AU3733599A - Novel gene regulating the synthesis of abscisic acid - Google Patents

Description

-- AR015 DESCRIPTION NOVEL GENE CONTROLLING ABSCISIC ACID SYNTHESIS 5 TECHNICAL FIELD The present invention relates to a novel gene. More particularly, the present invention relates to a novel gene encoding a protein having a function of controlling abscisic 10 acid synthesis in a plant. BACKGROUND ART Transposons are mutagenic genes which are 15 ubiquitous in the genomes of animals, yeast, bacteria and plants. Transposons are classified into two categories according to their transposition mechanism. Transposons of class II undergo transposition in the form of DNA without replication. Examples of known class II transposons 20 include Ac/Ds, Spm/dSpm and Mu elements of maize (Zea mays) (Fedoroff, 1989, Cell 56, 181-191; Fedoroff et al., 1983, Cell 35, 235-242; Schiefelbein et al., 1985, Proc. Natl. Acad. Sci. USA 82, 4783-4787), and Tam element of Antirrhinum (Antirrhinum majus) (Bonas et al., 1984, EMBO J, 3, 25 1015-1019). Class II transposons are widely used in gene isolation by means of transposon tagging. Such a technique utilizes a property of transposons. That is, a transposon transposes within a genome and enters a certain gene and, as a result, such a gene is functionally modified, whereby 30 the phenotype controlled by the gene is changed. The affected gene may be isolated by detecting such a phenotype change (Bancroft et al., 1993, The Plant Cell, 5, 631-638; Colasanti et al., 1998, Cell, 93, 593-603; Gray et al., 1997, - 2 - AR015 Cell, 89, 25-31; Keddie et al., 1998, The Plant Cell, 10, 877-887; Whitham et al., 1994, Cell, 78, 1101-1115). Transposons of class I are also called 5 retrotransposons. Retrotransposons undergo replicative transposition through RNA as an intermediate. A class I transposon was originally identified and characterized in Drosophila and yeast. A recent study has revealed that retrotransposons are ubiquitous and dominant in plant 10 genomes (Bennetzen, 1996, Trends Microbiolo., 4, 347-353; Voytas, 1996, Science, 274, 737-738). It appears that most retrotransposons are an integratable but non-transposable unit. Recently, it has been reported that some retrotransposons of such a type are activated under stress 15 conditions, such as injury, pathogen attack, and cell culture (Grandbastien, 1998, Trends in Plant Science, 3, 181-187; Wessler, 1996, Curr. Biol. 6, 959-961; Wessler et al., 1995, Curr. Opin. Genet. Devel. 5, 814-821). For example, such activation under stress conditions was found 20 in retrotransposons of tobacco, TntlA and Ttol (Pouteau et al., 1994, Plant J., 5, 535-542; Takeda et al., 1988, Plant Mol. Biol., 36, 365-376), and a retrotransposon of rice, Tos17 (Hirochika et al., 1996, Proc. Natl. Acad. Sci. USA, 93, 7783-7788). 25 The rice retrotransposon Tos17 is a class I element in a plant which has been extensively studied. Tos17 was cloned by RT-PCR using degenerate primers which had been prepared based on a conserved amino acid sequence of a 30 reverse transcriptase domains of Tyl-copia group retro elements (Hirochika et al., 1992, Mol. Gen. Genet., 233, 209-216). Tos17 has a length of 4.3 kb and has two identical LTRs (long terminal repeats) of 138 bp and a PBS (primer -3 - AR015 binding site) which is complementary to the 3' end of the initiator methionine tRNA (Hirochika et al., 1996, supra). Transcription of Tos17 is strongly activated by tissue culture, and the copy number of Tos17 increases with time 5 in culture. This initial copy number in Nipponbare, which is a japonica variety used as a genome research model, is two. In plants regenerated from tissue culture, the copy number is increased to 5 to 30 (Hirochika et al., 1996, supra) . Unlike class II transposons found in yeast and Drosophila, 10 Tos17 undergoes random transposition in a chromosome and induces mutation in a stable manner. Therefore, Tos17 provides a useful tool for isolating genes in rice (Hirochika et al., 1997, Plant Mol. Biol. 35, 231-240; 1999, Molecular Biology of Rice, K. Shimamoto Ed., Springer-Verlag, 43 15 48). Abscisic acid is an important plant hormone. It is known that the hormone has various physiological actions in plants, such as acceleration of abscission, induction 20 of dormancy, acceleration of aging, inhibition of growth, and stomatal closing (McCarty, D.R., Annu. Rev. Plant Physiol. Plant Mol. Biol. 46, 71-93 (1995), Giraudat, J. Curr. Opin. Cell Biol. 7: 232-240 (1995); Addicott, F.T. (Ed.), "Abscisic Acid", Praeger Scientific, New York 25 (1983)). It is also inferred that a reduction in the synthesis of abscisic acid leads to precocious germination and wilting of plants (e.g., maize) (McCarty, D.R., Annu. Rev. Plant Physiol. Plant Mol. Biol. 46, 71-93 (1995); Addicott, F.T., supra). Therefore, it is predicted that if 30 abscisic acid synthesis can be controlled, it will become possible to regulate or confer plant expression, such as inhibition of precocious germination and drought resistance.

