AU4368300A - Single nucleotide polymorphisms in mitochondrial genes that segregate with alzheimer's disease - Google Patents

Description

WO 00/63441 PCT/USOO/10906 SINGLE NUCLEOTIDE POLYMORPHISMS IN MITOCHONDRIAL GENES THAT SEGREGATE WITH ALZHEIMER'S DISEASE TECHNICAL FIELD The present invention relates generally to Alzheimer's disease and, more 5 specifically, to compositions and methods for detecting predisposition to such diseases by detecting single nucleotide polymorphisms in mitochondrial DNA. BACKGROUND OF THE INVENTION A number of degenerative diseases are thought to be caused by, or are associated with, alterations in mitochondrial function. These diseases include 10 Alzheimer's Disease, diabetes gillitu, Parkinson's Disease, Huntington's disease, dystonia, Leber's hereditary optic neuropathy, schizophrenia, and myodegenerative disorders such as "mitochondrial encephalopathy, lactic acidosis, and stroke" (MELAS), and "myoclonic epilepsy ragged red fiber syndrome" (MERRF). Other diseases involving altered metabolism or respiration within cells may also be regarded 15 as diseases associated with altered mitochondrial function. Alzheimer's disease (AD) is a progressive neurodegenerative disorder that is characterized by loss and/or atrophy of neurons in discrete regions of the brain, and that is accompanied by extracellular deposits of p-amyloid and the intracellular accumulation of neurofibrillary tangles. It is a uniquely human disease, affecting over 20 13 million people worldwide. It is also a uniquely tragic disease. Many individuals who have lived normal, productive lives are slowly stricken with AD as they grow older, and the disease gradually robs them of their memory and other mental faculties. Eventually, they cease to recognize family and loved ones, and they often require continuous care until their eventual death. .25 There is evidence to suggest that the genetic basis of at least some diseases associated with altered mitochondrial function resides in mitochondrial DNA rather than in extramitochondrial DNA such as that found in the nucleus. For example, noninsulin dependent diabetes mellitus (NIDDM) exhibits a predominantly maternal pattern of inheritance and is also present in diseases known to be based on a 30 mitochondrial DNA (mtDNA) defect. Approximately 1.5% of all diabetic individuals, for instance, harbor a mutation at mtDNA position 3243 in the mitochondrial gene encoding leucyl-tRNA (tRNALe"). This mutation is known as the MELAS (mitochondrial encephalopathy, lactic acidosis and stroke) mutation. (Gerbitz et al., Biochim. Biophys. Acta 1271:253-260, 1995.) Similar theories have been advanced for 1 WO 00/63441 PCT/USOO/10906 analogous relationships between mtDNA mutations and other diseases associated with altered mitochondrial function, including but not limited to Alzheimer's Disease (AD), Huntington's Disease (HD), Parkinson's Disease (PD), dystonia, Leber's hereditary optic neuropathy (LHON), schizophrenia, and myoclonic epilepsy ragged red fiber 5 syndrome (MERRF). Identification of such mutations and their functional consequences may provide targets for development of diagnostic and/or therapeutic agents. Mitochondria are the subcellular organelles that manufacture bioenergetically essential adenosine triphosphate (ATP) by oxidative phosphorylation. 10 Functional mitochondria contain gene products encoded by mitochondrial genes situated in mitochondrial DNA (mtDNA) and by extramitochondrial genes not situated in the circular mitochondrial genome. The 16.5 kb mtDNA encodes 22 tRNAs, two ribosomal RNAs (12s and 16s rRNA) and only 13 enzymes of the electron transport chain (ETC). the elaborate multi-complex mitochondrial assembly where, for example. 15 respiratory oxidative phosphorylation takes place. (See, e.g., Wallace et al., in Mitochondria & Free Radicals in Neurodegenerative Diseases, M.F. Beal, N. Howell and I. Bodis-Wollner, eds., 1997 Wiley-Liss, Inc., New York, pp. 283-307, and references cited therein; see also, e.g., Scheffler, I.E., Mitochondria, 1999 Wiley-Liss, Inc., New York.) Mitochondrial DNA includes gene sequences encoding a number of 20 ETC components, including seven subunits of NADH dehydrogenase, also known as ETC Complex I (ND1, ND2, ND3, ND4, ND4L, ND5 and ND6); one subunit of Complex III (ubiquinol: cytochrome c oxidoreductase, Cytb); three cytochrome c oxidase (Complex IV) subunits (COXI, COX2 and COX3); and two proton translocating ATP synthase (Complex V) subunits (ATPase6 and ATPase8). The 25 overwhelming majority of mitochondrial structural and functional proteins are encoded by extramitochondrial, and in most cases presumably nuclear, genes. Accordingly, mitochondrial and extramitochondrial genes may interact directly, or indirectly via gene products and their downstream intermediates, including metabolites, catabolites, substrates, precursors, cofactors and the like. Alterations in mitochondrial function, for 30 example impaired electron transport activity, defective oxidative phosphorylation or increased free radical production, may therefore arise as the result of defective mtDNA, defective extramitochondrial DNA, defective mitochondrial or extramitochondrial gene products, defective downstream intermediates or a combination of these and other factors. 35 In the case of AD, efforts to demonstrate relationships between mtDNA mutations and disease typically involve preparation of mtDNA followed by restriction WO 00/63441 PCT/USOO/10906 fragment length polymorphism (RFLP) or related analysis (see, e.g., Shoffner et al, 1993 Genomics 17:171; Petruzzella et al., 1992 Biochem. Biophys. Res. Commun. 186:491; Kosel et al., 1994 Biochem. Biophys. Res. Commun. 203:745; Hutchin et al., 1995 Proc. Nat. Acad. Sci. USA 18:6892; Brown et al., 1996 Am J. Med. Genet. 61:283; 5 Wragg et al., 1995 Neurosci. Lett. 201:107: Zsurka et al., 1998 Biol. Psychiatry 44:371; Hutchin et al., 1997 Biochem. Biophys. Res. Commun. 241:221; Hamblet et al., 1997 Mutat. Res. 379:253; Egensperger et al., 1997 Neuropathol. Apple Neurobiol. 23:315; Lin et al., 1992 Biochem. Biophys. Res. Commun. 182:238; Tanno et al., 1998 Neurobiol. Of Aging, 19(1 S):S47; WO 94/09162) relative to RFLP patterns predicted 10 by the sequence of wildtype human mtDNA (e.g., Anderson et al., 1981 Nature 290:457). Such approaches, however, rely upon the occurrence of a mutation such as a nucleotide substitution at particular positions within the mtDNA sequence. such that the restriction fragment pattern profile generated by selected restriction endonucleases is altered. 15 Clearly there is a need for improved compositions and methods for the detection of AD, and for identifying therapeutic agents that will be useful in the treatment of AD. Regardless of whether a defect underlying AD may have mitochondrial or extramitochondrial origins, and regardless of whether a defect underlying altered mitochondrial function has been identified, the present invention 20 provides methods that are useful for determining the risk or presence of AD, and for identifying agents that are suitable for treating this disease. In particular, as is elaborated herein below, the present invention provides compositions and methods for the detection of AD by identification of unusual single nucleotide polymorphisms or homoplasmic mtDNA mutations, and other related advantages. 25 SUMMARY OF THE INVENTION Briefly stated, the present invention is directed to compositions and methods useful for detecting AD and involving identification of single nucleotide polymorphisms or homoplasmic mutations in mitochondrial DNA (mtDNA). It is therefore an aspect of the invention to provide a method for determining the risk for or 30 presence of Alzheimer's disease in a first subject suspected of having or being at risk for having such a disease, comprising determining the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease in each of a first and a second biological sample comprising mitochondrial DNA, the first biological sample being obtained from the first subject and the second 35 sample being obtained from a second subject known to be free of a risk or presence of a 3 WO 00/63441 PCT/USOO/10906 disease associated with altered mitochondrial function, wherein the presence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease in the first biological sample and the absence of a mitochondrial single nucleotide polymorphism at a corresponding nucleotide in the second biological sample 5 indicates an increased risk of Alzheimer's disease, and therefrom determining the risk or presence of Alzheimer's disease. In a related embodiment, the mitochondrial DNA in the first sample is amplified and the mitochondrial DNA in the second sample is amplified. In another embodiment, the step of determining comprises contacting each of the first and second 10 biological samples with an oligonucleotide primer having a nucleotide sequence that is complementary to a sequence present in the mitochondrial DNA of the first sample and present in the mitochondrial DNA of the second sample, under conditions and for a time sufficient to allow hybridization of the primer to the mitochondrial DNA; and detecting hybridization and extension of the primer to the mitochondrial DNA of the first sample 15 to produce a first product and hybridization and extension of the primer to the mitochondrial DNA of the second sample to produce a second product distinguishable from the first product, and therefrom determining the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease. In certain embodiments, the mitochondrial DNA in the first sample is 20 amplified and the mitochondrial DNA in the second sample is amplified. In another embodiment, at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and present in the first biological sample and that is absent at a corresponding nucleotide in the second biological sample is present in a mitochondrial DNA region that is a D-loop, a 25 mitochondrial rRNA gene, a mitochondrial NADH dehydrogenase gene, a mitochondrial tRNA gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene or a mitochondrial cytochrome b gene. In another embodiment, at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and present in the first biological sample and that is absent at a 30 corresponding nucleotide in the second biological sample is present in a mitochondrial DNA region that is a D-loop, a mitochondrial rRNA gene, a mitochondrial NADH dehydrogenase gene, a mitochondrial tRNA gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene or a mitochondrial cytochrome b gene. In another embodiment, at least one mitochondrial single nucleotide 35 polymorphism that is associated with Alzheimer's disease and present in the first biological sample and that is absent at a corresponding nucleotide in the second 4 WO 00/63441 PCT/USOO/10906 biological sample is present in a mitochondrial DNA region that is a mitochondrial NADH dehydrogenase gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene or a mitochondrial cytochrome b gene, and the single nucleotide polymorphism is a non-synonymous nucleotide substitution. In another 5 embodiment, at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and is present in the first biological sample and that is absent at a corresponding nucleotide in the second biological sample is present in a mitochondrial DNA region that is a mitochondrial NADH dehydrogenase gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene or a 10 mitochondrial cytochrome b gene, and the single nucleotide polymorphism is a synonymous nucleotide substitution. In certain embodiments of the present invention, at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and is present in the first biological sample and that is absent at a corresponding 15 nucleotide in the second biological sample is a mitochondrial single nucleotide polymorphism located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is position 72, 114, 146, 185, 189, 199, 204. 207, 228, 236, 239, 456, 462, 482. 489, 497, 500, 516, 522, 523, 547, 593, 669, 960, 1007, 1243, 1393, 1719, 1809, 2352,2483,2702,2851,3197,3333, 3336, 3348, 3394,3398, 3423, 3505, 3559, 3915, 20 3992,4024,4095,4216,4336,4529,4727,4793,4917,4991, 5004, 5046, 5228, 5315, 5418. 5426, 5460, 5461,5516, 5554, 5634, 5656, 5773. 6182,6221,6341,6367, 6371, 6489,7184,7325,7621,7768,7787, 7789,7864,7895,7963, 8149, 8251, 8269, 8276 8284, 8470, 8485, 8508, 8602, 8697, 8752, 8901, 8994, 9123,9254,9362, 9380. 9477, 9554, 9708, 9804, 9861, 10034, 10044, 10238. 10463, 10589, 10978, 11065, 11251. 25 11253, 11272, 11470, 11527, 11611, 11674, 11812, 11914, 11947, 12414, 12501, 12609, 12705, 12954, 13111, 13194, 13212, 13368, 13617, 13780, 13966, 14020, 14148, 14178, 14179, 14182, 14212, 14233, 14470, 14582, 14905. 15028, 15043, 15191, 15299, 15380, 15553, 15607, 15758, 15790, 15808, 15833, 15884, 15924, 15928, 16069, 16086, 16093, 16126, 16129, 16145, 16147, 16172, 16174, 16182, 30 16183, 16189, 16192, 16193, 16223, 16224. 16234, 16235, 16239, 16248, 16256. 16261, 16270, 16278, 16290, 16292, 16293, 16294, 16298, 16300, 16304, 16309, 16311, 16320, 16355, 16362, 16391, 16482 or 16524. In another embodiment, at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and is present in the first 35 biological sample and that is absent at a corresponding nucleotide in the second biological sample is a mitochondrial single nucleotide polymorphism located at a 5 WO 00/63441 PCT/USOO/10906 nucleotide that corresponds to a nucleotide position of SEQ ID NO: 1 that is position 709,930,960,980,1189,1243, 1700,1719,1809,1811,1888,2098,2158,2259,2352, 3010, 3197, 669, 789, 793, 870, 980, 1007, 1243, 1393, 1709, 1719, 2156, 2294, 2483, 2581, 2851, 6366 or 12954. 5 In certain other embodiments the invention provides a method for determining the risk for or presence of Alzheimer's disease in a subject, comprising: determining the presence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease in a biological sample comprising mitochondrial DNA from the subject. In certain embodiments at least one 10 mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present in a mitochondrial DNA region that is a D-loop, a mitochondrial rRNA gene, a mitochondrial NADH dehydrogenase gene, a mitochondrial tRNA gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene or a mitochondrial cytochrome b gene. In certain other embodiments at least one 15 mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present in a mitochondrial DNA region that is a mitochondrial NADH dehydrogenase gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene or a mitochondrial cytochrome b gene, and the single nucleotide polymorphism is a non-synonymous nucleotide substitution. In certain other 20 embodiments at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present in a mitochondrial DNA region that is a mitochondrial NADH dehydrogenase gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene or a mitochondrial cytochrome b gene, and the single nucleotide polymorphism is a synonymous nucleotide substitution. 