AU3598999A - Formulation having a papilloma virus-specific protein, and the production and use thereof - Google Patents

Description

WO 99/48917 PCT/EP99/01999 Formulation with papillomavirus-specific protein, its preparation and use The present invention relates to a formulation 5 comprising at least one papillomavirus-specific protein with about 0.3 to about 4M of a salt at a pH of about 7.3 to about 7.45. Papillomaviruses, also called wart viruses, are double 10 stranded DNA viruses having a genome size of approximately 8000 base pairs and an icosahedron-like capsid having a diameter of about 55 nm. To date, more than 100 different human papillomavirus types are known, of which some, e.g. HPV-16, HPV-18, HPV-31, 15 HPV-33, HPV-39, HPV-45, HPV-52 or HPV-58, can cause malignant tumours and others, e.g. HPV-6, HPV-11 or HPV-42, can cause benign tumours. The genome of the papillomaviruses can be subdivided 20 into three areas: the first area concerns a non-coding region which contains regulation elements for the transcription and replication of the virus. The second region, the so-called E (early) region, contains various protein-coding sections El-E7, of which, for 25 example, the E6 and the E7 protein are responsible for the transformation of epithelial cells and the El protein controls the DNA copy number. The E6 region and E7 region are so-called oncogenes, which are also expressed in malignantly degenerate cells. The third 30 region, also called the L (late) region, contains two protein-coding sections Ll and L2, which code for structural components of the virus capsid. The Ll protein is present to over 90% in the viral capsid, the ratio of Ll:L2 in general being 30:1. 35 HPV-6 and HPV-11 have been held responsible, inter alia, for genital warts; some papillomavirus types such as HPV-16, HPV-18, HPV-31, HPV-33, HPV-39, HPV-45, HPV-52 and HPV-58 are associated with malignant tumours WO 99/48917 - 2 - PCT/EP99/01999 of the anogenital tract. In over 50% of the cases, HPV-16 is connected with cervical cancer (carcinoma of the cervix) . HPV-16 is the main risk factor for the formation of cervical neoplasias. In addition, the 5 immune system plays an important role in the progress of the disease. Thus cellular immune responses and in particular antigen-specific T lymphocytes are supposedly important for the defence mechanism. It has furthermore been found that in high-grade cervical 10 intraepithelial neoplasias (CIN II/III) and cervical tumour the E7 gene is expressed constitutively in all layers of the infected epithelium. The E7 protein is therefore considered as a potential tumour antigen and as a target molecule for activated T cells. The 15 E7-induced cellular immune response in the patient, however, is apparently not strong enough to influence the course of the disease. The immune response can possibly be amplified by suitable vaccines. 20 It has now been possible to show that the expression of the Li gene or the coexpression of the Li and L2 gene forms virus-like particles (VLPs) . It was possible to use the VLPs for the formation of neutralizing antibodies in various animal systems. The formation of 25 virus-neutralizing antibodies, however, is of relatively low clinical importance if the virus infection has already taken place, since for the elimination of virus-infected cells a virus-specific cytotoxic T-cell (CTL) response appears to be 30 necessary. So-called chimeric papillomavirus-like particles (CVLPs) were therefore developed which consist of a chimeric Ll-E7 protein (Miller, M. et al. (1997) Virology, 234, 93): some CVLPs induce an E7-specific CTL response in mice, although experiments 35 failed to induce antibodies against E7 by immunization of mice with CVLPs (MUller, M. et al. (1997), supra). In addition, neutralizing antibodies of HPV-associated disorders in patients appear to limit the immune WO 99/48917 - 3 - PCT/EP99/01999 response to administered Ll protein (Miller, M. et al. (1997), supra) . CVLPs, however, are still of interest for the development of a vaccine, as the E7 proteins of tumour cells presented via MHC molecules of class I 5 would represent target molecules of CTLs. Peng et al. (1998) Virology, 240, 147 now describe CVLPs consisting of C-terminally truncated Li of the bovine papillomavirus (BPV) and HPV-16E7 49

