AU628329B2 - Diagnosis of mycobacterium bovis infection - Google Patents

Description

(r William NOCK Registre Patent Attorney

I

~ii OPI DATE 16/10/89 v AOJP DATE 09/11/89 APPLN. I D 33658 89

PCT

PCT NUMBER PCT/AU89/00143 INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (51) International Patent Classification 4~ C12N 15/00, C07K 13/00 C12Q 1/68, G01N 33/53 C07H 2 1/04. A61K 39/04 (11) International Publication Number: WO 99/ 09261 Al (43) International Publication Date: 5 October 1989 (05.10.89) (21) International Application Number: PCT/AU89/00 143 (k22) International Filing Date: (31) Priority Application Number: (32) Priority Date: (33) Priority Country: 31 March 1989 (31.03.89) PI 7550 31 March 1988 (3 1.03.88) (71) Applicant (for all designated States except US): COM- MONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION [AU/AU]; Limestone Avenue, Campbell, ACT 2601 (AU).

(72) Inventors; and Inventors/Applicants (for US only) WOOD, Paul, Richard [AU/AU]; I Yarra Court, Lower Temple,,towe, VIC 3107 RADFORD, Anthony, John [AU/ AU]; 2 Pakington Street, Kew, VIC 3 101 FIFIS, Theodora [AU/AU]; 16 Almond Street, North Balwyn, VIC 3104 (AU).

(74) Agents: SLATTERY, John, Michael et al.; Davies Collison, I Little Collins Street, Melbourne, VIC 3000 (AU).

(81) Designated States: AT (European patent), AU, BE (European patent), CH (European patent), DE (European patent), FR (Earopean patent), GB (ELu-opean patent), IT (European patent), LU (European patent), NL (European patent), SE (European patent), US.

Published With international search report.

Before the expiration of the time limit for amending the claims and to be republished in the event of the receipt of amendments.

(54)Title: DIAGNOSIS OF MYCOBACTERIUM BOVIS INFECTION DNA AND INFERRED AMINO ACID SEQUENCE (i D L V G P G C A E Y AA A N P T G P A

GGCGATCTGOTGUIGCCCGCTGCGCGGMATACGCGOCAGCCMATCCCACTGGGCCOGCC

S V 0 G M S Q 0 P V A V A A S N N P E L TCGGTGCAGGGOMTGTCGCAGGACCCGGTCG CIGTGGCGGCCTCGAACMATCCGGAGTTIJ T T L r A A 1. S G Q L N P a V N L V 0 T ACAACO CTGAC3GGCr0 CACTGTC OGOCCAQE TCAAT CCGCMOGTAAACCTOGGTGGACACC I NS G Q YT VF A R TN A AF S KL P !TCAACAGCGGTCAGTACACGf3TGTTCGCACGGACCAACGCGGCATTTAGCAAGCTGCCG A S T ID E L K T N S S L LIT S I L r Y G CATC CACGATC GACGAG CTC AAGACMTT CGTC ACTG C TACCAG CATC C TAC CTAC H V VAG0 QT S PA N VV G T R QT L Q

CACOTAGTGGCCGGCCAAACCAGCCCGGCCAACGTCGTCGGCACCCGTCAGACCCTCCAG

GAS VT VTG 00 NS L Ky (iNADV

GGCGCCAGCGTGACGGTGACCGGTCAGTAACAGCCTCAAGGTCGGTACGCCGACGTC

VC G GV S TAN A T VYM 1 DS VL M GTC TGTGGTG0JGT0TCTACCGC CAACGCGACGGTGTACATGATTGACACGGCTMATG PP A CCTC CGGCGTAA (57) Abstract A method for the diagnosis of Mycobacterium bovis infection in a susceptible animal, comprises detection in said animal of antibodies against the MPB-70 protein of M.bovis and/or the detection of a cell-mediated immune response of said animal to the said MPB-70 protein. Also discloscd is a recombinant DNA molecule corresponding to'all or portion of the M.bovis DNA sequence coding for the MPB-70 protein or a polypeptide having the antigenicity of MPB-70 protein, or degenerate forms thereof ell as recombinant MPB-0 protein or polypeptide and a process for the preparation thereof.

WO 89/09261 PCT/AU89/00143 -1- DIAGNOSIS OF MYCOBACTERIUM BOVIS INFECTION This invention relates to the diagnosis of bovine tuberculosis, and in particular it relates to the use of a particular species-specific antigen for the diagnosis of Mycobacterium bovis infection, such as bovine tuberculosis, by both antibody and cellular assays.

Bovine tuberculosis (BTB) is a major disease of cattle worldwide. In the Americas alone it was estimated to have cost the cattle industry $83 million in 1977 (World Health Organisation, 1983). Several nations have mounted or are running campaigns to eliminate BTB, and although these campaigns have drastically reduced the incidence of the disease, none have been totally successful. In many parts of the world there is no concerted effort to control the disease, which poses human, as well as animal, health risks. The causative agent of bovine tuberculosis, Mycobacterium bovis, is closely related to M.tuberculosis.

WO 89/09261 PCT/AU89/00143 -2- Eradication of the disease from cattle has been hampered by the lack of sensitivity and specificity of the bovine skin test currently used for detection of infected animals. A simple serological test for BTB would be the preferred option, but there are two fundamental problems with any test for M.bovis-specific antibody. Infected animals generally have low levels of antibody to ~blvisa, and many of the antibodies produced cross-react with antigens from other environmental mycobacterial or nocardial species (Daniel et.al., 1978). Enzyme-linked immunoassays using M.bovis protein extracts as antigens have been used to detect infected cattle (Ritacco et.al., 1987; Theon et.al., 1983), but these tests using crude antigens appear to lack sufficient specificity or sensitivity to be acceptable for use in an eradication campaign (Auer, 1987). These problems are common to the serological diagnosis of all mycobacterial infections.

The MPB-70 protein is a major antigen of Mycobacterium bovis and M.bovis/BCG strains and can constitute more than 10% of the total protein present in culture filtrate preparations from these organisms.

(Nagai et.al., 1981; Harboe and Nagai, 1984). It has been shown that this protein induces a potent delayed skin test reaction in M.bovis/BCG immunized guinea pigs and has limited cross-reactivity with other species of Mycobacteria, (Harboe et.al., 1986; Haslov, et.al., 1987).

In work leading to the present invention, the utility of this antigen in antibody and cellular assays for the diagnosis of M.bovis infections in cattle has been examined. The MPB-70 protein was found to be expressed by all bovine field isolates of M.bovis tested (151 separate field isolates, Table 1) and was not present in various other mycobacteria commonly found in the environment.

-3- Accordingly, the present invention provides a method for the diagnosis of Mvcobacterium bvis infection in susceptible animal, which is characterised by the detection in said animal of antibodies against the protein of M.bovis and/or the detection of a cell-mediated immune response of said animal to the said MPB-70 protein.

In essence, the present invention is based on the use of the MPB-70 protein as a specific antigen for the diagnosis of M.bovis infection. MPB-70 may be used as an antigen in a test for antibody to M.bovis in accordance with any of the commonly known antibody tests, such as ELISA, RIA, CFT methods, and the like. MPB-70 may also be used as an antigen in the caudal fold skin test in vivo, as well as an antigen in in vitro assays for cell-mediated immune responses such as proliferation assays or assays based on the release of gamma interferon or interleukin 2.

Whilst the present invention is particularly directed to the diagnosis of M.bovis infection in cattle, causing bovine tuberculosis, the method of the invention extends to detection of M.bovis infection in any other susceptible animal species, including for example, deer, badgers, possums, pigs and camels.

The present invention also extends to a process for the purification of MPB-70 from M.bovis culture filtrate material, as well as to the production of recombinant by cloning and expression in a host cell such as E.coli.