25 In another embodiment, at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is a mitochondrial single nucleotide polymorphism located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is position 72, 114, 146, 185, 189, 199, 204, 207, 228, 236, 239, 456, 462, 482. 489, 497, 500, 516, 522, 523, 547, 593, 669, 960, 1007, 1243, 30 1393, 1719, 1809, 2352, 2483, 2702, 2851, 3197, 3333, 3336, 3348, 3394, 3398, 3423, 3505, 3559, 3915, 3992, 4024, 4095, 4216, 4336, 4529, 4727, 4793, 4917, 4991, 5004, 5046, 5228, 5315, 5418, 5426, 5460,5461, 5516, 5554, 5634, 5656, 5773, 6182, 6221, 6341,6367,6371,6489,7184,7325,7621,7768,7787,7789,7864,7895, 7963, 8149, 8251, 8269, 8276-8284, 8470, 8485, 8508, 8602, 8697, 8752, 8901, 8994, 9123, 9254, 35 9362, 9380, 9477, 9554, 9708, 9804, 9861, 10034, 10044, 10238, 10463, 10589, 10978, 11065, 11251, 11253, 11272, 11470, 11527, 11611, 11674, 11812, 11914, 11947, 6 WO 00/63441 PCT/USOO/10906 12414, 12501, 12609, 12705. 12954, 13111, 13194, 13212, 13368, 13617, 13780, 13966, 14020, 14148, 14178, 14179, 14182, 14212, 14233, 14470, 14582, 14905, 15028, 15043, 15191, 15299, 15380, 15553, 15607, 15758, 15790, 15808, 15833, 15884, 15924, 15928, 16069, 16086, 16093, 16126, 16129, 16145, 16147. 16172, 5 16174, 16182, 16183, 16189, 16192, 16193, 16223, 16224, 16234, 16235, 16239, 16248, 16256, 16261, 16270, 16278, 16290, 16292, 16293, 16294, 16298, 16300, 16304, 16309, 16311, 16320, 16355, 16362, 16391, 16482 or 16524. In certain embodiments, at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is a mitochondrial single 10 nucleotide polymorphism located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is position 709, 930, 960, 980, 1189, 1243, 1700, 1719, 1809, 1811, 1888, 2098, 2158, 2259. 2352, 3010, 3197, 669, 789, 793, 870, 980. 1007, 1243, 1393, 1709, 1719, 2 156,2294,2483,2581,2851,6366or 12954. In another aspect. the invention provides a method of determining if an 15 agent is likely to cause, contribute to the pathology of, or exacerbate Alzheimer's disease, comprising contacting a cell with a candidate agent, conducting an assay of a mitochondrial nucleic acid to determine if the mitochondrial nucleic acid contains one or more single nucleotide polymorphisms after being contacted with the agent, wherein the nucleic acid is present in or derived from the cell and the one or more single 20 nucleotide polymorphisms segregate with Alzheimer's disease. It is another aspect of the invention to provide a method of determining if an agent is likely to cause, contribute to the pathology of, or exacerbate Alzheimer's disease, comprising the steps of contacting a first cell with a candidate agent; incubating a second cell, that has not been contacted with the agent, and the first cell, under 25 equivalent conditions; conducting an assay of one or more mitochondrial nucleic acids to determine if the mitochondrial nucleic acids contain one or more single nucleotide polymorphisms, wherein the nucleic acids are present in or derived from the cells and the single nucleotide polymorphisms segregate with Alzheimer's disease, wherein the presence of one or more of the mutations in the mitochondrial nucleic acids present in 30 or derived from the first cell, and the absence of one or more of the mutations in the mitochondrial nucleic acids present in or derived from the second cell, indicates that the agent is likely to cause, contribute to the pathology of, or exacerbate Alzheimer's disease. In another aspect the present invention provides a nucleic acid array 35 comprising a plurality of isolated nucleic acid molecules immobilized on a solid support, wherein the isolated nucleic acid molecules comprise all or a portion of the 7 WO 00/63441 PCTUSOO/10906 nucleic acid sequence set forth in SEQ ID NO: 1 in which at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present. In certain embodiments, the mitochondrial single nucleotide polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO: 1 that is any of the 5 above recited position numbers. In other embodiments, the step of determining comprises contacting each of the first and second biological samples with an oligonucleotide primer comprising all or a portion of the nucleic acid sequence set forth in SEQ ID NO: 1 in which at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present. under conditions and for a time 10 sufficient to allow hybridization of the primer to the mitochondrial DNA; and comparing an amount of hybridization of the oligonucleotide primer to the mitochondrial DNA of the first sample to an amount of hybridization of the primer to the mitochondrial DNA of the second sample, and therefrom determining the presence or absence of at least one mitochondrial single nucleotide polymorphism that is 15 associated with Alzheimer's disease. In certain embodiments, the mitochondrial single nucleotide polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO: 1 that is any of the above recited position numbers. In certain other embodiments, the step of determining comprises contacting each of the first and second biological samples with a nucleic acid array comprising a plurality of isolated 20 nucleic acid molecules immobilized on a solid support, wherein the isolated nucleic acid molecules comprise all or a portion of the nucleic acid sequence set forth in SEQ ID NO: 1 in which at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present, under conditions and for a time sufficient to allow hybridization of mitochondrial DNA to the isolated nucleic acid 25 molecules; and comparing an amount of hybridization of the mitochondrial DNA of the first sample to the nucleic acid array to an amount of hybridization of the mitochondrial DNA of the second sample to the nucleic acid array, and therefrom determining the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease. In certain embodiments, the mitochondrial 30 single nucleotide polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO: 1 that is any of the above recited position numbers. These and other aspects of the present invention will become evident upon reference to the following detailed description and attached drawings. In addition, 35 various references are set forth herein which describe in more detail certain aspects of this invention, and are therefore incorporated by reference in their entireties. 8 WO 00/63441 PCT/USOO/10906 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 depicts mitochondrial rRNA gene mutations associated with AD. Figure 2 shows oligonucleotide primer extension reaction results from 5 AD and control cybrid cells. Figure 3 depicts mitochondrial ETC Complex IV activity in AD and control cybrid cells. Figure 4 shows western immunoblot analysis of COX subunits in AD and control cybrid cells, and in SH-SY5Y neuroblastoma cells. 10 Figure 5 illustrates the effect on ROS production of agents that interfere with radical scavenging enzymes in AD and control cybrid cells. Figure 6 shows the oxidative buffering capacity of radical scavenging enzymes in AD- 1 cybrid cells relative to mixed control cybrid cells, and also shows the relative levels of gene expression for two of the enzymes, Cu/Zn SOD and Mn SOD. 15 Figure 7 shows differences between AD and control subjects in mtDNA single nucleotide polymorphisms in mitochondrial rRNA genes as a function of age. Figure 8 depicts AD-associated and control SNPs according to haplogroup. Figure 9 depicts AD-associated and control non-synonymous SNPs 20 according to mtDNA gene loci. ND, NADH dehydrogenase; CO, cytochrome c oxidase; AT, ATP synthase; CYB, cytochrome b. Figure 10 depicts AD-associated and control non-synonymous SNPs according to mtDNA gene loci. Abbreviations as in Fig. 9. Figure 11 depicts AD-associated and control synonymous SNPs 25 according to mtDNA gene loci. Abbreviations as in Fig. 9. Figure 12 depicts AD-associated and control SNPs according to each of the 22 mitochondrial tRNA genes of mtDNA indicated by amino acid or mitochondrial genetic code specificity (F, V, LUUR, I, Q, M, W, A, N, C, Y, SUCN, D, K, G, R, H, SAGY, LCUR, E, T, P; for additional information on the mitochondrial genetic code, 30 see, e.g., Steele et al., 1996 Proc. Nat. Acad. Sci. USA 93:5253 and references cited therein.) Figure 13 summarizes AD-associated and control SNPs according to mtDNA regions. Figure 14 summarizes the frequencies per subject of AD-associated and 35 control SNPs according to mtDNA regions. 9 WO 00/63441 PCT/USOO/10906 DETAILED DESCRIPTION OF THE INVENTION The present invention is directed generally to compositions and methods for diagnosing the risk or presence of Alzheimer's disease (AD), and to compositions and methods for the identification of agents that may be suitable for treating AD. 5 According to the present invention, alterations in mitochondrial DNA (mtDNA) as described herein provide a novel and useful parameter for diagnosing the risk or presence of AD, and for identifying agents that may be suitable for treating this disease. Such alterations may include, for instance, single nucleotide polymorphisms (SNPs) or homoplasmic mtDNA mutations (see, e.g., Scheffler, I.E., Mitochondria, 10 1999. Wiley-Liss, Inc., New York, pp. 286-287). The present invention is therefore directed in pertinent part to mutations that are associated with AD, including but not limited to SNPs or homoplasmic mtDNA mutations that occur at specific positions in mtDNA in certain embodiments. SNPs or homoplasmic mtDNA mutations that in certain other embodiments occur with altered frequencies (e.g., frequencies that are 15 increased or decreased in a statistically significant manner) in subjects having or being at risk for having AD relative to subjects known to be free of a risk for having AD, or SNPs or homoplasmic mtDNA mutations that in certain other embodiments occur with altered frequencies (e.g., frequencies that are increased or decreased in a statistically significant manner) in patient populations having or being at risk for having AD relative 20 to populations known to be free of a risk for having AD. A biological sample for use according to the present invention, containing mtDNA as provided herein, may comprise any tissue or cell preparation in which mitochondrially derived nucleic acids (e.g., mtDNA) are present. Compositions and methods useful for obtaining and detecting mtDNA are provided, for example, in 25 U.S. Patent Nos. 5,565,323 and 5,840,493. Biological samples may be provided by obtaining a blood sample, biopsy specimen, tissue explant, organ culture or any other tissue or cell preparation from a subject or a biological source. The subject or biological source may be a human or non-human animal, a primary cell culture or culture adapted cell line, including but not limited to genetically engineered cell lines 30 that may contain chromosomally integrated or episomal recombinant nucleic acid sequences, immortalized or immortalizable cell lines, somatic cell hybrid or cytoplasmic hybrid "cybrid" cell lines (see, e.g., U.S. Patent No. 5,888,498), differentiated or differentiatable cell lines, transformed cell lines and the like. In certain embodiments of the invention, the subject or biological source may be suspected of 35 having or being at risk for having a disease associated with altered mitochondrial function (e.g., AD), and in certain embodiments of the invention, the subject or 10 WO 00/63441 PCT/USOO/10906 biological source may be known to be free of a risk or presence of such a disease. For example, and according to non-limiting theory, in certain embodiments it may be desirable to use as a subject or biological source a control individual, typically an age and/or sex-matched individual, a healthy individual or an individual appropriate as a 5 control for a subject suspected of having or being at risk for AD by any number of other biological, physiological, immunological, pharmacological, pathological, neurological or other biomedical criteria, or the like. Those having ordinary skill in the art are familiar with design and selection of such parameters for clinical correlation. For instance, in certain embodiments it may be desirable to identify such a control 10 individual who is believed to be free of any AD-associated signs and symptoms as described below, and in certain other embodiments, a control individual may share a mitochondrial genetic relationship to a subject suspected of being at risk for AD, such as the mother or sibling of the subject (see, e.g., Scheffler, 1999, supra). In certain other embodiments of the present invention the subject or biological source is at least 15 64 years of age, and in certain other embodiments the subject or biological source is at least 75 years of age. In certain preferred embodiments the subject or biological source is at least 85 years of age. In certain other preferred embodiments it may be desirable to determine whether a subject or biological source falls within clinical parameters indicative of 20 Alzheimer's disease (AD). Signs and symptoms of AD accepted by those skilled in the art may be used to so designate a subject or biological source, for example clinical signs referred to in McKhann et al. (Neurology 34:939, 1984, National Institute of Neurology, Communicative Disorders and Stroke and Alzheimer's Disease and Related Disorders Association Criteria of Probable AD, NINCDS-ADRDA) and references cited therein. 25 or other means known in the art for diagnosing AD. Any mtDNA sequence or portion of a mutated mtDNA sequence that corresponds to the human mtDNA sequence disclosed by Anderson et al. (SEQ ID NO:1, 1981 Nature 290:457; see also Marzuki et al., 1991 Human Genet. 