class II bovine ainterferon and with that of human 0-interferon. The said abstract further indicates that oTP-1 has cysteines in positions 1, 29, 99 and 139 and at the same time a sequence: Cys-Ala-Trp-Gly-Ile-Val-Val-Arg 139 146 which is found in the majority of a-interferons. The abstract also indicates that the authors have demonstrated that oTP-1 possesses the antiviral and antiproliferative properties of an interferon, which leads them to suggest that oTP-1 not only corresponds to a maternal recognition of pregnancy signal in sheep, but might also behave as a local immunomodulator.

An article published in NATURE (1987) vol. 330, 26 November 1987, under the signature of ROBERTS et al., rerorts the amino acid sequence of oTP-1, as deduced from a cloned cDNA, and demonstrates that the protein is very probably an a-interferon. One of the Figures in the said article reproduces the nucleotide sequence, and the amino acid sequence deduced therefrom, of the whole length of the oTP-1 cDNA of clones kaz-6 and kaz-2; it contains 972 kbases; the deduced amino acid sequence identified contains 172 amino acids with the following sequence 139 146: Cys-Ala-Trp-Glu-Ile-Val-Arg-Val 139 146 The article reports the verification of the identity of the formula with the purified oTP-1 and the homology of the latter with the formula of the a-interferons of various mammals, including humans, which would suggest that the isoforms of oTP-1 might be very specialized interferons which might participate in the immunoprotection of the fetus, having regard to the fact that interferons can delay the rejection of allografts and can inhibit the activation of the lymphocytes by lectins and antigens. These isoforms have been identified as follows oTP-1 consists of 3 4 isoelectric variants with isoelectric points of 5.5 5.8 and with a molecular weight of 18 kDa, and the OTP-1 obtained by translation in vitro (pre-oTP-1) from polyadenylated RNA consists of several polypeptides, each of which has a molecular weight of the order of 21 kDa.

An article published in FEBS LETTERS, vol. 228, no. 1, p. 12-16, February 1988r under the signature of MARAL et al., describes the purification of trophoblastin or oTPB (ovine trophoblastic protein B) by analytical HPLC and the determination of the first 45 amino acids. The authors further demonstrated, by comparison of the sequences, a significant homology between oTPB (which seems to be immunologically identical to oTP-1) and bovine class II ainterferons; 64% of the amino acids are identical and are homologous; the region 23 44 has a homology of 82%.

Moreover, because of the 55% identity between oTPB and human interferon-a-I.9 on the one hand and murine interferon-a-I.1 on the other, from the N-terminal end, the authors consider that oTPB (or oTP-1 or trophoblastin) -ought to be an embryonic interferon. The only difference between the sequence of 45 amino acids shown in the said publication and the corresponding sequence shown in the publication in NATURE is the fact that it contains a Gin residue in the 5-position and an Arg residue in the 6position, whereas the corresponding amino acid sequence published in NATURE respectively contains an Arg residue and a Lys residue in these two successive positions.

As is apparent from the publications cited above, the embryonic signal which trophoblastin represents is secreted at the moment of differentiation of the embryo; its secretion starts on day 9, when the embryo is merely an undifferentiated mass of cells, and it disappears on day 22 of gestation, when the embryo is already formed.

Furthering our knowledge relating to the protein designated by the name trophoblastin would make it possible to lower the detection threshold of the embryonic signal in question, this being of particular importance in the techniques of embryo transfer and transplantation, in which it is essential to detect as early as possible whether the transferred embryo is alive, and in which it would be even more favorable to be able to detect the viability of embryos in synthetic media before transplantation. Furthering our knowledge relating to this protein, whose homology with class a interferons has recently been demonstrated, would probably make it possible by virtue of making available a clearly identified physiological model capable of giving information on the mode of operation of an embryonic interferon in a normal cell to understand the behavior of an interferon in a cell infected by a virus and to improve the properties of interferons.

The present invention relates to isoforms of trophoblastin or its embryonic analogs, which comprise an N-terminal amino acid sequence having a common general *formula I: 7 Cys-Tyr-bseu-Ser- -Arg-Leu-Met-Leu-Asp-Ala- -Glu-Asn-Leu 1 5 10 12 Lys- Leu-Leu-Asp-Arg-Met-Asn-Arg-Leu-Ser-Pro-H-is-Ser-Cys-Leu 25 Gln-Asp-Arg-Lys- (Y )-Phe-Giy-Leu-Pro-Glu-Glu-Met-Val-(CZ )-Gly 40 Asp-Gln- (W)-(V)-Lys-Asp--Gln-Aila-Phe-Pro

(I)

in which (X5) represents Giu or Gin (t312) represents Arg or Lys represents Lys or Asp (Z44) represents Glu or Asp (W48) represents Asp or Leu (V49) represents Leu or Gin.

In one advantageous emnbodimnent of an isoform of trophoblastin, the isoform Ti comprises an N-terminal amino acid sequence having the formula Ii below: Cys-Tyr-Leu-Ser--Glu-Arg-Leu-Met-Leu-Asp-Ala-Arg-Glu-Asn-Leu 1 5 10 Lys-Leu-Leu-Asp-Arg-Met-Asn-Arg-Leu-Ser-Pro-His-Ser-Cys-Leu 25 Gln-Asp-Arg-Lys-Lys-Phe-Gly-Leu-Pro-Gln-Glu-Met-Val-Glu-Gly 40 44 Asp-Gln-Asp-Leu-Lys-Asp-Gln-Ala-Phe-Pro 3. In another advantageous embodiment of an isoform of trophoblastin, the isoform T2 comprises 'an N-terminal amino acid sequence having the formula 12 below: Cys-Tyr-Leu-Ser-Gln-Arg-Leu-Met-Leu-Asp-A la-Arg-G lu-Asn- Leu 1 5 10 Lys-Leu-Leu-Asp--Arg-Met-Asn-Arg-Leu-Ser--Pro--His-Ser-Cys-Leu 25 8 G ln-Asp-Arg-Lys-Asp-Phe-Gly-Leu-Pro-Gln-G lu-Met--Val-Glu-G ly 40 44 Asp-Gln-Leu-Gln-'Lys-Asp-Gln-Ala-Phe-Pro-Val-Leu (12) In yet another advantageous embodiment of an isoform of trophoblastin, the isoformn T3 comprises an Nterminal amino acid sequence having the formula I3 below: Cys-Tyr-Leu-Ser-Gln-Arg-Leu-Met-Leu-Asp-A la-Arg-Glu-Asn-Leu 1 5 10 Lys-Leu-Leu-Asp-Arg-Met-Asn-Arg-Leu-Ser-Pro-His-Ser-Cys-Leu 25 Gln-Asp-Arg-Lys-Asp-Phe-Gly-Leu-Pro-Gln-Glu-Met-Val-Asp-Gly 40 44 (13) In another advantageous embodiment of an isoform of trophoblastin, the isoform T4 comprises an N-terminal amino acid sequence having the formula 14 below: Cys-Tyr-Leu-Ser-Gln-Arg-Leu-Met-Leu-Asp-Ala-Arg-Glu-Asn- 1 5 10 12 20 Cys-Leu-Gln-Asp-Arg-Lys-Asp-Phe-G ly-Leu-Pro-G ln-G lu-Met- 35 Val-G lu-Gly-Asp-Gln-Leu 44 45 48 (14) In yet another advantageous embodiment of an isoform of trophoblastin, the isoform T5 Comprises an Nterminal amino acid~ sequence having the formula 15 below: Cys-Tyr-Leu-Ser-Gln-Arg- Leua-Met-Leu-Asp-Ala-Lys-Glu-Asn- Leu 1 5 10 12 Lys-Leu-Leu-Asp-Arg-Met-Asn-Arg-Leu-Ser-Pro-His-Ser-Cys-Leu 25 Gln-Asp-Arg-Lys-Asp-Phe-Gly-Leu-Pro-Gln-Glu-Met-Val-Glu-Gly 40 Asp-Gln-Leu-Gln-Lys-Asp-Gln-Ala-Phe-Pro-Val-Leu 48 49 50 (Ie) The present invention further relates to a method of isolating the isoforms of trophoblastin by high performance liquid chromatography (HPLC), wherein a culture medium obtained after incubation of mammal conceptus for an appropriate time is subjected to chromatography on an anion exchange column equilibrated with a cationic buffer, and then to the action of a saline gradient in a cationic buffer, within an appropriate interval of time, this being followed by isocratic elution during which the isoforms are collected in succession.

