AU611676B2 - Hybrid serpins and dna coding for them - Google Patents

Description

-r-17 1 r:I-I i I I I -i

COMPLE

61176 Form COMMONWEALTH OF AUSTRALIA PATENTS ACT 1952-69 TE SPECIFICATION

(ORIGINAL)

Class Int. Class Ap plcatian NL, irJc: Llodgcd: Cqx-aptuk p ei~tln Lodgcd: Accepted: Pueblisncd: R64cd A~t: A ~IE9~O -6 HOECHST AKTIENGESELLSCHAFT N-into or, Appliccq: Addrco 0 ApI:2co AddrcS3 for Scr430 45 Bruningstrasse, D6230 Frankfurt/Main 80, Federal R2public of Germany HERMANN RAGG, GERALD PREIEISCH, FRIEDRICH HEIN, EUGEN UHLMANN and WERNER LINDENMAIER EDWD. WATERS SONS, 50 QUEEN STREET, 1M1ELJOURNE, AUSTRALIA, 3000.

Cormpcto Slpification for tho Invention entitled: HYBRID SERFINS AND DNA CODING FOR THEM SIhn following statement is a full description of this Invention, Including the best meitod of performing It known to I.-US As.oCati-cn Registered Patent Attorney To: THIE COMMISSIONER OF PATENTS.

Edtd. Watels Sons.

Mebourne.

la HYBRID SERPINS AND DNA CODING FOR THEM The European Patent Application with the publication No. (EP-A) 0,190,652 discloses a human serpin which has since been given the name "leuserpin-2" (hLS2).

This EP-A also reproduces the cDNA for hLS2 and points to the possibility of preparing modified genes or part-genes which produce correspondingly modified proteins in which individual amino acids have been replaced, omitted or inserted. For example, mention is made of a "building block principle" in which a part-gene I which codes for the amino acid sequence upstream of the active center is combined with a part-gene II which codes for the amino acid sequence downstream of the active center, with insertion between of a gene fragment which codes for an active center. However, ge.nonAC pfA the gene structure for the e4PNA was not known.

As a result of work done for the instant "specification, the genomic clone which codes for hLS2 has been found, and its gene structure has been determined.

This gene structure is utilized according to the invention s* .20 for the preparation of new hybrid serpins.

The serpins are a group of proteins which function as proteinase inhibitors in the coagulation of blood and the activation of complement and in various aspects of inflammatory reactions. The serpins belong to a protein family whose members have an amino acid homology with one another of about 20 to 35% Doolittle, Science 222 (1983) 417-419; H. Ragg, Nucl. Acids. Res. 14 (1986) 1073-1088). The specificity of these proteinase inhibitors is determined on the one hand by an amino acid in the P1 position of the reactive center Laskowski and I. Kato, Annu. Rev. Biochem. 49 91980) 593-629), as well as on the other hand by further amino acid sequences and structural S elements which apparently also have an effect /DI8K 158/C.C.

2 on the activity of the serpins. In addition to this, in some serpins such as, for example, in angiotensinogen the N-terminal region plays an independent functional and structural role Synder and R. Innis, Annu. Rev.

Biochem. 48 (1979) 755-782).

The primary and tertiary structures of the serpins resemble one another Loebermann et al., J. Mol. Biol. 177 (1984) 531-556; S.C. Bock et al. Biochemistry 25 (1986) 4292-4301) but, surprisingly, this is not based on a uniform gene structure, as is the case with many other protein families, for example with the globins. Of the serpin genes which have hitherto been described, only those for human al-antitrypsin and for rat angiotensinogen have 15 equivalent exon/intron structures Tanaka et al.,J.

Biol. Chem. 259 (1984) 8063-8065): in each case 5 exons are interrupted at corresponding positions by four introns.

The structure of the other serpin genes hitherto known differs, however, considerably from this pattern. The 20 human antithrombin III gene contains 6 exons Prochownik et al., J. Biol. Chem. 260 (1985) 9608-9612), but homology can be established between only one of the intron positions of aQ-antitrypsin or angiotensinogen. The gene for the human C1 inhibitor has at least 7 introns, but the location of these is as yet unknown Bock et al., loc. cit.).