-

57 , which 10 induce E7-specific cytotoxic T cells after inoculation of C57B1/6 mice and protect against the growth of E7-expressing tumours. Greenstone et al. (1998) Proc. Natl. Acad. Sci. USA, 95, 1800 describe CVLPs consisting of HPV-16L1 plus HPV-16L2 fused to the full 15 length HPV-16E7 protein, which protect against the growth of epithelial E7-expressing tumour cells after immunization of C57B1/6 mice, cytotoxic T cells, however, not being detected and thus the induction of the immune response appearing to be less efficient. 20 VLPs and CVLPs are in general prepared by means of genetic engineering by expression of the corresponding genes coding for one or more L proteins or L and E proteins in suitable expression systems. The corresponding genes are described, for example, in 25 Kirnbauer, R. et al. (1994) J. Virol., 67, 6929-6936 or obtainable via the EMBL databank. The accession numbers are, for example, for HPVl8: PAPHPVl8; for HPV31: PAPPPH31; for HPV33: PAPPPH33 or for HPV58: PAPPPH58. Suitable expression systems are, for example, yeasts 30 modified by genetic engineering, e.g. Saccharomyces (cerevisiae), Pichia (pastoris), Kluyvermyces (lactis), Schizosaccharomyces (pombe) or Hansenula (polymorpha) (Carter, J. J. et al. (1991), Virology, 182, 513), insect cells, such as, for example, Trichoplusia ni 35 High Five (see, for example, Miller, M. et al. (1997), supra) or prokaryotic cells (see, for example, WO 96/11272). In the case of the production of the particles in prokaryotic cells, these are in general WO 99/48917 - 4 - PCT/EP99/01999 deposited in the cell and form so-called inclusion bodies, which then have to be renatured and brought into solution. For use of the particles or capsids produced by genetic engineering or their precursors, 5 the so-called capsomers, further purification steps are necessary after expression. A significant problem in the use of capsids and capsomers as medicaments is their poor solubility. 10 Thus, for example, capsids or capsomers of HPV-16 tend to aggregate, whereby the solubility is significantly reduced. The low solubility of the capsids or capsomers in some cases leads not only to a loss of yield, but also to complicated use as a medicament or diagnostic. 15 Moreover, sometimes degradation of the C terminus of the Ll protein can be observed, which leads to inhomogeneous material which is not suitable for licensing as a medicament or diagnostic. 20 WO 98/44944 describes an HPV antigen formulation comprising a vaccine component, a salt to physiologically acceptable concentrations and a non ionic detergent to physiologically acceptable concentrations. 25 It was therefore the object of the present invention to make available a simple and advantageous formulation in which papillomavirus-specific proteins are soluble and stable. 30 It has now surprisingly been found that the solubility of papillomavirus-specific proteins is dependent on the salt concentration and on the pH of the formulation. In particular, it was surprising that a composition 35 without addition of an excipient is not stable at neutral pH in an isotonic salt solution of about 100-150 mM salt, although VLPs or CVLPs are formed in the cytoplasm of the host cells. In addition, it was WO 99/48917 - 5 - PCT/EP99/01999 found according to the present invention that at a pH of less than about 5.5 the CVLPs precipitate and at a pH of greater than 9.5 the CVLPs aggregate. 5 One subject of the present invention is therefore a formulation comprising at least one late protein (L protein) of one or more papillomaviruses and/or at least one early protein (E protein) of one or more papillomaviruses and about 0.3 to about 4 M, preferably 10 about 0.4 to about 2.5-3 M, in particular about 0.4-0.5 to about 1-2 M, especially about 1 to about 2 M, of a salt at a pH of about 7.3 to about 7.45, preferably about 7.4, and, if appropriate, suitable additives and/or excipients, preferably without any additive 15 and/or excipient. The term "formulation" is understood according to the present invention as meaning a composition in the form of a solution or a suspension of the papillomavirus 20 specific proteins mentioned, where immunoreactive papillomavirus-specific proteins in general and in particular do not significantly sediment at up to at most about 5000 g. 25 The salt is in general an alkali metal or alkaline earth metal salt, preferably a halide or phosphate, in particular an alkali metal halide, especially NaCl and/or KCl. Use of NaCl is particularly preferred for the production of a pharmaceutical formulation. 30 The pH of the composition is in general adjusted using a suitable organic or inorganic buffer, such as, for example, preferably using a phosphate buffer, tris buffer (tris(hydroxymethyl)aminomethane), HEPES buffer 35 ([4-(2-hydroxyethyl)piperazino]ethanesulphonic acid) or MOPS buffer (3-morpholino-l-propanesulphonic acid). The choice of the respective buffer in general depends on the desired buffer molarity. Phosphate buffer is WO 99/48917 - 6 - PCT/EP99/01999 suitable, for example, for injection and infusion solutions. For the use of the composition according to the 5 invention as a medicament or diagnostic it is particularly preferred if the papillomavirus-specific proteins contain no papillomavirus-unspecific epitopes, since hereby a papillomavirus-unspecific immune response can be reduced or prevented. 10 The terms L protein and E protein are understood within the meaning of the present invention as meaning both the full-length proteins and their mutants, such as, for example, deletion mutants. 15 In a further preferred embodiment, the composition according to the invention contains a deleted L protein, preferably a deleted Ll and/or L2 protein. The deletion has the advantage that different proteins, 20 for example papillomavirus-specific E protein sequences, can be inserted into the deleted area, whereby the application area of the composition according to the invention can be widened. An L protein having a C terminal deletion and in particular a 25 C-terminally deleted Li protein is particularly preferred. The C-terminal deletion has the advantage that the efficiency of the formation of virus-like particles can be increased, since the nuclear location signal located at the C terminus is deleted. The 30 C-terminal deletion is therefore preferably up to about 35 amino acids, in particular about 25 to about 35 amino acids, especially about 32 to 34 amino acids. For example, a C-terminal deletion of the HPV-16 L1 protein 32 amino acids long and a C-terminal deletion 35 of the BPV-1 Ll protein (bovine papillomavirus type 1) about 26 amino acids long is [sic] adequate to be able to increase the formation of virus-like particles by at least about 10-fold.