The invention covers of course the said method and its variants.

In one way of carrying out the method according to the present invention, the medium for collecting the conceptus to be cultivated consists of an appropriate buffer devoid of serum albumin and containing polyvinylpyrrolidone at a concentration of about 0.05% to 0.5% by weight/volume.

In another way of carrying out the method according to the present invention, the conceptus are cultivated in a synthetic culture medium devoid of serum albumin and blood serum and containing polyvinylpyrrolidone at a concentration of about 0.05% to 0.5% by weight/volume.

The polyvinylpyrrolidone is preferably selected from the high-molecular polyvinylpyrrolidones so as to favor its elimination by exclusion on a chromatography column or by insolubilization at acid pH.

According to the invention, these isoforms, each of which has a molecular weight of the order of 20 kDa, have an isoelectric point of about 5.4 for the Ti form, about 5.3 for the T2 form and about 5.2 for the T3 form.

The present invention further relates to an agent having antiviral, antiproliferative, antitumoral, immunological, immunomodulating, rejection-inhibiting, celldifferentiating and luteolysis-inhibiting activities at the start of gestation in mammals, as well as genetic select.ion activities, the said agent consisting of a class II a-interferon which is one of the isoforms of trophoblastin as identified by their N-terminal sequences of formulae Ii, 12, Is, 14 and Is, or mixtures thereof.

The present invention further relates to the cDNA nucleotide sequences of each of the isoforms of trophoblastin and to the amino acid sequences which are deduced therefrom.

According to the invention, the cDNA nucleotide sequence of the isoform T2, and the deduced amino acid sequence, consist-s of a polypeptide whose molecular weight is of the order of 23 kDa, corresponding to the precursor of trophoblastin, and which has formula II below:

AGAGAACCTAOOTGAAG

A £T%"CCOCTGACOOOATCTOAGOCAGCCCAGCAGOAGCCGOATOTTOCOCATGGCO Met Ala -23 TTC GTG OTC TCT CTA OTG ATG GCC CTG GTG CTG GTC AGO TAT GGC Phe Val Leu. Ser Leu Leu Met Ala Leu Val Leu Val Ser Tyr Gly

COA

Pro

GAT

Asp

TCC

Ser

CAG

Gin

OCT

Pro

ACA

Thr

OTC

Leu

AGG

Arg 100

GAO

Asp 115

TAO

Tyr 130

AGA

Arg 145

GGA

Gly

GC

Ala

OCT

Pro

GAG

G iu

GTG

Val

GAG

Glu

TGO

Cys

GGT

Gly 000 Pro

CTG

Lexu

GTC

Val GGA TOT Gly Ser AGG GAG Arg Giu OAT TOO His Ser ATG GTG Met Val OTO TAO Leu Tyr CAC TOO His Ser ACT GGA Thr Giy CAA GTG Gin Val ATT GTG Ile Vai CAA GAG Gl Giu GAG ATG Giu Met OTG GGT TGT Leu Gly Cys -1 +1 'AAO OTO AAG Asn Leu Lys 15 TGT OTG CAG Cys Loeu Gin 30 GAG GGO GAO Glu Giy Asp 45 GAG ATG OTO Giu Met Leu 60 TOT GOT GC Ser Ala Ala 75 OTO CAA CAG Leu Gin Gin 90 ATG GGA GAG Met Gly Giu 105 ACC GTG AAG Thr Val Lys 120 AAG GGA TAO L~ys Gly Tyr 135 ATG AGA GC Met Arg Ala 150 AAG ATG GGT Lys Met Gly 165 rAO Tyr

CTO

Leu

GAO

Asp

CAG

Gin

CAG

Gin

TGG

Trp

OAG

Gin

GAA

Giu

AAG

Lys

AGO

SF.r

OTC

Leu

GGP

Gl-,

OTA

Leu,

OTG

Leu

AGA

Arg

OTO

Leu

CAG

Gin

GAO

Asp

OTG

Leu,

GAO

Asp

TAO

Tyr

GAO

Asp

ACT

Thr

GAT

Asp TOT CAG Ser Gin GAO OGA Asp Arg AAA GAO Lys Asp CAG AAG Gin Lys AGO TTO Ser Phe ACC ACC Thr Thr so8 GAO CAC Asp His TOT GAA Ser Giu 110 TTO OAG Phe Gin 125 TGO GC Cys Ala 140 GTA TOA Val Ser 155 OTG MAC pLeu Asr AGA OTO ATG OTG 143 Arg Leu Met Leu ATG MOC AGA OTO 188 Met Asn Arg Leu TTT GGT OTT 000 233 Phe Gly Leu Pro GAO CAG GOC TTO 278 Asp Gin Ala Phe MOC OTO TTO TAO 323 Asn Leu Phe Tyr CTO OTG GAO CAG 368 Leu Leu Asp Gin CTG GAO ACC TOG 413 Leu Asp Thr Cys CTG GGT MOC ATG 458 Leu Gly Asn Met GGO ATO TAT GAO 503 Gly Ile Tyr Asp TGG GMA ATO GTYZ 548 Trp Glu Ile ACC ACC TTG CAM 593 Thr Thr Leu Gin TOA COT TGATGAOT 640 LSer Pro AMA AGG TTA AOP Lys Arg Leu Thx 160 170 172 OTTGOOGAOTMAGATGOOAOATOAGOOTOOTAOAOOOGCOTGTGTTOATTTOAGMAGAOT 700 OTGATTTOTGOTOOAGOOAOOAAATTOATTGMATTAOTTTAGOTGATAOTTTGTOAGTAG 760 TAAAAGOMGTAGATATAAAAGTATTAGTGTAGGGGATGAGTOOTGAAATGATG 820 OOTTCOCTGATGTTATOTGTTGOTGATTTATTTATAOCTTOTAGCATTTMOCATAOTTAA 880 AATATTAGGAAATTTGTTMAGTTAOATTTOATOTGTAOATOATATTAAAATTTOTAAAAO 940 ATG polyA 943

(II)

The present invention further relates to an oligodeoxynucleotide probe for the characterization of clones containing the cDNA of the mRNA of trophoblastin and its isoforms, which is deduced from the nucleotide sequence of the cDNA of one of the isoforms of trophoblastin.

In an embodiment of such a probe, the latter corresponds to residues 34 to 43 of the N-terminal sequence of trophoblastin and has formula III below: 34 35 40 43 Lys Asp Phe Gly Leu Pro Gln Glu Met Val (III) 3' TTC CTI AAI CCI IAI GGI GTC CTC TAC CA T T T it being possible for the I's to be replaced by A, G or C.

The invention naturally encompasses any equivalent probe, deduced from the sequence of formula II or the sequences of formulae Ii, 12, la, 14 and 15, which is capable of characterizing clones containing the cDNA of the mRNA of trophoblastin or the gene of trophoblastin.

