AU4647500A

AU4647500A - Dna binding protein and sequence as insulators having specific enhancer blocking activity for regulation of gene expression

Info

Publication number: AU4647500A
Application number: AU46475/00A
Authority: AU
Inventors: Adam C. Bell; Gary Felsenfeld; Adam G. West
Original assignee: US Department of Health and Human Services
Current assignee: US Department of Health and Human Services
Priority date: 1999-06-30
Filing date: 2000-04-19
Publication date: 2001-01-22
Anticipated expiration: 2020-04-19
Also published as: CA2377929A1; WO2001002553A3; AU776752B2; EP1196612A2; WO2001002553A2; JP2003504016A

Description

WO 01/02553 PCT/USOO/10509 Title Of The Invention DNA BINDING PROTEIN AND SEQUENCE AS INSULATORS HAVING SPECIFIC ENHANCER BLOCKING 5 ACTIVITY FOR REGULATION OF GENE EXPRESSION Field Of The Invention The present invention relates to the identification of an insulator 10 nucleic acid sequence which has the ability to block the action of enhancers and prevent gene activation, and a DNA binding protein which binds to the insulator sequence. The invention also relates to methods for insulating the expression of a given gene by employing the insulator sequence and/or the DNA binding protein of the invention. The invention further relates to the identification of an insulator 15 element which has the ability to block the expression of the insulin growth factor 2 (Igf2) gene. The enhancer-blocking activity of this insulator element is dependent upon CTCF binding to the insulator. Methylation of the insulator element abolishes the ability of the CTCF to bind to the insulator and would therefore result in loss of CTCF-dependent enhancer-blocking activity. The invention also relates to methods 20 of modulating the enhancer-blocking activity of the insulator element. Background Of The Invention Enhancer-mediated activation is a fundamental mechanism of gene regulation in eukaryotic organisms. Enhancers can act over large distances to 25 activate transcription, independent of their orientation and position relative to the promoter. In many cases, if given access, enhancers can act promiscuously to activate transcription of heterologous promoters. In fact, some types of cancers are thought to arise as a result of translocations which artificially juxtapose an oncogene with a heterologous enhancer. 30 Genome sequencing has revealed many cases where differentially regulated genes neighbor each other at distances over which enhancers could act, yet the genes are independently regulated. Thus, mechanisms are likely to exist that are able to prevent the action of an enhancer on a neighboring locus. This restriction must be achieved, at least in some cases, without impeding the action of 35 the enhancer within its native locus. A DNA element able to function in this way WO 01/02553 PCT/USOO/10509 -2 would, in effect, constitute a boundary to the action of an enhancer, thereby preventing it from acting across the boundary, while otherwise leaving the enhancer unimpeded. This property is one of the defining characteristics of an insulator, a type of regulatory element that has only recently been recognized. (Kellum and 5 Elgin, 1998; Udvardy, 1999; Bell and Felsenfeld, 1999, U.S. Patent No. 5,610,053 to J. Chung et al.). The first DNA sequences to be described as having the properties of an insulator were the scs and scs'elements of Drosophila, which were initially identified as marking the chromatin boundaries of a heat shock locus. When scs 10 elements (i.e., scs DNA sequences) were placed on either side of a gene for eye color and introduced as transgenes into Drosophila embryos, the resulting offspring flies all had similar eye color, independent of the site of integration of the transgene. This result indicated that scs had protected the reporter gene from both negative and positive endogenous influences, or 'position effects' (Kellum and Schedl, 1991 and 15 1992). Another Drosophila insulator element, gypsy, was first identified because of its ability to block the action of an enhancer on a promoter when the element lay between them, but not otherwise (Holdridge and Dorsett 1991; Geyer and Corces, 1992; Dorsett, 1993). Studies of these elements have led to a working definition of an insulator as an element that is capable of protecting against position effects 20 and/or blocking enhancer action in a directional manner. For both scs' and gypsy, proteins have been identified that bind specifically to the DNA elements and are, at least in part, responsible for mediating insulator activity (Geyer and Corces, 1992; Zhao et al., 199S). Insulator elements have also been identified in vertebrates (Chung et 25 al., 1993 and 1997; Zhong and Krangel, 1997; Robinett et al., 1997). U.S. Patent No. 5,610,053 to Chung et al. has described a 1.2 kb DNA insulator element, which was derived from the 5' end of the chicken 1-globin locus and exhibited strong enhancer-blocking activity. (Chung et al., 1993 and 1997). This region contains a constitutive DNase I hypersensitive site that is present in all tissues. The 1.2 kb 30 insulator element coincides almost exactly with the point of transition between an active chromatin conformation, marked both by histone hyperacetylation and a WO 01/02553 PCT/USOO/10509 -3 heightened general sensitivity to DNase, and an inactive domain extending farther 5' that is insensitive to nuclease and less highly acetylated. (Hebbes et al., 1994). Within the 1.2 kb element is a 250 base pair (bp) 'core' fragment or region that possesses a large part of the enhancer blocking activity (U.S. Patent No. 5 5,610,053 to J. Chung et al.; Chung et al., 1997). However, the identification and characterization of additional and specific sub-sequences having insulator function within the 1.2 kb insulator element and 250 bp core remain to be elucidated. In addition, there remains to be discovered and identified one or more DNA binding sites within the core region that is/are necessary and sufficient for enhancer 10 blocking activity and that are recognition sites for regulatory protein binding to DNA. Directional enhancer-blocking activity of proteins that bind to specific insulator nucleic acid sequences provides to the art important methods to control gene function at numerous complex gene loci in many organisms. The 15 identification and characterization of an insulator sequence and protein that binds thereto can establish the foundation for maintenance of boundaries between different groups of genes that have distinct regulatory patterns. The use of such isolated sequences and their purified binding proteins provide significant tools for the regulation of gene expression and function in mammals and plants. 20 Description Of The Drawings Figs. 1A-IG show the fine mapping of the insulator core. In Figs. 1A and lB, the position of HS4 was measured by comparing the migration of the DNase I digestion fragment generated by limited digestion of chicken erythrocyte 25 chromatin to the migration of DNAs of known length and identical composition. The logic of this mapping is outlined in Fig. 1A. Fig. 1B shows the autoradiographic results of enhancer blocking activity of fragments of the core. The position of the hypersensitive site relative to previously defined DNase I footprints (Chung et al., 1997) is indicated in Fig. 1C. Figs. ID-IF show the results of 30 enhancer blocking assays in which the elements indicated were placed between enhancer and promoter as depicted in Fig. 1G, and the relative number of neomycin resistant colonies was counted. A schematic of each inserted element is shown WO 01/02553 PCT/USOO/10509 -4 ("Test Fragments"), as well as the relative numbers of neomycin-resistant colonies observed ("Relative NeoR Colonies"), and the numerical value of the insulation effect ("Fold Insulation") relative to the non-insulated controls (pNI and X DNA). In particular, Figs. ID and E show the effect on enhancer blocking of deletion of 5 footprinted regions from the core. Fig. IF shows increased enhancer blocking that is observed when insulating elements were multimerized. The data presented in Figs. ID-F represent an average of at least 4 independent assays. Fig. 1G presents a schematic diagram of the construction used to test various DNA fragments for enhancer-blocking activity. 10 Figs. 2A-2E present the identification of a minimal enhancer blocking site. In Fig. 2A, a 90 bp fragment spanning FII and FIII was subjected to further deletion; the effects on enhancer blocking are shown. Fig. 2B presents the results of an examination of the effect of the relative positions of enhancer and promoter on the enhancer-blocking effect of FI in the colony assay. Fig. 2C 15 presents the effect of mutation of SpI sites within FII/III on enhancer blocking. Fig. 2D shows the results of an evaluation of the contribution to the enhancer blocking activity of FII of motifs homologous to cx2 and Su(Hw). Fig. 2E shows a truncated sequence of FIl (SEQ ID NO:2) and its homologies to known transcription factor binding sites, namely, Su(Hw): SEQ ID NO:3; Sp1; SEQ ID NO:4; and a2: SEQ 20 ID NO:5. The enhancer-blocking data presented in Figs. 2A-D represent the average of 2-5 independent assays for each construction. Figs. 3A-3D show the sequence specificity of enhancer blocking and nuclear factor binding by FI. In Fig. 3A, the indicated sequences (SEQ ID NOS:1, 6-10) were inserted into the AscI site of pNI; their ability to block an enhancer was 25 measured in the colony assay. Specifically, as shown in Fig. 3A, SEQ ID NO: I corresponds to the FII fragment; SEQ ID NO:6 corresponds to x5'; SEQ ID NO:7 corresponds to xM; SEQ ID NO:8 corresponds to x3'; SEQ ID NO:9 corresponds to AF; and SEQ ID NO:10 corresponds to rev sequences. Figs. 3B and 3C show gel mobility shift assays with a labeled 60 bp FII probe and nuclear extracts from 30 human K562 (Fig. 3B) and chicken red blood cells (RBC), (Fig. 3C). Cold competitors as shown (sequences in Fig. 3A) were added at a 100 fold molar excess WO 01/02553 PCT/USOO/10509 -5 in these experiments. Fig. 3D presents a comparison of the capacity of the indicated FII mutants (SEQ ID NOS:1, 6-17) to (i) act as insulators in the colony assay, (ii) bind to a candidate insulator protein in gel shift and (iii) bind to CTCF in southwestern binding assays (see also Figs. 4A-C). Data were normalized with FII 5 activity considered as 100% in each assay. Figs. 4A-4D relate to purification of an FII binding factor. Fig. 4A shows sequence specific FII binding observed at -140 kDa apparent molecular weight in protein fractions obtained during different stages of purification. Fig. 4B shows a schematic outline of the protocol used to purify the FII binding factor. 10 Figs. 4C and 4D provide a representative example of a Coomassie stained gel of the purified fractions eluted from the hydroxyapatite column with the internal peptide sequences obtained from the indicated band indicated (labeled "Coomassie", Fig. 4C), and the result of a southwestern assay of FII binding to this fraction (labeled "Southwestern", Fig. 4D). 15 Fig. 5 shows FII binding and enhancer blocking by CTCF. Purified FII binding factor (lane 1) and in vitro translated CTCF (lanes 2-11) have identical specificity for FII (compare to Fig. 3A) and identical complex migration in a gel shift assay when bound to either FII (lanes 2-8) or previously-characterized CTCF sites from the chicken c-myc promoter (lane 9), the chicken Iysozyme promoter 20 (lane 10) or the human amyloid beta-protein promoter (lane 11). The table in the right of the figure summarizes the capacity of CTCF sites to act as enhancer blockers in the colony assay. The data presented represent the average of two independent measurements. Figs. 6A-6C show sequence homologies among CTCF sites and 25 vertebrate insulators. Fig. 6A, (SEQ ID NOS:1, 8, 18-20), shows that the alignment of FII with other known CTCF sites reveals a conserved 3' region which corresponds to the sequence altered in the x3' mutant (see Figs. 3A-3D). Fig. 6B, (SEQ ID NOS:1, 21-27), shows the alignment of the 100 bp repeats of the Xenopus RO element and FII. Fig. 6C, (SEQ ID NOS:1 and 28), shows the alignment of FII 30 with a homologous site (BEAD-A) in the BEAD-I element from the human T cell receptor W locus.

