AU628025B2 - Human mannose binding protein - Google Patents

Description

Corporate seirl THE CHILDREN'S MEDICAL CENTER if any

CORPORATION

Note: No legalization or other witness t required 4 PHILLIPS ORMONDE AND FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street.

Melbourne, Australia P1712183 flrr WORLD INTELLECTUAL PROPERTY ORGANIZATION A ~-AInternational Bureau INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)~ (51) Interpational Patent Classification 4: 1)ItrainlPbiainNme: W 9 11 C12N 15/00, 1/20,1/14(1)IerainlPbiainNm r: W 8/059 C12N 5/00, C12P 21/02 Al A61K 37/02, 39/395, G01N 33/5619 (43) International Publication Date: 23 February 1989 (23102.89) I(C12P 21:00, C12R 1:91) (21) International Application Number: PCT/US88/02591 (81) Designated States; AT (European patent), AU, BE (European paet), CH (European-patent), DE (Euro- (22) International Filing Date: 5 August 1988 (05,0,88) pean patn) DK, FT. FR, (European patent), GB (European patent), IT (European patent), JP, KR, LU (31)Prioity ppliatio Numer;(European. patent), ML (European patent), NO, SE (31 Proriy Apliatin Nmbe;Q87,628 (European patent).

(312) Priority, Date: 20 August 1987 (20,08,87) Published (33) Priority, Countrv: us Withu international search report, 1or amending the SECTION 3 4 DIRECTION SEE FOLIO-- 20 __enofhreet (71) ME DIRECT 1 ~onA 14 1989 (721).v~3~ Beacon, Street, Boston, MA 02116 L4 (74) Agents: LEVINSON, Lawrence, S, et al.: Squibb Cor- N ?18 poration, P.O. Box, 4000, Princeton, Nj.'08543.4000

(US),

6 280 25 (54)Title; HUMIANN MANNOSE BINDING PROTEIN A~aAaplnCysiu.Iuly §rpThrLylh,e4ilal I igjo-yAr. Cro.3 c u V41 Sole Tip oil oir A p' "all to~ Ala to lilt 041II tea Tr Ala a h j tle a r. §A It trlp A14 Tr.Ori.CB Ayl li Ot i Aso Poo At$ y.At.hrVe.A, This inventi provIdei luclidc atfd crgrncec to produte 0ppldos rotatod, to hurnan mia"nnos bindin pQotol.

Those poptil* tire used In diagnosis and trcatment Of( isAC&s Dated IS 'DoV 19 Cm) S~waIUN(I)of ICIDKEN' S ,MEDICA qVCEl CO" QRTION (SEAL)

Q

To: The Commissioner of Patents .art 9 !W~in 3 4b, V.cel President PHILLIPS ORMON'DE FITZPATRICK Patent and Tradk Mark Attorneys Melbourne, Australia W89/01519 PC/S8/29 HUMAN MANNOSE BINDING PROTEIN Background of the Invention This invention relates to proteins able to bind mannose.

Mannose-binding proteins (MBPs) hjave been isolated. from rabbit, rat, and human liver, Taylor et al+ clinical Science 70,-539, 1986, MBPs have also been found in serum, and may play a role in the disposal of piathogenic organisis rd, Summer4 Iield et al., Bioc. Bip Acta 883:,197, 1986 describe two types of Mu Is in. human serum., These were detected using antibodies raised against a 30 kDa subunit of one The authors suggest that MBPs may bind noxious glycoproteins in the, c .rculation prior to the removal of these g2.ycoproteins; and that yeasts, and bacteria contain glycoproteins which and, are bound by M'BPs.

Stahl et al, Biol. Cell 51,#215, 1984 describe a mannose receptor,, which is distinct from MBPs, These two proteins appear to be stru ,cturally related since anatibodies to one protein, may react with the other pratnn Wild et 'al, Biochemn. 3. 2101167, 1903 describe the i.~olation of MBP from human and rat liver'., The human MBP has a Molecular weight greater than orwi il1ion, rnd consists of 28 lcDa, an(, J0.5 )cfla oubunitcs WO89/01519 PCT/US88/02591 -2- Drickamer et al. J. Biol. Chem. 261:6878, 1986 descrLbe the isolation of MBPs from rat liver, and the cloning of cDNAs encoding these proteins. Each MBP has a cysteine rich region, a collagen-like domain and a carbohydrate binding domain.

Summary of Invention In one aspect, the invention features engineered nucleic acid encoding for at least about 20 contiguous amino acids of human mannose-binding protein, or having at least about or 90 bases able to hybridize under hybridizing conditions to nucleic acid encoding human mannose-binding protein. By engineered nucleic acid is meant nucleic acid removed from its natural environment by recombinant DNA methodology, or synthetic nucleic acid, or cDNA, This nucleic acid may be a fragment of DNA or RNA, it may be present in a vector system, or it may be within the genome of an organism.

The other aspects, the invention features Vectors, and expression vectors or cells containing these vectors, each vector having the engineered nucleic acid, and the invention features peptides expressed from these vectors or cells, By peptide is meant a chain of two or more amino acids, including proteins and polypeptides.

These peptides, and antibodies to these peptides, may be used as therapeutic or diagnostic agents.

In preferred embodiments, the nucleic acid encodes for a peptide having a greater than homology to a fragment of at least thirty amino acids of human mannose-binding protein; most 8 sUBa ir, 7T SHET -4 7'~ WO 89/01519 PCr[US88/02591 -3preferably the nucleic acid encodes for human mannose-binding protein. In other preferred embodiments the nucleic acid is cDNA; the hybridizing conditions are at 42 0 C in 5 x SSC, with washing at 68 0 0 in 0.1 x SSC; and the nucleic acid encodes a carbohydrate binding region. Most preferably the region has at least about 60 bases from region 309-714, shown in Fig. 1; the nucleic acid is ligated to nucleic acid encoding the toxic part of a toxin molecule, most preferably the toxin molecule is chosen from AZT, ricin, or cholera toxin; the cell is a virus, bacterium, fungus,, or eucaryotic cell; the viru~s Is vaccinia, the bacterium is Escherichia coli, the fungus is yeast, and the eucaryotic cel~l is a cultered, cell line, In a related, aspect, the invention features a fragment of at least. about 60 contiguous bases of' the. nucleic acid encoding human mannose binding protein. deposited in the- ATCC as strain number 67483.

In another aspect, the invention feat'res a method for treating animals infected with a bacterium, fungus, or virms The method entails 2$ providiLng, a peptide able to bind, the mannooe units Qon these orqanisis* The peptide is able. to c ause host defensive cello to be attracted to the organisms., The Method further entails administering the peptide to the animal.

in preferred Ombodiments, the Peptide is a fragment of human mannose bindin~g protein able to bind a carbohydrate; this peptide is able to disable the bacteriume fUngi~st or Virus, and is 4a Peptide as described, above, Most pre~erably, the WO 89/01519 PCT/US88102591 -4animal is human; the infection results in a bacteremia or local bacterial infection, parasitic infection, or fungal colonization, and the route of administration is either intravenous, intramuscular, oral, or local, in the form of a powder, or lotion; or the virus is HIV or a related virus, and the peptide lowers the rate of infection of eucaryotic cells by the virus; the protein or peptide is the mannose binding protein provided at 1-500 pg/ml final concentration in human serum or tissue.

In another aspect, the invention features a method for diagnosing patients susceptible to invention by viruses, bacteria, parasites or fungi, the method features detecting the serum level of mannose-binding proteins in an animal, Wherein this level reflects the susceptibility of the animal to an infection.

Preferably, the sethod features detecting reaction of an antibody to the above Peptides with the serum, most preferably the detecting coprises an ELISA test.

Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.

Description of the Preferred Embodiments The drawings will first, briefly be described.

