AU6134100A - Novel modified tie-2 receptor ligands - Google Patents

Description

AUSTRALIA

Patents Act COMPLETE SPECIFICATION

(ORIGINAL)

Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: o o Name of Applicant: Regeneron Pharmaceuticals, Inc.

Actual Inventor(s): SAMUEL DAVIS, GEORGE D. YANCOPOULOS Address for Service: '*PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: NOVEL MODIFIED TIE-2 RECEPTOR LIGANDS Our Ref: 626913 POF Code: 1271/134671 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): -1- 1A NOVEL MODIFIED TIE-2 RECEPTOR LIGANDS

INTRODUCTION

The present application is a divisional application from Australian patent application number 724032 (39687/97) the entire disclosure of which is incorporated herein by reference.

The present invention relates generally to the field of genetic engineering and more particularly to genes for receptor tyrosine kinases and their cognate ligands, their insertion into recombinant DNA vectors, and the 0 production of the encoded proteins in recipient strains of microorganisms and recipient eukaryotic cells. More specifically, the present invention is directed to a novel modified TIE-2 ligand that binds the TIE-2 receptor, as well as to methods of making and using the modified ligand. The invention 15 further provides a nucleic acid sequence encoding the modified ligand, and methods for the generation of nucleic acid encoding the modified ligand and the gene product. The modified TIE-2 ligand, as well as nucleic acid encoding it, may be useful in the diagnosis and treatment of certain diseases involving endothelial cells and associated TIE receptors, such as neoplastic 20 diseases involving tumor angiogenesis, wound healing, thromboembolic diseases, atherosclerosis and inflammatory diseases. In addition, the modified ligand may be used to promote the proliferation and/or differentiation of hematopoietic stem cells.

More generally, the receptor activating modified TIE-2 ligands described herein may be used to promote the growth, survival, migration, and/or differentiation and/or stabilization or destabilization of cells expressing TIE receptor. Biologically active modified TIE-2 ligand may be used for the in vitro maintenance of TIE receptor expressing cells in culture. Cells and tissues expressing TIE receptor include, for example, cardiac and vascular endothelial cells, lens epithelium and heart epicardium and early hematopoietic cells.

Alternatively, such human ligand may be used to support cells which S1 are engineered to express TIE receptor. Further, Trodified TIE-2 ligand and its cognate receptor may be used in assay systems to identify further agonists or antagonists of the receptor.

BACKGROUND OF THE INVENTION The cellular behavior responsible for the development, maintenance, and repair of differentiated cells and tissues is regulated, in large part, by intercellular signals conveyed via growth factors and similar ligands and their receptors. The receptors are located on the ceil surface of responding cells and they bind peptides or polypeptides known as growth factors as well as other hormone-like ligands. The results of this interaction are rapid biochemical changes in the responding cells, as well as a rapid and a long-term readjustment of cellular gene expression. Several receptors associated with various cell surfaces may bind specific growth factors.

The phosphorylation of tyrosine residues in proteins by tyrosine kinases is one of the key modes by which signals are transduced across the plasma membrane. Several currently known protein tyrosine kinase genes encode transmembrane receptors for polypeptide growth factors and hormones such as epidermal growth factor (EGF), insulin, insulin-like growth factor-I (IGF-I), platelet derived growth factors (PDGF-A and and fibroblast growth factors (FGFs). (Heldin et al., Cell Regulation, 1: 555-566 (1990); Ullrich, et al., Cell, 61: 243-54 (1990)). In each instance, these growth factors exert their action by binding to the extracellular portion of their cognate receptors, which leads to activation of the intrinsic tyrosine kinase present on the 1 0 cytoplasmic portion of the receptor. Growth factor receptors of endothelial cells are of particular interest due to the possible involvement of growth factors in several important physiological and pathological processes, such as vasculogenesis, angiogenesis, atherosclerosis, and inflammatory diseases. (Folkman, et al. Science, 15 235: 442-447 (1987)). Also, the receptors of several hematopoietic growth factors are tyrosine kinases; these include c-fms, which is the colony stimulating factor 1 receptor, Sherr, et al., Cell, 41: 665-676 (1985), and c-kit, a primitive hematopoietic growth factor receptor reported in Huang, et al., Cell, 63: 225-33 (1990).

20 The receptor tyrosine kinases have been divided into evolutionary subfamilies based on the characteristic structure of their ectodomains. (Ullrich, et al. Cell, 61: 243-54 (1990)). Such subfamilies include, EGF receptor-like kinase (subclass I) and insulin receptor-like kinase (subclass II), each of which contains repeated homologous cysteine-rich sequences in their extracellular domains. A single cysteine-rich region is also found in the extracellular domains of the eph-like kinases. Hirai, et al., Science, 238: 1717-1720 (1987); Lindberg, et al. Mol. Cell. Biol., 10: 6316-24 (1990); Lhotak, et al., Mol.

Cell. Biol. 11. 2496-2502 (1991). PDGF receptors as well as c-fms and c-kit receptor tyrosine kinases may be grouped into subclass III; while the FGF receptors form subclass IV. Typical for the members of both of these subclasses are extracellular folding units stabilized by intrachain disulfide bonds. These so-called immunoglobulin (Ig)-like folds are found in the proteins of the immunoglobulin superfamily which contains a wide variety of other cell surface receptors having either cell-bound or soluble ligands. Williams, et al., Ann. Rev.

Immunol., 6: 381-405 (1988).

10 Receptor tyrosine kinases differ in theirS specificity and affinity.

In general, receptor tyrosine kinases are glycoproteins which consist of an extracellular domain capable of binding the specific growth factor(s); a transmembrane domain which usually is an alphahelical portion of the protein; a juxtamembrane domain where the 1 5 receptor may be regulated by, protein phosphorylation; a tyrosine kinase domain which is the enzymatic component of the receptor; and a carboxyterminal tail which in many receptors is involved in recognition and binding of the substrates for the tyrosine kinase.

20 Processes such as alternative exon splicing and alternative choice of gene promoter or polyadenylation sites have been reported to be capable of producing several distinct polypeptides from the same gene. These polypeptides may or may not contain the various domains listed above. As a consequence, some extracellular domains may be expressed as separate, secreted proteins and some forms of the receptors may lack the tyrosine kinase domain and contain only the extracellular domain inserted in the plasma membrane via the transmembrane domain plus a short carboxyl terminal tail.

A gene encoding an endothelial cell transmembrane tyrosine kinase, originally identified by RT-PCR as an unknown tyrosine kinasehomologous cDNA fragment from human leukemia cells, was described by Partanen, et al., Proc. Natl. Acad. Sci. USA, 87: 8913-8917 (1990).

This gene and its encoded protein are called "TIE" which is an abbreviation for "tyrosine kinase with Ig and EGF homology domains." Partanen, et al. Mol. Cell. Biol. 12: 1698-1707 (1992).

It has been reported that tie mRNA is present in all human fetal and mouse embryonic tissues. Upon inspection, tie message has been S 1 0 localized to the cardiac and vascular endothelial cells. Specifically, tie mRNA has been localized to the endothelia of blood vessels and endocardium of 9.5 to 18.5 day old mouse embryos. Enhanced tie expression was shown during neovascularization associated with developing ovarian follicles and granulation tissue in skin wounds.

1 5 Korhonen, et al. Blood 80: 2548-2555 (1992). Thus the TIEs have been suggested to play a role in angiogenesis, which is important for developing treatments for solid tumors and several other angiogenesis-dependent diseases such as diabetic retinopathy, psoriasis, atherosclerosis and arthritis.

20 Two structurally related rat TIE receptor proteins have been reported to be encoded by distinct genes with related profiles of expression. One gene, termed tie-1, is the rat homolog of human tie.

Maisonpierre, et al., Oncogene 8: 1631-1637 (1993). The other gene, tie-2, may be the rat homolog of the murine tek gene, which, like tie, has been reported to be expressed in the mouse exclusively in endothelial cells and their presumptive progenitors. Dumont, et al.

Oncogene 8: 1293-1301 (1993). The human homolog of tie-2 is described in Ziegler, U.S. Patent No. 5,447,860 which issued on September 5, 1995 (wherein it is referred to as which is incorporated in its entirety herein.

Both genes were found to be widely expressed in endothelial cells of embryonic and postnatal tissues. Significant levels of tie-2 transcripts were also present in other embryonic cell populations, including lens epithelium, heart epicardium and regions of mesenchyme. Maisonpierre, et al., Oncogene 8: 1631-1637 (1993).

The predominant expression of the TIE receptor in vascular endothelia suggests that TIE plays a role in the development and 9 1 o maintenance of the vascular system. This coulq include roles in endothelial cell determination, proliferation, differentiation and cell migration and patterning into vascular elements. Analyses of mouse embryos deficient in TIE-2 illustrate its importance in angiogenesis, particularly for vascular network formation in endothelial cells. Sato, 15 et al., Nature 376:70-74 (1995). In the mature vascular system, the TIEs could function in endothelial ceil survival, maintenance and response to pathogenic influences.

The TIE receptors are also expressed in primitive hematopoietic stem cells, B cells and a subset of megakaryocytic cells, thus 20 suggesting the role of ligands which bind these receptors in early hematopoiesis, in the differentiation and/or proliferation of B cells, and in the megakaryocytic differentiation pathway. Iwama, et al.

Biochem. Biophys. Research Communications 195:301-309 (1993); Hashiyama, et al. Blood 87:93-101 (1996), Batard, et al. Blood 87:2212-2220 (1996).

SUMMARY OF THE INVENTION The present invention provides for a composition comprising a modified TIE-2 ligand substantially free of other proteins. As used herein, modified TIE-2 ligand refers to a ligand of the TIE family of ligands, whose representatives comprise ligands TL1, TL2, TL3 and TL4 as described herein, which has been altered by addition, deletion or substitution of one or more amino acids, or by way of tagging, with for example, the Fc portion of human lgG-1, but which retains its ability to bind the TIE-2 receptor. Modified TIE-2 ligand also includes a chimeric TIE-2 ligand comprising at least a portion of a first TIE-2 ligand and a portion of a second TIE-2 ligand which is different from 1 o the first. By way of non-limiting example, the 4irst TIE-2 ligand is TL1, and the second TIE-2 ligand is TL2. The invention envisions other combinations using additional TIE-2 ligand family members. For example, other combinations for creating a chimeric TIE-2 ligand are possible, including but not limited to those combinations wherein the 15 first ligand is selected from the group consisting of TL1, TL2, TL3 and TL4, and the second ligand, different from the first ligand, is selected the group consisting of TL1, TL2, TL3 and TL4.

The invention also provides for an isolated nucleic acid molecule 20 encoding a modified TIE-2 ligand. In one embodiment, the isolated nucleic acid molecule encodes a TIE-2 ligand of the TIE family of ligands, whose representatives comprise ligands TL1, TL2, TL3 and TL4 as described herein, which has been altered by addition, deletion or substitution of one or more amino acids, or by way of tagging, with for example, the Fc portion of human IgG-1, but which retains its ability to bind the TIE-2 receptor. In another embodiment, the isolated nucleic acid molecule encodes a modified TIE-2 ligand which is a chimeric TIE-2 ligand comprising at least a portion of a first TIE-2 ligand and a portion of a second TIE-2 ligand which is different from the first. By way of non-limiting example, the first TIE-2 ligand is TL1 and the second TIE-2 ligand is TL2. The invention envisions other combinations using additional TIE-2 ligand family members. For example, other combinations are possible, including but not limited to those combinations wherein the isolated nucleic acid molecule encodes a modified TIE-2 ligand which is a chimeric TIE-2 ligand comprising a portion of a first ligand selected from the group consisting of TL1, TL2, TL3 and TL4, and a portion of a second ligand, different from the.

o1 first ligand, selected from the group consisting of TL1, TL2, TL3 and, T L4.

The isolated nucleic acid may be DNA, cDNA or RNA. The invention also provides for a vector comprising an isolated nucleic acid molecule 1 5 encoding a modified TIE-2 ligand. The invention further provides for a host-vector system for the production in a suitable host cell of a polypeptide having the biological activity of a modified TIE-2 ligand.

The suitable host cell may be bacterial, yeast, insect or mammalian.

The invention also provides for a method of producing a polypeptide having the biological activity of a modified TIE-2 ligand which comprises growing cells of the host-vector system under conditions permitting production of the polypeptide and. recovering the.

polypeptide so produced.

The invention herein described of an isolated nucleic acid molecule encoding a modified TIE-2 ligand further provides for the development of the ligand as a therapeutic for the treatment of patients suffering from disorders involving cells, tissues or organs which express the TIE-2 receptor. The present invention also provides for an antibody which specifically binds such a therapeutic molecule.

The antibody may be monoclonal or polyclonal. The invention also provides for a method of using such a monoclonal or polyclonal antibody to measure the amount of the therapeutic molecule in a sample taken from a patient for purposes of monitoring the course of therapy.

The present invention also provides for an antibody which specifically binds a modified TIE-2 ligand as described herein. The antibody may be monoclohnl 6fpotyclonal. Thus the invention further S 1 0 provides for therapeutic compositions comprising an antibody which speqifically binds a modified TIE-2 ligand, in a pharmaceutically acceptable vehicle. The invention also provides for a method of blocking blood vessel growth in a mammal by administering an effective amount of a therapeutic composition comprising an antibody Sis 15 which specifically binds a receptor activating modified TIE-2 ligand as described herein, in a pharmaceutically acceptable vehicle.

The invention further provides for therapeutic compositions comprising a modified TIE-2 ligand as described herein, in a pharmaceutically acceptable vehicle. The invention also provides for 20 method of promoting neovascularization in a patient by administering an effective amount of a therapeutic composition comprising a receptor activating modified TIE-2 ligand as described herein, in a pharmaceutically acceptable vehicle. In one embodiment, the method may be used to promote wound healing. In another embodiment, the method may be used to treat ischemia. In yet another embodiment, a receptor activating modified TIE-2 ligand as described herein is used.

alone or in combination with other hematopoietic factors, to promote the proliferation or differentiation of hematopoietic stem cells, B cells or megakaryocytic cells.

Alternatively, the invention provides that a modified T1E-2 ligand may be conjugated to a cytotoxic agent and a therapeutic composition prepared therefrom. The invention further provides for a receptorbody which specifically binds a modified TIE-2 ligand. The invention further provides for therapeutic compositions comprising a receptorbody which specifically binds a modified TIE-2 ligand in a pharmaceutically acceptable vehicle. The invention also provides for a method of blocking blood vessel growth in a mammal by administering 1 o an effective amount of a therapeutic composition comprising a receptorbody which specifically binds a modified TIE-2 ligand in a pharmaceutically acceptable vehicle.

The invention also provides for a TIE-2 receptor antagonist as well as a method of inhibiting TIE-2 biological activity in a mammal 1 5 comprising administering to the mammal an effective amount of a TIE- 2 antagonist. According to the invention, the antagonist may be a modified TIE-2 ligand as described herein which binds to, but does not activate, the TIE-2 receptor.

BRIEF DESCRIPTION OF THE FIGURES FIGURES 1A and 1B TIE-2 receptorbody (TIE-2 RB) inhibits the development of blood vessels in the embryonic chicken chorioallantoic membrane (CAM). A single piece of resorbable gelatin foam (Gelfoam) soaked with 6 Iig of RB was inserted immediately under the CAM of 1day chick embryos. After 3 further days of incubation, 4 day old embryos and surrounding CAM were removed and examined. FIGURE 1A: embryos treated with EHK-1 RB (rEHK-1 ecto/hlgG1 Fc) were viable and possessed normally developed blood vessels in their surrounding CAM. FIGURE 1B all embryos treated with TIE-2 RB (r TIE-2 ecto h IgG1 Fc) were dead, diminished in size and were almost completely devoid of surrounding blood vessels.

FIGURE 2 Vector pJFE14.

FIGURE 3- Restriction map of Xgtl0.

FIGURE 4 Nucleic acid and deduced amino acid (single letter code) sequences of human TIE-2 ligand 1 from clone Xgt10 encoding htie-2 00.S* .ligand 1.

FIGURE 5 Nucleic acid and deduced amino acid (single letter code) oo sequences of human TIE-2 ligand 1 from T98G clone.

0 FIGURE 6 Nucleic acid and deduced amino acid (single letter code) i° sequences of human TIE-2 ligand 2 from clone pBluescript KS encoding o0 human TIE 2 ligand 2.

FIGURE 7 Western blot showing activation of TIE-2 receptor by TIE-2 ligand 1 (Lane L1) but not by TIE-2 ligand 2 (Lane L2) or control (Mock).

FIGURE 8 Western blot showing that prior treatment of HAEC cells with excess TIE-2 ligand 2 (Lane 2) antagonizes the subsequent ability of dilute TIE-2 ligand 1 to activate the TIE-2 receptor (TIE2-R) as compared with prior treatment of HAEC cells with MOCK medium (Lane FIGURE 9 Western blot demonstrating the ability of TL2 to competitively inhibit TL1 activation of the TIE-2 receptor using the human cell hybrid line, EA.hy926.

FIGURE 10 Histogram representation of binding to rat TIE-2 IgG immobilized surface by TIE-2 ligand in C2C12 ras, Rat2 ras, SHEP, and T98G concentrated (10x) conditioned medium. Rat TIE-2 (rTIE2) 1 0 specific binding is demonstrated by the significant reduction in the binding activity in the presence of 25 pg/ml soluble rat TIE-2 RB as compared to a minor reduction in the presence of soluble trkB RB.

FIGURE 11 Binding of recombinant human TIE-2 ligand 1 (hTL1) and 1 5 human TIE-2 ligand 2 (hTL2), in COS cell supernatants, to a human TIE- 2 receptorbody (RB) immobilized surface. Human TIE-2-specific binding was determined by incubating the samples with 25 lig/ml of either soluble human TIE-2 RB or trkB RB; significant reduction in the binding activity is observed only for the samples incubated with human 20 TIE-2 RB.

FIGURE 12 Western blot showing that TIE-2 receptorbody (denoted TIE-2 RB or, as here, TIE2-Fc) blocks the activation of TIE-2 receptors by TIE-2 ligand 1 (TL1) in HUVEC cells, whereas an unrelated receptorbody (TRKB-Fc) does not block this activation.

FIGURE 13 Agarose gels showing serial dilutions [undiluted to 10-4]of the TL1 and TL2 RT-PCR products obtained from E14.5 mouse fetal liver (Lanes 1- total, Lanes 3- stromal enriched, and Lanes 4- ckit+TER119 hematopoietic precursor cells) and E14.5 mouse fetal thymus (Lanes 2- total).

FIGURE 14 Agarose gels showing serial dilutions [undiluted to 3 ]of the TL1 and TL2 RT-PCR products obtained from E17.5 mouse fetal thymus cortical stromal cells (Lanes 1- CDR1+/A2B5-) and medullary stromal cells (Lane CDR1-/A2B5+).

o FIGURE 15 A/schematic representation of the hypothesized role of the.TIE-2/TIE ligands in angiogenesis. TL1 is represented by TL2 is represented by TIE-2 is represented by VEGF is represented by and flk-1 (a VEGF receptor) is represented by FIGURE 16 In situ hybridization slides showing the temporal expression pattern of TIE-2, TL1, TL2, and VEGF during angiogenesis associated with follicular development and corpus luteum formation in the ovary of a rat that was treated with pregnant mare serum. Column 1: Early pre-ovulatory follicle; Column 2: pre-ovulatory follicle; Column 3: early corpus luteum; and Column 4: atretic follicle; Row A: bright field; Row B: VEGF; Row C: TL2; Row D: TL1 and Row E: TIE-2 receptor.

FIGURE 17 Comparison of amino acid sequences of mature TL1 protein and mature TL2 protein. The TL1 sequence is the same as that set forth in Figure 4, except that the putative leader sequence has been removed. Similarly, the TL2 sequence is the same as that set forth in Figure 6, except that the putative leader sequence has been removed.

Arrows indicate residues Arg49,. Cys245 and Arg264 of TL1, which correspond to the residues at amino acid positions 69, 265 and 284, respectively, of TL1 as set forth in Figure 4.

FIGURE 18 Western blot of the covalent multimeric structure of TL1 and TL2 (Panel A) and the interconversion of TL1 and TL2 by the mutation of one cysteine (Panel B).

FIGURE 19 A typical curve of TIE-2-lgG binding to immobilized TL1 1 0 in a quantitativp cell-free binding assay.

S FIGURE 20 A typical curve showing TIE-2 ligand 1 ligandbody comprising the fibrinogen-like domain of the ligand bound to the Fc Sdomain of IgG (TL1-fFc) binding to immobilized TIE-2 ectodomain in a 1 5 quantitative cell-free binding assay.

FIGURE 21 Nucleotide and deduced amino acid (single letter code) sequences of TIE ligand-3. The coding sequence starts at position 47.

The fibrinogen-like domain starts at position 929.

FIGURE 22 Comparison of Amino Acid Sequences of TIE Ligand Family Members. mTL3 mouse TIE ligand-3; hTL1 human TIE-2 ligandl; chTL1 chicken TIE-2 ligandl; mTL1 mouse TIE-2 ligand 1; mTL2 mouse TIE-2 ligand 2; hTL2 human TIE-2 ligand 2. The boxed regions indicate conserved regions of homology among the family members.

FIGURE 23 Nucleotide and deduced amino acid (single letter code) sequences of TIE ligand-4. Arrow indicates nucleotide position 569.

1-1- FIGURE 24 Nucleotide and deduced amino acid (single letter code) sequences of chimeric TIE ligand designated 1N1C2F (chimera The putative leader sequence is encoded by nucleotides 1-60.

FIGURE 25 Nucleotide and deduced amino acid (single letter code) sequences of chimeric TIE ligand designated 2N2C1F (chimera The putative leader sequence is encoded by nucleotides 1-48.

0o FIGURE 26 Ncleotide and deduced amino acid (single letter code) sequences of chimeric TIE ligand designated 1N2C2F (chimera The putative leader sequence is encoded by nucleotides 1-60.

FIGURE 27 Nucleotide and deduced amino acid (single letter code) 1 5 sequences of chimeric TIE ligand designated 2N1C1F (chimera The putative leader sequence is encoded by nucleotides 1-48.

DETAILED DESCRIPTION OF THE INVENTION As described in greater detail below, applicants have created novel modified TIE-2 ligands that bind the TIE-2 receptor. The present invention provides for a composition comprising a modified TIE-2 ligand substantially free of other proteins. As used herein, modified TIE-2 ligand refers to a ligand of the TIE family of ligands, whose representatives comprise ligands TL1, TL2, TL3 and TL4 as described herein, which has been altered by addition, deletion or substitution of one or more amino acids, or by way of tagging, with for example, the Fc portion of human IgG-1, but which retains its ability to bind the TIE-2 receptor. Modified TIE-2 ligand also includes a chimeric TIE-2 ligand comprising at least a portion of a first TIE-2 ligand and a portion of a second TIE-2 ligand which is different from the first. By way of non-limiting example, the first TIE-2 ligand is TL1 and the second TIE-2 ligand is TL2. The invention envisions other combinations using additional TIE-2 ligand family members. For example, other combinations for creating a chimeric TIE-2 ligand are possible, including but not limited to those combinations wherein the 1 0 first ligand is selected from the group consisting of TL1, TL2, TL3 and TL4, and the second ligand, different from the first ligand, is selected from the group consisting of TL1, TL2, TL3 and TL4.

o.

The invention also provides for an isolated nucleic acid molecule 1 5 encoding a modified TIE-2 ligand. In one embodiment, the isolated nucleic acid molecule encodes a TIE-2 ligand of the TIE family of ligands, whose representatives comprise ligands TL1, TL2, TL3 and TL4 as described herein, which has been altered by addition, deletion or substitution of one or more amino acids, or by way of tagging, with for j 20 example, the Fc portion of human IgG-1, but which retains its ability to bind the TIE-2 receptor. In another embodiment, the isolated nucleic acid molecule encodes a modified TIE-2 ligand which is a chimeric TIE-2 ligand comprising at least a portion. of a first TIE-2 ligand and a portion of a second TIE-2 ligand which is different from the first. By way of non-limiting example, the first TIE-2 ligand is TL1 and the second TIE-2 ligand is TL2. The invention envisions other combinations using additional TIE-2 ligand family members. For example, other combinations are possible, including but not limited to those combinations wherein the isolated nucleic acid molecule encodes a modified TIE-2 ligand which is a chimeric TIE-2 ligand comprising a portion of a first ligand selected from the group consisting of TL1, TL2, TL3 and TL4, and a portion of a second ligand, different from the first ligand, selected from the group consisting of TL1, TL2, TL3 and TL4.

The present invention comprises the modified TIE-2 ligands and their amino acid sequences, as well as functionally equivalent variants ro thereof, as wellas proteins or peptides, comprising substitutions, deletions or insertional mutants of the described sequences, which S bind TIE-2 receptor and act as agonists or antagonists thereof. Such variants include those in which amino acid residues are substituted for residues within the sequence resulting in a silent change. For 5 example, one or more amino acid residues within the sequence can be substituted by another amino acid(s) of a similar polarity which acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the sequence may be selected from other members.of the class to which the amino acid belongs. For example, the class of nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

Also included within the scope of the invention are proteins or fragments or derivatives thereof which exhibit the same or similar biological activity as the modified TIE-2 ligands described herein, and derivatives which are differentially modified during or after translation, by glycosylation, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Functionally equivalent molecules also include molecules that contain modifications, including N-terminal modifications, which result from expression in a particular recombinant host, such as, for example, Nterminal methylation which occurs in certain bacterial E. coli) expression systems.

The present invention also encompasses the nucleotide sequences that encode the proteins described herein as modified TIE-2 ligands, as .well as host cells, including yeast, bacteria, viruses, and mammalian cells, which are genetically engineered to produce the proteins, by e..

'1 5 transfection, transduction, infection, electroporation, or microinjection of nucleic acid encoding the modified TIE-2 ligands described herein in a suitable expression vector. The present invention also encompasses introduction of the nucleic acid encoding modified TIE-2 ligands through gene therapy techniques such as is described, for example, in Finkel and Epstein FASEB J. 9:843-851 (1995); Guzman, et al. PNAS (USA) 91:10732-10736 (1994).

One skilled in the art will also recognize that the present invention encompasses DNA and RNA sequences that hybridize to a modified TIE- 2 ligand encoding nucleotide sequence, under conditions of moderate stringency, as defined in, for example, Sambrook, et al. Molecular Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp. 101-104, Cold Spring Harbor Laboratory Press (1989). Thus, a nucleic acid molecule contemplated by the invention includes one having a nucleotide sequence deduced from an amino acid sequence of a modified TIE-2 ligand prepared as described herein, as well as a molecule having a sequence of nucleotides that hybridizes to such a nucleotide sequence, and also a nucleotide sequence which is degenerate of the above sequences as a result of the genetic code, but which encodes a ligand that binds TIE-2 receptor and which has an amino acid sequence and other primary, secondary and tertiary characteristics that are sufficiently duplicative of a modified TIE-2 ligand described herein so o as to confer on/the molecule the same biological activity as the modified TIE-2 ligand described herein.

The present invention provides for an isolated nucleic acid molecule S encoding a modified TIE-2 ligand that binds and activates TIE-2 5 receptor comprising a nucleotide sequence encoding TIE-2 ligand 1 wherein the portion of the nucleotide sequence that encodes the N- S. terminal domain of TIE-2 ligand 1 is replaced by a nucleotide sequence that encodes the N-terminal domain of TIE-2 ligand 2. The invention also provides for such a nucleic acid molecule, with a further modification such that the portion of the nucleotide sequence that encodes the coiled-coil domain of TIE-2 ligand 1 is replaced by a nucleotide sequence that encodes the coiled-coil domain of TIE-2 ligand 2.

The present invention also provides for an isolated nucleic acid molecule encoding a modified TIE-2 ligand that binds and activates TIE-2 receptor comprising a nucleotide sequence encoding TIE-2 ligand 1 wherein the portion of the nucleotide sequence that encodes the Nterminal domain of TIE-2 ligand 1 is replaced by a nucleotide sequence that encodes the N-terminal domain of TIE-2 ligand 2 and which is further modified to encode a different amino acid instead of the cysteine residue encoded by nucleotides 784-787 as set forth in Figure 27. A serine residue is preferably substituted for the cysteine residue. In another embodiment, the nucleic acid molecule is further modified to encode a different amino acid instead of the arginine residue encoded by nucleotides 199-201 as set forth in. Figure 27. A serine residue is preferably substituted for the arginine residue.

The ,present invention also provides for an isolated nucleic acid molecule encoding a modified TIE-2 ligand that binds and activates TIE-2 receptor comprising a nucleotide sequence encoding TIE-2 ligand 1 which is modified to encode a different amino acid instead of the cysteine residue at amino acid position 245. A serine residue is preferably substituted for the cysteine residue.

o The invention further provides for an isolated nucleic acid molecule encoding a modified TIE-2 ligand that binds but does not activate TIE- 20 2 receptor comprising a nucleotide sequence encoding TIE-2 ligand 1 wherein the portion of the nucleotide sequence that encodes the Nterminal domain of TIE-2 ligand 1 is deleted.. The invention also provides for such a nucleic acid molecule further modified so that the portion of the nucleotide sequence that encodes the coiled-coil domain of TIE-2 ligand 1 is deleted and the portion encoding the fibrinogenlike domain is fused in-frame to a nucleotide sequence encoding a human immunoglobulin gamma-1 constant region (IgG1 Fc).

The invention further provides for an isolated nucleic acid molecule encoding a modified TIE-2 ligand that binds but does not activate TIE- 2 receptor comprising a nucleotide sequence encoding TIE-2 ligand 2 wherein the portion of the nucleotide sequence that encodes the Nterminal domain of TIE-2 ligand 2 is deleted. The invention also provides for such a nucleic acid molecule further modified so that the portion of the nucleotide sequence that encodes the coiled-coil domain of TIE-2 ligand 2 is deleted and the portion encoding the fibrinogenlike domain is fused in-frame to a nucleotide- sequence encoding a o human immunoglobulin gamma-1 constant region (IgG1 Fc).

The invention further provides for an isolated nucleic acid molecule encoding a modified TIE-2 ligand that binds but does not activate TIEi 2 receptor comprising a nucleotide sequence encoding TIE-2 ligand 1 5 wherein the portion of the nucleotide sequence that encodes the fibrinogen-like domain of TIE-2 ligand 1 is replaced by a nucleotide sequence that encodes the fibrinogen-like domain of TIE-2 ligand 2.

The invention also provides for such a nucleic acid molecule further modified so that the portion of the nucleotide sequence that encodes the coiled-coil domain of TIE-2 ligand 1 is replaced by a nucleotide sequence that encodes the coiled-coil domain of TIE-2 ligand 2.

The invention further provides for a modified TIE-2 ligand. encoded by any of nucleic acid molecules of the invention.

The present invention also provides for a chimeric TIE-2 ligand comprising at least a portion of a first TIE-2 ligand and a portion of a second TIE-2 ligand which is different from the first, wherein the first and second TIE-2 ligands are selected.from the group consisting of TIE-2 Ligand-1, TIE-2 Ligand-2, TIE Ligand-3 and TIE Ligand-4.

Preferably, the chimeric TIE ligand comprises at least a portion of TIE-2 Ligand-1 and a portion of TIE-2 Ligand-2.

The invention also provides a nucleic acid molecule that encodes a chimeric TIE ligand as set forth in Figure 24, 25, 26, or 27. The invention also provides a chimeric TIE ligand as set forth in Figure 24, 26, or 27. The invention further provides a chimeric TIE ligand as 1 0 set forth in Figwre 27, modified to have a different amino acid instead' of, the cysteine residue encoded by nucleotides 784-787.

:Any of the methods known to one skilled in the art for the insertion of DNA fragments into a vector may be used to construct expression S 1 5 vectors encoding a modified TIE-2 ligand using appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinations (genetic recombination). Expression of a nucleic acid sequence encoding a 20 modified TIE-2 ligand or peptide fragments thereof may be regulated by a second nucleic acid sequence which is operably linked to the a modified TIE-2 ligand encoding sequence such that the modified TIE-2 ligand protein or peptide is expressed in a host transformed with the recombinant DNA molecule. For example, expression of a modified TIE- 2 ligand described herein may be controlled by any promoter/enhancer element known in the art. Promoters which may be used to control expression of the ligand include, but are not limited to the long terminal repeat as described in Squinto et al., (Cell 65:1-20 (1991)); the SV40 early promoter region (Bernoist and Chambon, Nature 290:304-310), the CMV promoter, the M-MuLV 5' terminal repeat, the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al., Cell 22:787-797 (1980)), the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:144- 1445 (1981)), the adenovirus promoter, the regulatory sequences of the metallothionein gene (Brinster et al., Nature 296:39-42 (1982)); prokaryotic expression vectors such as the p-lactamase promoter (Villa-Kamaroff, et al., Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731 o (1978)), or the tac promoter (DeBoer, et al., Proc. Natl. Acad. Sci. U.S.A 80.:21-25 (1983)), see also "Useful proteins from recombinant bacteria" in Scientific American, 242:74-94 (1980); promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADH (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) "1 5 promoter, alkaline phosphatase promoter, and the following animal S transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals; elastase I gene control region which is active in pancreatic acinar cells (Swift et al., Cell 38:639- 646 (1984); Ornitz et al., Cold Spring Harbor Symp. Quant. Biol. 50:399- 409 (1986); MacDonald, Hepatology 7:425-515 (1987); insulin gene control region which is active in pancreatic beta cells [Hanahan, Nature 315:115-122 (1985)]; immunoglobulin gene control region which is active in lymphoid cells (Grosschedl et al., 1984, Cell 38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et al., 1987, Genes and Devel.

1:268-276), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al., 1987, Science 235:53-58); alpha 1-antitrypsin gene control region which is active in the liver (Kelsey et al, 1987, Genes and Devel.

1:161-171), beta-globin gene control region which is active in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94); myelin basic protein gene control region which is active in oligodendrocytes in the brain (Readhead et al., 1987, Cell 48:703-712); myosin light chain-2 gene control region which is active in skeletal mus9le (Shani, 1985, Nature 314:283-286), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al., 1986, Science 234:1372-1378). The invention further encompasses the production of antisense compounds which are capable of specifically hybridizing with a sequence of RNA 1 5 encoding a modified TIE-2 ligand to modulate its expression. Ecker, U.S. Patent No. 5,166,195, issued November 24, 1992.

Thus, according to the invention, expression vectors capable of being replicated in a bacterial or eukaryotic host comprising a nucleic acid encoding a modified TIE-2 ligand as described herein, are used to 20 transfect a host and thereby direct expression of such nucleic acid to produce a modified TIE-2 ligand, which may then be recovered in a biologically active form. As used herein, a biologically active form includes a form capable of binding to TIE receptor and causing a biological response such as a differentiated function or influencing the phenotype of the cell expressing the receptor. Such biologically active forms could, for example, induce phosphorylation of the tyrosine kinase domain of TIE receptor. Alternatively, the biological activity may be an effect as an antagonist to the TIE receptor. In alternative embodiments, the active form of a modified TIE-2 ligand is one that can recognize TIE receptor and thereby act as a targeting agent for the receptor for use in both diagnostics and therapeutics. In accordance with such embodiments, the active form need not confer upon any TIE expressing cell any change in phenotype.

Expression vectors containing the gene inserts can be identified by four general approaches: DNA-DNA hybridization, presence or absence of "marker" gene functions, expression of inserted sequences and PCR detection. In the first approach, the presence of! 0 a foreign gene ipserted in an expression vector can be detected by DNA-DNA hybridization using probes comprising sequences that are e a °0 homologous to an inserted modified TIE-2 ligand encoding gene. In the second approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "marker" 1 5 gene functions thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in O'.ee baculovirus, etc.) caused by the insertion of foreign genes in the vector. For example, if a nucleic acid encoding a modified TIE-2 ligand 0°° is inserted within the marker gene sequence of the vector, recombinants containing the insert can be identified by the absence of the marker gene function. In the third approach, recombinant expression vectors can be identified by assaying the foreign gene product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of a modified TIE-2 ligand gene product, for example, by binding of the ligand to TIE receptor or a portion thereof which may be tagged with, for example, a detectable antibody or portion thereof or by binding to antibodies produced against the modified TIE-2 ligand protein or a portion thereof. Cells of the present invention may transiently or, preferably, constitutively and permanently express a modified TIE-2 ligand as described herein. In the fourth approach, DNA nucleotide primers can be prepared corresponding to a tie specific DNA sequence. These primers could then be used to PCR a tie gene fragment. (PCR Protocols: A Guide To Methods and Applications, Edited by Michael A. Innis et al., Academic Press (1990)).

The. recombinant ligand may be purified by any technique which allows for the subsequent formation of a stable, biologically active So protein. Preferably, the ligand is secreted into the culture medium from, which it is recovered. Alternatively, the ligand may be recovered from cells either as soluble proteins or as inclusion bodies, from which it may be extracted quantitatively by 8M guanidinium hydrochloride and dialysis in accordance with well known methodology.

1 5 In order to further purify the ligand, affinity chromatography, [conventional ion exchange chromatography, hydrophobic interaction o c chromatography, reverse phase chromatography or gel filtration may be used.

@20 In additional embodiments of the invention, as described in greater detail in the Examples, a modified TIE-2 ligand encoding gene may be used to inactivate or "knock out" an endogenous gene by homologous recombination, and thereby create a TIE ligand deficient cell, tissue, or animal. For example, and not by way of limitation, the recombinant TIE ligand-4 encoding gene may be engineered to contain an insertional mutation, for example the neo gene, which would inactivate the native TIE ligand-4 encoding gene. Such a construct, under the control of a suitable promoter, may be introduced into a cell, such as an embryonic stem cell, by a technique such as transfection, transduction, or injection. Cells containing the construct may then be selected by G418 resistance. Cells which lack an intact TIE ligand-4 encoding gene may then be identified, by Southern blotting, PCR detection, Northern blotting or assay of expression. Cells lacking an intact TIE ligand-4 encoding gene may then be fused to early embryo cells to generate transgenic animals deficient in such ligand. Such an animal may be used to define specific in vivo processes, normally dependent upon the ligand.

o The present invention, also provides for antibodies to a modified S TIE-2 ligand described herein which are useful for detection of the igand in, for example, diagnostic applications. For preparation of monoclonal antibodies directed toward a modified TIE-2 ligand, any technique which provides for the production of antibody molecules by 15 continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495-497), as well as the trioma technique, the human Bcell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, in "Monoclonal Antibodies and Cancer Therapy," Alan R. Liss, Inc. pp. 77-96) and the like are within the scope of the present invention.

The monoclonal antibodies may be human monoclonal antibodies or chimeric human-mouse (or other species) monoclonal antibodies.

Human monoclonal antibodies may be made by any of numerous techniques known in the art Teng et al., 1983, Proc. Natl. Acad.

Sci. U.S.A. 80:7308-7312; Kozbor et al., 1983, Immunology Today 4:72- 79; Olsson et al., 1982, Meth. Enzymol. 92:3-16). Chimeric antibody molecules may be prepared containing a mouse antigen-binding domain with human constant regions (Morrison et al., 1984, Proc. Natl. Acad.

Sci. U.S.A. 81:6851, Takeda et al., 1985, Nature 314:452).

Various procedures known in the art may be used for the production of polyclonal antibodies to epitopes of a modified TIE-2 ligand described herein. For the production of antibody, various host animals, including but not limited to rabbits, mice and rats can be immunized by injection with a modified TIE-2 ligand, or a fragment or derivative thereof. Various adjuvants may be used to increase the immunological response, depending on the host species, and including/ bul-not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful 1 5 human adjuvants such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum.

o A molecular clone of an antibody to a selected a modified TIE-2 ligand epitope can be prepared by known techniques. Recombinant DNA methodology (see Maniatis et al., 1982, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York) may be used to construct nucleic acid sequences which encode a monoclonal antibody molecule, or antigen binding region thereof.

The present invention provides for antibody molecules as well as fragments of such antibody molecules. Antibody fragments which contain the idiotype of the molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab') 2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. Antibody molecules may be purified by known techniques, immunoabsorption or immunoaffinity chromatography, chromatographic methods such as HPLC (high performance liquid chromatography), or a combination thereof.