It will of course be appreciated that the references to MPB-70 protein herein include not only the full protein, but also any polypeptides derived therefrom which have the antigenicity of MPB-70 and therefore can be used in the assays described herein in the same manner as protein itself.

I

WO 89/09261 PCT/AU89/00143 -4- The MPB-70 protein has been purified from an MYbovis culture filtrate by chromatofocusing on a Mono-P column.

Figure 1 shows a typical elution profile with the arrowed peaks containing the majority of the MPB-70 antigen. When the fractions in each peak were pooled and probed on Western blots with a monoclonal antibody specific for a protein of 22 kd molecular weight was detected (Figure 2).

Purified MPB-70 has been examined using both in vivo and in vitro cellular assays. The in yi._ tests were carried out using the conventional skin test in both guinea pigs sensitized with killed M.bovis cells and cattle infected with live M.bovis. MPB-70 induced a positive reaction in both immunised guinea pigs (Table 2) and infected cattle (Table 3) although not as strong as that induced by bovine tuberculin Purified Protein Derivative (PPD) at similar concentrations. MPB-70 has also been tested in vitro for the ability to stimulate proliferation of peripheral blood lymphocytes from ELbovis infected cattle. The level of reactivity to MPB-70 was similar in all the M.bovis infected animals and there was no activity with lymphocytes from uninfected control cattle (Table 4).

In order to ascertain its suitability as a specific antigen for detection of M.bovis infected cattle, has been tested in an antibody assay (ELISA). Crude culture filtrate antigen was used for comparison in the antibody assay and the antibody results were compared with the conventional in vivo caudal fold skin test. Although the sensitivity of the MPB-70 ELISA was less than that achieved with both the crude antigen ELISA and the caudal fold test, the specificity of this assay was far superior with only a few false positive results (Table The low sensitivity of the antibody assay was most likely due to the fact that mycobacteria preferentially induce a T cell rather than a humoral response (Thorns and Morris, 1983).

h6-

L~II

WO 89/09261 PCT/AU89/00143 In further investigations, the MPB-70 gene from M.bovis has been cloned into the Xgtll expression vector and its DNA sequence determined. The sequence of so determined differs considerably from that deduced by Patarroyo et.al., (1986;1986a) using protein sequencing methods (Figure When serum samples from M.bovis infected cattle were screened by Western blotting on a variety of recombinant M.bovis fusion proteins, MPB-70 was shown to be the dominant antigen recognised (Table 6).

The recombinant MPB-70 protein has also been found to induce good cellular responses in M.bovis immunized guinea pigs and cattle.

Determination of the DNA sequence of the MPB-70 gene enables production of DNA probes corresponding to all or a portion of this DNA sequence, and the use of such a probe for the detection of M.bovis or M.bovis/BCG organisms in samples such as cultures, sputum or tissue samples.

Accordingly, in another aspect of this invention there is provided a method for the detection of M.bovis or M.bovis/BCG organisms in a sample, which comprises the steps of contacting said sample with a DNA probe corresponding to all or a portion of the DNA sequence of the MPB-70 gene, and detecting binding of said probe to indicate the presence of said organisms in said sample.

-6- Table 1. Im2unoperoxidase Staining of Mycobacterium bOVis and other bacteria with a monoclonal antibody specific for Posi ti ve Negativye M.bovis M.bovis M~bOVIS M.bovis M boy is M.bovis strain TMC 1 410 strain AN5 strain pMC 2 203 strain PMC, 205 strain P'C 259 field strains CSIRO Vic.

6 Qld.

7 M.africanun strain TM~ 5122 M.mIcrotI strain TMC 601 BCG-1 strain Glaxo, BCG strain Copenhagen H. tuberculosis strain H37Rv (CSIRO daughter strain) M.A.I.S serovars 2,6,8,9,10,15,18 H. gordonae M.phlei M.kansa311 M. paratuberculosis M. f Iav escens Nocardia asteroides Brucella melitenais strain 16M B.abortus strain 19 Rhodococcus equi R. rhodochrous BCG strain Moreau BCG strain Tokyo BCG strain Pasteur BCG strain CSL H. tuberculosis strain H37Rv (Qid daughter strain) M.tuberculos13 strain DT M.tuberculosiS strain C M. tuberculosis strain PN H. tuberculosis field strains 7 1 TMC -Trudeau Mycobacteria Collection 2 PlC Parkville Mycobacteria Collection 3 BCG Bacille Cal mette-Guerin 14 M.A.I.S. Mcacterium avium-intracellulare-srofulaeum com~plex S. A. South Australia 6 Vic Victoria 7 Qid Queensl and 8 N.Z. New Zealand 9 CSL Commonwealth Serm~ Laboratories t..

-7- TA BLE 2. Delayed skin response to bovine PPD( 1 and to purified In guinea pigs sensitized with killed 1.bovis strain AN5( 3 Anti gen Concentrati on Pl (2) R espons e Diameter (mean S.D.) Area mm2 (mean S.D.) Bovine PPD MPB -70 350.0 35.0 12.62 9.80 2.16 1.51 3.149 1.10 0.89 169.0 98. 5 14.8 149.8 65.14 010 32.3 29.6 26.1 27.7 16.8 350.0 35.0 12.2 7.9 0.0 1. concentration of PPD is based on known biological activity.

2. conjentration or purified antigens s based on freeze-dried weight.

3. control animals did not show any response.

WO 89/09261 PCT/AU89/00143 -8- TABLE 3. Delayed skin response to bovine PPD and purtied MPB-70 In cattle inrected with live M. bovis.

Animal No. M. bovis+ PP D MPB Skin thi ckne3s Diam (mm) (mm2) Diam (mm) Skin thickness (=n2) I. v.

I. T.

I. T.

I.v I. v.

I. T.

Nil N il 14. 7 20.6 7.1 14~.1 10.0 14.5 0. 1 4J.3 9.6 9.6 16.0 9.2 6.8 10.1 0.1 1.2 Bovine PPD 0.1mg, MPB-70 0. 08mg, 106 M. bovis injected either intravenously or intratrachealy (IT) -9- TABLE 4. Proliferative response of bovine lymphocytes from M.bovis infected cattle to bovine PPD and purified MPB Antigen Animal 81 219 230 220 252 275 269 277 Immunization AN5 immunized

NIL

NIL

i.t.+M.bovis i.t. M.bovis i.t. M.bovis i.v.+M.bovis i.v. M.bovis

PPD

11.8 1.0 1.5(1.1)* 16.1(23.0) 10.2(37.3) 28.8(60.4) 60.6(87.6) 43.4(41.3) 9.1 0.7(1.1) 5.7(8.7) 2.9(5.2) 4.7(9.5) 13.5(17.6) 5.4(5.6) H.bovis PPD 20 ug/ml.

purified MPB-70 50 vg/ml.

Animals tested 8 weeks post Infection.

Results reported as stimulation indexes from two separate experiments.

i.t. intratracheal, i.v. intravenous.

WO 89/09261 PCT/AU89/00 143 WO 89/09261 PCT/AU89/00143.

TABLE 5. Comparison, or an antibody assay Using KPB-70 or crude antigen with the caudal fold test.

Test Results Caudal fold Test MPB-70

ELISA

Crude antigen

ELISA

True Positive 68 culture posi ti ve 28 animal s False Negative True Negative 59 culture negative 40O animals False Positive The Infected status, of all cattle was determined by extensive culture of lymph node and lesioned material.

WO 89/09261 PCT/AU89/00143 -11- TABLE 6. Western blot analysis of M. bovis fusion proteins with sera from M. bovi3 Infected cattle.

Molecular weight of cloned antigen Number of sera tested *number of sera giving a positive signal 1iPB-70 -22k protein.

The 19, 65 and 70k proteins have previously been clone'i and described (Shinnick et al, 1987)

I:;

WO 89/09261 PCT/AU89/00143 -12- Further features of the present invention will be apparent from the following detailed Examples and the accompanying drawings.