WO 99/48917 - 7 - PCT/EP99/01999 In a further preferred embodiment, the E protein is also deleted, especially the E6 and/or E7 protein. It is particularly preferred if the C-terminal part of the 5 E protein is deleted, preferably the C-terminal part of the E7 protein, as these constructs can preferably form capsomers and/or capsids in combination with deleted L protein. Deletions of up to about 55 amino acids are particularly preferred, preferably about 5 to about 10 55 amino acids, in particular about 38 to about 43 amino acids. A particularly preferred construct is, for example, E7 having the N-terminal amino acids 1 to about 60, as 15 this construct contains a mouse epitope for the activation of cytotoxic T lymphocytes, which is located in the area of the amino acids 49-57. Another preferred construct is E7 having the N-terminal amino acids 1 to about 55, which preferably forms capsomers and capsids 20 in combination with deleted L protein, as this construct presumably does not contain E7-specific sequences in the area of the amino acids 56-70, which can interfere with the formation of capsids. An Li protein of HPV-16 C-terminally deleted by 32 amino 25 acids and which is linked to an E7 protein of HPV-16 having the amino acids 1-55 or 1-60 is particularly preferred. These constructs not only induce neutralizing antibodies or a specific CTL response, but on the one hand prevent the formation of tumours and on 30 the other hand cause regression of already existing tumours in animal experiments. E7 having the amino acids 1-60 especially exhibits a marked prophylactic and therapeutic action in tumours. A particularly preferred embodiment of the present invention is 35 therefore an LlAE7 1 _x [sic] fusion protein, preferably in the form of a CVLPs, in particular of HPV16, x being an integer from 55 up to and including 60, and in particular an L1ACE7 1

-

55 or L1ACE7 1

-

60 fusion protein.

WO 99/48917 - 8 - PCT/EP99/01999 For the production of a medicament which is active both prophylactically and therapeutically, it is preferred if the protein is bonded to the E protein, for example 5 in the form of a fusion protein. It is furthermore preferred if the described papillomavirus-specific proteins are present in the form of a capsid and/or capsomer, since the immune reaction can additionally be markedly increased by the capsids and/or capsomers and 10 in particular by the fraction of L protein. Preferred fusion proteins which are suitable for capsid and/or capsomer formation are therefore, for example, fusion proteins from deleted Li and E7, E6 and/or El. 15 Capsids within the meaning of the present invention are viral or virus-like structures in a generally icosahedral form, which in general are constructed of about 72 capsomers. 20 Capsomers within the meaning of the present invention are assembled proteins comprising at least one papillomavirus structural protein, preferably Li or deletions of L1. For example, 5 fusion proteins can be assembled to give a capsomer which in turn can be 25 assembled to give a capsid. For the production of a human medicament or diagnostic, proteins or peptides of the human papillomavirus (HPV) and preferably of HPV-6, HPV-11, HPV-16, HPV-18, 30 HPV-31, HPV-33, HPV-35, HPV-39, HPV-45, HPV-52 and/or HPV-58, in particular HPV-16, HPV-18, HPV-31 and/or HPV-45 are suitable for the constructs described. Especially for the production of a combination vaccine, it is advantageous to combine proteins or peptides from 35 various HPV types, for example a combination of HPV-16 and HPV-18 or HPV-18, HPV-31, HPV-45 and HPV-58 in the case of, for example, carcinoma of the cervix or HPV-6 and HPV-11 in the case of, for example, condylomas.