DUSTTUTs SH WO 89/01519 PCr/US88/02591 Fig. 1 is a restriction endonuclease map of the MBP-human cDNA insert in, pMBP.

Fig. 2 is a representation of the cDNA sequence and corresponding amino acid sequence of MBP human.

Fig. 3 ;is a representation of the genomic DNA, and corresponding amino acid sequences in all three reading fram~es of human MBP.

Fig. 4 is a- diagram of a proposed model of

MBP.

Fig. 5 is a comparison of the amino acid sequences of 1B?-human, with. other lectins; invariant regions are shown on the top linet and galactose and mannQse-specifiQ regions on the lower lines, Hluman Mannose-binding protein (MBP-human) MBP-human is a soluble. lecti-le I oecl which is synthesized in hepatocytes and released into the bloodstream, Generally, MBP~humao is able to, bi'-nd carbohydrates, such as mannose, at its carbohydrate binding domain. MBP-human. can be isolated generally as described by Wild et. al.,, supra, and Drickamer et al, supraf for example, by passage down a, mannose-sepharose column, The general structure of I MP-hunan is shown in Pig. 4. The a~in-terminal. end. 10 is cysteine rich, consistent with mltimer formation by, intorchain 4isulfide bridges. Next to this is a collagen-like Segient 12 having a repeated pattetn of Gly-X-Y (Gly represents 41yci.ne; X and. Y are other amino acidS), Similar to those of non-filbrillar co~lagen, genes, Finally, there. is a, $T~WT(s +7 WO 89/01519 PCT/US88/02591 -6carboxy-terminal carbohydrate recognition domain 14. The mannose-binding domain is within the region.

Nucleic acid, for example, DNA, encoding MBP-human can be isolated by standard techniques, For example, oligonucleotide probes specific for the nucleic acid may be constructed and used to probe either genomic or cDNA libraries, as described by Drickamer et al., supra, Altenatively, gene fragments from related genes can be used as probes. Preferably, the probe is homologous to a region of the carbohydrate binding domain of MBP-human. The clones isolated by this technique contain engineered nucleic acid. Once isolated, the gene encoding MBP-human is useful for producing recombinant MBP-human protein, or peptide fragments thereof. In addition, the nucleic acid can be modified by standard techniques in order to express modified peptides.

Examples of cloning MBP-Human encoding nucleic acid are given below. These examples are not limiting to the invention and one skilled in the art will recognize that there are many equivalent means for accomplishing similar results.

Example 1: cDNA clones A human liver cDNA library was constructed in pKT218 by standard technique as described by Woods et al. 79 Proc. Natl.Acad. Sci. USA. 5661, 1982. This library was probed using 4 gel purified radiolabelled rat MBP-C cDNA sequence digested with XhoI and EcoRI as described by Drickamer et al, supra. This probe was used suh3T .AJEr WO 89/01519 PCT/US88/02591 -7under non-stringent conditions to identify potentially useful clones. The filters w~ire prehybridized for 1 hour at 42 0 C in 0.75 M NaICl, sodium, phosphate, pfl7,4, 5mM EDTA, Dehardts solution and 0.10% SDS (5 x SSC), and then hybridized overnight at 42 0 C, The filters were washed at 45 0 C in 2xSSC for 30 minutes and then in lxSSC for 30 minuteN n addition a XHEPG2 gtl. cDNA library plated~ in E. coliC600 was screened, as described by K(wiatkowski et al, 323 Nature 455, 1986.

Five clones, including ppMp, were isolated and their sequences determined by the method of Sanger et, (74 Proc. Natl. Acad. Sci. USA 5463,, 1s 1.977) using M1.3# Mpl8 cl~oning vectors (Mess-Ing et, al.. Proc., Nat, Acad. ScL_ USA 74t3642, 1977).

This sequ~ence is shown in Fig 1 2. The restriction map of'pMflP is shown in Fig. 1, it has a 3.6Wb EcoRI insert isolated from the above X~ gt l0 library.

Example 2: Genomic clone The 650 bp carboxy terminal Pst-1. fraqment (F'ig. 1) of a MBP-huxnan cDNA clone was, Used as a probe for human qenoniC library, This library war.

contructed by standard techniques in EMBL~ 3A by inserting Mb].-digested genoinic- DNA, into the BamfT S ito Clones which hybridized under stringent conditions Wore Isolated, Specifically, the hybridization Was performed As described above, except the wash conditions were at 680C in 0,1xssc.

WO 89/01519 PCTJUS88/02591 -8- The positively identified clones were plaque purified and their nucleic acid sequence determined as above. This sequence is presented in Fig. 3.

Other related genes can be isolated by this procedure. For example, the embrane receptor protein of macrophages is similar to MBP-human in that its DNA hybridizes under less stringent conditions (using the above hybridization buffer at 37 0 C) to MBP-human probes, and a peptide of similar size to MBP-human is immunoprecipitated with antisera to MBP-human.

Expression of MB-human peptide fragments is by standard procedure, For example, the desired I$ region of the MBP-human encoding DNA, preferably the cDNA, can be isolated from one of the above-described clones and inserted into any one of several standard expression vectors. A preferred region for expression is that encoding the carbohydrate binding domain, most preferably the mannose binding domain. This region is between nucleotide bases 359-807 in Fig. I, including a 350bp Pst1-Xba fragment. To identify the desired region more specifically the sequence is compared to that in related proteins such as human mannose receptor. Comparison to rat A and G MBPs reveals most homology between other mannose binding proteins at the region equivalent to the coagetn regiont at nucleotide bases 287-359 (Fig, This region it not usaful in the invention '9 U 7Q 7 Cd I ET: L WO89/01519 PCT/US88/02591 -9since it; is not involved with mannose binding.

Rather, the region from 359-807 in Fig. 1 is most useful.

In order to show that any particular region of MBP-human does bind mannose the CDNA encoding it can be engineered by standard procedures to produce clones containing just this region, The resulting cloned DNA is then inserted into an expression vector, The peptide produced by such a vector is then passed through a mannose-sepharose column to see whether it will bind to mannose.

Alternatively, a radioimmunoassay can be performed to see if radiolabelled mannose will react with the expressed peptide. Those peptides which bind mananose are useful in this invention.

It is unlikely that a single short linear region of amino acids of the MBP-human peptide is involved in binding to mannose, rather two or more such regions will probably cooperate to form a three-dimensional peptide configuration which can interact with, and bind, mannose, Such regions can be identified by compasaon to other mannosebinding proteins as described above, and the DNA fragment encoding all such regions cloned and expressed such a D$A fragment is likely to be at least 60-90 base pairs in length, encoding at least about 20-30 amino acids, Referring to Fig. 5, such a cQmparison was parformed by comparing other lectins, with mannose 3o or other sugar binding specilities, to MP-human.

