AU4183700A - Prediction of risk of interstitial lung disease - Google Patents

Description

WO 00/60117 PCT/US00/08492 PREDICTION OF RISK OF INTERSTITIAL LUNG DISEASE 1. BACKGROUND OF THE INVENTION 1.1 Interstitial Lung Disease and Idiopathic Pulmonau Fibrosis Interstitial lung disease (ILD) is a broad term applied to disorders of both known and unknown etiology characterized by fibrosis and inflammation. Representative known etiologies for ILD include occupational exposures (silicosis, asbestosis, berylliosis, coal miner's pneumoconiosis and hard metal pneumoconiosis), infectious exposures fungall disease and post viral syndromes), systemic rheumatoid disorders (rheumatoid arthritis, systemic lupus erythematosis, Sjogren's syndrome, systemic sclerosis, dermatomyositis/polymyositis, mixed connective tissue disease and ankylosing spondilytis) and other miscellaneous causes (drug induced pneumonitis, oxygen toxicity, radiation exposure, hypersensitivity pneumonitis and ARDS sequelae). Fibrotic/ inflammatory interstitial lung disease of unknown etiology is termed idiopathic pulmonary fibrosis (IPF). An early description of IPF was provided in 1944 by Hamman and Rich, where a series of patients was presented in whom developed what would now be considered a type of IPF (Hamman and Rich, "Acute diffuse interstitial fibrosis of the lungs," Bull. Johns Hopkins Hosp. 74:177-206, 1944). Although the term Hamman-Rich syndrome for a while was used to denote any case of IPF, in more modern usage it is reserved for cases of IPF with a rapidly progressive downhill course that often culminate acutely in death. Today, this syndrome is more commonly referred to as acute interstitial pneumonitis (AIP). Other names have been proposed for IPF over the years, including such terms as cryptogenic fibrosing alveolitis, diffuse interstitial lung disease and interstitial pulmonary fibrosis. These terms will be encountered throughout the medical literature as synonyms for IPF, although with some individual variation. Two discrete subcategories of IPF have been recognized: usual interstitial pneumonitis (UIP) and desquamative interstitial pneumonitis (DIP). A prevalence of 3-5 cases per 100,000 has been estimated for IPF. It is thus second only to sarcoidosis as a cause of ILD of unknown etiology. There is some regional variation for the disease, with higher rates identified, for example, in the American Southwest. -1- WO 00/60117 PCT/US00/08492 In New Mexico, IPF was responsible for about 45% of all ILD. It is common for IPF to exist anatomically without producing clinical symptoms, according to autopsy studies. The cause for IPF is, by definition, unknown. Contributory factors have been identified, including organic dust exposure, antecedent viral illnesses, and cigarette smoking. Smoking may also cause pulmonary bronchiolitis, an entity histologically similar to DIP that can also lead to fibrosis. Symptoms of IPF typically manifest themselves one or two years before the patient seeks medical attention. The disease is usually a progressive one, with early symptoms worsening over time. Upon presentation, the patient may manifest dyspnea at rest, dyspnea worsening with exertion, and a non-productive cough. Constitutional symptoms of malaise and weight loss may also be found. There may be accompanying rheumatological symptoms such as arthralgias even in the absence of discrete rheumatological disease. Findings on physical examination generally include tachypnea, exercise induced cyanosis and bibasilar, fine, late inspiratory crackles. These crackles are thought to be associated with subpleural fibrosis, although vibrations from the airway walls may also be involved. Dyspnea and limitation of physical activity may be quantitated as part of the patient's physical evaluation. Dyspnea is thought to be due to reduced lung compliance and increased elastic work of breathing. The patient may have sufficiently advanced pulmonary disease to have developed pulmonary hypertension or even cor pulmonale. The anatomic changes to the lungs and the pulmonary vasculature may not be reversible by the time the patient presents for medical evaluation. The typical IPF patient is of middle age and is somewhat more likely to be male than female. Sudden onset of symptoms for which no etiology can be identified is suggestive of AIP or Hamman-Rich syndrome. AIP patients are younger, and may include children. Although the disease has a poor prognosis, those who survive may have no pulmonary residua. Another syndrome of acute onset is bronchiolitis obliterans with organizing pneumonia (BOOP). This disorder, involving damage to the small airways and adjacent lung parenchyma, tends to have a good prognosis. History of the patient's present illness and physical exam may not definitively differentiate IPF from other ILDs. Unfortunately, IPF is a diagnosis of exclusion. Past medical history, including occupational exposures, may help identify other causes for the patient's ILD symptoms. A familial form of IPF has been described that is thought to be autosomal dominant with variable penetrance (Bitterman et al., "Familial IPF: evidence of lung inflammation in unaffected family members," N. Engl. J. Med. 314:1343-1347, 1986). Further evaluation of the symptomatic patient requires laboratory investigation. Several different types of diagnostic tests are presently available: pulmonary function tests, radiological studies, bronchioalveolar lavage -2- WO 00/60117 PCT/US00/08492 and lung biopsy. No non-invasive diagnostic modality exists to date that will unequivocally yield the diagnosis of IPF. Laboratory investigation of the IPF patient may begin with measurements of pulmonary function, including arterial blood gases (ABGs) and pulmonary function tests (PFTs). In IPF, PFTs show both an impairment of gas exchange (measured by the single-breath diffusion of carbon monoxide (DLCO)) and a restrictive lung deficit, with a reduction of lung volume and an increase in elastic recoil. Arterial hypoxemia is noted on ABGs, best explained by the ventilation-perfusion mismatch, though exacerbated by the diffusion abnormalities. These test results are consistent with a whole spectrum of inflammatory/fibrotic lung disorders, and do not specifically identify IPF. Serum and urine biochemical tests tend to be of limited usefulness in the work-up of IPF, except insofar as they exclude other etiologies. Radiological studies that are undertaken include plain chest Xrays (CXRs) and CT scans. When CXR abnormalities are seen, the most characteristic findings are prominent bibasilar reticular or reticulonodular infiltrates that may progress to honeycombing as the disease advances. However, 10% of patients with significant disease show no CXR abnormalities. CT scan is thought to be superior to CXR in the evaluation of IPF. Limitations in the diagnostic accuracy of CT scan in IPF have been noted. For example, the diffuse patchiness of the disease may be missed by CT scan. Further, CT scan may miss early cases of IPF. Other techniques, including gallium scans, MRI and PET scans have been undertaken to diagnose IPF, without notable success. Bronchioalveolar lavage (BAL) is performed to recover fluid from the bronchioalveolar tree that can be analyzed for cellular elements, pathogens and secreted proteins. This technique involves instilling a saline solution into the bronchioalveolar tree through a flexible bronchoscope that has been wedged in a third or fourth order bronchus. The fluid retrieved is then analyzed. It is still considered by most authorities to be a research tool, rather than a diagnostic method of proven clinical utility. Nonetheless, the identification of inflammatory substances correlates with other indicia of active lung inflammation, even though the technique is not standardized. Serial BALs may be followed in a particular patient to monitor a response to therapy or to predict a prognosis, although its overall diagnostic accuracy is questionable. Lung biopsy may be required to establish the diagnosis of IPF. Lung biopsy usually involves an open procedure through a thoracotomy because it permits sampling of grossly affected areas as well as more proximal areas that may be in the early stage of the disease. Open lung biopsy, however, results in serious complications 11-23% of the time. -3- WO 00/60117 PCT/US00/08492 Thorascopic techniques have lowered this complication rate while still providing diagnostic accuracy equivalent to the open procedures. For these procedures, nonetheless, a surgical intervention with general anesthesia is required, with the morbidity thereby entailed. The decision to proceed with a biopsy must take into consideration the patient's often fragile clinical status and the likelihood of post-operative complications, as well as the clinical utility of the information the biopsy will provide. Patients are not infrequently treated empirically in order to avoid the biopsy that would yield the definitive diagnosis. There is therefore a need in the art for techniques that would increase the clinician's diagnostic abilities in the evaluation of symptoms suggestive of IPF, particularly in its earliest clinical stage. For example, earlier diagnosis could permit earlier therapeutic intervention while the pathological changes were reversible (Coker et al., "Pulmonary fibrosis; cytokines in the balance," Eur. Respir. J 11(6): 1218-21 1998). Further, a definitive diagnosis of IPF would obviate the time-consuming and costly process of elimination that is currently employed. This would be especially important in the pediatric population, in whom the disease can run a fulminant course (Osika et al., "Idiopathic pulmonary fibrosis in infants," Pediatr. Pulmonol. 23(1): 49-54, 1997). Indeed, a test that could identify the population at increased risk for developing IPF, environmental and other factors could be manipulated to maximize their protection and alert health care personnel to watch for earliest signs of the disease. Pulmonary fibrosis has also been identified as a co-morbid condition in other lung disorders. One study has shown that pulmonary fibrosis in the adult respiratory distress syndrome (ARDS) patient is correlated with a 57% mortality rate, in contrast to the 0% mortality in those patients without pulmonary fibrosis. It is possible that patients inherently more susceptible to pulmonary fibrosis are more vulnerable to other types of lung pathology, such as those that characterize ARDS, so these patients are more likely to do poorly in the ARDS setting (Martin et al., "Pulmonary fibrosis correlates with outcome in adult respiratory distress syndrome. A study in mechanically ventilated patients," Chest 107(1):196-200 1995). It is further understood in the art that certain patients are prone to develop pulmonary fibrosis as a side-effect of various therapies. Bleomycin and amiodarone are known to bring about this complication (Swiderski et al., "Differential expression of extracellular matrix remodeling genes in a murine model ofbleomycin-induced pulmonary fibrosis," Am J. Pathol. 152(3):821-8, 1998). Pulmonary fibrosis is a frequent and serious complication of treating early stage invasive breast cancer with wide excision and radiation (Btittner et al., "Local production of interleukin-4 during radiation-induced pneumonitis and pulmonary fibrosis in rats: macrophages as a prominent source of interleukin-4," Am. . Respir. Cell. Mol. Biol. 17(3):315 -4- WO 00/60117 PCT/US00/08492 25, 1997). While this type of pulmonary fibrosis is not, strictly speaking, idiopathic, nor is it an inevitable consequence of the particular treatment: some patients will develop it following a treatment modality and others will not (See, for example, Van der veen, et al., "Fatal pulmonary fibrosis complicating low dose methotrexate therapy for rheumatoid arthritis," J. Rheumatol. 22(9):1766-8, 1995, and Malik, et al., "Lung toxicity associated with cyclophosphamide use. Two distinct patterns," Am. J. Respir. Crit. Care Med. 154(6 Pt 1): 1851-6, 1996. Some genetic variability in susceptibility to radiation induced pulmonary fibrosis has been identified in mice (Johnston, et al., "Differences in correlation of mRNA gene expression in mice sensitive and resistant to radiation-induced pulmonary fibrosis," Radiat. Res. 142 (2): 197-203, 1995). TGF beta is one of the cytokines that is involved in the development of post-radiation pulmonary fibrosis, though other cytokines have also been implicated (Yi, et al., "Radiation-induced lung injury in vivo: expression of transforming growth factor-beta precedes fibrosis," hIflammation 20(4):339-52, 1996, Zhang, et al., "Cytokines and pulmonary fibrosis," Biol Signals 5(4):232-9, 1996, Johnston, et al., "Early and persistent alterations in the expression of interleukin-1 alpha, interleukin-1 beta and tumor necrosis factor alpha mRNA levels in fibrosis-resistant and sensitive mice after thoracic irradiation," Radiat. Res. 145(6):762-7, 1996, Rubin, et al., "A perpetual cascade ofcytokines postirradiation leads to pulmonary fibrosis," Int. J. Radiat. Oncol. Biol. Phys. 33(1):99-109, 1995). A test to identify those patients at increased risk for the potentially lethal side effect of pulmonary fibrosis would aid the clinician in determining which patients are not candidates for a particular treatment. Differentiating among the different clinical ILD syndromes has further import for therapeutics. IPF is understood to have a 50% five-year survival rate. Planning treatment has been stymied by the inadequacy of diagnostic methods (Sharma, "Idiopathic pulmonary fibrosis," Curr. Opin. Pulm. Med. 2(5):343-6, 1996). These patients, as opposed to other ILD patients, may be candidates for more aggressive therapies, including corticosteroids, antimetabolites, cytotoxic drugs, colchicine or combinations thereof (Entzian, et al., "Anti inflammatory and antifibrotic properties of colchicine: implications for idiopathic pulmonary fibrosis," Lung 175(1):41-51, 1997, Hunninghake, et al., "Approaches to the treatment of pulmonary fibrosis," Am. J. Respir. Crit. Care Med. 151(3 Pt 1):915-8, 1995). Anticytokine therapies have also been proposed for use in IPF, but these agents are sufficiently complex in their pharmacological behavior that precise diagnosis should precede their utilization. (Coker, et al., "Anticytokine approaches in pulmonary fibrosis: bringing factors into focus," Thorax 52(3):294-6, 1997). An additional complication of IPF is bronchogenic cancer, most commonly adenocarcinoma. Bronchogenic cancer is known to develop in approximately 5-10% of patients -5- WO 00/60117 PCT/US00/08492 with IPF, a relative risk of almost ten times that of a similar age and sex-matched group. This excess risk cannot be accounted for by cigarette smoking alone. With a diagnosis of IPF, the clinician is on notice to be watchful for earliest changes suggestive of malignancy. It is well recognized among practitioners that the invasiveness of an open lung biopsy, even if performed thoracoscopically, is to be avoided if possible. Currently, though, open lung biopsy is required because the less invasive tests tend to be inconclusive. More informative diagnostic modalities would incline the clinician away from open biopsy if equally useful information were otherwise available. If such a test could decrease the need for open lung biopsy, these fragile patients would face one less set of risks. 1.2 Genetic Screening The early detection of a predisposition to a particular set of diseases presents the best opportunity for medical intervention. For diseases with a genetic component, this involves techniques of genetic screening. Early genetic screening may improve the prognosis for a patient through supervision and early intervention before the disorder becomes clinically detectable. In cases where patients with similar symptoms are treated with variable success, sophisticated genetic screening can differentiate individual patients with subtle or undetectable differences and can lead to more suitable individual treatments. It is conceivable that early intervention may one day involve methods such as gene therapy. Traditional methods for the screening of heritable diseases have depended on either the identification of abnormal gene products (e.g., sickle cell anemia) or an abnormal phenotype (e.g., mental retardation). These methods are of limited utility for heritable diseases with late onset and no easily identifiable phenotypes such as, for example, Alzheimer's disease. With the development of simple and inexpensive genetic screening methodology it is now possible to identify polymorphisms that indicate a propensity to the development of a disease, even when the disease is of polygenic origin. The number of diseases that can be screened by molecular biological methods continues to grow with increased understanding of the genetic basis of multifactorial disorders. Genetic screening (also called genotyping or molecular screening), can be broadly defined as testing to determine ifa patient has mutations (or alleles or polymorphisms) that either cause a disease state or are "linked" to the mutation causing a disease state. Linkage refers to the phenomenon that DNA sequences which are close together in the genome have a tendency to be inherited together. Two sequences may be linked because of some selective advantage of co inheritance. More typically, however, two polymorphic sequences are co-inherited because of -6- WO 00/60117 PCT/US00/08492 the relative infrequency with which meiotic recombination events occur within the region between the two polymorphisms. The co-inherited polymorphic alleles are said to be in linkage disequilibrium with one another because, in a given human population, they tend to either both occur together or else not occur at all in any particular member of the population. Indeed, where multiple polymorphisms in a given chromosomal region are found to be in linkage disequilibrium with one another, they define a quasi-stable genetic "haplotype." In contrast, recombination events occurring between two polymorphic loci cause them to become separated onto distinct homologous chromosomes. If meiotic recombination between two physically linked polymorphisms occurs frequently enough, the two polymorphisms will appear to segregate independently and are said to be in linkage equilibrium. While the frequency of meiotic recombination between two markers is generally proportional to the physical distance between them on the chromosome, the occurrence of "hot spots" as well as regions of repressed chromosomal recombination can result in discrepancies between the physical and recombinational distance between two markers. Thus, in certain chromosomal regions, multiple polymorphic loci spanning a broad chromosomal domain may be in linkage disequilibrium with one another, and thereby define a broad-spanning genetic haplotype. Furthermore, where a disease-causing mutation is found within or in linkage with this haplotype, one or more polymorphic alleles of the haplotype can be used as a diagnostic or prognostic indicator of the likelihood of developing the disease. This association between otherwise benign polymorphisms and a disease-causing polymorphism occurs if the disease mutation arose in the recent past, so that sufficient time has not elapsed for equilibrium to be achieved through recombination events. Therefore identification of a human haplotype which spans or is linked to a disease-causing mutational change, serves as a predictive measure of an individual's likelihood of having inherited that disease-causing mutation. Importantly, such prognostic or diagnostic procedures can be utilized without necessitating the identification and isolation of the actual disease-causing lesion. The statistical correlation between a disorder and a polymorphism does not necessarily indicate that the polymorphism directly causes the disorder. Rather the correlated polymorphism may be a benign allelic variant which is linked to (i.e. in linkage disequilibrium with) a disorder-causing mutation which has occurred in the recent human evolutionary past, so that sufficient time has not elapsed for equilibrium to be achieved through recombination events in the intervening chromosomal segment. Thus, for the purposes of diagnostic and prognostic assays for a particular disease, detection of a polymorphic allele associated with that disease can be utilized without consideration of whether the polymorphism is directly involved in the etiology -7- WO 00/60117 PCT/US00/08492 of the disease. Furthermore, where a given benign polymorphic locus is in linkage disequilibrium with an apparent disease-causing polymorphic locus, still other polymorphic loci which are in linkage disequilibrium with the benign polymorphic locus are also likely to be in linkage disequilibrium with the disease-causing polymorphic locus. Thus these other polymorphic loci will also be prognostic or diagnostic of the likelihood of having inherited the disease-causing polymorphic locus. Indeed, a broad-spanning human haplotype (describing the typical pattern of co-inheritance of alleles of a set of linked polymorphic markers) can be targeted for diagnostic purposes once an association has been drawn between a particular disease or condition and a corresponding human haplotype. Thus, the determination of an individual's likelihood for developing a particular disease of condition can be made by characterizing one or more disease associated polymorphic alleles (or even one or more disease-associated haplotypes) without necessarily determining or characterizing the causative genetic variations. 1.3 Genetics of the IL-1 Gene Cluster The IL-1 gene cluster is on the long arm of chromosome 2 (2q13) and contains at least the genes for IL-1 alpha (IL-1A), IL-1 beta (IL-1B), and the IL-1 receptor antagonist (IL 1RN), within a region of 430 Kb (Nicklin, et al., Genomics, 19:382-4 (1994)). The agonist molecules, IL-1 alpha and IL-1 beta, have potent pro-inflammatory activity and are at the head of many inflammatory cascades. Their actions, often via the induction of other cytokines such as IL-6 and IL-8, lead to activation and recruitment of leukocytes into damaged tissue, local production of vasoactive agents, fever response in the brain and hepatic acute phase response. All three IL-1 molecules bind to type I and to type II IL-1 receptors, but only the type I receptor transduces a signal to the interior of the cell. In contrast, the type II receptor is shed from the cell membrane and acts as a decoy receptor. The receptor antagonist and the type II receptor, therefore, are both anti-inflammatory in their actions. Certain alleles from the IL-1 gene cluster are already known to be associated with particular disease states. For example, IL-1RN allele 2 has been found to be associated with coronary artery disease (co-owned PCT/US/98/04725, and USSN 08/813456), osteoporosis (co owned U.S. Patent No. 5,698,399), nephropathy in diabetes mellitus (Blakemore, et al. (1996) Hum. Genet. 97(3): 369-74), alopecia areata (Cork, et al., (1995) J. Invest. Dermatol. 104(5 Supp.): 15S-16S; Cork et al. (1996) Dermatol Clin. 14: 671-8), Graves disease (Blakemore, et al. (1995) J. Clin. Endocrinol. 80(1): 111-5), systemic lupus erythematosus (Blakemore, et al. (1994) Arthritis Rheum. 37: 1380-85), lichen sclerosus (Clay et al. (1994) Hum. Genet. 94: 407-10), and ulcerative colitis (Mansfield, et al. (1994) Gastroenterol. 106(3): 637-42). -8- WO 00/60117 PCT/US00/08492 Likewise, the IL-1A allele 2 from marker -889 and IL-1B (TaqI) allele 2 from marker +3954 are associated with periodontal disease (co-owned U.S. Patent No. 5,686,246; Kornman and di Giovine (1998) Ann Periodont 3: 327-38; Hart and Kornman (1997) Periodontol 2000 14: 202-15; Newman (1997) Compend Contin Educ Dent 18: 881-4; Kornman et al. (1997) J. Clin Periodontol 24: 72-77). The IL-1A allele 2 from marker -889 has also been found to be associated with juvenile chronic arthritis, particularly chronic iridocyclitis (McDowell, et al. (1995) Arthritis Rheum. 38: 221-28 ). The IL-1B (TaqI) allele 2 from marker +3954 of IL-1B has also been found to be associated with psoriasis and insulin dependent diabetes in DR3/4 patients (di Giovine, et al. (1995) Cytokine 7: 606; Pociot, et al. (1992) Eur J. Clin. Invest. 22: 396-402). Additionally, the IL-1RN (VNTR) allele 1 is associated with diabetic retinopathy (See Co-owned USAN 09/037472, and PCT/GB97/02790). Furthermore allele 2 of IL-1RN (VNTR) is associated with ulcerative colitis in Caucasian populations from North America and Europe (Mansfield, J. et al., (1994) Gastroenterology 106: 637-42). Interestingly, this association is particularly strong within populations of ethnically related Ashkenazi Jews (PCT WO97/25445). Additionally, it has been shown that alleles from the IL-1 (33221461) and the IL-1 (44112332) haplotypes are in linkage disequilibrium (See Co-owned PCT/GB98/01481). Thus, many linked alleles can also be said to be associated with the above diseases. 