AU5938899A - LAG-3 protein soluble polypeptide fractions, method of production, therapeutic composition and anti-idiotype antibody - Google Patents

Description

_ii__llY1~

AUSTRALIA

PATENTS ACT 1990

ORIGINAL

COMPLETE SPECIFICATION Name of Applicant: at f *f ft ft ft 1 ft fta ft f Address of Applicant: Actual Inventor(s): Address for Service: Applied Research Systems ARS Holding N.V.

AND Institut Gustave Roussy AND Institut National De La Sante Et De La Recherche Medicale (INSERM) 6 John R. Gorsiraweg, PO Box 3889, Curacao, Netherlands Antilles Florence Faure; Thierry Hercend; Bertrand Huard; Frederic Triebel.

DAVIES COLLISON CAVE, Patent Attorneys, 1 Little Collins Street, Melbourne, 3000.

ft ft ft Complete Specification for the invention entitled: "LAG-3 protein soluble polypeptide fractions, method of production, therapeutic composition and anti-idiotype antibody" The following statement is a full description of this invention, including the best method of performing it known to us: -1- 1A- The invention relates to soluble forms derived from the LAG-3 membrane protein which are useful as immunosuppressants, as well as antibodies capable of preventing the specific binding of the LAG-3 protein to MHC (major histocompatibility complex) Class II molecules as immunostimulants.

In WO-A 91/10682, a protein designated LAG-3 has been described.

The LAG-3 protein is a protein selectively expressed by NK cells and activated T lymphocytes.

Similarity of the amino acid sequence, the comparative exon/intron organization and the chromosomal localization show that LAG-3 is related to CD4. The initial characterization of the LAG-3 gene has been described by TRIEBEL et al. The corresponding DNA codes for a type I transmembrane protein of 498 amino acids containing 4 extracellular sequences of the immunoglobulin type. LAG-3 is a member of the immunoglobulin superfamily.

The mature protein comprises 476 amino acids (SEQ ID No. 1) with a theoretical molecular weight of :52 kD. The extracellular region contains 8 cysteine residues and 4 potential N-glycosylation sites. By Western blot analysis, it was shown that LAG-3 inside PHA-blasts or activated NK cells has an apparent mass Mr of 70,000. After treatment with N-glycosidase F, a reduction in size to 60 kD was obtained, thereby demonstrating that native LAG-3 is glycosylated. Fuller details are described in WO-A 91/10682.

BAIXERAS et al., in J. Exp. Med. 176, 327-337 have, in addition, described their finding that rosette formation between cells transfected with LAG-3 (expressing LAG-3 at their surface) and B lymphocytes expressing MHC Class II was specifically dependent on LAG-3/MHC Class II interaction.

Surprisingly, this ligand for MHC Class II was detected with higher levels on activated CD8* lymphocytes (MHC Class I-restricted) than on activated CD4* lymphocytes. In vivo, only a few disseminated LAG-3* cells (MHC 2 Class II-restricted) were to be found in non-hyperplastic lymphoid tissue comprising the primary lymphoid organs, that is to say thymus and bone marrow. LAG-3* cells were to be found in hyperplastic lymphoid nodules and tonsils, as well as among peripheral blood mononuclear cells (PBMC) of patients receiving injections of high doses of IL-2.

These observations confirm that LAG-3 is an activation antigen in contrast to CD4 expressed in a subpopulation of resting lymphocytes and other cell .types, in particular macrophages.

S. The MHC comprises Class I and Class II molecules which are membrane glycoproteins which present fragments of protein antigens to the T lymphocyte receptors (TCR).

Class I molecules are responsible for the presentation to CD8* cytotoxic cells of peptides derived in large part from endogenously synthesized proteins, while Class II molecules present to CD4* helper lymphocytes peptides originating in the first place from foreign proteins which have entered the endocytic, that is to say exogenous, pathway. T helper lymphocytes regulate and amplify the immune response, while cytotoxic lymphocytes are needed to destroy cells irrespective of the tissues expressing "non-self" antigens, for example viral antigens. The mechanism of recognition involves intracellular signals leading to an effective activity of T lymphocytes.

It is apparent that, to initiate an immune response mediated by T (CD4*) lymphocytes, the foreign antigens must be captured and internalized in the form of peptides by specialized cells, the antigen presenting cells (APC). The resulting antigenic peptides are reexpressed at the surface of the antigen presenting cells, where they are combined with MHC Class II molecules. This MHC Class II/peptide complex is specifically recognized by the T lymphocyte receptor, resulting in an activation of the T helper lymphocytes.

Moreover, animal models created by recombination techniques have made it possible to emphasize the part ~II __I__I~~LIPl~n~ 3 played in vivo by MHC Class II molecules and their ligands.

Thus, mice deficient in MHC Class II molecules and possessing almost no peripheral CD4* T lymphocytes and having only a few immature CD4* lymphocytes in the thymus have proved to be completely incapable of responding to T-dependent antigens.

CD4"/' mutant mice have a substantially decreased T lymphocyte activity but show normal development and function of the CD8* T lymphocytes, demonstrating that the expression of CD4 on the daughter cells and CD4* CD8* thymocytes is not obligatory for the development. Compared to normal mice, these CD4-deficient mice have a large amount of CD4" CD8" cells.

These doubly negative cells are restricted to MHC Class II and capable of recognizing the antigen.

When they are infected with Leishmania, these mice show a population of functional T helper lymphocytes despite the absence of CD4. These cells are restrictive *to MHC Class II and produce interferon-y when they are activated by the antigen. This indicates that the lineage of the T lymphocytes and their peripheral function need not necessarily depend on the function of CD4.

It is now recognized that the proteins encoded by MHC Class II region are involved in many aspects of immune recognition, including the interaction between different lymphoid cells such as lymphocytes and antigen presenting cells. Different observations have also shown that other mechanisms which do not take place via CD4 participate in the effector function of T helper lymphocytes.

These different observations underline the pivotal role played by MHC Class II and its ligands in the immune system.

Moreover, the importance is known of chimeric molecules composed of the extracytoplasmic domain of proteins capable of binding to ligands and a constant region of human immunoglobulin (Ig) chains for obtaining soluble forms of proteins and of cell receptors which are 4 useful, in particular, as therapeutic agents.

Thus, soluble forms of CD4 have proven their efficacy in inhibiting an HIV infection in vitro in a dose-dependent manner.

Nevertheless, clinical trials with soluble CD4 molecules, in particular of CD4-Ig, have not enabled a significant decrease in viral titres to be demonstrated.

Transgenic mice expressing up to 20 yg/ml of soluble CD4 in their serum were created. These mice showed no difference as regards their immune function relative to control mice. Hitherto, no direct binding tr MHC Class II *of molecules derived from CD4 has been reported. This strongly suggests that soluble CD4 molecules do not interact in vivo with MHC Class II molecules.

15 Surprisingly, the authors of the present invention have shown that soluble molecules containing different fragments of the extracytoplasmic domain of the LAG-3 protein were capable of binding to MHC Class II molecules and of having an immunosuppressant action.

20 The extracytoplasmic region of LAG-3 represented by the sequence SEQ ID No. 1 comprises the domains Dl, D2, D3 and D4 extending from amino acids 1 to 149, 150 to 239, 240 to 330 and 331 to 412, respectively.

Thus, the subject of the invention is a soluble polypeptide fraction consisting of all or part of at least one of the 4 immunoglobulin type extracellular domains of the LAG-3 protein (amino acid 1 to 149, 150 to 239, 240 to 330 and 331 to 412 of the sequence SEQ ID No. or of a peptide sequence derived from these domains by replacement, addition and/or deletion of one or more amino acids, and which possesses a specificity at least equal to or greater than that of LAG-3 for its ligand.

The present invention encompasses, in particular, soluble polypeptide fractions having a sequence derived from the native LAG-3 sequence originating from the wellknown phenomenon of polytypy.

The soluble polypeptide fraction is characterized in that it comprises the peptide region of LAG-3 5 responsible for the affinity of LAG-3 for MHC Class II -molecules.

The soluble polypeptide fraction comprises, in particular, a peptide sequence derived from these domains by replacement, addition and/or deletion of one or more amino acids, and which possesses a specificity equal to or greater than that of LAG-3 for its ligand, for example the whole of the first two immunoglobulin type domains of LAG-3, or the 4 immunoglobulin type domains of the extracytoplasmic domain of LAG-3.

Advantageously, the soluble polypeptide fraction is comprised of all or part of at least one of the four immunoglobulin type extracellular domains of the LAG-3 protein (amino acid 1 to 149, 150 to 239, 240 to 330 and 331 to 412 of sequence SEQ ID NO:l) comprising one or more of the arginine (Arg) residues at the positions 73, 75 and 76 of sequence SEQ ID NO:1 substituted with glutamic acid (Glu).

Preferably, the soluble polypeptide fraction comprises a loop in which the average position of the atoms forming the basic linkage arrangement is given by the position of amino acids 46 to 77 (SEQ ID No. 1) appearing in Table 1 or Table 2 or differs therefrom by not more than The soluble polypeptide fraction advantageously comprises, in addition, the second immunoglobulin type extracellular domain (D2) of LAG-3 (amino acids 150 to 241).

Advantageously, the soluble polypeptide fraction comprises, besides the peptide sequence of LAG-3 as defined above, a supplementary peptide sequence at its C-terminal and/or N-terminal end, so as to constitute a fusion protein. The term "fusion protein" means a portion of any protein permitting modification of the physicochemical features of the subfragments of the extracytoplasmic domain of the LAG-3 protein. Examples of such fusion proteins contain fragments of the extracytoplasmic 1^1__111_ 6 domain of LAG-3 as are defined above, bound to the heavy chain -CH2-CH3 junction region of a human immunoglobulin, preferably an isotype IgG4 immunoglobulin.

Such fusion proteins may be dimeric or monomeric.

These fusion proteins may be obtained by recombination techniques well known to a person skilled in the art, for example a technique such as that described by Traunecker et al. Generally speaking, the method of production of these fusion proteins comprising an immunoglobulin region fused with a peptide sequence of LAG-3 as defined above consists in inserting into a vector the fragments of cDNA coding for the polypeptide regions corresponding to LAG-3 or derived from LAG-3, where appropriate after amplification by PCR, and the cDNA coding for the relevant region of the immunoglobulin, this cDNA being fused with cDNA coding for the corresponding polypeptide regions or derivatives of LAG-3, and in expressing after transfection the fragments cDNA in an expression system, in particular mammalian cells, for example hamster ovary cells.

The fusion proteins according to the invention may also be obtained by cleavage of a LAG-3/Ig conjugate constructed so as to contain a suitable cleavage site.

The subject of the invention is also a therapeutic composition having immunosuppressant activity comprising a soluble polypeptide fraction according to the invention. This composition will be useful for treating pathologies requiring immunosuppression, for example autoimmune diseases.

The subject of the invention is also the use of antibodies directed against LAG-3 or soluble polypeptide fractions derived from LAG-3 as are defined above, or fragments of such antibodies, in particular the Fab, Fab' and fragments, for the preparation of a therapeutic composition having immunostimulatory activity.

"Immunostimulatory" means a molecular entity capable of stimulating the maturation, differentiation, proliferation and/or function of cells expressing LAG-3, that is 7 to say T lymphocytes or active NK cells. The anti-LAG-3 antibodies may be used as potentiators of vaccines or immunostimulants in immunosuppressed patients, such as patients infected with HIV or treated with immunosuppressant substances, or be used to stimulate the immune system by elimination of self cells displaying abnormal behaviour, for example cancer cells.

Immunostimulatory activity of anti-LAG-3 antibodies is surprising, inasmuch as anti-CD4 antibodies have an immunosuppressant action.

Such antibodies may be polyclonal or monoclonal; however, monoclonal antibodies are preferred. The polyclonal antibodies may be prepared according to well-known methods, such as that described by BENEDICT A.A. et al.

Monoclonal antibodies are preferred, on account of the fact that they are specific for a single epitope and yield results with better reproducibility. Methods of production of monoclonal antibodies are well known from the prior art, especially the one described by KOHLER and MILSTEIN. This method, together with variants thereof, are described by YELTON et al. The subject of the invention is also anti-idiotype antibodies directed against the antibodies according to the invention, which contain the internal image of LAG-3 and are consequently capable of binding to MHC Class II. Such antibodies may be used, in particular, as immunosuppressants, and, for example, in autoimmune pathologies.

The therapeutic compositions according to the present invention comprise soluble LAG-3 proteins or antibodies as are defined above, as well as a pharmaceutically acceptable vehicle. These compositions may be formulated according to the usual techniques. The vehicle can vary in form in accordance with the chosen administration route: oral, parenteral, sublingual, rectal or nasal.

For the compositions for parenteral administration, the vehicle will generally comprise sterile water as well as other possible ingredients promoting the Sll*-~ 8 solubility of the composition or its ability to be stored. The parenteral administration routes can consist of intravenous, intramuscular or subcutaneous injections.

The therapeutic composition can be of the sustained-release type, in particular for long-term treatments, for example in autoimmune diseases. The dose to be administered depends on the subject to be treated, in particular on the capacity of his/her immune system to achieve the desired degree of protection. The precise amounts of active ingredient to be administered may be readily determined by the practitioner who will initiate the treatment.

The therapeutic compositions according to the invention can comprise, in addition to soluble LAG-3 or the antibodies according to the invention, another active ingredient, where appropriate bound via a chemical bond to LAG-3 or to an antibody according to the invention. As an example, there may be mentioned soluble LAG-3 proteins according to the invention fused to a toxin, for example ricin or diphtheria toxoid, capable of binding to MHC Class II molecules and of killing the target cells, for example leukaemic or melanoma cells, or fused to a radioisotope.

The examples which follow, together with the attached reference figures, will illustrate the invention in greater detail.

EXAMPLE 1 Proliferation of active T lymphocyte lines in the presence of anti-LAG-3 monoclonal antibodies The anti-LAG-3 monoclonal antibodies used were 17B4, described in BAIXERAS et al. and deposited at the CNCM under No. 1-1240 on 10th July 1992, and 11E3, described in HUARD et al. These antibodies belong to the isotype IgG1.

These antibodies were tested for their biological effects on activated T lymphocytes, stimulated by specific antigenic peptides or processed antigens presented by MHC Class II molecules expressed by autologous antigen presenting cells, expressing LAG-3.

9 An anti-CD48 monoclonal antibody designated 10 H3 was used as irrelevant IgG1 antibody (negative control).

The saturating concentrations of anti-LAG-3 and anti-CD48 antibodies were determined by immunofluorescence on PHA (phytohaemagglutinin)-blasts and cell lines transformed by Epstein-Barr virus (EBV). In the proliferation tests, the monoclonal antibodies were added in the proportion of 5 times the saturating concentration.

The T lymphocyte lines used were, on the one hand the clone 154 derived from peripheral blood lymphocytes, raised against a peptide mimicking an influenza haemagglutinin (HA) fragment having an amino acid sequence extending from amino acid 306 to 329 (p20 peptide), and on the other hand the clone 28, a T lymphocyte clone derived from peripheral lymphocytes of a single human donor, raised against diphtheria toxoid The antigen presenting cells (APC) corresponding to clone 154 were EBV-transformed B lymphocytes of the same donor (DR3/DR11) as T 154. The antigen presenting cells corresponding to clone 28 were EBV-transformed B lymphocytes of 0009 the same donor. This clone was restricted to HLA DR7.

For clone 154, the APC (5 x 106) were incubated at 37 0 C for one and a half hours with variable doses of the p20 peptide, then washed and irradiated (10,000 rad).

The cells were plated out on 96-well microtitration plates at the same time as the clone 154 cells (0.5 x 105 to 10 x 105 cells/ml) in a 3:1 ratio. For clone 28, the responding cells/stimulating cells ratio was 1.

The HLA DR7/EBV APC cells were either treated with mitomycin or irradiated, then added to the T lymphocytes in the presence of DT (which remained in the culture). The final concentration of clone 28 cells was 100,000 cells/ml.

['H]Thymidine (1 Ci/well) was added at varying time intervals from day 2 to day 10 of culture.

Each experiment was carried out in triplicate.

The results were expressed as the mean cpm and after subtraction of the cpm found in the negative control (T lymphocytes cocultured with APC unladen with 10 immunogens). The proliferation tests were carried out on 96-well plates. The absorption of tritiated thymidine in the individual 200 sl wells was measured after adding 1 ACi of thymidine for the last 18 hours of culture. The results were expressed in the form of the mean of 3 tests. The standard deviation was usually less than 12% (a little more in the case of very low cpm measurements).

