AU3389500A - Cloning of cdna of mage's 5, 8, 9 and 11 and their uses in diagnosis of cancer - Google Patents

Description

WO 00/52163 PCTIUSOO/05346 CLONING OF CDNA OF MAGE'S 5,8,9 AND 11 AND THEIR USES IN DIAGNOSIS OF CANCER RELATED APPLICATION 5 This is a continuation in part application of Serial No. 09/260,978, filed March 2, 1999, incorporated by reference. FIELD OF THE INVENTION This invention relates to nucleic acid molecules which are members of the MAGE family, uses thereof, and a method for determining and quantifying their expression. Also 10 a part of the invention are fragments of these nucleic acid molecules, proteins encoded by both the whole nucleic acid molecules and the fragments, peptides based thereon which form complexes with MHC or HLA molecules, fusion proteins, polytopes, and so forth. BACKGROUND AND PRIOR ART It was shown by Van der Bruggen, et al., Science 254: 1643-1647 (1991), that 15 there is a family of tumor rejection antigens which complex to human leukocyte antigens ("HLAs"), and provoke response by autologous, cytolytic T cells. In addition to Van der Bruggen et al., supra, see U.S. Patent No. 5,342,774 to Boon, et al., incorporated by reference. These references also describe the isolation of genes which encode proteins that are then processed to these tumor lrejection antigens. Further investigations led to 20 the discovery of twelve closely related genes. These genes have been found to be located in region q28 of the X chromosome. While first named genes MAGE-1 through MAGE 12, these genes are now referred to as MAGE-Al through MAGE-A12, in view of subsequent discoveries. To elaborate, four additional related genes have been located in region p21 of the X chromosome, and are referred to as the MAGE-B cluster of genes.