1.4 The TNF-alpha Gene (TNFA) Locus The tumor necrosis factor (TNF) locus lies in the class III region of the major histocompatibility complex (MHC) on the short arm of chromosome 6, approximately 250 kilobases (kb) centromeric of the human leukocyte antigen (HLA)-B locus and 850 kb telomeric of the class II region (Carroll et al. (1987) Proc Natl Acad Sci USA 84:8535-9; Dunham et al. (1987) Proc Natl Acad Sci USA 84:7237-41). The genes for TNF-a and lymphotoxin-ca (LT-c) lie within a 7-kb stretch and are separated by 1.1 kb in a tandem arrangement, LT-a lying telomerically. Both consist of four exons and three introns and encode short 5' untranslated and longer 3' untranslated stretches in the corresponding mRNA (Nedospasov et al. (1986) Cold Spring Harbor Symp Quant Biol 511:611-24; Nedwin et al. (1985) Nucleic Acids Res 13:6361 73). The most significant region of homology is found in the fourth exon, which encodes 80% and 89% of secreted LT-ca and TNF-ca, respectively (Nedwin et al. (1985) Nucleic Acids Res 13:6361-73). The MHC is a 4-megabase (Mb) stretch of DNA on the short arm of chromosome 6 (Campbell et al. (1993) Immunol Today 14:349-52), comprising approximately 0.1% of the human genome. It is known to contain 110 genes, most of which code for immunologically relevant proteins (Trowsdale (1993) Trends Genet 9:117-22). A striking feature of the MHC is -9- WO 00/60117 PCT/US00/08492 the high degree of polymorphism of the genes in the class I and II regions (Bodmer et al. (1991) Tissue Antigens 37:97-104). There are, for example, more than 70 alleles of HLA-A, and the polymorphic stretches of these genes encode the cleft in which processed antigen is presented to the T-cell receptor (Sinha et al. (1990) Science 248:1380-88; Nepom et al. (1991) Annu Rev Immunol 9:493-525). Another important feature is the strong linkage disequilibrium between particular alleles of genes across the MHC. Thus, for example, haplotypes HLA-A1-B8-DR3-DQ2 and HLA-A2-B44-DR4-DQ8 occur more frequently than the products of their individual allelic frequencies would suggest (Tiwari et al. (1985) New York: Springer-Verlag). Recombination over the whole of the MHC is not significantly different from that of any other region of the human genome (Trowsdale (1993) Trends Genet 9:117-22), so that the explanation for the strong linkage disequilibrium is not clear, but it may be due to selection by infectious agents, as is seen in parts of Africa in which malaria is endemic (Hill et al. (1991) Nature 352:595-600). Genes in the class III region have also been shown to be polymorphic. The complement cluster, containing the genes for the two isotypes of C4: C4A and C4B, as well as the genes for C2 and factor B, lies at the centromeric end of this region in close proximity to the two steroid 21-hydroxylase genes (Campbell et al. (1988) Annu Rev Immunol 6:161-95). These genes are also highly polymorphic, with large deletions involving several genes associated with particular MHC haplotypes (Schneider et al. (1986) J Clin Invest 78:650-57; Braun et al. (1990) J Exp Med 171:129-40). Within the central class III region lies the 70-kd heat-shock protein, which contains a restriction fragment length polymorphism (RFLP) (Pugliese et al. (1992) Diabetes 41:788-91) and at the telomeric end lies the TNF locus, which is also polymorphic (see below). A large number of studies have demonstrated associations between various MHC alleles and many of the common autoimmune diseases; indeed, of the 40 or so diseases classified as autoimmune in nature, almost all show some association of susceptibility, or in the case of rheumatoid arthritis of clinical severity, with alleles of genes encoded within the MHC (Sinha et al. (1990) Science 248:1380-88). The strength of association varies from relatively weak, as with systemic lupus erythematosus and myasthenia gravis, to very strong with ankylosing spondylitis, in which carriage of the HLA-B27 alleles rises from 8% in normals to 96% in patients (Tiwari et al. (1985) New York: Springer-Verlag). In addition, studies of HLA-identical and nonidentical sibs have demonstrated that genetic factors in other regions of the genome also contribute to many of these diseases. Susceptibility is, however, multifactorial, as shown by studies of concordance rates for disease in monozygotic twins. If a disease is purely genetic then a concordance rate of 100% would be expected. However, the rate varies from 5% for multiple sclerosis to 30% for -10- WO 00/60117 PCT/US00/08492 rheumatoid arthritis. These observations indicate that additional environmental factors, perhaps viral or bacterial, are important in disease susceptibility. TNFa is mainly secreted by macrophages. The expression of TNT-a is induced by bacterial lipopolysaccharides, mitogens, and viruses, and it is regulated both transcriptionally and postranscriptionally (Golfeld et al. (1990) Proc Natl Acad Sci USA 87: 9769-73; Golfeld et al. (1991) J Exp Med 174: 73-81; Han et al. (1990) J Exp Med 171: 465-75; Han et al. (1991) J Immunol 146: 1843-48). Regulation of the TNFA gene is mediated by the 5'- and 3'- flanking regions surrounding the coding sequence, and as well as sequence occurring in the introns distributed between the coding exons. There are approximately 1000 base pairs in the TNFA 5' flanking region which contain elements critical to transcriptional control, including three putative NFkB type consensus sequences, a Y-box of the MHC class II promotors, and a cyclic adenosine 3' 5'- monophosphate (cAMP) response element (CRE) similar to that of the somatostatin promotor. The NFkB element nearest the coding sequence is an area of intense study, with overlapping elements involved in transcriptional inhibition by cyclosporin A and activation by the nuclear factor C/EBPB in T cells. Of note, the third intron possesses enhancer activity which stems from viral enhancer sequences within this region. The 3' untranslated region (3'UTR) contains evolutionarily conserved TA-rich sequences, also present in the 3'UTR of other inflammation-related genes including granulocyte macrophage colony stimulating factor (GM CSF) and the human hepatocyte inducible nitric oxide synthase genes. 1.5 Transcriptional Activation of the TNFA Gene Exposure of macrophages to LPS results in a three-fold increase in the transcriptional rate of the TNFA gene in macrophages, which is at least in part mediated through the induction of the transcription factor nuclear factor kB (NF-kB) Beutlor BA, et al. 1986 Immunol, Collart M., et al. 1990, Mol Cell Biol). NF-kB is a heterodimeric protein, normally present in the cytoplasm, which is bound to its 37-kD inhibitor (IkB) until a stimulatory signal is sensed at the cell surface. Exposure of macrophages to LPS leads to NF-kB activation through protein kinase C-dependent and independent mechanisms. Deletion of segments of the TNFA 5'- flanking sequence has indicated that deletion of greater than two of the kB enhancer sequences leads to significantly diminished LPS-induced gene activation in macrophages (Shakhov et al. (1990) J Exp Med 171: 35-47). In T cells, induction of NF-kB may not be as critical to TNFA gene activation as it is in macrophages. Instead, Pope and colleagues (Pope et al. (1994) J Clin Invest 94: 1449-55) identified a specific binding site for the C/EBPB in the TNTA promoter. Over expression of C/EBPB caused activation of the TNFA gene in a transient contransfection reporter system in Jurkat T Cells. Furthermore, blockage of C/EBPB activity by a mutant form of C/EBPB eliminated TNFA induction by phorbol myristic acetate (PMA) in this same cell line. Whether C/EBPB is critical to activation of macrophages is not yet known. -11- WO 00/60117 PCT/US00/08492 Therefore it is possible that polymorphisms in the TNFA promoter may cause polymorphism-specific differences in the transcriptional response of TNFA to LPS and other TNFA inducing stimuli, thereby at least partly accounting for interindividual differences in clinical presentations among patients with similar disease processes, as well as fundamental interindividual differences in genetic predisposition to such processes. Recently, polymorphisms in or near the TNFA promoter have been described in humans (Pociot F., et. al 1993 Gene). 1.6 TNFA Translational Regulation Three observations, occurring soon after the cytokine was originally isolated and cloned, suggested that TNF-a biosynthesis was significantly regulated at the level of translation. First, in response to LPS stimulation, the directly measured rate of TNFA transcription increased by only three-fold, whereas the TNFA messenger RNA (mRNA) levels increased nearly 100-fold and the TNF-a protein actually secreted increased 10,000-fold (Beutler BA, et al. 1986 Immunol). Second, TNFA mRNA was detectable in cultured macrophages during periods when no TNF-a protein was secreted, especially in macrophages which had been treated with dexamethasone prior to LPS stimulation. This observation suggested that mechanisms which repress the translation of TNFA mRNA might be active in nonstimulated macrophages, and that this repression was released upon stimulation with LPS (Beutler B., et al. 1986 Science). Third, C3H/HeJ mice differ from their wild-type congenics only by mutation of the "LPS gene" located on murine chromosome 4. These mice are resistant to challenges with large doses of endotoxin which are uniformly fatal to wild-type animals. Macrophages from C3H/HeJ mice, when stimulated with LPS in vitro, failed to secrete the TNF-a protein; however, nearly normal increases in TNFA mRNA were noted. This finding again suggested a regulatory mechanism that functioned to repress translation of TNFA mRNA under nonstimulated conditions (Beutlor B., et al. 1986 Science), C3H/HeJ mice appeared to manifest a defect in translational derepression which normally occurred upon stimulation of wild-type macrophages with LPS. The mechanisms involved in translational regulation of TNF-a expression have been elucidated by the work of several investigators. Multiple evolutionarily conserved regions in the 3'UTR of many cytokines and oncogenes exist (Caput et al. (1986) Proc Natl Acad Sci USA 83: 1670-74; Shaw and Kamen Shaw G., et al. (1986) Cell 46: 659-67; and Kruys et al. (1989) Science 245: 852-55). These regions consisted of TA-rich regions frequently evident as the repeated octameric motif "TTATTTAT." Among the genes initially reported to contain such sequences were human and mouse. TNFA human and mouse IL-1A, human and mouse GM CSF, human and mouse interferon (IFN) a, human and mouse c-fos, and others. Most recently the 3'UTR of the human hepatocyte inducible nitric oxide synthase gene was also shown to contain a TTATTTAT consensus sequence and several TA-rich flanking sequences. Thus far, these sequences have been shown to have two important regulatory roles. First, the presence of -12- WO 00/60117 PCT/US00/08492 TA-rich regions confers mRNA instability and therefore a short mRNA half-life. Furthermore, substitution of the 3'UTR of GM-CSF for the 3'UTR of 3-globin caused a decrease in mRNA half-life from several hours to several minutes. Although the half-life of TNFA mRNA is indeed short, there is yet no definite evidence to demonstrate that TNFA mRNA half-life is appreciably altered following LPS stimulation. The second regulatory role of TTATTTAT, however, concerns the efficiency of translation of mRNA. Using in vitro mammalian systems, it was demonstrated that a > 90% inhibition of protein production resulted from inclusion of a single UUAUUUAU sequence in the 3'UTR of a reporter construct (Kruys, V. et. al. (1989) Science 245: 852-55; Kruys et al. (1987) Proc. Natl. Acad Sci USA 84: 6030-34). Furthermore, the presence of the 3'UTR of TNFA causes a 600-fold decrease in translational efficiency of the TNFA mRNA, but this translational inhibition is overcome by the stimulation of macrophages with LPS and resulted in a rapid surge in TNF-a protein synthesis. Still further, transgenic mice in which the TNFA 3'UTR has been replaced by the 3'UTR of the globin gene displayed disregulated TNF-a biosynthesis and developed chronic inflammatory polyarthritis (Keffer J., et al. (1991) EMBO J 10: 4025-31). Interestingly, polymorphisms in the 3'UTR of various mouse strains, including mutations in the TTATTTAT sequences in New Zealand white and Mus spretus strains indicated that polymorphisms in the 3'UTR of the TNFA gene may be associated with TNFA mediated diseases in animals, and potentially in humans as well (Beutler et al. (1993) Gene 129: 279-83). In humans, abnormalities in TNFa regulation and/or secretion have been described in patients with certain autoimmune conditions, in particular diabetes mellitus and rheumatoid arthritis. The possibility that mutations in the TNFA 3'UTR are present in pediatric patients with autoimmunity has been investigated (Becker et al. (1995) Pediatr Res.37: 165-68) recently. Blood samples were collected from 48 pediatric patients with connective tissue diseases including juvenile rheumatoid arthritis, systemic lupus erthematosus, dermatomyositis, type I diabetes, noninflammatory arthritis, as well as four healthy volunteers. A 190-base pair fragment of the TNFA 3'UTR which included the TTATTTAT motifs was amplified and sequenced from each patient. All patients and control subjects exhibited the normal wild-type sequence, with no deletions, insertions, or substitutions in TTATTTAT; these data imply that mutations in this region occur infrequently, if at all in patients with diseases examined in this study. Nonetheless, it remains possible that 3'UTR polymorphisms are responsible for interindividual differences in the response to LPS. 1.7 Post-Translational Regulation of TNFA TNF-ca is initially synthesized as a prohormone which contains in humans, 76 additional amino acids at the N-terminus. This sequence is cleaved, followed by trimerization and secretion of the mature 157 amino acid sub-units (Ceoh, et al. (1989) J Biol Chem.26: 16256 -13- WO 00/60117 PCT/US00/08492 80). A 26-kD membrane form of TNF-a is also described which may participate in macrophage killing of target cells (Kriegler et al. (1988) Cell.53: 45-53). There is no information concerning altered regulation of post-translational events following LPS stimulation of macrophages. 1.8 TNFA locus polymorphisms TNF-a is a cytokine with a wide variety of functions: it can cause cytolysis of certain tumor cell lines, it is implicated in the induction of cachexia, it is a potent pyrogen causing fever by direct action or by stimulation of interleukin 1 secretion, and it can stimulate cell proliferation and induce cell differentiation under certain conditions. The TNF locus in the class III region of the MHC is also a good candidate gene cluster in autoimmune and inflammatory diseases, but because of the high degree of linkage disequilibrium across the MHC, it is difficult to determine which genes on a haplotype are important in the aetiology of a disease. Measurement of TNF-a in the supernatant of LPS and phytohemagglutinin stimulated mononuclear cells from HLA-DR-typed individuals have demonstrated a correlation of HLA-DR2 with low production (Bendtzen et al. (1988) Scand J Immunol 28:599-606; Ml61vig et al. (1988) Scand J Immunol 27:705-16; Jacob et al. (1990) Proc Natl Acad Sci USA 87:1233 37) and HLA-DR3 and -DR4 with high production (Jacob et al. (1990) Proc Natl Acad Sci USA 87:1233-37; Abraham et al. (1993) Clin Exp Immunol 92:14-18), suggesting that polymorphism may arise in the regulatory regions of the TNFA gene. In view of the chromosomal localization, the biological effects, its implication in chronic inflammation, and the phenotypic associations with HLA-DR alleles, it is likely that polymorphisms in the TNF locus may be involved in the pathogenesis, or clinical manifestations, of infectious and inflammatory diseases (Sinha et al. (199) Science 248:1380-88; Jacob (1992) Immunol Today 13:122-25). Indeed, tumor necrosis factor-a (TNF-a) has been implicated in the pathogenesis of several human diseases including systemic lupus erythematosis (Wilson et al. (1994) Eur J Immunol 24: 191-5 ), insulin-dependent diabetes mellitus (Cox et al. (1994) Diabetologia 37: 500-3), dermatitis herpetiformis (Wilson (1995) J Invest Dermatol 104:856-8), celiac disease (Mansfield et al. (1993) Gut 34: S20-23), and myasthenia gravis (Degli-Esposti et al. (1992) Immunogenetics 35: 355-64). The TNF-A gene locus lies in the class III region of the major histocompatibility complex (MHC) and so the association between a particular TNF polymorphism and a particular disease or disorder may result from linkage disequilibrium with particular MHC class III alleles. The haplotype HLA-A1-B8-DR3-DQ2, known as the "autoimmune haplotype" has been associated with a number of autoimmune diseases, including insulin dependent diabetes, Graves' disease, myastenia gravis, SLE, dermatitis herpetiformis and coeliac disease (Svejgaard et al. (1989) Genet Epidemiol 6: 1-14; Welch et al. (1988) Dis Markers 6: 247-55; Ahmed (1993) J Exp Med 178: 2067-75). A biallelic polymorphism at position -308 of the TNF alpha promoter has been studied in these diseases, since it has been shown that (a) -14- WO 00/60117 PCT/US00/08492 high TNF alpha production levels have been associated with particular DR3 and DR4 haplotypes (Pociot et al. (1993) Eur J Immunol 23: 224-31) and (b) that the TNF2 allele at -308 is carried on the autoimmune haplotype (Wilson et al. 1993) J Exp Med 177: 557-60). However, in all the diseases mentioned above, it has not been possible to demonstrate any association of TNF with disease independently of the association with the autoimmune haplotype. Nevertheless, not all diseases which have been associated with particular HLA polymorphisms show similar associations with a TNFA polymorphism. For example, rheumatoid arthritis, which is associated with certain HLA DR B alleles (Salmon et al. (1993) Br J Rheumatol 32: 628-30), does not appear to be associated with a particular TNFA polymorphic marker (Wilson et al. (1995) Ann Rheum Dis Ann Rheum Dis 54:601-3). Therefore it is probable that, in addition to serving as useful HLA-linked markers in this immunologically important region of human chromosome 6, certain TNF locus polymorphisms may actually directly contribute to the etiology of particular diseases. Furthermore, it seems that TNF does have an important role to play in infectious diseases; in a large study of patients with malaria in the Gambia, TNFA allele 2 homozygosity was strongly associated with death from cerebral malaria, and no association with clinical outcome was found with any other marker in the class I and II regions of the MHC (McGuire et al. (1994) Nature 371: 508-511). Investigations of other infectious diseases will be very interesting in this regard. The results from population-based association studies with candidate genes are useful for the confirmation of candidate gene status, and as a starting point for functional studies. Additional data is required to confirm linkage of the candidate gene region - involving family based studies to demonstrate segregation of the gene of interest with the disease. Once linkage is confirmed, linkage disequilibrium mapping can be carried out to fine-map the region of maximum association with the disease, for example using a panel of microsatellite markers spanning the region of interest for transmission disequilibrium testing (Copeman et al. (1995) Nature Genet 9: 80-85). A number of polymorphisms have been described in the TNF locus. Three RFLP's have been described in the LT-a gene. The uncommon allele of an NcoI RFLP (TNFBl1), the result of a single base change in the first intron, has been shown to be associated with a variant amino acid at position 26 of the mature protein and also with the HLA-A1-B8-DR3 haplotype (Messer et al. (1991) J Exp Med 173:209-19). The association of TNFB1 with phenotype is not clear; however, one study demonstrating association with high LT-ca production and no association with TNF-ca production (Messer et al. (1991) J Exp Med 173:209-19), while another demonstrated association with low TNF-ca production, except when it is found on the extended haplotype HLA-A1-B8-TNFB1-DR3-DQ2, when it is associated with high production (Pociot et al. (1993) Eur J Immunol 23:224-31). Two other RFLPs are known in the LT-ct gene: (a) a -15- WO 00/60117 PCT/US00/08492 rare EcoR1 RFLP generated as a result of a polymorphism in the untranslated region of the fourth exon, although its low carriage rate (1% in normal individuals) limits its use as a marker (Partanen et al. (1988) Scand J Immunol 28:313-16); and (2) anAsphl RFLP, due to a single base polymorphism in the first intron, which has also been described, the rare allele of which is in linkage disequilibrium with HLA-B7 (Ferencir et al. (1992) Eur J Immunogenet 19:425-30). Five microsatellites spanning the TNF locus have also been characterized (Udalova et al. (1993) Genomics 16:180-86) (Fig. 4). These involve a variable copy number of dinucleotide repeats. Two lie adjacent to each other, approximately 3.5 kb upstream of the LT-a gene; TNFA consists of a (CA), sequence and has 12 alleles. TNFB (CT), sequence has 7 alleles (Jongeneel et al. (1991) Proc Natl Acad Sci USA 88:9717-21). TNFc is a biallelic (CT)n sequence that lies in the first intron ofLT-a (Nedospasov et al. (1991) J Immunol 147:1053-59). TNFd and TNFe lie 8-10 kb downstream of the TNF-ct gene; both consist of(CT), sequences and have 7 and 3 alleles, respectively (Udalova et al. (1993) Genomics 16:180-86). Typing of these microsatellites and of the LT-a Ncol RFLP has defined at least 35 distinct TNF haplotypes, making these markets very useful in genetic analysis of the importance of this region in MHC related diseases. Furthermore, linkage disequilibrium has been demonstrated between microsatellite alleles and extended MHC haplotypes ((Jongeneel et al. (1991) Proc Natl Acad Sci USA 88:9717-21). Not surprisingly, in view of the association of TNF-a production with DR alleles, some have also been shown to be correlated with TNF-a production levels (Pociot et al. 91993) Eur J Immunol 23:224-31). Regulation of TNF production occurs at the transcriptional and post-transcriptional levels (Sariban et al. (1988) J. Clin Invest 81:1506-10). Sequences within the 5' DNA control the rate of transcription (Goldfeld et al. (1991) J Exp Med 174:73-81). This region of the gene was therefore investigated for polymorphisms and a biallelic polymorphism was discovered at -308 relative to the transcriptional start site involving the substitution of guanine by adenosine in the uncommon (TNF2) allele (Wilson et al. (1992) Hum Mol Genet 1:353). The TNF2 allele was found to be very strongly associated with HLA-Al-B8-DR3-DQ2 haplotype (Wilson et al. (1993) J Exp Med 177:577-560), raising the possibility that the association of this haplotype with autoimmune diseases and high TNF-a production may be related to polymorphism within the TNF-a locus. A second polymorphism has recently been described in the TNF-ca promoter region at -238, in a putative Y box (D'Alfonso et al. (1994) Immunogenetics 39:150-54), the rare allele of which in linkage disequilibrium with HLA-B 18 and -B57. As discussed above, a large number of studies have examined the importance of TNF genetics in susceptibility to autoimmune diseases. These have mostly involved comparison of the frequency of alleles between different cohorts of unrelated affected individuals and a "normal" control population. The advantage of this type of study is that DNA collections are easier to establish than in extended family studies or sib-pair analysis; however, it is very -16- WO 00/60117 PCT/US00/08492 important to ensure that the controls are ethnically similar to the affected group, individuals must also be rigorously clinically evaluated to exclude, as far as possible, disease heterogeneity (Lander et al. (1994) Science 265:2037-48). This is the most common type of study used in the examination of the MHC associations with autoimmune diseases. 1.9 Pathophysiolog', of ILD and IPF Normal functioning of the lungs is required for the exchange of oxygen and carbon dioxide between the bloodstream and the atmosphere. The lung is divided into a multitude of terminal respiratory units or acini at the end of the multiply branched terminal bronchioles. Acini contain minute respiratory bronchioles which in turn give off clusters of alveolar sacs that are formed of multiple alveoli. A cluster of three to five terminal bronchioles, each with its appended acini, is referred to as a pulmonary lobule. The architecture of the lung is vital to the function of gas exchange. The design of the respiratory tree is to permit gas exchange to occur at the alveolar level while protecting the terminal structures from airborne particles. The first line of defense in the respiratory tree is mechanical: cough and glottic closure protect the proximal respiratory tree. On the microscopic level, the bronchioles are lined with pseudostratified columnar, ciliated epithelial cells admixed with goblet cells adapted for the secretion of mucus. These cells are part of the lung's defense against inhaled particulate matter. Secreted mucus traps particles while the cilia fan the secretions up the tracheobronchial tree to be expelled. Repeated branching ofbronchioles render access to the distal alveoli more difficult. Particles reaching the alveoli, however, have eluded these mechanical barriers and must be handled by mechanisms that are part of the body's immune system. Immune mechanisms in the lung must function to aid in the elimination of pathogens while leaving intact the alveolar-level processes of gas exchange. The alveoli are intimately associated with a network of anastamosing capillaries that maximize the surface area for gas exchange. The alveolar walls or septae consist of structures derived from both capillary endothelium and respiratory epithelium. Beginning on the blood side, moving towards the air side, these structures include: 1) capillary endothelium; 2) a basement membrane and surrounding interstitial tissue between the vascular system and the respiratory system; 3) the alveolar epithelium; 4) pulmonary surfactant. Gas exchange takes place when the oxygen in the alveolus passes through its wall, to be taken up by the red blood cells in an adjacent capillary, a process that is coincident with the diffusion of dissolved carbon -17- WO 00/60117 PCT/US00/08492 dioxide from the bloodstream into the alveolus. The layers of the alveolar wall are organized to achieve these two gas exchange functions. Alveolar epithelium is made up of two main cell types: Type I pneumocytes, covering about 95% of the alveolar surface, and Type II pneumocytes. Type II pneumocytes have two important functions. These cells are the source of pulmonary surfactant, and they are responsible for the repair of the alveolar epithelium after it is damaged. Loosely attached to the alveolar epithelium or floating free within the alveolus are alveolar macrophages. The alveolar walls are perforated by numerous pores that permit solid and liquid material to pass readily between adjacent alveoli. ILDs are among the conditions affecting the interstitium between the alveolar wall and the capillary endothelium area. ILDs are characterized by a combination of inflammation and fibrosis. Alveolitis is understood to be the initial abnormality in ILD. Infiltrates of lymphocytes and plasma cells are observed early in the course of the disease. Soon after, there follows interstitial edema with the loss of Type I pulmonary epithelial cells and capillary endothelial cells. Desquamation may accompany these processes. Desquamation is defined as the state in which Type II pneumocytes and alveolar macrophages come to fill the alveolar lumen. Desquamation indicates active inflammation. Type II pneumocytes proliferate in areas where the lung damage is less severe and where there is less fibrosis. Cuboidal epithelial cells and metaplastic squamous epithelial cells regenerate the alveolar epithelium in areas that have been more severely damaged. As the damaged areas heal, there is an accumulation of fibroblasts and collagen within the alveolar septae. This results in the dense alveolar septal fibrosis that characterizes more advanced ILD. The presence of edema fluid within the alveolus and the alveolar wall impairs gas exchange by thickening the membrane through which gas molecules must travel. Similarly, the thickening of the alveolar wall with fibrosis leads to the same pathological problem. Furthermore, the distortion of lung architecture impairs lung mechanics so that ventilatory efficiency is compromised. The interaction of these factors results in the symptoms