The present invention further relates to a method of obtaining the cDNA of the mRNA of the isoforms of trophoblastin by cloning, which comprises the following successive steps: isolation of the total embryonic poly(A)- RNA's from mammal embryos by an appropriate method; measurement of the biological activity of the embryonic poly(A)- RNA's isolated during the previous step, by in vitro translation in an appropriate cell-free system and estimation, by electrophoresis/SDS, of the amount of trophoblastin synthesized, followed by immunoprecipitation with the aid of a monospecific antitrophoblastin serum, and detection of a polypeptide with a molecular weight of about 23 kDa, corresponding to the precursor of trophoblastin; building of a library of complementary DNA's of mammal embryos by synthesis of the cDNA's from a reverse trans- RA4 criptase and insertion of these cDNA's into an expression vector, followed by cloning in appropriate cellular expression systems suitable for producing recombinant trophoblastin or one of its isoforms; and testing, by any appropriate means, for clones containing the cDNA of the mRNA of the isoform of trophoblastin.

In one way of carrying out the method of cloning trophoblastin according to the present invention, testing for clones containing the cDNA of the mRNA of trophoblastin is carried out with the aid of antitrophoblastin monospecific immune serum.

In another way of carrying out this method, testing for the said clones is carried out with the aid of an oligodeoxynucleotide probe deduced from the nucleotide sequence of the cDNA of one of the isoforms of trophoblastin, and especially with the aid.of the oligodeoxynucleotide probe of formula III above, by hybridization of the said clones with the said probe, followed by isolation of the inserts of appropriate size and by subcloning in an appropriate plasmid (especially pUC18), in order to determine that one of the clones hybridizes with a single RNA of 1.1 kb coding for a polypeptide of about 23 kDa corresponding to the precursor of trophoblastin, and that the other clone hybridizes with the mRNA corresponding to the cDNA of one of the isoforms of trophoblastin.

The present invention further relates to a kit for detecting an embryonic signal for checking the viability of an embryo at an early stage of its development, which comprises, as the detection agent, at least one isoform of trophoblastin of formula I above.

The present invention further encompasses the application of the isoforms of trophoblastin according to the present invention as agents for protecting embryos during their transfer into the uterus of a recipient IT0 Cc~~ 1N "d~TO mammal, and as therapeutic agents, especially antiviral agents, antiproliferative agents, antitumoral agents and immunomodulators, in veterinary or human medicine.

Apart from the foregoing provisions, the invention also includes other provisions which will become apparent from the following description.

The invention will be understood more clearly with the aid of the following additional description, which refers to Examples of how the subject of the present invention is put into effect.

It must be clearly understood, however, that these Examples are given solely by way of illustration of the subject of the invention, without in any way implying a limitation.

EXAMPLE 1: PREPARATION OF THE ISOFORMS OF TROPHO-

BLASTIN

Trophoblastin is the first class II a-interferon isolated which is naturally expressed in a mammal tissue.

Hitherto the rare class II a-interferons known (bovine, human, equine, porcine) have only been detected with the aid of DNA molecular probes or by expression in bacterial systems. Consequently, the properties of class II ainterferons are not well known. Furthermore, the structure of a natural interferon can differ substantially in its glycosylated parts from the interferons obtained by genetic engineering. Trophoblastin has the originality for an interferon.not to besecreted following a viral infection.

In addition, it is produced in exceptionally large amounts compared with all the naturally expressed interferons.

Because of the immunomodulating activities of interferons, one may suspect that trophoblastin plays a part in the immunological tolerance of the mother towards the embryo.

Whereas the antiluteolytic activity of trophoblastin has only been demonstrated in ruminants, the inventors have been able to investigate the existence of identical NT O molecules in numerous other species by utilizing their antiviral property, as well as with the aid of trophoblastin cDNA probes or by virtue of the crossed imnological properties. On the other hand, the culture media of bovine and caprine conceptus have an antiviral activity comparable to that of ovine trophoblastin, and those of porcine or rabbit conceptus also have an antiviral activity, although greatly reduced.

1. Culture of ovine embryos and 16-day embryos are taken from sheep of the Pr6alpes du Sud breedby washing of the uterine tubes several times with a phosphate-buffered physiological saline solution, and are then transferred to Petri dishes containing 15 ml of Eagle's minimum essential medium (MEM), in which they are cultivated at 38°C, in an atmosphere of air containing 5% of CO2, on an oscillating platform.

When the incubation period has ended, the embryos are removed and the culture medium is centrifuged at 000 g for 20 minutes at 4*C and then dialyzed and concentrated against 50 mM TRIS/HC1 buffer of pH 6.00.

2. Purification by high performance liquid chromatography 2.1. Conditions of separation on the analytical scale The trophoblastin is purified to a high degree by high performance liquid chromatography (HPLC) on a DEAE PW column of diameter 7.5 mm and length 75 mm, which is eluted at a rate of 0.5 ml/min by a gradient of 0 to 0.15M KC1 in a 0.05 M Tris HC1 buffer of pH 6.00 over a perioc.

of 40 min, this being followed by is6cratic elution with 0.15 M KC1 in the same buffer. -ke Fm, 9 n 'htutHr-tt5;- retention times of the isoforms ore s -A f o\S: peak 4 (T4) 34.8 minutes -o peak 5 (T5) 37.2 minutes peak 1 (Ti) 45.6 minutes peak 2 (T2) 47.2 minutes peak 3 (Ts) 49.0 minutes.

2.2. Conditions of semipreparative purification The trophoblastin is purified to a high degree by high performance liquid chromatography (HPLC) on a PW semipreparative anion exchange column of diameter 21.5 mm and length 150 mm, which is eluted at a rate of 4 ml/ min by a gradient of 0 to 0.15 M KC1 in a 0.05 M Tris-HCl buffer of pH 6.00 over a period of 60 minutes, this being followed by isocratic elution with 0.15 M KC1 in the same buffer.

Develooine ion used Chloride ion (Cl) of KC1; KC1 introduced at M in 50 mM Tris/HCl buffer of pH 6.00 Elution conditions Flow rate: 4 ml/minute.

Gradient: formation of a KC1 gradient in the elution buffer so as to reach 0.15 M KC1 in the minute. Elution is continued from the 60th to the minute under isocratic conditions with 0.15 M KC1 in 50 mM Tris/HCl buffer of pH 6.00. From the 80th to the 100th minute, the gradient is linear up to 0.5 M KC1. From the 100th to the 120th minute, elution is continued at 0.5 M KC1 in 50 mM Tris/HCl buffer of pH 6.00.

Retention times of the isoforms of trophoblastin under semipreparative conditions .ig Isoform Retention time Elution volume peak 4 (T4) 46.4 minutes 185.6 ml peak 5 (Ts) 49.8 minutes 199.2 ml peak 1 (Ti) 61.2 minutes 244.8 ml peak 2 (T2) 64.4 minutes 257.6 ml peak 3 (Ts) 66.6 minutes 266.4 ml Figure 1 attached shows the isolation peptides Ti, T2 and T3 i ratic part of the gra i e region of 0.5 M KC1.

The purified trophoblastin has an apparent molecular weight of 20 kDa and an isoelectric point of about 5.3. It binds specifically to the endometrial membrane receptors, showing that it retains its biological activity after the purification steps. The uterine receptor of this embryonic signal exists as soon as the luteal phase of the estrous cycle has ended, when the embryo is absent.

The five isoforms of trophoblastin, Ti, T2, T3, T4 and Ts, isolated according to the present invention are variants of trophoblastin, as shown by sequencing of the N-terminal end of these five proteins, as is apparent from formulae I, Ii, I2, Is, 14 and 15 above.