It has now been found that the hLS2 gene structure corresponds to that of ai-antitrypsin and of (rat) angiotensinogen in respect of the rumber and location of the introns. This analogy is utilized according to the invention for the preparation of the hybrid serpins.

The invention is defined in its various aspects in the patent claims. Developments of the invention and preferred embodiments are explained hereinafter.

The invention is also represented in Figures 1 and 2 and in Table 1 (annex) (with, here and hereinafter, "Figure 2" also -to be understood -to mean its continuation in Figur 2a): Figure 1 shows the structure of the hLS2 gene diagrammaticaLLy. "Ex 1" -to "Ex 511 represent the exons. Th a r es t r ict ion cleavage sites are abbreviated as followcs: B BamHI 0 NcoI Bg BgLI1 SS Sstl E =EcoRi x Xbal H HindII In the case of EBgLII and Ncol, only the cteavage sites necessary for construction of the hybrid gene as shown in Figure 2 are drawn.

Figure 2 shows (not true to scale) the construction of a hybrid seripin gene having the exons 1 to 4 of hLS2, represented as black bars and designated "Ex I" to "Ex 480 as 0 in Figure 1, and having the 3'-terminaL exon of the human al-antitr>'psin gene, depicted as shaded bars and designated "Ex al-AT".

Where the customary names of the restriction enzymes have been abbreviated, the explanations relating to Figure 1 a pp Ly; the foLLowing; have been used additionalty: P P st I 6*.S S aLI Sm =smia X hl Xhol K FiLLing in with KLenow poLymerase Si Degradation with Si nucLease Ph =aLkaline phosphatase L L inV er A signif ies cleavage sites which have been made bLunt-ended by degradation or f illing-io of the protruding ends.

TabLe I shows the DNA sequences of the exons and of the i flanking regions of the hLS2 gene, with intron sequences being represented by snalL Letters. The signal peptidle and the signal AATAAA necessary for the formation of _I~1I;;L ii C 4 correct 3'-transcript ends are underlined. The exonlln= tron boundaries emerge from a comparison with the known hLS2 cDNA. The arrow indicates the 5' starting point of the Zongest hLS2 c3NA clone hitherto found.

The term "hybrid serpin" in connection with the present invention is intended to indicate that the protein being dealt with is composed of amino acid blocks which substantially correspond to exons of hLS2 and analogous serpins having the same gene structure, and exhibits proteinase-inhibitory activity. The expression "hybrid serpins" is also intended to exclude natural products which would theoretically be obtainable by combination of identical exons from different sources. "Substantially" is intended 15 to express the fact that the products obtained by genetic manipulation can be modified in a manner known per sk, in that, for example, amino acids can be added or omitted or replaced. Modifications of these types are possible, for example, by insertion of appropriate linkers or adapters.

It is also possible to use synthetic gene fragments in the preparation according to the invention of the recombinant gene. This procedure has the advantage that it is possible to incorporate additional cleavage sites for restriction enzymes, which allow additional modifications of the encoded amino acid sequence. It is also possible in this way, for example, to modify the active centers and, in general, to produce hybrid serpins having altered substrate specificity and/or activity.

In the recombination of the exons they are expediently used with inclusion of all the necessary sequences -ithin the introns which are necessary for splicing and other post-transcription procedures. For linking, it is possible, for example, for protruding DNA sequencesto be made blunt-ended by degradation or filling in, and thus for the exons to be connected as desired, where appropriate with insertion of synthetic oligonucleotide linkers which act as substrates for useful restriction enzymes.

i 5 Exon modules of this type can, according to the inventiom, be assembled in a ligase reaction in virtually any desired combination but in the correct relative orientation to one another and in the correct sequence. The hybrid genes obtained in this way can, if the promoter used is not intri sic to serpins, be connected to a suitable eukaryotic promoter and, where appropriate, to a polyadenylation signal and, after introduction into the appropriate eukaryotic cells, their expression can be brought about there.

It is possible to use, in a manner known per se, as host/ vector systems higher cells such as insect or nammalian cells. A large number of eukaryotic expression systems of these types are now known. It is also possible, where a 15 appropriate, to isolate the hybrid serpin mRNA which has formed and to employ it for the synthesis of cDNA which then after attachment of suitable transcription signals can be used for expression in bacteria or yeasts. If yeasts are used, it is possible to obtain glycosylated proteins typical of yeasts.