88:139) and revised according to Andrews et al. (1999 Nature Genetics 23:147), or a portion thereof or several portions thereof, may be useful in these 30 embodiments of the invention. Examples of human mtDNA point mutations derived from specific mtDNA sequence regions that are useful in these and other embodiments of the invention are disclosed, according to the nucleotide positions at which wildtype and mutant mtDNA differ, in Tables 1-4 and Table 9. Portions of the mtDNA sequence of SEQ ID NO:1, and portions of a 35 sample mtDNA sequence derived from a biological source or subject as provided herein, are regarded as "corresponding" nucleic acid sequences, regions, fragments or 11 WO 00/63441 PCT/USOO/10906 the like, based on the convention for numbering mtDNA nucleic acid positions according to SEQ ID NO:l (Anderson et al., Nature 290:457, 1981), wherein a sample mtDNA sequence is aligned with the mtDNA sequence of SEQ ID NO:1 such that at least 70%, preferably at least 80% and more preferably at least 90% of the nucleotides 5 in a given sequence of at least 20 consecutive nucleotides of a sequence are identical. For example, a portion of the mtDNA sequence in a biological sample containing mtDNA from a subject suspected of having or being at risk for having AD, or, as another example, a portion of the mtDNA sequence in mtDNA containing at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's 10 disease as provided herein (e.g., mutated mtDNA), may be aligned with a corresponding portion of the mtDNA sequence of SEQ ID NO: 1 using any of a number of alignment procedures and/or tools with which those having ordinary skill in the art will be familiar (e.g., CLUSTAL W, Thompson et al., 1994 Nucl. Ac. Res. 22:4673: CAP., xww.no.embnet.org/clustahv.htmi: FASTA/FASTP, Pearson, 1990 Proc. Nat. Acad. 15 Sci. USA 85:2444, available from D. Hudson, Univ. of Virginia, Charlottesville, VA). In certain preferred embodiments, a sample mtDNA sequence is greater than 95% identical to a corresponding mtDNA sequence of SEQ ID NO: 1. In certain other preferred embodiments, a sample mtDNA sequence is identical to a corresponding mtDNA sequence of SEQ ID NO: 1. Those oligonucleotide probes having sequences 20 that are identical in corresponding regions of the mtDNA sequence of SEQ ID NO: I and sample mtDNA may be identified and selected following hybridization target DNA sequence analysis, to verify the absence of mutations. According to the present invention and as known in the art, the term "haplotype" refers to a particular combination of genetic markers in a defined region of 25 the mitochondrial chromosome. Such genetic markers include, for example, RFLPs and SNPs. RFLPs (restriction fragment polymorphisms) result from an alteration in a recognition site, often a palindrome, that is specifically cleaved in a site-specific manner by a DNAse known as a restriction enzyme. A SNP (single nucleotide polymorphism) is a change (e.g., a deletion, insertion or substitution) in any single nucleotide base in a 30 region of a genome of interest. In particularly preferred embodiments provided by the instant disclosure, the genome of interest is the mitochondrial genome. Because SNPs vary from individual to individual, they are useful markers for studying the association of a genome. Moreover, because they occur more frequently than other markers such as RFLPs, analysis of SNPs should produce a "higher resolution" picture of disease 35 associated genetic marker segregation (Weiss, Genome Res. 8:691-697, 1998; Gelbert and Gregg, Curr. Opin. Biotechnol. 8:669-674, 1997). 12 WO 00/63441 PCT/USOO/10906 The term "haplogroup" refers to a group of haplotypes found in association with one another. Several mitochondrial DNA haplotypes and haplogroups are known in the art, including ten European mtDNA haplogroups as well as discrete Asian, Native American and African mtDNA haplogroups, each identified on the basis 5 of the presence or absence of one or more specific restriction endonuclease recognition sites (see, e.g., Wallace et al., 1999 Gene 238:211; Torroni et al., 1996 Genetics 144:1835). Nucleic acid sequences within the scope of the invention include isolated DNA and RNA sequences that specifically hybridize under conditions of moderate or 10 high stringency to mtDNA nucleotide sequences, including mtDNA sequences disclosed herein or fragments thereof, and their complements. As used herein, conditions of moderate stringency, as known to those having ordinary skill in the art, and as defined by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press (1989), include, for 15 example, the use as a prewashing solution for nitrocellulose filters on which proband nucleic acids have been immobilized of 5X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of 50% formamide, 6X SSC at 42'C (or other similar hybridization solution), and washing conditions of about 50-60 0 C, 0.5X SSC, 0.1% SDS. Conditions of high stringency are defined as hybridization conditions as above, 20 and with washing at 60-68*C, 0.2X SSC, 0.1% SDS. In other embodiments, hybridization to an mtDNA nucleotide sequence may be at normal stringency, which is approximately 25-30*C below Tm of the native duplex (e.g., 5X SSPE, 0.5% SDS, 5X Denhardt's solution, 50% formamide, at 42'C or equivalent conditions), at low stringency hybridizations, which utilize conditions approximately 40'C below Tm, or at 25 high stringency hybridizations, which utilize conditions approximately 1 0 0 C below Tm. The skilled artisan will recognize that the temperature, salt concentration, and chaotrope composition of hybridization and wash solutions may be adjusted as necessary according to factors such as the length and nucleotide base composition of the probe. (See also, e.g., Ausubel et al., Current Protocols in Molecular Biology, Greene 30 Publishing, 1987.) Thus, desired variations in stringency of hybridization conditions may be achieved by altering the time, temperature and/or concentration of the solutions used for prehybridization, hybridization and wash steps. Accordingly, it will be appreciated that suitably stringent conditions can be readily selected without undue experimentation where a desired selectivity of the probe is identified, based on its 35 ability to hybridize to one or more certain proband sequences while not hybridizing to certain other proband sequences. 13 WO 00/63441 PCT/USOO/10906 An "isolated nucleic acid molecule" refers to a polynucleotide molecule in the form of a separate fragment or as a component of a larger nucleic acid construct, that has been separated from its source cell (including the chromosome it normally resides in) at least once, preferably in a substantially pure form. Isolated nucleic acids 5 may be nucleic acids having particular disclosed nucleotide sequences or may be regions, portions or fragments thereof. Those having ordinary skill in the art are able to prepare isolated nucleic acids having the complete nucleotide sequence, or the sequence of any portion of a particular isolated nucleic acid molecule, when provided with the appropriate nucleic acid sequence information as disclosed herein. Nucleic acid 10 molecules may be comprised of a wide variety of nucleotides, including DNA, RNA, nucleotide analogues such as phosphorothioates or peptide nucleic acids, or other analogues with which those skilled in the art will be familiar, or some combination of these. The present invention, as described herein, provides mtDNA sequences 15 and isolated mtDNA nucleic acid molecules. mtDNA may be isolated from cellular DNA according to well known methodologies, for example those described in U.S. Patent No. 5,840,493, which is hereby incorporated by reference in its entirety. Where it is advantageous to use oligonucleotide primers according to the present invention, such primers may be 10-60 nucleotides in length, preferably 15-35 20 nucleotides and still more preferably 18-30 nucleotides in length. Primers may be useful in the present invention for quantifying mtDNA mutations, including single nucleotide polymorphisms or homoplasmic mtDNA mutations provided herein, by any of a variety of techniques well known in the art for determining the amount of specific nucleic acid target sequences present in a sample based on specific hybridization of a 25 primer to the target sequence. Optionally, in certain of these techniques, hybridization precedes nucleotide polymerase catalyzed extension of the primer using the strand containing the target sequence as a template, and/or ligation of oligonucleotides hybridized to adjacent target sequences, and embodiments of the invention using primer extension are particularly preferred. 30 For examples of references on such quantitative detection techniques, including those that may be used to detect nucleotide insertions, substitutions or deletions in a portion of an mtDNA sequence site near an oligonucleotide primer target hybridization site that corresponds to a portion of the wildtype mtDNA sequence as disclosed in Anderson et al. (1981 Nature 290:457, SEQ ID NO:l) or a mutated site 35 such as may be created by any of the mtDNA point mutations disclosed herein, and further including those that involve primer extension, see U.S. 5,760,205 and the 14 WO 00/63441 PCT/USOO/10906 references cited therein, all of which are hereby incorporated by reference, and see also. for example, Botstein et al. (Am. J. Hum. Gen. 32:314, 1980), Gibbs et al. (Nucl. Ac. Res. 17:2437, 1989), Newton et al. (Nucl. Ac. Res. 17:2503, 1989), Grossman et al. (Nucl. Ac. Res. 22:4527, 1994), and Saiki et al. (Proc. Nat. Acad Sci. 86:6230, 1989), 5 all of which are hereby incorporated by reference. A particularly useful method for this purpose is the primer extension assay disclosed by Fahy et al. (Nucl. Acids Res. 25:3102, 1997) and by Ghosh et al. (Am. J. Hum. Genet. 58:325, 1996), both of which references are hereby incorporated in their entireties, as is Krook et al. (Hum. Molec. Genet. 1:391, 1995) which teaches modification of primer extension reactions to detect 10 multiple nucleotide substitutions, insertions, deletions or other mutations. Other examples of useful techniques for quantifying the presence of specific nucleic acid target sequences in a sample include but need not be limited to labeled probe hybridization to the target nucleic acid sequences with or without first partially separating target nucleic acids from other nucleic acids present in the sample. 15 Examples of other useful techniques for determining the amount of specific nucleic acid target sequences present in a sample based on specific hybridization of a primer to the target sequence include specific amplification of target nucleic acid sequences and quantification of amplification products, including but not limited to polymerase chain reaction (PCR, Gibbs et al., Nucl. Ac. Res. 17:2437, 1989), 20 transcriptional amplification systems, strand displacement amplification and self sustained sequence replication (3SR, Ghosh et al, in Molecular Methods for Virus Detection, 1995 Academic Press, NY, pp. 287-314), the cited references for which are hereby incorporated in their entireties. Examples of other useful techniques include ligase chain reaction, single stranded conformational polymorphism analysis, Q-beta 25 replicase assay, restriction fragment length polymorphism (RFLP, Botstein et al., Am. J Hum. Gen. 32:314, 1980) analysis and cycled probe technology, as well as other suitable methods that will be known to those familiar with the art. In a particularly preferred embodiment of the invention, primer extension is used to quantify mtDNA mutations present in a biological sample. (Ghosh et al., Am. 30 J Hum. Genet. 58:325, 1996) This embodiment may offer certain advantages by permitting both wildtype and mutant mtDNA to be simultaneously quantified using a single oligonucleotide primer capable of hybridizing to a complementary nucleic acid target sequence that is present in a defined region of wildtype mtDNA and in a corresponding region of a mutated mtDNA sequence. Without wishing to be bound by 35 theory, the use of a single primer for quantification of wildtype and mutated mtDNA is believed to avoid uncertainties associated with potential disparities in the relative 15 WO 00/63441 PCT/USOO/10906 hybridization properties of multiple primers and may offer other advantages. Where such a target sequence is situated adjacent to a mutated mtDNA nucleotide sequence position that is a nucleotide substitution, insertion or deletion relative to the corresponding wildtype mtDNA sequence position, primer extension assays may be 5 designed such that oligonucleotide extension products of primers hybridizing to mutated mtDNA are of different lengths than oligonucleotide extension products of primers hybridizing to wildtype mtDNA. Accordingly, the amount of mutant mtDNA in a sample and the amount of wildtype mtDNA in the sample may be determined by quantification of distinct extension products that are separable on the basis of sequence 10 length or molecular mass. Sequence length or molecular mass of primer extension assay products may be determined using any known method for characterizing the size of nucleic acid sequences with which those skilled in the art are familiar. In a preferred embodiment, primer extension products are characterized by gel electrophoresis. In another preferred 15 embodiment, primer extension products are characterized by mass spectrometry (MS). which may further include matrix assisted laser desorption ionization/ time of flight (MALDI-TOF) analysis or other MS techniques known to those having skill in the art. See, for example, U.S. 5,622,824, U.S. 5,605,798 and U.S. 5,547,835. all of which are hereby incorporated by reference in their entireties. In another preferred embodiment, 20 primer extension products are characterized by liquid or gas chromatography, which may further include high performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS) or other well known chromatographic methodologies. In another particularly preferred embodiment of the invention, DNA in a 25 biological sample containing mtDNA is first amplified by methodologies well known in the art, such that the amplification products may be used as templates in a method for detecting single nucleotide polymorphisms or homoplasmic mtDNA mutations present in the sample. Accordingly, it may be desirable to employ oligonucleotide primers that are complementary to target sequences that are identical in, and common to, wildtype 30 and mutant mtDNA, for example PCR amplification templates and primers prepared according to Fahy et al. (Nucl. Acids Res., 25:3102, 1997) and Davis et al. (Proc. Nat. Acad. Sci. USA 94:4526, 1997; see also Hirano et al., Proc. Nat. Acad. Sci. USA 94:14894, 1997, and Wallace et al., Proc. Nat. Acad Sci. USA 94:14900, 1997.) In certain other preferred embodiments, mtDNA mutations may be 35 efficiently detected, screened and/or quantified by high throughput hybridization methodologies directed to independently probing a plurality of distinct mtDNAs, or a 16 WO 00/63441 PCT/USOO/10906 plurality of distinct oligonucleotide primers as provided herein, that have been immobilized as nucleic acid arrays on a solid phase support. Typically, the solid support may be silica, quartz or glass, or any other material on which nucleic acid may be immobilized in a manner that permits appropriate hybridization, washing and 5 detection steps as known in the art and as provided herein. In preferred embodiments, solid-phase nucleic acid arrays are precisely spatially addressed, as described, for example, U.S. Patent 5,800,992 (see also, e.g., WO 95/21944; Schena et al., 1995 Science 270:467-470, 1995; Pease et al., 1994 Proc. Nat. Acad Sci. USA 91:5022; Lipshutz et al., 1995 Biotechniques 19: 442-447). 