AU3072199A - Novel polypeptides and nucleic acids encoding the same - Google Patents

Description

WO 99/46281 PCT/US99/05028 NOVEL POLYPEPTIDES AND NUCLEIC ACIDS ENCODING THE SAME FIELD OF THE INVENTION The present invention relates generally to the identification and isolation of novel DNA and to the recombinant production of novel polypeptides encoded by that DNA. 5 BACKGROUND OF THE INVENTION Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate 10 environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment. 15 Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. Efforts are being undertaken by both industry and academia to identify new, native secreted proteins. Many efforts are focused on the screening 20 of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sc., 23:7108-7113 (1996); U.S. Patent No. 5,536,637)]. Membrane-bound proteins and receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, 25 differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors 30 involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including as 35 pharmaceutical and diagnostic agents. Receptor iimunoadhesins, for instance, can be employed as therapeutic agents 1 WO 99/46281 PCTIUS99/05028 to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Efforts are being undertaken by both industry and academia to identify new, native receptor proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel receptor proteins. We herein describe the identification and characterization of novel secreted and transmembrane polypeptides 5 and novel nucleic acids encoding those polypeptides. 1. PRO213 Human growth arrest-specific gene 6 (gas6) encodes a protein that is expressed in a variety of different tissues and which has been reported to be highly expressed during periods of serum starvation and negatively 10 regulated during growth induction. See Manfioletti et al., Mol. Cell. Biol. 13(8):4976-4985 (1993) and Stitt et al., Cell 80:661-670 (1995). Manfioletti et al. (1993), supra, have suggested that the gas6 protein is member of the vitamin K-dependent family of proteins, wherein the members of the latter family of proteins (which include, for example, Protein S, Protein C and Factor X) all play regulatory roles in the blood coagulation pathway. Thus, it has been suggested that gas6 may play a role in the regulation of a protease cascade relevant in growth regulation or in 15 the blood coagulation cascade. Given the physiological importance of the gas6 protein, efforts are currently being undertaken by both industry and academia to identify new, native proteins which are homologous to gas6. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins, specifically those having homology to gas6. Examples of such 20 screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. We herein describe the identification of a novel polypeptide which has homology to the gas6 polypeptide. 2. PR0274 25 The 7-transmembrane ("7TM") proteins or receptors, also referred to in the literature as G-protein coupled receptors, are specialized proteins designed for recognition of ligands and the subsequent signal transduction of information contained within those ligands to the machinery of the cell. The primary purpose of cell surface receptors is to discriminate appropriate ligands from the various extracellular stimuli which each cell encounters, then to activate an effector system that produces an intracellular signal, thereby controlling cellular processes. [Dohlman, 30 H.,Ann. Rev. Biochem., 60:653 (1991)]. The ability of 7TM receptors to bind ligand to a recognition domain and allosterically transmit the information to an intracellular domain is a specialized feature of 7TM proteins [Kenakin, T., Pharmacol. Rev., 4:413 (1996)]. The gene family which encodes the 7TM receptors or G-protein linked receptors encode receptors which recognize a large number of ligands, including but not limited to, C5a, interleukin 8 and related chemokines. Research in this area suggests that distinct signals at the cell surface feed into common 35 pathways of cell activation. [Gerard, C. and Gerard, N.,Curr. Op. Immunol.. 6:140 (1994), Gerard, C. and Gerard, N.,A n, Rev. Immunol., 12:775 (1994)]. The superfamily of 7TM or G-protein coupled receptors contains several hundred members able to recognize various messages such as photons, ions and amino acids among others [Schwartz, T.W., et al., H.,Trends in Pharmacol. Sci., 17(6):213 (1996)]. {Dohnan, H.,Ann. Rev. Biochem., 60:653 (1991)]. [Schwartz, T.W., et al., H.,Eur. J. Pharm. Sci., 2:85 (1994)]. 2 WO 99/46281 PCT/US99/05028 We describe herein the identification of a novel polypeptide (designated herein as PR0274) which has homology to the 7 transmembrane segment receptor proteins and the Fn54 protein. 3. PRO300 The Diff 33 protein is over-expressed in mouse testicular tumors. At present its role is unclear, however, 5 it may play a role in cancer. Given the medical importance of understanding the physiology of cancer, efforts are currently being under taken to identify new, native proteins which are involved in cancer. We describe herein the identification of a novel polypeptide which has homology to Diff 33, designated herein as PRO300. 4. PR0284 10 Efforts arre currently being undertaken to identify and characterize novel transmembrane proteins. We herein describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PR0284. 5. PRO296 15 Cancerous cells often express numerous proteins that are not expressed in the corresponding normal cell type or are expressed at different levels than in the corresponding normal cell type. Many of these proteins are involved in inducing the transformation from a normal cell to a cancerous cell or in maintaining the cancer phenotype. As such, there is significant interest in identifying and characterizing proteins that are expressed in cancerous cells. We herein describe the identification and characterization of a novel polypeptide having homology to the sarcoma 20 amplified protein SAS, designated herein as PR0296. 6. PRO329 Immunoglobulin molecules play roles in many important mammalian physiological processes. The structure of immunoglobulin molecules has been extensively studied and it has been well documented that intact 25 immunoglobulins possess distinct domains, one of which is the constant domain or Fc region of the immunoglobulin molecule. The F. domain of an immunoglobulin, while not being directly involved in antigen recognition and binding, does mediate the ability of the immunoglobulin molecule, either uncomplexed or complexed with its respective antigen, to bind to F, receptors either circulating in the serum or on the surface of cells. The ability of an Fe domain of an inmunoglobulin to bind to an Fc receptor molecule results in a variety of important activities, including for 30 example, in mounting an immune response against unwanted foreign particles. As such, there is substantial interest in identifying novel F, receptor proteins and subunits thereof. We herein describe the identification and characterization of a novel polypeptide having homology to a high affinity immunoglobulin Fc receptor protein, designated herein as PR0329. 35 7. PRO362 Colorectal carcinoma is a malignant neoplastic disease which has a high incidence in the Western world, particularly in the United States. Tumors of this type often metastasize through lymphatic and vascular channels and result in the death of some 62,000 persons in the United States annually. 3 WO 99/46281 PCTIUS99/05028 Monoclonal antibody A33 (mAbA33) is a murine immunoglobulin that has undergone extensive preclinical analysis and localization studies in patients inflicted with colorectal carcinoma (Welt et al., J. Clin. Oncol. 8:1894 1906 (1990) and Welt et al., J. Clin. Oncol. 12:1561-1571 (1994)). mAbA33 has been shown to bind to an antigen found in and on the surface of normal colon cells and colon cancer cells. In carcinomas originating from the colonic mucosa, the A33 antigen is expressed homogeneously in more than 95% of the cases. The A33 antigen, however, 5 has not been detecting in a wide range of other normal tissues, i.e., its expression appears to be rather organ specific. Therefore, the A33 antigen appears to play an important role in the induction of colorectal cancer. Given the obvious importance of the A33 antigen in tumor cell formation and/or proliferation, there is substantial interest in identifying homologs of the A33 antigen. In this regard, we herein describe the identification and characterization of a novel polypeptide having homology to the A33 antigen protein, designated herein as 10 PR0362. 8. PR0363 The cell surface protein HCAR is a membrane-bound protein that acts as a receptor for subgroup C of the adenoviruses and subgroup B of the coxsackieviruses. Thus, HCAR may provide a means for mediating viral 15 infection of cells in that the presence of the HCAR receptor on the cellular surface provides a binding site for viral particles, thereby facilitating viral infection. In light of the physiological importance of membrane-bound proteins and spcficially those which serve a cell surface receptor for viruses, efforts are currently being undertaken by both industry and academia to identify new, native membrane-bound reeptor proteins. Many of these efforts are focused on the screening of mammalian 20 recombinant DNA libraries to identify the coding sequences for novel receptor proteins. We herein describe a novel membrane-bound polypeptide having homology to the cell surface protein HCAR and to various tumor antigens including A33 and carcinoembryonic antigen, designated herein as PR0363, wherein this polypeptide may be a novel cell surface virus receptor or tumor antigen. 25 9. PR0868 Control of cell numbers in mammals is believed to be determined, in part, by a balance between cell proliferation and cell death. One form of cell death, sometimes referred to as necrotic cell death, is typically characterized as a pathologic form of cell death resulting from some trauma or cellular injury. In contrast, there is another, "physiologic" form of cell death which usually proceeds in an orderly or controlled manner. This orderly 30 or controlled form of cell death is often referred to as "apoptosis " [see, e.g., Barr et al., Bio/Technologv, .12:487-493 (1994); Steller et al., Science, 267:1445-1449 (1995)]. Apoptotic cell death naturally occurs in many physiological processes, including embryonic development and clonal selection in the immune system [Itoh et al., Cell, 66:233-243 (1991)]. Decreased levels of apoptotic cell death have been associated with a variety of pathological conditions, including cancer, lupus, and herpes virus infection [Thompson, Science, 267:1456-1462 (1995)]. Increased levels 35 of apoptotic cell death may be associated with a variety of other pathological conditions, including AIDS, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, retinitis pigmentosa, cerebellar degeneration, aplastic anemia, myocardial infarction, stroke, reperfusion injury, and toxin-induced liver disease [see, Thompson, supral. 4 WO 99/46281 PCTIUS99/05028 Apoptotic cell death is typically accompanied by one or more characteristic morphological and biochemical changes in cells, such as condensation of cytoplasm, loss of plasma membrane microvilli, segmentation of the nucleus, degradation of chromosomal DNA or loss of mitochondrial function. A variety of extrinsic and intrinsic signals are believed to trigger or induce such morphological and biochemical cellular changes [Raff, Nature, 356:397 400 (1992); Steller, supra; Sachs et al., Blood, 82:15 (1993)]. For instance, they can be triggered by hormonal 5 stimuli, such as glucocorticoid hormones for immature thymocytes, as well as withdrawal of certain growth factors [Watanabe-Fukunaga et al., Nature, 356:314-317 (1992)]. Also, some identified oncogenes such as myc, rel, and E1A, and tumor suppressors, like p53, have been reported to have a role in inducing apoptosis. Certain chemotherapy drugs and some forms of radiation have likewise been observed to have apoptosis-inducing activity [Thompson, supral. 10 Various molecules, such as tumor necrosis factor-a ("TNF-a"), tumor necrosis factor-P ("TNF-P" or "lymphotoxin-a"), lymphotoxin-P ("LT-P"), CD30 ligand, CD27 ligand, CD40 ligand, OX-40 ligand, 4-1BB ligand, Apo-1 ligand (also referred to as Fas ligand or CD95 ligand), and Apo-2 ligand (also referred to as TRAIL) have been identified as members of the tumor necrosis factor ("TNF") family of cytokines [See, e.g., Gruss and Dower, Blood, 85:3378-3404 (1995); Pitti et al., J. Biol. Chem., 271:12687-12690 (1996); Wiley et al., Immunity, .:673-682 (1995); 15 Browning et al., Cell, 72:847-856 (1993); Armitage et al. Nature, 352:80-82 (1992), WO 97/01633 published January 16, 1997; WO 97/25428 published July 17, 1997]. Among these molecules, TNF-a, TNF-P, CD30 ligand, 4-1BB ligand, Apo-1 ligand, and Apo-2 ligand (TRAIL) have been reported to be involved in apoptotic cell death. Both TNF-a and TNF-p have been reported to induce apoptotic death in susceptible tumor cells [Schmid et al., Proc. Natl. Acad. Sci., 83:1881 (1986); Dealtry et al., Eur. J. Immunol., 17:689 (1987)]. Zheng et al. have reported that TNF-a 20 is involved in post-stimulation apoptosis of CD8-positive T cells [Zheng et al., Nature, 377:348-351 (1995)]. Other investigators have reported that CD30 ligand may be involved in deletion of self-reactive T cells in the thymus [Amakawa et al., Cold Spring Harbor Laboratory Symposium on Programmed Cell Death, Abstr. No. 10, (1995)]. Mutations in the mouse Fas/Apo-1 receptor or ligand genes (called lpr and gid, respectively) have been associated with some autoimmune disorders, indicating that Apo-1 ligand may play a role in regulating the clonal 25 deletion of self-reactive lymphocytes in the periphery [Krammer et al., Curr. Op. Immunol., 6:279-289 (1994); Nagata et al., Science, 267:1449-1456 (1995)]. Apo-1 ligand is also reported to induce post-stimulation apoptosis in CD4-positive T lymphocytes and in B lymphocytes, and may be involved in the elimination of activated lymphocytes when their function is no longer needed [Krammer et al., supra; Nagata et al., supral. Agonist mouse monoclonal antibodies specifically binding to the Apo-1 receptor have been reported to exhibit cell killing activity 30 that is comparable to or similar to that of TNF-a [Yonehara et al., J. Exp. Med., 169:1747-1756 (1989)]. Induction of various cellular responses mediated by such TNF family cytokines is believed to be initiated by their binding to specific cell receptors. Two distinct TNF receptors of approximately 55-kDa (TNFR1) and 75 kDa (TNFR2) have been identified [Hohman et al., J. Biol. Chem., 264:14927-14934 (1989); Brockhaus et al., Proc. Natl. Acad. Sci., K2:3127-3131 (1990); EP 417,563, published March 20, 1991] and human and mouse cDNAs 35 corresponding to both receptor types have been isolated and characterized [Loetscher et al., Cell, 1:351 (1990); Schall et al., Cell, 1:361 (1990); Smith et al., Science, 248:1019-1023 (1990); Lewis et al., Proc. Natl. Acad. Sci., 88:2830-2834 (1991); Goodwin et al., Mol. Cell. Biol., 11:3020-3026 (1991)]. Extensive polymorphisms have been associated with both TNF receptor genes [see, e.g., Takao et al., Immunogenetics, 37:199-203 (1993)]. Both TNFRs share the typical structure of cell surface receptors including extracellular, transmembrane and intracellular regions. 5 WO 99/46281 PCT/US99/05028 The extracellular portions of both receptors are found naturally also as soluble TNF-binding proteins [Nophar, Y. et al., EMBO J., 9:3269 (1990); and Kohno, T. et al., Proc. Natl. Acad. Sci. U.S.A., 82:8331 (1990)]. More recently, the cloning of recombinant soluble TNF receptors was reported by Hale et al. [J. Cell. Biochem. Supplement 15F, 1991, p. 113 (P424)]. The extracellular portion of type 1 and type 2 TNFRs (TNFR1 and TNFR2) contains a repetitive amino acid 5 sequence pattern of four cysteine-rich domains (CRDs) designated 1 through 4, starting from the NH 2 -terminus. Each CRD is about 40 amino acids long and contains 4 to 6 cysteine residues at positions which are well conserved [Schall et al., sura; Loetscher et al., supra; Smith et al., supra; Nophar et al., supra; Kohno et al., supral. In TNFR1, the approximate boundaries of the four CRDs are as follows: CRD1- amino acids 14 to about 53; CRD2- amino acids from about 54 to about 97; CRD3- amino acids from about 98 to about 138; CRD4- amino acids from about 139 to 10 about 167. In TNFR2, CRD1 includes amino acids 17 to about 54; CRD2- amino acids from about 55 to about 97; CRD3- amino acids from about 98 to about 140; and CRD4- amino acids from about 141 to about 179 [Banner et al., Cell, 23:431-435 (1993)]. The potential role of the CRDs in ligand binding is also described by Banner et al., supra. A similar repetitive pattern of CRDs exists in several other cell-surface proteins, including the p75 nerve growth factor receptor (NGFR) [Johnson et al., Cell 4:545 (1986); Radeke et al., Nature, 325:593 (1987)], the B 15 cell antigen CD40 [Stamenkovic et al., EMBO J., 8:1403 (1989)], the T cell antigen OX40 [Mallet et al., EMBO J., 9: 1063 (1990)] and the Fas antigen [Yonehara et al., supra and Itoh et al., Cell 66:233-243 (1991)]. CRDs are also found in the soluble TNFR (sTNFR)-like T2 proteins of the Shope and myxoma poxviruses [Upton et al., Virology, 160:20-29 (1987); Smith et al., Biochem. Biophys. Res. Commun., 1276:335 (1991); Upton et al., Virology, 184:370 (1991)]. Optimal alignment of these sequences indicates that the positions of the cysteine residues are well conserved. 20 These receptors are sometimes collectively referred to as members of the TNF/NGF receptor superfamily. Recent studies on p75NGFR showed that the deletion of CRD1 [Welcher, A.A. et al., Proc. Natl. Acad. Sci. USA, $8:159 163 (1991)] or a 5-amino acid insertion in this domain [Yan, H. and Chao, M.V., J. Biol. Chem., 266:12099-12104 (1991)] had little or no effect on NGF binding [Yan, H. and Chao, M.V., supral. p75 NGFR contains a proline-rich stretch of about 60 amino acids, between its CRD4 and transmembrane region, which is not involved in NGF binding 25 [Peetre, C. et al., Eur. J. Hematol., 4:414-419 (1988); Seckinger, P. et al., J. Biol. Chem., 264:11966-11973 (1989); Yan, H. and Chao, M.V., supral. A similar proline-rich region is found in TNFR2 but not in TNFR1. The TNF family ligands identified to date, with the exception of lymphotoxin-a, are type II transmembrane proteins, whose C-terminus is extracellular. In contrast, most receptors in the TNF receptor (TNFR) family identified to date are type I transmembrane proteins. In both the TNF ligand and receptor families, however, homology 30 identified between family members has been found mainly in the extracellular domain ("ECD"). Several of the TNF family cytokines, including TNF-a, Apo-1 ligand and CD40 ligand, are cleaved proteolytically at the cell surface; the resulting protein in each case typically forms a homotrimeric molecule that functions as a soluble cytokine. TNF receptor family proteins are also usually cleaved proteolytically to release soluble receptor ECDs that can function as inhibitors of the cognate cytokines. 35 Recently, other members of the TNFR family have been identified. Such newly identified members of the TNFR family include CAR1, HVEM and osteoprotegerin (OPG) [Brojatsch et al., _Cdl, 87:845-855 (1996); Montgomery et al., _Cel, 7:427-436 (1996); Marsters et al., J. Biol. Chem., 272:14029-14032 (1997); Simonet et al., Cl, B2:309-319 (1997)]. Unlike other known TNFR-like molecules, Simonet et al., supra, report that OPG contains no hydrophobic transmembrane-spanning sequence. 6 WO 99/46281 PCTIUS99/05028 Moreover, a new member of the TNF/NGF receptor family has been identified in mouse, a receptor referred to as "GITR" for "glucocorticoid-induced tumor necrosis factor receptor family-related gene" [Nocentini et al., Proc. Natl. Acad. Sci. USA 94:6216-6221 (1997)]. The mouse GITR receptor is a 228 amino acid type I transmembrane protein that is expressed in normal mouse T lymphocytes from thymus, spleen and lymph nodes. Expression of the mouse GITR receptor was induced in T lymphocytes upon activation with anti-CD3 antibodies, Con A or phorbol 5 12-myristate 13-acetate. It was speculated by the authors that the mouse GITR receptor was involved in the regulation of T cell receptor-mediated cell death. In Marsters et al., Curr. Biol., 6:750 (1996), investigators describe a full length native sequence human polypeptide, called Apo-3, which exhibits similarity to the TNFR family in its extracellular cysteine-rich repeats and resembles TNFR1 and CD95 in that it contains a cytoplasmic death domain sequence [see also Marsters et al., Curr. 10 Biol, 6:1669 (1996)]. Apo-3 has also been referred to by other investigators as DR3, wsl-1 and TRAMP [Chinnaiyan et al., Science, 274:990 (1996); Kitson et al., Nature, 384:372 (1996); Bodmer et al., Immunity, 6:79 (1997)]. Pan et al. have disclosed another TNF receptor family member referred to as "DR4" [Pan et al., Science, 276:111-113 (1997)]. The DR4 was reported to contain a cytoplasmic death domain capable of engaging the cell 15 suicide apparatus. Pan et al. disclose that DR4 is believed to be a receptor for the ligand known as Apo-2 ligand or TRAIL. In Sheridan et al., Science, 277:818-821 (1997) and Pan et al., Science, 277:815-818 (1997), another molecule believed to be a receptor for the Apo-2 ligand (TRAIL) is described. That molecule is referred to as DR5 (it has also been alternatively referred to as Apo-2). Like DR4, DR5 is reported to contain a cytoplasmic death 20 domain and be capable of signaling apoptosis. In Sheridan et al., supra, a receptor called DcR1 (or alternatively, Apo-2DcR) is disclosed as being a potential decoy receptor for Apo-2 ligand (TRAIL). Sheridan et al. report that DcR1 can inhibit Apo-2 ligand function in vitro. See also, Pan et al., sura, for disclosure on the decoy receptor referred to as TRID. For a review of the TNF family of cytokines and their receptors, see Gruss and Dower, supra. 25 As presently understood, the cell death program contains at least three important elements - activators, inhibitors, and effectors; in C. elegans, these elements are encoded respectively by three genes, Ced-4, Ced-9 and Ced-3 [Steller, Science, 262:1445 (1995); Chinnaiyan et al., Science, 225:1122-1126 (1997); Wang et al., Cell, 90:1 20 (1997)]. Two of the TNFR family members, TNFR1 and Fas/Apol (CD95), can activate apoptotic cell death [Chinnaiyan and Dixit, Current Biology, :555-562 (1996); Fraser and Evan, Cell; L:781-784 (1996)]. TNFR1 is 30 also known to mediate activation of the transcription factor, NF-KB [Tartaglia et al., Cell, 74:845-853 (1993); Hsu et al., Cell, 4:299-308 (1996)]. In addition to some ECD homology, these two receptors share homology in their intracellular domain (ICD) in an oligomerization interface known as the death domain [Tartaglia et al., supra; Nagata, Cell, .8:355 (1997)]. Death domains are also found in several metazoan proteins that regulate apoptosis, namely, the Drosophila protein, Reaper, and the mammalian proteins referred to as FADD/MORT1, TRADD, and RIP 35 [Cleaveland and Ihle, eli, Ll:479-482 (1995)]. Upon ligand binding and receptor clustering, TNFR1 and CD95 are believed to recruit FADD into a death inducing signalling complex. CD95 purportedly binds FADD directly, while TNFR1 binds FADD indirectly via TRADD [Chinnaiyan et al., edl, &:505-512 (1995); Boldin et al., J. Biol. Chem., 270:387-391 (1995); Hsu et al., supra; Chinnaiyan et al., J. Biol. Chem., 271:4961-4965 (1996)]. It has been reported that FADD serves as an 7 WO 99/46281 PCT/US99/05028 adaptor protein which recruits the Ced-3-related protease, MACHa/FLICE (caspase 8), into the death signalling complex [Boldin et al., .Cll, 85:803-815 (1996); Muzio et al., Cell, 85:817-827 (1996)]. MACHa/FLICE appears to be the trigger that sets off a cascade of apoptotic proteases, including the interleukin-1 3 converting enzyme (ICE) and CPP32/Yama, which may execute some critical aspects of the cell death programme [Fraser and Evan, supra]. It was recently disclosed that programmed cell death involves the activity of members of a family of cysteine 5 proteases related to the C. elegans cell death gene, ced-3, and to the mammalian IL-I-converting enzyme, ICE. The activity of the ICE and CPP32/Yama proteases can be inhibited by the product of the cowpox virus gene, crmA [Ray et al., Cell, 69:597-604 (1992); Tewari et al., Cell, 1:801-809 (1995)]. Recent studies show that CrmA can inhibit TNFR1- and CD95-induced cell death [Enari et al., Nature, 375:78-81 (1995); Tewari et al., J. Biol. Chem., 270:3255-3260 (1995)]. 10 As reviewed recently by Tewari et al., TNFR1, TNFR2 and CD40 modulate the expression of proinflammatory and costimulatory cytokines, cytokine receptors, and cell adhesion molecules through activation of the transcription factor, NF-xB [Tewari et al., Curr. Op. Genet. Develop., 6:39-44 (1996)]. NF-KB is the prototype of a family of dimeric transcription factors whose subunits contain conserved Rel regions [Verma et al., Genes Develop., 2:2723-2735 (1996); Baldwin, Ann. Rev. Immunol., 14:649-681 (1996)]. In its latent form, NF-KB is 15 complexed with members of the IKB inhibitor family; upon inactivation of the IKB in response to certain stimuli, released NF-KB translocates to the nucleus where it binds to specific DNA sequences and activates gene transcription. 10. PR0382 Proteases are enzymatic proteins which are involved in a large number of very important biological 20 processes in mammalian and non-mammalian organisms. Numerous different protease enzymes from a variety of different mammalian and non-mammalian organisms have been both identified and characterized, including the serine proteases which exhibit specific activity toward various serine-containing proteins. The mammalian protease enzymes play important roles in biological processes such as, for example, protein digestion, activation, inactivation, or modulation of peptide hormone activity, and alteration of the physical properties of proteins and enzymes. 25 In light of the important physiological roles played by protease enzymes, efforts are currently being undertaken by both industry and academia to identify new, native protease homologs. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci,, 23:7108-7113 (1996); U.S. Patent No. 5,536,637)]. We 30 herein describe the identification of novel polypeptides having homology to serine protease enzymes, designated herein as PR0382 polypeptides. 11. PR0545 The ADAM (A Disintegrin And Metalloprotease) family of proteins of which meltrin is a member may have 35 an important role in cell interactions and in modulating cellular responses. [see, for example, Gilpin et al., J. Biol. Chem., 273(L):157-166 (1998)]. The ADAM proteins have been implicated in carcinogenesis. Meltrin-a (ADAM 12) is a myoblast gene product reported to be required for cell fusion. [Harris et al., J. Cell. Biochem., 67(l):136-142 (1997), Yagami-Hiromasa et al., Nature, 32:652-656 (1995)]. The meltrins contain disintegrin and metalloprotease domains and are implicated in cell adhesive events involved in development, through the integrin-binding disintegrin 8 WO 99/46281 PCT/US99/05028 domain, but also have an anti-adhesive function through a zinc-dependent metalloprotease domain. [Alfandari et al., Devel. Biol., 182(2):314-330 (1997)]. Given the medical importance of cell fusion and modulation of cellular responses in carcinogenesis and other disease mechanisms, efforts are currently being under taken to identify new, native proteins which are involved in cell fusion and modulation of cellular responses. We describe herein the identification of a novel polypeptide which has homology to meltrin, designated herein as PR0545. 5 12. PR0617 CD24 is a protein that is associated with the cell surface of a variety of different cells of the mammalian immune system, including for example, neutrophils, monocytes and some lymphocytes, for example, B lymphocytes. CD24 has been shown to be a ligand for the platelet-associated surface glycoprotein P-selectin (also known as granule 10 membrane protein-140 or GMP-140), a glycoprotein that is constitutively synthesized in both platelets and endothelial cells and becomes exposed on the surface of platelets when those cells become activated. In this way, P-selectin mediates the calcium-dependent adhesion of activated platelets and endothelial cells to the various cells of the immune system that express one or more ligands for the P-selectin molecule, particularly CD24. This mechanism allows for recruitment of immune system cells to locations where they are most needed, for example, sites of injury. Thus, 15 there is substantial interest in identifying novel polypeptides that exhibit homology to the cell surface antigens of the immune system cells. We herein describe the identification and characterization of a novel polypeptide having homology to the CD24 protein, wherein that novel polypeptide is herein designated PR0617. 13. PRO700 20 Protein-disulfide isomerase (PDI) is a catalyst of disulfide formation and isomerization during protein folding. It has two catalytic sites housed in two domains homologous to thioredoxin, one near the N terminus and the other near the C terminus. [See for example, Gilbert HF, J.Biol.Chem., 47:29399-29402 (1997), Mayfield KJ, Science, 278:1954-1957 (1997) and Puig et al., J.Biol.Chem., 52:32988-32994 (1997)]. PDI is useful for formation of natural type disulfide bonds in a protein which is produced in aprokaryotic cell. (See also, U.S. Patent Nos. 25 5,700,659 and 5,700,678). Thus, PDI and molecules related thereto are of interest, particularly for ability to catalyze the formation of disulfide bonds. Moreover, these molecules are generally of interest in the study of redox reactions and related processes. PDI and related molecules are further described in Darby, et al., Biochemistry 34, 11725-11735 (1995). We herein describe the identification and characterization of novel polypeptides having homology to protein disulfide 30 isomerase, designated herein as PRO700 polypeptides. 14. PRO702 Conglutinin is a bovine serum protein that was originally described as a vertebrate lectin protein and which belongs to the family of C-type lectins that have four characteristic domains, (1) an N-terminal cysteine-rich domain, 35 (2) a collagen-like domain, (3) a neck domain and (4) a carbohydrate recognition domain (CRD). Recent reports have demonstrated that bovine conglutinin can inhibit hemagglutination by influenza A viruses as a result of their lectin properties (Eda et al., Biochem. J. 316:43-48 (1996)). It has also been suggested that lectins such as conglutinin can function as immunoglobulin-independent defense molecules due to complement-mediated mechanisms. Thus, conglutinin has been shown to be useful for purifying immune complexes in vitro and for removing circulating 9 WO 99/46281 PCT/US99/05028 immune complexes from patients plasma in vivo (Lim et al., Biochem. Biophys. Res. Commun. 218:260-266 (1996)). We herein describe the identification and characterization of a novel polypeptide having homology to the conglutinin protein, designated herein as PR0702. 15. PR0703 5 Very-long-chain acyl-CoA synthetase ("VLCAS") is a long-chain fatty acid transport protein which is active in the cellular transport of long and very long chain fatty acids. [see for example, Uchida et al., J Biochem (Tokyo) 119(3):565-571 (1996) and Uchiyama et al., J Biol Chem 271(48):30360-30365 (1996). Given the biological importance of fatty acid transport mechanisms, efforts are currently being under taken to identify new, native proteins which are involved in fatty acid transport. We describe herein the identification of a novel polypeptide which has 10 homology to VLCAS, designated herein as PR0703. 16. PR0705 The glypicans are a family of glycosylphosphatidylinositol (GPI)-anchored proteoglycans that, by virtue of their cell surface localization and possession of heparin sulfate chains, may regulate the responses of cells to 15 numerous heparin-binding growth factors, cell adhesion molecules and extracellular matrix components. Mutations in one glypican protein cause of syndrome of human birth defects, suggesting that the glypicans may play an important role in development (Litwack et al., Dev. Dyn. 211:72-87 (1998)). Also, since the glypicans may interact with the various extracellular matrices, they may also play important roles in wound healing (McGrath et al., Pathol. 183:251-252 (1997)). Furthermore, since glypicans are expressed in neurons and glioma cells, they may also play 20 an important role in the regulation of cell division and survival of cells of the nervous system (Liang et al., J. Cell. Bfiol. 139:851-864 (1997)). It is evident, therefore, that the glypicans are an extremely important family of proteoglycans. There is, therefore, substantial interest in identifying novel polypeptides having homology to members of the glypican family. We herein describe the identification and characterization of a novel polypeptide having homology to K-glypican, designated herein as PR0705. 25 17. PR0708 Aryl sulfatases are enzymes that exist in a number of different isoforms, including aryl sulfatase A (ASA), aryl sulfatase B (ASB) and aryl sulfatase C (ASC), and that function to hydrolyze a variety of different aromatic sulfates. Aryl sulfatases have been isolated from a variety of different animal tissues and microbial sources and their 30 structures and functions have been extensively studied (see, e.g., Nichol and Roy, J. Biochem. 55:643-651 (1964)). ASA deficiency has been reported to be associated with metachromatic leukodystrophy (MLD) (Giles et al., Prenat. Diagn. 7(4):245-252 (1987) and Herska et al., Am. J. Med. Genet. 26(3):629-635 (1987)). Additionally, other groups have reported that aryl sulfatases have been found in high levels in natural killer cells of the immune system and have hypothesized a possible role for these enzymes in NK cell-mediated cellular lysis (see, e.g., Zucker-Franklin 35 et al., Proc. Natl. Acad. Sci. USA 80(22):6977-6981 (1983)). Given the obvious physiological importance of the aryl sulfatase enzymes, there is a substantial interest in identifying novel aryl sulfatase homolog polypeptides. We herein describe the identification and characterization of novel polypeptides having homology to the aryl sulfatases, wherein these novel polypeptides are herein designated PR0708 polypeptides. 10 WO 99/46281 PCT/US99/05028 18. PR0320 Fibulin-1 is a cysteine-rich, calcium-binding extracellular matrix (ECM) component of basement membranes and connective tissue elastic fibers and plasma protein, which has four isoforms, A-D, derived from alternative splicing. Fibulin-1 is a modular glycoprotein with amino-terminal anaphlatoxin-like modules followed by nine epidermal growth factor (EGF)-like modules and, depending on alternative splicing, four possible carboxyl termini. 5 Fibulin-2 is a novel extracellular matrix protein frequently found in close association with microfibrils containing either fibronectin or fibrillin. There are multiple forms of fibulin-1 that differ in their C-terminal regions that are produced through the process of alternative splicing of their precursor RNA. [see for example Tran et al., Matrix Biol 15(7):479-493 (1997).] Northern and Western blotting analysis of 16 cell lines established from tumors formed in athymic mice and 10 malignant cell lines derived from patients indicate that low expression of fibulin-1D plays a role in tumor formation and invasion. [Qing et al., Oncogene, 18:2159-2168 (1997)]. Ovarian-cancer cells are characterized by their ability to invade freely the peritoneal cavity. It has been demonstrated that estradiol stimulates the proliferation of estrogen receptor (ER)-positive ovarian-cancer cells, as well as expression of fibulin-1. Studies on the effect of fibulin-1 on motility of the MDA-MB231 breast-cancer cell line, indicated inhibition of haptotactic migration of MDA-MB231 15 cells, and the authors concluded that fibulin-1 can inhibit cancer cell motility in vitro and therefore has the potential to inhibit tumor invasion. [Hayashido et al., Int J Cancer , 75(4):654-658 (1998)] Thus, fibulin, and molecules related thereto are of interest, particularly for the use of preventing cancer. Moreover, these molecules are generally of interest in the study of connective tissue and attachment molecules and related mechanisms. Fibulin and related molecules are further described in Adams, et al., J. Mol. Biol., 20 272(2):226-36 (1997); Kielty and Shuttleworth, Microsc. Res. Tech., 38(4):413-27 (1997); and Child, J. Card. Surg. 12(2Supp.):131-5 (1997). We herein describe the identification and characterization of novel polypeptides having homology to fibulin, designated herein as PR0320 polypeptides. 25 19. PR0324 Oxidoreductases are enzymes that catalyze a reaction in which two molecules of a compound interact so that one molecule is oxidized and the other is reduced, with a molecule of water entering the reaction. There are many different types of oxidoreductase enzymes that play very important physiological roles in the mammalian organism. Some of the most important oxidoreductases include, for example, lyases, lactases, cholesterol oxidases, and the like. 30 These enzymes play roles in such essential processes as digestion, signal transduction, maintenance of ionic homeostasis, and the like. As such, given that oxidoreductase enzymes find various essential uses in the mammalian organism, there is a substantial interest in identifying novel oxidoreductase enzyme homologs. We herein describe the identification and characterization of a novel polypeptide having homology to oxidoreductases, designated herein as PR0324. 