-4 - AR015 Abscisic acid is a type of apocartenoide. Apocartenoides are compounds produced by oxidative cleavage of carotenoids, which exist widely in nature. Abscisic acid 5 is produced by oxidative cleavage of an epoxycarotenoid. Oxidative cleavage is the first reaction involved in abscisic acid biosynthesis, and has been proposed to be a rate-determining step in the reaction. 10 To date, two genes involving in abscisic acid biosynthesis have been isolated from plants. One of the two genes is VP14 isolated from a tobacco (Marvin, E. et al., EMBO J. , 15: 2331-2342, 1996), and the other is VP14 isolated from maize (Tan, B-C et al., Proc. Natl. Acad. Sci. 15 USA, 94, 12235-12240, 1997; Scheartz, S.H. et al., Science 276, 1872-1874), both of which were isolated by utilizing transposons. It is believed that there are other various genes which are involved in abscisic acid biosynthesis. There is a demand for further study of enzymes for abscisic 20 acid biosynthesis. The VP14 gene is a gene encoding abscisic acid synthetase. The product of the gene, which is an 9-cis epoxycarotenoid dioxygenase, cleaves 9-cis-epoxy 25 carotenoids (e.g., 9'-cis-violaxanthin and 9'-cis neoxanthin) to produce C 25 apoaldehyde and xanthoxin. Xanthoxin is a precursor of abscisic acid in higher plants. Expression of abscisic acid is induced by drying (Zeevaart, J.A.D. and Creelman, R.A., Annu. Rev. Plant Mol. Biol. 39, 30 439 (1988)). Further, mutations of the VP14 gene result in a decrease in abscisic acid synthesis. Therefore, it has been proposed that the VP14 gene is a rate-determining enzyme for abscisic acid synthesis (Scheartz, S.H., et al., Science -5 - AR015 276, 1872-1874, 1997). To date, VP14 has been identified only in maize. DISCLOSURE OF THE INVENTION 5 The present invention provides a novel plant gene provided using Tos17. The inventors have diligently studied and 10 systematically analyzed the phenotypes of plants having a newly transposed Tos17 copy and a sequence flanking a Tos17 target site. As a result, the inventors obtained a rice mutant having a precocious germination mutation due to Tos17 insertion and examined the Tos17 target site to find a novel 15 gene controlling abscisic acid synthesis, thereby completing the present invention. The present invention relates to an oligonucleotide encoding a plant gene capable of controlling abscisic acid 20 synthesis, comprising an oligonucleotide encoding an amino acid sequence from position 1 (M) to 164 (I) of SEQ ID NO. 2 in SEQUENCE LISTING, or an oligonucleotide encoding a second amino acid sequence having one or several amino acid deletions, substitutions, or additions in the amino acid 25 sequence. Preferably, the oligonucleotide is derived from rice. 30 Preferably, the oligonucleotide is represented by SEQ ID NO. 1 in SEQUENCE LISTING. Preferably, the oligonucleotide encodes a gene -6 - AR015 capable of regulating expression of a VP14-like gene. According to one aspect, the present invention relates to a vector comprising the above-described 5 oligonucleotide, in which the oligonucleotide is operatively linked to a control sequence. Preferably, the present invention relates to the pBIl01-Hm-VS1 vector. 10 According to one aspect, the present invention relates to a plant transformed using the above-described vector. 15 Further, the present invention relates to a method for controlling abscisic acid synthesis in a plant, comprising the step of introducing into a plant the above-described oligonucleotide. 20 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows photographs indicating phenotypes of precocious germination mutants. The left phenotype in the photograph shows a precocious germination mutant 25 (hetero) line and the right phenotype in the photograph shows a normal line. Figure 2 is a diagram showing linkage analysis between precocious germination mutation and Tos17. In the 30 figure, mutation indicates samples derived from precociously germinated individuals and WT indicates samples derived from normal plants. Lanes 1 to 10 indicate the precocious germination mutants and lanes 11 to 19 -7 - AR015 indicate the normal lines. An arrow indicates homo bands of Tos17. In the precocious germination mutants, the Tos17 bands are homozygous. 5 Figure 3 shows the sequence of a TAIL-PCR product of a sequence in the vicinity of a Tos17 insertion site (SEQ ID NO. 3). Figure 4 shows an about 6.0 kb sequence in the 10 vicinity of the Tos17 insertion site. The sequence was obtained by screening in Example 3 (SEQ ID NO. 4). Figure 5 is a diagram showing the nucleotide sequence (SEQ ID NO. 1) of an oligonucleotide according to 15 the present invention and the corresponding amino acid sequence. The base sequence and amino acid sequence of cDNA, which was obtained using RACE and a primer extension method based on the sequence in the vicinity of the Tos17 insertion site obtained using TAIL-PCR, was determined. In the figure, 20 a sequence of nucleotides from position 383 to 877 encodes an ORF consisting of 164 amino acids (SEQ ID NO. 2). In the figure, bold characters indicate the nuclear localization signal (bold character), and an underline indicates a glycine-rich amino acid sequence. A downward arrow 25 indicates a Tos17 insertion site in the mutant line A0150 (position 274). Figure 6 is a schematic diagram showing the T-DNA plasmid used in a complementation test. A 2390 bp fragment 30 obtained by BglII digestion, which includes an ORF into which Tos17 is inserted, was inserted into a BamHI site of pBI101-Hm.