In the drawings: Figure 1 shows separation of M.bovis antigens on a Mono-P column by chromatofocusing. Freeze dried culture filtrate, approx. 15mg was dissolved in 0.5 ml of 1:10 Polybuffer PB-74, pH 4.0 and applied onto the column.

Fractions were analysed by SDS-PAGE and Western blotting for monoclonal antibody reactivity. Arrowed peaks contain reactive antigen(s). The fractions for each of these peaks were combined.

Figure 2 shows SDS-PAGE and Western blotting analysis of pooled antigens from the Mono-P column. of each pool was loaded.

gel stained with silver stain, Western transfer of similar gel probed with M.bovis specific monoclonal antibody Lanes mol wt markers, culture filtrate, pool a, pool b, pool c and pool d.

Figure 3 shows the sequence of the M.bovis AN5 of gene, and its translated protein sequence.

Figure 4 shows probing of various mycobacterial DNA with a MPB-70 gene probe.

EXAMPLE 1: Isolation and Purification of MPB-70 antigen from M.bovis AN5 cultures.

1. Mycobacterial cultures were grown in BAI medium for 12 weeks in 5% CO 2 in air at 37 0

C.

2. The culture medium was collected and centrifuged to remove cells and debris. It was then filtered successively through 0.45pm and twice through 0.22 pm Millipore membranes.

t i I 1 1 !i 'ii WO 89/092C1 PCT/AU89/00143 -13- 3. The culture filtrate (CF) was concentrated tenfold by ultrafiltration (Amicon YM-5) or by reverse osmosis against Aquacide II (Calbiochem). The buffer was exchanged for dist. H 2 0 and the antigens were lyophilized.

4. The lyophilized material was dissolved in a small volume of a tenfold dilution of Polybuffer PB-74 (Pharmacia) which was adjusted to pH 4.0 with imino-diacetic acid (IMDAA). Precipitated antigens were removed by centrifugation and the supernatant was applied onto a chromatofocusing column (Pharmacia Mono-P, 0.5 x or a 1.5 x 60cm column packed with Pharmacia PBE-94 gel) which was equilibrated with 0.025 M piperazine adjusted to pH 5.6 with IMDAA. The antigens were eluted with 14 column volumes of PB-74 diluted tenfold and adjusted to pH 4.0 with IMDAA. The elution was monitored by absorbance at 280nm.

Fractions containing MPB-70 were pooled and further purified by gel filtration. When minor contaminancs were present the preparation was further purified by passing it through a Sepharose Con A column and/or a Superose 12 (Pharmacia) column.

EXAMPLE 2: Use of Purified MPB-7 MATERIALS AND METHODS 0 antiaen in Assays Antisera and Monoclonal Antibodies. Sera from immunized animals, from naturally or experimentally M.bovis infected animals, and from non-infected control animals were used.

Cattle were immunized by repeated subcutaneous injection of 10mg of killed M.bovis (AN5 strain) in Iml of saline. Cattle were also infected wi-' i live M.bovis by either intravenous or intra.racheal injection of 106 bacteria.

Monoclonal antibodies against irradiated M.bovis sonicate, were raised and kindly provided by Agen .i uuULHULULUI lUUI ALLUU I LAU'1 I AALAULLI LAAUUI LUT TAACGCCGACGTC 141 V C G G V S T A N A T V Y M I D S V L M 421 GTCTGTGGTGGGGTTCTACCGCCAACGCGACGGTGTACATGATTGACAGCGTGCTAATG 161 P P A 481 CCTCCGGCGTAA (57) Abstract A method for the diagnosis of Mycobacterium bovis infection in a susceptible animal, comprises detection in said animal of antibodies against the MPB-70 protein of M.bovis and/or the detection of a cell-mediated immune response of said animal to the said MPB-70 protein. Also disclosed is a recombinant DNA molecule corresponding to all or portion of the M.bovis DNA sequence coding for the MPB-70 protein or a polypeptide having the antigenicity of MPB-70 protein, or degenerate forms thereof, well as recombinant MPB-70 protein or polypeptide and a process for the preparation thereof.

WO 89/09261 PCT/AU89/00143 -14- Biomedical Ltd. They have been characterized and designated SB1-SB10 (Wood et.al., 1988).

ELISA. Polystyrene microtitre trays (Nunc Immuno Plate) were coated with 100pl of 3pg/ml of M.bovis culture filtrate or, 10pg/ml of purified antigen in phosphate buffered saline (PBS) (pH 7.2) overnight at 40C. Plates were then washed 4 times in PBS with Tween 20 (PBST), bxocked with 0.1% sodium casein, and sera diluted in PSBT were added. Trays were incubated for 90 min at room temperature washed and reincubated with an antibovine IgG antibody conjugated to horseradish peroxidase (HRP:Miles).

After 90 min the trays were washed and incubated with substrate [(2,2'-azino-di(3-ethylbenzthiazoline sulphonate)] (ABTS) for 30 min. Results were read at 405 nm in a Titertek Multiskan.

Immunization and skin testing of guinea Pias. Guinea pigs were sensitized with a suspension of killed and dried M.bovis strain AN5 in a paraffin oil at a concentration of An initial dose of 0.4ml was given by injecting 0.lml subcutaneously at each of four sites. A booster injection of 0.2ml was given intradermally at two sites 37 days later. Skin testing was conducted 40 days after the second inoculation.

For each antigen two groups of five guinea pigs were used. One group consisted of sensitized animals and the other non-sensitized controls. Each guinea pig was inoculated intradermally with 50pl of each of three tenfold dilutions of only one antigen. The response to "r this antigen was assessed at 48 hours by r.easuring the diameter and area of erythema.

The responses to the purified antigens were compared to an equal weight of bovine tuberculin PPD (Commonwealth Serum Laboratories, Aust.).

i human, as well as animal, health risks. The causative agent of bovine tuberculosis, Mycobacterium bovis, is closely related to M.tuberculosis.

Preparation of peripheral blood lymphocytes (PBL). Ten to of blood was collected into vacutainers (Becton-Dickinson) containing heparin (20 units/ml) or sodium citrate The blood was then centrifuged at 800g for 20min, the buffy coat removed, diluted up to with Hanks (GIBCO:Ca Mg free) and overlayed onto of lymphopaque (BDH: 1.086 g/ml). After centrifuging at 800 a. for 25 min the interphase cell layer was collected and washed twice (450 x g; 10 min) with 20ml Hanks. The cells were finally resuspended in 5ml RPMI 1640 (GIBCO) and viable counts done using eosin exclusion.

Lymphocyte Proliferation Assay. Isolated lymphocytes were cultured in flat-bottom 96 well trays (Nunc) at 2.1 x 105 cells/well in RPMI containing 5% foetal calf serum, L-glutamine, 2-Mercaptoethanol and antibiotics. After 48 hour incubation with antigen (25pl/well) the cultures were pulsed with tritiated thymidine (Amersham; and harvested 24 hours later using an automatic cell harvester (Skatron). The amount of tritiated thymidine incorporated was determined using an appropriate scintillant by counting in a liquid 13 scintillation counter. Results were expressed as mean coun\-s per minute (CPM) of triplicate cultures, and the stimulation index calculated as shown below.

mean CPM with antigen Stimulation index mean CPM without antigen SDS-Polvacrylamide Gel Electrophoresis. Antigens were characterised by their electrophoretic mobility on polyacrylamide gel cast on a Bio-Rad Protean II apparatus. Three centimetres of 4% polyacryalmide stacking gel was used. The buffer system was that of Laemmli (1970). Electrophoresis was carried out at room L- 6=u separate field isolates, Table 1) and was not present in various other mycobacteria commonly found in the environment.

WO 89/09261 PCT/AU89/00143 -16temperature at 20mA per gel through the stacking gel and then at 25mA per gel through.the separating gel. In some experiments a Bio-Rad mini gel apparatus was used. The buffers and gel concentrations were as above.