10 Detection of hybridized (e.g., duplexed) nucleic acids on the nucleic acid array may be achieved according to any known procedure, for example, by spectrometry or potentiometry (e.g., MALDI-MS). Within certain preferred embodiments the array contains oligonucleotides that are less than 50 bp in length. For high throughput screening of nucleic acid arrays, the format is preferably amenable to automation. It is 15 preferred, for example, that an automated apparatus for use according to high throughput screening embodiments of the present invention is under the control of a computer or other programmable controller. The controller can continuously monitor the results of each step of the nucleic acid deposition, washing, hybridization, detection and related processes, and can automatically alter the testing paradigm in response to 20 those results. The present invention also provides compositions and methods that are useful in pharmacogenomics, for the classification and/or stratification of a subject or a patient population. Such stratification may involve, for example, correlation of single nucleotide polymorphisms or homoplasmic mtDNA mutations as provided herein with, 25 for instance, one or more particular traits in a subject, and further, optionally, with indicators of the responsiveness to, or efficacy of, a particular therapeutic treatment. In one aspect of the invention, detection in a biological sample of single nucleotide polymorphisms or homoplasmic mtDNA mutations that segregate with AD from a subject is combined with identification of the subject's apolipoprotein E (APOE) 30 genotype to determine the risk for, or presence of, Alzheimer's disease (AD) in the subject. The apolipoprotein E type 4 allele (APOE-s4) allele is a genetic susceptibility factor for sporadic AD and confers a two fold risk for AD (Corder et al., Science 261:921, 1993; see also "National Institute on Aging/Alzheimer's Association Working Group Consensus Statement," Lancet 347:1091, 1996 and references cited therein, all of 35 which are hereby incorporated by reference in their entireties.). Accordingly, in a preferred embodiment of the invention, the method for determining the risk for or 17 WO 00/63441 PCTUSOO/10906 presence of AD in a subject by detecting single nucleotide polymorphisms or homoplasmic mtDNA point mutations according to the present disclosure will further comprise determining the APOE genotype of the subject suspected of being at risk for AD. By using the combination of the methods for determining mtDNA point mutations 5 as disclosed herein, and methods known in the art for determining APOE genotype, an enhanced ability to detect the relative risk for AD is provided by the instant invention along with other related advantages. Similarly, where APOE genotype and risk for AD are correlated, the present invention provides advantageous methods for identifying agents suitable for treating AD where such agents affect may be correlated with 10 detection of one or more specific single nucleotide polymorphisms or homoplasmic mtDNA mutations in a biological source. As described herein, determination of specific single nucleotide polymorphisms or homoplasmic mtDNA mutations may be used to stratify an AD patient population. Accordingly, in another preferred embodiment of the invention, 15 determination of such mutations in a biological sample from an AD subject may provide a useful correlative indicator for that subject. An AD subject so classified on the basis of one or more specific mutations may then be monitored using AD clinical parameters referred to above, such that correlation between particular mtDNA mutations and any particular clinical score used to evaluate AD may be monitored. For 20 example, stratification of an AD patient population according to at least one of the single nucleotide polymorphisms or homoplasmic mtDNA mutations provided herein may provide a useful marker with which to correlate the efficacy of any candidate therapeutic agent being used in AD subjects. In a further preferred embodiment of this aspect of the invention, determination of one or more specific mtDNA mutations in 25 concert with determination of an AD subject's APOE genotype, as described above, may also be useful. These and related advantages will be appreciated by those familiar with the art. In particularly preferred embodiments, oligonucleotide primers will be employed that permit specific detection of the single nucleotide polymorphisms or 30 homoplasmic mtDNA point mutations disclosed in Tables 1-4 and Table 9, wherein specific substitution and deletion mutations in mitochondrial genes including, for example, those encoding 12S rRNA. 16S rRNA, several tRNAs, COX1, COX2, COX3, cytochrome b, ATPase 8, ATPase 6, NDl, ND2, ND4 and ND5 are disclosed, as are numerous mutations in the mtDNA D-loop region. Each mutation listed in Tables 1-4 35 and Table 9 is designated with (i) the identity of the nucleotide at a particular nucleotide position according to the wildtype human mtDNA sequence (Anderson et al., 1981 18 WO 00/63441 PCT/US0O/10906 Nature 290:457; see also Andrews et al., 1999 Nature Genetics 23:147 and references cited therein), (ii) the nucleotide position number according to the convention of Anderson et al. (1981) and (iii) the identity of the mutated nucleotide at that position, identified as disclosed herein. Thus, for example, the nucleotide T (thymine) situated at 5 position 1189 of the wildtype mtDNA 12S rRNA gene is mutated to the nucleotide C (cytosine) in mtDNA analyzed from a substantial number of patients diagnosed with AD (see Tables 1, 2, 4). Table 9 also presents the number of samples in which a particular AD-associated SNP was detected, and the mitochondrial haplogroup of the mtDNA sample donor in which the AD-associated SNP was first identified (see also 10 Examples, below). As presented in Tables 2-4 and as disclosed herein, a mitochondrial single nucleotide polymorphism or homoplasmic mtDNA point mutation, which includes a deviation in the identity of the nucleotide base situated at a specific position in a mtDNA sequence relative to the "wildtype" human mtDNA sequence (CRS) 15 disclosed by Anderson et al. (1981), may fall into at least one of the following categories: An "error" refers to sequencing mistakes in the human mtDNA sequence reported by Anderson et al. (1981), as corrected by Andrews et al. (1999 Nature Genetics 23:147). A "polymorphism" in Tables 2-4 refers to a known polymorphism in a human mtDNA sequence that is not associated with a particular human disease, but 20 that has been detected and described as a result of naturally occurring variability in the identity of the nucleotide base situated at a given position in a human mtDNA sequence (see, e.g., "Mitomap", Emory University School of Medicine, available at http://www.gen.emory.edu). A "rare polymorphism" in Tables 2-4 refers to a mtDNA nucleotide that differs from the base situated at the corresponding position in the 25 Cambridge Reference Sequence (CRS) of Anderson et al. (1981) but which, upon subsequent accumulation of human mtDNA sequence data from a plurality of subjects (and in contrast to the reliance of Anderson et al. upon the mtDNA sequence of a single donor to generate the CRS), suggests the presence of a low frequency allele in the CRS donor, relative to the larger sample population (see Andrews et al., 1999 Nature 30 Genetics 23:147 and references cited therein). Particularly useful mutations that segregate with AD according to the present invention include homoplasmic mtDNA point mutations (e.g., single nucleotide polymorphisms) presented in Tables 2-4 that are not errors, polymorphisms or rare polymorphisms as just described, and additionally, the homoplasmic mtDNA point mutations (e.g., single nucleotide polymorphisms) 35 presented in Table 9. 19 WO 00/63441 PCTUSOO/1 0906 CD CD CD c- c- C 7> 0<< z co LL CD\DJC 02 WO 00/63441 PCT/USOO/10906 Cn Cn C\I 0 0 t-I CD 0- \ o o o o o o o o o o o o mI -41 m o C o\ L - : -O - -J -J m + m m c 0 c w m m 00 m -C- M M o o o o o 0 o 21 WO 00/63441 PCTIUSOO/10906 C-=) C ) C-) C-) C=-)C m = C~f M 0! 0:5 co c c I-- LL- I- = H- ) (i) <c 6w CD _j< =:)) 0) 0) C) 0) C) V) 0 0 - o C) C2 co co co co m) m) m) CO 02 c.D V) <n C-) <) C ) L ~ ~ C 'T Co co C) CT)1 1__= 0', C~j C (-) C-) L) C) m) C) C) C) C) <) <) <) < m) co 00 0o 0o 00 0o 0o 0o 0oc noc ~ 0 0 0 0 0 0 02 WO 00/6344 1 PCTIUSOO/10906 ~DC) (A co O c c c-4 Ofc C:)CD CDDl 1-. =:) 4) V)C 0- 0 CD 0 0 C 0 0 CJ C-) U) ) (-Z 1-0 0 0o 0, 0- 0 0 0 0 2 0 0 0 0~ m C m 0 0O I co cn -:I C) <1 23 WO 00/6344 1 PCT/USOO/10906 ~~OD -1 C\D L > o c of-) C : *cco C)) C0 CD CD L, cc -J -Zj -Jj C < < < CC) c C)' < <a- co cc Q- Q) ) (L) ( cc- 0i 0 0c00 o - o ccJ ccL cc LU o co 00~ CC) LW H- ~ ~ (2~' ra~ ~cx24 WO 00/63441 PCT/US0O/1 0906 - -4 r-4 LL C~CD -4 co~C co OD co co 14 CD CD: Ci Of <c cc cc <<< < < cm fm CID <<< < < < WU -0 7U -0 -0 -0- - ~ 0 0 0 0 0 0 0 0 0 0 0 0 0 0 000 'J~~~~~~~~~~ o) o oooor- 0 ~ ( cc cc co cc cc cc co co co co 02c c c c cc c c c f' Ln CID (7 r-cc 1 H - i co 'T 'l co CID Sco cc c cc c c cc (J r-_ 1T_ LC) (C LO) Q0 (N SCO) mO C O O C O CO) mO -Z ' O ' C> i IT ,* (J NOD cc cc cc 25 WO 00/63441 PCT[USOO/10906 C\j C,)) CD CD C 00i '-4 LO2 cc m co cV ccc c o c C2oI V o o L (-) -< c < < CC 0 0 m cc 0 o cc0 02 WO 00/63441 PCTUSOO/10906 Table 2 SEQUENCE ANALYSIS OF AD-1 HUMAN MITOCHONDRIAL DNA Nucleotide position Gene Mutation CRS AD-1 Remarks 73 D-Loop - A G Polymorphism 2 114 D-Loop - C T Polymorphism 2 263 D-Loop - A G rare polymorphism in CRS! 311-315 D-Loop - CTC CCTCC rare polymorphism in CRS' 750 12S rRNA - A G rare polymorphism in CRS' 1189 12S rRNA - T C 1438 12S rRNA - A G rare polymorphism in CRSI 1811 16S rRNA - A G Polymorphism 2 2706 16S rRNA - A G Polymorphism 2 3106-3107 16S rRNA - CC C Error' 3423 ND1 - G T Error' 3480 ND1 - A G Polymorphism2 4769 ND2 - A G rare polymorphism in CRS' 4985 ND2 - G A Error' 6366 COI Vall55Ile G A 7028 col - C T Polymorphism 2 8860 ATPase 6 Thrll2Ala A G rare polymorphism in CRS 9055 ATPase 6 Alal77Thr G A polymorphism 2 9559 CIII Alall8Pro G C error' 10398 ND3 Thrll4Ala A G polymorphism 2 10550 ND4L - A G polymorphism 2 11299 ND4 - T C polymorphism 2 11335 ND4 - T C error' 11467 ND4 - A G polymorphism2 11719 ND4 - G A polymorphism2 11914 ND4 - G A polymorphism 2 12308 ND5 - A G polymorphism 2 12372 NDS - G A polymorphism 2 12954 ND5 - T C 13702 ND5 Gly456Arg G C error 14167 ND6 - C T polymorphism2 14199 ND6 - G T error' 14272 ND6 - G C error 14365 ND6 - G C error' 14368 ND6 - G C error 27 WO 00/63441 PCT/USOO/10906 Nucleotide position Gene Mutation CRS AD-1 Remarks 15326 Cytb Thr194Ala A G rare polymorphism in CRS 15924 tRNA'lr - A G polymorphism 2 16519 D-Loop - T C polymorphism 2 1 Andrews et al. (1999) Nature Gen 23. 147 2 Mitomap. Emory University School of Medicine (www.gen.emory.edu) Table 3 5 SEQUENCE ANALYSIS OF AD-2 HUMAN MITOCHONDRIAL DNA Nucl eoti d e Gene Mutation CRS AD-2 Remarks position 263 D-Loop - A G rare polymorphism in CRS' 311-315 D-Loop - CTC CCTCC rare polymorphism in CRS' 750 12S rRNA - A G rare polymorphism in CRS' 980 12S rRNA - T C 3010 16S rRNA - G A polymorphism 2 3106-3107 16S rRNA - CC C error 3423 ND1 - G T errors 4769 ND2 - A G rare polymorphism in CRS 4985 ND2 - G A error 8860 ATPase 6 Thrll2Ala A G rare polymorphism in CRS' 9559 CCIII Alall8Pro G C error' 11335 ND4 - T C error 13702 ND5 Gly456Arg G C error 14199 ND6 - G T error 14272 ND6 - G C error 14365 ND6 - G C error 14368 ND6 - G C error 14766 Cytb Ile7Thr T C polymorphism 15326 Cytb Thr194Ala A G rare polymorphism in CRS' 152 ftN T h r S2 15924 tRNA- A G polymorphism 16519 D-Loop - T C polymorphism 2 1 Andrews et al. (1999) Nature Gen. 23. 147 2 Mitomap. Emory University School of Medicine (www.gen.emory.edu) 28 WO 00/63441 PCT/USOO/10906 Table 4 SNP's IN THE MITOCHONDRIAL RRNA GENES Patient Diagnosis N Nucl. Pos. # Patients Remarks A750G I 1I of 112 rare polymorphism in CRSI A1438G 108 of 112 rare polymorphism in CRSI A2706G 65 of 112 polymorphism 2 C3107Del 1 I of 112 error in CRS 1 Living N=13 G709A I of 13 polymorphism 2 hapologroup T, Controls some W TI189C 4of13 A181 IG 5 of 13 polymorphism 2 haplogroup U G2098A I of 13 G301OA 3 of 13 polymorphism 2 haplogroup H, some Y Autopsy- N=41 G709A 6 of41 polymorphism 2 haplogroup T, Confirmed some W Controls T789C l of4I 793T ins I of 41 C870T I of4l G930A I of 41 T980C l of4l T1189C 3 of 41 T1243C I of 41 G1719A I of41 polymorphism 2 T1809C I of 41 A181IG 5 of41 polymorphism 2 haplogroupU G1888A 4 of 41 haplogroupT A2294G I of 4l A2581G l of4l G3010A 5 of 41 polymorphism 2 haplogroup H, some Y 29 WO 00/63441 PCT/USOO/10906 Patient Diagnosis N Nuc . Pos. # Patients Remarks Living ADs N=13 T980C I of 13 T1189C 4 of 13 CI700T 1 of 13 A] 811 G 3 of 13 polymorphism 2 haplogroup U T2156C I of 13 T2158C I of 13 G301 10A 2 of 13 polymorphism 2 haplogroup H, some Y T3197C I of 13 polymorphism 2 Autopsy- N=45 T669C I of 45 Confirmed ADs G709A 8 of 45 polymorphism 2 haplogroup T, some W G930A 2 of 45 polymorphism 2 haplogroup T C960DeI I of 45 GI007A I of 45 T1189C 9 of 45 T1243C I of45 G1393A 1 of 45 G1709A I of 45 GI719A 3 of 45 polymorphism 2 A181IG 9 of 45 polymorphism 2 haplogroup U G1888A 5 of 45 haplogrooup T C2259T I of 45 T2352C 1 of 45 polymorphism 2 T2483C I of 45 A2851G I of 45 G3010A 10 of 45 polymorphism 2 haplogroup H, some Y T3197C 2 of 45 polymorphism 2 Andrews et a]. (1999) Nature Gen. 23, 147. 2 Mitomap, Emory University School of Medicine (www.gen.emory.edu) 5 The following examples are offered by way of illustration, and not by way of limitation. 30 WO 00/63441 PCT/USOO/10906 EXAMPLES EXAMPLE 1 DNA ISOLATION FROM BLOOD AND BRAIN SAMPLES Venous blood samples were obtained from donor individuals and 5 collected in vacutainer tubes containing EDTA. White blood cell fractions were obtained by centrifugation at 2,500 rpm at 4'C for 30 min. The white blood cell layers were collected and diluted with 5 ml sterile TE buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA) and centrifuged at 2,500 rpm for 10 min at 4'C. The cell pellet was then lysed by the addition of 10 ml lysis buffer containing 1% SDS and 400 tg/ml proteinase K in 10 TE buffer. Cells were incubated for 4 hrs at 37 0 C while shaking at 200 rpm in an orbital shaker. Total cellular DNA was purified by two extractions with phenol/chloroform and two extractions with chloroform. DNA was precipitated by adding 1/10 volume 5 M NaCl and 2x volume 100% ethanol and placed at -20'C. DNA was pelleted by centrifugation, washed with 70% ethanol, and resuspended in TE 15 buffer. Total cellular DNA was also isolated from frozen brain tissue by homogenizing the tissue in lysis buffer (50 mM Tris-HCl, pH 7.9, 100 mM EDTA, 0.1 M NaCl, 0.03 M DDT, 1% SDS, 1 mg/ml proteinase K) using a dounce glass homogenizer. The homogenized brain tissue was incubated for 30-60 min at 45-50'C. 20 DNA was purified by two extractions with phenol/chloroform and two extractions with chloroform. DNA was precipitated by adding 1/10 volume 5 M NaCl and 2x volume 100% ethanol and placed at -20'C. DNA was pelleted by centrifugation, washed with 70% ethanol, and resuspended in TE buffer. Total cellular DNA was also isolated from human SH-SY5Y 25 neuroblastoma cells by first removing the cells from the tissue culture flasks by treatment with 0.5 mM EDTA in Dulbecco's PBS. Cells were then pelleted by centrifugation at 2,000 g for 10 min and DNA was extracted with DNAzol reagent (Molecular Research Center, Inc., Cincinnati, OH) according to the manufacturer's recommendations. 