The present invention further encompasses an immunoassay for measuring the amount of a modified TIE-2 ligand in a biological sample io by

I

a 1 5 20 a) contacting the biological sample with at least one antibody which specifically binds a modified TIE-2 ligand so that the antibody forms a complex with any modified TIE-2 ligand present in the sample; and b) measuring the amount of the complex and thereby measuring the amount of the modified TIE-2 ligand in the biological sample.

The invention further encompasses an assay for measuring the amount of TIE receptor in a biological sample by a) contacting the biological sample with at least one ligand of the invention so that the ligand forms a complex with the TIE receptor; and b) measuring the amount of the complex and thereby measuring the amount of the TIE receptor in the biological sample.

The present invention also provides for the utilization of a modified TIE-2 ligand which activates the TIE-2 receptor as described herein, to support the survival and/or growth and/or migration and/or differentiation of TIE-2 receptor expressing cells. Thus, the ligand may be used as a supplement to support, for example, endothelial cells in culture.

Further, the creation by applicants of a modified TIE-2 ligand for the TIE-2 receptor enables the utilization of assay systems useful for the identification of agonists or antagonists of the TIE-2 receptor.

Such assay systems would be useful in identifying molecules capable of promoting or inhibiting angiogenesis. For example, in one embodiment, antagonists of the TIE-2 receptor may be identified as 110 test molecules that are capable of interfering with the interaction of/ the, TIE-2 receptor with a modified TIE-2 ligand that binds the TIE-2 receptor. Such antagonists are identified by their ability to 1) block the binding of a biologically active modified TIE-2 ligand to the S receptor as measured, for example, using BIAcore biosensor technology 1 5 (BIAcore; Pharmacia Biosensor, Piscataway, NJ); or 2) block the ability .of a biologically active modified TIE-2 ligand to cause a biological response. Such biological responses include, but are not limited to, phosphorylation of the TIE receptor or downstream components of the TIE signal transduction pathway, or survival, growth or differentiation of TIE receptor bearing cells.

In one embodiment, cells engineered to express the TIE receptor, may be dependent for growth on the addition of a modified TIE-2 ligand. Such cells provide useful assay systems for identifying additional agonists of the TIE receptor, or antagonists capable of interfering with the activity of the modified TIE-2 ligand on such cells. Alternatively, autocrine cells, engineered to be capable of coexpressing both a modified TIE-2 ligand and receptor, may provide useful systems for assaying potential agonists or antagonists.

Therefore, the present invention provides for introduction of a TIE-2 receptor into cells that do not normally express this receptor, thus allowing these cells to exhibit profound and easily distinguishable responses to a ligand which binds this receptor. The type of response elicited depends on the cell utilized, and not the specific receptor introduced into the cell. Appropriate cell lines can be chosen to yield a response of the greatest utility for assaying, as well as discovering, molecules that can act on tyrosine kinase receptors. The molecules may be any type of molecule, including but 0o not limited to peptide and non-peptide molecules, that will act in systems to be described in a receptor specific manner.

One of the more useful systems to be exploited involves the introduction of a TIE receptor (or a chimeric receptor comprising the extracellular domain of another receptor tyrosine kinase such as, for 1 s example, trkC and the intracellular domain of a TIE receptor) into a fibroblast cell line NIH3T3 cells) thus such a receptor which does not normally mediate proliferative or other responses can, following introduction into fibroblasts, nonetheless be assayed by a variety of well established methods to quantitate effects of fibroblast growth 20 factors thymidine incorporation or other types of proliferation assays; see van Zoelen, 1990, "The Use of Biological Assays For Detection Of Polypeptide Growth Factors" in Progress Factor Aesearch, Vol. 2, pp. 131-152; Zhan and M. Goldfarb, 1986, Mol. Cell. Biol., Vol. 6, pp. 3541-3544). These assays have the added advantage that any preparation can be assayed both on the cell line having the introduced receptor as well as the parental cell line lacking the receptor; only specific effects on the cell line with the receptor would be judged as being mediated through the introduced receptor. Such cells may be further engineered to express a modified TIE-2 ligand, thus creating an autocrine system useful for assaying for molecules that act as antagonists/agonists of this interaction. Thus, the present invention provides for host cells comprising nucleic acid encoding a modified TIE-2 ligand and nucleic acid encoding TIE receptor.

The TIE receptor/modified TIE-2 ligand interaction also provides a useful system for identifying small molecule agonists or antagonists of the TIE.receptor. For example, fragments, mutants or derivatives of a modified TIE-2 ligand may be identified that bind TIE receptor but do 1 0 not induce any./other biological activity. Alternatively, the characterization of a modified TIE-2 ligand enables the further characterization of active portions of the molecule. Further, the identification of a ligand enables the determination of the X-ray crystal structure of the receptor/ligand complex, thus enabling 1 5 identification of the binding site on the receptor. Knowledge of the binding site will provide useful insight into the rational design of novel agonists and antagonists.

The specific binding of a test molecule to TIE receptor may be measured in a number of ways. For example, the actual binding of test molecule to cells expressing TIE may be detected or measured, by detecting or measuring test molecule bound to the surface of intact cells; (ii) test molecule cross-linked to TIE protein in cell lysates; or (iii) test molecule bound to TIE in vitro. The specific interaction between test molecule and TIE may be evaluated by using reagents that demonstrate the unique properties of that interaction.

As a specific, nonlimiting example, the methods of the invention may be used as follows. Consider a case in which a modified TIE-2 ligand in a sample is to be measured. Varying dilutions of the sample (the test molecule), in parallel with a negative control (NC) containing no modified TIE-2 ligand activity, and a positive control (PC) containing a known amount of a modified TIE-2 ligand, may be exposed to cells that express TIE in the presence of a detectably labeled modified TIE-2 ligand (in this example, radioiodinated ligand). The amount of modified TIE-2 ligand in the test sample may be evaluated by determining the amount of 2 5 1-labeled modified TIE-2 ligand that binds to the controls and in each of the dilutions, and then comparing the sample values to a standard curve. The more modified TIE-2 ligand q o in the sample, the less 12 5 1-ligand that will bind to TIE.

S. The amount of 1 2 5 1-ligand bound may be determined by measuring the amount of radioactivity per cell, or by cross-linking a modified TIE-2 ligand to cell surface proteins using DSS, as described in Meakin and Shooter, 1991, Neuron 6:153-163, and detecting the amount of 5 labeled protein in cell extracts using, for example, SDS polyacrylamide gel electrophoresis, which may reveal a labeled protein having a size corresponding to TIE receptor/modified TIE-2 ligand. The specific test molecule/TIE interaction may further be tested by adding to the assays various dilutions of an unlabeled control ligand that does not bind the 20 TIE receptor and therefore should have no substantial effect on the competition between labeled modified TIE-2 ligand and test molecule for TIE binding. Alternatively, a molecule known to be able to disrupt TIE receptor/modified TIE-2 ligand binding, such as, but not limited to, anti-TIE antibody, or TIE receptorbody as described herein, may be expected to interfere with the competition between 12 5 1-modified TIE- 2 ligand and test molecule for TIE receptor binding.

Detectably labeled modified TIE-2 ligand includes, but is not limited to, a modified TIE-2 ligand linked covalently or noncovalently to a radioactive substance, a fluorescent substance, a substance that has enzymatic activity, a substance that may serve as a substrate for an enzyme (enzymes and substrates associated with colorimetrically detectable reactions are preferred) or to a substance that can be recognized by an antibody molecule that is preferably a detectably labeled antibody molecule.

Alternatively, the specific binding of test molecule to TIE may be measured by evaluating the secondary biological effects of a modified TIE-2 ligand/TIE receptor binding, including, but not limited to, cell growth /and/or differentiation or immediate early gene expr.ession or phosphorylation of TIE. For example, the ability of the test molecule to induce differentiation can be tested in cells that lack r" tie and in comparable cells that express tie; differentiation in tie- 1o expressing cells but not in comparable cells that lack tie would be indicative of a specific test molecule/TIE interaction. A similar oo analysis could be performed by detecting immediate early gene (e.g.

fos and ujn) induction in tie-minus and tie-plus cells, or by detecting phosphorylation of TIE using standard phosphorylation assays known in the art. Such analysis might be useful in identifying agonists or 20 antagonists that do not competitively bind to TIE.

Similarly, the present invention provides for a method of identifying a molecule that has the biological activity of a modified TIE-2 ligand comprising exposing a cell that expresses' tie to a test molecule and (ii) detecting the specific binding of the test molecule to TIE receptor, in which specific binding to TIE positively correlates with TIE-like activity. Specific binding may be detected by either assaying for direct binding or the secondary biological effects of binding, as discussed supra. Such a method may be particularly useful in identifying new members of the TIE ligand family or, in the pharmaceutical industry, in screening a large array of peptide and nonpeptide molecules peptidomimetics) for TIE associated biological activity. In a preferred, specific, nonlimiting embodiment of the invention, a large grid of culture wells may be prepared that contain, in alternate rows, PC12 (or fibroblasts, see infra) cells that are either tie-minus or engineered to be tie-plus. A variety of test molecules may then be added such that each column of the grid, or a portion thereof, contains a different test molecule. Each well could then be So scored for the presence or absence of growth and/or differentiation.

An extremely large number of test molecules could be screened for such activity in this manner.

In additional embodiments, the invention provides for methods of detecting or measuring TIE ligand-like activity or identifying a 1 5 molecule as having such activity comprising exposing a test molecule to a TIE receptor protein in vitro under conditions that permit binding to occur and (ii) detecting binding of the test molecule •00 to the TIE receptor protein, in which binding of test molecule to TIE 9900 receptor correlates with TIE ligand-like activity. According to. such 20 methods, the TIE receptor may or may not be substantially purified, may be affixed to a solid support as an affinity column or as an ELISA assay), or may be incorporated into an artificial membrane.

Binding of test molecule to TIE receptor may be evaluated by any method known in the art. In preferred embodiments, the binding of test molecule may be detected or measured by evaluating its ability to compete with detectably labeled known TIE ligands for TIE receptor binding.

The present invention also provides for a method of detecting the aomIiy OT a test molecule to Tunction as an antagonist oT I It tiganalike activity comprising detecting the ability of the molecule to inhibit an effect of TIE ligand binding to TIE receptor on a cell that expresses the receptor. Such an antagonist may or may not interfere with TIE receptor/modified TIE-2 ligand binding. Effects of a modified TIE-2 ligand binding to TIE receptor are preferably biological or biochemical effects, including, but not limited to, cell survival or proliferation, cell transformation, immediate early gene induction, or TIE phosphorylation.

1 0 The invention further provides for both a method of identifying antibodies or other molecules capable of neutralizing the ligand or blocking binding to the receptor, as well as the molecules identified by the method. By way of nonlimiting example, the method may be a performed via an assay which is conceptually similar to an ELISA 1 5 assay. For example, TIE receptorbody may be bound to a solid support, such as a plastic multiwell plate. As a control, a known amount of a modified TIE-2 ligand which has been Myc-tagged may then be introduced to the well and any tagged modified TIE-2 ligand which binds the receptorbody may then be identified by means of a reporter antibody directed against the Myc-tag. This assay system may then be used to screen test samples for molecules which are capable of i) binding to the tagged ligand or ii) binding to the receptorbody and thereby blocking binding to the receptorbody by the tagged ligand. For example, a test sample containing a putative molecule of interest together with a known amount of tagged ligand may be introduced to the well and the amount of tagged ligand which binds to the receptorbody may be measured. By comparing the amount of bound tagged ligand in the test sample to the amount in the control, samples containing molecules which are capable of blocking ligand binding to the receptor may be identified. The molecules of interest thus identified may be isolated using methods well known to one of skill in the art.

Once a blocker of ligand binding is found, one of skill in the art would know to perform secondary assays to determine whether the blocker is binding to the receptor or to the ligand, as well as assays to determine if the blocker molecule can neutralize the biological activity of the ligand. For example, by using a binding assay which o employs BlAcore biosensor technology (or the equivalent), in which z either TIE receptorbody or a modified T1E-2 ligand or ligandbody is covalently attached to a solid support carboxymethyl dextran on a gold surface), one of skill in the art would be able to determine if the blocker molecule is binding specifically to the ligand, ligandbody or to 1 5 the receptorbody. To determine if the blocker molecule can neutralize the biological activity of the ligand, one of skill in the art could perform a phosphorylation assay (see Example 5) or alternatively, a functional bioassay, such as a survival assay, by using primary cultures of, for example, endothelial cells. Alternatively, a blocker o molecule which binds to the receptorbody could be an agonist and one of skill in the art would know to how to determine this by performing an appropriate assay for identifying additional agonists of the TIE receptor.

In addition, the invention further contemplates compositions wherein the TIE ligand is the receptor binding domain of a TIE-2 ligand described herein. For example, TIE-2 ligand 1 contains a "coiled coil" domain (beginning at the 5' end and extending to the nucleotide at about position 1160 of Figure 4 and about position 1157 of Figure and a fibrinogen-like domain (which is encoded by the nucleotide sequence of Figure 4 beginning at about position 1161 and about position 1158 of Figure The fibrinogen-like domain of TIE-2 ligand 2 is believed to begin on or around the same amino acid sequence as in ligand 1 (FRDCA) which is encoded by nucleotides beginning around 1197 of Figure 6. The fibrinogen-like domain of TIE ligand-3 is believed to begin on or around the amino acid sequence which is encoded by nucleotides beginning around position 929 as set forth in Figure 21. Multimerization of the coiled coil domains during 1 production of the ligand hampers purification. As described in Example 19,, Applicants have discovered, however, that the fibrinogen-like domain comprises the TIE-2 receptor binding domain. The monomeric forms of the fibrinogen-like domain do not, however, appear to bind the receptor. Studies utilizing myc-tagged fibrinogen-like domain, *1 5 which has been "clustered" using anti-myc antibodies, do bind the TIE- 2 receptor. [Methods of production of "clustered ligands and ligandbodies are described in Davis, et al. Science 266:816-819 (1994)]. Based on these finding, applicants produced ."ligandbodies" o. which comprise the fibrinogen-like domain of the TIE-2 ligands 20 coupled to the Fc domain of IgG These ligandbodies, which Sform dimers, efficiently bind the TIE-2 receptor. Accordingly, the present invention contemplates the production of modified TIE ligandbodies which may be used as targeting. agents, .in diagnostics or in therapeutic applications, such as targeting agents for tumors and/or associated vasculature wherein a TIE antagonist is indicated.

The invention herein further provides for the development of the ligand, a fragment or derivative thereof, or another molecule which is a receptor agonist or antagonist, as a therapeutic for the treatment of patients suffering from disorders involving cells, tissues or organs which express the TIE receptor. Such molecules may be used in a method of treatment of the human or animal body, or in a method of diagnosis.

Because TIE receptor has been identified in association with endothelial cells and, as demonstrated herein, blocking of TIE-2 ligand 1 appears to prevent vascularization, applicants expect that a modified TIE-2 ligand described herein may be useful for the induction of vascularization in diseases or disorders where such vascularization *o is indicated. Such diseases or disorders would include wound healing, ischaemia and diabetes. The ligands may be tested in animal models' and used therapeutically as described for other agents, such as vascular endothelial growth factor (VEGF), another endothelial cellspecific factor that is angiogenic. Ferrara, et al. U.S. Patent No.

5,332,671 issued July 26, 1994. The Ferrara reference, as well as S other studies, describe in vitro and in vivo studies that may be used to demonstrate the effect of an angiogenic factor in enhancing blood flow to ischemic myocardium, enhancing wound healing, and in other therapeutic settings wherein neoangiogenesis is desired. [see Sudo, et oo al. European Patent Application 0 550 296 A2 published July.7, 1993; Banal, et al. Circulation 89:2183-2189 (1994); Unger, et al. Am. J.

Physiol. 266:H1588-H1595 (1994); Lazarous, et al. Circulation 91:145- 153 (1995)]. According to the invention, a modified TIE-2 ligand may be used alone or in combination with one or more additional pharmaceutically active compounds such as, for example, VEGF or basic fibroblast growth factor (bFGF), as well as cytokines, neurotrophins, etc.

Conversely, antagonists of the TIE receptor, such as modified TIE-2 ligands which bind but do not activate the receptor as described herein, receptorbodies as described herein in Examples 2 and 3, and TIE-2 ligand 2 as described in Example 9, would be useful to prevent or attenuate vascularization, thus preventing or attenuating, for example, tumor growth. These agents may be used alone or in combination with other compositions, such as anti-VEGF antibodies, that have been shown to be useful in treating conditions in which the therapeutic intent is to block angiogenesis. Applicants expect that a modified TIE-2 ligand described herein may also be used in combination with agents, such as cytokine antagonists such as IL-6 antagonists, that areknown to block inflammation.

o*o .For example, applicants have determined that TIE ligands are expressed in cells within, or closely associated with, tumors. For example, TIE-2 ligand 2 appears to be tightly associated with tumor mo 15 endothelial cells. Accordingly, it and other TIE antagonists may also be useful in preventing or attenuating, for example, tumor growth. In addition, TIE ligands or ligandbodies may be useful for the delivery of toxins to a receptor bearing cell. Alternatively, other molecules, such as growth factors, cytokines or nutrients, may be delivered to a TIE receptor bearing cell via TIE ligands or ligandbodies. TIE ligands or 2 ligandbodies such as modified TIE-2 ligand described herein may also be used as diagnostic reagents for TIE receptor, to detect the receptor in vivo or in vitro. Where the TIE receptor is associated with a disease state, TIE ligands or ligandbodies such as a modified TIE-2 ligand may be useful as diagnostic reagents for detecting the disease by, for example, tissue staining or whole body imaging. Such reagents include radioisotopes, flurochromes, dyes, enzymes and biotin. Such diagnostics or targeting agents may be prepared as described in Alitalo, et al. WO 95/26364 published October 5, 1995 and Burrows, F.

and P. Thorpe, PNAS (USA) 90:8996-9000 (1993) which is incorporated herein in its entirety.

In other embodiments, the TIE ligands, a receptor activating modified TIE-2 ligand described herein are used as hematopoietic factors. A variety of hematopoietic factors and their receptors are involved in the proliferation and/or differentiation and/or migration of the various cells types contained within blood. Because the TIE receptors are expressed in early hematopoietic cells, the TIE ligands are expected to play a comparable role in the proliferation or differentiation or migration of these cells. Thus, for example, TIE containing compositions may be prepared, assayed, examined in in S vitro and in vivo biological systems and used therapeutically as described in any of the following: Sousa, U.S. Patent No. 4,810,643, 1 5 Lee, et al., Proc. Natl. Acad. Sci. USA 82:4360-4364 (1985) Wong, et al.

Science, 228:810-814 (1985); Yokota, et ai. Proc. Natl. Acad. Sci (USA) 81:1070 (1984); Bosselman, et al. WO 9105795 published May 2, 1991 entitled "Stem Cell Factor" and Kirkness, et al. WO 95/19985 published July 27, 1995 entitled "Haemopoietic Maturation Factor".

Accordingly, receptor activating modified TIE-2 ligand may be used to diagnose or treat conditions in which normal hematopoiesis is suppressed, including, but not limited to anemia, thrombocytopenia, leukopenia and granulocytopenia. In a preferred. embodiment, receptor activating modified TIE-2 ligand may be used to stimulate differentiation of blood cell precursors in situations where a patient has a disease, such as acquired immune deficiency syndrome (AIDS) which has caused a reduction in normal blood cell levels, or in clinical settings in which enhancement of hematopoietic populations is aesired, such as in conjunction with bone marrow transplant, or in the treatment of aplasia or myelosuppression caused by radiation, chemical treatment or chemotherapy.

The receptor activating modified TIE-2 ligands of the present invention may be used alone, or in combination with another pharmaceutically active agent such as, for example, ctyokines, neurotrophins, interleukins, etc. In a preferred embodiment, the ligands may be used in conjunction with any of a number of the above referenced factors which are known to induce stem cell or other hematopoietic precursor proliferation, or factors acting on later cells in the hematopoietic pathway, including, but not limited to, hemopoietic maturation factor, thrombopoietin, stem cell factor, erythropoietin, G-CSF, GM-CSF, etc.

In an alternative embodiment, TIE receptor antagonists are used 1 5 to diagnose or treat patients in which the desired result is inhibition of a hematopoietic pathway, such as for the treatment of myeloproliferative or other proliferative disorders of blood forming organs such as thrombocythemias, polycythemias and leukemias. In such embodiments, treatment may comprise use of a therapeutically effective amount of the a modified TIE-2 ligand, TIE antibody, TIE receptorbody, a conjugate of a modified TIE-2 ligand, or a ligandbody or fFC as described herein.

The present invention also provides for pharmaceutical compositions comprising a modified TIE-2 ligand or ligandbodies described herein, peptide fragments thereof, or derivatives in a pharmacologically acceptable vehicle. The modified TIE-2 ligand proteins, peptide fragments, or derivatives may be administered systemically or locally. Any appropriate mode of administration known in the art may be used, including, but not limited to, intravenous, intrathecal, intraarterial, intranasal, oral, subcutaneous, intraperitoneal, or by local injection or surgical implant. Sustained release formulations are also provided for.

The present invention also provides for an antibody which specifically binds such a therapeutic molecule. The antibody may be monoclonal or polyclonal. The invention also provides for a method of using such a monoclonal or polyclonal antibody to measure the amount of the therapeutic molecule in a sample taken from a patient for purposes of monitoring the course of therapy.

The invention further provides for a therapeutic composition comprising a modified TIE-2 ligand or ligandbody and a cytotoxic agent conjugated thereto. In one embodiment, the cytotoxic agent may be a radioisotope or toxin.

1 5 The invention also provides for an antibody which specifically binds a modified TIE-2 ligand. The antibody may be monoclonal or polyclonal.

The invention further provides for a method of purifying a modified TIE-2 ligand comprising: o0 a) coupling at least one TIE binding substrate to a solid matrix; b) incubating the substrate of a) with a cell lysate so that the substrate forms a complex with any modified TIE-2 ligand in the cell lysate; c) washing the solid matrix; and d) eluting the modified TIE-2 ligand from the coupled substrate.

ine suustrate may oe any suosiance tnat speciricaiiy oinas the modified TIE-2 ligand. In one embodiment, the substrate is selected from the group consisting of anti-modified TIE-2 ligand antibody, TIE receptor and TIE receptorbody. The invention further provides for a receptorbody which specifically binds a modified TIE-2 ligand, as well as a therapeutic composition comprising the receptorbody in a pharmaceutically acceptable vehicle, and a method of blocking blood vessel growth in a human comprising administering an effective amount of the therapeutic composition.

The invention also provides for a therapeutic composition comprising a receptor activating modified TIE-2 ligand or ligandbody in a pharmaceutically acceptable vehicle, as well 'as a method of promoting neovascularization in a patient comprising administering to the patient an effective amount of the therapeutic composition.

5 In addition, the present invention provides for a method for identifying a cell which expresses TIE receptor which comprises contacting a cell with a detectably labeled modified TIE-2 ligand or ligandbody, under conditions permitting binding of the detectably labeled ligand to the TIE receptor and determining whether the detectably labeled ligand is bound to the TIE receptor, thereby identifying the cell as one which expresses TIE receptor. The present invention also provides for a therapeutic composition comprising a modified TIE-2 ligand or ligandbody and a cytotoxic agent- conjugated thereto. The cytotoxic agent may be a radioisotope or toxin.

The invention also provides a method of detecting expression of a modified TIE-2 ligand by a cell which comprises obtaining mRNA from the cell, contacting the mRNA so obtained with a labeled nucleic acid molecule encoding a modified TIE-2 ligand, under hybridizing conditions, determining the presence of mRNA hybridized to the labeled molecule, and thereby detecting the expression of a modified TIE-2 ligand in the cell.

The invention further provides a method of detecting expression of a modified TIE-2 ligand in tissue sections which comprises contacting the tissue sections with a labeled nucleic acid molecule encoding a modified TIE-2 ligand, under hybridizing conditions, determining the presence of mRNA hybridized to the labelled molecule, and thereby detecting the expression of a modified TIE-2 ligand in 0 tissue sections.

EXAMPLE 1 IDENTIFICATION OF THE ABAE CELL LINE AS REPORTER CELLS FOR THE TIE-2 RECEPTOR Adult BAE cells are registered in the European Cell Culture 1 5 Repository, under ECACC#92010601. (See PNAS 75:2621 (1978)).

Northern (RNA) analyses revealed moderate levels of tie-2 transcripts in the ABAE (Adult Bovine Arterial Endothelial) cell line, consistent with in situ hybridization results that demonstrated almost exclusive localization of tie-2 RNAs to vascular endothelial cells. We therefore :.920 examined ABAE cell lysates for the presence of TIE-2 protein, as well as the extent to which this TIE-2 protein is tyrosine-phosphorylated under normal versus serum-deprived growth conditions. ABAE cell lysates were harvested and subjected to immunoprecipitation, followed by Western blot analyses of immunoprecipitated proteins with TIE-2 specific and phosphotyrosine-specific antisera. Omission or inclusion of TIE-2 peptides as specific blocking molecules during TIE-2 immunoprecipitation allowed unambiguous identification of TIE- 2 as a moderately detectable protein of -150 kD whose steady-state r r phosphotyrosine levels diminish to near undetectable levels by prior serum-starvation of the cells.

Culture of ABAE cells and harvest of cell lysates was done as follows. Low-passage-number ABAE cells were plated as a monolayer at a density of 2 x 106 cells/150mm plastic petri plate (Falcon) and cultured in Dulbecco's modified Eagle's medium (DMEM) containing bovine calf serum (10 BCS), 2 mM L-glutamine and 1% each of penicillin and streptomycin in an atmosphere of 5% CO2. Prior to harvest of cell lysates, cells were serum-starved for 24 hours in 1 o DMEM/Q/P-S, followed by aspiration of the medium and rinsing of the, plates with ice-cold phosphate buffered saline (PBS) supplemented with sodium orthovanadate, sodium fluoride and sodium benzamidine.

Cells were lysed in a small volume of this rinse buffer that had been supplemented with 1% NP40 detergent and the protease inhibitors 1 5 PMSF and aprotinin. Insoluble debris was removed from the cell lysates by centrifugation at 14,000 xG for 10 minutes, at 4°C and the supernatants were subjected to immunoprecipitation with antisera specific for TIE-2 receptor, with or without the presence of blocking peptides added to -20 tg/ml lysate. Immunoprecipitated proteins were resolved by PAGE Laemmli gel), and then electrotransferred to PVDF membrane and incubated either with various TIE-, 2- or phosphotyrosine-specific antisera. TIE-2 protein was visualized by incubation of the membrane with HRP-linked secondary antisera followed by treatment with ECL reagent (Amersham).

r r ~i EXAMPLE 2 CLONING AND EXPRESSION OF TIE-2 RECEPTORBODY FOR AFFINITY-BASED STUDY OF TIE-2 LIGAND

INTERACTIONS

An expression construct was created that would yield a secreted protein consisting of the entire extracellular portion of the rat TIE-2 receptor fused to the human immunoglobulin gamma-1 constant region (IgG1 Fc). This fusion protein is called a TIE-2 "receptorbody" (RB), and would be normally expected to exist as a dimer in solution based on formation of disulfide linkages between individual IgG1 Fc tails.

The Fc portion of the TIE-2 RB was prepared as follows. A DNA 'o fragment encoding the Fc portion of human IgG1 that spans from the hinge region to the carboxy-terminus of the protein, was amplified from human placental cDNA by PCR with oligonucleotides corresponding to the published sequence of human IgG1; the resulting DNA fragment was cloned in a plasmid vector. Appropriate DNA 5 restriction fragments from a plasmid encoding the full-length TIE-2 receptor and from the human IgG1 Fc plasmid were ligated on either side of a short PCR-derived fragment that was designed so as to fuse, in-frame, the TIE-2 and human IgG1 Fc protein-coding sequences.

Thus, the resulting TIE-2 ectodomain-Fc fusion protein precisely 0 substituted the IgG1 Fc in place of the region spanning the TIE-2 transmembrane and cytoplasmic domains. An alternative method of preparing RBs is described in Goodwin, et. al. Cell 73:447-456 (1993).

Milligram quantities of TIE-2 RB were obtained by cloning the TIE-2 RB DNA fragment into the pVL1393 baculovirus vector and subsequently infecting the Spodoptera frugiperda SF-21AE insect cell line. Alternatively, the cell line SF-9 (ATCC Accession No. CRL-1711) or the cell line BTI-TN-5bl-4 may be used. DNA encoding the TIE-2 RB was cloned as an Eco RI-Notl fragment into the baculovirus transfer plasmid pVL1393. Plasmid DNA purified by cesium chloride density gradient centrifugation was recombined into viral DNA by mixing 3 .tg of plasmid DNA with 0.5 pg of Baculo-Gold DNA (Pharminigen), followed by introduction into liposomes using 30ipg Lipofectin (GIBCO- BRL). DNA-liposome mixtures were added to SF-21AE cells (2x 106 dish) in TMN-FH medium (Modified Grace's Insect Cell Medium (GIBCO-BRL) for 5 hours at 27'C, followed by incubation at 27'C for 5 days in TMN-FH medium supplemented with 5% fetal calf serum. Tissue culture medium was harvested for plaque purification of recombinant, viruses, which was carried out using methods previously described (O'Reilly, L.K. Miller, and V.A. Luckow, Baculovirus Expression Vectors A Laboratory Manual. 1992, New York: W.H. Freeman) except that the agarose overlay contained 125 gg/mL X- *gal (5-bromo-4-chloro-3-indolyl-3-D-galactopyranoside;

GIBCO-BRL).

1 5 After 5 days of incubation at 27'C, non-recombinant plaques were scored by positive chromogenic reaction to the X-gal substrate, and their positions marked. Recombinant plaques were then visualized by addition of a second overlay containing 100 i.g/mL MTT 9 dimethylthiazol-2-yl]2,5,diphenyltetrazolium bromide; Sigma).

20 Putative recombinant virus plaques were picked by plug aspiration, and purified by multiple rounds of plaque isolation to assure homogeneity.

Virus stocks were generated by serial, low-multiplicity passage of plaque-purified virus. Low passage stocks of one virus clone (vTIE-2 receptorbody) were produced.

SF-21AE cells were cultured in serum free medium (SF-900 II, Gibco BRL) containing 1X antibiotic/antimycotic solution (Gibco BRL) and 25 mg/L Gentamycin (Gibco BRL). Pluronic F-68 was added as a surfactant to a final concentration of 1g/L. Cultures (4L) were raised in a bioreactor (Artisan Cell Station System) for at least three days prior to infection. Cells were grown at 27°C, with gassing to 50 dissolved oxygen, at a gas flow rate of 80 mL/min (aeration at a sparge ring). Agitation was by means of a marine impeller at a rate of 100 rpm. Cells were harvested in mid-logarithmic growth phase (-2 6 cells/mL), concentrated by centrifugation, and infected with plaque forming units of vTIE-2 receptorbody per cell. Cells and inoculum were brought to 400mL with fresh medium, and virus was o adsorbed for 2 hours at 27'C in a spinner flask. The culture was then.' resuspended in a final volume of 8L with fresh serum-free medium, and the cells incubated in the bioreactor using the previously described conditions.

Culture medium from vTIE-2 receptorbody-infected SF21AE cells 5 were collected by centrifugation (500x g, 10 minutes) at 72 hours post-infection. Cell supernatants were brought to pH -8 with NaOH.

EDTA was added to a final concentration of 10 mM and the supernatant pH was readjusted to 8. Supernatants were filtered (0.45 um, Millipore) and loaded on a protein A column (protein A sepharose 4 fast flow or HiTrap protein A, both from Pharmacia). The column was washed with PBS containing 0.5 M NaCI until the absorbance at 280 nm, decreased to baseline. The column was washed in PBS and eluted with M acetic acid. Column fractions were immediately neutralized by eluting into tubes containing 1 M Tris pH 9. The peak fractions containing the TIE-2 receptorbody were pooled and dialyzed versus

PBS.

EXAMPLE 3 DEMONSTRATION THAT TIE-2 HAS A CRITICAL ROLE IN DEVELOPMENT OF THE VASCULATURE Insight into the function of TIE-2 was gained by introduction of "excess" soluble TIE-2 receptorbody (TIE-2 RB) into a developing system. The potential ability of TIE-2 RB to bind, and thereby neutralize, available TIE-2 ligand could result in an observable disruption of normal vascular development and characterization of the ligand. To examine whether TIE-2 RB could be used to disrupt vascular 1 0 development in ,early chick embryos, small pieces of a biologically resorbable foam were soaked with TIE-2 RB and inserted immediately beneath the chorioallantoic membrane at positions just lateral to. the primitive embryo.

cl Early chicken embryos develop atop the yolk from a small disk of cells that is covered by the chorioallantoic membrane (CAM). The endothelial cells that will come to line the vasculature in the embryo arise from both extra- and intra-embryonic cell sources. Extraembryonically-derived endothelial cells, which provide the major source of endothelial cells in the embryo, originate from accretions of mesenchyme that are situated laterally around the embryo-proper, just underneath the CAM. As these mesenchyme cells mature, they give rise to a common progenitor of both the endothelial and hematopoietic cell lineages, termed the hemangioblast. In turn, the hemangioblast gives rise to a mixed population of angioblasts (the endothelial cell progenitor) and hematoblasts (the pluripotential hematopoietic precursor). Formation of rudiments of the circulatory system begins when endothelial cell progeny segregate to form a one-cell-thick vesicle that surrounds the primitive blood cells. Proliferation and migration of these cellular components eventually produces a vast network of blood-filled microvessels under the CAM that will ultimately invade the embryo to join with limited, intraembryonically-derived vascular elements.

Newly fertilized chicken eggs obtained from Spafas, Inc. (Boston, MA) were incubated at 99.5 0 F, 55 relative humidity. At about 24 hrs.

of development, the egg shell was wiped down with 70% ethanol and a dentist's drill was used to make a 1.5 cm. hole in the blunt apex of each egg. The shell membrane was removed to reveal an air space 1o directly above the embryo. Small rectangular pieces of sterile Gelfoam (Upjohn) were cut with a scalpel and soaked in equal concentrations of either TIE-2- or EHK-1 receptorbody. EHK-1 receptorbody was made as set forth in Example 2 using the EHK-1 extracellular domain instead of the TIE-2 extracellular domain 15 (Maisonpierre et al., Oncogene 8:3277-3288 (1993). Each Gelfoam piece S. absorbed approximately 6 tig of protein in 30 pl. Sterile watchmakers forceps were used to make a small tear in the CAM at a position several millimeters lateral to the primitive embryo. The majority of the piece of RB-soaked Gelfoam was inserted under the CAM and the egg shell was sealed over with a piece of adhesive tape. Other similarly-staged eggs were treated in parallel with RB of the unrelated, neuronally expressed receptor tyrosine kinase, EHK-1 (Maisonpierre et al., Oncogene 8:3277-3288 (1993). Development was allowed to proceed for 4 days and then the embryos were examined by visual inspection. Embryos were removed by carefully breaking the shells in dishes of warmed PBS and carefully cutting away the embryo with surrounding CAM. Of 12 eggs treated with each RB, 6 TIE-2 RB and 5 EHK-1 RB treated embryos had developed beyond the stage observed at the start of the experiment. A dramatic difference was seen between these developed embryos, as shown in Figures 1A and 1B.

Those treated with EHK-1 RB appeared to have developed relatively normally. Four out of five EHK-1 embryos were viable as judged by the presence of a beating heart. Furthermore, the extra-embryonic vasculature, which is visually obvious due to the presence of red blood cells, was profuse and extended several centimeters laterally under the CAM. By contrast, those treated with TIE-2 RB were severely stunted, ranging from 2-5 mm. in diameter, as compared with more O 10 than 10 mm in ,iameter for the EHK-1 RB embryos. All of the TIE-2 RB treated embryos were dead and their CAMs were devoid of blood vessels. The ability of TIE-2 RB to block vascular development in the chicken demonstrates that TIE-2 ligand is necessary for development of the vasculature.

EXAMPLE 4 IDENTIFICATION OF A TIE-2-SPECIFIC BINDING ACTIVITY IN CONDITIONED MEDIUM FROM THE ras ONCOGENE-TRANSFORMED C2C12 MOUSE MYOBLAST CELL LINE 9 Screening of ten-fold-concentrated cell-conditioned media CCM) from various cell lines for the presence of soluble, TIE-2specific binding activity (BIAcore; Pharmacia Biosensor, Piscataway, NJ) revealed binding activity in serum-free medium from oncogenicras-transformed C2C12 cells (C2C12-ras), RAT 2-ras (which is a ras transformed fibroblast cell line), human glioblastoma T98G and the human neuroblastoma cell line known as SHEP-1.

The C2C12-ras 10X CCM originated from a stably transfected line of C2C12 myoblasts that was oncogenically transformed by transfection with the T-24 mutant of H-ras by standard calcium phosphate-based methods. An SV40 based neomycin-resistance expression plasmid was physically linked with the ras expression plasmid in order to permit selection of transfected clones. Resulting G418-resistant ras-C2C12 cells were routinely maintained as a monolayer on plastic dishes in DMEM/glutamine/penicillinstreptomycin supplemented with 10 fetal calf serum (FCS). Serumfree C2C12-ras 10X CCM was made by plating the cells at o confluence in a serum free defined media for 12 hours. [Zhan and Goldfarb, Mol. Cell. Biol. 6: 3541-3544 (1986)); Zhan, et al. Oncogene 1: 369-376 (1987)]. The medium was discarded and replaced with fresh DMEM/Q/P-S for 24 hours. This medium was harvested and cells were re-fed fresh DMEM/Q/P-S, which was also harvested after a further 24 1 5 hours. These CCM were supplemented with the protease inhibitors PMSF (1mM) and aprotinin (10pg/ml), and ten-fold concentrated on sterile size-exclusion membranes (Amicon). TIE-2-binding activity could be neutralized by incubation of the medium with an excess of TIE-2 RB, but not by incubation with EHK-1 RB, prior to BIAcore S' 2 0 analysis.

Binding activity of the 10x CCM was measured using biosensor technology (BIAcore; Pharmacia Biosensor, Piscataway, NJ) which monitors biomolecular interactions in real-time via surface plasmon resonance. Purified TIE-2 RB was covalently coupled through primary amines to the carboxymethyl dextran layer of a CM5 research grade sensor chip (Pharmacia Biosensor; Piscataway, NJ). The sensor chip surface was activated using a mixture of N-hydroxysuccinimide

(NHS)

and N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide (EDC), followed by immobilization of TIE-2 RB (25 lg/mL, pH 4.5) and deactivation of unreacted sites with 1.0 M ethanolamine (pH A negative control surface of the EHK-1 receptorbody was prepared in a similar manner.

The running buffer used in the system was HBS (10 mM Hepes, 3.4 mM EDTA, 150 mM NaCI, 0.005% P20 surfactant, pH The 10x CCM samples were centrifuged for 15 min at 40 C and further clarified using a sterile, low protein-binding 0.45 gm filter (Millipore; Bedford, MA). Dextran (2mg/ml) and P20 surfactant (0.005%) were added to each CCM sample. Aliquots of 40 gL were injected across the immobilized surface (either TIE-2 or EHK-1) at a flow rate of 5 pL/rp i anadthe receptor binding was monitored for 8 min. The binding activity (resonance units, RU) was measured as the difference between a o baseline value determined 30 s prior to the sample injection and a measurement taken at 30 s post-injection. Regeneration of the 1 5 surface was accomplished with one 12-pL pulse of 3 M MgCI 2 The instrument noise level is 20 RU; therefore, any binding activity with a signal above 20 RU may be interpreted as a real interaction with the receptor. For C2C12-ras conditioned media, the ~binding activities were in the range 60-90 RU for the TIE-2 RB :.920 immobilized surface.. For the same samples assayed on a EHK-1 RB immobilized surface, the measured activities were less than 35 RU.