WO 00/52163 PCT/USOO/05346 Additional MAGE family members have been located at region q26, and have been named MAGE-CI and MAGE-C2. For obvious reasons, it was and is desirable to analyze expression ofMAGE genes. There has been extensive work in this area, with patterns of MAGE-A expression having 5 been analyzed by reverse transcription-polymerase chain reaction ("RT-PCR"), in various tumor samples, tumor cell lines, and normal tissues. Essentially, the level of transcription and expression is established, semi-quantitatively, via RT-PCR. This entails evaluating intensity of bands on agarose gels, and comparing these to standard dilutions of material from a reference or control. This research has established that the genes MAGE-Al, A2, 10 A3, A4, A6 and A12 are transcribed, at high levels, in many tumors. Gene MAGE-A8 was expressed at a high level in one tumor, while MAGE-A5, A9, Al0 and Al l appeared to be transcribed weakly in positive tumors. Collectively, MAGE-A genes were not found to be expressed by any normal tissues except in testis and, in a few cases, placenta. See Brasseur, et al., Int. J. Cancer 52:839-841 (1992); Brasseur, et al., Int. J. Canc 63: 375-380 15 (1995); De Plaen, et al., Immunogenetics 40: 360-369 (1994); van der Bruggen, et al., supra, and Weynants, et al., Int. J. Canc 56: 826-829 (1994). The expression of MAGE-A genes in testis was restricted to germ line cells in the early phases of spermatogenesis. See Takahashi et al., Canc. Res. 55: 3478-3482 (1995). Testis expresses all MAGE-A genes, except MAGE-A7. MAGE-A4, A8, A9, AlO and All have been found to be 20 transcribed in placenta. For CTLs to recognize complexes of TRAs and HLAs, a certain level of expression of the relevant MAGE-A gene appears to be required. DePlaen, et al. -2- WO 00/52163 PCT/USOO/05346 Methods 12:125-142 (1997); Leth6, et al., Melanoma Res 7: Suppl 2: S83-8 (1997) have shown that in melanoma, the level of expression of MAGE-Al must exceed 10% of the level found in reference cell line MZ2-MEL in order to observe recognition of a MAGE Al peptide presented by HLA-A1. The level of expression of MAGE-A2, A3, A4, A6 5 and A12 genes has been shown, via semi-quantitative RT-PCR, to be similar to MAGE Al, suggesting that these genes can be processed into TRAs which are presented for recognition by CTLs. Several peptides from MAGE-Al and A3 have, in fact, been found to be presented by HLAs, and then recognized by autologous CTLs derived from mixed lymphocyte-tumor cell culture. 10 Recently, it was reported that a monoclonal antibody which was reactive with MAGE-Al cross reacted with another protein expressed in melanoma. See allowed U.S. Patent Application, Serial No. 08/724,774 filed on October 3, 1996 and Carrel, et al.. Int. J. Canc 67:417-422 (1996), both of which are incorporated by reference. Subsequently, it was found that this cross-reactive protein was encoded by MAGE-AlO. In MZ2-MEL, 15 the abundance of this protein was similar to that of the MAGE-Al protein. These results were surprising, since very low levels of expression of MAGE-AlO had been found in MZ2-MEL via RT-PCR. This suggested that the primers used to amplify MAGE-A10 in the RT-PCR were not very efficient. As a result, investigations were undertaken to develop a method for evaluating frequency of expression of a gene which is independent 20 of aberrations due to primers. Application of the method, described herein, led to the isolation of nucleic acid molecules which are described herein, and are a feature of the invention. -3- WO 00/52163 PCTIUSOO/05346 BRIEF DESCRIPTION OF THE FIGURE Figure 1 presents exon/intron structures of MAGE genes, including for MAGE A5, A8, A9 and Al l (SEQ ID NOS: 17, 18, 19 and 20). DETAILED DESCRIPTION 5 OF PREFERRED EMBODIMENTS EXAMPLE 1 Experiments were carried out to determine whether the choice of primer influenced values obtained when quantifying frequency of expression via RT-PCR. The frequency of expression of MAGE-A10 was determined using cell line MZ2-MEL, and 10 one of two pairs of primers. The first pair is described by De Plaen, et al., Immunogenetics 40: 360-369 (1994); i.e.: CACAGAGCAG CACTGAAGGA G (SEQ ID NO: 1) and CTGGGTAAAG ACTCACTGTC TGG (SEQ ID NO: 2), 15 or AGCAGCCAAA AGGAGGAGAG TC (SEQ ID NO: 3) TGACCTCCTC AGGGGTGCAG TA (SEQ ID NO: 4). SEQ ID NOS: 3&4 correspond to sequences complementary to the last exon of MAGE-A10. 20 The frequency of expression of MAGE-Al was determined using cell line LB 11 OCI, and two pairs of primers , i.e.: CGGCCGAAGG AACCTGACCC AG (SEQ ID NO: 5) -4- WO 00/52163 PCT/USOO/05346 and GCTGGAACCC TCACTGGGTT GCC (SEQ ID NO: 6) or TCAGGGGACA GGCCAACCC (SEQ ID NO: 7) 5 and CTTGCACTGA CCTTGATCAC ATA (SEQ ID NO: 8) In the experiments, total RNA was extracted from cells. Then, 2 pg samples were used for reverse transcription, following Weynants, et al., supra. The PCR was then carried out using 1/10 of total cDNA, supplemented with 2.5 pt 1 of 10 x PCR buffer, 2.5 10 pt 1 of 10mM of dNTP, 10 pmoles of the primers, and 0.5 units of polymerase, plus water to a volume of 25 pt 1. Each mixture was heated to 94"C for 5 minutes, followed by amplification for 30 cycles. In the case of SEQ ID NOS: 1-4, 7 & 8, a cycle was 1 minute at 94'C, two minutes at 65'C, and three minutes at 72'C. For SEQ ID NOS: 5 & 6, a cycle was 1 minute at 94'C, and 3 minutes at 72'C. Cycling was concluded with a final 15 extension at 72'C for 5 minutes. Analysis was carried out using 5pl samples, each of which was run on a 1% agarose gel, and visualized via standard ethidium bromide staining. When SEQ ID NOS: 1 & 2 were used, a low level of expression of MAGE-A10 was found, whereas use of SEQ ID NOS: 3 & 4 showed a level of expression equivalent 20 to that of MAGE-Al. This result is in agreement with the Western blotting work of Carrel, et al., supra, which showed equivalent levels of expression. -5- WO 00/52163 PCT/USOO/05346 Given that SEQ ID NOS: 3 & 4 corresponded to regions of the last exon of MAGE-Al 0, it was possible that contaminating genomic DNA had also been amplified. To test this possibility, amplification was carried out with omission of the reverse transcription step. No amplification was observed, however, indicating that there 5 probably was no contamination. A number of PCR products were sequenced, where SEQ ID NOS: 3 & 4 had been used as primers. All corresponded to MAGE-A10. When results obtained using the primers for MAGE-Al were compared, different levels of expression were observed, with SEQ ID NOS: 7 & 8 showing higher levels than SEQ ID NOS: 5 & 6. 