Moreover, mixed culture (clone 154/APC) supernatants were combined, filtered through 0.22 Am membranes, divided into samples and frozen at -20 0 C until the time of titration using commercial immunoassay kits: Immunotech IL-2 and INF-a titration kit, Genzyme IFN-y kit and Cayman Chemicals IL-4 kit.

A dose determination study was carried out to establish the proliferation profiles of clone 154 brought into contact with the p20 specific antigen at varying concentrations and in the presence or absence of anti- LAG-3 monoclonal antibodies or irrelevant monoclonal antibodies (negative control).

The individual results of 16 separate tests showed that, irrespective of the concentration of added antigen, the initial point up to the peak of proliferation was not modified, but a significant prolongation of the proliferation of T lymphocytes incubated with the anti-LAG-3 monoclonal antibodies was observed systematically. Fab fragments of the monoclonal antibody 17B4 were prepared and used in a test of proliferation of clone 154. The proliferation profile of T lymphocytes activated by the antigen with the 17B4 Fab fragments (15 fg/ml) was similar to that of cells incubated in the presence of whole 17B4 monoclonal antibody (40 gg/ml) (Figure 1).

These results show that the observed biological effects are not attributable to a non-specific reaction induced by the Fc region of the anti-LAG-3 monoclonal antibodies.

Similar results were obtained with the 11E3 anti- LAG-3 monoclonal antibodies.

Clone 28 was also stimulated with the antigen (tetanus toxoid 10 xg/ml) in the presence of 17B4 monoclonal antibodies after coculture with the 11 corresponding APC in the presence of DT. The results are shown in Figure 2.

The effects of the anti-LAG-3 monoclonal antibodies observed with clone 28, namely the prolongation of proliferation, are similar to those observed with clone 154.

Tests were carried out designed to measure the miscellaneous cellular events occurring after the antigenic stimulation of clone 154 cells incubated in the presence of anti-LAG-3 monoclonal antibodies.

The cells were harvested during conventional antigenic stimulation of clone 154 in the presence of *anti-LAG-3 or anti-CD48 monoclonal antibodies or in the absence of antibodies, and tested for the expression of LAG-3 and CD25 transmembrane receptors, and samples of culture supernatants were collected at different time intervals after stimulation and tested for the presence of IFN-y, TNF-a, IL-4 and IL-2.

"Two-colour direct immunofluorescence tests (anti- CD3 monoclonal antibodies and anti-CD25 monoclonal antibodies) showed that IL-2 receptors were weakly but significantly increased 5 days after the antigenic stimulation. Similar tests with anti-CD3 and 11E3 (anti- LAG-3) monoclonal antibodies showed that LAG-3 was over- "9'0'9 expressed from the day following activation onwards. In addition, the secretion of IL-2, IL-4, IFN-y and TNF-a was also modulated by incubation with anti-LAG-3 monoclonal antibodies, thus showing that different cellular events are modified by the presence of anti-LAG-3 monoclonal antibodies and that some events already take place 24 hours after stimulation.

These results show indirectly that LAG-3 plays a regulatory role for CD4 cells. The fact that anti-LAG-3 monoclonal antibodies increase proliferation, and hence act as immunopotentiators, suggest that LAG-3 is involved in the "deactivation" of CD4 T lymphocytes with a negative role of LAG-3 on the antigen-dependent stimulation.

_iijiii_ 12 EXAMPLE 2 Transient expression of LAG-3 fusion proteins Soluble proteins derived from LAG-3 were obtained by a recombinant DNA technique using suitable vectors comprising DNA coding for LAG-3 and DNA coding for an immunoglobulin fragment. The transient expression system consisted of transfected Cos cells. This system makes it possible to produce several mg of recombinant fusion proteins. Recombinant DNA techniques were carried out as described by MANIATIS et al. The modifications were made as recommended by the manufacturer.

Construction of LAG-3 D1-D4 Iq and LAG-3 D1D2 Iq Fragments coding for the D1D2 or D1-D4 regions were amplified (30 cycles) from a fragment of cDNA (FDC sequence) encompassing LAG-3 cDNA (TRIEBEL et al. using Taq polymerase free from 5'-endonuclease activity and relatively resistant to an exposure to very high temperature; the amplification was followed by a S: .denaturation at 98°C (with a Perkin Elmer Cetus "DNA thermal cycle"). Specific primers were used as recorded in the table below.

The resulting amplified fragments (739 bp and 1312 bp for LAG-3 D1D2 and LAG-3 D1-D4, respectively) were inserted into a pBS plasmid (Stratagene).

Inserts were prepared after digestion with XhoI and BglII and introduced into the XhoI/BamHI sites of the vector pCDM7-CD8-IgGl (pCDM7 being derived from pCDM8 marketed by Stratagene), as illustrated in Figure 3, so as to exchange the DNA sequences coding for CD8 for those coding for the subfragments of LAG-3. The resulting expression vectors contained the sequences coding for D1D2 or D1-D4 fused to the DNA sequences coding for the

-CH

2

-CH

3 junction region of a human IgG1 chain.

13 TABLE 3 Primers used to amplify LAG-3 DNA sequences by PCR Primers used for amplification of the DNA Resulting encoded sub fraginent fused with a subfraginent Ig 4 Primer (5'1) GCGCCTCGAQGCCCAQACCATAGGAGAGA6TGT 3' coupling untranslated start of site 5' sequences translation Primer 5' GCQCAGATCTCTCCAGACCCAGAACAGTGAGGTTATACAT 3' LAG-3 D1D2 from the leader sequence to amino acid 241 Vq

S.

S S S. S

S

S

*5 EglIl coupling site End of D2 Primer LAG-3 D1-D4 identical to LAG-3 D1D2 Primer from the leader QCQCAGATCTACCTQGGCTAQACAQCTCTQTGAA 3' sequence to amino acid 412 BglIl coup- End of D4 ling site CDM7 is a eukaryotic expression vector derived from the vectors developed by SEED et al. (10) for the cloning of DNA and its expression in H. coli and eukaryotic cells. CDM7 possesses the following features: Mi the human cytomegalovirus promoter for transient expression in mammalian cells; (ii) a viral origin of for an autosomal replication of mammalian cells expressing T antigen; (iii) wr VX (type Col El) as plasmid origin for a high copy number; (iv) a Sup F selection for resistance to ampicillin and tetracycline in Tet~b and Amp' Z. coil strains; an origin of replication of M13 for the release of a single strand; (vi) a T7 RNA promoter; and (vii) a polylinker for an efficient cloning of heterologous DNA.

(__IIIE;~ill~lll.lY~~ 14 Transient expression in Cos cells Cos cells (5 x 106) were transfected with 30 jg of DNA of suitable expression vectors (coding for either LAG-3 DlD2 Ig, or LAG-3 D1-D4 Ig, or CD8 Ig) by electroporation (200 V, 1500 MF, 30-40 msec) using a Cellject apparatus (Eurogentech, Liege, BE). The cells were plated out again and cultured on a medium containing 5% of foetal calf serum. The supernatants were withdrawn 6 days after transfection.

The synthesis of the resulting fusion proteins was analysed from the supernatants as well as from cell extracts of transfected cells, by Western blot analysis with the 17B4 monoclonal antibodies. Immunoreactive materials were observed in the supernatant of cells

S

transfected with DNA coding for LAG-3 D1D2 Ig or LAG-3 D1-D4 Ig.

Concomitantly, a recombinant CD8 immunoadhesin (CD8 Ig) was obtained as negative control using the same expression system and the expression vector pCDM7-CD8 (Figure 3).

The recombinant proteins LAG-3 D1D2 Ig, LAG-3 D1-D4 Ig and CD8 Ig were purified by means of the standard method on protein A-Sepharose. The resulting material was analysed by SDS-PAGE, followed by Coomassie staining or a Western blot analysis using anti-human Ig antibody.

EXAMPLE 3 Production of soluble subfraqments of LAG-3 In order to produce large amounts of recombinant proteins, a stable expression system consisting of transfected mammalian cells was developed. The host cells are anchorage-dependent hamster ovary (CHO) cells isolated from CHO cells deficient in dihydrofolate reductase (DHFR) and consequently necessitating glycine, a purine and thymidine for their growth. The pivotal role of DHFR in the synthesis of nucleic acid precursors, combined with the sensitivity of DHFR-deficient cells with respect to tetrahydrofolate analogues such as methotrexate (MTX), has two major advantages. Transfection of these cells XX_ -~.LIIY~ 15 with expression vectors containing the DHFR gene permits the secretion of recombinant DHFR-resistant clones, and the culturing of these cells on selective media containing increasing amounts of MTX results in amplification of the-DHFR gene and the DNA associated therewith.

Construction of LAG-3 D1, LAG-3 D1D2, LAG-3 D1-D4 Fragments of DNA coding for the D1, D1D2 or D1-D4 regions were amplified using a PCR method identical to the one described previously, using the primers specified in the table below.

So See o ee *5 16 TABLE 4 Primers used for amplifying LAG-3 DNA sequences by PCR *5 S

S

S S

S

S. S S S

S

555555

S

Primers used f or amplification of the DIM Resulting Primer LAG-3 Dl CGCCGTCGACCGCTGCCCAGACCATAGGAGAGATGTG 3' from the leader Sall coup- untranslated start of sequence to ling site 5' sequences translation amino acid 149 Primer 5' GCGCGTCGACTTACATCGAGGCCTGGCCCAGQCGCAG 3' Sall coup- End of Dl ling site Primer LAG-3 DlD2 identical to LAG-3 Dl Primer from the leader 5' QCGCGTCQACTTAACCCAGAACAGTGAGGTTATAC 3' sequence to amino acid 239 Sall coup- End of D2 ling site Primer LAG-3 Dl-D4 identical to LAG-3 Dl Primer from the leader (CGCGTCGACTTAACCTGGGCTAGACAGCTCTGTG 3' sequence to amino acid 412 Sail coup- End of D4 ling site The resulting amplified fragments were digested with Sall and inserted into the Sail site of pUC 18 (Stratagene) The amplified sequences were verified, and the inserts subcloned into the expression vector pCLH3 AXS V2 DHFR hot IVS as described by COLE et al. (Biotechnology 11, 1014-1024, 1993) (Figure 4).

i; 17 This vector is a eukaryotic expression vector which is multifunctional for the expression cDNA and its amplification in eukaryotic cells. It possesses the following features: the murine promoter of the metallothionein-1 gene and a polyadenylation sequence SV 40 (comprising a donor-acceptor splicing site) to bring about transcription of the gene of interest, (ii) a human intervening sequence A containing the donoracceptor splicing site of the gene for the subunit of a glycoprotein for obtaining high levels of transcription of cDNA, (iii) the pML sequence containing the origin of replication of pBR 322 and a gene for resistance to o* ampicillin for bacterial amplification, and (iv) a DHFR transcription unit of SV 40 to bring about transcription of the sequences used for selection and amplification of the transfectants.

Stable expression in CHO cells The expression vectors coding for LAG-3 D1, LAG-3 D1D2 and LAG-3 D1-D4 were used to transfect CHO DUKX cells, and these cells were cultured on a selective medium. Cells capable of multiplying under these conditions were combined and cultured on a medium containing increasing amounts of MTX. Levels of expression were measured by Western blot analysis using the 17B4 monoclonal antibody. Clones producing high levels of recombinant soluble molecules derived from LAG-3 were propagated in bioreactors, and the material derived from LAG-3 was purified by ion exchange chromatography and immunoaffinity.

Western blot analyses revealed, in supernatants of cells transfected with expression vectors coding for LAG-3 Dl, LAG-3 D1D2 and LAG-3 D1-D4, bands with apparent Mr values of 15 to 18 kD, 34-36 kD (doublets) and 55 kD (2 possible bands). The respective Mr values of these immunoreactive materials corresponded to the expected Mr values of glycosylated LAG-3 D1 Ig (139 amino acids and a putative N-glycosylation site), glycosylated LAG-3 D1D2 Ig (239 amino acids containing 3 glycosylation sites) and glycosylated LAG-3 D1-D4 Ig (412 amino acids containing R1 18 4 glycosylation sites).

EXAMPLE 4 Specific binding of LAG-3 Iq to cells expressin MHC Class II The reactivity of the monoclonal antibodies and of LAG-3 D1-D4 Ig was studied by indirect immunofluorescence. Target cells (4 x 10 s were incubated for 30 minutes at 4 0 C in the presence of LAG-3 D1-D4 Ig, CD8 Ig, a murine monoclonal antibody, (949) anti-human MHC Class II (DR, DP, DQ) conjugated to FITC (isothiocyanate fluoride) from a Coulter clone, or murine Ig-FITC: an irrelevant immunoglobulin G conjugated to FITC. The cells were washed and incubated at 4°C for 30 minutes with either a goat anti-human Ig polyclonal F(ab') 2 conjugated to fluorescein or a goat anti-mouse Ig polyclonal antibody conjugated to fluorescein (Coulter clone).

To confirm the LAG-3/MHC Class II binding, LAG-3 D1-D4 Ig was incubated with MHC Class II-positive or -negative cells. Four B lymphocyte lines expressing MHC Class II(L31, Phil EBV, Raji, Sanchez and Personnaz) were treated with anti-Class II monoclonal antibody 949, or the supernatants of Cos cells transfected with DNA coding *either for LAG-3 D1-D4 Ig or for CD8 Ig. The five cell lines expressing the different haplotypes of MHC Class II molecules were recognized by LAG-3 Ig in the same way as by the anti-Class II monoclonal antibodies (positive control), while the supernatant containing CD8 Ig (negative control) did not bind to these cell lines, as could be expected. Four MHC Class II-negative cell lines (CEM, RJ, HSB2, K562).were treated with the same reagents as above. None reacted, either with the anti-MHC Class II (negative control) or with LAG-3 D1-D4 Ig, showing that the binding of LAG-3 D1-D4 is specific to MHC Class II molecules.

Further experiments were carried out using (i) mouse fibroblasts transfected or otherwise with genes coding for human DR7 or human DP4, (ii) mouse cells expressing or otherwise MEC Class II molecules, (iii) _1 19 activated human CD4* or CD8* cells, and (iv) T lymphocyte lines expressing the different haplotypes of MHC Class II molecules (Figure 8).

Unlike CD8 Ig, LAG-3 D1-D4 Ig binds to all cells expressing MHC Class II as efficiently as the anti-MHC Class II monoclonal antibody 949. LAG-3 D1-D4 Ig binds to all DR and DP haplotypes tested, to human MHC Class II molecules expressed by transfected mouse cells, to murine MHC Class II molecules and also to MHC Class II molecules expressed by CD4* or CD8* T lymphocytes.

These results represent for the first time proof that soluble molecules derived from a ligand for MHC Class II are capable of binding to cells expressing MHC Class II.

S

Similar experiments showed that LAG-3 D1D2 bound to cells expressing MHC Class II in as specific a manner and with the same efficiency as LAG-3 D1-D4.

Binding activity of LAG-3Iq and cellular distribution of ligands for LAG-3Iq The capacity of this immunoadhesin to bind to cell ligands is measured using a fluorescein-labelled goat serum directed against human immunoglobulins.

In these experiments, the target cells are first incubated with a human monoclonal antibody or an immuno- .I adhesin for 30 min at 4°C in RPMI 1640 containing 10% of FCS (foetal calf serum). The cells are then incubated with an FITC-labelled goat anti-mouse immunoglobulin serum (Coulter) for the murine monoclonal antibodies or with an FITC-labelled goat anti-human immunoglobulin serum (Tago) for the immunoadhesins. The fluorescence is measured after two washes, analyzing 3,000 cells with an Elite cytometer (Coultronics, Hialeah, FL). Figure 9 shows the degrees of binding of LAG-3Ig, CD8Ig, antibody 949 or antibody OKT3 (anti-CD3, ATCC), represented by the number of cells counted as a function of the logarithm of the measured fluorescence intensity.

LAG-3Ig binds to mouse fibroblasts transfected for the gene for the HLA DR, molecule, and does not bind to untransfected cells. CD8Ig is incapable of binding to I 20 HLA DR 4 fibroblasts under the same conditions.

The cellular distribution of the ligands for LAG-3Ig was evaluated on a cell population sample by immunofluorescence.

LAG-3Ig is visualized on all positive Class II cells tested, including B cell lines transformed by Epstein-Barr virus (derived from genetically unrelated donors, including 10 homozygous lines of DR, to DR,, typing), as well as on activated T and NK cells.