indicative of ILD. Varying combinations of inflammation, edema, fibrosis and architectural disruption characterize the different ILDs. IPF is understood to be one form of ILD. There are two histologically identifiable forms of IPF: UIP and DIP. DIP tends to be clinically milder, characterized pathologically by mild inflammation of the alveolar interstitium, preservation of the alveolar architecture and the presence of large numbers of macrophages in the alveolar air spaces. In UIP, the alveolar wall is thickened and the lung parenchyma is undergoing reorganization, with inflammatory cells and -18- WO 00/60117 PCT/US00/08492 fibrosis evident. DIP and UIP may represent different stages of the same disease process. The characteristic changes may be found in different places in the same specimen. Ultrastructural histopathology may help differentiate IPF from those ILD conditions associated with other etiologies, such as those ILDs associated with systemic rheumatologic disorders. Endothelial cell swelling and intracellular tuboreticular structures are seen in patients with systemic rheumatologic disorders and associated ILD; the tuboreticular structures are also seen in patients with viral pneumonia. These findings, however, are not observed in IPF patients. AIP is another form of ILD. Its course tends to be rapid, progressive and often fatal. It can be distinguished from IPF on the basis of routine histology. The histological changes found in AIP include intra-alveolar hyaline membranes, interstitial septal widening, endothelial and epithelial damage and cellular fibroblast proliferation without marked collagen deposition. These changes are also found in adult respiratory distress syndrome, which is known to resolve in many cases without permanent lung damage. AIP, however, frequently progresses to a condition of permanent fibrosis, as does IPF. In AIP, hyperplasia of the Type II pneumocytes typically takes place within the first few weeks of the disease. As the pneumocytes proliferate, the collapsed alveoli coalesce into a single thickened alveolar septum. Type I pneumocytes proliferate along the basement lamina of these alveolar septae, adding to their thickness. Intra-alveolar exudates further thicken the lung parenchyma. In AIP, there is a characteristic collapse of entire alveoli with apposition of their walls. The final histology of AIP resembles that seen in IPF, although their histopathologies are distinct in the earlier stages of the disorders. Regardless of the type of ILD, the earliest common pathological manifestation is alveolitis, understood herein to be an accumulation of inflammatory and immune effector cells within the alveolar spaces and walls. Inflammatory and immune effector cells within the lung consist mostly of macrophages, with lymphocytes, neutrophils and eosinophils also present. In alveolitis, macrophages and neutrophils predominate. The accumulation of leukocytes in alveolitis has two consequences: it distorts normal alveolar architecture, and it results in the release of mediators that can injure parenchymal cells and stimulate fibrosis. The initial stimulus for alveolitis in ILD can take a number of forms, including environmental inhalants, drug exposure, radiation and infection; the stimulus can also be unknown, as in IPF. The stimulus may have a direct toxic effect on the alveolar epithelium, the capillary endothelium or both, as is the case with certain chemicals, radiation and oxygen free radicals. Beyond this direct toxicity, though, the key event is the triggering of the sequence of inflammatory processes, including recruitment and activation of inflammatory and immune effector cells. The end stage -19- WO 00/60117 PCT/US00/08492 of these processes in ILD is a fibrotic lung in which the alveoli are replaced by cystic spaces separated by thick bands of connective tissue infiltrated with inflammatory cells. The two dominant cell types in the mediation of ILD are alveolar macrophages and neutrophils. Alveolar macrophages (AMs) have as their primary function the ingestion and elimination of foreign material that has entered the alveolus. They are part of the alveolar immune system. For example, they avidly bind particles opsonized by IgG or complement. Most AMs are derived from monocytes in the bloodstream. Bloodbomrne monocytes pass into the alveolar wall to become AMs. AMs are normally found in the alveolar tissues, comprising about 2-5% of the normal lung parenchyma. In contrast, neutrophils (PMNs) are rarely found in the alveoli or interstitium in healthy people. However, a large number of PMNs circulate through the extensively branching pulmonary vascular tree. Since these cells are larger than the red blood cells, they pass through alveolar capillaries more slowly. In response to chemoattractants, they readily move from the intravascular space to the interstitium. In response to inflammatory stimuli or in response to certain cytokines, AMs become activated. In the activated state, macrophages produce a large number of enzymes, cytokines and other inflammatory proteins. For example, activated AMs secrete complement components Cl q, C2, C3 and C5 that are essential for clearance of opsonized organisms and immune complexes. Important cytokines released by the activated macrophage include IL-1 and TNF, both of which have autocrine and paracrine effects. TNF provides auto-stimulation to monocytes and macrophages to maintain full activation. TNF further stimulates PMNs to full activation. The activated PMN may act as a primary phagocyte, responsible for ingesting and killing invading organisms. These cells may further release free oxygen radicals and lysosomal enzymes into the tissue fluid, causing extracellular killing of pathogens. Side-effects of the release of these cellular cytotoxic products include tissue necrosis, further inflammation and the activation of the coagulation cascade. More PMNs are attracted from adjacent microvessels by the release of complement cleavage products and TNF. As these PMNs marginate within the microvascular adjacent to the alveoli, they can cause endothelial damage, increased vascular permeability and subsequent exudation of cells and serum proteins into the tissue space. Furthermore, when activated, AMs secrete IL-1. In response to macrophage-derived IL-1, endothelial cells and fibroblasts secrete additional IL-1, thereby amplifying the inflammatory response. IL-1 induces the expression of adhesion molecules on the endothelial cells and is chemotactic for lymphocytes. IL- 1 is further understood to induce angiogenesis and fibrosis. The PMNs effects on the local microvessels increase their permeability, thereby increasing the fluid load in the lung parenchyma. Accompanying the fluid leakage into the -20- WO 00/60117 PCT/US00/08492 interstitium are the component proteins and cells for the process of fibrosis. First albumin and globulin become imbedded in the interstitium, then circulating fibroblasts are attracted into the tissues by the growth factors secreted by the AMs within the inflamed area. Fibroblasts, in turn, produce collagen, a protein that is the basis of scar tissue. Furthermore, certain AMs can be induced to differentiate in a different direction than the typical activated AM. This alternate differentiation pathway results in an AM with predominately secretory activity. Secretory AMs produce growth factors that are intended to aid in repair of tissue injuries. In the lung, however, they contribute to lung fibrosis by stimulating fibroblast recruitment and collagen production. Mesenchymal cells of the interstitium, considered to be incompletely differentiated AMs, synthesize type I collagen, type III collagen, fibronectin and other matrix proteins found in fibrotic lungs. These cells are more numerous in IPF, and their synthetic products are altered. They are thought to contribute to the interstitial accumulation of fibrous tissue in IPF and related conditions. The lung damage in ILD and in IPF is produced by both AMs and PMNs. It is thought that interactions among the AMs and PMNs, with the release of their cytokines and other active substances, play an important role both in slowly progressive pulmonary fibrosis and in the more fulminant conditions. The inflammatory effects of these cellular mechanisms combine with the processes of fibroplasia to result in the alveolar damage and architectural distortion that characterizes ILDs in general and IPF in particular. Macrophages directly damage lung parenchyma by the release of their activated products such as free oxygen radicals. Further, activated AMs attract and activate PMNs and other inflammatory cells. They release chemotactic factors for PMNs such as leukotriene B4, growth factors for fibroblasts such as fibronectin, platelet derived growth factor and insulin-like growth factor, and proinflammatory cytokines. Macrophages release both IL-lbeta and its specific inhibitor, IL-1Ra. It is understood that the IL-lbeta/IL-1Ra ratio is increased in patients with IPF, providing a proinflammatory environment. PMNs directly damage lung tissue in multiple ways. Their presence in bronchioalveolar lavage fluid has been correlated with a poor prognosis in IPF. Once activated, PMNs release several cytotoxic substances, including oxidants, proteinases such as collagenase, and products of lipid peroxidation. The reactive products of respiratory oxygenation (superoxide, hydrogen peroxide, hydroxyl radicals and hypochlorous acid) react with essentially all cellular components, causing denaturation and cross-linkage of proteins, changes in membrane permeability and damage to nucleic acids and cellular organelles. Proteolytic enzymes released by PMNs such as elastase and metalloproteinase can digest all the -21- WO 00/60117 PCT/US00/08492 architectural components of the lung interstitium. Neutrophil oxidants act synergistically with these enzymes, heightening local tissue damage. Hypochlorous acid, for example, inactivates the proteolytic inhibitors like alpha-1 antitryptase that would otherwise check the action of neutrophil elastase. Oxidation products activate neutrophil collagenase. Lipid peroxidation products cause changes in vascular permeability. These substances, further, are chemotactic for neutrophils and lymphocytes. Thus, the inflammatory cycle controlled by PMNs is auto amplifying. 2. SUMMARY OF THE INVENTION In one aspect, the present invention provides novel methods for identifying whether a patient has or is predisposed to developing an interstitial lung disorder (ILD), such as, but not limited to, IPF. In one embodiment, the method comprises determining whether an ILD associated allele is present in a nucleic acid sample obtained from the subject. In a preferred embodiment, the ILD associated allele is IL-1RN (+2018) allele 2, TNFA (-308) allele 2, or alternatively a nucleic acid sequence that is in linkage disequilibrium with IL-1RN (+2018) allele 2 or TNFA (-308). The ILD associated allele can be detected by any of a variety of techniques including: 1) performing a hybridization reaction between a nucleic acid sample and a probe that is capable of hybridizing to an ILD associated allele; 2) sequencing at least a portion of an ILD associated allele; or 3) determining the electrophoretic mobility of an ILD associated allele or fragment thereof (e.g., fragments generated by endonuclease digestion). The allele can optionally be subjected to an amplification step prior to performance of the detection step. Preferred amplification steps are selected from the group consisting of: the polymerase chain reaction (PCR), the ligase chain reaction (LCR), strand displacement amplification (SDA), cloning, and variations of the above (e.g. RT-PCR and allele specific amplification). Primers for amplification may be selected to either flank the marker of interest (as required for PCR amplification) or directly overlap the marker (as in ASO hybridization). Oligonucleotides primers that hybridize to 11-1 and TNFA genes can easily be selected with commercially available primer selection programs. In a particularly preferred embodiment, the sample is hybridized with a set of primers, which hybridize 5' and/or 3' in a sense or antisense sequence to the ILD associated allele, and is subjected to a PCR amplification. In another aspect, the invention features kits for performing the above-described assays. The kit can include nucleic acid sample collection means and a means for determining -22- WO 00/60117 PCT/US00/08492 whether a subject carries an ILD associated allele. The kit may also comprise control samples, either negative or positive, or standards. The kit may also include an algorithmic device for assessing identity match. The algorithmic device may be used in conjunction with controls, or may be used independently of controls. The kits of the invention may also contain a variety of additional components such as a DNA amplification reagent, a polymerase, a nucleic acid purification reagent, a restriction enzyme, a restriction enzyme buffer, a nucleic acid sampling device, deoxynucleotides (dNTPs), and the like. Information obtained using the assays and kits described herein (alone or in conjunction with information on another genetic defect or environmental factor, which contributes to an ILD) is useful for determining whether a non symptomatic subject has or is likely to develop ILD, or more generally, a disease or condition that is caused by or contributed to by the allelic pattern detected. In addition, the information alone or in conjunction with information on another genetic defect contributing to ILD allows customization of therapy for preventing the onset of symptoms associated with ILD, or for preventing the progression of the disease to end-stage, irreversible fibrosis. For example, this information can enable a clinician to: 1) more effectively prescribe a therapeutic that will address the molecular basis of ILD; and 2) better determine the appropriate dosage of a particular therapeutic for a particular subject In yet a further aspect, the invention features methods for treating or preventing the development of an ILD in a subject, by administering to the subject, a pharmaceutically effective amount of an ILD therapeutic of the invention. In still another aspect, the invention provides in vitro and in vivo assays for screening test compounds to identify ILD therapeutics. In one embodiment, the screening assay comprises contacting a cell transfected with an ILD causative mutation that is operably linked to an appropriate promoter with a test compound and determining the level of expression of a protein in the cell in the presence and in the absence of the test compound. In a preferred embodiment, the ILD causative mutation results in decreased production of IL- 1 receptor antagonist, and increased production of the IL-1 receptor antagonist or TNF-a in the presence of the test compound indicates that the compound is an agonist of IL-1 receptor antagonist or TNF-a activity. In another embodiment, the invention features transgenic non-human animals and their use in identifying antagonists of IL-l a, IL-1 3 or TNF-a activity or agonists of IL-1Ra activity. Other features and advantages of the invention will be apparent from the following detailed description and claims. -23- WO 00/60117 PCT/US00/08492 3. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the nucleic acid sequence for IL-1A (GEN X03833; SEQ ID No. 1). FIG. 2 shows the nucleic acid sequence for IL-1B (GEN X04500; SEQ ID No. 2). FIG. 3 shows the nucleic acid sequence for the secreted IL-1RN (GEN X64532; SEQ ID No. 3). FIG.4 shows the nucleic acid sequence for TNF-A (GenBank Accession Nos. X02910, X02159, SEQ ID NO. 4). The position of allelic form 1 of the TNF-A (-308) polymorphism is indicated by a lower case "g" in bold at position 308 (allele 2 corresponds to "A" at this position). Sequences complementary to the primers used in TNF-A (-308) polymorphism typing experiments are underlined. The position of allelic form 1 of the TNF-A (-238) polymorphism is indicated by a lower case "g" in bold at position 378 (allele 2 corresponds to "A" at this position). Sequences complementary to the primers used in TNF-A (-238) polymorphism typing experiments correspond to nucleotide residues 190 to 212 (forward primer) and 379 to 399 (reverse primer). 4. DETAILED DESCRIPTION OF THE INVENTION 4.1 Definitions For convenience, the meaning of certain terms and phrases employed in the specification, examples and appended claims are provided below. In addition, these terms and phrases should be understood in relation to the specification as a whole. The term "allele" refers to the different sequence variants found at different polymorphic sites in DNA obtained from a subject. For example, IL-1RN (VNTR) has at least five different alleles. The sequence variants may be single or multiple base changes, including without limitation insertions, deletions, or substitutions, or may be a variable number of sequence repeats. Allelic variants at a certain locus are commonly numbered in decreasing order of frequency. In a biallelic situation the frequent allele is allele 1, the rarer allele will be allele 2. 2/2 - Refers to the homozygous allele 2/allele 2 state. 2/1 - Refers to the heterozygous allele 2/allele 1 state. -24- WO 00/60117 PCT/US00/08492 The term "allelic pattern" refers to the identity of an allele or alleles at one or more polymorphic sites. For example, an allelic pattern may consist of a single allele at a polymorphic site, as for IL-1RN (+2018) allele 1, which is an allelic pattern having at least one copy of IL-1RN allele 1 at position +2018 of the IL-1RN gene loci. Alternatively, an allelic pattern may consist of either a homozygous or heterozygous state at a single polymorphic site. For example, IL1-RN (VNTR) allele 2,2 is an allelic pattern in which there are two copies of the second allele at the VNTR marker of IL-1RN and that corresponds to the homozygous IL-RN (VNTR) allele 2 state. Alternatively, an allelic pattern may consist of the identity of alleles at more than one polymorphic site. The term "antibody " as used herein is intended to refer to a binding agent including a whole antibody or a binding fragment thereof which is specifically reactive with an IL-1 or TNFu polypeptide. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab) 2 fragments can be generated by treating an antibody with pepsin. The resulting F(ab) 2 fragment can be treated to reduce disulfide bridges to produce Fab fragments. The antibody of the present invention is further intended to include bispecific, single-chain, and chimeric and humanized molecules having affinity for an IL-1 or TNFa polypeptide conferred by at least one CDR region of the antibody. "Biological activity" or "bioactivity" or "activity" or "biological function", which are used interchangeably, for the purposes herein means an effector or antigenic function that is directly or indirectly performed by an IL-1 or TNFu polypeptide (whether in its native or denatured conformation), or by any subsequence thereof. Biological activities include binding to a target peptide, e.g., a receptor. A bioactivity can be modulated by directly affecting the polypeptide. Alternatively, a bioactivity can be modulated by modulating the level of a polypeptide, such as by modulating expression of the gene encoding the polypeptide. As used herein the term "bioactive fragment" refers to a fragment of a full-length polypeptide, wherein the fragment specifically mimics or antagonizes the activity of a wild-type polypeptide. The bioactive fragment preferably is a fragment capable of interacting with a receptor. The term "an aberrant activity" refers to an activity which differs from the activity of the wild-type or native polypeptide or which differs from the activity of the polypeptide in a healthy subject. An activity of a polypeptide can be aberrant because it is stronger than the activity of its native counterpart. Alternatively, an activity can be aberrant because it is weaker or absent relative to the activity of its native counterpart. An aberrant activity can also be a -25- WO 00/60117 PCT/US00/08492 change in an activity. For example an aberrant polypeptide can interact with a different target peptide. "Cells", "host cells" or "recombinant host cells" are terms used interchangeably herein to refer not only to the particular subject cell, but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact be identical to the parent cell, but is still included within the scope of the term as used herein. A "chimera," "mosaic," "chimeric mammal" and the like, refers to a transgenic animal, which has a knock-out or knock-in construct in at least some of its genome-containing cells. The terms "control" or "control sample" refer to any sample appropriate to the detection technique employed. The control sample may contain the products of the allele detection technique employed or the material to be tested. Further, the controls may be positive (e.g., IL-lRN (+2018) allele 2 or TNFA (-308) allele 2) or negative (e.g., allele 1 of the described marker) controls. By way of examples of end product controls, where the allele detection technique is PCR amplification, followed by size fractionation, the control sample may comprise DNA fragments of the appropriate size. Likewise, where the allele detection technique involves detection of a mutated protein, the control sample may comprise a sample of mutant protein. However, it is preferred that the control sample comprise the material to be tested. For example, the controls may be a sample of genomic DNA or a cloned portion of the IL-1 gene cluster. However, where the sample to be tested is genomic DNA, the control sample is preferably a highly purified sample of genomic DNA. The phrases "disruption of the gene" and "targeted disruption" or any similar phrase refers to the site specific interruption of a native DNA sequence so as to prevent expression of that gene in the cell as compared to the wild-type copy of the gene. The interruption may be caused by deletions, insertions or modifications to the gene, or any combination thereof. "Genotyping" refers to the analysis of an individual's genomic DNA (or a nucleic acid corresponding thereto) to identify a particular disease causing or contributing mutation or polymorphism, directly or based on detection of a mutation or polymorphism (a marker) that is in linkage disequilibrium with the disease causing or contributing gene. The term "haplotype" refers to a set of alleles that are inherited together as a group (are in linkage disequilibrium). As used herein, haplotype is defined to include those haplotypes that occur at statistically significant levels (pco, < 0.05). As used herein, the phrase an "IL-1 -26- WO 00/60117 PCT/US00/08492 haplotype" refers to a haplotype in the IL-1 loci and a "TNFA haplotype" refers to a haplotype in the TNFA loci. The term "interstitial lung disease (ILD)" refers to that group of lung disorders of both known and unknown etiology that are characterized by parenchymal inflammation and fibrosis. The primary pathological locus of these conditions is the interstitial tissue in the alveolar wall between the alveolar epithelium and the capillary endothelium, although the pathological changes in these disorders are not limited to the interstitium. This term includes, but is not limited to those disorders selected from the group consisting of acute interstitial pneumonitis, pulmonary fibrosis, idiopathic pulmonary fibrosis, usual interstitial pneumonitis, desquamative interstitial pneumonitis, bronchiolitis obliterans organizing pneumonia, mineral exposure pneumonitis and fibrosis (silicosis, asbestosis, berylliosis, coal dust pneumoconiosis, hard metal pneumoconiosis), post-adult respiratory distress syndrome fibrosis, hypersensitivity pneumonitis, drug-related pneumonitis, radiation-exposure pneumonitis, oxygen-exposure pneumonitis, sarcoidosis, Goodpasture's syndrome, idiopathic pulmonary hemosiderosis, eosinophilic pneumonia, histiocytosis X, giant cell pneumonitis, lymphocytic interstitial pneumonitis, and the inflammatory/fibrotic manifestations of systemic rheumatic disorders. The term may also encompass other interstitial lung disorders. These include, but are not limited to individuals who are at risk of developing lung disease which is histologically similar to IPF, such as patients with connective tissue diseases, (e.g., SLE, systemic sclerosis); patients being considered for treatment with chemotherapeutic agents or the anti-arrhythmic amiodarone; and individuals at risk for occupational exposure (e.g. asbestos or certain dusts), extrinsic allergic alveolitis - sarcoidosis (where high levels of IL-1RN are expressed within granulomas); chronic inflammatory lung diseases; adult respiratory distress syndrome (ARDS, low concentrations of IL-1RN in bronchoalveolar lavage samples have been shown to be associated with poor prognosis in patients with ARDS); pulmonary embolic diseases, especially the resolution of repeated pulmonary emboli of any type; infectious lung diseases such as tuberculosis (mycobacterial), mycoplasmal, bacterial, viral, protozoan, helminthic and other lung infections associated with an inflammatory response; and reactivity to lung irritants. An "ILD associated allele" refers to an allele whose presence in a subject indicates that the subject is susceptible to developing interstitial lung disease. Examples of ILD associated alleles include allele 2 of the +2018 marker of IL-1RN (contains an Msp 1 site); allele 2 of the -308 marker of TNFA (is not cut by Nco I), allele 2 of the VNTR marker of IL-1RN (240 bp PCR product); allele 4 of the 222/223 marker of IL-1A (132 mobility units (mu) PCR product); allele 4 of the gz5/gz6 marker of IL-1A (91 mu PCR product); allele 1 of the -889 marker of IL-1A -27- WO 00/60117 PCT/US00/08492 (contains an NcoI site); allele 1 of the +3954 marker of IL-1B contains two TaqI sites); allele 2 of the -511 marker of IL-1B (contains a Bsu36I site); allele 3 of the gaat.p33330 marker (197 mu PCR product); and allele 3 of the Y31 marker (160 mu PCR product); allele 2 of the 1731 marker of the IL-1RN gene (A at position 1731); allele 2 of the 1812 marker of the IL-1RN gene (A at position 1812); allele 2 of the 1868 marker of the IL-1RN gene (G at position 1868); allele 2 of the 1887 marker of the IL-1RN gene (C at position 1887); allele 2 of the 8006 marker of the IL 1RN gene (contains an HpaII or MspI site), allele 2 of the 8061 marker of the IL1-RN gene (lacks an MwoI site) and allele 2 of the 9589 marker of the IL-1RN gene (contains an SspI site), and allele 2 TNF(-308). An "ILD causative functional mutation" refers to a mutation which causes or contributes to the development of interstitial lung disease in a subject. Preferred mutations occur within the IL-1 complex or TNF-A. An ILD causative functional mutation occurring within an IL-1 gene (e.g. IL-1A, IL-1B or IL-1RN) a TNA A gene or a gene locus, which is linked thereto, may alter, for example, the open reading frame or splicing pattern of the gene, thereby resulting in the formation of an inactive or hypoactive gene product. For example, a mutation which occurs in intron 6 of the IL-1A locus corresponds to a variable number of tandem repeat 46 bp sequences corresponding to from five to 18 repeat units (Bailly, et al. (1993) Eur. J. Immunol. 