10 Very low expression levels had been observed previously for MAGE-A5, A9 and Al 1. Hence, it was suspected that changing primers might resolve this. EXAMPLE 2 The results obtained supra suggested that a better method for determining frequency of expression of genes, MAGE genes for example, was needed. The method 15 developed is described in this example. A cDNA library was prepared from a MAGE-A positive sample, following standard procedures; see De Plaen, et al., Methods 12: 125-142 (1997), incorporated by reference, and was maintained as recombinant plasmids in E. coli bacteria. Specifically, samples were homogenized in guanidine thiocyanate to form a lysate, 20 which was then loaded on top of a CsCl cushion. Then, poly(A)+ RNA was isolated by processing total RNA through two successive oligo(dT) cellulose columns. The isolated poly(A)+ RNA was converted to cDNA with an oligo(dT) primer which contained a NotI -6- WO 00/52163 PCTIUSOO/05346 restriction site. The resulting cDNA was ligated to BstXI adaptors, digested with NotI, and then inserted into the BstXI and NotI sites of expression vector pcDNAI/Amp. The resulting recombinant plasmids were introduced into E. coli DH5o, using standard electroporation techniques, followed by selection with ampicillin (25 gg/ml). 5 All libraries were then diluted in LB medium, supplemented with ampicillin, to obtain 3-6 clones/1. Following this, 9.6 mls of each dilution were seeded in a 96 microwell plate (100 gls per microwell). Two or three plates were seeded from every library in order to obtain about 100,000 independent clones spread over the plates. Plates were then incubated overnight at 37 0 C, after which 10 ptl from every microwell were 10 pooled, to obtain 20 different pools from every plate (i.e., 8 pools from lines, and 12 pools from columns). Plates and pools were duplicated, the masters frozen (-70'C, LB medium containing 20% glycerol), and duplicates were maintained at 4"C for PCR assays. The PCR assays were carried out on both the living and frozen bacteria, with the first assays being carried out on pools from lines and columns. Positive microwells were 15 found at the intersection of a positive line, and a positive column. To carry out the amplification assay, 3 pl of living bacteria were supplemented with 2.5 p1 of 10 x PCR buffer, 2.5 pl of 10mM dNTP, 10 pmoles of each primer, 0.5 units of polymerase, and water to a volume of 25 pl. In most cases, the number of positive wells in a plate was less than 20%. In 20 accordance with Poisson distribution if the percent of positive clones was less than 20%, the likelihood of having a single clone in a well should be 90% or greater. Limiting -7- WO 00/52163 PCT/USOO/05346 dilution could be carried out to the point where less than 10% of the wells are positive, with a presumed accuracy of 95%. In these experiments, as indicated, the number of positives was less than 20%. It was then possible to calculate the abundance of the different MAGE-A cDNAs in the 5 library, taking the number of independent clones in each well into account. The experiments were repeated for seven cDNA libraries (five tumor cell lines, one testis library, one placenta library) for all twelve MAGE-A genes. The results are presented in the Table, which follows. -8- WO 00/52163 PCT/USOO/05346 , + + + 0 o .C o - - c <C 00~ 0 + oo - I C)*Ca) E o o o o C o a a 0o o 00 Cv o oo 0I - 0 , 0o o3 ot oa e o 0+ C,. ,., oo + ca 0 c, + + o -+ o -o o+ C+ o 0 0 w-C -~ a c + + < o 0 o9i 0 a)o o o o- 0 -o o+*++0+ o+ g~ .. oo 0 + o o o o N--~ a o - - - - o >o 0 o a) ID < C> 2 2 C> v-- a), ov- oj~ Cv Cv- 0 0 > )>o. 0'l ~ ,, -,. 0 a) - - o--_ C C o 00 Li.~ ~ oT v- ~o o C - - 0 'O C~o a > -t .t -c ~~ coCC H - WO 00/52163 PCT/USOO/05346 The results were compared to the results obtained in RT-PCR assays, as set forth in the table supra. MAGE-Al, A9 and A10 were evaluated twice, with different pairs of primers, and a level of expression was estimated based upon intensity of banding on an agarose gel. 5 The limiting dilution assay revealed a level of expression of MAGE-A10 which was comparable to that obtained with primers SEQ ID NOS: 3 and 4, and higher than that obtained with SEQ ID NOS: 1 and 2. These higher values are in agreement with Western blotting work reported by Carrel, et al., supra, and in allowed U.S. patent application Serial No. 0/724,774 filed October 3, 1996, incorporated by reference. The frequency was 10 comparable to that of MAGE-Al in several of the lines. In other lines, while the level decreased, it was still comparable to levels for Al, A2 or A12. -10- WO 00/52163 PCT/USOO/05346 The calculated frequencies for Al, A2, A3, A4, A6 and A12 were essentially consistent with results obtained by RT-PCR. In one library, the results (one clone in 124,000 analyzed), was consistent with the results obtained with SEQ ID NOS: 7 and 8, but not SEQ ID NOS: 5 and 6, suggesting that SEQ ID NOS: 5 and 6 are more efficient at determining 5 transcript present, but SEQ ID NOS: 7 and 8 are better at determining expression levels. EXAMPLE 3 One aspect of the results of the experiments described supra, which provoked further investigation was expression ofMAGE-A8. Weak expression was always observed, with the exception of the cell line TT-THYR, which showed high levels of expression in a semi 10 quantitative PCR assay. The average size of an insert in the TT-THYR library was only 0.9kb, so primers were designed which would amplify a segment of the last 450 nucleotides of MAGE-A8 mRNA. Similar primers were designed for MAGE-Al, A2, A4 and A8 as well, i.e.: SEQ ID NO.: 9 GAAGAGAGCGGTCAGTGTTC-3 (sense) 15 SEQ ID NO.: 10 AATCCAGGTATGCATATATCTTTA (anti-sense) SEQ ID NO.: 11 GCCTCTTTGAAGAGAGCAGTC (sense) SEQ ID NO.: 12 CAAAGAAGCAAAAACATACACATA (anti-sense) SEQ ID NO.: 13 CACTCTGTTTGAAGAAAATAGTC (sense) SEQ ID NO.: 14 AGTATCTTTTAATTTATCTCACCTA (anti-sense) 20 SEQ ID NO.: 15 AGCATGTTGGGTGTGAGGGA (sense) SEQ ID NO.: 16 AGGGTACACTAAGAGGTACAG (anti-sense) -11- WO 00/52163 PCT/USOO/05346 (SEQ ID NOS: 9 and 10 amplify A1, NOS: 11 and 12 amplify A2, NOS: 13 and 14 amplify A4, and NOS: 15 and 16 amplify A8) RT-PCR was carried out as described, supra, using these primers. When completed, the frequency of MAGE-A8 expression was found to be much higher; i.e., on a par with MAGE 5 A2. When the results for testis were analyzed, the level of expression of MAGE-A4 was found to be higher than MAGE-Al, levels of A2, A3, A8, A9 and Al 1 were low, and no cDNA for A6, A10 or A12 was found. These results are in accordance with those provided by Carrel et al. supra, for MAGE-Al AND MAGE-A10. 