Electrophoresis was carried out at 150 volts for approx.

hours. The gels were stained with Coomassie Brilliant Blue (CBB) and/or with silver stain (Bio-Rad).

Immunoblotting. Antigens from SDS-PAGE, gels were transferred electrophoretically onto nitrocellulose membranes according to the method of Towbin et.al.

(1979). The membranes were probed for two hours with antisera or monoclonal antibodies diluted in PBST. They were then incubated with HRP-conjugated sheep anti-bovine, or anti-mouse IgG (Silenus), followed by the HRP substrate (4-chloro-l-naphthol) until the reactive bands were visible.

RESULTS.

Purification of single components containing the specific determinants was achieved by chromatofocusing on a Mono-P column as described in Example 1. Figure 1 shows a typical elution profile of this step. The arrowed peaks contain most of the antigen that binds to the M.bovis specific monoclonal antibodies but all the peaks eluted after the first arrowed peak contain material that reacts with the monoclonal antibodies. The mol.wt. of the reactive antigen in peak is approx.20K, while the antigens in all the following peaks were 22K. The fractions in each arrowed peak were pooled. Figure 2(a) shows the SDS-PAGE patterns of these pools and Figure 2(b) shows the reaction of the antigens with the monoclonal antibody (SB10), after they were transferred onto nitrocellulose. Western transfers of the purified antigens probed with serum from an M.bovis infected animal, also show single reactive bands (result not shown). ~I L L UDo--I ana tnererore can De usea in the assays described herein in the same manner as protein itself.

WO 89/09261 PCT/AU89/00143 -17- The elution pattern varied somewhat for different CF batches showing-considerable variation in their content of the antigen in relation to the total protein (Fig.2(a)).

The amounts of the higher mol.wt. species present, which contained the reactive epitopes, also varied. In some cases they were only minimal (Fig.2(a)) and in others quite considerable. The lower the relative amounts of these higher species, the better the recovery of the 22K protein. When the higher species were relatively abundant, small amounts could be recovered in the chromatofocusing purification, often co-purifying with the 22K bands. They were removed if the CF was first passed through a Con A-Sepharose column. This suggests that the larger molecules contain a sugar moiety. The Con A Sepharose step improved the recovery of the 22K protein.

Gel filtration was used to remove additional contaminants when necessary.

Antigens from pools a, b and c were tested in an ELISA system for their suitability for diagnostic use.

Crude CF was used as a comparison. A panel of sera of M.bovis infected and non-infected animals were tested as well as some sera from animals infected with related mycobacteria and other bacteria.

Sera from M.bovis infected animals that gave high ELISA values with the CF were tested against the purified antigens. In this experiment only antigens and 'c' were examined, however in earlier experiments it was found that antigen gave similar ELISA readings to 'b' (result not shown).

MPB-70 was also examined in CMI tests both in yiyo and in vitro. The in vivo tests were carried out using the conventional skin test on guinea pigs which were sensitized with M.bovis cells. MPB-70 gave a positive reactions although it was not as active as PPD at the lower concentrations tested (Table 2).

41 Aui inriJ. JuIII ILif! ULUue antigen tajibA ana tne caucial fold test, the specificity of this assay was far superior with only a few false positive results (Table The low sensitivity of the antibody assay was most likely due to the fact that mycobacteria preferentially induce a T cell rather than a humoral response (Thorns and Morris, 1983).

qi WO 89/09261 PCT/AU89/00143 -18was also tested in vitro for its ability to induce proliferation of peripheral blood lymphocytes from M.bovis infected cattle. The protein induced similar levels of reactivity in all the M.bovis infected animals and showed no activity with lymphocytes from uninfected control animals. The absolute level of reactivity of was less than that seen with M.bovis PPD antigen and varied considerably between individual animals.

EXAMPLE 3 Cloning of M.bovis AN5 DNA into hat 11 and Detection of Clones Expressing Specific Antigens of M.bovis.

XAl MATERIALS AND METHODS Phaae and bacteria. Xgtll, Escherichia coli Y1089, and E.coli Y1090 have been previously described (Young Davis, 1983), as has the pEX expression vector (Stanley Luzio, 1984). MboYis AN5 was obtained from the Commonwealth Serum Laboratories, Parkville, Australia.

The Commonwealth Serum Laboratories obtained the strain from the Ministry of Agriculture Weybridge Laboratories, England, in 1973. Subsequently, it has been stored in freeze-dried ampoules.

Enzymes. All enzymes were purchased from Promega Biotec.

Except where specifically mentioned, all of the DNA techniques used were as described by Maniatis et.al., (1982).

MAbs. MAbs to M.bovis were a generous gift from Agen Biomedical Australia Ltd. The properties of MAbs SB1 to SB10 are published elsewhere (Wood et.al., 1988).

Isolation of M.bovis DNA. M.bovis AN5 was grown on BAI medium (Paterson et.al., 1958) for 6 weeks, after which cells were harvested by centrifugation. DNA extraction was essentially by the method of Shoemaker et.al. (1986).

L i WO 89/09261 PCT/AU89/00143 -19- Construction of the M.bovis library in atl1. DNM.bai DNA was sonicated briefly (~3secs) at low power, giving DNA fragments ranging in size from 2 kilobase pairs to 200 base pairs as assessed by agarose gel electrophoresis. DNA methylation, flushing with T4 DNA polymerase, and addition of EcoRI linkers were by the protocol of Young et.al. (1985). Elimination of excess EcoRI linkers after linker ligation and EcoRI digestion was achieved by using gel filtration (Superose 12 column; Pharmacia), and the eluate was monitored by UV absorption. The DNA was then ethanol precipitated and suspended in the TE buffer, and 0.5pg was ligated with lig of dephosphorylated EcoRI-digested Xgtll (Promega) overnight at 4 0 C. Phage packaging was in Stratagene gigapack extracts.

Preparation of affinity-purified antibody to M.bovis. An emulsion of approximately 2 x 109 heat-killed mycobacterial cells in Freund incomplete adjuvant was used for hyperimmunization of rabbits. Rabbits received two inoculations, 35 days apart. Blood was taken from the ear of each rabbit 10 days after the second inoculation. Sera were collected, and the titer to M.bovis PPD (Commonwealth Serum Laboratories) was determined by enzyme-linked immunosorbent assay. Rabbit sera used in affinity purification gave titers of 1:40,960, as determined by enzyme-linked immunosorbent assay. An M.bovis affinity column was prepared by coupling M.bovis PPD to Sepharose 4B by the method of March et.al, (1974). The column was equilibrated with 3 volumes of affinity buffer (0.1 M Tris, 0.5M NaCI, 0.1% Tween 20), 5ml of rabbit serum was pumped through, and the column was then washed with 3 volumes of affinity buffer to elute unbound material. Bound substances were then eluted with 2 M glycine hydrochloride (pH 2.5) into 2 M Tris, and the i WO 89/09261 PCT/AU89/00143 eluate was monitored by UV absorption. Eluted protein was concentrated by using an Amicon concentrator and washed with phosphate-buffered saline (PBS), and the protein concentration was determined by the method of Bradford (1976).

Screening of the .atll library. Filters were taken from phage overlay plates prepared as described by Young et.al.,(1985). Immediately after removal from the plates, filters were washed for 10 min. in PBST and then blocked in PBS-5% bovine lacto transfer technique optimizer (skim milk) for lh. Affinity-purified antibody to M.bovis was added to 3.5pg ml 1, and the filters were shaken gently overnight to 4 0 C. The filters were then sequentially washed for 10min in PBS, PBST, and PBS, after which swine anti-rabbit horseradish peroxidase conjugate was added tin PBST (Daiko; 1/300) and the filters were incubated with gentle rocking for 2h. Washing was repeated, and 4-chloro-l-naphthol substrate was added.

Colour development was complete after 15 min. The filters were then washed in distilled water and dried.