30 DNA concentrations were determined by UV absorption at 260 nm. 31 WO 00/63441 PCT/USOO/10906 EXAMPLE 2 PCR AMPLIFICATION, SEQUENCING, AND SEQUENCE ANALYSIS Total cellular DNA prepared from white blood cells, brain tissue, and SH-SY5Y cells, as described in Example 1, was used for amplification with sets of 5 oligonucleotide primers specific for the indicated regions of mtDNA light strand (Table 5, "L" primers) and heavy strand (Table 5, "H") nucleotide sequences, or primers complementary to portions of mtDNA D-loop regions (see, e.g., Wallace et al., in Mitochondria & Free Radicals in Neurodegenerative Diseases, M.F. Beal, N. Howell and I. Bodis-Wollner, eds., 1997 Wiley-Liss, Inc., pp. 283-307, and references cited 10 therein) that are capable of amplifying a region spanning essentially the entire mitochondrial DNA molecule (Table 6). Amplifications were performed in 50 Vl reaction volumes using 0.5-1.0 [tg of DNA, 200 ng each of L-strand and H-strand or forward (Table 6, "F") and reverse (Table 6, "R") primers, 200 PM of each dNTP, 10 mM Tris-HCl, pH 8.3, 50 mM KCL, 2 mM MgCl 2 , and one unit of AmpliTaq DNA 15 polymerase (Perkin-Elmer, Norwalk, CT). Using a Gene Amp PCR System 9600 thermal cycler (Perkin-Elmer), amplification was carried out as follows: 95'C for 10 sec, 30 cycles at 95'C for 1 min, 60'C for 1 min, and 72'C for 1 min. and 1 cycle at 72'C for 4 min. Amplicons were purified by the QlAquick PCR Purification Kit (Qiagen, Chatsworth, CA). 32 WO 00/6344 1 PCTIUSOO/10906 Cl 00 00 t L Ln ~ f 00 o0 cn U/7 C/) V) Con CID CC ON ~ O 00 100 - O Cl 00 'L~ ) - Cl - - C Cl l . Cl tr~ ~ i C-)~~C < < tHn u HU<0 U H U H< 33 WO 00/63441 PCT/USOOI1 0906 -b C:- QC 00 NN c, a, CA 00 C'l CIA M~O 1 r- r- -0 o E H74tH H M U U 0 U U H 34 WO 00/63441 PCT/USOO/10906 Table 6 D-Loop PCR PRIMERS Primer Nucleotide Sequence 5'-> 3' False Priming SEQ ID NO: 51F 15968 TCTTTAACTCCACCATT AGCAC 51R 16388 AGGATGGTGGTCAAGG GACCCC 52F 16343 ACAGTCAAATCCCTTC TCGTCC 52R 241 GGCTGTGCAGACATTC AATTGT 53F 165 ACCTACGTTCAATATT ACAGGC 53R 598 AACATTTTCAGTGTATT GCTTT Sequencing of the purified PCR products was performed using the same 5 primer as used previously for amplification and the BigDye Terminator Cycle Sequencing kit (Perkin-Elmer). Sequencing reaction products were purified by ethanol precipitation or with CentriSep spin columns (Princeton Separations, Adelphia, NJ) and electrophoresed in the Applied Biosystems Model 373A DNA sequencing system (Applied Biosystems Division, Perkin-Elmer, Foster City, CA). The Sequence 10 Navigator software (Applied Biosystems Division., Perkin-Elmer) was used for analysis of sequence data, in addition to CAP and ALIGN sequence analysis programs, and mutations were identified by comparison with the published sequence of human mtDNA (Anderson et al., 1981 Nature 290:457). EXAMPLE 3 15 SINGLE NUCLEOTIDE POLYMORPHISM (SNPs) IN MITOCHONDRIAL RIBOSOMAL RNAs THAT SEGREGATE WITH ALZHEIMER'S DISEASE Mitochondrial DNA (mtDNA) was isolated and sequenced from brain and blood samples of 24 controls (12 autopsy-confirmed disease controls, 2 autopsy confirmed normal controls, and 10 living controls) and 33 AD cases (20 autopsy 20 confirmed AD, and 13 living AD patients) according to Examples 1 and 2. Altered mitochondrial rRNA sequences were detected in 82% of AD samples versus 50% of controls (Table 1 and Figure 1). When this analysis was restricted to only autopsy 35 WO 00/63441 PCT/USOO/10906 confirmed (AC) cases, rRNA sequence changes were detected in 85% of AD and 43% of control samples. Approximately half of the mtDNA changes were associated with haplogroups T, U, and H (familial lineages). Thus, these haplogroups did not strictly 5 track with AD. However, considering only mutations in mtDNA encoding mitochondrial rRNA that are not associated with haplogroups, 49% of AD versus 21% of control samples carried sequence changes. (Table 1 and Figure 1). The specific correlation of AD with non-haplogroup associated mutations in mtDNA encoding mitochondrial rRNA was higher when only autopsy-confirmed cases were included. 10 Mutations in mtDNA encoding mitochondrial rRNA are detected in 40% of AD versus 7% of autopsy-confirmed control cases. EXAMPLE 4 HOMOPLASMIC SINGLE NUCLEOTIDE POLYMORPHISMS IN THE MITOCHONDRIAL DNA OF A SUBJECT DIAGNOSED WITH ALZHEIMER'S DISEASE 15 This example describes detection of mtDNA single nucleotide polymorphisms in DNA obtained from white blood cells of a subject (D-1) diagnosed as having Alzheimer's Disease, and in a cybrid cell line prepared using platelet-derived mtDNA from the same subject. Venous blood samples were collected from a human donor subject (D-1) 20 diagnosed with AD (McKhann et al., Neurology 34:939, 1984, National Institute of Neurology, Communicative Disorders and Stroke and Alzheimer's Disease and Related Disorders Association Criteria of Probable AD, NINCDS-ADRDA) into vacutainer tubes (Becton-Dickinson, Inc., San Jose, CA) containing EDTA and maintained at 0 4*C for preparation of white blood cell fractions, or containing acid citrate/ dextrose and 25 maintained at ambient room temperature for preparation of platelet fractions. To prepare white blood cell fractions, the blood samples were layered onto Histopaque@-1077 (Sigma, St. Louis, MO) and centrifuged at 2500 rpm for 30 min at 4'C. The white blood cell layers were collected and diluted with 5 ml sterile TE buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA) and centrifuged at 2500 rpm for 10 min 30 at 4'C. The cell pellet was then lysed by the addition of 10 ml lysis buffer (TE containing 1% SDS and 400 ptg/ml proteinase K, both from Sigma) and incubated for 4 hrs at 37 'C in an orbital shaker set at 200 rpm. Total cellular DNA was purified by two extractions with phenol/chloroform and two extractions with chloroform. DNA was precipitated by adding 1/10 volume 5 M NaCl and 2x volume 100% ethanol, and 36 WO 00/63441 PCT/USOO/10906 incubating at -20'C. DNA was pelleted by centrifugation, washed with 70% ethanol and resuspended in TE buffer. Preparation of platelets and use of the platelets (as a source of mtDNA) for fusion to p4 SH-SY5Y neuroblastoma cells to produce a cybrid cell line was as 5 described by Miller et al. (1996 . Neurochem. 67:1897-1907). The resulting cybrid cell line (AD-1) had a stable deficiency in mitochondrial Complex IV (cytochrome c oxidase, COX, CO) activity (described below). Expanded cultures of AD-I cybrid cells were dislodged from tissue culture flasks by exposing them to 0.5 mM EDTA in Dulbecco's PBS (GIBCO-BRL, Grand Island, NY). Harvested AD-1 cells were 10 pelleted by centrifugation (2000 x g, 10 min) and total cellular DNA was extracted from the cell pellet with DNAzol reagent (Molecular Research Center, Inc.. Cincinnati, OH) according to the manufacturer's instructions. DNA concentrations were determined by UV absorption at 260 nm. Total cellular DNA prepared from AD white blood cells and from AD cybrid cells was 15 used as template for DNA amplification by polymerase chain reaction (PCR) with sets of L-strand and H-strand oligonucleotide primers spanning the entire mtDNA molecule (Table 7). Amplifications were performed in 50 pl reaction volumes using 0.5-1.0 ptg of template DNA, 200 ng each of L-strand and H-strand or forward and reverse primers, 200 tM of each dNTP, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 MM MgCl, and one 20 unit of AmpliTaq DNA polymerase (Perkin-Elmer, Inc., Norwalk, CT). Amplification was carried out as follows using a GeneAmpTM PCR System 9600 thermal cycler (Perkin-Elmer): 95'C for 1 min, 60*C for 1 min, and 72'C for 1 min, for 30 cycles followed by one cycle at 72'C for 4 min. Amplification products were purified by horizontal agarose gel electrophoresis, band excision, elution of DNA from the agarose, 25 and ethanol precipitation. Alternatively, amplicons were purified by the QIAquickTM PCR purification kit (Qiagen, Chatsworth, CA). PCR products were cloned using the TA-CloningTM kit (Invitrogen, Inc., Carlsbad, CA) and XL2BlueTM or XL2BlueMRFTM competent cells (Stratagene, Inc., La Jolla, CA), all according to the suppliers' recommendations. Recombinant colonies 30 were selected and plasmid DNA was purified using the Wizard TM Series 9600 DNA purification system (Promega, Inc., Madison, WI). 37 WO 00/63441 PCT/USOO/10906 Table 7 PCR PRIMERS FOR MTDNA FRAG PRIMER GENE NUCLEOTID PRIM. PRIMER SEQUENCE 5'- >3' FRAG. SEQ ID E LENGTH LENGTH NO: 0 1 52F D-LOOP 16343 22 ACAGTCAAATCCCTTCTCGTCC 489 52R D-LOOP 241 22 GGCTGTGCAGACATTCAATTGT 489 2 53F D-LOOP 165 22 ACCTACGTTCAATATTACAGGC 455 53R D-LOOP 598 22 AACATTTTCAGTGTATTGCTTT 455 3 11OF TRNA Phe/12S 501L 19 CCATCCTACCCAGCACACA 362 110R TRNA Phe/12s 837H 26 TATAGCTTAGTTAAACTTTCGTTTAT 362 4 lllF 12S 770L 18 CAATGCAGCTCAAAACGC 378 111R 12S 1130H 18 CGTAGTGTTCTGGCGAGC 378 5 112F 12S 1065L 21 CCAAACTGGGATTAGATACCC 385 112R 125 1424H 26 CACTCTACTCTTAGTTTACTGCTAAA 385 6 113F 12S/tRNA 1372L 22 CTACCCCAGAAAACTACGATAG 365 Val/165 113R 12S/tRNA 1719H 18 TTGGGTAAATGGTTTGGC 365 Val/16S 7 114F 16S 16 4 9L 21 CAACTTAACTTGACCGCTCTG 368 114R 16S 2000H 17 GCTATCACCAGGCTCGG 368 8 115F 16S 1934L 20 TAAAAGAGCACACCCGTCTA 367 115R 162 2305H 26 AGGAGAATGTTTTCATGTTACTTATA 367 9 116F 162 2255L 18 CTCACACCCAATTGGACC 369 116R 16S 2602H 22 TCCCTATTTAAGGAACAAGTGA 369 10 ll7F 16S 2544L 19 CTGCCCAGTGACACATGTT 386 117R 16S 2911H 19 GGGTAACTTGTTCCGTTGG 386 11 118F 16S 2861L 19 ACTTCACCAGTCAAAGCGA 333 118R 16S 3171H 23 AGTTGAGATGATATCATTTACGG 333 12 119F 16S/tRNA Leu 3091L 22 GTCGGTTTCTATCTACCTTCAA 301 119R 16S/tRNA Leu 3370H 22 CTAGAATTTTTCGTTCGGTAAG 301 13 61F ND1 3281 23 GAGGTTCAATTCCTCTTCTTAAC 372 61R ND1 3631 22 TTGAGTAAACGGCTAGGCTAGA 372 14 62F ND1 3589 20 CTGGTCAACCTCAACCTAGG 373 62R ND1 3946 16 GGCCTGCGGCGTATTC 373 15 63F ND1 3908 17 CCGAAGGGGAGTCCGAA 387 63R ND1 4270 25 ATCAAAGTAACTCTTTTATCAGACA 387 16 120F TrnAs 4186L 22 CTACCACTCACCCTAGCATTAC 370 Ile/Gln/Met 120R TRNAs 4539H 20 GTAAAAAATCAGTGCGAGCT 370 Ile/Gln/Met 17 71F ND2 4447 20 TTGGTTATACCCTTCCCGTA 348 71R ND2 4769 26 CTATTCCTAGTTTTATTGCTATAGCT 348 18 72F ND2 4699 22 ACAATATACTCTCCGGACAATG 378 72R ND2 5054 23 GAATGGTTATGTTAGGGTTGTAC 378 19 73F ND2 4990 22 AGCTACGCAAAATCTTAGCATA 340 38 WO 00/63441 PCT/USOO/10906 FRAG PRIMER GENE NUCLEOTIDE PRIM. PRIMER SEQUENCE 5'- >3' FRAG. SEQ ID E LENGTH LENGTH NO: 73R ND2 5311 19 AGGGTGATGGTGGCTATGA 340 20 74F ND2 5234 15 CCCGCTAACCGGCTT 320 74R ND2 5536 18 AGGGCTTTGAAGGCTCTT 320 21 121F TRNAs Trp/Ala 5449L 17 CCACACTCATCGCCCTT 287 121R TRNAs Trp/Ala 5714H 22 GAGAAGTAGATTGAAGCCAGTT 287 22 122F tRNAs 5651L 20 CCCTTACTAGACCAATGGGA 322 Asn/Cys/Tyr+O-L 122R tRNAs 5950H 23 GCCGAATAATAGGTATAGTGTTC 322 Asn/Cys/Tyr+O-L 23 11F C0 I 5864 21 GTCCAATGCTTCACTCAGCCA llFA CO I 5859 21 TTACAGTCCAATGCTTCACTC 340 llR CO I 6177 18 TATGCGGGGAAACGCCAT llRA CO 1 6180 19 TGTTTATGCGGGGAAACGC 340 24 12F CO I 6138 21 GGCAACTGACTAGTTCCCCTA 12FA CO 1 6125 21 AATCGGAGGCTTTGGCAACTG 318 12R CO I 6425 21 GTTTGGTATTGGGTTATGGCA 12RA CO I 6422 21 TGGTATTGGGTTATGGCAGGG 318 25 13F CO I 6383 20 GGCCATCAATTTCATCACAA 13FA CO I 6358 22 TAGCAGGTGTCTCCTCTATCTT 366 13R CO I 6697 25 ATACCTATGTATCCAAATGGTTCTT 13RA CO I 6699 25 CCATACCTATGTATCCAAATGGTTC 366 26 14F CO I 6657 25 GGAATAATCTCCCATATTGTAACTT 308 14R CO I 6945 18 CAGGCCACCTACGGTGAA 14RA CO I 6947 18 GTCAGGCCACCTACGGTG 308 27 15F CO I 6914 20 AGTGCTCTGAGCCCTAGGAT 15FA CO I 6902 20 ATGATCTGCTGCAGTGCTCT 309 15R CO I 7193 18 ATTCCGGATAGGCCGAGA 309 28 16F C0 I 7159 22 TCGGCGTAAATCTAACTTTCTT 332 16R CO I 7451 19 GGGGTTCGATTCCTTCCTT 16RA CO I 7472 19 TTGGCTTGAAACCAGCTTT 332 29 123F TRNAs Ser/Asp 7373L 23 AAACCTGGAGTGACTATATGGAT 306 123R TRNAs Ser/Asp 7659H 20 AATGATTATGAGGGCGTGAT 306 30 21F CO II 7546 24 TTGTCAAAGTTAAATTATAGGCTA 21FA CO II 7548 24 GTCAAAGTTAAATTATAGGCTAAA 309 21R CO II 7832 23 ACCTCGTCTGTTATGTAAAGGAT 21RA CO II 7834 23 TGACCTCGTCTGTTATGTAAAGG 309 31 22F CO II 7792 20 CGCCATCATCCTAGTCCTCA 281 22R CO II 8050 23 ATGAGTGCAAGACGTCTTGTGAT 281 32 23F CO II 8003 23 AATCGAGTAGTACTCCCGATTGA 23FA CO II 8007 23 GAGTAGTACTCCCGATTGAAGCC 304 23R CO II 8286 24 GTTAGCTTTACAGTGGGCTCTAGA 23RA CO II 8287 24 AGTTAGCTTTACAGTGGGCTCTAG 304 33 124F tRNA Lys 8204L 19 ATGCCCATCGTCCTAGAAT 263 124R tRNA Lys 8441H 26 TGGTAGTTTGTGTTTAATATTTTTAG 263 34 41F ATPase 8 8292 23 GCCCACTGTAAAGCTAACTTAGC 361 39 WO 00/63441 PCT/USOO/10906 FRAG PRIMER GENE NUCLETID PRIM. PRIMER SEQUENCE 5'- >3' FRAG. SEQ ID E LENGTH LENGTH NO: 41R ATPase 8 8631 22 TAGTCGGTTGTTGATGAGATAT 361 41RS ATPase 8 8632 17 AGTCGGTTGTTGATGAG 35 42F ATPase 6 8572 23 GGCCTACCCGCCGCAGTACTGAT 360 42R ATPase 6 8909 23 TGTAGGTGTGCCTTGTGGTAAGA 360 36 43F ATPase 6 8866 22 ATTATAGGCTTTCGCTCTAAGA 43FA ATPase 6 8806 21 CCAACCACCCAACTATCTATA 430 43R ATPase 6 9214 22 ATATGATAGGCATGTGATTGGT 430 N/A 26F ATPase 8 8311 25 TAGCATTAACCTTTTAAGTTAAAGA 224 26R ATPase 8 8516 19 TCGTTCATTTTGGTTCTCA 224 37 31F Co III 9171 24 ACTTCTAGTAAGCCTCTACCTGCA 31FA CO III 9173 24 TTCTAGTAAGCCTCTACCTGCACG 295 31R CO III 9447 25 AGGTAATAAATAGGATTATCCCGTA 31RA Co III 9443 25 AATAAATAGGATTATCCCGTATCGA 295 38 32F CO III 9416 19 CCACACACCACCTGTCCAA 32FA Co III I 9415 19 ACCACACACCACCTGTCCA 349 32R CO III 9741 23 AAGGGAGACTCGAAGTACTCTGA 349 39 33F CO III 9712 23 TGGGTCTCTATTTTACCCTCCTA 33FA CO III 9698 23 TATTACAATTTTACTGGGTCTCT 337 33R CO III 10010 25 ACTAGTTAATTGGAAGTTAACGGTA 337 40 125F tRNA Glu 9932L 21 GCATTTTGTAGATGTGGTTTG 221 125R tRNA Glu 10132H 21 CTATGTAGCCGTTGAGTTGTG 221 41 75F ND3 10007 25 TAGTACCGTTAACTTCCAATTAACT 374 75R ND3 10430 24 TCATAATTTAATGAGTCGAAATCA 374 42 126F tRNA Arg 10341L 21 ATCATCATCCTAGCCCTAAGT 205 126R tRNA Arg 10522H 24 GGTGTGAGCGATATACTAGTATTC 205 43 81F ND4L 10433 25 TTTCGACTCATTAAATTATGATAAT 365 81R ND4L 10782 25 CATGTCAGTGGTAGTAATATAATTG 365 44 82F ND4 10718 22 CACATATGGCCTAGACTACGTA 368 82R ND4 11060 23 ATAATTAAGGAGATTTGTAGGGA 368 45 83F ND4 10999 19 CCAACGCCACTTATCCAGT 364 83R ND4 11342 25 AAGCTATTGTGTAAGCTAGTCATAT 364 46 84F ND4 11275 25 CTCACTAAACATTCTACTACTCACT 362 84R ND4 11618 21 GTGGCTGATTGAAGAGTATGC 362 47 85F ND4 11554 24 CCTATGAGGCATAATTATAACAAG 336 85R ND4 11894 22 ACGTGGTTACTAGCACAGAGAG 336 48 86F ND4 11834 19 TGACTTCTAGCAAGCCTCG 342 86R ND4 12147 23 ACAATCTGATGTTTTGGTTAAAC 342 49 127F TRNAs 12052L 19 ACGAGAAAACACCCTCATG 358 His/Ser/Leu 127R TRNAs 12391H 20 TTAACGAGGGTGGTAAGGAT 358 His/Ser/Leu 50 93F NDS 12281 21 CAGCTATCCATTGGTCTTAGG 415 93R ND5 12671 25 TATTTGAAGAACTGATTAATGTTTG 415 51 94F NDS 12612 21 AGCATTGTTCGTTACATGGTC 353 94R ND5 12944 21 GGCTTGGATTAGCGTTTAGAA 353 40 WO 00/63441 PCT/USOO/10906 FRAG PRIMER F GENE NUCLEOTID PRIM. PRIMER SEQUENCE 5'- >3' FRAG. SEQ ID E LENGTH LENGTH NO: 52 95F NDS 12881 20 TCATCCTCGCCTTAGCATGA 354 95R ND5 13212 23 TTTTGATGTCATTTTGTGTAAGG 354 53 96F ND5 13156 23 CAAACTCTAACACTATGCTTAGG 383 96R ND5 13519 20 ATGTTTGCGGTTTCGATGAT 383 54 97F ND5 13458 20 CATTGGCAGCCTAGCATTAG 423 97R NDS 13855 26 GATTTTATTTTAAGTTTGTTGGTTAG 423 55 98F ND5 13795 19 AAACTCACAGCCCTCGCTG 353 98R ND5 14124 24 TATGTGATTAGGAGTAGGGTTAGG 353 56 91F ND6 14119 22 CTCATCCTAACCCTACTCCTAA 329 91R ND6 14442 19 GCGATGGCTATTGAGGAGT 329 57 92F ND6 14384 20 GCTAACCCCACTAAAACACT 447 92R ND6 14693 20 TTCATATCATTGGTCGTGGT 447 58 128F TRNA Glu/Cyt B 14692L 20 AACCACGACCAATGATATGA 372 128R TRNA Glu/Cyt B 15044H 20 GATCCGTAATATAGGCCTCG 372 59 129F Cyt B 14981L 17 ATCCGCTACCTTCACGC 376 129R Cyt B 15339H 18 CCGTTTCGTGCAAGAATA 376 60 130F Cyt B 15279L 23 TCTTTACCTTTCACTTCATCTTG 374 130R Cyt B 15632H 21 TGCTAGGATGAGGATGGATAG 374 61 131F Cyt B 15557L 21 GAATGATATTTCCTATTCGCC 342 131R Cyt B 15910H 19 CCGGTTTACAAGACTGGTG 342 62 132F TRNA Thr/Phe 15841L 24 AATACCAACTATCTCCCTAATTGA 270 132R TRNA Thr/Phe 16089H 22 CTGGCAGTAATGTACGAAATAC 270 63 51F D-LOOP 15968 22 TCTTTAACTCCACCATTAGCAC 442 51R D-LOOP 16388 22 AGGATGGTGGTCAAGGGACCCC 442 Sequencing of the purified PCR products was performed as described in Example 2, and 10-12 clones were sequenced for each cloned PCR product. Mutations were identified by comparison with published sequences including related corrections 5 and reported polymorphisms for human mtDNA, as described above (Anderson et al., 1981 Nature 290:457; Andrews et al., 1999 Nature Genetics 23:147; Mitomap, www.gen.emory.edu). Identical, homoplasmic mtDNA mutations were detected in DNA sampled from D-l white blood cells and in DNA from AD-1 cybrid cells. As shown in Table 2, polymorphisms, rare polymorphisms and sequence "errors" relative 10 to the CRS (as described above) were detected. In addition, three novel, homoplasmic single nucleotide polymorphisms were detected as mtDNA mutations (Table 2): TI 189C was observed in the 12S rRNA gene, G6366A was present in the CO1 (COXI) gene, and T12954C was found in the ND5 gene. Sequence analysis indicated that the G6366A mutation causes a valine->isoleucine substitution (missense) mutation at 15 amino acid position 155 in the COXI subunit of Complex IV, and that T12954C, by contrast, apparently represents a silent mutation in the ND5 subunit of Complex I. 41 WO 00/63441 PCT/USOO/10906 EXAMPLE 5 EXPRESSION OF AD DONOR-DERIVED MITOCHONDRIAL DNA IN A CYBRID CELL LINE This example shows expression of AD donor-derived mtDNA sequences in the AD-I cybrid cell line constructed with mtDNA from a donor diagnosed as having 5 AD, as described in Example 4. A competitive primer extension assay was employed essentially as described (Fahy et al., 1997 Nucl. Ac. Res. 25:3102), but exploiting the homoplasmic G6366A transition mutation detected in AD-1 cybrid cells (described in Example 4). Template DNA was prepared from white blood cells and from cybrid cells as described 10 in Example 4, and was also prepared from parental SH-SY5Y neuroblastoma cells and from pooled control cybrid cells, i.e., cybrid cells constructed according to Miller et al. (1996 J Neurochem. 