10 With respect to placenta, MAGE-A10 showed the highest level of expression, while Al-A7 A9 and A12 were not found at all among 230,000 clones analyzed. EXAMPLE 4 While the literature on the MAGE-A genes is substantial, cDNA for several members of the family has never been isolated, notwithstanding inferences regarding their structure, 15 based upon the structure of MAGE-Al. The approach described in example 2, supra, led to isolation of cDNA for MAGE-A5, A8, A9, A10 and All. The cDNA for MAGE-AlO was described in e.g., U.S. patent application Serial No. 08/724,774, filed October 3, 1996 and incorporated by reference, but the others were not known. The cDNA for A5, AS, A9 and Al 1 is presented as SEQ ID 20 NOS: 17 through 20, respectively. Further, knowledge of the sequences of cDNA led to an ability to complete exon/intron structures of the genes, as shown in figure 1. -12- WO 00/52163 PCT/USOO/05346 The sequencing of MAGE-A5 cDNA led to some interesting observations, as it consisted of the first two exons of MAGE-A10, followed by a sequence corresponding to a previously unknown exon, and two exons of MAGE-A5. The foregoing examples describe the invention, which in addition to nucleic acid 5 molecules as described herein includes a method for determining the frequency of expression of a particular gene or gene of interest. The method involves preparing cDNA from a sample, and then transforming or transfecting the cDNA into cells, to create a library of transformants/transfectants. These cells are then divided into a plurality of samples of approximately equal size, after which each sample is assayed for presence (as compared to 10 quantity), of cDNA. The number of positive samples should be less than or equal to 20% of the total number of and, more preferably, equal or less than 10% of the number of samples being tested. If the number of positives is greater than the chosen value, then the library is diluted, divided into samples and the assay is repeated. When the positive value is below the chosen value, the frequency of each MAGE cDNA is determined. 15 Preferably, the method is carried out by distributing the samples in a predetermined array, so that different portions of samples can be pooled. When the samples are arrayed in this way, one can determine which samples do contain the cDNA of interest, by determining where the two sample pools intersect. For example, consider a rectangular array of samples, arranged in vertical and horizontal lines. If the horizontal lines are represented by letters, i.e., 20 "A", "B", "C", etc., and vertical lines by numbers, i.e., "1", "2", "3", etc., then one can create pools "A", "B", "2", "3", etc. Each vertical and horizontal line will intersect at one point, -13- WO 00/52163 PCTIUSOO/05346 these points being represented by codes such as "Al", "B2", "C3", "D4", etc. Ifboth pool "B" and pool "7" are positive, then one can conclude that the sample at point "B7" is positive. By doing this, one can identify a well containing the sample of interest. In addition to quantifying expression, the method permits the artisan to identify cDNA 5 molecules of interest, especially those which are present at low frequency. As was described herein, practice of the invention led to isolation of cDNA for various MAGE genes. Such cDNA had not been isolated previously, and is a further feature of the invention, i.e., isolated cDNA molecules which encode MAGE-A8, MAGE-A9, and MAGE- 11 proteins, such as cDNA molecules which encode proteins whose amino acid sequence is that of the protein 10 encoded by any of SEQ ID NOS: 18, 19 or 20. Also a part of the invention are newly isolated nucleic acid molecules, such as the one set forth in SEQ ID NO: 17 or other similar molecules i.e., those comprising two exons for MAGE-A5 and two exons for MAGE-A10, separated by a nucleotide sequence between the MAGE-A5 and MAGE-A10 sequences as well as nucleic acid molecules which comprise 15 portions that hybridize to both the MAGE-A5 portion, and the MAGE-Al 0 portion. These nucleic acid molecules, i.e., all of the nucleic acid molecules described herein, can be used to make expression vectors which comprise the nucleic acid molecule operably linked to a promoter. These vectors, as well as the isolated nucleic acid molecules themselves, can be used to transform or to transfect cells, to produce recombinant cells thereby. 20 These nucleic acid molecules can also be used both diagnostically and therapeutically. In the diagnostic area, one can examine a sample, such as a cell containing sample, a cell -14- WO 00/52163 PCTIUSOO/05346 lysate, etc., for expression of the nucleic acid molecules described herein, using oligomer probes in connection with standard methods, such as polymerase chain reactions, and so forth. One can also assay such samples by determining presence of the proteins encoded thereby. Also a part of the invention are methods based upon these newly identified and 5 isolated molecules. For example, one can determine expression of a MAGE gene by contacting a sample with one or more oligonucleotides which hybridize specifically to a MAGE nucleic acid molecule of interest. For example SEQ ID NO: 9 and/or SEQ ID NO: 10 can be used to determine MAGE-A1, SEQ ID NO: 11 and/or 12 can be used to determine MAGE-A2, and so forth. Any form of hybridization based assay can be used, as exemplified, 10 but not limited to PCR. One can also assay for the MAGE proteins, using standard methodologies such as antibody assays, or other systems for determining proteins. Also apart of the invention are peptides consisting of from about 8 to about 25 amino acids concatenated to each other along the amino acid sequence of the MAGE proteins which are a part of the invention. Such peptides are specific binders for MHC molecules, such as 15 MHC Class I or Class II molecules, including HLA molecules such as HLA-Al, A2, A3, A24, B7, B8, B35, B44, B52, and CW6. Determination of relevant sequences can be carried out using, e.g., Parker, et al, J. Immunol 152:163 (1994), D'Amaro, et al Hum. Immunol 43:13-18 (1995), Drijfhout, et al, Hum. Immunol 43:1-12 or Sturniolo, et al, Nat. Biotechnol 17(6):555-61 (1999) all of which are incorporated by reference, or websites such the NIH 20 worldwide web site, found at URLhttp:\\bimas.dcrt.nih.gov., and http://www.uni tuebingen.de/uni/kxc, which are incorporated by reference. The tables which follow list some -15- WO 00/52163 PCT/USOO/05346 of these peptides, with reference to the relevant MAGE amino acid sequence. The complete amino acid sequences are set out at SEQ ID NOS:21-24, where SEQ ID NO:21 is that for MAGE A5, SEQ ID NO:22 is that for MAGE A8, SEQ ID NO:23 is that for MAGE A9, and SEQ ID NO:24 is that for MAGE Al 1: 5 MAGE A5: HLA-Al Binders 98-107 SPDPESVFR 69-78 SAIPTAIDF 32-41 TTEEQEAVS 116-125 LIHFLLLKY 10 113-122 VADLIHFLL 115-124 DLIHFLLLK 2-11 SLEQKSQHC 77-86 FTLWRQSIK 73-82 TAIDFTLWR 15 74-83 AIDFTLWRQ 15-24 GLDTQEEAL MAGE A5: HLA-A2 Binders 112-123 KVADLIHFL 108-117 ALSKKVADL 20 24-33 GLVGVQAAT 70-79 AIPTAIDFT -16- WO 00/52163 PCT/USOO/05346 38-47 AVSSSSPLV 