WO 01/02553 PCT/USOO/10509 -6 Figs. 7A and 7B show the conservation of sequence-specific enhancer blocking activity among vertebrate insulators. Fig. 7A presents gel mobility shift assays with FII and BEAD A as probes to reveal sequence specific binding to partially purified CTCF. An antibody raised against a C-terminal peptide 5 of CTCF specifically supershifts both complexes. Fig. 7B shows enhancer blocking activities of vertebrate insulators. These data are the average of at least two independent experiments, with the exception that the data for the RO element are from a single determination. Figure 8A-B show that differentially methylated region (ICR) 10 upstream of H19 has the enhancer-blocking properties of an insulator. Fig. 8A shows a schematic of the neighboring mouse Igf2 and H19 genes. On the maternally inherited chromosome, the ICR is unmethylated (white rectangles) and contains two nuclease-hypersensitive regions (hatched boxes, HS1 and HS2); on the paternally inherited chromosome, the ICR is methylated (black rectangles) and 15 contains no hypersensitive sites. Deletion of a 1.6 kb fragment of the ICR (termed the DMD fragment) eliminates HS2 and most of HS1. Fig. 8B shows enhancer blocking activity of various constructs. Constructs in which various fragments of the ICR were inserted at defined positions relative to the enhancer and promoter were prepared. For each construct, colony number was normalized to an 20 uninsulated control, NI. Data are the average of three independent measurements. Figure 9A-D shows conserved CTCF sites within the H19 ICR. Fig. 9A shows sequences of the CTCF sites clustered upstream of the mouse, rat, and human H19 genes. Shading indicates identity among the sites; gray shading indicates species-specific identities, while black shading indicates cross-species 25 sequence conservation among these sites. Fig. 9B shows enhancer-blocking activity of a fragment spanning only m3 from the mouse ICR. Data are the average of three independent experiments. Fig. 9C shows gel mobility-shift analysis of p-globin FII (60-mer) and 83-91-mer duplexes spanning mouse and human ICR sites binding to K562 nuclear extract (E), partially purified (chicken) CTCF (P), and in vitro 30 translated human CTCF (I). An asterisk indicates the position of the CTCF:DNA complex. Labeled DNA probes are indicated at the panel bottom. Fig. 9D shows analysis of CTCF binding to representative mouse and human ICR sites. DNAs WO 01/02553 PCT/USOO/10509 -7 were incubated with K562 nuclear extract in the presence of a 50-fold excess of unlabeled competitors as indicated or with an anti-CTCF antibody. SS indicates the position of the supershifted CTCF complex. Figures 1OA-B show that CTCF is responsible for the methylation 5 sensitive enhancer-blocking activities of the mouse and human ICRs. Fig. 1 OA shows enhancer blocking activities of fragments of the mouse ICR after sequential deletion of the sequences spanning individual CTCF sites. Results are the average of two to three independent measurements. Fig. 1 OB shows on the left panel the effect of CpG methylation on binding of partially purified chicken CTCF to various 10 sites in the absence of competitor DNA (-), in the presence of 50-fold excess of unlabeled duplex DNA (S, self) or a 50-fold excess of unlabeled duplex of identical sequence with 5 meC incorporated at every CpG (M, uniformly methylated). Labeled DNA probes are indicated at the bottom of the panel. In the right panel: the effect of 5 meC substitution at a single site (M1, singly methylated at the first CpG in the 15 black-shaded region of Fig. 9a). Figure 11 shows a model for methylation-dependent modulation of insulator action in the epigenetic regulation of Igf2. On the maternally inherited chromosome, the ICR is unmethylated. This allows binding of CTCF to its sites (ml-4), two in each nuclease-hypersensitive region (shaded boxes), and the 20 resulting insulator blocks activation of the maternal copy of Igf2 by the H19 enhancer. On the paternally inherited chromosome, the ICR is methylated. This prevents CTCF binding, thereby inactivating the insulator and allowing the H19 enhancer to activate Igf2. Summary Of The Invention 25 The present invention provides a newly-identified insulator nucleic acid sequence that acts as a barrier to the influences of neighboring cis-acting elements, thereby preventing gene activation, for example, when juxtaposed between an enhancer sequence and a promoter sequence. According to the present 30 invention, the new insulator nucleic acid sequence is 42 base pairs (bp) in length and comprises a new, specific and previously unidentified fragment of the chicken beta (p)-globin insulator element. This insulator sequence was shown to be both WO 01/02553 PCT/USOO/10509 -8 necessary and sufficient for the enhancer blocking activity in human cells, as described herein. It is an object of the present invention to provide a method for using the newly-characterized and isolated insulator element to insulate or buffer the 5 expression of a reporter gene from adverse effects of neighboring or surrounding chromatin. The incorporation of the defined insulator sequence into vectors and constructs allows gene transfer and expression in cells and tissues with virtually no concern for suppression or inhibition of expression due to the chromosomal milieu after integration. 10 It is another object of the present invention to provide genetic expression constructs or vectors which are designed to contain one or more operational DNA sequence insulator elements comprising SEQ ID NO: 1 which can insulate or buffer the activity of a particular gene from the effects of the activity of cis-acting regulatory elements, such as enhancer or silencer regions of the DNA. 15 The constructs may contain one or more insulator elements and one or more reporter genes in the form of transcription units or mini-loci, including at a minimum, an enhancer, a promoter, and a reporter gene. The insulator element-containing constructs allow for the transfection of cells of a particular lineage or of a particular tissue type, depending upon the gene to be transfected and upon other features of the 20 construct which may be cell- or tissue-specific, such as specific promoter or enhancer elements, or upon particular regulatory molecules, proteins, or factors which are produced by a particular cell or tissue type and which influence the expression of a given transfected gene. In accordance with the invention, the insulator element(s), reporter 25 gene(s), and transcription unit may be provided in the form of a cassette designed to be conveniently ligated into a suitable plasmid or vector, which plasmid or vector is then used to transfect cells or tissues, and the like, for both in vitro and in vivo use. It is a further object of the present invention to provide a mechanism and a tool to restrict the action of cis-acting regulatory elements on genes whose 30 activities or encoded products are needed or desired to be expressed in certain cells and tissues. The genes to be insulated and expressed may be introduced into cells by employing the constructs or vectors achieved by the present invention in which WO 01/02553 PCT/USOO/10509 -9 one or more insulator elements in a chromatin domain are strategically positioned so as to buffer the transfected genes from the influence of the action of other DNA sequences from different chromatin domains located in cis. It is also an object of the present invention to provide a specific 5 binding site for a purified protein, CTCF, which is an eleven zinc finger DNA binding protein, highly conserved in vertebrates. The sequence specificity of CTCF accounts precisely for the sequence requirements of directional enhancer-blocking in vivo. It is a further object of the present invention to provide a method for 10 insulating a given gene by employing the insulator sequence and/or the CTCF binding protein to achieve directional enhancer blocking of a gene. Also provided is a kit or kits containing the vector constructs of the invention and used to insulate the expression of a heterologous gene or genes integrated into host DNA. 15 The invention further provides a method and constructs to insulate the expression of a gene or genes in transgenic animals such that the transfected genes will be able to be protected and stably expressed in the tissues of the transgenic animal or its offspring, for example, even if the DNA of the construct integrates into areas of silent or active chromatin in the genomic DNA of the host 20 animal. Yet another object of the present invention to provide a method for insulating the expression and function of a given gene by employing the DNA binding protein CTCF to bind to the insulator sequence as described herein. The invention further relates to the identification of an insulator 25 element which has the ability to block the expression of the insulin growth factor 2 (Igf2) gene. This insulator element contains CTCF binding sites and its enhancer blocking activity is dependent upon CTCF binding to these sites. Methylation of the insulator element abolishes the ability of the CTCF to bind to the insulator and would therefore result in loss of the CTCF-dependent enhancer-blocking activity. 30 The invention also relates to methods of modulating the enhancer blocking activity of an insulator by targeted methylation or demethylation of the insulator.