Figure 9 shows, by way of example, the binding of LAG-3Ig to Daudi cells which are positive for Class II antigens.

The mean fluorescence intensity with LAG-3Ig is similar to that observed with antibody 949 which is specific for Class II antigens. The binding of LAG-3Ig to

DR

4 (Figure DR,, DR, or DPw4 (not shown) expressed at the surface of mouse fibroblasts is, in contrast, weaker than that observed for antibody 949.

No binding is detected on cell lines which are negative for Class II antigens of T origin (peripheral blood T cells, CEM, HSB2, REX lines), of B origin (RJ 2.2.5 line) or of non-lymphoid origin (human lines, K562 of erythromyoloid origin and line originating from Smelanoma cells (not shown)).

Moreover, LAG-3Ig binds to xenogeneic Class II molecules of the MHC, such as the antigens expressed by mouse lymphoma A 20 and the monkey Classes II expressed by phytohaemagglutinin-stimulated blasts (data not shown).

The specificity of binding of LAG-3Ig was also verified using the monoclonal antibodies 17B4, whose capacity to block LAG-3/MHC Class II interactions in cell adhesion tests was demonstrated beforehand (Figure In these experiments, the LAG-3Ig molecules are preincubated for 30 minutes at 4 0 C either with medium alone, or with 17B4 (1 mg/ml), or with OKT3 (1 mg/ml), before being brought into contact with Daudi cells.

Figure 10 shows that a preincubation of LAG-3Ig with 17B4 inhibits the binding to Class II* cells, 21 whereas no inhibition is detected with the OKT3 control.

EXAMPLE Inhibition of LAG-3/MHC Class II interaction by soluble fragments of LAG-3 The inhibition of LAG-3/MHC Class II interaction by the soluble fragments of LAG-3 may be observed directly in relation to the binding of LAG-3Ig by Class II MHC molecules, by competitive experiments with the soluble fragments.

To verify whether the soluble LAG-3DD 2 fragments produced by CHO cells could displace the binding of immunoadhesins derived from LAG-3, the following tests were carried out: Daudi cells are incubated with soluble LAG3-DiD, S. fragments so as to permit the binding of these molecules to the MHC Class II antigens expressed at the surface of the Daudi cells.

In a second step, the cells are incubated in the presence of LAG-3DiD 4 Ig in dimeric form or LAG-3DIDIg in .monomeric form.

The binding of these immunoadhesins derived from LAG-3 is measured using a goat anti-human Ig F(ab'), conjugated to fluorescein (GAH-FITC).

The control groups are represented by Daudi cells incubated with dimeric LAG-3D 1

D

4 Ig or monomeric LAG-3DID,Ig without preincubation with the soluble LAG-3D 1

D,

fragments.

The results are recorded in Table 5, which shows that the soluble LAG-3DD 2 fragments are capable of displacing the immunoadhesins derived from LAG-3 in monoor dimeric form.

22 4* 4* 0

S.

0* 4 4.

S. CS

S

S

55*S 0* 55 4

S

S 5 64 *4 4. 4S4*S*

S

S

.4 5 5S

S

54*505

S

TABLE Reactants Detection Mean fluor- Conclusion escence GAH-FITC 0.3 GAB does not interfere Dimeric GAH-FITC 20.8 The binding of LAG- 3D1D4Ig CH0/LAG- 3D1D2 inhibits the binding CH0/LAG-3D1D2, GAH-FITC 8.5 of dimeric then dimeric LAG-3DlD4Ig (58%) LAG-3DlD4Ig Monomeric GAH-FITC 62.5 The binding of LAG- 3Dl12Ig CH0/LAG- 3D12 inhibits the binding CH0/LAG-3DD2, GAH-FITC 10.9 of monomeric then monomeric LAG-3DlD2Ig (27%) LAG-3DlD2IgI These data confirm that the soluble LAG-3D1D2 fragments bind to MEC Class II molecules.

Inhibition of LAG-3/I4HC C lass II and CD4IMEIC Class II interaction Rosette formation between Cos cells transfected with wild-type LAG-3 and B lymphocytes transformed with RBV expressing DaHC Class II molecules was demonstrated by BAIXERAS et al. This interaction is inhibited both by anti-LAG-3 and anti-ZinC Class II. monoclonal antibodies.

The method described in this publication was modified by replacing the visualization and counting of Cos cells binding to B lymphocytes by counting the radioactivity remaining after incubation of 5 1 Cr-labelled B lymphocytes with Cos cells expressing LAG-3 (binding assay).

The possible inhibitory effects of soluble molecules derived from LAG-3 on LAG-3/MHC Class II interaction, and also on CD4/MHfC Class II interaction, were studied.

Cos cells transfected with a suitable expression vector (coding for wild-type LAG-3 or for CD4). Two days 23 later, the Cos cells were treated with trypsin and plated out again on the basis of 0.05 x 106 cells/well on flatbottomed 12-well tissue culture plates. 24 hours later, 1 Cr-labelled Daudi cells (5.5 x 106) were incubated on this monolayer of Cos cells (final vol.: 1 ml) for 1 hour. The target B cells were then aspirated off and the wells washed 5 to 7 times, gently adding 1 ml of medium dropwise. The edges of the wells were washed by suction using a Pasteur pipette. The remaining cells were lysed with 1 ml of PBS, 1% Triton for 15 minutes at 37°C.

The lysates were centrifuged at 3000 rpm for 10 minutes, and 100 Al of the resulting supernatant were counted.

LAG-3 D1-D4 Ig was used to inhibit LAG-3/MHC Class II and CD4/MHC Class II interaction in the 5 Cr binding assay. Human CD8 Ig and IgG1 were tested in parallel and used as negative controls.

A significant inhibition of LAG-3/Class II interaction by LAG-3 D1-D4 Ig was detected (Fig. °However, the LAG-3/MHC Class II interaction can be partially and non-specifically inhibited by human CD8 Ig and IgG1. Moreover, LAG-3 Ig proved to be a potential inhibitor of CD4/Class II interaction (Figure 5B) under experimental conditions in which CD4/MHC Class II interaction was not modified by human CD8 Ig or IgG1. This •suggests that LAG-3/Class II interaction is weaker than CD4/Class II interaction. These results represent the first proof of a possible competition of soluble molecules in an interaction of MHC Class II with its ligands.

EXAMPLE 6 Immunosuppressant activity of LAG-3 D1-D4 Ic Functional tests were performed using the proliferation tests described above for the biological activity of the anti-LAG-3 monoclonal antibodies.

3 days and 5 days (D3 and D5) after antigenic stimulation, LAG-3 D1-D4 Ig showed a strong inhibition of the proliferation of clone 28, while human CD8 Ig and IgG had no effect (Figure Similar experiments were carried out with clone 154 (Figure and showed a partial inhibition in the presence of LAG-3 Ig. A control 24 carried out with anti-LAG-3 monoclonal antibodies had the reverse effects, as observed previously.

A significant inhibition of the cell proliferation of cells incubated in the presence of LAG-3 Dl- D4 Ig was also observed for clone 28.

These observations show that LAG-3 D1-D4 Ig is a potential immunosuppressant of the proliferation of T lymphocytes stimulated by an antigen, and indicate that LAG-3 might act as an "extinguisher" of the secondary immune response induced by activated CD4* T helper lymphocytes.

Role of LAG-3Iq in the negative regulation of the immune responses of T cells To demonstrate that a soluble form of LAG-3, mimicking the functions of the membrane molecule, could inhibit the activation of CD 4 T clones stimulated by an antigen, the following tests were carried out on clone T154: the T cells are incubated beforehand with a saturating amount of LAG-3Ig (100 nM). The cells are then washed twice with cold RPMI and incubated with 10 gg/ml of goat antibodies directed against human immunoglobulins (Tago) at 4 0 C for 30 minutes.

After two more washes, the cells are resuspended in RPMI containing 10% of foetal calf serum and incubated for 2 hours at 37 0 C before adding the signal. To couple ("cross-link") the monoclonal antibodies, a goat antimouse antibody at a concentration of 10 gg/ml (Tago) is used.

Figure 11 depicts an experiment in which clone T154 has been preincubated with LAG-3Ig bound ("crosslinked") to a second reactant (polyclonal serum specific for the constant region of human immunoglobulins). The degree of binding of LAG-3Ig to the cells is measured by immunofluorescence (Figure 11A). Figure 11B shows that a more than 50% inhibition of the proliferation of clone T154 is produced by LAG-3Ig. Under the same experimental conditions, no effect is observed with the control CD8Ig or with LAG-3Ig without "cross-linking" (not shown in the figure).

25 Figure 11C also shows that no effect is observed when LAG-3Ig is used to bind ("cross-link") the MHC Class II molecules expressed by antigen-presenting B cells.

The possible effects of bound ("cross-linked") anti-Class II monoclonal antibodies in relation to the proliferation of T cells were compared to those of LAG-3Ig. A weak inhibition (less than 50 is observed with antibody 949 and antibody D1.12 (anti-DR) bound to a goat anti-mouse polyclonal serum (Figure 12). The inhibition of proliferation is hence epitope-dependent, the largest effect being obtained with the epitope of LAG-3 specific for the binding to Classes II.

The effects of LAG-3Ig on the proliferation of T cells were also studied using different signals on another CD 4 T clone, clone TDEL specific for peptide 34- 53 of the basic myelin protein.

An inhibition of proliferation is observed (n 2) when TDEL is stimulated with the antigen (not shown), with immobilized OKT3 (Figure 13A), with lectins (PHA PMA) (Figure 13B) and with 5 IU/ml of IL, (Figure 13C). No inhibition is observed with 100 IU/ml of IL, (Figure 13D).

In conclusion, these results collectively show that LAG-3 and MHC Class II molecules, which are each T cell-activating antigens, may be likened to effector molecules involved in the phase of inactivation of T cell responses. Moreover, these results illustrate the importance of interactions between T cells in the control of the cellular immune response.

EXAMPLE 7 Stimulation of cell cytotoxicity by LAG-3Iq The role of LAG-3Ig in relation to cell cytotoxicity is studied on two types of effector cells: freshly drawn human peripheral blood lymphocytes (PBL), S1B5 line cells (clone of human NK cells).

The cytotoxic activity of these cells is measured by counting the "Cr released into the medium by previously labelled target cells, in the presence or 26 absence of LAG-3Ig in the medium.

Figure 14 shows the degree of cytotoxicity of for a line of human B cells transformed by Epstein- Barr virus and carrying major histocompatibility complex Class I and II antigens (LAZ 388 line), as a function of different reactants added to the cultures.

Measurements are carried out after 4 hours of coculture for effector/target (SlB5/LAZ 388) cell ratios of 3:1 (clear columns) or 1:1 (shaded columns).

The negative controls consist of medium alone (MED), the immunoadhesin CD8Ig and the monoclonal antibody 17.B4 (anti-LAG-3).

The positive controls consist of three different monoclonal antibodies: antibody L243 directed against Class II DR antigens, antibody 9.49 directed against Class II DR, DP, DQ antigens, antibody W632 directed against human major histocompatibility complex Class I antigens.

Anti-HLA Class I (W632) or Class II (L243) antibodies increase the lysis of the target cells (and not the 17B4 control). The immunoadhesin LAG-3Ig increases the lysis. The CD8Ig control has no effect.

Figure 15 shows the results of an experiment similar to the above, in which the cytotoxicity of PBL with respect to Daudi cells (HLA Class is measured, for effector/target ratios of 50:1 (clear columns) and 15:1 (shaded columns). The reactants added to the medium are the same as the ones used in the first experiment, except for antibody 9.49 and antibody 17.B4. Antibody 10H3 is an isotype IgGl immunoglobulin specific for the surface antigen. It is used as negative control.

No change is observed with an antibody directed against major histocompatibility complex Class I antigens (W632).

The data from these two series of measurements show that, compared to negative controls, LAG-3Ig activates the cytotoxicity of NK cells. This effect is 27 similar to the one observed with antibodies directed against I4HC Class II molecules.

0* 0* a

S..

a.

S.

S

a

S.

a ~_I~--XII-YIIII~ 28 SEQUENCE LISTING I GENERAL INFORMATION APPLICANTS: INSTITUT GUSTAVE ROUSSY/INSERM, APPLIED RESEARCH SYSTEMS ARS HOLDING N.V.

TITLE OF INVENTION: Soluble polypeptide fractions derived from LAG-3, therapeutic composition, use of anti- LAG-3 antibodies.

NUMBER OF SEQUENCES: 1 10 II INFORMATION FOR THE SEQUENCE SEQ ID No. 1 SEQUENCE CHARACTERISTICS Type: Nucleotide Length: 476 Strandedness: double Topology: linear :Molecule type: cDNA Organism: homo sapiens Tissue: T lymphocytes Name: LAG-3 Sequence description: a Leader peptide -22 Met-TP-GIu-ACa-Gln-Pe-Lou-Gly-Leu- 4 eu-he-Leu-G1U-flo-Leu- Tp-Va1-Mla- Pro-Val-Lys -ro I Leu-Gln-Pro-Gly-Aa--Cu-Val-?ZO-Val-Val-Trp-Ma-Gn-Glu-Gly.

16 la-Pro-Ala-Gln-Lu-FZo-Cys-Sez-Pro-Th:-Ile-1ro-Lu-Gin-sp- 31 Leu-Sez-Leu-Leu-g-Azq-Gly-Vl-al-Th:-Tp-Gln-Kiz-Gin-Pro- 46 Ap-S.-Gly-1 -Pzv- Ma&-A1a-P.-Gy-Kia-Pz-Lu-MA-Pzo- 61 Gly-?ro-Rie-Pz-A-Ala--Pz-Se -Sz--Gy-pz.-Aq-?zo-My- 29 76 Axg-Tyr-ThrVa1Leu-SerVa1Gly-Pro-GlyGly-LeuArg-Ser-Gly 91 Arg-LeuPro-Leu-GlProArgVal1GflLeuAspGlu-Arg-Gy-Arg 106 GlAgGyAspPheSerLeuTrp-LeuArgPro-la-Arg-Arg-Ala .21 As p-Ala -GyG u-TyrArg1a-AaValHis Leu-Arg-As pArg-Ala 136 Leu-SerCys-AguArg-LAg-LeuGY-GGfln a-Ser-met 149 02 10150 Thr- *151 Ala-Ser-rPro-rGlySerLeuArga-Ser-Ap-Trp-Va-I le-Leu *166 Asn-CysSerPheSerArgProApArg-ProAaSer-Va-Hi-Trp- *181 Phe-Arg-A n-Arg Gly- Glr-G yArg-Va1 -P ro-Va 1 Ag -Gu S er -Pro 196 His-Hi3-His-Leu-Ala-Glu-Ser-Phe-Leu-Phe-Leu-Pro-Gfl-Val-Ser- 211 Pro-MetApSer Gly-Pro-Trp-Gly-Cys-Ie-Leu-Thr-Tyr-Azg-ASPa. 226 Gly-Phe-Asfl-Va1-Ser-Ile-Met-Tyr-A~fl-Leu-Thr-Va1-Leu-G1y 239 D3 240 Leu- *C241 Gl-r-r-h-r-e-h-a-y-l-l-l-GySrAg .:256 VaGyLeuProCysArgLeuProAaGly-VaGlyThrArgSer a..a271 PheLeu-ThrAa Lys-T rpThr-ProP roGlyGly-Gly- Pro-ApLeu- 286 Leu-Val-Thr-G1ysp- sn-Gly-Asp-Phe-Thr- Leu-Arg-Leu-Glu-Asp- 301 Val-SrGnflaGl&laG1y-Thr-TyrThr-Cys-His-IleHisLeu- 316 GlnGuGlU-GflG LeAn-la-Thr-ValThr-Leu Ala- Ile- Ile-Thr 330 D4 331 Val-Thr- P ro- Lys Se r-Phe-Gly-Ser Pro-Gly-Se r- Leu-G1 y-Ly3 Leu- 346 Leu-Cys-GluValIThr-Pro-Val-Ser-Gly-Gln-GIu-Arg-Phe-Val-Trp- 361 Se-e-e-~-h-r-e-lnAgSrPeSrGyPoTp 376 LeuGuAa-GflG1u-aGlnLeu-Leu-Sr-Gln-Pro-Trp-Gln-Cys 30 391 Gl-e-y -l-l-l-r -e-e -l-%aAaVlTrPe 406 Tr-Glu-Leu-erSer-ProGy 412 Transutmmbrane 41; Ala-Gln-Ar-Sez-Gly-ArgAlta-Pro- 421 Gl-l-e-r-l-l-i-ouLuLuPeLuTrLuGy 436 Va-o-e-o-o-o-o-alTrGyAaP*GyPeHs 451 Leu-Trp 452 incacytoplasU. c 453 Arq-Azq-Gln-TZp-Arq- 1:o-AZ;-Aqg-Pbe-Se:-Ala- Lou-Glu- 466 Gla-Gy11Ie-iis-Pr@-A9q-Arq-L4u-AZ9-Mla-Ar9 476 31 BIBLIOGRAPHIC REFERENCES

S

9*

U

U U

U

U.

