AU4793199A - (chlamydia) antigens and corresponding dna fragments and uses thereof - Google Patents

Description

WO 00/06741 PCT/IB99/01330 CHLAMYDIA ANTIGENS AND CORRESPONDING DNA FRAGMENTS AND USES THEREOF RELATED U.S. APPLICATION The present patent application claims priority to United States provisional patent 5 applications U.S.S.N. 60/094,192, filed July 27, 1998, and U.S.S.N. 60/122,044, filed March 1, 1999. FIELD OF THE INVENTION The present invention relates to Chlamydia antigens and corresponding DNA molecules, which can be used in methods to prevent and treat disease caused by Chlamydia infection in 0 mammals, such as humans. BACKGROUND OF THE INVENTION Chlamydiae are prokaryotproes. They exhibit morphologic and structural similarities to gram negative bacteria including a trilaminar outer membrane, which contains lipopolysaccharide and several membrane proteins. Chlamydiae are differentiated from other 5 bacteria by their morphology and by a unique developmental cycle. They are obligate intracellular parasites with a unique biphasic life cycle consisting of a metabolically inactive but infectious extracellular stage and a replicating but non-infectious intracellular stage. The replicative stage of the life-cycle takes place within a membrane-bound inclusion which sequesters the bacteria away from the cytoplasm of the infected host cell. 0 Because chlamydiae are small and multiply only within susceptible cells, they were long thought to be viruses. However, they have many characteristics in common with other bacteria: (1) they contain both DNA and RNA, (2) they divide by binary fission, (3) their cell envelopes resemble those of other gram-negative bacteria, (4) they contain ribosomes similar to those of other bacteria, and (5) they are susceptible to various antibiotics. Chlamydiae can be seen in the 5 light microscope, and the genome is about one-third the size of the Escherichia coli genome. Many different strains of chlamydiae have been isolated from birds, man, and other mammals, and these strains can be distinguished on the basis of host range, virulence, WO 00/06741 PCT/IB99/01330 pathogenesis, and antigenic composition. There is strong homology of DNA within each species, but surprisingly little between species, suggesting long-standing evolutionary separation. C. trachomatis has a high degree of host specificity, being almost completely limited to man; it causes ocular and genitourinary infections of widely varying severity. In contrast, 5 C. psittaci strains are rare in man but are found in a wide range of birds and also in wild, domestic, and laboratory mammals, where they multiply in cells of many organs. C. pneumoniae is a common human pathogen, originally described as the TWAR strain of C. psittaci, but subsequently recognized to be a new species. C. pneumoniae is antigenically, genetically, and morphologically distinct from other Chlamydia species (C. trachomatis, 10 C. pecorum and C. psittaci). It shows 10% or less DNA sequence homology with either of C. trachomatis or C. psittaci and so far appears to consist of only a single strain, TWAR. C. pneumoniae is a common cause of community acquired pneumonia, less frequent only than Streptococcus pneumoniae and Mycoplasma pneumoniae. Grayston et al., J. Infect. Dis. 168: 1231 (1995); Campos et al., Invest. Ophthalmol. Vis. Sci. 36: 1477 (1995), each 15 incorporated herein by reference. It can also cause upper respiratory tract symptoms and disease, including bronchitis and sinusitis. See, e.g., Grayston et al., J. Infect. Dis. 168: 1231 (1995); Campos et al., Invest. Ophthalmol. Vis. Sci. 36: 1477 (1995); Grayston et al., J. Infect. Dis. 161: 618 (1990); Marrie, Clin. Infect. Dis. 18: 501 (1993). The great majority of the adult population (over 60%) has antibodies to C. pneumoniae (Wang et al., Chlamydial Infections, Cambridge 20 University Press, Cambridge, p. 329 (1986)), indicating past infection which was unrecognized or asymptomatic. C. pneumoniae infection usually presents as an acute respiratory disease (i.e., cough, sore throat, hoarseness, and fever; abnormal chest sounds on auscultation). For most patients, the cough persists for 2 to 6 weeks, and recovery is slow. In approximately 10% of these cases, 25 upper respiratory tract infection is followed by bronchitis or pneumonia. Furthermore, during a C. pneumoniae epidemic, subsequent co-infection with pneumococcus has been noted in about half of these pneumonia patients, particularly in the infirm and the elderly. As noted above, there is more and more evidence that C. pneumoniae infection is also linked to diseases other than respiratory infections. -2- WO 00/06741 PCT/IB99/01330 The reservoir for the organism is presumably people. In contrast to C. psittaci infections, there is no known bird or animal reservoir. Transmission has not been clearly defined. It may result from direct contact with secretions, from formites, or from airborne spread. There is a long incubation period, which may last for many months. Based on analysis of epidemics, 5 C. pneumoniae appears to spread slowly through a population (case-to-case interval averaging 30 days) because infected persons are inefficient transmitters of the organism. Susceptibility to C. pneumoniae is universal. Reinfections occur during adulthood, following the primary infection as a child. C. pneumoniae appears to be an endemic disease throughout the world, noteworthy for superimposed intervals of increased incidence (epidemics) that persist for 2 to 10 3 years. C. trachomatis infection does not confer cross-immunity to C. pneumoniae. Infections are easily treated with oral antibiotics, tetracycline or erythromycin (2 g/day, for at least 10 to 14 days). A recently developed drug, azithromycin, is highly effective as a single-dose therapy against chlamydial infections. In most instances, C. pneumoniae infection is mild and without complications, and up to 15 90% of infections are subacute or unrecognized. Among children in industrialized countries, infections have been thought to be rare up to the age of 5 years, although a recent study has reported that many children in this age group show PCR evidence of infection despite being seronegative, and estimates a prevalence of 17-19% in 2-4 years old. See, Normann et al., Acta Paediatrica, 87: 23-27 (1998). In developing countries, the seroprevalence of C. pneumoniae 20 antibodies among young children is elevated, and there are suspicions that C. pneumoniae may be an important cause of acute lower respiratory tract disease and mortality for infants and children in tropical regions of the world. From seroprevalence studies and studies of local epidemics, the initial C. pneumoniae infection usually happens between the ages of 5 and 20 years. In the USA for example, there are 25 estimated to be 30,000 cases of childhood pneumonia each year caused by C. pneumoniae. Infections may cluster among groups of children or young adults (e.g., school pupils or military conscripts). C. pneumoniae causes 10 to 25% of community-acquired lower respiratory tract infections (as reported from Sweden, Italy, Finland, and the USA). During an epidemic, -3- WO 00/06741 PCT/IB99/01330 C. pneumonia infection may account for 50 to 60% of the cases of pneumonia. During these periods, also, more episodes of mixed infections with S. pneumoniae have been reported. Reinfection during adulthood is common; the clinical presentation tends to be milder. Based on population seroprevalence studies, there tends to be increased exposure with age, 5 which is particularly evident among men. Some investigators have speculated that a persistent, asymptomatic C. pneumoniae infection state is common. In adults of middle age or older, C. pneumoniae infection may progress to chronic bronchitis and sinusitis. A study in the USA revealed that the incidence of pneumonia caused by C. pneumoniae in persons younger than 60 years is 1 case per 1,000 persons per year; but in the 10 elderly, the disease incidence rose three-fold. C. pneumoniae infection rarely leads to hospitalization, except in patients with an underlying illness. Of considerable importance is the association of atherosclerosis and C. pneumoniae infection. There are several epidemiological studies showing a correlation of previous infections with C. pneumoniae and heart attacks, coronary artery and carotid artery disease. See, Saikku et 15 al., Lancet 2: 983 (1988); Thom et al., JAMA 268: 68 (1992); Linnanmaki et al., Circulation 87: 1030 (1993); Saikku et al., Annals Int. Med. 116: 273 (1992); Melnick et al., Am. J. Med. 95: 499 (1993). Moreover, the organisms has been detected in atheromas and fatty streaks of the coronary, carotid, peripheral arteries and aorta. See, Shor et al., South African Med. J. 82: 158 (1992); ; Kuo et al., J. Infect. Dis. 167: 841 (1993); Kuo et al., Arteriosclerosis and Thrombosis 20 13: 1500 (1993); Campbell et al., J. Infect. Dis. 172: 585 (1995); Chiu et al., Circulation 96: 2144-2148 (1997). Viable C. pneumoniae has been recovered from the coronary and carotid artery. Ramirez et al., Annals Int. Med. 125: 979 (1996); Jackson et al., Abst. K121, p272, 36th ICAAC, New Orleans (1996). Furthermore, it has been shown that C. pneumoniae can induce changes of atherosclerosis in a rabbit model. See, Fong et al., (1997) Journal of Clinical 25 Microbiolology 35: 48. Taken together, these results indicate that it is highly probable that C. pneumoniae can cause atherosclerosis in humans, though the epidemiological importance of chlamydial atherosclerosis remains to be demonstrated. A number of recent studies have also indicated an association between C. pneumoniae infection and asthma. Infection has been linked to wheezing, asthmatic bronchitis, adult-onset 30 asthma and acute exacerbation of asthma in adults, and small-scale studies have shown that -4- WO 00/06741 PCT/IB99/01330 prolonged antibiotic treatment was effective at greatly reducing the severity of the disease in some individuals. Hahn et al., Ann Allergy Asthma Immunol. 80: 45-49 (1998); Hahn et al., Epidemiol Infect. 117: 513-517 (1996); Bjornsson et al., Scand JInfect Dis. 28: 63-69 (1996); Hahn, J Fam. Pract. 41: 345-351 (1995); Allegra et al., Eur. Respir. J 7: 2165-2168 (1994); 5 Hahn et al., JAMA 266: 225-230 (1991). In light of these results, a protective vaccine against disease caused by C. pneumoniae infection would be of considerable importance. There is not yet an effective vaccine for human C. pneumoniae infection. Nevertheless, studies with C. trachomatis and C. psittaci indicate that this is an attainable goal. For example, mice which have recovered from a lung infection with 10 C. trachomatis are protected from infertility induced by a subsequent vaginal challenge. Pal et al., Infection and Immunity 64: 5341 (1996). Similarly, sheep immunized with inactivated C. psittaci were protected from subsequent chlamydial-induced abortions and stillbirths. Jones et al., Vaccine 13: 715 (1995). Protection from chlamydial infections has been associated with Th1 immune responses, particularly the induction of INFy-producing CD4+ T cells. Igietsemes et al., 15 Immunology 5: 317 (1993). The adoptive transfer of CD4+ cell lines or clones to nude or SCID mice conferred protection from challenge or cleared chronic disease (Igietseme et al., Regional Immunology 5: 317 (1993); Magee et al., Regional Immunology 5: 305 (1993)), and in vivo depletion of CD4+ T cells exacerbated disease post-challenge (Landers et al., Infection & Immunity 59: 3774 (1991); Magee et al., Infection & Immunity 63: 516 (1995)). However, the 20 presence of sufficiently high titres of neutralizing antibody at mucosal surfaces can also exert a protective effect. Cotter et al., Infection and Immunity 63: 4704 (1995). The extent of antigenic variation within the species C. pneumoniae is not well characterized. Serovars of C. trachomatis are defined on the basis of antigenic variation in major outer membrane proteins (MOMP), but published C. pneumoniae MOMP gene sequences show 25 no variation between several diverse isolates of the organism. See, Campbell et al., Infection and Immunity 58: 93 (1990); McCafferty et al., Infection and Immunity 63: 2387-9 (1995); Knudsen et al., Third Meeting of the European Society for Chlamydia Research, Vienna (1996). Regions of the protein known to be conserved in other chlamydial MOMPs are conserved in C. pneumoniae. See, Campbell et al., Infection and Immunity 58: 93 (1990); McCafferty et al., 30 Infection and Immunity 63: 2387-9 (1995). One study has described a strain of C. pneumoniae with a MOMP of greater that usual molecular weight, but the gene for this has not been -5- WO 00/06741 PCT/IB99/01330 sequenced. Grayston et al., J. Infect. Dis. 168: 1231 (1995). Partial sequences of outer membrane protein 2 from nine diverse isolates were also found to be invariant. Ramirez et al., Annals Int. Med. 125: 979 (1996). The genes for HSP60 and HSP70 show little variation from other chlamydial species, as would be expected. The gene encoding a 76 kDa antigen has been 5 cloned from a single strain of C. pneumoniae. It has no significant similarity with other known chlamydial genes. Marrie, Clin. Infect. Dis. 18: 501 (1993). Many antigens recognized by immune sera to C. pneumoniae are conserved across all chlamydiae, but 98kDa, 76 kDa and 54 kDa proteins may be C. pneumoniae-specific. Campos et al., Invest. Ophthalmol. Vis. Sci. 36: 1477 (1995); Marrie, Clin. Infect. Dis. 18: 501 (1993); 10 Wiedmann-Al-Ahmad et al., Clin. Diagn. Lab. Immunol. 