The lower line of the figure abows a concensus for mannose binding proteins, the amino acids on this ~1~7 WO 89/01519 PCTIUS88/02591 line and in the upper line (showning invarianL amino acids) are the most important for binding to mannose. These results were obtained by comparison of MIBP-human to lectin proteins including the human and rat hepatic asialoglycoprotein receptors (Drickamer, 1987, Structure and biosynthesis of membrane receptors which mediate endocytosis of glycproteins, Kidney International, in press), the avian heptic receptor (Dricamer, 3987 supra), the apoprotein of dog (Benson et a1,, Proc. Natl, Acad, Sci, USA 82;6379, 1985) and human surfactant (White et Nature 317;361, 3985),; the N 2 portion of a glalctose specific 3eqtin isolated from the hemolymph of S. periginia (Takahashi et al,, J. Biol. Chem. 260;1222$, 1985); a, 1ectin isolated from the coelomic fluid. of a sea urchin A. crassispina (QOia et 41,1 1, Biol. Chem. 1; 6197, 1987); 4 chicken cartilage cQre proteoglycan 2Q protein (Shigaku et Proc Natl. A S USA 83:508Q1,986) and the IgE Fc receptor (IIuta Ot Proc. Natl., Acad, Sci. USA 84t819, 1987), The above described maInQe binding peptidet or the entire recombinant protein, s useftul for 2$ specificall1y targeting cells expressing mnose on their surfac,e~g., bacteria, fungi, and Viruses.~ Thus, by linking this peptide to Molecules able to kill or inhibit growth of such cells a hybrid peptide ot great theraputic use cAn be .constructed. For example, the toxic part of rici and chol.era tQxin or chemicals such 4z AZT can be 14 ad to this paptide. In order to do WO 89/01519 PCT/US88/02591 this, the nucleic acid encoding such toxins can be ligated to the mannose binding peptide-encoding nucleic acid and expressed as a single entity to form a hybrid peptide, for example, as described by Murphy U.S. Patent 4,675,382, hereby incorporated by reference, Alternatively, the two peptides can be synthesized separately and linked chemically, for example, as described by Ross U,S, Patent 4,275,000, hereby incorporated by reference, Expression vectors suitable for peptide expression include all standard bacterial pKK233-2, Amann et al, Gene in press, sold by Pharmacia, 800 Centennial Avenue, Piscataway, NJ 08854), yeast, and viral expression vectors, as well as eucaryotic vectors. Those skilled in the art will realize that such vectors generally are suitable for expressing the protein and the example below is not limiting to this invention, The full length or partial cDNA MBP clone, with or without toxin peptide-encoding nucleic acid, can be ligated into the vector psV2neo (Southern et al. J. Mol.-g A Genet, 1:327 (1982) and Cloning Vectors, A Laboratory manual Ed, Pouwels et al, Elsevie Science Pub. NY, 52 Vanderbilt Avenue, NY, NY 10017, 1985) which contains an origin of replication from pBR322 and an ampicillin resistance gone. It also contains sequences to provide a transcriptional promoter and a polyadenylation sequence. The DNA is inserted between thesr two sequences. After ligation the recombinant vector 4s propagated in WO 89/01519 PC7IJS88/02591 -12- Escherichia coli and then introduced into Chinese hamster ovary cells using a standard calcium, phosphate transfection protocol. The neo, gene on this vector provides resistance to G41.8, which can be Used to select for transformed cells.

Expression of mannose binding peptides by these vectors and organisms can be followed Using a sepharpse-mannose. column, Expressed material is bound to the column, eluted with 50mm4 Tris9/lOmM EDTAI and run, in 8% polyacrylamide gels (using Laemmli bufI~qrst Nature 227:600P 1970) to observe the presence of peptides, Those clones which produce mannose-binding peptides, peptides which bind to such. a colun, are suitable in this invention, Antibodies to such expressed peptidps or to MBP-huma4 itself' can be produced by standard techniques. They may be monoclonal or polyclona].

and are Useful for identification of the peptides within, animal serum or in clinical, diagnostic tests, Use Exposed niannose is a feature of the cell1 Walls of many pathogens, whereas higher organisms, including humans and aniimals, tend to have processed membrane gIlycoptoteins having complex sugars which mos1k internal Mannose residues., These. internal mannose residues are not :recognized, by "vPa, Iaecombinarit mannose binding protein, or ohimeric peptides containing the mannoze binding domain, Aae useful therapeutic agents. The proteins or peptidea apacifically bind 3M~T WO 89/01519 Pc1/US88/02591 -13mannose-rich pathogens, incl.uding bacteria, fungi,, yeasts, parasites, or the envelope glycoproteins of certain viruses, and thus direct removal of such pathogens from the animal.

For non-viral pathogens, efficacy of removal.

by host defense mechanisms may be increased by directing attachment of the mannose binding protein complex tQ the surface of phagocyte cells, thereby enhancing the clearance of the pathogens from the irculation, by causinthpagces o recognlze these pathogens, For Viruses, which express mannose-rich glycoproteins, direct inactivation of the Virus and Viral infected cells is, enhanced by attaching 1$ toxins, sUcph as ricin, cholera, or diptheria or antimetabolite drugs, sucOh, 4s AZTf to the znannose binding9 domaip of the mannose binding protein, For example, the 350bp Pstl-XbaI fragmnent Shown in iig 1, comprising the carboXy-'terminal maranose binding domain of M-huxnan ran be, eXpregssed in an expression vector, and the peptide produced linked chemically to nUclootide such as dideoxycytooine or AZT, As shown below, fluoreacencely labelled such peptides do not bind to cells unintected with fly, the Virus thought- to cau4se Acquired Immunodeficiency Syndrome (AIDS.) but do bind to infected cells, The resulting product should be particularly effective, in spdc4.fiCally targeting drug-like molecules to HIV 3 0 or. HMI-iofected cells, Example 3: HIV targeting ?'1P-human was shown to be effective in vivo for preventing infection of H9 CD4~ cells with MYv Puri fied lXV' was incubated in the presence SUBSTITUTE SHART ProtE~s sR-mTr-4a-e4U P heTriCSULys.Lys4T1y4WVaA&- Erait Arg I'rpoi (57) Abstract This invention provides nucleic, acid engineered to produce, peptides related to human mannose- binding protein' These peptides are used in diagnosis and treatment of diseases., WO 89/01519 PCIUS88/02591 -14or absence of highly purified homogenous MBP-human (prepared as described, by Summerfield et al, Biochimica et Biop. Acta 883;197, 1986; Wild et al,, Biochem.. J. 210:-167,j 1983; Townsend et al.,, Biochem. J. 194:209, 1981; and Kawasaki et al., J. Biochem. 94:937, 1983), The treated, virus. was then incubated with. H9 CD4 lymphocytes (which are primary targets for HIV infection) and 7 days later viral infectivity was measured by a) the appearance of HIV envelope gJlycoprotein (which was assayed on the cell. surface by immUnofluorescence using specific antaienvelope glycoprotein antisera) and b) the presence. of reverse transcriptase activity' (which is present only- when the cell, is infected with HIV). MBP-human completely inhibited viral, entry, into cells, This was shown by the absence of HIV envelope glycoprotein QA the cell, surfae and by indectectable reverse transcriptase aqtivity, Control experiments showed that the inhibition by, M$-human was' specific; these experiments involved, completing MBP-humtan, with mannose rich yeast mannan, and o-qjyooproteini mannoself, In experiments using fluorescently-labelled 2$ MP-human to observe binding to infected or uninfeCted cells,, the 4lUorescently labelled.

MBP-human was used to show that mannan and Mannose-BSA inhibits the binding of, M-human to Virally infected cells, and that M-humon does not bind uninfected 119 cells. Thus M-human is recognizing oxposed mainnose units on these cell.

Thus, MBPt-huxan or the marinosd binding domain thereof are suitable for~ identifying cells.

infected with HIV, or related viruses Which, suBSTtT 6- S -1 L greater than on i9 dillion and consists of 28 kDa.

and-r-0. 5 kDa subunits.

a U aST 2- Ba T WO 8901519PCrT/US8/02591 express mannose rich envelope glycoproteins on their cell surface, The MBP-human, th16 mannose binding domain or chimeric molecules thereof can be used to target cytotoxic agents to directly and specifically kill infected cells. Further, these molecules can be used to prevent the spread. of viral infection, and even the initial infection itself.

NBP-human and rel~ated peptides as described above may be administered by routine, methods. For example, they can be injected directly into the blood, stream, of an animal, especially humans, tQ a level of between l-SO0pg/m). serum (Most preferably, l5Ojig/mJ. final concentration, and 1$ dose repeated to maintain this level,~ They can be administered prophylaticaly or after Infection, Similarly, the molecules may be administered orally, injected subcutaneous1Y, or even applied in powder or lotion form, for example, to treat local infectiopns, such as bpfcterial infection, or in feqtion With Trichoehyton rubrun, which cau~ses Athloets foot.