22-31 ALGLVGVQA 15-24 GLDTQEEAL 45-54 LVPGTLGEV 5 31-40 ATTEEQEAV 71-80 IPTAIDFTL 113-122 VADLIHFLL 25-34 LVGVQAATT 78-87 TLWRQSIKG 10 48-57 GTLGEVPAA 18-27 TQEEALGLV MAGE A5: HLA-A3 Binders 115-124 DLIHFLLLK 103-112 SVFRAALSK 15 108-116 ALSKKVADL 15-23 GLDTQEEAL 77-85 FTLWRQSIK 116-124 LIHFLLLKY 24-32 GLVGVQAAT 20 73-81 TAIDFTLWR 22-30 ALGLVGVQA MAGE A5: HLA-A24 Binders -17- WO 00/52163 PCTIUSOO/05346 112-120 KVADLIHFL 42-50 SSPLVPGTL 17-25 DTQEEALGL 37-45 EAVSSSSPL 5 76-84 DFTLWRQSI 113-121 VADLIHFLL 71-79 IPTAIDFTL 15-23 GLDTQEEAL 108-116 ALSKKVADL 10 69-77 SAIPTAIDF 97-105 TSPDPESVF 63-71 KSPQGASAI 109-117 LSKKVADLI 67-75 GASAIPTAI 15 114-122 ADLIHFLLL 111-119 KKVADLIHF MAGE A5: HLA-B7 Binders 71-79 IPTAIDFTL 112-123 KVADLIHFL 20 108-116 ALSKKVADL 37-45 EAVSSSSPL 17-25 DTQEEALGL 42-50 SSPLVPGTL 113-121 VADLIHFLL -18- WO 00/52163 PCT/USOO/05346 38-47 AVSSSSPLV 60-68 GPLKSPQGA 54-62 PAAGSPGPL 114-122 ADLIHFLLL 5 67-75 GASAIPTAI 15-23 GLDTQEEAL 45-53 LVPGTLGEV 30-38 AATTEEQEA 31-39 ATTEEQEAV 10 100-108 DPESVFRAA 8-16 QHCKPEEGL 25-33 LVGVQAATT 109-117 LSKKVADLI MAGE A5: HLA-B8 Binders 15 108-117 ALSKKVADL 37-46 EAVSSSSPL 109-118 LSKKVADLI 71-80 IPTAIDFTL 67-75 GASAIPTAI 20 42-50 SSPLVPGTL 102-110 ESVFRAALS MAGE A5: HLA-B35 Binders -19- WO 00/52163 PCT/USOO/05346 71-79 IPTAIDFTL 97-105 TSPDPESVF 109-118 LSKKVADLI 42-50 SSPLVPGTL 5 63-71 KSPQGASAI 112-120 KVADLIHFL 37-46 EAVSSSSPL 69-77 SAIPTAIDF 17-25 DTQEEALGL 10 60-68 GPLKSPQGA 116-124 LIHFLLLKY 67-75 GASAIPTAI 108-116 ALSKKVADL 113-121 VADLIHFLL 15 100-107 DPESVFRAA 31-39 ATTEEQEAV 106-114 RAALSKKVA 41-49 SSSPLVPGT 102-110 ESVFRAALS 20 30-38 AATTEEQEA MAGE A5: HLA-B44 Binders 69-77 SAIPTAIDF 34-42 EEQEAVSSS 20-28 EEALGLVGV -20- WO 00/52163 PCT/USOO/05346 33-41 TEEQEAVSS 90-98 QEEEGPSTS 51-59 GEVPAAGSP 114-122 ADLIHFLLL 5 41-49 SSSPLVPGT 92-100 EEGPSTSPD 97-105 TSPDPESVF 48-56 GTLGEVPAA 91-99 EEEGPSTSP 10 36-44 QEAVSSSSP 116-124 LIHFLLLKY 56-64 AGSPGPLKS 23-31 LGLVGVQAA 13-23 EEGLDTQEE 15 75-83 IDFTLWRQS 100-108 DPESVFRAA 17-25 DTQEEALGL MAGE A5: HLA-B52 Binders 18-26 TQEEALGLV 20 97-105 TSPDPESVF 45-53 LVPGTLGEV 109-117 LSKKVADLI 71-79 IPTAIDFTL 63-71 KSPQGASAI -21- WO 00/52163 PCT/USOO/05346 23-31 LGLVGVQAA 67-75 GASAIPTAI 20-28 EEALGLVGV 69-77 SAIPTAIDF 5 46-54 VPGTLGEVP 14-22 EGLDTQEEA 106-114 RAALSKKVA 113-121 VADLIHFLL 31-39 ATTEEQEAV 10 60-68 GPLKSPQGA 76-84 DFTLWRQSI 96-104 STSPDPESV 89-107 NQEEEGPST 112-120 KVADLIHFL 15 MAGE A5: HLA-CW6 Binders 112-120 KVADLIHFL 108-116 ALSKKVADL 71-79 IPTAIDFTL 113-121 VADLIHFLL 20 116-124 LIHFLLLKY 105-113 FRAALSKKV 67-75 GASAIPTAI 18-26 TQEEALGLV 37-45 EAVSSSSPL -22- WO 00/52163 PCTIUSOO/05346 114-122 ADLIHFLLL 45-53 LVPGTLGEV 42-50 SSPLVPGTL 15-23 GLDTQEEAL 5 8-16 QHCKPEEGL 20-28 EEALGLVGV 17-25 DTQEEALGL 41-49 SSSPLVPGT 63-71 KSPQGASAI 10 76-84 DFTLWRQSI 109-117 LSKKVADLI MAGE Al l: HLA-Al Binders 376-384 GTDPACYEF 281-290 EVDPTSHSY 15 211-220 LIDPESFSQ 71-80 NLEDRSPRR 142-150 QAEEQEAAF 352-360 FGEPKRLLT MAGE Al 1: HLA-A2 Binders 20 313-321 GLLIIVLGV 350-358 FLFGEPKRL -23- WO 00/52163 PCT/USOO/05346 221-229 ILHDKIIDL 89-97 VLWGPITQI 333-341 VMWEVLSIM 384-392 FLWGPRAHA 5 271-279 MQLLFGIDV 225-233 KIIDLVHLL 398-406 KVLEYIANA 337-345 VLSIMGVYA 289-297 YVLVTSLNL 10 316-324 IIVLGVIFM 335-353 WEVLSIMGV MAGE Al 1: HLA-A3 Binders 272-280 QLLFGIDVK 228-236 DLVHLLLRK 15 89-97 VLWGPITQI 359-367 LTQNWVQEK 313-321 GLLIIVLGV MAGE Al 1: HLA-A24 Binders 343-351 VYAGREHFL 20 255-263 NYEDYFPEI -24- WO 00/52163 PCTIUSOO/05346 351-359 LFGEPKRLL 225-234 KIIDLVHLL 288-296 SYVLVTSLN 236-244 KYRVKGLIT 5 82-90 RITGGEQVL 311-319 KSGLLIIVL 413-421 SYPSLYEDA MAGE Al 1: HLA-B7 Binders 98-106 FPTVRPADL 10 414-422 YPSLYEDAL 283-291 DPTSHSYVL 64-73 QVFREQANL 76-84 SPRRTQRIT 289-297 YVLVTSLNL 15 127-135 QAQEEDLGL 307-315 QSMPKSGLL 266-279 EASVCMQLL 147-155 EAAFFSSTL MAGE Al 1: HLA-B8 Binders 20 98-106 FPTVRPADL 221-229 ILHDKIIDL -25- WO 00/52163 PCTUSOO/05346 241-250 GLITKAEML 234-242 LRKYRVKGL 2-10 ETQFRRGGL 309-317 MPKSGLLII 5 307-315 QSMPKSGLL MAGE Al 1: HLA-B5 Binders 374-382 VPGTDPACY 410-418 DPTSYPSLY 102-110 RPADLTRVI 10 394-402 TSKMKVLEY 309-317 MPKSGLLII 283-291 DPTSHSYVL 181-190 SPTAMDAIF 414-422 YPSLYEDAL 15 98-106 FPTVRPADL 389-497 RAHAETSKM 48-56 APYGPQLQW 311-319 KSGLLIIVL 378-386 DPACYEFLW 20 MAGE Al 1: HLA-B44 Binders -26- WO 00/52163 PCTUSOO/05346 143-151 AEEQEAAFF 58-66 QDLPRVQVF 256-269 YEDYFPEIF 392-400 AETSKMKVL 5 166-174 AESPSPPQS 144-152 EEQEAAFFS 394-402 TSKMKVLEY 280-288 KEVDPTSHS 265-273 REASVCMQL 10 406-414 ANGRDPTSY 410-418 DPTSYPSLY 335-343 WEVLSIMGV 146-154 QEAAFFSST 331-339 EEVMWEVLS 15 MAGE Al 1: HLA-B52 Binders 309-318 MPKSGLLII 102-110 RPADLTRVI 314-322 LLIIVLGVI 333-341 VMWEVLSIM 20 271-279 MQLLFGIDV 218-226 SQDILHDKI 181-189 SPTAMDAIF 315-323 LIIVLGVIF 29-37 FGLQVSTMF -27- WO 00/52163 PCT/USOO/05346 219-227 QDILHDKII 57-65 SQDLPRVQV 90-98 LWGPITQIF 245-254 KAEMLGSVI 5 329-338 IPEEVMWEV 256-264 YEDYFPEIF 58-66 QDLPRVQVF 128-136 AQEEDLGLV 283-291 DPTSHSYVL 10 87-95 EQVLWGPIT 325-334 EGNCIPEEV MAGE Al 1: HLA-CW6 Binders 225-233 KIIDLVHLL 311-319 KSGLLIIVL 15 287-295 HSYVLVTSL 221-229 ILHDKIIDL 147-155 EAAFFSSTL 229-237 LVHLLLRKY 269-277 VCMQLLFGI 20 244-252 TKAEMLGSV 313-321 GLLIIVLGV 222-230 LHDKIIDLV 184-192 AMDAIFGSL -28- WO 00/52163 PCTIUSOO/05346 MAGE A9: HLA-Al Binders 94-103 SVDPAQLEF 167-176 EVDPAGHSY 262-271 GSDPAHYEF 1324-143 MLESVIKNY 153-162 ASEFMQVIF 189-198 LGDGHSMPK 238-247 YGEPRKLLT 112-121 VAELVHFLL 246-255 TQDWVQENY 280-289 TSYEKVINY 249-258 WVQENYLEY MAGE A9: HLA-A2 Binders 199-208 ALLIIVLGV 22-232 ALSVMGVYV 102-111 FMFQEALKL 307-316 VLGEEQEGV 270-279 FLWGSKAHA 175-184 YILVTALGL IU7-166 MQVIFGTDV 140-149 KNYKRYFPV 219-228 VIWEALSVM 290-299 VMLNAREPI 284-293 KVINYLVML -29- WO 00/52163 PCT/US00/05346 221-230 WEALSVMGV 24-33 GLMGAQEPT 187-196 SMLGDGHSM MAGE A9: HLA-A3 Binders 235-244 HMFYGEPRK 114-123 ELVHFLLHK 203-212 IVLGVILTK 225-234 SVMGVYVGK 102-111 FMFQEALKL 113M-143 MLESVIKNY 158-167 QVIFGTDVK 118-127 FLLHKYRVK 199-208 ALLIIVLGV 107-116 ALKLKVAEL 270-279 FLWGSKAHA 148-157 VIFGKASEF MAGE A9: HLA-A24 Binders 281-290 SYEKVINYL 237-246 FYGEPRKLL 22P-238 VYVGKEHMF 71-80 VYYTLWSQF -30- WO 00/52163 PCT/USOO/05346 141-150 NYKRYFPVI 236-245 MFYGEPRKL 284-293 KVINYLVML MAGE A9: HLA-B7 Binders 1@-178 DPAGHSYIL 300-309 YPSLYEEVL 127-136 EPVTKAEML 284-293 KVINYLVML 111-120 KVAELVHFL 119/-206 KAALLIIVL 17-26 EAQGEDLGL 107-116 ALKLKVAEL 193-202 HSMPKAALL 195-204 MPKAALLII 22-237 GVYVGKEHM 181-190 LGLSCDSML 201-210 LIIVLGVIL 173-182 HSYILVTAL 175-184 YILVTALGL 9!