Specific binding to the TIE-2 receptorbody was evaluated by incubating the samples with an excess of either soluble TIE-2 or EHK-1 RB prior to assaying the binding activity. The addition of soluble EHK-1 RB had no effect on the TIE-2 binding activity of any of the samples, while in the presence of soluble TIE-2 binding to the surface is two-thirds less than that measured in the absence of TIE-2. A repeat assay using concentrated C2C12-ras CCM resulted in a four-fold enhancement over background of the TIE-2 specific binding signal.

EXAMPLE 5 C2C12-ras CCM CONTAINS AN ACTIVITY THAT INDUCES TYROSINE PHOSPHORYLATION OF TIE-2

RECEPTOR

C2C12-ras 10X CCM was examined for its ability to induce tyrosine phosphorylation of TIE-2 in ABAE cells. Serum-starved ABAE *o cells were briefly incubated with C2C12-ras CCM, lysed and subjected; to i.mmunoprecipitation and Western analyses as described above.

S Stimulation of serum-starved ABAE cells with serum-free C2C12-ras x10X CCM was done as follows. The medium of ABAE cells starved as described above was removed and replaced with either defined medium 1 5 or 10X CCM that had been pre-warmed to 37°C. After 10 minutes, the media were removed and the cells were twice rinsed on ice with. an excess of chilled PBS supplemented with orthovanadate/NaF/benzamidine. Cell lysis and TIE-2-specific immunoprecipitation was done as described above.

0 ABAE cells incubated for 10 minutes with defined medium o. showed no induction of TIE-2 tyrosine phosphorylation, whereas incubation with C2C12-ras CCM stimulated at least a 100 X increase in TIE-2 phosphorylation. This activity was almost totally depleted by pre-incubation of the C2C12-ras 10X CCM for 90 minutes at room temperature with 13 pg of TIE-2 RB coupled to protein G-Sepharose beads. Medium incubated with protein G Sepharose alone was not depleted of this phosphorylating activity.

EXAMPLE 6 EXPRESSION CLONING OF TIE-2 LIGAND COS-7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS), 1% each of penicillin and streptomycin and 2 mM glutamine in an atmosphere of CO2. The mouse myoblast C2C12 ras cell line was cultured in Eagle's minimal essential medium (EMEM) with 10% FBS, and 2 mM glutamine. Full length mouse TIE-2 ligand cDNA clones were obtained by screening a C2C12 ras cDNA library in the pJFE14 vector expressed in COS cells. This vector, as shown in Figure 2, is a modified version of the vector pSR, (Takebe, et al. 1988, Mol. Cell. Biol. 8:466-472). The 5 library was created using the two BSTX1 restriction sites in the pJFE14 vector.

COS-7 cells were transiently transfected with either the pJFE14 library or control vector by the DEAE-dextran transfection protocol.

Briefly, COS-7 cells were plated at a density of 1.0 x 10 6 cells/100 mm plate 24 hours prior to transfection. For transfection, the cells were cultured in serum-free DMEM .containing 400 tg/ml of DEAEdextran, 1 pM chloroquine, and 2 mM glutamine, and 1 pg of the appropriate DNA for 3-4 hours at 370C in an atmosphere of 5% CO2.

The transfection media was aspirated and replaced with PBS with DMSO for 2-3 min. Following this DMSO "shock", the COS-7 cells were placed into DMEM with 10% FBS, 1% each of penicillin and streptomycin, and 2 mM glutamine for 48 hours.

Because the TIE-2 ligand is secreted it was necessary to permeabilize the cells to detect binding of the receptorbody probe to the ligand. Two days after transfection the cells were rinsed with PBS and then incubated with PBS containing 1.8% formaldehyde for min. at room temperature. Cells were then washed with PBS and incubated for 15 min. with PBS containing 0.1% Triton X-100 and Bovine Calf Serum to permeabilize the cells and block non-specific binding sites.

The screening was conducted by direct localization of staining using a TIE-2 receptorbody which consisted of the extracellular domain of TIE-2 fused to the IgG1 constant region. This receptorbody was prepared as set forth in Example 2. A 100 mm dish of transfected, fixed and permeabilized COS cells was probed by incubating them for o0 30 min with TIE;2 RB. The cells were then washed twice with PBS and incubated for an additional 30 min with PBS/10% Bovine Calf S Serum/anti-human IgG-alkaline phosphatase conjugate. After three PBS washes, cells were incubated in alkaline-phosphatase substrate for 30-60 min. The dish was then inspected microscopically for the 1 5 presence of stained cells. For each stained cell, a small area of cells including the stained cell was scraped from the dish using a plastic pipette tip and plasmid DNA was then rescued and used to electroporate bacterial cells. Single bacterial colonies resulting from the electroporation were picked and plasmid DNA prepared from these colonies was used to transfect COS-7 cells which were probed for TIE- 2 ligand expression as evidenced by binding to TIE-2 receptorbodies.

This allowed identification of single clones coding for TIE-2 ligand.

Confirmation of TIE-2 ligand expression was obtained by phosphorylation of the TIE-2 receptor using the method set forth in Example 5. A plasmid clone encoding the TIE-2 ligand was deposited with the ATCC on October 7, 1994 and designated as "pJFE14 encoding TIE-2 ligand" under ATCC Accession No. 75910.

EXAMPLE 7 ISOLATION AND SEQUENCING OF FULL LENGTH cDNA CLONE ENCODING HUMAN TIE-2 LIGAND A human fetal lung cDNA library in lambda gt-10 (see Figure 3) was obtained from Clontech Laboratories, Inc. (Palo Alto, CA). Plaques were plated at a density of 1.25 x 10 6 /20x20 cm plate, and replica filters taken following standard procedures (Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Ed:, page 8.46, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York).

1 o Isolation of human tie-2 ligand clones was carried out as follows. A 2.2 kb Xhol fragment from the deposited tie-2 ligand clone (ATCC NO. 75910 see Example 6 above) was labeled by random priming to a specific activity of approximately 5xl08cpm/ng.

Hybridization was carried out at 65 0 C in hybridization solution 1 5 containing 0.5 mg/ml salmon sperm DNA. The filters were washed at 65 0 C in 2 x SSC, 0.1 SDS and exposed to Kodak XAR-5 film overnight o at -70 0 C. Positive phage were plaque purified. High titre phage lysates of pure phage were used for isolation of DNA via a Qiagen column using standard techniques (Qiagen, Inc., Chatsworth, CA, 1995 catalog, page 36). Phage DNA was digested with EcoRI to release the cloned cDNA fragment for subsequent subcloning. A lambda phage vector containing human tie-2 ligand DNA was deposited with the ATCC on October 26, 1994 under the designation Xgtl0 encoding htie-2 ligand 1 (ATCC Accession No. 75928). Phage DNA may be subjected directly to DNA sequence analysis by the dideoxy chain termination method (Sanger, et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74: 5463- 5467).

Subcloning of the human tie-2 ligand DNA into a mammalian expression vector may be accomplished as follows. The clone encoding htie-2 ligand 1 contains an EcoRI site located 490 base pairs downstream from the start of the coding sequence for the human TIE-2 ligand. The coding region may be excised using unique restriction sites upstream and downstream of the initiator and stop codons respectively. For example, an Spel site, located 70 bp 5' to the initiator codon, and a Bpu1102i (also known as BIpl) site, located 265 bp 3' to the stop codon, may be used to excise the complete coding region. This may then be subcloned into the pJFE14 cloning vector, 00 using the Xbal (compatible to the Spel overhang) and the PstI sites (the Pstl ,and Bpu1102i sites are both made blunt ended).

The coding region from the clone Xgt10 encoding htie-2 ligand 1 was sequenced using the ABI 373A DNA sequencer and Taq Dideoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Inc., Foster 1 5 City, CA). The nucleotide and deduced amino acid sequence of human TIE-2 ligand from the clone Xgt10 encoding htie-2 ligand 1 is shown in Figure 4.

In addition, full length human tie-2 ligand cDNA clones were obtained by screening a human glioblastoma T98G cDNA library in the pJFE14 vector. Clones encoding human TIE-2 ligand were identified by 1'. DNA hybridization using a 2.2 kb Xhol fragment from the deposited tie-, 2 ligand clone (ATCC NO. 75910) as a probe (see Example.6 above). The coding region was sequenced using the ABI 373A DNA sequencer and Taq Dideoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Inc., Foster City, CA). This sequence was nearly identical to that of clone Xgtl0 encoding htie-2 ligand 1. As shown in Figure 4, the clone encoding htie-2 ligand 1 contains an additional glycine residue which is encoded by nucleotides 1114-1116. The coding sequence of 59 the T98G clone does not contain this glycine residue but otherwise is identical to the coding sequence of the clone Xgt10 encoding htie-2 ligand 1. Figure 5 sets forth the nucleotide and deduced amino acid sequence of human TIE-2 ligand from the T98G clone.

EXAMPLE 8 ISOLATION AND SEQUENCING OF SECOND FULL LENGTH cDNA CLONE A ENCODING HUMAN TIE-2 LIGAND S1 o A humanfetal lung cDNA library in lambda gt-10 (see Figure 3) was obtained from Clontech Laboratories, Inc. (Palo Alto, CA). Plaques were plated at a density of 1.25 x 10 6 /20x20 cm plate, and replica filters taken following standard procedures (Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., page 8.46, Cold Spring 1 5 Harbor Laboratory, Cold Spring Harbor, New York). Duplicate filters were screened at low stringency (2 x SSC, 550 C) with probes made to the human TIE-2 ligand 1 sequence. One of the duplicate filters was probed with a 5' probe, encoding amino acids 25 265 of human TIE-2 ligand 1 as set forth in Figure 4. The second duplicate filter was 20 probed with a 3' probe, encoding amino acids 282 498 of human TIE-2 ligand 1 sequence (see Figure Both probes were hybridized at 550 C o in hybridization solution containing 0.5 mg/ml- salmon sperm DNA.

Filters were washed in 2 x SSC at 550 C and exposed overnight to X-ray film. In addition, duplicate filters were also hybridized at normal stringency (2 x SSC, 650 C) to the full length coding probe of mouse TIE-2 ligand 1 (F3-15, Xhol insert). Three positive clones were picked that fulfilled the following criteria: i. hybridization had not been seen to the full length (mouse) probe at normal stringency, and ii.

hybridization was seen at low stringency to both 5' and 3' probes.

EcoRI digestion of phage DNA obtained from these clones indicated two independent clones with insert sizes of approximately 2.2kb and approximately 1.8 kb. The 2.2kb EcoRI insert was subcloned into the EcoRI sites of both pBluescript KS (Stratagene) and a mammalian expression vector suitable for use in COS cells. Two orientations were identified for the mammalian expression vector. The 2.2kb insert in pBluescript KS was deposited with the ATCC on December 9, 1994 and designated.as pBluescript KS encoding human TIE 2 ligand 2. The start oo site of the TIE-2 ligand 2 coding sequence is approximately 355 base pairs, downstream of the pBluescript EcoRI site.

COS-7 cells were transiently transfected with either the expression vector or control vector by the DEAE-dextran transfection protocol. Briefly, COS-7 cells were plated at a density of 1.0 x 10 6 cells/100 mm plate 24 hours prior to transfection. For transfection, the cells were cultured in serum-free DMEM containing 400 pg/ml of DEAE-dextran, 1 pM chloroquine, and 2 mM glutamine, and 1 p.g of the appropriate DNA for 3-4 hours at 370C in an atmosphere of 5% CO2.

The transfection media was aspirated and replaced with phosphatebuffered saline with 10% DMSO for 2-3 min. Following this DMSO S "shock", the COS-7 cells were placed into DMEM with 10% FBS, 1% each of penicillin and streptomycin, and 2 mM glutamine for 48 hours.

Because the TIE-2 ligand is secreted it was necessary to permeabilize the cells to detect binding of the receptorbody probe to the ligand. Transfected COS-7 cells were plated at a density of 1.0 x 106 cells/100 mm plate. The cells were rinsed with PBS and then incubated with PBS containing 1.8% formaldehyde for 15-30 min. at room temperature. Cells were then washed with PBS and incubated for min. with PBS containing 0.1% Triton X-100 and 10% Bovine Calf Serum to permeabilize the cells and block non-specific binding sites.

The screening was conducted by direct localization of staining using a TIE-2 receptorbody, which consisted of the extracellular domain of TIE-2 fused to the IgG1 constant region. This receptorbody was prepared as set forth in Example 2. Transfected COS cells were probed by incubating them for 30 min with TIE-2 receptorbody. The cells were then washed twice with PBS, fixed with methanol, and then incubated for an additional 30 min with PBS/10% Bovine Calf 1 0 Serum/anti-human IgG-alkaline phosphatase conjugate. After three PBS washes, cells were incubated in alkaline-phosphatase substrate for 30-60 min. The dish was then inspected microscopically for the presence of stained cells. Cells expressing one orientation of the clone, but not the other orientation, were seen to bind the TIE-2 1 5 receptorbody.

One of skill in the art will readily see that the described methods may be used to further identify other related members of the TIE ligand family.

The coding region from the clone pBluescript KS encoding human TIE-2 ligand 2 was sequenced using the ABI 373A DNA sequencer and Taq Dideoxy Terminator Cycle Sequencing Kit (Applied Biosystems, o* Inc., Foster City, CA). The nucleotide and deduced amino acid sequence of human TIE-2 ligand from the clone pBluescript KS. encoding human TIE-2 ligand 2 is shown in Figure 6.

EXAMPLE 9 TIE-2 LIGAND 2 IS A RECEPTOR ANTAGONIST IT Conditioned media from COS cells expressing either TIE-2 ligand 2 (TL2) or TIE-2 ligand 1 (TL1) were compared for their ability to activate TIE-2 receptors naturally present in human endothelial cell lines.

Lipofectamine reagent (GIBCO-BRL, Inc.) and recommended protocols were used to transfect COS-7 cells with either the pJFE14 expression vector alone, pJFE14 vector containing the human TIE-2 ligand 1 cDNA, or with a pMT21 expression vector (Kaufman, 1985, Proc. Natl. Acad. Sci. USA 82: 689-693) containing the human TIE-2 0 ligand 2 cDNA. /COS media containing secreted ligands were harvested.

S after, three days and concentrated 20-fold by diafiltration (DIAFLO ultrafiltration membranes, Amicon, Inc.). The quantity of active T1E-2 0 ligand 1 and TIE-2 ligand 2 present in these media was determined and expressed as the amount (in resonance units, of TIE-2 receptor 1 5 specific binding activity measured by a BIAcore binding assay.

Northern (RNA) analyses revealed significant levels of TIE-2 transcripts in HAEC (Human Aortic Endothelial Cell) human primary endothelial cells (Clonetics, Inc.). Therefore, these cells were used to examine whether TIE-2 receptor is tyrosine-phosphorylated when exposed to COS media containing the TIE-2 ligands. HAEC cells were maintained in a complete endothelial cell growth medium (Clonetics, Inc.) that contained 5% fetal bovine serum, soluble bovine brain extract, 10 ng/ml human EGF, 1 mg/ml hydrocortisone,. 50 mg/ml gentamicin and 50 ng/ml amphotericin-B. Assessment of whether TL1 and TL2 could activate TIE-2 receptor in the HAEC cells was done as follows. Semi-confluent HAEC cells were serum-starved for two hours in high-glucose Dulbecco's MEM with added L-glutamine and penicillin-streptomycin at 370C followed by replacement of the starvation medium with ligand-containing conditioned COS media for 7 minutes at 37°C in a 5% C02 incubator. The cells were subsequently lysed and T1E-2 receptor protein was recovered by immunoprecipitation of the lysates with TIE-2 peptide antiserum, followed by Western blotting with antiphosphotyrosine antiserum, exactly as described in example 1. The results are shown in Figure 7.

Phosphotyrosine levels on the TIE-2 receptor (TIE-2-R) were induced by treatment of HEAC cells with TIE-2 ligand 1 (Lane L1) but not by TIE-2 ligand 2 (Lane L2) conditioned COS media. MOCK is conditioned media from COS transfected with JFE14 empty vector.

Evidence that both TL1 and TL2 specifically bind to the TIE-2 receptor was demonstrated by using a BIAcore to assay the TIE-2 receptor specific binding activities in transfected COS media and by S immunostaining of TL1- and TL2-expressing COS cells with TIE-2 1 5 receptorbodies.

Because TL2 did not activate the TIE-2 receptor, applicants set out to determine whether TL2 might be capable of serving as an antagonist of TL1 activity. HAEC phosphorylation assays were *.performed in which cells were first incubated with an "excess" of TL2, "4 20 followed by addition of dilute TL1. It was reasoned that prior occupancy of TIE-2 receptor due to high levels of TL2 might prevent subsequent stimulation of the receptor following exposure to TL1 present at a limiting concentration.

Semi-confluent HAEC cells were serum-starved as described above and then incubated for 3 min., at 370C with 1-2 ml. of COS/JFE14-TL2 conditioned medium. Control plates were treated with COS/JFE14-only medium (MOCK). The plates were removed from the incubator and various dilutions of COS/JFE14-TL1 medium were then added, followed by further incubation of the plates for 5-7 min. at 37°C. Cells were subsequently rinsed, lysed and TIE-2-specific tyrosine phosphorylation in the lysates was examined by receptor immunoprecipitation and Western blotting, as described above. TL1 dilutions were made using 20X COS/JFE14-TL1 medium diluted to 2X, 0.1X, or 0.02X by addition of 20X COS/JFE14-alone medium. An assay of the initial 20X TL1 and 20X TL2 COS media using BIAcore biosensor technology indicated that they contained similar amounts of TIE-2-specific binding activities, 445 R.U. and 511 R.U. for TL1 and 1 TL2, respectively, The results of the antiphosphotyrosine Western blot, shown in Figure 8, indicate that when compared to prior S treatment of HAEC cells with .MOCK medium (lane prior treatment of HAEC cells with excess TIE-2 ligand 2 (lane 2) antagonizes the subsequent ability of dilute TIE-2 ligand 1 to activate the TIE-2 receptor (TIE-2-R).

The ability of TL2 to competitively inhibit TL1 activation of the S TIE-2-R was further demonstrated using the human cell hybrid line, EA.hy926 (see Example 21 for detailed description of this cell line and its maintenance). Experiments were performed in which 0 unconcentrated COS. cell media containing TL1 were mixed at varying dilutions with either MOCK- or TL2- conditioned media and placed on serum-starved EA.hy926 cell monolayers for 5 minutes at 370C. The media were then removed, the cells were harvested-by lysis and TIE-2specific tyrosine phosphorylation was examined by Western blots, as described above. Figure 9 shows an experiment which contains three groups of treatments, as viewed from left to right. As shown in the four lanes at the left, treatment of the EA.hy926 cells with lx COS- TL1 alone robustly activated the endogenous T1E-2-R in these cells, whereas lx TL2 COS medium was inactive. However, mixture of TL1 with either MOCK or TL2 demonstrated that TL2 can block the activity of TL1 in a dose-dependent fashion. In the central three pairs of lanes the ratio of TL2 (or MOCK) was decreased while the amount of TL1 in the mixture was correspondingly increased from 0.1x to 0.3x. At any of these mixture ratios the TL1:TL2 lanes showed a reduced level of TIE-2-R phosphorylation compared to that of the corresponding TL1:MOCK lanes. When the amount TL1 was held steady and the amount of TL2 (or MOCK) was decreased, however (shown in the three pairs of 1 o lanes at the right), a point was reached at which the TL2 in the sample: was too dilute to effectively inhibit TL1 activity. The relative amount of each ligand present in these conditioned COS media could be estimated from their binding units as measured by the BIAcore assay and from Western blots of the COS media with ligand-specific 1 5 antibodies. Consequently, we can infer that only a few-fold molar excess of TL2 is required to effectively block the activity of TL1 in vitro. This is significant because we have observed distinct examples in vivo (see Example 17 and Figure 16) where TL2 mRNAs achieve considerable abundance relative to those of TL1. Thus, TL2 may be 4" 20 serving an important physiological role in effectively blocking signaling by the TIE-2-R at these sites.

Taken together these data confirm that, -unlike TL1, TL2 is unable to stimulate endogenously expressed TIE-2-R on endothelial cells.

Furthermore, at a few fold molar excess TL2 can block TL1 stimulation of the TIE-2 receptor, indicating that TL2 is a naturally occurring TIE- 2 receptor antagonist.

EXAMPLE 10 IDENTIFICATION OF TIE-2-SPECIFIC BINDING ACTIVITY IN CONDITIONED MEDIUM AND COS CELL

SUPERNATANTS

Binding activity of 10x CCM from the cell lines C2C12-ras, Rat2 ras, SHEP, and T98G, or COS cell supernatants after transfection with either human TIE-2 ligand 1 (hTL1) or human TIE-2 ligand 2 (hTL2) was measured using biosensor technology (BIAcore; Pharmacia Biosensor, Piscataway, NJ) which monitors biomolecular interactions in real- @o time via surface plasmon resonance (SPR). Purified rat or human TIE-2' RB.was covalently coupled through primary amines to the carboxymethyl dextran layer of a CM5 research grade sensor chip (Pharmacia Biosensor; Piscataway, NJ). The sensor chip surface was activated using a mixture of N-hydroxysuccinimide (NHS) and N-ethyldimethylaminopropyl)carbodiimide (EDC), followed by immobilization of TIE-2 RB (25 gg/mL, pH 4.5) and deactivation of unreacted sites with 1.0 M ethanolamine (pH In general, 9000- 10000 RU of each receptorbody was coupled to the sensor chip.

The running buffer used in the system was HBS (10 mM Hepes, 150 mM NaCI, 0.005% P20 surfactant, pH The samples were centrifuged for 15 min at 4°C and further clarified using a sterile, low, protein-binding 0.45 p.m filter (Millipore; Bedford, MA). Dextran (2mg/ml) and P20 surfactant (0.005%) were added to each sample.

Aliquots of 40 4L were injected across the immobilized surface (either rat or human TIE-2) at a flow rate of 5 .L/min and the receptor binding was monitored for 8 min. The binding activity (resonance units, RU) was measured as the difference between a baseline value determined 30 s prior to the sample injection and a measurement taken at 30 s post-injection. Regeneration of the surface was accomplished with one 15-4L pulse of 3 M MgCl 2 The CCM samples (C2C12-ras, Rat2-ras, SHEP, T98G) were tested on the rat TIE-2 RB immobilized surface, while the recombinant hTL1 and hTL2 were tested on the human TIE-2 RB immobilized surface. In each case, specific binding to the TIE-2 receptorbody was evaluated by incubating the samples with 25 pg/ml of either soluble TIE-2 (rat or human) RB or trkB RB prior to assaying the binding activity. As shown in Figures 10 and 11, the addition of soluble trkB RB causes a slight decrease in the, TIE-2 binding activity, while the addition of soluble TIE-2 RB significantly reduces the binding activity as compared to that measured in the absence of TIE-2 RB.

1 5 TIE-2 RECEPTOR BY TIE-2 LIGAND 1 serve as a competitive inhibitor to block activation of TIE-2 receptor by TIE-2 ligand 1 (TL1). To do this, TL1-containing COS media were E preincubated with either TIE-2- or TrkB-RB and then compared for vtheir ability to activate TIE-2 receptors naturally present in a human endothelial cell line.

Conditioned COS media were generated from COS-7 cells transfected with either the pJFE14 expression vector alone (MOCK), or pJFE14 vector containing the human TIE-2 ligand 1 cDNA (TL1) and harvested as described in Example 9 hereinabove, with the exception that the media were sterile filtered but not concentrated. The quantity of TL1 was determined and expressed as the amount (in resonance units, of TIE-2 receptor-specific binding activity measured by BIAcore binding assay.

Northern (RNA) analyses revealed significant levels of tie-2 transcripts in HUVEC (Human Umbilical Vein Endothelial Cell) human primary endothelial cells (Clonetics, Inc.). Therefore, these cells were used to examine whether TIE-2 receptor can be tyrosinephosphorylated when exposed in the presence of TIE-2- or TrkB-RBs to COS media containing TL1. HUVEC cells were maintained at 370C, CO2 in a complete endothelial cell growth medium (Clonetics, Inc.) that 0o contained 5% fetal bovine serum, soluble bovine brain extract with g/ml heparin, 10 ng/ml human EGF, 1 ug/ml hydrocortisone, 50 pg/ml gentamicin and 50 ng/ml amphotericin-B. Assessment of whether TL1 could activate TIE-2 receptor in the HUVEC cells was done as follows.

Confluent dishes of HUVEC cells were serum-starved for two-to-four hours in low-glucose Dulbecco's MEM at 370C, 5% CO2, followed by minute incubation in-starvation medium that included 0.1 mM sodium orthovanadate, a potent inhibitor of phosphotyrosine phosphatases.

Meanwhile, conditioned COS media were preincubated 30 min. at room 4 temperature with either TIE-2- or TrkB-RB added to 50 Ig/ml. The starvation medium was then removed from the HUVEC dishes and incubated with the RB-containing COS media for 7 minutes at 370C.

HUVEC cells were subsequently lysed and TIE-2 receptor protein was recovered by immunoprecipitation with TIE-2 peptide antiserum, followed by Western blotting with an anti-phosphotyrosine antibody, as described in Example 1. The results are shown in Figure 12.

Phosphotyrosine levels on the TIE-2 receptor were induced by treatment of HUVEC cells with TIE-2 ligand 1 (TL1) relative to that seen with control medium (MOCK) and this induction is specifically blocked by prior incubation with TIE-2-RB (TIE-2-Fc) but not by incubation with TrkB-RB (TrkB-Fc). These data indicate that soluble TIE-2 RB can serve as a selective inhibitor to block activation of TIE-2 receptor by TIE-2 ligand 1.

EXAMPLE 12 CONSTRUCTION OF TIE-2 LIGANDBODIES An expression construct was created that would yield a secreted protein consisting of the entire coding sequence of human TIE-2 ligand 1 (TL1) or TIE-2,ligand 2 (TL2) fused to the human immunoglobulin gamma-1 constant region (IgG1 Fc). These fusion proteins are called TIE-2 "ligandbodies" (TL1-Fc or TL2-Fc). The Fc portion of TL1-Fc and

S

TL2-Fc was prepared as follows. A DNA fragment encoding the Fc portion of human IgG1 that spans from the hinge region to the carboxy- 1 5 terminus of the protein, was amplified from human placental cDNA by PCR with oligonucleotides corresponding to the published sequence of human IgG1; the resulting DNA fragment was cloned in a plasmid

S

vector. Appropriate DNA restriction fragments from a plasmid encoding full-length TL1 or TL2 and from the human IgG1 Fc plasmid were ligated on either side of a short PCR-derived fragment that was designed so as to fuse, in-frame, TL1 or TL2 with human IgG1 Fc protein-coding sequences.

Milligram quantities of TL2-Fc were obtained by cloning the TL2- Fc DNA fragment into the pVL1393 baculovirus vector and subsequently infecting the Spodoptera frugiperda SF-21AE insect cell line.

Alternatively, the cell line SF-9 (ATCC Accession No. CRL-1711) or the cell line BTI-TN-5bl-4 may be used. DNA encoding the TL2-Fc was cloned as an Eco RI-Notl fragment into the baculovirus transfer plasmid pVL1393. Plasmid DNA was recombined into viral DNA by mixing 3 gg of plasmid DNA with 0.5 pig of Baculo-Gold DNA (Pharminigen), followed by introduction into liposomes using Lipofectin (GIBCO-BRL). DNA-liposome mixtures were added to SF- 21AE cells (2x 106 cells/60mm dish) in TMN-FH medium (Modified Grace's Insect Cell Medium (GIBCO-BRL) for 5 hours at 27°C, followed by incubation at 27°C for 5 days in TMN-FH medium supplemented with fetal calf serum. Tissue culture medium was harvested for plaque purification of recombinant viruses, which was carried out using methods previousy described (O'Reilly, L.K. Miller, and V.A.

Luckow, Baculovirus Expression Vectors A Laboratory Manual. 1992, New York: W.H. Freeman) except that the agarose overlay contained 125 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b- D-galactopyranoside; GIBCO-BRL). After 5 days of incubation at 27 0 C, non-recombinant 1 5 plaques were scored by positive chromogenic reaction to the X-gal substrate, and their positions marked. Recombinant plaques were then visualized by addition of a second overlay containing 100 mg/mL MTT (3-[4,5-dimethylthiazol-2-yl]2,5,diphenyltetrazolium bromide; Sigma).

*00* Putative recombinant virus plaques were picked by plug aspiration, and purified by multiple rounds of plaque isolation to assure homogeneity.

Virus stocks were generated by serial, low-multiplicity passage of plaque-purified virus. Low passage stocks of one virus clone (vTL2-Fc Clone were produced.

SF-21AE cells were cultured in serum-free medium (SF-900 II, Gibco BRL) containing 1X antibiotic/antimycotic solution (Gibco BRL) and 25 mg/L Gentamycin (Gibco BRL). Pluronic F-68 was added as a surfactant to a final concentration of 1g/L. Cultures (4L) were raised in a bioreactor (Artisan Cell Station System) for at least three days 0 prior to infection. Cells were grown at 27°C, with gassing to 50 dissolved oxygen, at a gas flow rate of 80 mL/min (aeration at a sparge ring). Agitation was by means of a marine impeller at a rate of 100 rpm. Cells were harvested in mid-logarithmic growth phase (-2 X10 6 cells/mL), concentrated by centrifugation, and infected with plaque forming units of vTL2-Fc per cell. Cells and inoculum were brought to 400mL with fresh medium, and virus was adsorbed for 2 hours at 27°C in a spinner flask. The culture was then resuspended in a final volume of 8L with fresh serum-free medium, and the cells incubated in the, bioreactor using the previously described conditions..,' Culture medium from vTL2-Fc-infected SF21AE cells were collected by centrifugation (500x g, 10 minutes) at 72 hours postinfection. Cell supernatants were brought to pH 8 with NaOH. EDTA was added to a final concentration of 10 mM and the supernatant pH was readjusted to 8. Supernatants were filtered (0.45 im, Millipore) and loaded on a protein A column (protein A sepharose 4 fast flow or HiTrap protein A, both from Pharmacia). The column was washed with PBS containing 0.5 M NaCI until the absorbance at 280 nm decreased to baseline. The column was washed in PBS and eluted with 0.5 M acetic acid. Column fractions were immediately neutralized by eluting into tubes containing 1 M Tris pH 9. The peak fractions containing the TL2- Fc were pooled and dialyzed versus PBS.

EXAMPLE 13- EXPRESSION OF TIE-1, TIE-2, TL1, AND TL2 IN RENAL CELL CARCINOMA In situ hybridization experiments were performed on human renal cell carcinoma tumor tissue using TIE-1, TIE-2, TL1, and TL2 cDNA probes. TIE-2, TIE-1, TL1, and TL2 expression were all up-regulated in the tumor vasculature. Ligand expression appeared to be localized to either the vascular endothelial cells (TL2) or very near the vascular endothelial cells in the mesenchyme (TL1). VEGF has been shown to be dramatically up-regulated in this tumor tissue. Brown, et al. Am. J.

Pathol. 143:1255-1262 (1993).

EXAMPLE 14 EXPRESSION OF TIE-1, TIE-2, TL1, AND TL2 IN WOUND

HEALING

o In situ hybridization experiments were performed on crosssectional tissue slices obtained from a rat cutaneous wound model using TIE-1, TIE-2, TL1, and TL2 cDNA probes. The wound healing S model involves pressing a small cork bore against the skin of a rat and removing a small, cylindrical plug of skin. As healing begins at the base of the wound, a vertical slice of tissue is taken and used for in situ hybridization. In the tested tissue sample, TL1 and TL2 appeared o to be slightly up-regulated by four days post-injury. In contrast to the slightly up-regulated expression of TL1 and TL2 in this tissue, VEGF expression, which may precede TL1 and TL2 expression, is dramatically up-regulated.

EXAMPLE 15 EXPRESSION OF TIE LIGANDS IN FETAL LIVER AND

THYMUS

Reverse transcription-PCR (RT-PCR) was performed on mouse E14.5 fetal liver and mouse E17.5 fetal thymus. Agarose gel electrophoresis of the RT-PCR products revealed that in the mouse fetal liver, TIE-2 ligand 1 (TL1) RNA is enriched in the stromal region, but is absent in c-kit+TER119 hematopoietic precursor cells. In this same tissue, TIE-2 ligand 2 (TL2) RNA is enriched in the stromal cells, but absent in the hematopoietic precursor cells (Figure 13). In the mouse fetal thymus, TL2 is enriched in the stromal cells (Figure 14).

1 0 EXAMPLE 16 THE TIE RECEPTOR/LIGAND SYSTEM IN ANGIOGENESIS Although the TIE-2/TIE ligand system appears to play an important role in endothelial cell biology, it has not been shown to play a significant, active role in the early to intermediate stages of vascularization angioblast or endothelial cell proliferation and migration, tubule formation, and other early stage events in vascular modeling). In contrast to the receptors and factors known to mediate these aspects of vascular development, the temporally late pattern of expression of TIE-2 and TL1 in the course of vascularization suggests V.1 20 that this system plays a distinct role in the latter stages vascular development, including the structural and functional differentiation and stabilization of new blood vessels. The pattern of expression of TIE-2/TL1 also is consistent with a continuing role in the maintenance of the structural integrity and/or physiological characteristics of an established vasculature.

TIE Ligand .2 (TL2) appears to be a competitive inhibitor of TL1.

The spatiotemporal characteristics of TL2 expression suggest that this single inhibitory molecule may play multiple, context-dependent roles essential to appropriate vascular development or remodeling (e.g.

de-stabilization/de-differentiation of mature endothelial cells allowing the formation of new vessels from existing vasculature, inhibition of inappropriate blood vessel formation, and regression/involution of mature blood vessels). Figure 15 is a schematic representation of the hypothesized role of the TIE-2/TIE ligands in angiogenesis. In this figure TL1 is represented by TL2 is represented by TIE-2 is represented by VEGF is represented by and flk-1 (a VEGF receptor) is represented by EXAMPLE 17 EXPRESSION OF TIE LIGANDS IN THE FEMALE REPRODUCTIVE SYSTEM: EXPRESSION IN THE

OVARY

5 Preliminary observations made in experiments examining the expression of the TIE receptors and ligands in the female reproductive system are consistent with the hypothesis the TL1 plays a role in S neovascularization which temporally follows that of VEGF. The pattern of TL2 expression is also consistent with an antagonism of the o action of TL1, and a specific role in vascular regression. To verify this, expression of relevant mRNAs can be examined following experimental induction of follicular and luteal development so that their temporal relation to various aspects of neovascularization/vascular regression can be more clearly defined in conjunction with endothelial cell staining, vascular fills).

Angiogenesis associated with follicular development and corpus luteum formation in staged ovaries of mature, female rats or following induced ovulation in pre-pubertal animals was followed using in situ hybridization. Figure 16 contains photographs of in situ hybridization slides showing the temporal expression pattern of TIE-2, TL1, TL2, and VEGF during the ovarian cycle [Column 1: Early preovulatory follicle; Column 2: pre-ovulatory follicle; Column 3: early corpus luteum; and Column 4: atretic follicle; Row A:bright field; Row B:VEGF; Row C: TL2; Row D: TL1 and Row E: TIE-2 receptor]. These studies revealed that VEGF, TL1 and TL2 are expressed in a temporally and spatially coordinate fashion with respect to the development and regression of vasculature in the ovary, specifically with respect to the 1 0 establishment of, the vascular system which is generated in the course, of the conversion of an ovarian follicle to a corpus luteum (CL).

Briefly, VEGF expression increases in the follicular granule layer prior to its vascularization during the process of luteinization. During the process of CL formation, highest levels of VEGF expression are 1 5 apparent in the center of the developing CL in the vicinity of luteinizing cells which are not yet vascularized. VEGF levels remain moderately high and are diffusely distributed in the developed CL. In contrast, noticeably enhanced expression of TIE-2 ligand 1 occurs only late in process of CL formation, after a primary vascular plexus has been established. Later, TL1 expression is apparent throughout the CL at which time the definitive capillary network of the CL has been established.

TL2 exhibits a more complex pattern of expression than either VEGF or TL1. In the developing CL, TL2 is expressed at highest levels at the front of the developing capillary plexus- between the central avascular region of the CL where VEGF expression is highest, and the most peripheral portion of the CL where TL1 expression is dominant and where the luteinization process is complete and the vascular system is most mature. TL2 also appears to be expressed at high levels in the follicular layer of large follicles which are undergoing atresia. While TL1 is also apparent in atretic follicles, VEGF is not expressed.

The pattern of expression described above is most consistent with a role for VEGF in the initiation of angiogenesis, with TL1 acting late in this process-for example in modeling and/or stabilization of the definitive vascular network. In contrast, TL2 is present both in areas of active expansion of a newly forming vascular network (during O o CL formation), and in regions which fail to establish a new vasculature S and vascular regression is in progress (atretic follicles). This suggests a more dynamic and complex role for TL2, possibly involving destabilization of existing vasculature (necessary for regression) or developing vasculature (necessary for the dynamic modeling of newly 5 forming vessels).

EXAMPLE 18 A RECEPTORBODY BINDING ASSAY AND A LIGAND BINDING AND COMPETITION ASSAY 0 "o o A quantitative cell-free binding assay with two alternate formats has been developed for detecting either TIE-2 receptorbody binding or ligand binding and competition. In the receptorbody binding version of the assay, TIE-2 ligands (purified or partially purified; either TL1 or TL2) are coated onto an ELISA plate. Receptorbody at varying concentrations is then added, which binds to the immobilized ligand in a dose-dependent manner. At the end of 2 hours, excess receptorbody is washed away, then the amount bound to the plate is reported using a specific anti-human Fc antibody which is alkaline phosphatase tagged. Excess reporter antibody is washed away, then the AP reaction is developed using a colored substrate. The assay is quantitated using a spectrophotometer. Figure 19 shows a typical TIE- 2-lgG binding curve. This assay has been used to evaluate the integrity of TIE-2-lgG after injection into rats and mice. The assay can also be used in this format as a ligand competition assay, in which purified or partially-purified TIE ligands compete with immobilized ligand for receptorbody. In the ligand binding and competition version of the 1 o binding assay, TIE-2 ectodomain is coated onto the ELISA plate. The Fc.-tagged fibrinogen-like domain fragments of the TIE ligands (TL1fFc and TL2-fFc) then bind to the ectodomain, and can be detected using the same anti-human Fc antibody as described above. Figure shows an example of TL1-fFc binding to TIE-2 ectodomain. This 1 5 version of the assay can also be used to quantitate levels of TL1-fFc in serum or other samples. If untagged ligand (again, either purified or unpurified) is added at the same time as the TL1-fFc, then a competition is set up between tagged ligand fragment and full-length ligand. The full-length ligand can displace the Fc-tagged fragment, S 20 and a competition curve is generated.

EXAMPLE 19 EA.hy926 CELL LINE CAN BE USED AS A REPORTER CELL LINE FOR TIE LIGAND ACTIVITY EA.hy926 is a cell hybrid line that was established by fusion of HUVEC with the human lung carcinoma-derived line, A549 [Edgell, et al.

Proc. Natl. Acad. Sci. (USA) 80, 3734-3737 (1983). EA.hy926 cells have been found to express significant levels of TIE-2 receptor protein with low basal phosphotyrosine levels. The density at which EA.hy926 cells are passaged prior to their use for receptor assays, as well as *o their degree of confluency at the time of assay, can affect TIE-2 S receptor abundance and relative inducibility in response to treatment with ligand. By adopting the following regimen for growing these cells the EA.hy926 cell line can be used as a dependable system for assay of TIE-2 ligand activities.

1 EA.hy926 cells are seeded at 1.5 x 106 cells in T-75 flasks S (Falconware) and re-fed every other day with high-glucose Dulbecco's MEM, 10% fetal bovine serum, L-glutamine, penicillin-streptomycin, and lx hypoxanthine-aminopterin-thymidine (HAT, Gibco/BRL). After three to four days of growth, the cells are passaged once again at 1.5 x 6 cells per T-75 flask and cultured an additional three to four days.