S Besides the possibility of producing hybrid serpins having altered substrate specificity or activity, the invention provides an approach to the preparation of bifunctional 25 proteins which, for example, contain the activities of angiotensin II and antitrypsin, and thus not only regulate the water balance but also have an inhibitory effect on the function of elastase.

3 The invention also relates to diagnostic aids which contain all or part of the genomic DNA of hLS2 to be used for the identification of genetic defects in the hLS2 gene or in diagnostic methods in which material containing human rNA or RNA is hybridized with corresponding gene probes.

The invention is explained in more detai' by the examples which follow. Unless otherwise indicated, percentages are =6 percntages by weight.

ExanipLe 1: ZIsoLation of hLS2 cosmids frm a huan pP~acenta gana bank The method of W. Lindenmaier et at. (in: 35th Nosbach CoLLoquium 1984, "The Impact of Gene Transfer Techniques in Eukaryotic Cel SioLogy",. Springer-VerL-39 BerLin, Heidetberg 1985) was used to construct a cosmid bank, with N0 the genomic human DNA fragments which had been partiaLt.y c~eaved with MspI being Linked to the vector pHC79-2coslTK which had been treated with CLal and alkaline phosphatese.

The cosmid bank contains about 300,000 independent clones.

6 1.8 X 10 packaged cosmids were mixed with 5 mL of TM 'I 15 buffer (50 mM Tris-HCL, pHl 7.5, '10 MM MgS0 4 and 5 n:L of an overnight culture of E. ccLi DH1 which had been grown at 37 C in NZ medium (10 g/l NZ amine, 5 g/l SOdium chLoride, 2 g/t MgCL2.6 H20, 4 mg/I thiamine) cootaining 0.4,'Z maltose, and were incubated at 37 0 C without shaking fo1'r 20 20 minutes. After addit4on of 40 ml of LB medium (10 g/L bacto tryptone (Difco), 5 9/L yeast extract (Difco), 10 g/I sodium chloride) containing 4 mg/I thiamine, the cuktu;-e ~.was shaken at 37 0 C for one hour.

5 ml samples of a bacterial culture of this type were distributed on autocLaved nitroceLLuLose membranes on the surface of an agar plate (23 x 23 cm; LB medium containing 1.4% agar and 50 jig/mL arnpiciLLin). The plates were incubated at 37 0 C until the colonies had a diameter of 0.5 mm. The preparation of iepLica filters, the Lysis and the fixation of the colonies forn the h'/bridization were carried out by known methods Handhan and M4. MeseLson, Methods in En.zymoLogy 100 (1983) 333-342, T. Maniatis et aL., Molecular Cloning, CoLd Spring Harbor, 1982). The filters were washed with prewashini solution (Maniatis et aL., Loc. cit., page 326) at 42 0 C .r one hour. The prehybridization (4 to 6 hours) and the hybridization (16 hours at 60 0 0) were carried out in the following solution: 01.9 M4 a C L 0.18 14 Tris-HCt, pH X Denhardt's solution 0.2% (WlV) SDS (sodium dodecyt suLfate) 200 ig/mL sheared and heated ,-aLf thymtic DNA 200 i ig/mL yeast RNA non-ionic detergent CNonide P-4C,; Sig?"_U.

The probes used for the hybridization were the fot~owin 16 restriction fragments of hLS2 cOMA (EP-A 6,190,652 V 1.07 kb Hindu!l fragment fron the p ,asrid pH14, which embraces the 51 haLf of the h6LS2 cDNA.

8) 0.5 kb Xmnl fragment from the ptasmid pLIG012. T hi s -fragment is Located in the 31 half of the hLS21 cDNA 0 C. 4(positions 1121 to 1619).

The said -fragments were cut out by treatment of the retevant pLasmids with the montioned restriction enzymez, on agarose gels and then eLectroetuted and nick-translated 10 8 cpm/gig; Maniatis et aL., Loc.