U

U.

U..

U

a.

U.

1. TRIEBEL T. et al., 1990, J. Exp. Med. 171, 1393- 1405 2. BAIXERAS E. et al., 1992, J. Exp. Med. 176, 327-337 3. COSGROVE D. et al., 1991, Cell 66, 1051-1066 4. RAHEMTULLA A. et al., 1991, Nature 353, 180-184 TRAUNECKER A. et al., 1988, Nature 331, 84-86 6. BENEDICT A.A. et al., 1967, Methods in Immunology 1, 197-306 (1967) 7. YELTON D.E. et al., Ann. Rev. of Biochem. 50, 657- 680 (1981) 8. HUARD B. et al., Immunogenetics 39:213 9. MANIATIS T. et al. (1982), Molecular cloning A laboratory manual Cold Spring Harbor Laboratory, New-York.

SEED 1987, Nature 329, 840-842 11. COLE S.C. et al., Biotechnology 11, 1014-1024, 1993 12. COLE S.C. et al., Biotechnology 11, 1014-1024, 1993.

32 TABLE NO. 1 residue atoms type, *9 4 4 4.

4.

4 4 p

C.

4* 4 44 4 .4 44*4** *SS*4.

*4 4 4.

AtM

CA

MA

C

0 La owl CLo

CA

w 00

CS

CA

KU

C

0

K

CA

KU

a

CS

an 183

CL

Sh XD2

C

0

CS

x 25.172370911 24.625223160 24.393711090 23.*93695370 2S.692700762 25.29S415878 23.764021729 23.6"285956 24.413949040 23.921775812 22.060102944 22.125716334 26.904179420 27.84014556t 27.12"641700 27.274552.772 28.25206459t 27.937834920 29.093"=2.27 as.786190033 29.631L8992 as.99S222.939 30.48255595 ZS.B57526779 29.199710475 29.2517204219 29.520187273 2S.983497691 30.6916SX43 31."406L9"92 31.U126624 32-55349409 23.O9602204 30.21407503t 29.4M7"01 29.44882640 32.3180232 2z.6"2361603 32.432&39039 33.350620370 3a.46379034 31.160949707 31.279307690 30.7"4$41386 34.48367359 35.485736847' 3S.SI19527965 35.509251153 35.41257660 3S.214973450 35.700343311 34.4430742 34.77IS44830 y 27. 25943197 26.471963862 26.8 67494S$3 27. 474391663 27 .480395126 34.772513794 27 .09074733 25.5870&6967 25.727443691L 24.744903"4 25.15241i495 25.923233551 a4.0092213 26.304518319 25.91VO764 26.22313202 25.063520 27.00504591 38.20"23021 S5.290935131 34.599295753 3f692913674 24.S78149196 24.23164554 36.55805204 37.4406U"4 25.414510291 35.312047950 3S.890144348 37.675793457 27.02602409 39.13213075 29.476200104 2s.608407715 30.174203673 30.51&269"4 29.791r97795 29 .96874710 30.537023539 30.574240M1 3L.23199316 30.210524643 31.299722672 32.024162292 31.662606226 29.902477264 20.671145612 2004546214 39043407 21.24"937 27.955933417 32.17324042 32.477428436 29.343718124 nano and Charge and no. no.

47.355064292 AP-fl 40 n2 -0.5000 1 47.420535632 AP-i 40 hn 0.1200 2 49.130244446 AF-i 40 C& 0.1200 2 67.230003150 40 hfl 0.1300 4 69.464050311 AP-i 40 ft 0.0700 S 70.350130544. AP-fl 40 C' 0.3600 4 71.462070923 AP-fi 40 0' -0.4100 7 43.990869250 AP-0 40 C2 0.3600 a 46.LS23513?9 LA"f 40 ft 0.0700 9 44.84931201 AV-"l 40 ht 0.07"0 L0 70.16960449 40 C 0.3400 L1 70.67"017761 A"-f 400- -0.5700 12 70."67"3574 At-fl 40 0- -G.A7M 13 70.134969422 618 41 nI -0.5000 14 7&.20751331 SCR 41 CA 0. 120 is 99.12621988S 118R 41 U3 0.3800 is 7&.7442694 SIX 41 ft 0.1000 17 72.27179181 8E 41a, 0.380" 1o 7201""25410 818 41 0 -0.3300 19 70.49483476 an8 41 as -0.1700 6490531240 01U 41 ft 0.1000 21 70.004031726 318 41 b 0.100 22 7&.424116042 31 41 Ob -0.3600 33 70.923277649 518 41 ftO 0.2500 24 73.28"054443 43 M -0.5000 74.525232544 GLY 42 Gq 0.00" 26 73.26739362 CU 42 ha 0.3600 27 74.51165910 ML 43 kt 0.1000 23 7S.46444824 CLV 42 ft 0.1000 74.617674S$ LV 42 C' 0.3800 W,"934582 CLV 430' -0.,600 31, 74.264671= 33 43 a -0.4200 32 74.L2679206 38W 42 3 M 0.60 22 72.706091736 PW 42 ht 0.1000 34 73,72262332 VW 42 3 02.""0 74.46a7434"9 3W 43 ht 0.200 36 72.83860600 38 43 %t 6.10" 27 7S.41491.692 10 43 a* 0.330 36 76.212222153 VIM 43 0 -0.360" 29 73.0431.34597 180 4363s -0.3000 72.04"049377 1W 43 ft 0.1800 41 72.036743164 NO 43 k 0.1800 42 73.307487483 180 4362 -0.200 43 74.137779236 PW 43 kt 0.1000 44 72.42632225 1M 43 ft 0.1000 7S.502466633 1WM 44 R -0.4200 46 74.490$24292 no 44 Ca 0.04 47 77.413.592407 1W 44 ft 0.100 48 74.655700464 NO0 44 C2 C.040 49 73.$7746123 MW 44 fL 0.1000 So 74.801914324 MID 44 ft 0.1000 $1 76."43334792 POW 44 C' 0.3800 53 7S.126132607 1W 44 Op 030 53 74.S47344022 PRO 44 62 -030 4 The numbering of the amino acids is shifted by minus 6 relative to the sequence SEQ ID No. 1.

33

S.

e a. 0 0* a.

S

K82

MCI

M02

N

CA

m

MA

C

0 Ca Not K52 M3

K

CA

VA

C

0

I=

OW

2-3

K

CA

C

0 203 =3 0 ca co =2 c 0 cm an Wie

CA

37,iG276931; 36.667S64392 3' .940749 196 37.446662003 37.55329513S 3S.026676172 35.034379870 14.4S2354431 35. 10501096 24..309384919 26.163S38442 33.4369924 32.S34690546 3a.82392029 33.46$57"97 37.3"4737045 37.216701508 34.4439349 38.262L2693 39.098414499 3a.932710419 39-.S26044753 40.446155091 39.131204812 "921903229 390737358611 39.717637"01 39.901103973 41.54573124 43.5&633343S 39.7220300640 40.045072279 40.0597S723 42.S37422180 44.009857176 44452939054 41.*90301122 4&.481170754 "8.44"952322 43.633030211 "4.30&9027n1 45.227154321 "44312103 43.051033200 43.o4434"545 42.944491804 45.70079"035 46.389"727 46.207077026 4S.620614913 .49.397043293 47.482319441 45.560506274 47,042975614 46.947166443 49.020114399 49.32453918S "0.4"0863647 10-130650,1.

29 .027102424 29.250995434 29.962709865 26.329140687 33.104183197 34.544979095 32.747509003 34.G599444 35. 322113037 35.637248044 35.*083190918 36. 190441469 24 59 135794 35 .01331144 35.61375S087 3S.231555939 24.310384458 26.S7&456146 37.311935425 37.10041091 35.211301514 3S.433424294 34.46997333 34."63463592 34.364345022 30.429889679 38.512592316 39.319231938 39.413407407 40.164442488 40.769994443 41.61121039 48.779975S 41.0073735 35.623.197290 38.718185425 35.555972290 37.522361755 37.871139526 26.761222539 39.441L42914 4.225761414 27.20404S*44 37.249"4094 36.597515106 36.929685463 37.389352227 35.525415701 40.224272154 41.291931152 39.986907959 41.460151672 42.253206940 40.950555255 41.411416636 39.718383789 39.222202301 39.216525033 36.296&14$2 39.*993574050 7%.a4.3.73sJa PRO 4~4 hl 77.29862S919 PRO 44 h 75.143180847 PRO 64 C2 74.483322144 PRO 44 ht 75.1347S0364 PRO 44 ht 74.753537555 ALA 45 nl 76.400695601 ALA 45 C& 77.336170959 ALA 45 1W 75.298250195 ALA 45 ft 77.074705933 A"A 45 0' 78.2625804 ALA 45 0 74.800727844 A&A 45 C3 76.52320224 ALA 4S ft 76.2903zo979 ALA 49 ft 77.8"519345 ALL 4S ft 76.397294617 AIA 46 a 75.3466581 X: A 44 ha 74.78,6270142 V. 44GCA 77.716934204 44 ht 7S.727844228 44 a* 74.516731263 MlA 44 0' 77.108406867 ALA 46 63 77.115480957 ALL 44 ft 77.8=210667 NlA 46 ht 76.197715759 &LA 46 ft 76.150330740 A&A 47 at 7S.275463647 ALA 47.Ca 77. 194257727 A 47 ho 74.24590454 ASA 47 ht 75.17050655 MZA 47 a' 75.9065740,64 A 47 0' 75.786385400 MA 47 03 75.1154121 A 47 ht 75.757467957 MtA 47 ft 76.512346563 MZA 47 bt 74.274406433 M1 455i 74.04574580 1VW 4868a 75.005773504 VW0 41 It 73.516381.135 NO 45 692 72.860626221 VW 48 kt 74.206545145 VW 45 ft 73.044319123 VW0 486' 72.144134521 VW 486Os 73.10059502 VW 45 62 7Z.597534775 IM 45 It 74.34152946 NO 45 kt 72.70201118 MID 45 @2 71.6"613=459 1W 45 bt 73.511740354 "NO 45 bt 72.145117261 OLT 49 N 72.124675488 @1.1 49 69 73.991729736 GZX 49 Wa 71.317451477 49 ft 72.672356419 OLT 49 ft 71.60099792S GLY 496'* 7L.601101465 01* 49 0' 71.0910186773 MIS S9 71.052453057 325 SO ha 70.30419612032 5068 O 70.63423S10 325 SO ft 70.153189941 HIS 50 C# C.LOGO 0.10OG0 st -0.2000 57 C.1000 s6 0.1000 S9 -0.5000 0.1200 41 0.2800 42 0.1000 43 0.2100 4 -0.3600 -0.3000 66 0.1000 67 0.1000 4 0.1000 G9 -0.5000 0.2500 71 0.1200 72 0.1000 72 0.3580 74 -0.3800 -0.3000 74 0.1000 77 0.1000 78 0. 1000 79 -0.5000 s0 0.1300 $1 0.2600 12 0.1000 52 0.3800 64 -0.3500 Is -0.3000 84 0.1000 87 0.1000 as 0.1000 at -0.4300 t0 0.0600 91 0.1000 93 0.0600 92 0G1000 94 0.1000 0.3500 96 -0.3500 97 -6.2000 98 0.1000 99 0.1000 100 -0.2000 L01 0.1000 102 0.1000 103 -0.50100 104 0.0205 105 0.3500 104 0.1000 107 0. 100 &OR 0.2500 L0s -0.3300 110 500 12I1 0.2200 112 a. 1200 113 0.1000 114 0.2500 115

S

U U.

34 9t

C.

a 0 ca M52

CI

ctl

MEU

CA

MA

101 0 =21 cc

IC

1Ch a =2 mu 0012 002 mm mu Ch 0 an =31 ma Ch NA2 50). 7 33476S46 4g.45534S154 49.238SO2502 47.63942711S 47.954322515 44.759342194 4G.S2557296" 47.S$76113I9 4S.6275651S 46.0432473 4S.092224221 49.566501617 SI.2711770447 S2.667034149 52.723180492 50C.954447601 60.920970917 49.968422394 53.707103129 53.6349916 52.844494946 3*907955170 52.373264313 53.%s58X3S17 53.7520S1004 s31.753145 64.704383S7$ 55.79152060 54.653743744 "4.479202271 55.3013121 95.63769S313 54.97151SS06 "8.039743164 57."541262 57.352307912 617553526 57.675057230 ss.353120341 57.04371531 55.618544606 S.5314*S2 $9.820976,440 99.3092'77 59.192740449 54.5344,6895 $3.940"43302 54.153572601- 53.004452941 S2.439'778137 51.626416 55.005755249 S4.552756043 55.525"44272 55.479701994 53.555103202 51.304950714 S4.578764921 53.705532421 54.*215921974 S4.452265326 40.446022034 le.673969269 3s .os17*622I 37.951335281 39.&2S293427 40.404,147009 41.133701324 40. 964004 517 40.019775391 41.8523840424 41.403281348 39.99$07739 40 .105460194 40.689155SO 41.393622352 39.767082214 36.670558929 40.190531340 39.47812711 39.391644412 41.253794403 41.442169159 43235846710 40.3741025425 29.54529535 40.91322"96 33.722S33709 35.749330261 40.4532330 39. 38530800 37.535024414 37*42593003 38.316741017 37.710464418 37.4032797 39.42074964 40o20079'779 35.832915710 29.60187530S 35.402957367 38.028410 45.03555357 40.557164290 29,355541044 40.592193404 346183961 3s.420303345 36.958141327 25.75332260 24.81257S429 34,518498883 34.33076855 22.460170746 34.711517334 33.941404709 34.469379 32.917493542 33.172523499 34.*425420990 3S.409960774 33.693523407 49.061465675 His s 50, 68.g52773499 KIS S0 C2 66.4611GS747 HIS5 S0 h 69. 144145039 HIS so h 67.919425364 HIS SO CS 66.035292579 HIS S0 np 66.673245239 HIS 50 cS &6.014495650 HIS 50 ftp 66.717041016 HIs s SO 66.655343930 SO5 h 65.1089332 MIS 50 hfl 66.396347046 MIS S0 ft 71.326615906 FIND 51 8 71.077911377 POO 51 06 70.357094116 PRO 51 b 72.6244966 PRO 51 Ca 72.747252115 P00 S1 b 72.947&6643 M0 51 ft 70.6044391.26 NO0 51 CO 71.39&415457 MID 51 72.455955505 NO St133 72.729284194 P20 51 ft 72.449127197 300 S1 b 73.440299179 P 51 32 72.789713428 300 51 b 74.33132279 P0W 51 9.92471600 LM S2 10 69.64125306101 Lm 530as 69.490256445 ZZN 53 UP 4.921917480 MW 52 b "6.745040594 LM 52 90 67.963049864 ZV S2@00 70.839437256 &N 53 32 7n.50289"994 ZNV S3 I 70.457434387 ZN 52 b 7&.6g5102234 &N S2 al 71.9282410 in 52 1 73.00454719 ZN 53 03 73.04213M420 ZN 52 h 72.601577759 ZN S2 72.852442769 ZNV 52 b 70.92320317 ZN 52023 71,603245 ZN 52 b 70.634619031 ZNV 53 k 75.005549458 ZN S2 h 69.354279935 MA 52 a 48.6357690 ASA 53 a& 70.244542884 MA 52 UK 47.671240942 MZA S3 b 63.31399505 At& S2 0' 66.6770477n MA 52 0' 6".422494425 MZA 53 03 97.592203436 MA S3 k 47.75723851 MLA 52 b 69.3512259as MA 53 b 70.698249@74 NO 54 A 71.25450653 P0W S4 CA 70.584S47097 PIC 54 b 71.63465S5 PRO S4 C2 71.739934629 M3 54 ft 71.268109912 PRO S4 h -0.3600 116 -0.2000 117 C.1000 I1I 0.1000 l19 0.1000 120 -0.4200 1.21 0.2700 122 -0.5000 123 0.0100 124 0.1300 125 0.3600 126 0.1200 127 -0.4200 126 0.0400 139 0.1000 120 0.0600 131 0.1000 122 0.1000 133 0.3600 124 -0.3600 135 -0.2000 126 0.1000 127 0.1000 128 -0.200 129 0.1000 140 0.1000 141 -0.S000 1L42 0.1200 142 0.2300 144 0.1000 145 0.300 146 -0.3800 147 -0.2000 1L46 0.1000 1L49 0.100 -0.1000 151 0.1000 153 -0.3000 152 0.1000w 154 0.1000 155 0.1000 154 -002000 157 0.1000 155 0.10010 159 0.1000 160 -0.5000 161 0.1200 162 0.2500 162 0.1000 1L44 0.3800 165 -0.200 166 -0.3000 167 0.1000 16s 0.1000 169 0.1000 170 -0.4200 171 0.0400 172 0.1000 172 0.0600 174 0.1000 175 0.1000 176 p.