-8 - AR015 Figure 7 shows a portion of the sequence of a rice VP14-like gene (SEQ ID NO. 5). This sequence was used as a probe to analyze expression of the VP14 gene. 5 Figure 8 is a diagram showing expression of a VP14-like gene in a vsl mutant strain. Expression of the VP14-like rice gene was analyzed by northern blotting. WT indicates a sample from a normal line and vsl indicates a sample from a precocious germination mutant. In "low 10 humidity" indicated in the figure, - indicates growth at normal humidity and + indicates growth at low humidity. An arrow indicates the band position of the RNA which disappeared in the precocious germination mutant vsl. 15 Figure 9 is a diagram showing expression analysis of a VS1 gene using a primer extension method. RNA prepared from rices grown at high humidity (control) or low humidity (low humidity) was used to perform primer extension. Induction due to drying was not observed. 20 BEST MODE FOR CARRYING OUT THE INVENTION The present invention provides a novel plant gene provided using Tos17, a vector including the novel gene, 25 a plant transformed using the novel gene, and a method for improving a plant comprising the step of transforming a plant using the novel gene. The present invention provides an oligonucleotide 30 encoding a plant gene capable of controlling abscisic acid synthesis. The term "capable of controlling abscisic acid synthesis" as used herein refers to prevention or enhancement of a gene involved in abscisic acid biosynthesis -9 - AR015 in a plant. The term "plant" comprises both monocotyledons and dicotyledons. Representative examples of an oligonucleotide 5 according to the present invention, which encodes a plant gene capable of controlling abscisic acid synthesis, include an oligonucleotide encoding an amino acid sequence from position 1 (M) to 164 (I) of SEQ ID NO. 2 in SEQUENCE LISTING, and an oligonucleotide encoding an amino acid 10 sequence having one or several amino acid deletions, substitutions, or additions in that amino acid sequence. The oligonucleotide of the present invention, which encodes a plant gene capable of abscisic acid synthesis 15 comprises an oligonucleotide having at least an 80% sequence identity with an amino acid sequence from position 1 (M) to 164 (I) of SEQ ID NO. 2 in SEQUENCE LISTING, preferably at least an 85% sequence identity, more preferably at least a 90% sequence identity, even more preferably at least a 20 95% sequence identity, and most preferably at least a 99% sequence identity, as long as the oligonucleotide is capable of controlling abscisic acid synthesis in a plant. The term "sequence identity" refers to that two oligonucleotides of interest have the same sequence. The level (%) of sequence 25 identity between two oligonucleotide sequences of interest is calculated as follows: the two oligonucleotide sequences are optimally aligned; sequence positions having the same nucleotide base (e.g., A, T, C, G, U, or I) between the sequences are counted and the total number of matching 30 positions is called the matching position number; and the matching position number is divided by the total number of bases of the two oligonucleotides and the result is multiplied by 100. The sequence identity may be, for - 10 - AR015 example, calculated using the following sequence analyzing tools: Unix-based GCG Wisconsin Package (Program Manual for the Wisconsin Package, Version 8, September 1994, Genetics Computer Group, 575 Science Drive Madison, 5 Wisconsin, USA53711; Rice, P., (1996) Program Manual for EGCG Package, Peter Rice, The Sanger Centre, Hinxton Hall, Cambridge, CB10 1RQ, England); the ExPASy World Wide Web Server for Molecular Biology (Geneva University Hospital and University of Geneva, Geneva, Switzerland); and 10 MacVector 6.0 (Teijin System Technology). Herein, peptide variation includes amino acid addition, deletion, substitution,.or modification. Amino acid addition refers to addition of one or more amino acids 15 to an original peptide chain. Amino acid deletion refers to deletion of one or more amino acids from an original peptide. Amino acid substitution refers to substitution of one or more amino acids in an original peptide. Amino acid or peptide modification includes, but is not limited to, 20 single or multiple, amidation, carboxylation, sulfation, halogenation, alkylation, glycosylation, phosphorylation, hydration, acylation (e.g., with an acetyl group or aliphatic group), and the like. An amino acid to substitute or be added may be a naturally-occurring amino acid or 25 alternatively a non-naturally-occurring amino acid. A naturally-occurring amino acid is preferable. In another embodiment of the present invention, the peptide and its variant of the present invention may be in the form of a salt of a peptide, such as ammonium salt (including alkyl 30 or aryl-ammonium salt), sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, dihydrogen