After -the hybridization, the membranes were washed, in each case for 30 minutes at room temperature, at 450C and at 600 C, with 0.1 x, SSC (I x SSC 0.15 M4 NaCL, mM sodium citrate, pH1 7.0) containing 0.1% SDS.

After drying, these membranes were used to expose X-ray films. Hybridizing coLonies were singled out by diLution and cultured on nitroceLLulose membranes, tysed and further hybridized as described. After a further singling out, there remained of the total of 750,000 analyzed colonies 3 independent hybridization-positive cLones. The clone p4R hybridized only with probe A but not with probe B.

Conversely, the clones p6R and p9R hybridized only with probe a but not with A.

Cosmid DNA 'from 'the clones p4R, p6R and p9R wai'oe by the aLkaLine Lysis method (Maniatis et tor The DNA preparations were cut with va'-ious restriatio endonucLeases, fractionated on 0.7% or 1% agarose qeLs and transferred onto nitroceLLuLose membranes Southern, J. MoLec. BioL. 98 (1975) 503-517). Exon-containing DN~A -fragments of the cosinids weo ident ified by hybr idization w,,ith various radiotabe(Led restrittio fragments Ofth hLS2 cDNA which are Listed beLow: Probe 1: H-indlllfBamlil 'fragment which contains, te reg ion between pos itions I and 310 of the hLS2! Ch ~W indRZI site is Located in the poLytinkor region of the vector t pUC13 in which the hLS2 ONA is ctonecD.

Probe 2: SamHl 'ragment which onbracos positions 311 to 834 of the hLS2 cDNA.

Probe 3: PvuIl 'frament containing the region beweon positions 984 and 1399.

Probe 4: Xmn! fragment which embraces the region between positions 1121 and 1619.

Probe 5: EcoRl -fragment which embraces the region between positions 1560 and 2081 (one of the EcoRi sites is Located in 'the poLyL inker region of the vector pUIC1D.

ALL the positions specified here for restriction enzyme cleavage siltes relate to the coding strand in the sONA.

Hybridization was carried out in each case at 42 0 C overnight in the abovementioned hybridizat ion buffer. The membranes were subsequently washed 2 x 15 minutes at room temperatulre in 2 x SSC containing 0. 1% SDS and then a x minutes at 42 0 C in 0.1 x SSC containing 0.1% SDS, and were dried and exposed on X-ray flms. To remove the probes, the membranes were each incubated in a boiling water bath for 2 minutes and then used again for rehybridizat ion.

For the identification of the firct e:4on (Ex I the o igonucteotide having the DNA squence 3' -CGCGGTGAAGAGTCTTTGTGTC TC-=51 Wvhich ios depicted here opposite t@ the cuotmary 513 ,direction) was synthesized by the phosphorarnidite methed Natteucci et aL., JD. Am. Chen. Soc. 103 (1981 3185-3191) and Purified on a poLyacryLamide/urea gel. The lh0 sequence of the oligonucLeotide was derived from a hman hLS2 cDNA sequence which was isolated tc'om a I qt1I1 cD[A 4 44 bank which had been obtained by the method of T. Huynh ot i aL., in: D.M. Gtover DNA CLoning, a Practical Approach, Vol. 1, XRL Press, Oxford UK, Washington, D.C.

1985, pages 49-78. Cosmid DNA of the clone pRwsanakyzd a decriedabove vsinq the Southern tcnqe The oLigonucLeoti(,'e having the abovementiened DUA sequence was radliotabeLLed using r,,1_ 2 P-ATP (NEN) and poLynucteotidle kinase (Maniatis et aL., loc. cit.).

The hybridization temperature was 42 C.

,,The membranes were washed with 6 x SSC at room temperature (2 x 15 minutes) and at 33 0 C Q2 x 30 minutes).

On 'the basis of the hybridization experiments, overlapping restriction fragm~ents of the cosrnids were subeLoned into *the iector pU:13 by standard methods. The exons and adjacent 4ritrop1 regi:)ns were sequenced by the chenical degradation method of A. Maxam and W. GiLbert, Methods in Enzyrnotogy 65 (1980) 499-560. Figure 1 shows diagrammatically the structure of the hLS2 gene derived from restri, tion cleavage and southern blotting as weLt as sequencing.