EXAMPLE 2: DEMONSTRATION OF THE ANTIVIRAL PROPER- TIES OF TROPHOBLASTIN The inventors have demonstrated that ovine trophoblastin possesses the antiviral activity of interferons in the presence of MDBK bovine cells infected with bovine vesicular stomatitis virus (VSV). This was demonstrated with the aid of the following two tests: a) The specific antiviral activity of each isoform was measured by a standard plaque test. Monolayers of 24-hour MDBK cells were incubated in 0.6 cm 2 wells for 18 hours with 3-fold dilutions of trophoblastin or a reference interferon (IFN) in MEM medium containing 5% of fetal calf serum (FCS). After removal of the supernatant, the cells were infected with 100 PFU of VSV (serotype Indiana) in 0.2 ml of MEM 2% of FCS and then finally covered with 3 ml of MEM 2% of FCS containing 0.6% of iAl/ agarose, with which they were incubated for a further 24 PIT 0 e! hours at 37*C. The viral plaques were counted after staining with crystal violet and the dilution of the protein which caused 50% inhibition of the VSV plaques was determined. The titers, expressed in international units of human IFN (iu/ml), were deduced from the titer of a standard laboratory IFN included in these tests and calibrated relative to the human IFN reference Ga23-902- 530 Bethesda, Md, 12,000 iu/ml).

The specific activities of isoforms 1, 2 and 3 purified by HPLC are respectively 0.6-108 iu/mg of protein, 0.8-108 iu/mg of protein and 0.7-108 iu/mg of protein, in the presence of MDBK cells and VSV (cf. Figure 2 attached).

The antiviral activity of two pools of culture media of 16-day ovine embryos is between 0.25 and 0.68-108 iu/mg of trophoblastin.

b) The differential antiviral activity was measured in cells of different species by inhibition of the effect exerted on VSV carried by plaques as described above. The results obtained are collated in Table I below, in which MM6 denotes an ovine cell line established from fetal lamb fibroblasts, PD-5 is a porcine kidney cell line, WISH is a human cell line and L 929 is a murine cell line.

The three purified isoforms were diluted to give the same antiviral titer on MDBK cells (taken as the reference cell line). The titers are expressed as the reciprocal of the highest protecting dilution. In the case of endometrial cells and WISH cells, the titers could not be read off with great accuracy, which is why the estimated lower and upper limits have been given.

rQ TABLE I ANTIVIRAL ACTIVITY OF 3 ISOFORMS OF TROPHOBLASTIN ON DIFFERENT CELL LINES Isoform MDBK MM6 endometrial PD5 WISH L929 bovine ovine ovine porcine human murine cells cells cells cells cells cells 1 6500 550 3800-11 000 46 27-81 3 2 6500 420 2100-6500 81 81-243 27-81 3 6500 550 1200-3800 46 27-81 9 This Table shows that the three isoforms exhibit the same scheme of relative activity, at least on bovine, ovine, porcine and human cells, isoform 2 being about 9 to 27 times more active on murine cells than the other two isoforms.

Consequently, not only does trophoblastin have a strong structural homology with interferons, as indicated in the publication in FEBS LETTERS cited above, but it also possesses the antiviral activity characteristic of all the families of interferons. By seroneutralization, the inventors have been able to confirm that ovine trophoblastin is indeed a class II a-interferon: an immune serum directed against class I a-interferon does not recognize trophoblastin and, conversely, an antitrophoblastin monospecific immune serum does not recognize class I a-interferons.

Table II below illustrates seroneutralization of the viral activity in the presence of interferon (IFN) and anti-IFN immune serum. The antiviral activity was tested on MDBK bovine cells infected with vesicular stomatitis virus (VSV).

The immune serum used is anti-T rabbit immune serum (mixture of isoforms Ti, T2 and Ta).

TABLE II

I

I-

|Ovine trophoblastinj (mixture of lisoforms 1,2 and 3)1 Immune serum

I

an ti-T anti-human IFNaIIz S(recombinant)

I-

-tanti-human IFNai

I

Porcine IFNai -I I EXAMPLE 3: CLONING OF TROPHOBLASTIN The preparation of clones containing the cDNA of the mRNA of trophoblastin comprises the following steps: 1. Isolation of the total embryonic poly(A)- RNA's, using the guanidine isothiocyanate method, from 16-day ovine embryos (CATHALA et al., 1983). In order to provide a "negative" control corresponding to a late stage during which trophoblastin is no longer secreted, mRNA's were also isolated from 29-day embryos. After purification on an affinity column (oligo dT cellulose), about 50 to 60 pg of poly(A)* RNA were obtained from about twenty 16-day embryos removed by surgery.

Characterization of the precursor of trophoblastin and quantification of the correspondine mRNA. The biological activity of the embryonic poly(A)* RNA's was measured by in vitro translation in two cell-free systems (lyzate of reticulocytes and wheatgerm) in the presence of methionine. In both these cases, the amount of trophoblastin synthesized was estimated by electrophoresis/SDS followed by immunoprecipitation, respectively with the aid of a monospecific antitrophoblastin immune serum prepared by the inventors. Under these conditions, a polypeptide with an apparent molecular weight of 23 kDa was detected; it corresponds to the precursor of trophoblastin and represents about 1 to 2% of the total mRNA's. This type of molecule could not be detected when starting from the poly(A)- RNA's of later (29-day) embryos, which confirms the brief expression of trophoblastin. When the poly(A)- RNA's of 16-day embryos are translated in the presence of microsomal membranes, an immunoprecipitable protein whose apparent molecular weight is identical to that of native trophoblastin (20 kDa) is observed by acrylamide gel electrophoresis in a denaturirg medium (cf.

Figure 3 attached).

2. Building a library of complementary DNA's of 16-day ovine embryos The cDNA's were synthesized by the method of GUBLER and HOFFMAN (1983), which makes it possible to obtain cDNA's with a length similar to that of tne mRNA's.

After the addition of EcoRI linkers, these cDNA's were inserted respectively into the EcoRI sites of a plasmid vector (pUC8) and of an expression vector, namely the bacteriophage lambda gt 11 (Xgtll), and then cloned in strains (DH5 and Y1088) of colibacilli (Escherichia coli).

The plasmid and phage libraries respectively contained 4-105 and 1.2-106 recombinants per ug of DNA.

3. Testing for clones containing the cDNA of the mRNA of troDhoblastin with the aid of synthetic oligodeoxvnucleotide probes A partially degenerate oligodeoxynucleotide of 29 bases, complementary to the mRNA of trophoblastin and RA corresponding to amino acid residues 34 to 43 of the trophoblastin sequence, was synthesized. To limit the problem posed by the degenerescence of the genetic code, certain variable bases of the probe were replaced by inosine, which has the property of not destabilizing the hybrids: Lys-Asp-Phe-Gly-Leu-Pro-Gln-Glu-Met-Val 3' TTC-CTI-AAI-CCI-IAI-GGI-GTC-CTC-TAC-CA T T T Of the 300,000 recombinant phages, three positive clones were detected by hybridization with this probe. After successive replatings at low density, two of them still give a permanent signal. The DNA of these two clones was digested by EcoRI and two inserts of similar size L kb), called mdp 7 and mdp 13, were isolated and subcloned in the plasmid pUC18.

4. Characterization of the clones isolated and structural analysis of the cDNA of trophoblastin The homology of these inserts was demonstrated after labeling of one of them by nick translation and Southern blotting analysis. mdp 7 hybridized with a single mRNA of 1.1 kb (Northern blotting technique); this size was compatible with that of an mRNA coding for a polypeptide of 23 kDa (precursor of trophoblastin). It is for this reason that more thorough analysis of these clones was undertaken.

Hybridization-translation of the complementary mRNA of these clones, followed by immunoprecipitation and electrophoresis in a denaturing gel of the protein synthesized, showed that the product was indeed the cDNA of trophoblastin. These results as a whole were moreover confirmed by determination of the seqbence of the cDNA of mdp 7 according to SANGER's technique (1977). 943 nucleotides were identified. The coding sequence is 585 nucleotides, which determine 195 amino acids of the precursor of 7trophoblastin (23 kDa). The primary structure of trophoblastin corresponds to 172 amino acids, as does that of class II a-interferons (IFNaII), whereas class I IFNa's have a sequence of 166 residues. The amino acid sequence of isoform 2, determined by peptide hydrolyses, is strictly identical to the cDNA (Figure Lt). No Nglycosylation sites (ASN-X-THR or SER) are observed.