&101 SSSVDPAQL 67-76 SSISVYYTL 102-111 FMFQEALKL 112-121 VAELVHFLL 180-189 ALGLSCDSM -31- WO 00/52163 PCT/USOO/05346 MAGE A9: HLA-B8 Binders 107-116 ALKLKVAEL 127-136 EPVTKAEML 195-204 MPKAALLII 190-202 HSMPKAALL 169-178 DPAGHSYIL 300-309 YPSLYEEVL MAGE A9: HLA-B52 Binders 195-204 MPKAALLII 20-209 LLIIVLGVI 219-228 VIWEALSVM 157-166 MQVIFGTDV 104-113 FQEALKLKV 131-140 KAEMLESVI 11.2-161 KASEFMQVI 96-105 DPAQLEFMF 201-210 LIIVLGVIL 300-309 YPSLYEEVL 212-221 DNCAPEEVI 139-178 DPAGHSYIL 278-287 AETSYEKVI -32- WO 00/52163 PCT/USOO/05346 141-150 NYKRYFPVI MAGE A9: HLA-CW6 Binders 197-206 KAALLIIVL 111-120 KVAELVHFL 5 173-182 HSYILVTAL 107-116 ALKLKVAEL 199-208 ALLIIVLGV 100-109 LEFMFQEAL 130-139 TKAEMLESV 10 115-124 LVHFLLHKY 201-210 LIIVLGVIL MAGE A9: HLA-B44 Binders 105-113 QEALKLKVA 221-229 WEALSVMGV 4'5-55 EEVSAAGSS 296-304 EPICYPSLY 280-288 TSYEKVINY 217-225 EEVIWEALS 255-263 LEYRQVPGS 28-286 AETSYEKVI 166-174 KEVDPAGHS -33- WO 00/52163 PCTUSOO/05346 33-41 GEEEETTSS 96-104 DPAQLEFMF 222-230 EALSVMGVY MAGE A9: HLA-B35 Binders 5 260-269 VPGSDPAHY 296-305 EPICYPSLY 195-204 MPKAALLII 300-309 YPSLYEEVL 127-136 EPVTKAEML 10 96-105 DPAQLEFMF 169-178 DPAGHSYIL 280-289 TSYEKVINY 65-74 ASSSISVYY 264-273 DPAHYEFLW 15 92-101 SSSVDPAQL 18-27 AQGEDLGLM 222-231 EALSVMGVY 64-73 GASSSISVY 197-206 KAALLIIVL 20 MAGE A8: HLA-Al Binders -34- WO 00/52163 PCT/USOO/05346 171-180 EVDPAGHSY 266-275 GSDPVRYEF 138-147 MLESVIKNY 157-166 ASECMQVIF 5 250-259 TQEWVQENY 98-107 SPDPAHLES 116-125 VAELVRFLL 253-262 WVQENYLEY 193-202 LGDDQSTPK 10 181-190 LVTCLGLSY MAGE A8: HLA-B52 Binders 199-208 TPKTGLLII 223-232 AIWEALSVM 161-170 MQVIFGIDV 15 286-295 YVKVLEHVV 204-213 LLIIVLGMI 135-144 KAEMLESVI 262-271 RQAPGSDPV 205-214 LIIVLGMIL 20 156-165 KASECMQVI 173-182 DPAGHSYIL MAGE A8: HLA-A3 Binders -35- WO 00/52163 PCTIUSOO/05346 280-289 ALAETSYVK 118-127 ELVRFLLRK 122-131 FLLRKYQIK 1-10 MLLGQKSQR 5 203-212 GLLIIVLGM 210-219 GMILMEGSR 162-171 QVIFGIDVK 138-147 MLESVIKNY 2-11 LLGQKSQRY 10 111-120 ALDEKVAEL 274-283 FLWGPRALA 29-38 QIPTAEEQK 24-33 GLMDVQIPT 253-262 WVQENYLEY 15 MAGE A8: HLA-B7 Binders 299-308 RVRISYPSL 304-313 YPSLHEEAL 173-182 DPAGHSYIL 22-31 APGLMDVQI 20 64-73 SPEGASSSL 240-249 SVYWKLRKL 115-124 KVAELVRFL 37-46 KAASSSSTL 17-26 QAQGEAPGL -36- WO 00/52163 PCTIUSOO/05346 199-208 TPKTGLLII 216-225 GSRAPEEAI 196-205 DQSTPKTGL 116-125 VAELVRFLL 5 MAGE A8: HLA-B8 Binders 197-206 QSTPKTGLL 199-208 TPKTGLLII 240-249 SVYWKLRKL 297-306 NARVRISYP 10 111-120 ALDEKVAEL 299-308 RVRISYPSL MAGE AS: HLA-A2 Binders 288-297 KVLEHVVRV 274-283 FLWGPRALA 15 24-33 GLMDVQIPT 111-120 ALDEKVAEL 115-124 KVAELVRFL 45-54 LIMGTLEEV 179-188 YILVTCLGL 20 161-170 MQVIFGIDV 203-212 GLLIIVLGM -37- WO 00/52163 PCT/USOO/05346 191-200 GLLGDDQST 223-232 AIWEALSVM 71-80 SLTVTDSTL 279-288 RALAETSYV 5 251-260 QEWVQENYL 184-193 CLGLSYDGL MAGE A8: HLA-A24 Binders 241-250 VYWKLRKLL 145-154 NYKNHFPDI 10 273-282 EFLWGPRAL 121-130 RFLLRKYQI 126-135 KYQIKEPVT 115-124 KVAELVRFL 285-294 SYVKVLEHV 15 303-312 SYPSLHEEA 201-210 KTGLLIIVL 116-125 VAELVRFLL 299-308 RVRISYPSL 37-46 KAASSSSTL 20 205-214 LIIVLGMIL 17-26 QAQGEAPGL 64-73 SPEGASSSL 131-140 EPVTKAEML 179-188 YILVTCLGL -38- WO 00/52163 PCT/USOO/05346 185-194 LGLSYDGLL 42-51 SSTLIMGTL 111-120 ALDEKVAEL MAGE A8: HLA-CW6 Binders 5 115-1241 KVAELVRFL 201-210 KTGLLIIVL 177-186 HSYILVTCL 240-249 SVYWKLRKL 111-120 ALDEKVAEL 10 241-250 VYWKLRKLL 119-128 LVRFLLRKY 205-214 LIIVLGMIL 104-113 LESLFREAL 42-51 SSTLIMGTL 15 134-143 TKAEMLESV MAGE A8: HLA-B35 Binders 264-273 APGSDPVRY 199-208 TPKTGLLII 304-313 YPSLHEEAL 20 131-140 EPVTKAEML 173-182 DPAGHSYIL -39- WO 00/52163 PCT/USOO/05346 100-109 DPAHLESLF 39-48 ASSSSTLIM 268-277 DPVRYEFLW MAGE A8: HLA-B44 Binders 5 282-291 AETSYVKVL 20-29 GEAPGLMDV 225-234 WEALSVMGL 33-42 AEEQKAASS 234-243 YDGREHSVY 10 109-118 REALDEKVA 221-230 EEAIWEALS 170-179 KEVDPAGHS 34-43 EEQKAASSS 296-305 VNARVRISY 15 226-235 EALSVMGLY 237-246 REHSVYWKL Compositions based upon these molecules are also a part of the invention, such as compositions containing a MAGE protein in accordance with the invention, and a pharmaceutically acceptable adjuvant such as a cytokine, an interleukin (e.g., IL-2,IL-4, IL 20 12, etc.), or GM-CSF. Similarly, compositions containing one or more of the peptides -40- WO 00/52163 PCT/USOO/05346 discussed supra and an adjuvant, complexes of HLA or MHC molecules and the peptides plus adjuvant are also a part of the invention. These complexes can be combined per se, or on antigen presenting cells, such as dendritic cells, which may be treated to be rendered non-proliferative, etc. 5 The skilled artisan will also recognize that nucleic acid molecules encoding the peptides or proteins may be used in the form of appropriate compositions, such as in liposome based compositions. Also a part of the invention are isolated cytolytic T cell lines which are specific for complexes of these peptides and their MHC binding partner, i.e., an HLA molecule. 10 The ability of these peptides to bind to HLA molecules makes them useful as agents for determining presence of cells positive for particular HLA molecules such as HLA-A*0201 positive cells, by determining whether or not the peptides bind to cells in a sample. This "ligand/receptor" type of reaction is well known in the art, and various methodologies are available for determining it. 15 A further aspect of the invention are so-called "mini genes" which carry information necessary to direct synthesis of modified decapeptides via cells into which the mini genes are transfected. Mini genes can be designed which encode one or more antigenic peptides, and are then transferred to host cell genomes via transfection with plasmids, or via cloning into vaccinia or adenoviruses. See, e.g., Zajac, et al., Int. J. Cancer 71: 496 (1997), incorporated 20 by reference These recombinant vectors, such as recombinant vaccinia virus vectors, can be constructed so as to produce fusion proteins. For example, fusion proteins can be constructed -41- WO 00/52163 PCTIUSOO/05346 where one portion of the fusion protein is the desired tumor rejection antigen precursor, or tumor rejection antigen, and additional protein or peptide segments can be included. Exemplary, but by no means the only types of additional protein or peptide segments which can be added to the fusion proteins, are reporter proteins or peptides, i.e., proteins or peptides 5 which give an observable signal so as to indicate that expression has occurred, such as green fluoresence protein. Additional reporter proteins include, but are by no means limited to, proteins such as pgalactosidase, luciferase, dhfr, and "eGFP", or enhanced green fluorescent protein, as described by Cheng, et al., Nature Biotechnology 14:606 (1996), incorporated by reference, and so forth. The various reporter proteins available to the skilled artisan can be, 10 and are used, in different ways. For example, "GFP" and "eGFP" can be used to visualize infected cells, thereby facilitating tracking when flow cytometry is used, and the isolation of the cells so infected. Other reporter proteins are useful when methods such as western blotting, immunoprecipitation, and so forth are used. These techniques are standard in the art and need not be reiterated here. Protein or peptide segments which facilitate the cleavage 15 of the tumor rejection antigen precursor or tumor rejection antigen from the fusion peptide may also be included. The fusion protein can include more than one tumor rejection antigen, as described, supra , and can also include proteins or peptides which facilitate the delivery of the tumor rejection antigen or antigens to a relevant MHC molecule. Such proteins and peptides are well known to the art, and need not be elaborated herein. 