Examiole 2: SubcLonkng of exons including ftanking, intron sequences of the hLS2 gene and construct ion of an IiLS2-a 1 -antitrypsin hybrid gene.

The cons lruction of a hybrid 3crPin gene which can be 1.J lo0 expressed is described by way of exampte and witb the aid of TabLe 2 (and Figure Of course, in ptace ol the restriction fragments described, it is possibLe to use other suitabte DNA fragments and other combinations of OINA fragments,. In particuLar, it is possibLe to use in pae of the hfLS2specific promoter region other eukaryotic prormoter, for exampke thoe -from another serpin PgPe.

Ta$be 2 Restriction f ra gent contains 1% f+ *r *i 11 I1 1.8 kb NcOIIEoQR Exon I of the htS2 gene inc Iuding promoter reg i on ochficatlon of the ends Fikting in with 'Kdenow fragment of DNA potynerase I fron E. coki; SubckoninU into the vector pUC13 which has been cleaved with SalX and trpiued with S1 nucleose I-. ~5---VPI-~115L=T; riil~4~e I_ 1.3 kb Xbadl lliwcAltx *o Exon 2 of tho hLS2 gene codbc for the signak peptide inter akia) Hikking in with KLenow fragment, subc oning into the vector DUC13 which has been treated with 8amHI and with F1 nuct eseJ 4s 0.65 kb SstISst. Exon 3 of the CLeavage with Si nuehLS gene Lease, subotoning into the vector pUC13 which has been cleaved with Sat! ind treated with SI nuctease 1.O kb BgLII/afL Exon 4 of the hLS2 gene FiLLing in with Kienow fragmento subctoning into the vector PUtC13 which has been treated with Smal and aLkatin ohosh ;a t as e e- ALL exon-conta ining restriction fragmertG atso i~t', any DNA sequences at the exon/intron boundaries nece~zary 'for correct spLicing (El. Ruskin et aL., ceL 38 C 1984,D 317-331; E. KeLLer et at., Proc. lNati. Acad., Sci., USA 81 51 C1984) 7417'-7420; 8. Wieringa et at., CeLL 37 C1984D 915-92 7he isatation of the DNA fragmen~ts cn agaro,$p Ucr La, the treatment of the fragment ends and the subcLoning lrt the M8 vector pUC13 are carried out by Gtandard methods; (Manldtis ot at., toc. cit.J. The orientation of the vtnsertc -us At, et ab L ish ed b y r e nat ict io n c t a Ya Ie a nd t he p L a- i!s A having the correct insert ion oritentatien are used for tho I construction of tthe hyt-rid scerpin gene.

t AA Lnking of exons to 4 of the V.SZ gene in th~e cco -Pect sequence, and correc t or ientat ion of the xc nO with voopect to one anohep, io Miewlse capied out by known m~ethods.

At Exampte 3- SubctoniT a cf the 'rinLexon of the human aT antitrypstn geno A 1.7 kb-tong XheMidZ fragment hay{nq the 31tec-rinak 06* exon of the gene is isoLated from a jenomic Qtonc, -on- A taining the human cti-antitrypsin gene G. Long fet atW Biochemistry 23 (19$410 4828-4837; M. Leicht ot at., Nature 297 (1982) 655-659,*. This exon codes forinter atia, the 3 0 reactive center of thp protein CG. Long et at., Loc. cit.; R. CarreLL et at., Nature a98 C1982) 329-334). Aftqr repair of the ends and attachment of EcoRl tinkers StCCGAATTCGG 31 'the fragmient is tioated into the vector pUC13 which has been treo ted w ith EcokRI and a Lka L ine Phosphatase The human a&l-antitrypsin jene codes 'for the, amino- acids -12 niethion ine and ser ine in the reactive center of the, prtt~e ir.

In a naturalLy occurring al-antitrypsin. variant the inethionyL radlicaL has been replaced by~ an arginyi radica'.

This exchange confers antithrombotic properties on th n mutated protein (M Owen e t New Engl and J. Med, 309 C1983) 694-698). Mutation,- f this type can be introdur,, byf known methods,. for exampLe ir ;itro nutagenesis N.