4: 700-704 (1997). Immunoblotting of isolates with sera from patients does show variation of blotting patterns between isolates, indicating that serotypes C. pneumoniae may exist. Grayston et al., J. Infect. Dis. 168: 1231 (1995); Ramirez et al., Annals Int. Med. 125: 979 (1996). However, the results are potentially confounded by the infection status of the patients, since immunoblot profiles of a patient's sera 15 change with time post-infection. An assessment of the number and relative frequency of any serotypes, and the defining antigens, is not yet possible. Thus, a need remains for effective compositions for preventing, treating, and diagnosing Chlamydia infections. SUMMARY OF THE INVENTION 20 In one aspect, the present invention provides purified and isolated DNA molecules that encode Chlamydia polypeptides designated outer membrane protein (mip) or alternatively CPN100501 (SEQ ID NO:1 - full-length sequence and SEQ ID NO:3 - coding sequence for the mature polypeptide). The terms mip and CPN100501 are used interchangeably in the present application. The encoded polypeptides can be used in methods to prevent, treat, and diagnose 25 Chlamydia infection, and include polypeptides having the amino acid sequence shown in SEQ ID NO:2 and 4. Those skilled in the art will appreciate that the invention also includes DNA molecules that encode mutants, variants, and derivatives of such polypeptides, which result from the addition, deletion, or substitution of non-essential amino acids as described herein. The invention also includes RNA molecules corresponding to the DNA molecules of the invention. -6- WO 00/06741 PCT/IB99/01330 In addition to the DNA and RNA molecules, the invention includes the corresponding polypeptides and monospecific antibodies that specifically bind to such polypeptides. The present invention has wide application and includes expression cassettes, vectors, and cells transformed or transfected with the polynucleotides of the invention. Accordingly, the 5 present invention provides (i) a method for producing a polypeptide of the invention in a recombinant host system and related expression cassettes, vectors, and transformed or transfected cells; (ii) a live vaccine vector, such as viral or bacterial live vaccine vectors which include, pox virus, alphavirus, Salmonella typhimurium, or Vibrio cholerae vector, containing a polynucleotide of the invention, such vaccine vectors being useful for, e.g., preventing and 10 treating Chlamydia infection, in combination with a diluent or carrier, and related pharmaceutical compositions and associated therapeutic and/or prophylactic methods; (iii) a therapeutic and/or prophylactic method involving administration of an RNA or DNA molecule of the invention, either in a naked form or formulated with a delivery vehicle, a polypeptide or combination of polypeptides, or a monospecific antibody of the invention, and related pharmaceutical 15 compositions; (iv) a method for diagnosing the presence of Chlamydia in a biological sample, which can involve the use of a DNA or RNA molecule, a monospecific antibody, or a polypeptide of the invention; and (v) a method for purifying a polypeptide of the invention by antibody-based affinity chromatography. BRIEF DESCRIPTION OF THE DRAWINGS 20 The present invention will be further understood from the following description with reference to the drawings, in which: FIG. 1 shows the nucleotide sequence of the mip gene (top sequences) and the deduced amino acid sequence of the mip protein from Chlamydia pneumoniae (full-length protein middle sequences; truncated protein - bottom sequences). 25 FIG. 2 shows the restriction enzyme analysis of the gene encoding the C. pneumoniae mip gene. FIG. 3 shows the construction and elements of plasmid pCAI501. -7- WO 00/06741 PCT/IB99/01330 FIG. 4 illustrates protection against C. pneumoniae infection by pCAI501 following DNA immunization, wherein individual data points (open diamonds) are shown for each animal, as well as the mean (solid squares) and standard deviation for each groups. DETAILED DESCRIPTION OF THE INVENTION 5 In the C. pneumoniae genome, open reading frames (ORFs) encoding chlamydial polypeptides have been identified. These polypeptides include polypeptides permanently found in the bacterial membrane structure, polypeptides that are present in the external vicinity of the bacterial membrane, include polypeptides permanently found in the inclusion membrane structure, polypeptides that are present in the external vicinity of the inclusion membrane, and 10 polypeptides that are released into the cytoplasm of the infected cell. These polypeptides can be used in vaccination methods for preventing and treating Chlamydia infection. According to a first aspect of the invention, there are provided isolated polynucleotides encoding the precursor and mature forms of Chlamydia polypeptides. An isolated polynucleotide of the invention encodes a polypeptide having an amino acid 15 sequence that is homologous to a Chlamydia amino acid sequence, the Chlamydia amino acid sequence being selected from the group consisting of the amino acid sequences as shown in SEQ ID NOS:2 or 4. The term "isolated polynucleotide" is defined as a polynucleotide removed from the environment in which it naturally occurs. For example, a naturally-occurring DNA molecule 20 present in the genome of the bacteria is not isolated, but the same molecule separated from the remaining part of the bacterial genome, as a result of, e.g., a cloning event (amplification), is isolated. Typically, an isolated DNA molecule is free from DNA regions (e.g., coding regions) with which it is immediately contiguous at the 5' or 3' end, in the naturally occurring genome. Such isolated polynucleotides could be part of a vector or a composition and still be isolated in 25 that such a vector or composition is not part of its natural environment. A polynucleotide of the invention can be in the form of RNA or DNA (e.g., cDNA, genomic DNA, or synthetic DNA), or modifications or combinations thereof. The DNA can be double-stranded or single-stranded, and, if single-stranded, can be the coding strand or the non-coding (anti-sense) strand. The sequence that encodes a polypeptide of the invention as -8- WO 00/06741 PCT/IB99/01330 shown in SEQ ID NOS:2 and 4, can be: (a) the coding sequence as shown in SEQ ID NOS:1 or 3; (b) a ribonucleotide sequence derived by transcription of (a); or (c) a different coding sequence; this latter, as a result of the redundancy or degeneracy of the genetic code, encodes the same polypeptides as the DNA molecules of which the nucleotide sequences are illustrated in 5 SEQ ID NOS:1 and 3. By "homologous amino acid sequence" is meant an amino acid sequence that differs from an amino acid sequence shown in SEQ ID NOS:2 or 4, only by one or more conservative amino acid substitutions, or by one or more non-conservative amino acid substitutions, deletions, or additions located at positions at which they do not destroy the specific antigenicity of the 10 polypeptide. Preferably, such a sequence is at least 75%, more preferably 80%, and most preferably 90% identical to an amino acid sequence shown in SEQ ID NOS:2 or 4. Homologous amino acid sequences include sequences that are identical or substantially identical to an amino acid sequence as shown in SEQ ID NOS:2 and 4. By "amino acid sequence 15 substantially identical" is meant a sequence that is at least 90%, preferably 95%, more preferably 97%, and most preferably 99% identical to an amino acid sequence of reference and that preferably differs from the sequence of reference, if at all, by a majority of conservative amino acid substitutions. Conservative amino acid substitutions typically include substitutions among amino acids 20 of the same class. These classes include, for example, (a) amino acids having uncharged polar side chains, such as asparagine, glutamine, seine, threonine, and tyrosine; (b) amino acids having basic side chains, such as lysine, arginine, and histidine; (c) amino acids having acidic side chains, such as aspartic acid and glutamic acid; and (d) amino acids having nonpolar side chains, such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, 25 tryptophan, and cysteine. Homology is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705). Similar amino acid sequences are aligned to obtain the maximum degree of homology (i.e., identity). To this end, it 30 may be necessary to introduce gaps into the sequence. Once the optimal alignment has been set -9- WO 00/06741 PCT/IB99/01330 up, the degree of homology (i.e., identity) is established by recording all of the positions in which the amino acids of both sequences are identical, relative to the total number of positions. Alternatively, homology can be determined by aligning the candidate sequence and the reference sequence using an alignment tool, such as the dynamic programming algorithm 5 described in Needleman et al., J. Mol. Biol. 48: 443 (1970), and the Align Program, a commercial software package produced by DNAstar, Inc., the teachings of which are incorporated by reference herein. After the initial alignment is made, it can be refined by comparison to a multiple sequence alignment of a family of related proteins. Once the alignment between the candidate and reference sequences is made and refined, a percent homology score is 10 calculated. The individual amino acids of each sequence are compared sequentially according to their similarity to each other. Similarity factors include similar size, shape and electrical charge. One particularly preferred method of determining amino acid similarities is the PAM250 matrix described in Dayhoff et al., 5 ATLAS OF PROTEIN SEQUENCE AND STRUCTURE 345-352 (1978 & Supp.), 15 incorporated by reference herein. A similarity score is first calculated as the sum of the aligned pairwise amino acid similarity scores. Insertions and deletions are ignored for the purposes of percent homology and identity. Accordingly, gap penalties are not used in this calculation. The raw score is then normalized by dividing it by the geometric mean of the scores of the candidate compound and the reference sequence. The geometric mean is the square root of the product of 20 these scores. The normalized raw score is the percent homology. Preferably, a homologous sequence is one that is at least 45%, more preferably 60%, and most preferably 85% identical to (i) a coding sequence of SEQ ID NO: 1, or (ii) a coding sequence of SEQ ID NO:3. Polypeptides having a sequence homologous to one of the sequences shown in SEQ ID 25 NOS:2 and 4, include naturally-occurring allelic variants, as well as mutants and variants or any other non-naturally-occurring variants that are analogous in terms of antigenicity, to a polypeptide having a sequence as shown in SEQ ID NOS:2 or 4. An allelic variant is an alternate form of a polypeptide that is characterized as having a substitution, deletion, or addition of one or more amino acids that does not substantially alter the 30 biological function of the polypeptide. By "biological function" is meant the function of the -10- WO 00/06741 PCT/IB99/01330 polypeptide in the cells in which it naturally occurs, even if the function is not necessary for the growth or survival of the cells. For example, the biological function of a porin is to allow the entry into cells of compounds present in the extracellular medium. The biological function is distinct from the antigenic function. A polypeptide can have more than one biological function. 5 Allelic variants are very common in nature. For example, a bacterial species, e.g., C. pneumoniae, is usually represented by a variety of strains that differ from each other by minor allelic variations. Indeed, a polypeptide that fulfills the same biological function in different strains can have an amino acid sequence that is not identical in each of the strains. Such an allelic variation may be equally reflected at the polynucleotide level. 