Mnother Use of thes etdes is in- the determination of an animal's ssceptibility to 2$ infection by agents such As HIV., gere, the serum level of NBPS in the animnal is measured using, Antibodies Produced to MBtP-hulman, or related peptidesi in for exam~ple, an ELXSA protocol. The level, of, MBPs in the serum can then be related to the susceptibil.ity~ to inftction of this animal to An agent, and this relationuhip used to estimate other animals' susceptibility. Thus, for excample at high level of MBP.hftan is lnied to, low -Susceptibility to infection by HZVI then A human.

acids of human mannose-bdiding protein; most 1 WO 89/01519 PCTJS88/02591 -16having a low level of MBP-human is likely to be susceptible to HIV infection. Further, at the genomic level, such susceptibility may be related to defects in the nucleic acid. Such defects can be discovered using the cloned MBP-human genes, or fragments thereof, as probes. Polymorphisms linked to HIV susceptibility can be detected and used to predict susceptibility of other humans to infection.

Deposits The following deposit was made on August 4, 1987, with the American Type Culture Collection (ATCC), where the deposit was given the accession number ATCC 67483.

Applicants' assignee, Children's Medical Center Corporation, represents that the ATCC is a depository affording permanence of the deposit and ready accessibility thereto by the public if a patent is granted. All restrictions on the availability to the public of the material so deposited will be irrevocably removed upon the granting of a patent, The material will be available during the pendency of the patent application to one determined by the commissioner to be entitled thereto under 37 CFR L ,14 and 35 USC 122. The deposited material will be maintained with all the care necessary to keep it viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposited microorganism, and in any case, for a period of at least thirty years after the date of deposit or for the enforceable life of the patent, whichever period ~sUB71 A L ;12 1 alsaD.Le tne bacterium, fungus, or virus, and is a peptide as described above. Most preferably, the

I

~Cgrs.

i i. .ii-ii~ii. i. i. i liriii_ /_~i~ii~il IC( i-ti_-_iilli WO 89/01519 PCr/US88/02591 -17is longer. Applicants' assignee acknowledges its duty to replace the deposit should the depository be unable to furnish a sample when requested due to the condition of the deposit.

Other embodiments are within the following claims.

SUBstoUn 72I

Claims (29)

1. Engineered nucleic acid encoding for at least contiguous amino acids of human mannose-binding protein.

2. Engineered nucleic acid comprising at least 60 bases able to hybridize under hybridizing conditions to nucleic acid encoding human mannose-binding protein with the proviso that said engineered nucleic acid is not a rat mannose-binding protein cDNA construct.

3. A nucleic acid of claim 1 or 2 wherein said nucleic acid encodes a peptide having greater than 75% homology to a fragment of at least thirty amino acids of said human mannose-binding protein,

4. A nucleic acid of claim 2 wherein said nucleic acid ii encodes said human mannose-binding protein. 5:*2 A nucleic acid of claim 4 wherein said nucleic acid is cDNA. S6. A nucleic acid of claim 2 wherein said nucleic acid comprises at least 90 bases able to hybridize under e2 hybridizing conditions to human nucleic acid encoding mannose-binding protein,

7. A nucleic acid of claim 2 wherein said hybridizing conditions comprise 42 0 C in 5 x SSC, with washing at 68 0 C in 0.1. x SSC

8. A nucleic acid fragment of at least 60 contiguous bases of the nucleic acid encoding human mannose binding protein deposited in the ATCC as strain number 67483. 39 18 r o digested with Xhol and EcoRI as described by Drickamer et al., supra. This probe was used 19

9. A nucleic acid of claim 6 wherein said nucleic acid encodes a carbohydrate binding region. A nucleic acid of claim 9 wherein said region comprises at least 60 bases from region 359-807 shown in Fig. 1.

11. A nucleic acid of claim 10 wherein said nucleic acid is ligated to nucleic acid encoding the toxic part of a toxin molecule.

12. A nucleic acid of claim 11 wherein said toxin molecule is chosen from AZT, ricin, or cholera toxin.

13. A vector or an expression vector comprising the nucleic acid of claims 1, 2, 8, 9, 10, 11, or 12.

14. A peptide encoded by the nucleic acid of claim 1, 2, 8, 9, 10, 11, or 12.

15. A cell or virus comprising the nucleic acid of claim 1, 2, 8, 9, 10, 11, or 12.

16. A cell or virus comprising the peptide of claim 14,

17. A cell of claim 15 wherein said cell is bacterium, fungus, or eucaryotic cell, 20 18. A cell of claim 17 wherein said bacterium is S" Escherichia ,coli said fungus is yeast, and said eucaryotic cell is a cultured cell line.

19. A virus of claim 15 or 16 wherein said virus is :o vaccinia. 25 20. A therapeutic agent comprising the peptide of claim 14.

21. A method for treating animals infected with a bacterium, a fungus, or a virus, said method comprising administering to said animal a peptide able to bind to mannose.

22. A method of claim 21 wherein said peptide comprises a fragment of human mannose binding protein able to bind a carbohydrate,

23. A method of claim 22 wherein said peptide inhibits growth or infection of said bacterium, fungus, or virus,

24. A method for treating animals infected with a bacterium, a fungus, or a virus, said method comprising administering to said animal a peptide of claim 14. "S 25. A method of claim 21 wherein said animal is human. u Sy JM 20

26. A method of claim 25 wherein said peptide is administered by application of a powder comprising said peptide to the foot of said human.

27. A method of claim 24 wherein said virus is HIV and said peptide lowers the rate of infection of eucaryotic cells by said virus.

28. A method of claim 25 wherein said administration is local, intravenous, intramuscular or oral.

29. Antibodies binding to the peptide of claim 14.

30. A method for diagnosing susceptibility to infection by viruses, bacteria, or fungi, said method comprising detecting the serum level of mannose-binding proteins.

31. A method of claim 30 wherein said detecting comprises detecting reaction of an antibody of claim 15 with said serum.

32. A method of claim 31, wherein said detecting comprises of ELISA test,

33. A method of claim 27 wherein said peptide is mannose- binding protein provided at 1-500pg/ml final serum 20 concentration in said human

34. A nucleic acid of claim 1 or claim 2 substantially as hereinbefore described with raference to any one of the examples. A method of claim 21 substantially as hereinbefore :25 described with reference to any one of the examples.