Plaques corresponding to reactive spots on the filters were picked off and placed in 1.0ml of SM medium.

Purification was by spotting of 5-pl samples from serial dilutions of the original phage suspensions on lawns of E.coli Y1090 for further antibody probing, after which single reactive plaques were picked, suspended and streaked on lawns of E.coli Y1090.

When Mabs were used for analysis of isolated clones, preparation of filters was identical to the method described. MAbs were substituted for affinity-purified serum (1/2,000 ascites), and anti-mouse alkaline phosphatase conjugate (Promega; 1/5,000) was used for detection. Filters were developed in 5-bromo-4-chloro- 3-indolyl-phosphate-Nitro Blue Tetrazolium substrate.

WO 89/09261 PCT/AU89/00143 -21- Protein electrophoresis and Western blottina (Immunoblottina). Protein samples were solubilized by heating at 100 0 C for 5 min in Tris hydrochloride (pH 6.8) containing 2% sodium dodecyl sulfate, 5% (vol/vol) glycerol, and 0.002% (wt/vol) bromophenol blue. Vertical slab sodium dodecyl sulfate-polyacrylamide gel electrophoresis was carried out essentially as described by Laemmli (1970), in 12% acrylamide gels. Proteins were transferred to nitrocellulose by electro-blotting overnight. Probing with MAbs (1/2,000) was done by the protocol used for phage spots. Probing with cattle sera was Jone at 1/50 dilution in PBST for 2h, and the sera were absorbed with pEX-derived protein bound to nitrocellulose for lh before use. Bovine antibodies were detected by using a peroxidase-conjugated antibovine immunoglobulin MAb (Australian Monoclonal Developments).

Sequencing. Sequence analysis was done by the primer extension dideoxy termination method of Sanger et.al.

(1980) after subcloning in M13tgl30 (Amersham Corp.); the products of the sequencing reaction were analysed on 6% polyacrylamide-8 M urea gels.

-bl RESULITS Construction of a Xgtll library of M.bovis. M. bo-r DNA was extracted, sonicated, and cloned into Xgtll.

Australian PPD for use in the bovine caudal-fold-skin test is isolated from M.bovis AN5, and since PPD is a proven diagnostic reagent, this was the strain chosen for extraction of DNA for cloning. The AN5 library contained 2.5 x 106 independent PFU, of which 90% were recombinant as assessed by 8-galactosidase inactivation. The sizes of the inserts, as measured by restriction digestion and agarose gel analysis of the library, ranged from 200 to 900bp.

I

Bovine PPD O.lmg, MPB-70 0.08mg, 10 6 bovis injected either intravenously or intratrachealy

(IT)

WO 89/09261 PCT/AU89/00143 -22- Probing the M.bovis AN5 library with polvclonal sera.

Twenty filters representing 5 x 10 4 PFU per filter (106 PFU overall) were probed with affinity-purified polyclonal anti-MJbvis AN5 serum. Between two and eight reactive phage plaques were found on each filter, and these were picked off the plates and further purified. The signal strength of each plaque varied greatly, ranging from barely perceptible dots to conspicuous spots. Not all of the filter spots revealed further reactions on phage purification; of the 88 spots found on the original filters, 32 phage gave consistent signals and passed through primary and secondary purification steps. Very little background due to E.coli cross-reactive antibody was found by using the affinity-purified antibodies, in contrast to the situation when unpurified sera from either rabbits or cattle were used. Absorption with E.coli lysate either bound to nitrocellulose or added directly to serum was far less effective in reducing background signal than the use of affinity-purified antiserum.

Analysis of recombinant clones with MAbs. Purified phage preparations and lysogens of the Xgtll clones reactive with polyclonal antibody were probed with M.bovis-M.tuberculosis-specific MAbs SB1 to SB10 in phage spot and colony assays to check for the presence of the specific epitopes.

Of the 32 recombinant phage, 5 expressed antigens that were recognised by at least one of the MAbs when phage spots were probed, although as might be expected of antigens derived from a randomly cloned library, not all of these five clones were recognised by all of the MAbs (Table Since MAbs SB1 to SB10 are known to recognise three separate epitopes on the protein antigen MPB70 (Wood 1988), this is indicative that the recombinant antigens recognised by the MAbs are coded by clones derived from separate ligation events carrying inserts representing different sections of the MPB70 gene.

I i 11Th B 9- WO 89/09261 PCT/AU89/00143 -23- Of the five Xgtll clones recognised by the MAbs, two designated pB3C and C4a, displayed affinity for all of the MAbs in the panel, with the exception of MAb SB9, which did not recognize clone pB3C. Agarose gel analysis showed that clone C4a had an EcoRI fragment insert of -250bp.

This was the smallest inserted fragment found that carried all of the specific epitopes and was capable of coding for less than half of MPB70 (molecular weight, 22,000). As such it was possible that this clone carried non- of the cross-reactive epitopes thought to be present on (Harboe Nagai, 1984) and might prove useful as an antigen in serological diagnosis of BTB.

"I)

WO 89/09261 PCT/AU89/00143 -24- TABLE 7 Recognition of M.bovis clones by SB MAbs* Reactivity with the following clones: MAb pB2a pB3c C4a XB2a XC2a SB1 SB2 SB3 SB4 SB6 SB7 SB8 SB9 Reactivity was assessed by probing of phage spots.

Drops (5pl) containing -103 phage were spotted on E.coli Y1090 lawns, and filters were prepared and probed as described in the text. The symbol indicates a weak reaction.

To facilitate serological analysis, the C4a insert was cloned into the high-expression pEX vector (Shoemaker et.al., 1986), and expression was confirmed by immunoblotting of colonies with the SB10 MAb. The pEX vectors express cloned proteins as a cro-B-gal fusion protein, insoluble in most aqueous solutions, which allows for a relatively simple initial purification, eliminating most soluble proteins by washing in 1% Nonidet P-40-1% deoxycholate in PBS. After the washed pEX C4a fusion

L

e I CI i WO 89/09261 PCT/AU89/00143 protein was dissolved in sodium dodecyl sulfate loading buffer, the mixture was run on an acrylamide gel before transfer to nitrocellulose. Sera from both M.bovis-infected and healthy cattle were used to probe the Western blots. These blots indicated that antibody reactive to the fusion protein was limited to infected animals. However, not all animals with the disease had a detectable antibody response to the cloned protein.

Neither pooled sera from BTB-free herds nor six sera from uninfected cattle in a 3TB-infected herd showed reactions with the cloned protein, although it was necessary to absorb out anti-E.coli activity in the sera and to use a specific monoclonal antibovine immunoglobulin conjugate to lower cross-reactivity.

Sequence of the MPB-70 aene. Synthetic peptides containing the specific epitopes of MPB70 have diagnostic potential and should be totally free of endogenous cross-reactions. To obtain the DNA sequence of the gene, and consequently the peptide sequence of the a clone of the MPB-70 gene was isolated. The insert from Xgtll clone C4a was used to probe a long-fragment library of M bovis AN5 constructed in the vector EMBL3. After purification of an EMBL3 clone reactive by DNA hybridization with the Xgtll C4a insert, DNA was extracted from the EMBL3 clone and analysed by restriction enzyme digestion and agarose gel electrophoresis. Southern blot analysis, again using the Xgtll insert as a probe, showed the MPB-70 gene to be located on a 1.85Kbpr Pstl restriction fragment. Subcloning of the 1.85Kbpr Pstl fragment into the bacteriophage M13 permitted the elucidation of the sequence of the MPB-70 gene. Figure 3 shows the DNA sequence and inferred protein sequence of the mature protein MPB-70. This protein is produced intracellularly with a signal sequence that is cleared from the mature molecule.

i ixemiuv iei.L adnu ueuris. it was mnen riiterea successively through 0.45pm and twice through 0.22 pm Millipore membranes.