S.

*0 *0

C

0 ce R422 HCi 1402

N

CA

N

N&I

0

CA

cm an a=

CA

MA

c 0 Mal mu

=I

N

Ma cm Em

CL

=2 c 01 862 v 50.177021027 50.3)77993093 51.867893219 51.125505"'6 S2. 1813774 11 S3.08713671 53. 768703461 $3.731838154 48.*977436404 47.23220392 48 .958133498 47.S30284119 46.894526337 47.* 70829772 47.*347O002 47.956193870 47.83004,481 48.225147247 43.653484522 48.106484001 4g.45:7214015 46.341007959 45.894090943 49.804837308 4a.542221069 49.828592041 44.762564071 47.9032419795 49.67906=299 45.4505730 .46.04gutstf 44.244419098 43.68756077 "4.172530S79 44.75003051B 43.610416412 44.3785876 42.S890"9494 43.256400543 "4.U1428375 43.235973511 42.446156295 42.045005798 43.712"70445 41.370846468 42.236827850 43.213856795 43.S#3978642 44.607,42345 42.232599691 42.093353271 43.562110870 42.805988312 4L.5406960 43.072513590 43.559719194 43.9204S4297 43.15444072S 41.151851454 42.02392040S 42.540418496 14 .94S980072 36. 144409631 33.173828125 33.05183292 32.*150829315 3299192943 34.8714064 23. 414070139 34.414421082 35. 22502132 22. 29709472 26.238574982 34.*772280829 35S.263448987 34.*242198944 36.372848511 36.396587372 35.4$7425007 27.55S43788 28.040233612 37.2540,4442 36.604677472 37.732730845 37.531744984 39.03429412S 37.1,24542234 29.488700867 29.158111572 39.133480072 35.440880157 U4.47379150 35.504474440 36.207443231 35.943927745 35.234142303 34.0995429 08 23.323795319 34.03487777 33,67123203S 33.7234442S7 33.139041901 32.711650S61 33.040448617 23.001421 3.229382759 22.915439441 27.064405151 37.549734481 37.630648640 38.010932922 37.514507556 33.527089252 36.69577024 36.693944985 29.01A571045 39.*392253876 39 .704352234 38.999494440 30.629453931 29.996752594 35.961261749 71.442837524 PRO 54 C' 71.677795410 PRO 54 Ce 72.519187927 PRO 54 C2 73.34064009S PRO S4 ht 72.232274917 PRO S4 ht 72.949317932 PRO 54 c2 72.538475027 PRO 54 ht 72.579084304 PRO 54 ft 71.936704943 CL? 55 Ai 72.404747009 CL? 55 eq 71.929513024 GLY SS hit 7142474453 CLY 55 h 72.004432678 C? IS ft 73.950414"5 GL? 55el 74.498336792 CLY 55 of 74.494281433 PO 54 a 74.179130554 8M 5408a 74.619560342 Prw 56 ft 74.163940430 -W 54 C3 73232545304 38W 54 ft 73.79920877 IM 54 h 7648052673 38W S6 o 74.560951233 VW8 I 542 76.697493954 M8 54 6 75.3"$530273 W 54 C3 75.4344167M5 PRO 54 ft 72.321792602 VW of 7641944114362 US 573a 76.43"904767 US S7 ho 77.387696120 338 57 a 76.75$348894 838 57 b 72.901000M 71 57 c' 79.734030579 835 S7.of 77.1550585S94 US8 57 C3 77.42374877 838 57 h 77.796158354 N= 57 b 75.7517273 NU5 57 05 74.444069821 M3 57 up 73.713264465 38 57.of 14.034412829 M 57 a 75.379244832 M 57.35 73.44243916 85 57 &A 7G.053W 835 57 b 79.311038940 NO 80.71397070 M8 S&40a 31.02492392 VW80 b 78.407653809 M- 5cR 77.751"07010M 0, b 77.75M674622 IM 58 h 81.747009377 V80 58 of 81.769704724 MW8 S 580 30.579101543 M8 S8 c2 81.485702515 P 3058 8 80.396040771 380 5o k 79.353309431 M8 5882a 79.434307461 PM0 58 b 76.896965027 MW0 $a h -92.66S430603 ALA St3a 0 ]Bo 117 -C -34 0 0 178 0.2000 179 0.1000 La0 0.1000 111 -0.2000 122 a.1000 183 0.1000 184 -0.3000 185 0.0200 184 0.3800 Is7 0.1000 18g 0.1000 lot 0.3S409 190 -0.2800 191 -0.4200 192 0.0600 192 0.1000 194 0.0600 135 0.1000 196 0.1000 197 0.3800 Los -0.3800 199 -0.2000 200 0.1000 201 0.1000 202 -4.2000 303 0.1000 204 0.1000 205 -a.50" 0.2800 207 0.1200 208 0.1000 209 0.3800 210 -0.3800 211 -0.20"0 212 0.1000 213 0.1000 314 0.1000 215 -0.4200 216 0.2700 217 -0.5000 218 0.0"00 219 0.1.309 230 0.3m00221, 0.1500 222 -0.4200 223 0.0600 224 0.100 225 0.0400 326 0.1000 227 0.1000 228 0.3000 229 -0.3800 230 -0.2000 221 0.1000 232 0.1000 222 -0.2000 234 0.1000 33 0.1000 236 -0.5000 237 .5 C

U.

36 S *q S.

S

CA

KA

C

0 Cs Mal M22 M3 p Mw

CA

MA

C

a Ma a

CA

KA

0 m Ma an 31C

ON

CA

0 ca 01 a a 3

KA

C

0 44.5373 304 27 43.949653425 42.197692871 42.20896437S 42. 494323256 44.107444763 43.761249642 44.544420514 "4.2591@9SO 41.192a04237 8 41. 124549966 40.303084653 40.423948469 38.83S28296 37.837604260 46.754333215 40.04146S74 41.631904417 41.~o72632 37.403762617 34.49102023 29.556003571 40.9914301 39.57102944 37.375294440 36.264397939 37.4736S71680 36.949714441 3231,176 34.94"431744 39.3973940M 39.1"0202404 319.2433482 36.184100,4939 33.0291534 31.921707243 37ol4i4400 37,444691154 33.420265941 39.640292979 40.3494S469 40.022703400 39.252223949 35.9,02244544 34.747534076 23S.76447976 3S.6"424741 34.1047951183 33.7148457 32.716615946 24.1971043 32.3330719 32.434590149 32.159793G54 32.914193177 323.11319946 34 *221500397 22.404721750O 31.S73041216 30.*996960447 3S.932937622 34 .9462089SA 24. 355514524 35.488]9 7 2 is.i273S3668 33.975412640 33.13038940 332.5158693 34.467308044 323741913 3454992676 34.790743594 3S.94$789980 37.03730$603 36.3 834859S4 37.971491122 39.2$7004073 37.6 54120300 26.613133123 37.9U9370367 37.8744944" 37.82483434 30."03845215 38.45019402 29.77494153 36.712962104 36.47630719 39.24463"t 33.321305134 d0.017912818 33.572613312 39.0462911981 40.449400963 25,771151923 34.634955042 35.927340"35 2S.004183424 33.5287949 32.624044301 34.042240442 33.206644440 34.83245737$ 3.941415836S 32.33293403 31.447914701.

32.874445942 34.503352344 32.2415518188 31.93499347 3k.3471302810 33.819464404 34.971384430 34.542503503 33.222091675 32.710407257 30.454697400 29.494124222 30.422499246 39.612145121 22.941977005 29.94089124 82.36569974 ALA 59 hfl 62.52415469 ALA 59 ca 12.965g11186S ALA SO h~ 84.903995596 ALA S9 C' 65.946333740 ALA 99 C' 12.339767456 ALA S9 C3 34.46328354 ALA 59 ft 82.924507141 ALA S9 ht 34.299597163 ALA 5O ht s4.553051514 *.LA 60 n 83.555343628 ALA 40 ha 65.5429621 AMA 40 C& $4.283721924 ALA 40 ft $4.346977234 ASA 40 C' 35.19340332 MZA 40 0' 86.389417920 ALA 40 63 87.102043152 ALA 40 ft 86.983191144 ASA 40 ft 35.765472412 MZA "0 ft 62.12939134 M0 41 0 92.94944628 P00 4108a 83.573593140 NO0 41 ht 82.42977732 FID6.1 C2 82.304066631 10W 41 ft 04.250646499 1M 41 ft 81.892074585 PRO 41 C' 81.133494948 90 610', g2.264957305 900 at03 61.212719399 100 a1 ft 82.938967733 10W 41 ft 92.14432W00 61 G2 61.292793274 V00 41 ft 82.029207456M 41 &t 61.785024180 626 42 30.844133640 2R62 420, 83.4149921414 EUR 42 an 79.0411254441 8= 2 Ik o1.241909485 6642 a' 22.04112499 ER 42 V 6.7253.94 EU 432 79.904261614 EU 42 &t 60.4425024"9 am 43 bt 81.928830920 82 642 oft 82.254242733 EU 62 0 80.744541424 U 43 a 51.297317505 =U 420G 10.30530019 EU 62 ba 32.170570374 SU 43 bt 60.223&474114 EU 43.a' 71.14212341 EUR 430'O 51.843544004 EUR 432 32.17210406 EU 43 bt 61.036794170 EU 43 ht 82.4947390 EU 42 Ob 81.832328796 EU 43 ho 30.531376906 131 64 a 79.73S4446 TV 44 0a 81.5389IS541 O 44 hn 76.7219314150 731 64 ft 79.483049011 731 44 C' $0.975959775 73F1 44 GO C.2800 235 0.1200 239 0.1000 240 0.3800 241 -0.3800 242 -0.3000 243 0.1000 244 0.1000 24S 0.1000 246 -0.5000 247 0.2800 248 0.1200 249 0.1000 250 0.3800 211 -0.3S00 252 -0.3000 253 0.1000 254 0.1000 255 0.1000 254 -0.4200 257 0.0600 258 0.1000 259 0.0400 240 0.1000 241 0.1000 322 0.3600 263 -0.3300 24 -0.2000 245 0.1000 244 0.1000 247 -0.2000 2go 0.1000 34s 0.1000 270 -0.5000 271 0.1300 272 0. 2800 273 0.1000 374 0.3000 27S -0.3000 276 -0.1700 277 0.1000 27S 0.1600 279 -4.3800 280 0.2500 261 -0.5000 32 0.1=0 213 0.3800 264 0.1000 0.3300 364 -0.3600 287 -0.1700 255 0.1000 239 0.1000 290 -0.3600 291 0.350" 292 -0.5000 212 0.1200 294 0.2000 295 0.1000 294 0.3800 297 -0.300 29I

S.

S

699 oO@V0oftc 9oono Lit OO1c* ic 0009*0sic O~v* tVC ooic*@ cee 0o0h10- Est O0C10O 'Tic OCT.* ag 0060*0etc sOCVO etc eeC'tO &PC *OOK*tc OTT*S Svc eon's Poe SOM10etc *@ig.0cEc Don't Tt m".o etc eon 0 $cc ow1 $cc 000500 Lee e@0T*e 9cc eOUT*O see Pec OO0Ve ccc 0001.6 o00e*0uCC "elosecc Doft*@ fee DOOO etc 000110 ne: 000f*O fec OOIO*oetc eO?*o- 19C 0Oi00 Ogg OOO tc 0001.0 tc 0001*@- 3O!C 0001*0 stic 0001*0- VTC @OOe1 LC 0001*0 tic 00010 ic 00t00 Sac 0001*0tot 0000*0 sac OOVTO c OOTOVo oo 0o01o0 CW Lt V *t£0K50OL uq Lt +WVY 0Kti03DI0T wq Lo +MY CICSICOO L 93 1 9 v +01ISULSS*IL 33 Lt +mW LCeicl91L 94 Lt +M W9GSZTCVC£ KU L9 STSO03£UIKL q L9 +991 CtSV9iiI33l 90 L9 gIe£SUT1*CL 4 L9 +MV O0L811IVU 4 L9 40EV 6£9g119 VL 99 L9 4ME ICVVMVC*PL I L9 40w GsfuCOOP4-u itL9 MV MfSLSWC To LO 40EV SSiI>ISSVPL ,0 L9 40EV 99LGSU9-9 #9 L9 40EV lflU93190L MR £9 40EV 1633t13S"L w £9 .0EV UOLeMII v £9 40V I OS3£USL 4 to 0EV 5143S69£ to DO 0Ei UTMOI9Wl3 iw to Md :IPST00SSOI "1 me 49COMS41*04 99I MA CSP&5336OL UI of iU tICC311 #0 SO XW OSS£9t33L .4 9 SM NI015CGSSK3G MR so NIP O9OfftW£& ba so 113 I5S3309L do *9 imxt:. "G IW3 to~ 4 to Am& tOtiut00i do *9 dEL V*VSlT91C 4 o a=dE ITVCt@£IL T do to dr" 9ISASIVC V to dl" itt9OV@LIt So to d7EL 9494OL*£1I go to d=L C2LGCCKICl du t dli SMCOtOWit3 so t d"a *tttttzti?3 So opt dW.L ODOCtLI7itt 'pq dl rZ03I,11s6L uz to LVI. SZ2&C1?0 LLttst$Lt1@K tLOLAMOVS?: gLt$Ltclci:t WIOSOiL9 M s~comKctt 3KiLC9nC9tK 9669t£9 GCLImSL9K g6LCO33KIO2 £SL6fIVIKL to.KUiLVOeZ M*SUV1U wesomeL£ 133900£K19£Z 66=gLICK6t Ot099VOP£ 9C9L9TKSZ3 £g.IPe9c919 LSdVO09S*i gOfCL@IC L 530KKLt

ULIGI£LOC

VLtovttmw* LicoiSoU aLt CSSK3OL Lt LverattwceZ tzLI13t0£S I

SOLSLJCLO*LK

C19V2162*K T61'IC26K0*9 V99CgULOS? £93B96009 91IS~CL,0 0313630CLIU 968106OSSLt CPSIP31*9£ LflIC?9Kg 9901965919*9 9LOSSISIVU gLYu106I5U KS£olLO'63*1 vSS"CCv*OC U0LitOV69 96iteoOiC gvtiSCOPLC qCstIot"T ?LOCOIs1%stv cm 32 tcm Cm

IN

12 0 3 Km 1vU '3 to

III

Ti

SO

9m

TUM

cc 0 3m

KU

A1

CZ

'3 cm

CIX

:3m C2m T29 103

CIN

Tom 9 9. 9 9 .9 **999* 9 9* 9 9 9** 0e 9. 9 9.

9 9 9.

99 9.

9* 9 9~ 9* 9 LE 38 99 9 9 9 0@ 09 99 9 9 9.

99 9 .9 9 9 9 9.

9 9.