Furthermore, the region corresponding to the signal peptide has a homology of more than 95% in terms of the nucleotides, and of 100% in terms of the primary structure, with that of class II bovine a-interferon (CAPON, SHEPARD and GOEDDEL, MOL. CELL. BIOL. (1985) 768-779), which suggests that these two molecules may be derived from a common ancestral gene.

As shown in Table III below, the identity of the nucleotide sequences of ovine trophoblastin with class II bovine IFNa is 80% (and 71% with human IFNaII), whereas it is only 64% with class I bovine IFNa. The identity of the primary structures of ovine trophoblastin with class II bovine IFNa is 71% (and 56% with human IFNaII), whereas it is only 48% with class I bovine IFNa. Consequently, trophoblastin corresponds to a class II embryonic ainterferon. These results are summarized in Table III below: AQw "iFU A.7- e TABLE III COMPARISON OF THE NUCLEOTIDE SEQUENCE AND THE PRIMARY STRUCTURE OF TROPHOBLASTIN WITH THOSE OF BOVINE AND HUMAN CLASS I AND II a-INTERFERONS SOvine Bovine Bovine Human tropho- IFNaI IFNaII IFNaII blastin blastin Bovine IFNal 1 48.1 68.3 65.1 7 Bovine IFNall 1 71.8 54.3 77.4 Human IFNall 5i.9 50. 63.1 Northern blotting analysis of total RNA's of 15-day to 18day embryos of different species (goat, cow, sow), with the aid of an ovine trophoblastin probe according to the invention, made it possible to identify mRNA of similar length in two of these species (goat, cow). These results indicate on the one hand a very substantial structural homology and on the other hand the existence of a similar chronology in the expression of this gene. In the ovine species, this gene very rapidly becomes silent since, as from day 22 of development, the mRNA of trophoblastin is no longer detectable, which clarifies and rigorously confirms the results of experiments involving intrauterine injections of homogenates of 21-23-day conceptus.

EXAMPLE 4: DETECTION OF TROPHOBLASTIN BY AN RIA

TEST

A quantitative method for the detection of ovine trophoblastin has been developed by the inventors. It consists of a competitive radioimmunoassay, using two antibodies, under the following conditions: the ovine trophoblastin used for labeling with iodine 125 and for t'e calibration curves originates from the purification of culture media of ovine embryos by HPLC. An antitrophoblastin antiserum obtained after the immunization of rabbits is used at a final dilution of 1/360,000; it binds of the radioactive trophoblastin under the assay conditions established by the inventors.

Characteristics of the assay Sensitivity: this method makes it possible to detect 15 pg of trophoblastin in 100 pl of test sample.

The intra-assay and inter-assay reproducibility, expressed as the coefficient of variation, is 8% and respectively.

Parallelism: different culture media of ovine embryos and of uterine perfusates of gestating sheep have dose-response curves parallel to the reference curve, as shown in Figure 5 which represents the curve of the inhibition of binding between I12s-labeled trophoblastin and antitrophoblastin antibody for increasing dilutions: the represent the standard trophoblastin, the A represent the uterine perfusate of gestating sheep, and the A represent the culture medium of ovine embryos.

The other compounds secreted in the culture medium by the embryos, or present in the uterine fluid, do not therefore interfere with the assay of trophoblastin.

Specificity of the assay: there is no cross immunoreactivity with porcine a-interferons, secretion products of bovine, porcine or rabbit embryos, or serum compounds.

By virtue of this assay, the evolution of the secretion of trophoblastin can be followed in vivo and in vitro. The sensitivity of the assay makes it possible to detect small amounts of trophoblastin secreted by ovine and caprine embryos at very early stages (20 ng/embryo in ovine perfusates after 11 days of gestation, 1 pg/day for an 11-day embryo cultivated in vitro).

This reliable, rapid and sensitive method of assay makes it possible to study factors regulating the secretion of trophoblastin and appears to be a possible method of evaluating embryonic viability.

The cDNA of the isoforms of trophoblastin which form the subject of the present invention, or their analogs, can also be used in all the methods of producing class II a-interferons by genetic engineering processes (by bacterial expression, cellular expression or genetic engineering or via transgenic animals).

As is apparent from the foregoing description, the invention is in no way limited to those methods of execution, embodiments and methods of application which have now been described more explicitly; on the contrary, it encompasses all the variants which may occur to those skilled in the art, without deviating from the framework or the scope of the present invention.

Claims (14)

1. A purified preparation of a single isoform of trophoblastin, said isoform comprising an N-terminal amino acid sequence having a common general formula I- Cyc -Tyr-Lu-Ser-(X) -Arg-Leu-Met-Leu-Asp-Ala- Glu-Asn-Leu 1 5 10 12 Lys-Leu-Leu-As-Arg-Met-Asn-Arg-Leu-Sar-Pro-His-Ser-Cys-Leu 25 Gln-Asp-Arg-Lys-(Y)-Phe-Gly-Leu-Pro-Gln-Glu-Met-Val-(Z)-Gly 40 Asp-Gin-(W)-(V)-Lys-Asp-Gln-Ala-Phe-Pro (I) in which (X5) represents Glu or Gln (U12) represents Arg or Lys (Y35) represents Lys or Asp (Z44) represents Glu or Asp (W48) represents Asp or Leu (V49) represents Leu or Gln, wherein said preparation being devoid of contamination by other isoforms of trophoblastin.

2. A purified preparation according to claim 1, wherein the isoform Ti comprises an N-terminal amino acid sequence having the formula Ii below: Cys-Tyr-Leu-Ser-Glu-Arg-Leu-Met-Leu-Asp-Ala-Arg-Glu-Asn-Leu 1 5 10 Lys-Leu-Leu-Ap-Arg-Met -Asn-Arg-Leu-Ser-Pro-His-Ser-Cys-Leu 20 25 Gln-Asp-Arg-Lys-Lys-Phe-Gly-Leu-Pro-G2n-Glu-Met-Val-Glu-Gly 35 40 44 Asp-Gln-Asp-Leu-Lys-Asp-Gln-Ala-Phe-Pro 28

3. A purified preparation according to claim 1, wherein the isoform T2 comprises an N-terminal amino acid sequence having the formula 12 below: Cys -Tyr-Leu-Ser-Gln-Arg-Leu-Met -Leu-Asp-Ala-Arg-Glu-Asn-Leu 1 5 10 Lys-Leu-Leu-Asp-Arg-Met-Asn-Arg-Leu-Ser-Pro-His-Ser-Cys-Leu 25 Gln-Asp--Arg- Lys-Asp -Phe-Gly- Leu-Pro-Gln-Glu-Met-Val-Glu-Gly 40 44 Asp-Gln-Leu-Gln-Lys-Asp-Gln-Ala-Phe-Pro-Val-Leu (12)

4. A purified preparation according to claim 1, wherein the isoform T3 comprises an N-terminal amino acid 0~ sequence having the formula 13 below: Cys -Tyr-Leu-Ser-Gln-Arg-Leu-Met-Leu-Asp-Ala-Arg-Glu-Asn-Leu 10 Lys-Leu-Leu-Asp-Arg-Met-Asn-Arg-Leu-Ser-Pro-His- Ser-Cys-Leu 25 Gln-Asp-Arg- Lys-Asp -Ple-Gly-Leu-Pro-Gln-Glu-Met-Val-Asp-Gly 40 44 (13) A purified preparation according to claim 1, *wherein the isoform T4 comprises an N-terminal amino acid sequence having the formula 14 below: Cys-Tyr-Leu-Ser-Gln-Arg-Leu-Met-Leu-Asp-Ala-Arg-Glu-Asn- 1 5 10 12 Leu-Lys -Leu-Leu-Asp-Arg-Met -Asn-Arg-Leu-Ser-Pro-His -Ser- 20 Cys-Leu-Gln-Asp-Arg-Lys-Asp-Phe-Gly-Leu-Pro-Gln-Glu-Met- 35 Val -Glu-Gly-Asp-Gln-Leu 44 45 48 (14) 28a