WO 01/02553 PCT/USOO/10509 -10 Further objects and advantages of the present invention will be appreciated in light of the description herein. Detailed Description Of The Invention 5 The present invention provides an isolated, 42 base pair (bp) fragment (DNA sequence motif) of the chicken B-globin insulator which has been newly found to be both necessary and sufficient for enhancer blocking activity in human cells. This DNA fragment, called FII herein, has been found to serve as an insulator molecule, i.e., a DNA sequence which can act as a barrier to the influences 10 of neighboring cis-acting elements, for example, to prevent gene activation when located between an enhancer and a promoter of a given gene. According to the present invention, this small DNA sequence motif, FII, comprises the minimal binding site for a cellular DNA binding protein and has the following DNA sequence, from 5' to 3: 15 5'-CCCAGGGATGTAATTACGTCCCTCCCCCGCTA G G G G G C A G C A - 3' (SEQ ID NO:1), (Figs. 3A, 3D and 6A-6C). Newly identified and isolated in accordance with the present invention, the sequence motif of SEQ ID NO:1 accounts for most of the ability of the insulator element to block enhancer activity. Indeed, the function of this smaller 20 sequence has been shown to be pivotal to the ability of the insulator element to block the action of enhancers. The 42 bp fragment containing the sequence motif of SEQ ID NO:1 was able to suppress enhancer activity in a directional manner about as well as the full 1.2 kb element as described in U.S. Patent No. 5,610,053 to J. Chung et al., the 25 contents of which are hereby incorporated by reference herein. The fragment also contains binding sites for Spl and the yeast c2 repressor; however, mutation of these sites had no effect on its blocking activity. By contrast, mutations of the 3' end of FII site did abolish enhancer-blocking. According to the present invention, a DNA fragment encompassing 30 SEQ ID NO: 1 has also been newly discovered to be the core binding site for CTCF, a DNA binding protein that is highly conserved in vertebrates. A further significance of the CTCF site is that it has been found within the BEAD 1 element WO 01/02553 PCT/USOO/10509 - 11 of the T-cell a/6 locus (Zhong and Krangel, 1997) and accounts for the activity of the BEAD 1 element. The DNA sequence motif characterized by SEQ ID NO: 1 specifies the minimal functional binding site for CTCF, as demonstrated in in vitro studies. For optimal binding by the CTCF protein, the DNA sequence motif 5 characterized by SEQ ID NO: 1 preferably comprises additional base pairs at the the 5' and 3' ends, thereby yielding a DNA binding element having approximately 50 to 70, more preferably 5 0-60 total base pairs, which includes SEQ ID NO: 1. For example, the DNA binding element for CTCF may comprise SEQ ID NO: 1 and from about 5-20 additional bases, added to the 5' and 3' ends of the sequence, 10 without adversely affecting its insulator function. When the 42 bp FI DNA fragment was used as a probe in gel retardation experiments, two major shifted bands were observed. One of these bands was attributable to interaction with Spl. The other band appeared to be associated with insulating activity, based on its properties determined from 15 competition experiments. More specifically, the second of the two bands was competed by any DNA that was also active in the enhancer blocking assay, but not by any of the inactive mutated sequences that were tried. Similar gel shift patterns were obtained with extracts from nuclei from chicken erythrocytes and from the human erythroleukemia cell line, K562, which were used to carry out the enhancer 20 blocking assays. These observations and results were used to purify the protein responsible for the specific shifted band. The purified protein was determined to be the protein CTCF. The product of an in vitro transcription/translation reaction with cloned CTCF cDNA yielded results that were identical to those obtained using the above-mentioned cell extracts. 25 CTCF is an 82 kDa protein with 11 zinc fingers (Filippova et al. 1996), and is characterized by an unusually extensive DNase I footprint (51 bp) when bound to its site on DNA, consistent with an involvement of several fingers in typical binding sites. It migrates aberrantly on acrylamide/SDS gels, which accounts for the discrepancy in apparent molecular weight (Klenova et al., 1997). 30 Studies of CTCF in other systems suggest that it can play a variety of regulatory roles. For example, it binds to the promoter of the amyloid p-protein precursor and causes transcriptional activation (Vostrov and Quitschke, 1997), but when it WO 01/02553 PCT/USOO/10509 -12 interacts with sites in the c-myc oncogene, it causes repression (Filippova 1996). CTCF has also been found to be capable of acting in synergy with certain thyroid hormone receptor binding sites both in repression and in T3 induction (Baniahmad et al., 1990). Not all of the 11 zinc fingers of the protein are involved in binding to 5 the sites that have been examined so far. Furthermore, different sites employ partially different subsets of fingers to contact the DNA (Filippova et al. 1996). From this, it can be surmised that the characteristics of the binding site would have a large influence on the conformation of the protein, the nature of its interactions with cofactors, and its ultimate biological effect(s). 10 According to the results presented herein, the CTCF binding site is necessary and sufficient for enhancer blocking activity, as demonstrated in the exemplified assays. The presence of similar binding sites at each of the vertebrate loci known to have enhancer-blocking activity is strong evidence for the role of CTCF sites in insulator function in vivo. 15 Also according to the present invention, the CTCF binding site has been determined to be a sub-fragment (42 bp) of the larger 1.2 kb insulator element containing the p-globin 5' HS4. As mentioned above, it is noteworthy that the P protein 5' insulator element shares with the Drosophila insulators the additional ability to protect against position effects. For example, when two copies of the 20 entire 1.2 kb fragment containing the p-globin 5' HS4 are placed on either side of a stably-integrated reporter gene, the reporter is protected both against variation in expression from one line to another and also against extinction of expression over a period of at least 40-80 days in culture (Pikaart et al., 1998). It is likely that this activity depends upon sequences other than or in addition to FII within the larger 25 insulator element. The complete activity of the p-globin 5' insulator element is thus likely to involve multiple components. It has been newly determined as described herein that enhancer blocking activity of the 5' p-globin insulator and the isolated portions thereof, is dependent upon CTCF. In addition, similar DNA binding site sequences are present 30 in two other vertebrate insulators. The first of these is the BEAD-I element found in the human T-cell receptor (TCR) cc/S locus (Zhong and Krangel, 1997). BEAD- WO 01/02553 PCT/USOO/10509 - 13 1, which has strong directional enhancer blocking properties, is located between TCR 8 gene segments and TCR a joining gene segments. It has been proposed that BEAD-I prevents a 6-specific enhancer from acting on the a genes early in T-cell development. The present findings have shown that BEAD-I contains a CTCF 5 binding site (i.e., the 42 bp DNA sequence motif sub-fragment of the 1.2 kb element) and that this site is responsible for a large portion of the observed enhancer blocking activity. Taken together, the results described herein suggest a conserved and perhaps widely used function of insulators in which CTCF is involved in the 10 maintenance of distinct regulatory regions. Indeed, additional analyses in the inventors' laboratory have shown that the 3' end of the chicken p-globin locus is marked by a hypersensitive site with similar properties to 5' HS4. This 3' end hypersensitive site also contains a CTCF binding site. This element is located between the globin genes and a nearby, yet distinctly unrelated, gene encoding an 15 odorant receptor (Burger et al., 1999), further substantiating the nature and likely function of these boundary elements in vivo. Insulators typically are capable of both blocking enhancer activity and protecting against position effects. These two functions might have only partially overlapping mechanisms. Protection against position effects implies that 20 activation by external endogenous enhancers is blocked, consistent with the activity described herein. However, position effects also arise from silencing induced by neighboring heterochromatin. While the insulator described herein is able to protect against external position effects, it may also be that additional components of the insulator element, or additional cofactors, are involved in protecting against such 25 effects. Without wishing to be bound by theory, it may be likely that in some situations, where enhancer blocking activity is all that is required, a CTCF binding site alone is sufficient, while in the case of a permanent chromatin domain boundary, such as that found at the 5' end of the chicken @-globin locus, additional 30 components are involved. Indeed, even in those cases where only CTCF sites are present, the activity of CTCF may require the participation of other proteins, just as WO 01/02553 PCT/USOO/10509 - 14 the directional enhancer-blocking activity of the suppressor of Hairy-wing protein involves interaction with the mod(mdg4) protein (Gerasimova et al., 1995; Gdula et al., 1996; Georgiev and Kozycina, 1996; Gdula and Corces, 1997; Gerasimova and Corces, 1998). Thus, proteins that interact with, or bind to, CTCF are likely to 5 exist, although none are presently known. According to the present invention, an insulator element, or CTCF binding site, is preferably located between an enhancer and a promoter to influence expression. The position of the insulator is the determining factor -- it can be inserted in either orientation with equal effect and insulator function. With regard to 10 current understanding of how enhancers function, various models have been proposed to account for enhancer blocking. The models fall into two broad categories: steric models and tracking models (Kellum and Elgin, 1998; Udvardy, 1999; Bell and Felsenfeld, 1999). Steric mechanisms postulate that insulators partition an enhancer and a promoter into two separate domains that are inaccessible 15 to each other. The steric models are related to existing ideas of how enhancers work. There is strong evidence that enhancers recruit the RNA polymerase complex to the promoter through interactions between proteins bound to that complex and proteins bound to the enhancer. If this occurs through formation of a loop between the enhancer site and the promoter, then the enhancer will be blocked if looping is 20 prevented. Tracking models presume that some activating signal must travel along the DNA from enhancer to promoter, and that the insulator blocks this transmission. Such activating signals might involve replication, or might for example, require that a polymerase complex travel along the DNA to reach the promoter. The identification of CTCF as a vertebrate enhancer blocking protein provides the ability 25 to functionally dissect the enhancer blocking process. CTCF is likely to play a role in the function of many insulator elements. The first vertebrate insulator to be identified was located at the 5' end of the chicken p-globin domain; this 5' insulator site is likely to serve to protect the globin genes from inappropriate interaction with neighboring genes and their 30 regulatory elements (U.S. Patent No. 5,610,053 to J. Chung et al.). In particular, an independently regulated gene coding for a folate receptor has recently been identified 5' of the globin locus. The globin and folate receptor genes are close WO 01/02553 PCT/USOO/10509 - 15 enough so that the regulatory elements of the two loci might influence each other inappropriately in the absence of an insulator. A similar situation exists in the case of the T-cell receptor locus (Zhong and Krangel, 1997), where the BEAD insulator element shields against inappropriate activity of an enhancer. The presence of 5 CTCF DNA binding sites in these quite different genetic loci implies that the role of such sites in the establishment and maintenance of enhancer boundaries is likely to be a conserved and important component of gene regulation. According to the present invention, the insulator element of SEQ ID NO: 1 demonstrates enhancer-blocking function, both by itself and when bound by 10 the CTCF protein as described herein. Thus, this element and the CTCF protein can be regarded, in a broad sense, as a receptor and its ligand. These two entities can be used together or separately to regulate gene expression. The insulator defined herein is a DNA sequence which is capable of acting as a barrier to neighboring cis acting elements, insulating the transcription of a gene placed within its range of 15 action, when juxtaposed between an enhancer and a promoter. Gene activation by external endogenous enhancers is blocked when the insulator is positioned between the enhancer and the promoter of a given gene. A significant advantage of the insulator sequence defined by SEQ ID NO: 1 is that it is a small molecule and is more versatile for use in a variety of 20 vectors for gene delivery into cells and organisms. By contrast, the larger 1.2 kb insulator and 250 bp core sequences are cumbersome and their sizes may preclude their use in some applications of gene delivery and/or gene transfer. Indeed, according to the results herein, the DNA motif which comprises the insulator of the present invention has been found to be both necessary and sufficient for insulating 25 and enhancer-blocking effects and so may be preferentially used as the insulator of choice in the vectors and constructs embraced by the invention. Another aspect of the insulator sequence described herein, or the insulator bound by its cognate DNA binding protein, is the protection of a stably integrated reporter gene from position effects. 30 In one embodiment, the present invention provides constructs or vectors containing the insulator sequence of SEQ ID NO:1, enhancer and promoter sequences, and at least one heterologous gene sequence encoding a protein, WO 01/02553 PCT/USOO/10509 - 16 polypeptide, or peptide, wherein the insulator sequence is situated between the enhancer and promoter sequences, and upstream of the gene sequence. The construct or vector provides the vehicle for introducing the heterologous gene into a cell where it is integrated into the DNA and expressed and where its expression is 5 insulated from the unwanted or adverse effects of cis-acting elements or sequences in surrounding chromatin. Insulated gene expression and regulation of gene expression by the use of the insulator of the present invention can be further regulated or controlled by endogenous CTCF, or a CTCF-like protein which binds to the DNA binding site specified by SEQ ID NO: 1. Alternatively, a gene encoding 10 CTCF, or a gene encoding a protein having DNA binding function like CTCF, can be used in a vector or construct that is co-introduced into a cell and expressed to more precisely control the expression of the introduced heterologous gene. The vectors or constructs as used herein broadly encompass any recombinant DNA material that is capable of transferring DNA from one cell to 15 another. The vector as described in the above embodiment can represent a mini locus which can be integrated into a mammalian cell where it can replicate and function in a host cell type-restricted and copy number dependent manner, independent of the site of integration. Thus, the expression and production of the introduced gene is insulated from any effects exerted by neighboring genetic loci or 20 chromatin following integration. The insulator element as described herein can be employed to provide novel constructs for the efficient isolation and protection of genes and for the undisturbed production of a particular protein or other molecule encoded by a gene used in the constructs introduced into cells. The insulator element of the 25 invention may also be used to insulate particular genes introduced and subsequently expressed in transgenic animals, such as fruit flies (e.g., Drosophila melanogaster), mice, rats, rodents, higher mammals and the like. Constructs containing the insulator element of the invention may be introduced into early fetal or embryonic cells for the production of transgenic animals containing the functional insulator 30 element and reporter gene transcription unit. By insulating a gene or genes introduced into the transgenic animal, the expression of the gene(s) will be protected from negative or inappropriate regulatory influences in the chromatin at or near the WO 01/02553 PCT/USOO/10509 - 17 site of integration. In addition, the insulator will prevent inappropriate or unwanted activity from external enhancers that may affect the expression of the gene that has integrated into the DNA of a host cell. The use of constructs harboring the insulator segment is envisioned 5 for the creation of knockout mice to determine the effects of a gene on development, or for the testing of therapeutic agents, such as chemotherapeutic or other types of drugs. In general, the constructs of the present invention contain the insulator sequence of SEQ ID NO: 1, an enhancer element and a transcription unit 10 comprising, at a minimum, a gene of interest, for example, a gene encoding a protein or precursor thereof, and a promoter to drive the transcription of the gene of interest, and other sequences necessary or required for proper gene transcription and regulation (e.g. start and stop sites, origin of replication, splice sites and polyadenylation signal). The enhancer is located in sufficient proximity to the 15 transcription unit to enhance the transcription thereof. The constructs may contain more than one small insulator of the invention, preferably in tandem, which are positioned so as to insulate the reporter gene and its transcription unit from surrounding DNA at the site of integration. Transcriptionally competent transcription units can be made by 20 conventional techniques. In a preferred aspect of the present invention, the insulator element is situated between the enhancer and the promoter of a given gene to buffer the effects of a cis-acting DNA region on the promoter of the transcription unit. In some cases, the insulator can be placed distantly from the transcription unit. In addition, the optimal location of the insulator element can be determined by routine 25 experimentation for any particular DNA construct. The function of the insulator element is substantially independent of its orientation, and thus the insulator can function when placed in genomic or reverse genomic orientation with respect to the transcription unit to insulate the gene from the effects of cis-acting DNA sequences of chromatin. 30 The constructs as described herein may be used in gene transfer and gene therapy methods to allow the protected expression of one or more given genes that are stably transfected into the cellular DNA. The constructs of the invention WO 01/02553 PCT/USOO/10509 - 18 would not only insulate a transfected gene or genes from the influences of DNA surrounding the site of integration, but would also prevent the integrated constructs from impacting on the DNA at the site of integration and would therefore prevent activation of the transcription of genes that are harmful or detrimental to the cell. 5 The specificity of the constructs of the invention involves transfecting the particular gene(s) of interest into a cell type having the appropriate milieu for transcription of the gene(s) whose products are desired to be expressed. The constructs of the invention are capable of being transfected into a variety of cell and tissue types. In addition, since the insulator element itself is not cell or tissue 10 specific, it is a universal element which can act as a part of the constructs of the invention to insulation gene expression in the absence of strict cell or tissue specificity. The constructs can be designed to contain the appropriate regulatory sequences and all of the necessary DNA elements for integration of the construct and/or the appropriate components thereof and expression of a gene of interest in a 15 given cell type. For assembly of the construct, the insulator element for ligation can be positioned in accordance with the desired use of the constructs of the invention. Thus, as disclosed above, at least one insulator may be positioned between an enhancer element and a promoter in a transcription unit, or the insulator can be 20 otherwise positioned on either side of a gene so as to obtain optimal insulation of the gene or genes desired to be transcribed. The insulator element can be obtained from natural sources or by synthetic means. For example, the insulator element can be excised from genomic or cDNA clones of eukaryotes, including chickens, mice, and humans, and the like, and then ligated with segments of DNA comprising the 25 enhancer and the transcription unit. Alternatively, the insulator element can be synthetically produced by conventional techniques of DNA synthesis such as the phosphite triester chemistry method (for example, see U.S. Patent No. 4,415,732 to Caruthers et al.; and Sinha, N.D. et al., 1984). Those skilled in the art will appreciate that a variety of enhancers, 30 promoters, and genes are suitable for use in the constructs of the invention, and that the constructs will contain the necessary start, termination, and control sequences for proper transcription and processing of the gene of interest when the construct is WO 01/02553 PCT/USOO/10509 - 19 introduced into a vertebrate cell, such as that of mammal or a higher eukaryote. The constructs may be introduced into cells by a variety of gene transfer methods known to those skilled in the art, for example, gene transfection, lipofection, microinjection, electroporation, transduction and infection. In addition, it is 5 envisioned that the invention can encompass all or a portion of a viral sequence containing vector, such as those described in U.S. Patent No. 5,112,767 to P. Roy Burman and D.A. Spodick, for targeted delivery of genes to specific tissues. It is preferred that the constructs of the invention integrate stably into the genome of specific and targeted cell types. 10 Further, the DNA construct comprising the insulator element, enhancer and transcription unit may be inserted into or assembled within a vector such as a plasmid or virus, as mentioned above. The construct can be assembled or spliced into any suitable vector or cosmid for incorporation into the host cell of interest. The vectors may contain a bacterial origin of replication so that they can be 15 amplified in a bacterial host. The vectors may also contain, in addition to a selectable marker for selection of transfected cells, as in the exemplary constructs, another expressible and selectable or marker gene of interest. Vectors can be constructed which have the insulator element in appropriate relation to an insertion region for receiving DNA encoding a protein or 20 precursor thereof. The insertion region can contain at least one restriction enzyme recognition site. A particularly useful vector for gene therapy is the retroviral vector. A recombinant retroviral vector may contain the following parts: an intact 5' LTR from an appropriate retrovirus, such as MMTV, followed by DNA containing the 25 retroviral packaging signal sequence; the insulator element placed between an enhancer and the promoter of a transcription unit containing the gene to be introduced into a specific cell for replacement gene therapy; a selectable gene as described below; and a 3' LTR which contains a deletion in the viral enhancer region, or deletions in both the viral enhancer and promoter regions. The selectable 30 gene may or may not have a 5' promoter that is active in the packaging cell line, as well as in the transfected cell.