WO 99/48917 - 9 - PCT/EP99/01999 The expression vectors can be, for example, prokaryotic or eukaryotic expression vectors. Examples of prokaryotic expression vectors are, for expression in 5 E. coli, e.g. the vectors pGEM or pUC derivatives (see, for example, WO 96/11272). Examples of eukaryotic expression vectors are, for expression in Saccharomyces cerevisiae, e.g. the vectors p426Met25 or p426GAL1 (Mumberg et al. (1994) Nucl. Acids Res., 22, 5767-5768, 10 Carter, J. J. et al. (1991) supra) and, for expression in insect cells, e.g. Baculovirus vectors, in particular the Autographa Californica virus, such as disclosed in EP-B1-0 127 839 or EP-B1-0 549 721 (see, for example, also WO 94/20137), and, for expression in 15 mammalian cells, e.g. the vectors Rc/CMV and Rc/RSV or SV40 vectors which are all generally obtainable. However, commercially obtainable Baculovirus expression systems are also suitable, such as, for example, the Baculo GoldTM transfection kit from Pharmingen or the 20 Bac-to-BacTM Baculovirus expression system from Gibco BRL. Further suitable expression systems are recombinant vaccinia viruses (see, for example WO 93/02184). 25 In general, the expression vectors also contain promoters suitable for the respective host cell, such as, for example, the trp promoter for expression in E. coli (see, for example, EP-B1-0 154 133), the ADH2 promoter for expression in yeasts (Russel et al. 30 (1983), J. Biol. Chem. 258, 2674-2682), the Baculovirus polyhedrin promoter for expression in insect cells (see, for example EP-B1-0 127 839 or U.S. 5,004,687) or the early SV40 promoter or LTR promoters, e.g. of MMTV (mouse mammary tumour virus; Lee et al. (1981) Nature 35 214, 228-232). Suitable host cells are, for example, the E. coli strains DH5, HB101 or BL21, the yeast strains WO 99/48917 - 10 - PCT/EP99/01999 Saccharomyces cerevisia [sic], Pichia, Kluyvermyces, Schizosaccharomyces or Hansenula (Carter, J. J. et al. (1991), Virology, 182, 513), the insect cell line Lepidopteran, e.g. from Spodoptera frugiperda, 5 Trichoplusia ni, Rachiplusia ou or Galleria Mellonela or the animal cells COS, C127, Vero, 293 and HeLa, which are all generally obtainable (see, for example, WO 94/00152). 10 The coding nucleic acids for the individual papillomavirus-specific proteins can be isolated and cloned, for example, from a gene bank by means of a PCR (polymerase chain reaction) amplification. For example, the genome of BPV-1 is generally obtainable under the 15 GenBank Accession No. X02346 or HPV-16 under the GenBank Accession No. K02718. An HPV-16 Ll sequence is also disclosed, for example, in WO 94/05792. The sequence of the 98 amino acid-long HPV16 E7 protein is described, for example, in Seedorf et al. (1985) 20 Virology, 145, 181-185. Another method of obtaining the desired nucleic acids is to isolate the papillomavirus specific genes directly from warts or tumours by means of PCR. Suitable primers for the E6 and E7 genes from HPV-16 and HPV-18 are disclosed, for example, in 25 WO 93/21958. Further references for the desired nucleic acids are, for example, Kirnbauer, R. et al. (1994), supra or the clones deposited in the EMBL databank already mentioned above. In a further preferred embodiment, the expression 30 vector is constructed such that the expressed fusion protein is extended by no further amino acids caused by the vector. This is achieved, for example, by removing undesired nucleotides which code for additional amino acids by mutagenesis in a PCR reaction by means of 35 suitable primer oligonucleotides (Ho et a. [sic] (1989) Gene, 77, 51-59) . In this way, a fusion protein is obtained which is free of additional amino acids and WO 99/48917 - 11 - PCT/EP99/01999 thus free of possible additional foreign epitopes which can cause immunological side reactions. After the expression of the described fusion protein, 5 it is preferred to purify this further or to renature it. Examples of chromatographic purification processes are found in Hjorth, R. & Moreno-Lopez, L. (1982) J. Virol. Meth. 5, 151; Nakai, Y. et al. (1987) J. Gen. Virol., 68, 1891 [sic]; Hofmann, K. J. et al. (1995) 10 Virology, 209, 506; Rose, R. C. et al. (1993) J. Virol., 67, 1936, Sasagawa, T. et al. (1995) Virology, 206, 126 or WO 95/31532.. Suitable additives and/or excipients which serve, for 15 example, for the further stabilization of the papillomavirus-specific protein in the composition according to the invention are, for example, detergents, such as, for example, Triton X-100 or sodium deoxycholate, but also polyols, such as, for 20 example, polyethylene glycol or glycerol, sugars, such as, for example, sucrose or glucose, zwitterionic compounds, such as, for example, amino acids such as glycine or in particular taurine or betaine and/or protein, such as, for example, bovine or human serum 25 albumin. Detergents, polyols and/or zwitterionic compounds are preferred. Other suitable additives and/or excipients are protease inhibitors, such as, for example, aprotinin, 30 c-aminocaproic acid or pepstatin A. Another subject of the present invention is a process for the production of the formulation according to the invention, in which the papillomavirus-specific protein 35 described above is introduced, for example, into solution