6. A purfied preparation according to claim 1, wherein the isoform, T5 comprises an N-terminal amino acid so B SO 0 s SO 00 sequence having the formula Is below: Cys-Tyr-Leu-Ser-Gln-Arg-Leu-Met-Leu-Asp-Ala-Lys-Glu-Asn-Leu 1 5 10 12 Lys-Leu-Leu-Asp-Arg-Met-Asn-Arg-Leu-Ser-Pro-His-Ser-Cys-Leu 20 25 Gln-Asp-Arg-Lys-Asp-Phe-Gly-Leu-Pro-Gln-Glu-Met-Val-Glu-Gly 40 Asp-Gln-Leu-Gln-Lys-Asp-Gln-Ala-Phe-Pro-Val-Leu 48 49 50 (Is)

7. A method of isolating the isoforms of trophoblastin by high performance liquid chromatography, wherein a culture medium obtained after incubation of mammal conceptus for an appropriate time is subjected to HPLC chromatography on an anion exchange column; said chromatography comprising the following steps: a) elution by a gradient of 0 to 0.15 M KC1 in a 50 mM Tris-HC1 buffer, pH 6; over about 60 mn, then b) isocratic elution by a 50 mM Tris-HC1 buffer, pH 6, 0.15 M KC1 over about 20 mn, then c) elution by a gradient of 0.15 M to 0.5 M KCI in 50 mM Tris-HC1 buffer, pH 6, over about 20 mn d) elution by a 50 mM Tris-HC1 buffer, pH 6, 0.5 M KC1; and the fraction corresponding to T 4 and T s isoforms being 25 successively collected at steps a) and the fractions corresponding to isoforms T 2 and T 3 being successively collected in step b).

8. The method according to claim 7, wherein the medium for collecting the conceptus to be cultivated consists of an appropriate buffer devoid of serum albumin and containing polyvinylpyrrolidone at a concentration of about 0.05% to by weight/volume,

9. The method according to claim 7, wherein the conceptus are cultivated in a synthetic culture medium devoid of 35 serum albumin and blood se:um and containing 4* 4 4 s; RL i no 29a polyvinylpyrrolidone at a concentration of about 0.059% to by weight/volume. ill O An agent having antiviral, antiproliferative, antitumoral, immunological, immunomodulating, rejection- inhibiting, cell-differentiating and luteolysis-inhibiting activities at the start of gestation in mammals, as well as genetic selection activities, the said agent consisting of a class II a-interferon which is one of the isoforms of trophoblastin as identified by their N-terminal sequences of formulae Ii, 12, Is, 14 and I 'a -m xursecSthee+.

11. The cDNA nucleotide sequence of an isoform of tropho- blastin, and the deduced amino acid sequence, consisting of a polypeptide whose molecular weight is of the order of 23 kDa, corresponding to the precursor of trophoblastin, and having formula II below, which is that of the isoform T2: A RA AGAGAACCTACCTGAAG ATTCOCCCTGACCCCATCTCAGCCAGCCCAGCAGCAGCCGCATCTTCCCCATGGCC 53 Met Ala -23 TTC GTG CTC TOT OTA CTG ATG GOC CTG GTG CTG GTC AGC TAT GGC 98 Phe Val Leu Ser Leu Leu Met Ala Leu Val Leu Val Ser Tyr Gly CCA GGA GGA TCT CTG GGT TGT TAC CTA TCT CAG AGA CTC ATG CTG 143 Pro Gly Gly Ser Leu Gly Cys Tyr Leu Ser Gin Arg Leu Met Leu -1 +1 GAT GCC AGG GAG MAC CTC AAG CTC, CTG GAC CGA ATG AAC, AGA CTC 188 Asp Ala Arg Glu Asn Leu Lys Leu Leu Asp Arg Met Asn Arg Leu 15 TCC COT CAT TCC TGT CTG CAG GAC AGA AAA GAC TTT GGT CTT CCC 233 Ser Pro His Ser Cys Leu Gin Asp Arg Lys Asp Phe Giy Leu Pro 30 CAG GAG ATG GTG GAG GGC GAC CAG CTC, CAG MAG GAC CAG GCC TTC 278 Gin Giu Met Val Glu Gly Asp Gin Leu Gin Lys Asp Gin Ala Phe 45 OCT GTG CTC TAO GAG ATG CTC CAG CAG AGO TTC AAO OTO TTO TAO 323 Pro Val Leu Tyr Giu Met Leu Gin Gin Ser Phe Asn Leu Phe Tyr 60 ACA GAG CAC, TOO TOT GOT GOC TGG 'JAC ACC ACC OTO CTG GAO, CAG 368 Thr Giu His Ser Ser Ala Ala Trp Asp Thr Thr Leu Leu Asp Gin 75 OTO TGO ACT GGA OTO CAA CAG CAG CTG GAO CAC CTG GAO ACC TOG 413 Leu Cys Thr Giy Leu Gin Gin Gin Leu Asp His Leu Asp Thr Cys 90 AGG GGT CMA GTG ATG GGA GAG GMA GAO TOT GAA CTG. GGT MOC ATG 458 Arg Giy Gin Val Met Giy Giu Glu Asp Ser Giu Leu Gly Asn Met 100 105 110 GAO CCC ATT GTG ACC GTO MAG MAG TAO TTC CAG GGO ATO TAT GAO 503 Asp Pro Ile Vai Thr Val Lys Lys Tyr Phe Gin Gly T le Tyr Asp 115 120 125 TAO OTG CMA GAG MAG GGA TAO AGO GAO TGC GC T GG GMA ATO GTC 548 Tyr Leu Gin Giu Lys Gly Tyr Ser Asp Cys Ala Trp Giu Ile Vai 130 135 140 AGA GTC GAG ATG ATG AGA GOC OTO ACT GTA TCA ACC ACC TTG CMA 593 Arg Val Giu Met Met Arg Ala Leu Thr Val Ser Thr Thr Leu Gin 145 150 155 AMA AGG TTA ACA AAG ATG GGT GGA GAT CTG MAC TCA COT TGATGAOT 640 Lys Arg Leu Thr Lys Met Gly Gly Asp Leu Asn Ser Pro 160 165 170 172 CTTGCCGAOTMAGATGCCACATOAGCCTCCTACACCCGCCTGTGTTCATTTCAGAAGACT 700 CTGATITTGCTOOAGCCACCMAATTCATTGM iTTAOTTTAGCTGATACTTTGTOAGTAG 760 TAAAAAGOAAGTAGATATAAMAGTATTOAGCTGTAGGGGCATGAGTCOTGMAATGATG 820 CCTTCCOTGATGTTATCTGTTGCTGATTTATTTATACOTTCTAGCATTTMOCATACTTMA 880 MATATTAGGAAATTTGTTAAGTTACATTTOATOTGTACATOATATTAAAATTTOTAMAC 940 ,.ATG poiyA 943 (II)

12. An oligodeoxynucleotide probe for the characteriza- tion of clones containing the cDNA of the mRNA of tropho- blastin and its isoforms, which is deduced from the sequence of the cDNA of trophoblastin of formula II according to claim 11 or from the sequences of formulae Ii, 12 and Is according to any one of claims 2 to 4.

13. An oligodeoxynucleotide probe according to claim 12, which corresponds to residues 34 to 43 of the N-terminal sequence of trophoblastin and has formula III below: 34 35 40 43 Lys Asp Phe Gly Leu Pro Gln Glu Met Val (III) 3' TTC CTI AAI CCI IAI GGI GTC CTC TAC CA T T T it being possible for the I's to be replaced by A, G or C.