36. A method of claim 30 substantially as hereinbefore described with reference to any one of the examples, rDATED: 23 Octoberf 1991 THE CHILDREN'S MEDICAL CENTER CORPORATXION By their Patent Attorneys: PHIL:IPS ORMONDE FITZPATRICK i L ~U~T7U7~: C~A ~T WO 89/01519 PCT/1JS88/02591 'A A0 AC 0 IOUIH 31OUIN 1309 H3*S9, IS U -I-a'T E HI ET -11 WO 89i015fl? PCr[US88/02591 gct cgg taa ata tgt ttc att ttt ctc aca cca agg gag act CTT CTC CIG ACT ATG GTG GCA Leu Lou Leu Ser Met Val Ala FIG, 2 aac tga gat taa cct tcc ctg agt ATG TCC TGT TTC ATC ACT CCC TCT Met Ser Cys Phe le Thr Pro Ser GCG TCT TAC TCA FG~ ACT GTG AC Ala Ser Tyr Ser Lq Thr Val, Thr 180 TGC CCT QCA GTC ATT GCC TGT AGC Cys Pro Ala Val. Ile~ Ala Cys Ser 225 CCA GGC AAA GAT GGG CGT, GAT GGC Pro Glty Lys Asp G:ly Arg Asp, Gly 270 GAG GGT Glu Gly CCAYGGC PrQ Gly GCC CAA AAG ACC Ala Gin, Lys Thr ATC: AAC GGC' TTC Ile Asn Gly Phe ACC MAG OCT AGA AAA GGG GGA ACA GGT CAA GGG CTC: AGA GCC Thr Lys Gly Arg, Lys Gly Gly Thr Cly Ginv Cly ILeu Arg GIly CAG GGC CCC CCT GGA, AAG TTG GGG CCT CCA GGA AAT CCA GGC Cmn Gly Pro Pro G:Ly Lys Leo, Gly Pr Pro Gly Asn Pro Cly TCT GGG TCA COA GGA CCA. AG GOC CMA AMA GGA GAC CCT GGAI Ser Gly Ser Pro Gly Pro Lys Gly Gin Lys G],y Asp Pro Cly ACT CCC GAT GGT QAT ACT AGC CCA GGO TGC CTC AGA MG AMA $er Pro Asp Gly Asp Ser Ser Pro Gly Cys Leu Arg Lys Lys TCT GCA MAC AGA AW GGC ACq TAT CAA MG TGC CTG ACC TTC Ser Ala~ Asmk Arg Asi4 Gly Thr Tyr Gln Lys Cys Leu Thr Phe CTG CCC AMA CAA GTT GGG AAC MG TTC TTC CTG ACC MAT OCT Lou Cly Lys Gln. Val Gly Asn Lys Phe Phe Lou Thr Asn Gly ATA ATG ACC TTT CAA AAA GTO MCG CCC TTG TGT GTC MAG TTC Ile t Thr Ph Glu Ly's Val, Lys Ala Lou~ Cys V al L~ys Ph OCT OTa TOG CCA CCC CCA GGA ATO GOT GCA GAG M.T CGA COG Pro Lo~u Trp P'ro Pro Pro G2ly feat Ala Ala Glu Asn Gly Ala CAG MAT CTC ATC MAG GAG CMA OCC TTC CTG CCC ATG CCT GAT Qln Asn Lou Ile Lys Glu. Glu Ala Ph. Lou Gly Me Proi Asp AAQ ACA GMA 000 GAG TTT GTG GAT CTG ACA GCA MT AGA CTG Lys 'Thr Glu C].y Glrn Phe Val Asp Lau~ Thir Gly Asrx Arg Leu TAO ACA MOC TCQ MGC GAG GGT GMA COG MAC MT GCT GGT TOT Tyr Thw Agn, rp Asn (Glu Gly Glu Pro Asrn As Ala Gly Sor GMA CAT TGT OTA TTG CTA CTO MAA MAT G CAG TG(G MT GAC l Hi Oys Val1 Leu Leu Lou Ly Asri Gly Gln Tirp Ann Asp TTA Leui 31.5 CCT Pro r360 A Lys 405 AGO Ser 450 TOT Ser 495 GMA Giuf 540 CAC Gin 585 ATT Ile 630 GAG 675 ACC Thr 720 GAT Asp TCC GOT TG TTC CAC CTC CCA TOT Pro Cys Pho i ULe ProS~ ata c4a, 44',. tac tca~ Cct t4c 810 OCC OTO TGT GAG TTO CCT ATO t iia Ala al Cs Gu Ph ProIle855 a4a get tat gt tgA g 4 44 S4t nag 4Et4 a$4 C88 cat tta tt t At8 Ace ACA gt~t too to Coe 4gc ~tta 4gA AAA tc tan ct 993 4 .6 .L&A WO 89/01519 PCT/US8/02591 3/9 FIG, 3 20 30 4P006 CGCCAGAAAOTAGIAGAGGTATTTAGCACTCTGCCAGGGCCAACGTAOTAAGAAATTTCCA Arg~l nLyVal 01 uArgTyrL~uAl aLeuCysGI rnG1 yG.1 ngrSerLyLyPh.Prc At aArgLysEndArgGl y II End~iusSrAlaA-gAlaAsnVal Val ArgAgnPh*Gl ProG1 uSerArg~l uVal PheSerThrL,.k~i-Gl yPrcThrEndEnd01 u I 1 wSwrA so ?0 100 110 120 GAGAAAATGCrTACCCAGGCAAGCCTGT GTAAAACACCAAGGGGAAGCAAACTCCAGTTA GI uLy.PletLwuThrGl nAl &SerLwuCysLysThrPrcArgGl YSerLyu.nLeu nArgLysCysLeuPrcArgGl nAI aCysV&l LysHi 0 s~l ~yGl uAl aAsrnSerS~rEn rgGl uA~nAl aTyrPi-oGi yLysPioVal ErndAsnThriys01 yLysQ1 nThrPrcVsl A 130 140 ISO0 10 170 190 ATTCTOGGCTGGGTTGGTGACTAAGGTTGAGGTTGATCT0AGGTTGAGACCTTCCTC-TTT lI oeuGi yTrpVal 01yAspEndOl yEnc9Gl yEndSor01 uValQ01ujhrPhqLsuPg,. dPheTrpAl a~lyLeuVal Thri.y.Val 01uVal AspLuArg.uArgProSerS~rL.. wnSer01yLeu01yTrpgndLuuArgL~uArgL..oulluEnd01 yEndAspLeuProL.uT 190 200 210 220 230 240 CGATCACCAGCTTTCAGCTCAGCGCCTGCCAATGTTTAAAT0ATAGTTAACAGGTCCT 01 ySerProAl aPh*S~rSrol yPrcA4.aAsnGl uPhs1.YsEnd~ndLeuThro1 yPro uAspHt s~l n~euSerAl aGI nql yLeuPraMtS~rL..uAnAPSvrEndGI riVal Lo epI*h~rh~ LurA ~~l~d~.6Mt1 VlAnr~r 28.10 ".10 270 290 29~0 300 GGAGGGAATCACTOCpAATCAAAGATG0ATTCAGTGGCA0AT0ACCAAG 0I1 y1 luSorAl aAl a~l n~l eLysAspOl Y1 1.01 riVal Al aA~p01 yPro~l uGiu UGl uLP1yAsml n~uuProArgSarLysMotGl yPh.AegTrpOl nMotAspProLy.Ar rpArg~lyU eS~rCyuiProAopOinArgTrpAspSor01y0l yArgTrpmhrArqArgG 310 320 330 :340 330 340 GACATGOA0AGAAA0AGGAA0AGQAAGCTCCTACA0ACACCTOGGTTTCCACTCATTCTC AsphqtO1 uArgLysArg~ysArgLysLou~euGl nThrPeaGl yPhoProLoull.Leu gThrTrpArg~l uArq~l yArg~l ysorSorTyrArg~i sLwu~l yPhsHi sSorlti.S* I yH4 .01 yOI uLysOl uGi uGI uGi uAl aProThrAspThrTrp Val SerThrHi %SprH, 370 3w0 390 400 410 4-o ATTCCCTAAGCTAACA00CATAAGCCA0CT0OCAAT0CAC00TCCCATTT0TTCTCACTO Ii I Praln*Ai aA~nArgHi .&.ysProA1 A01 yAsnAl aArgS.,'Ni sLouPho*MLou rPhoPrcLyzLuThr~l yIlue 1 rilLcuAl aMetHi .02 yProl 21 CysSsrHi sCY I .SorLwuSr~ndGlnAl aknc1A1 a5rTrpOI nCysThr~al ProPho*al.