.9 9 KH121 MR122

H

CA

MA

co H01 102 c 0 502 x

CA

WA

0 ce x= ci

I

MuA MS2 0 cm cm 3.

cmo

=I

802 co mDIl Rol 25.030595"'9 24. 266489029 22.080270767 20.743734360 20.817SS6381 22.076143345 32.539228439 22.632146835 20.1823825844 20.4205398SG 19. 946141096 1.88543063 20.066789627 20.592071533 30.153363342 20.428294132 19.455055496 15.89275466 19.221294310 19 .6"7410168 15.514461517 17.,28331876" 17.441.77754 38. 03.184689 16.994420090 16..94689171 SS.849517059 3,7.628776778 18.685191414 3.5.980263873 15,090464510 15.27354S$ 3..6444$3910 Z23.04415456 3 .57"30592 &a.090744019 3.2.989939292 L23.033432908 13.525M7967 19.436428322 2.2.22009109 30. 257131958 39.0"14677 as.51252891 20 72812271 27 .925553597 17 "9237431 7 .03328596 17 MUM6S 1.9.04568100 IS. 540752928 16.3683.16379 36.095691651 Is5.630163.285 &6.255954742 16 .2S3637314 16.1.44437790 16.055492401 16.071464S39 15.971571632 21.456792831 22.916227341 26. 971176147 26. 358839035 25.605155945 25.448001862 38.949869156 38.776126862 25.166324692 24.3$1649017 27.549791336 27.490163503 279854434 2804237829 29.031393051 29.7042"355 24.339065756 25.542047901 27.198925$33 24.872461319 26.60824127 27.0933273 34.654710770 23.935996466 2S.310214996 23.5652.25S 34.8516223.3 23.127802802 233.6446SO64 7 23.365550995 33-96859024 33.62804413 22.616125923 23.3143890281 31.755460728 31.8333879 31. 43.47250 33.054522513 21.964094513 2372974296 329221"9 37.5130651 26*45123S293 27 .06812412 28.57549536 25.46871963 26.69771764 29.055472107 25.032053147 29.043765092 "8.$4603"56S 30.51563096 30.502414703 30.813327 2".711160460 31.997$9377 31.35054957 32.90674S392 33.71.269062S 33.29421G156 34.708631972 70.033142090 A.R0* 61 Mnf 70.850784302 ARG- 67 rn 76.244251066 PRtO 68 f 76.4I5237122 PRO 68 c 77.2943S7300 RO 66 1k 7&.34291g396 PRO 6S 02 7S.469612122 PRO 68 hk 77.244499307 PMO 68 hk 7S.240180969 PRO 66' c 7S.139877319- PW 68 01 77.062515259 MR 68 C2 76.S77128601 PRO 68 ft 78.163002014 POO 66 ft 76.467758179 PRW 65.92 75.475172303 -W 66 O 77.09233663 V- 68 ft 74.300010491 £30. 69 Ri 73.096710209 £394 49 0& 74.83901456 AM* 69 Ma 73.64407319 539469 b 73~.1504575 5394 6# c 72.626094466 AW6 so 0 .73.529657592 399 602 74.33.5147400 &MCI* 9 IL 74.06165942 Am#04 9 8h 73.43749034 .W 69 62 7&.612152M90v 394 6 71.96054 AMP*4' 9 h 72.575959776 AMD# SO 02 73.666542214 AND+4. 9 b 73.554351807 8394 69 8k 73L.84615916 839 69 VA 70.898552450 3394 49 Ua 7&.943446734 MI39469 CC 70.250700008 &M394 69 &2 69.97923.006 AW9 69 Ua 70.234060922 39 4Xf 9 hD 73.074682507 539l 69 a2 73.044241292 839 69 Us 72.663234021 AMD#449 8 71.074901038 834 0 09.676324416 &SO0* e 71..65965167 £ASS# 70 M 69.071138645 A14 70 ft 69.29652666 1394w 70 a' 6".2330S67 AM* 79 69.732457268 839 706C2 65.694063 8394 70 k 69.507691844 83946 70 k 76.717642102 839+ 70.32 71.747383116 3394, 70 h 70.495443614 5394 70 b 70.692214417 AM#4 7062l 69.6448475 AM+ 7@ 8 70.937812605 5394 70 h 71.71101379 A39+ 70 1 72.706426 539*70 h 71.464S&1462 5394*70 CC 73.451109619 AM* 70 82 73.413330078 530. 70 h: 72.277374368 A34 70 bn 0.3600 36C 0.3600 361 -0.4200 36: 0.0600 363 0.1000 364 0.0600 36S 0.1000 368 0.1000 347 0.3800 366 -0.3800 369 -0.2000 370 0.1000 371 0.1000 372 -0.2000 373 0.1000 374 0.1000 375 -0;5000 376 a.1200 377 0. 3800 378 0.1000 379 0.3800 360 -0.3600 381 -0.2000 23 0.1100 33 0.1100 364 -0.3090 385 0.1300 366 0.1300 367 -0.090 388 0.1300 289 0.1200 290 -0.5000 391 0.3600 392 0.4500 293 -0.50W0 294 0.3600 295 0.3600 296 -0.5000 297 0.3600 396 0,2600 299 -0.5000 400 0.1300 401 0.2800 402 0.3.000 603 0.3600 404 -0.3800 405 -0.2000 406 0.1100 407 0.1100 406 -0.2000 409 0.3300 410 0.1200 411 -0.0900 412 0.1300 413 0.1300 414 -0.5000 415 0.3600 416 0.4500 417 -0.5000 41.

0.3600 419 0.3600 420 9. 9 9 99 9 9.

999999 9 9 39 wM2 KH21 30122

CA

HA

OXT

0 no 532 cc1 as

C=

Cu2 002 16. 1203S1791 16.023016692 16. 187112808 22.11512302 22.014273148 22.S71009064 21. 3S2120532 20.393353505 21.928325653 21. 439272601 22.96911241 22.369367059 23 .40199 2798 24.*14454450" 23.927837372 22.94443S391 24.987041473 24.819047920 26.27331972 27.21446123S 26.960180740 26.504697000 27.5022295 25.447391510 23.65249443& )3.420074463 )4.432674403 32.736862193 21. 562902451 30. 117514572 29.*314456940 22.444023401 24.953493110 29.152261621 27. 313042603 27.538662415 30.11S55337 31.*487627029 30.559690475 30.666317292 31.26276016 31.434467430 31.212265015 31.551503445 38.841675"62 30.,57265026 31.23"07033 30.42263"329 20.14384653 30.325349606 29 964065 70.259972437 ARC.* 70 70.167800903 ARtG* 70 69.509996704 ARC+ 70 70.071769714 ?YRC 71 @9.338010842 TVRC 71 71.21897668 TTRC 71 70.976676941 TRC 71 72.563385010 TTRC 71 73.048G52649 ffRC 71 73.1457977VT13C 71 73.909762410 TTW 71 7L.36196423 a VTRC 71 71.215415344 2129 71 72.381825939 "WR 71 70.3S22111 "SC 71 49.04441633S TfE 71 68.717597961 TV= 71 66.143023259 TTC 71 47.1,31973267 TMIt 71 69.54227447S USM 71 67.652267454 TIE 71 66.796659741 TV= 71 1 69.84L3'77256 TME 71 4 70.140815735 TMC 711A 70.742820190 TMC 71 9 71.745229440 TOE 71 1 -0.5000 421 0.3600 422 0.3600 422 -0.1000 424 0.2300 42S 0.1200 426 0.1000 427 0.4100 428 -0.3800 429 -0.3800 430 0.3500 431 -0.2000 42 0.1000 433 0.1000 434 0.0000 435 -0.1000 436 0.1000 437 -0.1000 438 0.1000 439 0.0200 440 -0.3800 441 0.3500 442 -0.1000 443 0.1000 444 -0.1000 441 0.1000 430

S.

S

S

*5 a.

S S S *5 S p 40 TABLE No. 2* residue ata.s type, namie and charge ad Ato asU no.

no.

0 see a so@ so 0'

CA

mll W42

IMA

CS

0

CA

C

0

CS

No

CL

0 of

CA

KA

CD

CA

a

CM

CA

VA

CD

C

0 ce not 24.7S705430 24 .S10 200029 IS. 35049046 0 23.690571194 25.747&90471 35.411134039 z2.5154753 33.34523.7209 22.630342010 34.910153435 22."52199953 34.921674733 27.14t.57404 3S. 47 705450.3 28o43.334748 29.357233S"3 33.1171018332 30.2846143S 31.027490496 38.90403221? 31.I40473413 29.547244557 28.949164335 39.7241476120 31.3.75983429 32.627410889 33.1.5344233 30.2V12S67SO 29.4051434697 39.434679 33.36994 5984 32.7$43"1299 3.5419041525 3L263490477 21.431163733 30.8940200031 34.75446440 35.153145979 31.0344711 35.974893953.

25.473111764 3s.361490542 35.767509460 34.544441223 36.64922790S 37.73277"442 24..411.S0 26..4$6292725 24. 439992476 2S.603431424 27.2347760773 24.S05004683 27. 304543160 25.32$43473) 2S.378625470 34.277304422 24.444741562 35.161421 25.732015930 25.473434354 24.842X7117 34.9333453 25.09740654 as. 2337999 34.40332239 26.030597487 24.713312594 34.4467376 26.617259979 27.4394462 2S.64443 38.19967106 27.2299434149 28.040772392 37.3.7319490 33.10420312 33.42350419 29.72178893S 30.2740767S& 3s.7299"3409 30.03644794 30.3.M244447 36.46354062 30.7303224I 31.37803492 30.247140503 3L.444432643 22204300745 32.033309965 30.0&15"2057 30.7430632.9 30.91350447 29.335635646 33.27346"793 28.07444 32.265411377 32.999441522 29.2271.03043 30.102979279 4 8. 2 44 so08 4 2 cs.* 0e 07 69.70768732 CISft 40 CA 0.1200 47.73439748 CYSR 40 hn 0.1400 47.909477334 CYSft 40 hn 0.1400 z 69.940788269 CISR 40 hk 0.100 70.62949839 CT~n 40 C' 0.2300 71.634971619 CISft 40 0 -0.3900 69.97954512 CIS& 40 C2 -0.3000 69.716011047 CTSa 40 ft 0.1000 49.33.7671094 CTSMI 40 1k 0.1140 IQ 71.67904d778 CISR 40 91 0.1000 11 76.3$047149? SIM 41 a -0.5000 12 71.3&.0294287 SCR 41C a .0.1.300 11 49.43322996 SWR 42 ha 0.3600 14 71.975842"0 SCR 41 6 0.1000 is 72.22"499639 SCR 41 C' 0.334 146 71.63990449 SCR 41 0* 3800 12 70.4800&90948 San 41 62 -0.1100 Is 49.704743&.4 825 41 ft 0.1000 19 49.841693860 SM 41 ft 0.1004 73.33913.336 SC 4L onk -0.3000 21 70.785003"2 SM 41 60 0.3500 22 73.464474440 GL! 43 0 -0.5000 22 74.497333.346 CL 43 09 0.0300 24 73.2,87F33043 IL! 42 On 0.3600 2S 74.394309996 CL! 42 A 0.3.000 26 7S.48392464" CLY 42 h 0.3.000 27 74.567SO9351 CL! 42 C* 0.3600 38 74.961143404 CL! 43 0' -0.334 39 74.32=5775. IS50 43 M -0.4300 74.1.40M7934 PO43 04 0.0400 i1 73.73343 43 0.1000 33 73.784043356 950 42 02 33 74'.S7US499 NO5 43 bk 0.1"0 24 72.92961921,33 43 1k 0.3000 3S 75.429033721MID 43 C' 0.3800 34 76.3273S4431 35O 43 0' .3600 37 73.057368304 125 43 CZ -0.3000 28 73.055461584150 43 ft 0.1000 29 73.051818048 150 43 h 0.3000 73.3342343 PM0 43 02 -0.2000 41 74.14M75903 PM0 43 k9 0.1.000 43 72.450388619 150 43 h 0.1000 42 75.533440366 125 44 a -0.4200 44 76.534265400 M2 44 8 0.0400 *4s 77.S39547696 M5 44 k 0.1000 46 74.44123439 95W 44 G2 0.0400 47 73.566935653 POO 44 1k 0.3000O 46 74.6073O5935 MW0 44 Ok 0.3.000 49 79.141L2363. 15W 44 C' 0.3800 S0 75.36444255 130 44 0' -0.34100 1 76.547779541 PM0 44 C2 -0.2000 52 76.0190090 35W 44 ft 0.2.to9 S) OC 0 *6 4 04 000eS0

S

*The numbering of the amino acids is shifted by minus 6 relative to the sequence SEQ ID No. 1 41 1452

CI

1402

CA

N

NA

C

0 Ca M82 M33

CA

C

a ell No

CA

w

C

0 co -3

CA

EL

CD

863 c MLi an 01

CA

us 0 )6.733722697 37 .05489349 17.50211$52: 37 25408173 3 0470062) 35 .0 1133 3466 34.4 7140S029 33. 065350096 36. 197729582 36 .133365519 33.615478516 233.490375519 33.511222076 33 .433117414 37.364499664 37t.345832703 34.503642169 39. 303600311 2311&2"&7 32I.509181791 40. 44IS550 39.10W40390 311.7905023&9 2 74814O37 401.32364320 311.793836365 39.93""0923 42.90002721 42 33844415 39712"43659 40.043342190 40.042076349 42.576651426 44 052474976 44:974434546 al.916359843 414149431 41.3574114,61 44.493455244 43.1832615 44.329039 4S. 2732.297G "4.5138L683 4:1.102409393 43 2028009 "3.31760406S 46.169"86725 45.654992110 46.40631864 47.710880280 44.30644521 47.8307306 4g.515542316 49.04159215 49.31S334320 50.433021$45 SO.773132334 29. 369605197 30. ii9005303 25. 45L32S49l 33. 17243S211 34.609930502 32.79924S291 34.699813843 35.4 14947510 35.5192054 20 3S.13%440826 36.157460927 34.9S4399155 3S.096365754 35.61366713 35 .07""7973 36.39549461L 36.83266449 37.23509979 37.05308 35.17904649 35.582756042 34.46061421 3415977328m 38.344066620 39.3934S&428 39.4531931@5 9.40174817 40.171451569 40.731719971 41.16116870 40.726497450 40.987442017 36.403935054 35.70385797 p8.8501853*4 37.474~741 37.74627234 34-73291095 35.820354462 40.12096296 37-28141.51 37 1234290229 39-5122031 3g.55414673 37 231112.50 2S.75"948015 4o.36622389 4..33251344S 40.089491142 41.$3701211 42.31324754 46.553461903 41.772S21973 39.763301645 39.310573576 35.310660260 3&.320864705 35.9&1941223 40.4230,164 7!.2i~l3J.)3i* PRO *4 7S.1S2b1540S PRO 44 C2 74.5.34155020 PR 4 h 7S.I1 S015545 P10 '4 h' 76.816978455 ALA 4S ft 76.449313750 ALA 45 C& 77.190728760 ALA 4S hn 75.34g3a4506 ALA 4S hi 77.090&4092# ALA 45 C' 78.2sS42213 ALA 45 0' 76.8311761$8 ALA 45 C3 74.517280579 ALA 4S h 74.338433L2 A&A 4S h1 77.932439S75 ALA 41 ft 76.306355S5 ALA 46 ft 75.433102197 ALA 46 ftf 74.764076333 ALA 46 68 77.656695093 ALA 46 ft 75.687S44211 "lA 46 0' 74.461193542 ALA 46 0' 77.1030G5451 MLA 46 03 77.S35073327 AWA 46 h 77.62944"021 AWA 46 IL 76.30506365 ALA 46 k 76.133790916 MA 47 at 75. 22576068" MA 47 es 77.149337765 MA 47 bft 74.1,96365356 MA 47 b 75.12690734 MZA 47 0' 71.8546124O5 WA 470a' 75.714275175 MA 47.93 71.059873458 MIA 47 h 75.71U342"6 A" 47 b 76.739311214 MA 47 h 74.s42019653 986 46 A 74.013555581 POD 46 ca 74.57705411 M8 46 ft 72.520225525 PW 46 02 732.87279510 M8 48 b 74.339131742 M46 b.