14. A method for the obtention by cloning of the cDNA of mARN of trophoblastin, wherein the clones containing said cDNA are searched for with an oligodeoxynucleotidic probe according to any of the claims 12 or 13. A kit for detecting an embryonic signal for checking the viability of an embryo at an early stage of its development, which comprises, as the detection agent, at least one of the isoforms of trophoblastin of formula I according to claim 1.

16. Application of the isoforms according to any one of claims 1 to 6 as agents for protecting embryos during their transfer, in order to improve their ability to survive.

17. Application of the isoforms according to any one of claims 1 to 6 as therapeutic agents, especially as anti- viral agents, antiproliferative agents, antitumoral agents and immunomodulators, in human and veterinary medicine. WO 89/08706 WO 8908706PCT/FR89/001 16 A 6 2 0 kd 4 k d F I G13 *1 1 WO 89/08706 WO 8908706PCT/FR89/001 16 [K CI1 I K. S. rn1 C-I 0 4-J 4- 0 Absorbance 28Onm .1 FEUILLE DE. RE-MPLACEMENT zQ Frruin.: i N)w CL C2 rD 91 100/6HAi/J.J)d900/8O 90L80/68 OM WO 89/08706 WO 898706CT[FR89!001 16 Y LA Peptide sequence of the isoform 2 of the trophoblastine- obtained by successive hydrolyses. Asp Ala Ser Pro Gin Gtu Pro Val Arg H is Met' Leu Glu S er Vat Tyr Cys Tyr Leu '.Ser G In Arg Leu Met. Leu +1 Asn Leu Lys Leu Leu Asp Ang Met' Asn Arg Leu Cys Leu Gin Asp Ang Lys Asp Phe Gty Leu Pro Gtu Gly Asp Gin Leu Gin Lys Asp Gin Ala Phe Oiu Met' LeU Gin Gin Ser Phe Cys Thr Gly Arg Gly Gin Val Asp Pro Ile Vat Tyr Leu Gin Giu Arg Val C'a.u Mel' Lys Arg Leu Thr Leui Met Thr Ly s Met' L ys Gin Gin Gin Leu Asp His Leu Gly Giu Giu Asp Ser Giu Leu Val Lys Ly s Tyr Phe Gin Gly Gly Tyr Ser Asp Cys Ala Trp Arg Ala Le u Thr Val Ser Thr Hel Gly Gly Asp Leu Asn Ser Asp Thr Cys Gly Asn Met' Ile Tyr Asp G Iu lie Val. Thr Leu Gin Pro 172 Peptide not identified by enzymatic hydrolysis. FEUILLE DE REMPLACEMENT £LN3W3V 'dW3U 3I 311lin3.4 Number Of plaques of lysate J-n P.0 15 34 91 100/6811-4/3d "0L80168 OM INTERNATIONAL SEARCH REPORT International Application No P CT/FR 89/00 116 I. CLASSIFICATION OF bUBJECT MATTER (if several classficatlon symbols apply, Indicate all) e According to Interational Patent Classification (IPC) or to both National Classlfication and IPC Int.Cl C 12 N 15/00, C 12 P 21/02, C 12 Q 1/68, G 01 N 33/68 A 01 N 1/02 II. FIELDS SEARCHED Minimum Documentation Searched 7 Classification System Classification Symbols Int.Cl 4 C 12 N, C 12 P, C 12 Q, G 01 N Documentation Searched other than Minimum Documentation to the Extent that such Documents are Included In the Fields Searched III. DOCUMENTS CONSIDERED TO BE RELEVANT* Category Citation of Document, 11 with Indication, where appropriate, of the relevant passages 12 Relevant to Claim No. 1" X FEBS Letters, volume 228, No. 1, February 1-16 1988, Elsevier Science Publishers B.V,, (Biomedical Division), G. Charpigny et aj. "High homology between a trophoblastic I protein (trophoblastin) isolated from ovijne embryo and c- interferons", pages 12-16 see the whole document cited in the application X Nature, volume 330, 26 November 1987, 1-16 K. Imakawa et al.: "Interferon-like sequence of ovine trophoblast protein secreted by embryonic trophectoderm", pages 377-379, see the whole document cited in the application A Molecular and Cellular Biology, volume 5, 1 No. 4, April 1985, American Society for Microbiology, D.J. Capon et al.: "Two distinct families of human and bovine interferon -ogenes are coordinately expressed and encode functional I I Special categories of cited documents: to later document published after the International filing date document defining the general state of the art which is not or priority date and not in conflict with the application but consi"A" d red to be o paticular relevance irtwhch notted to understand the principle or theory underlyng the €onsldered to be o1 particular relevane invention earlier document but published on or after the International document of particular relevance; the claimed invention filing date cannot be considered novel or cannot be considered to document which may throw doubts on priority claim(s) or Involve an inventive step which Is cited to establish the publication date of another document of particular relevance; the claimed Invention citation or other special reason (as specified) cannot be considered to Involve an inventive step when the document referring to an oral disclosure, use, exhibition or document is combined with one or more other such docu- other means ments, such combination being obvious to a person skilled document published prior to the international filing date but in the art. later than the priority date claimed document member of the same patent family IV. CERTIFICATION Date of the Actual Completion of the International Search Date of Mailing of this International Search Report June.1989 (30.06.89) 19 July 1989 (19.07.89) International Searching Authority Signature of Authorized Officer EUROPEAN PATENT OFFICE Form PCTIISA210 isecond sheet) (January 1985) International Atiplication I'o0pCT /FR 8 9 0 0116 FURTHER INFORMATION CONTINUED FROM TN4E SECOND SHEET polypeptides", pages '768-779 see the whole document EP, A, 0174143 (GENENTECH) 12 March 1986 see claims; figures V0 OBSERVATIONS WHERE CERTAIN CLAIMS WERE FOUND UNSE11ARCHANLE I This International search report has not been established In respect of certain claims under Article 17M2 for the flowing reasons. I-DCiaim numbers...... becauws they rotate to subject matter not required to be searcted by this Audthoy, namely: see rule 39.l(iv): methodes for treatment of the human or animal body by surgery or therapy, as well as diagnostic methodes. 2El Claim numbers beesuse they relate to parts of the Intenratonal application that do not comply wth the. Pecflbed require- mnents to such on eirtent that no meaningful International search can be caried out. specIfically: Clai nu~eira.......becauae they are ap~iident rMinu and sre ot drafte in acoordlinoe with this eetmil Vid t*d satneof PCT Rule 6.4(a). VI.E OBSERVATIONS WHERE UNITY OF, 1INVENTION IS LACKING 2 This Internationai Searching Athortty found multiple Inventions in this Interuational application as follows: IIQ As sit required additional search tees *ere timely paid by the applicant this internationail search report covers al sehoble claims of the international spplication. LEI As only some of the required addftional &earch fee@ were timely paid by the applicant. this Internvational search raport covers only those claims of thei international applicatilon for which leas were paid, spefflcaty clalms: No requlfed addtional saarch tees wers timeiy paid by the applicant. Consequently, this Interrnational isearth report Is resticted to the Invention first mentioned In the claims; Is covered by claim numbers: 4r7Asa ali sarchable claims could be searched without effort justifying an additional fee, the International Searching Authority did not Invite payment of any additional fps. Remark on Protest SThe additional search fees were accompanied by aplicant's protest. ENo Protest accompanied the payment of additional search fee, Form PCTIISAi'210 (oupplemental siheet (January 111115) ANNEX TO THE INTERNATIONAL