For phosphorylation assays, cells prepared as described above were serum-starved by replacement of the culture medium with highglucose DMEM and incubation for 2-3 hours at 37 0 C. This medium was aspirated from the flask and samples of conditioned media or purified ligand were added to the flask in a total volume of 1.5 ml followed by incubation at 37°C for 5 minutes. Flasks were removed from the incubator and placed on a bed of ice. The medium was removed and replaced with 1.25 ml Lysis Buffer containing 1% nonidet P-40, sodium deoxycholate, 0.1% SDS in 20 mM Tris, pH 7.6, 150 mM NaCI, mM NaF, 1mM sodium orthovanadate, 5 mM benzamidine, and 1mM EDTA containing the protease inhibitors PMSF, aprotinin, and leupeptin.

After 10 minutes on ice to allow membrane solubilization, plates were scraped and cell lysates were clarified by microcentrifugation at top speed for 10 minutes at 4°C. TIE-2 receptor was immunoprecipitated from the clarified supernatant by incubation in the cold with an anti- 1 o TIE-2 polyclonal, antiserum and Protein G-conjugated Sepharose beads.

The. beads were washed three times with cold cell lysis buffer and :iD" boiled 5 minutes in Laemmli sample buffer, which was then loaded on o 7.5% SDS-polyacrylamide gels. Resolved proteins were electrotransferred to PVDF (Lamblia-P) membrane and then subjected 1 5 to Western blot analysis using anti-phosphotyrosine antibody and the ECL reagent. Subsequent comparison of total TIE-2 protein levels on the same blots was done by stripping the anti-phosphotyrosine antibody and reincubating with a polyclonal antiserum specific to the ectodomain of TIE-2.

EXAMPLE 20 ISOLATION AND SEQUENCING OF FULL LENGTH cDNA CLONE ENCODING MAMMALIAN TIE LIGAND-3 TIE ligand-3 (TL3) was cloned from a mouse BAC genomic library (Research Genetics) by hybridizing library duplicates, with either mouse TL1 or mouse TL2 probes corresponding to the entire coding sequence of those genes. Each copy of the library was hybridized using phosphate buffer at 550C overnight. After hybridization, the filters were washed using 2xSSC, 0.1% SDS at 60°C, followed by exposure of X ray film to the filters. Strong hybridization signals were identified corresponding to mouse TL1 and mouse TL2. In addition, signals were identified which weakly hybridized to both mouse TL1 and mouse TL2.

DNA corresponding to these clones was purified, then digested with restriction enzymes, and two fragments which hybridized to the original probes were subcloned into a bacterial plasmid and sequenced.

The sequence of the fragments contained two exons with homology to o both mouse TL1and mouse TL2. Primers specific for these sequences S were used as PCR primers to identify tissues containing transcripts corresponding to TL3. A PCR band corresponding to TL3 was identified in a mouse uterus cDNA library in lambda gt-11. (Clontech Laboratories, Inc., Palo Alto, CA).

Plaques were plated at a density of 1.25 x 10 6 /20x20 cm plate and replica filters taken following standard procedures (Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., page 8.46, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). Duplicate- filters 20 were screened at "normal" stringency (2 x SSC, 65 0 C) with a 200 bp PCR radioactive probe made to the mouse TL3 sequence. Hybridization was at 65°C in a solution containing 0.5 mg/mi salmon sperm DNA.

Filters were washed in 2 x SSC at 65 0 C and exposed for 6 hours to Xray film. Two positive clones that hybridized in duplicate were picked. EcoRI digestion of phage DNA obtained from these clones indicated two independent clones with insert sizes of approximately 1.2 kb and approximately 2.2 kb. The 2.2kb EcoRI insert was subcloned into the EcoRI site of pBluescript KS (Stratagene). Sequence analysis showed that the longer clone was lacking an initiator methionine and signal peptide but otherwise encoded a probe homologous to both mouse TL1 and mouse TL2.

Two TL3-specific PCR primers were then synthesised as follows: US2: cctctgggctcgccagtttgttagg US1: ccagctggcagatatcagg The following PCR reactions were performed using expression libraries derived from the mouse cell lines C2C12ras and MG87. In tt)e primary PCR reaction, the specific primer US2 was used in conjunction with vector-specific oligos to allow amplification in either orientation. PCR was in a total volume of 100ml using 35 cycles of 940 C, 1 min; 420C or 480 C for 1 min; 72° C, 1 min. The secondary PCR 15 reaction included the second specific primer, US1, which is contained within the primary PCR product, in conjunction with the same vector oligos. The secondary reactions were for 30 cycles, using the same temperatures and times as previous. PCR products were gel isolated and submitted for sequence analysis. On the basis of sequences obtained from a total of four independent PCR reactions using two different cDNA libraries, the 5' end of the TL3 sequence was deduced.

Northern analysis revealed moderate to low levels of mouse TL3 transcript in mouse placenta. The expression of mouse TL3 consisted of a transcript of approximately 3 kb. The full length TL3 coding sequence is set forth in Figure 21.

The mouse TL3 sequence may then be used to obtain a human clone containing the coding sequence of human TL3 by hybridizing either a human genomic or cDNA library with a probe corresponding to mouse TL3 as has been described previously, for example, in Example 8 supra.

EXAMPLE 21 ISOLATION OF FULL LENGTH GENOMIC CLONE ENCODING HUMAN TIE LIGAND-4 TIE ligand-4 (TL4) was cloned from a mouse BAC genomic library (BAC HUMAN Genome Systems Inc.) by hybridizing library duplicates, with either a human TL1 radioactive probe corresponding to the entire fibrinogen coding sequence of TL1 (nucleotides 1153 to 1806 of Figure.

4) or a mouse TL3 radioactive probe corresponding to a segment of186 nucleotides from the fibrinogen region of mouse TL3 (nucleotides 1307 to 1492 of Figure 21). Each probe was labeled by PCR using exact oligonucleotides and standard PCR conditions, except that dCTP was 1 5 replaced by P 32 dCTP. The PCR mixture was then passed through a gel filtration column to separate the probe from free P32 dCTP. Each copy of the library was hybridized using phosphate buffer, and radiactive probe at 55 0 C overnight using standard hybridization conditions. After hybridization, the filters were washed using 2xSSC, 0.1% SDS at 55 0

C,

00°o followed by exposure of X ray film. Strong hybridization signals were observed corresponding to human TL1. In addition, signals were identified which weakly hybridized to both human TL1 and mouse TL3.

DNA corresponding to these clones was purified using standard procedures, then digested with restriction enzymes, and one fragment which hybridized to the original probes was subcloned into a bacterial plasmid and sequenced. The sequence of the fragments contained one exon with homology to both human TL1 and mouse TL3 and other members of the TIE ligand family. Primers specific for these sequences may be used as PCR primers to identify tissues containing transcripts corresponding to TL4.

The complete sequence of human TL4 may be obtained by sequencing the full BAC clone contained in the deposited bacterial cells. Exons may be identified by homology to known members of the TIE-ligand family such as TL1, TL2 and TL3. The full coding sequence of TL4 may then be determined by splicing together the exons from the TL4 genomic clone which, in turn, may be used to produce the TL4 protein.

Alternatively, theexons may be used as probes to obtain a full length cDNA clone, which may then be used to produce the TL4 protein. Exons may also be identified from the BAC clone sequence by homology to protein domains such as fibrinogen domains, coiled coil domains, or protein signals such as signal peptide sequences. Missing exons from 1 5 the BAC clone may be obtained by identification of contiguous BAC clones, for example, by using the ends of the deposited BAC clone as probes to screen a human genomic library such as the one used herein, by using the exon sequence contained in the BAC clone to screen a cDNA library, or by performing either 5' or 3' RACE procedure using 20 oligonucleotide primers based on the TL4 exon sequences.

Identification of Additional TIE Ligand Family Members The novel TIE ligand-4 sequence may be used in a rational search for additional members of the TIE ligand family using an approach that takes advantage of the existence of conserved segments of strong homology between the known family members. For example, an alignment of the amino acid sequences of the TIE ligands shows several regions of conserved sequence (see boxed regions of Figure 22).

Degenerate oligonucleotides essentially based on these boxes in combination with either previously known or novel TIE ligand homology segments may be used to identify new TIE ligands.

The highly conserved regions among TL1, TL2 and TL3 may be used in designing degenerate oligonucleotide primers with which to prime PCR reactions using cDNAs. cDNA templates may be generated by reverse transcription of tissue RNAs using oligo d(T)o.r other appropriate Sprimers. Aliquots of the PCR reactions may then be subjected to electrophoresis on an agarose gel. Resulting amplified DNA fragments may be cloned by insertion into plasmids, sequenced and the DNA sequences compared with those of all known TIE ligands.

5 Size-selected amplified DNA fragments from these PCR reactions may be cloned into plasmids, introduced into E. coli by electroporation, and transformants plated on selective agar. Bacterial colonies from PCR transformation may be analyzed by sequencing of plasmid DNAs that are purified by standard plasmid procedures.

*:0 SCloned fragments containing a segment of a novel TIE ligand may be used as hybridization probes to obtain full length cDNA clones from a cDNA library. For example, the human TL4 genomic sequence may be used to obtain a human cDNA clone containing the complete coding sequence of human TL4 by hybridizing a human cDNA library with a probe corresponding to human TL4 as has been described previously.

rAMivlrLt- Z ULUIIIIU UPt I HE t-ULL UUUING SEQUENCE OF hTL4 Both 5' and 3' coding sequence from the genomic human TL-4 clone encoding human TIE ligand-4 (hTL-4 ATCC Accession No. 98095) was obtained by restriction enzyme digestion, Southern blotting and hybridization of the hTL-4 clone to coding sequences from mouse TL3, followed by subcloning and sequencing the hybridizing fragments.

Coding sequences corresponding to the N-terminal and C-terminal amino acids of hTL4 were used to design PCR primers (shown below), 1o which in turn were used for PCR amplification of TL4 from human ovary cDNA. A PCR band was identified as corresponding to human TL4 by DNA sequencing using the ABI 373A DNA sequencer and Taq Dideoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Inc., Foster

O***O

City, CA). The PCR band was then subcloned into vector pCR-script and 1 5 several plasmid clones were analyzed by sequencing. The complete human TL4 coding sequence was then compiled and is shown in Figure 23. In another embodiment of the invention, -the nucleotide at position 569 is changed from A to G, resulting in an amino acid change from Q to R.

The PCR primers used as described above were designed as follows: hTL4atg 3' hTL4not gtgtcgacgcggccgctctagatcagacTTAGATGTCCAAAGGCCGTATCATCAT-3' Lowercase letters indicate "tail" sequences added to the. P.CR primers to facilitate cloning of the amplified PCR fragments.

EXAMPLE 23 CONSTRUCTION AND CHARACTERIZATION OF MODIFIED TIE LIGANDS A genetic analysis of TIE-2 ligand-1 and TIE-2 ligand-2 (TL1 and TL2) was undertaken to gain insight into a number of their observed properties. Although TL1 and TL2 share similar structural homology, they exhibit different physical and biological properties. The most prominent feature that distinguishes the two ligands is that although *0 they both bind to the TIE-2 receptor, TL1 is an agonist while TL2 is an,

**@OSS

antagonist. Under non-reducing electrophoretic conditions both o proteins exhibit covalent, multimeric structures. TL1 is produced as a mixture of disulfide cross-linked multimers, primarily trimers and higher order species, without any dimeric species. But TL2 is produced 5 almost exclusively as a dimeric species. Also, while TL2 is produced well in most expression systems, TL1 is expressed poorly and is difficult to produce in large quantities. Finally, production and purification conditions also appear to predispose TL1 to inactivation by proteolytic cleavage at a site near the amino terminus.

*.o 0 So To study these differences, several modified ligands were constructed as follows.

23.1. Cysteine substitution Investigations into what factors might be contributing to the different physical and biological properties of the two molecules revealed the presence in TL1 of a cysteine residue (CYS 265 in Figure 4; CYS 245 in Figure 17) preceding the fibrinogenlike domain in TL1 but absent in TL2 there was no corresponding cysteine residue in TL2. The CYS265 residue in TL1 is encoded by TGC and is located at about nucleotides 1102-1104 (see Figure 4) at the approximate junction between the coiled-coil and fibrinogen-like domains. Because cysteine residues are generally involved in disulfide bond formation, the presence of which can contribute to both the tertiary structure and biological properties of a molecule, it was thought that perhaps the presence of the CYS265 residue in TL1 might be at least partially responsible for the different properties of the two molecules.

To..test this hypothesis, an expression plasmid was constructed which contained a mutation in TL1 in which the CYS (residue 265 in Figure 4; residue 245 in Figure 17) was replaced with an amino acid (serine) which does not form disulfide bonds. In addition to this TL1/CYS- 1 5 mutant, a second expression plasmid was constructed which mutated the approximately corresponding position in TL2 (Met247 in Figure 17) so that this residue was now a cysteine. Both non-mutated and mutated expression plasmids of TL1 and TL2 were transiently transfected into COS7 cells, cell supernatants containing the 20 recombinant proteins were harvested, and samples were subjected to both reducing and non-reducing SDS/PAGE electrophoresis and subsequent Western blotting.

Figure 18 shows the Western blots under non-reducing conditions of both non-mutated and mutated TL1 and TL2 proteins, revealing that the TL1/CYS- mutant runs as a dimer much like TL2 and that the TL2/CYS+ mutant is able to form a trimer, as well as higher-order multimers, more like TL1. When the two mutant proteins were tested for their ability to induce phosphorylation in TIE-2 expressing cells, the TL1/CYS- mutant was able to activate the TIE-2 receptor, whereas the TL2/CYS+ mutant was not.

Thus, when the cysteine residue (residue 265 in Figure 4; residue 245 in Figure 17) of TL1 was genetically altered to a serine, it was found that the covalent structure of TL1 became similar to that of TL2, i.e., primarily dimeric. The modified TL1 molecule still behaved as an agonist, thus the trimeric and/or higher order multimeric structure Swas not the determining factor giving TL1 the ability to activate.

Although the removal of the cysteine did make a molecule with more desirable properties, it did not improve the production level of TL1.

23.2. Domain deletions The nucleotide sequences encoding TL1 and 1r5 TL2 share a genetic structure that can be divided into three domains, based on the amino acid sequences of the mature proteins. The last approximately 215 amino acid residues of each mature protein contains six cysteines and bears strong resemblance to a domain of fibrinogen. This region was thus denoted the "fibrinogen-like" domain g o or "F-domain." A central region of the mature protein containing approximately 205 residues had a high probability of assuming a "coiled-coil" structure and was denoted the "coiled-coil" domain or "Cdomain." The amino-terminal approximately 55 residues of the mature protein contained two cysteines and had a low probability of having a coiled-coil structure. This region was designated the "Nterminal" domain or "N-domain." The modified ligands described herein are designated using a terminology wherein N N-terminal domain, C coiled-coil domain, F fibrinogen-like domain and the numbers 1 and 2 refer to TL1 and TL2 respectively. Thus 1N indicates the N-terminal domain from TL1, 2F indicates the fibrinogen-like domain of TL2, and so forth.

In order to test whether the fibrinogen-like domain (F-domain) of the TIE-2 ligands contained TIE-2 activating activity, expression plasmids were constructed which deleted the coiled-coil and N-terminal domains, leaving only that portion of the DNA sequence encoding the Fdomain (for TL1, beginning in Figure 4 at about nucleotide 1159, amino.

acid residue ARG284; for TL2, corresponding to about nucleotide 1200,.

in Figure 6, amino acid residue 282). This mutant construct was then transiently transfected into COS cells. The supernatant containing the S* recombinant protein was harvested. The TL1/F-domain mutant was tested for its ability to bind the TIE-2 receptor. The results showed.

1 5 that, as a monomer, the TL1/F-domain mutant was not able to bind TIE-2 at a detectable level.

But when the TL1/F-domain monomer was myc-tagged and subsequently clustered with an antibody directed against the myc tag, it exhibited detectable binding to TIE-2. However, the antibodyclustered TL1/F-domain mutant was not able to induce phosphorylation in a TIE-2 expressing cell line.

Thus it was determined that the F-domain of the TIE-2 ligands is involved in binding the receptor but that a truncation consisting of just the F-domain alone is not sufficient for receptor binding. This raised the possibility that the coiled-coil domain was responsible for holding together several fibrinogen-like domains, which might be essential for receptor binding. In an attempt to confirm this hypothesis, the F-domain was fused with the Fc section of human antibody IgG1. Because Fc sections dimerize upon expression by mammalian cells, these recombinant proteins mimicked the theoretical configuration of the F-domains were the native ligands to dimerize. This F-domain-Fc construct bound but failed to activate the receptor. Apparently, multimerization caused by other regions of the ligands is necessary to enable the ligands to bind the TIE-2 receptor.

In addition, some other factor outside of the F-domain must contribute Sto phosphorylation of the receptor.

Mutants were then constructed which were missing the fibrinogen-like domain, and therefore contained only the N-terminal and coiled-coil domains. They were not capable of binding to the receptor. To assess the role of the N-terminal domain in receptor binding and activation, the ligands were truncated to just their C- and F-domains and tagged with a FLAG tag at the N-terminus, creating constructs termed FLAG- S 1C1F and FLAG-2C2F. Although these molecules stained robustly in COS7 cells transfected transiently to express the TIE-2 receptor, they *.qo failed to respond in a phosphorylation assay. Thus the N-domain does contain an essential factor for receptor activation although, as disclosed infra, the ability of chimeric molecule 2N2C1F to activate the receptor shows that even the N-domain of an inactive ligand can fill that role.

The differences in behavior between the myc-tagged F-domain truncation and the Fc-tagged F-domain truncation described previously suggested that the TIE ligands can only bind in dimeric or higher multimeric forms. Indeed, non-reducing SDS-PAGE showed that the TIE ligands exist naturally in dimeric, trimeric, and multimeric forms.

That the FLAG-1C1F and FLAG-2C2F truncations can bind to the TIE-2 receptor without dimerization by a synthetic tag (such as Fc), whereas the F truncations cannot, suggests that the C-region is at least partly responsible for the aggregation of the F-domains.

23.3. Swapping constructs (chimeras): Applicants had noted that the level of production of TL1 in COS7 cells.

was approximately tenfold lower than production of TL2. Therefore, chimeras of TL1 and TL2 were constructed in an attempt to explain this difference and also to further characterize the agonist activity of TL1 as compared to the antagonist activity of TL2.

a 1 5 Four chimeras were constructed in which either the N-terminal domain or the fibrinogen domain was exchanged between TL1 and TL2 and were designated using the terminology described previously such that, for S: example, 1N1C2F refers to a chimera having the N-terminal and coiledcoil domains of TL1, together with the fibrinogen-like domain from 20 TL2. The four chimeras were constructed as follows: chimera 1 1N1C2F chimera 2 2N2C1F chimera 3 1N2C2F chimera 4 2N1C1F The nucleotide and amino acid sequences of chimeras 1-4 are shown in Figures 24-27 respectively.

Each chimera was inserted into a separate expression vector pJFE14.

The chimeras were then transfected into COS7 cells, along with the empty pJFE14 vector, native TL1, and native TL2 as controls, and the culture supernatants were. collected.

In order to determine how the swapping affected the level of expression of the ligands, a 1:5 dilution and a 1:50 dilution of the COS7 supernatants were dot-blotted onto nitrocellulose. Three ligands that contained the TL1 N-domain native TL1, 1N2C2F and 1N1C2F) were then probed with a rabbit antibody specific to the N-terminus of TL1.

o Three ligands containing the TL2 N-domain, native TL2, 2N1C1F 4o*o and 2N2C1F) were probed with a rabbit antibody specific for the Nterminus of TL2. The results. demonstrated that the COS7 cells were expressing any molecule containing the N-domain of TL2 at roughly ten times the level of any molecule containing the TL1 N-domain, 5 regardless of the makeup of the rest of the protein. The conclusion ~was that the N-domain must principally control the level of expression of the ligand.

The next question addressed was the chimeras' ability or inability to 0o activate the TIE-2 receptor. EAhy926 cells were challenged with the four chimeras, as well as TL1 as a positive control for phosphorylation and TL2 or an empty pJFE14-transfected COS7 cell supernatant as negative controls for phosphorylation. The cells were lysed, and the TIE-2 receptor was immunoprecipitated out of the cell lysate and run on an SDS-PAGE. The samples were Western blotted and probed with an anti-phosphotyrosine antibody to detect any receptors that had been phosphorylated. Surprisingly, only the constructs containing the TL1 fibrinogen-like domain (2N1C1F and 2N2C1F) could phosphorylate the TIE-2 receptor. Thus, although the N-terminal region of TL1 is essential for activation, it can be replaced by the N-terminal region of TL2, the information that determines whether the ligand is an agonist or an antagonist is actually contained in the fibrinogen-like S domain.

Thus it was determined that the F-domain, in addition to binding the TIE-2 receptor, is responsible for the phosphorylation activity of TL1.

Further, when TL2, an otherwise inactive molecule, was altered by replacing its F-domain with the TL1 F-domain, the altered TL2 acted as an agonist.

The 2N1C1F construct was somewhat more potent, however. The signal caused by chimera 2N1C1F appeared slightly stronger than that of chimera 2N2C1F, leading to speculation that the C-domain of TL1, though not crucial for phosphorylation, might enhance the potency of TL1. However, since the samples used for the phosphorylation assay were not normalized in terms of the concentration of ligand, it was possible that a stronger phosphorylation signal only indicated the i. 20 presence of more ligand. The phosphorylation assay was therefore repeated with varying amounts of ligand to determine whether the active chimeras displayed different potencies. The concentration of ligand in the COS7 supernatants of ligand transfections was determined through BlAcore biosenser technology according to methods previously described (Stitt, et al. (1995) Cell 80: 661-670).

BIAcore measured the binding activity of a supernatant to the TIE-2 receptor in arbitrary units called resonance units Fairly good correlation between RU's and ligand concentration has been generally observed, with 400 RU of activity corresponding to about 1 lig of protein per mL of supernatant. Samples were diluted to concentrations of 100 RU, 20 RU, and 5 RU each and the phosphorylation assay was repeated. The results demonstrated that chimera 2N2C1F was clearly more potent than either the native TL1 or chimera 1N1C2F at the same concentrations.

Another interesting aspect of these exchange constructs is in their levels of expression. Each of the four chimeras was tested for its o level of production in COS cells, its ability to bind to TIE2, and its ability to phosphorylate TIE2. The results of these experiments showed that chimeras 1 and 3 were produced at levels comparable to TL1, whereas chimeras 2 and 4 were produced, at levels comparable to TL2. Thus a high level of protein production was correlated with the ,1 5 TL2 N-terminal domain. Additionally, when tested on endothelial EAhy926 cells, chimeras 2 and 4 were active, whereas 1 and 3 were not. Thus activity (phosphorylation of the receptor) correlates with the TL1 fibrinogen-like domain. Chimeras 2 and 4 therefore each had the desirable properties of high production levels as well as agonist i' o activity.

23.4. Proteolytic resistant constructs Based on the observation that a large fraction of TL1 preparations was often proteolytically cleaved near the N-terminus, it was proposed that an arginine residue located at position 49 of the mature protein (see Figure 17) was a candidate cleavage site that might be involved in the regulation of the protein's activity in vivo, and that replacing the arginine with a serine (R49might increase the stability of the protein without necessarily affecting its activity. Such a mutant of TL1 was constructed and was found to be about as active as the native TL1 but did not exhibit resistance to proteolytic cleavage.

23.5. Combination mutants The most potent of the chimeric constructs, 2N1C1F, was additionally altered so that the cysteine encoded by nucleotides 784-787 as shown in Figure 27 was converted to a serine. This molecule (denoted 2N1C1F (C246S)) was expressed well, potently activated the receptor, was resistant to proteolytic S1 cleavage and was primarily dimeric, rather than higher-order multimeric. Thus the 2N domain appeared to confer protease resistance on the molecule. Finally, this molecule was further altered to eliminate the potentially protease sensitive site encoded by nucleotides 199-201 as shown in Figure 27, to give a molecule (denoted 2N1C1F (R51->S,C246->S)) which was expected to be activating, well expressed, dimeric, and protease resistant.

Table 1 summarizes the modified TIE-2 ligand constructs that were made and characterizes each of them in terms of ability to bind the 20 TIE-2 receptor, ability to activate the TIE-2 receptor, the type of structure formed (monomer, dimer, etc.) and their relative production levels. Unmodified TL1 (plain) and TL2 (striped) are shown with the three domains as boxes. Thus striped boxes indicate domains from TL2.

The cysteine located at position 245 of the mature TL1 protein is indicated by a An through the indicates that that cysteine residue was substituted for by another amino acid as in, for example, the TL1 CYS- mutant. Similarly, an through the in the last construct indicates the substitution for an Arg residue at position 49 of the mature TL1 protein. The is present in one modified TL2 construct showing the TL2 CYS mutant. Constructs having Fc tails or flag tagging are also indicated.

Based upon the teachings herein, one of skill in the art can readily see that further constructs may be made in order to create additional modified and chimeric TIE-2 ligands which have altered properties.

For example, one may create a construct comprised of the N-terminal domain of TL2 and the F-domain of TL1 fused- with the Fc section of human antibody JgG1. This construct would be expected to bind and activate the TIE-2 receptor. Similarly, other constructs may be created using the teachings herein and are therefore considered to be within the scope of this invention.

*5 23.6.Materials and Methods Construction of Chimeras Swapping constructs were inserted into a pJFE14 vector in which the Xbal site was changed to an Ascl site. This vector was then digested with Ascl and Notl yielding an Ascl-Noti backbone. DNA fragments for o the chimeras were generated by PCR using appropriate oligonucleotides.

The FLAG-1C1F and FLAG-2C2F inserts were subcloned into a pMT21 vector backbone that had been digested with EcoRI and Notl. The "CF" truncations were obtained through PCR, and the FLAG tag and a preceding trypsin signalling sequence were constructed by annealing synthetic oligonucleotides.

I ranstections All constructs were transfected transiently into COS7 cells using either DEAE-Dextran or LipofectAMINE according to standard protocols.

Cell cultures were harvested 3 days after the transfection and spun down at 1000 rpm for 1 minute, and the supernatants were transferred to fresh tubes and stored at -200C.

Staining of FLAG-1C1 F-Transfected and FLAG-2C2F-Transfected Cells 6-well dishes of COS7 cells were transfected transiently with the 1 0 TIE-2 receptor. The COS7 supernatant from various ligand tansfections was incubated on the cells for 30 minutes, followed by two washes with Phosphate Buffered Saline (PBS) without magnesium or calcium. The cells were fixed in -20 0 C methanol for 3 minutes, washed once with PBS, and incubated with anti-FLAG M2 antibody (1BI;1:3000 dilution) in PBS/10% Bovine Calf Serum (BCS) for minutes. The cells were washed once with PBS and incubated with goat anti-mouse IgG Alkaline Phosphatase (AP) conjugated antibody (Promega;1:1000) in PBS/10% BCS. The cells were washed twice with PBS and incubated with the phosphate substrate, BCIP/NBT, with 1mM levamisole.

Phosphorylation Assays Dilution of COS7 supernatants for the dose response study was done in the supernatants of COS7 cells transfected with the empty vector pJFE14. EA cells that naturally express the TIE-2 receptor were starved for >2 hours in serum-free medium, followed by challenge with the appropriate COS7 supernatant for 10 minutes at 370C in an atmosphere of 5% C02. The cells were then rinsed in ice-cold PBS and lysed with 1% NP40 lysis buffer containing protease inhibitors tig/ml leupeptin, 10 ig/ml aprotinin, 1mM PMSF) followed by immunoprecipitation with an antibody specific for the TIE-2 receptor.

Samples were then subjected to immunoblot analysis, using anti pTyr antibodies.

Dot Blots Samples were applied to a nitrocellulose membrane, which was blocked and probed with the appropriate antibodies.

o S 23.7 Production of Chimeric Tie-2 Ligand from CHO and Baculovirus Infected Insect Cells Virus Production 1 5 The gene for the chimeric ligand (denoted 2N1C1F (C246S)) was engineered into a baculovirus expression plasmid and recombined with viral DNA to generate recombinant baculovirus, amplified and harvested using methods previously described (O'Reilly, L.K.

Miller, and V.A. Luckow, Baculovirus Expression Vectors A Laboratory i. o Manual 1992, New York: W.H. Freeman). SF21 insect cells (Spodoptera frugiperda) obtained from Invitrogen were adapted and expanded at 270C in Gibco SF900 II serum-free medium. Uninfected cells were grown to a density of 1x1.06 cells/mL. Cell density was determined by counting viable cells using a hemacytometer. The virus stock for the ligand was added to the bioreactor at a low multiplicity 0.01-0.1 PFU/cell to begin the infection. The infection process was allowed to continue for 3-4 days allowing maximum virus replication without incurring substantial cell lysis. The cell suspension was aseptically aliquoted into sterile centrifuge bottles and the cells removed by centrifugation (1600 RPM, 30 min). The cell-free supernatant was collected in sterile bottles and stored at 4°C in the absence of light until further use.

9e e@S 4 9SO* S. @9 9 09

S

The virus titer was determined by plaque assay as described -by O'Reilly, Miller and Luckow. The method is carried out in tissue-culture dishes which are seeded with 1.5x106 cells. Serial dilutions of the virus stock are added to the attached cells and the 1 o mixture incubated with rocking to allow the virus to adsorb to individual cells.' An agar overlay is added and plates incubated for days at 27°C. Viable cells were stained with neutral red revealing circular plaques which were counted to give the virus titer expressed in plaque forming unit per milliliter (PFU/mL).

Infection of Cells for Protein Production Uninfected SF21 cells were grown in tissue culture plates, and virus containg the chimeric ligand gene was added at a multiplicity of 1-10 pfu/cell. The virus was allowed to adsorb for 90 minutes at 27C with gentle rocking, after which the cells were refed with fresh amounts of Sf-900 II serum-free medium. After 3 days of growth at 27C, tissue culture fluids were harvested, and the ligand detected by immunoblotting.

c 9* 5

S.

CHO expression of Tie-2 ligand chimeras Tie-2 ligand chimeras were cloned into any of several mammalian cell expression vectors, including (but not limited to) pJFE, pcDNA3, 100 pMT21, pED or others. Plasmids were transfected into CHO DG44 cells (Urlaub, G. and Chasin, L.A. 1980.. Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity. Proc. Natl. Acad.

Sci. U.S.A. 77:4216-4220; Urlaub, Kas, Carothers, and Chasin, L.A. 1983. Deletion of the diploid dihydrofolate locus from cultured mammalian cells. Cell 33:405-412) by calcium phosphate preciptation or cationic liposomes. In the case of vectors lacking a dhfr selectable marker, the plasmid pSV2.dhfr was cotrahsfected at a molar ratio to the plasmid containing the TIE ligand chimera.

0 DHFR+ cells were selected by growth in selection medium (a medium lacking nucleosides and nucleotides containing 10% dialyzed fetal calf serum), and clones screend for production of chimeric TIE ligands by S immunoblotting with a TIE2 receptor body. Clones expressing the desired protein were subjected to several rounds of gene amplification using graded concentrations of methotrexate in selection medium.

Highly expressing clones were identified after gene amplification by similar immunoblotting techniques.

Cell lines expressing chimeric TIE ligands were cultured. in :10 monolayers, suspension flasks, roller bottles, and bioreactors in selection medium or in medium lacking selection, and can be grown in serum-free medium formulations.

Throughout the description and claims of this specification, the word "comprise" and variations of the word, such as "comprising" and "comprises", is not intended to exclude other additives, components, integers or steps.

101 9 *3 TABLE 1 M!UTATION ANALYSIS N CO(LED-COIL FIRINGEN-

UIKE

ml C TL2 :C F OF TIE LIGANDS 0 0 Hi.R LOW

ORDER

Oman 1-108 DA LOW HliM IG ORDER 10 N.D. N.D. LOW N.D. N.D. H MONOER 1H MONOE 4 DMAR HIGH DMAEvR IIGI-E1

ORDER

I-W-E

ORDER

N.D.

HIGH

HIGHiEST PRODUCTION OF RIJ MOST POTENTLY ACTIVATING N.D. NOT DETERMINED VZV/7777,'%777777F flag-C flag- N.lD. "-GH N.RD. 1408

EDC

rz 1 C

IC

N.D. I-UGH N.D. LOW N.D. 1-mG N.D. LOW N.D. 1-1G D& HI1M N.D. LOW I ;K ~c i

DEPOSITS

The following have been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852 in accordance with the Budapest Treaty. A plasmid clone encoding a TIE- 2 ligand was deposited with the ATCC on October 7, 1994 and designated as "pJFE14 encoding TIE-2 ligand" under ATCC Accession No. 75910. Recombinant Autographa californica baculovirus encoding TIE-2 receptorbody was deposited with the ATCC on October 7, 1994 Sand designated as "vTIE-2 receptorbody" under ATCC Accession No.

VR2484. A lambda phage vector containing human tie-2 ligand DNA was deposited with the ATCC on October 26, 1994 and designated as "lgt10 encoding htie-2 ligand 1" under ATCC Accession No. 75928. A plasmid clone encoding a second TIE-2 ligand was deposited with the ATCC on December 9, 1994 and designated as "pBluescript KS encoding human TIE 2 ligand 2" under ATCC Accession No. 75963. E. coli strain containing plasmid pBeLoBac11 with a human TL-4 gene insert encoding human TIE ligand-4 was deposited with the ATCC on July 2, 1996 and designated as "hTL-4" under ATCC Accession No. 98095.

The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become. apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

103 SEQUENCE LISTING GENERAL INFORMATION APPLICANT: REGENERON PHARMACEUTICALS,

INC.

(LI) TITLE OF THE INVENTIONt NOVEL MODIFIED LIGANDS (ILL) NUMBER OF SEQUENCESt 28 (Lv) CORRESPONDENCE

ADDRESS:

ADDRESSEE: Regeneroft PharmacetticaLsf Inc.

STREET: 777 034 Saw Hll Road CITY: Tarrytown STATE: NY COUNTRY: USA ZIP: 10591 COMPUTER READABLE FORK: MEDIUM TYPE: Diskette COMPUTER: IBM Compatible OPERATING SYSTEM: DOS SOFTWARE: FastSEQ Version (vi) CURRENT APPLICATION

DATA:

APPLICATION NUMBER: NOT YET KNOWN FILING DATE: FILED HEREWITH

CLASSIFICATION-:

(vii) PRIOR APPLICATION

DATA:

-APPLICATION NUMBER: USSH 08/740,222 FILING DATE: 25-OCT-1.996

CLASSIFICATION:

(vii) PRIOR APPLICATION

DATA:

APPLICATION NUMBER: USSN 60/022/999 FILING DATE: 02-AUG-1996 (viii) ATTORNEY/AGENT

INFORMATION:

NAME: Cobert Robert J REGISTRATION NUMBER: 36,108 REFERENCE/DOCKET NUMBER:. REG 333 (1x) TELECOMMUNICATION

INFORMATION:

TELEPHONE: 914-345-7400 TELEFAX: 914-345-7721 INFORMATION FOR SEQ ID NO:1: SEQUENCE

CHARACTERISTICS:

LENGTH: 2149 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (Ix) FEATURE: NAME/KEY: Coding Sequence LOCATION: 310... .1803 OTHER INFORMATION: NAME/KEY: Human TIE-2 ligand 1 LOCATION: 1 2149 OTHER INFORMATION: from clone IgtlO encoding htie-2 ligand 1 (xi) SEQUENCE DESCRIPTION: SEQ ID NOS: CAGCTGACTC AGGCAGGCTC GCTACTATGC AATAAATATC AAAATTTTAA AATTTTAGAA AACGCTTTCT TTGAGGGGGA CTAGTTTTAG AGGTCAGAAG GGCAGTACA ATG ACA GTT Met Thr Val.

1 CATGCTGAAC GGTCACACAG AGAGGAAACA ATAAATCTCA TCAAGTTTTA ACGAAGAALAA ACATCATTGC AGTGAAATAA CAAAGCTAAC AAATGGCTAG TTTTCTATGA TTCTTCTTCA AAGAOTCAA.A CAAACAAGCA GTTTTACCTkG*AAATAAAGAA AAAGGAGCAA GTTTTGCGAG AGO CACGGAA GGAGTGTGCT TTC CTT TCC TTT GCT TTC CTC OCT GCC ATT CTG Phe Leu Ser Phe Ala Phe Leu. Ala Ala Ile Leu 5

ACT

.Thr 15 CAC ATA G TGC His Ile Gly Cys AGC AAT CAG COC Ser Aan Gin Arg 20 ATT CAA CAT GG Ile Gin His Gly

CGA

Arg

CAA

Gin 40

AGT

Ser 25 CCA GAA AAC AGT Pro Glu Asn Ser 000 Gly AGA AGA TAT AAC Arg Arg Tyr Asn

CGG

Arg TOT GCC TAC ACT Cys Ala Tyr Thr TTC ATT Phe Ile 120 180 240 300 351 399 447 495 543 591 639 687 CTT CCA OAA Leu Pro Giu AAC, ACA AAC Asn Thr Asn

CAC

His s0 OAT GGC AAC TOT Asp Oly Aen Cys

COT

Arg 55 GAG AGT ACO ACA Giu Ser Thr Thr GAC CAG TAC Asp Gin Tyr CCG GAT TTC Pro Asp Phe OCT CTG CAG AGA Ala Leu Gin Arg

GAT

Asp 70 GCT CCA CAC GTG Ala Pro-His Val

GAA

Glu 7S TCT TCC Ser Ser CAG AAA CTT CAA Gin Lys Leu Gin

CAT

His 85 CTG GAA CAT GTG Leu Glu His Val

ATG

Met GAA AAT TAT ACT Glu Asn Tyr Thr

CAG

Gin TOG CTG CAA AAA Trp Leu Gin Lys

CTT

Leu 100 GAG AAT TAC ATT Giu Aon Tyr Ile

GTG

Val 105 GAA AAC ATG AAG Glu Asn Met Lys GAG ATO GCC CAG Glu Met Ala Gin

ATA

Ile 115 CAG CAG AAT GCA Gin Gin Asn Ala

OTT

Val 120 CAG AAC CAC ACO Gin Asn His Thr OCT ACC Ala Thr 125 ATG CTG GAG met Leu Giu AGA AAG CTG Arg Lys Leu 145

ATA

Ile 130 GGA ACC AGC CTC Gly Thr Ser Leu

CTC

Leu 135 TCT CAG ACT OCA Ser Gin Thr Ala GAG CAG ACC Giu Gin Thr 140 ACT TCT CGA Thr Ser Arg ACA GAT GTT GAG Thr Asp Val Giu

ACC

Thr 150 CAG OTA CTA AAT Gin Val Leu Asn

CAA

Gin 155 CTT GAG Leu Giu 160 ATA CAG CTG CTG Ile Gin Leu Leu

GAG

Glu 165 AAT TCA TTA TCC Asn Ser Leu Ser

ACC

Thr 170 TAC AAG CTA GAG Tyr Lys Leu Glu

AAG

Lys 175 CAA CTT CTT CAA Gin Leu Leu Gin

CAG

Gin 180 ACA AAT GAA ATC Thr Aen Giu Ile

TTG

Leu 185 AAG, ATC CAT GAA Lys Ile His Giu

AAA

Lye 190 831 879 927 AAC AGT TTA TTA GAA Asn Ser Leu Leu Giu 195 CAT AAA ATC TTA HIS Lys Ile Leu GAA ATG GAA GGA AAA CAC AAG Glu Met Giu Gly Lye His Lys 200 205 GAA GAG TTG Glu Giu Leu GTT ACT CGT Val. Thr hrg 225

GAC

Asp 210 ACC TTA AAG GAA Thr Leu Lys Glu GAG AAA GAG AAC CTT CAA GGC TTG Giu Lys Giu Asn Leu GIn Gly Leu 215 220 975 CAA ACA TAT ATA Gin Thr Tyr Ile

ATC

Ile 230 CAG GAG CTG GAA Gin Giu Leu Giu

AAG

Lys 235 CAA TTA AAC Gin Leu An AGA GCT ACC ACC AAC AAC AGT GTC CTT CAG AAG CAG CAA CTG GAG CTG Arg Ala Thr Thr Asn Asn Ser Val Leu Gin Lys Gin Gin Leu Giu Leu 240 245 250

ATG

Met 255 GAC ACA GTC CAC Asp Thr Vai His

AAC

An 260 CTT GTC AAT CTT Leu Val Ann Leu

TGC

Cy a 265 ACT AAA GAA GOT Thr Lys Giu Gly

GT

Vai 270 TTA CTA AAG OGA Leu Leu Lys Gly

OGA

Gly 275 AAA AGA GAG GAA Lye Arg Giu Giu

GAG

Glu 280 AAA CCA TTT AGA Lys Pro Phe Arg GAC TGT Asp Cye 285 1023 1071 1119 1167 1215 1263 1359 GCA GAT GTA Ala Asp Val1 TAT ,ATT AAT Tyr Ile An 305 TAT CAA Tyr Gin 290 GCT GGT TTT Ala Gly Phe

AAT

An 295 AAA AGT GGA ATC Lys Ser Gly Ile TAC ACT ATT Tyr Thr Ile 300 AAT ATG GAT Ann Met Asp AAT ATG CCA GAA Asn Met Pro Glu

CCC

Pro 310 AAA AAG GTG TTT Lys Lye Vai Phe GTC AAT GOG GGA GOT TGO ACT GTA ATA CAA CAT CGT GAA GAT GGA AGT Vai Ann Giy Gly Gly Trp Thr Vai Ile Gin His Arg Giu Asp Giy Ser 320 325 330 CTA GAT TTC CAA AGA GOC TGG AAG GAA TAT AAA ATG GOT TTT GGA AAT Leu Asp Phe Gin Arg Gly Trp Lys Giu Tyr Lye Met Gly Phe Gly An 335 340 345 350 CCC TCC GOT GAA Pro Ser Gly Glu TAT TGG CTG GOG AAT GAG TTT ATT TTT GCC ATT ACC Tyr Trp Leu Gly Ann Giu Phe Ile Phe Ala Ile Thr 355 360 365 AGT CAG AGG Ser Gin Arg AAC CGA GCC Ann Arg Ala 385 TAC ATG CTA AGA Tyr Met Leu Arg

ATT

Ile 375 GAG TTA ATG GAC Giu Leu Met Asp TGG GAA CG Trp Glu Giy 380 AAT GAA AAG Ann Giu Lys TAT TCA CAG TAT Tyr Ser Gin Tyr

GAC

Asp 390 AGA TTC CAC ATA Arg Phe His Ile

GGA

Gly 395 CAA AAC TAT AGO TTG TAT TTA AAA GGT CAC ACT G Gin Ann Tyr Arg Leu Tyr Leu Lye Gly His Thr Gly 400 405 410 ACA GCA GGA AAA Thr Ala Gly Lys 1407 1455 1503 1551 1599 1647 1695 1743

CAG

Gin 415 AGC AGC CTG ATC Ser Ser Leu Ile

TTA

Leu 420 CAC GGT GCT GAT His Giy Ala Asp

TTC

Phe 425 AGC ACT AAA GAT Ser Thr Lys Asp

GCT

Ala 430 GAT AAT GAC AAC Asp Ann Asp An

TGT

Cys 435 ATG TGC AAA TGT Met Cye Lye Cys 0CC Ala 440 CTC ATG TTA ACA Leu Met Leu Thr GGA GGA Gly Giy 445 TGG TGG TTT Trp Trp Phe

CAT

Asp 450 GCT TGT GCC CCC Ala Cys Gly Pro

TCC

Ser.