WO 01/02553 PCT/USOO/10509 - 20 The recombinant retroviral vector DNA can be transfected into the amphotrophic packaging cell line '-AM (see Cone, R. and Mulligan, R., 1984) or other packaging cell lines which are capable of producing high titer stocks of helper-free recombinant retroviruses. After transfection, the packaging cell line is 5 selected for resistance to G418, present at appropriate concentration in the growth medium. Adenoviral vectors (e.g. DNA virus vectors), particularly replication defective adenovirus vectors, or adeno-associated vectors, are also suitable for use and have been described in the art (S. Kochanek et al., 1996; G. Ascadi et al., 1994; 10 Ali et al., 1994). Examples of transfectable reporter or heterologous genes that can be used in the present invention include those genes whose function is desired or needed to be expressed in vivo or in vitro in a given cell or tissue type. Genes having significance for genetic or acquired disorders are particularly appropriate for 15 use in the constructs and methods of the invention. Genes that may be insulated from cis-acting regulatory sequences by the insulator elements of the present invention may be selected from, but are not limited to, both structural and non structural genes, or subunits thereof. Examples include genes which encode proteins and glycoproteins (e.g. factors, cytokines, lymphokines), enzymes (e.g. key 20 enzymes in biosynthetic pathways), hormones, which perform normal physiological, biochemical, and biosynthetic functions in cells and tissues. Other useable genes are selectable antibiotic resistance genes (e.g. the neomycin phosphotransferase gene (Neo @) or the methotrexate-resistant dihydrofolate reductase (dhfr) gene) or drug resistance genes (e.g. the multi-drug resistance (MDR) genes), and the like. 25 Further, the genes may encode a precursor of a particular protein, or the like, which is modified intracellularly after translation to yield the molecule of interest. Further examples of genes to be used in the invention may include, but are not limited to, erythroid cell-specific genes, B-lymphocyte-specific genes, T-lymphocyte-specific genes, adenosine deaminase (ADA)-encoding genes, blood clotting factor-encoding 30 genes, ion and transport channel-encoding genes, growth factor receptor- and hormone receptor-encoding genes, growth factor- and hormone-encoding genes, insulin-encoding genes, transcription factor-encoding genes, protooncogenes, cell WO 01/02553 PCT/USOO/10509 -21 cycle-regulating genes, nuclear and cytoplasmic structure-encoding genes, and enzyme-encoding genes. The present invention is also applicable to targeting tumor or malignant cells with the insulator element-containing constructs carrying genes 5 encoding toxins or toxoids, e.g. diphteria toxoid and the like, to kill or otherwise damage and destroy the targeted cells. In addition, newly-cloned and isolated genes may be suitable candidates for use as reporter genes in the present invention. Examples of eukaryotic promoters suitable for use in the invention are may include, but are not limited to, the thymidine kinase (TK) promoter, the 10 alpha globin, beta globin, and gamma globin promoters, the human or mouse metallothionein promoter, the SV40 promoter, retroviral promoters, cytomegalovirus (CMV) promoter, and the like. The promoter normally associated with a particular structural gene which encodes the protein of interest is often desirable, but is not mandatory. Accordingly, promoters may be autologous 15 (homologous) or heterologous. Suitable promoters may be inducible, allowing induction of the expression of a gene upon addition of the appropriate inducer, or they may be non-inducible. Further, a variety of eukaryotic enhancer elements may be used in the constructs of the invention. Like the promoters, the enhancer elements may be 20 autologous or heterologous. Examples of suitable enhancers include, but are not limited to, erythroid-specific enhancers, (e.g. as described by Tuan, D. et al., and in U.S. Patent No. 5,126,260 to I.M. London et al.), the immunoglobulin enhancer, virus-specific enhancers, e.g. SV40 enhancers, or viral LTRs, pancreatic-specific enhancers, muscle-specific enhancers, fat cell-specific enhancers, liver specific 25 enhancers, and neuron-specific enhancers. Many types of cells and cell lines (e.g. primary cell lines or established cell lines) and tissues are capable of being stably transfected by or receiving the constructs of the invention. Examples of cells that may be used include, but are not limited to, stem cells, B lymphocytes, T lymphocytes, 30 macrophages, other white blood lymphocytes (e.g. myelocytes, macrophages, monocytes), immune system cells of different developmental stages, erythroid lineage cells, pancreatic cells, lung cells, muscle cells, liver cells, fat cells, neuronal WO 01/02553 PCT/USOO/10509 -22 cells, glial cells, other brain cells, transformed cells of various cell lineages corresponding to normal cell counterparts (e.g. K562, HEL, HL60, and MEL cells), and established or otherwise transformed cells lines derived from all of the foregoing. In addition, the constructs of the present invention may be transferred by 5 various means directly into tissues, where they would stably integrate into the cells comprising the tissues. Further, the constructs containing the insulator elements of the invention can be introduced into primary cells at various stages of development, including the embryonic and fetal stages, so as to effect gene therapy at early stages of development. 10 In another embodiment of the invention, the constructs may be designed to contain genes encoding two subunits or components of a single protein so that each chain could be expressed from the same plasmid or suitable vector. For example, some proteins such as growth factors, growth factor receptors, blood clotting factors, and hormones are frequently comprised of two chains or subunits 15 (e.g. ax and 1) which associate to form the functional molecule. In this embodiment, the gene coding for one chain or subunit of the molecule can be positioned in the plasmid or vector in conjunction with the insulator elements and specific promoter and enhancer elements (or heterologous promoter and enhancer, if desired), and the gene coding for the other chain or subunit can be positioned in the same plasmid or 20 vector in conjunction with its insulator, promoter, and enhancer elements. The plasmid or vector containing the dual chain-encoding genes with their appropriately positioned insulator elements can be transfected into cells to allow for the expression of a complete, two-chained molecule from the incorporated plasmid DNA, with each chain being regulated independently and with the copy numbers 25 remaining the same. When used in gene transfer and gene therapy, the constructs described herein may be administered in the form of a pharmaceutical preparation or composition containing a pharmaceutically acceptable carrier, diluent, or a physiological excipient, in which preparation the vector may be a viral vector 30 construct, or the like, to target the cells, tissues, or organs of interest. The composition may be formed by dispersing the components in a suitable pharmaceutically-acceptable liquid or solution such as sterile physiological saline or WO 01/02553 PCT/USOO/10509 - 23 other injectable aqueous liquids. The composition may be administered parenterally, including subcutaneous, intravenous, intramuscular, or intrasternal routes of injection. Also contemplated are intranasal, peritoneal or intradermal routes of administration. For injectable administration, the composition is in sterile 5 solution or suspension or may be emulsified in pharmaceutically- and physiologically-acceptable aqueous or oleaginous vehicles, which may contain preservatives, stabilizers, and material for rendering the solution or suspension isotonic with body fluids (i.e. blood) of the recipient. Excipients suitable for use are water, phosphate buffered saline, pH 7.4, 0.15 M aqueous sodium chloride solution, 10 dextrose, glycerol, dilute ethanol, and the like, and mixtures thereof. The amounts or quantities, as well as routes of administration, used are determined on an individual basis, and correspond to the amounts used in similar types of applications or indications known to those of skill in the art. Also contemplated by the invention is a kit or kits containing 15 insulator constructs in which the insulator elements of the invention are provided in a DNA receivable vector or plasmid that contains or can be readily adapted by the user to contain the appropriate DNA elements for proper expression of a gene or genes of interest. The insulator element-containing plasmids or vectors of the kit contain insulator elements, enhancers, a transcription unit, and the gene or genes of 20 interest may be inserted downstream of the insulator(s), as desired. Alternatively, the constructs of the kit may contain some or all of the necessary genetic elements for proper gene expression, or combinations of these, and the remaining genetic elements may be provided and readily inserted by the user, preferably between the insulator elements in the construct. The insulator element-containing plasmids or 25 vectors may be provided in containers (e.g. sealable test tubes and the like) in the kit and are provided in the appropriate storage buffer or medium for use and for stable, long-term storage. The medium may contain stablizers and may require dilution by the user. Further, the constructs may be provided in a freeze-dried form and may require reconstitution in the appropriate buffer or medium prior to use. 30 The present invention further provides an insulator element found in the insulin-like growth factor 2 (Igf 2) locus. The insulator element contains a set of CTCF binding sites and comprises the sequence shown in SEQ ID NOS:84-87 WO 01/02553 PCT/USOO/10509 - 24 (mouse), SEQ ID NOS:88-91 (rat), or SEQ ID NOS:92-98 (human). The Igf2 gene encodes a growth promoting (or mitogenic) protein and the expression of this gene and its neighboring gene H19 are imprinted. Expression of Igf2 occurs exclusively from the paternally inherited allele. The insulator element identified is within a 5 region between the Igf2 and H19 genes that is methylated in the paternal allele only. According to the present invention, the enhancer-blocking activity of the insulator element identified in the Igf2 locus is dependent upon CTCF binding to the insulator. Methylation of the insulator element (cytosines in the sequence that are followed by a guanine (CpG) are methylated) abolishes the ability of CTCF to 10 bind to the insulator and would result in loss of CTCF-dependent enhancer-blocking activity. Therefore, on the paternal allele, methylation of the insulator element prevents CTCF binding to the insulator element which results in Igf2 expression, whereas in the maternal allele where the insulator element is unmethylated, CTCF is capable of binding to the insulator element and prevent Igf2 expression. 15 As methylation is likely to be the general mechanism by which an insulator whose enhancer-blocking activity is dependent upon CTCF binding is regulated, the invention also provides methods of modulating the CTCF-dependent enhancer-blocking activity of an insulator element by targeted methylation and demethylation of the insulator element. The gene of interest may be introduced into 20 cells by employing constructs or vectors in which the insulator element is strategically positioned with respect to the gene of interest, the promoter and the enhancer element so as to regulate the expression of the gene as described above. In one embodiment, a methylase is employed to methylate the insulator element, thereby activating the expression of the gene of interest in the cell. In one method, 25 DNA methyltransferase 3, which has been shown to be capable of de novo methylation of the cytosine of the CpG residues both in vivo and in vitro (See Bird, 1999 for review), is employed. In this method, in addition to the gene of interest, the promoter, the enhancer element and the insulator element, the vector introduced into the cells also comprises a DNA binding sequence of a DNA binding protein, for 30 example, Gal4 or LexA. The DNA binding sequence would be located in regions adjacent to the CpG residues to be methylated in the insulator element. A vector encoding a fusion protein in which the enzymatic domain of the DNA WO 01/02553 PCT/USOO/10509 - 25 methyltransferase 3 is fused to the DNA binding domain of the DNA binding protein is then introduced into the cells. Methods for generating such domain fusion proteins are well known to those skilled in the art. Binding of the fusion protein to the DNA binding sequence adjacent to the CpG residues and the 5 expression of the fusion protein allow the CpG residues to be methylated by the methyltransferase. In another embodiment, a similar method may be employed to prevent the expression of the gene of interest in a cell by demethylating the CpG residues using a demethylase. Examples 10 The examples as set forth herein are meant to exemplify the various aspects of carrying out the invention and are not intended to limit the invention in any way. Example 1 Materials and Methods 15 A. Plasmid Construction and Oligonucleotides The plasmid pNI was the base plasmid in which all DNA fragments were tested for enhancer blocking activity. DNA fragments subcloned into the AscI site of this plasmid are located between the enhancer (mouse HS2) and the reporter ("y-neo"). When 20 cloned into the NdeI site of pNI, inserted DNA sequences are located "upstream" of the enhancer, and when cloned into the XbaI site, the sequences are located "downstream" of the reporter; in both of these cases the insert is located outside the promoter-enhancer path. pNI was generated by replacing the SacI copy of the 1.2 kb insulator 25 (found between the enhancer and the promoter) in pJC5-4 (Chung et al, 1993) with an AscI linker (New England Biolabs) after digestion of this plasmid with EcII36II. The following primers were used in PCR amplifications to generate fragments for cloning into the AscI site of pNI: AC1F (SEQ ID NO:29); ACIR (SEQ ID NO:30); AC2F (SEQ ID 30 NO:31); AC2R (SEQ ID NO:32); AIACF (SEQ ID NO:33); AIiacF (SEQ ID NO:34); AIiacR (SEQ ID NO:35); AIIIACF (SEQ ID NO:36); AIIIACR (SEQ ID WO 01/02553 PCT/USOO/10509 - 26 NO:37); AIVACF (SEQ ID NO:38); AIVACR (SEQ ID NO:39); AVACR (SEQ ID NO:40); BEADascF (SEQ ID NO:41); BEADascR (SEQ ID NO:42); BEADAAF (SEQ ID NO:43); and BEADAAR (SEQ ID NO:44). The core, FI/FII, FIII/FIV/FV, Al and AV were generated by PCR 5 using the plasmid p501 (Reitman and Felsenfeld, 1990) as a template and the primer pairs AC1F/AC2R, ACIF/ACIR, AC2F/AC2R, AIACF/AC2R, and AC1F/AVACR, respectively. Deletions of FII, FIII and FIV from the core were accomplished by two-step, overlapping PCR. For each deletion, a pair of intermediate fragments was generated by PCR in separate reactions using p501 as the template and the primer 10 pairs AC 1 F/AIIacR, AIIacF/AC2R, AC 1 F/AIIIACR, AIIIACF/AC2R, AClF/AIVACR, and AIVACF/AC2R. The products of each of these reactions were gel-purified, mixed pair-wise to generate the appropriate templates, and the final products were amplified with AClF/AC2R (for example, the products of amplifications with AC1F/AIIacR and AIIacF/AC2R were mixed to generate the 15 template for PCR of the core-All). The full-length BEAD-I fragment was generated by PCR from K562 genomic DNA with primers BEADascF and BEADascR. The fragment BEADAA was generated in a two-step, overlapping PCR reaction, first using the BEAD-1 fragment as a template and the primers BEADascF/BEADAAR and BEADAAF/ 20 BEADascR in separate reactions, then mixing the gel-purified products of these reactions with primers BEADascF and BEADascR to generate the final product by PCR. The a 1.6 kb fragment containing the full length RO element was subcloned into Ec 13611 cut pJC5-4 after liberation of this fragment from p0, 1 25 (Robinett et al., 1997) by digestion with Ec 13611 and PvuII. All other enhancer blocking fragments were generated by direct synthesis of the appropriate complementary oligonucleotides on an ABI 394 DNA synthesizer. The top strands of these were FII/FIII: (SEQ ID NO:45); FIlI/III-ASpl* (SEQ ID NO:46); FII/III Ac2 (SEQ ID NO:47); A spacer (SEQ ID NO:48); AIIN (SEQ ID NO:49); AIIIN 30 (SEQ ID NO:50); FII (SEQ ID NO:51); FIll (SEQ ID NO:52); gypsy-3 (SEQ ID WO 01/02553 PCT/USOO/10509 - 27 NO:53); mycFV (SEQ ID NO:54); lys (SEQ ID NO:55); ApB (SEQ ID NO:56); ROOO (SEQ ID NO:57); and BEAD-A (SEQ ID NO:58). All FII mutants were identical to F'II, except for those bases indicated in lowercase in Fig. 3D. For use in the enhancer-blocking assay, single stranded 5 oligonucleotides were purified by denaturing PAGE, quantified, annealed, digested with AscI, and subeloned into pNI. The FII site was also generated as above with NdeI sites at its ends for cloning upstream of the enhancer in pNI to generate FII UP. To generate FII-DOWN, FII was digested out of pNI-FII, the ends were flushed with Klenow, and XbaI linkers (New England Biolabs) were added for 10 cloning into the XbaI site of pNI. The 2.5 kb Imprinted Control Region (ICR) fragment and the 1.6 kb deleted fragment (DMD) within the ICR were generated by PCR on genomic DNA with ICRR (SEQ ID NO:62) and ICRF (SEQ ID NO:63); ICRR and DMDF (SEQ ID NO:64) primers, respectively. The -800 bp HS1 fragment was generated with 15 ICRF and HS1R (SEQ ID NO:65); and the HS2 fragment was generated with HS2F (SEQ ID NO:66) and ICRR. Deletions of ml and m2 from HSl were accomplished by PCR using the following additional primers: HSlAm1F (SEQ ID NO:67); HSlAmlR (SEQ ID NO:68); HS1Am2F (SEQ ID NO:69); HS1Am2R (SEQ ID NO:70); HS2Tm4R (SEQ ID NO:71); HS2F (SEQ ID NO:72); HS2Tm3F (SEQ ID 20 NO:73); HS2Am3F (SEQ ID NO:74); HS2Am3R (SEQ ID NO:75). The fragments Am3 and Am4 are -200 base pair truncations of the 5' and 3' of HS2 generated by PCR with the primer pairs HS2Tm3F/ICRR and HS2F/HS2Tm4R, respectively. In the fragment Am3Am4, -90 base pairs spanning the m3 site were internally deleted while the deletion of m4 results from a 3'-truncation. This was accomplished by 25 two-step overlapping PCR using the primer pairs HSAm3F/HS2Tm4R and HS2F/HS2Am3R on a DMD clone template. The products of these reactions were gel-purified, mixed, and the final product was amplified by PCR with the primer pairs HS2F/HS2Tm4R. Internal deletions of-90 bp fragments spanning ml and m2 from HS1 were generated by first amplifying with the primer pairs 30 HS1F/HSlAmlR, HS1Am1F/ HS1R, HSlAm1F/HS1Am2R, HS1F/HS1Am2R, and HS1Am2F/HS1R. To generate singly or doubly deleted fragments the products of WO 01/02553 PCT/USOO/10509 - 28 these reactions were gel-purified, mixed accordingly, and amplified with HS 1 F/HS 1 R. The resulting fragments were sub-cloned into pNI after addition of the appropriate linkers where necessary. For enhancer blocking assays with m3, 5' GCTGTTATGTGCAACAAGGGAACGGATGCTACCGCGCGGTGGCAGCATA 5 CTCCTATATATCGTGGCCCAAATGCTGCCAACTTGGGGGGAGCGATTCA TTC (SEQ ID NO:83) was directly synthesized with the appropriate restriction sites at its ends and cloned into pNI at either the AscI or NdeI sites. B. Enhancer Blocking Assay Enhancer blocking assays were performed as previously described 10 (Chung et al., 1993 and Chung et al., 1997). Briefly, 20 pg of each construct was linearized by SalI digestion, phenol-chloroform extracted, ethanol precipitated, and quantified by UV absorption. 20 ng of each DNA was then electroporated into K562 cells (1 x 107) and after allowing 24 hours for recovery, cells were plated in soft agar with geneticin (Life Technologies) at 750 ptg/ml (active). Colonies were 15 counted after 3 weeks of selection and the colony number was normalized to that obtained with pNI or a construct which had 2.3 kb of k DNA inserted between the enhancer and the reporter as a spacer control. C. DNase I Hypersensitive Site Analysis Nuclei were isolated from adult chicken red blood cells, essentially 20 as described previously (Bresnick and Felsenfeld, 1994), except that 0.2 mM EGTA was included in all buffers. After incubation of the nuclei with varying concentrations of DNase I for 5 minutes at room temperature, the reaction was terminated by the addition of SDS and the genomic DNA was purified. To map precisely the position of HS4, DNase I digested and undigested genomic DNAs (10 25 pig) were further digested with StyI to generate an -I kb parent fragment which spanned the insulator core. Style digested control DNAs were also digested with the enzymes indicated in Fig. 1A. All of these DNAs were resolved on a 1.3 % agarose gel and subjected to Southern blotting by standard techniques using a 503 bp Styl Sac fragment from the plasmid p501 as a probe (Reitman and Felsenfeld, 1990). 30 D. DNA Binding Assays WO 01/02553 PCT/USOO/10509 - 29 All DNA binding assays were carried out in a binding buffer containing 20 mM HEPES, pH 7.9; 150 mM KCI; 5 mM MgCI 2 ; and 1 mM DTT. For gel mobility shift assays, DNA binding was carried out at room temperature for 30 minutes in binding buffer plus 5% glycerol, 20-40 fmol of labeled double 5 stranded oligonucleotide probe, poly dI/dC at 50-100 pig/ml, and 1-5 p1 of protein in a final volume of 20 pl. Probes were oligonucleotide duplexes identical to those used for subcloning into the enhancer-blocking assay. 10 pmol of each top strand was end-labeled with 32 P and then annealed with 15 pmol of an unlabeled complementary oligonucleotide; the resulting duplexes were used directly as probes. 10 Cold competitor duplexes were added simultaneously with labeled probes at 50-fold molar excess. An antibody was raised against a C-terminal peptide (APNGDLTPEMILSMMD), SEQ ID NO: 59, of CTCF. Supershifts were carried out by pre-incubating the appropriate proteins with purified antibodies in binding 15 buffer for 2 hours at 0* C, followed by a room temperature incubation of 30 minutes in the presence of DNA. For southwestern assays, proteins were resolved by SDS-PAGE, transferred to PVDF, and then denatured and renatured by successive 10 minute incubations in binding buffer supplemented with guanidine hydrochloride at 4.8, 3, 20 1.5, and 0.75 M. After an additional 10 minute wash in binding buffer, the blots were blocked in binding buffer plus 5% non-fat dry milk for 16 hours at 40 C. An FII probe was generated for southwestern assays by annealing a full length top strand sequence: (CCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGG CAGCAGGCGCGCCT), (SEQ ID NO:60) to a short 3' complementary primer 25 (AGGCGCGCCTGCTGC), (SEQ ID NO:61). This partial duplex was then extended with Klenow in the presence of cc-2P-dCTP resulting in a probe identical to that used in gel-shift assays but with 10 labeled phosphates per molecule. Blots were probed for 3 hours at room temperature in binding buffer supplemented with 0.25% non-fat dry milk, 5 pg/ml poly dI/dC and 3 pmol of labeled probe in a final 30 volume of 20 ml, washed three times for 10 minutes in the same buffer without DNA and exposed to film.