SEARCH REPORT ON INTERNATIONAL PATENT APPLICATION NO. FR 8900116 SA 27579 This annex lists the patent family members relatng~ to the patent documents cited in the above-mentioned international search report. The members are as contained in the European Patent Office EDP file on 11 107/89 The European Patent Office is in no way Liable for these particulars which are merely given for the purpose of information. Patent docunvent Publication Patent family Publication cited in search report date Member(s) -T te EP-A- 0174143 12-03-86 None SFor more details about this annex see Official Journal of the European Patent Office, No. 12/BZ RAPPORT DE RECHERCHE INTERNATIONALE Demands lnitstnatlonsfle N, PCT/FR 89 /00116 1. CLASSEMENT Of LINVENTION Cci plusiours symbol@$ do classification sant spoiscables, Ise ifldiquer tous) Solon In classification internationale des brevets (CI B) ou Alas foss salon Is classification nationals at a CIB CIB 4 C 12 N 15/00, C 12 P 21/02p C 12 Q1/68, G 01 N 33/68, A 01 N 1/02 11, DOMAINKS SUR LESQUELS LA RECHERCHE A POR~t Documentation minimal. conauttie S Systbme do classific lion Symbol** do classification CIB 4 C 12 N, C 12PFi C 12Q, G 01N Documentation consultdo autre out Is documentation minimal@ dent Is mature oij do tela documents font Varb* des domainec our losquels Ca recherche a poflA IIIl DOCUMENTS CONS109RES COMME PERTINKNTG Ca *ol dntfcto e documents citks.11 avec Indication, SI nicsairs, N, des rov~ndiCeijons Cet~~gorls0 pdniiaio e asagd& pertintif is vias"$ X FEBS Letters, volume 228, no. 1, f6vrier 1-16 1988, Elsevier Science Publishers B.V., (Biomedical Division), G. Charpigny et al.: "High homology between a trophoblastic protein (trophoblastin) isolated from ovine embryo and 0.-interferois", pages 12-16 voir le document en entier citif dans la demande X Nature, volume 330, 26 novembre 1987, 1-16 K. Imakawa et al.: "Interf eron- like sequence of ovine trophoblast protein secreted by embryonic trophectoderi", pages 377-375 voir le document en entier cit6 dans la dernande A Molecular and Cellular Biology, volume 5, 1 no. 4, avril 1985, American Society for Microbiology, Categories sp0cials do documients cit~s: 11 si document utirour publit Valtdriouroent A Isdatede dep6i a*Asa document diinissent l'itst gin~ral do Is technique, non international ou A to date do prioritt at ui'appartenant oat considers~~~ com ancusAtatpetnnt611t do Ia technique pertinent. Mal* cite Pour compoenor, a*dcuiibcma ctcirment anpertriwisPb16 innta do d tieraIsPrincipe ou to thiaorie constituent Is base do Pinvintion o a oun apisn da a eullAI aedodptitra x adocument particutlromont Derminmnt- Pinventon revendi. bana oueprs cete atequit no pout 6tre considdrile comma nouvelie oU comma a L d documnent pouvant liter Un d ut our Una revandicstion do impliquant une activitt inventive pririt CuciA pur ~temier c dte S ubiin due t Y a document Particulibraent pertinent: tinvention reon- a utre citation ou pour une raiason spdciaWe talle qundique.) Miaua no pOutW Att onsid~tre comma impliquent une s~a docuiment co rktdrant A une divulgaton arm[e, A un usage. A activitt inventive torsQuo to document oat associA A Un Cu Un6 exposittan ou tout autfes moyans plusieurc autres documents do m~ine nature, cotta combi- eas document PubliA avant to dote do dbpbt Interntat;2l, male nciaen dtant *vidente Dour une personne du mtior. Poat~rleuremint Aten date do prioritd ravenaiqUte oto document Qu fail partis do Is m~ie tamlille do brevets IV. CERTIFICATION Date A laquelia Ia rechierchte international. a 4t. eflectivent Oata deapidion du artsent raoport do recherchie internalionale 1989vi J U J L 1989 Adiniitration cflargis do Is recherche international* 3 u ~Ltnt otaitor OFFICE EUROPEEN DES BPEVETS Formnuiaire PCTIISAM2O (dauxiime fou ille) lianver 1355) Demands Internationals N, SUITE DE5 RENSEIGNEMENTS INDIQU92 SUR LA DEUtiIME MEILLE D.J. Capon et "Two distinct families of human and bovine inter- f eron-t.. genes are coordinately expressed and encode functional polypeptides", pages 768-779 voir le document en entier A EP, A, 0174143 (GENENTECH) 1 12 mars 1986 voir revendications; figures V. OBSERVATIONS ILORSQUIIL A I1TI E1TIMI QUE CENTA 5511 ftVENDICATIONS NE POUVAIENT PAZ FAIRE LOB11JET DUNE RECH4ERCHE' Solon Ilartict, 17.2) a) certaines raeandicstiona ,Want pit fait I-objel d-une recherche nour Its mot suivants: 1. fMLee revendicutions num~ro... 9 e rappwient A un objet A t'dgard duquat I pribsento administration We poe l'obigation do. Pro- tadot a it rucrierths, a savoir: Voir R~gle 39.1(iv): Mdthodes de traitement du corps huxnain ou animal par la chirurgie Cu la thdrapie, ainsi que m6thodes de diagnostic. 2. Los revendications numiroa as rapportent A des parties do Ia demnands Internationals gut no remplisni pas Its conditions preserites dona uns mature tells guam.e recherche sitiniricative no pout 6tre efo clu~, pr6tia6mmnt: 3. Les revmndicatons numiros ti des irindicaboris 64pendanso al no son; pas rdVg~e eonformiment A ta d*Ux*bme al A I troasme Wars" o oa rge Gsa) Ou PCT, Vt. OBSERVATIONS LORSQUIIL Y A A3SEXCK D'UNtTI! 01 LINVIENTION' L'admaralattation charot. do In recherche Itna~mtionas a trouv6 piusleura Invention& dlana as prsants demands Internationale, Csat14-dire: 1. L Com* touts& its taxes addtonneltes demnand**$ o114 110 PAY60e done Its diltaia, Is pr~aent rapport do recherche Internationale eouvre loute, Its a vndications do to demands iternational* pouvant laire tobitt d'une recherche. 2.nQ Comm. eaismgnt wao perti. on taxes additioflnoes damsA Id a s psy&e dans W~e dil$,e is pnisent raPpor u recherche Iternationals onu aexnt oeifta dee raqgroiatons uos a ewaro pow WsIo~s IWe taxes 01W AU* pay*Oa. C00t+ao We ftvwnidcatmsn 3.D Aucuns faze addtonnetle demand#* We 616 pardt dane Me d6laia par to d6posent. En consiquents, to arilsent rapport do recherche Internationsle sot lImiti A Ilinvention rnsntioninde en premier dent Its rvendications; set couvafli par Its rovendicationa nu inro.: 4. Etant donn# quo touts% to% revendicallona susepljbles do fltIr lbial d'une recherche It ouvoant aoaia eflori oarticulier lustifiant un. taxi additiornslle, t'ad ministration chorgis do is recherche internatiorimloe a olatist paisment o aucune tax@ tddoilonnelle. Remargue quent 6 Is riaerva Lea taxes addltionnottee do recherchte itlnt accompagniles dune ruiN.v du dilpoant. Aucune riserve na M1 falls lori du palement dot taxes additionnetla do recherche. Formulaire PCTIISA1210 (foulti. auppldnuntatre (Jancti 1955) ANNEXE AU RAPPORT DE RECHERCHE INTERNATIONALE RELATIF A LA DEMANDE [NTERNATIONALE NO. FR 8900116 SA 27579 l~a presente annexe indique lee, membres de la famille de bre%ets relatifs aux docunments brevets cites dans ke rapport de recherchc internationale wise ci-demus, levdits meMbres son: conlcnus au fichier informahique de l'Office europien rAes hre~ets a la date du 26/05/89 Les renseignements fournis sont donnes a tutre indicatif et nerigagent pas in eesponsabilite de I'Office europeen des brevets. Document brevet citi Date de IMetnbre(s) de In Date au rapport de tecthe. he publication famille de brevet(s) publicai EP-A- 0174143 12-03-86 Pour tout renseignernent concernanh ctne annexe yoir Journal Olfciel de l'0flice europeen des brevets, No.12/82