KZramer et aL., NucLeic Acids Res, '12 p1984. 9.44 1-9436 Exons modif iod in this way can, of owrse, i sc b r F T tor 'the cons truc t i LcrcJril v t n b rid !"rin 44 t4 cthc ertv 99 L 4 94 C Is J U. ~L.

CTGGGrrAG~~GTAC~AATAGCAi-CCTCGCrGGACAGGMGCC= W-AACTG-CGGG G*rc (CT-A~-CAGA (GAGCAAGGGATaC* .ACTCCAG AG~C~-CA~rGCAA a CG~rrATA~iA~TAAAAA~AG T GA a a S 54 a ~GTAT~raGCa [aGGA GrAGGAGGACGTGAT CAGGGAGTGAGGTGCTGTGAGCATGAAAGAGACCAGrGAGGTAGAGATGGACVI'GTGCCTCAAATAGCAGCCGT CCGG C* AAC* =TG(GGA~CaG a r(CC T-rSaC ,.Ti~aGTArA-GTA*GTAAA T~CAGCAGT7GACCCAGCA-fGGGAGGCAGCACCAGGCACAITCATCAAGTCACAITGAGtGiGGCGACAAGGCCC L4 CTGcrrrAMATT~ACAATrACIrrGGAAATAGTGGCAAGCCATCACCAc(G~CAGAGCMvrGAGATGAACMGrGtCrG AGAcrGAG~jrGCATACTGGACCAGCCCTCGAA"A ;~tag~gttGctatgttcAgcCgaAAt(tGtatCAatttggAACAAacga'aACAcaaActg ttattcagca aattaag (nr a-,Slkb aggccttatttcgtt Me ay all SrLuAnla Le e l h e l l h e l r l AArTTCccCrYCTCCACCAc ATGAACA TGA AGACAGG C C4XCC TATACrG AGC AGCACA TC Cr GGAGG al ae Ly al ar Leu As al ae l y l .,yGuTrAaGl e l s r l r l CGGG GAMGGCAGGrTGA cATCAG CA GGGAGAGArGGAGGGWACGATAGTCT IGA GACCC CA TGGGAGGTGh TcA AATGTAGC AAAA CG G ATGGGA~rGMCAA GC C ~GA T CAC AAGvrGAGGGGG ACCGTCACC AACGTGGC cTTGTCA GG GGG GAGTGAG ACGGAC ATAT CAGAACG AGCAAGATAcTC AAAATCCGAC GAT GAC fTGCrCGC U 9 V 9 4. 4 4 S .4 4. 4 9 S* 4 4 a a a S S S V S 4 Sf 44 4. 4 S..