*uThrA 430 440 4505 460 470 400 CCAC00AAA0CATGTTTATAGTCTTCCAT0TTTATA0TCTTCCAGCACAACCAGGTQ PrqArqLyAl aCysLeukmdU.,gorMt~Phe1 I eVal PheGZ nGlnQlnArgGlnVa1 sHA 01 yLyvHA s'41 TyrjorL,.uPvoCysL~u~ndS~mI@rSerorAnAl ArgCy 490 500 520 $20 50540 TCTAOOCACAATAACCCCTCTtA0ATCCCCACTCCATCATATCCACTTT.O 3*e.'ArgMA 9n~r~cr~d~pr~ sCysu.,6.vgndCysLwuPrcL. Lw* 1 TrsluProLouL..jAs'.q I .4roThrAl aHI sMi sierAl aTyrLmuCy SUBST ITUT2 S'X'2T WO089/01519 PCTJUS8/O259I 4/9 FIG. 3 Contd 560 570 590 590 600 LwuLysTyr End SerAr Ar gPhTh rA gAsnVal TyrPhoSerLysSerProAl aArg %EridS~rThrSwrHi sAl a~l YSerGl n~l yMt~h*ThrPhqPrcAsnPrcGl nLsu~l al LysVal LvuVal Thr5l riVal Hi sLySGi uCysLmuLwuPhvGln iI *ProS~rEidA 410 620 630 640 650 660 GGCCAGGGTGGGTCATCTATTTCTATATAGCCTGCACCCAiOATT0TAG5ACA5AGGGCAT 51 yGl nGl yGl ySerSe Ii I S*r I1 I EnciPrcAl aPrcArgLuEndAspArg~l yHi.s uAl aAi-gV l S2 yHi %L~uPhvLweuTyr SerLuuHi *PrcAspCysArgThrGl u~l yMe rgPrcGl yTrpVal I I TyrPh,,Tyr II.Al aCyThrGl n I.Va 1YGI nArgAl &C 470 680 490 700 710 720 0CTC5GCTAAATATGTTATTAACTAGATTAACCTTCCCTGA0TTTTCTCACACCAAG Al &ArgEnd 11 wCysV&al Hi sEncit..uArqL..uThrPh*Prc51 uPhoierHi %ThrLyl tL~ouGl yLysryrVPh. 14 uAsnEndAspEnciProSrLuS~rPh.L"uThrPreAr YSer~al AsnM~tCysSorLauThr~iI u X1 *AunLeuProEridVal PIh.SorHi s51 riG 740 750 760 770 700 GTGAGACCATGTCCTGTTTCATCACTCCCTCTCTTCTCCTGAGTAT0GTGGCA5C0TCTT' Val ArqPrcCysProVA I SerS*rLwuProQL..PhwSwrEniV&1 TrpTrpG1 nAvgLou gEridAspHi *Va 1 LwuPh*Hi *Hi %SerLm%4SqrSrPrcG1 uTyrOl YGI ySerYal L& I yGl uThrm~tSwrCyPh.11 ThrPr oSr4*~uLout..uSr Mt Yo A4 aAl a~erT 790 8QQ 910 920 930 940 ArCTCAAAACTTACCTTAGOTCCAAAAACCTCCTCAGTGATTGCCTGTA ThrOl nLysLwuEncPrciV&1 ArgVal I FrotyvArgProAl &LmuGl n~ndL.uProVa I uLe4Arg A~nCysAspLvwuEndQl yCY*Pray sp L uPr oCysSr ApCysLeuEn yrSorGl uThrval Thrcyscll uGI yAl a0l nLYuThrCyPrqA1 a~'al 11 oAl &CyS 850 860 970 goo 96 900 GCTCTCCA0GCATCAACGGCTTCCCAG0CAAAGATG00CTAT0CACCAA0GTAGAA Al aLsuGl nAl aSev'ThrAl aSor~l riAl aLySe1,tG yvallMetAl aProArgVAI 01 t4 dL~uSerArgHi %G1 nArgLwuProArgGl nArqTrpA1 agnOTrpHt '02 nQ yEndt~y orSorProGi Y I I @Aun01 yPhi.Prq~ll yLyvAvp~l yArqAspO1,yThrL*',*G1 yArgL. 90920 9:30 940 950 16 AAGQGGGAACAGGTACGTGTTGGOCTQTTCTGTCTCTOCAATTCTTTACCTTCCAGAOGA Lys~l yGl uOI nVal ArgVal 01 yL~uPheCysLauCysAs erL~uPro5.rArgf22 Y *ArgGl yAsnArqTyrVal Leu01 yCysS~rVal SorAl &I eL..uTyrL..uPro01 uGl, ys02 yC31 yThrOl yThrCyTrpAl aYal LvuSor.u01nPh*PhoThPh*G01nArg,'* 970' Igo 400 W0OO 1010 1020 AACTCTGOATATAGAACOATTCCTATTTAGATATTrTTTCTCAACTATAC, A~nCysL~u01 y I I egridQ yAspOl yCysProt 1 ofndVa1 Tyr~hler0l nLt~uTyr uThrAl aTrp02 yTyrG1 u0l uThrA*pV~l LeuPho0Z ulyr t I aPhei.uAunTyrTh y*L~uPrci(l yAspMt ArgArgAegI'1tior Tyr LouUor XII ua'hoPIh.r Thr Ilot. 1Q::o 1040 TOTAACTCAAAACAOA0ATTCAOCTC, Cy1AenlevLy*G1 nokegPh.3.f* rYal ThrOl mAunArgA~pviw,'A *UsfmdLouL~v*Thrtjju1 I.I OIJKC u~j'LL1u Lv was incubatea In tne presence SUBSTITUTE SHEET WO 89/01519 PCT/US88/02591 5/9 FIG, 3 Contd to 20 30 40 50 6 GAATTCCACACAGCAGTTT6TGACTAATATT6TrCTGCCAGCCCA0GAAA0T06CCCAC G1 uPh@Hl sThrAl &Val CyAspEndEndLutiS#0Cys61 nPrcoArgLysVa I Al aHf Asn~SqrThrG1 mG1 nPhaYal ThrA~nSqrCyL~uAl aSwrPraGl yLysTrpF'rcTh 11 *PreH *$erSorLuEndLeuZ1 Val Val LqouproAl a~l n~l u~erG1 y,#ro so 90 100 110 IZ0 Arq~ScrG1 yHt sProVal 61 yH4 sArgtMtAurnPhSrSrLeuG1 y~i %Cywpl1 sVal rG1 ylnA alePrTrpAsPThr61 yndI ePhLuL.uTspV&1 1lOV41m~tS* I nVal ArgProS*rArgGl yThrGl nAspG31uPt~ePhep?,.Sor01. S~r..uSrCy.G 130 140 M5 140 t70 160 AGACCATTCACTTCATAGGATGOCACCAGCOOCAAC. AAAOAAAATOAGT Arg~rdL.~wPhwThrS*rVa1 61 Y'MmtAl aProAl oAl rAupProTyrS~rL..u61 nEnd~l yTrpHi C31 nAt*901 n~t s61 nArgArgAep~jl yVa 1 nrhrpral 1 eMi .P1,.$.rArqAiip61 'yThrSorr61 yAsnThrlyura Wit uMet6l kjS 190 200 210 220 230 24Q CA0CAAACA CTATTTTCT~GGAATCTGTTAA AATCCACACA0T6 G1 nOl nrhrA~r 1i.1 e~lyPh*.Thr6l yQl y!I .CyLu3 nG I yA~pProAl aAl &Val I SerLyGl nThr~ndVal L.~4Lou~l y61 u6or Val 1yrArqG1 u 11.0 wI Ol nrl mTr erAl aAunLyuMf sArqPhvryrTrpQ1 yA!%nL~uPh*ThrG1 yArgS*rSqrSvr ~rG 2Z 260 270 280 290 zoo qCT6GACAGAACAAAACTACTGTAAAAACAAAT00AQTTAATTTTCACTTTG3CA 61 yTrpThrQl yOl uC31 n~l nL~uL,.uyal LYsThr*AvnAl aVal AvwnPh*Hi uFI,.Al a pAl a61 yGOl~ ijA~nAunAanTyrTrp~ndLyG1 nM.e 61 nL .u 11 wPh .ThrL~uHi 1 YL..uwAsPArgArq~hrThrThrThral ywLyw.~yCSer-nPhSrL oCyT 310 20 330 340 3Z5074 Pra~erLu01 nal nPra~roArgGl yAunLeuPheLuIysLuLvuL.uS~rOI yAl a sProPrqCySwrAsnLvui sV&AlAl &I *TyrFh@e~u*rTyrCy*S~rG1 nfl. 1Hi hrt.qu~roAl aA1 aThrSrThrTrp31nPh.f 1 eSerEndVal I I *A1 aLe"ArgCysT 370 :3806 0 400o 410 420 CACCATACAGTTATT0A0AOCA0t0CTCAGAAA00TCAGT00TOGOTCAA00,TCTCCCIT Hi sHi uThrVal I I.OluSer$.rAl OlnLysOl YOlviSrTrpVa LyVal SarL~u %Thr I11.01 nL*uL%JArgAl aVal LouArgLysVa1 Sqr~ru01 hrProTyrS~rtyrgndGl uQi nyE.,*G uArgOarVa1 LeuGl yG1 nOl yLou~roS 4,40 440 450 440 470 480 CTCTAGAA0G0ATTr0CATCAACTCTTAAAAAACAAAACTAATATTAAO LouLeuArgArgApTrpAZ aRvrAvnSvefndArqArG1 u~l n~l, uLevAr 1 1 Lys *SerndOl u01 y I 1.01 yH .01 nThr~j,qu01 u~l u0I u2*rLyuAen~nd 1 tvLauSo Or~rQ01uLy*01 yLouQ I yl I *LyooALWuLy*LyArQA1 #ArgThrArgTyrEndV 0 0 510 S3,0 340 3SeA~i s~Q-uYL~ c v46n1 v'Leu~rq*1 yLe4'~ na I y~roPr oGI y rMA U 0-Ph. QV 1, PIheI nOI mAl 4a.yeG 1le Y53 tSAl alyrAo-gO4 aPra~oud4 4,~hiPh~ o~a~oerAAP qoA rgA1AGrAg t inxectea withl HIV, or related viruses wich/ s Urns ~u av,-s1, !PCI/US88/02591 WO 89/01519 00 FIG. 3 Contd 60 570 58 30 0 LysLeulG y~ro~roGl y~snProG1 yPraSsr~ll