73,062609263 98W 46 C 73.4797363= 8W 40 2 74.33221U44 3W 46 5k 72.70056560 fm6 45 ca 71.63124169 VW 48 ft 71.573324060 V= 45 h 73.185453469 615 45 A 72.31455526 015 of 74.5357229 6549 ba 71.351181030 6CU 49 b 72.71313340 6GO 49 b 71.454037476 G0X 490a, 71.754951477 UK 49 so 71.0"36 254 NS SO a 70.943237305 IMS SO bft 70.37S061035 US5 SO ca 70.972137411 US2 50 "k 70.367AS2763 MIS SOS 65.175673791 US3 S 50 0.1000 54 -0.2000 0.1000 56 0.1000 S7 -0.3000 so 0.1200 59 0.2300 0.1000 6i 0.3600 42 -0.3600 43 -0.3000 64 8.1000 as 0.1000 64 0. 1000 67 -0.5000 66 0.3600 69 0.1300 0. 1000 71 0.3600 72 -0.3600 73 -0.3000 74 0.1000 0.1000 76 0.1000 -0.5000 76 0.1300 0.2800 s0 0.1000 as 0.3800 82 -0.3800 23 -0.3000 54 0.1000 as 0.1000 56 0.1000 37 -0.4300 as 0.0600 so 0.1000 t0 0.6600 91 0.1000 $2 0.1000 93 0.2800 94 -0.30 VS, -0.2006 9 *.16oo 97 0.31000 -0.2m0 9 0.1000 t00 0.1000 101 -0.1000 102 0.0200 103 0.2860 104 0.1000 101 0.0 106ooLo 0.3800 107 -0.3500 t66 -0.1000 105 0.3800 110 9.1m0 111 0.1000 2.3.2 0.3800 W.1 3600 114 42 e

S

5~ 9

S

S. S 4.

9* cc H862

MCI

C91 NE2 C02

NEI

KE2 M02

N

CA

Kh 502 0 301 203

CA

UK

a Wi on2 a cc mu =13 Cox

C&

0 a -a

UL

=a =31 vI

CA

g&.S5i776355 49.39033SO93 47.792594910 47.,976272SI 46.669251006 46.730144S01 47. g1167068S 44 .729323441 45 83067169 49.13529040S 49 78972$257 $1.307849084 53.7426153 so 980473555 SO.9,909463 4g9 97#06049 S3.739063263 53.706900453 3 666911742 s3.929205621 S2:439229734 S2 097048643 52 .790400543 S4*Sj"45007 55.7#6056924 9457M589325 54:414021932 55.261269082 55.65430415 66.7399234416 sf*.Z553&1 417.48&136292 57.4317317"0 56.952648924 u15.010104948 59.47saa263 F7.236072540 55.79730392 O5.51743901 53.99369047 S,9.22178?36 S4.41"113733 53.39650448 14.100524902 52.602260590 51.569202561 54.970031733 !14.9'346333 !55.742454529 55.500236511 152.52343as56 51.S36402557 So0. 80397339 53 .4782989S0 4.14699039 54.4563S9S39 50.13700104 3&.009521484 37.&1719207$ 29.9S65676483 *O.78SIO337~ 40.950614929 40.126420511 41.327060699 41.S443167 39 .961491009 40.071152251 40.596351349 41. 290510559 3t.702777313 36.60S394827 4@.07131S765 39.471420096 38.394466400 41.240936279 41.364253996 43.253"47919 40.349472046 39.56276990 44.92326350 29 .729749430 3$:.76446147 0.937012462 39.3a9927734 37.54000470 37.41112513 39.3$4763031 37.737205505 37.658962250 39.487993962 40.244640250 38.9369430$4 39.7357$2106 39.499894409 39.1711.12061 43,.00124359& 29.437013535 40 6473113G90 36.6420315669 35.4S14166016 37.00703510 35,773445129 34.9035033 34.28303105 34.364224924 33.449=14 34.720954*95 34.0"645752 34.§519321442 33.944232941 22.194515223 34.5&3732910 35,509193420 33.90415777S 34 .9737472S3 .9.132410125 7 HIS S0 C2 65.577232361 HIS S0Of ,9.2273101 1 HIS So f ,j7.95676074 IS S0 CS 67.913121 338 IS So ftP 6.29002230 IS 50 5 46.152232491 IS So P 66.9042 3$40 IS So a$ 66.517621523 HIS So ft a5.249315269 HIS 50 lif 66.7336292 HIS S0 ft 71.317932129 PRO 1 ft 71.1 49136 3S PRO 51 "a 70.412712097 P0W 51 t 72.7069702 3-S P RO St 2 73.313397522 PO St ht 7 3.0 1 9 5 4186 7 P R O S 1 1 70.80722046 M5 51 c, 71.4 883054 S PRO 51t 7,.S72446377 PRO 51 2 72,364352905 P0 51 ft 72545372192 M5 51 ft 73.547019958 10 S1 2 73.96231842 51D Sth 74.402717041 P5W S1 b 6946899414 LW 52 A 69.5702S9094 UN 52 C& 9.433866424 1zu N5 h 4.669346619 LW 52 ft 6.713757429 1SV 52 67.550910950 Lm 52 0, 70.751991272 L= 52 62 71.45663402 LWU 2 kt 70.37401634 UM 52 f 71,552939417 LW* 52 61 71.34617S15 LW 52 ht 73.359525217 LWU 52 3 73.46733821 LWV 53 kt 7.497505152 LW 52 kt 72.675750722 LM 52 bt 70.742620005 130 52 62 71.210292 LW 52 bt 70.445312500 LW 52 kt 69.81623305 LW 52 ft gq.215346582 =A 53 I 63,439259335 WA 53 G& 70.205220713 MZA 53 W 67.624333379 WA 13 b, 49,253744507 MIA 53 0' 65.65004414 MUA 530' 643294615173 AIA 53 C3 67.949613642 MA 52 kt g7.668003540 MTA 53 ft 69.162"9438 MA 53 bt 70.6032661 PRO 54 a 71.26637511 5M 546 70.573051970 PRO 4 f 71.60114270 p50 4 -2 71.717322303 PRO 54 bt 71.26494 9 4 P RO 54 fh 71.631500244 p50 S4 C.

-0 .2000 115 0.1000 1 0.1000 120 0.100 122 .0.1200 119 0.2700 120 -0.5000 125 0.0200 122 0.0300 127 0.2000 124 0.0600 129 -0.4200 130 0.000 127 0.3000 132 -0.0300 129 -0.2000 130 0.1000 122 0.26000 12 -0.3000 137 -0.2000 138 0.10010 135 -0.5000 136 -0.200 137 0.1000 142 0.1000 13 -0.3000 140 -0.300 141 -0.3300o 142 0.1000 143 0.1300 144 -0.3300 145 -0.2000 146 -0.3000 147 0.1000 146 -0.1000 149 0.1000 150 -0.3000 151 0.1000 152 0.1000 153 0.10006 154 -0.1006 156 0.1000 157 0.1000 153 0.1200 160 -a.2500 161 -0.3000 162 0.3600 163 -0.1300 164 -0.200 165 0.1000 166 0.1000 1671 0.1000 172 0.0600 170 0.1000 171 0.3600 172 43 9~ *e *9 0 co Hai Mf52

MCI

NC2

CA

KOU

C

0 x

CA

MA

1 0 m un 9=

CA

0 352 C21 m

CA

=I

N=2 0 ca mm -c 102 &C0.35L3511u59 Si. 866866 55 Si. 140216827 52. 2017 2S004 S3.*074 722290 52. 7422 7S2 38 53. 734ISIS 34 43.9$0717926 47.799011230 46..3242340 47. 533734802 46.8734671 47.63421023 47.184692393 47 .910079956 47.763894104 48 .177114334 49."02729797 49.04"642263 43.535470426 44.227344"0 46.77090018 ".9234734497 43.71551313 49.752750297 47.873317145 43.655212402 45,614233 44e014194449 44.212440491 43.43401044 44.146274567 44.719753615 43.577262375 44.24205394 42.6"522216 42.130551755 44.003615214 43.220763234 43.00507215 43*003445 43.55225077 41.224546614 41.228442720 43.4124156133 43.5764233102 44.640773773 42.62632mo3 42.06195601 43.5791504 42,782455444 41.54621.1243 43.067096710 42.553604126 43.922630310 42.156223297 41.146440778 43.024239624 43.$11478424 44.50376542S 34. 047100067 34 .32@012335 32.462340674 34.4S&513345 35.364300206 332.42775363 34 .251043357 34.6381625226 35.343022990 34 .220916164 36.34$740301 34.319246133 3S.361667433 37.541939301 36.06542053 37.261715750 36.43109355 37.457508650 37 .43*6*777* 37.698471632 37.009433144 38.431.644440 33.10353450 29.44"531522 35.415036136 34.579135 25.43415625 36.135774530 35.68293122 30.174320573 34.6250307 33.250703534 23.6065944166 33.724720001, 23.102317261 32.4038617?M 22.321348S72 32.9O952678 32.638732310 37.61,4246150 37.523991730 27.575752256 3709,601833813 27.47.43362 26.4676741070 36.6404164672 36442364651 39.325644224 3.652941731 33.956542.370 3S.59304035 35.934526351 3S.9001024333 ,;.70647U.5v PRO 5 72.-49711036.1 PRO C 73.313441113 PRO 54 h 72.207275391 PRO 64 h 72.92521667S PRO $4 C2 73.520271301 PRO S4 h 73.547462463 PRO S4 h 71.362225037 CLV 55 n 72.3S4167812 GtLV SS C9 71.33122253 CLT 55 hn 71.343481445 CLV 55 h 71.12508637S SLY 55 hi 73.830422241 GLY 55 C* 74.4111253 GLY 55 74.67351807 PRO 56 8 76.1627$0244 VING 56 C& 7S.54742033 No0 16 ft 74.154362300 PRO 56 CZ 73.3S009"704 F30 56 11 73.79341612 PRO 1k 74.41627191.77 1 56 a, 74.842826543 NSO 04 76.573451423 PRO 542 77.5467352 POO It 76.631267046 PRO 54 a 75.432636304 1W3 542 75.522354126 VW5 56 h 75.393.1144 VW0 SS h 74.811327148 315 S57R 74.450481306 316 S7 bR 77.3367433 313 S7 s 76.762603 313 57 ft 73.30,4235640 313 37 G' 79.742973322 313 570' 77.198186762331337 62 77.626487722 313 57 a 77.3222636 313 57 k 7S.77013004 313 57 05 74.G440041 S 57 Si 73.724327067 AMS 57 05 74.667606702 18 ST Up 75.423764485 US S7 08 72.70693246 38 17 11 73.5232260 5= 7 b~ 76.211022276 =5S7 b 73.314620572 NO5 s 80.71,320242 pm5 5e 62.62.3523621 ISO 53 b 79.235561,216 700 530G2 77.725382060 VW0 SO h 77.743665553 900 SO h 8L.747703552 13W S380 31.766304016 POD SO 0' 30.563407636, O5 562 31.445323435 VW SO k 80.2352720947 M3 56 b 73.332323340 M3 53062 73.6122343 13D 58 k 73.671760206 M3 53 b 82.617271423 ASA SO u 32.1S6S83050 LEA S3 bn 0.1000 173 0.1000 179 -0.2000 0.1000 1&1 0.1000 162 -0.5000 133 0.0200 184 0.2300 135 0.1000 184 0.1000 107 0.2300 m8 -0.3300 189 -0.4200 130 0.0400 lot 0.1000 192 0.0466 13 0.1000Q 194 0.1000 195 0.3800 104 -0.3800 197 -0.2060 1os 0. 1600 Ito 0.1000 200 -0.2600 201 0. 1000 202 0.1000 203 -0.5000 204 0.2860 205 0.1200 204 0.1000 207 0.3800 208 -0.38006209 -0.2000 210 6.1600 a11 0.1000 212 0.1000 213 -0.4200 314 0.2700 2.15 -0.5000 216 0.0100 217 0.1200 216 0.2800 21 6.14300 220 -0.4200 221 .060 232 0.1000 223 0.0400 234 0.2.600225 0.1000 224 0.3600 227 -0.3600 223 -0.300 22" 0.1000 230 0.1000 232.

-0.2000 332 0.1000 222 o.1000 234 -0.5600 0.2800 236 a. 44 0a S

S

4* S

CA

KA

C

0

CS

Hal M32 3

CA

MA

C

0 ca .53

CA

KA

IM2

CA

0 mu ma ca

CA

w Sh

C

0

CS

42.913761119 42.154701222 42. 131308746 42. 459964752 44.063701630 43.70641052 44.503014160 44.883900228 41. 178901472 41.L13032917 40. 169502716 40. 006514 404 3a.GLuOLOa*7 37.681935938 40.74624"a7 39.997776031 4L.624504089 41.019444885 38.66021946 37.398490906 36.485267639 29. 953070418 4.5909542 3 .56453751 27.256782533 36.343216650 M7477272834 36.9641925L 36.96125754 39.972$12921 29.40916064 39e1U329920G 38 .212741202 38. 14496311 39.689M604 27 .892218M3 37.085021973 37.382484434 39.363152632 29.601100922 40.317090924 39.954036330 39.157264709 25.653912324 34.68157990 35.73422632 34 .978876021 34.*024967665 23.624335834 33.674S41473 34,1=307697 33.3020"7694 32.576236725 22.004390912 33.852432964 33.070664"31 34.153343201 33.375730973 21.526346307 30.936735153 3 *496636517 ).;.928112030 341350155 35.481448201 1123394 33.966839651 32. 104522705 33.503505707 34.4 23902740 26. 323104995 36.562049844 36.803413391 35.99174269 37.03780746S 36.301105499 37.961549927 39.372333527 37.670467377 328630841064 37.922316323 37.873673S76 37.839759827 39,0015"43" 38.6533776 29.70074""4 36.7000214"4 36.657413463 39.25"717663 39.296637390 40.0144885 39.562190493 29.034259794 40.640045166 3S.75344363 34.60020832 25.69752.93 34.983073094 33.524326334 33.625640760 22.9943532L3 33.242325462 34.75931922 23.297904643 32.922677698 33."43447476 22.693772125 34.507610321 32.281942344 21.96300064 32.4431223 23.9374S$039 34.61435499 34.594402212 23.30&517487 22.604425344 30.677625454 29.7094U5434 30.425497284 29.6 40501785 29 .9530698 29.911304381 25. 252068753 $3.544029236 A LA S9 c.& 62.997920298 ALA 59 h 84.821102696 ALA 19 C' 65.945452464 ALA S9 0.

83.858291636 ALA 19 C) 84.478195190 ALA St h 82.9441322314 ALA S9 h 54.432613416 ALA 53 h 34.577079773 ALA 60 n 83.573013304 ALA 60 hn 85.571857433 AMA 40 CA 64.30281899 ALA 60 ft 64.60046367 ALA 40 c6 35.3052744 ALA 40 0' 6.401313732 ALA 40 63 37.1653&372 ALA "0 k 66.994170044 ALA 40 h 65.774902244 ALA 40 h 93.526889038 PRO 61 a 82.9586343.82 NO 61 a& 82.S76164346 6W 1 k 63.440945139 PRO 61 63 62.21111450 PM 1 k 84.247795105 PUS 61 6 31.909325815P 41 00 61.209106445 no0 41 00 i2.211460452 m 61 03 81.390761742 PRO 61 b 82.90677628 PmO 61b 82.163795471 6m 1 02 41.2536245786 61 h 62.832295227 PO 41 k 31.804442259 822 62 a "0.44340332012 63R 4 a 83.434690747 6 2 Mo 79.856529226 822 62 k 61.373221506 S5 62 ad 63.070343013 6 2 0 60.7605=3306 622 62 03 79.9490509,03 322 62 b 60.47599561 63 92 3.984091614 6M 2 oh 82.314406250 835 63 he 80.7489013M 6253 G&.280097561M 4309 690.2006772 6 3 ba 32.155424377 6M 3 k 90.21446516 83 43of 79.12435778 620of 31.52.55775 522 62 03 62.533943059 322 63 k 51.003764180 8EU 63 ft 32.47158456232 6 3 oh 31.807703740 522 63 ho 30.536045332 MR 645a 79.732810974 WE "6as 61.506057739 UP 44 ba 79.674745442 UP "4 b 79.316452026 UP 64 ct 20.9"0970432 URP 640f 60d@S642S7&1 UPF 64 02 0.1200 23' 0.1000 218 0.3200 239 -0.3600 240 -0.3000 241 0.1000 242 0.1000 243 0.1000 244 -0.5000 245 0.2800 246 0.1300 347 0.1000 24S 0.3600 249 -0.3400 350 -0.3000 311 0.1000 252 0.1000 252 0.1000 354 -0.4300 355 0.0400 354 0.1000 357 0.0600 256 0.1000 219 0.1000 340 0.3600 341 -0.3800 262 -0.2000 263 0.1000 34 0.1000 365 -0.3000 264 0.1000 367 0.1000 326 -0.5000 269 0.1200 270 0.3500 271 0.1000 273 0.3800 273 -0.3600 274 -0.1700 375 0.1000 276 0.1000 277 -4.3800 270 0.3100 279 -*.5000 230 0.1200 231 0.2500 323 0.1000 23 0.3600 284 -0.38"0 285 -0.1700 26 0.280" 257 0.1000 256 -0.2300 289 0.2900 290 -0.5000 291 0.1200 292 0.2300 293 0.1000 294 0.3600 295 -0.300 296 -0.2000 297 45 9* 9.