*5* Ile Val Asp Ser Leu Ser Val Ser Pro Thr As p Ser Asp Val Ser Ala Giy Msn Ile Leu Gin Leu Phe His GI~ ATC GTC GAG AGT Cr6 TCA, G1T TCC CCG ACA GAc-TCT Gar GITG AGT GCT (k~i AAC AIC crc CAG CMTMICAT G Lys Set Arg Ile Gin Arg Leu Asn Ile Lcu Msn Ala Lys MAG AGC CGG ATC CAG CGT CiT AAG ATC CrC MAC GCC MAG P-he Ala Phe Msn Leu TrC GCT TIC MAC CrC 140 Ile Ser Thr Ala Met AT TCT ACT GCG ATG Tyr Arg Val Leu Lys Asp Gin TAC CGA GTG, Cr6 AMA GAC CAG Gly Met Ile Ser Leu Gly Leu GGT ATG AT TCC TITA GGT crr6 Val Msn Thr Phe Asp Msn Ile Phe GC MAC ACrTTC GAT MAC ATC TC Ile Ala ATA GCA 160 HIs Ser CAC TCG Pro Val Gly CCC GIT 660 Lys Gly Giu MAG GGA GAG Ile Thr Thr ATC ACG ACC Thr is ACC CAT 180 Ile His NIT- CAT Giu Gin Val GAA CAA GTG Ile Leu is Phe Lys Asp Phe Val Asn Ala Ser Afl TTG CAT TIT MAA GAC TGTIT M AT 6CC AGC Ser Lys Tyr Glu AGC MAG TAT GMA 200 Tyr Thr Leu Arg TAC ACA Cr6 CGG Asn Leti Phe Arg Lys Leu Thr 'Ms Arg Leu Phe Arg Arg Asn AAT CrC TrC CGT MAG Cr6 ACT CAT CGC CrC 'TOC AGG AGG MAT Phe Gly lTfT 666 220 Ser Val Asn Asp Leu Tyr Ile Gin Lys Gin TCA GTC MAT GAC CIT TAT ATC GAG MG GAG Phe Ala Giu Ala Gin Ile Ala Asp Phe Set M~ 6Cr GAG GCC CAG ATA GOT GACG TTC TCA Phe Pro ile Leu Leu Asp Phe Lys Thr Lys Vai Arg Giu Tyr Tyr lT CON ATO Cr6 CIT GAO TC AMA ACT AMA GTA AGA GAG TAT TAC 240 Asp Pro Ala Phe Ile Ser Lys Thr Msn Asn Ills Ile Met-Lys Leu GAC OCT GCC 1TC ATA TCA AMA ACC MOC MO GAO ATO ATG MG CrC Thr Lys Gly Leu Ile~ Lys Asp Ala Leu Giu Asn Ile Asp Pro Ala Thr Gin Met Met Ile Leu Asn Cys Ile Tyr' ACC MAG GGC CrC ATA AMA GAT GCT CTG GAG MAT ATA GAC CCr GCr ACC GAG ATG ATG Tr CTC MAC TGO ATO 1AO 278 Phe Lys G TC AMA G gtaagaggcacctttacagtttc-(lntron Bn,.3 .7 kb)-accttctcataacagcctcttcctgtggcctttacag 278 300 ly Ser Trp Vat Asn Lys Phe Pro Val rGlu Wet Thr His Msn His Msn Phe Arg Leu Msn Giu Arg Giu Val CTA TCC 166 GTG MT MAA TIIC CCA GTG GMA ATG ACA GCAC CGAC MAC 'ITC CGG CrG MAT GAG AGA GAG GrA G~l? 320 Lys Vat Set Met Met Gin Thr Lys Gly Msn Phe Leu Ala Ala Asn Asp Gin Glu Leu Asp Cys Asp Ile Leu Gin MAG Gr T CC ATG ATG GAG ACC MAG CG MC TrC CrC GGA GGA MAT GAC GAG GAG CTG GAC TGO GAO ATO CrC GAG 340 Leu Glu Tyr Val Gly Gly Ile Set Met Leu Ile Val Val Pro ils Lys Met Set Gly Met Lys Thr Leu Glu Ala CTG GMA TAG GTG GGG GGC ATC AGC ATG CIA NIT- GIG GrC CON GAC MAG ATG ICT 666 ATG MAG ACC CTC GMA GCG 36 369 S S Gln -e Th Pr Arg Va Va Gl Ar Tr n Ly 4 e TrA 369 380 g Thr Arg Glu Val Leu Leu Pro Lys Phe Lys Leu Glu Lys Asn Tyr Asn Leu Val Glu Ser Leu Lys Leu Wet A ACT CGA GAA GTrG CIT CIG CCG AAA TIC MAG CIG GAG-AMG MAC TAG MAT CTA GTG GAG TCC CIG MAG TI2G ATG 400 417 Gly Ile Arg Met Leu Phe Asp Lys Asn Gly Asn Met Ala Gly Ile Set Asp Gin Arg Ile Ala Ile Asp Leu GGG ATC AGG ATG GIG 1T GAG AAA MAT GGG MAC ATG GCA GGG ATC TCA GAG CAA AGG ATC GCC ATG GAG GIG gta r accactcccttgtccacccccg (Intron D3"-'0.7 kb) ctgacctccagaatctgacaactttcctttccaaacag 418 440 Phe Lys His Gin Gly Thr Ile Thr Val Asn Glu Glu Gly Thr Gin Ala Thr Thr Val Thr Thr Val Gly Phe Met TIC MAG CAC CAA GGC AGG ATC ACA GTG APO GAG GM GG AGG CAA GCG AGC ACT GTG AGG ACG GTG GGG TC ATG 460 Pro Leu Ser Thr Gin Val Arg Phe Thr Val Asp Arg Pro Phe Leu Phe Leu lI'e Tyr Glu His Arg Thr Set Cys CCG GIG TGC ACC CAA GTG GG TIC ACT (-TC GAG CGG CCC T17 C1r TIC GIC ATC TAC GAG CAT CGC AGC AGG TGC 480 Lea Leu Phe Met Gly Arg Val Ala Asn Pro Set Arg Set xxx C"G GIG TrG ATG GGI\ AGA GTG GCG AMC CCC AGG AGG TCC TAG AGGTGGAGGTCTAGGTGTGGAAGTGCMGGGGGCACCCICAT MI rrCATCCAACMCGAGAACAGAGATGITTGGGCATCAMrACGTGCTrACGCTACCTIGAATCGAGGCCATATGAGAGGAGrIAGA- AACGACCAAGAAGAGAGGCTGTGG -MTCAAiTGGCAGMATAGCCCATGTGTAAGTCATAGMAGTCAGGTAGIGIAGTGIGGIGCIG1TACCr AGAGGGCrCACGCrCCCAGCrTCACAGCAACGIGAGCAGGGCGTCGIMAGCACCTCCCGGCTCGGTGACCCCATCC1TGcAcACGIGACI~rGTWAC