comprising about 0.3 to about 4 M, preferably about 0.4 to about 2.5-3 M, in particular about 0.4-0.5 to about 1-2 M, especially about 1 to about 2 M, of a Wo 99/48917 - 12 - PCT/EP99/01999 salt at a suitable pH of about 7.3 to about 7.45, preferably about 7.4, and, if appropriate, suitable additives and excipients, and/or is dialysed against the described composition. The formulation can 5 preferably be stably stored at about 4 0 C or especially about -80 0 C over a relatively long period of time, for example 1-2 months or longer. The formulation according to the invention is suitable 10 as a medicament or diagnostic. The present invention therefore also relates to the use of the formulation according to the invention as a medicament or diagnostic. For the immediate use as a medicament or diagnostic, the formulation according to the invention 15 is preferably adjusted to a concentration of about 0.45 M. In particular, it is preferred if the medicament contains no adjuvant, i.e. no substance which amplifies the immunogenicity of the papillomavirus-specific protein, since the 20 immunogenicity is already adequately amplified, in particular in the presence of an L protein especially of L1. This property is particularly advantageous in the licensing as a medicament or diagnostic, as the only immunostimulating materials at present licensed by 25 the licensing authorities are aluminium salts. The medicament is particularly suitable for the avoidance and/or treatment of papillomavirus-specific benign or malignant tumour, in particular of malignant 30 tumour, such as, for example, carcinoma of the larynx, cervix, penis, vulva or anus, and the diagnostic for the diagnosis of one or more papillomavirus infections. An example of a diagnostic is the immunodiagnostic known to the person skilled in the art, for example an 35 ELISA for the measurement of papillomavirus-specific antibodies (see, for example, Voller, A. et al. (1976) Bull. World Health Organ., 53, 55-63) or a skin test WO 99/48917 - 13 - PCT/EP99/01999 according to, for example, Hbpfl et al. (1991) Lancet. 1, 373-374). In general, the medicament can be administered orally, 5 parenterally, such as, for example, subcutaneously, intramuscularly or via the mucous membrane, in liquid or suspended form, in the form of an elixir or as capsules, preferably as an injection or infusion solution. In the case of the formulations according to 10 the invention, an adjuvant can be dispensed with, which is particularly advantageous. A further subject of the present invention therefore relates to the use of the formulation according to the 15 invention as an injection or infusion solution. Injection solutions are in general used if only relatively small amounts of a solution or suspension, for example about 1 to about 20 ml, are to be 20 administered to the body. Infusion solutions are in general used if a larger amount of a solution or suspension, for example one or more litres, are to be administered. Since, in contrast to the infusion solution, only a few millilitres are administered in 25 the case of injection solutions, small differences from the pH and from the osmotic pressure of the blood or the tissue fluid in the injection do not make themselves noticeable or only make themselves noticeable to an insignificant extent with respect to 30 pain sensation. Dilution of the formulation according to the invention before use is therefore in general not necessary. In the case of the administration of relatively large amounts, however, the formulation according to the invention should be diluted briefly 35 before administration to such an extent that an isotonic solution can be obtained. An example of an isotonic solution is a 0.9% strength sodium chloride solution. In the case of infusion, the dilution can be WO 99/48917 - 14 - PCT/EP99/01999 carried out, for example, using sterile water while the administration can be carried out, f or example, via a so-called bypass. 5 The significant advantage of the present invention is that the formulation according to the invention essentially does not lead to precipitation of immuno reactive papillomavirus-specific protein. In particular, more than about 90%, especially more than 10 about 95%, of the protein remains in solution and does not precipitate for a period of time of at least about 12 hours. The immunoreactive papillomavirus-specific protein is also not substantially sedimentable by centrifugation at a maximum of 5000 g. In addition, the 15 formulation remains homogeneous and stable over a relatively long period of time of about 1-2 months and longer. The figure and the following examples are intended to 20 illustrate the invention in greater detail without restricting it. Fig. 1 shows graphically the dependence of the solubility of virus-like particles on the salt 25 concentration. Examples 1. Preparation of chimeric genes coding for HPV16L1E7 30 fusion proteins HPV 16L1AC* E7 1-55 was prepared according to Muller, M. et al. (1997), supra. The HPV-16Ll open reading frame (ORF) was in this case excized from the 35 plasmid HPV-16-114/k-Ll/L2-pSynxtVI~ (Kirnbauer, R. et al. (1994) J. Virol. 67, 6929) using the restriction endonuclease BglII and cloned into the BamHI site in the vector pUC19 (New England Biolabs).