35 20. PRO351 Prostasin is a novel human seine proteinase purified from human seminal fluid. Immunohistochemical localization reveals that prostasin is present in epithelial cells and ducts of the prostate gland. The cDNA for prostasin has been cloned and characterized. Southern blot analysis, following a reverse transcription polymerase 11 WO 99/46281 PCT/US99/05028 chain reaction, indicates that prostasin mRNA is expressed in prostate, liver, salivary gland, kidney, lung, pancreas, colon, bronchus, renal proximal tubular cells, and prostate carcinoma LNCaP cells. Cellular localization of prostasin mRNA was identified within epithelial cells of the human prostate gland by in situ hybridization histochemistry. [See for example, Yu et al., J Biol Chem. (1994) 269(29):18843-18848, and Yu et al., J Biol Chem. (1994) 270(22):13483 13489]. 5 Thus, prostasin, and molecules related thereto are of interest, particularly for the study, diagnosis and treatment of medical conditions involving the prostate. Prostasin and related molecules are further described in Yu et al., Genomics (1996) 32(3):334-340. We herein describe the identification and characterization of novel polypeptides having homology to prostasin, designated herein as PR0351 polypeptides. 10 21. PR0352 Butyrophilin is a milk glycoprotein that constitutes more than 40% of the total protein associated with the fat globule membrane in mammalian milk. Expression of butyrophilin mRNA has been shown to correlate with the onset of milk fat production toward the end pregnancy and is maintained throughout lactation. Butyrophilin has been identified in bovine, murine and human (see Taylor et al., Biochim. Biophys. Acta 1306:1-4 (1996), Ishii et al., 15 Biochim. Biophys. Acta 1245:285-292 (1995), Mather et al., J. Dairy Sci. 76:3832-3850 (1993) and Banghart et al., J. Biol. Chem. 273:4171-4179 (1998)) and is a type I transmembrane protein that is incorporated into the fat globulin membrane. It has been suggested that butyrophilin may play a role as the principle scaffold for the assembly of a complex with xanthine dehydrogenase/oxidase and other proteins that function in the budding and release of milk-fat globules from the apical surface during lactation (Banghart et al., supra). 20 Given that butyrophilin plays an obviously important role in mammalian milk production, there is substantial interest in identifying novel butyrophilin homologs. We herein describe the identification and characterization of a novel polypeptide having homology to butyrophilin, designated herein as PR0352. 22. PRO381 25 The immunophilins are a family of proteins that function as receptors for immunosuppressant drugs, such as cyclosporin A, FK506, and rapamycin. The immunophilins occur in two separate classes, (1) the FK506-binding proteins (FKBPs), which bind to FK506 and rapamycin, and (2) the cyclophilins, which bind to cyclosporin A. With regard to the FK506-binding proteins, it has been reported that the FK506/FKBP complex functions to inhibit the activity of the serine/threonine protein phosphatase 2B (calcineurin), thereby providing immunosuppressant activity 30 (Gold, Mol. Neurobiol. 15:285-306 (1997)). It has also been reported that the FKBP immunophilins are found in the mammalian nervous system and may be involved in axonal regeneration in the central nervous system through a mechanism that is independent of the process by which immunosuppression is achieved (Gold, supra). Thus, there is substantial interest in identifying novel polypeptides having homology to the FKBP immunophilins. We herein describe the identification and characterization of a novel polypeptide having homology to an FKBP immunophilin 35 protein, designated herein as PR0381. 23. PRO386 Mammalian cell membranes perform very important functions relating to the structural integrity and activity of various cells and tissues. Of particular interest in membrane physiology is the study of transmembrane ion 12 WO 99/46281 PCT/US99/05028 channels which act to directly control a variety of physiological, pharmacological and cellular processes. Numerous ion channels have been identified including calcium (Ca), sodium (Na) and potassium (K) channels, each of which have been analyzed in detail to determine their roles in physiological processes in vertebrate and insect cells. One type of cell membrane-associated ion channel, the sodium channel, plays an extremely important role in a cell's ability to maintain ionic homeostasis as well as transmit intracellular and extracellular signals. Voltage 5 gated sodium channels in brain neurons have been shown to be complexes of a pore-forming alpha unit with smaller beta-1 and beta-2 subunits (Isom et al., Cell 83:433-442 (1995)). Given the obvious importance of sodium channels in cellular homeostasis and other important physiological functions, there is a significant interest in identifying novel polypeptides having homology to sodium channel subunits. We herein describe the identification and characterization of a novel polypeptide having homology to the beta-2 subunit of the rat sodium channel, designated herein as 10 PR0386. 24. PRO540 Lecithin-cholesterol acyltransferase ("LCAT"), also known as phosphatidylcholine-sterol acyltransferase is a key enzyme in the intravascular metabolism of high density lipoproteins, specifically in the process of cholesterol 15 metabolism. [see, for example, Brousseau et al., J. Lipid Res., 38(12):2537-2547 (1997), Hill et al., Biochem. J., 294:879-884 (1993), and Drayna et al., Nature 327 (6123):632-634 (1987)]. Given the medical importance of lipid metabolism, efforts are currently being under taken to identify new, native proteins which are involved in lipid transport. We describe herein the identification of a novel polypeptide which has homology to LCAT, designated herein as PRO540. 20 25. PR0615 Synaptogyrin is a synaptic vesicle protein that is uniformly distributed in the nervous system. The cDNA encoding synaptogyrin has been cloned and sequenced and the sequence predicts a protein with a molecular mass of 25,900 D with four membrane-spanning domains. Synaptogyrin has been implicated in membrane traffic to and from 25 the plasma membrane. Stenius et al., J. Cell. Biol. 131(6-2):1801-1809 (1995). In addition, a novel isoform of synaptogyrin called cellugyrin exhibits sequence identity with synaptogyrin. In rat tissues, cellugyrin and synaptogyrins are expressed in mirror image patterns. Cellugyrin is ubiquitously present in all tissues tested with the lowest levels in brain tissue, whereas synaptogyrin protein is only detectable in brain. In rat tissues, cellugyrin and synaptogyrins are expressed in mirror image patterns. The synaptic vesicle protein synaptogyrin may be a specialized 30 version of a ubiquitous protein, cellugyrin, with the two proteins sharing structural similarity but differing in localization. This finding supports the emerging concept of synaptic vesicles as the simplified and specialized form of a generic trafficking organelle. [Janz et al., J. Biol. Chem. 273(5):2851-2857 (1998)] . The sequence for cellugyrin derived from the Norway rat, Rattus norvegicus has been deposited in the Genbank database on 23 December 1997, designated accession number AF039085. See also, Janz et al., J. Biol. Chem. 273 (1998), in press. 35 Given the medical importance of synaptic transmission, efforts are currently being under taken to identify new, native proteins that may be part of a simplified and specialized generic trafficking organelle in the form of synaptic vesicles. We describe herein the identification of a novel polypeptide which has homology to synaptogyrin, designated herein as PRO615. 13 WO 99/46281 PCTIUS99/05028 26. PR0618 Enteropeptidase is a key enzyme in the intestinal digestion cascade specifically cleaves the acidic propeptide from trypsinogen to yield active trypsin. This cleavage initiates a cascade of proteolytic reactions leading to the activation of many pancreatic zymogens. See, for example, Matsushima et al., J. Biol. Chem. 269(31):19976-19982 (1994), Kitamoto et al., Proc. Nat. Acad. 5 S, 91(16):7588-7592 (1994). Enterokinase (enteropeptidase) is a related to mammalian serine proteases involved in digestion, coagulation, and fibrinolysis. LaVallie et al., J Biol Chem., 268(31):23311-23317 (1993). Given the medical importance of digestive processes, efforts are currently being under taken to identify new, native proteins that may be involved in digestion, coagulation, and fibrinolysis. We describe herein the identification of a novel polypeptide which has homology to enteropeptidase, designated herein as PRO618. 10 27. PR0719 Lipoprotein lipase is a key enzyme that mediates the hydrolysis of triglycerides and phospholipids present in circulating plasma lipoproteins (Dugi et al., J. Biol. Chem.. 270:25396-25401 (1995)). Moreover, lipoprotein lipase has been shown to mediate the uptake of lipoproteins into cells, wherein cellular uptake of lipoproteins is 15 initiated by binding of lipoprotein lipase to cell surface proteoglycans and to the low density lipoprotein (LDL) receptor-related protein (Krapp et al., J. Lipid Res. 36:2362-2373 (1995)). Thus, it is clear that lipoprotein lipase plays an extremely important role in lipoprotein and cholesterol metabolism. There is, therefore, substantial interest in identifying novel polypeptides that share sequence homology and/or biological activity with lipoprotein lipase. We herein describe the identification and characterization of a novel polypeptide having sequence homology to lipoprotein 20 lipase H, designated heein as PR0719. 28. PR0724 The low density lipoprotein (LDL) receptor is a membrane-bound protein that plays a key role in cholesterol homeostasis, mediating cellular uptake of lipoprotein particles by high affinity binding to its ligands, apolipoprotein 25 (apo) B-100 and apoE. The ligand-binding domain of the LDL receptor contains 7 cysteine-rich repeats of approximately 40 amino acids, wherein each repeat contains 6 cysteines, which form 3 intra-repeat disulfide bonds. These unique structural features provide the LDL receptor with its ability to specifically interact with apo B-100 and apoE, thereby allowing for transport of these lipoprotein particles across cellular membranes and metabolism of their components. Soluble fragments containing the extracellular domain of the LDL receptor have been shown to retain 30 the ability to interact with its specific lipoprotein ligands (Simmons et al., J. Biol, Chem. 272:25531-25536 (1997)). Thus, it is clear that the LDL receptor is intimately involved in important physiological activities related to cholesterol metabolism. As such, there is substantial interest in identifying novel LDL receptor homolog proteins. We herein describe the identification and characterization of a novel polypeptide having homology to the human LDL receptor protein, designated herein as PR0724.. 35 29. PR0772 Expression of the human gene A4 is enriched in the colonic epithelium and is transcriptionally activated on differentiation of colonic epithelial cells in vitro (Oliva et al., Arch. Biochem. Biophys. 302:183-192 (1993) and Oliva et al., Am. J. Physiol. 272:C957-C965 (1997)). A4 cDNA contains an open reading frame that predicts a polypeptide 14 WO 99/46281 PCTIUS99/05028 of approximately 17 kilodaltons in size. Hydropathy analysis of the A4 protein revealed four putative membrane spanning alpha-helices. Immunocytochemical studies of cells expressing A4 protein indicated that expression is localized to the endoplasmic reticulum. The four membrane-spanning domains and the biophysical characteristics of the A4 protein suggest that it belongs to a family of integral membrane proteins called proteolipids, some of which multimerize to form ion channels. In fact, preliminary evidence has suggested that A4 may itself multimerize and 5 take on the properties of an ion channel (Oliva et al., Am. J. Physiol. 272:C957-C965 (1997)). Given the importance of ion channels in maintaining cellular homeostasis, there is a significant interest in identifying novel polypeptides having homology to known and putative ion channels. We herein describe the identification and characterization of a novel polypeptide having homology to the putative ion channel protein, A4, designated herein as PR0772. 10 30. PRO852 Proteases are enzymatic proteins which are involved in a large number of very important biological processes in mammalian and non-mammalian organisms. Numerous different protease enzymes from a variety of different mammalian and non-mammalian organisms have been both identified and characterized. The mammalian protease enzymes play important roles in many different biological processes including, for example, protein 15 digestion, activation, inactivation, or modulation of peptide hormone activity, and alteration of the physical properties of proteins and enzymes. In light of the important physiological roles played by protease enzymes, efforts are currently being undertaken by both industry and academia to identify new, native protease homologs. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel 20 secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., _93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. We herein describe the identification of novel polypeptides having homology to various protease enzymes, designated herein as PRO852 polypeptides. 25 31. PR0853 Studies have reported that the redox state of the cell is an important determinant of the fate of the cell. Furthermore, reactive oxygen species have been reported to be cytotoxic, causing inflammatory disease, including tissue necrosis, organ failure, atherosclerosis, infertility, birth defects, premature aging, mutations and malignancy. Thus, the control of oxidation and reduction is important for a number of reasons, including the control and 30 prevention of strokes, heart attacks, oxidative stress, hypertension and may be associated with the development of malignancies. The levels of antioxidant enzymes, such as reductases, which catalyze the conversion of reactive oxygen species to water have been shown to be low in cancer cells. In particular, malignant prostate epithelium may have lowered expression of such antioxidant enzymes [Baker et ., Prostate 32(4):229-233 (1997)]. In this regard, reductases, are of interest. In addition, the transcription factors, NF-kappa B and AP-1, are known to be regulated 35 by redox state and to affect the expression of a large variety of genes thought to be involved in the pathogenesis of AIDS, cancer, atherosclerosis and diabetic complications. Publications further describing this subject matter include Engman et al., Anticancer Res. (Greece), 17:4599-4605 (1997), Kelsey, et al., Br. J. Cancer, 76(7):852-4 (1997); Friedrich and Weiss. J. Tleor. Biol., 187(4):529-40 (1997) and Pieulle, et al., J. Bacteriol., 179(18):5684-92 (1997). Given the physiological importance of redox reactions in vivo, efforts are currently being under taken to identify new, 15 WO 99/46281 PCT/US99/05028 native proteins which are involved in redox reactions. We describe herein the identification of a novel prostate specific polypeptide which has sequence similarity to reductase, designated herein as PR0853. 32. PR0860 Neurofascin is a member of the Li subgroup of the cellular adhesion molecule ("CAM") family of nervous 5 system adhesion molecules and is involved in cellular aggregation. Cell-cell recognition and patterning of cell contacts have a critical role in mediating reversible assembly of a wide variety or transcellular complexes in the nervous system. Cell interactions may be regulated through modulation of ankyrin binding to neurofascin. See, for example, Tuvia et al., Proc. Nat Acad. Sci., 94(24) 12957-12962 (1997). Neurofascin has been described as a member of the Li subgroup of the immunoglobulin superfamily implicated in neurite extension during embryonic 10 development for which numerous isoforms have been detected at various stages of development. See also Hassel et al., J. Biol. Chem., 272(45) 28742-28749 (1997), Grumet., Cell. Tissue Res. 290(2) 423-428 (1997), Garver et al., J. Cell. Biol., 137:703-714 (1997), and Lambert et al., J. Neurosci., 17:7025-7-36 (1997),. Given the physiological importance of cellular adhesion molecules and development of the nervous system in vivo, efforts are currently being under taken to identify new, native proteins which are involved in regulation of 15 cellular interactions in the nervous system. We describe herein the identification and characterization of a novel polypeptide which has sequence similarity to neurofascin, designated herein as PR0860. 33. PR0846 The CMRF35 monoclonal antibody was used to identify a cell membrane antigen, designated CMRF35, 20 which is present on the surface of monocytes, neutrophils, a proportion of peripheral blood T and B lymphocytes and lymphocytic cell lines. The CMRF35 cDNA encodes a novel integral membrane glycoprotein member of the inimunoglobulin (Ig) gene superfamily. The molecule comprises (a) a single extracellular Ig variable domain remarkably similar to the Fc receptor for polymeric IgA and IgM, (b) a membrane-proximal domain containing a high proportion of proline, serine and threonine residues that was predicted to be heavily O-glycosylated, (c) an unusual 25 transmembrane anchor that contained a glutamic acid and a proline residue and (d) a short cytoplasmic tail. Transcripts encoding the CMRF35 protein have been detected in early monocytic cell lines, in peripheral blood T cells and in some B lymphoblastoid cell lines, confirming the results of immunocytological staining. Jackson et al., Eur. J. Immunol, 22(5):1157-1163 (1992). CMRF-35 molecules are differentially expressed in hematopoietic cells, and the expression of the antigen was shown to be markedly influenced by stimulation with mitogens and cytokines. 30 See, for example, Clark et al., Exp. Hematol. 25(8):759 (1997), Daish et al., Immunol. 79(1):55-63 (1993), and Clark et al., Tissue Antigens 48:461 (1996). Given the physiological importance of the immune system and antigens associated with various immune system cells, efforts are currently being under taken to identify new, native proteins which are expressed on various cells of the immune system. We describe herein the identification of a novel polypeptide which has sequence 35 similarity to CMRF35, designated herein as PR0846. 34. PR0862 Lysozyme is a protein which is widely distributed in several human tissues and secretions including milk, tears and saliva. It has been demonstrated to hydrolyze linkages between N-acetylglucosamines. It has been 16 WO 99/46281 PCT/US99/05028 demonstrated to be an inhibitor of chemotaxis and of the production of toxic oxygen free radicals and may also have some role in the calcification process. As such, there is substantial interest in identifying novel polypeptides having homology to lysozyme. We describe herein the identification of a novel polypeptide which has sequence similarity to lysozyme. 5 35. PR0864 Wnt-4 is a secreted glycoprotein which correlates with, and is required for, kidney tubulogenesis. Mice lacking Wnt-4 activity fail to form pretubular cell aggregates; however, other aspects of mesenchymal and ureteric development are unaffected. Thus, Wnt-4 appears to act as an autoinducer of the mesenchyme to epithelial transition that underlies nephron development. Stark et al., Nature ;372(6507):679-683 (1994). In addition, members of the 10 Wnt gene family code for cysteine-rich, secreted proteins, which are differentially expressed in the developing brain and possibly act as intercellular signaling molecules. A Wnt gene, e.g., Wnt-1 is known to be essential for specification of the midbrain cell fate. Yoshioka et al., Biochem. Bionhys. Res. Commun. 203(3):1581-1588 (1994). Several member of the Wnt family of secreted factors are strongly implicated as regulators of mammary cellular growth and differentiation. Shimizu et al., Cell Growth Differ. 8(12) 1349-1358. Wnt-4 is normally expressed in 15 early pregnancy. Wnt-4 may therefore be a local signal driving epithelial branching in pregnancy. Edwards PA, Biochem Soc Symp.63:21-34 (1998). See also, Lipschutz JH, Am. J. Kidney Dis. 31(3):383-397, (1998). We describe herein the identification and characterizaton of a novel polypeptide which has sequence similarity to Wnt-4, designated herein as PR0864. 20 36. PRO792 At least two cell-derived signals have been shown to be necessary for the induction of immunoglobulin isotype switching in B-cells. The first signal is given by either of the soluble lymphokines, interleukin (IL)-4 or IL 13, which induce germline epsilon transcript expression, but this alone is insufficient to trigger secretion of immunoglobulin E (IgE). The second signal is provided by a physical interaction between B-cells and activated T 25 cells, basophils and mast cells, and it has been shown that the CD40/CD40 ligand pairing is crucial for mediating IgE synthesis. Additionally, amongst the numerous pairs of surface adhesion molecules that are involved in IgE synthesis, the CD23/CD21 pair appears to play a key role in the generation of IgE. CD23 is a protein that is positively and negatively regulated by factors which increase or decrease IgE production, respectively. Antibodies to CD23 have been shown to inhibit IL-4-induced human IgE production in vitro and to inhibit antigen-specific IgE 30 responses in a rat model, in an isotype selective manner (Bonnefoy et al., Eur. Respir. J. Suppl. 22:63S-66S (1996)). CD23 interacts with CD21 on B-cells, preferentially driving IgE production. Given that the CD23 protein plays an extremely important role in the induction of a mammalian IgE response, there is significant interest in identifying novel polypeptides having homology to CD23. We herein describe the identification and characterization of a novel polypeptide having homology to CD23, designated herein as PRO792. 35 37. PR0866 Mindin and spondin proteins are secreted proteins that are structurally related to one another and which have been identified in a variety of organisms. For example, Higashijima et al., Dev Biol. 192:211-227 (1997) have reported the identification of spondin and mindin expression in floor plate cells in the zebrafish embryonic axis, 17 WO 99/46281 PCT/US99/05028 thereby suggesting that mindin and spondin prtoteins play important roles in embryonic development. This same group has reported that mindin and spondin proteins function as extracellular matrix proteins that have a high affinity for the basal lamina. (Id.). It has been reported that F-spondin is a secreted protein that promotes neural adhesion and neurite extension (Klar et al., Cell 69:95-110 (1992) and that M-spondin is an extracellular matrix protein that localizes to muscle attachment sites in Drosophila (Umemiya et al., Dev. Biol. 186:165-176 (1997)). Thus, there 5 is significant inteest in identifying novel polypeptides having homology to the mindin and spondin proteins. We herein describe the identification and characterization of a novel polypeptide having homology to mindin2 and mindin1, designated herein as PR0866. 38. PRO871 10 Cyclophilins are a family of proteins that bind to cyclosporin A and possess peptidyl-prolyl cis-trans isomerase activity (Sherry et al., Proc. Natl. Acad. Sci. USA 95:1758-1763 (1998)). In addition, cyclophilins are secreted by activated cells and act in a cytokine-like manner, presumably via signaling through a cell surface cyclophilin receptor. Host cell-derived cyclophilin A has been shown to be incorporated into HIV-1 virions and its incorporation has been shown to be essential for viral infectivity. Thus, one or more the cyclophilins may be directly 15 associated with HIV-1 infectivity. Given the obvious importance of the cyclophilin proteins, there is substantial interest in identifying novel polypeptides which have sequence homology to one or more of the cyclophilin proteins. We herein describe the identification and characterization of a novel polypeptide having homology to cyclophilin-like protein CyP-60, designated herein as PR0871. 20 39. PR0873 Enzymatic proteins play important roles in the chemical reactions involved in the digestion of foods, the biosynthesis of macromolecules, the controlled release and utilization of chemical energy, and other processes necessary to sustain life. Enzymes have also been shown to play important roles in combating various diseases and disorders. For example, liver carboxylesterases have been reported to assist in sensitizing human tumor cells to the 25 cancer prodrugs. Danks et al., report that stable expression of the cDNA encoding a carboxylesterase in Rh30 human rhabdomyosarcoma cells increased the sensitivity of the cells to the CPT-1 1 cancer prodrug 8.1-fold. Cancer Res. (1998) 58(1):20-22. The authors propose that this prodrug/enzyme combination could be exploited therapeutically in a manner analogous to approaches currently under investigation with the combinations of ganciclovir/herpes simplex virus thymidine kinase and 5-fluorocytosine/cytosine deaminase. van Pelt et al. demonstrated that a 55 kD 30 human liver carboxylesterase inhibits the invasion of Plasmodium falciparum malaria sporozoites into primary human hepatocytes in culture. J Hepatol (1997) 27(4):688-698. Carboxylesterases have also been found to be of importance in the detoxification of drugs, pesticides and other xenobiotics. Purified human liver carboxylesterases have been shown to be involved in the metabolism of various drugs including cocaine and heroin. Prindel et al. describe the purification and cloning of a broad substrate 35 specificity human liver carboxylesterase which catalyzes the hydrolysis of cocaine and heroin and which may play an important role in the degradation of these drugs in human tissues. J. Biol. Chem. (1997) 6:272(23):14769-14775. Brzenzinski et al. describe a spectrophotometric competitive inhibition assay used to identify drug or environmental esters that are metabolized by carboxylesterases. Drug Metab Dispos (1997) 25(9):1089-1096. 18 WO 99/46281 PCT/US99/05028 In light of the important physiological roles played by carboxylesterases, efforts are being undertaken by both industry and academia to identify new, native carboxylesterase homologs. We herein describe the identification and characterization of a novel polypeptide having homology to carboxylesterase, designated herein as PR0873. 40. PR0940 5 CD33 is a cell-surface protein that is a member of the sialoadhesin family of proteins that are capable of mediating sialic-acid dependent binding with distinct specificities for both the type of sialic acid and its linkage to subterminal sugars. CD33 is specifically expressed in early myeloid and some monocyte cell lineages and has been shown to be strongly associated with various myeloid tumors including, for example, acute non-lymphocytic leukemia (ANLL). As such, CD33 has been suggested as a potential target for the treatment of cancers associated with high 10 level expression of the protein. There is, therefore, significant interest in the identification of novel polypeptides having homology to CD33. In fact, one CD33 homolog (designated CD33L) has already been identified and described (see Takei et al., Cytogenet. Cell Genet. 78:295-300 (1997)). We herein describe the identification of another novel polypeptide having homology to CD33, designated herein as PR0940. The novel polypeptide described herein also exhibits significant homology to the human OB binding proteins designated HSU71382_1 and 15 HSU71383_1 in the Dayhoff database (version 35.45 SwissProt 35). 41. PR0941 Cadherins are a large family of transmembrane proteins. Cadherins comprise a family of calcium-dependent glycoproteins that function in mediating cell-cell adhesion in virtually all solid tissues of multicellular organisms. 20 At least cadherins 1-13 as well as types B, E, EP, M, N, P and R have been identified and characterized. Among the functions cadherins are known for, with some exceptions, are that cadherins participate in cell aggregation and are associated with cell-cell adhesion sites. Recently, it has been reported that while all cadherins share multiple repeats of a cadherin specific motif believed to correspond to folding of extracellular domains, members of the cadherin superfamily have divergent structures and, possibly, functions. In particular it has been reported that 25 members of the cadherin superfamily are involved in signal transduction. See, Suzuki, J. Cell Biochem., 61(4):531 542 (1996). Cadherins are further described in Tanihara et al., J. Cell Sci., 107(6):1697-1704 (1994), Aberle et al., J. Cell Biochem., 61(4):514-523 (1996) and Tanihara et al., Cell Adhes. Commun., 2(1):15-26 (1994). We herein describe the identification and characterization of a novel polypeptide having homology to a cadherin protein, designated herein as PRO941. 30 42. PR0944 Clostridium perfringens enterotoxin (CPE) is considered to be the virulence factor responsible for causing the symptoms of C. perfringens type A food poisoning and may also be involved in other human and veterinary illnesses (McClane, Toxicon. 34:1335-1343 (1996)). CPE carries out its adverse cellular functions by binding to an 35 approximately 50 kD cell surface receptor protein designated the Clostridium perfringens enterotoxin receptor (CPE R) to form an approximately 90,000 kD complex on the surface of the cell. cDNAs encoding the CPE-R protein have been identified characterized in both human and mouse (Katahira et al., J. Cell Biol. 136:1239-1247 (1997) and Katahira et al., J. Biol. Chem. 272:26652-26658 (1997)). Since the CPE toxin has been reported to cause a variety of illnesses in mammalian hosts and those illnesses are initiated by binding of the CPE toxin to the CPE-R, there is 19 WO 99/46281 PCT/US99/05028 significant interest in identifying novel CPE-R homologs. We herein describe the identification and characterization of a novel polypeptide having homology to the CPE-R, designated herein as PR0944. 43. PR0983 Membrane-bound proteins include not only cell-surface membrane-bound proteins, but also proteins that are 5 found on the surface of intracellular vesicles. These vesicles are involved in exocytosis, which is the fusion of secretory vesicles with the cellular plasma membrane, and have two main functions. One is the discharge of the vesicle contents into the extracellular space, and the second is the incorporation of new proteins and lipids into the plasma membrane itself. Exocytosis can be either constitutive or regulated. All eukaryotic cells exhibit constitutive exocytosis, which is marked by the immediate fusion of the secretory vesicle after formation. In contrast, regulated 10 exocytosis results in the accumulation of the secretory vesicles that fuse with the plasma membrane upon receipt of an appropriate signal by vesicle-associated membrane proteins. Usually, this signal is an increase in the cytosolic free Ca" concentration. However, regulated exocytosis that is independent of CP' has been reported (see, e.g. Fujita-Yoshigaki et al. J. Biol. Chem. (1996) 31:271(22):13130-13134). Regulated exocytosis is crucial to many specialized cells, including neurons (neurotransmitter release from synaptic vesicles), adrenal chromaffin cells 15 (adrenaline secretion), pancreatic acinar cells (digestive enzyme secretion), pancreatic P-cells (insulin secretion), mast cells (histamine secretion), mammary cells (milk protein secretion), sperm (enzyme secretion), egg cells (creation of fertilization envelope) and adipocytes (insertion of glucose transporters into the plasma membrane). Disorders involving exocytosis are known. For example, inflammatory mediator release from mast cells leads to a variety of disorders, including asthma. Similarly, Chediak-Higashi Syndrome (CHS) is a rare autosomal 20 recessive disease in which neutrophils, monocytes and lymphocytes contain giant cytoplasmic granules. Accordingly, the proteins involved in exocytosis are of paramount interest and efforts are being undertaken by both industry and academia to identify new, vesicle-associated proteins. For example, Skehel et al. identified a 33-kilodalton membrane protein in Aplysia, termed VAP-33, which is required for the exocytosis of neurotransmitter. Science (1995) 15:269(5230):1580-1583, and Neuropharmagology (1995) 34(11):1379-1385. Many efforts are focused on the 25 screening of mammalian recombinant DNA libraries to identify the coding sequences for novel vesicle- associated membrane proteins. It is an object of the invention to provide proteins having homology to the vesicle associated protein, VAP-33, designated herein as PR0983. 44. PRO1057 30 Proteases are enzymatic proteins which are involved in a large number of very important biological processes in mammalian and non-mammalian organisms. Numerous different protease enzymes from a variety of different mammalian and non-mammalian organisms have been both identified and characterized. The mammalian protease enzymes play important roles in many different biological processes including, for example, protein digestion, activation, inactivation, or modulation of peptide hormone activity, and alteration of the physical properties 35 of proteins and enzymes. In light of the important physiological roles played by protease enzymes, efforts are currently being undertaken by both industry and academia to identify new, native protease homologs. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [see, for example, 20 WO 99/46281 PCT/US99/05028 Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. We herein describe the identification of novel polypeptides having homology to various protease enzymes, designated herein as PRO1057 polypeptides. 45. PRO1071 5 Thrombospondin-1 is a trimeric high molecular weight glycoprotein that is released from platelet alpha granules in response to thrombin stimulation and that is also a transient component of the extracellular matrix in developing and repairing tissues (Adams, Int. J. Biochem. Cell Biol. 29:861-865 (1997) and Qian et al., Proc. Soc. Exp. Biol. Med. 212:199-207 (1996)). A variety of factors regulate thrombospondin expression and the protein is degraded by both extracellular and intracellular routes. Thrombospondin-1 functions as a cell adhesion molecule and 10 also modulates cell movement, cell proliferation, neurite outgrowth and angiogenesis. As such, there is substantial interest in identifying novel polypeptides having homology to thrombospondin. We herein describe the identification and characterization of a novel polypeptide having homology to thrombospondin, designated herein as PRO1071. 46. PRO1072 15 Studies have reported that the redox state of the cell is an important determinant of the fate of the cell. Furthermore, reactive oxygen species have been reported to be cytotoxic, causing inflammatory disease, including tissue necrosis, organ failure, atherosclerosis, infertility, birth defects, premature aging, mutations and malignancy. Thus, the control of oxidation and reduction is important for a number of reasons, including the control and prevention of strokes, heart attacks, oxidative stress, hypertension and may be associated with the development of 20 malignancies. The levels of antioxidant enzymes, such as reductases, which catalyze the conversion of reactive oxygen species to water have been shown to be low in cancer cells. In particular, malignant prostate epithelium may have lowered expression of such antioxidant enzymes [Baker et al., Prostate 32(4):229-233 (1997)]. In this regard, reductases, are of interest. In addition, the transcription factors, NF-kappa B and AP-1, are known to be regulated by redox state and to affect the expression of a large variety of genes thought to be involved in the pathogenesis of 25 AIDS, cancer, atherosclerosis and diabetic complications. Publications further describing this subject matter include Engman et al., Anticancer Res. (Greece), 17:4599-4605 (1997), Kelsey, et al., Br. J. Cancer, 76(7):852-854 (1997); Friedrich and Weiss, J. Theor. Biol., 187(4):529-40 (1997) and Pieulle, et al., J. Bacteriol., 179(18):5684-92 (1997). Given the physiological importance of redox reactions in vivo, efforts are currently being under taken to identify new, native proteins which are involved in redox reactions. We describe herein the identification of a novel polypeptide 30 which has sequence similarity to reductase enzymes, desiignated herein as PRO1072. 47. PRO1075 Protein disulfide isomerase is an enzymatic protein which is involved in the promotion of correct refolding of proteins through the establishment of correct disulfide bond formation. Protein disulfide isomerase was initially 35 identified based upon its ability to catalyze the renaturation of reduced denatured RNAse (Goldberger et al., J. Biol. Chem. 239:1406-1410 (1964) and Epstein et al., Cold Sprring Harbor Symp. Quant. Biol. 28:439-449 (1963)). Protein disulfide isomerase has been shown to be a resident enzyme of the endoplasmic reticulum which is retained in the endoplasmic reticulum via a -KDEL or -HDEL amino acid sequence at its C-terminus. Given the importance of disulfide bond-forming enzymes and their potential uses in a number of different 21 WO 99/46281 PCT/US99/05028 applications, for example in increasing the yield of correct refolding of recombinantly produced proteins, efforts are currently being undertaken by both industry and academia to identify new, native proteins having homology to protein disulfide isomerase. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel protein disulfide isomerase homologs. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); 5 U.S. Patent No. 5,536,637)]. We herein describe a novel polypeptide having homology to protein disulfide isomerase, designated herein as PRO1075. 48. PRO181 In Drosophila, the dorsal-ventral polarity of the egg chamber depends on the localization of the oocyte 10 nucleus and the gurken RNA to the dorsal-anterior corner of the oocyte. Gurken protein presumably acts as a ligand for the drosophila EGF receptor (torpedo/DER) expressed in the somatic follicle cells surrounding the oocyte. Cornichon is a gene required in the germline for dorsal-ventral signaling (Roth et al., Cell 81:967-978 (1995)). Cornichon, gurken and torpedo also function in an earlier signaling event that establishes posterior follicle cell fates and specifies the anterior-posterior polarity of the egg chamber. Mutations in any or all of these genes prevent the 15 formation of a correctly polarized microtubule cytoskeleton required for proper localization of the anterior and posterior determinants bicoid and oskar and for the asymmetric positioning of the oocyte nucleus. Thus, it is clear that the cornichon gene product plays an important role in early development. We herein describe the identification and characterization of a novel polypeptide having homology to the comichon protein, designated herein as PRO181. 20 49. PRO195 Efforts arre currently being undertaken to identify and characterize novel transmembrane proteins. We herein describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO195. 25 50. PRO865 Efforts arre currently being undertaken to identify and characterize novel secreted proteins. We herein describe the identification and characterization of a novel secreted polypeptide, designated herein as PR0865. 51. PRO827 30 VLA-2 is an cell-surface integrin protein that has been identified and characterized in a number of mammalian organisms, including both mouse and human. VLA-2 has been shown to be a receptor on the surface of cells for echovirus-1 (EV-1) which mediates infection of VLA-2-expressing cells by EV-1 (Zhang et al., Virology 235(2):293-301 (1997) and Bergelson et al., Science 255:1718-1720 (1992)). VLA-2 has also been shown to mediate the interaction of collagen with endothelium during in vitro vascular tube formation (Jackson et al., Cell Biol. Int. 35 18(9):859-867 (1994)). Various other integrin proteins that share various degrees of amino acid sequence homology with VLA-2 have been identified and characterized in a variety of mammalian organism. These integrins have been reported to play important roles in a variety of different physiological functions. Therefore, there is significant interest in identifying novel polypeptides having homology to one or more of the integrin proteins. We herein describe the identification and characterization of a novel polypeptide having homology to VLA-2 integrin protein, 22 WO 99/46281 PCT/US99/05028 designated herein as PR0827. 52. PRO1114 Many important cytokine proteins have been identified and characterized and shown to signal through specific cell surface receptor complexes. For example, the class II cytokine receptor family (CRF2) includes the 5 interferon receptors, the interleukin-10 receptor and the tissue factor CRFB4 (Spencer et al., J. Exp. Med. 187:571 578 (1998) and Kotenko et al., EMBO J. 16:5894-5903 (1997)). Thus, the multitude of biological activities exhibited by the various cytokine proteins is absolutely dependent upon the presence of cytokine receptor proteins on the surface of target cells. There is, therefore, a significant interest in identifying and characterizing novel polypeptides having homology to one or more of the cytokine receptor family. We herein describe the identification and 10 characterization of a novel polypeptide having homology to cytokine receptor family-4 proteins, designated herein as PRO1117. Interferons (IFNs) encompass a large family of secreted proteins occurring in vertebrates. Although they were originally named for their antiviral activity, growing evidence supports a critical role for IFNs in cell growth and differentiation (Jaramillo et al., Cancer Investigation 13(3):327-338 (1995)). IFNs belong to a class of negative 15 growth factors having the ability to inhibit the growth of a wide variety of cells with both normal and transformed phenotypes. IFN therapy has been shown to be beneficial in the treatment of human malignancies such as Karposi's sarcoma, chronic myelogenous leukemia, non-Hodgkin's lymphoma, and hairy cell leukemia as well as in the treatment of infectious diseases such as hepatitis B (Gamliel et al., Scanning Microscopy 2(1):485-492 (1988), Einhorn et al., Med. Oncol. & Tumor Pharmacother. 10:25-29 (1993), Ringenberg et al., Missouri Medicine 20 85(1):21-26 (1988), Saracco et al., Journal of Gastroenterology and Hepatology 10:668-673 (1995), Gonzalez-Mateos et al., Hepato-Gastroenterology 42:893-899 (1995) and Malaguarnera et al., Pharmacotherapy 17(5):998-1005 (1997)). Interferons can be classified into two major groups based upon their primary sequence. Type I interferons, IFN-a and IFN-P, are encoded by a superfamily of intronless genes consisting of the IFN-a gene family and a single 25 IFN-p gene that are thought to have arisen from a common ancestral gene. Type I interferons may be produced by most cell types. Type II IFN, or IFN-y, is restricted to lymphocytes (T cells and natural killer cells) and is stimulated by nonspecific T cell activators or specific antigens in vivo. Although both type I and type II IFNs produce similar antiviral and antiproliferative effects, they act on distinct cell surface receptors, wherein the binding is generally species specific (Langer et al., Immunol. Today 9:393 30 400 (1988)). Both IFN-a and IFN-P bind competitively to the same high affinity type I receptor, whereas IFN-y binds to a distinct type II receptor. The presence and number of IFN receptors on the surface of a cell does not generally reflect the sensitivity of the cell to IFN, although it is clear that the effects of the IFN protein is mediated through binding to a cell surface interferon receptor. As such, the identification and characterization of novel interferon receptor proteins is of extreme interest. 35 We herein describe the identification and characterization of novel interferon receptor polypeptides, designated herein as "PRO1 114 interferon receptor" polypeptides. Thus, the PROl 114 polypeptides of the present invention represents a novel cell surface interferon receptor. 23 WO 99/46281 PCTIUS99/05028 53. PRO237 Carbonic anhydrase is an enzymatic protein that which aids carbon dioxide transport and release in the mammalian blood system by catalyzing the synthesis (and the dehydration) of carbonic acid from (and to) carbon dioxide and water. Thus, the actions of carbonic anhydrase are essential for a variety of important physiological reactions in the mammal. As such, there is significant interest in the identification and characterization of novel 5 polypeptides having homology to carbonic anhydrase. We herein describe the identification and characterization of a novel polypeptide having homology to carbonic anhydrase, designated herein as PRO237. 54. PR0541 Numerous trypsin inhibitory proteins have been identified and characterized (see, e.g., Yamakawa et al., 10 Biochim. Biophys. Acta 1395:202-208 (1998) and Mizuki et al., Mammalian Genome 3:274-280 (1992)). Trypsin inhibitor proteins play important roles in a variety of different physiological and biological pathways and are specifically involved in such processes as the regulation of protein degradation, digestion. and the like. Given the important roles played by such enzymatic proteins, there is significant interest in identifying and characterizing novel polypeptides having homology to known trypsin inhibitor proteins. We herein describe the identification and 15 characterization of a novel polypeptide having homology to a trypsin inhibitor protein, designated herein as PR0541. 55. PR0273 Leukocytes include monocytes, macrophages, basophils, and eosinophils and play an important role in the immune response. These cells are important in the mechanisms initiated by T and/or B lymphocytes and secrete a 20 range of cytokines which recruit and activate other inflammatory cells and contribute to tissue destruction. Thus, investigation of the regulatory processes by which leukocytes move to their appropriate destination and interact with other cells is critical. Currently, leukocytes are thought to move from the blood to injured or inflamed tissues by rolling along the endothelial cells of the blood vessel wall. This movement is mediated by transient interactions between selectins and their ligands. Next, the leukocyte must move through the vessel wall and 25 into the tissues. This diapedesis and extravasation step involves cell activation which promotes a more stable leukocyte-endothelial cell interaction, again mediated by integrins and their ligands. Chemokines are a large family of structurally related polypeptide cytokines. These molecules stimulate leukocyte movement and may explain leukocyte trafficking in different inflammatory situations. Chemokines mediate the expression of particular adhesion molecules on endothelial cells, and they produce chemoattractants which activate 30 specific cell types. In addition, the chemokines stimulate proliferation and regulate activation of specific cell types. In both of these activities, chemokines demonstrate a high degree of target cell specificity. The chemokine family is divided into two subfamilies based on whether two amino terminal cysteine residues are immediately adjacent (C-C) or separated by one amino acid (C-X-C). Chemokines of the C-X-C family generally activate neutrophils and fibroblasts while the C-C chemokines act on a more diverse group of target cells including 35 monocytes/macrophages, basophils, eosinophils and T lymphocytes. The known chemokines of both subfamilies are synthesized by many diverse cell types as reviewed in Thomson A. (1994) The Cytokine Handbook, 2 d Ed. Academic Press, N.Y. Chemokines are also reviewed in Schall TJ (1994) Chemotactic Cytokines: Targets for Therapeutic Development. International Business Communications, Southborough Mass. pp 180-270; and in Paul WE (1993) Fundamental Immunology, 3rd Ed. Raven Press, N.Y. pp 822-826. 24 WO 99/46281 PCTIUS99/05028 Known chemokines of the C-X-C subfamily include macrophage inflammatory proteins alpha and beta (MIP-1 and MIP-2 ), interleukin-8 (IL-8), and growth regulated protein (GRO-alpha and beta). MIP-2 was first identified as a 6 kDa heparin binding protein secreted by the mouse macrophage cell line RAW 264.7 upon stimulation with lipopolysaccharide (LPS). MIP-2 is a member of the C-X-C (or CXC) subfamily of chemokines. Mouse MIP-2 is chemotactic for human neutrophils and induces local neutrophil infiltration when 5 injected into the foot pads of mice. Rat MIP-2 shows 86% amino acid homology to the mouse MIP-2 and is chemotactic for rat neutrophils but does not stimulate migration of rat alveolar macrophages or human peripheral blood eosinophils or lymphocytes. In addition, the rat MIP-2 has been shown to stimulate proliferation of rat alveolar epithelial cells but not fibroblasts. Current techniques for diagnosis of abnormalities in inflamed or diseased issues mainly rely on observation 10 of clinical symptoms or serological analyses of body tissues or fluids for hormones, polypeptides or various metabolites. Problems exist with these diagnostic techniques. First, patients may not manifest clinical symptoms at early stages of disease. Second, serological tests do not always differentiate between invasive diseases and genetic syndromes. Thus, the identification of expressed chemokines is important to the development of new diagnostic techniques, effective therapies, and to aid in the understanding of molecular pathogenesis. 15 To date, chemokines have been implicated in at least the following conditions: psoriasis, inflammatory bowel disease, renal disease, arthritis, immune-mediated alopecia, stroke, encephalitis, MS, hepatitis, and others. In addition, non-ELR-containing chemokines have been implicated in the inhibition of angiogenesis, thus indicating that these chemokines have a rule in tumor vascularization and tumorigenesis. Therefore it is the object of this invention to identify polypeptides and nucleic acids encoding the same which 20 have sequence identity and similarity with cytokine-induced neutrophil chemoattractants, MIP-1, MIP-2, and other related proteins. The efforts of this object are provided herein. 56. PRO701 Beta neurexins and neuroligins are plasma membrane proteins that are displayed on the neuronal cell surface. 25 Neuroligin 1 is enriched in synaptic plasma membranes and acts as a splice site-specific ligand for beta neurexins as described in Ichtchenko, et al., Cell, 81(3):435-443 (1995). The extracellular sequence of neuroligin 1 is composed of a catalytically inactive esterase domain homologous to acetylcholinesterase. Neuroligin 2 and 3 are similar in structure and sequence to neuroligin 1. All neuroligins contain an N-terminal hydrophobic sequence with the characteristics of a cleaved signal peptide followed by a large esterase homology domain, a highly conserved single 30 transmembrane region, and a short cytoplasmic domain. The three neuroligins are alternatively spliced at the same position and are expressed at high levels only in the brain. Tight binding of the three neuroligins to beta neurexins is observed only for beta neurexins lacking an insert in splice site 4. Thus, neuroligins constitute a multigene family of brain-specific proteins with distinct isoforms that may have overlapping functions in mediating recognition processes between neurons, see Ichtchenko, et al., J. Biol. Chem., 271(5):2676-2682 (1996). Moreover, neurexins 35 and neuroligins have been reported as functioning as adhesion molecules in a Ca 2 dependent reaction that is regulated by alternative splicing of beta neurexins, i.e., see Nguyen and Sudhof, J. Biol. Chem., 272(41):26032-26039 (1997). Given the foregoing, membrane bound proteins are of interest. More generally, membrane-bound proteins and receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is 25 WO 99/46281 PCTIUS99/05028 typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance. mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and 5 cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including as 10 pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Efforts are being undertaken by both industry and academia to identify new, native membrane-bound receptor proteins, particularly those having sequence identity and/or similarity with neuroligins 1, 2 and 3. Many 15 efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., .93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. The results of such efforts are provided herein. 20 57. PR0704 VIP36 is localized to the Golgi apparatus and the cell surface, and belongs to a family of legume lectin homologues in the animal secretory pathway that might be involved in the trafficking of glycoproteins, glycolipids, or both. It is further believed that VIP36 binds to sugar residues of glycosphingolipids and/or gycosylphosphatidyl inositol anchors and might provide a link between the extracellular/luminal face of glycolipid rafts and the cytoplasmic 25 protein segregation machinery. Further regarding VIP36, it is believed that there is a signal at its C-terminus that matches an internalization consensus sequence which confers its ability to cycle between the plasma membrane and Golgi. See, Fiedler, et al, EMBO J., 13(7):1729-1740 (1994); Fiedler and Simons, J. Cell Sci., 109(1):271-276 (1996); Itin, et al., MBO J., 14(10):2250-2256 (1995). It is believed that VIP36 is either the same as or very closely related to the human GP36b protein. VIP36 and/or GP36b are of interest. 30 More generally, vesicular, cytoplasmic, extracellular and membrane-bound proteins play important roles in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and 35 hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment, usually at a membrane-bound receptor protein. Secreted proteins have various industrial applications, including use as pharmaceuticals, diagnostics, biosensors and bioreactors. In fact, most protein drugs available at present, such as thrombolytic agents, interferons, 26 WO 99/46281 PCT/US99/05028 interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane-bound proteins, also have potential as therapeutic or diagnostic agents. Receptor imnmunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. Membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Such membrane-bound proteins and cell receptors include, but are not limited 5 to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. Transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. 10 Efforts are being undertaken by both industry and academia to identify new, native vesicular, cytoplasmic, secreted and membrane-bound receptor proteins, particularly those having sequence identity and/or similarity with VIP36. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. 15 Patent No. 5,536,637)]. 58. PRO706 Acid phophatase proteins are secreted proteins which dephophorylate terminal phosphate groups under acidic pH conditions. Acid phophatases contain a RHGXRXP amino acid sequence, which is predicted to be mechanistically 20 significant. Acid phosphatases may have important functions in the diagnosis and treatment of human diseases. For example, prostatic acid phosphatase is a secreted protein uniquely expressed in prostatic tissue and prostate cancer. The level of prostatic acid phosphatase is a potential prognostic factor for local and biochemical control in prostate cancer patients treated with radiotherapy, as described in Lankford et al., Int. J. Radiat. Oncol. Biol. Phys. 38(2): 327-333 (1997). Research suggests that a cellular immune response to prostatic acid phosphatase may mediate 25 destructive autoimmune prostatitis, and that xenogeneic forms of prostatic acid phosphatase may prove useful for immunotherapy of prostate cancer. See Fong et al., J. Immunol. 169(7): 3113-3117 (1997). Seminal prostatic acid phosphatase levels correlate significantly with very low sperm levels (oligospermia) in individuals over 35, see Singh et al., Singapore Med. J. 37(6): 598-599 (1996). Thus, prostatic acid phosphatase has been implicated in a variety of human diseases, and may have an important function in diagnosis and therapy of these diseases. A series of 30 aminobenzylphosphatic acid compounds are highly potent inhibitors of prostatic acid phosphatase, as described in Beers et al., Bioore. Med. Chem. 4(10): 1693-1701 (1996). More generally, extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or 35 the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment. 27 WO 99/46281 PCT/US99/05028 Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. Efforts are being undertaken by both industry and academia to identify new, native secreted proteins, particularly those having sequence identity 5 with prostate acid phosphatase precursor and lysosomal acid phosphatase precursor and in some cases, those having identity with DNA found in fetal heart. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. 10 59. PR0707 Cadherins are a large family of transmembrane proteins. At least cadherins 1-13 as well as types B, E, EP, M, N, P and R have been characterized. Among the functions cadherins are known for, with some exceptions, cadherins participate in cell aggregation and are associated with cell-cell adhesion sites. Cadherins are further 15 described in Tanihara, et al., J. Cell Sci., 107(6):1697-1704 (1994) and Tanihara, et al., Cell Adhes. Commun., 2(1):15-26 (1994). Moreover, it has been reported that some members of the cadherin superfamily are involved in general cell-cell interaction processes including transduction. See, Suzuki, J. Cell Biochem., 61(4):531-542 (1996). Therefore, novel members of the cadherin superfamily are of interest. More generally, all novel proteins are of interest, including membrane-bound proteins. Membrane-bound 20 proteins and receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse 25 cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast 30 growth factor receptor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. 35 Efforts are being undertaken by both industry and academia to identify new, native secreted and membrane bound receptor proteins, particularly membrane bound proteins having identity with cadherins. The results of such efforts are provided herein. 28 WO 99/46281 PCT/US99/05028 60. PRO322 Proteases are enzymatic proteins which are involved in a large number of very important biological processes in mammalian and non-mammalian organisms. Numerous different protease enzymes from a variety of different mammalian and non-mammalian organisms have been both identified and characterized, including the serine proteases which exhibit specific activity toward various serine-containing proteins. The mammalian protease enzymes 5 play important roles in biological processes such as, for example, protein digestion, activation, inactivation, or modulation of peptide hormone activity, and alteration of the physical properties of proteins and enzymes. Neuropsin is a novel serine protease whose mRNA is expressed in the central nervous system. Mouse neuropsin has been cloned, and studies have shown that it is involved in the hippocampal plasticity. Neuropsin has also been indicated as associated with extracellular matrix modifications and cell migrations. See, generally, Chen, 10 et al., Neurosci., 7(2):5088-5097 (1995) and Chen, et al., J. Histochem. Cytochem., 46:313-320 (1998). Efforts are being undertaken by both industry and academia to identify new, native membrane-bound or secreted proteins, particularly those having homology to neuropsin, serine protease, neurosin and trypsinogen. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described 15 in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. 61. PRO526 Protein-protein interactions include those involved with receptor and antigen complexes and signaling 20 mechanisms. As more is known about the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions can be more easily manipulated to regulate the particular result of the protein protein interaction. Thus, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community. All proteins containing leucine-rich repeats are thought to be involved in protein-protein interactions. 25 Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to beta-alpha structural units. These units are arranged so that they form a parallel beta-sheet with one surface exposed to solvent, so that the protein acquires an unusual, nonglobular shape. These two features have been indicated as responsible for the protein-binding functions of proteins containing leucine-rich repeats. See, Kobe and 30 Deisenhofer, Trends Biochem. Sci., 19(10):415-421 (Oct. 1994). A study has been reported on leucine-rich proteoglycans which serve as tissue organizers, orienting and ordering collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. lozzo, R. V., Crit. Rev. Biochem. Mol. Biol., 32(2):141-174 (1997). Others studies implicating leucine rich proteins in wound healing and tissue repair are De La Salle, C., et al., Vouv. Rev. 35 Fr. Hematol. (Germany), 37(4):215-222 (1995), reporting mutations in the leucine rich motif in a complex associated with the bleeding disorder Bernard-Soulier syndrome, Chlemetson, K. J., Thromb. Haemost. (Germany), 74(1): 111 116 (July 1995), reporting that platelets have leucine rich repeats and Ruoslahti, E. I., et al., W09110727-A by La Jolla Cancer Research Foundation reporting that decorin binding to transforming growth factor has involvement in a treatment for cancer, wound healing and scarring. Related by function to this group of proteins is the insulin like 29 WO 99/46281 PCT/US99/05028 growth factor (IGF), in that it is useful in wound-healing and associated therapies concerned with re-growth of tissue, such as connective tissue, skin and bone; in promoting body growth in humans and animals; and in stimulating other growth-related processes. The acid labile subunit (ALS) of IGF is also of interest in that it increases the half-life of IGF and is part of the IGF complex in vivo. ALS is further described in Leong and Baxter, Mol. Endocrinol., 6(6):870-876 (1992); Baxter, J. Biol. Chem., 264(20):11843-11848 (1989); and Khosravi, et al., J. Clin. Endocrinol. 5 Metab., 82(12):3944-3951 (1997). Another protein which has been reported to have leucine-rich repeats is the SLIT protein which has been reported to be useful in treating neuro-degenerative diseases such as Alzheimer's disease, nerve damage such as in Parkinson's disease, and for diagnosis of cancer, see, Artavanistsakonas, S. and Rothberg, J. M., W09210518-Al by Yale University. Also of interest is LIG-1, a membrane glycoprotein that is expressed specifically in glial cells 10 in the mouse brain, and has leucine rich repeats and immunoglobulin-like domains. Suzuki, et al., J. Biol. Chem. (U.S.), 271(37):22522 (1996). Other studies reporting on the biological functions of proteins having leucine rich repeats include: Tayar, N., et al., Mol. Cell Endocrinol., (Ireland), 125(1-2):65-70 (Dec. 1996) (gonadotropin receptor involvement); Miura, Y., et al., Nippon Rinsho (Japan), 54(7):1784-1789 (July 1996) (apoptosis involvement); Harris, P. C., et al., J. Am. Soc. Nephrol., 6(4):1125-1133 (Oct. 1995) (kidney disease involvement). 15 Efforts are therefore being undertaken by both industry and academia to identify new proteins having leucine rich repeats to better understand protein-protein interactions. Of particular interest are those proteins having leucine rich repeats and identity or similarity to known proteins having leucine rich repeats such as ALS. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound proteins having leucine rich repeats. Examples of screening methods and techniques 20 are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. 62. PR0531 Cadherins are a large family of transmembrane proteins. Cadherins comprise a family of calcium-dependent 25 glycoproteins that function in mediating cell-cell adhesion in virtually all solid tissues of multicellular organisms. At least cadherins 1-13 as well as types B, E, EP, M, N, P and R have been characterized. Among the functions cadherins are known for, with some exceptions, cadherins participate in cell aggregation and are associated with cell cell adhesion sites. Recently, it has been reported that while all cadherins share multiple repeats of a cadherin specific motif believed to correspond to folding of extracellular domains, members of the cadherin superfamily have 30 divergent structures and, possibly, functions. In particular it has been reported that members of the cadherin superfamily are involved in signal transduction. See, Suzuki, J. Cell Biochem., 61(4):531-542 (1996). Cadherins are further described in Tanihara, et al., J. Cell Sci., 107(6):1697-1704 (1994), Aberle, et al., J. Cell Biochem., 61(4):514-523 (1996) and Tanihara, et al., Cell Adhes. Commun., 2(1):15-26 (1994). Protocadherins are members of the cadherin superfamily which are highly expressed in the brain. In some 35 studies, protocadherins have shown cell adhesion activity. See, Sano, et al., EMBO J., 12(6):2249-2256 (1993). However, studies have also shown that some protocadherins, such as protocadherin 3 (also referred to as Pcdh3 or pc3), do not show strong calcium dependent cell aggregation activity. See, Sago, et al., Genomics, 29(3):631-640 (1995) for this study and further characteristics of Pcdh3. 30 WO 99/46281 PCT/US99/05028 Therefore, novel members of the cadherin superfamily are of interest. More generally, all membrane-bound proteins and receptors are of interest. Such proteins can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic 5 factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various 10 cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential 15 peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Efforts are therefore being undertaken by both industry and academia to identify new, native membrane bound proteins, particular those having sequence identity with protocadherins, especially 3 and 4. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel membrane-bound proteins. Provided herein are the results of such efforts. 20 63. PRO534 Protein disulfide isomerase is an enzymatic protein which is involved in the promotion of correct refolding of proteins through the establishment of correct disulfide bond formation. Protein disulfide isomerase was initially identified based upon its ability to catalyze the renaturation of reduced denatured RNAse (Goldberger et al., J. Biol. 25 Chem. 239:1406-1410 (1964) and Epstein et al., Cold Spring Harbor Symp. Ouant. Biol. 28:439-449 (1963)). Protein disulfide isomerase has been shown to be a resident enzyme of the endoplasmic reticulum which is retained in the endoplasmic reticulum via a -KDEL or -HDEL amino acid sequence at its C-terminus. Protein disulfide isomerase and related proteins are further described in Laboissiere, et al., J. Biol. Chem., 270(47:28006-28009 (1995); Jeenes, et al., Gene, 193(2):151-156 (1997; Koivunen, et al., Genomics, 42(3):397-404 (1997); and Desilva, 30 et al., DNA Cell Biol., 15(1):9-16 (1996). These studies indicate the importance of the identification of protein disulfide related proteins. More generally, and also of interest are all novel membrane-bound proteins and receptors. Such proteins can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically 35 governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin 31 WO 99/46281 PCT/US99/05028 molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including as 5 pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Given the importance of membrane bound proteins, efforts are under way to identity novel membrane bound proteins. Moreover, given the importance of disulfide bond-forming enzymes and their potential uses in a number 10 of different applications, for example in increasing the yield of correct refolding of recombinantly produced proteins, efforts are currently being undertaken by both industry and academia to identify new, native proteins having sequence identity with protein disulfide isomerase. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel protein disulfide isomerase homologs. We herein describe a novel polypeptide having sequence identity with protein disulfide isomerase and the nucleic acids 15 encoding the same. 64. PR0697 Secreted frizzled related proteins (sFRPs) are related to the frizzled family of transmembrane receptors. The sFRPs are approximately 30 kDa in size, and each contains a putative signal sequence, a frizzled-like cysteine 20 rich domain, and a conserved hydrophilic carboxy-terminal domain. It has been reported that sFRPs may function to modulate Wnt signaling, or function as ligands for certain receptors. Rattner, et al., PNAS USA, 94(7):2859-2863 (1997). Therefore, sFRPs and proteins having sequence identity and/or similarity to sFRPs are of interest. Another secreted protein of interest is any member of the family of secreted apoptosis-related proteins (SARPs). Expression of SARPs modifies the intracellular levels of beta-catenin, suggesting that SARPs interfere with 25 the Wnt-frizzled proteins signaling pathway. Melkonyan, et al., PNAS USA, 94(25):13636-13641 (1997). Therefore, SARPs and proteins having sequence identity and/or similarity to SARPs are of interest. In addition to sFRPs and SARPs, many extracellular proteins are of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed 30 by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment. 35 Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. 32 WO 99/46281 PCT/US99/05028 Efforts are being undertaken by both industry and academia to identify new, native secreted proteins, particularly those having sequence identity or similarity with sFRP-2 and SARP-1. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. 5 65. PR0717 Efforts are being undertaken by both industry and academia to identify new, native transmembrane receptor proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel receptor proteins. The results of such efforts are provided herein. 10 66. PRO731 Cadherins are a large family of transmembrane proteins. Cadherins comprise a family of calcium-dependent glycoproteins that function in mediating cell-cell adhesion in virtually all solid tissues of multicellular organisms. At least cadherins 1-13 as well as types B, E, EP, M, N, P and R have been characterized. Among the functions 15 cadherins are known for, with some exceptions, cadherins participate in cell aggregation and are associated with cell cell adhesion sites. Recently, it has been reported that while all cadherins share multiple repeats of a cadherin specific motif believed to correspond to folding of extracellular domains, members of the cadherin superfamily have divergent structures and, possibly, functions. In particular it has been reported that members of the cadherin superfamily are involved in signal transduction. See, Suzuki, J. Cell Biochem., 61(4):531-542 (1996). Cadherins 20 are further described in Tanihara, et al., J. Cell Sci., 107(6):1697-1704 (1994), Aberle, et al., J. Cell Biochem., 61(4):514-523 (1996) and Tanihara, et al., Cell Adhes. Commun., 2(1):15-26 (1994). Protocadherins are members of the cadherin superfamily which are highly expressed in the brain. In some studies, protocadherins have shown cell adhesion activity. See, Sano, et al., EMBO J., 12(6):2249-2256 (1993). However, studies have also shown that some protocadherins, such as protocadherin 3 (also referred to as Pcdh3 or 25 pc3), do not show strong calcium dependent cell aggregation activity. See, Sago, et al., Genomics, 29(3):631-640 (1995) for this study and further characteristics of Pcdh3. Therefore, novel members of the cadherin superfamily are of interest. More generally, all membrane-bound proteins and receptors are of interest. Such proteins can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, 30 differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors 35 involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. 33 WO 99/46281 PCT/US99/05028 Membrane-bound proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Efforts are therefore being undertaken by both industry and academia to identify new, native membrane 5 bound proteins, particular those having sequence identity with protocadherins, especially 4, 68, 43, 42, 3 and 5. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel membrane-bound proteins. Provided herein are the results of such efforts. 67. PR0218 10 Efforts are being undertaken by both industry and academia to identify new, native membrane bound proteins, particularly those having sequence identity with membrane regulator proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel receptor proteins. 15 68. PR0768 The integrins comprise a supergene family of cell-surface glycoprotein receptors that promote cellular adhesion. Each cell has numerous receptors that define its cell adhesive capabilities. Integrins are involved in a wide variety of interaction between cells and other cells or matrix components. The integrins are of particular importance in regulating movement and function of immune system cells. The platelet IIb/IIIA integrin complex is of particular 20 importance in regulating platelet aggregation. A member of the integrin family, integrin p-6, is expressed on epithelial cells and modulates epithelial inflammation. Another integrin, leucocyte-associated antigen-1 (LFA-1) is important in the adhesion of lymphocytes during an immune response. Of particular interest is H36-alpha 7, an integrin alpha chain that is developmentally regulated during myogenesis as described in Song, et al., J. Cell Biol., 117(3):643-657 (1992). The expression pattern of the laminin 25 binding alpha 7 beta 1 integrin is developmentally regulated in skeletal, cardiac, and smooth muscle. Ziober, et al., Mol. Biol. Cell, 8(9):1723-1734 (1997). It has been reported that expression of the alpha 7-X1/X2 integrin is a novel mechanism that regulates receptor affinity states in a cell-specific context and may modulate integrin-dependent events during muscle development and repair. Id. It has further been reported that laminins promote the locomotion of skeletal myoblasts via the alpha 7 integrin receptor. In particular it was reported that alpha 7 beta 1 receptor can 30 promote myoblast adhesion and motility on a restricted number of laminin isoforms and may be important in myogenic precursor recruitment during regeneration and differentiation. Yao, et al., J. Cell Sci., 109(13):3139-3150 (1996). Spliced variants of integrin alpha 7 are also described in Leung, et al., Biochem. Biophys. Res. Commune , 243(1):317-325 (1998) and Fornaro and Languino, Matrix Biol., 16(4):185-193 (1997). Moreover, it has been reported that absence of integrin alpha 7 causes a form of muscular dystrophy. Thus integrins, particularly those 35 related to integrin 7 and related molecules, are of interest. In addition to the interest of integrins, more generally, all membrane-bound proteins and receptors are of interest since such proteins can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate 34 WO 99/46281 PCTIUS99/05028 environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that 5 regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents 10 to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Therefore, efforts are being undertaken by both industry and academia to identify new, native receptor proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel receptor proteins. The results of such efforts, particularly those focused on identifying new 15 polypeptides having sequence identity with integrins, are provided herein. 