TCAAGCCCCACCAGGCCCCTCATCTGMTACCMGCACAGMATGAGTGGTGGAGIMTCCTACCTCCCCAAGGAGGGTACACACAGC.

rcATrCITGA;TGTCCAGqGGAAGAAGCCAC CTCGACATATGAGGGGTGCIGGGAATGTAGGGCTAATICTCAMGCCTGACCrICAATC

GATGATGAATGGCATC~AGTCCCTCCGTGTIGCCTCCCTGTGACGIGGAGGACAGTGTGTGCCATGWI-CCCATAIAGAGATAAATAAATGTAGCCAC

A1TACITGTFATGTATMV'r,CA1ITIGGCAAATATCAAAAGCCAAATCCAANLTr

Claims (8)

1. 2. A hybrid serpin as claimed in calim 1, which contains amino acid part-sequences which correspond to exons of hLS2, c, -anti irypsin or angiotensinogen.
2. 3. A process for the pa ration of hybrid serpins, which comprises recombination, from exons from at least two genes which have the exon/intron structure of hLi32 and cco: ffo r a serpin, if a gene which has a gene structure corresponding to hLS2, and expression of this recombinant gene in a host cell.
3. 4. The process as claimed in claim 3, wherein the host cell is a higher eukaryotic cell. S. A recombinant gene having a gene structure corresponding to hLS2, containing exons of serpin genes having a gene structure corcesponding to hLS2.
4. 5. A gene as claimed in claim 4, in which the exonG are flanked by Gplice signals and branch points of the relevant introns.
5. 7. A genomic DNA fragment containing an COon @f hLS2e q. Genomic DNA encoding hLS2. 9 ~9 9, U U U, U U 4U U. 9 9, US U. .9 U 9 9 9 U 9 U U 99 9 99 99 99 9 9 9 99 4 9 9 Ut, 9 .9 9949 Uti 9 9 2/DZSX 158,4PC.C. insertion of synthetic oLigonucleotide Linkers which act as substrates for useful restriction enzymes. '0. A 1 17
6. 9. A host cell transfected with DNA of claims 5 to 7. A medicament containing a hybrid in either of claims 1 or 2. as claimed in any serpin as claimed
7. 11. A diagnostic aid which contains all or part of the genomic DNA as claimed in either of claims 7 or 8.
8. 12. A method of diagnosing human genetic defects which comprises the hybridization of human DNA with DNA as claimed in either of claims 7 or 8, or with corresponding RNA. DATED this 22nd day of February, 1991. HOECHST AKTIENGESELLSCHAFT 'I fjE* S I II qo 00' t i I- qo qo eq. -e I 0' I I.e I I WATERMARK PATENT TRADE MARK ATTORNEYS 'THE ATRIUM', 2nd Floor 290 Burwood Road IHAWTHORN VIC. 3122. I CI 'C a t I it V a '-22 .s e e c 1 y 1 ^4 V.