phosphate, thiosulfate, carbonate, bicarbonate, benzonate, sulfonate, thiosulphonate, mesylate (methylsulfonate), - 11 - AR015 ethylsulfonate, and benzenesulfonate. (Variant having an equivalent biological function) Hereinafter, biological-functionally equivalent 5 substitution in a peptide will be briefly described. When biological-functionally equivalent substitution is performed in the peptide of the present invention or the DNA segment encoding the peptide, a protein or a functional molecule encoding a peptide, which still has a desired 10 property, is obtained. Hereinafter, a change in amino acid of protein for producing an equivalent or an improved second generated molecule will be discussed. Amino acid substitution may be conducted by chemical synthesis or by using a genetic engineering technique in which a codon 15 encoding an amino acid in a DNA sequence is changed. The present invention is not limited to these. A certain amino acid may be substituted with another amino acid without explicitly reducing or eliminating 20 interactive bonding ability, for example, in a protein structure having a cationic region or a binding site of a substrate molecule. Biological functional activity of a certain protein defines its interactive ability. Therefore, even when substitution of a specific amino acid sequence 25 is performed in a protein sequence and DNA coding a sequence therefor, a protein still having an original property can be obtained. Therefore, it is intended by the inventors that various modifications may be performed in the disclosed peptide sequence or a DNA sequence encoding the peptide 30 without explicitly reducing or eliminating the biological utility or activity thereof. When such variation is produced, the hydrophobic - 12 - ARO 15 index of an amino acid may be taken into consideration. The importance of the hydrophobic amino acid index of a protein is taken into consideration in the art when an attempt is made to confer an interactive biological function to the 5 protein (Kyte, J and Doolittle, R.F., J. Mol. Biol. 157(1): 105-132, 1982). It is recognized that the hydrophobic properties of its amino acid contributes to the secondary structure of a produced protein. The secondary structure defines interaction between the protein and other molecules 10 (e.g., a plasma membrane molecule, an enzyme, a substrate, a receptor, DNA, an antibody, and an antigen). A hydrophobic index is assigned to each amino acid based on the hydrophobicity and electric charge of the amino acid: isoleucine (+4.5); valine (+4.2); leucine (+3.8); 15 phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); praline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine 20 (-3.9); and arginine (-4.5)) (Kyte, J and Doolittle, R.F., 1982). It is well known in the art that even when a certain amino acid is substituted with another amino acid having 25 a similar hydrophobic index or value, a protein can still have a similar biological activity (e.g., a protein having an equivalent biological function). In such variation, amino acid substitution within ±2 of hydrophobic index is preferable, amino acid substitution within ±1 of hydrophobic 30 index is more preferable, and amino acid substitution within ±0.5 of hydrophobic index is even more preferable. It is understood in the art that amino acid substitution is effectively performed based on hydrophilicity. US Patent - 13 - AR015 No. 4,554,101 describes that the greatest local average hydrophilicity of a protein dominated by the hydrophilicity of a flanking amino acid relates to the biological properties of the protein. As described in US Patent No. 4,554,101, 5 the following hydrophilic indices are assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0±1); glutamic acid (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine(O); threonine (-0.4); proline (-0.5±1); alanine (-0.5); histidine (-0.5); 10 cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). It is to be understood that an amino acid may be substituted with another amino acid having a similar hydrophilic index so that a protein remains a 15 biological equivalent (particularly, an immunologically equivalent) protein. In such variation, amino acid substitution within ±2 of hydrophilic index is preferable, amino acid substitution within ±1 of hydrophilic index is more preferable, and amino acid substitution within ±0.5 20 of hydrophilic index is even more preferable. Herein, "conservative substitution" refers to amino acid substitution in which an original amino acid has a hydrophilic index or/and a hydrophobic index similar to 25 those of a substituting amino acid. A preferable conservative substitution is amino acid substitution within ±2 of hydrophilic index or/and hydrophobic index, more preferably ±1 of hydrophilic index or/and hydrophobic index, and even more preferably ±0.5 of hydrophilic index or/and 30 hydrophobic index. As briefly described above, amino acid substitution is performed based on the above-described indices.