WO 01/02553 PCT/USOO/10509 -30 Probes used in the DNA binding assays described'in Example 6 were annealed duplexes of the following sequences: ml (SEQ ID NO:76); m2 (SEQ ID NO:77); m3 (SEQ ID NO:78); m4 (SEQ ID NO:79); hi (SEQ ID NO:80); FIIx3' (SEQ ID NO:81); mlx3' (SEQ ID NO:82). 5 E. Protein Purification and Translation Nuclear extracts from K562 cells and whole chicken blood were prepared essentially as previously described (Evans et al., 1988). For purification of the FII binding protein, nuclei were prepared from 6 liters of whole chicken blood (Pelfreez Biologicals) and extracted in Buffer C: 20 mM HEPES, pH 7.9, 420 mM 10 NaCI, 5 mM MgCl 2 , 0.2 mM EDTA and 1 mM DTT. The resulting extract was diluted to 150 mM NaCI and 20% glycerol and fractionated on a 500 ml SP sepharose column (Pharmacia) using a 0.15-lM NaCI linear gradient. Active fractions were pooled, diluted to 150 mM NaCI and loaded onto a 25 ml CM sepharose column (Pharmacia). Active fractions eluted with a peak at 600 mM 15 NaCI from a 0.15-IM NaCI gradient. These fractions were pooled and loaded onto a 2.6/60 cm Sephacryl S-300 gel filtration column (Pharmacia) that was pre equilibrated with 20 mM HEPES, pH 7.9, 150 mM NaCI, 5 mM MgCI 2 , 0.2 mM EDTA and 1 mM DTT. Active fractions were pooled, dialyzed into 10 mM sodium phosphate pH 8.0, 150 mM NaCI, 5 mM MgCI 2 , 1 mM DTT and 20% glycerol, and 20 loaded onto a 25 ml Macro-Prep ceramic hydroxyapatite column (Bio-Rad). This column was eluted with a 10-800 mM phosphate gradient at pH 8.0. Throughout the isolation all buffers were supplemented with 1 mM PMSF, 0.7 pg/ml pepstatin, and 0.5 ptg/ml leupeptin and maintained at 4* C. Fractions pooled from the gel filtration, and all subsequent buffers, were also supplemented with 40 pig/ml bestatin 25 and AEBSF (at 200 pig/ml) was substituted for PMSF. Final active fractions were identified by gel shift assay, and analyzed by southwestern with an FII probe. For peptide sequencing, 1 ml of a final active fraction (representing -1/10th of the final yield and -5 pg of purified -140 kDa protein) was TCA precipitated, resolved on 7% Tris-acetate SDS-PAGE (Novex), transferred to PVDF, stained with imido 30 black, and internal protein sequence data were obtained at the Rockefeller University Protein/DNA Technology Center.

WO 01/02553 PCT/USOO/10509 -31 In vitro-translated human CTCF was obtained using the plasmid p4B7.1 as a template for in vitro transcription by T7 polymerase according to the manufacturers instructions (Ambion, 'Message Machine'), followed by in vitro translation of the resulting RNA in a nuclease treated rabbit reticulocyte system 5 (Promega). The plasmid p4B7.1 contains the full length human CTCF cDNA (Filippova, et al., 1996) subcloned into pCITE4b(+) (Novagen). Example 2 Identification of an Enhancer-Blocking DNA Fragment A 1.2 kb DNA element at the 5' end of the chicken B-globin locus, 10 corresponding to a constitutive DNase I hypersensitive site (5'HS4), was shown to function as an insulator in an enhancer-blocking assay (U.S. Patent No. 5,610,053 to J. Chung et al.; Chung et al., 1997). The assay tested the ability of a DNA sequence to prevent activation of a gene for neomycin resistance by a strong enhancer when the construct 'Was stably transformed into an erythroleukemia cell line (Chung et al., 15 1993). The insulator effect was manifested by a marked reduction in the number of colonies resistant to G418 only when the globin sequence element was placed between the enhancer and the promoter. This same assay was utilized to show that a large part of the insulator activity was contained in a 250 bp GC-rich 'core' fragment at the 5' end of the 1.2 kb element. HS4 mapped precisely within this core 20 region, consistent with its significance in vivo. (Fig. 1A). DNase I footprinting of the 250 bp core insulator sequence with nuclear extracts revealed five protected regions (FI to FV), as illustrated in Fig. IC; Chung et al. 1997). The FI-FV DNA segment was further dissected and analyzed to identify an insulator-protein binding site. The core region was divided into separate 25 fragments; each fragment was employed in enhancer blocking assays. Splitting the core between FII and FIII generated two fragments (FI/FII and FIII/IV/V) each of which had some enhancer blocking activity. However a fragment containing only FII and FIII had greater activity than the entire core (FII/III, Fig. 1D). Deletion analysis confirmed that FI and FIII were responsible for the 30 majority of the enhancer blocking activity. While deletion of FI had a slight effect, deletion of FII and FIII significantly reduced enhancer-blocking activity (Fig. lE).