69. PR0771 Testican is a multidomain testicular proteoglycan which is expressed in numerous tissue types including, but not limited to neuromuscular tissue, the brain and reproductive tissues. Testican resembles modulators of cell 20 social behavior such as the regulation of cell shape, adhesion, migration and proliferation. [Bonnet, F. et al., J. Biol. Chem., 271(8):4373 (1996), Perin, J.P. et al., EXS (Switzerland), 20:191 (1994), Alliel, P.M., et al, Eur. J. Biochem., 214(1):346 (1993), Charbonnier, F., et al., C. R. Seances Soc. Biol. Fil. (France), 191.(1):127 (1997)]. Among other reasons, since testican has been implicated in neuronal processes and may be associated with the growth of connective tissue, testican and related molecules are of interest. 25 More generally, all extracellular proteins are of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and 30 hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment. Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, 35 erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. Efforts are being undertaken by both industry and academia to identify new, native secreted proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature (see, for example, Klein et al., Proc. Natl. Acad. 35 WO 99/46281 PCT/US99/05028 Sci, 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. The results of such efforts, particularly those focused on identifying molecules having identity and/or similarity with testican are of interest. 70. PR0733 Tl/ST2 is a receptor-like molecule homologous to the type I interleukin-1 receptor, believed to be involved 5 in cell signaling. The T1/ST2 receptor and/or putative ligands are further described in Gayle, et al., J. Biol. Chem., 271(10):5784-5789 (1996), Kumar, et al., J. Biol. Chem., 270(46):27905-27913 (1995), and Mitcham, et al., J. Biol. Chem., 271(10):5777-5783 (1996). These proteins, and proteins related thereto are of interest. More generally all membrane-bound proteins and receptors are of interest since they can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, 10 e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, 15 receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including as 20 pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Efforts are being undertaken by both industry and academia to identify new, native receptor proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for 25 novel receptor proteins. The results of such efforts are provided herein. 71. PRO162 Pancreatitis-associated protein (PAP) is a secretory protein that is overexpressed by the pancreas during acute pancreatitis. Serum PAP concentrations have been shown to be abnormally high in patients with acute 30 pancreatitis. Pezzilli et al., Am. J. Gastroenterol., 92(10):1887-1890 (1997). PAP is synthesized by the pancreas due to pancreatic inflammation and has been shown to be a good serum marker for injury of the pancreas. In addition, serum PAP levels appear to strongly correlate with creatinine clearance measurements. In patients with a pancreas-kidney transplantation, PAP may prove to be a useful biological and histological marker of pancreatic graft rejection. Van der Pijl et al., Transplantation, 63(7):995-1003 (1997). 35 Further, PAP has been shown to be useful in screening neonates for cystic fibrosis. In fact, PAP may discriminate cystic fibrosis neonates with better specificity than the current immunoreactive trypsis assay. lovanna et al., C. R. Acad. Aci. III, 317(6):561-564. Secreted proteins such as PAP have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, 36 WO 99/46281 PCT/US99/05028 interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. Efforts are being undertaken by both industry and academia to identify new, native secreted proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [see, for 5 example, Klein et al., Proc. Natl. Acad. Sci., 23:7108-7113 (1996); U.S. Patent No. 5,536,637)]. The results of such efforts are presented herein. 72. PRO788 Anti-neoplastic urinary protein (ANUP) was identified as the major protein present in a fraction of human 10 urine which exhibits antiproliferative activity against human tumor cell lines without affecting the growth of several normal diploid cell lines or tumor cells of mouse or hamster origin. Sloane et al., Biochem. J., 234(2):355-362 (1986). ANUP is a unique cytokine that has been found in human granulocytes. The N-terminal amino acid sequence has been shown to be unique. A synthetic peptide corresponding to the first nine residues, with Cys at 15 positions 4 and 7, was found to be an anti-tumor agent in vitro. Ridge and Sloane, Cvtokine, 8(1):1-5 (1996). Secreted proteins such as ANUP have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. Efforts are being 20 undertaken by both industry and academia to identify new, native secreted proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. 25 73. PRO1008 Dickkopf-1 (dkk-1) is a member of a family of secreted proteins and functions in head induction. Dkk-1 is an inducer of Spemann organizer in amphibian embryos. Glinka, et al., Nature, 391(6665):357-362 (1998). Dkk-1 is a potent antagonist of Wnt signalling, suggesting that dkk genes encode a family of secreted Wnt inhibitors. Thus, dkk-1 family members and related molecules are of interest. 30 More generally, all extracellular proteins are of interest since they can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and 35 hormones) which are, in tmrn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment. Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, 37 WO 99/46281 PCT/US99/05028 erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. Efforts are being undertaken by both industry and academia to identify new, native secreted proteins, particularly those related to dkk-1. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques 5 are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. The results of such efforts to identify molecules related to dkk-1 are provided herein. 74. PRO1012 Protein disulfide isomerase is an enzymatic protein which is involved in the promotion of correct refolding 10 of proteins through the establishment of correct disulfide bond formation. Protein disulfide isomerase was initially identified based upon its ability to catalyze the renaturation of reduced denatured RNAse (Goldberger et al., J. Biol. Chem. 239:1406-1410 (1964) and Epstein et al., Cold Spring Harbor Symp. Quant. Biol. 28:439-449 (1963)). Protein disulfide isomerase has been shown to be a resident enzyme of the endoplasmic reticulum which is retained in the endoplasmic reticulum via a -KDEL or -HDEL amino acid sequence at its C-terminus. Protein disulfide 15 isomerase and related proteins are further described in Laboissiere, et al., J. Biol. Chem., 270(47:28006-28009 (1995); Jeenes, et al., Gene, 193(2):151-156 (1997; Koivunen, et al., Genomics, 42(3):397-404 (1997); and Desilva, et al., DNA Cell Biol., 15(1):9-16 (1996). These studies indicate the importance of the identification of protein disulfide related proteins. More generally, the identification of all extracellular and membrane-bound proteins is of interest since they 20 play important roles in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane 25 bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment, usually at a membrane-bound receptor protein. Secreted proteins have various industrial applications, including use as pharmaceuticals, diagnostics, biosensors and bioreactors. In fact, most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their 30 receptors, which are membrane-bound proteins, also have potential as therapeutic or diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. Membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and 35 cellular adhesin molecules like selectins and integrins. Transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. 38 WO 99/46281 PCT/US99/05028 Of particular interest are cellular proteins having endoplasmic reticulum (ER) retention signals. These proteins are retained in the cell and function closely with endoplasmic reticulum in protein production. Such proteins have been described previously, i.e., see Shorrosh and Dixon, Plant J., 2(1):51-58 (1992). Efforts are being undertaken by both industry and academia to identify new, native secreted and membrane bound receptor proteins, and in particular, cellular proteins having ER retension signals. Many efforts are focused 5 on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. The results of such efforts, particularly the identification of novel polypeptides and nucleic acids encoding the same, which have sequence identity and similarity to protein disulfide isomerase are presented herein. 10 75. PRO1014 Oxygen free radicals and antioxidants appear to play an important role in the central nervous system after cerebral ischemia and reperfusion. Moreover, cardiac injury, related to ischaemia and reperfusion has been reported to be caused by the action of free radicals. Additionally, studies have reported that the redox state of the cell is a 15 pivotal determinant of the fate of the cells. Furthermore, reactive oxygen species have been reported to be cytotoxic, causing inflammatory disease, including tissue necrosis, organ failure, atherosclerosis, infertility, birth defects, premature aging, mutations and malignancy. Thus, the control of oxidation and reduction is important for a number of reasons including for control and prevention of strokes, heart attacks, oxidative stress and hypertension. In this regard, reductases, and particularly, oxidoreductases, are of interest. Publications further describing this subject 20 matter include Kelsey, et al., Br. J. Cancer, 76(7):852-4 (1997); Friedrich and Weiss, J. Theor. Biol., 187(4):529-40 (1997) and Pieulle, et al., J. Bacteriol., 179(18):5684-92 (1997). In addition to reductases in particular, novel polypeptides are generally of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed 25 by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment. 30 Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. Efforts are being undertaken by both industry and academia to identify new, native secreted proteins. Many efforts are focused on the screening 35 of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. L, 22:7108-7113 (1996); U.S. Patent No. 5,536,637)]. The results of such efforts, particularly those identifying polypeptides having sequence identity with reductases, and the nucleic acids encoding the same, are presented herein. 39 WO 99/46281 PCTIUS99/05028 76. PRO1017 Enzymatic proteins play important roles in the chemical reactions involved in the digestion of foods, the biosynthesis of macromolecules, the controlled release and utilization of chemical energy, and other processes necessary to sustain life. Sulfotransferases are enzymes which transfer sulfate from a sulfate donor to acceptor substrates, particularly those containing terminal glucoronic acid. The HNK-1 carbohydrate epitope is expressed 5 on several neural adhesion glycoproteins and a glycolipid, and is involved in cell interactions. The glucuronyltransferase and sulfotransferase are considered to be the key enzymes in the biosynthesis of this epitope because the rest of the structure occurs often in glycoconjugates. HNK-1 sulfotransfererase is further described in Bakker, H., et al., J. Biol. Chem., 272(47):29942-29946 (1997). In addition to HNK-1 sulfotransfererase, and novel proteins related thereto, all novel proteins are of 10 interest. Extracellular and membrane-bound proteins play important roles in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, 15 received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment, usually at a membrane-bound receptor protein. Secreted proteins have various industrial applications, including use as pharmaceuticals, diagnostics, biosensors and bioreactors. In fact, most protein drugs available at present, such as thrombolytic agents, interferons, 20 interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane-bound proteins, also have potential as therapeutic or diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. Membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Such membrane-bound proteins and cell receptors include, but are not limited 25 to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. Transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. 30 Efforts are being undertaken by both industry and academia to identify new, native secreted and membrane bound receptor proteins, particularly those having sequence identity with HNK-1 sulfotransferase. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad, Sci., 22:7108-7113 (1996); U.S. Patent No. 35 5,536,637)]. The results of such efforts are provided herein. 77. PRO474 Enzymatic proteins play important roles in the chemical reactions involved in the digestion of foods, the biosynthesis of macromolecules, the controlled release and utilization of chemical energy, and other processes 40 WO 99/46281 PCT/US99/05028 necessary to sustain life. Glucose dehydrogenase functions in the oxidation of glucose to gluconate to generate metabolically useful energy. The regulation of the PQQ-linked glucose dehydrogenase in different organisms is reviewed in Neijssel, et al., Antonie Van Leeuwenhoek, 56(1):51-61 (1989). Glucose dehydrogenase functions as an auxiliary energy generating mechanism, because it is maximally synthesized under conditions of energy stress. In addition to molecules related to glucose dehydrogenase, all novel proteins are of interest. Extracellular 5 and membrane-bound proteins play important roles in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse 10 cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment, usually at a membrane-bound receptor protein. Secreted proteins have various industrial applications, including use as pharmaceuticals, diagnostics, biosensors and bioreactors. In fact, most protein drugs available at present, such as thrombolytic agents, interferons, 15 interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane-bound proteins, also have potential as therapeutic or diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. Membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Such membrane-bound proteins and cell receptors include, but are not limited 20 to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. Transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. 25 Efforts are being undertaken by both industry and academia to identify new, native secreted and membrane bound receptor proteins, and particularly cellular proteins and those related to dehydrogenase or oxidoreductase. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent 30 No. 5,536,637)]. The results of such efforts are presented herein. 78. PRO1031 It has been reported that the cytokine interleukin 17 (IL-17) stimulates epithelial, endothelial, and fibroblastic cells to secrete cytokines such as IL-6, IL-8, and granulocyte-colony-stimulating factor, as well as prostaglandin E2. 35 Moreover, it has been shown that when cultured in the presence of IL-17, fibroblasts could sustain proliferation of CD34+ preferential maturation into neutrophils. Thus it has been suggested that IL-17 constitutes an early initiator of the T cell-dependent inflammatory reaction and/or an element of the cytokine network that bridges the immune system to hematopoiesis. See, Yao, et al., J. Immunol., 155(12):5483-5486 (1995); Fossiez, et al., J. Exp. Med., 183(6):2593-2603 (1996); Kennedy, et al., J. Interferon Cytokine Res., 16(8):611-617 (1996). Thus, proteins related 41 WO 99/46281 PCT/US99/05028 to IL-17 are of interest. More generally, all novel proteins are of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides 5 (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment. Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors 10 and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. Efforts are being undertaken by both industry and academia to identify new, native secreted proteins, particularly those related to IL-17. Many efforts are focused on the screening of mammalian recombinant DNA 15 libraries to identify the coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 23:7108-7113 (1996); U.S. Patent No. 5,536,637)]. The results of such efforts are presented herein. 79. PRO938 20 Protein disulfide isomerase is an enzymatic protein which is involved in the promotion of correct refolding of proteins through the establishment of correct disulfide bond formation. Protein disulfide isomerase was initially identified based upon its ability to catalyze the renaturation of reduced denatured RNAse (Goldberger et al., J. Biol. Chem. 232:1406-1410 (1964) and Epstein et al., Cold Spring Harbor Symp. Quant, Biol. 28:439-449 (1963)). Protein disulfide isomerase has been shown to be a resident enzyme of the endoplasmic reticulum which is retained 25 in the endoplasmic reticulum via a -KDEL or -HDEL amino acid sequence at its C-terminus. Protein disulfide isomerase and related proteins are further described in Laboissiere, et al., J. Biol. Chem., 270(47):28006-28009 (1995); Jeenes, et al., Gene, 123(2):151-156 (1997); Koivunen, et al., Genomics, 42(3):397-404 (1997); Desilva, et al., DNA Cell Biol., 15(1):9-16 (1996); Freedman, et al. Trends in Biochem. Sci. 12:331-336 (1994); Bulleid, N.J. Advances in Prot. Chem. 44:125-50 (1993); and Noiva, R., Prot. Exp. and Purification 5:1-13 (1994). These studies 30 indicate the importance of the identification of protein disulfide related proteins. More generally, and also of interest are all novel membrane-bound proteins and receptors. Such proteins can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often 35 transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and 42 WO 99/46281 PCT/US99/05028 differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents 5 to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Given the importance of membrane bound proteins, efforts are under way to identity novel membrane bound proteins. Moreover, given the importance of disulfide bond-forming enzymes and their potential uses in a number of different applications, for example in increasing the yield of correct refolding of recombinantly produced proteins, 10 efforts are currently being undertaken by both industry and academia to identify new, native proteins having sequence identity with protein disulfide isomerase. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel protein disulfide isomerase homologs. We herein describe the identification and characterization of a novel polypeptide having homology to protein disulfide isomerase. 15 80. PRO1082 The low density lipoprotein (LDL) receptor is a membrane-bound protein that plays a key role in cholesterol homeostasis, mediating cellular uptake of lipoprotein particles by high affinity binding to its ligands, apolipoprotein (apo) B-100 and apoE. The ligand-binding domain of the LDL receptor contains 7 cysteine-rich repeats of 20 approximately 40 amino acids, wherein each repeat contains 6 cysteines, which form 3 intra-repeat disulfide bonds. These unique structural features provide the LDL receptor with its ability to specifically interact with apo B-100 and apoE, thereby allowing for transport of these lipoprotein particles across cellular membranes and metabolism of their components. Soluble fragments containing the extracellular domain of the LDL receptor have been shown to retain the ability to interact with its specific lipoprotein ligands (Simmons et al., J. Biol. Chem. 272:25531-25536 (1997)). 25 LDL receptors are further described in Javitt, FASEB J., 9(13):1378-1381 (1995) and Herz and Willnow, Ann. NY Acad. Sci., 737:14-19 (1994). Thus, proteins having sequence identity with LDL receptors are of interest. More generally, all membrane-bound proteins and receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other 30 cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, 35 transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor. Of particular interest are membrane bound proteins that have type II transmembrane domains. 43 WO 99/46281 PCT/US99/05028 Membrane-bound proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Efforts are thus being undertaken by both industry and academia to identify new, native proteins, particularly 5 membrane bound proteins including type II transmembrane bound proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel receptor proteins. The results of such efforts are provided herein. 81. PRO1083 10 Of particular interest are membrane bound proteins that belong to the seven transmembrane (7TM) receptor superfamily. Examples of these receptors include G-protein coupled receptors such as ion receptors. Another example of a 7TM receptor superfamily member is described in Osterhoff, et al., DNA Cell Biol., 16(4):379-389 (1997). Membrane-bound proteins and receptor molecules have various industrial applications, including as 15 pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. The membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Efforts are being undertaken by both industry and academia to identify new, native receptor proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for 20 novel receptor proteins. The results of such efforts are presented herein. 82. PRO200 Polypeptides involved in survival, proliferation and/or differentiation of cells are of interest. Polypeptides known to be involved in the survival, proliferation and/or differentiation of cells include VEGF and members of the 25 bone morphogenetic protein family. Therefore, novel polypeptides which are related to either VEGF or the bone morphogenetic protein are of interest. The heparin-binding endothelial cell-growth factor, VEGF, was identified and purified from media conditioned by bovine pituitary follicular or folliculo-stellate cells over several years ago. See Ferrara et al., Biophys. Res. Comm. 161, 851 (1989). VEGF is a naturally occurring compound that is produced in follicular or 30 folliculo-stellate cells (FC), a morphologically well characterized population of granular cells. The FC are stellate cells that send cytoplasmic processes between secretory cells. VEGF is expressed in a variety of tissues as multiple homodimeric forms (121, 165, 189 and 206 amino acids per monomer) resulting from alternative RNA splicing. VEGF 121 is a soluble mitogen that does not bind heparin; the longer forms of VEGF bind heparin with progressively higher affinity. The heparin-binding forms of 35 VEGF can be cleaved in the carboxy terminus by plasmin to release (a) diffusible form(s) of VEGF. Amino acid sequencing of the carboxy terminal peptide identified after plasmin cleavage is Arg,,O-Alam 11 . Amino terminal "core" protein, VEGF (1-110) isolated as a homodimer, binds neutralizing monoclonal antibodies (4.6.1 and 2E3) and soluble forms of FMS-like tyrosine kinase (FLT-1), kinase domain region (KDR) and fetal liver kinase (FLK) receptors with similar affinity compared to the intact VEGF 16 s homodimer. 44 WO 99/46281 PCT/US99/05028 As noted, VEGF contains two domains that are responsible respectively for binding to the KDR and FLT-1 receptors. These receptors exist only on endothelial (vascular) cells. As cells become depleted in oxygen, because of trauma and the like, VEGF production increases in such cells which then bind to the respective receptors in order to signal ultimate biological effect. The signal then increases vascular permeability and the cells divide and expand to form new vascular pathways - vasculogenesis and angiogenesis. 5 Thus, VEGF is useful for treating conditions in which a selected action on the vascular endothelial cells, in the absence of excessive tissue growth, is important, for example, diabetic ulcers and vascular injuries resulting from trauma such as subcutaneous wounds. Being a vascular (artery and venus) endothelial cell growth factor, VEGF restores cells that are damaged, a process referred to as vasculogenesis, and stimulates the formulation of new vessels, a process referred to as angiogenesis. 10 VEGF would also find use in the restoration of vasculature after a myocardial infarct, as well as other uses that can be deduced. In this regard, inhibitors of VEGF are sometimes desirable, particularly to mitigate processes such as angiogenesis and vasculogenesis in cancerous cells. Regarding the bone morphogenetic protein family, members of this family have been reported as being involved in the differentiation of cartilage and the promotion of vascularization and osteoinduction in preformed 15 hydroxyapatite. Zou, et al., Genes Dev. (U.S.), 11(17):2191 (1997); Levine, et al., Ann. Plast. Surg., 39(2):158 (1997). A number of related bone morphogenetic proteins have been identified, all members of the bone morphogenetic protein (BMP) family. Bone morphogenetic native and mutant proteins, nucleic acids encoding therefor, related compounds including receptors, host cells and uses are further described in at least: U.S. Patent Nos. 5,670,338; 5,454,419; 5,661,007; 5,637,480; 5,631,142; 5,166,058; 5,620,867; 5,543,394; 4,877,864; 5,013,649; 20 55,106,748; and 5,399,677. Of particular interest are proteins having homology with bone morphogenetic protein 1, a procollagen C-proteinase that plays key roles in regulating matrix deposition. The present invention is predicated upon research intended to identify novel polypeptides which are related to VEGF and the BMP family, and in particular, polypeptides which have a role in the survival, proliferation and/or differentiation of cells. While the novel polypeptides are not expected to have biological activity identical to the 25 known polypeptides to which they have homology, the known polypeptide biological activities can be used to determine the relative biological activities of the novel polypeptides. In particular, the novel polypeptides described herein can be used in assays which are intended to determine the ability of a polypeptide to induce survival, proliferation or differentiation of cells. In turn, the results of these assays can be used accordingly, for diagnostic and therapeutic purposes. The results of such research is the subject of the present invention. 30 83. PR0285 and PR0286 The cloning of the Toll gene of Drosophila, a maternal effect gene that plays a central role in the establishment of the embryonic dorsal-ventral pattern, has been reported by Hashimoto et al., Cell 52, 269-279 (1988). The Drosophila Toll gene encodes an integral membrane protein with an extracytoplasmic domain of 803 35 amino acids and a cytoplasmic domain of 269 amino acids. The extracytoplasmic domain has a potential membrane spanning segment, and contains multiple copies of a leucine-rich segment, a structural motif found in many transmembrane proteins. The Toll protein controls dorsal-ventral patterning in Drosophila embryos and activates the transcription factor Dorsal upon binding to its ligand Spatzle. (Morisato and Anderson, Cell 76, 677-688 (1994).) In adult Drosophila, the Toll/Dorsal signaling pathway participates in the anti-fungal immune response. (Lenaitre et 45 WO 99/46281 PCT/US99/05028 al., Cell 6, 973-983 (1996).) A human homologue of the Drosophila Toll protein has been described by Medzhitov et al., Nature 388, 394-397 (1997). This human Toll, just as Drosophila Toll, is a type I transmembrane protein, with an extracellular domain consisting of 21 tandemly repeated leucine-rich motifs (leucine-rich region - LRR), separated by a non-LRR region, and a cytoplasmic domain homologous to the cytoplasmic domain of the human interleukin-1 (IL-1) receptor. 5 A constitutively active mutant of the human Toll transfected into human cell lines was shown to be able to induce the activation of NF-xB and the expression of NF-icB-controlled genes for the inflammatory cytokines IL-I, IL-6 and IL-8, as well as the expression of the constimulatory molecule B7. 1, which is required for the activation of native T cells. It has been suggested that Toll functions in vertebrates as a non-clonal receptor of the immune system, which can induce signals for activating both an innate and an adaptive immune response in vertebrates. The human Toll 10 gene reported by Medzhitov et al., supra was most strongly expressed in spleen and peripheral blood leukocytes (PBL), and the authors suggested that its expression in other tissues may be due to the presence of macrophages and dendritic cells, in which it could act as an early-warning system for infection. The public GenBank database contains the following Toll sequences: Toll1 (DNAX# HSU88540-1, which is identical with the random sequenced full-length cDNA #HUMRSC786-1); Toll2 (DNAX# HSU88878-1); Toll3 (DNAX# HSU88879-1); and Toll4 (DNAX# 15 HSU88880-1, which is identical with the DNA sequence reported by Medzhitov et al., supra). A partial Toll sequence (Toll5) is available from GenBank under DNAX# HSU88881-1. Further human homologues of the Drosophila Toll protein, designated as Toll-like receptors (huTLRsl-5) were recently cloned and shown to mirror the topographic structure of the Drosophila counterpart (Rock et al., Proc. Natl. Acad. Sci. USA 95, 588-593 [1998]). Overexpression of a constitutively active mutant of one human TLR 20 (Toll-protein homologue - Medzhitov et al., supra; TLR4 - Rock et al., supra) leads to the activation of NF-icB and induction of the inflammatory cytokines and constimulatory molecules. Medzhitov et al., supra. 84. PR0213-1. PRO1330 and PRO1449 Cancer is characterized by the increase in the number of abnormal, or neoplastic, cells derived from a 25 normal tissue which proliferate to form a tumor mass, the invasion of adjacent tissues by these neoplastic tumor cells, and the generation of malignant cells which eventually spread via the blood or lymphatic system to regional lymph nodes and to distant sites (metastasis). In a cancerous state a cell proliferates under conditions in which normal cells would not grow. Cancer manifests itself in a wide variety of forms, characterized by different degrees of invasiveness and aggressiveness. 30 Alteration of gene expression is intimately related to the uncontrolled cell growth and de-differentiation which are a common feature of all cancers. The genomes of certain well studied tumors have been found to show decreased expression of recessive genes, usually referred to as tumor suppression genes, which would normally function to prevent malignant cell growth, and/or overexpression of certain dominant genes, such as oncogenes, that act to promote malignant growth. Each of these genetic changes appears to be responsible for importing some of the 35 traits that, in aggregate, represent the full neoplastic phenotype (Hunter, Cell 64, 1129 [1991]; Bishop, Cell 64, 235 248 [1991]). A well known mechanism of gene (e.g. oncogene) overexpression in cancer cells is gene amplification. This is a process where in the chromosome of the ancestral cell multiple copies of a particular gene are produced. The process involves unscheduled replication of the region of chromosome comprising the gene, followed by 46 WO 99/46281 PCT/US99/05028 recombination of the replicated segments back into the chromosome (Alitalo et al., Adv. Cancer Res. 47, 235-281 [1986]). It is believed that the overexpression of the gene parallels gene amplification, i.e. is proportionate to the number of copies made. Proto-oncogenes that encode growth factors and growth factor receptors have been identified to play important roles in the pathogenesis of various human malignancies, including breast cancer. For example, it has been 5 found that the human ErbB2 gene (erbB2, also known as her2, or c-erbB-2), which encodes a 185-kd transmembrane glycoprotein receptor (p185HER2; HER2) related to the epidermal growth factor receptor (EGFR), is overexpressed in about 25% to 30% of human breast cancer (Slamon et al., Science 235:177-182 [1987]; Slamon et al., Science 244:707-712 [1989]). It has been reported that gene amplification of a protooncogene is an event typically involved in the more 10 malignant forms of cancer, and could act as a predictor of clinical outcome (Schwab et al., Genes Chromosomes Cancer 1, 181-193 [1990]; Alitalo et al., supra). Thus, erbB2 overexpression is commonly regarded as a predictor of a poor prognosis, especially in patients with primary disease that involves axillary lymph nodes (Slamon et al., [1987] and [1989], supra; Ravdin and Chamness, Gene 159:19-27 [1995]; and Hynes and Stem, Biochem Biophys Acta 1198: 165-184 [1994]), and has been linked to sensitivity and/or resistance to hormone therapy and 15 chemotherapeutic regimens, including CMF (cyclophosphamide, methotrexate, and fluoruracil) and anthracyclines (Baselga et al., Oncology 11 (3 Suppl 1): 43-48 [1997]). However, despite the association of erbB2 overexpression with poor prognosis, the odds of HER2-positive patients responding clinically to treatment with taxanes were greater than three times those of HER2-negative patients (Ibid). A recombinant humanized anti-ErbB2 (anti-HER2) monoclonal antibody (a humanized version of the murine anti-ErbB2 antibody 4D5, referred to as rhuMAb HER2 20 or Herceptin 7o) has been clinically active in patients with ErbB2-overexpressing metastatic breast cancers that had received extensive prior anticancer therapy. (Baselga et al., J. Clin. Oncol. 14:737-744 [1996]). The protein Notch and its homologues are key regulatory receptors in determining the cell fate in various development processes. The protein Notch-4, also known as int-3 oncogene, was originally identified as a frequent target in mouse mammary tumor virus (MMVS). Notch-4 is believed to be a transgene which affects the 25 differentiation capacity of stem cells and leads to neoplastic proliferation in epithelial cells. Shirayoshi et al., Genes Cells 2(3): 213-224 (1997). During embryogenesis, the expression of Notch-4 was detected in endothelial cells of blood vessels forming tissues such as the dorsal aorta, intersegmental vessels, yolk sac vessels, cephalic vessels, heart, vessels in branchial arches, and capillary plexuses. Notch-4 expression in these tissues was also associated with flk-1, the major regulatory gene of vasculogenesis and angiogenesis. Notch-4 is also upregulated in vitro during 30 the differentiation of endothelial stem cell. The endothelial cell specific expression pattern of Notch-4, as well as its structural similarity to Notch suggest that Notch-4 is an endothelial cell specific homologue of Notch and that it may play a role in vaculogenesis and angiogenesis. 85. PR0298 35 Efforts are being undertaken by both industry and academia to identify new, native receptor proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel receptor proteins. We herein describe the identification and characterization of novel transmembrane polypeptides, designated herein as PR0298 polypeptides. 47 WO 99/46281 PCT/US99/05028 86. PRO337 Neuronal development in higher vertebrates is characterized by processes that must successfully navigate distinct cellular environment en route to their synaptic targets. The result is a functionally precise formation of neural circuits. The precision is believed to result form mechanisms that regulate growth cone pathfinding and target recognition, followed by latter refinement and remodeling of such projections by events that require neuronal activity, 5 Goodman and Shatz, Cell/Neuron [Suppl.] 72(10): 77-98 (1993). It is further evident that different neurons extend nerve fibers that are biochemically distinct and rely on specific guidance cues provided by cell-cell, cell-matrix, and chemotrophic interactions to reach their appropriate synaptic targets, Goodman et al., supra. One particular means by which diversity of the neuronal cell surface may be generated is through differential expression of cell surface proteins referred to as cell adhesion molecules (CAMs). Neuronally expressed CAMs have 10 been implicated in diverse developmental processes, including migration of neurons along radial glial cells, providing permissive or repulsive substrates for neurite extension, and in promoting the selective fasciculation of axons in projectional pathways. Jessel, Neuron 1: 3-13 (1988); Edelman and Crossin, Annu. Rev. Biochem. 60: 155-190 (1991). Interactions between CAMs present on the growth cone membrane and molecules on opposing cell membranes or in the extracellular matrix are thought to provide the specific guidance cues that direct nerve fiber 15 outgrowth along appropriate projectional pathways. Such interactions are likely to result in the activation of various second messenger systems within the growth cone that regulate neurite outgrowth. Doherty and Walsh, Curr. Opin Neurobiol. 2: 595-601 (1992). In higher vertebrates, most neural CAMs have been found to be members of three major structural families of proteins: the integrins, the cadherins, and the immunoglobulin gene superfamily (IgSF). Jessel, supra.; Takeichi, 20 Annu. Rev. Biochem. 59: 237-252 (1990); Reichardt and Tomaselli, Annu. Rev. Neurosci. 14: 531-570 (1991). Cell adhesion molecules of the IgSF (or Ig-CAMs), in particular, constitute a large family of proteins frequently implicated in neural cell interactions and nerve fiber outgrowth during development, Salzer and Colman, Dev. Neurosci. 