10 Support for the use of allelic variants of polypeptide antigens comes from, e.g., studies of the Chlamydial MOMP antigen. The amino acid sequence of the MOMP varies from strain to strain, yet cross-strain antibody binding plus neutralization of infectivity occurs, indicating that the MOMP, when used as an immunogen, is tolerant of amino acid variations. Polynucleotides, e.g., DNA molecules, encoding allelic variants can easily be retrieved by 15 polymerase chain reaction (PCR) amplification of genomic bacterial DNA extracted by conventional methods. This involves the use of synthetic oligonucleotide primers matching upstream and downstream of the 5' and 3' ends of the encoding domain. Suitable primers can be designed according to the nucleotide sequence information provided in SEQ ID NOS:1 and 3. Typically, a primer can consist of 10 to 40, preferably 15 to 25 nucleotides. It may be also 20 advantageous to select primers containing C and G nucleotides in a proportion sufficient to ensure efficient hybridization; e.g., an amount of C and G nucleotides of at least 40%, preferably 50% of the total nucleotide amount. Useful homologs that do not naturally occur can be designed using known methods for identifying regions of an antigen that are likely to be tolerant of amino acid sequence changes 25 and/or deletions. For example, sequences of the antigen from different species can be compared to identify conserved sequences. Polypeptide derivatives that are encoded by polynucleotides of the invention include, e.g., fragments, polypeptides having large internal deletions derived from full-length polypeptides, and fusion proteins. - 11 - WO 00/06741 PCT/IB99/01330 Polypeptide fragments of the invention can be derived from a polypeptide having a sequence homologous to any of the sequences shown in SEQ ID NOS:1 and 3, to the extent that the fragments retain the desired substantial antigenicity of the parent polypeptide (specific antigenicity). Polypeptide derivatives can also be constructed by large internal deletions that 5 remove a substantial part of the parent polypeptide, while retaining the desired specific antigenicity. Generally, polypeptide derivatives should be about at least 12 amino acids in length to maintain the antigenicity. Advantageously, they can be at least 20 amino acids, preferably at least 50 amino acids, more preferably at least 75 amino acids, and most preferably at least 100 amino acids in length. 10 Useful polypeptide derivatives, e.g., polypeptide fragments, can be designed using computer-assisted analysis of amino acid sequences in order to identify sites in protein antigens having potential as surface-exposed, antigenic regions. Hughes et al., Infect. Immun. 60: 3497 (1992). Polypeptide fragments and polypeptides having large internal deletions can be used for 15 revealing epitopes that are otherwise masked in the parent polypeptide and that may be of importance for inducing, for example, a protective T cell-dependent immune response. Deletions can also remove immunodominant regions of high variability among strains. It is an accepted practice in the field of immunology to use fragments and variants of protein immunogens as vaccines and immunogens, as all that is required to induce an immune 20 response to a protein may be a small (e.g., 8 to 10 amino acid) region of the protein. This has been done for a number of vaccines against pathogens other than Chlamydia. For example, short synthetic peptides corresponding to surface-exposed antigens of pathogens such as murine mammary tumor virus, peptide containing 11 amino acids (Dion et al., Virology 179: 474-477 (1990)); Semliki Forest virus, peptide containing 16 amino acids (Snijders et al., J. Gen. Virol. 25 72: 557-565 (1991)); and canine parvovirus, two overlapping peptides, each containing 15 amino acids (Langeveld et al., Vaccine 12: 1473-1480 (1994)) have been shown to be effective vaccine antigens against their respective pathogens. Polynucleotides encoding polypeptide fragments and polypeptides having large internal deletions can be constructed using standard methods (see, e.g., Ausubel et al., CURRENT 30 PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons Inc. (1994)); for example, by PCR, -12- WO 00/06741 PCT/IB99/01330 including inverse PCR, by restriction enzyme treatment of the cloned DNA molecules, or by-the method of Kunkel et al. (Proc. Natl. A cad. Sci. USA 82: 448 (1985)); biological material available at Stratagene. A polypeptide derivative can also be produced as a fusion polypeptide that contains a 5 polypeptide or a polypeptide derivative of the invention fused, e.g., at the N- or C-terminal end, to any other polypeptide. For construction of DNA encoding the amino acid sequence corresponding to hybrid fusion proteins, a first DNA encoding amino acid sequence corresponding to portions of the CPN100202 nucleotide sequence (SEQ ID NOS:1 or 3) is joined to a second DNA using methods described in, for example, U.S. Patent 5,844,095, incorporated 10 herein by reference. A product can then be easily obtained by translation of the genetic fusion. Vectors for expressing fusion polypeptides are commercially available, such as the pMal-c2 or pMal-p2 systems of New England Biolabs, in which the fusion peptide is a maltose binding protein, the glutathione-S-transferase system of Pharmacia, or the His-Tag system available from Novagen. These and other expression systems provide convenient means for further purification 15 of polypeptides and derivatives of the invention. Another particular example of fusion polypeptides included in the invention includes a polypeptide or polypeptide derivative of the invention fused to a polypeptide having adjuvant activity, such as, e.g., the subunit B of either cholera toxin or E. coli heat-labile toxin. Several possibilities are can be used for achieving fusion. First, the polypeptide of the invention can be 20 fused to the N-, or preferably, to the C-terminal end of the polypeptide having adjuvant activity. Second, a polypeptide fragment of the invention can be fused within the amino acid sequence of the polypeptide having adjuvant activity. As stated above, the polynucleotides of the invention encode Chlamydia polypeptides in precursor or mature form. They can also encode hybrid precursors containing heterologous 25 signal peptides, which can mature into polypeptides of the invention. By "heterologous signal peptide" is meant a signal peptide that is not found in the naturally-occurring precursor of a polypeptide of the invention. A polynucleotide of the invention, having a homologous coding sequence, hybridizes, preferably under stringent conditions, to a polynucleotide having a sequence as shown in SEQ ID 30 NOS:1 and 3. Hybridization procedures are described in, e.g., Ausubel et al., CURRENT -13- WO 00/06741 PCT/IB99/01330 PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons Inc. (1994); Silhavy et al., EXPERIMENTS WITH GENE FUSIONS, Cold Spring Harbor Laboratory Press (1984); Davis et al., A MANUAL FOR GENETIC ENGINEERING: ADVANCED BACTERIAL GENETICS, Cold Spring Harbor Laboratory Press (1980), each incorporated herein by reference. Important parameters that can 5 be considered for optimizing hybridization conditions are reflected in a formula that allows calculation of a critical value, the melting temperature above which two complementary DNA strands separate from each other. Casey and Davidson, Nucl. Acid Res. 4: 1539 (1977). This formula is as follows: Tm = 81.5 + 0.5 x (% G+C) + 1.6 log (positive ion concentration) - 0.6 x (% formamide). 10 Under appropriate stringency conditions, hybridization temperature (Th) is approximately 20-40'C, 20-25*C or, preferably, 30-40'C below the calculated Tm. Those skilled in the art will understand that optimal temperature and salt conditions can be readily determined empirically in preliminary experiments using conventional procedures. For example, stringent conditions can be achieved, both for pre-hybridizing and 15 hybridizing incubations, (i) within 4-16 hours at 42'C, in 6xSSC containing 50% formamide or (ii) within 4-16 hours at 65*C in an aqueous 6xSSC solution (1 M NaCl, 0.1 M sodium citrate (pH 7.0)). For polynucleotides containing 30 to 600 nucleotides, the above formula is used and then is corrected by subtracting (600/polynucleotide size in base pairs). Stringency conditions are 20 defined by a Th that is 5 to 10 C below Tm. Hybridization conditions with oligonucleotides shorter than 20-30 bases do not exactly follow the rules set forth above. In such cases, the formula for calculating the Tm is as follows: Tm = 4 x (G+C) + 2 (A+T). For example, an 18 nucleotide fragment of 50% G+C would have an approximate Tm of 54*C. 25 A polynucleotide molecule of the invention, containing RNA, DNA, or modifications or combinations thereof, can have various applications. For example, a DNA molecule can be used (i) in a process for producing the encoded polypeptide in a recombinant host system, (ii) in the construction of vaccine vectors such as poxviruses, which are further used in methods and -14- WO 00/06741 PCT/IB99/01330 compositions for preventing and/or treating Chlamydia infection, (iii) as a vaccine agent (as well as an RNA molecule), in a naked form or formulated with a delivery vehicle and, (iv) in the construction of attenuated Chlamydia strains that can overexpress a polynucleotide of the invention or express it in a modified, mutated form, such as a non-toxic form, if appropriate. 5 For vaccine compositions and uses of the proteins and peptides and encoding nucleotides of the present invention for protection against diseases caused by Chlamydia, it is not preferred to use naked DNA encoding the protein or peptides and administering these nucleotides intranasally or intramuscularly. For these proteins, it is preferred to administer the encoding nucleic acids by other routes such as intradermally and/or to formulate the encoding nucleic acids to improve (or 10 adjuvant) the immune response. It is also preferred to include the encoding nucleic acid as part of a recombinant live vector, such as a viral or bacterial vector for use as the immunizing agent. It is also preferred to immunize with vaccine formulations comprising the proteins or peptides of the invention themselves. These vaccine formulations may include the use of adjuvants. According to a second aspect of the invention, there is therefore provided (i) an 15 expression cassette containing a DNA molecule of the invention placed under the control of the elements required for expression, in particular under the control of an appropriate promoter; (ii) an expression vector containing an expression cassette of the invention; (iii) a prokaryotprocaryotic or eukaryotic cell transformed or transfected with an expression cassette and/or vector of the invention, as well as (iv) a process for producing a polypeptide or 20 polypeptide derivative encoded by a polynucleotide of the invention, which involves culturing a prokaryotprocaryotic or eukaryotic cell transformed or transfected with an expression cassette and/or vector of the invention, under conditions that allow expression of the DNA molecule of the invention and, recovering the encoded polypeptide or polypeptide derivative from the cell culture. 25 A recombinant expression system can be selected from prokaryotprocaryotic and eukaryoteucaryotic hosts. Eukaryotic hosts include yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris), mammalian cells (e.g., COS1, NIH3T3, or JEG3 cells), arthropods cells (e.g., Spodopterafrugiperda (SF9) cells), and plant cells. Preferably, a prokaryotproic host such as E. coli is used. Bacterial and eukaryoteuic cells are available from a number of different sources 30 to those skilled in the art, e.g., the American Type Culture Collection (ATCC; Rockville, Maryland). -15- WO 00/06741 PCT/IB99/01330 The choice of the expression system depends on the features desired for the expressed polypeptide. For example, it may be useful to produce a polypeptide of the invention in a particular lipidated form or any other form. The choice of the expression cassette will depend on the host system selected as well as 5 the features desired for the expressed polypeptide. Typically, an expression cassette includes a promoter that is functional in the selected host system and can be constitutive or inducible; a ribosome binding site; a start codon (ATG) if necessary, a region encoding a signal peptide, e.g., a lipidation signal peptide; a DNA molecule of the invention; a stop codon; and optionally a 3' terminal region (translation and/or transcription terminator). The signal peptide encoding region 10 is adjacent to the polynucleotide of the invention and placed in proper reading frame. The signal peptide-encoding region can be homologous or heterologous to the DNA molecule encoding the mature polypeptide and can be specific to the secretion apparatus of the host used for expression. The open reading frame constituted by the DNA molecule of the invention, solely or together with the signal peptide, is placed under the control of the promoter so that transcription and 15 translation occur in the host system. Promoters, signal peptide encoding regions are widely known and available to those skilled in the art and includes, for example, the promoter of Salmonella