WO 01/02553 PCT/USOO/10509 -32 Deletions of FIV and FV were essentially neutral. Considered together, these results show that regions FII and FII represent a functional enhancer-blocking region of the core. Consistent with this conclusion, the insertion of an increasing number of copies of FII/FIII between the enhancer and the promoter resulted in a 5 linear increase in blocking activity, as was also observed for the 1.2 kb insulator and the 250 bp core sequence (Fig. IF). Further analysis of the FIl/FIII element revealed an internal 'spacer' sequence that appeared to partially counteract the enhancer-blocking activity. Removal of this spacer region (Fig. 2A) resulted in even stronger blocking activity. 10 In fact, the removal of sequences adjacent to FII resulted in the discovery of an approximately 50 bp sequence spanning FII that alone was found to possess a blocking activity nearly equal to that of the full 1.2 kb insulator element. Consistent with the behavior in vivo, it is noted that the position of FII is coincident with that of HS4 in nuclei (Fig. 1A). Importantly, enhancer-blocking by these minimal 15 fragments, including FII, displayed the same position-dependence as that observed for the entire 1.2 kb insulator element. When placed either upstream of the enhancer or downstream of the promoter in the enhancer blocking assay, FII had essentially no effect on expression (Fig. 2B; Chung et al., 1997). Thus, in order to effect expression, FII must be located between the enhancer and the promoter (Fig. 20 2B). Example 3 Identification of a Specific Enhancer-Blocking Protein Experiments were conducted to identify proteins that bound to the FII fragment, in view of the strong enhancer-blocking activity exhibited by this 25 fragment. A comparison of the sequence of FII with that of known transcription factor binding sites revealed several potentially significant homologies (Fig. 2E). An Sp I consensus sequence lies in the middle of the FII fragment and a sequence homologous to a yeast c2 binding site (Sauer et al., 1988) overlaps a partial match to the binding site of the Drosophila protein suppressor of Hairy-wing (Su(Hw)), 30 (Fig. 2E; Geyer and Corces, 1992). To test whether any of these homologies could account for the blocking activity of FII, mutations were introduced that were WO 01/02553 PCT/USOO/10509 - 33 predicted to reduce dramatically the affinity of each of these proteins for the sequence of the FII fragment. The mutations were introduced into either the FII or the FII/III fragments and were tested in the enhancer-blocking assay. A deletion of 4 base pairs within the region that overlaps both the ax2 and the Su(Hw) binding 5 sites had no effect on the blocking activity of the FII/II fragment (Fig. 2D). Furthermore a 100 bp fragment, derived from the Drosophila gypsy element and containing three canonical Su(Hw) binding sites had no activity in the assay. Thus, it was concluded that neither the Su(Hw) site nor the c2 site can account for the activity contained in FII. 10 Similarly, in the context of FIT, mutation of the Spi consensus sequence had no effect on the blocking activity of the fragment; in fact, mutation of each of the three potential SpI binding sites in FII/III resulted in substantially increased activity (Fig. 2D). Sp l may act as an inhibitor of enhancer-blocking in the enhancer-blocking assays described here. This may also explain the above 15 mentioned inhibitory effect of the "spacer" sequence between FlI and FIII and account for the observation that the activities of FII and FIJI are not always additive (see, for example, A spacer in Fig. 2A). In addition, mutation of the Sp l sites in FII/III rendered the level of enhancer-blocking activity equal to the sum of that of FII and FIII. 20 To determine which sequences within FII were responsible for its activity, multiple transversions (e.g., C4A and GIT) were made across the 5', middle and 3' regions of the fragment (Fig. 3A). All of these transversions reduced the level of enhancer-blocking activity of FIT, but changes at the 3' end of the fragment (x3') caused a complete loss of activity. In addition, deletion of 10 bp 25 from both ends of FII (AF), or a reversal of the sequence 5' - 3' (rev), resulted in dramatic reductions in activity. An effect of sequence composition is ruled out by the "rev" mutant since its base composition is identical to that of FIT. In light of the foregoing, experiments were carried out to identify protein(s) that bounds to FIT with a competition profile that matched the sequence 30 specificity observed in the enhancer-blocking assay. Nuclear extracts were prepared from the human erythroleukemic cell line K562 (the cell line in which the enhancer- WO 01/02553 PCT/USOO/10509 - 34 blocking assay was performed) and from adult chicken red blood cells (the FII insulator is a chicken-derived element). Identical patterns were obtained with these two extracts in a gel mobility-shift assay (Figs. 3B and 3C). For each cell source of nuclear extract, two major complexes were observed when the extract was incubated 5 with a 60 bp probe spanning footprint I. The upper complex could be super-shifted with an antibody against SpI and was competed by a 100-fold excess of an unlabeled oligomer carrying an SpI consensus binding site. This complex was concluded to contain Spl. In contrast, the lower complex was neither super-shifted by anti-Sp 1 antibody, nor was its binding influenced by an excess of Sp 1 consensus 10 binding site. Importantly, the degree to which each of the tested fragments competed for binding to this complex paralleled its ability to act as an insulator in the enhancer-blocking assay (Fig. 3D). Example 4 Isolation of a Protein Responsible for 15 the Sequence Specificity of Enhancer-Blocking Probing a southwestern blot of nuclear proteins with labeled FII revealed a single FII-specific DNA binding protein with an apparent size on gels of -140 kDa (Fig. 4A). This protein was purified by conventional chromatography. Throughout the purification, the elution profiles of FII binding activities were 20 identical in gel-mobility shift and southwestern assays. This protein bound tightly to S, CM, and hydroxyapatite columns, and eluted with a peak at -330 kDa on gel filtration (Fig. 4B). Coomassie staining of gels of the final hydroxyapatite fractions revealed a single protein with an apparent molecular weight of 140 kDa corresponding to the position of the FII southwestern activity (Fig. 4D). The 25 sequences of four internal peptides (Fig. 4C) from the 140 kDa DNA binding component of the final purified fraction all perfectly matched the predicted sequence of a previously cloned 11 zinc finger DNA binding protein, CTCF (Klenova, 1993; Filippova et al., 1996). Consistent with this identification, in vitro-translated CTCF bounds 30 to FII with a sequence specificity identical to that observed in the gel-mobility shift and enhancer-blocking assays (Fig. 5). As expected, this protein also bound to other previously characterized CTCF sites (Fig. 5, lanes 9-11) and these sites also act as WO 01/02553 PCT/USOO/10509 - 35 enhancer blockers in our assay (Figure 5). Alignment of these CTCF sites with FII revealed a conserved region which has been shown to be critical for binding of CTCF to these other sites (Filippova et al., 1996; Burcin et al., 1997; Vostrov and Quitschke, 1997). Mutation of this conserved 3' sequence completely abrogated 5 binding and enhancer blocking in the relevant binding and enhancer-blocking assays (see x3' in Figs. 3A-3D and alignment in Fig. 6A). Example 5 Conservation of Sequence Among Vertebrate Insulators Because CTCF is highly conserved among vertebrates, an 10 investigation as to whether CTCF sites might be present in other vertebrate insulator elements was carried out. Two such elements have recently been described. A 1.4 kb fragment found in the intergenic spacer region of the ribosomal RNA genes of Xenopus laevis, termed the repeat organizer (RO), has been shown to prevent enhancer action in a directional manner (Robinett et al., 1997). The 3' half of this 15 sequence is composed of seven tandem repeats of an -100 bp GC-rich sequence (Labhart and Reeder, 1987). The RO sequences bear significant homology with CTCF sites, including FII (Fig. 6B). In the enhancer-blocking assay, the full-length RO conferred moderate enhancer-blocking activity and a single copy of the 100 bp RO repeat had weak enhancer blocking activity on its own (Fig. 7B). It is perhaps 20 because of the weak activity of a single copy of this sequence, that attempts to obtain reproducible binding of CTCF to a single RO repeat have been unsuccessful. The only other vertebrate insulator described to date, BEAD- 1, is a 1.6 kb enhancer-blocking element derived from the human T-cell alpha/delta (a/S) locus (Zhong and Krangel, 1997). Best-fit alignment of this element with various 25 CTCF sites revealed a good match between FII and a-sequence roughly at the center of this element (BEAD-A in Fig. 6C). In fact, a DNA fragment containing this region also bound specifically to purified chicken CTCF (Fig. 7A, lanes 6 and 5 respectively). Consistent with these observations, both full-length BEAD-I and the CTCF binding BEAD-A element defined here were effective enhancer-blocking 30 elements in the described enhancer-blocking assay (Fig. 7B). Furthermore, deletion WO 01/02553 PCT/USOO/10509 - 36 of the BEAD-A sequence from BEAD-I largely eliminated the activity of the larger element. Example 6 Methylation of CTCF Binding Sites Controls Imprinted Expression of the Igf2 gene 5 The gene encoding insulin-like Growth Factor 2 (Igf2) and the H 19 gene are neighboring genes on the same chromosome. The Igf2 gene encodes a growth promoting (or mitogenic) protein and abnormal expression of this gene has been linked to numerous cancers and is thought to play a causal role in the etiology of several growth defect-related syndromes. 10 Expression of the Igf2 and H19 genes is imprinted. Genomic imprinting refers to a mechanism through which expression of a particular gene is dependent upon the gamete (or parent) of origin. For example, a gene is expressed when on the chromosome contributed by the mother, but not expressed from the paternal chromosome. As the alleles are identical in sequence, the signal for such a 15 mechanism cannot rely on DNA sequence. Gamete specific modification of the DNA though DNA methylation is believed to play a major role in specifying the allele's parent-of-origin. Although the Igf2 and H19 genes share an enhancer (Yoo-Warren, 1988), H19 is only expressed from the maternal allele, while expression of Igf 2 20 occurs exclusively from the paternally inherited allele (Bartolomer, 1991; Dechiara, 1991). A region located upstream of the mouse H19 gene and between the Igf2 and H19 genes is methylated in the paternal allele only. This differentially methylated region appears to be the site of an epigenetic mark that is required for the imprinting of these genes. One study has shown that a deletion within this region results in loss 25 of imprinting of both H19 and Ig/2 and maternal transmission of a 1.6 kb deletion within this region results in expression of the normally silent Ig/ 2 allele (Thorvaldsen, 1998). The ability of this deleted fragment (DMD) to act as a positional enhancer-blocking element was examined by inserting it at various locations relative to an enhancer as shown in Figure 8. Insertion of the 1.6 kb DMD 30 fragment between the enhancer and the promoter results in an 8-10-fold drop in colony number, similar to the 8-fold drop observed with the previously WO 01/02553 PCT/USOO/10509 - 37 characterized 1.2 kb chicken p-globin insulator (U.S. Patent No. 5,610,053). These results cannot be explained by the increased distance between the enhancer and the promoter, as insertion of up to 2.3 kb of heterologous DNA between them has little effect on colony number (U.S. Patent No. 5,610,053). Furthermore, like the P 5 globin insulator, when the DMD is placed outside the enhancer-promoter path, either upstream of the enhancer or downstream of the promoter, it has little effect on expression (Fig. 8b). Therefore, DMD appears to have the position-dependent enhancer-blocking properties of an insulator. The DMD fragment is part of a slightly larger (~2 kb) imprinted 10 control region (ICR) that is methylated throughout development exclusively on the paternal allele (Tremblay, 1995 and 1997). Allele-specific alterations in chromatin structure were also observed in this region (Szabo, 1998; Khosla, 1999 and Hark, 1998). Two nuclease-hypersensitive regions are located exclusively on the maternal allele (HS1 and HS2 in Fig. 8a), whereas the chromatin on the paternally derived 15 allele is methylated and nuclease insensitive (Hark, 1998). Both HS1 and HS2 remain hypersensitive throughout development and are present independent of tissue type. The enhancer-blocking potential of fragments spanning HS1, HS2, and a larger fragment that spans the entire ICR was tested. All of these fragments confer enhancer-blocking activity (Fig. 8b). HS1 and HS2 individually show considerable 20 enhancer-blocking activity; a fragment that contains both HS1 and HS2 essentially eliminates the enhancer's influence on expression (Fig. 8b, compare NI E with ICR). A BestFit comparison between the FII fragment of p-globin and the 2.6 kb of sequence spanning the ICR revealed a 13/16 match between the 3'-end of FII and a sequence at the 5'-edge of HS2 (m3 in Fig. 9a). By searching the 25 remainder of the ICR with the m3 sequence, a total of four homologous sequences (ml-4 in Fig 9a) was identified. Consistent with their in vivo significance, sequences homologous to these mouse sites are also found upstream of-the human and rat H19 genes (aligned in Fig. 9a); conservation of sequences overlapping those shown here was recently noted (Frevel, 1999a; Stadnick, 1999). In humans, a 30 region of paternal-specific DNA methylation upstream of H19 has also been defined (Jinno, 1996; Frevel, 1999b) and these homologous sequences are part of a larger WO 01/02553 PCT/USOO/10509 - 38 repeating element found in that region. An alignment of all of the sites from rat, human, and mouse reveals a 12 base pair consensus sequence that is shared among them (Fig. 9a). This consensus bears an 11/12 match with the sequence at the 3' of p-globin FII. In addition, each of these mouse sites, and a representative human site 5 bind to both purified chicken CTCF (P) and in vitro translated human CTCF (I) (Figure 9c). Like FII, a fragment spanning a single mouse ICR site confers position-dependent enhancer blocking activity in vivo (Fig. 9b). Furthermore, in gel shifts with K562 nuclear extracts (E) (the cells in which the enhancer blocking assays were performed) a complex that comigrates with the FII/CTCF complex was 10 observed with each of these mouse and human ICR sites (Figure 9c) and an antibody raised against CTCF supershifts this complex (Fig. 1Od). Consistent with the enhancer blocking activity of CTCF, this complex was competed by FIT, but not by a mutant of FII in which both enhancer blocking and CTCF binding have been eliminated (FIIx3' in Fig. 9d). When the base pairs shared among the ICR sites and 15 FIT are altered in the context of one of these mouse sites it no longer competes for binding to CTCF (mIx3' in Fig. 9d). In the mouse H19 ICR, HS 1 and HS2 each contain two CTCF sites. The two sites were deleted sequentially and the enhancer blocking activities of the resulting fragments were measured (Fig. 10). Since the enhancer blocking activities 20 of HS1 and HS2 are somewhat dependent upon their orientations (data not shown), deletion analyses were carried out with the orientation that gave the strongest activities. In each case, a deletion that eliminates either one of the CTCF sites results in a reduction in enhancer blocking activity, while deletion of both sites from either HS 1 or HS2 eliminates their activity (Fig. 10 a). The deletions span sequence 25 that are larger than the average -53 bp CTCF footprint. Among these sequences, however, the only significant similarity is within the CTCF sites. These similarities define a consensus for CTCF binding (Fig. 9a and d) which is essential to the enhancer blocking activity of p-globin FI. As shown in Fig. 9b, single CTCF site from several other loci (including the mouse ICRO alone confer enhancer blocking 30 activity. The above results demonstrate that sequences within the mouse H19, ICR have the enhancer blocking properties of an insulator. Several recent studies WO 01/02553 PCT/USOO/10509 - 39 suggest that this activity is directly involved in the regulation of Igf2. One study showed that if the H19 enhancer is moved from its genomic location downstream of H19 to a new location upstream of the ICR, the normally silent maternal allele of Igf2 is expressed (Webber, 1998). This suggests that it is the enhancer's position 5 downstream of the H19 locus that prevents activation of the maternal Igf2 allele. Competition between the H19 and Igf2 promoters cannot explain this result since deletion of the H19 promoter has no effect on Igf2 expression (Schmidt, 1999). Instead, it is the enhancer's position relative to the ICR that restricts its action: a deletion within the ICR results in biallelic expression of Igf 2 (Thorvaldsen, 1998). 10 This line of reasoning is further supported by the observation that maternal inheritance of the relocated enhancer results in loss of expression of the normally active H19 allele, in this case because the ICR, now located between the enhancer and the H19 promoter, blocks their interaction. Thus, the dependence of H19 and g/2 expression on the position of the H19 enhancer is explained by a single model 15 that posits the existence of an insulator within the ICR (Thorvaldsen, 1999; Webber, 1998; Leighton, 1995). As the H19 locus contains an insulator that is active only on the unmethylated (maternal) allele, a model has been proposed which suggests that the influence of the ICR on expression of Igf 2 depends upon the allele's parent of origin 20 (Leighton, 1995). In this model, inheritance of paternal-specific CpG methylation in the ICR results in inactivation of the insulator and thus on this allele the H19 enhancer is free to activate Igf2. Direct support for a role of DNA methylation in activation of Igf2 comes from the observation that in DNA methyltransferase- 1 deficient mouse embryos, both alleles of Igf2 are silent (Li, 1993). 25 The results of the deletion analysis of HS1 and HS2 imply that it is the conserved CTCF sites in these elements that are responsible for their enhancer blocking activities. One model that could explain why CpG methylation abolishes this activity is that CTCF cannot bind these sites when they are methylated. To test this, the corresponding oligomers were synthesized with 5 meC incorporated at each 30 CpG and the ability of the resulting duplex to compete for the binding of CTCF to the unmethylated form was assessed. Methylation of each of the mouse sites, and a representative human site, greatly reduces their ability to compete for binding of WO 01/02553 PCT/USOO/10509 - 40 CTCF to an unmethylated site, even at a 50-fold molar excess (Fig. 10b). Methylation of s-globin FII has a similar effect. Because FII and the ICR sites have only one CpG in common, the influence of methylation at only this site (on both strands) in several ICR sites was examined (Fig. lOb, right panel). In fact, 5 methylation of this CpG alone significantly reduced CTCF binding to all of these sites (Fig. 1Ob, M1 lanes). This result implies that enhancer access could, in principle, be regulated by a single (perhaps targeted) methylation event. Further examination of the influence of methylation on gene expression will require a system that allows for the establishment and maintenance of partially methylated 10 transgenes in vivo. The above results demonstrate that the H19 ICR is an enhancer blocking element. CTCF binding sites are required for this activity and when these sites are methylated, they no longer bind the insulator protein CTCF. These results provide direct evidence for a mechanistic explanation of Igf2 imprinting in which 15 differential methylation of an enhancer boundary allows for epigenetic control of Igf2 expression in the embryo (Fig. 11). In humans, a causal link between overexpression of Igf 2 and the pathogenesis of some cases of Beckwith-Wiedemann syndrome (BWS) has been suggested (Eggenschwiler, 1997; Sun, 1997; Weksberg, 1993; Joyce, 1997). BWS, or fetal overgrowth syndrome, is a disorder of prenatal 20 overgrowth and predisposition to embryonal malignancies such as Wilms tumor. Studies have shown a correlation between loss of imprinting of Igf2 in Wilms tumor and BWS and increased methylation of the maternal H19 allele (Steenman, 1994; Okamoto, 1997; Reik, 1995; Taniguchi, 1995). In Wilms tumor, this aberrant methylation pattern was recently shown to include the CTCF sites illustrated in 25 Figure 9a (Frevel, 1999b). These sites were consistently methylated on both alleles in Wilms tumors with loss of Igf2 imprinting. The results described herein are consistent with the notion that the loss of Ig/2 imprinting observed in those tumors is caused by inactivation of a CTCF dependent insulator in that locus. Recent evidence shows that in Drosophila, the activity of an 30 insulator can be modulated by adjacent cis-acting sequences (Zhou, 1999). The results described herein reveal that in vertebrates the activity of enhancer boundaries can be controlled by DNA methylation. Not relegated simply to the role of a fixed WO 01/02553 PCT/USOO/10509 -41 boundary, some insulators may act as switches that provide a novel kind of modulated gene regulation.