11: 377-390 (1989); Brmmendorf and Rathjen, J. Neurochem. 61: 1207-1219 (1993). However, the majority of mammalian Ig-CAMs appear to be too widely expressed to specify navigational pathways or synaptic targets 25 suggesting that other CAMs, yet to be identified, have role in these more selective interactions of neurons. Many of the known neural Ig-CAMs have been found to be attached to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor. Additionally, many studies have implicated GPI-anchored proteins in providing specific guidance cues during the outgrowth on neurons in specific pathways. In studies of the grasshopper nervous system, treatment of embryos with phosphatidylinositol-specific phopholipase C (PIPLC), which selectively 30 removes GPI-anchored proteins from the surfaces of cells, resulted in misdirection and faulty navigation among subsets of pioneering growth cones, as well as inhibited migratory patterns of a subset of early neurons, Chang et al., Devel. 114: 507-519 (1992). The projection of retinal fibers to the optic tectum appears to depend, in part, on a 33 kDa GPI-anchored protein, however, the precise nature of this protein is unknown. Stahl et al., Neuron 5: 735 743 (1990). 35 The expression of various GPI-anchored proteins has been characterized amongst the different populations of primary rat neurons amongst dorsal root ganglion, sympathetic neurons of the cervical ganglion, sympathetic neurons of the superior cervical ganglion, and cerebellar granule neurons. Rosen et al., J. Cell Biol. 117: 617-627 (1992). In contrast to the similar pattern of total membrane protein expression by these different types of neurons, striking differences were observed in the expression of GPI-anchored proteins between these neurons. Recently, a 48 WO 99/46281 PCTIUS99/05028 65 kDa protein band known as neurotrimin was discovered and found to be differentially expressed by primary neurons (Rosen et al., supra), and restricted to the nervous system and found to be the most abundant and earliest expressed of the GPI-anchored species in the CNS. Struyk et al., J. Neuroscience 15(3): 2141-2156 (1995). The discovery of neurotrimin has further lead to the identification of a family of IgSF members, each containing three Ig like domains that share significant amino acid identity, now termed IgLON. Struyk et al., supra; Pimenta et al., Gene 5 170(2): 189-95 (1996). Additional members of the IgLON subfamily include opiate binding cell adhesion molecule (OBCAM), Schofield et al., EMBO J. 8: 489-495 (1989); limbic associated membrane protein (LAMP), Pimenta et al., supra; CEPU-1; GP55, Wilson et al., J. Cell Sci. 109: 3129-3138 (1996); Eur. J. Neurosci. 9(2): 334-41 (1997); and AvGp50, Hancox et al., Brain Res. Mol. Brain Res. 44(2): 273-85 (1997). 10 While the expression of neurotrimin appears to be widespread, it does appear to correlated with the development of several neural circuits. For example, between E18 and P10, neurotimin mRNA expression within the forebrain is maintained at high levels in neurons of the developing thalamus, cortical subplate, and cortex, particularly laminae V and VI (with less intense expression in II, II, and IV, and minimal expression in lamina I). Cortical subplate neurons may provide an early, temporary scaffold for the ingrowing thalamic afferents en route to 15 their final synaptic targets in the cortex. Allendoerfer and Shatz, Annu. Rev. Neurosci. 17: 185-218 (1994). Conversely, subplate neurons have been suggested to be required for cortical neurons from layer V to select VI to grow into the thalamus, and neurons from layer V to select their targets in the colliculus, pons, and spinal cord (McConnell et al., J. Neurosci. 14: 1892-1907 (1994). The high level expression of neurotrimin in many of these projections suggests that it could be involved in their development. 20 In the hindbrain, high levels of neurotrimin message expression were observed within the pontine nucleus and by the internal granule cells and Purkinje cells of the cerebellum. The pontine nucleus received afferent input from a variety of sources including corticopontine fibers of layer V, and is a major source of afferent input, via mossy fibers, to the granule cells which, in turn, are a major source of afferent input via parallel fibers to Purkinje cells. [Palay and Chan-Palay, The cerebellar cortex: cytology and organization. New York: Springer (1974]. High level 25 expression of neurotrimin these neurons again suggests potential involvement in the establishment of these circuits. Neurotrimin also exhibits a graded expression pattern in the early postnatal striatum. Increased neurotrimin expression is found overlying the dorsolateral striatum of the rat, while lesser hybridization intensity is seen overlying the ventromedial striatum. Struyk et al., supra. This region of higher neurotrimin hybridization intensity does not correspond to a cytoarchitecturally differentiable region, rather it corresponds to the primary area of afferent input 30 from layer VI of the contralateral sensorimotor cortex (Gerfen, Nature 311: 461-464 (1984); Donoghue and Herkenham, Brain Res. 365: 397-403 (1986)). The ventromedial striatum, by contrast, receives the majority of its afferent input from the perirhinal and association cortex. It is noteworthy that a complementary graded pattern of LAMP expression, has been observed within the striatium, with highest expression in ventromedial regions, and lowest expression dorsolaterally. Levitt, Science 223: 299-301 (1985); Chesselet et al., Neuroscience 40: 725-733 35 (1991). 87. PRO403 Type II transmembrane proteins, also known as single pass transmembrane proteins have an N-terminal portion lodged in the cytoplasm while the C-terminal portion is exposed to the extracellular domain. 49 WO 99/46281 PCT/US99/05028 Endothelin is a family of vasoconstrictor peptides about which much activity has been focused to better understand its basic pharmacological, biochemical and molecular biological features, including the presence and structure of isopeptides and their genes (endothelin-1, -2 and 3), regulation of gene expression, intracellular processing, specific endothelin converting enzymes (ECE), receptor subtypes (ET-A and ET-B), intracellular signal transduction following receptor activation, etc. 5 The endothelin (ET) family of peptides have potent vascular, cardiac and renal actions which may be of pathophysiological importance in many human disease states. ET-1 is expressed as an inactive 212 amino acid prepropeptide. The prepropeptide is first cleaved at Arg52-Cys53 and Arg92-Ala93 and then the carboxy terminal Lys91 and Arg92 are trimmed from the protein to generate the propeptide big ET-1. Endothelin is generated from inactive intermediates, the big endothelins, by a unique processing event 10 catalyzed by the zinc metalloprotease, endothelin converting enzyme (ECE). ECE was recently cloned, and its structure was shown to be a single pass transmembrane protein with a short intracellular N-terminal and a long extracellular C-terminal that contains the catalytic domain and numerous N-glycosylation sites. ECEs cleave the endothelin propeptide between Trp73 and Val74 producing the active peptide, ET, which appears to function as a local rather than a circulating hormone (Rubanyi, G.M. & Polokoff, M.A., Pharmachological Reviews 46: 325-415 15 (1994). Thus ECE activity is a potential site of regulation of endothelin production and a possible target for therapeutic intervention in the endothelin system. By blocking ECE activity, it is possible stop the production of ET-l by inhibiting the conversion of the relatively inactive precursor, big ET-1, to the physiologically active form. Endothelins may play roles in the pathophysiology of a number of disease states including: 1) cardiovascular diseases (vasospasm, hypertension, myocardial ischemia; reperfusion injury and acute myochardial infarction, stroke 20 (cerebral ischemia), congestive heart failure, shock, atherosclerosis, vascular thickening); 2) kidney disease (acute and chronic renal failure, glomerulonephritis, cirrhosis); 3) lung disease (bronchial asthma, pulmonary hypertension); 4) gastrointestinal disorders (gastric ulcer, inflammatory bowel diseases); 5) reproductive disorders (premature labor, dysmenorhea, preeclampsia) and 6) carcinogenesis. Rubanyi & Polokoff, supra. 25 SUMMARY OF THE INVENTION 1. PRO213 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PR0213". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 30 PR0213 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0213 polypeptide having amino acid residues 1 to 295 of Figure 2 (SEQ ID NO:2), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another embodiment, the invention provides isolated PR0213 polypeptide. In particular, the invention provides isolated native sequence PR0213 polypeptide, which in one embodiment, includes an amino acid sequence 35 comprising residues 1 to 295 of Figure 2 (SEQ ID NO:2). 50 WO 99/46281 PCT/US99/05028 2. PRO274 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as " PR0274". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0274 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0274 polypeptide 5 having amino acid residues 1 to 492 of Figure 4 (SEQ ID NO:7), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA39987-1184 vector deposited on April 21, 1998 as ATCC 209786 which includes the nucleotide sequence encoding PR0274. In another embodiment, the invention provides isolated PR0274 polypeptide. In particular, the invention 10 provides isolated native sequence PR0274 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 492 of Figure 4 (SEQ ID NO:7). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0274 polypeptide. Optionally, the PR0274 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA39987-1184 vector deposited on April 21, 1998 as ATCC 209786. 15 In another embodiment, the invention provides three expressed sequence tags (EST) comprising the nucleotide sequences of SEQ ID NO:8 (herein designated as DNA17873), SEQ ID NO:9 (herein designated as DNA36157) and SEQ ID NO: 10 (herein designated as DNA28929) (see Figure 5-7, respactively). 3. PRO300 20 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PRO300". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO300 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0300 polypeptide having amino acid residues I to 457 of Figure 9 (SEQ ID NO:19), or is complementary to such encoding nucleic acid 25 sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA40625-1189 vector deposited on April 21, 1998 as ATCC 209788 which includes the nucleotide sequence encoding PRO300. In another embodiment, the invention provides isolated PRO300 polypeptide. In particular, the invention provides isolated native sequence PRO300 polypeptide, which in one embodiment, includes an amino acid sequence 30 comprising residues 1 to 457 of Figure 9 (SEQ ID NO: 19). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PRO300 polypeptide. Optionally, the PR0300 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA40625-1189 vector deposited on April 21, 1998 as ATCC 209788. 35 4. PRO284 Applicants have identified a cDNA clone that encodes a novel transmembrane polypeptide, wherein the polypeptide is designated in the present application as "PR0284". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0284 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0284 polypeptide 51 WO 99/46281 PCTIUS99/05028 having amino acid residues 1 to 285 of Figure 11 (SEQ ID NO:28), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0284 polypeptide having amino acid residues about 25 to 285 of Figure 11 (SEQ ID NO:28) or 1 or about 25 to X of Figure 11 (SEQ ID NO:28), where X is any amino acid from 71 to 80 of Figure 11 (SEQ ID NO:28), or is complementary to such 5 encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA23318-1211 vector deposited on April 21, 1998 as ATCC 209787 which includes the nucleotide sequence encoding PR0284. In another embodiment, the invention provides isolated PR0284 polypeptide. In particular, the invention provides isolated native sequence PR0284 polypeptide, which in one embodiment, includes an amino acid sequence 10 comprising residues 1 to 285 of Figure 11 (SEQ ID NO:28). Additional embodiments of the present invention are directed to isolated PRO284 polypeptides comprising amino acids about 25 to 285 of Figure 11 (SEQ ID NO:28) or 1 or about 25 to X of Figure 11 (SEQ ID NO:28), where X is any amino acid from 71 to 80 of Figure 11 (SEQ ID NO:28). Optionally, the PRO284 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA23318-1211 vector deposited on April 21, 1998 as ATCC 209787. 15 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA12982 which comprises the nucleotide sequence of SEQ ID NO:29. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA15886 which comprises the nucleotide sequence of SEQ ID NO:30. 20 5. PR0296 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to the sarcoma amplified protein SAS, wherein the polypeptide is designated in the present application as "PR0296". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0296 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0296 polypeptide 25 having amino acid residues 1 to 204 of Figure 15 (SEQ ID NO:36), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0296 polypeptide having amino acid residues about 35 to 204 of Figure 15 (SEQ ID NO:36) or amino acid 1 or about 35 to X of Figure 15 (SEQ ID NO:36), where X is any amino acid from 42 to 51 of Figure 15 (SEQ ID NO:36), or is complementary to 30 such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA39979 1213 vector deposited on April 21, 1998 as ATCC 209789 which includes the nucleotide sequence encoding PR0296. In another embodiment, the invention provides isolated PR0296 polypeptide. In particular, the invention provides isolated native sequence PR0296 polypeptide, which in one embodiment, includes an amino acid sequence 35 comprising residues 1 to 204 of Figure 15 (SEQ ID NO:36). Additional embodiments of the present invention are directed to PR0296 polypeptides comprising amino acids about 35 to 204 of Figure 15 (SEQ ID NO:36) or amino acid 1 or about 35 to X of Figure 15 (SEQ ID NO:36), where X is any amino acid from 42 to 51 of Figure 15 (SEQ ID NO:36). Optionally, the PRO296 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA39979-1213 vector deposited on April 21, 1998 as ATCC 209789. 52 WO 99/46281 PCT/US99/05028 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA23020 comprising the nucleotide sequence of SEQ ID NO:37. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA21971 comprising the nucleotide sequence of SEQ ID NO:38. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as 5 DNA29037 comprising the nucleotide sequence of SEQ ID NO:39. 6. PRO329 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to a high affinity immunoglobulin Fc receptor, wherein the polypeptide is designated in the present application as "PR0329". 10 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0329 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0329 polypeptide having amino acid residues I to 359 of Figure 20 (SEQ ID NO:45), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA40594-1233 vector 15 deposited on February 5, 1998 as ATCC 209617 which includes the nucleotide sequence encoding PR0329. In another embodiment, the invention provides isolated PR0329 polypeptide. In particular, the invention provides isolated native sequence PR0329 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 359 of Figure 20 (SEQ ID NO:45). Optionally, the PR0329 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA40594-1233 vector deposited on 20 February 5, 1998 as ATCC 209617. 7. PRO362 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to A33 antigen and HCAR membrane-bound protein, wherein the polypeptide is designated in the present application as "PR0362". 25 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0362 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0362 polypeptide having amino acid residues 1 to 321 of Figure 22 (SEQ ID NO:52), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0362 polypeptide having 30 amino acid residues 1 to X of Figure 22 (SEQ ID NO:52) where X is any amino acid from amino acid 271 to 280, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45416-1251 vector deposited on February 5, 1998 as ATCC 209620 which includes the nucleotide sequence encoding PR0362. 35 In another embodiment, the invention provides isolated PR0362 polypeptide. In particular, the invention provides isolated native sequence PR0362 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 321 of Figure 22 (SEQ ID NO:52). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0362 polypeptide comprising amino acids 1 to X of the amino acid sequence shown in Figure 22 (SEQ ID NO:52), wherein X is any amino acid from amino acid 271 to 280. 53 WO 99/46281 PCT/US99/05028 Optionally, the PR0362 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA45416-1251 vector deposited on February 5, 1998 as ATCC 209620. 8. PR0363 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to the cell 5 surface receptor protein HCAR, wherein the polypeptide is designated in the present application as "PR0363". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0363 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0363 polypeptide having amino acid residues 1 to 373 of Figure 24 (SEQ ID NO:59), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 10 conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PR0363 extracellular domain polypeptide having amino acid residues I to X of Figure 24 (SEQ ID NO:59) where X is any amino acid from amino acid 216 to amino acid 225, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45419-1252 vector deposited on February 5, 1998 as ATCC 209616 15 which includes the nucleotide sequence encoding PRO363. In another embodiment, the invention provides isolated PR0363 polypeptide. In particular, the invention provides isolated native sequence PR0363 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 373 of Figure 24 (SEQ ID NO:59). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0363 polypeptide, wherein that extracellular domain may 20 comprise amino acids 1 to X of the sequence shown in Figure 24 (SEQ ID NO:59), where X is any amino acid from amino acid 216 to 225. Optionally, the PR0363 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA45419-1252 vector deposited on February 5, 1998 as ATCC 209616. 25 9. PRO868 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to tumor necrosis factor receptor, wherein the polypeptide is designated in the present application as "PR0868". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0868 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0868 polypeptide 30 having amino acid residues 1 to 655 of Figure 26 (SEQ ID NO:64), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0868 polypeptide having amino acid residues 1 to X of Figure 26 (SEQ ID NO:64), where X is any amino acid from amino acid 343 to 352 of the sequence shown in Figure 26 (SEQ ID NO:64), or is complementary to such encoding nucleic acid sequence, 35 and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In yet another aspect, the isolated nucleic acid comprises DNA encoding the PR0868 polypeptide having amino acid residues X to 655 of Figure 26 (SEQ ID NO:64), where X is any amino acid from amino acid 371 to 380 of the sequence shown in Figure 26 (SEQ ID NO:64), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated 54 WO 99/46281 PCT/US99/05028 nucleic acid sequence may comprise the cDNA insert of the DNA52594-1270 vector deposited on March 17, 1998 as ATCC 209679 which includes the nucleotide sequence encoding PR0868. In another embodiment, the invention provides isolated PR0868 polypeptide. In particular, the invention provides isolated native sequence PR0868 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 655 of Figure 26 (SEQ ID NO:64). In another aspect, the isolated PR0868 polypeptide 5 comprises amino acid residues 1 to X of Figure 26 (SEQ ID NO:64), where X is any amino acid from amino acid 343 to 352 of the sequence shown in Figure 26 (SEQ ID NO:64). In yet another aspect, the PR0868 polypeptide comprises amino acid residues X to 655 of Figure 26 (SEQ ID NO:64), where X is any amino acid from amino acid 371 to 380 of the sequence shown in Figure 26 (SEQ ID NO:64). Optionally, the PR0868 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA52594-1270 vector deposited 10 on March 17, 1998 as ATCC 209679. 10. PRO382 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to seine proteases, wherein the polypeptide is designated in the present application as "PRO382". 15 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0382 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0382 polypeptide having amino acid residues 1 to 453 of Figure 28 (SEQ ID NO:69), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45234-1277 vector 20 deposited on March 5, 1998 as ATCC 209654 which includes the nucleotide sequence encoding PR0382. In another embodiment, the invention provides isolated PR0382 polypeptide. In particular, the invention provides isolated native sequence PR0382 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 453 of Figure 28 (SEQ ID NO:69). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0382 polypeptide, with or without the signal peptide. Optionally, 25 the PR0382 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA45234-1277 vector deposited on March 5, 1998 as ATCC 209654. 11. PR0545 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to meltrin, 30 wherein the polypeptide is designated in the present application as "PR0545". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO545 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0545 polypeptide having amino acid residues 1 to 735 of Figure 30 (SEQ ID NO:74), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 35 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 5, 1998 as ATCC 209655 which includes the nucleotide sequence encoding PR0545. In another embodiment, the invention provides isolated PR0545 polypeptide. In particular, the invention provides isolated native sequence PR0545 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 735 of Figure 30 (SEQ ID NO:74). An additional embodiment of the present invention is 55 WO 99/46281 PCT/US99/05028 directed to an isolated extracellular domain of a PRO545 polypeptide. Optionally, the PR0545 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on March 5, 1998 as ATCC 209655. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA13217 comprising the nucleotide sequence of SEQ ID NO:75 (Figure 31). 5 12. PR0617 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to CD24, wherein the polypeptide is designated in the present application as "PRO617". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 10 PR0617 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0617 polypeptide having amino acid residues 1 to 67 of Figure 33 (SEQ ID NO:85), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48309-1280 vector deposited on March 5, 1998 as ATCC 209656 which includes the nucleotide sequence encoding PR0617. 15 In another embodiment, the invention provides isolated PR0617 polypeptide. In particular, the invention provides isolated native sequence PR0617 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 67 of Figure 33 (SEQ ID NO:85). Optionally, the PR0617 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA48309-1280 vector deposited on March 5, 1998 as ATCC 209656. 20 13. PRO700 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to protein disulfide isomerase, wherein the polypeptide is designated in the present application as "PRO700". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 25 PRO700 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO700 polypeptide having amino acid residues 1 to 432 of Figure 35 (SEQ ID NO:90), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PRO700 polypeptide having amino acid residues from about 34 to 432 of Figure 35 (SEQ ID NO:90), or is complementary to such encoding 30 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 31, 1998 as ATCC 209721 which includes the nucleotide sequence encoding PRO700. In another embodiment, the invention provides isolated PRO700 polypeptide. In particular, the invention provides isolated native sequence PRO700 polypeptide, which in one embodiment, includes an amino acid sequence 35 comprising residues 1 to 432 of Figure 35 (SEQ ID NO:90). In another embodiment, the invention provides an isolated PRO700 polypeptide absent the signal sequence, which includes an amino acid sequence comprising residues from about 34 to 432 of Figure 35 (SEQ ID NO:90). Optionally, the PRO700 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on March 31, 1998 as ATCC 209721. 56 WO 99/46281 PCT/US99/05028 14. PR0702 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to conglutinin, wherein the polypeptide is designated in the present application as "PR0702". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0702 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO702 polypeptide 5 having amino acid residues 1 to 277 of Figure 37 (SEQ ID NO:97), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0702 polypeptide having amino acid residues 26 to 277 of Figure 37 (SEQ ID NO:97), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. 10 The isolated nucleic acid sequence may comprise the cDNA insert of the DNA50980-1286 vector deposited on March 31, 1998 as ATCC 209717 which includes the nucleotide sequence encoding PR0702. In another embodiment, the invention provides isolated PR0702 polypeptide. In particular, the invention provides isolated native sequence PR0702 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 277 of Figure 37 (SEQ ID NO:97). An additional embodiment of the present invention is 15 directed to an isolated PR0702 polypeptide comprising amino acid residues 26 to 277 of Figure 37 (SEQ ID NO:97). Optionally, the PR0702 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA50980-1286 vector deposited on March 31, 1998 as ATCC 209717. 15. PR0703 20 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to VLCAS, wherein the polypeptide is designated in the present application as "PR0703". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0703 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO703 polypeptide having amino acid residues 1 to 730 of Figure 39 (SEQ ID NO: 102), or is complementary to such encoding nucleic 25 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0703 polypeptide having amino acid residues from about 43 to 730 of Figure 39 (SEQ ID NO: 102), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA50913-1287 vector 30 deposited on March 31, 1998 as ATCC 209716 which includes the nucleotide sequence encoding PR0703. In another embodiment, the invention provides isolated PRO703 polypeptide. In particular, the invention provides isolated native sequence PR0703 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 730 of Figure 39 (SEQ ID NO: 102). In another embodiment, the invention provides an isolated PRO703 polypeptide absent the signal sequence, which includes an amino acid sequence comprising residues 35 from about 43 to 730 of Figure 30 (SEQ ID NO: 102). Optionally, the PRO730 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA50913-1287 vector deposited on March 31, 1998 as ATCC 209716. 57 WO 99/46281 PCT/US99/05028 16. PR0705 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to K-glypican, wherein the polypeptide is designated in the present application as "PR0705". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0705 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0705 polypeptide 5 having amino acid residues 1 to 555 of Figure 41 (SEQ ID NO: 109), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0705 polypeptide having amino acid residues about 24 to 555 of Figure 41 (SEQ ID NO: 109), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 10 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA50914-1289 vector deposited on March 31, 1998 as ATCC 209722 which includes the nucleotide sequence encoding PR0705. In another embodiment, the invention provides isolated PRO705 polypeptide. In particular, the invention provides isolated native sequence PRO705 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 555 of Figure 41 (SEQ ID NO: 109). An additional embodiment of the present invention 15 is directed to an isolated PR0705 polypeptide comprising amino acid residues about 24 to 555 of Figure 41 (SEQ ID NO: 109). Optionally, the PRO705 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA50914-1289 vector deposited on March 31, 1998 as ATCC 209722. 17. PR0708 20 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to the aryl sulfatases, wherein the polypeptide is designated in the present application as "PR0708". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0708 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0708 polypeptide having amino acid residues 1 to 515 of Figure 43 (SEQ ID NO: 114), or is complementary to such encoding nucleic 25 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48296-1292 vector deposited on March 11, 1998 as ATCC 209668 which includes the nucleotide sequence encoding PR0708. In another embodiment, the invention provides isolated PR0708 polypeptide. In particular, the invention provides isolated native sequence PR0708 polypeptide, which in one embodiment, includes an amino acid sequence 30 comprising residues 1 to 515 of Figure 43 (SEQ ID NO:114). Another embodiment is directed to a PR0708 polypeptide comprising residues 38-515 of the amino acid sequence shown in Figure 43 (SEQ ID NO:114). Optionally, the PRO708 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA48296-1292 vector deposited on March 11, 1998 as ATCC 209668. 35 18. PRO320 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to fibulin, wherein the polypeptide is designated in the present application as "PRO320". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0320 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0320 polypeptide 58 WO 99/46281 PCT/US99/05028 having amino acid residues 1 to 338 of Figure 45 (SEQ ID NO: 119), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 11, 1998 as ATCC 209670 which includes the nucleotide sequence encoding PR0320. In another embodiment, the invention provides isolated PR0320 polypeptide. In particular, the invention 5 provides isolated native sequence PR0320 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 338 of Figure 45 (SEQ ID NO: 119). Optionally, the PR0320 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on March 11, 1998 as ATCC 209670. 10 19. PRO324 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to oxidoreductases, wherein the polypeptide is designated in the present application as "PR0324". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0324 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0324 polypeptide 15 having amino acid residues 1 to 289 of Figure 47 (SEQ ID NO: 124), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0324 polypeptide having amino acid residues 1 or about 32 to X of Figure 47 (SEQ ID NO:124), where X is any amino acid from 131 to 140, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, 20 and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA36343-1310 vector deposited on March 30, 1998 as ATCC 209718 which includes the nucleotide sequence encoding PR0324. In another embodiment, the invention provides isolated PR0324 polypeptide. In particular, the invention provides isolated native sequence PR0324 polypeptide, which in one embodiment, includes an amino acid sequence 25 comprising residues 1 to 289 of Figure 47 (SEQ ID NO:124). The invention also provides isolated PR0324 polypeptide comprising residues 1 or about 32 to X of Figure 47 (SEQ ID NO: 124), wherein X is any amino acid from about 131-140. Optionally, the PR0324 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA36343-1310 vector deposited on March 30, 1998 as ATCC 209718. 30 20. PRO51 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to prostasin, wherein the polypeptide is designated in the present application as "PR0351 ". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0351 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0351 polypeptide 35 having amino acid residues 1 to 571 of Figure 49 (SEQ ID NO: 132), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0351 polypeptide having amino acid residues about 16 to 571 of Figure 49 (SEQ ID NO:132), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 59 WO 99/46281 PCT/US99/05028 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA40571-1315 vector deposited on April 21, 1998 as ATCC 209784 which includes the nucleotide sequence encoding PRO351. In another embodiment, the invention provides isolated PR0351 polypeptide. In particular, the invention provides isolated native sequence PRO351 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 571 of Figure 49 (SEQ ID NO: 132). In another embodiment, the invention provides an 5 isolated PR0351 polypeptide absent the signal sequence, which includes an amino acid sequence comprising residues from about 16 to 571 of Figure 49 (SEQ ID NO:132). Optionally, the PR0351 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA40571-1315 vector deposited on April 21, 1998 as ATCC 209784. 10 21. PRO352 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to butyrophilin, wherein the polypeptide is designated in the present application as "PR0352". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0352 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0352 polypeptide 15 having amino acid residues 1 to 316 of Figure 51 (SEQ ID NO: 137), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0352 polypeptide having amino acid residues of about 29 to 316 of Figure 51 (SEQ ID NO:137), or 1 or about 29 to X of Figure 51, where X is any amino acid from 246 to 255, or is complementary to such encoding nucleic acid sequence, and remains 20 stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA41386-1316 vector deposited on March 26, 1998 as ATCC 209703 which includes the nucleotide sequence encoding PR0352. In another embodiment, the invention provides isolated PR0352 polypeptide. In particular, the invention provides isolated native sequence PR0352 polypeptide, which in one embodiment, includes an amino acid sequence 25 comprising residues 1 to 316 of Figure 51 (SEQ ID NO: 137). In other embodiments, the invention provides isolated PRO352 polypeptide comprising residues about 29 to 316 of Figure 51 (SEQ ID NO:137) and 1 or about 29 to X of Figure 51 (SEQ ID NO:137), wherein X is any amino acid from 246 to 255. Optionally, the PR0352 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA41386-1316 vector deposited on March 26, 1998 as ATCC 209703. 30 22. PR0381 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to immunophilin proteins, wherein the polypeptide is designated in the present application as "PR0381". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 35 PR0381 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0381 polypeptide having amino acid residues 1 to 211 of Figure 53 (SEQ ID NO: 145), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0381 polypeptide having amino acid residues about 21 to 211 of Figure 53 (SEQ ID NO: 145), or is complementary to such encoding nucleic 60 WO 99/46281 PCT/US99/05028 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA44194-1317 vector deposited on April 28, 1998 as ATCC 209808 which includes the nucleotide sequence encoding PRO381. In another embodiment, the invention provides isolated PR0381 polypeptide. In particular, the invention provides isolated native sequence PR0381 polypeptide, which in one embodiment, includes an amino acid sequence 5 comprising residues 1 to 211 of Figure 53 (SEQ ID NO:145). Another embodiment is directed to a PR0381 plypeptide comprising amino acids about 21 to 211 of Figure 53 (SEQ ID NO: 145). Optionally, the PR0381 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA44194 1317 vector deposited on April 28, 1998 as ATCC 209808. 10 23. PR0386 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to the beta-2 subunit of a sodium channel, wherein the polypeptide is designated in the present application as "PR0386". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0386 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0386 polypeptide 15 having amino acid residues 1 to 215 of Figure 55 (SEQ ID NO:150), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0386 polypeptide having amino acid residues about 21 to 215 of Figure 55 (SEQ ID NO:150) or 1 or about 21 to X, where X is any amino acid from 156 to 165 of Figure 55 (SEQ ID NO: 150), or is complementary to such encoding nucleic acid sequence, 20 and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45415-1318 vector deposited on April 28, 1998 as ATCC 209810 which includes the nucleotide sequence encoding PR0386. In another embodiment, the invention provides isolated PR0386 polypeptide. In particular, the invention provides isolated native sequence PR0386 polypeptide, which in one embodiment, includes an amino acid sequence 25 comprising residues 1 to 215 of Figure 55 (SEQ ID NO:150). Other embodiments of the present invention are directed to PR0386 polypeptides comprising amino acids about 21 to 215 of Figure 55 (SEQ ID NO: 150) and 1 or about 21 to X of Figure 55 (SEQ ID NO: 150), wherein X is any amino acid from 156 to 165 of Figure 55 (SEQ ID NO: 150). Optionally, the PR0386 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA45415-1318 vector deposited on April 28, 1998 as ATCC 209810. 