23: 1240-45). These repeat sequences contain three potential binding sites for transcriptional factors: an SP1 site, a viral enhancer element, and a glucocorticoid-responsive element; therefore individuals carrying IL-1A intron 6 VNTR alleles with large numbers of repeat units may be subject to altered transcriptional regulation of the IL- 1A gene and consequent perturbations of inflammatory cytokine production. Indeed, there is evidence that increased repeat number at this polymorphic IL-1A locus leads to decreased IL-la synthesis (Bailly et al. (1996) Mol Immunol 33: 999-1006). Alternatively, a mutation can result in a hyperactive gene product. For example, allele 2 of the IL-1B (G at +6912) polymorphism occurs in the 3' UTR (untranslated region) of the IL-1B mRNA and is associated with an approximately four-fold increase in the steady state levels of both IL-1B mRNA and IL-1B protein compared to those levels associated with allele 1 of the IL 1B gene (C at +6912). Further, an IL-1B (-511) mutation occurs near a promoter binding site for a negative glucocorticoid response element (Zhang et al. (1997) DNA Cell Biol 16: 145-52). This element potentiates a four-fold repression of IL-1B expression by dexamethosone and a deletion of this negative response elements causes a 2.5-fold increase in IL-1B promoter activity. The IL IB (-511) polymorphism may thus directly affect cytokine production and inflammatory responses. These examples demonstrate that genetic variants occurring in the IL-1A or IL-1B gene can directly lead to the altered production or regulation of IL-1 cytokine activity. -28- WO 00/60117 PCT/US00/08492 An "ILD therapeutic" refers to any agent or therapeutic regimen (including pharmaceuticals, nutraceuticals and surgical means) that prevents or postpones the development of or alleviates the symptoms of an interstitial lung disease in a subject. An ILD therapeutic can be a polypeptide, peptidomimetic, nucleic acid or other inorganic or organic molecule, preferably a "small molecule" including vitamins, minerals and other nutrients. Preferably an ILD therapeutic can modulate at least one activity of an IL-1 and/or TNF-a polypeptide, e.g., interaction with a receptor, by mimicking or potentiating (agonizing) or inhibiting (antagonizing) the effects of a naturally-occurring polypeptide. An agonist can be a wild-type protein or derivative thereof having at least one bioactivity of the wild-type, e.g., receptor binding activity. An agonist can also be a compound that upregulates expression of a gene or which increases at least one bioactivity of a protein. An agonist can also be a compound which increases the interaction of a polypeptide with another molecule, e.g., a receptor. An antagonist can be a compound which inhibits or decreases the interaction between a protein and another molecule, e.g., a receptor or an agent that blocks signal transduction or post-translation processing (e.g., IL I converting enzyme (ICE) inhibitors). Accordingly, a preferred antagonist is a compound which inhibits or decreases binding to a receptor and thereby blocks subsequent activation of the receptor. An antagonist can also be a compound that downregulates expression of a gene or which reduces the amount of a protein present. The antagonist can be a dominant negative form of a polypeptide, e.g., a form of a polypeptide which is capable of interacting with a target peptide, e.g., a receptor, but which does not promote the activation of the receptor. The antagonist can also be a nucleic acid encoding a dominant negative form of a polypeptide, an antisense nucleic acid, or a ribozyme capable of interacting specifically with an RNA. Yet other antagonists are molecules which bind to a polypeptide and inhibit its action. Such molecules include peptides, e.g., forms of target peptides which do not have biological activity, and which inhibit binding to receptors. Thus, such peptides will bind the active site of a protein and prevent it from interacting with target peptides. Yet other antagonists include antibodies interacting specifically with an epitope of a molecule, such that binding interferes with the biological function of the polypeptide. In yet another preferred embodiment, the antagonist is a small molecule, such as a molecule capable of inhibiting the interaction between a polypeptide and a target receptor. Alternatively, the small molecule can function as an antagonist by interacting with sites other than the receptor binding site. An antagonist can be any class of molecule, including a nucleic acid, protein, carbohydrate, lipid or combination thereof, but for therapeutic purposes is preferably a small molecule. Preferred ILD therapeutics include: corticosteroids (e.g. -29- WO 00/60117 PCT/US00/08492 prednisone and methylprednisone), cyclophosphamide (e.g. cytoxan), colchicine, azathioprine (e.g Imuran), methotrexate, penicillamine, cyclosporine and other immunosuppressive agents (e.g. chlorambucil and vincristine sulfate). "Idiopathic pulmonary fibrosis (IPF)" refers generally to those pulmonary disorders characterized by diffuse interstitial inflammation and fibrosis for which no underlying causative disease process can be identified. As used herein, this term refers to a discrete syndrome wherein symptoms of respiratory difficulty are observed, accompanied in advanced cases by hypoxemia and cyanosis with secondary pulmonary hypertension. Lung histopathology reveals septal fibrosis, that constitutes a significant physiological alveolocapillary block. Morphological changes in the lung vary according to the stage of the disease. In the early stages, the lungs are grossly firm in consistency with microscopic findings of pulmonary edema, intra alveolar exudation, hyaline membranes, alveolar septal mononuclear infiltration, and hyperplasia of Type II pneumocytes which appear as cuboidal or columnar cells lining the alveolar spaces. As the disease advances, the intra-alveolar exudate organizes into fibrous tissue, and fibrosis and inflammation lead to a thickening of the intra-alveolar septae. Grossly, the lungs are solid with alternating areas of fibrosis and normal lung consistency. At the end stage of the disease, the lung consists of spaces lined by cuboidal or columnar epithelium separated by inflammatory fibrous tissue. Lymphoid hyperplasia and intimal thickening of the pulmonary arteries can also be seen. Since these pathological changes are not specific to IPF, but rather reflect the changes seen in many different advanced ILDs, the diagnosis of IPF requires excluding the known causes of these pathological changes. IPF is understood to represent a stereotyped inflammatory response of the alveolar wall to injuries of different types, durations or intensities (Kobzik and Schoen, "The lung," pp. 673-734 in Robbins' Pathological Basis of Disease, eds. Coltran et al. (Philadelphia: W.B. Saunders, 1994) at 714). The initiating injury results in interstitial edema with the accumulation of inflammatory cells, a condition generally termed alveolitis. The Type I membranous pneumocyte is commonly injured by these processes. The Type II pneumocytes then proliferate in an attempt to reconstitute the alveolar epithelial lining. Fibroblasts enter the area as part of the region's attempt to heal the injured area. Fibroplasia in the interalveolar septae and IN the intra-alveolar exudate results in the obliteration of the normal pulmonary architecture. The terms "IL-1 gene cluster" and "IL-1 loci" as used herein include all the nucleic acid at or near the 2q13 region of chromosome 2, including at least the IL-1 A, IL-1B and IL-1 RN genes and any other linked sequences. (Nicklin et al., Genomnics 19: 382-84, 1994). The terms "IL-1A", "IL-1B", and "IL-1RN" as used herein refer to the genes coding for IL-1 , IL-1 , and -30- WO 00/60117 PCT/US00/08492 IL-1 receptor antagonist, respectively. The gene accession number for IL-1 A, IL-1B, and IL-1RN are X03833, X04500, and X64532, respectively. "IL-1 functional mutation" refers to a mutation within the IL-1 gene cluster that results in an altered phenotype (i.e. effects the function of an IL-1 gene or protein). Examples include: IL IA(+4845) allele 2, IL-1B (+3954) allele 2, IL-1B (+6912) allele 2 and IL-1RN (+2018) allele 2. "IL-1X (Z) allele Y " refers to a particular allelic form, designated Y, occurring at an IL-1 locus polymorphic site in gene X, wherein X is IL-1A, B, or RN or some other gene in the IL-1 gene loci, and positioned at or near nucleotide Z, wherein nucleotide Z is numbered relative to the major transcriptional start site, which is nucleotide +1, of the particular IL-1 gene X. As further used herein, the term "IL-1X allele (Z)" refers to all alleles of an IL-1 polymorphic site in gene X positioned at or near nucleotide Z. For example, the term "IL-1RN (+2018) allele" refers to alternative forms of the IL-1RN gene at marker +2018. "IL-1RN (+2018) allele 1" refers to a form of the IL-1RN gene which contains a cytosine (C) at position +2018 of the sense strand. Clay et al., Hum. Genet. 97:723-26, 1996. "IL-1RN (+2018) allele 2" refers to a form of the IL 1RN gene which contains a thymine (T) at position +2018 of the plus strand. When a subject has two identical IL-1RN alleles, the subject is said to be homozygous, or to have the homozygous state. When a subject has two different IL-1RN alleles, the subject is said to be heterozygous, or to have the heterozygous state. The term "IL-1RN (+2018) allele 2,2" refers to the homozygous IL-1 RN (+2018) allele 2 state. Conversely, the term "IL-1RN (+2018) allele 1,1" refers to the homozygous IL-1 RN (+2018) allele 1 state. The term "IL-1RN (+2018) allele 1,2" refers to the heterozygous allele 1 and 2 state. "IL-1 related" as used herein is meant to include all genes related to the human IL 1 locus genes on human chromosome 2 (2q 12-14). These include IL-1 genes of the human IL-1 gene cluster located at chromosome 2 (2q 13-14) which include: the IL-1A gene which encodes interleukin- la, the IL- 1B gene which encodes interleukin-1 3, and the IL- 1RN (or IL- Ira) gene which encodes the interleukin-1 receptor antagonist. Furthermore these IL-1 related genes include the type I and type II human IL-1 receptor genes located on human chromosome 2 (2q12) and their mouse homologs located on mouse chromosome 1 at position 19.5 cM. Interleukin-1 c, interleukin-13, and interleukin-1RN are related in so much as they all bind to IL-1 type I receptors, however only interleukin- 1 c and interleukin-1 3 are agonist ligands which activate IL-1 type I receptors, while interleukin- 1 RN is a naturally occurring antagonist ligand. Where the term "IL- 1" is used in reference to a gene product or polypeptide, it is meant to refer to all gene products encoded by the interleukin-1 locus on human chromosome 2 -31- WO 00/60117 PCT/US00/08492 (2q 12-14) and their corresponding homologs from other species or functional variants thereof. The term IL-1 thus includes secreted polypeptides which promote an inflammatory response, such as IL- Ia and IL-1 3, as well as a secreted polypeptide which antagonize inflammatory responses, such as IL-1 receptor antagonist and the IL-1 type II (decoy) receptor. An "IL-1 receptor" or "IL-1R" refers to various cell membrane bound protein receptors capable of binding to and/or transducing a signal from IL-1 locus-encoded ligand. The term applies to any of the proteins which are capable of binding interleukin-1 (IL-1) molecules and, in their native configuration as mammalian plasma membrane proteins, presumably play a role in transducing the signal provided by IL-1 to a cell. As used herein, the term includes analogs of native proteins with IL-1-binding or signal transducing activity. Examples include the human and murine IL-1 receptors described in U.S. Patent No. 4,968,607. The term "IL-1 nucleic acid" refers to a nucleic acid encoding an IL-1 protein. An "IL-1 polypeptide" and "IL-1 protein" are intended to encompass polypeptides comprising the amino acid sequence encoded by the IL-1 genomic DNA sequences shown in Figures 1, 2, and 3, or fragments thereof, and homologs thereof and include agonist and antagonist polypeptides. "Increased risk" refers to a statistically higher frequency of occurrence of the disease or condition in an individual carrying a particular polymorphic allele in comparison to the frequency of occurrence of the disease or condition in a member of a population that does not carry the particular polymorphic allele. The term "interact" as used herein is meant to include detectable relationships or associations (e.g. biochemical interactions) between molecules, such as interactions between protein-protein, protein-nucleic acid, nucleic acid-nucleic acid and protein-small molecule or nucleic acid-small molecule in nature. The term "isolated" as used herein with respect to nucleic acids, such as DNA or RNA, refers to molecules separated from other DNAs, or RNAs, respectively, that are present in the natural source of the macromolecule. For example, an isolated nucleic acid encoding one of the subject IL-1 polypeptides preferably includes no more than 10 kilobases (kb) of nucleic acid sequence which naturally immediately flanks the IL-1 gene in genomic DNA, more preferably no more than 5kb of such naturally occurring flanking sequences, and most preferably less than 1.5kb of such naturally occurring flanking sequence. The term isolated as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an "isolated nucleic acid" is meant to include -32- WO 00/60117 PCT/US00/08492 nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. A "knock-in" transgenic animal refers to an animal that has had a modified gene introduced into its genome and the modified gene can be of exogenous or endogenous origin. A "knock-out" transgenic animal refers to an animal in which there is partial or complete suppression of the expression of an endogenous gene (e.g, based on deletion of at least a portion of the gene, replacement of at least a portion of the gene with a second sequence, introduction of stop codons, the mutation of bases encoding critical amino acids, or the removal of an intron junction, etc.). A "knock-out construct" refers to a nucleic acid sequence that can be used to decrease or suppress expression of a protein encoded by endogenous DNA sequences in a cell. In a simple example, the knock-out construct is comprised of a gene, such as the IL-1RN gene, with a deletion in a critical portion of the gene so that active protein cannot be expressed therefrom. Alternatively, a number of termination codons can be added to the native gene to cause early termination of the protein or an intron junction can be inactivated. In a typical knock-out construct, some portion of the gene is replaced with a selectable marker (such as the neo gene) so that the gene can be represented as follows: IL-1RN 5'/neo/ IL-1RN 3', where IL 1RN5' and IL-1RN 3', refer to genomic or cDNA sequences which are, respectively, upstream and downstream relative to a portion of the IL-1RN gene and where neo refers to a neomycin resistance gene. In another knock-out construct, a second selectable marker is added in a flanking position so that the gene can be represented as: IL-1RN/neo/IL-1RN/TK, where TK is a thymidine kinase gene which can be added to either the IL-1RN5' or the IL-1RN3' sequence of the preceding construct and which further can be selected against (i.e. is a negative selectable marker) in appropriate media. This two-marker construct allows the selection of homologous recombination events, which removes the flanking TK marker, from non-homologous recombination events which typically retain the TK sequences. The gene deletion and/or replacement can be from the exons, introns, especially intron junctions, and/or the regulatory regions such as promoters. "Linkage disequilibrium" refers to co-inheritance of two alleles at frequencies greater than would be expected from the separate frequencies of occurrence of each allele in a given control population. The expected frequency of occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in "linkage equilibrium". The cause -33- WO 00/60117 PCT/US00/08492 of linkage disequilibrium is often unclear. It can be due to selection for certain allele combinations or to recent admixture of genetically heterogeneous populations. In addition, in the case of markers that are very tightly linked to a disease gene, an association of an allele (or group of linked alleles) with the disease gene is expected if the disease mutation occurred in the recent past, so that sufficient time has not elapsed for equilibrium to be achieved through recombination events in the specific chromosomal region. When referring to allelic patterns that are comprised of more than one allele, a first allelic pattern is in linkage disequilibrium with a second allelic pattern if all the alleles that comprise the first allelic pattern are in linkage disequilibrium with at least one of the alleles of the second allelic pattern. An example of linkage disequilibrium is that which occurs between the alleles at the IL-1RN (+2018) and IL-1RN (VNTR) polymorphic sites. The two alleles at IL-1RN (+2018) are 100% in linkage disequilibrium with the two most frequent alleles of IL-1RN (VNTR), which are allele 1 and allele 2. The term "marker" refers to a sequence in the genome that is known to vary among individuals. For example, the IL-1RN gene has a marker that consists of a variable number of tandem repeats (VNTR). The marker IL-1RN (+2018) as described herein can be used for identification of propensity to develop ILD. A "mutated gene" or "mutation" or "functional mutation" refers to an allelic form of a gene, which is capable of altering the phenotype of a subject having the mutated gene relative to a subject which does not have the mutated gene. The altered phenotype caused by a mutation can be corrected or compensated for by certain agents. If a subject must be homozygous for this mutation to have an altered phenotype, the mutation is said to be recessive. If one copy of the mutated gene is sufficient to alter the phenotype of the subject, the mutation is said to be dominant. If a subject has one copy of the mutated gene and has a phenotype that is intermediate between that of a homozygous and that of a heterozygous subject (for that gene), the mutation is said to be co-dominant. A "non-human animal" of the invention includes mammals such as rodents, non human primates, sheep, dogs, cows, goats, etc. Preferred non-human animals are selected from the rodent family including rat and mouse, most preferably mouse, though transgenic amphibians, such as members of the Xenopus genus, and transgenic chickens can also provide important tools for understanding and identifying agents which can affect, for example, embryogenesis and tissue formation. The term "chimeric animal" is used herein to refer to animals in which the recombinant gene is found, or in which the recombinant gene is expressed in some but not all cells of the animal. The term "tissue-specific chimeric animal" indicates that one of the recombinant IL-1 genes is present and/or expressed or disrupted in some tissues but not others. -34- WO 00/60117 PCT/US00/08492 The term "non-human mammal" refers to any members of the class Mammalia, except for humans. As used herein, the term "nucleic acid" refers to polynucleotides or oligonucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs (e.g. peptide nucleic acids) and as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides. The term "polymorphism" refers to the coexistence of more than one form of a gene or portion (e.g., allelic variant) thereof. A portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymorphic region of a gene". A specific genetic sequence at a polymorphic region of a gene is an allele. A polymorphic region can be a single nucleotide, the identity of which differs in different alleles. A polymorphic region can also be several nucleotides long. The term "propensity to disease," also "predisposition" or "susceptibility" to disease or any similar phrase, means that certain alleles are hereby discovered to be associated with or predictive of ILD. The alleles are thus over-represented in frequency in individuals with disease as compared to healthy individuals. Thus, these alleles can be used to predict disease even in pre-symptomatic or pre-diseased individuals. "Small molecule" as used herein, is meant to refer to a composition, which has a molecular weight of less than about 5kD and most preferably less than about 4kD. Small molecules can be nucleic acids, peptides, peptidomimetics, carbohydrates, lipids or other organic or inorganic molecules. As used herein, the term "specifically hybridizes" or "specifically detects" refers to the ability of a nucleic acid molecule to hybridize to at least approximately 6 consecutive nucleotides of a sample nucleic acid. "Systemic rheumatologic disorder" refers to a disease selected from the group including at least the following disorders: systemic lupus erythematosis, Sjogren's syndrome, systemic sclerosis, dermatomyositis/polymyositis, mixed connective tissue disease, ankylosing spondylitis and the seronegative spondyloarthropathies. "Transcriptional regulatory sequence" is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operably linked. -35- WO 00/60117 PCT/US00/08492 As used herein, the term "transgene" means a nucleic acid sequence (encoding, e.g., one of the IL-1 polypeptides, or an antisense transcript thereto) which has been introduced into a cell. A transgene could be partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can also be present in a cell in the form of an episome. A transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid. A "transgenic animal" refers to any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art. The nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA. In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of the IL-1 or TNFct polypeptides, e.g. either agonistic or antagonistic forms. However, transgenic animals in which the recombinant gene is silent are also contemplated, as for example, the FLP or CRE recombinase dependent constructs described below. Moreover, "transgenic animal" also includes those recombinant animals in which gene disruption of one or more genes is caused by human intervention, including both recombination and antisense techniques. The term is intended to include all progeny generations. Thus, the founder animal and all Fl, F2, F3, and so on, progeny thereof are included. The term "treating" as used herein is intended to encompass curing as well as ameliorating at least one symptom of a condition or disease. The term "vector" refers to a nucleic acid molecule, which is capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. -36- WO 00/60117 PCT/US00/08492 Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto. The term "wild-type allele" refers to an allele of a gene which, when present in two copies in a subject results in a wild-type phenotype. There can be several different wild-type alleles of a specific gene, since certain nucleotide changes in a gene may not affect the phenotype of a subject having two copies of the gene with the nucleotide changes. 4.2 Predictive Medicine 4.2.1. Polymorphisms Associated with ILD The present invention is based, at least in part, on the identification of alleles that are associated (to a statistically significant extent) with the development of interstitial lung disease in subjects. In particular, as shown in the following examples, IL-1RN (+2018) allele 2 and TNFA (-308) allele 2 have been shown to be associated with ILD. Therefore detection of these alleles in a subject indicate that the subject has or is predisposed to the development of an ILD. However, because these alleles are in linkage disequilibrium with other alleles, the detection of such other linked alleles can also indicate that the subject has or is predisposed to the development of ILD. For example, IL-1RN (+2018) allele 2, also referred to as exon 2 (8006) (GenBank:X64532 at 8006) polymorphism, Clay et al., Hum. Genet. 97:723-26, 1996, is in linkage disequilibrium with IL-1RN (VNTR) allele 2, which is a member of the 44112332 human haplotype. Cox et al., Am. J. Human Genet. 62:1180-88, 1998; International Patent Application No. PCT/GB98/01481. Further, the following alleles of the 11-1 (44112332) proinflammatory haplotype are known to be in linkage disequilibrium with IL-1RN (+2018): allele 4 of the 222/223 marker of IL-1A (a dinucleotide repeat polymorphism (HUGO GDB: 190869); allele 4 of the gz5/gz6 marker of IL-1 A (a trinucleotide repeat polymorphism (HUGO GDB: 177384; Zuliani et al., Am. J. Hum. Genet. 46:963-69, 1990); allele 1 of the -889 marker of IL-1A (a single base variation marker- HUGO GDB: 210902; McDowell et al., Arthritis and Rheumatism 38:221-28, 1995); allele 1 of the +3954 marker of IL-1B (a single base C/T variation; di Giovine et al., -37- WO 00/60117 PCT/US00/08492 Cytokine 7:606 (1995); Pociot et al. EurJ. Clin. Invest. 22:396-402, 1992); allele 2 of the -511 marker of IL-1B; allele 3 of the gaat.p33330 marker; and allele 3 of the Y31 marker. Three other polymorphisms in an IL-1RN alternative exon (Exon lic, which produces an intracellular form of the gene product, GEN X77090) are in linkage disequilibrium with IL-1RN (+2018) allele 2. These include: the IL-1RN exon lic (1812) polymorphism (GenBank:X77090 at 1812); the IL-1RN exon lic (1868) polymorphism (GenBank:X77090 at 1868); and the IL-1RN exon lic (1887) polymorphism (GenBank:X77090 at 1887). Yet another polymorphism in the promoter for the alternatively spliced intracellular form of the gene, the Pic (1731) polymorphism (GenBank:X77090 at 1731), is also in linkage disequilibrium with IL-1RN (+2018) allele 2. The corresponding sequence alterations for each of these IL-1RN polymorphic loci is shown below. Allele Exon 2 Exon lic-1 Exon lic-2 Exon lic-3 Pic (1731 No. (+2018 of (1812 of GB: (1868 of GB: (1887 of of GB: IL- 1RN) X77090) X77090 GB:X77090) X77090) 1 T G A G G 2 C A G C A Clay et al., Hum. Genet. 