- 14 - AR015 Examples of illustrative substitution based on the consideration of the above-described various properties, include: arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and 5 valine, leucine, and isoleucine, which are well known to those skilled in the art. The present invention is not limited to these. A sequence of nucleotides may be changed by 10 utilizing a degenerate sequence of a genetic code. Such a degenerate sequence is well known to those skilled in the art. It is apparent to those skilled in the art that degenerate sequences encode identical amino acids. 15 The term "control sequence" as used herein refers to a DNA sequence, such as a functional promoter and any other relevant transcriptional element (e.g., an enhancer, a CCAAT box, a TATA box, and SPI site). 20 The term "operatively linked" as used herein refers to that an oligonucleotide is linked to a regulatory element which regulates gene expression, such as a promoter and an enhancer, in such a manner that a gene encoded by the oligonucleotide can be expressed in a host cell. 25 It is well known to those skilled in the art that the types and kinds of a control sequence vary depending on the host cell. Examples of control sequences well known to those skilled in the art include the CaMV35S promoter 30 and the nopaline synthase promoter. A gene may be introduced into a plant body using a known method. Examples of such known methods include a method mediated by Agrobacterium or a method of directly introducing a gene - 15 - AR015 into a cell. An example of a method mediated by Agrobacterium is Nagel et al.'s method (Micribiol. Lett.,67,325(1990)). In this method, for example, an expression vector is first introduced into 5 Agrobacterium using electroporation, and the transformed Agrobacterium is then introduced into a plant cell in accordance with a method described in Plant Molecular Biology Manual (S.B. Gelvin et al., Academic Press Publishers). Examples of known methods for directly 10 introducing a gene into a cell include the electroporation method and the gene gun method. A gene-introduced cell is selected with reference to drug resistance, such as hygromycin resistance, and 15 thereaf ter, is regenerated into a plant body using a commonly used method. Generally, names and laboratory protocols as used herein are well known in the art. Recombinant techniques, 20 polynucleotide synthesis, and microorganism culture and transformation (e.g., electroporation) are used within standard technologies. These techniques and protocols are described in various general publications in the art and in this specification (generally, Sambrook et al., 25 Molecular Cloning: A Laboratory Manual, 2nd Ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). These publications are herein incorporated by reference. The oligonucleotide of the present invention is 30 representatively obtained by a method described herein. Alternatively, the oligonucleotide of the present invention may be obtained by chemical synthesis based on the sequence disclosed herein. For example, the oligonucleotide of the - 16 - AR015 present invention may be synthesized using an oligonucleotide synthesizer (manufactured by Applied Bio Systems) in accordance with the specification provided by the manufacturer. 5 PCR amplification methods are well known in the art (PCR Technology: Principles and Applications for DNA Amplification, edited by HA Erlich, Freeman Press, New York, NY (1992) ; PCR Protocols: A Guide to Methods and Applications, 10 edited by Innis, Gelf land, Snisky, and White, Academic Press, San Diego, CA (1990); Mattila et al. (1991) Nucleic Acids Res. 19: 4967; Eckert, K.A. and Kunkel, T.A. (1991) PCR Methods and Applications 1: 17; PCR, McPherson, Quirkes, and Taylor, IRL Press, Oxford). These publications are 15 herein incorporated by reference. EXAMPLES Hereinafter, the present invention will be 20 described by way of examples. The present invention is illustrated by the examples described below and is not limited to the examples. Chemicals and kits used in the following Examples 25 are available from Iwai Chemicals Company unless otherwise specified. (Example 1) Activation of Tos17 by culture and characterization of a resultant mutant 30 A fully mature seed of Nipponbare, which is a japonica variety, was used as a starting material to conduct callus initiation culture and cell suspension culture as described previously (Hirochika et al., 1996, supra).