typhimurium (and derivatives) that is inducible by arabinose (promoter araB) and is functional in Gram-negative bacteria such as E. coli (as described in U.S. Patent 5,028,530 and in Cagnon et al., (Cagnon et al., Protein Engineering 4: 843 (1991)); the promoter of the gene of 20 bacteriophage T7 encoding RNA polymerase, that is functional in a number of E. coli strains expressing T7 polymerase (described in U.S. Patent 4,952,496); OspA lipidation signal peptide; and RlpB lipidation signal peptide (Takase et al., J. Bact. 169: 5692 (1987)). The expression cassette is typically part of an expression vector, which is selected for its ability to replicate in the chosen expression system. Expression vectors (e.g., plasmids or viral 25 vectors) can be chosen from those described in Pouwels et al. (CLONING VECTORS: LABORATORY MANUAL, 85, Supp. 1987). They can be purchased from various commercial sources. Methods for transforming/transfecting host cells with expression vectors will depend on the host system selected as described in Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR 30 BIOLOGY, John Wiley & Sons Inc. (1994). -16- WO 00/06741 PCT/IB99/01330 Upon expression, a recombinant polypeptide of the invention (or a polypeptide derivative) is produced and remains in the intracellular compartment, is secreted/excreted in the extracellular medium or in the periplasmic space, or is embedded in the cellular membrane. The polypeptide can then be recovered in a substantially purified form from the cell extract or from 5 the supernatant after centrifugation of the recombinant cell culture. Typically, the recombinant polypeptide can be purified by antibody-based affinity purification or by any other method that can be readily adapted by a person skilled in the art, such as by genetic fusion to a small affinity binding domain. Antibody-based affinity purification methods are also available for purifying a polypeptide of the invention extracted from a Chlamydia strain. Antibodies useful for purifying 10 by immunoaffinity the polypeptides of the invention can be obtained as described below. A polynucleotide of the invention can also be useful in the vaccine field, e.g., for achieving DNA vaccination. There are two major possibilities, either using a viral or bacterial host as gene delivery vehicle (live vaccine vector) or administering the gene in a free form, e.g., inserted into a plasmid. Therapeutic or prophylactic efficacy of a polynucleotide of the invention 15 can be evaluated as described below. Accordingly, in a third aspect of the invention, there is provided (i) a vaccine vector such as a poxvirus, containing a DNA molecule of the invention, placed under the control of elements required for expression; (ii) a composition of matter containing a vaccine vector of the invention, together with a diluent or carrier; particularly, (iii) a pharmaceutical composition containing a 20 therapeutically or prophylactically effective amount of a vaccine vector of the invention; (iv) a method for inducing an immune response against Chlamydia in a mammal (e.g., a human; alternatively, the method can be used in veterinary applications for treating or preventing Chlamydia infection of animals, e.g., cats or birds), which involves administering to the mammal an immunogenically effective amount of a vaccine vector of the invention to elicit an immune 25 response, e.g., a protective or therapeutic immune response to Chlamydia ; and particularly, (v) a method for preventing and/or treating a Chlamydia (e.g., C. trachomatis, C. psittaci, C. pneumonia, C. pecorum) infection, which involves administering a prophylactic or therapeutic amount of a vaccine vector of the invention to an individual in need. Additionally, the third aspect of the invention encompasses the use of a vaccine vector of the invention in the 30 preparation of a medicament for preventing and/or treating Chlamydia infection. -17- WO 00/06741 PCT/IB99/01330 A vaccine vector of the invention can express one or several polypeptides or derivatives of the invention, as well as at least one additional Chlanydia antigen, fragment, homolog, mutant, or derivative thereof. In addition, it can express a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12), that enhances the immune response (adjuvant effect). Thus, a vaccine 5 vector can include an additional DNA sequence encoding, e.g., a chlamydial antigen, or a cytokine, placed under the control of elements required for expression in a mammalian cell. Alternatively, a composition of the invention can include several vaccine vectors, each of them being capable of expressing a polypeptide or derivative of the invention. A composition can also contain a vaccine vector capable of expressing an additional Chlamydia antigen, or a 10 subunit, fragment, homolog, mutant, or derivative thereof; or a cytokine such as IL-2 or IL-12. In vaccination methods for treating or preventing infection in a mammal, a vaccine vector of the invention can be administered by any conventional route in use in the vaccine field, particularly, to a mucosal (e.g., ocular, intranasal, oral, gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral (e.g., subcutaneous, intradermal, 15 intramuscular, intravenous, or intraperitoneal) route. Preferred routes depend upon the choice of the vaccine vector. The administration can be achieved in a single dose or repeated at intervals. The appropriate dosage depends on various parameters understood by skilled artisans such as the vaccine vector itself, the route of administration or the condition of the mammal to be vaccinated (weight, age and the like). 20 Live vaccine vectors available in the art include viral vectors such as adenoviruses, alphavirus, and poxviruses as well as bacterial vectors, e.g., Shigella, Salmonella, Vibrio cholerae, Lactobacillus, Bacille bili6 de Calmette-Gu6rin (BCG), and Streptococcus. An example of an adenovirus vector, as well as a method for constructing an adenovirus vector capable of expressing a DNA molecule of the invention, are described in U.S. Patent 25 4,920,209. Poxvirus vectors that can be used include, e.g., vaccinia and canary pox virus, described in U.S. Patent 4,722,848 and U.S. Patent 5,364,773, respectively (also see, e.g., Tartaglia et al., Virology 188: 217 (1992)) for a description of a vaccinia virus vector; and Taylor et al, Vaccine 13: 539 (1995) for a reference of a canary pox). Poxvirus vectors capable of expressing a polynucleotide of the invention can be obtained by homologous recombination as 30 described in Kieny et al., Nature 312: 163 (1984) so that the polynucleotide of the invention is -18- WO 00/06741 PCT/IB99/01330 inserted in the viral genome under appropriate conditions for expression in mammalian cells. Generally, the dose of vaccine viral vector, for therapeutic or prophylactic use, can be of from about 1x10 4 to about 1x10", advantageously from about 1x10 7 to about 1x10 1 0 , preferably of from about 1x10 7 to about 1x10 9 plaque-forming units per kilogram. Preferably, viral vectors are 5 administered parenterally; for example, in three doses, four weeks apart. Those skilled in the art recognize that it is preferable to avoid adding a chemical adjuvant to a composition containing a viral vector of the invention and thereby minimizing the immune response to the viral vector. itself. Non-toxicogenic Vibrio cholerae mutant strains that are useful as a live oral vaccine are 10 described in Mekalanos et al., Nature 306: 551 (1983) and U.S. Patent 4,882,278 (strain in which a substantial amount of the coding sequence of each of the two ctxA alleles has been deleted so that no functional cholerae toxin is produced); WO 92/11354 (strain in which the irgA locus is inactivated by mutation; this mutation can be combined in a single strain with ctxA mutations); and WO 94/1533 (deletion mutant lacking functional ctxA and attRS1 DNA sequences). These 15 strains can be genetically engineered to express heterologous antigens, as described in WO 94/19482. An effective vaccine dose of a Vibrio cholerae strain capable of expressing a polypeptide or polypeptide derivative encoded by a DNA molecule of the invention can contain, e.g., about 1x10 5 to about 1x10 9 , preferably about 1x10 6 to about 1x10 8 viable bacteria in an appropriate volume for the selected route of administration. Preferred routes of administration 20 include all mucosal routes; most preferably, these vectors are administered intranasally or orally. Attenuated Salmonella typhimurium strains, genetically engineered for recombinant expression of heterologous antigens or not, and their use as oral vaccines are described in Nakayama et al., Bio/Technology 6: 693 (1988) and WO 92/11361. Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered 25 intranasally or orally. Others bacterial strains useful as vaccine vectors are described in High et al., EMBO 11: 1991 (1992); Sizemore et al., Science 270: 299 (1995) (Shigellaflexneri); Medaglini et al., Proc. Natl. Acad. Sci. USA 92: 6868 (1995) (Streptococcus gordonii); and Flynn, Cell. Mol. Biol. 40: 31 (1994), WO 88/6626, WO 90/0594, WO 91/13157, WO 92/1796, and WO 92/21376 (Bacille 30 Calmette Guerin). -19- WO 00/06741 PCT/IB99/01330 In bacterial vectors, polynucleotide of the invention can be inserted into the bacterial genome or can remain in a free state, carried on a plasmid. An adjuvant can also be added to a composition containing a vaccine bacterial vector. A number of adjuvants are known to those skilled in the art. Preferred adjuvants can be selected 5 from the list provided below. According to a fourth aspect of the invention, there is also provided (i) a composition of matter containing a polynucleotide of the invention, together with a diluent or carrier; (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a polynucleotide of the invention; (iii) a method for inducing an immune response against 10 Chlamydia, in a mammal, by administering to the mammal, an immunogenically effective amount of a polynucleotide of the invention to elicit an immune response, e.g., a protective immune response to Chlamydia; and particularly, (iv) a method for preventing and/or treating a Chlamydia (e.g., C. trachomatis, C. psittaci, C pneumoniae, or C. pecorum) infection, by administering a prophylactic or therapeutic amount of a polynucleotide of the invention to an 15 individual in need. Additionally, the fourth aspect of the invention encompasses the use of a polynucleotide of the invention in the preparation of a medicament for preventing and/or treating Chlamydia infection. The fourth aspect of the invention preferably includes the use of a DNA molecule placed under conditions for expression in a mammalian cell, e.g., in a plasmid that is unable to replicate in mammalian cells and to substantially integrate in a mammalian genome. 20 Polynucleotides (DNA or RNA) of the invention can also be administered as such to a mammal for vaccine, e.g., therapeutic or prophylactic, purpose. When a DNA molecule of the invention is used, it can be in the form of a plasmid that is unable to replicate in a mammalian cell and unable to integrate in the mammalian genome. Typically, a DNA molecule is placed under the control of a promoter suitable for expression in a mammalian cell. The promoter can 25 function ubiquitously or tissue-specifically. Examples of non-tissue specific promoters include the early Cytomegalovirus (CMV) promoter (described in U.S. Patent 4,168,062) and the Rous Sarcoma Virus promoter (described in Norton & Coffin, Molec. Cell Biol. 5: 281(1985)). The desmin promoter (Li et al., Gene 78: 243 (1989), Li & Paulin, J Biol. Chem. 266: 6562 (1991), and Li & Paulin, J. Biol. Chem. 268: 10403 (1993)) is tissue-specific and drives expression in -20- WO 00/06741 PCT/IB99/01330 muscle cells. More generally, useful vectors are described, i.a., WO 94/21797 and Hartikka et al., Human Gene Therapy 7: 1205 (1996). For DNA/RNA vaccination, the polynucleotide of the invention can encode a precursor or a mature form. When it encodes a precursor form, the precursor form can be homologous or 5 heterologous. In the latter case, a eukaryoteuic leader sequence can be used, such as the leader sequence of the tissue-type plasminogen factor (tPA). A composition of the invention can contain one or several polynucleotides of the invention. It can also contain at least one additional polynucleotide encoding another Chlamydia antigen or a fragment, derivative, mutant, or analog thereof. A polynucleotide encoding a 10 cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12), can also be added to the composition so that the immune response is enhanced. These additional polynucleotides are placed under appropriate control for expression. Advantageously, DNA molecules of the invention and/or additional DNA molecules to be included in the same composition, can be carried in the same plasmid. 