67:1897-1907) but repopulated with mtDNA from subjects diagnosed as not having AD. To assess expression of the mtDNA-encoded COXl (COI) gene, total cellular RNA was isolated from cybrid cells using TrizolTM reagent 15 (Life Technologies, Inc., Gaithersburg, MD) and reverse transcribed with SuperscriptTM reverse transcriptase (Life Technologies) according to the manufacturer's instructions, to generate cDNA. The following 5'-FAM labeled oligonucleotide primer was prepared according to standard methods: 20 5'--TGATGAAATTGATGGCCCCTAAGATAGAGGAGA--3' [SEQ ID NO:_] A nucleotide mixture comprising dTTP, ddATP and ddCTP was used, such that wildtype (i.e., CRS) mtDNA template directed extension of the primer with a 25 ddC residue while D-1 (i.e., AD-derived) mtDNA template directed extension of the primer with, sequentially, dT and ddA residues. As described in Fahy et al. (1997), primer extension reaction products were electrophoretically resolved under conditions permitting determination of differentially extended (e.g., by one or by two nucleotides) fluorescent primer products. As shown in Figure 2, template DNA or cDNA from AD 30 1 cybrid cells (lanes 5 and 7) and from D-1 (AD) white blood cells (lane 4) directed the generation exclusively of primer extension products that were extended by two nucleotide residues, consistent with the presence of the homoplasmic G6366A mutation in mtDNA from these cells. By contrast, template DNA or cDNA from pooled control cybrid cells or from parental SH-SY5Y cells (lanes 6, 8 and 9) directed the generation 35 only of primer extension products having a single nucleotide extension, indicative of the presence of wildtype DNA in these cells. 42 WO 00/63441 PCTIUSOO/10906 EXAMPLE 6 MITOCHONDRIAL ELECTRON TRANSPORT CHAIN ENZYMES IN AD-I CYBRID CELLS This example describes mitochondrial electron transport chain enzyme expression and activity in a cybrid cell model of Alzheimer's Disease. 5 AD-i cybrid cells were prepared as described in Example 4. A control cybrid cell line was constructed by PEG fusion of platelets from three age-matched, cognitively normal subjects p 0 SH-SY5Y neuroblastoma cells, as described (Miller et al., 1996 J. Neurochem. 67:1897). The control cybrid cells had normal Complex I and IV activities relative to parental SH-SY5Y cells when assayed (see below) 32-37 days 10 after fusion. Subsequently, an equal number of cells from each control cybrid cell line was pooled and this mixed control culture was maintained. Complex I (ND) and Complex IV (COX) activities were determined as described (Miller et al., 1996 J. Neurochem. 67:1897) and are reported as min-lmg-1 total cellular protein. Reactive oxygen species (ROS) were detected using the dichlorofluorescin diacetate (DCF-DA) 15 assay (Miller et al., 1996). Activities of catalase, total superoxide dismutase (SOD), Mn SOD, Cu/Zn SOD, glutathione peroxidase and glutathione reductase were determined as previously described (Cassarino et al., 1997 Biochim. Biophys. Acta 1362:77). For determination of 8-hydroxyguanosine (80H-dG) levels, DNA samples were prepared by hypo-osmotic lysis of cybrid cells, followed by proteolysis at 95'C with 20 thermostable alkaline protease. The DNA was digested with exonuclease P1 and endonuclease III, and analyzed for 80H-dG using electrochemical detection. Hydroxyl radical was assayed using thiobarbituric acid (Sattler et al., 1998 Meths. Mol. Biol. 110:167-191). Complex I activity in AD-1 cybrid cells was essentially identical to that 25 detected in mixed control cybrid cells. By contrast, Complex IV (COX) activity was markedly depressed in AD-1 cybrid cells relative to the mixed control cybrid cells, and this deficiency was stably maintained over extended culture periods (Figure 3). To determine whether the decreased Complex IV activity in AD-I cybrids might be due to decreased amounts of COX protein in these cells (for example, reduced COX 30 production related to the G6366A mutation in the COXl subunit), expression levels of COX subunits 1, 2 and 4 were compared at the polypeptide level by western immunoblot analysis. Detergent lysates of AD-1 cybrid cells, mixed control cybrid cells and SH-SY5Y neuroblastoma cells were resolved electrophoretically, blot transferred to nitrocellulose and probed with mouse anti-human COX subunit-specific 35 antibodies (Molecular Probes, Inc., Eugene, OR) according to established procedures (Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing, 1987). 43 WO 00/63441 PCT/USOO/10906 Blots were developed with HRP-conjugated anti-mouse immunoglobulin (Amersham, Inc., Arlington Heights, IL) and ECL chemiluminescent detection (Amersham) according to the supplier's instructions. As shown in Figure 4, AD-1 cybrid cells, mixed control cybrid cells and parental SH-SY5Y neuroblastoma cells all express 5 comparable levels of the COX subunits. Without wishing to be bound by theory, these results suggest that a COX catalytic defect or defects in the ability of COX submits to associate with one another or to localize to the proper subcellular location (and not reduced levels of COX biosynthesis) may be a consequence of the G6366A mutation in the COXI subunit of AD-I cybrid cells. 10 AD-1 cybrid cells also exhibited elevated levels of reactive oxygen species (ROS) production, relative to the mixed control cybrid cells (Table 8), with an apparent gradual decline in the relative level of elevated ROS over time. To determine whether compensatory mechanisms might be involved in this gradual decline, AD-I and mixed control cybrid cells were pre-loaded with 30 ptM DCF-DA for 2 hours, rinsed, 15 and then treated for 30 minutes with either 50 pM ethacrynic acid (a reduced glutathione scavenger) or with 2.5 mM aminotriazole (an inhibitor of the radical savenging enzyme catalase ) prior to ROS determination by the DCF-DA method. As shown in Figure 5, interfering with radical scavengers by treatment with either ethacrynic acid or aminotrialoze resulted in elevated ROS levels in AD-1 cells, relative 20 to the ROS levels in mixed control cybrid cells. The oxidative buffering activity levels of multiple specific radical scavenger enzymes was also determined to be elevated in AD-i cybrid cells relative to mixed control cybrids (Figure 6). Gene expression in the AD-1 cybrids relative to the control cybrids was investigated for two of these enzymes, Cu/Zn SOD and Mn SOD. As also shown in Fig. 6, the elevated activity levels for 25 these enzymes were accompanied by elevated expression levels, suggesting a possible compensatory mechanism related to the apparent oxidative defects in the AD-I cybrids. 44 WO 00/63441 PCT/USOO/10906 Table 8 ROS PRODUCTION IN AD-I CYBRID DECLINES OVER TIME Days Fold Increase Over Pooled Cybrid Controls from Fusion ROS 8-Hydroxyguanosine Thiobarbituric Acid 64 2.03 87 1.42 8 8.5 113 1.44 127 1.64 143 0.96 164 1.15 EXAMPLE 7 HOMOPLASMIC SINGLE NUCLEOTIDE POLYMORPHISMS IN THE MITOCHONDRIAL DNA OF 5 A SUBJECT DIAGNOSED WITH ALZHEIMER'S DISEASE This example describes detection of mtDNA single nucleotide polymorphisms in DNA obtained from white blood cells of a second subject (D-2) diagnosed as having Alzheimer's Disease, and in a cybrid cell line prepared using platelet-derived mtDNA from the same subject. Materials and methods were identical 10 to those described in Example 4, except that a different donor, D-2, was the source of white blood cells and platelets, and that a second AD cybrid cell line, AD-2, was constructed. The results are presented in Table 3. A novel, homoplasmic mtDNA mutation was identified in the 12S rRNA-encoding region of the mitochondrial genome, T980C. 15 EXAMPLE 8 SINGLE NUCLEOTIDE POLYMORPHISMS IN MITOCHONDRIAL RIBOSOMAL RNA GENES In this example, analysis of mtDNA sequences for homoplasmic mutations in 12S and 16S rRNA genes is described. Brain and/or blood samples were obtained from 13 normal living control subjects, 41 autopsy-confirmed normal and 20 neurological disease control (i.e., non-AD) subjects, 13 living AD subjects, and 45 autopsy-confirmed AD and LBV (Lewy body variant) subjects. DNA isolation from brain and blood samples was essentially as described in Examples 1 and 4, respectively, except that for some brain samples mitochondria were first purified and mtDNA extracted as described by Mecocci et al. 25 (1994 Ann. Neurol. 36:747). Oligonucleotide primers specific for 12S rRNA and 45 WO 00/63441 PCT/USOO/10906 16SrRNA genes are listed in Tables 5 and 7, and were used for PCR amplification, cloning and sequencing as described above. Ten fragments generated by PCR amplification with primer sets 110-119 were amplified, cloned and sequenced as described in Examples 1 and 4. Homoplasmic 5 single nucleotide polymorphisms detected in these mtDNA regions and the frequency of occurrence of these mutations are presented in Table 4, which includes mutations that are neither "polymorphisms" nor "rare polymorphisms" and that are also not "errors", as these terms are described above in the context of Tables 2-4. These include G709A, G930A, T980C, T1189C, T1243C, C1700T, G1719A, T1809C, A1811G, G1888A, 10 G2098A, T2158C, C2259T, T2352C, G3010A, T3197C and a deletion of base 960, and also include T669C, T789C, C870T, T980C, G1007A, T1243C, G1393A, G1709A, G1719A, T2156C, A2294G, T2483C, A2581G, A2851G and an insertion of a T at base position 793. Analysis of the data presented in Table 4 as a function of age indicated 15 that, in the subject groups studied, differences in the load of mtDNA 12S/ 16S rRNA region homoplasmic single nucleotide polymorphisms were most pronounced when AD and control subjects 85 years old or older were compared (Figure 7). A trend toward a greater number of single nucleotide polymorphisms in mitochondrial rRNA genes in AD cases relative to control subjects was detectable in all age groups analyzed (64-74 20 years, 75-84 and 85 or older). EXAMPLE 9 SINGLE NUCLEOTIDE POLYMORPHISMS (SNPs) IN MITOCHONDRIAL DNA THAT SEGREGATE WITH ALZHEIMER'S DISEASE Mitochondrial DNA (mtDNA) was isolated and sequenced from brain 25 and blood samples of 24 controls and 24 autopsy-confirmed AD cases. Confirmed AD samples consisted of 11 frontal cortex samples, 3 parietal cortex samples and 10 blood samples. Control samples consisted of 12 autopsy-confirmed brain samples (mean age 79.3 years: 5 normal controls, frontal cortex; 5 diffuse Lewy body dementia (DLBD) samples, frontal cortex; 2 parasupranuclear palsy (PSP) samples, frontal cortex) and 12 30 blood samples from healthy, normal volunteers (mean age 88.8 years) with no family history of AD. Isolation of DNA by organic extraction following proteinase K/SDS solubilization was as described in Example 1. PCR amplification was performed as described in Example 2, except the oligonucleotide primer set presented in Table 10 35 was used to generate 68 PCR product fragments spanning the complete mtDNA 46 WO 00/63441 PCT/USOO/10906 molecule, each fragment having approximately 50% sequence overlap with each neighboring product fragment. This strategy permitted direct mtDNA sequencing in both forward and reverse directions with four-fold redundancy in the identification of each nucleotide base, resulting in error-free sequencing. Thus, for each patient sample 5 approximately 68,000 nucleotides were sequenced and analysis of homoplasmic mutations was verified. 47 WO 00/63441 PCT/USOO/10906 L) u U U u rU <H 0 u U H HH< U H o ~ < C.) H~ < H u <U U ~U < H & <-H o U U< HH < Hu O u u u- 0 u LU _ cn kr< 0n kn0 0 0~ 7- k z CIA CIA N 48 WO 00/63441 PCTUSOO/10906 - tf z~ u 0 0 0 U HO 0< m0 H H<00= r <n <- HH <M tr)H< H <zH U < H U H 0 H: HL0H< <H H U U u H <UU 0 HH <H9 WO 00/63441 PCT/USOO/10906 C4 ON CIA -' Cyn 0 0 HO U< H HU .1 Q OH U0 5 0 < H<F o< < 0<<U H H rq U U U M & U <H 0<U UH& <H 0< U 0& < < OHU M< <5 O < 0 < <H<< 0< 0 & U a0 zo zoU 0U <0 OH < 0 H H0 WO 00/6344 1 PCTUSOO/10906 00 000o C) ' )00 7tNl 0 H OH 0 0 < u 0 < <D H<u C) < -< <U< 0 H << cr~u~ u~ u H <HH << < UH V')) <U<< <q H < UHH U<OO 0 0< HOt * 00n InC O CIA + C00 4 rn 'T 00 kn -n InONt O Cl Cl ItI n O ~ NN 0 Cl Cl l Cl C Cl Cl Cl ClCIAlCl C CL ClC lC l C l C lCClC 51 WO 00/63441 PCT/USOO/10906 H00 H m U 0 u O AI <Hs < < < U U 20 U < H H O < HO< H 0 H& < 0< H U H U <<UU 0 < 0< <U H< OO 0 U<H 0 00< <0O <U OH &QU 0 0 UU < H 0< OH MH < < d 0U<H 0 U 0 < H<U <HU UHO O U H U H U U H O O < 0 & H OHU < H<U UU <H<O UH< UU< H 0 <UO OU UO< HUU <HOH H U M& H< OU0 HH Us <OUHU0 < < 0 <U HUO U <- 0 SU M <U 0 O< 0 < 0< 0U < UH os~~r r-, c sq o UHO UUH ~o o oo o~ N o o - -~ c c ol m N ON e U ~ ~ \N~ N NN N N N N N NNO 52U U WO 00/63441 PCT/USOO/10906 u < U< A u0 u 0 < <- Q) < u QD u 0 c oe< 0 0 < H 00 H< H, C UU ~, ~H < H 00 U < U HU 0< H UOU < - Cl 000 O Cl 7 C C C C - Cl- = CmC H5 WO 00/63441 PCT[USOO/10906 Cl~Q Cl Cl H 0* H- H H' CI 0I 0q H c I H < H < < <t H < H < H H 0 U5H WO 00/6344 1 PCT/USOO/10906 0 C4 - 00 C C> m ZI 1 rju H OHO~< U< < Hu r<- 0) m 00 <0 00 0< < 0 H<0<kr H 0 0 H 0