- 17 - AR015 Tos17 was activated in accordance with Otsuki's method (1990) (Rice-protoplast culture, Agriculture, Forestry and Fisheries Technical Information Society). Briefly, a fully mature rice seed was cultured in MS medium containing 5 2,4-dichlorophenoxyacetic acid (2,4-D) (Otsuki (1990), supra) (25 0 C, one month) to induce callus. The resultant callus was cultured in N6 liquid medium containing 2,4-D (Otsuki (1990), supra) for 5 months and was then transferred to regeneration medium (Otsuki (1990), supra), thereby 10 obtaining regenerated rice (a first generation (R1) plant). A second generation of the resultant regenerated rice 500 line was disseminated in a field. The R2 group was germinated and, one week after the germination, seeds were produced. After maturation, each line was examined in 15 detail and precocious germination was found in one line. This strain is designated as VS1. To confirm the precocious germination property, a panicle whose precocious germination had been confirmed was incubated at a humidity of 100% and at a temperature of 25 0 C. As shown in Figure 1, 20 it was found that in the VS1 strain, about one quarter of the seeds on a panicle were germinated. In a normal line, no germination was observed under the same conditions. Such a result indicates that the VS1 strain has a precocious germination mutation. It was observed that on one panicle, 25 the ratio of the number of seeds having precocious germination to the number of seeds having no precocious germination was 1:3. This indicates that the mutation in precocious germination is recessive mutation. 30 (Example 2) Analysis of a precocious germination mutant As described above, the gene analysis revealed that the mutation in precocious germination was a recessive - 18 - AR015 mutation. An individual plant which had had precocious germination was further grown, and wilt as observed for a plant lacking in moisture, was observed. The phenomena of the precocious germination mutation and the wilt suggested 5 a reduction in an abscisic acid content (McCarty, D .R. , Annu. Rev. Plant Physiol. Plant Mol. Biol. 46, 71-93 (1995)). Thereafter, the abscisic acid content of a normal line and a mutant line were measured. The measurement was 10 conducted under a high humidity condition (i.e., in a sealed test tube) and then under a low humidity condition (i.e., six hours after the cap of a test tube was removed). The measurement of an abscisic acid content was conducted using an abscisic acid immunoassay detection kit (Sigma). The 15 result is shown in Table 1. In this measurement, the abscisic acid content of a young seedling was measured for each line. Whereas the abscisic acid content of a control line was increased due to drying, the abscisic acid content of the precocious germination mutant was not increased under 20 the same conditions. As a result, it was concluded that the isolated precocious germination mutant of this example had an abnormality in abscisic acid synthesis. Table 1: Abscisic acid content (nmol/g fresh weight) Growth Normal Mutant Ratio of abscisic acid condition content (Normal/mutant) High humidity 77.5 18.3 4.2 (sealed test tube) Low humidity 5025 28.5 176 (six hours after the cap of the test tube was removed) 25 - 19 - AR015 (Example 3) Isolation and structural analysis of a causative gene for the precocious germination mutant To identify and isolate a causative gene for the precocious germination mutant, linkage analysis with the 5 Tos17 gene was conducted using a population in which precocious germination mutants segregate. The linkage analysis was conducted in accordance with a typical method well known to in the art. Specifically, precocious germination mutants and normals were distinguished from one 10 another by the naked eye, and DNA was extracted from each group using a CTAB method (Murray, G.C. and Thompson, W.F., Nucl. Acids Res. 8: 4321-4325 (1980)). The resultant DNA was digested using a restriction enzyme, followed by 0.7% agarose gel electrophoresis. Thereafter, the DNA was 15 adsorbed to a nylon membrane (Schleicher & Schnell). Tos17 was digested using restriction enzymes, XbaI and BamHI, and the resultant DNA fragments were labeled with 32 P-dCTP, followed by Southern blotting. The result is shown in Figure 2. Lanes 1 to 10 indicate DNA obtained from the 20 precocious germination mutants, and lanes 11 to 19 indicate DNA obtained from the normals. Bands of Tos17 indicated by an arrow were observed for all of the precocious germination mutants. Although the Tos17 bands were observed for a part of the normals, the darkness of the bands were weak (the 25 amounts of DNA loaded on the lanes are not uniform. To avoid this problem, the darkness of a band was compared with that of a band immediately below the arrow). As a result, the Tos17 band indicated by the arrow was homozygous in the precocious germination mutants, and heterozygous in the 30 normals. This indicates that the Tos17 bands indicated by the arrow and the precocious germination mutation have complete linkage. Similar analysis was applied to a segregated population consisting of 60 individuals to - 20 - AR015 confirm the above-described results. These results suggest that Tos17 indicated by the arrow in Figure 2 induced a precocious germination mutation. 5 After the agarose electrophoresis of the mutant DNA treated with the above-described method, a portion of the gel corresponding to a region around a size indicated by the arrow in Figure 2 was dissected, followed by DNA extraction. The DNA extraction was conducted using 10 QIAquick Gel Extraction Kit (Qiagen). Using this DNA as a template, TAIL-PCR (Liu, Y.