30 In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO: 151 which corrsponds to an EST designated herein as DNA23350. In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO:152 which corrsponds to an EST designated herein as DNA23536. 35 24. PRO540 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to LCAT, wherein the polypeptide is designated in the present application as "PR0540". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO540 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO540 polypeptide 61 WO 99/46281 PCT/US99/05028 having amino acid residues 1 to 412 of Figure 59 (SEQ ID NO: 157), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0540 polypeptide having amino acid residues about 29 to 412 of Figure 59 (SEQ ID NO: 157), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 5 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA44189-1322 vector deposited on March 26, 1998 as ATCC 209699 which includes the nucleotide sequence encoding PRO540. In another embodiment, the invention provides isolated PR0540 polypeptide. In particular, the invention provides isolated native sequence PR0540 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 412 of Figure 59 (SEQ ID NO:157). The invention also provides isolated PR0540 10 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues about 29 to 412 of Figure 59 (SEQ ID NO: 157). Optionally, the PR0540 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA44189-1322 vector deposited on March 26, 1998 as ATCC 209699. 15 25. PR0615 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to synaptogyrin, wherein the polypeptide is designated in the present application as "PRO615". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0615 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0615 polypeptide 20 having amino acid residues 1 to 224 of Figure 61 (SEQ ID NO: 162), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0615 polypeptide having amino acid residues X to 224 of Figure 61 (SEQ ID NO:162), where X is any amino acid from 157 to 166, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and 25 optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48304-1323 vector deposited on April 28, 1998 as ATCC 209811 which includes the nucleotide sequence encoding PR0615. In another embodiment, the invention provides isolated PR0615 polypeptide. In particular, the invention provides isolated native sequence PR0615 polypeptide, which in one embodiment, includes an amino acid sequence 30 comprising residues 1 to 224 of Figure 61 (SEQ ID NO: 162). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0615 polypeptide which comprises amino acid residues X to 224 of Figure 61 (SEQ ID NO:162), where X is any amino acid from 157 to 166 of Figure 61 (SEQ ID NO:162). Optionally, the PR0615 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA48304-1323 vector deposited on April 28, 1998 as ATCC 209811. 35 26. PR0618 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to enteropeptidase, wherein the polypeptide is designated in the present application as "PR0618". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 62 WO 99/46281 PCTIUS99/05028 PR0618 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0618 polypeptide having amino acid residues 1 to 802 of Figure 63 (SEQ ID NO: 169), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding an isolated extracellular domain of a PR0618 polypeptide having amino acid residues X to 802 of Figure 63 (SEQ ID NO:169), where X is any amino 5 acid from 63 to 72 of Figure 63 (SEQ ID NO:169), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA49152-1324 vector deposited on April 28, 1998 as ATCC 209813 which includes the nucleotide sequence encoding PR0618. In another embodiment, the invention provides isolated PR0618 polypeptide. In particular, the invention 10 provides isolated native sequence PRO618 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 802 of Figure 63 (SEQ ID NO: 169). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PRO618 polypeptide comprising amino acid X to 802 where X is any amino acid from 63 to 72 of Figure 63 (SEQ ID NO: 169). Optionally, the PRO618 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA49152-1324 vector deposited 15 on April 28, 1998 as ATCC 209813. In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO:170, designated herein as DNA35597 (see Figure 64). 27. PR0719 20 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to lipoprotein lipase H, wherein the polypeptide is designated in the present application as "PR0719". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO719 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO719 polypeptide having amino acid residues 1 to 354 of Figure 66 (SEQ ID NO: 178), or is complementary to such encoding nucleic 25 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0719 polypeptide having amino acid residues about 17 to 354 of Figure 66 (SEQ ID NO: 178), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA49646-1327 vector 30 deposited on March 26, 1998 as ATCC 209705 which includes the nucleotide sequence encoding PR0719. In another embodiment, the invention provides isolated PRO719 polypeptide. In particular, the invention provides isolated native sequence PRO719 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 354 of Figure 66 (SEQ ID NO: 178). In another embodiment, the invention provides isolated PR0719 polypeptide which comprises residues about 17 to 354 of Figure 66 (SEQ ID NO: 178). Optionally, the 35 PR0719 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA49646-1327 vector deposited on March 26, 1998 as ATCC 209705. 63 WO 99/46281 PCT/US99/05028 28. PR0724 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to the LDL receptor, wherein the polypeptide is designated in the present application as "PR0724". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0724 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0724 polypeptide 5 having amino acid residues I to 713 of Figure 68 (SEQ ID NO: 183), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a soluble PR0724 polypeptide having amino acid residues I to X of Figure 68 (SEQ ID NO: 183) where X is any amino acid from amino acid 437 to 446, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least 10 moderate, and optionally, under high stringency conditions. The above two polypeptides may either possess or not possess the signal peptide. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA49631-1328 vector deposited on April 28, 1998 as ATCC 209806 which includes the nucleotide sequence encoding PR0724. In another embodiment, the invention provides isolated PR0724 polypeptide. In particular, the invention provides isolated native sequence PR0724 polypeptide, which in one embodiment, includes an amino acid sequence 15 comprising residues I to 713 of Figure 68 (SEQ ID NO:183). In another embodiment, the invention provides isolated soluble PR0724 polypeptide. In particular, the invention provides isolated soluble PR0724 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to X of Figure 68 (SEQ ID NO: 183), where X is any amino acid from 437 to 446 of the sequence shown in Figure 68 (SEQ ID NO: 183). Optionally, the PRO724 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA4963 1 20 1328 vector deposited on April 28, 1998 as ATCC 209806. 29. PR0772 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to A4 protein, wherein the polypeptide is designated in the present application as "PR0772". 25 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0772 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0772 polypeptide having amino acid residues 1 to 152 of Figure 70 (SEQ ID NO: 190), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0772 polypeptide having 30 amino acid residues 1 to X of Figure 70 (SEQ ID NO: 190), where X is any amino acid from 21 to 30 of Figure 70 (SEQ ID NO: 190), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA49645-1347 vector deposited on April 28, 1998 as ATCC 209809 which includes the nucleotide sequence encoding PR0772. 35 In another embodiment, the invention provides isolated PR0772 polypeptide. In particular, the invention provides isolated native sequence PR0772 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 152 of Figure 70 (SEQ ID NO: 190). Additional embodiments of the present invention are directed to PR0772 polypeptides comprising amino acids 1 to X of Figure 70 (SEQ ID NO: 190), where X is any amino acid from 21 to 30 of Figure 70 (SEQ ID NO: 190). Optionally, the PR0772 polypeptide is obtained or is 64 WO 99/46281 PCT/US99/05028 obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA49645-1347 vector deposited on April 28, 1998 as ATCC 209809. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA43509 comprising the nucleotide sequence of SEQ ID NO:191 (Figure 71). 5 30. PR0852 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to various protease enzymes, wherein the polypeptide is designated in the present application as "PR0852". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO852 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO852 polypeptide 10 having amino acid residues 1 to 518 of Figure 73 (SEQ ID NO: 196), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0852 polypeptide having amino acid residues about 21 to 518 of Figure 73 (SEQ ID NO:196) or 1 or about 21 to X of Figure 73 (SEQ ID NO: 196) where X is any amino acid from amino acid 461 to amino acid 470 of Figure 73 (SEQ ID NO: 196), or is 15 complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45493-1349 vector deposited on April 28, 1998 as ATCC 209805 which includes the nucleotide sequence encoding PR0852. In another embodiment, the invention provides isolated PR0852 polypeptide. In particular, the invention 20 provides isolated native sequence PRO852 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 518 of Figure 73 (SEQ ID NO: 196). In other embodiments, the PRO852 comprises amino acids about 21 to amino acid 518 of Figure 73 (SEQ ID NO:196) or amino acids 1 or about 21 to X of Figure 73 (SEQ ID NO:196), where X is any amino acid from amino acid 461 to amino acid 470 of Figure 73 (SEQ ID NO: 196). Optionally, the PRO852 polypeptide is obtained or is obtainable by expressing the polypeptide encoded 25 by the cDNA insert of the DNA45493-1349 vector deposited on April 28, 1998 as ATCC 209805. 31. PRO853 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to reductase, wherein the polypeptide is designated in the present application as "PRO853". 30 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0853 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0853 polypeptide having amino acid residues 1 to 377 of Figure 75 (SEQ ID NO:206), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0853 polypeptide having 35 amino acid residues about 17 to 377 of Figure 75 (SEQ ID NO:206), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48227-1350 vector deposited on April 28, 1998 as ATCC 209812 which includes the nucleotide sequence encoding PRO853. In another embodiment, the invention provides isolated PR0853 polypeptide. In particular, the invention 65 WO 99/46281 PCT/US99/05028 provides isolated native sequence PRO853 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 377 of Figure 75 (SEQ ID NO:206). In another embodiment, the invention provides an isolated PRO853 polypeptide absent the signal sequence, which includes an amino acid sequence comprising residues from about 17 to 377 of Figure 75 (SEQ ID NO:206). Optionally, the PRO853 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA48227-1350 vector deposited on 5 April 28, 1998 as ATCC 209812. 32. PR0860 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to neurofascin, wherein the polypeptide is designated in the present application as "PR0860". 10 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0860 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO860 polypeptide having amino acid residues 1 to 985 of Figure 77 (SEQ ID NO:21 1), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PRO860 polypeptide having 15 amino acid residues 1 to X of Figure 77 (SEQ ID NO:21 1), where X is any amino acid from 443-452 of Figure 77 (SEQ ID NO:21 1), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA41404-1352 vector deposited on May 6, 1998 as ATCC 209844 which includes the nucleotide sequence encoding PR0860. 20 In another embodiment, the invention provides isolated PR0860 polypeptide. In particular, the invention provides isolated native sequence PR0860 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 985 of Figure 77 (SEQ ID NO:21 1). In another embodiment, the invention provides an isolated PR0860 polypeptide which includes an amino acid sequence comprising residues 1 to X of Figure 77 (SEQ ID NO:211), where X is any amino acid residue from 443 to 452 of Figure 77 (SEQ ID NO:211). Optionally, the 25 PR0860 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA41404-1352 vector deposited on May 6, 1998 as ATCC 209844. 33. PR0846 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to 30 CMRF35, wherein the polypeptide is designated in the present application as "PR0846". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0846 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0846 polypeptide having amino acid residues 1 to 332 of Figure 79 (SEQ ID NO:216), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 35 conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0846 polypeptide having amino acid residues about 18 to 332 of Figure 79 (SEQ ID NO:216) or 1 or about 18 to X of SEQ ID NO:216, where X is any amino acid from 243 to 252 of Figure 79 (SEQ ID NO:216), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA44196-1353 vector 66 WO 99/46281 PCT/US99/05028 deposited on May 6, 1998 as ATCC 209847 which includes the nucleotide sequence encoding PRO846. In another embodiment, the invention provides isolated PR0846 polypeptide. In particular, the invention provides isolated native sequence PR0846 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 332 of Figure 79 (SEQ ID NO:216). In other embodiments, the invention provides an isolated PRO846 polypeptide absent the signal sequence, which includes an amino acid sequence comprising residues 5 from about 18 to 332 of Figure 79 (SEQ ID NO:216). Additional embodiments of the present invention are directed to an isolated PRO846 polypeptide comprising amino acid 1 or about 18 to X of Figure 79 (SEQ ID NO:216), where X is any amino acid from 243 to 252 of Figure 79 (SEQ ID NO:216). Optionally, the PR0846 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA44196-1353 vector deposited on May 6, 1998 as ATCC 209847. 10 34. PR0862 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to lysozyme, wherein the polypeptide is designated in the present application as "PR0862". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 15 PRO862 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0862 polypeptide having amino acid residues 1 to 146 of Figure 81 (SEQ ID NO:221), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0862 polypeptide having amino acid residues about 19 to 146 of Figure 81 (SEQ ID NO:221), or is complementary to such encoding nucleic 20 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA52187-1354 vector deposited on May 6, 1998 as ATCC 209845 which includes the nucleotide sequence encoding PR0862. In another embodiment, the invention provides isolated PR0862 polypeptide. In particular, the invention provides isolated native sequence PR0862 polypeptide, which in one embodiment, includes an amino acid sequence 25 comprising residues 1 to 146 of Figure 81 (SEQ ID NO:221). In another embodiment, the invention provides an isolated PR0862 polypeptide absent the signal sequence, which includes an amino acid sequence comprising residues from about 19 to 146 of Figure 81 (SEQ ID NO:221). Optionally, the PR0862 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA52187-1354 vector deposited on May 6, 1998 as ATCC 209845. 30 35. PRO864 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence similarity to Wnt-4, wherein the polypeptide is designated in the present application as "PR0864". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 35 PR0864 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0864 polypeptide having amino acid residues 1 to 351 of Figure 83 (SEQ ID NO:226), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0864 polypeptide having amino acid residues about 23 to 351 of Figure 83 (SEQ ID NO:226), or is complementary to such encoding nucleic 67 WO 99/46281 PCT/US99/05028 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48328-1355 vector deposited on May 6, 1998 as ATCC 209843 which includes the nucleotide sequence encoding PR0864. In another embodiment, the invention provides isolated PR0864 polypeptide. In particular, the invention provides isolated native sequence PR0864 polypeptide, which in one embodiment, includes an amino acid sequence 5 comprising residues 1 to 351 of Figure 83 (SEQ ID NO:226). In another embodiment, the invention provides an isolated PR0864 polypeptide absent the signal sequence, which includes an amino acid sequence comprising residues from about 23 to 351 of Figure 83 (SEQ ID NO:226). Optionally, the PRO864 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA48328-1355 vector deposited on May 6, 1998 as ATCC 209843 10 36. PR0792 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to CD23, wherein the polypeptide is designated in the present application as "PR0792". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 15 PR0792 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0792 polypeptide having amino acid residues 1 to 293 of Figure 85 (SEQ ID NO:23 1), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0792 polypeptide having amino acid residues X to 293 of Figure 85 (SEQ ID NO:231) where X is any amino acid from 50 to 59 of Figure 85 20 (SEQ ID NO:231), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA56352-1358 vector deposited on May 6, 1998 as ATCC 209846 which includes the nucleotide sequence encoding PR0792. In another embodiment, the invention provides isolated PR0792 polypeptide. In particular, the invention 25 provides isolated native sequence PR0792 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 293 of Figure 85 (SEQ ID NO:231). An additional embodiment of the present invention is directed to PRO792 polypeptide comprising amino acids X to 293 of Figure 85 (SEQ ID NO:23 1), where X is any amino acid from 50 to 59 of Figure 85 (SEQ ID NO:231). Optionally, the PR0792 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA56352-1358 vector deposited on 30 May 6, 1998 as ATCC 209846. 37. PRO866 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to mindin and spondin proteins, wherein the polypeptide is designated in the present application as "PR0866". 35 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0866 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0866 polypeptide having amino acid residues I to 331 of Figure 87 (SEQ ID NO:236), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0866 polypeptide having 68 WO 99/46281 PCT/US99/05028 amino acid residues about 27 to 229 of Figure 87 (SEQ ID NO:236), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA53971-1359 vector deposited on April 7, 1998 as ATCC 209750 which includes the nucleotide sequence encoding PR0866. In another embodiment, the invention provides isolated PR0866 polypeptide. In particular, the invention 5 provides isolated native sequence PR0866 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 331 of Figure 87 (SEQ ID NO:236). Another embodiment of the present invention is directed to PR0866 polypeptides comprising amino acids about 27 to 331 of Figure 87 (SEQ ID NO:236). Optionally, the PR0866 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA53971-1359 vector deposited on April 7, 1998 as ATCC 209750. 10 38. PR0871 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to CyP-60, wherein the polypeptide is designated in the present application as "PR0871". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 15 PR0871 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO871 polypeptide having amino acid residues 1 to 472 of Figure 89 (SEQ ID NO:245), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0871 polypeptide having amino acid residues about 22 to 472 of Figure 89 (SEQ ID NO:245), or is complementary to such encoding nucleic 20 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA50919-1361 vector deposited on May 6, 1998 as ATCC 209848 which includes the nucleotide sequence encoding PR0871. In another embodiment, the invention provides isolated PR0871 polypeptide. In particular, the invention provides isolated native sequence PR0871 polypeptide, which in one embodiment, includes an amino acid sequence 25 comprising residues 1 to 472 of Figure 89 (SEQ ID NO:245). An additional embodiment of the present invention is directed to PR0871 polypeptides comprising amino acids about 22 to 472 of Figure 89 (SEQ ID NO:245). Optionally, the PR0871 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA50919-1361 vector deposited on May 6, 1998 as ATCC 209848. 30 39. PR0873 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to carboxylesterase, wherein the polypeptide is designated in the present application as "PR0873". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0873 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0873 polypeptide 35 having amino acid residues 1 to 545 of Figure 91 (SEQ ID NO:254), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0873 polypeptide having amino acid residues about 30 to about 545 of Figure 91 (SEQ ID NO:254), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 69 WO 99/46281 PCTIUS99/05028 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA44179-1362 vector deposited on May 6, 1998 as ATCC 209851 which includes the nucleotide sequence encoding PR0873. In another embodiment, the invention provides isolated PR0873 polypeptide. In particular, the invention provides isolated native sequence PR0873 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 545 of Figure 91 (SEQ ID NO:254). Additional embodiments of the present invention are 5 directed to PR0873 polypeptides comprising amino acids about 30 to about 545 of Figure 91 (SEQ ID NO:254). Optionally, the PRO873 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA44179-1362 vector deposited on May 6, 1998 as ATCC 209851. 40. PR0940 10 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to CD33 and OB binding protein-2, wherein the polypeptide is designated in the present application as "PR0940". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0940 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0940 polypeptide having amino acid residues 1 to 544 of Figure 93 (SEQ ID NO:259), or is complementary to such encoding nucleic 15 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0940 polypeptide having amino acid residues about 16 to 544 of Figure 93 (SEQ ID NO:259) or 1 or about 16 to X of Figure 93 (SEQ ID NO:259), where X is any amino acid from 394 to 403 of Figure 93 (SEQ ID NO:259), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high 20 stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA54002-1367 vector deposited on April 7, 1998 as ATCC 209754 which includes the nucleotide sequence encoding PRO940. In another embodiment, the invention provides isolated PR0940 polypeptide. In particular, the invention provides isolated native sequence PR0940 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 544 of Figure 93 (SEQ ID NO:259). Other embodiments of the present invention are 25 directed to PR0940 polypeptides comprising amino acids about 16 to 544 of Figure 93 (SEQ ID NO:259) or 1 or about 16 to X of Figure 93 (SEQ ID NO:259), where X is any amino acid from 394 to 403 of Figure 93 (SEQ ID NO:259). Optionally, the PR0940 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA54002-1367 vector deposited on April 7, 1998 as ATCC 209754. 30 41. PR0941 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to a cadherin protein, wherein the polypeptide is designated in the present application as "PR0941". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0941 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0941 polypeptide 35 having amino acid residues 1 to 772 of Figure 95 (SEQ ID NO:264), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0941 polypeptide having amino acid residues about 22 to 772 of Figure 95 (SEQ ID NO:264) or 1 or about 22 to X of Figure 95 (SEQ ID NO:264), where X is any amino acid from 592 to 601 of Figure 95 (SEQ ID NO:264), or is complementary to such 70 WO 99/46281 PCT/US99/05028 encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA53906-1368 vector deposited on April 7, 1998 as ATCC 209747 which includes the nucleotide sequence encoding PRO941. In another embodiment, the invention provides isolated PRO941 polypeptide. In particular, the invention provides isolated native sequence PR0941 polypeptide, which in one embodiment, includes an amino acid sequence 5 comprising residues 1 to 772 of Figure 95 (SEQ ID NO:264). Additional embodiments of the present invention are directed to PR0941 polypeptides which comprise amino acid about 21 to 772 of Figure 95 (SEQ ID NO:264) or 1 or about 22 to X of Figure 95 (SEQ ID NO:264), where X is any amino acid from 592 to 601 of Figure 95 (SEQ ID NO:264). Optionally, the PR0941 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA53906-1368 vector deposited on April 7, 1998 as ATCC 209747. 10 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA6415 comprising the nucleotide sequence of Figure 96 (SEQ ID NO:265). 42. PR0944 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to Clostridium 15 perfringens enterotoxin receptor (CPE-R), wherein the polypeptide is designated in the present application as "PR0944". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0944 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0944 polypeptide having amino acid residues 1 to 211 of Figure 98 (SEQ ID NO:270), or is complementary to such encoding nucleic 20 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0944 polypeptide having amino acid residues about 22 to 229 of Figure 98 (SEQ ID NO:270) or amino acid 1 or about 22 to X of Figure 98 (SEQ ID NO:270) where X is any amino acid from 77 to 80 of Figure 98 (SEQ ID NO:270), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under 25 high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA52185 1370 vector deposited on May 14, 1998 as ATCC 209861 which includes the nucleotide sequence encoding PR0944. In another embodiment, the invention provides isolated PR0944 polypeptide. In particular, the invention provides isolated native sequence PRO944 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 211 of Figure 98 (SEQ ID NO:270). Additional embodiments of the present invention are 30 directed to PRO944 polypeptides comprising amino acids about 22 to 211 of Figure 98 (SEQ ID NO:270) or amino acid 1 or about 22 to X of Figure 98 (SEQ ID NO:270), where X is any amino acid from 77 to 86 of Figure 98 (SEQ ID NO:270). Optionally, the PRO944 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA52185-1370 vector deposited on May 14, 1998 as ATCC 209861. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as 35 DNA14007 comprising the nucleotide sequence of Figure 99 (SEQ ID NO:271). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA12733 comprising the nucleotide sequence of Figure 100 (SEQ ID NO:272). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA12746 comprising the nucleotide sequence of Figure 101 (SEQ ID NO:273). 71 WO 99/46281 PCT/US99/05028 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA12834 comprising the nucleotide sequence of Figure 102 (SEQ ID NO:274). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA12846 comprising the nucleotide sequence of Fiugure 103 (SEQ ID NO:275). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as 5 DNA13104 comprising the nucleotide sequence of Figure 104 (SEQ ID NO:276). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA13259 comprising the nucleotide sequence of Figure 105 (SEQ ID NO:277). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA13959 comprising the nucleotide sequence of Figure 106 (SEQ ID NO:278). 10 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA13961 comprising the nucleotide sequence of Figure 107 (SEQ ID NO:279). 43. PR0983 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to a vesicle 15 associated protein, VAP-33, wherein the polypeptide is designated in the present application as "PR0983". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0983 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0983 polypeptide having amino acid residues 1 to 243 of Figure 109 (SEQ ID NO:284), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 20 conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0983 polypeptide having amino acid residue 1 to X of Figure 109 (SEQ ID NO:284) where X is any amino acid from 219 to 228 of Figure 109 (SEQ ID NO:284), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA53977-1371 vector deposited on May 14, 1998 as ATCC 209862 which 25 includes the nucleotide sequence encoding PR0983. In another embodiment, the invention provides isolated PR0983 polypeptide. In particular, the invention provides isolated native sequence PR0983 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 243 of Figure 109 (SEQ ID NO:284). Additional embodiments of the present invention are directed to PR0983 polypeptides comprising amino acid 1 to X of Figure 109 (SEQ ID NO:284), where X is any 30 amino acid from 219 to 228 of Figure 109 (SEQ ID NO:284). Optionally, the PR0983 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA53977-1371 vector deposited on May 14, 1998 as ATCC 209862. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA17130 comprising the nucleotide sequence of Figure 110 (SEQ ID NO:285). 35 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA23466 comprising the nucleotide sequence of Figure 111 (SEQ ID NO:286). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA26818 comprising the nucleotide sequence of Figure 112 (SEQ ID NO:287). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as 72 WO 99/46281 PCT/US99/05028 DNA37618 comprising the nucleotide sequence of Figure 113 (SEQ ID NO:288). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA41732 comprising the nucleotide sequence of Figure 114 (SEQ ID NO:289). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA45980 comprising the nucleotide sequence of Figure 115 (SEQ ID NO:290). 5 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA46372 comprising the nucleotide sequence of Figure 116 (SEQ ID NO:291). 44. PRO1057 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to proteases, 10 wherein the polypeptide is designated in the present application as "PRO 1057". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1057 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1057 polypeptide having amino acid residues 1 to 413 of Figure 118 (SEQ ID NO:296), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 15 conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PRO1057 polypeptide having amino acid residues about 17 to 413 of Figure 118 (SEQ ID NO:296), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA57253-1382 vector deposited on May 14, 1998 as ATCC 209867 which includes the nucleotide sequence encoding PRO1057. 20 In another embodiment, the invention provides isolated PRO 1057 polypeptide. In particular, the invention provides isolated native sequence PRO1057 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 413 of Figure 118 (SEQ ID NO:296). Additional embodiments of the present invention are directed to PRO1057 polypeptides comprising amino acids about 17 to 413 of Figure 118 (SEQ ID NO:296). Optionally, the PRO1057 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA 25 insert of the DNA57253-1382 vector deposited on May 14, 1998 as ATCC 209867. 45. PRO1071 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to thrombospondin, wherein the polypeptide is designated in the present application as "PRO1071". 30 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1071 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1071 polypeptide having amino acid residues 1 to 525 of Figure 120 (SEQ ID NO:301), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PRO1071 polypeptide having 35 amino acid residues about 26 to 525 of Figure 120 (SEQ ID NO:301), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA58847-1383 vector deposited on May 20, 1998 as ATCC 209879 which includes the nucleotide sequence encoding PRO1071. In another embodiment, the invention provides isolated PRO1071 polypeptide. In particular, the invention 73 WO 99/46281 PCT/US99/05028 provides isolated native sequence PRO1071 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 525 of Figure 120 (SEQ ID NO:301). Additional embodiments of the present invention are directed to PRO1071 polypeptides comprising amino acids about 26 to 525 of Figure 120 (SEQ ID NO:301). Optionally, the PRO1071 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA58847-1383 vector deposited on May 20, 1998 as ATCC 209879. 5 46. PRO1072 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to reductase proteins, wherein the polypeptide is designated in the present application as "PRO1072". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 10 PRO1072 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1072 polypeptide having amino acid residues 1 to 336 of Figure 122 (SEQ ID NO:303), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PRO1072 polypeptide having amino acid residues about 22 to 336 of Figure 122 (SEQ ID NO:303), or is complementary to such encoding nucleic 15 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA58747-1384 vector deposited on May 14, 1998 as ATCC 209868 which includes the nucleotide sequence encoding PRO1072. In another embodiment, the invention provides isolated PRO1072 polypeptide. In particular, the invention provides isolated native sequence PRO1072 polypeptide, which in one embodiment, includes an amino acid sequence 20 comprising residues 1 to 336 of Figure 122 (SEQ ID NO:303). Additional embodiments of the present invention are directed to PRO1072 polypeptides comprising amino acids about 22 to 336 of Figure 122 (SEQ ID NO:303). Optionally, the PRO1072 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA58747-1384 vector deposited on May 14, 1998 as ATCC 209868. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as 25 DNA40210 comprising the nucleotide sequence of Figure 123 (SEQ ID NO:304). 47. PRO1075 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to protein disulfide isomerase, wherein the polypeptide is designated in the present application as "PRO1075". 30 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1075 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1075 polypeptide having amino acid residues 1 to 406 of Figure 125 (SEQ ID NO:309), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PRO1075 polypeptide having 35 amino acid residues about 30 to 406 of Figure 125 (SEQ ID NO:309), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA57689-1385 vector deposited on May 14, 1998 as ATCC 209869 which includes the nucleotide sequence encoding PRO1075. In another embodiment, the invention provides isolated PRO1075 polypeptide. In particular, the invention 74 WO 99/46281 PCT/US99/05028 provides isolated native sequence PRO1075 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 406 of Figure 125 (SEQ ID NO:309). Additional embodiments of the present invention are directed to PRO1075 polypeptides comprising amino acids about 30 to 406 of Figure 125 (SEQ ID NO:309). Optionally, the PRO1075 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA57689-1385 vector deposited on May 14, 1998 as ATCC 209869. 5 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA13059 comprising the nucleotide sequence of Figure 126 (SEQ ID NO:310). In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA19463 comprising the nucleotide sequence of Figure 127 (SEQ ID NO:311). 10 48. PRO181 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to the cornichon protein, wherein the polypeptide is designated in the present application as "PRO181". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO181 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO181 polypeptide 15 having amino acid residues 1 to 144 of Figure 129 (SEQ ID NO:322), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PRO181 polypeptide having amino acid residues about 21 to 144 of Figure 129 (SEQ ID NO:322) or amino acid 1 or about 21 to X of Figure 129 (SEQ ID NO:322) where X is any amino acid from 52 to 61 of Figure 129 (SEQ ID NO:322), or is complementary 20 to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA23330 1390 vector deposited on April 14, 1998 as ATCC 209775 which includes the nucleotide sequence encoding PRO181. In another embodiment, the invention provides isolated PRO181 polypeptide. In particular, the invention provides isolated native sequence PRO181 polypeptide, which in one embodiment, includes an amino acid sequence 25 comprising residues I to 144 of Figure 129 (SEQ ID NO:322). Additional embodiments of the present invention are directed to PRO181 polypeptides comprising amino acids about 21 to 144 of Figure 129 (SEQ ID NO:322) or amino acid 1 or about 21 to X of Figure 129 (SEQ ID NO:322), where X is any amino acid from 52 to 61 of Figure 129 (SEQ ID NO:322). Optionally, the PRO181 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA23330-1390 vector deposited on April 14, 1998 as ATCC 209775. 