U

0 H < 0 HH < H <<<UHH U <<< <55 WO 00/63441 PCTUSOO/10906 OH CI-0 CI CIA~< < H < HH

U

0 n <H 0 U<H rOU 0< W u< UOn kn< OHkr knH < H Z~ ~ HH HU z 2 0 u~~ z ~ H H ki< 0U0 OO < H H kuH kfHU O<U <H HO 0<CIHAO OU < < HU OUH HUHOH <<H56 WO 00/63441 PCT/USOO/1 0906 00 NO r- Ht HC <UIc 1 UOC \.0 \.D 0 Um 0 H U 0 U H <00 00 H 0 H <HU ~U HU7 WO 00/63441 PCT/USO0/10906 Sequencing was conducted using a Perkin-Elmer Model 3700 DNA Analyzer with 96-capillary array according to the manufacturer's instructions, and data analysis, performed essentially as described in Example 2, also included categorization of sample sequences according to various parameters, including: source of tissue 5 sample, patient clinical status (e.g., AD or control), patient haplogroup, mtDNA gene region in which an identified SNP resided and, for protein encoding mtDNA genes in which an AD-associated SNP was identified, whether the SNP was a synonymous substitution (i.e., resulted in no change in the amino acid sequence of the encoded protein) or a non-synonymous substitution (i.e., resulted in a different amino acid 10 sequence for the encoded protein). AD-associated SNPs are presented in Table 9. Figures 8-14 depict the results of quantitative data analyses wherein AD-associated SNPs were grouped according to selected parameters. Thus, Fig. 8 presents a profile of the samples analyzed in this Example according to mtDNA haplogroup. In Fig. 9. the distribution 15 (percentage of samples analyzed having one or more SNP per indicated gene region) of AD-associated SNPs from Table 9 that reflect non-synonymous nucleotide substitutions according to mtDNA protein coding regions (i.e., gene loci) is presented, wherein SNPs detected in the AD group are compared to SNPs detected in all non-AD control groups. 58 WO 00/63441 PCTIUSOO/10906 Table 9 MTDNA SINGLE NUCLEOTIDE POLYMORPHISMS ASSOCIATED WITH AD Nucleotide Nuc1. # Gene Position Nucleotide (crs) Substitution Samples Haplogroup D-LOOP 72 T C I H D-LOOP 114 C T I K D-LOOP 146 T C 2 U, H D-LOOP 185 G A I J D-LOOP 189 A G I K, W D-LOOP 199 T C I I D-LOOP 204 T C I W D-LOOP 207 G A 2 W, I D-LOOP 228 G A I J D-LOOP 236 T C I H D-LOOP 239 T C 2 H D-LOOP 456 C T I H D-LOOP 462 C T 2 J D-LOOP 482 T C I J D-LOOP 489 T C 2 J D-LOOP 497 C T I K, K D-LOOP 500 C G 5 H, W, J D-LOOP 516 C T I U D-LOOP 522 C DEL I H D-LOOP 523 A DEL I H D-LOOP 547 A T I 12S RRNA 593 T C I K 12S RRNA 669 T C I I 12S RRNA 960 C DEL I U 12S RRNA 1007 G A I J 12S RRNA 1243 T C I W 12S RRNA 1393 G A 1 H 16S RRNA 1719 G A I H, I 16S RRNA 1809 T C I U 16S RRNA 2352 T C I H 16S RRNA 2483 T C I K 16S RRNA 2702 G A I 59 WO 00/63441 PCT/USOO/10906 Nucleotide Nucl. Gene Position Nucleotide (crs) Substitution Samples Haplogroup 16S RRNA 2851 A G I H 16S RRNA 3197 T C I U ND 3333 C T I H ND] 3336 T C I I ND] 3348 A G I U ND] 3394 T C I J ND] 3398 T C I ND] 3423 G T I J ND] 3505 A G I W ND 3559 C T I H ND 3915 G A 2 H ND 3992 C T I H ND] 4024 A G I H NDI 4095 C T I H NDI 4216 T C 3 T, J TRNA-Q 4336 T C I H ND2 4529 A T I I ND2 4727 A G 2 H ND2 4793 A G I H ND2 4917 A G I T ND2 4991 G A I H ND2 5004 T C 2 H, W ND2 5046 G A I W ND2 5228 C G I H ND2 5315 A G I I ND2 5418 T G 1 J ND2 5426 T C 1 T ND2 5460 G A 3 H, W ND2 5461 C G I J TRNA-W 5516 A G I H TRNA-W 5554 C A I U TRNA-A 5634 A G I H TRNA-A/ 5656 A G I U TRNA-N TRNA-C 5773 G A I J 60 WO 00/63441 PCT/USOO/10906 Nucleotide Nucl. # Gene Posi tide (crs) Substitution Samples Haplogroup COl 6182 G A I U COl 6221 T C 1 H COl 6341 C T I U CO1 6367 T C 1 K COI 6371 C T I H COl 6489 C A I T COl 7184 A G I J COl 7325 A G I H C02 7621 T C 1 K C02 7768 A G I U C02 7787 C T I H C02 7789 G A I J C02 7864 C T I W C02 7895 G A I U C02 7963 A G I J C02 8149 A G I H C02 8251 G A 2 W, I C02 8269 G A I H C02/ 8276-8284 DEL I T TRNA-K ATPAse 8 8470 A G I H ATPASE 8 8485 G A I I ATPASE 8 8508 A G I I ATPASE6 8602 T C I H ATPASE6 8697 G A I T ATPASE 6 8752 A G I H ATPASE6 8901 A G I I ATPASE 6 8994 G A I W ATPASE6 9123 G A 1 H C03 9254 A G I H C03 9362 A G I H C03 9380 G A 2 H C03 9477 G A I U C03 9554 G A I H C03 9708 T C I H 61 WO 00/63441 PCT/USOO/10906 Nucleotide Nucl. # Gene Position Nucleotide (crs) Substitution Samples Haplogroup C03 9804 G A I H C03 9861 T C I H TRNA-G 10034 T C I I TRNA-G 10044 A G I H ND3 10238 T C 2 1 TRNA-R 10463 T C 2 T, J ND4L 10589 G A I H ND4 10978 A G I K ND4 11065 A G I I ND4 11251 A G I J ND4 11253 T C I H ND4 11272 A G I U ND4 11470 A G 2 K ND4 11527 C T I J ND4 11611 G A I H ND4 11674 C T I W ND4 11812 A G I T ND4 11914 G A 2 K ND4 11947 A G I W ND5 12414 T C I W ND5 12501 G A 2 1 ND5 12609 T C I U ND5 12705 C T 4 H. W, I ND5 12954 T C I K ND5 13111 T C I H ND5 13194 G A 2 H, U ND5 13212 C T I H ND5 13368 G A I T ND5 13617 T C I U ND5 13780 A G 2 I ND5 13966 A G I H ND5 14020 T C I T NDS 14148 A G I W ND6 14178 T C I I 62 WO 00/63441 PCT/USOO/10906 Nucleotide Nucl. # Gene Position Nucleotide (crs) Substitution Samples Haplogroup ND6 14179 A G I U ND6 14182 T C I U ND6 14212 T C I H ND6 14233 A G 1 T ND6 14470 T C I H ND6 14582 A G I H CYT.B 14905 G A I T CYT.B 15028 C A I T CYT.B 15043 G A 3 T, I CYT.B 15191 T C I U CYT.B 15299 T C I CYT.B 15380 A G I U CYT.B 15553 G A I H CYT.B 15607 A G I T CYT.B 15758 A G 1 I CYT.B 15790 C T I U CYT.B 15808 A G 1 H CYT.B 15833 C T I H CYT.B 15884 G C I W TRNA-T 15924 A G 3 K, I TRNA-T 15928 G A I T D-LOOP 16069 C T 2 J D-LOOP 16086 T C I I D-LOOP 16093 T C I K D-LOOP 16126 T C 3 T, J D-LOOP 16129 G A 2 H, I D-LOOP 16145 G A I I D-LOOP 16147 C A I I D-LOOP 16172 T C I U D-LOOP 16174 C T I U D-LOOP 16182 A C I T D-LOOP 16183 A C 4 T, U, H D-LOOP 16189 T C 5 T, U, H D-LOOP 16192 C T I U 63 WO 00/63441 PCT/USOO/10906 Nucleotide Nucl. # Gene Posit tide (crs) Substitution Samples Haplogroup D-LOOP 16193 C T I J D-LOOP 16223 C T 4 H, W, I D-LOOP 16224 T C 3 K D-LOOP 16234 C T 1 K D-LOOP 16235 A G I J D-LOOP 16239 C T I H D-LOOP 16248 C T I I D-LOOP 16256 C T I J D-LOOP 16261 C T I H D-LOOP 16270 C T I U D-LOOP 16278 C T 2 U, H D-LOOP 16290 C T 1 H D-LOOP 16292 C T I W D-LOOP 16293 A G I H D-LOOP 16294 C T I T D-LOOP 16298 T C 2 T, H D-LOOP 16300 A G I J D-LOOP 16304 T C I H D-LOOP 16309 A G I J D-LOOP 16311 T C 5 H, K, U D-LOOP 16320 C T I I D-LOOP 16355 C T I I D-LOOP 16362 T C 2 H D-LOOP 16391 G A I I D-LOOP 16482 A G 2 H D-LOOP 16524 A G I K In Fig. 10, the distribution (percentage of samples analyzed having one or more SNP per indicated gene region) of AD-associated SNPs from Table 9 that reflect non-synonymous nucleotide substitutions according to mtDNA protein coding 5 regions (i.e., gene loci) is presented, wherein SNPs detected in the AD group are compared to SNPs detected in non-AD control groups that have been further categorized as normal (i.e., healthy) or diseased controls. 64 WO 00/63441 PCT/US00/10906 Fig. 11 shows the distribution (percentage of samples analyzed having one or more SNP per indicated gene region) of AD-associated SNPs from Table 9 that reflect synonymous nucleotide substitutions according to mtDNA protein coding regions (i.e., gene loci), wherein SNPs detected in the AD group are compared to SNPs 5 detected in non-AD control groups that have been further categorized as normal (i.e., healthy) or diseased controls. Fig. 12 shows the distribution (percentage of samples analyzed having one or more SNP per indicated gene region) of AD-associated SNPs from Table 9 that reflect nucleotide substitutions in mitochondrial tRNA genes according to each of the 10 22 known human mitochondrial tRNA coding regions (i.e., gene loci), wherein SNPs detected in the AD group are compared to SNPs detected in non-AD control groups that have been further categorized as normal (i.e., healthy) or diseased controls. Figure 13 summarizes the distribution (percentage of samples analyzed having one or more SNP per indicated mtDNA region) of AD-associated SNPs from 15 Table 9 that reflect nucleotide substitutions in the indicated mtDNA region, wherein SNPs detected in the AD group are compared to SNPs detected in the corresponding mtDNA regions in samples derived from normal, healthy controls. Figure 14 summarizes the distribution (number of SNPs detected per patient) of AD-associated SNPs from Table 9 that reflect nucleotide substitutions in the 20 indicated mtDNA region, wherein SNPs detected in the AD group are compared to SNPs detected in the corresponding mtDNA regions in samples derived from normal, healthy controls. From the foregoing, it will be appreciated that, although specific 25 embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims. 65

Claims (24)

1. A method for determining the risk for or presence of Alzheimer's disease in a first subject suspected of having or being at risk for having such a disease, comprising: determining the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease in each of a first and a second biological sample comprising mitochondrial DNA, said first biological sample being obtained from said first subject and said second sample being obtained from a second subject known to be free of a risk or presence of a disease associated with altered mitochondrial function, wherein the presence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease in said first biological sample and the absence of a mitochondrial single nucleotide polymorphism at a corresponding nucleotide in said second biological sample indicates an increased risk of Alzheimer's disease, and therefrom determining the risk or presence of Alzheimer's disease.

2. The method of claim 1 wherein the mitochondrial DNA in the first sample is amplified and the mitochondrial DNA in the second sample is amplified.

3. The method of claim 1 wherein the step of determining comprises: contacting each of said first and second biological samples with an oligonucleotide primer having a nucleotide sequence that is complementary to a sequence present in the mitochondrial DNA of said first sample and present in the mitochondrial DNA of said second sample, under conditions and for a time sufficient to allow hybridization of said primer to the mitochondrial DNA; and detecting hybridization and extension of the primer to the mitochondrial DNA of the first sample to produce a first product and hybridization and extension of the primer to the mitochondrial DNA of the second sample to produce a second product distinguishable from said first product, and therefrom determining the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease.

4. The method of claim 3 wherein the mitochondrial DNA in the first sample is amplified and the mitochondrial DNA in the second sample is amplified. 66 WO 00/63441 PCT/USOO/10906

5. The method of claim 3 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and present in said first biological sample and that is absent at a corresponding nucleotide in said second biological sample is present in a mitochondrial DNA region selected from the group consisting of a D loop, a mitochondrial rRNA gene, a mitochondrial NADH dehydrogenase gene, a mitochondrial tRNA gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene and a mitochondrial cytochrome b gene.

6. The method of claim 1 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and present in said first biological sample and that is absent at a corresponding nucleotide in said second biological sample is present in a mitochondrial DNA region selected from the group consisting of a D loop, a mitochondrial rRNA gene, a mitochondrial NADH dehydrogenase gene, a mitochondrial tRNA gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene and a mitochondrial cytochrome b gene.

7. The method of claim 6 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and present in said first biological sample and that is absent at a corresponding nucleotide in said second biological sample is present in a mitochondrial DNA region selected from the group consisting of a mitochondrial NADH dehydrogenase gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene and a mitochondrial cytochrome b gene, and wherein the single nucleotide polymorphism is a non-synonymous nucleotide substitution.