97:723-26, 1996. For each of these polymorphic loci, the allele 2 sequence variant has been determined to be in linkage disequilibrium with IL-1RN (+2018) allele 2. In addition to the allelic patterns described above, one of skill in the art can readily identify other alleles (including polymorphisms and mutations) that are in linkage disequilibrium with IL-1RN (+2018) allele 2, and are thereby associated with ILD. For example, a nucleic acid sample from a first group of subjects without ILD can be collected, as well as DNA from a second group of subjects with ILD. The nucleic acid sample can then be compared to identify those alleles that are over-represented in the second group as compared with the first group, wherein such alleles are presumably associated with ILD. Alternatively, alleles that are in linkage disequilibrium with an ILD associated allele can be identified, for example, by genotyping a large population and performing statistical analyses to determine which alleles appear more commonly together than expected. Preferably the group is chosen to be comprised of genetically related -38- WO 00/60117 PCT/US00/08492 individuals. Genetically related individuals include individuals from the same race, the same ethnic group, or even the same family. As the degree of genetic relatedness between a control group and a test group increases, so does the predictive value of polymorphic alleles which are ever more distantly linked to a disease-causing allele. This is because less evolutionary time has passed to allow polymorphisms which are linked along a chromosome in a founder population to redistribute through genetic cross-over events. Thus race-specific, ethnic-specific, and even family-specific diagnostic genotyping assays can be developed to allow for the detection of disease alleles which arose at ever more recent times in human evolution, e.g., after divergence of the major human races, after the separation of human populations into distinct ethnic groups, and even within the recent history of a particular family line. Linkage disequilibrium between two polymorphic markers or between one polymorphic marker and a disease-causing mutation is a meta-stable state. Absent selective pressure or the sporadic linked reoccurrence of the underlying mutational events, the polymorphisms will eventually become disassociated by chromosomal recombination events and will thereby reach linkage equilibrium through the course of human evolution. Thus, the likelihood of finding a polymorphic allele in linkage disequilibrium with a disease or condition may increases with changes in at least two factors: decreasing physical distance between the polymorphic marker and the disease-causing mutation, and decreasing number of meiotic generations available for the dissociation of the linked pair. Consideration of the latter factor suggests that, the more closely related two individuals are, the more likely they will share a common parental chromosome or chromosomal region containing the linked polymorphisms and the less likely that this linked pair will have become unlinked through meiotic cross-over events occurring each generation. As a result, the more closely related two individuals are, the more likely it is that widely spaced polymorphisms may be co-inherited. Thus, for individuals related by common race, ethnicity or family, the reliability of ever more distantly spaced polymorphic loci can be relied upon as an indicator of inheritance of a linked disease-causing mutation. Appropriate probes may be designed to hybridize to a specific gene of the IL-1 locus, such as IL-1A, IL-1B or IL-1RN, TNFA or a related gene. These genomic DNA sequences are shown in Figures 1-4, respectively, and further correspond to formal SEQ ID Nos. 1-4, respectively. Alternatively, these probes may incorporate other regions of the relevant genomic locus, including intergenic sequences. Indeed the IL-1 region of human chromosome 2 spans some 400,000 base pairs and, assuming an average of one single nucleotide polymorphism every 1,000 base pairs, includes some 400 SNPs loci alone. Yet other polymorphisms available for use with the immediate invention are obtainable from various public sources. For example, the -39- WO 00/60117 PCT/US00/08492 human genome database collects intragenic SNPs, is searchable by sequence and currently contains approximately 2,700 entries (http://hgbase.interactiva.de). Also available is a human polymorphism database maintained by the Massachusetts Institute of Technology (MIT SNP database (http://www.genome.wi.mit.edu/SNP/humaniindex.html)). From such sources SNPs as well as other human polymorphisms may be found. For example, examination of the IL-1 region of the human genome in any one of these databases reveals that the IL-1 locus genes are flanked by a centromere proximal polymorphic marker designated microsatellite marker AFM220ze3 at 127.4 cM (centiMorgans) (see GenBank Acc. No. Z17008) and a distal polymorphic marker designated microsatellite anchor marker AFMO87xal at 127.9 cM (see GenBank Acc. No. Z16545). These human polymorphic loci are both CA dinucleotide repeat microsatellite polymorphisms, and, as such, show a high degree of heterozygosity in human populations. For example, one allele of AFM220ze3 generates a 211 bp PCR amplification product with a 5' primer of the sequence TGTACCTAAGCCCACCCTT-TAGAGC (SEQ ID No. 5) and a 3' primer of the sequence TGGCCTCCAGAAACCTCCAA (SEQ ID No. 6). Furthermore, one allele of AFMO87xal generates a 177 bp PCR amplification product with a 5' primer of the sequence GCTGATATTCTGGTGGGAAA (SEQ ID No.7) and a 3' primer of the sequence GGCAAGAGCAAAACTCTGTC (SEQ ID No. 8). Equivalent primers corresponding to unique sequences occurring 5' and 3' to these human chromosome 2 CA dinucleotide repeat polymorphisms will be apparent to one of skill in the art. Reasonable equivalent primers include those which hybridize within about 1 kb of the designated primer, and which further are anywhere from about 17 bp to about 27 bp in length. A general guideline for designing primers for amplification of unique human chromosomal genomic sequences is that they possess a melting temperature of at least about 50'C, wherein an approximate melting temperature can be estimated using the formula Tmelt = [2 x (# of A or T) + 4 x (# of G or C)]. A number of other human polymorphic loci occur between these two CA dinucleotide repeat polymorphisms and provide additional targets for determination of an ILD prognostic allele in a family or other group of genetically related individuals. For example, the National Center for Biotechnology Information web site (www.ncbi.nlm.nih.gov/genemap/) lists a number of polymorphism markers in the region of the IL-1 locus and provides guidance in designing appropriate primers for amplification and analysis of these markers. Accordingly, the nucleotide segments of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of human chromosome 2 q 12-13 or cDNAs from that region or to provide primers for amplification of DNA or cDNA from -40- WO 00/60117 PCT/US00/08492 this region. The design of appropriate probes for this purpose requires consideration of a number of factors. For example, fragments having a length of between 10, 15, or 18 nucleotides to about 20, or to about 30 nucleotides, will find particular utility. Longer sequences, e.g., 40, 50, 80, 90, 100, even up to full length, are even more preferred for certain embodiments. Lengths of oligonucleotides of at least about 18 to 20 nucleotides are well accepted by those of skill in the art as sufficient to allow sufficiently specific hybridization so as to be useful as a molecular probe. Furthermore, depending on the application envisioned, one will desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of probe towards target sequence. For applications requiring high selectivity, one will typically desire to employ relatively stringent conditions to form the hybrids. For example, relatively low salt and/or high temperature conditions, such as provided by 0.02 M-0. 1 5M NaCl at temperatures of about 50' C to about 70' C. Such selective conditions may tolerate little, if any, mismatch between the probe and the template or target strand. 4.2.2. Detection ofAlleles Many methods are available for detecting specific alleles at human polymorphic loci. The preferred method for detecting a specific polymorphic allele may depend, in part, upon the molecular nature of the polymorphism. For example, the preferred method of detection used for a single nucleotide polymorphism may differ from that employed for a VNTR polymorphism. By way of general introduction, detection of specific alleles may be nucleic acid techniques based on hybridization, size, or sequence, such as restriction fragment length polymorphism (RFLP), nucleic acid sequencing, and allele specific oligonucleotide (ASO) hybridization. In one embodiment, the methods comprise detecting in a sample DNA obtained from a woman the existence of an allele associated with ILD. For example, a nucleic acid composition comprising a nucleic acid probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence to an allele associated with ILD can be used as follows: the nucleic acid in a sample is rendered accessible for hybridization, the probe is contacted with the nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected. Such technique can be used to detect alterations or allelic variants at either the genomic or mRNA level as well as to determine mRNA transcript levels, when appropriate. In another exemplary embodiment, an allele associated with ILD at a VNTR polymorphism, such as IL-1RN (VNTR) allele 2, may be determined. For example, the number of tandem repeats of the IL-1RN (VNTR) polymorphic site may be determined by amplifying the -41- WO 00/60117 PCT/US00/08492 nucleic acid to be analyzed, and determining the identity of the allele of that site by analyzing the size of said amplification product. A preferred detection method is ASO hybridization using probes overlapping an allele associated with ILD and has about 5, 10, 20, 25, or 30 nucleotides around the mutation or polymorphic region. In a preferred embodiment of the invention, several probes capable of hybridizing specifically to other allelic variants involved in EOM are attached to a solid phase support, e.g., a "chip" (which can hold up to about 250,000 oligonucleotides). Oligonucleotides can be bound to a solid support by a variety of processes, including lithography. Mutation detection analysis using these chips comprising oligonucleotides, also termed "DNA probe arrays" is described e.g., in Cronin et al., Human Mutation 7:244, 1996. In one embodiment, a chip comprises all the allelic variants of at least one polymorphic region of a gene. The solid phase support is then contacted with a test nucleic acid and hybridization to the specific probes is detected. Accordingly, the identity of numerous allelic variants of one or more genes can be identified in a simple hybridization experiment. These techniques may also comprise the step of amplifying the nucleic acid before analysis. Amplification techniques are known to those of skill in the art and include, but are not limited to cloning, polymerase chain reaction (PCR), polymerase chain reaction of specific alleles (ASA), ligase chain reaction (LCR), nested polymerase chain reaction, self sustained sequence replication (Guatelli, J.C. et al., Proc. Natl. Acad. Sci. USA 87:1874-78, 1990), transcriptional amplification system (Kwoh, D.Y. et al., Proc. Natl. Acad. Sci. USA 86:1173-77, 1989), and Q Beta Replicase (Lizardi, P.M. et al., Bio/Technology 6:1197, 1988). Amplification products may be assayed in a variety of ways, including size analysis, restriction digestion followed by size analysis, detecting specific tagged oligonucleotide primers in the reaction products, allele-specific oligonucleotide (ASO) hybridization, allele specific 5' exonuclease detection, sequencing, hybridization, and the like. PCR based detection means can include multiplex amplification of a plurality of markers simultaneously. For example, it is well known in the art to select PCR primers to generate PCR products that do not overlap in size and can be analyzed simultaneously. Alternatively, it is possible to amplify different markers with primers that are differentially labeled and thus can each be differentially detected. Of course, hybridization based detection means allow the differential detection of multiple PCR products in a sample. Other techniques are known in the art to allow multiplex analyses of a plurality of markers. In a merely illustrative embodiment, the method includes the steps of(i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA or both) from -42- WO 00/60117 PCT/US00/08492 the cells of the sample, (iii) contacting the nucleic acid sample with one or more primers which specifically hybridize to IL-1RN (+2018) allele 2 or any nucleic acid sequence in linkage disequilibrium with that allele under conditions such that hybridization and amplification of the desired marker occurs, and (iv) identifying the amplification product. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In a preferred embodiment of the subject assay, IL-1RN (+2018) allele 2 or TNFA (-308) allele 2 is identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis. In yet another embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence IL-1RN (+2018) allele 2 or any nucleic acid sequence in linkage disequilibrium with it. Exemplary sequencing reactions include those based on techniques developed by Maxim and Gilbert (Proc. Natl. Acad. Sci. USA 74:560, 1977) or Sanger (Sanger et al., Proc. Nat. Acad. Sci. USA 74:5463, 1977). It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing the subject assays (Biotechniques 19:448, 1995), including sequencing by mass spectrometry (see, for example PCT publication WO 94/16101; Cohen et al., Adv. Chromatogr. 36:127-62, 1996; and Griffin et al., Apple. Biochem. Biotechnol. 38:147-59, 1993). It will be evident to one skilled in the art that, for certain embodiments, the occurrence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction. In a further embodiment, protection from cleavage agents (such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine) can be used to detect mismatched bases in RNA/RNA or RNA/DNA or DNA/DNA heteroduplexes (Myers et al., Science 230:1242, 1985). In general, the art technique of "mismatch cleavage" starts by providing heteroduplexes formed by hybridizing (labeled) RNA or DNA containing the wild-type allele with the sample. The double-stranded duplexes are treated with an agent which cleaves single-stranded regions of the duplex such as which will exist due to base pair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with S 1 nuclease to enzymatically digest the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. (See, for example, Cotton et al., Proc. Natl. Acad. Sci. USA -43- WO 00/60117 PCT/US00/08492 85:4397, 1988; Saleeba et al., Methods Enzymol. 217:286-95, 1992) In a preferred embodiment, the control DNA or RNA can be labeled for detection. In still another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes). For example, the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al., Carcinogenesis 15:1657-62, 1994). According to an exemplary embodiment, a probe based on IL-1 RN (+2018) allele 2 is hybridized to a cDNA or other DNA product from a test cell(s). The duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. (See, for example, U.S. Patent No. 5,459,039.) In other embodiments, alterations in electrophoretic mobility will be used to identify IL-1RN (+2018) allele 2 or any nucleic acid sequence in linkage disequilibrium with it. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al., Proc. Natl. Acad. Sci. USA 86:2766, 1989, see also Cotton, Mutat. Res. 285:125-44, 1993; and Hayashi, Genet. Anal. Tech. Appl. 9:73-79, 1992. Single-stranded DNA fragments of sample and control IL-1RN (+2018) alleles or alleles of any nucleic acid sequence in linkage disequilibrium with them are denatured and allowed to renature. The secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In a preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al., Trends Genet. 7:5, 1991). In yet another embodiment, the movement of IL-1RN (+2018) alleles, or alleles of any nucleic acid sequence in linkage disequilibrium with those alleles in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al., Nature 313:495, 1985). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used in place of a denaturing agent gradient to identify differences in -44- WO 00/60117 PCT/US00/08492 the mobility of control and sample DNA (Rosenbaum and Reissner, Biophys. Chem. 265:12753, 1987). Examples of other techniques for detecting IL-1RN (+2018) alleles or alleles of any nucleic acid sequence in linkage disequilibrium with them and other alleles associated with ILD include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers may be prepared in which the known mutation or nucleotide difference (e.g., in allelic variants) is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al., Nature 324:163, 1986); Saiki et al., Proc. Natl. Acad. Sci. USA 86:6230, 1989). Such allele specific oligonucleotide hybridization techniques may be used to test one mutation or polymorphic region per reaction when oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations or polymorphic regions when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA. Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the mutation or polymorphic region of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al., Nucleic Acids Res. 17:2437-2448, 1989) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner, Tibtech 11:238, 1993. In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al., Mol. Cell Probes 6:1, 1992). It is anticipated that in certain embodiments amplification may also be performed using Taq ligase for amplification (Barany, Proc. Natl. Acad. Sci USA 88:189, 1991). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification. In another embodiment, identification of the allelic variant is carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in U.S. Pat. No. 4,998,617 and in Landegren et al., Science 241:1077-80, 1988. The OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target. One of the oligonucleotides is linked to a separation marker, e.g,. biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. -45- WO 00/60117 PCT/US00/08492 Ligation then permits the labeled oligonucleotide to be recovered using avidin, or another biotin ligand. Nickerson, D. A. et al. have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson et al., Proc. Natl. Acad. Sci. USA 87:8923-27, 1990. In this method, PCR is used to achieve the exponential amplification of target DNA. which is then detected using OLA. Several techniques based on this OLA method have been developed and can be used to detect IL-1RN (+2018) alleles or alleles of any nucleic acid sequence in linkage disequilibrium with them. For example, U.S. Patent No. 5,593,826 discloses an OLA using an oligonucleotide having 3'-amino group and a 5'-phosphorylated oligonucleotide to form a conjugate having a phosphoramidate linkage. In another variation of OLA described in Tobe et al., Nucleic Acids Res. 24:3728, 1996, OLA combined with PCR permits typing of two alleles in a single microtiter well. By marking each of the allele-specific primers with a unique hapten, i.e. digoxigenin and fluorescein, each OLA reaction can be detected by using hapten specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase or horseradish peroxidase. This system permits the detection of the two alleles using a high throughput format that leads to the production of two different colors. Several methods have been developed to facilitate analysis of single nucleotide polymorphisms. In one embodiment, the single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in U.S. Pat. No.4,656,127 (Mundy et al.). According to the method, a primer complementary to the allelic sequence immediately 3' to the polymorphic site is permitted to hybridize to a target molecule obtained from a particular animal or human. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer. Such incorporation renders the primer resistant to exonuclease, and thereby permits its detection. Since the identity of the exonuclease-resistant derivative of the sample is known, a finding that the primer has become resistant to exonucleases reveals that the nucleotide present in the polymorphic site of the target molecule was complementary to that of the nucleotide derivative used in the reaction. This method has the advantage that it does not require the determination of large amounts of extraneous sequence data. In another embodiment of the invention, a solution-based method is used for determining the identity of the nucleotide of a polymorphic site. French Patent 2,650,840; PCT Appln. No. WO91/02087. As in the Mundy method of U.S. Pat. No. 4,656,127, a primer is employed that is complementary to allelic sequences immediately 3' to a polymorphic site. The -46- WO 00/60117 PCT/US00/08492 method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site will become incorporated onto the terminus of the primer. An alternative method, known as Genetic Bit Analysis or GBA TM is described by Goelet et al. in PCT Appln. No. 92/15712. The method of Goelet et al. uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site. The labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated. In contrast to the method of Cohen et al., French Patent 2,650,840 and PCT Appln. No. WO91/02087, the method of Goelet et al. is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase. Recently, several primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher et al., Nucleic Acids Res. 17:7779-84, 1989; Sokolov, Nucleic Acids Res. 18:3671, 1990; Syvanen et al., Genomics 8:684-92, 1990; Kuppuswamy et al., Proc. Natl. Acad. Sci. USA 88:1143-47, 1991; Prezant et al., Hum. Mutat. 1:159-64, 1992; Ugozzoli et al., GATA 9:107-12, 1992; Nyren et al., Anal. Biochem. 208:171-75, 1993). These methods differ from GBA TM in that they all rely on the incorporation of labeled deoxynucleotides to discriminate between bases at a polymorphic site. In such a format, since the signal is proportional to the number of deoxynucleotides incorporated, polymorphisms that occur in runs of the same nucleotide can result in signals that are proportional to the length of the run (Syvanen, et al., Amer. J. Hum. Genet. 52:46-59, 1993). For mutations that produce premature termination of protein translation, the protein truncation test (PTT) offers an efficient diagnostic approach (Roest et. al., Hum. Mol. Genet. 2:1719-21, 1993; van der Luijt et. al., Genomics 20:1-4, 1994). For PTT, RNA is initially isolated from available tissue and reverse-transcribed, and the segment of interest is amplified by PCR. The products of reverse transcription PCR are then used as a template for nested PCR amplification with a primer that contains an RNA polymerase promoter and a sequence for initiating eukaryotic translation. After amplification of the region of interest, the unique motifs incorporated into the primer permit sequential in vitro transcription and translation of the PCR products. Upon sodium dodecyl sulfate-polyacrylamide gel electrophoresis of translation products, the appearance of truncated polypeptides signals the presence of a mutation that causes premature termination of translation. In a variation of this technique, DNA (as opposed to RNA) is used as a PCR template when the target region of interest is derived from a single exon. -47- WO 00/60117 PCT/US00/08492 In still another method known as Dynamic Allele Specific Hybridization (DASH), a target sequence is amplified by PCR in which one primer is biotinylated. The biotinylated product strand is bound to a streptavidin or avidin coated microtiter plate well, and the non biotinylated strand is rinsed away with alkali. An oligonucleotide probe, specific for one allele, is hybridized to the target at low temperature. This forms a duplex DNA region that interacts with a double strand-specific intercalating dye. Upon excitation, the dye emits fluorescence proportional to the amount of double stranded DNA (probe-target duplex) present. The sample is then steadily heated while fluorescence is continually monitored. A rapid fall in fluorescence indicates the denaturing (or "melting") temperature of the probe-target duplex. When performed under appropriate buffer and dye conditions, a single-base mismatch between the probe and the target results in a dramatic lowering of melting temperature (Tm) that can be easily detected (Howell, W.M. et al., (1999) Nature Biotechnology 17.)87-88. Any cell type or tissue may be utilized in the diagnostics described herein. In a preferred embodiment the DNA sample is obtained from a bodily fluid, e.g, blood, obtained by known techniques (e.g. venipuncture) or saliva. Alternatively, nucleic acid tests can be performed on dry samples (e.g. hair or skin). When using RNA or protein, the cells or tissues that may be utilized must express the genes of the IL-1 loci. Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, PCR in situ Hybridization: Protocols and Applications (Raven Press, NY, 1992)). In addition to methods which focus primarily on the detection of one nucleic acid sequence, profiles may also be assessed in such detection schemes. Fingerprint profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT PCR. Another embodiment of the invention is directed to kits for detecting a propensity for ILD in a patient. This kit may contain one or more oligonucleotides, including 5' and 3' oligonucleotides that hybridize 5' and 3' to an ILD associated marker (e.g. IL-1RN (+2018) allele 2 or TNFA (-308) allele 2), or any nucleic acid sequence in linkage disequilibrium with that marker, or detection oligonucleotides that hybridize to the ILD associated marker. The kit may also contain one or more oligonucleotides capable of hybridizing near or at other alleles of the TNFA gene or an IL-1 gene. PCR amplification primers should hybridize between 25 and 2500 -48- WO 00/60117 PCT/US00/08492 base pairs apart, preferably between about 100 and about 500 bases apart, in order to produce a PCR product of convenient size for subsequent analysis. For use in a kit, oligonucleotides may be any of a variety of natural and/or synthetic compositions such as synthetic oligonucleotides, restriction fragments, cDNAs, synthetic peptide nucleic acids (PNAs), and the like. The assay kit and method may also employ labeled oligonucleotides to allow ease of identification in the assays. Examples of labels which may be employed include radio-labels, enzymes, fluorescent compounds, streptavidin, avidin, biotin, magnetic moities, metal binding moities, antigen or antibody moities, and the like. The kit may, optionally, also include DNA sampling means such as the AmpliCard T M (University of Sheffield, Sheffield, England S10 2JF; Tarlow, et al., J. of Invest. Dermatol. 103:387-389, 1994) and the like; DNA purification reagents such as Nucleon