WO 01/02553 PCT/USOO/10509 -42 References 1. Ali et al., 1994, "The Use of DNA Viruses as Vectors for Gene Therapy", Gene Therapy, 1:367-384. 2. G. Ascadi et al., 1994, Human Mol. Genetics, 3(4):579-584. 5 3. Baniahmad, A. et al. (1990). "Modular structure of a chicken Isozyme silencer: involvement of an unusual thyroid hormone receptor binding site". Cell 61, 505 514. 4. Bartolomei, M. S., Zemel, S. & Tilghman, S. M. Parental imprinting of the mouse H19 gene. Nature 351, 153-155 (1991). 10 5. Bell, A.C. and Felsenfeld, G. (1999) "Stopped at the border: boundaries and insulators". Current Opinion in Genetics and Development. 9, 191-198. 6. Bird (1999) Science 286:2287-8. 7. Bresnick, E.H. and Felsenfeld, G. (1994). "Dual promoter activation by the human beta-globin locus control region". Proc. Natl. Acad. Sci. U.S.A. 91, 15 1314-1317. 8. Bulger, M. et al. (1999). "Conservation of sequence and structure flanking the mouse and human beta-globin loci: the beta-globin genes are embedded within an array of odorant receptor genes" Proc. Natl. Acad. Sci. U.S.A. 96, 5129-5134. 9. Burcin, M. et al., (1997). "Negative protein 1, which is required for function of 20 the chicken Iysozyme gene silencer in conjunction with hormone receptors, is identical to the multivalent zinc finger repressor CTCF". Mol. Cell Biol. 17, 1281-1288. 10. Chung, J.H. et al., (1993). "A 5' element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position 25 effect in Drosophila". Cell. 74, 505-514. 11. Chung, J.H. et al., (1997). Characterization of the chicken beta-globin insulator". Proc. Natl. Acad. Sci. USA. 94, 575-5 80. 12. Cone, R. and Mulligan, R., 1984, Proc. Natl. Acad. Sci. USA, 81:6349. 13. DeChiara, T. M., Robertson, E. J. & Efstratiadis, A. Parental imprinting of the 30 mouse insulin-like growth factor II gene. Cell 64, 849-859 (1991). 14. Dorsett, D. (1993). "Distance-independent inactivation of an enhancer by the suppressor of Hairy-wing DNA-binding protein of Drosophila". Genetics. 134, 1135-1144. 15. Dunaway, M. and Droge, P. (1989). "Transactivation of the Xenopus rRNA 35 gene promoter by its enhancer". Nature. 341, 657-659. 16. Eggenschwiler, J. et al. Mouse mutant embryos overexpressing IGF-II exhibit phenotypic features of the Beckwith-Wiedemann and Simpson-Golabi-Behmel syndromes. Genes Dev 11, 3128-3142 (1997).

WO 01/02553 PCT/USOO/10509 - 43 17. Evans, T. et al., (1988). "An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes". Proc. Natl. Acad. Sci. USA. 85, 5976-5980. 18. Filippova, G.N. et al., (1996). "An exceptionally conserved transcriptional 5 repressor, CTCF, employs different combinations of zinc fingers to bind diverged promoter sequences of avian and mammalian c-myc oncogenes". Mol. Cell Biol. 16, 2802-2813. 19. Frevel, M. A., Hornberg, J. J. & Reeve, A. E. A potential imprint control element: identification of a conserved 42 bp sequence upstream of H19. Trends 10 Genet 15, 216-218 (1999). 20. Frevel, M. A., Sowerby, S. J., Petersen, G. B. & Reeve, A. E. Methylation sequencing analysis refines the region of H19 epimutation in Wilms tumor. J Biol Chem 274, 29331-29340 (1999). 21. Gdula, D.A. and Corces, V.G. (1997). "Characterization of functional domains 15 of the Su(Hw) protein that mediate the silencing effect of mod(mdg4) mutations". Genetics. 145, 153-161. 22. Gdula, D.A. et al., (1996). "Genetic and molecular analysis of the gypsy chromatin insulator of Drosophila". Proc. Natl. Acad. Sci. USA. 93, 9378-9383. 23. Georgiev, P. and Kozycina, M. (1996). "Interaction between mutations in the 20 suppressor of Hairy wing and modifier of mdg4 genes of Drosophila melanogaster affecting the phenotype of gypsy-induced mutations". Genetics. 142, 425-436. 24. Gerasimova, T.I. and Corces, V.G. (1998). "Polycomb and trithorax group proteins mediate the function of a chromatin insulator". Cell. 92, 511 -521. 25 25. Gerasimova, T.I. et al., (1995). "A Drosophila protein that imparts directionality on a chromatin insulator is an enhancer of position-effect variegation". Cell. 82, 587-597. 26. Geyer, P.K. and Corces, V.G. (1992). "DNA position-specific repression of transcription by a Drosophila zinc finger protein". Genes Dev. 6, 1865-1873. 30 27. Hark, A. T. & Tilghman, S. M. Chromatin conformation of the H19 epigenetic mark. Hum Mol Genet 7, 1979-1985 (1998). 28. Hebbes, T.R. et al., (1994). "Core histone hyperacetylation co-maps with generalized DNase I sensitivity in the chicken beta-globin chromosomal domain". EMBO J. 13, 1823-1830. 35 29. Holdridge, C. and Dorsett, D. (1991). "Repression of hsp70 heat shock gene transcription by the suppressor of hairy-wing protein of Drosophila melanogaster". Mol. Cell Biol. 11, 1894-1900. 30. Jinno, Y. et al. Mouse/human sequence divergence in a region with a paternal specific methylation imprint at the human H19 locus. Hum Mol Genet 5, 1155 40 1161 (1996).