8. The method of claim 6 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and is present in said first biological sample and that is absent at a corresponding nucleotide in said second biological sample is present in a mitochondrial DNA region selected from the group consisting of a mitochondrial NADH dehydrogenase gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene and a mitochondrial cytochrome b gene, and wherein the single nucleotide polymorphism is a synonymous nucleotide substitution.

9. The method of claim 6 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and is present in said first biological sample and that is absent at a corresponding nucleotide in said second biological sample is a mitochondrial single nucleotide polymorphism located at a nucleotide 67 WO 00/63441 PCT/USOO/10906 that corresponds to a nucleotide position of SEQ ID NO: 1 that is selected from the group consisting of position 72, 114, 146, 185, 189, 199, 204, 207, 228, 236, 239, 456, 462, 482. 489,497,500,516,522,523,547,593,669,960, 1007, 1243, 1393, 1719, 1809,2352,2483, 2702, 2851, 3197, 3333, 3336, 3348, 3394, 3398, 3423, 3505, 3559, 3915, 3992, 4024, 4095, 4216, 4336, 4529, 4727, 4793, 4917, 4991, 5004, 5046, 5228, 5315, 5418, 5426, 5460, 5461, 5516, 5554, 5634, 5656, 5773, 6182, 6221, 6341, 6367, 6371, 6489, 7184, 7325, 7621, 7768, 7787, 7789, 7864, 7895, 7963, 8149, 8251, 8269, 8276-8284, 8470, 8485, 8508, 8602, 8697, 8752, 8901, 8994, 9123, 9254, 9362, 9380, 9477, 9554, 9708, 9804, 9861, 10034, 10044, 10238, 10463, 10589, 10978, 11065, 11251, 11253, 11272, 11470, 11527, 11611, 11674, 11812, 11914, 11947, 12414, 12501, 12609, 12705, 12954, 13111, 13194, 13212, 13368, 13617, 13780, 13966, 14020, 14148, 14178, 14179, 14182, 14212, 14233, 14470, 14582, 14905, 15028, 15043, 15191, 15299, 15380, 15553, 15607. 15758, 15790, 15808, 15833, 15884, 15924, 15928, 16069, 16086, 16093, 16126, 16129, 16145, 16147, 16172, 16174, 16182, 16183, 16189, 16192, 16193, 16223, 16224, 16234, 16235, 16239, 16248, 16256, 16261, 16270, 16278, 16290, 16292, 16293, 16294, 16298, 16300, 16304, 16309, 16311, 16320, 16355, 16362, 16391, 16482 and 16524.

10. The method of claim 6 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease and is present in said first biological sample and that is absent at a corresponding nucleotide in said second biological sample is a mitochondrial single nucleotide polymorphism located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 709, 930, 960, 980, 1189, 1243, 1700, 1719, 1809, 1811, 1888, 2098. 2158, 2259. 2352, 3010, 3197, 669, 789, 793, 870, 980, 1007, 1243, 1393, 1709, 1719, 2156 2294 2483. 2581, 2851, 6366 and 12954.

11. A method for determining the risk for or presence of Alzheimer's disease in a subject, comprising: determining the presence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease in a biological sample comprising mitochondrial DNA from the subject.

12. The method of claim 11 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present in a mitochondrial DNA region selected from the group consisting of a D-loop, a mitochondrial rRNA gene, a mitochondrial NADH dehydrogenase gene, a mitochondrial tRNA gene, a 68 WO 00/63441 PCT/USOO/10906 mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene and a mitochondrial cytochrome b gene.

13. The method of claim 11 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present in a mitochondrial DNA region selected from the group consisting of a mitochondrial NADH dehydrogenase gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene and a mitochondrial cytochrome b gene, and wherein the single nucleotide polymorphism is a non-synonymous nucleotide substitution.

14. The method of claim 11 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present in a mitochondrial DNA region selected from the group consisting of a mitochondrial NADH dehydrogenase gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene and a mitochondrial cytochrome b gene, and wherein the single nucleotide polymorphism is a synonymous nucleotide substitution.

15. The method of claim 11 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is a mitochondrial single nucleotide polymorphism located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 72, 114, 146, 185, 189, 199, 204, 207, 228, 236, 239, 456, 462, 482. 489, 497, 500, 516, 522, 523, 547, 593, 669, 960, 1007, 1243, 1393, 1719, 1809, 2352, 2483, 2702, 2851, 3197, 3333, 3336, 3348, 3394,3398, 3423, 3505, 3559, 3915, 3992.4024,4095,4216,4336,4529,4727,4793, 4917,4991,5004,5046,5228,5315, 5418, 5426, 5460,5461,5516,5554,5634, 5656,5773, 6182,6221,6341,6367,6371,6489,7184,7325,7621,7768,7787,7789,7864,7895.7963, 8149, 8251, 8269, 8276-8284, 8470, 8485, 8508, 8602, 8697, 8752, 8901, 8994, 9123, 9254, 9362, 9380, 9477, 9554, 9708, 9804, 9861, 10034, 10044, 10238, 10463, 10589, 10978, 11065, 11251, 11253, 11272, 11470, 11527, 11611, 11674, 11812, 11914, 11947, 12414. 12501, 12609, 12705, 12954, 13111, 13194, 13212, 13368, 13617, 13780, 13966, 14020, 14148, 14178, 14179, 14182, 14212, 14233, 14470, 14582, 14905, 15028, 15043, 15191, 15299, 15380, 15553, 15607, 15758, 15790, 15808, 15833, 15884, 15924, 15928, 16069, 16086, 16093, 16126, 16129, 16145, 16147, 16172, 16174, 16182, 16183, 16189, 16192, 16193, 16223, 16224, 16234, 16235, 16239, 16248, 16256, 16261, 16270, 16278, 16290, 16292, 16293, 16294, 16298, 16300, 16304, 16309, 16311, 16320, 16355, 16362, 16391, 16482 and 16524. 69 WO 00/63441 PCT/USOO/10906

16. The method of claim 11 wherein at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is a mitochondrial single nucleotide polymorphism located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 709, 930, 960, 980, 1189, 1243, 1700, 1719, 1809, 1811, 1888, 2098, 2158, 2259, 2352, 3010, 3197, 669, 789, 793, 870, 980, 1007, 1243, 1393, 1709, 1719, 2156, 2294, 2483, 2581, 2851, 6366 and

12954.

17. A method of determining if an agent is likely to cause, contribute to the pathology of, or exacerbate Alzheimer's disease, comprising contacting a biological sample comprising a cell with a candidate agent, conducting an assay of a mitochondrial nucleic acid to determine if said mitochondrial nucleic acid contains one or more single nucleotide polymorphisms after being contacted with said agent, wherein said nucleic acid is present in or derived from said cell and said one or more single nucleotide polymorphisms segregate with Alzheimer's disease.

18. A method of determining if an agent is likely to cause, contribute to the pathology of, or exacerbate Alzheimer's disease, comprising the steps of: (a) contacting a first cell with a candidate agent; (b) incubating a second cell, that has not been contacted with said agent, and said first cell, under equivalent conditions; (c) conducting an assay of one or more mitochondrial nucleic acids to determine if said mitochondrial nucleic acids contain one or more single nucleotide polymorphisms, wherein said nucleic acids are present in or derived from said cells and said single nucleotide polymorphisms segregate with Alzheimer's disease, wherein the presence of one or more of said single nucleotide polymorphisms in said mitochondrial nucleic acids present in or derived from said first cell, and the absence of one or more of said single nucleotide polymorphisms in said mitochondrial nucleic acids present in or derived from said second cell, indicates that said agent is likely to cause, contribute to the pathology of, or exacerbate Alzheimer's disease.

19. A nucleic acid array comprising a plurality of isolated nucleic acid molecules immobilized on a solid support, wherein said isolated nucleic acid molecules comprise all or a portion of the nucleic acid sequence set forth in SEQ ID NO: 1 in which at 70 WO 00/63441 PCT/US00/10906 least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present.

20. The nucleic acid array of claim 19 wherein the mitochondrial single nucleotide polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 72, 114, 146, 185, 189, 199, 204, 207, 228, 236, 239, 456, 462, 482. 489, 497, 500, 516, 522, 523, 547, 593, 669, 960, 1007, 1243, 1393, 1719, 1809, 2352, 2483, 2702, 2851, 3197, 3333, 3336, 3348, 3394, 3398, 3423, 3505, 3559, 3915, 3992, 4024, 4095, 4216, 4336, 4529, 4727, 4793, 4917, 4991, 5004, 5046. 5228, 5315, 5418, 5426, 5460, 5461, 5516, 5554, 5634, 5656, 5773, 6182, 6221, 6341, 6367, 6371, 6489, 7184, 7325, 7621, 7768, 7787, 7789, 7864, 7895, 7963, 8149, 8251, 8269, 8276-8284, 8470, 8485, 8508, 8602, 8697, 8752, 8901, 8994, 9123, 9254, 9362, 9380, 9477, 9554, 9708, 9804, 9861, 10034, 10044, 10238, 10463, 10589, 10978, 11065, 11251, 11253, 11272, 11470, 11527, 11611, 11674, 11812, 11914, 11947, 12414, 12501, 12609, 12705, 12954, 13111, 13194, 13212, 13368, 13617, 13780, 13966, 14020, 14148, 14178, 14179, 14182, 14212, 14233, 14470, 14582, 14905, 15028, 15043, 15191, 15299, 15380, 15553, 15607, 15758, 15790, 15808, 15833, 15884, 15924, 15928, 16069, 16086, 16093, 16126, 16129, 16145, 16147, 16172, 16174, 16182, 16183, 16189, 16192, 16193, 16223, 16224, 16234, 16235, 16239, 16248, 16256, 16261, 16270, 16278, 16290, 16292, 16293, 16294, 16298, 16300, 16304, 16309, 16311, 16320, 16355, 16362, 16391, 16482, 16524, 709, 930, 960, 980, 1189, 1243, 1700, 1719, 1809, 1811, 1888, 2098. 2158, 2259, 2352, 3010, 3197, 669, 789, 793, 870, 980, 1007, 1243, 1393, 1709, 1719, 2156, 2294, 2483, 2581, 2851, 6366 and 12954.

21. The method of claim 1 wherein the step of determining comprises: contacting each of said first and second biological samples with an oligonucleotide primer comprising all or a portion of the nucleic acid sequence set forth in SEQ ID NO: 1 in which at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present, under conditions and for a time sufficient to allow hybridization of said primer to the mitochondrial DNA; and 71 WO 00/63441 PCT/USOO/10906 comparing an amount of hybridization of the oligonucleotide primer to the mitochondrial DNA of the first sample to an amount of hybridization of the primer to the mitochondrial DNA of the second sample, and therefrom determining the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease.

22. The method of claim 21 wherein the mitochondrial single nucleotide polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 72, 114, 146, 185, 189, 199, 204, 207, 228, 236, 239, 456, 462, 482. 489, 497, 500, 516, 522, 523, 547, 593, 669, 960, 1007, 1243,1393,1719, 1809,2352,2483,2702,2851,3197,3333,3336,3348,3394,3398,3423, 3505,3559,3915, 3992,4024,4095,4216,4336,4529,4727,4793,4917,4991,5004,5046, 5228,5315,5418,5426, 5460,5461,5516,5554, 5634, 5656, 5773, 6182,6221,6341, 6367, 6371,6489,7184,7325,7621,7768,7787,7789,7864,7895,7963, 8149, 8251,8269,8276 8284,8470,8485, 8508,8602,8697, 8752, 8901, 8994, 9123, 9254, 9362,9380,9477,9554, 9708,9804,9861,10034, 10044,10238,10463, 10589,10978, 11065, 11251,11253, 11272, 11470, 11527, 11611, 11674, 11812, 11914, 11947, 12414, 12501, 12609, 12705, 12954, 13111, 13194, 13212, 13368, 13617, 13780, 13966, 14020, 14148, 14178, 14179, 14182, 14212, 14233, 14470, 14582, 14905, 15028, 15043, 15191, 15299, 15380, 15553, 15607, 15758, 15790, 15808, 15833, 15884, 15924, 15928, 16069, 16086, 16093, 16126, 16129, 16145, 16147, 16172, 16174, 16182, 16183, 16189, 16192, 16193, 16223, 16224, 16234, 16235, 16239, 16248, 16256, 16261, 16270, 16278, 16290, 16292, 16293, 16294, 16298, 16300, 16304, 16309, 16311, 16320, 16355, 16362, 16391, 16482, 16524, 709, 930, 960, 980, 1189, 1243, 1700, 1719, 1809, 1811, 1888, 2098, 2158, 2259, 2352, 3010, 3197, 669, 789, 793, 870, 980, 1007, 1243, 1393, 1709, 1719, 2156, 2294, 2483, 2581, 2851, 6366 and 12954.

23. The method of claim 1 wherein the step of determining comprises contacting each of said first and second biological samples with a nucleic acid array comprising a plurality of isolated nucleic acid molecules immobilized on a solid support, 72 WO 00/63441 PCT/USOO/10906 wherein said isolated nucleic acid molecules comprise all or a portion of the nucleic acid sequence set forth in SEQ ID NO:1 in which at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease is present, under conditions and for a time sufficient to allow hybridization of mitochondrial DNA to said isolated nucleic acid molecules; and comparing an amount of hybridization of the mitochondrial DNA of the first sample to the nucleic acid array to an amount of hybridization of the mitochondrial DNA of the second sample to the nucleic acid array, and therefrom determining the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease.

24. The method of claim 23 wherein the mitochondrial single nucleotide polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 72, 114, 146, 185, 189, 199, 204, 207, 228, 236, 239, 456, 462, 482. 489, 497, 500, 516, 522, 523, 547, 593, 669, 960, 1007, 1243, 1393, 1719, 1809, 2352, 2483, 2702, 2851, 3197, 3333, 3336, 3348, 3394, 3398, 3423, 3505, 3559, 3915, 3992, 4024, 4095, 4216, 4336, 4529, 4727, 4793, 4917, 4991, 5004, 5046, 5228, 5315, 5418, 5426, 5460, 5461, 5516, 5554, 5634, 5656, 5773, 6182, 6221, 6341, 6367, 6371, 6489, 7184, 7325, 7621, 7768, 7787, 7789, 7864, 7895, 7963, 8149, 8251, 8269, 8276 8284, 8470, 8485, 8508, 8602, 8697, 8752, 8901, 8994, 9123, 9254, 9362, 9380, 9477, 9554, 9708, 9804, 9861, 10034, 10044, 10238, 10463, 10589, 10978, 11065, 11251, 11253, 11272, 11470, 11527, 11611, 11674, 11812, 11914, 11947, 12414, 12501, 12609, 12705, 12954, 13111, 13194, 13212, 13368, 13617, 13780, 13966, 14020, 14148, 14178, 14179, 14182, 14212, 14233, 14470, 14582, 14905, 15028, 15043, 15191, 15299, 15380, 15553, 15607, 15758, 15790, 15808, 15833, 15884, 15924, 15928, 16069, 16086, 16093, 16126, 16129, 16145, 16147, 16172, 16174, 16182, 16183, 16189, 16192, 16193, 16223, 16224, 16234, 16235, 16239, 16248, 16256, 16261, 16270, 16278, 16290, 16292, 16293, 16294, 16298, 16300, 16304, 16309, 16311, 16320, 16355, 16362, 16391, 16482, 16524, 709, 930, 960, 980, 1189, 1243, 1700, 1719, 1809, 1811, 1888, 2098, 2158, 2259, 2352, 3010, 3197, 669, 789, 793, 870, 980, 1007, 1243, 1393, 1709, 1719, 2156, 2294, 2483, 2581, 2851, 6366 and 12954. 73