ySerProGl yPr-oLystGl YGl nLys L(SprTrpGl yLeuG1 inG1ull vG1 nGl yLeuLwu(31y~isQ1 nA~pG1 nAr gAl a~y*Ly ysVal 6-1 yAl aSerArgLysSerArgAl aPheTrpt a1ThrArgThrLysGl yProLywA 610 620 6ZO 64q 650 660 GGAGACCCTGGAAAAAGTCGGAAqCCCAGCAGGTCTACTACTTCACCCAG 01lYAspProGl yLysSerPro~l yiyAspProSerLysVal EndAl aAspPhvThr131 n %01 uThrLPI(31 u~yYal ArgYal ArgThrProAl aArgSer(31 uLsuThr SwrPraAr rqArgPror'rpLys~ysSprS1 yEndG1 yProQ1 nG1 nql yti.Sor~ndLwuHt %ProO 670 680 690 700 710 720 G6TCCTGAGACCTTGAGTATCT6GTAAcQAGTGCCCCTTCTCCTTTCTTCAAAGOAAG 01 yPrcGl uThrLeuSer I Ii TrpEndG1 u~al ProL..uL.'jLuuPhaLowG1 nArgLys q~al LeuArgPro~ndVal SerQ1 yLyxArg~ysProPh.SerCysSrPhLyG1I yAr 1 .ndApLeuG1 uTyr RuVal Ar~g~ yAl oProSorProVa1 PrpSwrLy%61lIA 730 740 750 760 AITACCAAATTTCTTTCTACCCAGT 'ICCCTCAG3CCCTCTC 11 e ProtysPheAl aPheEnd~froSerAl aL.*t4SerPraL.*u qTyrPrqAsnLeuLeuSerA~pPro~a 1 PrpSerA1 aLMOu 5pThr01 n I I aCysPhe .L,4ThrG1 nCysProrl nFrcSor 6iji Id LJAL~'£ V WO 89/01519 PCT/US88/02591 FIG. 4 IL~ FIG. nGI yfls-CjijTyr-Arg- Cys Pro -Asn 5Tr!JVal Ser C s~ Trp Lys Ser *LyS h INVARIANTf CPG-R Gal Man ID r~1 U, NtsPheProAspJkrg-lu-hrfr-l~a-Jkp-Aa-Gti-~ri;-Agi Arg-Glu-Gl n-Gln-Ser His- eu- Ph~jp 'Tyr Ala Hislj Met Lys Ala Leu Str-ser-Ile-Val-Thr-Pro Giiit Glu Gin Glu hoVa-Asn-Lys-Asn-Ala-Gln-Pro-Asp-Tyr-Gln Trp Val, Ser (Glu -0n Ihe is 10 Pro Ala Glu Asn Ala Ile Lys *Ala Phe INVARIAN4T CPG-R Gal Man III AR ANiT CPG-R Gal Man 1-A Sly Thrff~ij Thr Ile 1Gly~LuA AsArg-Thr-IeuGl yAs-hAr Ir Se-s GySr mgLt~ Gly Trp Lys TrjjGJ Leu Thr Slit Vhe a Gly INUVARIJANT CPG-R Tyr Gal Man Leu-Gln-Phe-Glu-Lyst UpJAr-Pro-Asn Gnr.Asp Asn-Ph e-Phe- LYS Asr Trp Gly'His Glu Xs ii Gly Al &-Thr-Gly-Gly.- Ser INVARIANT CPG-R Gal Hart I FIG. 5 Contd C C? lu jil Gly y Ir sAsp Gl s-y-flVlMtIe-r-iiGu!r-I-l Trp-sn-Asp Val- Asp Asn Fc-y-s f Ey-s GlIu ProEX~~n4rG f-e~oPe;hj~jy -Ls-l-TrV -Al a- Arg Trp IN VARIANT CPG-R Gal Man INVARIANT CPG-R Gal Man (0 U' (I~ I r~i WDNI WNI-, 18 K INTERNATIONAL SEARCH REPORT International Application No PCT/US 88/02591 1. CLASSIFICATION OF SUBJECT MATTER (it several clasailic3tion symools apoly, Indicate all) According to International Patent Classification or to bothl National Classification and IPC d C 12 N 1-5/00; 1/20; 1/14; 5/00; C 12 P 21/02; A 61 K 37/02 IPC:. 39/395;- G 01 N 33/569; 12, P 21/00; C 12 R 1:91) 11, FIELDS SEARCHED Minimum Documentation Searched 7 Classification system I Classification Symbols C 12 N Documentatlon Searched other than Minimum Documentation to the Extent that such Documents are Included In the Ficle SearchedI 111, DOCUMENTS CONSIDERED TO 31 RELE1VANTO Category Citation of Document, 11 with indilcation, where appropriate. of the relevant passages 12 F!4ioyant to Clairn No, l X jchemical Abstracts, vol~ume 105t no. 21, 14,28 24 November 1986, (Colum~bus, Ohio, US); J.A. Sumnierfield et IMannose- binding proteins in hum~an seruml: identification of mannose-specific imunng2oblins and a calcium- dependent lectin, of broader carbo- hydrate specificity, secreted by hepatocytes", see page 573, ablstraqt 189211v, a Biochim. Biophys. Acta 1986, 883(2), 197-206 cited in the. application A 29-31 A The Journal of Biological Chernistryt vol~ume 261, no. 15, 25 May 1986, 17 The Amierican Society of Biological Chemis.ts, Xnc., (Baltimnore, US), X. Drickamer et "Mannose-, binding proteins i~olated from rat J,liver' contain carohydrate- rp- cognition domains linked to Soecial doaegories i Ofcited documentalis T" Iltr document 0liblihed car the Initernational fiing date doumet eflnng he eneal tat citheartwhih I r priority dote and not in conflict wilth the application but. W dncierit tlo~n b e ctral tat alevaneonwiltois cited tI lnderotarlo the PrIncipie 9f theory unoerying the ocitl~~soto e o Paswa reevace i1fireln "Al earlier document ou publishedt On of char the Illjernilnal OX document. of 0arti4414r roloveftcet the claimed Invention filing dale Cannot be 40rialdered movel at cannot be wpeiciaredi to '*iV document which may throw doubts On priority GlIGIt(s) or, involve en invenive stop which is Cited to eatabhier the, outlIcatlon date of another doclument of particular relevancet the claimed inventiorn 04f11011 ot other special reason (as apeciflsd)' cannot be considered to Involve an Inventive oleo when the I'D" documentl referringii to on oral diaclpeure, uoo, ahiitiort of document Is combined With one ot More Other such dlocu* Other moons Mantes such c4oleition 0eing 0oviquse pereor skilled document outilahed prior to the frnlernetioflat filing 4Me 'hut In the, Ott. ill' then to priority date claImed 04 document member~ of the tame patent family IV, CRTIPICArTION aeg alfgo heItreintaaai ci 01a14 of the Actual Completion of the International *cat'ch ae9 eln fti ntrainlN0 ,110 .19th December 1988 11JNIQ Inter(lillmal Searching Authlority U1inerts of Aiiihefil" QM1 I EUA Opr' PAT OFFICE: M YAN 110k frm 110TYIIA114oQ itecn shoat) (Joriwar tjoill 24. A method for treating animals infected with a bacterium,. a fungus, or a virus, said method comprising administering to said animal a peptide of claim. 