T

M kits, lysis buffers, proteinase solutions and the like; PCR reagents, such as 10x reaction buffers, thermostable polymerase, dNTPs, and the like; and allele detection means such as the HinJIfl restriction enzyme, allele specific oligonucleotides, degenerate oligonucleotide primers for nested PCR from dried blood. 4.2.3. Pharmacogenomics Knowledge of the particular alleles associated with ILD, alone or in conjunction with information on other genetic defects contributing to the same disease (the genetic profile of the particular disease) allows a customization of the therapy for a particular disease to the individual's genetic profile, the goal of"pharmacogenomics". For example, subjects having IL 1RN (+2018) allele 2, TNF-A (-308) allele 2 or any nucleic acid sequence in linkage disequilibrium with either allelic pattern may have or be predisposed to developing ILD and may respond better to particular therapeutics that address the particular molecular basis of the disease in the subject. Thus, comparison of an individual's IL-1 and/or TNF-A profile to the population profile for the disease, permits the selection or design of drugs that are expected to be safe and efficacious for a particular patient or patient population (i.e., a group of patients having the same genetic alteration). The ability to target populations expected to show the highest clinical benefit, based on genetic profile can enable: 1) the repositioning of marketed drugs with disappointing market results; 2) the rescue of drug candidates whose clinical development has been discontinued as a result of safety or efficacy limitations, which are patient subgroup-specific; and 3) an accelerated and less costly development for drug candidates and more optimal drug labeling (e.g. -49- WO 00/60117 PCT/US00/08492 since measuring the effect of various doses of an agent on an ILD causative mutation is useful for optimizing effective dose). The treatment of an individual with a particular therapeutic can be monitored by determining protein (e.g. IL- 1 a, IL- 1 3, IL- 1Ra or TNAu), mRNA and/or transcriptional level. Depending on the level detected, the therapeutic regimen can then be maintained or adjusted (increased or decreased in dose). In a preferred embodiment, the effectiveness of treating a subject with an agent comprises the steps of: (i) obtaining a preadministration sample from a subject prior to administration of the agent; (ii) detecting the level or amount of a protein, mRNA or genomic DNA in the preadministration sample; (iii) obtaining one or more post-administration samples from the subject; (iv) detecting the level of expression or activity of the protein, mRNA or genomic DNA in the post-administration sample; (v) comparing the level of expression or activity of the protein, mRNA or genomic DNA in the preadministration sample with the corresponding protein, mRNA or genomic DNA in the postadministration sample, respectively; and (vi) altering the administration of the agent to the subject accordingly. Cells of a subject may also be obtained before and after administration of a therapeutic to detect the level of expression of genes other than an IL-1 gene or TNFA, to verify that the therapeutic does not increase or decrease the expression of genes which could be deleterious. This can be done, e.g., by using the method of transcriptional profiling. Thus, mRNA from cells exposed in vivo to a therapeutic and mRNA from the same type of cells that were not exposed to the therapeutic could be reverse transcribed and hybridized to a chip containing DNA from numerous genes, to thereby compare the expression of genes in cells treated and not treated with the therapeutic. 4.3 ILD Therapeutics Modulators of IL-1 (e.g. IL-la, IL-13 or IL-1 receptor antagonist) or TNFa or a protein encoded by a gene that is in linkage disequilibrium with an IL-1 or TNF-A gene can comprise any type of compound, including a protein, peptide, peptidomimetic, small molecule, or nucleic acid. Preferred agonists include nucleic acids (e.g. encoding an IL-1 protein or TNFa or a gene that is up- or down-regulated by an IL-1 or TNFa protein), proteins (e.g. IL-1 or TNFt proteins or a protein that is up- or down-regulated thereby) or a small molecule (e.g. that regulates expression or binding of an IL-1 protein or TNFa). Preferred antagonists, which can be identified, for example, using the assays described herein, include nucleic acids (e.g. single (antisense) or double stranded (triplex) DNA or PNA and ribozymes), protein (e.g. antibodies) -50- WO 00/60117 PCT/US00/08492 and small molecules that act to suppress or inhibit IL-1 or TNFA transcription and/or protein activity. 4.3.1. Effective Dose Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining The LD50 (the dose lethal to 50% of the population) and the Ed50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissues in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. 4.3.2. Formulation and Use Compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the compounds and their physiologically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration. For such therapy, the compounds of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences. Meade -51- WO 00/60117 PCT/US00/08492 Publishing Co., Easton, PA. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, the compounds of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included. For oral administration, the compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., ationd oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated to give controlled release of the active compound. For buccal administration the compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch. The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The -52- WO 00/60117 PCT/US00/08492 compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt. Other suitable delivery systems include microspheres which offer the possibility of local noninvasive delivery of drugs over an extended period of time. This technology utilizes microspheres of precapillary size which can be injected via a coronary catheter into any selected part of the e.g. heart or other organs without causing inflammation or ischemia. The administered therapeutic is slowly released from these microspheres and taken up by surrounding tissue cells (e.g. endothelial cells). Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For topical administration, the oligomers of the invention are formulated into ointments, salves, gels, or creams as generally known in the art. A wash solution can be used locally to treat an injury or inflammation to accelerate healing. The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The present invention is further illustrated by the following examples which should not be construed as limiting in any way. The contents of all cited references (including literature references, issued patents, published patent applications as cited throughout this application) are hereby expressly incorporated by reference. -53- WO 00/60117 PCT/US00/08492 The practice of the present invention will employ, unless otherwise indicated, conventional techniques that are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, (2nd ed., Sambrook, Fritsch and Maniatis, eds., Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); U.S. Patent No. 4,683,195; U.S. Patent No. 4,683,202; Nucleic Acid Hybridization (B. D. Hamines & S. J. Higgins eds., 1984); U.S. Patent No. 4,666,828; U.S. Patent No. 5,192,659; U.S. Patent No. 5,272,057; and U.S. Patent No. 4,801,531. 4.4 Assays to Identify ILD Therapeutics Based on the identification of mutations that cause or contribute to ILD, the invention further features cell-based or cell free assays, e.g., for identifying ILD therapeutics. In one embodiment, a cell expressing an IL- 1 receptor, TNFT receptor or a receptor for a protein that is encoded by a gene which is in linkage disequilibrium with TNF-A or an IL- 1 gene, on the outer surface of its cellular membrane is incubated in the presence of a test compound alone or in the presence of a test compound and a IL-1, TNF-a or other protein and the interaction between the test compound and the receptor or between the protein (preferably a tagged protein) and the receptor is detected, e.g., by using a microphysiometer (McConnell et al. (1992) Science 257:1906). An interaction between the receptor and either the test compound or the protein is detected by the microphysiometer as a change in the acidification of the medium. This assay system thus provides a means of identifying molecular antagonists which, for example, function by interfering with protein- receptor interactions, as well as molecular agonist which, for example, function by activating a receptor. Cellular or cell-free assays can also be used to identify compounds which modulate expression of an IL-1 or TNF-A gene or a gene in linkage disequilibrium therewith, modulate translation of an mRNA, or which modulate the stability of an mRNA or protein. Accordingly, in one embodiment, a cell which is capable of producing an IL-1, TNF-a or other protein is incubated with a test compound and the amount of protein produced in the cell medium is measured and compared to that produced from a cell which has not been contacted with the test compound. The specificity of the compound visa vis the protein can be confirmed by various control analysis, e.g., measuring the expression of one or more control genes. In particular, this assay can be used to determine the efficacy of antisense, ribozyme and triplex compounds. Cell-free assays can also be used to identify compounds which are capable of interacting with a protein, to thereby modify the activity of the protein. Such a compound can, -54- WO 00/60117 PCT/US00/08492 e.g., modify the structure of a protein thereby effecting its ability to bind to a receptor. In a preferred embodiment, cell-free assays for identifying such compounds consist essentially in a reaction mixture containing a protein and a test compound or a library of test compounds in the presence or absence of a binding partner. A test compound can be, e.g., a derivative of a binding partner, e.g., a biologically inactive target peptide, or a small molecule. Accordingly, one exemplary screening assay of the present invention includes the steps of contacting a protein or functional fragment thereof with a test compound or library of test compounds and detecting the formation of complexes. For detection purposes, the molecule can be labeled with a specific marker and the test compound or library of test compounds labeled with a different marker. Interaction of a test compound with a protein or fragment thereof can then be detected by determining the level of the two labels after an incubation step and a washing step. The presence of two labels after the washing step is indicative of an interaction. An interaction between molecules can also be identified by using real-time BIA (Biomolecular Interaction Analysis, Pharmacia Biosensor AB) which detects surface plasmon resonance (SPR), an optical phenomenon. Detection depends on changes in the mass concentration of macromolecules at the biospecific interface, and does not require any labeling of interactants. In one embodiment, a library of test compounds can be immobilized on a sensor surface, e.g., which forms one wall of a micro-flow cell. A solution containing the protein or functional fragment thereof is then flown continuously over the sensor surface. A change in the resonance angle as shown on a signal recording, indicates that an interaction has occurred. This technique is further described, e.g., in BIAtechnology Handbook by Pharmacia. Another exemplary screening assay of the present invention includes the steps of (a) forming a reaction mixture including: (i) an IL-1, TNF-a or other protein, (ii) an appropriate receptor, and (iii) a test compound; and (b) detecting interaction of the protein and receptor. A statistically significant change (potentiation or inhibition) in the interaction of the protein and receptor in the presence of the test compound, relative to the interaction in the absence of the test compound, indicates a potential antagonist (inhibitor). The compounds of this assay can be contacted simultaneously. Alternatively, a protein can first be contacted with a test compound for an appropriate amount of time, following which the receptor is added to the reaction mixture. The efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison. Complex formation between a protein and receptor may be detected by a variety of techniques. Modulation of the formation of complexes can be quantitated using, for example, -55- WO 00/60117 PCT/US00/08492 detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled proteins or receptors, by immunoassay, or by chromatographic detection. Typically, it will be desirable to immobilize either the protein or the receptor to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of protein and receptor can be accomplished in any vessel suitable for containing the reactants. Examples include microtitre plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the receptor, e.g. an 3 5 S-labeled receptor, and the test compound, and the mixture incubated under conditions conducive to complex formation, e.g. at physiological conditions for salt and pH, though slightly more stringent conditions may be desired. Following incubation, the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly (e.g. beads placed in scintilant), or in the supernatant after the complexes are subsequently dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of protein or receptor found in the bead fraction quantitated from the gel using standard electrophoretic techniques such as described in the appended examples. Other techniques for immobilizing proteins on matrices are also available for use in the subject assay. For instance, either protein or receptor can be immobilized utilizing conjugation of biotin and streptavidin. Transgenic animals can also be made to identify agonists and antagonists or to confirm the safety and efficacy of a candidate therapeutic. Transgenic animals of the invention can include non-human animals containing an ILD causative mutation under the control of an appropriate endogenous promoter or under the control of a heterologous promoter. The transgenic animals can also be animals containing a transgene, such as reporter gene, under the control of an appropriate promoter or fragment thereof. These animals are useful, e.g., for identifying drugs that modulate production of an IL-1 or TNF-a protein, such as by modulating gene expression. Methods for obtaining transgenic non-human animals are well known in the art. In preferred embodiments, the expression of the ILD causative mutation is restricted to specific subsets of cells, tissues or developmental stages utilizing, for example, cis acting sequences that control expression in the desired pattern. In the present invention, such mosaic expression of a protein can be essential for many forms of lineage analysis and can additionally provide a means to assess the effects of, for example, expression level which might grossly alter development in small patches of tissue within an otherwise normal embryo. Toward -56- WO 00/60117 PCT/US00/08492 this end, tissue-specific regulatory sequences and conditional regulatory sequences can be used to control expression of the mutation in certain spatial patterns. Moreover, temporal patterns of expression can be provided by, for example, conditional recombination systems or prokaryotic transcriptional regulatory sequences. Genetic techniques, which allow for the expression of a mutation can be regulated via site-specific genetic manipulation in vivo, are known to those skilled in the art. The transgenic animals of the present invention all include within a plurality of their cells an ILD causative mutation transgene of the present invention, which transgene alters the phenotype of the "host cell". In an illustrative embodiment, either the cre/loxP recombinase system of bacteriophage P1 (Lakso et al. (1992) PNAS 89:6232-6236; Orban et al. (1992) PNAS 89:6861-6865) or the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251:1351-1355; PCT publication WO 92/15694) can be used to generate in vivo site-specific genetic recombination systems. Cre recombinase catalyzes the site-specific recombination of an intervening target sequence located between loxP sequences. loxP sequences are 34 base pair nucleotide repeat sequences to which the Cre recombinase binds and are required for Cre recombinase mediated genetic recombination. The orientation of loxP sequences determines whether the intervening target sequence is excised or inverted when Cre recombinase is present (Abremski et al. (1984) J. Biol. Chem. 259:1509-1514); catalyzing the excision of the target sequence when the loxP sequences are oriented as direct repeats and catalyzes inversion of the target sequence when loxP sequences are oriented as inverted repeats. Accordingly, genetic recombination of the target sequence is dependent on expression of the Cre recombinase. Expression of the recombinase can be regulated by promoter elements which are subject to regulatory control, e.g., tissue-specific, developmental stage-specific, inducible or repressible by externally added agents. This regulated control will result in genetic recombination of the target sequence only in cells where recombinase expression is mediated by the promoter element. Thus, the activation of expression of the EOM causative mutation transgene can be regulated via control of recombinase expression. Use of the cre/loxP recombinase system to regulate expression of an ILD causative mutation transgene requires the construction of a transgenic animal containing transgenes encoding both the Cre recombinase and the subject protein. Animals containing both the Cre recombinase and the ILD causative mutation transgene can be provided through the construction of "double" transgenic animals. A convenient method for providing such animals is to mate two transgenic animals each containing a transgene. -57- WO 00/60117 PCT/US00/08492 Similar conditional transgenes can be provided using prokaryotic promoter sequences which require prokaryotic proteins to be simultaneous expressed in order to facilitate expression of the transgene. Exemplary promoters and the corresponding trans-activating prokaryotic proteins are given in U.S. Patent No. 4,833,080. Moreover, expression of the conditional transgenes can be induced by gene therapy-like methods wherein a gene encoding the transactivating protein, e.g. a recombinase or a prokaryotic protein, is delivered to the tissue and caused to be expressed, such as in a cell-type specific manner. By this method, the transgene could remain silent into adulthood until "turned on" by the introduction of the transactivator. In an exemplary embodiment, the "transgenic non-human animals" of the invention are produced by introducing transgenes into the germline of the non-human animal. Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell. The specific line(s) of any animal used to practice this invention are selected for general good health, good embryo yields, good pronuclear visibility in the embryo, and good reproductive fitness. In addition, the haplotype is a significant factor. For example, when transgenic mice are to be produced, strains such as C57BL/6 or FVB lines are often used (Jackson Laboratory, Bar Harbor, ME). Preferred strains are those with H-2b, H-2d or H-2q haplotypes such as C57BL/6 or DBA/1. The line(s) used to practice this invention may themselves be transgenics, and/or may be knockouts (i.e., obtained from animals which have one or more genes partially or completely suppressed). In one embodiment, the transgene construct is introduced into a single stage embryo. The zygote is the best target for microinjection. In the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter which allows reproducible injection of 1-2 pl of DNA solution. The use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incorporated into the host gene before the first cleavage (Brinster et al. (1985) PNAS 82:4438-4442). As a consequence, all cells of the transgenic animal will carry the incorporated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene. Normally, fertilized embryos are incubated in suitable media until the pronuclei appear. At about this time, the nucleotide sequence comprising the transgene is introduced into the female or male pronucleus as described below. In some species such as mice, the male pronucleus is preferred. It is most preferred that the exogenous genetic material be added to the -58- WO 00/60117 PCT/US00/08492 male DNA complement of the zygote prior to its being processed by the ovum nucleus or the zygote female pronucleus. It is thought that the ovum nucleus or female pronucleus release molecules which affect the male DNA complement, perhaps by replacing the protamines of the male DNA with histones, thereby facilitating the combination of the female and male DNA complements to form the diploid zygote. Thus, it is preferred that the exogenous genetic material be added to the male complement of DNA or any other complement of DNA prior to its being affected by the female pronucleus. For example, the exogenous genetic material is added to the early male pronucleus, as soon as possible after the formation of the male pronucleus, which is when the male and female pronuclei are well separated and both are located close to the cell membrane. Alternatively, the exogenous genetic material could be added to the nucleus of the sperm after it has been induced to undergo decondensation. Sperm containing the exogenous genetic material can then be added to the ovum or the decondensed sperm could be added to the ovum with the transgene constructs being added as soon as possible thereafter. Introduction of the transgene nucleotide sequence into the embryo may be accomplished by any means known in the art such as, for example, microinjection, electroporation, or lipofection. Following introduction of the transgene nucleotide sequence into the embryo, the embryo may be incubated in vitro for varying amounts of time, or reimplanted into the surrogate host, or both. In vitro incubation to maturity is within the scope of this invention. One common method in to incubate the embryos in vitro for about 1-7 days, depending on the species, and then reimplant them into the surrogate host. For the purposes of this invention a zygote is essentially the formation of a diploid cell which is capable of developing into a complete organism. Generally, the zygote will be comprised of an egg containing a nucleus formed, either naturally or artificially, by the fusion of two haploid nuclei from a gamete or gametes. Thus, the gamete nuclei must be ones which are naturally compatible, i.e., ones which result in a viable zygote capable of undergoing differentiation and developing into a functioning organism. Generally, a euploid zygote is preferred. If an aneuploid zygote is obtained, then the number of chromosomes should not vary by more than one with respect to the euploid number of the organism from which either gamete originated. In addition to similar biological considerations, physical ones also govern the amount (e.g., volume) of exogenous genetic material which can be added to the nucleus of the zygote or to the genetic material which forms a part of the zygote nucleus. If no genetic material is removed, then the amount of exogenous genetic material which can be added is limited by the -59- WO 00/60117 PCT/US00/08492 amount which will be