WO 99/48917 - 15 - PCT/EP99/01999 For the preparation of HPV-16L1AC, two primers were constructed which are complementary to HPV-16L1 ORF. The first primer has the sequence AAAGATATCTTGTAGTAAAAATTTGCGTCCTAAAGGAAAC 5 and the second primer [lacuna) AAAGATATCTAATCTACCTCTACAACTGCTAAACGCAAAAAACG Both primers encode an EcoRV restriction enzyme cleavage site 5'. In the primers lying downstream, a 10 TAA translation stop codon follows the EcoRV site in order to delete the last 34 amino acids of the HPV16L1 ORF. The PCR reaction was carried out in order to amplify the entire Ll ORF and the entire vector. The linear product was cleaved with EcoRV, circularized 15 with T4 DNA ligase and transformed [lacuna] E. coli DH5a cells. The clones were analysed for the presence of an EcoRV site. The construct pUCHPV16L1AC obtained was used in order to clone the ORF of HPV16E7 1-50 into the EcoRV site. 20 For the cloning of the fragment, primers having a 5'EcoRV restriction enzyme cleavage site were used. The following primer pair was used: AAAAGATATCATGCATGGAGATACACCTACATTGC 25 and TTTTGATATCGGCTCTGTCCGGTTCTGCTTGTCC The PCR products were cleaved with EcoRV and inserted into the EcoRV site of the modified Ll gene. 30 For the elimination of the EcoRV sites, two PCR reactions were carried out in order to amplify two overlapping fragments of the clone pUC-HPV16L1ACE7 1-50. The resulting DNA fragments overlapped in the 35 position of the L1/E7 boundary (Four Primer PCR, Ho, S. N. et al (1989) Gene 77, 51). However, the primers did not contain the two EcoRV restriction WO 99/48917 - 16 - PCT/EP99/01999 enzyme cleavage sites. Fragment 1 was prepared using the primers P1 and P2 and fragment 2 using the primers P3 and P4. P1: GTTATGACATACATACATTCTATG (L I) P2: CCATGCATTCCTGCTTGTAGTAAAAATTTGCGTCC (E7) P3: CTACAAGCAGGAATGCATGGAGATACACC (E7) 5 P4: CATCTGAAGCTTAGTAATGGGCTCTGTCCGGTTCTG (E7) A tenth of the purified products was mixed and used as a matrix in the PCR reaction with the primers P1 and P4 exclusively. The resulting product was cleaved using 10 EcoNI (L1) and HindIII (downstream of the stop codon on the primer P4) and used in order to replace an EcoNI/HindIII fragment of the cloned HPV16L1 ORF. The resulting clone therefore differs from the clone HPV16L1ACE7 1-50 by the loss of the two internal EcoRV 15 restriction enzyme cleavage sites and the corresponding non-HPV amino acids Asp and Ile between the Li ORF and E7 and downstream of E7. The first EcoRV site was replaced by the original L1 amino acids in this position (AlaGly). The second EcoRV site was replaced 20 by a translation stop signal. This clone (HPV16LlAC*E7 1-52) additionally contains the first 52 amino acids of HPV16E7. Clone HPV16LlAC*E7 1-52 was used for the preparation of the clones HPV16LlAC*E7 1-55 with the aid of the primer P1 in combination with P5. 25 P5 CATCTGAAGCTTATCAATATTGTAATGGGCTCTGTCCG (E7 1-55) In all cases, EcoNI and HindIII were used in order to replace the corresponding fragments. The clones were 30 analysed by DNA sequencing. 2. Preparation of recombinant baculoviruses Spodoptera frugiperda (Sf9) cells were used as a 35 monolayer or in suspension culture in TNM-FH insect WO 99/48917 - 17 - PCT/EP99/01999 medium (Sigma, Deisenhofen) with 10% foetal calf serum and 2 mM glutamine. Recombinant baculoviruses HPV16LlACE7 1-55 were transfected by cotransfection of 10 pg of the recombinant plasmids and 2 gg of 5 linearized Baculo-Gold DNA (Pharmingen, San Diego, CA) into Sf9 cells. Recombinant viruses were purified according to the instructions of the manufacturer. In order to test the expression, 106 Sf9 cells were infected with recombinant Baculovirus and an m.o.i. 10 (multiplicity of infection) of 5 to 10. After the incubation, the medium was removed and the cells washed with PBS (140 mM NaCl, 2.7 mM KCl, 8.1 mM Na 2