14. A method of claim 21 wherein said animal is human. IintenatfoflI APPliestfon No, PCT/US 88/02591- 2- TIll. DOCUMENTS CONSIDERED TO 51 RELEVANT (CONTINUED FROM THE SECOND SMIEET) Category *i C tation of Oocument, withl indicaion.. *Two appropriate, of the. revmnt passage$ I eevn to Clarim No PA collagenous tails", pages 6878-6887' see abstract; f igure. cited. in the application The Journal. of Biological Chemistry, volume 262, no. 6, 25 February 1987, The American. Society of Biological Chemists, Inc., (Baltimore, US), Drickanier et "Exon structure of a mannose,-binding protein gene reflects its evolutionary re- lationship to the. asialloglycoprote.n receptor and nonfibrillar collagens", pages 2582-2589 see abstract The Journal of Biological Chemistry, volume 262, no. 29., 15 October 1987, The American Soci ety for Biochemistry and Molecular Bi4ologyJ (Baltixpore, US), Hi.P, Haagsman et al.: "The major lung Surfactant protein, SP_ Z8-36, is a Palciuxn-dependent, carbohydrate binding protein", pages 13877-13880 see abstract7 page 13879, column 2, lines 20-44 Nature, volume 317, 26; September 1985, (tLondop, GB), Tyler White et al.; "Isolation. and qharacteri-ation. of the human Pulmonary surfactant~ apoprotein gene", pages 361-$3 see abstract; figure 2 cited in the application Chemical Abstracts, volume 109, no. l$, October 1988, (Columibus, Ohio, US)1. R4. EZe)owitz et "A human mannose-binding protein is an acute-phase reactant that sh a r s sequence homology with other vertebrate lectins", Ste PAVC 2680 abstract 124567d1, 4 a, rxp. Me4 1988, 167(3), 1034-46 Chemical Abstracts, volume l,09, no. 1,f 12 Sptember 1988, (Columbus, Ohlo, VS) R. tzekoWitz at al.: "The role of humian mantnose-l.,ctin-l 9 o mnolecules in host defense", see page $17t abstract 90799p, Symp. mol.Col 1-6,9,13- 17 1-6, 9, 13- 17,19 1-6090,3- 17 1-6, 9t 3- 17 19 I F'tPCT 13A;1 tows6 soot' Wooit MJA ill 11 -3- International Application No- PCT/US 88/025 91 PURTMER INFORMATION CONTINUED FROM THE SECOND SHORT New Ser. 1988, 64(Bact.-Host. Cell Interact.), 213-23 A WO, A, 83/03971 (PRESIDENT AND FELLOWS 11,12 OF HARVARD COLLEGE) 24 November 1983 see claims cited In the application V0 OBSER~VATIONS WHlERE, CERTAIN CLAIMS WOOI!E FOUND UN8EARCMABLI This Interarional search report, has not been established In respect qf certain clms under Article i7(21 fort"e following rqssle 1.m claim numbers because they relate to oubfe~t matter not required to be searched by this AthOwnrity enilyl ticlaijns 20-27 See PCT Rule 3 9 Methods f or treatmrent of the ht.xan or animral body by surgery or therapy, well as diagnostic Methods. claim 18 was rnot searched because there is no~ meaningfu rol~e given. f or vacqinia viru~s. 2.M C1eim numbers because they relate to parts of the tntsipatlonal applliaton that do no~t comply with the Prescribed require.- Mo'nte to such art extet that 04 Meaningful international search can bo ;&rrie4 out, spafcme~y~ 3QJ Cimb n ortu M bcauae whyse depa'dssm 04"isn~ am flt drttot in Soro5fl-e *M the sooond a4 thid eritene~ of PCT Mulefl. 44s). VI.Q ONSIIVATION3 WillR UNITY OF INVENTION IS LACK1004 I This lntaterntne 3earchlnf Author"t found mufliel lmrnjjnti in this Interoneenl applio~n, all follows( t~As sit required addItional searcht lees wee tiMely Paio by the eppilcesttf this finteetlonel $*arch leptt~er eitsrhbe ete of the International applicatll.oes i 04calocam Z0 As only some ol thes required adellifervI se6rch fest were "il gold by the 'eim tIs nternaional search aeor o nly these claims of the fitefretienl appklatiop fee whicht tees were P&l o Wi 'i laiet NO faluired 4oldilonaf search fees *eto timthey Paid by' the opollw~t Conseuety, this iltreiatnel qoarsIh report 1s restricted te the tnvettlan Atirs mentiortei in the Oteinisi It is severed by climn riumbert 4( A all si t rheleclalma could be erce itoeffort 140410160isi andditionali too# tihe hrtrtteMSee10104 Authrfity did net Invite payment of n diinife Plemert *A retestl 0The add1tional search fees were e4comnpanlIe by 4philts protestk N4H pretest steampaniod the Payment of44"lddltte seerel feec, Pollm PCTIISA 1110 (eumpterilental sheet (JdneeY 111141 ANNEX TO THE INTERNATIONAL SEARCH REPORT ON, INTERNATIONAL PATENT APPLICATION NO. US 8802591 SA 24331 This annex lists the patent family Members relating to the patent documents cited In the above-mentioned international search report, The~ members are as contained in the European Patent Office EDP file on 04/0 1I89 The European Patent office is in no way liable for these particulars which are merely given for the purpose of Information. P~atent document Publication Patent family Publication cited in s earch report date member(s) date WO-A- 8303971 24-11-83 AU-A- 1706283 02-12-83 EP-AB 0108146 16-0$-84 CA-A- 1217156 27-01-87 US-A- 4675382 23-06-87 AU-B- 673529 16-06-88 Frmore detal* about this un'Ox see Q(ficiat Journal of the Eurfq~an Patent Me.cq No. 12142