absorbed without being physically disruptive. Generally, the volume of exogenous genetic material inserted will not exceed about 10 picoliters. The physical effects of addition must not be so great as to physically destroy the viability of the zygote. The biological limit of the number and variety of DNA sequences will vary depending upon the particular zygote and functions of the exogenous genetic material and will be readily apparent to one skilled in the art, because the genetic material, including the exogenous genetic material, of the resulting zygote must be biologically capable of initiating and maintaining the differentiation and development of the zygote into a functional organism. The number of copies of the transgene constructs which are added to the zygote is dependent upon the total amount of exogenous genetic material added and will be the amount which enables the genetic transformation to occur. Theoretically only one copy is required; however, generally, numerous copies are utilized, for example, 1,000-20,000 copies of the transgene construct, in order to insure that one copy is functional. As regards the present invention, there will often be an advantage to having more than one functioning copy of each of the inserted exogenous DNA sequences to enhance the phenotypic expression of the exogenous DNA sequences. Any technique which allows for the addition of the exogenous genetic material into nucleic genetic material can be utilized so long as it is not destructive to the cell, nuclear membrane or other existing cellular or genetic structures. The exogenous genetic material is preferentially inserted into the nucleic genetic material by microinjection. Microinjection of cells and cellular structures is known and is used in the art. Reimplantation is accomplished using standard methods. Usually, the surrogate host is anesthetized, and the embryos are inserted into the oviduct. The number of embryos implanted into a particular host will vary by species, but will usually be comparable to the number of off spring the species naturally produces. Transgenic offspring of the surrogate host may be screened for the presence and/or expression of the transgene by any suitable method. Screening is often accomplished by Southern blot or Northern blot analysis, using a probe that is complementary to at least a portion of the transgene. Western blot analysis using an antibody against the protein encoded by the transgene may be employed as an alternative or additional method for screening for the presence of the transgene product. Typically, DNA is prepared from tail tissue and analyzed by Southern analysis or PCR for the transgene. Alternatively, the tissues or cells believed to express the transgene at the highest levels are tested for the presence and expression of the transgene using Southern analysis or PCR, although any tissues or cell types may be used for this analysis. -60- WO 00/60117 PCT/US00/08492 Alternative or additional methods for evaluating the presence of the transgene include, without limitation, suitable biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like. Analysis of the blood may also be useful to detect the presence of the transgene product in the blood, as well as to evaluate the effect of the transgene on the levels of various types of blood cells and other blood constituents. Progeny of the transgenic animals may be obtained by mating the transgenic animal with a suitable partner, or by in vitro fertilization of eggs and/or sperm obtained from the transgenic animal. Where mating with a partner is to be performed, the partner may or may not be transgenic and/or a knockout; where it is transgenic, it may contain the same or a different transgene, or both. Alternatively, the partner may be a parental line. Where in vitro fertilization is used, the fertilized embryo may be implanted into a surrogate host or incubated in vitro, or both. Using either method, the progeny may be evaluated for the presence of the transgene using methods described above, or other appropriate methods. The transgenic animals produced in accordance with the present invention will include exogenous genetic material. Further, in such embodiments the sequence will be attached to a transcriptional control element, e.g., a promoter, which preferably allows the expression of the transgene product in a specific type of cell. Retroviral infection can also be used to introduce the transgene into a non-human animal. The developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Jaenich, R. (1976) PNAS 73:1260-1264). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Manipulating the Mouse Embryo, Hogan eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986). The viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al. (1985) PNAS 82:6927-6931; Van der Putten et al. (1985) PNAS 82:6148-6152). Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart et al. (1987) EMBO J. 6:383-388). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (Jahner et al. (1982) Nature 298:623-628). Most of the founders will be mosaic for the transgene since incorporation occurs only in a subset of the cells which formed the transgenic non-human animal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. In addition, it is also -61- WO 00/60117 PCT/US00/08492 possible to introduce transgenes into the germ line by intrauterine retroviral infection of the midgestation embryo (Jahner et al. (1982) supra). A third type of target cell for transgene introduction is the embryonal stem cell (ES). ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (Evans et al. (1981) Nature 292:154-156; Bradley et al. (1984) Nature 309:255-258; Gossler et al. (1986) PNAS 83: 9065-9069; and Robertson et al. (1986) Nature 322:445-448). Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retrovirus mediated transduction. Such transformed ES cells can thereafter be combined with blastocysts from a non-human animal. The ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal. For review see Jaenisch, R. (1988) Science 240:1468-1474. The present invention is further illustrated by the following examples which should not be construed as limiting in any way. The contents of all cited references (including literature references, issued patents, published patent applications as cited throughout this application) are hereby expressly incorporated by reference. The practice of the present invention will employ, unless otherwise indicated, conventional techniques that are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, (2nd ed., Sambrook, Fritsch and Maniatis, eds., Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); U.S. Patent No. 4,683,195; U.S. Patent No. 4,683,202; and Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds., 1984). 5. EXAMPLES EXAMPLE 1: Genotyping Methods 5.1.1 Preparation ofDNA Blood is taken by venipuncture and stored uncoagulated at -20oC prior to DNA extraction. Ten milliliters of blood are added to 40 ml of hypotonic red blood cell (RBC) lysis solution (10 mM Tris, 0.32 Sucrose , 4 mM MgC1 2 , 1% Triton X-100) and mixed by inversion for 4 minutes at room temperature (RT). Samples are then centrifuged at 1300 g for 15 minutes, the supernatant aspirated and discarded, and another 30 ml of RBC lysis solution added to the cell pellet. Following centrifugation, the pellet is resuspended in 2ml white blood cell (WBC) lysis solution (0.4 M Tris, 60 mM EDTA, 0.15 M NaC1, 10% SDS) and transferred into a fresh 15 ml -62- WO 00/60117 PCT/US00/08492 polypropylene tube. Sodium perchlorate is added at a final concentration of IM and the tubes are first inverted on a rotary mixer for 15 minutes at RT, then incubated at 65 0 C for 25 minutes, being inverted periodically. After addition of 2 ml of chloroform (stored at-20 0 C), samples are mixed for 10 minutes at room temperature and then centrifuged at 800 G for 3 minutes. At this stage, a very clear distinction of phases can be obtained using 300 1 Nucleon Silica suspension (Scotlab, UK) and centrifugation at 1400 G for 5 minutes. The resulting aqueous upper layer is transferred to a fresh 15 ml polypropylene tube and cold ethanol (stored at-20 0 C) is added to precipitate the DNA. This is spooled out on a glass hook and transferred to a 1.5 ml eppendorf tube containing 500 1 TE or sterile water. Following overnight resuspension in TE, genomic DNA yield is calculated by spectrophotometry at 260 rinm. Aliquots of samples are diluted at 100 ug/ml, transferred to microtiter containers and stored at 4oC. Stocks are stored at -20oC for future reference. 5.1.2 Polvmerase Chain Reaction Oligonucleotide primers designed to amplify the relevant region of the gene spanning the polymorphic site (as detailed below) are synthesized, resuspended in Tris-EDTA buffer (TE), and stored at -20oC as stock solutions of 200 uM. Aliquots of working solutions (1:1 mixture of forward and reverse, 20 gM of each in water) are prepared in advance. Typically, PCR reaction mixtures are prepared as detailed below. Stock Concentration Volume Final Concentration Sterile H,0 29.5 .tl 10xPCR buffer 200 mM Tris-HCI (pH 8.4) 5.00 pl 20 mM Tris-HC1, MgCl, 50 mM 1.75 pl 1.75 mM dNTP mix 10 mM of each 4.00 ptl 0.2 mM of each primer forward 20 uM 2.5 jtl 1 uM prime reverse 20 uM 2.5 jtl 1 uM Taq polymerase 5 U / il 0.25 l 1.25 units/50 4l Detergent (eg W-1, Gibco) 1% 2.5 pl 0.05% Template 200 ng/jtl 2.00 jil 2 ng/ 1 Final Volume 50.00 il DNA template is dotted at the bottom of 0.2 ml tubes or microwells. The same volume of water or negative control DNA is also randomly tested. A master-mix (including all -63- WO 00/60117 PCT/US00/08492 reagents except templates) is prepared and added to the wells or tubes, and samples are transferred to the thermocycler for PCR. PCR can be performed in 0.5 ml tubes. 0.2 ml tubes or microwells, according to the thermocycler available. The reaction mixture is overlaid with mineral oil if a heated lid (to prevent evaporation) is not available. 5.1.3 Restriction Enzyme Digestion A master mix of restriction enzyme buffer and enzyme is prepared and aliquotted in suitable volumes in fresh microwells. Digestion is carried out with an oil overlay or capped microtubes at the appropriate temperature for the enzyme on a dry block. Restriction buffer dilutions are calculated on the whole reaction volume (i.e. ignoring salt concentrations of PCR buffer). Restriction enzymes are used 3-5 times in excess of the recommended concentration to compensate for the unfavorable buffer conditions and to ensure complete digestion. 5.1.4 Electrophoresis Polyacrylamide-gel electrophoresis (PAGE) of the PCR sample is carried out in Tris-Borate-EDTA buffer and at constant voltage. Depending on the size discrimination need, different PAGE conditions are used (9 to 12% acrylamide, 1.5 mm x 200) and different DNA size marker ( X174-Hae III or X 174-Hinf 1). A 2% agarose horizontal gel can be used for genotyping the IL-1RN (VNTR) marker. EXAMPLE 2. Genotyping Analysis of Two Populations of IPF Patients For these studies, two populations of IPF patients, and two ethnically matched sets of controls were used. All patients were phenotyped to a very high standard, including high resolution CT scanning and in many case lung biopsy. Genotyping was performed by allele specific restriction enzyme digest of PCR products as described in Tables 1, 2 and 3. Position of single nucleotide polymorphisms (snps) are indicated with respect to putative transcription initiation site. -64- WO 00/60117 PCT/US00/08492 Table 1 Marker IL-1 RN (+2018) TNFA (-308) Gene IL-IRN TNFA Accession No. X64532 X02910 Position +2018 -308 Table 2 Primer sequences IL-IRN (+2018) 5'-CTATCTGAGGAACAACCAACTAGTAGC-3' SEQ ID NO. 9 5'-TAGGACATTGCACCTAGGGTTTGT-3' SEQ ID NO. 10 TNF (-308) 5'-AGGCAATAGGTTTTGAGGGCCAT-3' SEQ ID NO 11 5'-TCCTCCCTGCTCCGATTCCG-3' SEQ ID NO 12 -65- WO 00/60117 PCT/US00/08492 Table 3 Reaction conditions IL-JRN (+2018) Reaction buffer is 20mM Tris-HCI (pH 8.4), 50mM KC1, 1.75 mM MgC1 2 , 0.2 mM dNTPs, 0.001 mM primers, 0.05% W-1 (Gibco-BRL), 100 ng. template, 1.25 Units Taq Polymerase, Cycling is performed at [96 , 1 min] x 1; [94 °, 1 min; 57 °, 1 min; 70 , 2 min;] x 35; [70 °, 5 min] x 1; 4 'C. One part of the PCR products are digested withAlu I, the other with Msp I (37 C overnight). Restriction products are sized on PAGE 9%. Alu I will produce 126 + 28bp fragments for allele 1, while it does not digest allele 2 (154 bp). Msp I will produce 125 + 29bp with allele 2, while allele 1 is uncut (154 bp). The two reactions will give inverted patterns of digestion for homozygote individuals, and identical patterns in heterozygotes. TNF (-308) Reaction conditions as above, but MgCl 2 is used at 1.5 mM final, and PCR primers at 0.0002mM. Cycling; [95 , 1 min] x 1; [94 °, 1 min; 60 °, 1 min; 72 , 1 min;] x 35; [72 0, 5 mini x 1; 4 C. PCR products are digested with Nco I (37 C overnight), electrophoresis by PAGE 6%. Nco I digestion produces 87 + 20 for allele 1, while it does not cut allele 2 (107 bp). Heterozygotes will have 107 + 87 + 29 bp fragments. Results were analysed as follows: Bologna population DNA was collected from a cohort of 61 IPF patients in the Bologna province in Italy. Controls (n=103) were recruited from a local blood donor bank, and were ethnically, age and sex matched. Results were analysed by comparison of Odds Ratio (OR) homozygous (ORhom) to OR heterozygous (ORhet) and, when appropriate, data were grouped into a 2 x 2 table, and tested by chi-square analysis. OR and 95% confidence intervals (95%c-.i.) were calculated by standard methods. Data and analysis are summarised in Table 4a. -66- WO 00/60117 PCT/US00/08492 Table 4 Genotypes, Italian population 4a) marker IL-1RN (+2018) TNF (-308) genotype 1.1 1.2 2.2 1.1 1.2 2.2 IPF 26 30 5 40 21 0 Controls 66 32 5 87 16 0 Analysis 2.2 + 1.2 vs. 1.1 2.2 + 1.2 vs. 1.1 X2 = 7.16 7.827 X2p = 0.0075 0.0058 O.R. = 2.40 2.85 95% c.i. = 1.26-4.59 1.35-6.05 4b) Composite Genotype Analysis Only a total of 18 IPF patients and 77 controls could be analysed. Composite genotype positive: individuals with IL-1 RN (+2018) 2.2 or 1.2 and TNFA (-308) 1.2. IPF n = 12 Controls, n = 9 Composite genotype negative: individuals with IL-1 RN (+2018) 1.1 and TNFA (-308) 1.1. IPF n = 17 Controls, n = 59 2 = 9.493 p = 0.0021. O.R. = 4.63 95% c.i. = 1.67 - 12.8 There was a strong association between individuals carrying at least one copy of the rare IRN (+2018) allele and IPF (O.R. = 2.4, 95% c.i. = 1.26 - 4.59). There was also an association between individuals possessing the TNFA (-308) allele and IPF (O.R. = 2.85, 95% c.i.= 1.35 - 6.05). IPF patients and controls were also analysed for the effects of composite IL 1RN (+2018)/TNF(-308) genotypes on susceptibility (Table 4b). The frequency of the composite genotype defined as the carriage of at least one copy of both rare alleles was tested in IPF patients and in matched controls. These allele frequencies were then compared with the frequency of the composite genotype defined as the non-carriage of the rare allele at both loci, i.e. homozygotes IL-1RN (+2018) 1.1 and TNFA (-308) 1.1. As shown in Table 4b, the presence of this composite genotype was associated to an increased relative risk of IPF (OR=4.63, 95% c.i.=1.67-12.82). -67- WO 00/60117 PCT/US00/08492 Nottingham Population DNA was collected from a cohort of 90 IPF patients with IPF, together with age, sex and environment-matched controls. Genotype frequencies were tested for IL-1RN (+2018) and TNFA (-308). Of these, 88 pairs were successfully genotyped. Results were analysed by conditional logistic regression. All genotyping and analysis was performed blind. Results are reported in Table 5a and 5b. -68- WO 00/60117 PCT/US00/08492 Table 5 Genotypes, English population (Nottingham) 5a) IL-1RN (+2018) CONTROLS 1.1 1.2 2.2 IPF CASES 1.1 36 12 1 1.2 18 11 0 2.2 6 3 1 1.2 vs 1.1, OR = 1.43; 95% c.i. = 0.70 - 2.92; p = 0.33 2.2 vs 1.1, OR= 10.76; 95% c.i. = 1.26- 81.4; p = 0.03 1.2 + 2.2 vs 1.1, OR = 1.85; 95% c.i. = 0.94-3.63); p=0.07 In this study, a higher risk of IPF could be identified in individuals homozygous for the rare allele of IL-1RN (+2018) (OR 10.76, 95% c.i. 1.26-81.4) TNF (-308) CONTROLS 1.1 1.2 2.2 IPF CASES 1.1 40 12 1 1.2 22 9 1 2.2 2 1 0 1.2 + 2.2 vs 1.1, OR = 1.85, 95% c.i., 0.94 to 3.63, p=0.07 In this second study on an independent population, a higher risk of IPF associated with the presence of the rare allele of IL-1RN (+2018) (2.2 vs 1.1, OR 10.76, 95%c.i. 1.26-81.4, p=0.03) was identified. A trend of association could only be demonstrated for TNF (-308) (p=0.07), but an analysis of the previously defined composite TNF (-308)/IL -69- WO 00/60117 PCT/US00/08492 1RN (+2018) genotype (Table 5b) confirmed an increased risk of IPF for individuals carrying this genotype vs. individuals not carrying it (OR = 8.0, 95% c.i. 1.00-64.0, p=0.05). 5b) Composite Genotype Analysis Individuals who carried at least one copy of the 2 allele for both IL-1RN (+2018) and TNF ( 308) were compared with those who were 1.1 homozygotes for both. Only 23 matched case control pairs could be analysed. CONTROLS 1.1 for both 1.2 or2.2 for both IPF CASES 1.1 for both 13 1 1.2 or 2.2 for both 8 1 i.e. 9 cases carried a 2 allele for both IL-1RN (+2018) compared with only 2 controls OR= 8.0, 95% c.i. 1.00-64.0, p=0.05 These results suggest that the IL-1RN polymorphism (+2018) and the related IL-1RN VNTR confer increased risk of developing IPF and implies that unopposed IL-1 beta biological activities may play a pathophysiological role in this condition. The rare allele of IL 1RN VNTR/IL-1RN (+2018) is associated with lower IL- 1RN protein production in vivo (Carter et al., 1978) and in vitro (Tountas et al., 1997). Lower levels of IL-1Ra will significantly dampen the anti-inflammatory activity of this cytokine, with a net effect of increased proinflammatory effects of IL- 1 alpha and IL- 1 beta. The results related to the TNFA (-308) gene variant, a promoter polymorphism which has been associated with increased levels of TNF alpha transcription (Wilson, A.G., et al., (1997) Proc. Natl. Acad. Sci. 94:3195-3199), indicate a contribution of this locus (human chromosome 6) to susceptibility to IPF. Alternative genotyping methods are described in the following Tables 6-8. -70- WO 00/60117 PCT/US00/08492 Table 6 TaqMan assays for IL-1RN (+2018) and TNFA (-308) IL-1RN (+2018) Cycling: [96 C, 1 min] x 1; [94 C, 1 min, 63 C, 1 min, 70 C, 1 min] x 35, [63 C, 5 min, 70 C, 5 min] x 1. Probe 1 5'- C (- FAM) AACCAACTAGTTGCTGGATACTTGCAAG (- TAMRA) -3' (SEQ ID NO. 13) Probe 2 5'- C (- TET) AACCAACTAGTTGCCGGATACTTGCAAG (- TAMRA) 3' (SEQ ID NO. 14) Forward 5' - AAGTTCTGGGGGACACAGGAAG -3' (SEQ ID NO. 15) Reverse 5' - ACGGGCAAAGTGACGTGATG -3' (SEQ. ID. 16) TNF (-308) Cycling: [50 C, 2 min] x 1; [95 C, 10 min] x 1; [95 C, 15 sec, 58 C, 1 min] x 40; [15 C, hold] Probe 1 5' - A (- TET) CCCCGTCCCCATGCCC (- TAMRA) -3' (SEQ ID NO. 17) Probe 2 5' - A (- FAM) ACCCCGTCCTCATGCCCC (- TAMRA) -3' (SEQ ID NO 18) Forward 5' - GGCCACTGACTGATTTGTGTG T -3' (SEQ ID NO. 19) Reverse 5' - CAAAAGAAATGGAGGCAATAGGTT -3' (SEQ ID NO. 20) -71- WO 00/60117 PCT/US00/08492 Table 7 Additional Method: IL-IRN VNTR IL-1RN (VNTR) The existence of a variable number of tandem repeats in intron 2 of IL-1RN gene was characterized by Tarlow et al (1993) Hum Genet. 91:403-404, as a variable number (2 to 6) of 86 bp repeats. GENE ACCESSION NUMBER: X64532. OLIGONUCLEO TIDE PRIMERS: 5' -CTCAGCAACACTCCTAT-3' SEQ ID NO 21 5' -TCCTGGTCTGCAGGTAA-3' SEQ ID NO 22 SPECIFIC CONDITIONS: Cycling: [96 , 1 min] x 1; [94 , 1 min; 60 , 1 min; 70 , 2 min;] x 35; [70 , 5 min] x 1; 4 C. Electrophoresis in 2% agarose, 90V, 30 min. INTERPRETATION: The PCR product sizes are direct indication of number of repeats: the most frequent allele (allele 1) yields a 412 bp product. As the flanking regions extend for 66 bp, the remaining 344 bp imply four 86 bp repeats. Similarly, a 240 bp product indicates 2 repeats (allele 2), 326 is for 3 repeats (allele 3), 498 is 5 (allele 4), 584 is 6 (allele 6). Frequencies in a North British Caucasian population for the four most frequent alleles are 0.734, 0.241, 0.021 and 0.004. -72- WO 00/60117 PCT/US00/08492 Table 8 TNF (-238) Polymorphism Typing This single base variation in the TNFA promoter was described by D'Alfonso et al. In 1993 (D'Alfonso, S. and Richiardi, P.M. (1994) Immunogenetics 39:150-154). One of the PCR primers has a base change to create an Aval site when amplifying allele 1. GENE ACCESSION NUMBER: X02910 and X02159 OLIGONUCLEOTIDE PRIMERS: 5' -GAA.GCC.CCT.CCC.AGT.TCT.AGT.TC-3' (-425/-403) 5' -CAC.TCC.CCA.TCC.TCC.CTG.GTC-3' (-236/-217) SPECIFIC CONDITIONS: MgCI 2 is used at 2 mM final, and PCR primers at 0125 uM. Cycling is performed at [940, 1 min; 610 , 1 min, 72', 1 min;] x35; [720, 5 min] xl; 4oC. Each PCR reaction is added of 5 Units of Aval in addition to 3ul of the specific 10X restriction buffer. Incubation is at 37oC overnight. Electrophoresis is by PAGE 12%. INTERPRETATION: Avall will produce a constant band of 77 bp the absence of which indicates incomplete digestion. In addition to this, allele 1 will be digested as 63+49+21 bands, allele2 as 70+63. Heterozygotes will have a mixed pattern of restriction. Frequencies in North English White Caucasian population are 0.94 and 0.06. For 90% power at 0.05 level of significance in a similar genetic pool, 1432 cases should be studied to detect 1.5 fold increase in frequency, or 149 for 0.1 absolute increase in frequency. -73- WO 00/60117 PCT/US00/08492 EXAMPLE 3. Association of Polymorphisms with Incidence of Silocosis in Mine Workers Genotyping studies were done by investigators at the National Institute of Occupational Safety and Hazards on samples obtained from subjects who worked in mines. The diagnosis of silicosis was based on gross and microscopic analyses of the lungs at autopsy. The controls were miners with no evidence on autopsy of silicosis or other occupational lung disorders. A significant association was found between IL- 1 RA allele 2 and moderate disease (OR 2.85 p=0.001 95%CI:1.72-4.74). 1.1 vs 1.2 or 2.2. A significant association was found between IL-1RA allele 2 and severe disease (OR 1.76 p=0.018 95%CI:1.10-2.81). 1.1 vs 1.2 or 2.2. A borderline negative association between IL-1RA allele 2 and disease severity among the disease patients (moderate vs severe) (OR 0.62 p=0.049 95%CI: 0.38-1.0). 1.1 vs 1.2 or 2.2. A significant association was found between IL-1RA allele 2 and disease (OR 2.16 p=0.001 95%CI: 1.41-3.29). 1.1 vs 1.2 or 2.2. A significant association was found between IL-1RA allele 2.2 and disease (OR 2.92 p=0.026 95%CI: 1.09-7.81). IL-1A +4845 A significant association was found between IL-1 A +4845 allele and disease severity among diseased patients (OR 1.97 p=0.022 95%CI: 1.10-3.53). 1.1 vs 1.2 or 2.2 IL-1B +3954 A significant association was found between IL-1B +3954 allele 2.2 and moderate disease (OR 3.26 p=0.024 95%CI: 1.11-9.55). 1.1 or 1.2 vs 2.2. A significant association was found between IL-1B +3954 allele 2.2 and severe disease (OR 3.12 p=0.025 95%CI: 1.10-8.83). 1.1 or 1.2 vs 2.2. A significant association was found between IL-1B +3954 allele 2.2 and disease (OR 5.7 p=0.024 95%CI: 2.13-15.26). 1.1 or 1.2 vs 2.2. TNFA (-238) A significant association was found between TNFA (-238) allele 2 and moderate disease (OR 4.00 p=0.001 95%CI: 2.52-6.37). 1.1 or 1.2 vs 2.2. A significant association was found between TNFA (-238) allele 2 and disease (OR 1.63 p=0.01 2 95%CI: 1.11-2.39). 1.1 or 1.2 vs 2.2. -74- WO 00/60117 PCT/US00/08492 IL-1RN (+2018) or VNTR is associated with increased risk for silicosis (i.e. pulmonary fibrosis). -75-