WO 89/09261 PCT/AU89/00143 -26- Patarroyo et.al., (1986,1986a) published two quite different peptide sequences for MPB-70 which were obtained by protein sequencing techniques. The sequence described in Figure 3 aligns with Pattaroyo's (1986a) up to amino acid 112, with 13 variations. From amino acids 112 to 163 there is no similarity. A similar situation occurs with the sequence of MPB-70 given in Pattaroyo (1986). In this case the similarity with our DNA translated sequence (Fig.

3) ends at amino acid 78, prior to which there are seven variations. Following on from amino acid 80 and discounting a 17 amino acid sequence of Pattaroyo's (1986) which is not present in the DNA translated sequence (Fig.

3) these sequences coincide up to amino acid 130, with eight variations. From amino acid 130 to 163 they are totally different.

EXAMPLEA 4 Diagnosis of M.bovis infections in deer.

Sera from M.bovis infected deer were tested in an ELISA using the MPB-70 protein as antigen. A pool of sera from non-infected deer was used as a negative control and serum from a known M.bovis infected cow was used as a positive control. A commercially available monoclonal antibody to bovine IgG, conjugated to horseradish peroxidase (Bi2, Australian Monoclonal Development, Sydney) was found to also bind cervine antibody and was therefore used as a conjugate in this system.

In this MPB-70 ELISA all six infected deer had antibody levels significantly above that of the control serum (Table Thirty-two individual sera from tuberculosis free deer were also tested in this system and found to be negative.

by either intravenous or intra.racheal injection of 10 6 bacteria.

Monoclonal antibodies against irradiated M.bovis sonicate, were raised and kindly provided by Agen :i WO 89/09261 PCT/AU89/00143 -27- Method The ELISA system used to test cervine sera was the same as that used for testing bovines, however two steps in the procedure were altered: the blocking step prior to antibody binding was omitted and a monoclonal anti-bovine IgG conjugate was used instead of a polyclonal conjugate.

The responses to the purified antigens were compared to an equal weight of bovine tuberculin PPD (Commonwealth Serum Laboratories, Aust.).

WO 89/09261 PCT/AU89/00143 -28- TABLE 8: MPB-70 ELISA with M.bovis-infected Deer Sera Infected Sera Optical Density 1 2.9 2 2.9 3 0.9 4 2.8 6 Negative control 0.1 Positive control 2.9 All sera from infected deer were obtained from New Zealand. M.bovis infection was confirmed by histology and bacteriological culture of tissues from the animals.

EXAMPLE 5 Use of M.bovis DNA sequence as hybridisation probe.

Method The mycobacteria listed were cultured in 50ml of Dubos broth media and harvested by centrifugation. Cell pellets were heat-killed at 70 0 C and stored frozen at until required. Nucleic acid was extracted from the cells as follows. Each of the cell pellets were resuspenderd in TE buffer to a total volume of lml. The cell suspensions were sonicated for 5 seconds on ice.

Proteinase K was added to give a final concentration of and the suspensions were incubated at 65 0 C for 1 hour. The samples were extracted once with 1 volume of phenol saturated with TE, then once with Leder phenol phenol, 50% CIA [chloroform:isoamyl alcohol, 24:13), once with an equal volume of CIA and finally with 1 volume of water saturated ether. The nucleic acid was ethanol precipitated and resuspended in 25pl of water.

Concentration of DNA and RNA in the extracts were measured polyacrylamide gel cast on a Bio-Rad Protean II apparatus. Three centimetres of 4% polyacryalmide stacking gel was used. The buffer system was that of Laemmli (1970). Electrophoresis was carried out at room WO 89/09261 PCT/AU89/00143 -29spectroscopically. Aliquots of approximately 200ng were applied to Hybond-N membrane using a dot blot apparatus.

The DNA was denatured and fixed to Hybond-N as described by the manufacturer. The blot was prehybridised and hybridised in a standard solution, including Blotto and sheared herring sperm DNA. The probe used was the 1.85kb Pstl fragment that contains the gene for MPB-70, labelled with 32 P using a standard method of oligonucleotide priming. Hybridisation was carried out at 37 0 C over night. The blot was washed in 1.0 SSC, 0.1% SDS at prior to autoradiography.

Results Various DNA preparations of the mycobacteria listed below were probed in dot blots with a radioactive DNA probe of the MPB-70 gene. As can be seen from Figure 4, all and only Mbovis isolates showed binding of the probe indicating the presence of an homologous MPB-70 gene and surrounding region: Row i. M.bovis 2. M.bovis 3. Field isolate a, Nth.Terr. M.bovis 4. Field isolate b, Nth.Terr. M.bovis Feral pig isolate, M.bovis 6. Victorian abattoir isolate, M.bovis 7. New Zealand possum isolate, M.bovis 8. M.bovis BCG Row (b) 1. MAIS 2 2. MAIS 2 3. M.phlei 4. M.phlei M.kansasii 6. Mkansasii 7. MAIS 8 8. MAIS 8 snows tne reaction or tne anrigen5 WILL 'Ii LI IUIU%-LUAQ-oL antibody (SBlO), after they were transferred onto nitrocellulose. Western transfers of the purified antigens probed with serum from an MJ)Dyja infected animal, also show single reactive bands (result not shown).

WO 89/09261 PCT/AU89/00143 1. Auer, L.A. (1987), Assessment of an enzyme linked immunosorbent assay for the detection of cattle infected with Mvcobacterium boQyis. A~LL .64:172-176.

2. Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem. 72:248-254.

3. Daniel, T.M. and Janicki, B..(17) isolation, chemistry, and immunological properties.

Micub.iol.Rev. 84-113.

4. Harboe, and Nagai, S. (1984). MPB70, a unique antigen of Mycobacterium boi BCG.

Am.Rev.R svir.Dis. 12:444-452.

Harboe, Nagai, Patarroyo, Torres, Ramirez, C. and Cruz, N. (1986). Properties of proteins MPB64, MPB70 and MPB80 of Mycobacterium boi BCG. Infect. Imm 51:293-302.

6. Haslov, Anderson, A.D. and Bentzon, M.W., Biological activity in sensitized guinea Pigs Of MPB7O, a protein specific for some Strains of !4vcobacte-rium Lc-iia BCG. Scand.J.Immunol. 26 44 5-454 7. Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 2217:680-685.

and in vitro. The in yi. tests were carried out using the conventional skin test on guinea pigs which were sensitized with M.bovis cells. MPB-70 gave a positive reactions although it was not as active as PPD at the lower concentrations tested (Table 2).

L i WO 89/09261 PCT/AU89/00143 -31- 8. Maniatis, Fritsch, E.F. and Sambrook, J.

(1982). Molecular cloning: a laboratory manual.

Cold Spring Harbor Laboratory, Cold Spring Harbor,

N.Y.

9. March, Parikh, I. and Custrecasas, P. (1974).

A simplified method for cyanogen bromide activation of agarose for affinity chromatography.

Anal.Biochem. Q: 149-152.

Miura, Nagai, Kinomoto, Haga, S. and Tokunaga, T. (1983). Comparative studies with various substrains of Mycobacterium bovis BCG on the production of an antigenic protein Irfect. Immun. 9.:540-545.

11. Nagai, Matsumoto, J. and Nagasuga, T. (1981).

Specific skin-reactive protein from culture filtrate of Mycobacterium bovis BCG. Infect.Immun.

31:1152-1160.

12. Patarroyo, Parra, Pinilla, C., delPortillo, Lozada, Oramas, Tores, M., Clavijo, Ramirez, Fajardo, Cruz, and Jimenez, C. (1986). Immunogenic synthetic peptides against Mycobacterium tuberculosis, 219-229. In F.Brown, R.M.Chanock and R.A.Lerner, Vaccines 86: new approach to imunization. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

13. Patarroyo, Parra, Pinilla, C., delPortillo, Torres, Clavijo, Salazar, Jimenez, Instituto de Inmunologia, Hospital San Juan de Dios, Universidad Nacional de Colombia, Bogota, Columbia. (1986a) N. i Q_.l VJO 0 ur a weeKs arter wnicn cells were harvested by centrifugation. DNA extraction was essentially by the method of Shoemaker et.al. (1986).