9 *9 9.

9 9* .9 .9 a .9 9.

9* m352

CG

col fc2 C02 Rol

MCI

Kc3 CZ2 UZ3 a Nza

CA

RA

co

XWI

0 co

WII

CA

w -3 0 Em ma im CD1 22.936897276 34 .545L2116' 33. 37233702 )2.226022949 32. 442039490 33.734771729 34.321319427S 31.30150893S 31.75146$419 35.62)460999 36.044209344 35. 338202430 37.342415471 36.716292S72 25.22475)04 5 34.449055176 34.023626556 30.864126463 29.*423704376 31.49044227 6 29.049406160 29.391=83498 38.566276950 as.4676S372 27.9190*76920 27.254581451 361*00720406 27.93L732178 27.64U4227 239.930458063 35."s14435 25.2344"0367 af.047063253 29421696091 27.743922546 26.819997253 678761391 27.0576596 25.76413343 24.576"562 26.47452572 24.437746044 23,25636266 23.2196225 24.90017509 25.5071715 25.10516296 23.'4731542 2.124127578 O.7859022 20.877&123 22.16M409375 23.6225620145 22.7232985S 20.1903U42 20 .55674432 20.,03347SB76 Is5.9400577S$ .123"422 0 657762.307 .234010496 27.55051231; 25. 11000442S, 27. 755053045 27.196472977 26.920638 113 37. 365074 158 27.8521957A 27.011001187 26.S133096770 35 .4 10655975 28.812973023 38.4013285 3S.8000631,80 27.887487411 27.891325525 27.397534637 26.975828430 30.2S3109007 30.58923426 30.324731827 30-927153151 31.462034225 39.43225O8 29.383417130 25.52005778 27.39706U49 26.74V544144 35.547025681 29.3.5265263 2a.2309747 27.540506362 28.49605641.

26.4875&9403 25.413533229 25.768"0661 27.505301340 37.974979401 27,053478241 26.424428447 29*"6564673 25.892445783 27.7014007 29.13027754 24.90492630 25.510905432 26.1719649297 24.76232372 25.844451904 26.695683299 24.297637097 25.604245640 38.3640S541 28.901371002 25.4311.74065 25.59393242 24.45&507548 27.482673096 27.449979752 27.455350043 28 .745070491 29.0172.92841 ?9.4;22;s453 TRP h 79.7ta 7 290112 TRP 64 It 61.551361084 TVs 64 cs 52.145233372 7*SP 64 C5 83.513213888 Tar 54 lnP $3.710177380 TSP 64 CS 53.561556934 Totp 54 'es 81.62237S4$4 TRP 64 h~ 54.193108114 TS.P 44 hAE 83.181643151 Tap 54 Op 81.655943054 TSP 64 h 83.745301477 TSP 64 CP 52.g&6780090 TSP 64 1 64.9S61139097 TSP 64 CP 81.875114441 73? 54 ft 54.959493909 73.9 54 OPP 85.68452973 TSP 64 ft 75.673030105 CLV 61 a 78.6257O5828 LU -45 Of 77.531860107 OW! 5 bI 79.604759215 CL! 65 h 77.99797"73 GL! 45 ft 76.049254552 GU! 9SC' 76.8209=182 CL! 65 0' 79.83"841 6 78.264295849 VW 665 77.67401886" 30 66 k1 80.307373047 VW 56 96.72796919 Pm66* 806435369 PRO ft 77.3676374 W. 66 77.550445557 PUS66 "9.50168762 NOS 462 79.730659418 46 b 80.7135656 1w 66 At 81.06744588 no0 66 *1 76.406606582 CWS 67 a 75.513832642 CfU 6708& 76.320016"7 CM 67 MR 75.252099609 Cro 67 At 76.&74392700 CUS CT 0 74.U16907316 CU 67 Of 74.26044464L CU 67,02 73.749794006 CU 67 *1 74.522329& CU 67 IL 73.&332224 CC$ 67 @1 76.264391409 V1W 6483 79.5"3960933 VW 686 77.3005625884 P" k8 76.422.9.3.92 M 46863 75.585960388 MW 68 k 77.34523=285 PXD "5 k 7S.255737205 1W 686' 74.9544132.47 VOI 4 08' 77.173645020 PW 46562 77.017181396 M3 "8 b 79.272S4675 1W 65 b1 76.604203500 PW 66 2 7S.922743635 MW 66 b1 0.1000 251 0.1000 295 0.0000 200 0.0100 301 -0.5000 302 0-1100 303 0.0000 304 0.1000 305 0.3800 306 -0.1000 307 0.1000 308 -0.1000 309 0.1000 210 -0.1000 311 0.1000 313 1600 313 0.1000 214 215 0.0200 316 0.2800 217 0.1000 all 0.1000 213 0.3500 320 -0.3800 321 -0.4300 323 0.0600 33 0.1000 24 0.0600 325 0.1000 26 0.1000 327 0.3800 32 -0.3800 333 2000 330 0.1000 331 0.1000 222 -o.2000 222 0.1000 334 0,1000 225 -0.2000 336 0.130 327 0.VI00 328 a.1000 339 0.2000 240 -0.3800 341 -0.2000 342 0.1000 343 0.100 244 0.1000 345 -o.4;00 246 0.0600 247 0.1000 348 0.0600 349 0.1000 350 0.1000O 351 0.3800 352 -0.3500 253 0.2000 3S4 0.1000 355 0.1000 3156 -0.2000 357 0.1000 355 9 46 9* 9 *8 p .9 9. 0* 9 9 9* *9 9 9* 9 9* 9. p.

CA

MA

0 cS K@2 co Hot xa

WI

-32

=I

MLI

Ua am a an 9=

CD

=1 3M es M122 cc 20.5stsl225 13. 3970G9550 19.72794S328 18.8948849 19.469439102 18. 426181793 17. 30241775S 17 .46771667S 17.790594 101 16. 74 2153260 14.0@4570053 14.5006345 17.$3184478 15 74314 117 L.S.99@2*453' 14.90237436 14 .86S127542 L5.293711642 13.6454463 .33.127552U' 02."6808821 12.18411021 12.36479546 L2.00840187 32.4054447 19*43033730 6 13.216965102 20.3Z7522954 19.&2377319 20.63015L2L3 21.2677214 L8.102061) 16.124477615 17.13977&27 17.94414403 18.23171737? 18.486578751 16.51"o0712 16.205235S L5.80439934 16.394249525 16.283333 14A.27032 14.13"342604 16.09778974 16.02082442 19.295974731 16.13531262 16.423920972 23.213326025 U1.9"232164 22.0275442S0 22.727042225 U3.2309"442 23.430524537 2I.52325053 20.394127274 22.3513892 21.221226120 23.392500595 24.110603333 29.62355-230 26.226366043 25.594141006 27.074655533 24. 639830671 26466302 27.170328140 24.741283417 24.038330073 25.409061432 23.230654 526 24.64G63559 23.23S559872 23.148350921 a2.237429374 23.8320600?7 22.52148032 22.5071307S 31.330354024 3U.522832870 21.608518600 21.122523S20 21.4674341 21.462950162 22.25"142503 26 .3660042.6 21.7843605 26.52093576 27.0&30253$4 38.39764623 27.342306152 .28.7533"&454 233289"81 219.13S446540 25.95235306 29.920405241 33.737546"0 3G.52$03323 30.81221438? "3.7243938 31.932"5383 2L.41357713 22.321114137 32.75S31490 321.25224315 24.751853202 23.42803420 34.426043562 31.73272340? 23.5013083 29.991484909 M4.49150542 35.601654053 25030534 30.105148315 26.107931937 29."0001444 30.740639733 31.452799606 30.83220517 30.7"0416031 77.265G.402SI PRO fil h 74.46020$075 ARC. 69n 73.223573657 ARG. 49 C& 74.874603271 ARC. 49 lui 72.733027039 ARC. 49 ft 72.12784S764 ARC. 69 C' 72.057307104 AC' 49 0' 73.644$401001 Ana# 49 C2 74.447227475 ARC.* 43 h 74.113343341 ARC* 63 ft 72.510340552 AM.* #3 c2 71.70215234% ARC. 43 h~ 72.052100554 AM.* 43 h 73.0074S2918 AM+ 43 C2 73.738624S73 AAM. 43 b 73.954016113 AM. 3* 3 71.855872108 AFM; 63 ml 70.32602331 AND# 63 RA 71.902374268 AM+ 60 cc 70.73361 AM'# 63 R2 3.9468525239 AM.# 63 ho 70.s3311118 Am# do hn 73.0004623 &AGO 49 U2 73.352254421 AM.# 63 bn 72.631558228 AM# 63 10 71.372284034 AW 70 n 70.016307554 AM04- 0 as 71.527733864 AM'1 70 In 63.341793401 AM.S 70 h d3.572241370 AM. 70 al 64.5S3154944 AWO 7 ll 49.73667543 AM'Z 7002 "8.734"75133 AM. 70 ft 63.8161540 AM$ 70 k 7".76723452 AID+ 70 2 71.7523571 ANM. 70 b 70.522433325 AM. 70 b 70.757433695 AM# 70 62 59.722438169 Am. 70 a 71.041206268 AM+ 70 k 71.181512S &MCI#- A0l 72.73440973 AM. 70n.

71.475237055 AjM. IS O0 72.47034103 AM.I 70 112 72.48723440 ASM "3 h 72.242814744 AM.+ 700No 70.262794435 AM4+ 70 63 70.4257046 AM* 70 10 43.52725127 AM.+ 70 ha 70.10453303 TM 713R 63.31336533G TM 710M 71.343724365 T!M 7&1a 71."467373. 71 k 72.463772M8 TIM 710'* 73.11335S400 TIM 71 ol 73.272973137 TIM 71 oft 74.046843125 TUC 71 ho 71.40204311 TMU 71 02 71.2357349 TV= 71 b 72.42045533 TIM 71 ft 70.402530261 AlU 71 cp 0.1000 259 -0.5000 140 0.1200 241 0.2500 32 0.1000 363 0.3800 34 -0.3800 365 -0.2000 344 0.1100 347 0.1100 360 -0.2000 369 0.1300 370 0.1200 371 -0.0300 372 0.1300 373 0.1300 374 -0.5000 37S 0.3600 376 0.4500 377 -0.5000 378 0.3400 379 0.3400 280 -0.S000 381 0.3400 382 0.3600 33 -0.5000 34 0.1.200 285 0.3800 384 0.1000 3? 0.3800 266 -0.3800 323 -0.2000 0.1100 31 0.1100 321 -0.3M 393 0.1300 394 0.1200 -0.0300 34 0.1200 37 0.1200 36 -0.5000 33 0.3400 400 0.4500 401 -0.9000 402 0.3600 403 0.3500 404 -0.5000 405 0.3600 404 0.3600 407 -0.5000 408 0."*00 403 0.1200 410 0.1000 411 0.4100 412 -0.2300 412 -0.2800 414 0.3500 415 -0.2000 416 0.1000 417 0.1000 413 0.0000 413 ~9 9*~999 47 22.9330772S 22.977622986 24.98$3843 24.833002090 26.2z7394104 27.26S848160 26. 966624750 24.415199280 27.277700806 25.36098400 25.52184677 1 )i~.274461746~ 31.679159164 21.264329910 31.650396347 20. 7570V1522 30.762793977 21. 154280798 20. 25191725 29.8524379 30.253S71918 29.44"44640 69.111869812 68.809974670 64.20120iS7S 67.203536987 68.577186534 67.686424255 66.862937378 69.l8599852 70.147377034 70.770927429 71.780574341 -VR: 71 rYRC 71 ytC 71 rrRtC 71 TIRtc 71 yjtC 71 TV= 71 mrC 71 TTUC 71 yTCw 71 TV=C 71 -0.1000 0.1000 -0.1000 0. 1000 0.80200 -0.2800 0. 2500 -0.1000 0. 1000 -0.1000 0. 1000 9.

9 *0 9.

9 9 9* 99 a 9 9* 9. 9 9 99 *9 9 9 .4 9c 9.99..

9 99t*~9 9 9* 9.

99999

Claims (12)

1. A therapeutic composition having immunosuppressant activity characterized in that it comprises a soluble polypeptide fraction consisting of all or part of at least one of the 4 immunoglobulin type extra-cellular domains of the LAG-3 protein (amino acid 1 to 149, 150 to 239, 240 to 330 and 331 to 412 of sequence SEQ ID No or of a peptide sequence derived o from these domains by replacement, addition and/or deletion of one or more amino acids, and which possesses a specificity at least equal to that of LAG-3 for its ligand.

2. The use of a soluble polypeptide fraction 15 consisting of all or part of at least one of the 4 immunoglobulin type extra-cellular domains of the LAG-3 protein (amino acid 1 to 149, 150 to 239, 240 to 330 and 331 to 412 of sequence SEQ ID No or of a peptide sequence derived from these domains by replacement, addition and/or deletion of one or more amino acids, and which possesses a specificity at least equal to that of LAG-3 for its ligand, for the preparation of a therapeutic composition having immunosuppressant activity.

3. The use of antibodies raised against LAG-3 or against soluble polypeptide fractions, consisting of all or part of at last one of the 4 immunoglobulin type extra-cellular domains of the LAG-3 protein (amino acid 1 to 149, 150 to 239, 240 to 330 and 331 to 412 of sequence SEQ ID No 1) or against a peptide sequence derived from these domains by replacement, addition and/or deletion of one or more amino acids, and which possesses a 49 specificity at least equal to that of LAG-3 for its ligand, or fragments of the said antibodies, for the preparation of a therapeutic composition having immunostimulatory activity.

4. The use according to Claim 3, wherein said antibodies are monoclonal antibodies or fragments of these antibodies, namely the Fab, Fab' or F(ab') 2 fragments. the use according to Claim 4, 10 characterized in that said antibodies are bound to a cytotoxic molecule or a radioisotope. 9 9

6. Anti-idiotype antibodies containing the internal image of LAG-3, raised against antibodies such as defined in Claims 1 to 15

7. A therapeutic composition comprising anti- idiotype antibodies according to Claim 6.

8. A soluble polypeptide fraction consisting of all or part of at least one of the 4 immunoglobulin type extra-cellular domains of the LAG-3 protein (amino acids 1 to 149, 150 to 239, 240 to 330 and 331 to 412 of sequence SEQ ID No.l), wherein one or more arginine (Arg) residues at the positions 73, 75 and 76 of sequence SEQ ID No.l are substituted with glutamic acid (Glu).

9. A soluble polypeptide fraction consisting of all or part of at least one of the 4 immunoglobulin type extra-cellular domains of the LAG-3 protein (amino acid 1 to 149, 150 to 239, 240 to 330 and 331 to 412 of sequence SEQ ID No.l), or of a peptide sequence derived from these domains by replacement, addition and/or deletion of one or more amino acids, and which possesses a specificity at least equal to that of LAG-3 for its ligand, wherein the polypeptide sequence of I_ i_ itL;i-~-iCL_.ili .I-..tilll -iLI_.I.~I~I_^I~II~IIP~L~LLL~ 50 LAG-3 further comprises a supplementary peptide sequence at its C-terminal and/or N-terminal end, so as to constitute a fusion protein. A soluble polypeptide fraction according to Claim 9 characterized in that it is further bound to a toxin or a radioisotope.

11. A soluble polypeptide fraction according to one of Claims 9 or 10, characterized in that the polypeptide region of LAG-3 comprises a portion of an 10 immunoglobulin.

12. A soluble polypeptide fraction according to Claim 9, characterized in that the immunoglobulin is of IgG4 isotype.

13. Method of production of soluble polypeptide fractions according to Claim 11 or Claim 12, character- ized in that the fragments of cDNA coding for the polypeptide regions corresponding to LAG-3 or derived from LAG-3, where appropriate after amplification by PCR, and the cDNA coding for the relevant region of the immunoglobulin, this cDNA being fused with cDNA coding for the corresponding polypeptide regions or derivatives of LAG-3, are inserted into a vector, and in that, after transfection, the fragments of cDNA are expressed in an expression system, in particular mammalian cells, for example hamster ovary cell.

14. A Method of production of antibodies according to Claim 11 or Claim 12, characterized in that a cleavage is carried out of a LAG-3/immunoglobulin conjugate constructed so as to contain a suitable cleavage site. Dated this 12th day of November 1999, Institut Gustave Roussy AND Institut National de La Sante et de La Recherche Medicale (INSERM) AND Applied Research Systems ARS Holding N.V. By their Patent Attorneys Davies Collison Cave