Claims (77)

1. A method for determining whether a subject has or is predisposed to developing an interstitial lung disease, comprising the steps of: a) obtaining a nucleic acid sample from the subject; and b) detecting an IL-1RN (+2018) allele, a TNF-A(-308) allele 2 or an allele in linkage disequilibrium with an IL-1RN (+2018) allele 2 or a TNF-1(-308) allele 2 in said sample, wherein detection of the IL-1RN (+2018) allele 2, TNF-A(-308) allele 2 or an allele in linkage disequilibrium with IL-1RN (+2018) allele 2 indicates that the patient has or is predisposed to the development of an ILD.

2. A method of claim 1, wherein the interstitial lung disease is an interstitial pneumonia.

3. A method of claim 1, wherein the interstitial lung disease is a pulmonary fibrosis.

4. A method of claim 1, wherein said detecting step is selected from the group consisting of: a) allele specific oligonucleotide hybridization; b) size analysis; c) sequencing; d) hybridization; e) 5' nuclease digestion; f) single-stranded conformation polymorphism; g) allele specific hybridization; h) primer specific extension; and j) oligonucleotide ligation assay. -76- WO 00/60117 PCT/US00/08492

5. A method of claim 1, wherein prior to the detection step, the nucleic acid sample is subject to an amplification step.

6. A method of claim 5, wherein said amplification step employs a primer selected from the group consisting of any of SEQ ID NO 1 through SEQ ID NO 12, SEQ ID NO 15, 16, 19 or 20.

7. A method of claim 4, wherein said size analysis is preceded by a restriction enzyme digestion.

8. A method of claim 7, wherein said restriction enzyme digestion uses a restriction enzyme selected from the group consisting of: Nco I, Alu I and Msp I.

9. A method of identifying an allele associated with an interstitial lung disease, said method comprising identifying an allele, which is in linkage disequilibrium with IL-1RN (+2018) allele 2 or TNF-A(-308) allele 2.

10. A kit for determining a subject's susceptibility to developing an interstitial lung disease, said kit comprising a first primer oligonucleotide that hybridizes 5' or 3' to an IL 1RN (+2018) allele, a TNF-A(-308) allele or an allele that is in linkage disequilibrium with an IL-1RN (+2018) allele or a TNF-A(-308) allele.

11. A kit of claim 10, wherein the allele that is in linkage disequilibrium with an IL-1RN (+2018) allele is IL-1RN (VNTR).

12. A kit of claim 10, which additionally comprises a second primer oligonucleotide that hybridizes 3' to an IL-1RN (+2018) allele or an allele that is in linkage disequilibrium with an IL-1RN (+2018) allele when the first primer hybridizes 5' and hybridizes 5' to an IL-1RN (+2018) allele or an allele that is in linkage disequilibrium with an IL-1RN (+2018) allele when the first primer hybridizes 3'.

13. A kit of claim 12, wherein said first primer and said second primer hybridize to a region in the range of between about 50 and 1000 base pairs. -77- WO 00/60117 PCT/US00/08492

14. A kit of claim 10 or 12, wherein said primer or primers is selected from the group consisting of any of SEQ ID NO 1 through SEQ ID NO 12, SEQ ID NO 15, 16, 19 or

20. 15. A kit of claim 10, wherein the interstitial lung disease is selected from the group consisting of an interstitial pneumonia. 16. A kit of claim 15, wherein the interstitial lung disease is pulmonary fibrosis. 17. A kit of claim 10, which additionally comprises a detection means. 18. A kit of claim 17, wherein the detection means is selected from the group consisting of: a) allele specific oligonucleotide hybridization; b) size analysis; c) sequencing; d) hybridization; e) 5' nuclease digestion; f) single-stranded conformation polymorphism; g) allele specific hybridization; h) primer specific extension; and j) oligonucleotide ligation assay. 19. A kit of claim 10, which additionally comprises an amplification means. 20. A kit of claim 10, which further comprises a control.

21. A method for selecting an appropriate therapeutic to administer to an individual having an interstitial lung disease, comprising the steps of: determining the IL-1 or TNF-A genotype of the individual to identify whether the subject contains an ILD associated allele and selecting a therapeutic that compensates for an ILD causative functional mutation that is in linkage disequilibrium with the polymorphism. -78- WO 00/60117 PCT/US00/08492

22. A method of claim 21, wherein the interstitial lung disease is an interstitial pneumonia.

23. A method of claim 21, wherein the interstitial lung disease is a pulmonary fibrosis.

24. A method of claim 21, wherein said genotyping is selected from the group consisting of: a) allele specific oligonucleotide hybridization; b) size analysis; c) sequencing; d) hybridization; e) 5' nuclease digestion; f) single-stranded conformation polymorphism; g) allele specific hybridization; h) primer specific extension; and j) oligonucleotide ligation assay.

25. A method of claim 21, wherein prior to the genotyping, the nucleic acid sample is subjected to an amplification step.

26. A method of claim 25, wherein said amplification step employs a primer selected from the group consisting of any of SEQ ID NO 1 through SEQ ID NO 12, SEQ ID NO 15, 16, 19 or 20.

27. A method of claim 24, wherein said size analysis is preceded by a restriction enzyme digestion.

28. A method of claim 27, wherein said restriction enzyme digestion uses a restriction enzyme selected from the group consisting of: Nco I, Alu I and Msp I.

29. A method of claim 21, wherein the therapeutic is selected from the group consisting of: a corticosteroid, antimetabolite, cytotoxic drug, colchicine or an anticytokine. -79- WO 00/60117 PCT/US00/08492

30. A method of claim 21, wherein the therapeutic is selected from the group consisting of: a modulator of an IL-1 or TNFc activity.

31. A method of claim 30, wherein the IL-1 is IL-la.

32. A method of claim 30, wherein the IL-1 is IL-11 3.

33. A method of claim 30, wherein the IL-1 is IL-1Ra.

34. A method of claim 30, wherein the therapeutic is a protein, peptide, peptidomimetic, small molecule or a nucleic acid.

35. A method of claim 30, wherein the modulator is an agonist.

36. A method of claim 30, wherein the modulator is an antagonist.

37. A method of claim 21, wherein the ILD associated allele is IL-1RN (+2018) allele 2, TNF-A(-308) allele 2 or an allele that is in linkage disequilibrium with IL-1RN (+2018) allele 2 or TNF-A(-308) allele 2.

38. A method of claim 21, wherein the ILD causative functional mutation is IL 1B (+6912) allele 2, IL-1B (-511) or IL-1RN (+2018).

39. A method for determining the effectiveness of treating an ILD subject with a particular dose of a particular therapeutic, comprising the steps of: (a) detecting the level, amount or activity of an IL-1 or TNF-ct protein; or an IL 1 or TNF-A mRNA or DNA in a sample obtained from a subject; (b) administering the particular dose of the particular therapeutic to the subject; detecting the level, amount or activity of an IL-1 or TNF-ct protein; or an IL-1 or TNF-A mRNA or DNA in a sample obtained from a subject; and (c) comparing the relative level, amount or activity obtained in step (a) with the level, amount or activity obtained in step (b). -80- WO 00/60117 PCT/US00/08492

40. A method of claim 39, wherein the therapeutic is selected from the group consisting of: a corticosteroid, antimetabolite, cytotoxic drug, colchicine or an anticytokine.

41. A method of claim 39, wherein the therapeutic is selected from the group consisting of: a modulator of an IL-1 or TNFt activity.

42. A method of claim 41, wherein the IL-1 is IL-la.

43. A method of claim 41, wherein the IL-1 is IL-13.

44. A method of claim 41, wherein the IL-1 is IL-1Ra.

45. A method of claim 41, wherein the therapeutic is a protein, peptide, peptidomimetic, small molecule or a nucleic acid.

46. A method of claim 41, wherein the modulator is an agonist.

47. A method of claim 41, wherein the modulator is an antagonist.

48. A method for treating a subject having an interstitial lung disease comprising the steps of: determining the IL-1 or TNF-A genotype of the individual to identify the presence of an ILD associated allele; and administering to the subject a therapeutic that compensates for an ILD causative mutation that is in linkage disequilibrium with the polymorphism.

49. A method of claim 48, wherein the interstitial lung disease is an interstitial pneumonia.

50. A method of claim 48, wherein the interstitial lung disease is a pulmonary fibrosis.

51. A method of claim 48, wherein said genotyping is selected from the group consisting of: a) allele specific oligonucleotide hybridization; -81- WO 00/60117 PCT/US00/08492 b) size analysis; c) sequencing; d) hybridization; e) 5' nuclease digestion; f) single-stranded conformation polymorphism; g) allele specific hybridization; h) primer specific extension; and j) oligonucleotide ligation assay.

52. A method of claim 48, wherein prior to the genotyping, the nucleic acid sample is subjected to an amplification step.

53. A method of claim 52, wherein said amplification step employs a primer selected from the group consisting of any of SEQ ID NO 1 through SEQ ID NO 12, SEQ ID NO 15, 16, 19 or 20.

54. A method of claim 52, wherein said size analysis is preceded by a restriction enzyme digestion.

55. A method of claim 54, wherein said restriction enzyme digestion uses a restriction enzyme selected from the group consisting of: Nco I, Alu I and Msp I.

56. A method of claim 48, wherein the therapeutic is selected from the group consisting of: a corticosteroid, antimetabolite, cytotoxic drug, colchicine or an anticytokine.

57. A method of claim 48, wherein the therapeutic is selected from the group consisting of: a modulator of an IL- 1 or TNFa activity.

58. A method of claim 57, wherein the IL-1 is IL-la.

59. A method of claim 57, wherein the IL-1 is IL-113.

60. A method of claim 57, wherein the IL-1 is IL-1Ra. -82- WO 00/60117 PCT/US00/08492

61. A method of claim 57, wherein the therapeutic is a protein, peptide, peptidomimetic, small molecule or a nucleic acid.

62. A method of claim 57, wherein the modulator is an agonist.

63. A method of claim 57, wherein the modulator is an antagonist.

64. A method of claim 48, wherein the ILD associated allele is IL-1RN (+2018) allele 2, TNF-A(-308) allele 2 or an allele that is in linkage disequilibrium with IL-1RN (+2018) allele 2 or TNF-A(-308) allele 2.

65. A method of claim 48, wherein the ILD causative functional mutation is IL-1B (+6912) allele 2, IL-1B (-511) or IL-1RN (+2018).

66. A method for screening for an ILD therapeutic comprising the steps of: a) combining an IL-1 or TNF-a polypeptide or bioactive fragment thereof, an IL-1 or TNF-a binding partner and a test compound under conditions wherein, but for the test compound, the IL-1 or TNF-a protein and IL-1 or TNF-a binding partner are able to interact; and b) detecting the extent to which, in the presence of the test compound, an IL-1 or TNF-a protein/IL-1 or TNF-a binding partner complex is formed, wherein an increase in the amount of complex formed by an agonist in the presence of the compound relative to in the absence of the compound or a decrease in the amount of complex formed by an antagonist in the presence of the compound relative to in the absence of the compound indicates that the compound is an ILD therapeutic.

67. A method of claim 66, wherein the agonist or antagonist is selected from the group consisting of: a protein, peptide, peptidomimetic, small molecule or nucleic acid.

68. A method of claim 67, wherein the nucleic acid is selected from the group consisting of: an antisense, ribozyme and triplex nucleic acid. -83- WO 00/60117 PCT/US00/08492

69. A method of claim 66, which additionally comprises the step of preparing a pharmaceutical composition from the compound.

70. A method of claim 66, wherein the IL-1 is IL-la.

71. A method of claim 66, wherein the IL-1 is IL-103.

72. A method of claim 66, wherein the IL-1 is IL-1Ra.

73. A method for identifying an ILD therapeutic, comprising the steps of: (a) contacting an appropriate amount of the candidate compound with a cell or cellular extract, which expresses an IL-1 or TNF-A gene; and (b) determining the resulting protein bioactivity, wherein a decrease of an agonist bioactivity or a decrease in an antagonist bioactivity in the presence of the compound as compared to the bioactivity in the absence of the compound indicates that the candidate is an ILD therapeutic.

74. A method of claim 73, wherein the modulator is an antagonist of an IL-la, IL- 13, or TNFa bioactivity.

75. A method of claim 73, wherein the modulator is an agonist of an IL-1Ra bioactivity.

76. A method of claim 73, wherein in step (b), the protein bioactivity is determined by determining the expression level of the IL-1 or TNF-A gene.

77. A method of claim 73, wherein the expression level is determined by detecting the amount of mRNA transcribed from the IL-1 or TNF-A gene. -84- WO 00/60117 PCT/US00/08492

78. A method of claim 73, wherein the expression level is determined by detecting the amount of the IL-1 or TNF-A gene product produced.

79. A method of claim 73, wherein the expression level is determined using an anti-the IL-1 or TNF-A antibody in an immunodetection assay.

80. A method of claim 73, which additionally comprises the step of preparing a pharmaceutical composition from the compound.

81. A method of claim 73, wherein said cell is contained in an animal.

82. A method of claim 81, wherein the animal is transgenic. -85-