15 Standard techniques of molecular biology for preparing and purifying polynucleotides can be used in the preparation of polynucleotide therapeutics of the invention. For use as a vaccine, a polynucleotide of the invention can be formulated according to various methods. First, a polynucleotide can be used in a naked form, free of any delivery vehicles, such as anionic liposomes, cationic lipids, microparticles, e.g., gold microparticles, precipitating agents, 20 e.g., calcium phosphate, or any other transfection-facilitating agent. In this case, the polynucleotide can be simply diluted in a physiologically acceptable solution, such as sterile saline or sterile buffered saline, with or without a carrier. When present, the carrier preferably is isotonic, hypotonic, or weakly hypertonic, and has a relatively low ionic strength, such as provided by a sucrose solution, e.g., a solution containing 20% sucrose. 25 Alternatively, a polynucleotide can be associated with agents that assist in cellular uptake. It can be, i.a., (i) complemented with a chemical agent that modifies the cellular permeability, such as bupivacaine (see, e.g., WO 94/16737), (ii) encapsulated into liposomes, or (iii) associated with cationic lipids or silica, gold, or tungsten microparticles. Anionic and neutral liposomes are well-known in the art (see, e.g., LIPOSOMES: A 30 PRACTICAL APPROACH, RPC New Ed, IRL press (1990)), for a detailed description of methods -21- WO 00/06741 PCT/IB99/01330 for making liposomes) and are useful for delivering a large range of products, including polynucleotides. Cationic lipids are also known in the art and are commonly used for gene delivery. Such lipids include Lipofectin TM also known as DOTMA (N-[1-(2,3-dioleyloxy)propyl]-N,NN 5 trimethylammonium chloride), DOTAP (1,2-bis(oleyloxy)-3-(trimethylammonio)propane), DDAB (dimethyldioctadecylammonium bromide), DOGS (dioctadecylamidologlycyl spermine) and cholesterol derivatives such as DC-Chol (3 beta-(N-(N',N'-dimethyl aminomethane) carbamoyl) cholesterol). A description of these cationic lipids can be found in EP 187,702, WO 90/11092, U.S. Patent 5,283,185, WO 91/15501, WO 95/26356, and U.S. Patent 5,527,928. 10 Cationic lipids for gene delivery are preferably used in association with a neutral lipid such as DOPE (dioleyl phosphatidylethanolamine), as described in, e.g., WO 90/11092. Other transfection-facilitating compounds can be added to a formulation containing cationic liposomes. A number of them are described in, e.g., WO 93/18759, WO 93/19768, WO 94/25608, and WO 95/2397. They include, i.a., spermine derivatives useful for facilitating 15 the transport of DNA through the nuclear membrane (see, for example, WO 93/18759) and membrane-permeabilizing compounds such as GALA, Gramicidine S, and cationic bile salts (see, for example, WO 93/19768). Gold or tungsten microparticles can also be used for gene delivery, as described in WO 91/359, WO 93/17706, and Tang et al. (Nature 356: 152 (1992)). In this case, the 20 microparticle-coated polynucleotides can be injected via intradermal or intra-epidermal routes using a needleless injection device ("gene gun"), such as those described in U.S. Patent 4,945,050, U.S. Patent 5,015,580, and WO 94/24263. The amount of DNA to be used in a vaccine recipient depends, e.g., on the strength of the promoter used in the DNA construct, the immunogenicity of the expressed gene product, the 25 condition of the mammal intended for administration (e.g., the weight, age, and general health of the mammal), the mode of administration, and the type of formulation. In general, a therapeutically or prophylactically effective dose from about 1 Rg to about 1 mg, preferably, from about 10 ptg to about 800 pig and, more preferably, from about 25 jig to about 250 jg, can be administered to human adults. The administration can be achieved in a single dose or 30 repeated at intervals. -22 - WO 00/06741 PCT/IB99/01330 The route of administration can be any conventional route used in the vaccine field. As= general guidance, a polynucleotide of the invention can be administered via a mucosal surface, e.g., an ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal, and urinary tract surface; or via a parenteral route, e.g., by an intravenous, subcutaneous, intraperitoneal, intradermal, intra 5 epidermal, or intramuscular route. The choice of the administration route will depend on, e.g., the formulation that is selected. A polynucleotide formulated in association with bupivacaine is advantageously administered into muscles. When a neutral or anionic liposome or a cationic lipid, such as DOTMA or DC-Chol, is used, the formulation can be advantageously injected via intravenous, intranasal (aerosolization), intramuscular, intradermal, and subcutaneous routes. A 10 polynucleotide in a naked form can advantageously be administered via the intramuscular, intradermal, or subcutaneous routes. Although not absolutely required, such a composition can also contain an adjuvant. If so, a systemic adjuvant that does not require concomitant administration in order to exhibit an adjuvant effect is preferable such as, e.g., QS21, which is described in U.S. Patent 5,057,546. 15 The sequence information provided in the present application enables the design of specific nucleotide probes and primers that can be useful in diagnosis. Accordingly, in a fifth aspect of the invention, there is provided a nucleotide probe or primer having a sequence found in or derived by degeneracy of the genetic code from a sequence shown in SEQ ID NOS:1 and 3. The term "probe" as used in the present application refers to DNA (preferably single 20 stranded) or RNA molecules (or modifications or combinations thereof) that hybridize under the stringent conditions, as defined above, to nucleic acid molecules having sequences homologous to those shown in SEQ ID NOS:1 and 3, or to a complementary or anti-sense sequence. Generally, probes are significantly shorter than full-length sequences shown in SEQ ID NOS:1 and 3; for example, they can contain from about 5 to about 100, preferably from about 10 to 25 about 80 nucleotides. In particular, probes have sequences that are at least 75%, preferably at least 85%, more preferably 95% homologous to a portion of a sequence as shown in SEQ ID NOS: 1 and 3 or that are complementary to such sequences. Probes can contain modified bases such as inosine, methyl-5-deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine, or diamino-2, 6-purine. Sugar or phosphate residues can also be modified or substituted. For 30 example, a deoxyribose residue can be replaced by a polyamide (Nielsen et al., Science 254: -23- WO 00/06741 PCT/IB99/01330 1497 (1991)) and phosphate residues can be replaced by ester groups such as diphosphate, alkyl, arylphosphonate and phosphorothioate esters. In addition, the 2'-hydroxyl group on ribonucleotides can be modified by including, e.g., alkyl groups. Probes of the invention can be used in diagnostic tests, as capture or detection probes. 5 Such capture probes can be conventionally immobilized on a solid support, directly or indirectly, by covalent means or by passive adsorption. A detection probe can be labelled by a detection marker selected from radioactive isotopes; enzymes such as peroxidase, alkaline phosphatase, and enzymes able to hydrolyze a chromogenic, fluorogenic, or luminescent substrate; compounds that are chromogenic, fluorogenic, or luminescent; nucleotide base analogs; and biotin. 10 Probes of the invention can be used in any conventional hybridization technique, such as dot blot (Maniatis et al., MOLECULAR CLONING: A LABORATORY MANUAL (1982) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York), Southern blot (Southern, J. Mol. Biol. 98: 503 (1975)), northern blot (identical to Southern blot to the exception that RNA is used as a target), or the sandwich technique (Dunn et al., Cell 12: 23 (1977)). The latter technique 15 involves the use of a specific capture probe and/or a specific detection probe with nucleotide sequences that at least partially differ from each other. A primer is usually a probe of about 10 to about 40 nucleotides that is used to initiate enzymatic polymerization of DNA in an amplification process (e.g., PCR), in an elongation process, or in a reverse transcription method. In a diagnostic method involving PCR, primers 20 can be labelled. Thus, the invention also encompasses (i) a reagent containing a probe of the invention for detecting and/or identifying the presence of Chlamydia in a biological material; (ii) a method for detecting and/or identifying the presence of Chlamydia in a biological material, in which (a) a sample is recovered or derived from the biological material, (b) DNA or RNA is extracted from 25 the material and denatured, and (c) exposed to a probe of the invention, for example, a capture, detection probe or both, under stringent hybridization conditions, such that hybridization is detected; and (iii) a method for detecting and/or identifying the presence of Chlamydia in a biological material, in which (a) a sample is recovered or derived from the biological material, (b) DNA is extracted therefrom, (c) the extracted DNA is primed with at least one, and -24- WO 00/06741 PCT/IB99/01330 preferably two, primers of the invention and amplified by polymerase chain reaction, and (d) the amplified DNA fragment is produced. As previously mentioned, polypeptides that can be produced upon expression of the newly identified open reading frames are useful vaccine agents. 5 Therefore, a sixth aspect of the invention features a substantially purified polypeptide or polypeptide derivative having an amino acid sequence encoded by a polynucleotide of the invention. A "substantially purified polypeptide" is defined as a polypeptide that is separated from the environment in which it naturally occurs and/or that is free of the majority of the 10 polypeptides that are present in the environment in which it was synthesized. For example, a substantially purified polypeptide is free from cytoplasmic polypeptides. Those skilled in the art will understand that the polypeptides of the invention can be purified from a natural source, i.e., a Chlamydia strain, or can be produced by recombinant means. Homologous polypeptides or polypeptide derivatives encoded by polynucleotides of the 15 invention can be screened for specific antigenicity by testing cross-reactivity with an antiserum raised against the polypeptide of reference having an amino acid sequence as shown in SEQ ID NOS:2 and 4. Briefly, a monospecific hyperimmune antiserum can be raised against a purified reference polypeptide as such or as a fusion polypeptide, for example, an expression product of MBP, GST, or His-tag systems or a synthetic peptide predicted to be antigenic. The homologous 20 polypeptide or derivative screened for specific antigenicity can be produced as such or as a fusion polypeptide. In this latter case and if the antiserum is also raised against a fusion polypeptide, two different fusion systems are employed. Specific antigenicity can be determined according to a number of methods, including Western blot (Towbin et al., Proc. Natl. A cad. Sci. USA 76: 4350 (1979)), dot blot, and ELISA, as described below. 25 In a Western blot assay, the product to be screened, either as a purified preparation or a total E. coli extract, is submitted to SDS-Page electrophoresis as described by Laemmli, Nature 227: 680 (1970). After transfer to a nitrocellulose membrane, the material is further incubated with the monospecific hyperimmune antiserum diluted in the range of dilutions from about 1:5 to about 1:5000, preferably from about 1:100 to about 1:500. Specific antigenicity is shown once a 30 band corresponding to the product exhibits reactivity at any of the dilutions in the above range. -25- WO 00/06741 PCT/IB99/01330 In an ELISA assay, the product to be screened is preferably used as the coating antigen. A purified preparation is preferred, although a whole cell extract can also be used. Briefly, about 100 g1 of a preparation at about 10 pig protein/ml are distributed into wells of a 96-well polycarbonate ELISA plate. The plate is incubated for 2 hours at 37*C then overnight at 4'C. 5 The plate is washed with phosphate buffer saline (PBS) containing 0.05% Tween 20 (PBS/Tween buffer). The wells are saturated with 250 pl PBS containing 1% bovine serum albumin (BSA) to prevent non-specific antibody binding. After 1 hour incubation at 37'C, the plate is washed with PBS/Tween buffer. The antiserum is serially diluted in PBS/Tween buffer containing 0.5% BSA. 100 pl of dilutions are added per well. The plate is incubated for 10 90 minutes at 37'C, washed and evaluated according to standard procedures. For example, a goat anti-rabbit peroxidase conjugate is added to the wells when specific antibodies were raised in rabbits. Incubation is carried out for 90 minutes at 37 0 C and the plate is washed. The reaction is developed with the appropriate substrate and the reaction is measured by colorimetry (absorbance measured spectrophotometrically). Under the above experimental conditions, a 15 positive reaction is shown by O.D. values greater than a non immune control serum. In a dot blot assay, a purified product is preferred, although a whole cell extract can also be used. Briefly, a solution of the product at about 100 pg/ml is serially two-fold diluted in 50 mM Tris-HC1 (pH 7.5). 