PO

4 , 1.5 mM

KH

2

PO

4 , pH 7.2). The cells were then lysed in SDS sample buffer and tested by SDS gel chromatography and 15 immunoblot assay. 3. Purification of virus-like particles For the preparation of CVLPs, Trichoplusia ni (TN) High 20 Five cells were cultured at 27 0 C up to a density of 1-1.5 x 106 cells per ml in Ex-Cell 405 serum-free medium (JRH, Biosciences, Lennexa [sic], KS). A 400 ml culture was harvested and infected with an m.o.i. of 2 to 5 with recombinant baculoviruses for one hour with 25 periodic inversions. Up to 240 ml of medium were added and the cells grew for 3 to 4 days. The cells were then pelleted and resuspended in 10 ml of extraction buffer (25 mM tris/HCl, pH 7.5; 500 mM NaCl, 1 mM EDTA) and sonicated for 45 seconds at 60 watts. After 30 centrifugation at 10,000 rpm in a Sorvall SS34 rotor, the pellet was dissolved in 6 ml of extraction buffer, sonicated for 30 seconds at 60 watts and centrifuged again. The supernatants were combined and applied to a two-stage gradient of 40% (w/v) sucrose and 57.5% (w/v) 35 CsCl. After centrifugation in an SW-28 rotor at 27,000 rpm for two hours, the interphase and the CsCl layer were collected, adjusted to a CsCl density of 1.38 g/ml and centrifuged at 45,000 rpm for 16 hours.

WO 99/48917 - 18 - PCT/EP99/01999 The gradients were fractionated and each fraction was tested by Western blot using anti-HPV16LlmAb Camvirl (Pharmingen, San Diego, CA) . The reactive fractions were combined and dialysed by means of an 5 ultrafiltration using a Centricon 30 microconcentrator (Amicon Corp. Beverly, MA) against Hepes buffer (1 mM Hepes, 149 mM NaCl, 0.5 mM KCl, pH 7.2) and the presence of CVLPs was confirmed by means of transmission electron microscopy. The concentration of 10 LlE7 protein was determined approximately, in an SDS gel which was stained with Coomassie blue, by comparison with BSA standards. 4. Microdialysis experiments 15 The sample used was a fraction containing virus-like particles which had been isolated from High Five cells by sucrose cushion and caesium chloride equilibrium ultracentrifugation. The total protein concentration 20 was 0.29 mg/ml and the CVLP concentration 0.17 mg/ml. 40 ml of the corresponding solution were introduced into a 50 ml plastic vessel with a screw closure. On this solution was carefully placed a dialysis filter 25 having a pore diameter of 0.025 pm, which floats on the liquid during the carrying-out of the dialysis. 30 pl of the pure CVLP solution were pipetted onto this filter and the vessel was sealed. The vessel was allowed to stand at 4-6 0 C for at least 12 hours so that 30 the solution of the drop was exchanged for the dialysis solution (50 mM tris/HCl, pH 7.5 with increasing NaCl concentration). The drop was removed using the piston pipette and it was equalized with 30 pl of reservoir solution. After centrifugation at 10,000 g (10 min, 35 4 0 C), the supernatant was investigated in the ELISA (Kemeny, D. M. (1994) indirect ELISA from: ELISA, use of the enzyme-linked immunosorbent assay in the biological/medicinal laboratory, Gustav Fischer Verlag, WO 99/48917 - 19 - PCT/EP99/01999 Stuttgart, p. 111, Test 6.2) using a conformation specific monoclonal antibody against HPV16L1 and in a protein assay. The protein concentration was determined using a bicinchoninic acid assay (Smith, P. K. et al. 5 (1985) Anal. Biochem., 150, 76-85) against bovine serum albumin as a standard. The result is shown in Fig. 1.