20 Also a part of the invention are recombinant cells which have been transfected with the recombinant vectors described herein. Such cells may be, e.g., any type of eukaryotic -42- WO 00/52163 PCTIUSOO/05346 cell, with human cells being especially preferred. Such cells can then be used, e.g., to produce tumor rejection antigen precursors or tumor rejection antigens. They can also be used, in an ex vivo context, to generate cytolytic T cells specific for particular complexes of MHC molecules and tumor rejection antigens. This can be done simply by contacting the 5 transfected cells to a source of T cells, such as a blood sample, so as to provoke the proliferation of any cells in the sample specific to the complexes of MHC molecules and TRAs (i.e., tumor rejection antigens) produced following expression of the fusion protein, and processing of the TRA. Such cells, when rendered non-proliferative, can also be used as vaccine materials, as they will present the relevant complexes on their surface, and provoke 10 the same type of T cell response in vivo, as is shown herein. Similarly, the vectors can be used as vaccine materials per se, and can be administered to a patient in need of a T cell response against complexes of MHC molecules and peptide on cell surfaces. Of course, T cells generated ex vivo can also be used to treat patients. The peptides may be combined with peptides from other tumor rejection antigens to 15 form 'polytopes'. Exemplary peptides include those listed in U.S. Patent Application Serial Numbers 08/672,351, 08/718,964, now U.S. Patent No. _, 08/487,135 now U.S. Patent No. 08/530,569 and 08/880,963 all of which are incorporated by reference. Additional peptides which can be used are those described in the following references, 20 all of which are incorporated by reference: U.S. Patent Nos. 5,405,940; 5,487,974; 5,519,117; 5,530,096; 5,554,506; 5,554,724; 5,558,995; 5,585,461; 5,589,334; 5,648,226; and -43- WO 00/52163 PCT/USOO/05346 5,683,886; PCT International Publication Nos. 92/20356; 94/14459; 96/10577; 96/21673; 97/10837; 97/26535; and 97/31017 as well as pending U.S. Application Serial No. 08/713,354. Polytopes are groups of two or more potentially immunogenic or immune stimulating 5 peptides, which can be joined together in various ways, to determine if this type of molecule will stimulate and/or provoke an immune response. These peptides can be joined together directly, or via the use of flanking sequences. See Thompson et al., Proc. Natl. Acad. Sci. USA 92(13): 5845-5849 (1995), teaching the direct linkage of relevant epitopic sequences. The use of polytopes as vaccines is well 10 known. See, e.g., Gilbert et al., Nat. Biotechnol. 15(12): 1280-1284 (1997); Thomson et al., supra; Thomson et al., J. Immunol. 157(2): 822-826 (1996); Tam et al., J. Exp. Med. 171(1): 299-306 (1990), all of which are incorporated by reference. The Tam reference in particular shows that polytopes, when used in a mouse model, are useful in generating both antibody and protective immunity. Further, the reference shows that the polytopes, when digested, 15 yield peptides which can be and are presented by MHCs. Tam shows this by showing recognition of individual epitopes processed from polytope 'strings' via CTLs. This approach can be used, e.g., in determining how many epitopes can be joined in a polytope and still provoke recognition and also to determine the efficacy of different combinations of epitopes. Different combinations may be 'tailor-made' for the patients expressing particular subsets of 20 tumor rejection antigens. These polytopes can be introduced as polypeptide structures, or via the use of nucleic acid delivery systems. To elaborate, the art has many different ways -44- WO 00/52163 PCT/USOO/05346 available to introduce DNA encoding an individual epitope, or a polytope such as is discussed supra. See, e.g., Allsopp et al., Eur. J. Immunol. 26(8); 1951-1959 (1996), incorporated by reference. Adenovirus, pox-virus, Ty-virus like particles, plasmids, bacteria, etc., can be used. One can test these systems in mouse models to determine which system seems most 5 appropriate for a given, parallel situation in humans. They can also be tested in human clinical trials. Also, a feature of the invention is the use of these peptides to determine the presence of cytolytic T cells in a sample. It was shown, supra, that CTLs in a sample will react with peptide/MHC complexes. Hence, if one knows that CTLs are in a sample, cells positive for 10 particular HLA molecules can be "lysed" by adding the peptides of the invention to positive cells, such as HLA-A2 positive cells, and then determining, e.g., radioactive chromium release, TNF production, etc. or any other of the methods by which T cell activity is determined. Similarly, one can determine whether or not specific tumor infiltrating lymphocytes ("TILs") are present in a sample, by adding one of the claimed peptides with 15 HLA positive cells to a sample, and determining lysis of the HLA positive cells via, e.g., "Cr release, TNF presence and so forth. In addition, CTL may be detected by ELISPOT analysis. See for example Schmittel et al., (1997). J. Immunol. Methods 210: 167-174 and Lalvani et al., (1997). J. Exp. Med. 126: 859 or by FACS analysis of fluorogenic tetramer complexes of MHC Class I/peptide (Dunbar et al., (1998), Current Biology 8: 413-416, Romero, et al., 20 J. Exp. Med. 188: 1641-1650 (1998). All are incorporated by reference. -45- WO 00/52163 PCT/USOO/05346 Of course, the peptides may also be used to provoke production of CTLs. As was shown, supra, CTL precursors develop into CTLs when confronted with appropriate complexes. By causing such a "confrontation" as it were, one may generate CTLs. This is useful in an in vivo context, as well as ex vivo, for generating such CTLs. 5 Other aspects of the inventions will be clear to the skilled artisan and will not be restricted herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, it being 10 recognized that various modifications are possible within the scope of the invention. -46-