100 pl of each dilution are applied to a nitrocellulose membrane 0.45 pm set in a 96-well dot blot apparatus (Biorad). The buffer is removed by applying vacuum 20 to the system. Wells are washed by addition of 50 mM Tris-HCl (pH 7.5) and the membrane is air-dried. The membrane is saturated in blocking buffer (50 mM Tris-HCI (pH 7.5) 0.15 M NaCl, 10 g/L skim milk) and incubated with an antiserum dilution from about 1:50 to about 1:5000, preferably about 1:500. The reaction is revealed according to standard procedures. For example, a goat anti-rabbit peroxidase conjugate is added to the wells when rabbit antibodies are 25 used. Incubation is carried out 90 minutes at 37'C and the blot is washed. The reaction is developed with the appropriate substrate and stopped. The reaction is measured visually by the appearance of a colored spot, e.g., by colorimetry. Under the above experimental conditions, a positive reaction is shown once a colored spot is associated with a dilution of at least about 1:5, preferably of at least about 1:500. 30 Therapeutic or prophylactic efficacy of a polypeptide or derivative of the invention can be evaluated as described below. -26- WO 00/06741 PCT/IB99/01330 According to a seventh aspect of the invention, there is provided (i) a composition of matter containing a polypeptide of the invention together with a diluent or carrier; in particular, (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a polypeptide of the invention; (iii) a method for inducing an immune response against 5 Chlamydia in a mammal, by administering to the mammal an immunogenically effective amount of a polypeptide of the invention to elicit an immune response, e.g., a protective immune response to Chlamydia; and particularly, (iv) a method for preventing and/or treating a Chlamydia (e.g., C. trachomatis. C. psittaci, C. pneumoniae. or C. pecorum) infection, by administering a prophylactic or therapeutic amount of a polypeptide of the invention to an 10 individual in need. Additionally, the seventh aspect of the invention encompasses the use of a polypeptide of the invention in the preparation of a medicament for preventing and/or treating Chlamydia infection. The immunogenic compositions of the invention can be administered by any conventional route in use in the vaccine field, in particular to a mucosal (e.g., ocular, intranasal, 15 pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route. The choice of the administration route depends upon a number of parameters, such as the adjuvant associated with the polypeptide. For example, if a mucosal adjuvant is used, the intranasal or oral route will be preferred and if a lipid formulation or an aluminum compound is used, the 20 parenteral route will be preferred. In the latter case, the subcutaneous or intramuscular route is most preferred. The choice can also depend upon the nature of the vaccine agent. For example, a polypeptide of the invention fused to CTB or LTB will be best administered to a mucosal surface. A composition of the invention can contain one or several polypeptides or derivatives of 25 the invention. It can also contain at least one additional Chlamydia antigen, or a subunit, fragment, homolog, mutant, or derivative thereof. For use in a composition of the invention, a polypeptide or derivative thereof can be formulated into or with liposomes, preferably neutral or anionic liposomes, microspheres, ISCOMS, or virus-like-particles (VLPs) to facilitate delivery and/or enhance the immune -27- WO 00/06741 PCT/IB99/01330 response. These compounds are readily available to one skilled in the art; for example, see LIPOSOMES: A PRACTICAL APPROACH (supra). Adjuvants other than liposomes and the like can also be used and are known in the art. An appropriate selection can conventionally be made by those skilled in the art, for example, 5 from the list provided below. Administration can be achieved in a single dose or repeated as necessary at intervals as can be determined by one skilled in the art. For example, a priming dose can be followed by three booster doses at weekly or monthly intervals. An appropriate dose depends on various parameters including the recipient (e.g., adult or infant), the particular vaccine antigen, the route 10 and frequency of administration, the presence/absence or type of adjuvant, and the desired effect (e.g., protection and/or treatment), as can be determined by one skilled in the art. In general, a vaccine antigen of the invention can be administered by a mucosal route in an amount from about 10 ptg to about 500 mg, preferably from about 1 mg to about 200 mg. For the parenteral route of administration, the dose usually should not exceed about 1 mg, preferably about 100 jg. 15 When used as vaccine agents, polynucleotides and polypeptides of the invention can be used sequentially as part of a multistep immunization process. For example, a mammal can be initially primed with a vaccine vector of the invention such as a pox virus, e.g., via the parenteral route, and then boosted twice with the polypeptide encoded by the vaccine vector, e.g., via the mucosal route. In another example, liposomes associated with a polypeptide or derivative of the 20 invention can also be used for priming, with boosting being carried out mucosally using a soluble polypeptide or derivative of the invention in combination with a mucosal adjuvant (e.g., LT). A polypeptide derivative of the invention is also useful as a diagnostic reagent for detecting the presence of anti-Chlamydia antibodies, e.g., in a blood sample. Such polypeptides are about 5 to about 80, preferably about 10 to about 50 amino acids in length and can be labeled 25 or unlabeled, depending upon the diagnostic method. Diagnostic methods involving such a reagent are described below. Upon expression of a DNA molecule of the invention, a polypeptide or polypeptide derivative is produced and can be purified using known laboratory techniques. For example, the polypeptide or polypeptide derivative can be produced as a fusion protein containing a fused tail 30 that facilitates purification. The fusion product can be used to immunize a small mammal, e.g., a -28- WO 00/06741 PCT/IB99/01330 mouse or a rabbit, in order to raise antibodies against the polypeptide or polypeptide derivative (monospecific antibodies). The eighth aspect of the invention thus provides a monospecific antibody that binds to a polypeptide or polypeptide derivative of the invention. By "monospecific antibody" is meant an antibody that is capable of reacting with a 5 unique naturally-occurring Chlamydia polypeptide. An antibody of the invention can be polyclonal or monoclonal. Monospecific antibodies can be recombinant, e.g., chimeric (e.g., constituted by a variable region of murine origin associated with a human constant region), humanized (a human immunoglobulin constant backbone together with hypervariable region of animal, e.g., murine, origin), and/or single chain. Both polyclonal and monospecific antibodies 10 can also be in the form of immunoglobulin fragments, e.g., F(ab)'2 or Fab fragments. The antibodies of the invention can be of any isotype, e.g., IgG or IgA, and polyclonal antibodies can be of a single isotype or can contain a mixture of isotypes. The antibodies of the invention, which are raised to a polypeptide or polypeptide derivative of the invention, can be produced and identified using standard immunological assays, 15 e.g., Western blot analysis, dot blot assay, or ELISA (see, e.g., Coligan et al., CURRENT PROTOCOLS IN IMMUNOLOGY (1994) John Wiley & Sons, Inc., New York, NY). The antibodies can be used in diagnostic methods to detect the presence of a Chlamydia antigen in a sample, such as a biological sample. The antibodies can also be used in affinity chromatography methods for purifying a polypeptide or polypeptide derivative of the invention. As is discussed 20 further below, such antibodies can be used in prophylactic and therapeutic passive immunization methods. Accordingly, a ninth aspect of the invention provides (i) a reagent for detecting the presence of Chlamydia in a biological sample that contains an antibody, polypeptide, or polypeptide derivative of the invention; and (ii) a diagnostic method for detecting the presence of 25 Chlamydia in a biological sample, by contacting the biological sample with an antibody, a polypeptide, or a polypeptide derivative of the invention, such that an immune complex is formed, and by detecting such complex to indicate the presence of Chlamydia in the sample or the organism from which the sample is derived. Those skilled in the art will understand that the immune complex is formed between a 30 component of the sample and the antibody, polypeptide, or polypeptide derivative, whichever is - 29 - WO 00/06741 PCT/IB99/01330 used, and that any unbound material can be removed prior to detecting the complex. As can be easily understood, a polypeptide reagent is useful for detecting the presence of anti-Chlamydia antibodies in a sample, e.g., a blood sample, while an antibody of the invention can be used for screening a sample, such as a gastric extract or biopsy, for the presence of Chlamydia 5 polypeptides. For use in diagnostic applications, the reagent (i.e., the antibody, polypeptide, or polypeptide derivative of the invention) can be in a free state or immobilized on a solid support, such as a tube, a bead, or any other conventional support used in the field. Immobilization can be achieved using direct or indirect means. Direct means include passive adsorption 10 (non-covalent binding) or covalent binding between the support and the reagent. By "indirect means" is meant that an anti-reagent compound that interacts with a reagent is first attached to the solid support. For example, if a polypeptide reagent is used, an antibody that binds to it can serve as an anti-reagent, provided that it binds to an epitope that is not involved in the recognition of antibodies in biological samples. Indirect means can also employ a 15 ligand-receptor system, for example, a molecule such as a vitamin can be grafted onto the polypeptide reagent and the corresponding receptor can be immobilized on the solid phase. This is illustrated by the biotin-streptavidin system. Alternatively, indirect means can be used, e.g., by adding to the reagent a peptide tail, chemically or by genetic engineering, and immobilizing the grafted or fused product by passive adsorption or covalent linkage of the peptide tail. 20 According to a tenth aspect of the invention, there is provided a process for purifying, from a biological sample, a polypeptide or polypeptide derivative of the invention, which involves carrying out antibody-based affinity chromatography with the biological sample, wherein the antibody is a monospecific antibody of the invention. For use in a purification process of the invention, the antibody can be polyclonal or 25 monospecific, and preferably is of the IgG type. Purified IgGs can be prepared from an antiserum using standard methods (see, e.g., Coligan et al., supra). Conventional chromatography supports, as well as standard methods for grafting antibodies, are disclosed in, e.g., ANTIBODIES: A LABORATORY MANUAL, D. Lane, E. Harlow, Eds. (1988). Briefly, a biological sample, such as an C. pneumoniae extract, preferably in a buffer 30 solution, is applied to a chromatography material, preferably equilibrated with the buffer used to -30- WO 00/06741 PCT/IB99/01330 dilute the biological sample so that the polypeptide or polypeptide derivative of the invention (i.e., the antigen) is allowed to adsorb onto the material. The chromatography material, such as a gel or a resin coupled to an antibody of the invention, can be in batch form or in a column. The unbound components are washed off and the antigen is then eluted with an appropriate elution 5 buffer, such as a glycine buffer or a buffer containing a chaotropic agent, e.g., guanidine HCl, or high salt concentration (e.g., 3 M MgCl 2 ). Eluted fractions are recovered and the presence of the antigen is detected, e.g., by measuring the absorbance at 280 nm. An antibody of the invention can be screened for therapeutic efficacy as described as follows. According to an eleventh aspect of the invention, there is provided: (i) a composition 10 of matter containing a monospecific antibody of the invention, together with a diluent or carrier; (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a monospecific antibody of the invention, and (iii) a method for treating or preventing a Chlamydia (e.g., C. trachomatis, C. psittaci, C. pneumoniae or C. pecorum) infection, by administering a therapeutic or prophylactic amount of a monospecific antibody of the invention 15 to an individual in need. Additionally, the eleventh aspect of the invention encompasses the use of a monospecific antibody of the invention in the preparation of a medicament for treating or preventing Chlamydia infection. To this end, the monospecific antibody can be polyclonal or monoclonal, preferably of the IgA isotype (predominantly). In passive immunization, the antibody can be administered to a 20 mucosal surface of a mammal, e.g., the gastric mucosa, e.g., orally or intragastrically, advantageously, in the presence of a bicarbonate buffer. Alternatively, systemic administration, not requiring a bicarbonate buffer, can be carried out. A monospecific antibody of the invention can be administered as a single active component or as a mixture with at least one monospecific antibody specific for a different Chlamydia polypeptide. The amount of antibody and the 25 particular regimen used can be readily determined by one skilled in the art. For example, daily administration of about 100 to 1,000 mg of antibodies over one week, or three doses per day of about 100 to 1,000 mg of antibodies over two or three days, can be an effective regimens for most purposes. Therapeutic or prophylactic efficacy can be evaluated using standard methods in the art, 30 e.g., by measuring induction of a mucosal immune response or induction of protective and/or -31- WO 00/06741 PCT/IB99/01330 therapeutic immunity, using, e.g., the C. pneumoniae mouse model. Those skilled in the art will recognize that the C. pneumoniae strain of the model can be replaced with another Chlamydia strain. For example, the efficacy of DNA molecules and polypeptides from C. pneumoniae is preferably evaluated in a mouse model using an C. pneumoniae strain. Protection can be 5 determined by comparing the degree of Chlamydia infection to that of a control group. Protection is shown when infection is reduced by comparison to the control group. Such an evaluation can be made for polynucleotides, vaccine vectors, polypeptides and derivatives thereof, as well as antibodies of the invention. Adjuvants useful in any of the vaccine compositions described above are as follows. 10 Adjuvants for parenteral administration include aluminum compounds, such as aluminum hydroxide, aluminum phosphate, and aluminum hydroxy phosphate. The antigen can be precipitated with, or adsorbed onto, the aluminum compound according to standard protocols. Other adjuvants, such as RIBI (ImmunoChem, Hamilton, MT), can be used in parenteral administration. 15 Adjuvants for mucosal administration include bacterial toxins, e.g., the cholera toxin (CT), the E. coli heat-labile toxin (LT), the Clostridium difficile toxin A and the pertussis toxin (PT), or combinations, subunits, toxoids, or mutants thereof. For example, a purified preparation of native cholera toxin subunit B (CTB) can be of use. Fragments, homologs, derivatives, and fusions to any of these toxins are also suitable, provided that they retain adjuvant activity. 20 Preferably, a mutant having reduced toxicity is used. Suitable mutants are described, e.g., in WO 95/17211 (Arg-7-Lys CT mutant), WO 96/6627 (Arg-192-Gly LT mutant), and WO 95/34323 (Arg-9-Lys and Glu-129-Gly PT mutant). Additional LT mutants that can be used in the methods and compositions of the invention include, e.g., Ser-63-Lys, Ala-69-Gly, Glu-1 10-Asp, and Glu-1 12-Asp mutants. Other adjuvants, such as a bacterial monophosphoryl 25 lipid A (MPLA) of, e.g., E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri; saponins, or polylactide glycolide (PLGA) microspheres, can also be used in mucosal administration. Adjuvants useful for both mucosal and parenteral administrations include polyphosphazene (WO 95/2415), DC-chol (3 b-(N-(N',N'-dimethyl aminomethane)-carbamoyl) 30 cholesterol (U.S. Patent 5,283,185 and WO 96/14831) and QS-21 (WO 88/9336). - 32 - WO 00/06741 PCT/IB99/01330 Any pharmaceutical composition of the invention, containing a polynucleotide, a polypeptide, a polypeptide derivative, or an antibody of the invention, can be manufactured in a conventional manner. In particular, it can be formulated with a pharmaceutically acceptable diluent or carrier, e.g., water or a saline solution such as phosphate buffer saline. In general, a 5 diluent or carrier can be selected on the basis of the mode and route of administration, and standard pharmaceutical practice. Suitable pharmaceutical carriers or diluents, as well as pharmaceutical necessities for their use in pharmaceutical formulations, are described in Remington's Pharmaceutical Sciences, a standard reference text in this field and in the USP/NF. The invention also includes methods in which Chlamydia infection, are treated by oral 10 administration of a Chlamydia polypeptide of the invention and a mucosal adjuvant, in combination with an antibiotic, an antacid, sucralfate, or a combination thereof. Examples of such compounds that can be administered with the vaccine antigen and the adjuvant are antibiotics, including, e.g., macrolides, tetracyclines, and derivatives thereof (specific examples of antibiotics that can be used include azithromycin or doxicyclin or immunomodulators such as 15 cytokines or steroids. In addition, compounds containing more than one of the above-listed components coupled together, can be used. The invention also includes compositions for carrying out these methods, i.e., compositions containing a Chlamydia antigen (or antigens) of the invention, an adjuvant, and one or more of the above-listed compounds, in a pharmaceutically acceptable carrier or diluent. 20 Amounts of the above-listed compounds used in the methods and compositions of the invention can readily be determined by one skilled in the art. In addition, one skilled in the art can readily design treatment/immunization schedules. For example, the non-vaccine components can be administered on days 1-14, and the vaccine antigen + adjuvant can be administered on days 7, 14, 21, and 28. 25 The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for purposes of illustration and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. Although specific terms have been employed herein, such 30 terms are intended in a descriptive sense and not for purposes of limitation. -33- WO 00/06741 PCT/IB99/01330 Example 1 Preparation of plasmid vector pCAI501 containing the mip gene This example illustrates the preparation of a plasmid vector pCAI501 containing the mip gene. 5 The mip gene was amplified from Chlamydia pneumoniae genomic DNA by polymerase chain reaction (PCR) using a 5' primer: 5'ATAAGAATGCGGCCGCCACCATGAAAAAAAAATTATCATTACTTGTAGGTT 3' (SEQ ID NO:5), which contains an Not I restriction site, a ribosome binding site, an initiation codon and the sequence encoding the N-terminal sequence of mip and a 3' primer: 10 5' GCGCCGGATCCGAAATATTCCCATGATATTTTG 3' (SEQ ID NO:6) including the sequence encoding the C-terminal sequence of the mip and a Bam HI restriction site. The stop codon was excluded and an additional nucleotide was inserted to obtain an in-frame C-terminal fusion with the Histidine tag. After amplification, the PCR fragment was purified using QIAquick T M PCR purification 15 kit (Qiagen) and then digested with Not I and Bam HI and cloned into the pCA-Myc-His eukaryotic expression vector describe in Example 2 (FIG. 3) with transcription under control of the human CMV promoter. Example 2 Preparation of eukaryotic expression vector pCA/Myc-His This example illustrates the preparation of the eukaryotic expression vector 20 pCA/Myc-His. Plasmid pcDNA3.1 (-)Myc-His C (Invitrogen) was restricted with Spe I and Bam HI to remove the CMV promoter and the remaining vector fragment was isolated. The CMV promoter and intron A from plasmid VR-1012 (Vical) was isolated on a Spe I / Bam HI fragment. The fragments were ligated together to produce plasmid pCA/Myc-His. The Not I/Bam HI restricted 25 PCR fragment containing the mip gene was ligated into the Not I and Bam HI restricted plasmid pCA/Myc-His to produce plasmid pCAI501 (FIG. 3). -34- WO 00/06741 PCT/IB99/01330 The resulting plasmid, pCAI501, was transferred by electroporation into E. coli XL-1 blue (Stratagene) which was grown in LB broth containing 50 pig/ml of carbenicillin. The plasmid was isolated by Endo Free Plasmid Giga Kit T (Qiagen) large scale DNA purification system. DNA concentration was determined by absorbance at 260 nm and the plasmid was 5 verified after gel electrophoresis and Ethidium bromide staining and comparison to molecular weight standards. The 5' and 3' ends of the gene were verified by sequencing using a LiCor model 4000 L DNA sequencer and IRD-800 labelled primers. Example 3 Protection against intranasal C. pneumoniae This example illustrates the immunization of mice to achieve protection against an 10 intranasal challenge of C. pneumoniae. It has been previously demonstrated that mice are susceptible to intranasal infection with different isolates of C. pneumoniae. Yang et. al., Infect. Immun. 61: 2037-2040 (1993). Strain AR-39 (Grayston, 1989) was used in Balb/c mice as a challenge infection model to examine the capacity of chlamydia gene products delivered as naked DNA to elicit a protective response 15 against a sublethal C. pneumoniae lung infection. Protective immunity is defined as an accelerated clearance of pulmonary infection. Groups of 7 to 9 week old male Balb/c mice (5 to 9 per group) were immunized intramuscularly (i.m.) plus intranasally (i.n.) with plasmid DNA containing the coding sequence of C. pneumoniae mip as described in Examples 1 and 2. Saline or the plasmid vector lacking an 20 inserted chlamydial gene was given to groups of control animals. For i.m. immunization alternate left and right quadriceps were injected with 100 Ig of DNA in 50 il of PBS on three occasions at 0, 3, and 6 weeks. For i.n. immunization, anaesthetized mice aspirated 50 pl of PBS containing 50 tg DNA on three occasions at 0, 3, and 6 weeks. At week 8, immunized mice were inoculated i.n. with 5 x 10 IFU of C. pneumoniae, 25 strain AR39 in 100 pl of SPG buffer to test their ability to limit the growth of a sublethal C. pneumoniae challenge. Lungs were taken from mice at day 9 post-challenge and immediately homogenized in SPG buffer (7.5% sucrose, 5 mM glutamate, 12.5 mM phosphate pH 7.5). The homogenate was stored frozen at -70'C until assay. Dilutions of the homogenate were assayed for the presence of -35- WO 00/06741 PCT/IB99/01330 infectious chlamydia by inoculation onto monolayers of susceptible cells. The inoculum was centrifuged onto the cells at 3000 rpm for 1 hour, then the cells were incubated for three days at 351C in the presence of 1 tg/ml cycloheximide. After incubation, the monolayers were fixed with formalin and methanol then immunoperoxidase stained for the presence of Chlamydial 5 inclusions using convalescent sera from rabbits infected with C. pneumoniae and metal-enhanced DAB as a peroxidase substrate. FIG. 4 illustrates that mice immunized i.n. and i.m. with pCAI501 had chlamydial lung titers less than 4600 in 3 of 5 cases whereas the range of values for control mice were 1800-23100 IFU/lung (mean 11811) and 16600-26100 IFU/lung (mean 22100) for sham 10 immunized with saline or immunized with the unmodified vector respectively (Table 1). The lack of protection with the unmodified vector confirms that DNA per se was not responsible for the observed protective effect. This is further supported by the results obtained for one additional plasmid DNA construct, pdagA, that failed to protect, and for which the mean lung titers were similar to those obtained for saline-immunized control mice. The construct pdagA is 15 identical to pCAI501 except that the nucleotide sequence encoding mip is replaced with a C.pneumoniae nucleotide sequence encoding the protein dagA. Table 1 Bacterial Load (Inclusion-Forming Units per Lung) in the Lungs of BALB/C Mice Immunized with Various DNA Immunization Constructs Mouse Immunizing Construct Saline Vector pdagA pCAI501 1 17700 19900 16000 3700 2 3900 16600 500 11300 3 1800 24300 18500 6200 4 16400 26100 12800 3800 5 11700 23600 6400 3200 6 23100 7 12000 8 5300 9 14400 10 18700 11 7300 12 8400 MEAN 11725 22100 10840 5640 SD 6567.71 3813.79 7344.59 3370.90 -36- WO 00/06741 PCT/IB99/01330 EQUIVALENTS From the foregoing detailed description of the specific embodiments of the invention, it should be apparent that a unique Chlamydia antigen has been described. Although particular embodiments have been disclosed herein in detail, this has been done by way of example for 5 purposes of illustration only, and is not intended to be limiting with respect to the scope of the appended claims which follow. In particular, it is contemplated by the inventor that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims. -37-