455 AAT CTA AAT GGA Ann Leu Ann Gly ATG TTC TAT Met Phe Tyr 460 TGG CAC TAC Trp His Tyr ACT GCG GGA CAA AAC CAT GGA AAA Thr Ala Gly Gin Ann His Gly Lye 465 470 CTG AAT GGG ATA Leu Ann Gly Ile TTC AAA GGG CCC AGT TAC TCC TTA CGT TCC ACA ACT ATG ATG ATT CGA 1791 Phe Lys Gly Pro Ser Tyr Ser Leu Arg Ser Thr Thr Met Met Ile Arg 480 485 490 CCT TTA GAT TTT TGA NAG CGCA ATGTCAGAAG CGATTNTGAA AGCAACAAAG AAATC 1848 Pro Leu Asp Phe 495 CGGAGAAGCT GCCAGGTGAG NAACTGTTTG NAAACTTCAG NAGCAAACAA TATTGTCTCC 1908 CTTCCAGCAA TAAGTGGTAG TTATGTGAAG TCACCANGGT TCTTGACCGT GAATCTGGAG 1968 CCGTTTGAGT TCACAAGAGT CTCTACTTGG GGTGACAGTG CTCACGTGGC TCGACTATAG 2028 AAAACTCCAC TGACTGTCGG GCTTTAAAAA GGGNAGAAAC TGCTGAGCTT GCTGTGCTTC 2088 A.AACTACTAC TGGACCTTAT TTTGGAACTA TGGTAGCCAG NTGATAAATA TGGTTAATTT 2148 C 2149 .9~9 9 9* 9 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 498 amino acids TYPE:.' amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein -()FRAGMENT TYPE: internal (ix) FEATURE: NAME/KEY: Human TIE-2 ligand 1 LOCATION: 498 OTHER INFORMATION: from clone XgtlO ligand 1 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Thr Val Phe Leu Ser Phe Ala Phe Leu Ala Ala encoding htie-2 Ile Ile Gly Cys Tyr I GluI NAn Gin Leu4 Ala Glu Leu 145 Ile Leu Leu Leu Arg 225 Thr Thr s6n 'is kla Gin Ile 130 Thr Gin Leu Leu Asp 210C Gir Arg Asp Leu Leu Lys Ile 115 Gly Asp Leu Gin Glu 195 Thr Ser Ile Giy Gin GI .n Leu 100 Gin Thr Val Leu Gin 180 His Leu ksn Gin P 3 in Asn Arg His Glu Gin Ser C iu C iu 165 Thr Lys

LYE

His C Cys Asp 70 Leu NAn An Leu Thr 150 NAn NAn le Glu Sle 230 10 Lrg Arg Ser Pro Glu 25 ;ly Gin Cys Ala Tyr 40 55 kla Giu Tyr Ala Leu 135 Gin Ser G iu Leu Giu 215 Glr 3lu Ser Thr Thr Pro I His Ile Val 120 Ser Val Leu Ile Glu 200 Lye Giu Gin iLeu 'is la 1 Jai 105 Gln Gin Leu Ser Leu 185 Met Gi1.

Let.

Val C Met 90 Giu NAn Thr NAn Thr 170 Lys Giu Aen Giu ;iu 75 3 lu Asn His NAn Ser Thr Phe Asp Gin Pro Asp an Tyr Met Lys Thr Ala 125 Leu Giy Ile Tyr Phe Thr Ser 110 Thr Thr Arg Leu NAn Ser Gin Giu Met His Nrg Pro Thr Ser Trp Met Leu Ala Gin 155 Tyr Ile G iy Leu Lys 235E Glu Gin Thr Arg Lys Thr.

Lye His Lys Gin 220 Gin Ser.

Leu Giu His 205 Gly Leu Arg Glu Lys 190 Lys Leu Asr Leu Lye 175 An G lu Val Arg Gilu 160 Gin Ser Giu Thr Ala 240 Thr Tyr 11E Thr Asn an Ser Val Le.

245 Val His Asn Leu Val Asr Lys Gin Gin 250 Cys Thr Lys Leu Giu Leu Met 255 Giu Giy Vai Leu Leu 260 265 270 Lys Giy Gly Lys Arg Glu Giu Glu Lys Pro Phe Arg Asp Cys Ala ASP 275 280 285 Val Tyr Gin Ala Gly Phe Asn Lye Ser Gly Ile Tyr Thr Ile Tyr Ile 290 295 300 Aen Asn Met Pro Glu Pro Lys Lys Val Phe Cys Aen Met Asp Val Aen 305 310 315 320 Gly Giy Gly Trp Thr Val Ile Gin His Arg Giu Asp Gly Ser Leu Asp 325 330 335 Phe Gin Arg Gly Trp Lys Glu Tyr Lye Met Giy Phe Gly Aen Pro Ser 340 345 .350 Gly Giu Tyr Trp Leu Gly Asn Giu Phe Ile Phe Ala Ile Thr Ser Gin 355 360 365 Arg Gin Tyr Met Leu Arg Ile Giu Leu Met Asp Trp Glu Gly RAn Arg 370 37S 380 Ala Tyr Ser Gln Tyr Asp Arg Phe His Ile Gly RAn Glu Lye Gin Asn 385 390 39S 400 Tyr Arg Leu Tyr Leu Lye Gly His Thr Gly Thr Ala Gly Lys Gin Ser 405 410 415' Ser Leu Ile Leu His Giy Ala Asp Phe Ser Thr Lye Asp Ala Asp an 420 425 430 Asp an Cys Met Cys Lys Cys Ala Leu Met Leu. Thr Gly Gly Trp Trp 435 440 445 Phe Asp Ala Cys Gly Pro Ser RAn Leu An Gly Met Phe Tyr Thr Ala 455 460 Gly 'Gin An His Gly Lye Leu. RAn Gly Ile Lye Trp His Tyr Phe Lys 465 470 475 480 Giy Pro Ser Tyr Ser Leu Rrg Ser Thr Thr Met Met Ile Arg Pro Leu *485 490 495 Asp Phe INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 2146 base pairs TYPE: nucleic acid STRMNDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (ix) FEATURE: NAME/KEY: Coding Sequence LOCATION: 310.. .1800 OTHER INFORMATION: NAME/KEY: Human TIE-2 iigand 1 LOCATION: 1 .2146 OTHER INFORMATION: from T98G clone (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CAGCTGACTC AGGCAGGCTC CATGCTGAAC GGTCACACAG AGAGGAAACA ATAAATCTCA GCTACTATGC AATAAATATC TCAAGTTTTA ACGAAGAAAA ACATCATTGC AGTGAAATRA 120 AAAATTTTAA AATTTTAGAA CAAAGCTAAC AAATGGCTAG TTTTCTATGA TTCTTCTTCA 180 AACGCTTTCT TTGAGGGGGA AAGAGTCAAA CAAACAAGCA GTTTTACCTG AAATAAAGAA 240 CTAGTTTTAG AGGTCAGAAG AAAGGAGCAA GTTTTGCGAG AGGCACGGAA GGRGTGTGCT 300 GGCAGTACA ATG ACA GTT TTC CTT TCC TTT GCT TTC CTC GCT GCC ATT CTG 351 Met Thr Val Phe Leu Ser Phe Ala Phe Leu Ala Ala Ile Leu 1 5 ACT CAC ATA GGG TGC AGC RAT CAG CGC CGA AGT CCA GRA ARC AGT GGG 399 Thr His Ile Gly Cys Ser Aen Gin Arg Arg Ser Pro Glu Asn Ser Gly 20 25 AGA AGA TAT AAC Arg Arg Tyr Aen

CGG

Arg ATT CAA CAT GGG Ile Gin His Gly

CAA

Gin 40 TGT GCC TAC ACT Cys Ala Tyr Thr TTC ATT Phe Ile CTT.CCA GAA Leu Pro Glu AAC ACA AAC Aen Thr Aen

CAC

His GAT GGC AAC TGT Asp Gly Aen Cys GAG AGT ACG ACA Glu Ser Thr Thr GAC CAG TAC Asp Gin Tyr CCG GAT TTC Pro Asp Phe GCT CTG CAG AGA Ala Leu Gin Arg

GAT

Asp 70 GCT CCA CAC GTG Ala Pro His Val

GAA

Giu 447 495 543 591 639 TCT TCC Ser Ser CAG AAA CTT CAA Gin Lye Leu Gln CTG CAA AAA CTT Leu Gin Lye Leu 100

CAT

His 85 CTG GAA CAT GTG Leu Giu His Val

ATG

Met GAA AAT TAT &CT- Giu Adn Tyr Thr

CAG

Gin

TGG

Trp GAG A.AT TAC ATT Glu'Asn Tyr Ile

GTG

Val 105 GAA AAC ATG AAG Glu. Asn Met Lys

TCG

Ser 110 0 9* GAG ATG GCC Giu. Met Ala ATG CTG GAG Met Xteu Glu AGA AAG CTG Arg Lye Leu 145 CAG ATA CAG Gin.'lie Gin 115 CAG AAT GCA Gin Asn Ala

GTT

Val 120 CAG AAC CAC ACG Gin Asn His Thr OCT ACC Ala'Thr 125

ATA

Ile 130

'OGA

Gly ACC AGC CTC Thr Ser Leu

CTC

Leu 135 TCT CAG ACT Ser Gin Thr GCA GAG CAG ACC Ala Glu Gin Thr -140 ACA OAT GTT GAG Thr Asp Val Giu

ACC

Thr 150 CAG GTA CTA AAT Gin Val Lou Asn

CAA

Gin 155 ACT TCT CGA Thr Ser Arg CTT GAG Lou Giu 160 ATA CAG CTG CTG Ile Gin Leu Leu

GAG

0 iu 165 AAT TCA TTA TCC Asn Ser Leu Ser

ACC

Thr 170 TAC, AAG CTA GAG Tyr Lys Leu Glu 687 735, 783 831 879 927 975 1023

AAG

Lye 175 CAA CTT CTT CAA Gin Leu Lou Gin

CAG

Gin 180 ACA AAT GAA ATC Thr Aen Giu Ile

TTG

Lou 185 A.AG ATC CAT GAA Lye Ile His Oiu

AAA

Lys 190 AAC ACT TTA TTA Asn Ser Lou Lou

GAA

Giu 195 CAT AAA ATC TTA His Lye Ile Lou

GAA

Giu 200 ATG GAA GGA AAA Met Giu Giy Lys CAC ANG His Lye 205 GAA GAG TTG Giu Oiu Lou OTT ACT CGT Val Thr Arg 225

GAC

Asp 210 ACC TTA AAG GAA Thr Leu Lye Giu

GAG

0 iu 215 AAA GAG AAC CTT Lys Giu Asn Lou CAA GOC TTG Gin Giy Lou 220 CAA TTA AAC Gin Leu Asn CAA ACA TAT ATA Gin Thr Tyr Ile

ATC

Ile 230 CAG GAG CTG GAA Gin Glu Leu Glu

AAG

Lys 235 AGA GCT Arg Aia 240 ACC ACC AAC AAC Thr Thr Asn Asn

AGT

Ser 245 GTC CTT CAG AAG Vai Lou Gin Lye

CAG

Gin 250 CAA. CTG_ GAG .CTG Gin leu Giu'Leu 1071

ATG,

Met 255 GAC ACA GTC CAC Asp Thr Vai His

AAC

As n 260 CTT GTC AAT CTT Lou Val Aen Lou

TG

Cys 265 ACT AAA GAA OTT Thr Lys Oiu Val

TTA

Leu 270 CTA AAG GGA 0-GA Lou Lys Gly Oly

AAA

Lys 275 AGA GAG GAA GAG Arg Giu Giu Glu

AAA

Lys 280 CCA TTT AGA GAC Pro Phe Arg Asp TOT GCA Cys Ala 285 1119 1167 1215 GAT GTA TAT Asp Vai Tyr CAA OCT OCT TTT AAT AAA Gin Ala Gly Phe Asn Lys 290 295 AGT GGA ATC TAC Ser Giy Ile Tyr ACT ATT TAT Thr Ile Tyr 300 ATT AAT AAT Ile Ann An 305 AAT COG GGA Asn Gly Gly 320 ATG CCA GAA CCC Met Pro Giu Pro

AAA

Lys 310 AAC GTG TTT TC Lys Val Phe Cys AAT ATG GAT CTC Asn Met Asp Val.

315 CAT GGA AGT CTA Asp Gly Ser Leu GGT TOG ACT Gly Trp Thr

GTA

Val 325 ATA CAA CAT CGT Ile Gln His Arg

GAA

Glu 330

GAT

Asp 335 TTC CAR AGA GCC Phe Gin Arg Gly

TG

Trp 340 RAG GAA TAT AA Lys Giu Tyr Lye

ATG

Met 345 COT TTT GGA ART Gly Phe Gly An

CCC

Pro 350 TCC COT GRA TAT Ser Giy Glu Tyr

TG

Trp 355 CTG GGG RAT GAG Leu Gly Ann Clu

TTT

Phe 360 ATT TTT GCC ATT Ile Phe Ala I e ACC ACT Thr Me r 365 CRC AGO CRC Gin Arg Gln CCA GCC TAT Arg Ala Tyr 385

TAC

Tyr 370 ATG CTA AGA ATT Met Leu Arg Ile

GAG

Giu 375 TTA ATG CRC TGG Leu Met Asp Trp CAR GGG AAC Glu Gly An 380 CAA AAG CAA Giu Lys GIn 1263 1311 1359 1407 1455 1503 1551 1599 1647 TCA CAG TAT GAC Ser Gin Tyr Asp

AGA

Arg 390 TTC CAC ATA GGR Phe His Ile Gly

AAT

An 395

S

RAC. TAT Asn Tyr 400 AGG TTG TAT TTA Arg Leu Tyr Leu

AA

Lys 405 GOT CAC ACT GG Gly His Thr Cly

ACA

Thr 410 GCA GOR ANCAG Ala Gly Lys Gin

AC

Ser 415 RGC CTG ATC TTR Ser Leu Ile Leu

CAC

His 420 COT CCT CAT TTC Cly Ala Asp Phe

AOC

Ser 425 ACT AAA CAT GCT Thr Lys Asp Ala

CAT

Asp 430 RAT CRC ARC TGT Ann Asp Aen Cys

ATG

Met 435 TOC AA TGT CC Cys Lys -Cys Ala

CTC

Leu 440 ATG TTA ACA CON Met Leu Thr Gly OGA TG Gly Trp 445 TGG TTT CAT Trp Phe Asp GC CON CAA Ala Cly Gin 465

CCT

Ala 450 TGT GGC CCC TCC Cya Gly'Pro Ser

AAT

Asn 455 CTA RAT GGA ATG Leu An Gly Met TTC TAT ACT Phe Tyr Thr 460 CRC TAC TTC His Tyr Phe ARC CAT CCA Ann His Arg AA CTC Lys Leu 470 R.AT CGG ATA AAG Ann Cly Ile Lys

TGG

Trp 475 1695 1743 1791

A

Lys CCC ACT TAC TCC Pro Ser Tyr Ser

TTA

Leu 485 CGT TCC ACA ACT Arg Ser Thr Thr

ATG

Met 490 ATG ATT CGN CCT Met Ile Arg Pro TTA CAT TTT TCA AAGCGCA ATGTCAGAAG CGATTATGAA AGCAACAAAG AATCCGGA 1849 Leu Asp Phe 495 GAAGCTGCCA GGTGAGAAAC TGTTTGAAAA.

CACCAATAAG TGGTACTTAT CTGAAGTCAC TTCRGTTCAC AAGAGTCTCT ACTTGGCCTG CTCCACTGAC TCTCGGGCTT TARARGOGA TACTACTGGA CCTTATTTC GARCTATCGT

CTTCACAAGC

CAAGGTTCTT

ACAGTGCTCA

AGAAACTGCT

ACCRGATGA

AAACAATATT GTCTCCCTTC

CACCGTGAAT*CTGOAGCCGT

CGTGCCTCGA CTATAGAAAA GAGCTTGCTG TGCTTCAAAC TAAATATGGT TAATTTC 1909 1969 2029 2089 2146 INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS: LENGTH: 497 amino-acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (Ui) MOLECULE TYPE: protein FRAGMENT TYPE: Internal

FEATURE:

NAME/KEY: Human TIE-2 ligand 1 LOCATION: .2146 OTHER INFORMATION: from T98G clone (xi) SEQUENCE DESCRIPTION: SEQ ID 140:4: Met Thr Val Phe Leu Ser Phe Ala Phe Leu Ala Ala Ile Leu Thr His 1 5 10 Ile Gly Cys Ser Asn Gin Arg Arg Ser Pro Giu Asn Ser Gly Arg A rg 25 Tyr Ann Arg Ile Gin His Gly Gin Cys Ala Tyr Thr Phe Ile Leu Pro 40 Giu His Asp Gly Asn Cys Arg Giu Ser Thr Thr Asp Gin Tyr Asn Thr 55 Asn Ala Leu Gin Arg Asp Ala Pro His Val Giu Pro Asp Phe Ser Ser 70 75 Gin Lys Leu Gin.His Leu Giu His Val Met Giu Asn Tyr Thr Gin Trp 90 Leu Gin Lys Leu Gliu Asn Tyr Ile Val Giu Aen Met Lys Ser Giu Met 100 1 05 110 Ala..Qln Ile Gin Gin Ann Ala Vai Gin Asn His Thr Ala Thr Met Leu 115 120 125 *Giu Ile Gly Thr Ser Leu Leu Ser Gin Thr Ala Glu Gin Thr Arg Lye Leu Thr Asp Val Giu Thr Gin Val Leu Asn Gin Thr Ser Arg Leu Giu 145 150 155 160 S le.Gin Leu Leu Glu Asn Ser Leu Ser Thr Tyr Lys Leu Glu Lys Gin 165 i170 175 Leu Leu Gin Gin Tkir Aen Giu Ile Leu Lys Ile His Giu Lye Asa Ser 180 15190 Leu Leu Giu His Lye Ile Leu Giu. Met Glu Gly Lye His Lye Giu Giu 195 200 205 Leu Asp Thr Leu Lye Giu Giu Lye Giu Aen Leu Gin Giy Leu Vai-Thr.

210 215 220 Arg Gin Thr Tyr Ile Ile Gin Giu'Leu Glu Lys Gin Leu Aen Arg Ala 225 230 235 240 *Thr Thr Asn Asn Ser Val Leu Gin Lye Gin Gin Leu Glu Leu Met Asp 245 -250 255 Thr Val His Asn Leu Val Asn Leu Cys Thr Lys Glu Val Leu Leu Lys 260 265 270 Gly Gly Lys Arg Giu Glu Giu Lys Pro Phe Arg Asp Cys Ala Asp Vai *275 280 285 Ty Gin Ala Gly Phe Aen Lye Ser Gly Ile Tyr Thr Ile Tyr Ile Aen 290 29S 300 Aen Met Pro Giu Pro Lye Lye Val Phe Cys Asn Met Asp Val Asn Gly 305 310 315 320 Gly Gly Trp Thr Val Ile Gin His Arg Glu. Asp Gly Ser Leu Asp Phe 325 330 33S Gin Arg Gly Trp Lye Giu Tyr Lye Met Gly Phe Gly Asn Pro Ser Gly 340 345 350 Giu Tyr Trp Leu Gly Ann Giu Phe Ile Phe Ala Ile Thr Ser Gin Arg 355 360 365 Gin Tyr Met Leu Arg Ile Giu Leu Met Asp Trp Giu Gly Ann Arg Ala 370 375 380 Tyr Ser Gin Tyr Asp Arg Phe His Ile Gly Ann G lu Lys Gin Aen Tyr 385 390 395 400 Arg Leu Tyr Leu Lye Gly His Thr Gly Thr Ala Gly Lye Gin Ser Ser 405 410 415 Leu Ile Leu His Gly Ala Asp Phe Ser Thr Lys Asp Ala Asp Ann Asp 420 425 430 Asn Cys Met Cys Lye Cys Ala Leu Met Leu Thr Gly Gly Trp Trp Phe 435 440 445 Asp Ala Cys Gly Pro Ser Asn Leu Asn Gly Met Phe Tyr Thr Ala Giy 450 455 460 Gin Nen His Arg Lys Leu Asn Giy Ile Lys Trp His Tyr Phe Lys Gly 465 470 475 480 Pro Ser Tyr Ser Leu Arg. Ser Thr Thr Met Met Ile Arg Pro Leu Asp 485 490 495 Phe INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 2282 base-pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (iU) MOLECULE TYPE: DNA (ix) FEATURE: NAME/KEY: Coding Sequence LOCATION: 357 i1844 OTHER INFORMATION: NAHE/KEY: Human TIE-2 ligand 2 LOCATION: 2282 OTHER INFORMATION: from clone pBiuescript KS encoding human TIE 2 ligand 2 (xi)*SEQUENCE DESCRIPTION: SEQ ID

GANTTCCTGG

TCTGGGGAGA

CCAAGTGAGC

AACACAGCAG

ACGGACCCAG

TGGACGTGTG

GTTGGTGTTT

GAGGAACAAA

AGGACTGTTC

TAAAAACCAG

CCATGGCAGC

TTTGCCCTCA.

ATCTCCTCCC

GGACCGTGAA

TTCCCACTGC

GTTTGCTACT

GTAGCAGCCC

AGTTTGCTAA

AGCCTTGAGG

AGCTGCTCTG

AATCTGACAG

GGAANAGAG

TGCGTTTCAG

GCTGCTGGTT

GAGGGANCAA

TAAAAGCTGA

TTTACTGCNT

GAAAGAGAAG

ACGGCAGCAG

TATTACTGAA

CACTGTAGGA

CACAGCCCTC

GCCTGGAGAG

ACTTTCATTG

CTCGGGACTC

GAAAGA ATG Met 1 120 180 240 300 359 TGG CAG ATT GTT Trp Gin Ile Vai GCC TAT ANC..NAC Aia Tyr Nen Aen TTC TTT ACT CTG Phe Phe Thr Leu

AGC

Ser 10 TGT GAT CTT GTC TTG GCC GCA Cys Asp Leu Val Leu Ala Ala is TTT CGG ANG Phe Arg Lye

AGC

Ser 25 ATO GAC AGC ATA Met ASP Ser Ile GGA NAG NAG CAN Gly.Lye Lye Gin TAT CAG GTC CAG CAT GGG TCC TGC AGC TAC ACT TTC CTC CTG CCA GAG Tyr Gin Val Gin His Gly Ser Cys Ser Tyr Thr Phe Leu Leu. Pro Giu .40 455 503, 551 599

ATG

Met so GAC AAC TGC CGC Asp Aen Cys Arg

TCT

Ser 55 TCC TCC NOC CCb Ser Ser Ser Pro

TAC

Tyr 60 GTG TCC ANT OCT Val Ser Asn Ala

GTG

Vai CAG AGG GAC GCG Gin Nrg Asp Ala

CCG

Pro CTC GAN TAC Leu Giu Tyr GAT GAC Asp Asp 75 TOG GTG CAG AGO Ser Val Gin Arg CTG CAN Leu Gin OTG CTG GAG Val Leu Glu GAG ANT TAT Oiu Aen Tyr 100

NAC

An ATC ATG GAA ANO Ile Met Giu An

ANO

Asn 90 ACT CAG TGG CTA Thr Gin Trp Leu NTG ANO OTT Met Lye Leu ATC CAG GAO ANO Ile Gin Asp An

ATO

Met 105 NAG ANA GAN ATG OTA GAG ATA CAG Lys Lye Giu Met Val Giu Ile Gin 110 695 CAG AAT GCA GTA Gin Aen Ala Val.

U1S CAG AAC CAG Gin Aen Gin 120 ACG OCT GTO ATG Thr Ala Val. Met

ATA

Ile 125 GAA 1ATA 000 ACA Giu Ile Gly Thr

A.AC

Asn 130 CTG, TTG AAC CAA Leu Leu Aen Gin

ACA

Thr 135 GCT GAG CAA ACG Ala Giu Gin Thr

CGG

Arg 140 AAG, TTA ACT GAT Lys Lou Thr Asp

GTO

Val 145 GAA 0CC CAA GTA Glu Ala Gin Val AAT CAG ACC ACG Asn Gin Thr Tkir

AGA

Arg 155 CTT GAA CTT CAG Leu Giu Lou Gin CTC TTG Leu Leu 160 GAA CAC TCC Glu Hie Sor ACC AGT GAA Thr Ser Oiu 180

CTC

Leu 165 TCG ACA AAC AA Ser Thr &an Lye

TTG

Leu 170 GAK AAA CAG ATT Giu Lys Gin Ile TTG GAC CAG.

Leu Asp din 175 ATA AAC. AAA TTG Ile Ken Lys Leu CAA GAT AAG KAC AGT TTC CTA OAK AAG 'Gin Asp Lys Aen Ser Phe Leu Giu Lys 185 190

S

AAG GTG Lys Val 195

AAA.GAA

Lys 'Glu 210 CTA GCT ATO OAK Leu Ala Met Giu GAC AAG CAC ATC KTC CAA CTA CAG TCA ATA Asp Lys His Ile Ile Gin Lou Gin Ser Ile 200 205 GAG AAA OAT Giu Lys Asp

CAG

Gin 215 CTA CAG GTG TTA Leu Gin Val Leu

GTA

Val 220 TCC AAG CAA AAT Ser Lys Gin.An

TCC

Ser 225 KTC ATT GAA GAA Ile Ile Giu Giu

CTA

Lou 230 OAA AAA AAA ATA Giu Lys Lys Ile ACT GCC ACG Thr Ala Thr TCA OTT CTT Ser Val Lou

CAA

Gin 245 AAG CAG CAA CAT Lys Gin Gln His

GAT

Asp 250 CTC ATG GAG ACA Leu Met Oiu Thr GTG AAT AAT Val Ken An 240 OTT KAT AAC Vali Aen Ken 255 CCC ACT OTT Pro Thr Val 743 791 839 887 935 983.

10313' 1079 1127 1175 1223 1271 1319 1367 1415 TTA CTG ACT ATG Leu Leu Thr Met 260.

ATG TCC ACA Met Ser Thr

TCA

Ser 265 AAC TCA GCT AAG Ken Ser Ala Lye

GAC

Asp 270 GCT AA Ala Lye 275 GKA GAK CAK ATC Giu Giu Gin Ile

AGC

Ser 280 TTC AGA GAC TGT Phe Arg Asp Cys

OCT

Ala 285 GAA GTA TTC AAA Giu Val Phe Lye

TCA

Ser 290 00K CAC ACC ACA AAT 0C ATC TAC ACO TTA ACA*TTC CCT AAT TCT Gly His Thr Thr.Ken Gly Ile Tyr Thr Lou Thr Phe Pro Asn Ser 295 300 305 ACA OAK GAG ATC Thr Glu Giu Ile

AAG

Lye 310 0CC TAC TOT GAC Ala Tyr Cys Asp

ATG

Met 315 OAA OCT OGA 00K Oiu Ala Gly Oly GOC 000 Gly Gly 320 TGG ACA ATT ATT CAG CGA COT GAG OAT Trp Thr Ile lI10 Gin Arg Krg Glu Asp 325 330 OGC AGC OTT GAT Oly Ser Val Asp TTT CAG AGO Phe Gin Arg 335 GGA OAK TAT Gly Giu Tyr ACT TOO AAA Thr Trp Lys 340 OAA TAT AAA OTO Giu Tyr Lys Val 00K Gly 345 TTT GOT AAC CCT Phe Gly Asn Pro

TCA

Ser 350 TOG CTG Trp Lou 355 GGA AAT GAG TTT OTT TCG CAA CTG ACT AAT Gly Ken Glu Phe Val Ser Gin Lou Thr Asn 360 365 CAG CAA COC TAT Gin Gin Arg Tyr 1463 1.511

GTG

Val 370 CTT AA ATA CAC Lou Lye Ile His CTT AAA GAC TOG OAK 000, Leu Lye Asp Trp Giu Gly 375 380 AAT GAG OCT TAC Asn Olu Ala Tyr

TCA

Ser 385 TTG TAT GAA CAT Leu Tyr Giu His

TTC

Phe 390 TAT CTC TCA AGT Tyr Leu Ser Ser GAA GAA CTC AAT Giu Glu Leu Asn 395 GGC AAA ATA AGC Gly Lys Ile Ser CAC CTT AAA His Leu Lys CAAi CCA GGA Gin Pro Gly 420

GGA

G ly 405 CTT ACA GGG ACA Leu Thr Gly Thr

GCC

Ala 410 TAT AGO ATT Tyr Arg Ile 400 AGC ATC AGC Ser Ile Ser 415 GAC AAA TGT Asp Lye Cys AAT GAT TTT AGC Asn Asp Phe Ser

ACA

Thr 425 AAG GAT GGA GAC Lys Asp Gly Asp ATT TGC Ile Cys 435 AAA TGT TCA CAA Lys Cys Ser Gin

ATG

Met 440 CTA ACA GCA GGC Leu Thr Gly Gly

TGG

Trp 445 TCG TTT GAT GCA Trp Phe Asp Kia

TGT

Cys 450 GGT CCT TCC AAC Cly Pro Ser Asn

TTG

Leu 455 AAC GGA ATG Aen Gly Met TAC TAT Tyr Tyr 460 CCA CAG AGG CAG Pro Gin Arg Gin AAiC Asn 465 i1559 1607 1655 1703 1751 1799 1849' .1909 1969 2029 2089 2149 2209 2269 2282 ACA AAT AAG TTC Thr Asn Lys Phe

AAC

Aen 470 GGC ATT AAA TGG Gly Ile Lys Trp TAC TOG AAA GC Tyr Trp Lye Giy TCA GGC Ser Gly 480 TAT TCG CTC Tyr Ser Leu AAG CCC ACA ACC ATG ATG ATC CGA CCA GCA CAT TTC TAAAC' Lys Ala Thr Thr Met-Met Ile Arg Pro Ala-Asp Phe 485 490 495 ATCCCAGTcc

GAAAGTCACG

CGGGACCCAC

AAC2GGACCAA

AGATGAACCC

AATGTTATGT

ACAGATCATC

ATGTCCTGAA

ACCTGAGGAA

GCTGCGCACT

ATCCTCCAGA

AGCAAGACCC

GAGGCTGAGA

GCAAGTTTAT

TTGGAACTGC

TTC

CTGTCTCCAA

GTGTCCTC!TT

TTAGAGCCTG

TAAACATCCA

ATCAGACTGA.

CAGTAAATAA

ATTCTTCTGA

CTATTTTCAA

CCACCACAGA

TAAACTTTAT

TAATTGTGAT

CAGTTTACAG

CTGGAAAACA

GCACTGTTTA

AGACTTAAGC

GGGCGTGTGC

CACTTAAACT

TAGACAGAAC

ACGCTGCTGT

GAACACTTAT

TACACTGTGT

CCAGTGCACT

TCGGTGCTGA

TGCATCACTT

ACCTATGCAA

CACAACCAAG,

GTTATACAAT

AAATACCCAT

INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS: LENGTH: 496 amino acids TYPE: amino* acid STRANDEDNESS: single TOPOLOGY: linear (1i) MOLECULE TYPE: protein FRAGMENT TYPE: internal (ix) FEATURE:..

NAME/K EY: Human TIE-2 ligand 2 LOCATION: .496 OTHER INFORMATION: from cione pBluescript KS encoding human TIE 2 ligand 2 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: Met Trp Gin 1 Ala Ala Tyr Gin Tyr Gin Glu Met Asp Val Gin-Arg Ile Val Phe Phe Thr Leu Ser Cys Asp Leu Aen Val Asn Phe Arg Lys Ser 25 Cy s Asp Ser Ile Val Leu Aia is Gly Lys Lye Leu Leu Pro Ser Aen Ala Gin His Gly Ser 40 Ser Ser Tyr Thr Phe Val Asn Cys Arg Ser 55 Leu Ser Ser Pro Tyr Ser Asp Ala Gin Val Leu Glu Asn Pro 70 Ile Glu Tyr Asp Asp 75 Thr Val Gin Arg Leu Lys Met Giu Aen Aen Gin Trp, Leu Met 114

C.

C

C.

*I

Leu Gin Thr Val 145 Leu Gin Lys Ile Ser 225 Aen Asen Val Lye Ser 305 Gly Arg Tyr Tyr Ser 385 Ile Ser Cys Ala Aesn 465 Gly Glu Aen Tyr I 100 Gin Asn Ala N 115 Asn Leu Leu 130 Glu Ala Gin Glu His Ser Thr Ser Gu 180 Lye Val Leu 195 Lye Giu Glu 210 Ile Ile Glu Ser Val Leu Leu Leu Thr, 260 Ala Lye Glu 275 .Ser Gly His 290 Thr Giu Glu Trp Thr Ile Thr Trp Lye 340 Trp Leu Gly 355 Val Leu Lye 370 Leu Tyr Glu His Leu Lye Gin Pro Gly 420 Ile Cys Lye 435 Cys Gly Pro 450 Thr Asn Lye Tvr Ser Leu le Gin Asp Asn Met Lye Lye Glu Met al Gin A Asn Gin T 1 Val Leu A 150 Leu Ser 1 Ile Asn I Ala Met Lye Asp Glu Leu 230 Gin Lye 245 Met Met Glu Gin Thr Thr Ile Lye 310 Ile Gin 325 Glu Tyr Asn Glu Ile His His Phe 390 Gly Leu 405 Asn Asp Cys Ser Ser Asn Phe Aen 470 Lye Ala 485 an Gin Thr Ala Val Met Ile Glu.

hr 35 Len Thr .ys Glu GIn 215 3lu Gin Ser Ile Asen 295 Ala Arg Lys Phe Let.

375 Tyr Th Ph G1I Le 45 G1 Th 120 Ala G Gin T Asn L Leu G 1 Asp L 200 Leu G Lys L Gin I Thr Ser 280 Gly Tye Arg Val Val 360 Lye SLeu r Gly e Ser n Met 440 u Asn 5 y Ile r Thr iu hr ye In 85 'ye In ye is 3er 265 ?he Ile Cye Glu Gly 345 Ser Asp Ser Thr Thr 42 Le

GI

Ly Me

G

T

L

1 In hr eu 70 Thr Arg 155 Glu Arg 140 Leu Lye 125 Lye Glu Gin Leu Leu Ile Ile Gly Thr Asp Gin Leu 160 Leu Asp 175 Asp Lye A His Ile I Val Leu V 2 Ile Val 235 Asp Leu b 250 Aen Ser Arg Asp Tyr Thr Asp Met 315 Asp Gly 330 Phe Gly Gin Leu Trp Glu Ser Glu 395 SAla Gly 410 SLye Asp u Thr Gly y Met Tyr a Trp Tyr 475 *sn le al hr et Ala Cys Leu 300 Glu Ser Asn Thr Gly 38C Gl% Ly Gi Gl' Ty 46 Ty Ser P 1 Gin L 205 Ser L Ala T Glu T Lye A 2 Ala G 285 Thr I Ala C Val Pro Aen 365 r Asn Leu a Ile y Asp y Trp 445 r Pro 0 r Trp he eu ys hr hr sp lu Phe Gly Sez G ir G1 As Se As 43 Tr G1 Ly Leu Gin Gin Val Val 255 Pro Val SPro Gly Phe 335 Gly SGi x Al n Ty r Se 41 n As 0 p Ph n Ar a Gl Glu Ser Aen Asen 240 Aen Thr Phe Asn Gly 320 Gin Glu I Arg a Tyr r Arg 400 r Ile p Lye e Asp g Gin y Ser 480 Val Glu Ile 110 t Met Ile Arg Pro Ala 490 NO:7: Asp Phe 495 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 478 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein (1x) FEATURE: NAME/KEY: Mature TL1 protein LOCATION: 1...478 OTHER INFORMATION: 115 (xI) SEQUENCE Ann Gin Arg Arg Ser 1 5 DESCRIPTION: SEQ ID Pro Giu Ann Ser Gly NO:17: Arg Krg 10 0* 0 0 *00 00 00 *000 Girn His G Ann Cys A 3 Arg Asp A His Leu G Giu Ann' Gin Aen P Ser Leu I Glu ThrC 130 Glu Ann 145 Thr Ann Lye Ile Lye Giu Ile Ile 210 Ser Val 225 Leu Val Arg Giu Giy Phe Glu Pro 290 Thr Val 305 Trp Lye Leu Gly Leu Arg iy Gi rg Gl

S

ia Pz iu Hi 'yr I lia Vd 14 ~eu S ;in V Ser L Giu I Leu G 1 Giu L 195.

Gin G Leu C Ann I GiuC Ann 275 Lye Ile Giu Ann Ile 355 Arg Gly Al a Cy 5 Ser 435 Leu Arg Ls le ai eu ie' u ~ys liu ~In .eu ;iu 60 Gin Tyr Gl.

3 4C G11.