-G. and Whiffier, R.F., Genomics 25, 674-681 (1995)) was conducted to clone a sequence flanking Tos17, i.e., a portion of a causative gene for the precocious germination mutation. TAIL-PCR was conducted in 15 accordance with a method described in Miyao et al., Plant Biotechnology 15: 253-256 (1998). The resultant sequence is shown in Figure 3 (SEQ ID NO. 3). This sequence was used as a probe to conduct screening of a rice genomic library (obtained from Makoto Takano of the National Institute of 20 Agrobiological Resources). The screening was conducted in accordance with Sambrook et al. (supra) . By this screening, an about 6 kbp sequence in the vicinity of a Tos17 insertion portion of the resultant clone was determined. The sequence is shown in Figure 4 (SEQ ID NO. 4). RACE primer extension 25 (Frohman, M.A. et al., Proc. Natl. Acad. Sci. USA 85: 8998-9002 (1988)) was conducted based on the base sequence of the gene to determine the base sequence of cDNA encoded in the Tos17 insertion site (Figure 5, SEQ ID NO. 1). This cDNA has a full length of 894 bp (Figure 5, SEQ ID NO. 1) 30 and encodes an ORF consisting of 164 amino acids (Figure 5, nucleotides from position 383 to 877; SEQ ID NO. 2). This ORF includes a glycine-rich motif (underlined in Figure 5), and a nuclear localization signal (bold characters in - 21 - AR015 Figure 5). The Tos17 insertion site is indicated by an arrow (Figure 5). 5 (Example 4) Complementation test by gene introduction 1. Construction of a complementary vector and transformation of a precocious germination mutant using Agrobacter ium tumefaciens 10 In Example 3, a 2390 bp BglII fragment including a full-length open reading frame of a gene was integrated into the pBI101-Hm vector (obtained from Kenzo Nakamura of the School of Agricultural Sciences of Nagoya University) (Figure 6). The resultant vector was designated as 15 pBI101-Hm-VS1. Using this recombinant vector, an Agrobacterium tumefaciens EHA strain was transformed by electroporation in a selective medium containing 50 mg/l of kanamycin and hygromycin (obtained from Kenzo Nakamura of the School of Agricultural Sciences of Nagoya University) . 20 The resultant Agrobacterium strain was cryopreserved until future use. The seed of the precocious germination mutant was sterilized with 1% sodium hypochlorite, and washed with 25 sterilized distilled water five times. The seed was placed on N6 medium containing 3% sucrose, 0.3 g/l casein hydrolysate, 2.8 g/l proline, and 2.0 mg/l 2, 4-D, which was solidified with 5.0 g/l gel gum (Chu et al., 1975, Sci. Sinica, 18, 659-668). The pH of the medium had been adjusted 30 to pH 5.8 before being autoclaved. The seed was grown in the dark at 28 0 C for three weeks, thereby obtaining a small callus having a size of about 2 mm. The small callus was transferred to a callus inducing medium and cultured in the - 22 - AR015 light for four days. The resultant callus was subjected to Agrobacterium inf ection. The above-described cryopreserved Agrobacterium 5 was cultured in the dark at 22 0 C for three days in AB medium containing 50 mg/l kanamycin and 50 mg/l hygromycin, which was adjusted to pH 7.2 and solidified with 15 g/l agar (Chilton et al., 1974, Proc. Natl. Acad. Sci. USA, 71, 3672-3676). Agrobacterium bacteria were collected and 10 suspended in liquid AAM medium (Hiei et al., 1994, Plant J., 6, 271-282) containing 20 Rg of acetosyringone (Hiei, 1994, Plants, 6, 271-282). The resultant suspension was co-incubated with the above-described induced callus in the dark at 22 0 C for seven days so that the callus was infected 15 with Agrobacterium. The resultant callus was washed five times with a liquid callus inducing medium containing 500 mg/l of carbenicillin, followed by drying on a sterilized Whatman No. 1 filter paper. The callus was cultured for three weeks on a callus inducing medium 20 containing 50 mg/l hygromycin to select a hygromycin resistance callus, which was then transferred to a regeneration medium containing MS basal medium (pH 5.8) (Murashige and Skoog, 1962, Physiol. Plant., 15, 473-497) containing 30 g/l sucrose, 30 g/l sorbitol, 2 g/l casein 25 hydrolysate, 2g/l kinetin, 500 mg/l carbenicillin, 50 mg/l hygromycin and 5 /1 gel gum. The transformant was easily regenerated in a regeneration medium containing hygromycin without auxin or 30 NAA, and transferred to soil. The transformant grew normally without exhibiting a wilt phenomenon which is observed in the precocious germination mutant. This result leads to the conclusion that the mutation of the gene - 23 - AR015 isolated in Example 3 is responsible for the precocious germination mutation. This gene was designated as the VS1 gene. 5 (Example 5) Isolation of a VP14-like gene from rice As described above, the VP14 gene is believed to control the rate-determining step in abscisic acid synthesis. To date, this gene has been isolated only from 10 maize. Therefore, in order to isolate the VP14 gene from rice, the VP14 gene isolated from maize and the VP14-like gene isolated from Arabidopsis were compared with each other with respect to a conserved sequence using the genetic analysis software MacVector 6.0 (Teijin system technology) 15 to identify the conserved sequence. A 5'-end primer and a 3' -end primer corresponding to two portions of the conserved sequence were prepared. Using these two primers, the rice VP14 gene was amplified. The template used in this amplification was prepared as follows: a rice leaf was 20 subjected to drying (a leaf was dissected and left at room temperature for three hours); RNA was extracted from the leaf; the RNA was treated with reverse transcriptase (TaKaRa) to obtain a cDNA sample. By this PCR, an about 3.0 kbp product was obtained. The sequence of this product 25 was partially determined to reveal a high identity between the rice VP14 and the maize VP14 (85%). The partial sequence is shown in Figure 7 (SEQ ID NO. 5). Thereafter, this product was used as a probe to conduct expression analysis of the rice VP14-like gene. DNA extracted from normal rice 30 was used as a sample to conduct Southern blotting analysis. Five bands were obtained, suggesting that at least five VP14-like genes are present in rice.