Claims (15)

1. Formulation comprising at least one late protein (L protein) of one or more papillomaviruses and/or 5 at least one early protein (E protein) of one or more papillomaviruses and about 0.3 to about 4 M, preferably about 0.4 to about 2.5-3 M, in particular about 0.4-0.5 to about 1-2 M, especially about 1 to about 2 M, of a salt at a pH 10 of about 7.3 to about 7.45, preferably of about

7.4, and, if appropriate, suitable additives and/or excipients. 2. Formulation according to Claim 1, characterized in 15 that the salt is an alkali metal or alkaline earth metal salt, preferably a halide or phosphate, in particular an alkali metal halide, especially NaCl and/or KCl. 20 3. Formulation according to Claim 1 or 2, characterized in that the pH is adjusted using a buffer, preferably using a phosphate buffer, tris buffer, HEPES buffer or MOPS buffer. 25 4. Formulation according to one of Claims 1-3, characterized in that the protein or proteins mentioned contains no papillomavirus-unspecific epitopes. 30 5. Formulation according to one of Claims 1-4, characterized in that the L protein is a deleted L protein, preferably a deleted Ll and/or L2 protein. 35 6. Formulation according to Claim 5, characterized in that the L protein is a C-terminally deleted L protein, in particular a C-terminally deleted LI protein. WO 99/48917 - 21 - PCT/EP99/01999 7. Formulation according to Claim 5 or 6, characterized in that up to about 35 amino acids are deleted from the L protein, preferably about 25 to about 35, in particular about 32 to about 5 34, amino acids.

8. Formulation according to one of Claims 1-7, characterized in that the E protein is a deleted E protein, especially a deleted E6 and/or 10 E7 protein.

9. Formulation according to Claim 8, characterized in that the deleted E protein is a C-terminally deleted E protein, preferably a C-terminally 15 deleted E7 protein.

10. Formulation according to Claim 8 or 9, characterized in that up to about 55 amino acids are deleted, preferably about 5 to about 55 amino 20 acids, in particular about 38 to about 43 amino acids.

11. Formulation according to one of Claims 1-10, characterized in that the L protein is bonded, 25 preferably fused, to the E protein.

12. Formulation according to one of Claims 1-11, characterized in that the protein mentioned is present in the form of a capsid and/or capsomer. 30

13. Formulation according to one of Claims 1-12, characterized in that the papillomavirus is a human papillomavirus (HPV). 35 14. Formulation according to Claim 13, characterized in that the HPV is selected from HPV-6, HPV-11, HPV-16, HPV-18, HPV-31, HPV-33, HPV-35, HPV-39, HPV-42, HPV-45, HPV-52 and/or HPV-58. WO 99/48917 - 22 - PCT/EP99/01999

15. Formulation according to one of Claims 1-14, characterized in that the additives and/or excipients are one or more detergents, polyols and/or zwitterionic compounds. 5

16. Process for the production of a formulation according to one of Claims 1-15, characterized in that the protein mentioned is incorporated into and/or dialysed against a solution comprising 10 about 0.3 to about 4 M, preferably about 0.4 to about 2.5-3 M, in particular about 0.4-0.5 to about 1-2 M, especially about 1 to about 2 M, of a salt at a pH of about 7.3 to about 7.45, preferably of about 7.4. 15

17. Use of a formulation according to one of Claims 1-15 as a medicament or diagnostic.

18. Use according to Claim 17, characterized in that 20 the formulation contains no adjuvant.

19. Use according to Claim 17 or 18, characterized in that the medicament serves for the avoidance or treatment of papillomavirus-specific tumour. 25

20. Use according to Claim 19, characterized in that the tumour is a carcinoma of the larynx, cervix, penis, vulva or anus. 30 21. Use according to one of Claims 17-20, characterized in that the formulation mentioned is used as an injection or infusion solution.

22. Use according to Claim 17, characterized in that 35 the diagnostic serves for the diagnosis of one or more papillomavirus infections.