Ph As Ai 42'

AS

As Se Se

G

G

is al 5 in Thr Vai Met 710 G iu Ann Thr G iu 55 G iu Ann His Asp 40 Pro Ann Met Thr re Ala Tyr Thr Phe 25 Gin Asp Tyr Lys Ala Ile Tyr Phe Thr Ser 90 Thr Leu An Ser Gin 75 G iu met 105 in Thr Ala

GL

Leu Ser.

Leu 165 Met G iu Leu Lys eye 245 Lye Set Val His Lyi 32~ Ph: Le~ SHi.

s Th p Ph a Le 0 n Le n GI r Ti, Ann G 1 Thr T I50 Lye I Giu G Ann I Giu I Gin C 230 Thr Pro Phe A rg 310.

Met u' Met r Giy 390 e Ser 5 u Met u Ann y Ile Lr Thr In TI 35 yr L le H iy L ,eu G 2 *ys G ;In I .sys C Phe Ile Cys 295 Giu Gly Phe Asp G iy 375 Thr Thr Leu G iy Lys 455 Met lu C 20 hr I ye is5 ye ~in 00 Iin .eu flu T'yr 280 Ann In ~er eu ;1(1 His 185 dly Leu Glu Giy Asi1 261 Thi Mel ThrP Arg Giu Lye 170 Lye Leu Ann Leu Val 250 Ile Asp LrgI eu Ann Q iu Vai Arg Met 235 Leu Aia Tyr Val G1u 140 0 ir Se: Gii Th: Al 22 As Le As 11 As Thr Ser Trp Met Leu Tyr Ann Arg 13 Giu His Asp G~ Ann Aia Lou G: Gin Lys Leu G Leu Gilp.;ys L 8 Aia Gin Ile Glu Ile Giy TI 110 .Leu Thr Asp N 125 .Ile Gin Lou I Leu Lou Gin ?Leu Leu Giu 175 i Leu Asp Thr 190 r Arg Gin Thr 205 a Thr Thr Ann 0 p Thr Val His u Lye Giy Giy 255 p Val Tyr Gin 270 e0 Asn Asn Met 285 nr Gly Gly Gly )0 .e Ly In in eu 0.

In 'hr !al Jeu 160 His Lou Tyr Ann Ann 240 Lys Aia Pro Trp Asp Giy Ser Tyr Lou 385 His Cys Gly G iy Ser 465 Asp 370 Lys G iy Lys Pro Lys 450 Lou Phe4 Ala Trp 360 Ann Ala Lys Thr Met 440 Trp 3 iy Ile 345 Giu G iu G iy Asp Gly 425 Phe His Ann 330 Thr Gly Lys Lys Aia 410 Giy Tyr Tyx Lou 315 Pro Ser Ann Gin Gin 395 Asp *Trp *Thr *Phe I Prc 47! Asp Phe Gin Ser Gly Giu Gin Arg Gin 350 Arg Aia Tyr 365 Ann Tyr Arg 380 Ser Ser Lou Ann Asp Ann Trp Phe Asp 430 Ala GIly Gin 445 Lys Gly Pro 460 ;krg ryr 333 Tyr Ser Lou Ile Cys 415 Aia Ann Ser ;ly 320 Trp Met Gin Tyr Lou 400 Met Cys

HIS.

Tyr Met Ile Arc Lou Asp Phe INFORMATION FOR SEQ ID NO:8: SEQUENCE

CHARACTERISTICS:

LENGTH: 480 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (1i) MOLECULE TYPE: protein (1x) FEATURE: NAME/KEY: Mature-TL2 protein LOCATION: 1...480 OTHER. INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: Ala Ala Tyr Aen Aen Phe Arg Lys Ser Met Asp Ser Ile Gly Ly I4 Gin Tyr Gin Val Giu Val Gin Leu\ Gin Thr Val Lou 145 Gin Lys Ile Ser Aen 225 Asn Val Lye Met I Gin so Val Giu Gin Asn Glu 130 Giu Thr Lye Lys Sle 210 Ser Leu *Ala Ser ~sp rg 4 0u ksn

L

4 eu Ala His Ser Val Giu 195 Ile Val Leu Lye 0Gi3 27! Aen Asp Giu, Tyr Ala 100 Leu Gin Ser Glu Lou *Leu Thr Giv 260 SHis x Glt p Ly~ "1 Gi~ 34' Lyi 5 r Gl u Ly Gin His Gly S Cys Arg Ser S 4 Ala Pro Lou G 'Asn Ile Met G 70 Ile Gin Asp A 85 Val Gin Asn G Asn Gin Thr P Val Lou Aen C 135 Lou Ser Thr Ile Aen Lyes 165 Ala Met Glu Lys Asp Gin Glu Lou Giu 215 Gin Lys Gin 230 Met Met Ser 245' Giu'Gin Ile Thr Thr Aen Sle Lye Ala 295 Ile Gin Arg 310 3 Giu Tyr Lys 325 ~Asn Glu Phe SIle His Lou uI His Phe Tyr 375 s Gly Leu Thr .390 er C 2 er S 0 iu T lu Ai ~sn V.

~in I in .1 Wsn eu ksp Lou4 200 Lys Gin Thr Ser Gly 280.

Tyr- Arg Val Val Lye 360 Lou Gly ye 5 er yr .sn Let 'hr .05 iu ~hr ys ;ln 185 Gir Lye H!i Se~ Phi 26] Cy Gi Gi Se 34 As Se Tt 10r Ser Asp Asn Lye 90 Ala Gin Thr Loui Asp 170 His Val 1iC I As] c- Asi 25S e Ar' 5 a Ty s As u As y Ph 33 r G1 5 p Tr .r Sc ar A] Tyr Tb Pro T Asp Se Thr G 75 Lye G Val MX Thr IL Arg L Glu L 155 ILye A Ile I Leu N Val 'I Leu 235 n Ser 0 g Asp r Thr p Met p Gly 315 o Gly 0 .n Lou *p Giu ~r Giu La Gly 395 Xr ar r Ln Lu eu ye s n le ral 'hr ~20 'let CyI Lei GIl 30' Se As Th

GI.

Gl Phe Lou Le Val Sor AE Val Gin Ai Trp Lou M( Met Val G: 1 9] Ile Glu I 110 Lye Leu T 125 Giu Lou G Gin Ile L Ser Phe L

I

Gin Lou G 190 Ser Lye C 205 Ala Thr Gi u Thr Lys Asp 3 Ala Giu 270 u1 Thr Phe 285 ui Ala Gly r- Val- Aspn Pro Ser r Asn Gin 350 y Asn Giu 365 .u Lou Aen s5 Ile Sor 13 Ly ~u Pr an A] ?g Li Bt L~ 81 lu I 5 le G hr A -In L eu A ueu G .75 lIn S In I fal lal Pro 255 Val Pro Gly Phe Gly 335 Gin Ala Tyr Ser

S

eu .0 ler ~s ~eu ~sn 240 Pe Aen Gly Gin Tr Arg lie Ser Gly 305 Arg Tyr Tyr Ser Ile 385 Thr 290 Trp Thr Trp Val Leu 370 His Gl Th~ Tr Lei Le' Ty Le Ser Gin Pro Gly Aen 405 Asp Phe Sor Thr Lye 410 Asp Gly Asp Asn Asp Lye 415 117 Cys Ile Cys Lys 420 Ala Cys Gly Pro 435 Aen Thr Asa Lys Cys Ser Gin Met Leu 425 Gly Thr Gly Giy Met Tyr Tyr Trp Trp Phe Asp 430 Pro Gin Arg Gin Ser Aen Leu Aen 440 Ile 445 Trp Phe Aen 450 Tyr G ly 455 Thr Lys Trp Tyr Tyr 460 Arg Lys Gly Ser Ser Leu Lye Ala 470 Thr Met Met Ile 475 Pro Aia Asp Phe 480 0:000 INFORMATION FOR SEQ ID NOt9: SEQUENCE CHARACTERISTICS: LENGTH: 1849 base pairs TYPE: nucleic acid STRANDEDNESS: singie TOPOLOGY: linear (1i) MOLECULE TYPE: DNA (1x) FEATURE: NAME/KEY: Coding Sequence LOCATION: 47..-1573 OTHER INFORMATION: NAME/KEY: TIE ligand-3 LOCATION: 1849 OTHER INFORMATION:.The fibrinogen-like domain starts at posi1tion 929., (xi) SEQUENCE DESCRIPTION: SEQ ID 140:9: CTGTCCTGGT ACCTGACAAG ACCACCTCAC CACCACTTGG TCTCAG ATG CTC TGC Met Leu Cys CAG CCA Gin Pro

S

GCT ATG CTA CTA Ala Met Leu Leu

GAT

Asp 10 GGC CTC CTC CTG Gly Leu Leu Leu

CTG

Leu is GCC ACC ATG OCT Ala Thr Met Ala

GCA

Ala GCC CAG CAC AGA Ala Gin His Arg 000 Gly 25 CCA GAA GCC GGT Pro Giu Ala Gly

GGG

Gly 30 CAC CGC CAG ATT His Arg Gin Ile

CAC

His 103 151 199 247 CAG GTC CGG CGT Gin Val Arg Arg GOC CAG TGC AGC TAC Gly Gin Cys Ser Tyr

ACC

Thr 45 TTT GTG GTG CCG Phe Val Val Pro GAG CCT Glu Pro so GAT ATC TGC CAG CTG GCG CCG ACA GCG GCG CCT GAG GCT Asp Ile Cys Gin Leu Ala Pro Thr Ala Ala Pro Giu Ala 60.

TTG GGG GGC Leu Gly Giy CAC CTA ACA His Leu Thr 295 TCC AAT AGC Ser Asn Ser CTC CAG AGG GAC Leu Gin Arg Asp

TTG

Leu 75 CCT 0CC TCG AGG Pro Ala Ser Arg

CTG

Leu GAC TG Asp Trp6 CGA GCC CAG AGO, Arg Ala Gln Arg 0CC Ala 90 CAG CGG GCC GAG Gin Arg Ala Gin

CGT

Arg GTG AGC CAG CTG Val Ser Gin Leu

GAG

Giu 100 AAG ATA CTA GAG Lys Ile Leu Olu

AAT

Asn 105 AAC ACT CAG TG Ann Thr Gin Trp

CTG

Leu 110 CTG AAG CTG GAG Leu Lys Leu Giu

CAG

Gln 115 343 391 439 TCC ATC AAG OTO Ser Ile Lye Val

AAC

Asa 120 TTG AGG TCA CAC Leu Arg Ser His

CTG

Leu 125 GTG GAG 0CC CAG, Val Gin Ala Gin GAG GAC Gin Asp 130 ACA ATC CAG AAC Thr Ile Gin Aen 135 ATG AAC CAG ACC Met Aen Gin Thr

ISO

CAG ACA ACT ACC GIn Thr Thr Thr ATG CTG Met Leu 140 GCA CTG GGT Ala Leu Gly GCC AAC CTC Ala Asn Lou 145 GTG GAG GCA Val Glu Ala AAA GCT CAG Lys Aia Gin

'ACC

Thr 155 CAC AAG CTG ACT His Lys Lou Thr

GCT

Ala 160 CAG GTC Gin Val 165 CTA AAC CAG ACA Leu Asn Gin Thr

TTG

Leu 170 CAC ATG AAG ACC His Met Lys Thr

CAA

Gin 175 ATG CTG GAG AAC Met Leu Giu Aen 487 535 583 631 679

TCA

Ser 180 CTG TCC ACC AAC Lou Ser Thr Asn CTG GAG CGG CAG Leu Glu Arg GIn

ATG

Met 190 CTG ATG CAG AGC Lou Met Gin Ser

CGA.

Krg 195 GAG CTG CAG CG Giu Lou Gin Arg

CTG

Leu 200 CAG GGT CGC AAC Gin Gly Arg Asn

AGG

Arg 205 GCC CTG GAG ACC Ala Leu Glu Thr AGO CTG Arg Lou 210 CAG GCA CTG Gin Ala Leu AAG AGO GAA Lye Arg Glu 230 GAA OCA Glu Ala 215 CAA CAT CAG Gin His Gin

GCC

Ala 220 CAG, CTT AAC AGC Gin Lou Asn Ser CTC CAA GAG Lou Gin Glu 225 CAA CTG CAC AGT Gin Leu His Ser CTC CTG GGC CAT CAG, ACC G00 ACC CTG Lou Lou Gly His Gin Thr Gly Thr Leu 235 240 GCT AAC Ala NAn 245 CTG NAG CAC ANT Lou Lys His Aen

CTG

Lou 250 CAC GCT CTC NOC His Ala Loul Ser

AOC

Ser 255 ANT TCC. AGC TCC Aen Ser Sor Ser 727 775..

823 871 919 967

CTG

Lou 260 CAG CAG CAG CAG GIn Gin Gin Gin

CAG

GIn 265 CANA CTG ACG GAG Gin Lou Thr Giu

TTT

Phe 270 GTA CAG CGC CTG Val Gin Arg Lou

GTA

Val 275 COO ATT GTA GCC Nrg Ile Val Ala CAG GAC CAG CAT CCG, GtT TCC TTA AAG ACA CCT AAG Gin Asp Gin His Pro Val Ser Lou LyB Thr Pro Lys 280 285 290 CCA GTG TTC Pro -Val Pho

CAG

Gin 295 GAC TGT GCA GAG Asp Cys Ala Glu

ATC

Ile 300 NAG CGC TCC GGG Lys Arg.Ser Gly GTT ANT ACC Val Asn Thr 305 AGC GOT GTC TAT ACC ATC TAT Ser Gly Val Tyr Thr Ile Tyr 310 GAG ACC AAC ATG ACA Glu Thr An Met Thr 315 NAG CCT CTC AAG Lys Pro Lou Lye 320 ACC CTC ATC CAG Thr Leu Ile Gin GTG TTC Vai Pho 325 TGT GAC ATG GAG Cys Asp Met Glu

ACT

Thr 330 GAT CON GGT GGC Asp Gly Gly Gly

TGG

Trp 335 1015.

1063 1159

CAC

His 340 CGG GAG GAT GGA Arg Giu Asp Gly

AGC

Ser 34S

NAT

Asn GTA ANT TTC CAG Val Asn Phe Gin GTG GCC AGA GAG Val Ala Ara Giu 365

AGO

Arg 350 ACC TGG GAA GA Thr Trp Giu Giu AAA GAG GOT TT'T Lys Glu Gly Phe

GOT

Gly 360 CAC TGG CTG GGC His Trp, Lou Gly AT GAG Asn Gilu 370 OCT GTG CAC Ala Val His

CGC

Arg 375 CTC ACC AGC AGA Lou Thr Ser Arg

ACG

Thr 380 GCC TAC TTG CTA Ala Tyr Leu Lou CGC GTG GAA Arg Val Olu 385 1207 1255 CTG CAT GAC TOO GAA GOC CGC Lou His Asp Trp Glu Gly Arg 390

CAG

GIn 395 ACC TCC ATC CAG Thr Ser Ile Gin TAT GAG NAC TTC Tyr Giu Asn Phe 400 CAG CTG Gin Leu 405 GGC AGC GAG Gly Ser Glu AGG CAG CGG TAC AGC CTC TCT GTG AAT GAC AGC Arg Gin Arg Tyr Ser Leu Ser Val Ann ASP Ser 410 415

AGC

ser 420 AGT TCA GCA GGG Ser Ser Ala Gly CGC. AAG Arg Lys 425 AAC AGC CTG Ann Ser Leu

GCT

Ala 430 CCT CAG GGC ACC Pro Gin Gly Thr

AAG

Lys 435 TTC AGC ACC AAA Phe Ser Thr Lys

GAC

Asp 440 ATG GAC AAT GAT Met Asp Ann Asp

AAC

Ann 445 TOC ATG TGT AAA Cys Met Cys Lye TOT GCT Cys Ala 450 1303 1351.

1399 1447 1495 CAG ATG CTG Gin Met Leu CTC AAT GOC Leu Ann Giy 470

TCT

Ser 455 GGA GGG TGG TGG TTT GAT GCC TGT GGC CTC TCC AAC Gly Gly.Trp Trp Phe Asp Ala Cys Gly Leu Ser Aen 460 465 ATC TAC TAT TCA Ile Tyr Tyr Ser GTT CAT CAG CAC TTG CAC AAG ATC AAT Val Hie Gin His Leu His Lye Ile Ann 475 480 GGC ATC Gly Ile 485 CGC TGG CAC TAC TTC CGA GCC CCC AGC TAC TCA CTG CACGC Arg Trp His Tyr Phe Arg Gly Pro Ser Tyr Ser Leu His Gly /490 495 ACA CGC ATG Thr' krg Met 500

GATGCCGTAG

TCAGTGCCCA

AATTACAAGA

AAGGCACCTG

CCTGCCATGA

ATO CTG Met Leu AGG CCA ATG GGT GCC TGA Arg Pro Met Gly Ala

SOS

CACACAG CCCTGCAGAG ACT 1543 1596 1656 1716 1776 1.836 1849 GAGGATTCTC AACCCAGGTG ACTCTGTGCA GGGCTCATCT TGACATTCTG GAACATCGGA ATTCACCTGC CTCCCTGTTG CCCTCTAATT CCTCTGTTGG, AACCATACTC TTTCCCCCTC

ACT

CGCTGGGCCC

ACC-AGCTTAC

GTGAAATTGC

CTGCTGCATG

TGCCCAGAAA

CTTGCCCCTG

TGGGTGCTTG

CCCGGGAATC

INFORMATION FOR SEQ ID NO:i0: SEQUENCE CHARACTERIST ICS: LENGTH: 509 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (Ui) MOLECULE TYPE: protein FRAGMENT TYPE: internal (1x) FEATURE: NAME/KEY: TIE iigand- 3 LOCATION: 1 509 OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID Met Leu Cys Gin Pro

S

Ala Ala Met Leu Leu Asp 10 Pro Gly Leu Leu Giu Ala Gly Thr Met Ala Gin Ile His Pro Glu Pro Ala Gin His Arg Gly 25 Gin Leu Leu Ala is Gly His Arg Phe Val. Val Pro Giu Ala so Leu Gly Gin Val Arg Arg Asp Ile Cys Gin 55 Ser Ann Ser Leu C iy 40 Leu Cys Ser Tyr Ala Pro Thr Ala Pro Thr Ala Gly Gin Arg Asp Leu 75 Ala Ser Arg Leu Hie Ser Leu Thr Asp Trp Gin Leu Glu Lys Arg Ala Gin Arg Ile Leu Giu Ann Ala 90 Ann GIn Arg Ala Gin Thr Gin Trp Leu Arg Val Leu Lys Leu GJ Gin G; Ala At 145 Val G Leu G Gin S Thr Ai 2 Leu G 225 Gly I1 SerI Arg Thr Val 305 Pro Leu 0 iu Gly Arg 385 Giu As n Giy Lys Leu 465 100 u Gin Ser I 115 *n Asp Thr I: rn Leu Met A Lu Ala Gin V 1 Lu Aen ser L 180 er Arg Glu L 195 rg Leu Gin A 10 In Giu Lyes hr Leu Ala I er Ser Leu 2 60' eu Val Arg 275 'ro Lye Pro- ~90 aen Thr Ser .eu Lye Val Ile Gin His 340 ;1u. Tyr Lye 355 Asn Giu Ala 370 V'al Giu Leu Aen Phe Gin Asp Ser Ser 420 Thr Lys Phe 435 Cys Aia Gin 450 Ser Aen Leu le le en 65 eu ,eu lia aen ;In Ile Vlal Gl 1 y Phe 325 Arc 0l Va Hi, Le 40 Se Se He As Lys Gin Gin 150 Leu Ser Gin Leu Glu 230 Leu Gin Val Ph( Va 311 Cyi Gil aGi a Ae 39 uLI 0 5 r Se r Th t Lc n* GI 4.

Vai As 12 An GI 135 Thr Ll Asn G Thr Ai Arg Li 2' Giu A 215 Gin L *Lye H Gin G -Ala C Gin 1 295 1 Tyr a Asp *a Asp y Phe a Arg 375 p Trp 0 y Ser r Ala ir Lye :u Ser .455 Ly Ile 70 n .0 Ln an 00 1la eu 1.8 Fir r Gi 36 Le 01 01 105 Leu Ar Thr Thl Ala 0] Thr* LE 1* LyS LE 185 Gin 0 Gin H His S Aen L 2 Gin G 265 Asp C SCys r Ile t Giu y Ser 345 y Asn 0 u Thr u Giy .u Arg .y Arg 425 ip Met I0 Ly Gly fr Tyr 9 70 ly Is er eu Fir 1r rh: 33' Va Va Se Ar

GI

43 As

S

Ser HI Thr Me 14 Thr Hi 155 HIS Me Giu A] Arg Ai Gin A 2 Leu L 235 His A Leu 'T His P i GiuI r Giu 315 r Asp 0 1 Asn 1 Ala r Arg g Gin 395 .n Arg .0 ae Aen 3p, Aen rp Trp, er Val 475 a t 0 .9 an la :1 30 C1 Ph~ Al

TI

S

A

P

4 110 Leu Val 125 Leu. Al~ Lye Le Lye Th Gin Me 19 Arg Ai 205 Gin Le Gly Hi L. Leu Se r Giu -P 0 Val Si 285 e Lye A 0 r Aen M y Gly 0 ~e Gin A 3 :g Giu F~ 365 ir Ala ar Ser y'r Ser er Leu ep Amn 445 he Asp [is Gin iiy Pro ;iy Ala t 0 a el Ii Ley 4:

A

H

S

GIn Ala Leu Giy Thr Ala 160 Gin Met 175 Leu Met Lau Giu Asn Ser Gin Thr 240 Ser Aen 255 Val Gin Leu Lys ;Ser Gly t Thr Lye 320 y Trp Thr 335 g Thr Trp 0 Trp Leix *r Leix Leu .e Gin Tyr 400* ~u Ser Val 415 La Pro Gin ys Met Cys l~a Cys Gly is Leu His.

480 er Tyr Ser 495 Lye Ile Asn Gly Leu His Gly Thr 500 Ile Arg 485 Arg ,Met Trp Met His Tyr Leix Arg 505 Phe 490 Pro Arg C Met INFORMATION FOR SEQ ID NO:11: SEQUENCE CHARkACTERISTICS: LENGTH: 503 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE: NAME/KEY: mTL3 LOCATION: 503 OTHER INFOR14ATION: mouse TIE ligand-3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: Met Leu Leu 1 His Arg Gly Arg Giy GIn Gin Leu Ala Leu Val

L

G

G

G

eu Ala 0 In Arg in Arg lu Asn* anf Leu 115 Aen Gin Thr 130 Thr Lys Ala 145 A.x Gin Thir Thr Asn Lys Arg Leu Gin 195 Giu Ala Gin 210 Gin Leu HIS 225 LyB His Asri Gin Gin Gir Ala Gin Asj 275 Gin Asp Cyf 290 Tyr Thr Il 305 Asp Met Gi: Asp Gly Se~ Phe Gly Asi Arg Leu Th 370 Trp Giu GI 385 Ser Giu Ar Ala Gly Ar Lye Asp Me 43 Ser Gly Gi 450 Ile Tyr Ty 465 Trp His Ty Asp Gly Leu Le 5 Pro Giu Aia GJ Cys Ser Tyr TI Pro Thr Ala A 5! Asp Leu Pro A 70 Ala Gin Arg A Aen Thr Gin T 100 Arg Ser His L Thr Thr Met L 1 Gin His L I50 Leu His Met L 165 Leu Giu Arg C 180 Gly Arg Asn His Gin AlaC Ser Leu Leu 230 Leu His Ala 245 Gin Leu Thr 260 Gin His Pro Ala Gu Ile Tyr Giu Thr 310 i Thr Asp Gly 325 Vai Asn> Phe 340 *i Val Ala Arg 5 r Ser Arg Thr y Arg Gin Thr 390 g Gin Arg Tyr 405 g Lys Asn Ser 420 t Asp Asn Asp 5 y Trp Trp Phe r Ser Val His 470 Piie Arg Ply 485 La 5 la rp eu eo .35 'yo y a ~rg ilr Va 29 1 Lyl

A

G4 Gi Gly Hi 25 Phe Va 40 Pro G3 Ser A2 Gin Aj Leu L4 Val G 120 Ala L Leu T Thr G Met L Ala 1 200 Leo I rHis C xSer .i Phe I Ser 280 sArg n Met y Gly n Arg u His 360 a Tyr 5 r Ile ~r Leu ~u Ala in Cys 440 3p Ala In His eu ~u Leu Leo Ala Thr Met Ala Ala Arg Val Ala Leu Val 90 Lys Ala Gly G3n Pro Leu His Ser Lau Gin Ala Ile

GIU

Gly Leu Gin Glu Gin Asn His4 Pro Giy Thr Leu Gin Asp 125.

Leu Gln Asp Ser Asp Giu Ser 110 Thr Met Ala Val1 Ile Aen Trp Lys Ile Ile Asn G3n Arg Cys Ser ?%rg Ile Lys Gin Gin 140 hr Ala Val Giu Ala Gin Val Leu ~in .eu .85 4 eu asn In 3er wJal 265 Leu Ser Thr Trp Thr 345 Trp Gir Sez Pr~ 42! Mel Cy Le'

I!

Met LI 170 Met G Glu T Ser L Thr G 2 Asn S 250 Gin A Lye I Gly N Lyes Thr 330 Trp Leu Leu Tyr rVal 410 Gin 5 t Cys a Gly u His r Ser 490 in hr eu by 35 er Lrg ~hr tal ?rc 315 Ar GlI 39 As G1 Le Ly Glu Ai Ser A: Arg L 2 Gin G 220 Thr L Ser S Leu V Pro I Aen 'I 300 Leu Ile Glu* SAsn g Va-l 380 uz Aen.

5 n Asp y Thr s Cys u Ser 460 a Ile '5 eu lu *eu er ~al ~85 Lhr !'yS 31in Tyr 365 Gli PhE Se~ Ly Al 44 As As Ser L 1 Giu L 190 Gin A Lye A Ala A Leu C Arg 270 Pro Ser Val *His *Lys 350 Ala :Leu B Gin r Ser s Phe 430 a Gin n Leu n Gly eu eu ,ia *rg asn In le lai 31y Phe Arc 33! Git Va HiL Le Se 41 Se Me As .I

I

Ser Gin Leu Giu Leu 240 Gin Val Phe Val Cys 320 Glu x Gly I His Asp Gly 400 r Ser

S

r Thr t Lau in Gly e Arg 480 Pro Ser Ty Ile His Gly Thr Arg Met 495 Met Leu Arg Pro Met Gly Ala S00 INFORMATION FOR SEQ ID NO: 12: SEQUENCE CHAR.ACTERISTICS: LENGTH: 490 amino acids TYPE: amino acid STP.ANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE: NAME/KEY: hTL1 LOCATION: I1.. .400 OTHER INFORMATION: human TIE-2 iigand 1 (xi) SEQUENCE DESCRIPTION: SEQ ID N40212: 00 0 Ala P 1 Arg S Giu S Pro E His N Ile N~ Val C Ser Val 145 Leu Ile Giu Lys C iu 225 Gin Leu Lys Val 305 His Lys Phe he Leu Ala Aia er Pro Giu Kan ye Aia Tyr Thr ~er Thr Thr Asp 0 [is Val Giu Pro ral Met Giu Asn ral Giu Aen Met 100 ;In Aen Hie Thr 115 ;In Thr Ala Giu 130 .aeu Aen Gin Thr Ser Thr Tyr Lye 165 Leu Lys Ile His 180 Met Glu Giy Lys 195 Giu Aen Leu Gir 210* Leu Giu Lye Gir Lye Gin Gin Let 24E Cys Thr Lye Gi% 260 Pro Phe Arg Asi 275 Gly Ile Tyr Thi 290 Phe Cys Ann Mel Arg Giu Asp Gi' 32' Met Gly Phe GI' 340 Ile Phe Ala Ii Ile Leu Thr His Ile Gly Cys Ser Asn

G]

Ser Phe Gin Asp 70 Tyr Lye Ala Gin Ser 150 Leu Glu His Gly Leu 230 aVal SCysa As; 31iC ~Sex y Aar e Thi Gly ArgA 2 Ile Leu P 40 Tyr Asn T~ 55 Phe Ser S Thr Gin 'I Ser Ciii k Thr Met.I .120 Thr Arg 135- Arg Leu Giu Lye Lye Ann Lye Giu 200 Leu Val 215 Asn-Arg Leui Met Leu Leu Ala Asp 280 Tyr Ile.

295 Vai Ann Leu Asp iPro Ser Ser Gin 360 rAen Arg .rg 5 ro hr er t'p ~et

LOS

e 3mu Ser 185 G lu Thr Ala Ael Lyf 26!

V.

Asi G1i Ph di 34 Ar Tyr A Giu H Aen A Gin L .7 Leu G 90 Ala G GluI Leu I~ Ile Leu 170 Leu Liau Arg Thr Thr 250 Gly L Tyr a: Ann y Gly e Gin 330 y Giu 5 a Gin en is la *ys '5 lIn ~In le Lhr ;in 155 [Ueu Leu Asp Gin Thr 235 Val Gi) Gi: Mel

GI'

31i Ar' Ty Ty Arg I Asp G.

41 Leu G Leu C Lye L Ile G Gly TI Asp 'Y 140 Leu I Gin C Glu Thr Thr 220 Ann *His Lye I Ala -Pro 300 y' Trp 5 g Giy r Trp r Met, .e Gin H~ .y AnnC Lri Arg A In His L eu Giu A 9 In Gin A 110 hr Ser L al Giu TI eu Giu In Thr I Lie Lye 190 ~eu Lye Lyr Ile k.sn Ser ksn Leu A~rg Giu 270' Gly Phe 285 Giu Pro Thr Val Trp Lye Leu Gly 350 Leu Arg 36S Lu GJ ep A.

eu G enT on A eu L 'hr G oen S asnC L7 Ile .iu Ile4 Val Vai 255 Guu.

Ann Lys Ile G-iu 335 an Ile Ly La, Lu 0 yr la, eu In er liu eu aiu Glm Leu 240 An G lu Lys Lye Gin 320 Tyr Glu Glu 355 Leu Met Asp Trp Giu G1l Ala Tyr Ser Gin Tyr Asp Arg Phe IZ3 His 385 Thr Phe Lelv Lei.

G13 46! Th2 370 375 380 Ile oly Aen Giu Lys Gin Ken Tyr Arg Leu Tyr Leu Lys 390 395 Giy Thr Ala Giy Lye Gin Ser Ser Leu Ile Leu His Giy 405 410 Ser Thr Lys Asp Ala Asp Asn Asp Aen Cys Met Cys Lys 420 425 430 Met Leu Thr Gly. Giy Trp Trp, Phe Asp Ala Cys Giy Pro 435 440 445 1 Kn Giy Met Pfie Tyr Thr Aia Giy GI .n Aen His Giy Lye 450 455 460 SIe Lye Trp His Tyr Phe Lye Gly Pro Ser Tyr Ser Ile 470 475 :Thr Met Met Ile Arg Pro Leu Asp Phe 485 490 INFORMATION FOR SEQ ID NOt13: SEQUENCE CHARACTERISTICS: LENGTH: 491 amino acids TYPE: amino acid STRANDEDNESS: single (D).TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE: NAME/KEY: chTLl LOCATION: l...491 OTHER INFORMATION: chicken TIE-2 ligand 1 Gly Aia 415 Cys Ser Leu Arg His 400 Asp Ala Aen Ken Ser 480- 0 0 *0 00 0 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: Ala Phe Leu Ala Ala 0 Arg Gin Glu Pro His Ile Val Ser Val 145 Leu Ile Glu Lye G iu 225 Gin Ser Cys Ser His Val Val Gin Gin 130 Leu Ser Leu Met Glu 210 Leu Lys Pro Thr Thr Val Met Giu Ken 115 Thr Aen Thr Lye G iu 195 Ken Giu Gin o iu Tyr Thr G iu G iu Ken 100 His Ala Gin Tyr Ile 180 G iu Leu Lys Gin Ken Thr Asp Gin Ken Met Thr Glu Thr Lye 165 His Arg Gin Gin Leu 245 Ile S er Phe Gin Asp 70 Tyr Lye Ala Gin .Ser 150 Leu Giu His Gly Leu 230 G iu Leu Gly Ile Tyr 55 Phe Thr Ser Thr Thr 135 Arg Giu Lye Lye Leu 215 Aen Leu il a krg Leu 40 Asn Ser Gin Giu Met 120 Arg Leu Lye Ken Glu 200 Val Lye Met His Ile C Arg Phe 25 Pro Giu Thr Ken Phe Gin Trp Leu 90 Met *Ala 105 Leu Giu Lys Leu Giu Ile Gin Leu 170 Ser Leu 185 Giu Met Thr. Arg Ala Thr Asp Thr 250 ly kon .In Ala Lye 75 Gin Gin Ile Thr Gin 155 Leu Leu Kel Gir Thi 23! Va2 Cys Arg Asp Leu Leu Lye Leu Gly Asp 140 Leu Gir Thi i Se: 22( SAsl 1 Hii Thr T Ile G 3 Gly P~ Gin P Gin Leu Gin Thr 125 Val Leu Gin IHis Leu 205 r Tyr 0 ni Ken o Thr 'hr In ~0 oen Lrg iis ilu Gin i110 Ser Giu Giu Thr Lys 190 Lys lie Sez Le~ Gin His Cys Asp Leu Ser Ken Leu Thr Asr Asr 17 E I I(

GI

Va.

Arg Gly Arg Ala 0 lu Tyr Ala Leu Gin Ser Giu Leu i Glu e Gin I. Leu 240 e Thr 255 Leu Cys Ser Lye Glu Gly Val Leu Leu Lye Ken Ala Lye Arg Glu Giu 260 Phe Giu Lys LYe Ser 290 Lye Val 305 Gin His Tyr Lye Giu Phe Glu Leu .370 Phe His 385 His Ser Giu. Phe Ala Leu Aen Leu 450 Ken y 465 Ser Thr Pro 275 Gly Phe Arg Met Ile 355 met Ile G ly Ser met 435 Ken Ile Thr Arg Asp Cys Ala 280 265 Asp Val Tyr Gin

P

270 la. Gly Phe Aon ~er Asp Pro Lye Ile Tyr Cys Ken Glu Asp 325 Gly Phe 340 Phe Ala Asp Trp Gly Ken Thr Ala 405 Thr Lys 420.

Led Thr Giy,'Met Lye Trp Met Met 485 rhr met 310 Gly Gly Ile Glu G iu 390 Gly Asp G iy Phe His 470 Ile Ile 295 Asp Ser Ser Thr Gly 375 Lye Lye Ala Gly Tyr 455 Tyr Arc Tyr Ile Val Aen Leu Asp Pro Ser 345 Ser Gin 360 Ken Arg Gin Ken Gin Ser Asp Ken 425 Trp Trp 440 Thr Ala Phe Lye Pro Leu ken Ken GlyC Phe 330 Gly krg Ala Tyr Ser 410 Asp Phe Gly G ly Asp 490 315 31n Gliu Gln Tyr Arg 395 Leu Ken Asp Gin Pro 475 Phe Val E 300 Gly Lye Tyr Tyr Ser 380 Leu Ile Cye Ala Ken 460 Arg LVrp ;iy Trp Ser 365 Gin Tyr Leu Met Cys 445 His Tyr Thr Trp Leu 350 Leu Tyr Leu His Cye.

430 Gly Gly Ser lal Lys 335 Giy Arg Asp Lye Gly 415 -Lys Pro Lye Ile Ile 320 G lu.

Aen Ile Arg Gly 400 Ala, Cys Ser Leu Arg 480 0 .6 INFORMATION FOR SEQ ID NO:14: SEQUENCE CHARACTERISTICS: LENGTH: 497 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (1i) MOLECULE TYPE: protein (ix) FEATURE: NAME/KEY: mTLl LOCATION: 497 OTHER INFORMATION: mouse TIE-2 ligand 1 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: Met Thr Val Phe Leu Ser Phe Ala Phe Phe Ala Ala Ile Leu Thr His Ile Tyr Glu Ken Gin Leu Ala Giu Leu Gly Ken His Ala Lye Gin Gin Ile 130 Thr Cys Arg Asp Leu Leu Lye Ilie 115 Giy Asp Ser Ken Ile Gin Gly Ken Gin Arg Gin His Leu Glu 100 Gin Gin Thr Ser Val Giu Gin His Cys Asp 70 Leu Ken Ken Leu Thr Arg Gly Arg 55 Ala G lu Tyr Ala Leu 135 Gin Krg Gin 40 Glu Pro His Ile Val 120 Ser ValI Ken 25 Cys Ser His Val Val 105 Gin Gin Leu Pro Al a Thr Val Met G lu As n Thr As n Giu Tyr Thr Giu 75 Glu Ken His Al a Gin Ken Thr.

Asp Pro As n Met Thr Glu 140 Thr Ser Phe Gin Asp Tyr Lys Ala 125 Gin Ser Gly Ile Tyr Phe Thr Ser 110 Thr Thr Arg Arg Leu Ken Ser Gln Giu met Arg Leu Arg Pro Thr Ser Trp met Leu Lye Glu 125 145 IlIe 150 Aen Gin Leu Leu Giu Ser Leu Ser 155 160 Thr Tyr Lys Leu Glu Lys Gin 170 175 Ile Hie Glu Lys Asn Ser Leu

S

**54

S

S S Leu L Leu G Asp T1 GIn S 225 Val Gly Tyr Aen 305 Gly Gin Giu' Gin Tyr 385 Arg Leu NAn Asp Gin 465 Pro Phe ,eu

LU

hr ~er Wsn UiS ,iy GAn 290 VIal Giy Lye Tyr Tyr 370 Ser Let Ile Cys Al~ 45C Asi Arc Gin ~T His L 195 Leu I PheI NAn Lys 275 Pro Trp Gly Trp 355 Met Gin Tyr Leu 3Met 435 3, Cys n His g Tyr hr Asn Giu Ile Leu .ye aye ier eu 260 'Lrg 3 Ly Glu Thr Trp Leu Leu Tyr Let; Hie 42C Cyl Gil Gil Se~ Ile I Giu Ile Ile 245 Ile Giu Phe Pro Val Lye *Giy Arg *Asp Lys 405 Giy Lys ~Pro (Lys r Ile 485 ~eu ilu In 230 Leu Ser Giu NAn Lye 310 Ile Glu Asn Ile Arg 390 Giy Ala Cys Sel Le~ 47( Glu Lye 215 G Lu Gin Lau Giu Lys 295 Lye Gin Tyr Glu Git 375 Phe Hig As~ Al~ 45 I Asc Met 200 G iu Leu Lye Cys Lye 280 Ser Val His Lys Phe 360 Leu His Thi SPh( a Le~ 44( n Lec 5 ni Gi'

G

Lye 85 lu Gly Lye His Aen Leu Gin GLu Lye Gin 235 Gin Gin Leu 250 'Thr Lye Giu 265 Pro Phe Arg Giy.Iie Tyr Phe Cys Aar 31! Arg Glu As~ 330 Met Giy Phi 345 Ile Phe Al Met Asp Tr Ile Giy As 39 -Gly Thr Ni 410 Ser Thr Ly 425 1 Met Leu Tli u Ash Giy Me y Ile Lye Tz Giy 220 Leu Ser A e a r s Giu I Giy Asp Thr 300 met O Ly Giy Ile Giu 380 Giu Gly 3 Asp r Giy.

t Phe 460 p His seal I ::Ye 1 285 Ile Asp Ser Ser Thr 365 Giy Lys Lys Aia G iy 445 Tyr Tyr .rg et aeu lia Lryr Jai Leu Pro 350 Ser Aar Gir Gi: Ael 43' Tr Th Ph Ala Thr 240 Asp Thr 255, Leu Lye Asp Val Phe An NAn. Gly 320 Asp Phe 335 Ser Gly Gin Arg Arg Ala iAsn Tyr 400 i Ser Ser 4-15 p Asn Asp 03 p Trp Phe r Ala GLy e Lye Giy 480 190 Lys Glu Giu Met 205 Leu Val Ser Arg 475 Arg Ser Thr Thr Met Met Ile Arg Pro Leu hop 490 495 INFORMATION FOR SEQ rD NO*.lS: SEQUENCE CHARACTERISTICS: LENGTH: 496 amino acids TYPE: amino acid STRANDEDNESS: singie TOPOLOGY: linear (iU) MOLECULE TYPE: protein (IX) FEATURE: NAME/KEY: mTL2 LOCATION: 1 .496 (D)'OTHER INFORMATION: mouse TIE-2 iigand 2 (xi) StQdENCE DESCRIPTION: SEQ ID Met Trp Gin Ile Ile Phe Leu Thr Phe Gly Trp Asp Ala Vai Leu Thr 1 5 10 is Ser Aia Tyr Ser Aen Phe Arg Lye Ser Val Asp Ser Thr Gly Arg Arg Ile 25 Cy3 Arg Tyr Arg Gin Aen Gly Pro 40 Ala Tyr Thr Phe Leu Leu Pro w0 se**

S..