- 24 - AR015 (Example 6) Functional analysis of the VS1 gene Thereafter, whether or not the VS1 gene can regulate expression of the VP14-like gene was studied. In Example 6, initially, the rice VP14-like gene was isolated and was used 5 as a probe to conduct northern blotting analysis. mRNA was isolated from normal line rice and VS1-mutant rice, which had been grown at high and low humidities, using ISOGEN (Nippon gene). This mRNA was isolated using agarose gel (1%), and was absorbed on a nylon membrane (Schleicher & 10 Schnell). Thereafter, the mRNA was subjected to northern blotting using a 32 P-dCTP labeled VP14 probe (Sambrook et al., supra). X-ray film was obtained from Kodak. The result is shown in Figure 5. As is seen from Figure 5, in the case of high humidity (indicated by - in Figure 8), 15 expression of VP14 was not found in both the normal line (WT) and the mutant (vsl). In the case of low humidity (+), two bands having different sizes (2.0 kb and 2.5 kb) were detected in the normal line (WT), while a band disappeared in the vsl mutant (vsl). Therefore, VS1 is considered to 20 be a gene causing down regulation of the VP14 or VP14-like gene. Thereafter, expression of the VS1 gene was analyzed using a primer extension method. The primer used in the 25 primer extension method was TTCGAGTTTTTGTGTTAGGG (SEQ ID NO. 6) corresponding to the VS1 gene, whose 5' terminus was labeled with 3 2 p-y-ATP using polynucleotidekinase (TOYOBO). RNA was prepared from a leaf subjected to dry induction treatment or an untreated leaf using ISOGEN (Nippon gene), 30 This RNA which was used as a template was placed on a sequencing gel (Sambrook et al., supra), followed by electrophoresis and exposure of X-ray film (Kodak). The details of the experiment were in accordance with Hirochika - 25 - AR015 (EMBO J., 12, 2521-2528, 1993). The result is shown in Figure 9. As is seen from Figure 9, it is apparent that VS1 is expressed similarly at low and high humidities. 5 The above-described Examples illustrate and describe various aspects of the present invention, and how the specific oligonucleotide of the present invention is prepared and utilized, but are not intended to limit the scope of the present invention. 10 INDUSTRIAL APPLICABILITY A novel oligonucleotide capable of controlling abscisic acid synthesis, which is applicable to plant 15 breeding, is provided. When the oligonucleotide is introduced into a plant to control abscisic acid synthesis, a plant having useful traits, such as drought resistance and suppressed precocious germination, is provided.

Claims (8)

1. An oligonucleotide encoding a plant gene capable of controlling abscisic acid synthesis, comprising an 5 oligonucleotide encoding an amino acid sequence from position 1 (M) to 164 (I) of SEQ ID NO. 2 in SEQUENCE LISTING, or an oligonucleotide encoding a second amino acid sequence having one or several amino acid deletions, substitutions, or additions in the amino acid sequence. 10

2. An oligonucleotide according to claim 1, wherein the oligonucleotide is derived from rice.

3. An oligonucleotide according to claim 1, wherein the 15 oligonucleotide is represented by SEQ ID NO. 1 in SEQUENCE LISTING.

4. An oligonucleotide encoding a gene capable of regulating expression of a VP14-like gene. 20

5. A vector comprising an oligonucleotide according to any one of claims 1 to 4, wherein the oligonucleotide is operatively linked to a control sequence. 25

6. A vector according to claim 5, wherein the vector is pBIl01-Hm-VS1.

7. A plant transformed using a vector according to claim 5 or 6. 30

8. A method for controlling abscisic acid synthesis in a plant, comprising the step of introducing into a plant an oligonucleotide according to any one of claims 1 to 5.