Claims (17)

1. An isolated, compl63ementary DNA molecule which encodes a protein encoded by a nucleic acid molecule consisting of the nucleotide sequence set forth in SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20.

2. The isolated, complementary DNA molecule of claim 1, which encodes the 5 protein encoded by SEQ ID NO: 18.

3. The isolated, complementary DNA molecule of claim 1, which encodes the protein encoded by SEQ ID NO: 19.

4. The isolated nucleic acid molecule of claim 1, which encodes the protein encoded by SEQ ID NO: 20. 10

5. The isolated complementary DNA molecule of claim 1, consisting of the nucleotide sequence of SEQ ID NO: 18.

6. The isolated complementary DNA molecule of claim 1, consisting of the nucleotide sequence of SEQ ID NO: 19. 47 WO 00/52163 PCT/USOO/05346

7. The isolated nucleic acid molecule of claim 1, consisting of the nucleotide sequence of SEQ ID NO: 20.

8. Expression vector comprising the complementary DNA molecule of claim 1, operably linked to promoter. 5

9. Recombinant cell comprising the isolated complementary DNA molecule of claim 1.

10. Recombinant cell comprising the expression vector of claim 7.

11. An isolated nucleic acid molecule which comprises (i) a nucleotide sequence which hybridizes to an isolated nucleic acid molecule which encodes MAGE 10 A10, under stringent conditions, (ii) a second nucleotide sequence which hybridizes to an isolated nucleic acid molecule which encodes MAGE-A5, under stringent condition, and (iii) a third nucleotide sequence which is interposed between (i) and (ii).

12. The isolated nucleic acid molecule of claim 11, comprising the nucleotide sequence set forth at SEQ ID NO: 17. 48 WO 00/52163 PCTIUSOO/05346

13. Expression vector comprising the isolated nucleic acid molecule of claim 11, operably linked to a promoter.

14. Recombinant cell comprising the isolated nucleic acid molecule of claim 11.

15. Recombinant cell comprising the isolated nucleic acid molecule of claim 12. 5

16. A method for screening for cancer in a sample, comprising determining presence of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 17, 18, 19 or 20 in said sample, presence of said nucleic acid molecule being indicative of cancer in said sample.

17. The method of claim 16, comprising determining presence of said nucleic acid 10 molecule via polymerase chain reaction. 49