0 0 0@@0 Glu Thr Asp Ser Gly Arg S 5 Val Gin Arg Asp Ala Pro P 70 Gin Leu Leu Glu Asn Val M Leu Glu Aen Tyr Ile Gin A 100 Gin Gin Asn Val Val Gin A 115 Thr Ser Leu Leu Ser Gin T 130 Val Glu Thr Gin Val Leu A 145 150 Leu Gin His Ser Ile Ser T 165 Gin Thr Ser Giu Ile Asn I 180 Gin Lye Val Leu Aep Met 195 Met Lys Glu Gin Ly Asp .210 Ser Val Ile Asp Glu Leu 225 230 Aen Ser Leu Leu Gin Lye 245 Ser Leu Leu Thr Met Met 260 Ile Arg Arg Giu Glu Gin 275 Lye Ala Gly Leu Thr Lys 290 Ser Pro Glu Glu Ile Lye 305 310 Gly Trp Thr Val Ile Gin 325 Lys Gly Trp Lys Glu Tyr.

340 Tyr Trp Leu Gly Asn Glu 355 Tyr Val Leu Lys Ile Gin 370 Ser Leu Tyr Asp His Phe 385 390 Ile His Leu Thr Gly Leu 405 Ser Gin Pro Gly Ser Asp 420 Cys Ile Cys Lye Cys Ser 435 Ala Cys Gly Pro Ser Aan 450 Asn Thr Asn Lye Phe Asn 465 470 Glyv Tvr Ser Ile Lye Ala 5 ro et sp en hr 35 en hr Lys ;1u Glu 215 Glu Gin Serx Thr Ser2 29 Al Hi Ly Ph Le 37 Ty Th Ph Le Le 45

GI

Th Asp Ty Glu AE Aen ME 1 His T 120 Ala G Gin T Tyr L Ile H 1 Gly L 200 Leu G Lye L Gin H SSer I SThr 280 SGly I Tyr s Arg s Met e Ile 360 u Lye 5 r Ile r Gly e Ser u Met 440 u Aen 5 y Ile r Thr r in et )5 he Lu hr ys is 85 ye In ,ys i [ii r 26 ?h Il C:y G1 31 34 Se As Al Th Tk 4i

L

G

L

M

Glu Tyr 90 Lye Ala Gin Thr Leu 170 Aen His Val Let a As 25 o As e Ar a Ty a As u As 33 y Ph 5 r G1 p Tr a Gl r Al 4 r L 5 ?u T Ly G ys T at M 4 ID N er Ser Ser Sen Thr Tyr Me Asp Ser Va 75 Thr Gin Tr Lye Glu Me Val Met Il 12 Thr Arg Ly 140.

Arg Leu GI 155 Glu Lye G Lys Aen S Ser Glu G 2 Leu Val S 220 Val Thr A 235 SLeu Met A 2 a Ser Lye S g Asp Cys A 2 r Thr Leu 1 300 n Met Asp 315 p Gly Ser 0 e Gly Asn n Ile Thr p Glu Gly 380 y Glu Glu 395 a Ala Lye

LO

re Asp Ser hr Gly Gly Ln Phe Tyr 460 rp Tyr Tyr 475 et Ile Arg 90 O:16: t 1 p t Le lu Ln er el 0 at 1~ 3

A

I

ei .l 1 8 Th fa Le

P

G

3

A

S

I

A

T

4

P

I

Thr Gin Leu Ala 110 Glu Leu Leu Ile Phe 190 I Met r Lys a Th p Th r Se 27 a As r Ph li Gl u As :o Le 35 Ly G1 sn G er A le S sp A 4 rp T ro G rp L ?ro A Aen Ala Ser Leu Met Lye Glu Ile Ile Gly Thr Asp Gin Leu 160 Leu Asp 175 Leu Glu Gin Thr SGin Ser SVal Asn 240 Val Aan 255 r Leu Ala 0 p Val Phe e Pro Asn y Gly Gly 320 p Phe Gin 335 u Gly Glu 0 n His Arg Lu Ala His sn Tyr Arg 400 er Sen Ile 415 sn Asp Lye rp Phe Asp in Lye Gin ys Gly Ser 480 la Asp Phe 495 485 INFORMATION FOR SEQ SEQUENCE CHARACTERISTICS: LENGTH: 496 amino acid TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear 127 (IL) MOLECULE TYPE: protein (Ix) FEATURE: NAME/KEY: hTL2 LOCATION; 496 OTHER INFORMATION: human TIE-2 ligarid 2 (xi) SEQUENCE DESCRIPTION: SEQ ID 110:16: Met Trp GIn Ile Val Phe Phe Thr Ala A Arg T Glu M Val G Gin L Ieu C GIn. C Thr I et ValC 145 Leu Gl' Lys Ile Ser 225 Aen Val Lys Ser 305 Gly Lys Tyr Tyr Ser 385 Ile Ser Cys Ala la yr et 0 *In *eu ,In ~er 130 ilu ;In rhr L~ys Leys 210C I le Sex Let Al~ Al~ 29( Pr Tr Gl Va 37 Le Hi

GI

Ii

CY

Tyr Ang Asp.

Arg Leu Asn Asn 115 Leu Thr His Ser Val 195 Giiu Ile Val :Let i Arc 27! a Gi' 0 GIl pTh~ y Tr p Le 1 Le 0 u Ty s Le n Pr e Cy 43 s G1 Aen Aen Phe Arg Lys Ile Gin H Aen Gly A Asp Ala P 7 Giu Aen V Tyr Ile G 100'i Ala Vai G Leu Ser G Gin Val I Ser Ile 1 165 Glu Ile 180 Leu Asp Giu Lys Giu Giu *Leu Gin 245 Thr Met 260 ;Giu Giu SHis Thr u Giu Ile r Ile Ile 325.

p Lye Giu 340 Ui Giy Aen 5 Lye Ile Asp His Lys Gly 405 o Giy Aen 420 s Lys Cys c Is Gly Sen rg no 0 al In LIn ~In ~eu Lso er ken 4et Leu 230 Lys Met Gir Lyi Lyi 3 1 0 i Ty; G1 Hi Ph 39 Le As Se 41 Ser S Pro G Met G Asp A Aen H

I

Thr J1 135 Asn C Thr I] Lye Glu Giu 215 Giu IGin Sen I le 3 Asri 295 s Ala 0 Arg Lye Phe Leu 375 e Tyr 0 u Thr p Phe r Leu er iu iu en Lie ~20 lia ~yr 20C Let.

Lys G1: Th: Se 28' Gi Ty Ar Va

II

36

I]

G]

Sf Leu Sen C1 Ser Met AE 25 Cys Ala T~ Ser Ser TI Tyr Giu &i 7' Aen Tyr T 90 Met Lye L 105 Thr.Ala V Giu Gin T Thr Thr Lye Leu C 170 His Asp I 185 SLye His Gin Val 3 Lye Ile *i His Asp 250 Sen Asn 265 Phe Arg 0 y Ile Tyr r Cys Aen gGiu Asp .330 .1 Gly Phe 345 .e Ser Gin 0O *e Asp Trp *e Ser Gly .y Thr-Aia 410 :r Thr Lye 425 ag Asp Ala Val Leu Thr sp 5 hr ye Ser Thr Tyr Ser Gin 0 iu Ile Phe Val Val Trp Met Gly Leu Thr Gin Leu Ala Lye Leu Aen Ser Met Glu L ys.

Pro Ala Leu, Lye Ile al Met Ile C 125 hr Ang Lys 140 Lrg Leu Glu .55 liu Lye Gin ~ye Aen Ser Ile Ile Giu, 205 ,eu Val Ser 220 Val Thr Ala 235 Leu Met Asp Ser Ala Lye Asp Cys Ala 285 Thr Leu Thr 300 ;iu Ile Gly .eu Leu Ile Phe 190 Met Lys Thr Thr Asp 270 Asp PhE Thr Gin Leu 175 Leu4 Gin Gin Vai Val 255 Ser Val Pro w'p .eu 160 k'ep 3iu Thr Aen Aen 240 Aen Thr Phe Asn, Met 315 Gly Gly Ile Giu Giu 395 Ala Asp

ASP

Ser Ser Thr Gly 380 Glu Lye G ly Gly Ala Leu Pro Aen 365 Aen Leu Ile Asp Trp 31y Asp Sen 350 Gin Giu Aen Sen Aen 430 Trp Gly4 Phe 335 Gly Gin Ala Tyr Sen 415 Asp Phe 3 ly 320 Gin Giu Ang Tyr Arg 400 Ile Lye Asp Met Leu Thr Gly 440 445 y Pro Ser Aen Leu Aen Gly Met Phe Tyr Pro Gin Arg Gin 128 Asn 465 Gly o 0* *0 .4* *0 ~0

ATG

Met 1

GCC

Ala

TGC

Cyf

CTC

Lei

TC(

Se~ 65 AA1 Ly

AA,

As

AG

Ar

GC

Al

GI

450 455 460 Thr Asn Lys Phe Aen Gly Ile Lys Trp Tyr Tyr Trp Lys Gly Ser 470 475 480 Tyr Ser Ile Lys Ala Thr Thr Met Met Ile Arg Pro Ala Asp Phe 485 490 495 INFORMATION FOR SEQ ID NO:17: SEQUENCE CHARACTERISTICS: LENGTH: 1512 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (1x) FEATURE: NAME/KEY: Coding Sequence LOCATION: 1509 OTHER INFORMATION: NAN/KEY: TIE iigand-4 LO4ZATION: 1512 OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: CTC TCC CAG CTA GCC ATG CTG CAG GGC AGC CTC CTC CTT GTG G1 Leu Ser Gin Leu Ala Met Leu Gin Gly Ser Leu Leu Leu Val Ve S 10 ACC ATG TCT GTG GCT CAA CAG ACA AGG CAG GAG GCG GAT AGG G( Thr Met Ser Val Ala Gin.Gin Thr Arg Gin Glu.Ala Asp Arg.G 20 25 GAG ACA CTT GTA GTC CAG CAC GGC CAC TGT AGC TAC ACC TTC T Giu Thr Leu Val Val Gin His Giy His Cys Ser Tyr Thr Phe L 35 40 SCCC AAG TCT GAG CCC TGC CCT CCG GGG CCT GAG GTC TCC AGG G x Pro Lys Ser Giu Pro Cys Pro Pro Gly Pro Glu Val Ser Arg A 50 55 C AAC ACC CTC CAG AGA GAA TCA CTG GCC AAC CCA CTG CAC CTGG r Asn Thr Leu Gin Arg Giu Ser Leu Ala Aen Pro Leu His Leu G 70 STTG CCC ACC CAG CAG GTG AAA CAG CTG GAG CAG GCA CTG CAG d Leu Pro Thr Gin Gin Val Lys Gin Leu Giu Gin Ala Leu Gin 90 CACG CAG TGG CTG AAG AAG CTA GAG AGG GCC ATC AAG.ACG ATC n Thr Gin Trp Leu Lys Lys Leu Giu Arg Ala Ile Lye Thr le 100 105 110 GTCG AAG CTG GAG CAG GTC CAG CAG CAA ATG GCC CAG AAT CAG g Ser Lys Leu Giu Gin Val Gin Gin Gin Net Ala Gin Aen Gin 115 120 125 C CCC ATG CTA GAG CTG GGC ACC AGC CTC CTG AAC CAG ACC ACT a Pro Met Leu Giu Leu Gly Thr Ser Leu Leu Aen Gin Tkir Thr 130 135 140 *ATC CGC AAG CTG ACC GAC ATG GAG OCT CAG CTC CTG AAC CAG .n Ilie Arg Lye Leu Thr Asp Met Giu Ala Gin Leu Leu Aen Gin Ly

TG

AC

,sp ily

AC

k.sn

TTG

Leu

ACG

Thr

GCC

Ala

ACA

Thr 48 96 144 192 240 288 336 384 432 480 145 145 150 15516 160 TCA AGA ATG, GAT Ser Arg Met Asp

GCC

Ala 165 CAG ATG CCA GAG Gin Met Pro Glu

ACC

Thr 170 TTT CTG TCC ACC Phe Leu Ser Thr AAC AAG Asn Lys 175 CTG GAG AAC Leu Glu Aen GGC CAA AAC Gly Gin Asn 195

CAG

Gin 180 CTG CTG CTA CAG Leu Leu Leu Gin

AGG

Arg 185 CAG AAG CTC CAG Gin Lys Leu Gin CAG CTT CAG Gin Leu Gin 190 GAG ACC AAG Giu Thr Lys 528 576 624 AGC 0CG CTC GAG Ser Ala Leu Giu

AAG

Lye 200 COG TTG CAG GCC Arg Leu Gin Ala

CTG

Leu 205 CAG CAG GIn Gin 210 GAG GAG CTG GCC Glu Glu Leu Ala

AGC

Ser 215 ATC CTC AGC AAG, Ile Leu Ser Lys Lys 220 GCG AAG CTG CTG Ala Lys Leu Leu

AAC

Asn 225 ACG CTG AGC CGC Thr Leu Ser Arg

CAG

G in 230 AGC GCC GCC CTC Ser Ala Ala Leu

ACC

Thr 235 AAC ATC GAG CC Asn Ile Giu Arg

GCO

Gly 240 9 *o 9 .9 9

S

CTG CGC OT GTC AGO Leu Arg Gly Val .Arg 245 CAC AAC TCC AGC His Asn Ser Ser

CTC

Leu 250 CTO CAG GAC Leu Gin Asp CAG CAG CAC CGl*'Gln His 255 AGC CTG CGC Ser Leu Arg OCT AA C GCC Ala Aen Ala 275

CAG

Gin 260 CTG CTG GTG TTG Leu Leu Val Leu CGG CAC CTG Arg His Leu ATG OCA GOT Met Ala Gly GTG CAA OAA AGG Val Gin Giu Arg 270 TOG GCC COG GCC Ser Ala Pro Ala TTC ATA Phe Ile 280

GAG

Glu 285 CAG GTG TTC Gin Val Phe CAG GAC Gin Asp 290 TOT OCA GAG ATC CAG CGC .TCT GGC GCC AGT GOC ACT GOT OTC Cys Ala Giu Ile Gin Arg Ser Oly'Ala Ser Ala Ser Gly Val 295 300

TAC

Tyr 305 ACC ATC CAG GTG.

Thr Ile Gin Val

TC

Ser 310 AAT GCA ACO AAG Asn Ala Thr Lys

CCC

Pro 315 AGO AAG GTO TTC Arg Lys Val Phe

TOT

Cys 320 672 720 768 816 864 912 960 1008 1056 1104 1152 1200 1248 GAC CTG CAG AGC Asp Leu Gin Ser

ACT

Ser 325 GGA GOC AGG TG Oly Oly Arg Trp

ACC

Thr 330 CTO ATC-CAG COC Leu Ile Gin Arg COT GAG Arg Giu 335 AAT GGC ACC Aen Gly Thr TTC GGA GAC Phe Cly Asp 355

GTG

Val 340 AAT TTT CAG CG Asn'Phe Gin Arg

AAC

Asn 345 TOG AAO OAT TAC Trp Lye Asp Tyr AAA CAC GGC' Lys Gin Gly 350 OTO GTG CAC Val Val His CCA OCT 0GG GAG Pro Ala.Cly Giu CAC TG His Trp 360 CTG 0CC AAT Leu Gly Aen

GAA

O iu 365 CAC CTC Gin Leu 370 ACC AGA AGO GCA Thr Arg Arg Ala

CC

Ala 375 TAC TCT CTC COT Tyr Ser Leu Arg

OTO

Val 380 GAO CTG CAA GAC Oiu Leu Oin Asp

TOG

Trp 385 GAA GGC CAC GAG Giu Gly His Oiu

GCC

Ala 390 TAT GCC CAG TAC Tyr Ala Gin Tyr

GAA

Giu 395 CAT TTC CAC CTG His Phe His Leu 000 Gly 400 ACT GAG AAC CAG CTA Ser Clu Aen Gin Leu .405 TAO AGO CTT TCT Tyr Arg Leu Ser

GTO

Val1 410 GTC G TAO AGO Val Cly Tyr Ser 0CC TCA Gly Ser 415 OCA COG CCC CAC AGC AGC CTO GTO CTO CAG AAC ACC AGO TTT AGO ACC 19 1296 Ala Gly Arg CTT GAC TCA Leu Asp Ser 435 TCT GGA GGG Ser Gly Gly Gin 420

GAC

Asp Ser Ser Leu Val Leu 425

CTC

Leu Gin Aen Thr Ser AAC GAC CAC Asn Asp His

TOT

Cys 440

GCC

Ala TGC AAG TGT Cys Lys Cye

GCC

Ala 445

AAC

Asn Phe Ser Thr 430 CAG GTG ATG Gin Val Met CTC AAC GOC Leu Asn Gly TOG TOG TTT Trp Trp Phe

GTC

Val 465

TG

Trp 450

TAC

Tyr

GAC

Asp 455

GAC

Asp TOT GGC.CTG Cys Gly Leu

TCA

Ser 460

ATO

met TAC CAC OCT Tyr His Ala

CCC

Pro 470

GOC

Gly AAC AAG TAC Asn Lye Tyr 1344 1392 1440 1488

AAG

Lys 475

CTG

Leu GAC GGC ATC Asp Oly Ile

CGC

Arg 480'

ATO

Met CAC TAC TTC Ris Tyr Phe

AAG

Lys 485 CCC AOC TAC TCA Pro Ser Tyr Ser .490 COT 0CC TCT Arg Ala Ser

COC

Arg 495 *4* ATG ATA CGCCT TTG GAC ATC TAA Met Ile Arg ProLeu Asp Ile S0o, INFORMATION FOR SEQ ID NO:18: SEQUENCE CHARACTERISTICS: LENGTH: 503 amino acids TYPE: amino acid STRANDEDNESS:.single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: internal (1x) FEATURE:.

NAME/KEY.: TIE ligand-4 LOCATION: .503 OTHER INFORMATION: 1512 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: Met Leu Ser Gln Leu Ala Met Leu Gin Gly Ser Leu Leu Leu Val Val Ala Cys Leu Ser Lye Asn Arg Ala Gin 145 Ser Leu Thr Glu Pro Aen Leu Thr.

Ser Pro 130 1le Arg Glu Met Thr 35 Lys Thr Pro Gin Lye 115 Met Arg Met Asn Ser 20 Leu Ser Leu Thr Trp 100 Leu Leu Lys

ASP

Gin 180 Va Val Glu Gin Gin Leu Glu O lu Leu Ala 165 Leu Ala Val Pro Arg 70 Gin Lys Gin Leu Thr I50 Gin Gin Gin Cy13 55 Glu Val, Lys Val Gly 135 Asp Met Gin His 40 Pro Ser Lys Leu Gin 120 Thr Met Pro Thr 25 Gly Pro Leu Gin Giu 105 Gin Ser O lu Giu Arg 185 Arg His Gly Ala Leu Arg GIn Leu Ala Thr 170 Gin cys pro Asn 75 O lu Ala Met Leu Gin Phe Giu Ser Glu Pro Gin Ile Ala Asn 140 Leu Leu Ala Tyr Val Leu Ala.

Lys Gin 125 Gin Leu Ser AIsp Thr Ser His Leu Thr 110 Asn Thr Aezi Thr Arg Oly Phe Leu Arg Asp Leu Gly Gin Aen Ile Leu Gin Thr Thr Ala Gin Thr 160 Aen Lys 175 Leu Leu Gin Gin Lys Leu Gin Gin Leu Gin 190 Gly Gin Gin Gin 210 Ann Thr 225 Leu Arg Ser Leu Ala Asn Gin Asp 290 Tyr Thr 305 Asp Leu Ann Giy Phe Gly Gin Leu 370 Trp. Giu Ser GlU Ala. Giy Leu Asp Ser Gly 450 Val Tyr 465 Trp His Met Ile kesn Ser Ala Leu Glu Giu Lieu Gly Arg Ala 275 Cys Ile Gin Thr Asp 355 Thr G ly An Arg Ser 435 Gly Tyr Tyr Arg Glu Ser Val Gin 260 Ser Ala Gin Ser Val 340 Pro Arg His Gin Gin 420 Asp Trp His Phe Prc Soc Leu Arg Arg 245 Leu Ala 0 iu Val Ser 325 An Ala IArg Giu *Leu 405 *Ser Aen Trp Ala Lys 485 SLeu Ala Gin 230 His Leu Pro Ile Ser 310 Gly Phe Gly Ala Ala 390 Tyr Ser Asp Phe Pro 470 Gly IAsp ;er 3er ken VIal Ala Gin 295 An Giy Gin Glu Ala 375 Tyr Arc Leiu HiE AsI 45! Asl Prc I 1 Lys 200 Ile Ala Ser Leu Phe 280 Arg Ala Arg Arg His 360 Tyr Ala Leu IVal Cys 440 Ala SAn Ser ~rg Leu Gin Ala Leu 205 Gu Thr Lye Lys Leu Lau eu Ser kla Ser Lau 265 Ile Ser Thr Trp An 345 Trp Ser Gin Ser Leu 425 LeL CyE Lyc Ty2 Lau Leu 250 Arg Met Gly Lys Thr 330 Trp Leu Leu Tyr *Val 410 IGirn CyE Glj Tyz *Sea 49( Lye Lys A 220 Thr Ann I 235 Leu Gin I His Leu Ala Gly Ala Ser 300 Pro Arg 315 Leu Ile Lye Asp Gly An Arg Val 380 Giu His 395 Val Giy Asn Thr Lys Cys Leu Ser .460 Lye Met 475.

Leu Arg lia ie sBp Ia 1 .,iu 285 Alia Lys Gin Tyr Giu 365 Giu Phe Tyx Sea Al 44! Asi Asj Al G iu Gin Gin 270 Gin Ser Val Arg Lys 350 Val Leu His *Ser *Phe 43C 1. GIr ,i Le' p Gi' a Se: Arg G 2 Gln H~ 255 Giu Val I Gly Phe Arg 335 Gin I Val' Gin Leu Gly 415 Ser Val a An f Ile r Arg 495 iy [is Clr ~he :ys 320 "iu Giy Hie Asp Gly 400 Ser Thr Met Gly Arg 480 Met INFORMATION FOR SEQ ID -NO:19: SEQUENCE CHARACTERISTICS: LENGTH: 1497 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY.: linear (ii) MOLECULE TYPE: DNA (1x) FEATURE: NAME/KEY: Coding Sequence LOCATION: .1494 OTHER INFORMATION: NAME/KEY: lNlC2F (chimera 1) LOCATION: I1.. .1497.

OTHER INFORMATION: NAME/KEY: Other LOCATION: OTHER INFORMATION: Putative leader sequence is encoded by nucleotides 1-60 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: ATG ACA GTT TTC Met Thr Val Phe

CTT

Leu

S

TCC TTT GCT TTC Ser Phe Ala Phe CTC GCT GCC Leu Al.a Ala 10 CCA GAA AAC Pro Glu Asn ATA 000 TGC Ile Gly Cys TAT AAC CG Tyr Asn Arg

AOC

Ser AAT CAG COC CGA Asn Gin Arg Arg ATT CTG ACT CAC Ile Leu Thr His is AGT GGG AGA AGA Ser Gly Arg Arg TTC ATT CTT CCA Phe Ile Leu Pro ATT CAA CAT GGG Ile Gin His Gly TOT GCC TAC ACT Cys Ala Tyr Thr GAA CAC Giu His GAT GGC AAC TGT Asp Gly Asn Cys

CGT

Arg .55 GAG AGT AG ACA Giu Ser Thr Thr GAC GAG, TAC AAC ACA Asp Gin Tyr Aen Thr CCG OAT TTC TCT TCC Pro Asp Phe Ser Ser

AAC

Asn OCT CTG CAG, AGA Ala Leu Gin Arg GAT OCT CCA CAC OTG OAA Asp Ala Pro His Val Glu 70 CAG AAA CTT CAA, Gin Lys Leu Gin

CAT

His CTG OAR, CAT GTG Leu Giu His Val GAA AAT TAT ACT Giu Asn Tyr Thr CAG TG Gin Trp, 192 240 288 336 384 o* oe CTG CAA AAA Lou Gin.Lye GCC GAG ATA Ala Gin Ile 115

CTT

Leu 100 GAO A.AT TAG ATT Giu Asn Tyr Ile GAA AAC ATG AAOG Glu Asn Met Lys TOG GAG ATO Ser Glu Mot 110 ACC ATO CTG Thr Met Lo~u GAG CAG AAT GCA Gin Gin Aen Ala GAG AAC CAC. ACG Gin Asn His Thr

OCT

Ala 125 *0.

.*o 0 o GAO ATA Giu Ile 130 GGA AGO AGO CTC Gly Thr Ser Leu

CTC

Lou 135 TCT GAG ACT GCA Sor Gin Thr Ala

GAG

O iu.

140 GAG ACC AGA AAG Gin Thr Arg Lys

CTG

Lou 145 ACA GAT GTT GAG Thr Asp Val Oiu ACC GAG, Thr Gin 150 GTA OTA AAT Val Lou Asn

CAA

Gin 155 ACT TOT OGA OTT Thr Ser Arg Lou ATA CAG CTG CTG Ile Gin Lou Lou

GAG

O iu 165 AAT TCA TTA TCC Aen Ser Lou Ser ACC TAC AAG CTA GAG AAG CAA Thr Tyr Lye Lou Giu Lye Gin 170 -175 432 480 528 576 624 OTT OTT CAA Leu Lou Gin TTA TTA GAA Lou Lou Giu 195

GAG

Gin 180 ACA AAT GAA ATC Thr 'Asn Giu Ile AAG ATC CAT OAA Lye Ile His Glu AAA AAC AOT Lye Asn Ser 190 AAG GAA GAG Lye Giu Oiu CAT AAA ATO TTA His Lys Ile Lou OAk O lu 200 ATO OAk GGA AAA Mot Giu Giy LyB

CAC

Hie 205 TTO GAC Lou Asp 210 ACC TTA AAG GAA Tthr...Lpu Lye Giu

GAG

G iu 215 AAA GAG AAC OTT Lys Giu Aen Lou

CAA

Gin 220 000 TTG OTT ACT Gly Lou Vai Thr

COT

Arg 225 CAA. ACA TAT ATA Gin Thr Tyr Ile

ATC

Ile 230 0kG GAG CTO OAA Gin Glu Lou Oiu

AAG

Lys 235 CAk TTA kAC AGA Gin Lou Asn Arg

OCT

Ala 240 672 720 768 ACC ACC AAC AAC Thr Thr Ann Asfl

AGT

Ser 245 OTO CTT CAG AAG Val Leu Gin Lys

CAG

Gin 250 CAA CTG GAG OTO Gin Lou Giu Lou ATO GAG Met Asp 255 ACA GTO CAC AAC CTT OTO AAT OTT TGC ACT AAA GAA GOT GTT TTA CTA Thr Val His Asfl Leu Val Asn Leu Cya Thr Lys Giu 260 265 Giy Val Leu Leu 270 AAG GGA GGA Lys Gly Gly 275 AAA AGA GAG GAA Lys Arg Giu Giu

GAG

0 ii 280 AAA CCA TTT AGA Lys Pro Phe Arg

GAC

Asp 285 TGT GCT GAA Cys Ala Giu GTA TTC Val Phe 290 AAA TCA GGA CAC Lys Ser Gly His

ACC

Thr 295 ACA AAT GGCATC Thr Asn Gly Ile

TAC

Tyr 300 ACG TTA ACA TTC Thr Leu Thr Phe

CCT

Pro 305 AAT TCT ACA GAA Asn Ser Thr Giu

GAG

Giu 310 ATC AAG GCC TAC Ile Lys Ala Tyr

TGT

Cys 315 GAC ATG GAA OCT Aep Met Glu Ala GGA GGC 000 TGG Giy Giy GiyTrp ACA ATT Thr Ile 325.

ATT CAG CGA Ile Gin Arg

CGT

Arg 330 GAG GAT GGC AGC Giu Asp Gly Ser GTT OAT Val Asp 335 TTT CAG AGGO Phe Gin Arg

ACT

Thr 340 TGG AAA GAA TAT Trp, Lys Glu Tyr GTG OGA TTT.GOT Val Gly Phe Gly AAC CCT TCA Aen Pro Ser 350 ACT AAT CAG Thr Asn Gin GGA GAA TAT TOG CTG GGA AAT GAG Oly. Giu Tyr Trp Leu Oly Aen Giu 355 360 TTT GTT TCG CAA Phe Val Ser Gin

CTG

Leu 365 864 912 960 1008 1056 1104 1152 1200 1248 1296 1344 CAA COC Gin Arg 370 TAT OTO CTT AAA Tyr Val Leu Lys

ATA

Ile 375 CAC CTT AAA GAO His Leu Lys Asp

TG

Trp 380 GAA GGG AAT GAG Giu Oly Asn Giu

OCT

Ala 385 TAC TCA TTG TAT GAA CAT TTC TAT CTC TCA AGT OAA GAA CTC. AAT Tyr Ser Leu Tyr Giu His Phe Tyr Leu Ser Ser Giu Giu Leu Asn 390 395 400 TAT AGO ATT CAC Tyr Arg Ile His

CTT

Leu 405 AAA GGA CTT .ACA Lys Oly Leu Thr ACA GCC GGC AAA Thr Ala Gly Lys ATA AGC Ile Ser 415 AGC ATC AGO Ser Ile Ser GAO AAA TOT Asp Lys Cys 435

CAA

Gin 420 CCA GGA AAT GAT Pro Gly Asn Asp

TTT

Phe 425 AGO ACA AAG OAT Ser Thr Lye Asp GGA GAO AAC Gly Asp Aen 430' GOC TOG TG Giy Trp Trp ATT TOO AAA TOT Ile Cys Lys Cys

TCA

Ser 440 CAA ATO OTA ACA Gin Met Leu Thr

GGA

O iy 445 TTT OAT Phe Asp 450 OCA TOT GOT CCT Ala Cys Gly Pro

TOO

Ser 455 AAC TTO AAC OGA Aen Leu Aen Gly

ATG

Met 460 TAO TAT OCA CAG Tyr Tyr Pro Gin

AGO

Arg 46S CAG AAC ACA Gin Aen Thr AAT AAO Aen'Lye 470 TOG CTC Ser Leu 485 TTC AAC 000 ATT Phe Asn Oly Ile AAG 0CC ACA ACC Lye Ala Thr Thr 490 AAA TG Lye Trp 475 TAC TAC TG Tyr Tyr Trp 1392 1440 1488 GGC TCA 000 TAT Gly Ser Gly Tyr ATO ATO ATC CGA CCA OCA Met Met Ile Arg Pro Ala 495 OAT TTC TAA 1497 Asp Phe INFORMATION FOR SEQ ID SEQUENCE CHAR.ACTERISTICS: LENGTHt 498 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: Internal (ix) FEATURE: NAME/KEY: 1N1C2F (chimera 1) LOCATION: 498 OTHER INFORMATION: .4 *4 Met Ile Tyr Glu 65 Gin Leu Ala Giu Leg 145 S le Leu Leg Leu S Arg 225 (xil SEQUENCE L'hr Val Phe Leu DESCRIPTION: SEQ Ser Phe Ala Phe ;iy Ann H is so Ala Lys Gin Gin Ile 130 Thr Gin Leu Leu Asp 210C Gir Cys Arg 35 Asp Leu Leu

LYS

Ile 115 Gly Asp Leu Gin Giu 195 Thr Thz se~ Ann Gin Arg Arg Ser Ile G ly Gin Gin Leg 100 Gin Thr Val Leu Gin 180 His Leu Tyz As: 2 6 SLyl a Se~ r Th y Tr g Th 34 r Tr 5 r Va r Le Gln His G As n Cys A :11 5 Arg Asp A 70 His Leg G Giu Ann T Gin Ann P Ser Leu I Glu Thr C Glu Ann 165 Thr Ann Lye Ile Lye Glu Ile Ile .230 iSer Val 245' i Leu Val 3 Arg Giu Gly His Giu Giu 310 p Thr Ile 325 r Trp Lye 0 p Leu Gly 1 Leu Lye u Tyr Giu 390 iy 5 la 1.u yr lia .eu L35 In 3er 31u 21! Gix Le: G1 Th 29 Gi A13

I]

25 Gin Cys Ala T) 40 Glu Ser Thr Ti Pro His Val G2 His Val Met G 90 Ile Val Giu A 105 Val Gin Aen H 120 Ser Gin Thr A Val Leu Asn G 1 *Leu Ser Thr 1 170 Ile Leu Lye 3 185 Giu Met GiuC 200 Lye Giu Ann i Giu Leu Giu i Gin Lye Gin 250 ni Leu Cya Thr 265 u Giu Lye Pro 280 r Thr Ann Gly

S

e LYe Ala Tyr e Gin Arg Arg 330 u Tyr Lye Val 345 in Glu Phe Val 'r TI ir Z Lu 5 iu en is la ~In 'yr le ily Ueu Lys 235 Gin 'hr ~sp ?ro Ann Thr Giu 140 Thr Lye His

LYE

Gi1 22~ GlI Le IID NO0:20: Leu Ala Ala 10 Pro Giu Ann Ile Leg Thr His is Ser Gly Arg Arg Phe Ile Leu Pro Gin Tyr Ann Thr Asp Phe Ser Ser Tyr-Thr Gin.Trp Lye Ser Giu Met 110 Ala Thr Met Leg 125 Gin Thr Arg Lye Ser Arg Leu Giu 160 Leg Glu Lye Gin 175 Giu Lye Ann Ser 190 His Lye Giu Giu 205 -Gly Leu Val Thr ni Leu Ann Arg Ala 240 ui Glu Leu Met Asp 255 Thr Thr Lye Val Pro 305 Gly Phe Gly Gin Ala 385 Tyr Thr Val Gly Phe 290 Ann Gly Gin Giu Arg 370 Tyr Aar Hi: G1l 27! Lyi Se G I Ar Ty Ty Se Lye Phe Ile Cys 31is Glu Gly Ser Asp Ser 395 Thr GiuC Arg Tyr 300 Asp Asp Phe Gin Trp 380 Ser ;ly k*sp 285 Thr Met Gly Giy Leg 365 Glu G1% Vai 270 Cys Leu G lu Ser Ann 350 Thr Gly 1Glu Leg Ala Thr Ala Val 335 Pro Ann Ann Leu Leu G iu Phe Giy 320 Asp Ser Gin Giu Ann e 5 360 His Leu Lye Tyr Leu His Phe 400 Ala Gly Lys Ile Ser Arg Ile His Leu Lye Gly Leu Thr Gly 405 Pro 410 Ser Ser Ile Ser Gin 420 I le Giy Asn Asp Phe 425 Gln Thr Lys Asp Asp Phe Arg 465 Lys Cys 435 Asp Ala Cya Lys Cys Ser 440 Asn Met Leu Thr Gly 445 Tyr 415 Gly Asp Aen 430 Giy Trp Trp Tyr Pro Gin Cys Giy Pro Gin Ser 455 Phe Leu Asn Gly Met 460 Lys Trp 475 Aen Thr Asn Lye 470 Asn Giy Ile Tyr Tyr Trp Ile Arg Pro 495 Lye 480 Ala Gly Ser Gly Tyr Asp Phe Ser Leu Lye Ala Thr Thr'Het 485 490 Met INFORMATION FOR SEQ ID NO:21: SEQUENCE CHARACTERISTICS: LENGTH: 1491 base pairs T*YPE: nucleic acid STRANDEDNESS: single TOPO LOGY: linear (ii) MOLECUILE TYPE: DNA (ix) FE&TrrRE: NAME/KEY: Coding Sequence LOCATION: .1488 OTHER INFORMATION: NAME/KEY: 2N2CiF (chimera 2) LOCATION: 1491 OTHER INFORMATION: NAME/KEY: Other LOCATION: .48 OTHER INFORMATION: Putative leader sequence Is encoded by nucleotides 1-48 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

ATG

Met 1 TGG CAG ATT Trp Gin Ile

GTT

Val 5 TTC TTT ACT CTG Phe Phe Thr Lou AGC TGT Ser Cys 10 GAT CTT GTC TTG GCC Asp Leu Val Lou Ala GCA GCC TAT Ala Ala Tyr CAA TAT CAG Gin Tyr Gin

AAC

Aen 20 AAC TTT COG AAG Aen Phe Arg Lys

AGC

Ser 25 ATG GAC AGC ATA Met Asp Ser Ile GGA AAG AAG Gly Lye Lye CTC CTG CCA Lou Lou. Pro GTC CAG CAT GG Val Gin His Gly

TCC

Ser 40 TGC AGC TAC ACT Cys Ser Tyr Thr

TTC

Phe GAG ATO Giu Met GAC AAC TGC CGC Asp Aen Cys Arg

TCT

Ser 55 TCC TCC AGC CCC Ser Ser Ser Pro

TAC

Tyr GTG TCC AAT GCT Val Ser Aen Ala

GTG

Val CAG AGG GAC GCG Gin Arg Asp Ala CTC GAA TAC OAT Lou Giu Tyr Asp

GAC

Asp 75 TCG GTO CAG AGG Ser Val Gin Arg

CTG

Lou 192 240 288 336 CAA GTG CTG GAG Gin Val Lou Giu

AAC

Aen ATC ATG GAA AAC Ile Met Giu Asn

AAC

Asn 90 ACT CAG TGG CTA Thr Gin Trp Leu.