WO 01/02553 PCT/USOO/10509 - 44 31. Kellum, R. and Elgin, S.C. (1998). "Chromatin boundaries: punctuating the genome". Curr. Biol. 8, R521 -4. 32. Kellum, R. and Schedl, P. (1991). "A position-effect assay for boundaries of higher order chromosomal domains". Cell 64, 941-950. 5 33. Kellum, R. and Schedl, P. (1992). "A group of scs elements function as domain boundaries in an enhancer- blocking assay". Mol. Cell Biol. 12, 2424-2431. 34. Khosla, S., Aitchison, A., Gregory, R., Allen, N. D. & Feil, R. Parental allele specific chromatin configuration in a boundary- imprinting-control element upstream of the mouse H19 gene. Mol Cell Biol 19, 2556-2566 (1999). 10 35. Klenova, E.M., et al., (1993). "CTCF, a conserved nuclear factor required for optimal transcriptional activity of the chicken c-myc gene, is an 11-Zn-finger protein differentially expressed in multiple forms". Mol. Cell Biol. 13, 7612 7624. 36. Klenova, E.M., et al., (1997). "Molecular weight abnormalities of the CTCF 15 transcription factor: CTCF migrates aberrantly in SDS-PAGE and the size of the expressed protein is affected by the UTRs and sequences within the coding region of the CTCF gene". Nucleic Acids Res. 25, 466-474. 37. S. Kochanek et al., 1996, Proc. Natl. Acad. Sci. USA, 93:5731-5736. 38. Krebs, J.E. and Dunaway, M. (1998). "The scs and scs' insulator elements 20 impart a cis requirement on enhancer-promoter interactions". Mol. Cell. 1. 301 308. 39. Labhart, P. and Reeder, R.H. (1987). "DNA sequences for typical ribosomal gene spacers from Xenopus laevis and Xenopus borealis". Nucleic. Acids. Res. 15, 3623-3624. 25 40. Leighton, P. A., Ingram, R. S., Eggenschwiler, J., Efstratiadis, A. & Tilghman, S. M. Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature 375, 34-39 (1995). 41. Li, E., Beard, C. & Jaenisch, R. Role for DNA methylation in genomic imprinting [see comments]. Nature 366, 362-365 (1993). 30 42. Lobanenkov, V.V., et al. ( 1990). "A novel sequence-specific DNA binding protein which interacts with three regularly spaced direct repeats of the CCCTC motif in the 5'- flanking sequence of the chicken c-myc gene". Oncogene. 5, 1743-1753. 43. Okamoto, K., Morison, I. M., Taniguchi, T. & Reeve, A. E. Epigenetic changes 35 at the insulin-like growth factor ILI/H 19 locus in developing kidney is an early event in Wilms tumorigenesis. Proc Natl Acad Sci U SA 94, 5367-5371 (1997). 44. Pikaart, M.J., Recillas-Targa, F., and Felsenfeld, G. (1998). "Loss of transcriptional activity of a transgene is accompanied by DNA methylation and histone deacetylation and is prevented by insulators". Genes Dev. 12, 2852 40 2862.

WO 01/02553 PCT/USOO/10509 -45 45. Reik, W. et al. Imprinting mutations in the Beckwith-Wiedemann syndrome suggested by altered imprinting pattern in the IGF2-H19 domain. Hum Mol Genet 4, 2379-2385 (1995). 46. Reitman, M. and Felsenfeld, G. (1990). "Developmental regulation of 5 topoisomerase II sites and DNase I-hypersensitive sites in the chicken beta globin locus". Mol. Cell Biol. 10, 2774-2786. 47. Robinett, C.C., et al., (1997). "The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes". Mol. Cell Biol. 17, 2866-2875. 10 48. Sauer, R.T., et al., (1988). "Flexibility of the yeast alpha 2 repressor enables it to occupy the ends of its operator, leaving the center free". Genes Dev. 2, 807-816. 49. Schmidt, J. V., Levorse, J. M. & Tilghman, S. M. Enhancer competition between H19 and Igf2 does not mediate their imprinting. Proc Natl Acad Sci U SA 96, 9733-9738 (1999). 15 50. Sinha, N.D. et al., 1984, Nucl. Acids Res., 12:4539-4557 51. Spana, C., Harrison, D.A., and Corces, V.G. (1988). "The Drosophila melanogaster suppressor of Hairy-wing protein binds to specific sequences of the gypsy retrotransposon". Genes Dev. 2, 1414-1423. 52. Stadnick, M. P. et al. Role of a 461-bp G-rich repetitive element in H19 20 transgene imprinting. Dev Genes Evol 209, 239-248 (1999). 53. Steenman, M. J. et al. Loss of imprinting of IGF2 is linked to reduced expression and abnormal methylation of H19 in Wilms' tumour. Nat Genet 7, 433-439 (1994). 54. Sun, F. L., Dean, W. L., Kelsey, G., Allen, N. D. & Reik, W. Transactivation of 25 Igf2 in a mouse model of Beckwith-Wiedemann syndrome [see comments]. Nature 389, 809-815 (1997). 55. Szabo, P. E., Pfeifer, G. P. & Mann, J. R. Characterization of novel parent specific epigenetic modifications upstream of the imprinted mouse H19 gene. Mol Cell Biol 18, 6767-6776 (1998). 30 56. Taniguchi, T., Sullivan, M. J., Ogawa, 0. & Reeve, A. E. Epigenetic changes encompassing the IGF2/H19 locus associated with relaxation of IGF2 imprinting and silencing of H 19 in Wilms tumor. Proc Natl Acad Sci U S A 92, 2159-2163 (1995). 57. Thorvaldsen, J. L., Duran, K. L. & Bartolomei, M. S. Deletion of the H19 35 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev 12, 3693-3702 (1998). 58. Tremblay, K. D., Duran, K. L. & Bartolomei, M. S. A 5' 2-kilobase-pair region of the imprinted mouse H19 gene exhibits exclusive paternal methylation throughout development. Mol Cell Biol 17, 4322-4329 (1997).

WO 01/02553 PCT/USOO/10509 - 46 59. Tremblay, K. D., Saam, J. R., Ingram, R. S., Tilghman, S. M. & Bartolomei, M. S. A paternal-specific methylation imprint marks the alleles of the mouse H19 gene. Nat Genet 9, 407-413 (1995). 60. Tuan, D. et al., 1985, "The B-like-globin" gene domain in human erythroid 5 cells", Proc. Natl. Acad. Sci. USA, 82:6384-6388. 61. Udvardy, A. (1999). "Dividing the empire: boundary chromatin elements delimit the territory of enhancers". EMBO J 18, 1-8. 62. Udvardy, A., Maine, E., and Schedl, P. (1985). "The 87A7 chromomere. Identification of novel chromatin structures flanking the heat shock locus that 10 may define the boundaries of higher order domains". J. Mol. Biol. 185, 341-358. 63. Vostrov, A.A. and Quitschke, W.W. (1997). "The zinc finger protein CTCF binds to the APBbeta domain of the amyloid beta-protein precursor promoter. Evidence for a role in transcriptional activation". J. Biol. Chem. 272, 33353 33359. 15 64. Webber, A. L., Ingram, R. S., Levorse, J. M. & Tilghman, S. M. Location of enhancers is essential for the imprinting of H19 and Igf2 genes. Nature 391, 711-715 (1998). 65. Weksberg, R., Shen, D. R., Fei, Y. L., Song, Q. L. & Squire, J. Disruption of insulin-like growth factor 2 imprinting in Beckwith- Wiedemann syndrome. Nat 20 Genet 5, 143-150 (1993). 66. Yoo-Warren, H., Pachnis, V., Ingram, R. S. & Tilghman, S. M. Two regulatory domains flank the mouse H19 gene. Mol Cell Biol 8, 4707-4715 (1988). 67. Zhao, K., Hart, C.M., and Laemmli, U.K. (1995). "Visualization of chromosomal domains with boundary element-associated factor BEAF-32". Cell 25 81, 879-889. 68. Zhong, X.P. and Krangel, M.S. (1997). "An enhancer-blocking element between alpha and delta gene segments within the human T cell receptor alpha/delta locus". Proc. Natl. Acad. Sci. USA. 94, 5219-5224. 69. Zhou, J. & Levine, M. A Novel cis-Regulatory Element, the PTS, Mediates an 30 Anti-Insulator Activity in the Drosophila Embryo. Cell 99, 567-575 (1999). All of the references cited herein above are hereby incorporated by reference.

Claims

1. An isolated DNA molecule comprising SEQ ID NO: 1, said DNA molecule having enhancer-blocking function.

2. An expression construct comprising the DNA molecule of 5 claim 1.

3. The construct according to claim 2, wherein the construct is operable when inserted into the DNA of a cell to insulate the expression of one or more genes from one or more cis-acting regulatory sequences in chromatin.

4. The construct according to claim 3, wherein said cell is a 10 mammalian cell.

5. A vector construct comprising: (a) the DNA molecule according to claim 1; (b) a promoter domain; (c) a gene operably linked to the promoter domain; and 15 (d) an enhancer domain 5' of the promoter domain, wherein the insulator DNA molecule is positioned between the enhancer and the promoter domains so as to operably insulate the transcription and expression of the gene from cis-acting regulatory elements in chromatin.

6. An isolated DNA construct for incorporation into a host cell 20 and for insulation of the expression of a gene therein, comprising: a) DNA comprising a transcription unit comprising an expressible gene, a promoter to drive the transcription of the gene, and an enhancer element; and b) one or more DNA molecules according to claim 1, the 25 molecules being positioned in sufficient proximity to the transcription unit and to the gene to insulate the transcription and expression of the gene from cis-acting DNA regulatory sequences in chromatin outside of the DNA according to a). WO 01/02553 PCT/USOO/10509 - 48 7. The DNA construct according to claim 6, wherein the expressible gene is a structural gene.

8. The DNA construct according to claim 6, wherein the expressible gene is selected from the group consisting of protein-encoding genes, 5 hormone-encoding genes, peptide hormone-encoding genes, enzyme-encoding genes, and antibiotic-resistance-encoding genes.

9. The DNA construct according to claim 8, wherein the expressible gene is a neomycin-resistance gene or a hygromycin-resistance gene.

10. A mammalian cell stably tranfected with the construct 10 according to claim 2.

11. A method of insulating the expression of an introduced gene from cis-acting DNA regulatory sequences in the chromatin into which the gene has integrated, comprising: a) introducing into a cell the DNA construct according to 15 claim 2; b) integrating the construct into the chromatin of the cell, wherein the expression of a resultant integrated heterologous gene is insulated from cis-acting DNA regulatory sequences in the chromatin of said cell.

12. The method according to claim 11, further comprising 20 introducing into the cell a DNA construct containing a gene encoding the CTCF protein, wherein CTCF is expressed in the cell.

13. A kit for insulating the expression of a transfected and expressed gene, comprising a vector comprising the insulator molecule according to claim 1. 25 14. A pharmaceutical composition comprising the construct according to claim 2 in a pharmaceutically acceptable diluent, carrier, or excipient.

15. A method of blocking activity of an enhancer of a gene in a cell, comprising: WO 01/02553 PCT/USOO/10509 - 49 a) introducing into the cell a construct containing a DNA molecule comprising SEQ ID NO: 1; b) introducing into the cell a construct containing a gene encoding the CTCF protein, wherein the CTCF protein is 5 expressed in the cell and binds to the DNA molecule of step (a).

16. An isolated DNA molecule comprising the sequences shown in SEQ ID NOS:84-87, said DNA molecule having enhancer-blocking function.

17. An isolated DNA molecule comprising the sequences shown in SEQ ID NOS:88-91. 10 18. An isolated DNA molecule comprising the sequences shown in SEQ ID NOS:92-98.

19. The DNA molecule according to claims 16, 17 or 18, wherein the molecule contains binding site for the CTCF protein.

20. The DNA molecule according to claims 16, 17 or 18, wherein 15 the enhancer-blocking activity of the molecule is dependent upon CTCF binding to the molecule.

21. The DNA molecule according to claims 16, 17 or 18, wherein methylation of the cytosines (C) of the CpG residues in the molecule prevents CTCF binding to the molecule and inhibits the enhancer-blocking function of the 20 molecule.

22. A method of activating the expression of an introduced gene from cis-acting DNA regulatory sequences in the chromatin into which the gene has integrated, comprising: a) introducing into a cell a first DNA construct comprising a 25 transcription unit comprising an expressible gene, a promoter to drive the expression of the gene, an enhancer element and an insulator element; b) introducing into a cell a second DNA construct encoding a fusion protein, said fusion protein comprising the enzymatic domain of a methylase and the DNA binding domain of a DNA binding protein. WO 01/02553 PCT/USOO/10509 - 50

23. The method according to claim 22, wherein the first DNA construct further comprises DNA binding sequences for the DNA binding protein encoded by the second construct.

24. The method according to claim 22, wherein the DNA binding 5 protein is Gal4 or LexA.

25. The method according to claim 22, wherein the methylase methylates the cytosines of the CpG residues in the insulator element.

26. The method according to claim 22, wherein the methylase is DNA methyltransferase 3. 10 27. The method according to claim 22, wherein the insulator element comprises sequences selected from the group consisted of SEQ ID NOS:84

100. SUBSTITUTE SHEET (RULE 26) ISA/EP