WO 89/09261 PCT/AU89/00143 -32- 14. Paterson, Stuart, Leslie, I.W. and Leech, F.B. (1958). The use of tests on sloughterhouse cattle for estimating relative potencies of tuberculins and for the calculation of discrimination tests. J.H g. 6:1-18.14.

Ritacco, deKanter, Barrera, Nader, A., Bernardelli, Torres, Errice, F. and Fliess, E. (1987). Assessment of the sensitivity and specificity of enzyme-linked immunosorbent assay (ELISA) for the detection of mycobacterial antibodies in bovine tuberculosis. J.et Med.Ser.B.

34:119-125.

16. Sanger, Coulson, Barrell, Smith, A.J.H. and Ree, F. 91980). Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J.Mol.Bio1. 24:161-178.

17. Shinnick, Krat, C. and Schodow, S. (1987).

Isolation and restriction site maps of the genes encoding five M.tuberculosis proteins.

Infect.Immun. 5:1718-1721.

18. Shoemaker, Fisher, Jones, Jr., J.D, and Scoggin, C.H. (1986). Restriction fragment analysis of chromsomal DNA defines different strains of Mycobacterium tuberculosis. Am.Rev.Respir.Dis.

134 :210-213.

19. Stanley, K.K. and Luzio, J.P. Construction of a new family of high efficiency bacterial expression vectors: identification of cDNA clones coding for human liver proteins. EMB_ J. 3:1429-1434.

Infec.Immn. 5^17181721 18 Soeaer SA, iser oes J.,JDan Scogin C..(96.Rsrcinfam( serum was pumped through, and the column was then washed with 3 volumes of affinity buffer to elute unbound material. Bound substances were then eluted with 2 M glycine hydrochloride (pH 2.5) into 2 M Tris, and the WO 89/09261 PCT/AU89/00143 -33- Thoen, Hall, Petersburg, T.A., Harrington, Jr., R. and Pietz, D.E. (1983).

Application of a modified enzyme-linked immunosorbent assay for detecting mycobacterial antibodies in the sera of cattle from a herd in which Mycobacterium bovis infection was diagnosed, P.603-610. In Proceedings of the 87th Annual Meeting of the U.S. Animal Health Association, Las Vegas, Nev.

21. Thorns, C.J. and Morris, J.A. (1983). The immune spectrum of Mycobacterium bovis infections in some mammalian species a review. Vet.Bull 53:543-550.

22. Towbin, Staehelin, T. and Gordon, J. (1979).

Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets procedure and some applications.

Proc.Natl.Acad.Sci.USA. 76:4350-4354.

23. Wood, Ripper, Radford, Bundesen, Rylatt, Cottis, John, M. and Plackett, P. (1988). Production and characterisation of monoclonal antibodies specific for Mvcobacterium bovis. J.Gen.Micro. 111:2599- 2604.

24. World Health Organization. (1983). Diagnosis of' animal health in the Americas. Scientific publication No.452, Pan American Health Organization, Washington, D.C.

Young, and Davis, (1983). Yeast RNA polymerase II genes: isolation with antibody probes. Science 22:778-782.

serum (1/2,000 ascites), and anti-mouse alkaline phosphatase conjugrate (Promega; 1/5,000) was used for detection. Filters were developed in 5-bromo-4-chloro- 3-indolyl-phosphate-Nitro Blue Tetrazolium substrate.

WO 89/09261 PCT/A U89/00 143 -34- 26. Young, Mehra, Sweetser, Buchanan, T., Clark-Curtiss, Davis, R.W. and Bloom, B.R.

(1985). Genes for the major protein antigens of the leprosy parasite Mycobacterium lere Iiatule (London) 3-U:450-454'.

Claims (18)

1. A method for the diagnosis of Mycobacterium oliA infection in a susceptible animal, which comprises detection in said animal of antibodies against the protein of M.bovis and/or the detection of a cell-mediated immune response of said animal to the said MPB-70 protein.

2. A method according to claim 1, wherein said animal is selected from the group consisting of cattle, deer, badgers, possums, pigs and camels.

3. A method according to claim 1 or claim 2, wherein the presence of antibodies against the MPB-70 protein in said animal is detected by contacting a serum sample from said animal with MPB-70 protein or a polypeptide having the antigenicity of MPB-70 protein, and detecting binding of antibodies in said sample with said protein or polypeptide or competition with binding of labelled antibody to MPB-70 protein to indicate presence of said antibodies in said sample.

4. A method according to claim 1 or claim 2, wherein a cell-mediated immune response of said animal is detected by an in vivo caudal fold skin test using MPB-70 protein or a polypeptide having the antigenicity of MPB-70 protein as antigen. A method according to claim 1 or claim 2, wherein a cell-mediated immune response of said animal is detected by an in xitro assay using MPB-70 protein or a polypeptide having the antigenicity of MPB-70 protein as antigen. 1 1 11 1 1 WO 89/09261 PCT/AU89/00143 -36-

6. A method according to claim 5, wherein said in vitro assay is a lymphocyte proliferation assay or an assay based on release of gamma interferon or interleukin 2

7. A kit for the diagnosis of Mycobacterium bovis CA.\&n e se.aAro o c0.ori\ ,r-g TtkO ckc e infection in a susceptible anima/, which comprises means for the detection in said animals of antibodies against the MPB-70 protein of M.bovis and/or means for the detection of a cell-mediated immune response of said animal to the said MPB-70 protein.

8. A kit according to claim 7, comprising protein or a polypeptide having the antigenicity of protein as antigen.

9. MPB-70 protein of M.bovis in substantially pure form. A method for the preparation of MPB-70 protein in substantially pure form, which comprises purification of an M.bovis culture filtrate by chromatofocusing.

11. A method according to claim 10, wherein said chromatofocusing step is followed by further purification by gel filtration.

12. A recombinant molecule corresponding to all or portion of the M.bovis DNA sequence coding for the protein or a polypeptide having the antigenicity of protein, or degenerate forms thereof.

13. A recombinant DNA molecule according to claim 12, containing a DNA sequence which codes for a protein having the amino acid sequence 1 to 163 shown in Figure 3 or for portions thereof having the antigenicity of l protein, or degenerate forms thereof. IL LI A L.Lx j. U F L .LJ..I .L ULIi, i. ±LIIl.I I n Y most soluble proteins by washing in 1% Nonidet P-40-1% deoxycholate in PBS. After the washed pEX C4a fusion ;W WO 89/09261 PCT/AU9/00143 -37-

14. A recombinant cloning vehicle or vector containing a DNA molecule as claimed in claim 12 or claim 13. A transformed host cell or organism capable of expressing the MPB-70 protein or a polypeptide having the antigenicity of MPB-70 protein.

16. A transformed host cell or organism according to claim 15, containing a DNA sequence which codes for a protein having the amino acid sequence 1 to 163 shown in Figure 3 or for portions thereof having the antigenicity of MPB-70 protein, or degenerate forms thereof.

17. Recombinant MPB-70 protein or a recombinant polypeptide having the antigenicity of MPB-70 protein.

18. Recombinant protein or polypeptide according to claim 17, having the amino acid sequence 1 to 163 shown in Figure 3 or portions thereof having the antigenicity of protein.