ATG AAG Met Lys CTT GAG ART TAT ATC CAG GAC ARC ATO AAG AAA GAA ATO GTA GAG ATA Leu Giu Asr Tyr Ile Gin Asp Ann Met Lys Lye Giu Met Val Giu Ile 100 105 110 CAG CAG AAT Gin Gin Aen 115 GCA GTA CAG AAC Ala Val Gin Aen

CAG

Gln 120 ACG GCT GTG ATG Thr Ala Val Met

ATA

Ile 125 GAA ATA GGG Glu Ile Gly ACA AAC Thr Aen 130 CTG TTG AAC CAA Leu Leu Aen Gin

ACA

Thr 135 GCT GAG CAA ACG Ala Giu Gin Thr CGG AAG TTA ACT Arg Lye Leu Thr 140 CTT GAA CTT CAG Leu Glu Leu Gin

CAT

Asp

CTC

Leu- 384 432 480 528

GTG

Val 145 GAA GCC CAA GTA Glu Aa Gin Val

TTA

Leu 150 AAT CAG ACC ACG AEn Gin Thr Thr

AGA

Arg 155 TTC CAA CAC TCC Leu Giu His Ser CTC TCG ACA AAC Leu Ser Thr Aen 165 ATA AAC AAA TTG -Ile Ann Lye Leu AAA TTG Lye Leu 170 GAA AAA CAG ATT Glu Lye Gin Ile TTG GAC Leu Asp 175 CAG ACC ACT Gin Thr Ser AAG AAG GTG Lye Lyo Val 195

CAA

Glu 180

CAA

Gln 185 GAT AAC AAC AGT Asp Lye Aen Ser TTC CTA GAA Phe Leu Glu 190 CTA *OCT ATG GAA Leu Ala Met Glu GAC AAG CAC ATC ATC CAA CTA CAG TCA Asp Lye His Ile Ile Gin Leu Gin Ser 200 20.5 ATA AAA Ile Lye 210 GAA GAG AAA GAT Clu Glu Lye Asp

CAG

Gin 215 CTA CAG GTG TTA Leu Gin Vai Leu

GTA

Val 220 TCC AAG CAA AAT Ser Lye Gin Aen '576 624 672 720 768

TCC

Ser 225 ATC ATT GAA GAA Ile Ile Giu Glu CTA GAA AAA Leu Giu Lye 230 AAA ATA GTG Lye lie Vai 235 ACT CCC ACG GTG Thr Ala Thr Vai

AAT

Asn 240 AAT TCA GTT CTT Asn Ser Vai Leu

CAA

Gin 245 AAG CAG CAA CAT Lye Gin Gin His

GAT

Asp 250 CTC ATG GAG ACA Leu Met Giu Thr GTT AAT Vai Aen 255 AAC TTA CTG Aen Leu Leu GTT GCT AAA Val Aia Lye 275

ACT

Thr 260 ATG ATG.TCC ACA Met Met Ser Thr

TCA

Ser 265 AAC TCA GCT AAG Ann Ser Aia Lye GAC CCC ACT Asp Pro Thr 270 CAT GTA TAT Asp Vai Tyr GAA GAA CAA ATC Giu Glu Gin Ile

AGC

Ser 280 TTC AGA GAC TGT Phe Arg Asp Cys

OCA

Ala 285 CAA GCT Gin Ala 290 GOT TTT AAT AAA Gly Phe Aen Lye

AGT

Ser 295 GGA ATC TAC ACT Gly Ile Tyr Thr

ATT

Ile 300 TAT ATT AAT AAT Tyr Ile Asn Aen

ATG

Met 305 CCA GAA CCC AAA Pro Giu Pro Lye

AAG

Lye 310 GTG TTT TGC AAT Val Phe Cys Ann

ATG

Met 315 CAT GTC AAT GGG Asp Vai Aen Gly 816 864 912 960 1008 1056 1104 GGT TGG ACT GTA Gly Trp Thr Vai

ATA

Ile 325 CAA CAT CGT GAA Gin His Arg Glu

GAT

Asp 330 GGA ACT CTA GAT Gly Ser Leu Asp TTC CAA Phe Gin 335 AGA GOC TGG Arg Gly Trp

AAG

Lye 340 GAA TAT AAA ATO Glu Tyr Lye Met

GGT

Gly 345 TTT GGA AAT CCC Phe Gly Aen Pro TCC CT GAA Ser Cly Glu 350 TAT TGG CTG GGC ANT GAG TTT ATT TTT CCC ATT ACC ACT CAG AGO CAG Tyr Trp Leu Gly Ann Glu Phe lie Phe Ala Ile Thr Ser Gln Arg Gin 355 360 365 TAC ATG Tyr Met 370 CTA AGA ATT GAG Leu Arg Ile Glu

TTA

Leu 375 ATG GAC TGG Met Asp Trp GAN GGG Glu Gly 380 AAC CGA GCC TAT Asn Arg Ala Tyr

TCA

Ser 385 CAG TAT GAC AGA Gin Tyr Asp Arg

TTC

Phe 390 CAC ATA GGA AAT His Ile Gly Aen

GAA

Glu 395 NAG CAA AAC TAT Lys Gin Aen Tyr

AGG

Arg 400 TTG TAT TTA AAA Leu Tyr Leu Lys

GGT

Gly 405 CAC ACT GGG ACA GCA His Thr Gly Thr Ala 410 GOGA AAA CAG AGC Gly Lys Gin Ser AGC CTG Ser Leu 415 1152 1200 1248 1296 1344 1392 ATC TTA CAC Ile Leu His TGT ATG TGC Cys Met Cys 435

GGT

Gly 420 GCT GAT TTC AGC Ala Asp Phe Ser AAA OAT OCT GAT Lys Asp Ala Asp AAT GAC NAC Nsn Asp Aan 430 TGG TTT OAT Trp Phe Asp AAA TGT 0CC CTC Lys Cys Ala Leu

ATG

Met 440 TTA ACA GGA GGA Leu Thr Gly Gly

TGG

Trp 445 GCT TOT GOC CCC. TCC AAT CTA Ala Cys Gly Pro Ser Asn Leu 450 455 AAT GGA ATG TTC Asn Gly Met Phe

TAT

Tyr 460 ACT GCG OGA CAN Thr Ala Gly Gin AAC. CAT Asn His 465 GGA AAA CTG..AAT GGG ATA ANG TGG Gly Lye Leu Asn Gly Ile Lys Trp

CAC

His 475 TAC TTC AAA Tyr Phe Lys GGG CCC 1440 Gly Pro 480 GAT TTT T 1489 Asp Phe 495 AGT TAC TCC TTA Ser Tyr Ser Leu CGT TCC Nrg Ser 485 ACA ACT ATG Thr Thr Met

ATG

Met 490 ATT CGA CCT TTA Ile Arg Pro Leu 1491 INFORMATION FOR SEQ ID NO:22: SEQUENCE CHARACTERISTICS: LENGTH: 496 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: internal (ix) FEATURE: NAME/KEY: 2N2C1F (chimera 2) LOCATION: 496 OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: Met 1 Ala Trp Gin Ile Ala Tyr asn Val 5 Phe Phe Thr Leu Ser 10 Met Cys Asp Leu Val Asn Phe Arg Lys Ser 25 Cya Asp Ser Ile Gly Leu Leu Ala Lys Lys Leu Pro Gin Tyr Gin Glu Met Asp Val Gin Nrq Val Gin His Gly Ser 40 Ser Ser Tyr Thr Phe Val Asn Cys Arg Ser 55.

Leu Ser Ser Pro Tyr Asp Ser 75 Ser Asn Ala Asp Ala Pro 70 Glu Tyr Asp Val Gin Arg Gin Val Leu Glu Aen Ile Ile Met Olu Asn Asn 90 Lys Thr Gin Trp Leu Met Lys Giu Met Val Glu 110 Leu Lys Ile Leu Glu Asn Tyr 100 Gin Asp asn Met 105 138 GIn GIn Asn Ala Val GIn Asn GIn Thr Ala 115 120 @9 9 *4 a 4944 *4*e 9 *444 9**4 4 9*t* 4* *4 4 44** a 09 @9 .4 Thr Asn L 130 Val Giu A 145 Leu Giu H GIn Thr S Lys Lys N Ile Lys C 210 Ser Ile 225 Asn Ser Ann Leu Val Ala Gin Ala 290 Met Pro 305' Gly Trp Arg Gly Tyr Trp Tyr Met 370 Ser GIn 385 Leu Tyr Ile Leu Cys Met Aia Cys 450 Ann His 465 Ser Tyr eu ia 'is er ral liu Is l eu Lys 275 Giy Glu Thr Trp Let.

355 Let Tyi Le' Hii Cyi 43~ Gi GI1 Se Leu Gin Ser Giu 180 Leu Glu O iu Leu Thr 260 Giu Phe Pro *Val Lys 340 IGiy Ars -Asi iLye SGil 42C s Lyu

S

yr Pr y Lyi r Le Ann Gin Val Leu 150 Leu Ser 165 Ile An Aia Met Lys Asp Giu Leu 230 Gin Lye 245 Met Met ,Giu GIn 4-n Lye Lys Lys 310C Ile GlI 325 Giu Tyz Ann Gii Ile GlI Arg Phi 394 3Gly Hi 405 SAla Asi s Cys Ai D Ser As Leu As 47 Arg Se 485- Thr Ala Giu G 13 5 Ann Gin Thr I Thr Ann Lys I Lys Leu Gin 185 Giu Asp Lyes 200 Gin Leu Gin 215 Giu Lye Lys Gin. Gin His Ser Thr Ser 265 Ile Ser Ptie 280 ISer Gly Ile 295 Vai Phe Cys His Arg Giu Lys Met Gly .345 :Phe Ile Phe 360 i Leu Met Asp 375 e His Ile Gly 0 a Thr Gly Thr p Phe Ser Thr 425 a Leu Met Leu 440 n Leu Ann Gly 455 n Gly Ile Lye 0 r Thr Thr Met ;In !hr ~eu 170 ksp H[is Ile Ile Gin Leu Gin Ser V1al Ile Asp 250 An Arg Leu Val 235 Leu Ser Asp Val 220 Thr Met Ala Cys Tyr Thr Ile Afn Asp 330 Phe Ala Trp An Ala 410 Lye Thr met Met 315 Gly Gly Ile Giu Glu 395 Gly Asp Giy Phe 300 Asp Ser An Thr Gij 38C Lye Lys All 01' Ty 46 Ser Lye G Ala Thr V Giu Thr V 2 Lys Asp P 270 Ala Asp N~ 285 Tyr Ile Vai Aen Leu Asp Pro Ser 350 Ser Gin 365 Ann Arg Gin An 3 Gin Ser a Asp An 430 y Trp Trp 445 r Thr Ala 0 r Phe Lys In al 'ro Tal Wen Phe 335 Gl Arc Al~ Ty2 Se~ 41! As! Ph

GI

01 Asn An 240 Asn Thr Tyr An Gly 320 Gin Glu Gin LTyr Arg 400 r Leu p An e Asp y Gin y Pro 480 Val Met Ile GlU Ile Giy 125 Thr Arg Lye Leu Thr Asp 140 Arg Leu Giu Leu Gin Leu 155 160 Giu Lye Gin Ile Leu Asp Lye Ann Ser Phe Leu Giu 190 Trp His Ty 475 Met Ile 490 Arg Pro Leu Asp Phe 495 INFORMATION FOR SEQ ID NO:23: SEQUENCE CHARACTERISTICS: LENGTH: 1500 base pairs TYPE: nucieic acid STRANDEDNESS: single (D3) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (ix) FEATURE: NAME/KEY: Coding Sequence LOCATION: I. 1497 OTHER INFORMATION: NAME/KEY: iN2C2F (chimera 3) LOCATION: 1500 OTHER INFORMATION: NAME/KEY: Other LOCATION: OTHER INFORMATION: Putative leader sequence is encoded by nucleotides 1-60 (xi) SEQUENCE DESCRIPTION: SEQ. ID' NO: 23: ATG ACA GTT TTC CTT Met Thr Val Phe Leu.

1 5 TCC TTT GCT TTC CTC Ser Phe Ala Phe Leu 10 GCT GCC ATT CTG Ala Ala Ile Leu ACT CAC Thr His ATA 000 TGC Ile Gly Cys TAT AAC CGG Tyr Asn Arg

AGC

Ser AAT CAG CGC CGA Aen Gin Arg Arg

AGT

Ser 25 CCA GAA AAC AGT Pro Glu Asn Ser GG AGA AGA Gly Arg Arg ATT CTT CCA Ile Leu Pro ATT CAA CAT 000 Ile Gin His Gly

CAA

Gin 40- TGT GCC TAC ACT Cys Ala Tyr Thr

TTC

Phe GAA CAC Giu 'His 50 GAT GGC AAC TGT Asp Gly Asn Cys

COT

Arg 55 GAG AGT ACG ACA Glu Ser Thr Thr

GAC

Asp CAG TAC AAC ACA G!In Tyr Aen Thr

S

Soosee

S

a S. 95

S

S

S

5*

OSS

AAC

Asn 65' GCT CTG CAG AGA Ala Leu Gin Arg

GAT

Asp 70 GCT CCA CAC GTG Ala Pro His Val CCG OAT'GAC TCG Pro Asp Asp. Ser

GTG

Val CAG AGO CTG CAA Gin Arg Leu Gin

GTG

Val 85 CTG GAG AAC ATC Leu Giu Asn Ile

ATG

Met 90 GAA AAC AAC ACT Giu Asn Asn Thr CAG TG Gin Trp, 192 240 288 336 384 CTA ATG AAG Leu Met Lys OTA GAG ATA Val Oiu Ile 115

CTT

Leu 100 GAG AAT TAT ATC Glu Asn Tyr Ile CAG CAC Gin Asp lot CAG AAC Gin Asn AAC ATG AAG, Asn Met Lys CAG ACG GCT Gin Thr Ala 125 AAA GAA ATG Lys Oiu Met 110 OTG ATG ATA Val Met Ile CAG CAG AAT GCA Gin Gin Asn Ala

GTA

Val 120

S

S

S.

a as..

S

QS S a a GAA ATA Oiu Ile 130 000 ACA AAC CTG Gly Thr Aen Leu

TTG

Leu 135 AAC .CAA ACA GCT Asn Gin Thr Ala

GAG

Glu 140 CAA ACG COG AAG Gin Thr Arg Lys

TTA

Leu 145 ACT OAT GTG OAA Thr Asp Val'Giu 0CC 'Ala 150 CAA GTA TTA AAT Gin Val Leu Asn

CAG

Gin 155 ACC ACG AGA CTT Thr Thr Arg Leu

GAA

0 iu 160 CTT CAG CTC TTG Leu-Gln Leu Leu

GAA

Giu 165 CAC TCC CTC TCG His Ser Leu Ser

ACA

Thr 170 AAC AAA TTG GAA Aen Lys Leu Glu AAA CAG Lys Gin 175 432 480 528 576 624 672 ATT TTG GAC Ile Leu Asp TTC CTA GAA Phe Leu Glu 195 CAG ACC AGT Gin Thr Ser 180 GAA ATA AAC AAA TTG CAA OAT AAG AAC AGT Gu Ile RAn Lys Leu Gin Asp Lys Aen Ser 185 190 RAG AAG GTG CTA Lys Lys Val Leu

OCT

Ala 200 ATG GAA GAC RAG Met Giu Asp Lys

CAC

His 205 ATC ATC CAA Ile Ile Gin CTA ORG Leu Gin 210 TCA ATA AAA GAA Ser Ile Lys Giu

GAG

Giu 215 AA OAT ORG CTA Lye Asp Gin Leu CR0 Gin 220 GTG TTA GTA TC Val Leu Val Ser RAG CAA RAT TCC ATC ATT CAR OAR CTA GAA AM AAA ATA GTG ACT GCC 140 Lys Gin Ran Ser Ile Ile Giu Giu Leu Giu Lye Lye Ile Val Thr Aia 225 230 235 240 ACG GTG AAT RAT Thr Val An An

TCA

Ser 245 OTT CTT CAR RAG Val Leu Gin LyB CR0, Gin 250 CAA CAT GAT CTC Gin His Ap Leu ATG GAG Met Giu 255 ACA OTT RAT Thr Vali RAn GAC CCC ACT Asp Pro Thr 275

RAC

RAn 260 TTA CTG ACT ATO Leu Leu Thr Met

ATG

Het 265 TCC ACA TCA AAC Ser Thr Ser RAn TCA GCT RAG Ser Ala Lys* 270 GAC TOT GCT Asp Cys Ala- GTT OCT AA Vai Ala Lys GAR GAR Giu Giu 280 CAR RTC AGC TTC Gin Ile Ser Phe

AGA

Arg 285 GAR OTA Glu Val 290 TTC AA TCA GGA Phe Lys Ser Giy RCC RCA RAT 0C Thr Thr an Giy

ATC

Ile 300 TAC RCG TTA RCA Tyr Thr Leu Thr.

TTC

SPhe 305 COT RAT TOT RCA Pro an Ser Thr

A

Giu 310 GAG ATC RAG GCC Giu Ile Lys Ala

TAC

Tyr 315 TGT GRC. ATO Cys Ap Met GGR OCR C Giy. Giy Giy GAT TTT CAG Asp Phe Gin TCR OGA OAR Ser Gly Giu 355 000 'TGG Giy Trp 325 RCA ATT ATT CR0 Thr Ile Ile Gin GRA OCT 01w Ala 320 AGO GTT Ser Val 335

CGA

Arg 330 COT GAG OAT C Arg Oiu Asp Gly

AGG

Arg 340 ACT TOG AAA OAR Thr Trp Lys Oiu

TAT

Tyr 345 AA TG OCR TTT Lys Val Oly Phe OCT ARC CCT Gly An Pro 350 CTG ACT RAT Leu Thr An 768 816 864 912* 960 1008 1056 1104 1152 1200 1248 1296 1344 TAT TOG CTG GGR Tyr Trp Leu Oly GAG TTT OTT TCG Giu Phe Vai Ser

CAR

Gin 365 CR0 CAR Gin Gin 370 COO TAT OTO CTT Arg Tyr Vai Leu

AA

Lye 375 ATA CRC CTT AA Ile His Leu Lye

GAC

Asp 380 TGO OAR 000 RAT Trp, Giu Oly an 0 O..

GAG

Glu 385' GOT TAO TCA TTG Ala Tyr Ser Leu

TAT

Tyr 390 OAR CAT TTC'TAT Giu His Phe Tyr

CTC

Leu 395 TCA ROT ORA GAR Ser Ser Giu Giu

CTC

Leu 400 ART TAT AGO RTT an Tyr Rrg Ile

CRC

His 405 CTT AAA OGA CTT Leu Lys Gly Leu

ACA

Thr 410 GOG ACA 0CC 000 Gly Thr Ala Oly AAA ATA Lye Ile:' 415 AGO AGO ATO Ser Ser Ile ARC GAO AA an Ap Lye 435

AGC

Ser 420 CAA CCA GOR RAT Gin Pro Giy An

GAT

Asp 425 TTT AGO ACA ARO Phe Ser Thr Lys OAT OGA GAC Asp Gly Ap 430 OGA GOC TOG.- Gly Oly Trp TOT RTT TOC AA Cy Ile Cya Lys

TOT

Cys 440 TCA CAR ATO CTA Ser Gin Met Leu

ACA

Thr 445 TGG TTT Trp Phe 450 OAT OCR TOT OCT Ap Aia Cys Giy

CCT

Pro 455 TCC ARC TTG ARC Ser An Leu an

GOR

Gly 460 ATO TAC TAT CCA Met Tyr Tyr Pro CR0 AGO CR0 ARC RCA ART RAG TTC ARC GOC ATT AAA TOG TRC TAC Gin Arg Gin an Thr an Lye Phe an Gly Ile Lye Trp Tyr Tyr 465 470 475

TOO

Trp 480 1392 1440 1488 ARA GOC TCR 000 TAT TOO CTC RAG 0CC RCA Lye Oly Ser Gly Tyr Ser Leu Lye Ala Thr 485 490 ACC ATO ATG ATC Thr Met Met Ile COR CCR Rrg Pro 495 GCA GAT TTC TAN 1500 Ala Asp Phe INFORMATION FOR SEQ ID NO:24: SEQUENCE CHARACTERISTICS: LENGTH: 499 amino acids TYPE: amino acid STRANDEDNESSt single TOPOLOGY: linear (ii).MOLECULE TYPE: protein FRAGMENT TYPE: internal (ix) FEATURE: ()NAME/KEY: IN2C2F (chimera. 3) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:.

Met Thr Val Phe Leu Ser Phe Ala Phe Leu Ala Ala Ile Leu Thr His 1 5 10 is Ile Gly Cys Ser Asn Gln Arg Arg Ser Pro Glu NAn Ser Gly Arg Arg 25 Tyr Asn Arg Ile Gin His Gly Gin Cys Ala Tyr Thr Phe Ile Leu Pro 40 Glu His Asp Gly Asn Cys Arg Glu Ser Thr Thr Asp Gin Tyr NAn Thr V.so Gi5r5Aps As Ala Leu GnAgspAla Pro His Val Giu Pro Asp Asp Ser Val 70 75 *Gin Arg Leu GIn Val Leu Giu Asn Ile Met Giu Asn Asn Thr Gin Trp 90 Leu Met Lye Leu Glu An Tyr Ile Gin Asp NAn Met Lys Lys Giu Met 100 105 110 Val Glu Ile Gin Gin Asn Ala Va~l Gin Asn Gln Thr Ala Val Met Ile 115 120 .125 Glu Ile Gly Thr Asn Leu Leu Asn Gin Thr Ala Glu Gin Thr Arg Lys.

130 135 140 Leu Thr Asp Val Glu Ala Gin Val Leu NAn Gin Thr Thr Arg Leu Glu 145 150 155 160 *Leu Gin Leu Leu Glu His Ser Leu Ser Thr NAn LyB Leu Giu Lys Gin 165 170 175 Ile Leu Asp Gin Thr Ser Gu Ile an Lye Leu Gin Asp Lys an Ser 180 185 190 0 Phe Leu Giu Lys Lye Val Leu Ala Met Glu Asp Lye His Ile Ile Gin **195 200 205 *Leu Gin Ser Ile Lys Glu Glu Lys Asp Gin Leu Gin Val Leu Val Ser ***210 215 220 Lys Gin NAn Ser Ile Ile Glu Giu Leu Giu Lye Lys Ile Val Thr Ala 225 230 235 240 Thr Va~l an Asn Ser Val Leu Gin Lya Gin Gin His Asp Leu Met G.iu.

245 250 255 Thr Vai Asn Asn Leu Leu Thr Met Met Ser Thr Ser Asn Ser Ala Lys 260 265 270 Asp Pro Thr Val Ala Lye Glu Glu Gin Ile Ser Phe Arg Asp Cys Ala 275 280 285 Giu Val Phe Lys Ser Gly His Thr Thr An Gly Ile Tyr Thr Leu Thr 290 295 300 Phe Pro an Ser Thr Glu Giu Ile Lys Ala Tyr Cys Asp Met Giu Ala 305 310 315 320 Gly Gly Gly Gly Trp Thr Ile Ile Gin Arg Arg Giu Asp Gly Ser Val 325 330. 335 Asp Phe Gin Arg Thr Trp Lye Giu Tyr Lye Val Gly Phe Gly an Pro 340 345 350 Ser Gly Giu Tyr Trp Leu Giy an Glu Phe Val Ser Gin Leu Thr an 355 360 365 142 Gln Gin Arg Tyr Val Leu Lye Ile HIS Leu Lys Asp Trp Glu Giy Asn' 370 375 380 Giu Ala Tyr Ser Leu Tyr Giu His Phe Tyr Leu Ser Ser Glu Giu Leu 385 390 395 400 Asn Tyr Arg Ile His Leu Lye Gly Leu Thr Gly Thr Ala Gly Lye Ile 405 410 415 Ser Ser Ile Ser Gin Pro Giy Asn Asp Phe Ser Thr Lye Asp Gly Asp 420 425 430 Aen Asp Lye Cys Ile Cys Lye Cys Ser Gin Met Leu Thr Gly Giy Trp 435 440 445 Trp Phe Asp Aia Cys Gly Pro Ser Asn Leu Aen Gly Met Tyr Tyr Pro 450 455 460 Gin Arg Gin Aen Thr Asn Lye Phe Asn Gly Ile Lys Trp Tyr Tyr Trp 465 470 475 480 Lye. Gly Ser Giy Tyr Ser Leu Lye Ala Thr Thr Met Met Ile Arg Pro 485 490 495 Ala Asp Phe INFORMATION FOR SEQ ID 140:25: SEQUENCE CHARACTERISTICS: LENdO1H: 1488 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (ix) FEATURE: NAME/KEY:*Coding Sequence LOCATION: 1485

OTHER-INFORMATION:

NAME/KEY: 2N1ClF (chimera 4) LOCATION: 1488 OTHER INFORMATION: NAME/KEY: Other LOCATION: 48 OTHER INFORMATION: Putative leader sequence (xi) SEQUENCE-DESCRIPTION: SEQ ID 140:25: ATG TGG CAG ATT GTT TTC.TTT ACT CTG AGC TGT GAT CTT GTC TTG GCC 48 Met Trp Gin Ile Vai Phe Phe Thr Leu Ser Cys Asp Lau Val Leu Ala 1 5 10 GCA GCC TAT AAC AAC TTT CGG AAG AGC ATG GAC AGC ATA GGA.AAG AAG 96 Ala Ala Tyr Asn Asn Phe Arg Lye Ser Met Asp Ser Ile Gly* Lye. Lye, 25 CAA TAT C-AG GTC CAG CAT GGG TCC TGC AGC TAC ACT TTC CTC CTG CCA 144 Gin Tyr Gin Val Gin His Giy Ser Cys Scr Tyr Thr Phe Leu Leu Pro 40 GAG ATG GAC AAC TGC CGC TCT TCC TCC AGC CCC TAC GTG TCC AAT GCT 192 Glu Met Asp Asn Cys Arg Ser Scr Ser Ser Pro Tyr Val Ser Asn Ala 55 GTG CAG AGG GAC GC CCG CTC GAA TAC GAT TTC TCT TCC CAG AAA CTT 240 Val Gin Arg Asp Ala Pro Leu Glu Tyr Asp Phe Ser Ser Gin Lye Leu 70 75 CAA CAT CTG GAA Gin His Leu Glu

CAT

His as GTG ATG GAR. AAT Val Met Glu Asn

TAT

Tyr 90 ACT CAG TGG CTG Thr Gin Trp Leu CAA AAA Gin Lys CTT GAG AAT Leu Giu Asn

TAC

Tyr 100 ATT GTG GAA AAC, Ile Val Glu Asn.

ATG AAG TCG GAG ATG GCC CAG ATA Met Lye Ser Glu Met Ala Gin Ile 105 110 288 336 384 CAG CAG AAT Gin Gin Asn 115 GCA GTT CAG AAC Ala Val Gin Aen

CAC

His 120 ACG OCT ACC ATG Thr Ala Thr Met

CTG,

Leu 125 GAG ATA GGA Glu Ile Oly ACC AGC Thr Ser 130 CTC CTC TCT CAG Leu Leu Ser Gin GCA GAG CAG ACC Ala Giu Gin Thr

AGA

Arg 140 AAG CTG ACA GAT Lye Leu Tkir Xop GTT GAG ACC CAG GTA CTA AAT CAA ACT TCT Val Glu Thr Gin Val Leu Aon Gin Thr Ser

CGA

Arg 155 CTT GAG ATA CAG Leu Glu Ile Gin

CTG

Leu 160 480 CTG GAG AAT TCA TTA Leu Giu Aen Ser Leu .165 TCC ACC TAC AAG Ser Thr Tyr Lys

CTA

Leu 170 GAG AAG CAA CTT Giu. Lys Gin Leu CTT CAA Leu Gin 175 TTA GAA Leu Giu CAG ACA Gin ,Thr AAT GAA Aen Giu 180 ATC TTG AAG ATC Ile Leu Lys Ile

CAT

His 185 GAA A.AA AAC Giu Lys Asn AOT TTA Ser Leu 190 CAT AAA ATC His Lys Ile 195 TTA GAA ATG GAA Leu Giu Met Glu Gly 200 AAA CAC AAG GAA Lys His Lye Giu

GAG

Glu 205 TTG GAC ACC Leu Asp Thr TTA AAG Leu Lye 210 GAA GAG AAA GAG Giu Giu Lys Giu

AAC

Asn 215 CTT CAA GGC TTG Leu Gin Giy Leu

GTT

Val 220 ACT CGT CAA ACA Thr Arg Gin Thr

TAT

Tyr 225 ATA ATC CAG GAG Ile Ile Gin Giu

CTG

Leu 230 GAA AAG CAA TTA Giu Lys Gin Leu

AAC

Asn 235 AGA GCT ACC ACC Arg Ala Thr Thr

AAC

Aen 240 AAC AGT GTC CTT Asn Ser Val Leu

CAG

Gin 245 AAG CAG CAA CTO Lys Gin Gin*Leu

GAG

Giu 250 CTG ATG GAC ACA Leu Met Asp Thr GTC CAC Val Hie 255 52.8 516 624 672 720 768 816 864 912 960 1008 AAC CTT GTC Aen Leu Val

AAT

Asn 260 CTT TGC ACT AAA Leu Cys Thr Lye

GAA

0 iu 265.

GOT GTT TTA CTA Gly.Val Leu Leu AAG GGA OGA Lys Gly Gly 270 GTA TAT CAA Val Tyr Gin AAA AGA GAG GAA GAG AAA CCA TTT AGA GAC TGT GCA GAT Lys Arg Giu Giu Giu Lye Pro Phe Arg Asp Cyo Ala Asp 275 280 285 OCT GGT Ala Giy 290 TTT AAT AA.A AGT Phe Aen Lys Ser

GGA.

Gly 295 ATC TAC ACT ATT Ile Tyr Thr Ile

TAT

Tyr 300 ATT AAT AAT ATO Ile Aen Asn Met GAA CCC AAA AAG Oiu Pro Lys Lye

GTG

Vai 310 TTT TOC AAT ATG Phe Cys Asn Met

GAT

Asp 315 GTC AAT GOG OGA Val Asn Gly Oiy

GGT

Gly 320 TGG ACT GTA ATA Trp Thr Val Ile

CAA

Gin 325 CAT COT GAA GAT His Arg Glu Asp

GA

Gly 330 AGT CTA GAT TTC Ser Leu Asp Phe CAA AGA Gin Arg 335, 0CC TO AAG GAA TAT AAA ATG GOT TTT GGA AAT CCC TCC GGT GAA TAT Giy Trp Lys Giu Tyr Lye Met Oly Phe Gly Asn Pro Ser Gly Oiu Tyr 340 345 350 1056 TGG CTG GGG Trp Leu Gly 355 ATG CTA AGA Met Leu Arg 370~ AAT GAG TTT ATT Aen Giu Phe Ile

TTT

Phe 360 GCC ATT ACC AGT Ala Ile Thr Ser

CAG

Gin 365 AGG CAG TAG Arg Gin Tyr 1104 1152 ATT GAG TTA Ile Giu Leu

ATG

Met GAC TGG GAA GGG Asp Trp Giu Gly

AAC

Aen CGA GCC TAT TCA Ara Ala Tyr Ser J-1 380

CAG

Gin 385 TAT GAG AGA TTC Tyr Asp Arg Phe

CAC

His 390 ATA GGA AAT GAA Ile Gly Aen Giu

AAG

Lye 395 CAA AAC TAT Gin Asn Tyr AGO TTG, Arg Leu 400 CTG ATC Leu rie 41S TAT TTA AAA GOT CAC ACT GO ACA GCA Tyr Leu Lye Gly His Thr Giy Thr Ala

GGA

Gly 410 AAA CAG AGC AOC Lys Gin Ser Ser 1200 1248 1296 TTA CAC GGT Leu His Gly

GCT

Ala 420 GAT TTC ACC ACT Asp Phe Ser Thr AAA GAT OCT OAT AAT GAC AAC TOT Lye Asp Ala Asp Asn Asp Asn eys 425 430 ATG TGC-AAA met Gys Lys 435 TGT GGC CCC Cys Gly Pro 450 TOT GCC CTC ATG TTA Cys Ala Leu Met Leu 440 ACA GGA GGA TG Thr Gly Gly Trp

TG

Trp 445 TTT GAT GCT Phe Asp Ala TCC'AAT CTA Ser Aen Leu

AAT

Aen 455 GGA ATO TTC TAT Gly Met Phe Tyr

ACT

Thr 460 GCG GGA CAA AAC Ala Gly Gin Asn 1344 1392 1440 1488 GGA AAA CTG AAT Oly Lye Leu Aen 000 Gly 470 ATA AAG TOG CAC Ile Lys Trp His

TAC

Tyr 475 TTC AAA 000 CCC Phe Lye Gly Pro

AOT

Ser 480 TAC TCC TTA COT Tyr Ser Leu Arg

TCC

Ser 485 ACA ACT ATG ATO Thr Thr Met Met

ATT

Ile 490 CGA CCT TTA GAT Arg Pro Leu Asp TTT TGA Phe 495 9 9* INFORMATION FOR SEQ ID NO:26: SEQUENCE CHARACTERISTICS: LENGTH: 495.amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: internal (ix) FEATURE:.

NAME/KEY: 2N1ClF (chimera 4) LOCATION: .495 OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: Met Trp 1 Gin Ile Val1 5 Asn Phe Phe Thr Phe Arg Lys Leu Ser 10 Ser Met Cys Asp Leu Asp Ser Ile Ala Ala Tyr Aen Gin Tyr Gin Val Glu Met Asp Asn Val Gly Leu Leu Ala Lys Lye Leu Pro 25 cys Gin His Gly Ser 40 Cys Arg Ser Ser 5 Ala Pro Leu Glu Ser Tyr Thr Phe Val Gln Asp Arg Ser Ser Pro Tyr Val Tyr Asp Phe Ser Ser 75 Aen Tyr Thr Gin Trp Ser Aen Ala 70 Gin Lye Leu Leu Gin Lye Gin His Leu Glu His Val Met Glu Leu Glu Ken

S..

S

S S Gin Thr Val 145 Leu Gin His Leu Tyr 225 Aen Aen Lys Ala Pro 305 Trp Giy Trp Met Gin 385 Tyr Leu Met Cys His 465 Tyr Gin Ser 130 Glu Giu Thr Lys Lye 210 Ile Ser Leu Arg Gly 290 Giu Thr Trp Leu Leu 370 Tyr Leu His Cys Gly 450 Gly Ser Asn 115 Leu Thr Aen Asn Ile 195 Giu Ile Val Val G2lu 275 Phe Pro Val Lys Gly 355 Arg Asp Lys Gly Lys 435 Pro Lys Leu Tyr 100 Ala Leu Gin Ser Giu 180 Leu Giu Gin Leu Asn 260 G 1w' Asn Lye Ile Giu 340 Aen Ile Arg Gly Ala 420 Cys Ser Leu Arg Val Ser Val Leu 165 Ile G iu Lys Giu Gin 245 Leu Giu Lys Lys Gin 325 Tyr Giu Glu Phe His 405 Asp Ala Aen AB n Ser 485 Gin Gin Leu 150 Ser Leu Met G lu Leu 230 Lys Cys Lye Ser Val 310 His Lye Phe Leu His 390 Thr Phe Leu Leu Gly 470 Thr Aen Thr 135 Aen Thr Lye Giu Asn 215 Glu Gin Thr Pro Gly 295 Phe Arg Met Ile Met 375 Ile Gly Ser Met Aen 455 Ile Thr His 120 Ala Gin Tyr Ile Gly 200 Leu Lye Gin Lye Phe 280 Ile Cye3 Giu Gly Phe 360 Asp Gly Thr Thr Leu 440 Gly Lys Met Thr G iu Thr Lye His 185 Lye Gin Gin Leu G lu 265 Arg Tyr Asn Asp Phe 345 Ala Trp Asn Ala Lys 425 Thr Met TrF Met Ile Val Giu Aen Met Lye Ser C Ala Thr b Gin Thr Ser Arg 155 Leu Giu 170 Giu Lye His Lyes Gly Leu Leu Aen 235.

Glu Lou 250 Gly Vai Asp Cys Thr Ile Met Asp 315 Gly Ser 330 Gly Aen Ile Thr *Glu Gly *Glu Lye 395 *Gly Lye 410 *Asp Ala Gly Gly *Phe Tyr His Tyr 475 Ile Arg 490- (et krg L40 .ys Asn.

3 lu V1al 220 Arg Met Leu Ala Tyr 300 Val.

Leu Pro Ser Asn 380 Gin Gin Asp Trp Thr 460 Phe P ro Met Leu( 125 Lys Giu Gin Ser Glu 205 Thr Ala Asp Leu Asp 285 Ile Aen Asp Ser Gin 365 Arg Asn Ser *Aen Trp 445 *Ala Lys Leu lia LI0 ;lu .eu Ile Leu Leu 190 Leu Arg Thr Thr Lys 270 Val Aen Gly Phe G11 350 Arc Ali Ty: Soe As! 43( Phi Gl'

GI

As Gin I Ile G Thr F: Gin I Lett C 175 Leu Asp Gin' Thr Val Gly Tyr Asn Giy Gin 335 Giu Gin Tyr :Arg 415 e Asp y Gin y Pro p Phe 495 l e iiy .eu ;in rhr rhr Asn 240 Hlis Giy Gin Met Gly 320 Arg Tyr Tyr Ser Lou 400 Ile Cys Aia As n Ser 480 INFORMATION FOR SEQ ID NO:27: SEQUENCE CHARACTERISTICS: LENGTH: 47 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (1i) MOLECULE TYPE: DNA (ix) FEATURE: NAI4E/KEY: hTL4atg LOCATION: .47 OTHER INFORMATION: PCR primer NAME/KEY: other LOCATION: I. OTHER INFORMATION: "tail- sequences added to PCR primer to facilitate cloning of the amplified PCR fragments (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: GCATGCTATC TCGAGCCACC ATGCTCTCCC AGCTAGCCAT GCTGCAG 47 INFORMATION FOR SEQ ID NO:28: SEQUENCE CHAR~ACTERISTICS: LENGTH: 55 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: -hTL4not LOCATION: l...SS OTHER INFORMATION: PCR Primer NAME/KEY: Other LOCATION: 1..-28 OTHER INFORMATION: tail" sequence added to the PCR primers to facilitate cloning of the amplified PCR fragments (xi) SEQUENCE. DESCRIPTION: -SEQ ID NO:26: GTGTCGACGC GGCCGCTCTA GATCAGACTT4 AGATGTCCAA AGGCCGTATC ATCAT 147

Claims (29)

1. A modified TIE-2 ligand that binds and activates TIE-2 receptor which is TIE-2 ligand 1 modified to comprise a different amino acid instead of the cysteine residue at amino acid position 265 set forth in Figure 4.

2. A ligand according to claim 1, which is modified such that the amino acid at position 265 is serine. 10

3. A modified TIE-2 ligand that binds but does not activate TIE-2 wherein the N-terminal domain of the TIE-2 ligand is deleted. o o o

4. A ligand according to claim 3 which is TIE-2 ligand 1 or TIE-2 ligand 2 wherein the N-terminal domain is deleted.

5. A ligand according to claim 3 or 4, wherein the coiled-coil domain of the TIE-2 ligand is deleted and the fibrinogen-like domain is fused in- frame to a human immunoglobulin gamma-1 constant region. 20

6. A ligand according to claim 5 wherein the immunoglobulin constant region is IgG1-Fc.

7. A nucleic acid molecule which encodes a modified TIE-2 ligand of any one of the preceding claims.

8. A vector which comprises a nucleic acid molecule of claim 7.

9. A vector according to claim 8, wherein the nucleic acid molecule is operatively linked to an expression control sequence capable of directing its expression in a host cell.

L -149- A vector according to claim 8 or 9 which is a plasmid.

11. A host-vector system for the production of a modified ligand according to any one of claims 1 to 6 which comprises a host cell and a vector according to claim 9 or

12. A host-vector system according to claim 11 wherein the host cell is a bacterial, yeast, insect or mammalian cell. 10

13. A method of producing a ligand as defined in any one of claims 1 to 6 which comprises growing cells of a host-vector system according to claim 11 or 12, under conditions permitting production of the ligand and recovering the ligand so produced. 15

14. An antibody which specifically binds the ligand of any one of claims 1 to 6.

15. An antibody according to claim 14 which is a monoclonal antibody. 20

16. A conjugate comprising a ligand according to any one of claims 1 to 6 and conjugated thereto, a cytotoxic agent.

17. A conjugate according to claim 16 wherein the cytotoxic agent is a radioisotope or toxin.

18. A pharmaceutical composition comprising a modified ligand according to any one of claims 1 to 6 and a pharmaceutically acceptable carrier.

19. A pharmaceutical composition comprising an antibody according to claim 14 or 15 and a pharmaceutically acceptable carrier. -150- 0 0 p.

S 0 S 0**S 0 A pharmaceutical composition comprising a conjugate according to claim 16 or 17 and a pharmaceutically acceptable carrier.

21. A ligand produced by the method of claim 13.

22. A modified TIE-2 ligand according to claim 1 or 3 substantially as hereinbefore described with reference to the Examples.

23. A nucleic acid molecule according to claim 7 substantially as hereinbefore described with reference to the Examples.

24. A vector according to claim 8 substantially as hereinbefore described with reference to the Examples. 15

25. A host-vector system according to claim 11 substantially as hereinbefore described with reference to the Examples.

26. A method according to claim 13 substantially as hereinbefore described with reference to the Examples.

27. An antibody according to claim 14 substantially as hereinbefore described with reference to the Examples.

28. A conjugate according to claim 16 substantially as hereinbefore described with reference to the Examples.

29. A pharmaceutical composition according to claim 18, 19 or substantially as hereinbefore described with reference to the Examples. DATED: 26 September 2000 PHILLIPS ORMONDE FITZPATRICK ATTORNEYS FOR: REGENERON. HARMACEUTICALS, INC