Claims (37)

1. An isolated polynucleotide selected from the group consisting of: (a) a polynucleotide having a sequence comprising the nucleotide sequence SEQ ID NO: 1, and functional fragments thereof; (c) a polynucleotide encoding a polypeptide having a sequence that is at least 75% homologous to SEQ ID NO:2, and functional fragments thereof; and (d) a polynucleotide capable of hybridizing under stringent conditions to a polynucleotide having a sequence comprising the nucleotide sequence SEQ ID NO: 1, and functional fragments thereof.

2. The polynucleotide of claim 1, linked to a second nucleotide sequence encoding a fusion polypeptide

3. The nucleotide of claim 2 wherein the fusion polypeptide is a heterologous signal peptide.

4. The nucleotide of claim 2 wherein the polynucleotide encodes a functional fragment of the polypeptide having the SEQ ID NO:2.

5. An isolated polypeptide having a sequence that is at least 75% homologous to SEQ ID NO:4, and functional fragments thereof

6. The polypeptide of claim 5, wherein said polypeptide has the sequence of SEQ ID NO:2 or functional fragments thereof.

7. A polypeptide comprising the polypeptide of claim 5 linked to a fusion polypeptide

8. The polypeptide of claim 7, wherein the fusion polypeptide is a signal peptide. -38- WO 00/06741 PCT/IB99/01330

9. The polypeptide of claim 7, wherein the fusion polypeptide comprises a heterologous polypeptide having adjuvant activity.

10. An expression cassette, comprising the polynucleotide of claim 1 operably linked to a promoter.

11. An expression vector, comprising the expression cassette of claim 10.

12. A host cell, comprising the expression cassette of claim 10.

13. The host cell of claim 10, wherein said host cell is a prokaryotic cell.

14. The host cell of claim 13, wherein said host cell is a eukaryotic cell.

15. A method for producing a recombinant CPN100501 polypeptide, comprising: (a) culturing a host cell of claim 12, under conditions that the allow the expression of the polypeptide; and (b) recovering the recombinant polypeptide.

16. A vaccine vector, comprising the expression cassette of claim 10

17. The vaccine vector of claim 16, wherein said host mammal is human.

18. The vaccine vector of claim 16, in a pharmaceutically acceptable excipient.

19. A pharmaceutical composition, comprising a immunologically effective amount of the vaccine vector of claim 14.

20. A method for inducing an immune response in a mammal, comprising: administering to said mammal an immunologically effective amount of the vaccine vector of claim 16, wherein said administration induces an immune response.

21. A pharmaceutical composition, comprising an immunologically effective amount of the polypeptide of claim 5 and pharmaceutically acceptable diluent.

22. The pharmaceutical composition of claim 21, further comprising an adjuvant. -39- WO 00/06741 PCT/IB99/01330

23. The pharmaceutical composition of claim 21, further comprising one or more known Chlamydia antigens.

24. A method for inducing an immune response in a mammal, comprising: administering to said mammal an immunologically effective amount of the pharmaceutical composition of claim 21, wherein said administration induces an immune response.

25. A polynucleotide probe reagent capable of detecting the presence of Chlamydia in biological material, comprising a polynucleotide that hybridizes to the polynucleotide of claim 1 under stringent conditions.

26. The polynucleotide probe reagent of claim 25, wherein said reagent is a DNA primer.

27. A hybridization method for detecting the presence of Chlamydia in a sample, comprising the steps of: (a) obtaining polynucleotide from the sample; (b) hybridizing said obtained polynucleotide with a polynucleotide probe reagent of claim 21 under conditions which allow for the hybridization of said probe and said sample; and (c) detecting said hybridization of said detecting reagent with a polynucleotide in said sample.

28. An amplification method for detecting the presence of Chlamydia in a sample, comprising the steps of: (a) obtaining polynucleotide from the sample; (c) amplifying said obtained polynucleotide using one or more polynucleotide probe reagents of claim 25; and (d) detecting said amplified polypeptide.

29. A method for detecting the presence of Chlamydia in a sample comprising the steps of: -40- WO 00/06741 PCT/IB99/01330 (a) contacting said sample with a detecting reagent that binds to CPN100501 polypeptide to form a complex; and (b) detecting said formed complex.

30. The method of claim 29, wherein said detecting reagent is an antibody.

31. The method of claim 30, wherein said antibody is a monoclonal antibody.

32. The method of claim 30, wherein said antibody is a polyclonal antibody.

33. An affinity chromatography method for substantially purifying a CPN100501 polypeptide, comprising the steps of: (a) contacting a sample containing a CPN100501 polypeptide with a detecting reagent that binds to CPN100501 polypeptide to form a complex; (c) isolating said formed complex; (c) dissociating said formed complex; and (d) isolating the dissociated CPN100501 polypeptide.

34. The method of claim 33, wherein said detecting reagent is an antibody.

35. The method of claim 34, wherein said antibody is a monoclonal antibody.

36. The method of claim 34, wherein said antibody is a polyclonal antibody.

37. An antibody that immunospecifically binds a polypeptide of claim 5, or a fragment or derivative of said antibody containing the binding domain thereof. -41-