19. A process for preparing recombinant protein or polypeptide according to claim 17 or claim 18, wherein a transformed host cell or organism according to claim 15 or claim 16 is cultivated under suitable conditions and the exp:essed protein or polypeptide is recovered and purified. A method for the detection of MLbovis organisms in a sample, which comprises the step of contacting said sample with a DNA probe corresponding to all or a portion of the M,)boQi DNA sequence coding for the MPB-70 protein, and detecting hybridisation of said probe to indicate the presence of said organisms in said sample. L -F I- elucidation of the sequence of the MPB-70 gene. Figure 3 shows the DNA sequence and inferred protein sequence of the mature protein MPB-70. This protein is produced intracellularly with a signal sequence that is cleared from the mature molecule. WO 89/09261 PCT/AU89/00143 -38-

21. A test kit for the detection of M.bovis organisms in a sample, containing a DNA probe corresponding to all or a portion of the M.bovis DNA sequence coding for the protein. I o WO 89/09261 WO 8909261PCT/AU89/00143 1/3 0.20- 0.15- 0.10- 0.05- 5.-0 4.5 4. Volume Fig I I__SUTITUSHETJ water saturated ether. The nucleic acid was ethanol precipitated and resuspended in 25pl of water. Concentration of DNA and RNA in the extracts were measured i-i i -jlr WO 89/09261 PCT/AU89/00143 2/3 MW 3 1

97-- 66- 42 w 2 3 4 5 6 1 2 3 4 5 6 21 14 Fig. 2(a). 1 2 3 4 5 6 7 8 B Fig.2(b). Fig.4. SUBSTITUTE SHEET 21 61 121 61 181 81 24-1 101 301 121 361 111 421 161 4+81 DNA AND INFERRED AMINO ACID SEQUENCE G D L V G P G C A E YA A AN PT G P A GGCGATCTGGTGGGCCCGGGCTGCciCGGAATACGCGGCAGCCAATCCCACTGGGCCGGCC S VQ GM S QD P VA VA A SN N P E L TCGGTGCAGGGAATGTCGCAGGALCCGGTCGCGGTGGCGGCCTCGAACMATCCGGAGTTG TTL TAALSGQLN DGVNLVDT ACAACGCTGACGGCTGCACTGTCGGGCCAGCTCAATCCGCMAGTAAACCTGGTGGACACC L N S GQ YTV F A RT N AA F S K L P CTCAACAGCGGTCAGTACACGGTGTTCGC AC GGACCAACGCGGCATTTAGCAAGCTG CCG A ST I DE L K TN S SL L T S ILT Y H VV A GQT S PA N VV G T RQ0.T L Q. CACGTAGTGGCCGGCCMAACCAGCCCGGCCAACGTCGTCGGCACCCGTCAGACCCTCCAG G AS V T VTG Q G N S L K VG N AD V GGCGC CAGCGTGACGGTGAC CGGTCAGGGTMACAGC CT CMGGT C 66TAACGC CGACGTC V C G GVSTA NA T V YMI DS V LM GTCTGTGGTGGGGTGTCTAC CGC CAACGCGACGGTGTACATGATTGACAGCGTGCTMATG P PA CCTC CGGCGTMA 5ig.3 TJ r~Ul 1-41-4 ~4J 13. Patarroyo, Parra, Pinilla, C., delPortillo, Torres, Clavijo, Salazar, Jimenez, Instituto de Inmunologia, Hospital San Juan de Dios, Universidad Nacional de Colombia, Bogota, Columbia. (1986a) r i i. i i 1 ~i i~l INmERNATIONAL SEARCH REPORT International Application No. PCT/AU 89/00143 F SUBJCT MATER (if several classification symbols apply, indicate all) 6 I. CLASSIFICATION O According to International Patent Classification (IPC) or to both National Classification and IPC Int. Cl. 4 C12N 15/00, C07K 13/00, C12Q 1/68, G01N 33/53, CO7H 21/04, A61K 39/04 I. FIELDS SEARCHED Minimum Documentation Searched 7 Classification System I Classification Symbols IPC C07K 13/00, CO7H 21/04, A61K 39/04, S GO1N 33/53, 33/54, 33/56 with keyword bovi Documentation Searched other than Minimum Documentation to the Extent that such Documents are Included in the Fields Searched 8 AU IPC as above Chemical Abstracts, Keywords mycobacter, bovi III. DOCUMENS CONSIERE TO BE RELEVANT 9 Category* I Citation of Document, with indication, where appropriate, I Relevant to I of the relevant passages 12 CLaim No 13 P,X Infection and Immunity, Vol. 56, no. 4, pp 921-925, A.J. Radford <(1-21) et al. "Clcning of a Species-Specific Antigen of Mycobacterium bovis", (1988). X Vaccines 86 new approaches to immisation pp 219-224, (1-9) M.E. Patarroyo et al. "Immunogenic Synthetic Peptides against Mycobacterium tuberculosis," (Cold Spring Harbor Laboratory, 1986). X American Review of Respiratory Diseases, Vol. 129, pp 444-452, 9) M. Harboe and S. Nagai, "MPB70, a Unique Antigen of Mycobacterium bovis BOG", (1984). Y 10, 11) I CONTINUED Special categories of cited documents: 10 later document published after the international filing date or priority date document defining the general state of the and not in conflict with the application but art which is not considered to be of cited to understand the principle or theory particular relevance underlying the invention SE" earlier document but published on or document of particular relevance; the after the international filing date claimed invention cannot be considered novel L" document which may throw doubts on priority or cannot be considered to involve an claim(s) or which is cited to establish the inventive step publication date of another citation or document of particular relevance; the other special reason (as specified) claimed invention cannot be considered to *0 document referring to an oral disclosure, involve an inventive step when the document use, exhibition or other means is combined with one or more other such document published prior to the documents, such combination being obvious to international filing date but Later than a person skilled in the art. the priority date claimed document member of the same patent family IV. CERTIFICATION Date of the Actual Completion of the I Date of Mailing of this International International Search I Search Report I1 July 1989 (11.07.89)I J1 Ztl -7 z I)\ International Searching Authority I Signature or Aut rized fice Australan Patent Office IJ. ASMAN Form PCT/ISA/210 (second sheet) (January 1985) 19. Stanley, K.K. and Luzio, J.P. Construction of a new family of high efficiency bacterial expression vectors: identification of cDNA clones coding for human liver proteins. EMN_.J-. 2:1429-1434. International Appi ti on No. RT/AJ 89/O0l43b M n. wiiMir CONS==~ TO BE RMVA (MUM FROM4 7ME SM D M=) Category'. Citation of Document, with indication, where appropriate, IRelevant to I I of the relevant passages IClaim NoI I X I Y X Y X V PIx I Y X Y x Infection and Immunity, Vol. 39, no. 2, pp 540-545, K. Miura et aL. "Comparative Studies with Various Substrains of Mycobacterium bovis BCG on the Production of an Antigenic Protein, MPB70" (1953). Infection and Immunity, Vol. 52. no. 1, pp 293-302, N. Harboe et aL. "Properties of Proteins MPB64, MPB70, ano MPBBO of Mycobacterium bovis BCG" (1986). Infection and Immunity, Vol. 55, no. 12, pp 3213-3214, Z. Abou-Zeid et aL. 'Characterisation of the Secreted Antigens of Mycobacterium bovis OCG :comparison of the 46kd Dimeric Protein with Proteins MPS64 and MPa701 (1987). Journal of General Microbiology, Vol. 134, no. 9, pp 2599-2604, P.R. Wood et at. "Production and Characterisation of MonocLonaL Antibodies Specific for Mycobacterium bovis" (1988). Scandinavian JournaL of Immunology. Vol. 26, no. 4, pp445-.454, K. HasLov et aL. "BioLogicaL Activity in Sensitised Guinea Pigs of a Protein Specific for Some Strains of Mycobacterium bovis BCG' (198?). WO,A,87/05400 (CSIRO), 11 September 1987 (11.09.87); see claims I(1-4, 9) I(5-8, I(1-4, 9) I(9) I(10, 11) 9) I(7, 8, 1C I(1-6, 9) I(7, 8, 1( I(1-3, 0, 11) 0, 11) I Form PCT/ISA/210 (extra sheet) (January 1985)