30 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA13242 comprising the nucleotide sequence of Figure 130 (SEQ ID NO:323). 49. PRO195 Applicants have identified a cDNA clone that encodes a novel transmembrane polypeptide, wherein the 35 polypeptide is designated in the present application as "PRO195". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO195 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO195 polypeptide having amino acid residues I to 323 of Figure 132 (SEQ ID NO:330), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 75 WO 99/46281 PCT/US99/05028 conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PRO195 polypeptide having amino acid residues about 32 to 323 of Figure 132 (SEQ ID NO:330) or amino acid 1 or about 32 to X of Figure 132 (SEQ ID NO:330) where X is any amino acid from 236 to 245 of Figure 132 (SEQ ID NO:330), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA26847 5 1395 vector deposited on April 14, 1998 as ATCC 209772 which includes the nucleotide sequence encoding PRO 195. In another embodiment, the invention provides isolated PRO195 polypeptide. In particular, the invention provides isolated native sequence PRO195 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 323 of Figure 132 (SEQ ID NO:330). Additional embodiments of the present invention are directed to PRO195 polypeptides comprising amino acids about 32 to 323 of Figure 132 (SEQ ID NO:330) or amino 10 acid 1 or about 32 to X of Figure 132 (SEQ ID NO:330), where X is any amino acid from 236 to 245 of Figure 132 (SEQ ID NO:330). Optionally, the PRO195 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA26847-1395 vector deposited on April 14, 1998 as ATCC 209772. In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of Figure 133 (SEQ ID NO:331), herein designated DNA15062. 15 In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of Figure 134 (SEQ ID NO:332), herein designated DNA13199. 50. PR0865 Applicants have identified a cDNA clone that encodes a novel secreted polypeptide, wherein the polypeptide 20 is designated in the present application as "PR0865". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO865 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0865 polypeptide having amino acid residues 1 to 468 of Figure 136 (SEQ ID NO:337), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 25 conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0865 polypeptide having amino acid residues about 24 to 229 of Figure 136 (SEQ ID NO:337), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA53974-1401 vector deposited on April 14, 1998 as ATCC 209774 which includes the nucleotide sequence encoding PR0865. 30 In another embodiment, the invention provides isolated PR0865 polypeptide. In particular, the invention provides isolated native sequence PRO865 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 468 of Figure 136 (SEQ ID NO:337). An additional embodiment of the present invention is directed to a PR0865 polypeptide comprising amino acids about 24 to 468 of Figure 136 (SEQ ID NO:337). Optionally, the PR0865 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA 35 insert of the DNA53974-1401 vector deposited on April 14, 1998 as ATCC 209774. In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of Figure 137 (SEQ ID NO:338), herein designated as DNA37642. 76 WO 99/46281 PCTIUS99/05028 51. PR0827 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to integrin proteins, wherein the polypeptide is designated in the present application as "PRO827". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO827 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO827 polypeptide 5 having amino acid residues 1 to 124 of Figure 139 (SEQ ID NO:346), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PRO827 polypeptide having amino acid residues about 23 to 124 of Figure 139 (SEQ ID NO:346), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 10 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA57039-1402 vector deposited on April 14, 1998 as ATCC 209777 which includes the nucleotide sequence encoding PR0827. In another embodiment, the invention provides isolated PR0827 polypeptide. In particular, the invention provides isolated native sequence PRO827 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 124 of Figure 139 (SEQ ID NO:346). An additional embodiment of the present invention 15 is directed to a PR0827 polypeptide comprising amino acids about 23 to 124 of Figure 139 (SEQ ID NO:346). Optionally, the PR0827 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA57039-1402 vector deposited on April 14, 1998 as ATCC 209777. 52. PRO1114 20 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to cytokine receptor family-4 proteins, wherein the polypeptide is designated in the present application as PRO1 114". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1114 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1114 polypeptide having amino acid residues 1 to 311 of Figure 142 (SEQ ID NO:352), or is complementary to such encoding nucleic 25 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PRO 1114 polypeptide having amino acid residues about 30 to 311 of Figure 142 (SEQ ID NO:352) or amino acid 1 or about 30 to X of Figure 142 (SEQ ID NO:352), where X is any amino acid from 225 to 234 of Figure 142 (SEQ ID NO:352), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and 30 optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA57033-1403 vector deposited on May 27, 1998 as ATCC 209905 which includes the nucleotide sequence encoding PRO1114. In another embodiment, the invention provides isolated PRO 1114 polypeptide. In particular, the invention provides isolated native sequence PROl 114 polypeptide, which in one embodiment, includes an amino acid sequence 35 comprising residues 1 to 311 of Figure 142 (SEQ ID NO:352). Additional embodiments of the present invention are directed to PROl 114 polypeptides comprising amino acids about 30 to 311 of Figure 142 (SEQ ID NO:352) or amino acid I or about 30 to X of Figure 142 (SEQ ID NO:352), where X is any amino acid from 225 to 234 of Figure 142 (SEQ ID NO:352). Optionally, the PRO 1114 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA57033-1403 vector deposited on May 27, 1998 as ATCC 209905. 77 WO 99/46281 PCT/US99/05028 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA48466 comprising the nucleotide sequence of Figure 143 (SEQ ID NO:353). A cDNA clone (DNA57033-1403) has been identified that encodes a novel interferon receptor polypeptide, designated in the present application as "PRO 1114 interferon receptor". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 5 PRO 1114 interferon receptor polypeptide. In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to (a) a DNA molecule encoding a PRO 1114 interferon receptor polypeptide having the sequence of amino acid residues from about 1 or about 30 to about 311, inclusive of Figure 10 142 (SEQ ID NO:352), or (b) the complement of the DNA molecule of (a). In another aspect, the invention concerns an isolated nucleic acid molecule encoding a PRO 1114 interferon receptor polypeptide comprising DNA hybridizing to the complement of the nucleic acid between about nucleotides 250 or about 337 and about 1182, inclusive, of Figure 141 (SEQ ID NO:351). Preferably, hybridization occurs under stringent hybridization and wash conditions. 15 In a further aspect, the invention concerns an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209905 (DNA57033-1403) or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA 20 encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209905 (DNA57033-1403). In still a further aspect, the invention concerns an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to the 25 sequence of amino acid residues 1 or about 30 to about 311, inclusive of Figure 142 (SEQ ID NO:352), or (b) the complement of the DNA of (a). In a further aspect, the invention concerns an isolated nucleic acid molecule having at least 10 nucleotides and produced by hybridizing a test DNA molecule under stringent conditions with (a) a DNA molecule encoding a PROl 114 interferon receptor polypeptide having the sequence of amino acid residues from 1 or about 30 to about 30 311, inclusive of Figure 142 (SEQ ID NO:352), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about an 80 % sequence identity, prefereably at least about an 85% sequence identity, more preferably at least about a 90% sequence identity, most preferably at least about a 95% sequence identity to (a) or (b), isolating the test DNA molecule. In a specific aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 35 PRO1114 interferon receptor polypeptide, with or without the N-terminal signal sequence and/or the initiating methionine, and its soluble, i.e., transmembrane domain deleted or inactivated variants, or is complementary to such encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 29 in the sequence of Figure 142 (SEQ ID NO:352). The transmembrane domain has been tentatively identified as extending from about amino acid position 230 to about amino acid position 78 WO 99/46281 PCT/US99/05028 255 in the PRO1114 interferon receptor amino acid sequence (Figure 142, SEQ ID NO:352). In another aspect, the invention concerns an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide scoring at least about 80% positives, preferably at least about 85% positives, more preferably at least about 90% positives, most preferably at least about 95% positives when compared with the amino acid sequence of residues 1 or about 30 to about 311, inclusive of Figure 142 (SEQ ID NO:352), or (b) the complement of the DNA 5 of (a). Another embodiment is directed to fragments of a PRO 1114 interferon receptor polypeptide coding sequence that may find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and most preferably from about 20 to about 40 nucleotides in length and may be derived from 10 the nucleotide sequence shown in Figure 141 (SEQ ID NO:351). In another embodiment, the invention provides a vector comprising DNA encoding PRO 1114 interferon receptor or its variants. The vector may comprise any of the isolated nucleic acid molecules hereinabove identified. A host cell comprising such a vector is also provided. By way of example, the host cells may be CHO cells, E. coli, or yeast. A process for producing PRO1114 interferon receptor polypeptides is further provided and 15 comprises culturing host cells under conditions suitable for expression of PRO 1114 interferon receptor and recovering PRO 1114 interferon receptor from the cell culture. In another embodiment, the invention provides isolated PRO 1114 interferon receptor polypeptide encoded by any of the isolated nucleic acid sequences hereinabove identified. In a specific aspect, the invention provides isolated native sequence PRO1114 interferon receptor 20 polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 1 or about 30 to about 311 of Figure 142 (SEQ ID NO:352). In another aspect, the invention concerns an isolated PRO 1114 interferon receptor polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to the 25 sequence of amino acid residues 1 or about 30 to about 311, inclusive of Figure 142 (SEQ ID NO:352). In a further aspect, the invention concerns an isolated PRO 1114 interferon receptor polypeptide, comprising an amino acid sequence scoring at least about 80% positives, preferably at least about 85% positives, more preferably at least about 90% positives, most preferably at least about 95% positives when compared with the amino acid sequence of residues 1 or about 30 to about 311, inclusive of Figure 142 (SEQ ID NO:352). 30 In yet another aspect, the invention concerns an isolated PRO1114 interferon receptor polypeptide, comprising the sequence of amino acid residues 1 or about 30 to about 311, inclusive of Figure 142 (SEQ ID NO:352), or a fragment thereof sufficient to provide a binding site for an anti-PRO 1114 interferon receptor antibody. Preferably, the PRO 1114 interferon receptor fragment retains a qualitative biological activity of a native PRO 1114 interferon receptor polypeptide. 35 In a still further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under stringent conditions with (a) a DNA molecule encoding a PRO 1114 interferon receptor polypeptide having the sequence of amino acid residues from about 1 or about 30 to about 311, inclusive of Figure 142 (SEQ ID NO:352), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about an 80% sequence identity, preferably at least about an 85% sequence identity, more preferably at least about a 90% sequence 79 WO 99/46281 PCT/US99/05028 identity, most preferably at least about a 95% sequence identity to (a) or (b), (ii) culturing a host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. In another embodiment, the invention provides chimeric molecules comprising a PRO1114 interferon receptor polypeptide fused to a heterologous polypeptide or amino acid sequence. An example of such a chimeric 5 molecule comprises a PRO 1114 interferon receptor polypeptide fused to an epitope tag sequence or a Fc region of an immunoglobulin. In another embodiment, the invention provides an antibody which specifically binds to a PROl 114 interferon receptor polypeptide. Optionally, the antibody is a monoclonal antibody. In yet another embodiment, the invention concerns agonists and antagonists of a native PROl 114 interferon 10 receptor polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1114 interferon receptor antibody. In a further embodiment, the invention concerns a method of identifying agonists or antagonists of a native PRO1 114 interferon receptor polypeptide by contacting the native PRO1 114 interferon receptor polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide. 15 In a still further embodiment, the invention concerns a composition comprising a PRO1114 interferon receptor polypeptide, or an agonist or antagonist as hereinabove defined, in combination with a pharmaceutically acceptable carrier. 53. PRO237 20 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to carbonic anhydrase, wherein the polypeptide is designated in the present application as "PR0237". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0237 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0237 polypeptide having amino acid residues 1 to 328 of Figure 145 (SEQ ID NO:358), or is complementary to such encoding nucleic 25 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0237 polypeptide having amino acid residues about 24 to 328 of Figure 145 (SEQ ID NO:358) or amino acid 1 or about 24 to X of Figure 145 (SEQ ID NO:358), where X is any amino acid from 172 to 181 of Figure 145 (SEQ ID NO:358), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and 30 optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA34353-1428 vector deposited on May 12, 1998 as ATCC 209855 which includes the nucleotide sequence encoding PRO237. In another embodiment, the invention provides isolated PR0237 polypeptide. In particular, the invention provides isolated native sequence PR0237 polypeptide, which in one embodiment, includes an amino acid sequence 35 comprising residues 1 to 328 of Figure 145 (SEQ ID NO:358). Additional embodiments of the present invention are directed to PRO237 polypeptides comprising amino acids about 24 to 328 of Figure 145 (SEQ ID NO:358) or amino acid 1 or about 24 to X of Figure 145 (SEQ ID NO:358), where X is any amino acid from 172 to 181 of Figure 145 (SEQ ID NO:358). Optionally, the PR0237 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA34353-1428 vector deposited on May 12, 1998 as ATCC 209855. 80 WO 99/46281 PCT/US99/05028 54. PR0541 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to a trypsin inhibitor protein, wherein the polypeptide is designated in the present application as "PR0541". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0541 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0541 polypeptide 5 having amino acid residues 1 to 500 of Figure 147 (SEQ ID NO:363), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0541 polypeptide having amino acid residues about 21 to 500 of Figure 147 (SEQ ID NO:363), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 10 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45417-1432 vector deposited on May 27, 1998 as ATCC 209910 which includes the nucleotide sequence encoding PR0541. In another embodiment, the invention provides isolated PR0541 polypeptide. In particular, the invention provides isolated native sequence PR0541 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 500 of Figure 147 (SEQ ID NO:363). Additional embodiments of the present invention are 15 directed to PR0541 polypeptides comprising amino acids about 21 to 500 of Figure 147 (SEQ ID NO:363). Optionally, the PR0541 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA45417-1432 vector deposited on May 27, 1998 as ATCC 209910. 55. PR0273 20 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PR0273". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0273 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0273 polypeptide having amino acid residues 1 through 111 of Figure 149 (SEQ ID NO:370), or is complementary to such encoding 25 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another embodiment, the invention provides isolated PR0273 polypeptide. In particular, the invention provides isolated native sequence PR0273 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues I through 111 of Figure 149 (SEQ ID NO:370). 30 56. PRO701 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to neuroligins 1, 2, and 3, wherein the polypeptide is designated in the present application as "PRO701". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 35 PRO701 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO701 polypeptide having amino acid residues 1 through 816 of Figure 151 (SEQ ID NO:375), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited with the ATCC on March 31, 1998 which includes the nucleotide sequence encoding PRO701. 81 WO 99/46281 PCT/US99/05028 In another embodiment, the invention provides isolated PR0701 polypeptide. In particular, the invention provides isolated native sequence PRO701 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 816 of Figure 151 (SEQ ID NO:375). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PRO701 polypeptide. Optionally, the PRO701 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector 5 deposited with the ATCC on March 31, 1998. 57. PR0704 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with VIP36, wherein the polypeptide is designated in the present application as "PR0704". 10 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0704 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO704 polypeptide having amino acid residues 1 through 348 of Figure 153 (SEQ ID NO:380), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 31, 15 1998 with the ATCC as DNA50911-1288, which includes the nucleotide sequence encoding PR0704. In another embodiment, the invention provides isolated PR0704 polypeptide. In particular, the invention provides isolated native sequence PR0704 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 348 of Figure 153 (SEQ ID NO:380). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0704 polypeptide. Optionally, the PR0704 20 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on March 31, 1998 with the ATCC as DNA50911-1288. 58. PR0706 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to prostatic acid 25 phosphatase precursor and lysosomal acid phosphatase precursor, wherein the polypeptide is designated in the present application as "PR0706". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0706 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0706 polypeptide having amino acid residues 1 through 480 of Figure 155 (SEQ ID NO:385), or is complementary to such encoding 30 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on April 21, 1998 with the ATCC as DNA48329-1290 which includes the nucleotide sequence encoding PR0706. In another embodiment, the invention provides isolated PR0706 polypeptide. In particular, the invention provides isolated native sequence PR0706 polypeptide, which in one embodiment, includes an amino acid sequence 35 comprising residues 1 through 480 of Figure 155 (SEQ ID NO:385), or comprising residues 19 through 480 of Figure 155 (SEQ ID NO:385). Optionally, the PR0706 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on April 21, 1998 with the ATCC as DNA48329 1290. 82 WO 99/46281 PCT/US99/05028 59. PR0707 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to cadherins, particularly cadherin FIB3, wherein the polypeptide is designated in the present application as "PR0707". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0707 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0707 polypeptide 5 having amino acid residues I to 916 of Figure 157 (SEQ ID NO:390), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 27, 1998 with the ATCC as DNA48306-1291 which includes the nucleotide sequence encoding PR0707. In another embodiment, the invention provides isolated PR0707 polypeptide. In particular, the invention 10 provides isolated native sequence PR0707 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 916 of Figure 157 (SEQ ID NO:390). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0707 polypeptide. Optionally, the PR0707 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 27,.1998 with the ATCC as DNA48306-1291. 15 60. PRO322 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to neuropsin, wherein the polypeptide is designated in the present application as "PR0322". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 20 PR0322 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0322 polypeptide having amino acid residues 1 or 24 through 260 of Figure 159 (SEQ ID NO:395), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 11, 1998 as ATCC no. 209669 which includes the nucleotide sequence encoding PR0322. 25 In another embodiment, the invention provides isolated PR0322 polypeptide. In particular, the invention provides isolated native sequence PR0322 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 24 through 260 of Figure 159 (SEQ ID NO:395). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0322 polypeptide. Optionally, the PR0322 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector 30 deposited on March 11, 1998 as ATCC no. 209669. 61. PRO526 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with ALS, wherein the polypeptide is designated in the present application as "PR0526". 35 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0526 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0526 polypeptide having amino acid residues 1 to 473 of Figure 161 (SEQ ID NO:400), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 26, 83 WO 99/46281 PCTIUS99/05028 1998 with the ATCC as DNA44184-1319 which includes the nucleotide sequence encoding PR0526. In another embodiment, the invention provides isolated PR0526 polypeptide. In particular, the invention provides isolated native sequence PR0526 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 473 of Figure 161 (SEQ ID NO:400). Optionally, the PR0526 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on March 26, 1998 5 with the ATCC as DNA44184-1319 which includes the nucleotide sequence encoding PR0526. 62. PR0531 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with protocadherins, wherein the polypeptide is designated in the present application as "PR0531". 10 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0531 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0531 polypeptide having amino acid residues I to 789 of Figure 163 (SEQ ID NO:405), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 26, 15 1998 as DNA48314-1320 which includes the nucleotide sequence encoding PR0531. In another embodiment, the invention provides isolated PR0531 polypeptide. In particular, the invention provides isolated native sequence PR0531 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 789 of Figure 163 (SEQ ID NO:405). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0531 polypeptide. Optionally, the PR0531 polypeptide is 20 obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on March 26, 1998 as DNA48314-1320. 63. PR0534 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with 25 disulfide isomerase (sometimes referred to herein as protein disulfide isomerase), wherein the polypeptide is designated in the present application as "PR0534". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0534 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0534 polypeptide having amino acid residues I to 360 of Figure 165 (SEQ ID NO:410), or is complementary to such encoding nucleic 30 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 26, 1998 as DNA48333-1321 which includes the nucleotide sequence encoding PR0534. In another embodiment, the invention provides isolated PR0534 polypeptide. In particular, the invention provides isolated native sequence PR0534 polypeptide, which in one embodiment, includes an amino acid sequence 35 comprising residues 1 to 360 of Figure 165 (SEQ ID NO:410). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0534 polypeptide. Optionally, the PR0534 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on March 26, 1998 as DNA48333-1321. 84 WO 99/46281 PCT/US99/05028 64. PR0697 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with sFRPs, wherein the polypeptide is designated in the present application as "PR0697". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0697 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0697 polypeptide 5 having amino acid residues I through 295 of Figure 167 (SEQ ID NO:415), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited with the ATCC on March 26, 1998 as DNA50920-1325 which includes the nucleotide sequence encoding PR0697. In another embodiment, the invention provides isolated PR0697 polypeptide. In particular, the invention 10 provides isolated native sequence PR0697 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 295 of Figure 167 (SEQ ID NO:415). Optionally, the PR0697 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited with the ATCC on March 26, 1998 as DNA50920-1325. 15 65. PR0717 Applicants have identified a cDNA clone that encodes a novel 12 transmembrane polypeptide, wherein the polypeptide is designated in the present application as "PRO717". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO717 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO717 polypeptide 20 having amino acid residues 1 through 560 of Figure 169 (SEQ ID NO:420), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on April 28, 1998 with the ATCC as DNA50988-1326 which includes the nucleotide sequence encoding PR0717. In another embodiment, the invention provides isolated PR0717 polypeptide. In particular, the invention 25 provides isolated native sequence PR0717 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 560 of Figure 169 (SEQ ID NO:420). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PRO717 polypeptide. Optionally, the PRO717 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on April 28, 1998 with the ATCC as DNA50988-1326. 30 66. PRO731 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with protocadherin 4, wherein the polypeptide is designated in the present application as "PR0731". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 35 PR0731 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0731 polypeptide having amino acid residues 1 through 1184 of Figure 171 (SEQ ID NO:425), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on March 31, 1998 with the ATCC as DNA48331-1329 which includes the nucleotide sequence encoding PR0731. 85 WO 99/46281 PCT/US99/05028 In another embodiment, the invention provides isolated PR0731 polypeptide. In particular, the invention provides isolated native sequence PR0731 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 1184 of Figure 171 (SEQ ID NO:425). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0731 polypeptide. Optionally, the PR0731 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector 5 deposited on March 31, 1998 with the ATCC as DNA48331-1329. 67. PR0218 Applicants have identified a cDNA clone that encodes a novel multi-transmembrane protein having sequence identity with membrane regulator proteins, wherein the polypeptide is designated in the present application as 10 "PR0218". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO218 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO218 polypeptide having amino acid residues 1 through 455 of Figure 173 (SEQ ID NO:430), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 15 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on April 28, 1998 with the ATCC as DNA30867-1335 which includes the nucleotide sequence encoding PR0218. In another embodiment, the invention provides isolated PR0218 polypeptide. In particular, the invention provides isolated native sequence PR0218 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 455 of Figure 173 (SEQ ID NO:430). Optionally, the PR0218 polypeptide is obtained 20 or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on April 28, 1998 with the ATCC as DNA30867-1335. In another embodiment, the invention provides an expressed sequence tag (EST) sequence comprising the nucleotide sequence of Figure 174 (SEQ ID NO:431), designated herein as DNA14472. In another embodiment, the invention provides an expressed sequence tag (EST) sequence comprising the 25 nucleotide sequence of Figure 175 (SEQ ID NO:432), designated herein as DNA15846. 68. PRO768 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with integrins, wherein the polypeptide is designated in the present application as "PR0768". 30 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0768 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0768 polypeptide having amino acid residues 1 through 1141 of Figure 177 (SEQ ID NO:437), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on April 6, 35 1998 as DNA55737-1345 which includes the nucleotide sequence encoding PR0768. In another embodiment, the invention provides isolated PR0768 polypeptide. In particular, the invention provides isolated native sequence PR0768 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 1141 of Figure 177 (SEQ ID NO:437). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0768 polypeptide. Optionally, the PR0768 86 WO 99/46281 PCT/US99/05028 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on April 6, 1998 as DNA55737-1345. 69. PRO771 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with 5 testican, wherein the polypeptide is designated in the present application as "PR0771". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0771 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0771 polypeptide having amino acid residues 1 through 436 of Figure 179 (SEQ ID NO:442), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 10 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on April 7, 1998 with the ATCC as DNA49829-1346 which includes the nucleotide sequence encoding PR0771. In another embodiment, the invention provides isolated PR0771 polypeptide. In particular, the invention provides isolated native sequence PR0771 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 436 of Figure 179 (SEQ ID NO:442). Optionally, the PR0771 polypeptide is obtained 15 or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on April 7, 1998 with the ATCC as DNA49829-1346. 70. PRO733 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with 20 the T1/ST2 receptor binding protein, wherein the polypeptide is designated in the present application as "PR0733". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0733 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0733 polypeptide having amino acid residues 1 through 229 of Figure 181 (SEQ ID NO:447), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 25 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on April 7, 1998 with the ATCC as DNA52196-1348 which includes the nucleotide sequence encoding PRO733. In another embodiment, the invention provides isolated PR0733 polypeptide. In particular, the invention provides isolated native sequence PR0733 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 229 of Figure 181 (SEQ ID NO:447). An additional embodiment of the present 30 invention is directed to an isolated extracellular domain of a PR0733 polypeptide. Optionally, the PR0733 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on April 7, 1998 as DNA52196-1348. 71. PRO162 35 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with pancreatitis-associated protein, wherein the polypeptide is designated in the present application as "PRO162". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO162 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO162 polypeptide having amino acid residues 1 through 175 of Figure 183 (SEQ ID NO:452), or is complementary to such encoding 87 WO 99/46281 PCTIUS99/05028 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 6, 1998 with the ATCC as DNA56965-1356 which includes the nucleotide sequence encoding PRO162. In another embodiment, the invention provides isolated PRO162 polypeptide. In particular, the invention provides isolated native sequence PRO162 polypeptide, which in one embodiment, includes an amino acid sequence 5 comprising residues 1 through 175 of Figure 183 (SEQ ID NO:452). Optionally, the PRO162 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 6, 1998 with the ATCC as DNA56965-1356. 72. PR0788 10 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with anti-neoplastic urinary protein, wherein the polypeptide is designated in the present application as "PR0788". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0788 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0788 polypeptide having amino acid residues 1 through 125 of Figure 185 (SEQ ID NO:454), or is complementary to such encoding 15 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 6, 1998 with the ATCC as DNA56405-1357 which includes the nucleotide sequence encoding PR0788. In another embodiment, the invention provides isolated PR0788 polypeptide. In particular, the invention provides isolated native sequence PR0788 polypeptide, which in one embodiment, includes an amino acid sequence 20 comprising residues 1 through 125 of Figure 185 (SEQ ID NO:454). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0788 polypeptide. Optionally, the PR0788 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 6, 1998 with the ATCC as DNA56405-1357. 25 73. PRO1008 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with dickkopf-1 (dkk-1), wherein the polypeptide is designated in the present application as "PRO1008". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1008 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1008 polypeptide 30 having amino acid residues 1 through 266 of Figure 187 (SEQ ID NO:456), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 20, 1998 with the ATCC as DNA57530-1375 which includes the nucleotide sequence encoding PRO1008. In another embodiment, the invention provides isolated PRO1008 polypeptide. In particular, the invention 35 provides isolated native sequence PRO1008 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 266 of Figure 187 (SEQ ID NO:456). Optionally, the PRO1008 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 20, 1998 with the ATCC as DNA57530-1375. 88 WO 99/46281 PCTIUS99/05028 In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA16508 comprising the nucleotide sequence of Figure 188 (SEQ ID NO:457). 74. PRO1012 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with 5 disulfide isomerase and phospholipase C, wherein the polypeptide is designated in the present application as "PRO1012". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1012 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1012 polypeptide having amino acid residues 1 through 747 of Figure 190 (SEQ ID NO:459), or is complementary to such encoding 10 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 14, 1998 with the ATCC as DNA56439-1376, which includes the nucleotide sequence encoding PRO1012. In another embodiment, the invention provides isolated PRO1012 polypeptide. In particular, the invention provides isolated native sequence PRO1012 polypeptide, which in one embodiment, includes an amino acid sequence 15 comprising residues 1 through 747 of Figure 190 (SEQ ID NO:459). Optionally, the PRO1012 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 14, 1998 with the ATCC as DNA56439-1376. 75. PRO1014 20 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with reductase, wherein the polypeptide is designated in the present application as "PRO1014". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1014 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1014 polypeptide having amino acid residues 1 through 300 of Figure 192 (SEQ ID NO:464), or is complementary to such encoding 25 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 20, 1998 as DNA56409-1377 with the ATCC which includes the nucleotide sequence encoding PRO1014. In another embodiment, the invention provides isolated PRO1014 polypeptide. In particular, the invention provides isolated native sequence PRO1014 polypeptide, which in one embodiment, includes an amino acid sequence 30 comprising residues 1 through 300 of Figure 192 (SEQ ID NO:464). Optionally, the PRO1014 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 20, 1998 as DNA56409-1377 with the ATCC. 76. PRO1017 35 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with HNK-1 sulfotransferase, wherein the polypeptide is designated in the present application as "PRO1017". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1017 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1017 polypeptide having amino acid residues 1 through 414 of Figure 194 (SEQ ID NO:466), or is complementary to such encoding 89 WO 99/46281 PCT/US99/05028 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 20, 1998 with the ATCC as DNA56112-1379 which includes the nucleotide sequence encoding PRO1017. In another embodiment, the invention provides isolated PRO1017 polypeptide. In particular, the invention provides isolated native sequence PRO1017 polypeptide, which in one embodiment, includes an amino acid sequence 5 comprising residues 1 through 414 of Figure 194 (SEQ ID NO:466). Optionally, the PRO1017 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 20, 1998 with the ATCC as DNA56112-1379. 77. PRO474 10 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with dehydrogenase, wherein the polypeptide is designated in the present application as "PR0474". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0474 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0474 polypeptide having amino acid residues 1 through 270 of Figure 196 (SEQ ID NO:468), or is complementary to such encoding 15 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 14, 1998 with the ATCC as DNA56045-1380 which includes the nucleotide sequence encoding PR0474. In another embodiment, the invention provides isolated PR0474 polypeptide. In particular, the invention provides isolated native sequence PR0474 polypeptide, which in one embodiment, includes an amino acid sequence 20 comprising residues 1 through 270 of Figure 196 (SEQ ID NO:468). Optionally, the PR0474 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 14, 1998 with the ATCC as DNA56045-1380. 78. PRO1031 25 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with IL-17, wherein the polypeptide is designated in the present application as "PRO1031". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1031 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1031 polypeptide having amino acid residues 1 through 180 of Figure 198 (SEQ ID NO:470), or is complementary to such encoding 30 nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 14, 1998 with the ATCC as DNA59294-1381 which includes the nucleotide sequence encoding PRO1031. In another embodiment, the invention provides isolated PRO1031 polypeptide. In particular, the invention provides isolated native sequence PRO1031 polypeptide, which in one embodiment, includes an amino acid sequence 35 comprising residues 1 through 180 of Figure 198 (SEQ ID NO:470). Optionally, the PRO1031 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 14, 1998 with the ATCC as DNA59294-1381. 90 WO 99/46281 PCT/US99/05028 79. PR0938 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity to protein disulfide isomerase, wherein the polypeptide is designated in the present application as "PR0938". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0938 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0938 polypeptide 5 having amino acid residues 1 to 349 of Figure 200 (SEQ ID NO:472), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In other aspects, the isolated nucleic acid comprises DNA encoding the PR0938 polypeptide having amino acid residues about 23 to 349 of Figure 200 (SEQ ID NO:472) or amino acid 1 or about 23 to X of Figure 200 (SEQ ID NO:472), where X is any amino acid from 186 to 195 of Figure 200 (SEQ ID NO:472), or is 10 complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA56433-1406 vector deposited on May 12, 1998, as ATCC Accession No. 209857 which includes the nucleotide sequence encoding PR0938. In another embodiment, the invention provides isolated PR0938 polypeptide. In particular, the invention 15 provides isolated native sequence PR0938 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 349 of Figure 200 (SEQ ID NO:472). Additional embodiments of the present invention are directed to PR0938 polypeptides comprising amino acids about 23 to 349 of Figure 200 (SEQ ID NO:472) or amino acid 1 or about 23 to X of Figure 200 (SEQ ID NO:472), where X is any amino acid from 186 to 195 of Figure 200 (SEQ ID NO:472). Optionally, the PR0938 polypeptide is obtained or is obtainable by expressing the polypeptide 20 encoded by the cDNA insert of the DNA56433-1406 vector deposited on May 12, 1998, as ATCC Accession No. 209857. 80. PRO1082 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with 25 a lectin-like oxidized LDL receptor, wherein the polypeptide is designated in the present application as "PRO1082". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1082 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1082 polypeptide having amino acid residues 1 through 201 of Figure 202 (SEQ ID NO:477), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 30 conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 14, 1998 with the ATCC as DNA53912-1457 which includes the nucleotide sequence encoding PRO1082. In another embodiment, the invention provides isolated PRO1082 polypeptide. In particular, the invention provides isolated native sequence PRO1082 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 201 of Figure 202 (SEQ ID NO:477). An additional embodiment of the present 35 invention is directed to an isolated domain of a PRO1082 polypeptide, excluding the transmembrane domain. Optionally, the PRO1082 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited on May 14, 1998 with the ATCC as DNA53912-1457. 91 WO 99/46281 PCT/US99/05028 81. PRO1083 Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with a 7TM receptor, latrophilin-related protein 1, and a macrophage restricted cell surface glycoprotein, wherein the polypeptide is designated in the present application as "PRO1083". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a 5 PRO1083 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1083 polypeptide having amino acid residues 1 through 693 of Figure 204 (SEQ ID NO:483), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on May 12, 1998 with the ATCC as DNA50921-1458 which includes the nucleotide sequence encoding PRO1083. 10 In another embodiment, the invention provides isolated PRO1083 polypeptide. In particular, the invention provides isolated native sequence PRO1083 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 693 of Figure 204 (SEQ ID NO:483). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PRO1083 polypeptide. Optionally, the PRO1083 polypeptide is obtained or is obtainable by expressing the polypeptide encoded by the cDNA insert of the vector 15 deposited on May 12, 1998 with the ATCC as DNA50921-1458. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA24256 which comprises the nucleotide sequence of Figure 205 (SEQ ID NO:484). 82. PRO200 20 The objects of this invention, as defined generally supra, are achieved at least in part by the provision of a novel polypeptide, VEGF-E also herein designated PR0200, (SEQ ID NO:488) and the nucleic acid encoding therefor, SEQ ID NO:487, residues 259 through 1293. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a VEGF-E polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the VEGF-E polypeptide 25 having amino acid residues 1 through 345 of Figure 207 (SEQ ID NO:488), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under low stringency conditions. In another embodiment, variants are provided wherein the VEGF-E nucleic acid has single or multiple deletions, substitutions, insertions, truncations or combinations thereof. In another embodiment, the invention provides isolated VEGF-E polypeptide. In particular, the invention 30 provides an isolated native sequence VEGF-E polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 345 of Figure 207 (SEQ ID NO:488). In another embodiment, variants are provided wherein the VEGF-E polypeptide has single or multiple deletions, substitutions, insertions, truncations or combinations thereof. In yet further embodiments, the present invention is directed to compositions useful for treating indications 35 where proliferation, survival and/or differentiation of cells is desired, comprising a therapeutically effective amount of a VEGF-E polypeptide hereof in admixture with a pharmaceutically acceptable carrier. The invention further includes associated embodiments of VEGF-E such as modified VEGF-E polypeptides and modified variants which have the same biological applications as VEGF-E, and pharmaceutical compositions incorporating same. Inhibitors of VEGF-E are also provided. 92 WO 99/46281 PCT/US99/05028 83. PR0285 and PR0286 Applicants have identified two novel cDNA clones that encode novel human Toll polypeptides, designated in the present application as PR0285 (encoded by DNA40021-1154) and PR0286 (encoded by DNA42663-1154). In one embodiment, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more 5 preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to (a) a DNA molecule encoding a PR0285 polypeptide having amino acid residues 27 to 839 of Figure 209 (SEQ ID NO:496); or (b) to a DNA molecule encoding a PRO286 polypeptide having amino acid residues 27 to 825 of Figure 211 (SEQ ID NO:498) or (c) the complement of the DNA molecule of (a) or (b). The complementary DNA molecule preferably remains stably bound to such encoding nucleic acid sequence under at least moderate, and optionally, under high 10 stringency conditions. In a further embodiment, the isolated nucleic acid molecule comprises a polynucleotide that has at least about 90%, preferably at least about 95% sequence identity with a polynucleotide encoding a polypeptide comprising the sequence of amino acids 1 to 839 of Figure 209 (SEQ ID NO:496); or at least about 90%, preferably at least about 95% sequence identity with a polynucleotide encoding a polypeptide comprising the sequence of amino acids 1 to 15 1041 of Figure 211 (SEQ ID NO:498). In a specific embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding native or variant PR0285 and PR0286 polypeptides, with or without the N-terminal signal sequence, and with or without the transmembrane regions of the respective full-length sequences. In one aspect, the isolated nucleic acid comprises DNA encoding a mature, full-length native PR0285 or PR0286 polypeptide having amino acid 20 residues 1 to 1049 of Figure 209 (SEQ ID NO:496) and 1 to 1041 of Figure 211 (SEQ ID NO: 498), or is complementary to such encoding nucleic acid sequence. In another aspect, the invention concerns an isolated nucleic acid molecule that comprises DNA encoding a native PR0285 or PR0286 polypeptide without an N-terminal signal sequence, or is complementary to such encoding nucleic acid sequence. In yet another embodiment, the invention concerns nucleic acid encoding transmembrane-domain deleted or inactivated forms of the full-length native PRO285 25 or PR0286 proteins. In another embodiment, the invention the isolated nucleic acid molecule comprises the clone (DNA40021 1154) deposited on October 17, 1997, under ATCC number 209389; or the clone (DNA42663-1154) deposited on October 17, 1997, under ATCC number 209386. In yet another embodiment, the invention provides a vector comprising DNA encoding PR0285 and PR0286 30 polypeptides, or their variants. Thus, the vector may comprise any of the isolated nucleic acid molecules hereinabove defined. In another embodiment, the invention provides isolated PRO285 and PR0286 polypeptides. In particular, the invention provides isolated native sequence PRO285 and PRO286 polypeptides, which in one embodiment, include the amino acid sequences comprising residues 1 to 1049 and I to 1041 of Figures 209 and 211 (SEQ ID NOS:496 35 and 498), respectively. The invention also provides for variants of the PR0285 and PR0286 polypeptides which are encoded by any of the isolated nucleic acid molecules hereinabove defined. Specific variants include, but are not limited to, deletion (truncated) variants of the full-length native sequence PR0285 and PR0286 polypeptides which lack the respective N-terminal signal sequences and/or have their respective transmembrane and/or cytoplasmic domains deleted or inactivated. 93 WO 99/46281 PCTIUS99/05028 The invention also specifically includes antibodies with dual specificities, e.g., bispecific antibodies binding more than one Toll polypeptide. In yet another embodiment, the invention concerns agonists and antagonists of the native PR0285 and PR0286 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PR0285 or anti-PR0286 antibody. 5 In a further embodiment, the invention concerns screening assays to identify agonists or antagonists of the native PR0285 and PR0286 polypeptides. In a still further embodiment, the invention concerns a composition comprising a PR0285 or PR0286 polypeptide, or an agonist or antagonist as hereinabove defined, in combination with a pharmaceutically acceptable carrier. 10 The invention further concerns a composition comprising an antibody specifically binding a PR0285 or PR0286 polypeptide, in combination with a pharmaceutically acceptable carrier. The invention also concerns a method of treating septic shock comprising administering to a patient an effective amount of an antagonist of a PR0285 or PR0286 polypeptide. In a specific embodiment, the antagonist is a blocking antibody specifically binding a native PR0285 or PR0286 polypeptide. 15 84. PRO213-1. PRO1330 and PRO1449 The present invention concerns compositions and methods for the diagnosis and treatment of neoplastic cell growth and proliferation in mammals, including humans. The present invention is based on the identification of genes that are amplified in the genome of tumor cells. Such gene amplification is expected to be associated with the 20 overexpression of the gene product and contribute to tumorigenesis. Accordingly, the proteins encoded by the amplified genes are believed to be useful targets for the diagnosis and/or treatment (including prevention) of certain cancers, and may act as predictors of the prognosis of tumor treatment. In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0213-1, PRO1330 and/or PRO1449 polypeptide. In one aspect, the isolated nucleic acid comprises DNA 25 encoding the PRO213-1, PRO1330 and/or PRO1449 polypeptide having amino acid residues 1 to 295 of Figure 213 (SEQ ID NO:506), 20 to 273 of Figure 215 (SEQ ID NO:508) and 20 to 273 of Figure 217 (SEQ ID NO:510), respectively, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector designated as DNA30943-1163 (ATCC 209791) deposited on April 21, 1998; 30 DNA64907-1163-1 (ATCC 203242) deposited on September 9, 1998 and/or DNA64908-1163-1 (ATCC 203243) deposited on September 9, 1998. In another embodiment, the present invention comprises an isolated nucleic acid molecule having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to (a) a DNA molecule encoding a PR0213-1, 35 PRO1330 and/or PRO1449 polypeptide having amino acid residues 1 to 295 of Figure 213 (SEQ ID NO:506), 20 to 273 of Figure 215 (SEQ ID NO:508) and 20 to 273 of Figure 217 (SEQ ID NO:510), respectively; or (b) the complement of the DNA molecule of (a). In another embodiment, the invention provides an isolated PR0213-1, PRO1330 and/or PRO1449 polypeptide. In particular, the invention provides isolated native sequence PR0213-1, PRO1330 and/or PRO1449 94 WO 99/46281 PCT/US99/05028 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 295 of Figure 213 (SEQ ID NO:506), 20 to 273 of Figure 215 (SEQ ID NO:508) or 20 to 273 of Figure 217 (SEQ ID NO:510), respectively. Optionally, the PR0213-1, PRO1330 and/or PRO1449 polypeptide is obtained or obtainable by expressing the polypeptide encoded by the cDNA insert of the DNA30943-1163 (ATCC 209791), DNA64907-1163-1 (ATCC 203242) or DNA64908-1163-1 (ATCC 203243). 5 In another aspect, the invention provides an isolated PR0213-1, PRO1330, and/or PRO1449 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 95% sequence identity to amino acid residues 1 to 295 of Figure 213 (SEQ ID NO:506), 20 to 273 of Figure 215 (SEQ ID NO:508) or 20 to 273 of Figure 217 (SEQ ID NO:510), inclusive. 10 In yet another embodiment, the invention provides an isolated PR0213-1, PRO1330, and/or PRO1449 polypeptide, comprising the amino acid residues 1 to 295 of Figure 213 (SEQ ID NO:506), 20 to 273 of Figure 215 (SEQ ID NO:508) or 20 to 273 of Figure 217 (SEQ ID NO:510), or a fragment thereof sufficient to provide a binding site for an anti-PR0213-1, anti-PRO1330 and/or anti-PRO1449 antibody. Preferably, the PR0213-1, PRO1330, and/or PRO1449 fragment retains a qualitative biological activity of a native PR0213-1, PRO1330, and/or PRO1449 15 polypeptide. In a further aspect, the invention concerns an isolated PR0213-1, PRO1330, and/or PRO1449 polypeptide, comprising an amino acid sequence scoring at least about 80% positives, preferably at least about 85 % positives, more preferably at least about 90% positives, most preferably at least about 95% positives when compared with the amino acid sequence of residues 1 to 295 of Figure 213 (SEQ ID NO:506), 20 to 273 of Figure 215 (SEQ ID 20 NO:508) and 20 to 273 of Figure 217 (SEQ ID NO:510), respectively. In still a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under stringent conditions with: (a) a DNA molecule encoding a PR0213-1, PRO1330, and/or PRO1449 polypeptide having the amino acid residues from 1 to 295 of Figure 213 (SEQ ID NO:506), 20 to 273 of Figure 215 (SEQ ID NO:508) and 20 to 273 of Figure 217 (SEQ ID NO:510), respectively; or the complement of the DNA 25 molecule of (a), and if said test DNA molecule has at least about an 80% sequence identity to (a) or (b), (ii) culturing a host cell comprising said test DNA molecule under conditions suitable for the expression of said polypeptide, and (iii) recovering said polypeptide from the cell culture. In one embodiment, the present invention concerns an isolated antibody which binds a PR0213-1, PRO1330 and/or PRO1449 polypeptide. In one aspect, the antibody induces death of a cell overexpressing a PR0213-1, 30 PRO1330 and/or PRO1449 polypeptide. In another aspect, the antibody is a monoclonal antibody, which preferably has nonhuman complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled and may be immobilized on a solid support. In a further aspect, the antibody is an antibody fragment, a single-chain antibody, or an anti-idiotypic antibody. In another embodiment, the invention concerns a composition comprising an antibody which binds a 35 PRO213-1, PRO1330 and/or PRO1449 polypeptide in admixture with a pharmaceutically acceptable carrier. In one aspect, the composition comprises a therapeutically effective amount of the antibody. In another aspect, the composition comprises a further active ingredient, which may, for example, be a further antibody or a cytotoxic or chemotherapeutic agent. Preferably, the composition is sterile. 95 WO 99/46281 PCT/US99/05028 In a further embodiment, the invention concerns nucleic acid encoding an anti-PR0213-1, anti-PRO1330 and/or anti-PRO1449 antibody, and vectors and recombinant host cells comprising such nucleic acid. The invention further concerns antagonists and agonists of a PR0213-1, PRO1330 and/or PRO1449 polypeptide that inhibit one or more of the functions or activities of the PR0213-1, PRO1330 and/or PRO1449 polypeptide. 5 In a further embodiment, the invention concerns isolated nucleic acid molecules that hybridize to the complement of the nucleic acid molecules encoding the PR0213-1, PRO1330 and/or PRO1449 polypeptides. The nucleic acid preferably is DNA, and hybridization preferably occurs under stringent conditions. Such nucleic acid molecules can act as antisense molecules of the amplified genes identified herein, which, in turn, can find use in the modulation of the respective amplified genes, or as antisense primers in amplification reactions. Furthermore, such 10 sequences can be used as part of ribozyme and/or triple helix sequence which, in turn, may be used in regulation of the amplified genes. In another embodiment, the invention concerns a method for determining the presence of a PR0213-1, PRO1330 and/or PRO1449 polypeptide comprising exposing a cell suspected of containing the PR0213-1, PRO1330 and/or PRO1449 polypeptide to an anti-PR0213-1, PRO1330 and/or PRO1449 antibody and determining binding of 15 the antibody to the cell. In yet another embodiment, the present invention concerns a method of diagnosing tumor in a mammal, comprising detecting the level of expression of a gene encoding a PR0213-1, PRO1330 and/or PRO1449 polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher expression level in the test sample indicates the presence of tumor in the 20 mammal from which the test tissue cells were obtained. In another embodiment, the present invention concerns a method of diagnosing tumor in a mammal, comprising (a) contacting an anti-PRO213-1, anti-PRO1330 and/or anti-PRO1449 antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the anti-PR0213-1, anti PRO1330 and/or anti-PRO1449 antibody and the PR0213-1, PRO1330 and/or PRO1449 polypeptide in the test 25 sample. The detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample of known normal tissue cells of the same cell type. A larger quantity of complexes formed in the test sample indicates the presence of tumor in the mammal from which the test tissue cells were obtained. The antibody preferably carries a detectable label. Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art. The test sample 30 is usually obtained from an individual suspected to have neoplastic cell growth or proliferation (e.g. cancerous cells). In another embodiment, the present invention concerns a cancer diagnostic kit, comprising an anti-PRO213 1, anti-PRO1330 and/or anti-PRO1449 antibody and a carrier (e.g. a buffer) in suitable packaging. The kit preferably contains instructions for using the antibody to detect the PRO213-1, PRO1330 and/or PRO1449 polypeptide. In yet another embodiment, the invention concerns a method for inhibiting the growth of tumor cells 35 comprising exposing a cell which overexpresses a PR0213-1, PRO1330 and/or PRO1449 polypeptide to an effective amount of an agent inhibiting the expression and/or activity of the PR0213-1, PRO1330 and/or PRO1449 polypeptide. The agent preferably is an anti-PR0213-1, anti-PRO1330 and/or anti-PRO1449 antibody, a small organic and inorganic molecule, peptide, phosphopeptide, antisense or ribozyme molecule, or a triple helix molecule. In a specific aspect, the agent, e.g. anti-PR0213-1, anti-PRO1330 and/or anti-PRO1449 antibody induces cell death. 96 WO 99/46281 PCT/US99/05028 In a further aspect, the tumor cells are further exposed to radiation treatment and/or a cytotoxic or chemotherapeutic agent. In a further embodiment, the invention concerns an article of manufacture, comprising: a) a container; b) a label on the container; and 5 c) a composition comprising an active agent contained within the container; wherein the composition is effective for inhibiting the growth of tumor cells, the label on the container indicates that the composition can be used for treating conditions characterized by overexpression of a PR0213-1, PRO1330 and/or PRO1449 polypeptide, and the active agent in the composition is an agent inhibiting the expression and/or activity of the PR0213-1, PRO1330 and/or PRO1449 polypeptide. In a preferred aspect, the active agent is an anti-PR0213-1, anti-PRO1330 and/or anti 10 PRO1449 antibody. In yet a further embodiment, the invention provides a method for identifying a compound capable of inhibiting the expression and/or activity of a PR0213-1, PRO1330 and/or PRO1449 polypeptide, comprising contacting a candidate compound with a PR0213-1, PRO1330 and/or PRO1449 polypeptide under conditions and for a time sufficient to allow these two components to interact. In a specific aspect, either the candidate compound 15 or the PRO213-1, PRO1330 and/or PRO1449 polypeptide is immobilized on a solid support. In another aspect, the non-immobilized component carries a detectable label. 85. PRO298 Applicants have identified a cDNA clone that encodes a novel polypeptide. The DNA is designated in the 20 present application as "DNA39975-1210", encoding a novel multi-transmembrane protein, referred to as "PR0298". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95% sequence identity to (a) a DNA molecule encoding PR0298, comprising the sequence of amino acids 1 to 364 of Figure 219 (SEQ ID NO:515), or (b) the complement of the DNA molecule of (a). In one aspect, the isolated nucleic 25 acid comprises DNA encoding a PR0298 polypeptide having amino acid residues 1 to 364 of Figure 219 (SEQ ID NO:515), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In a further embodiment, the invention concerns an isolated nucleic acid molecule comprising DNA having at least an 80% sequence identity to (a) a DNA molecule encoding the same mature polypeptide encoded by the 30 human protein cDNA in ATCC Deposit No. 209783 (DNA39975-1210), or (b) the complement of the DNA molecule of (a). In a still further embodiment, the invention concerns nucleic acid which comprises a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209783 (DNA39975-1210). 35 In another embodiment, the invention provides isolated PR0298 polypeptide. In particular, the invention provides isolated native sequence PR0298 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 364 of Figure 219 (SEQ ID NO:515). In another embodiment, the invention provides an expressed sequence tag (EST) designated DNA26832 comprising the nucleotide sequence of Figure 220 (SEQ ID NO:516). 97 WO 99/46281 PCTIUS99/05028 86. PR0337 Applicants have identified a cDNA clone (DNA43316-1237) that encodes a novel polypeptide, designated in the present application as "PR0337". In one embodiment, the invention provides an isolated nucleic acid molecule having at least about 80% sequence identity to (a) a DNA molecule encoding a PR0337 polypeptide comprising the sequence of amino acids 5 1 to 344 of Figure 222 (SEQ ID NO:523), or (b) the complement of the DNA molecule of (a). The sequence identity preferably is about 85%, more preferably about 90%, most preferably about 95%. In one aspect, the isolated nucleic acid has at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95 (including 96, 97, 98 and 99%) sequence identity with a polypeptide having amino acid residues 1 to 344 of Figure 222 (SEQ ID NO:523). Preferably, the highest degree of sequence identity occurs within the 10 immunoglobulin and major histocompatibility domains (amino acids 113 to 130 of Figure 222, SEQ ID NO:523). In a further embodiment, the isolated nucleic acid molecule comprises DNA encoding a neurotrimin polypeptide having amino acid residues 1 to 344 of Figure 222 (SEQ ID NO:523), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the invention provides a nucleic acid of the full length protein of clone 15 DNA43316-1237, deposited with the ATCC under accession number ATCC 209487, alternatively the coding sequence of clone DNA43316-1237, deposited under accession number ATCC 209487. In yet another embodiment, the invention provides isolated PR0337 polypeptide. In particular, the invention provides isolated native sequence PR0337 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 344 of Figure 222 (SEQ ID NO:523). Native PR0337 polypeptides with or without the 20 native signal sequence (amino acids 1 to about 28 in Figure 222 (SEQ ID NO:523), and with or without the initiating methionine are specifically included. Alternatively, the invention provides a PR0337 polypeptide encoded by the nucleic acid deposited under accession number ATCC 209487. In yet another embodiment, the invention provides an expressed sequence tag (EST) comprising the nucleotide sequences identified in Figure 223 as DNA42301 (SEQ ID NO:524). 25 87. PR0403 Applicants have identified a cDNA clone (DNA55800-1263) that encodes a novel polypeptide, designated in the present application as "PRO403". In one embodiment, the invention provides an isolated nucleic acid molecule having at least about 80% 30 sequence identity to (a) a DNA molecule encoding a PR0403 polypeptide comprising the sequence of amino acids 1 to 736 of Figure 225 (SEQ ID NO:526), or (b) the complement of the DNA molecule of (a). The sequence identity preferably is about 85%, more preferably about 90%, most preferably about 95%. In one aspect, the isolated nucleic acid has at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with a polypeptide having amino acid residues 1 to 736 of Figure 225 (SEQ ID 35 NO:526). Preferably, the highest degree of sequence identity occurs within: (1) the putative N-glycosylatation sites (amino acid residues 132, 136, 177, 237, 282, 349, 505, 598 and 606; (2) Cys residues conserved with the Kell blood group protein family (amino acid residues 65, 70, 88 and 96) and the putative zinc binding motif (amino acid residues 570-579). 98 WO 99/46281 PCT/US99/05028 In a further embodiment, the isolated nucleic acid molecule comprises DNA encoding a PR0403 polypeptide having amino acid residues 1 to 736 of Figure 225 (SEQ ID NO:526), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the invention provides a nucleic acid of the full length protein of clone DNA55800 1263, deposited with the ATCC under accession number ATCC 209680, alternatively the coding sequence of clone 5 DNA55800-1263, deposited under accession number ATCC 209680. In yet another embodiment, the invention provides isolated PRO403 polypeptide. In particular, the invention provides isolated native sequence PR0403 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 736 of Figure 225 (SEQ ID NO:526). Native PR0403 polypeptides with or the initiating methionine are specifically included. Alternatively, the invention provides a PR0403 polypeptide encoded by the 10 nucleic acid deposited under accession number ATCC 209680. In yet another embodiment, the invention provides an expressed sequence tag (EST) and other sequence fragments comprising the nucleotide sequences identified herein as DNA34415 (Figures 226A-B; SEQ ID NO:527); DNA49830 (Figure 227 ; SEQ ID NO:528) and DNA49831 (Figure 228; SEQ ID NO:529). 15 88. Additional Embodiments In other embodiments of the present invention, the invention provides vectors comprising DNA encoding any of the above or below described polypeptides. A host cell comprising any such vector is also provided. By way of example, the host cells may be CHO cells, E. coli, or yeast. A process for producing any of the above or below described polypeptides is further provided and comprises culturing host cells under conditions suitable for expression 20 of the desired polypeptide and recovering the desired polypeptide from the cell culture. In other embodiments, the invention provides chimeric molecules comprising any of the above or below described polypeptides fused to a heterologous polypeptide or amino acid sequence. An example of such a chimeric molecule comprises any of the above or below described polypeptides fused to an epitope tag sequence or a Fc region of an immunoglobulin. 25 In another embodiment, the invention provides an antibody which specifically binds to any of the above or below described polypeptides. Optionally, the antibody is a monoclonal antibody. In yet other embodiments, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences, wherein those probes may be derived from any of the above or below described nucleotide sequences. 30 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a nucleotide sequence (SEQ ID NO: 1) of a native sequence PR0213 cDNA, wherein SEQ ID NO:1 is a clone designated herein as "UNQ187" and/or "DNA30943-1163". Figure 2 shows the amino acid sequence (SEQ ID NO:2) derived from the coding sequence of SEQ ID NO: 1 35 shown in Figure 1. Figure 3 shows a nucleotide sequence (SEQ ID NO:6) of a native sequence PR0274 cDNA, wherein SEQ ID NO:6 is a clone designated herein as "UNQ241" and/or "DNA39987-1184". Figure 4 shows the amino acid sequence (SEQ ID NO:7) derived from the coding sequence of SEQ ID NO:6 shown in Figure 3. 99 WO 99/46281 PCT/US99/05028 Figure 5 shows an EST nucleotide sequence designated herein as DNA17873 (SEQ ID NO:8). Figure 6 shows an EST nucleotide sequence designated herein as DNA36157 (SEQ ID NO:9). Figure 7 shows an EST nucleotide sequence designated herein as DNA28929 (SEQ ID NO:10). Figure 8 shows a nucleotide sequence (SEQ ID NO: 18) of a native sequence PRO300 cDNA, wherein SEQ ID NO:18 is a clone designated herein as "UNQ263" and/or "DNA40625-1189". 5 Figure 9 shows the amino acid sequence (SEQ ID NO: 19) derived from the coding sequence of SEQ ID NO:18 shown in Figure 8. Figure 10 shows a nucleotide sequence (SEQ ID NO:27) of a native sequence PR0284 cDNA, wherein SEQ ID NO:27 is a clone designated herein as "UNQ247" and/or "DNA23318-1211". Figure 11 shows the amino acid sequence (SEQ ID NO:28) derived from the coding sequence of SEQ ID 10 NO:27 shown in Figure 10. Figure 12 shows an EST nucleotide sequence designated herein as DNA12982 (SEQ ID NO:29). Figure 13 shows an EST nucleotide sequence designated herein as DNA15886 (SEQ ID NO:30). Figure 14 shows a nucleotide sequence (SEQ ID NO:35) of a native sequence PR0296 cDNA, wherein SEQ ID NO:35 is a clone designated herein as "UNQ260" and/or "DNA39979-1213". 15 Figure 15 shows the amino acid sequence (SEQ ID NO:36) derived from the coding sequence of SEQ ID NO:35 shown in Figure 14. Figure 16 shows an EST nucleotide sequence designated herein as DNA23020 (SEQ ID NO:37). Figure 17 shows an EST nucleotide sequence designated herein as DNA21971 (SEQ ID NO:38). Figure 18 shows an EST nucleotide sequence designated herein as DNA29037 (SEQ ID NO:39). 20 Figure 19 shows a nucleotide sequence (SEQ ID NO:44) of a native sequence PR0329 cDNA, wherein SEQ ID NO:44 is a clone designated herein as "UNQ291" and/or "DNA40594-1233". Figure 20 shows the amino acid sequence (SEQ ID NO:45) derived from the coding sequence of SEQ ID NO:44 shown in Figure 19. Figure 21 shows a nucleotide sequence (SEQ ID NO:51) of a native sequence PR0362 cDNA, wherein SEQ 25 ID NO:51 is a clone designated herein as "UNQ317" and/or "DNA45416-1251". Figure 22 shows the amino acid sequence (SEQ ID NO:52) derived from the coding sequence of SEQ ID NO:51 shown in Figure 21. Figure 23 shows a nucleotide sequence (SEQ ID NO:58) of a native sequence PR0363 cDNA, wherein SEQ ID NO:58 is a clone designated herein as "UNQ318" and/or "DNA45419-1252". 30 Figure 24 shows the amino acid sequence (SEQ ID NO:59) derived from the coding sequence of SEQ ID NO:58 shown in Figure 23. Figure 25 shows a nucleotide sequence (SEQ ID NO:63) of a native sequence PR0868 cDNA, wherein SEQ ID NO:63 is a clone designated herein as "UNQ437" and/or "DNA52594-1270". Figure 26 shows the amino acid sequence (SEQ ID NO:64) derived from the coding sequence of SEQ ID 35 NO:63 shown in Figure 25. Figure 27 shows a nucleotide sequence (SEQ ID NO:68) of a native sequence PR0382 cDNA, wherein SEQ ID NO:68 is a clone designated herein as "UNQ323" and/or "DNA45234-1277". Figure 28 shows the amino acid sequence (SEQ ID NO:69) derived from the coding sequence of SEQ ID NO:68 shown in Figure 27. 100 WO 99/46281 PCTIUS99/05028 Figure 29 shows a nucleotide sequence (SEQ ID NO:73) of a native sequence PR0545 cDNA, wherein SEQ ID NO:73 is a clone designated herein as "UNQ346" and/or "DNA49624-1279". Figure 30 shows the amino acid sequence (SEQ ID NO:74) derived from the coding sequence of SEQ ID NO:73 shown in Figure 29. Figure 31 shows an EST nucleotide sequence designated herein as DNA13217 (SEQ ID NO:75). 5 Figure 32 shows a nucleotide sequence (SEQ ID NO:84) of a native sequence PR0617 cDNA, wherein SEQ ID NO:84 is a clone designated herein as "UNQ353" and/or "DNA48309-1280". Figure 33 shows the amino acid sequence (SEQ ID NO:85) derived from the coding sequence of SEQ ID NO:84 shown in Figure 32. Figure 34 shows a nucleotide sequence (SEQ ID NO:89) of a native sequence PRO700 cDNA, wherein SEQ 10 ID NO:89 is a clone designated herein as "UNQ364" and/or "DNA46776-1284". Figure 35 shows the amino acid sequence (SEQ ID NO:90) derived from the coding sequence of SEQ ID NO:89 shown in Figure 34. Figure 36 shows a nucleotide sequence (SEQ ID NO:96) of a native sequence PR0702 cDNA, wherein SEQ ID NO:96 is a clone designated herein as "UNQ366" and/or "DNA50980-1286". 15 Figure 37 shows the amino acid sequence (SEQ ID NO:97) derived from the coding sequence of SEQ ID NO:96 shown in Figure 36. Figure 38 shows a nucleotide sequence (SEQ ID NO: 101) of a native sequence PR0703 cDNA, wherein SEQ ID NO: 101 is a clone designated herein as "UNQ367" and/or "DNA50913-1287". Figure 39 shows the amino acid sequence (SEQ ID NO: 102) derived from the coding sequence of SEQ ID 20 NO: 101 shown in Figure 38. Figure 40 shows a nucleotide sequence (SEQ ID NO: 108) of a native sequence PR0705 cDNA, wherein SEQ ID NO:108 is a clone designated herein as "UNQ369" and/or "DNA50914-1289". Figure 41 shows the amino acid sequence (SEQ ID NO: 109) derived from the coding sequence of SEQ ID NO:108 shown in Figure 40. 25 Figures 42A-B show a nucleotide sequence (SEQ ID NO: 113) of a native sequence PRO708 cDNA, wherein SEQ ID NO: 113 is a clone designated herein as "UNQ372" and/or "DNA48296-1292". Figure 43 shows the amino acid sequence (SEQ ID NO: 114) derived from the coding sequence of SEQ ID NO:113 shown in Figures 42A-B. Figure 44 shows a nucleotide sequence (SEQ ID NO: 118) of a native sequence PR0320 cDNA, wherein 30 SEQ ID NO: 118 is a clone designated herein as "UNQ281" and/or "DNA32284-1307". Figure 45 shows the amino acid sequence (SEQ ID NO: 119) derived from the coding sequence of SEQ ID NO:118 shown in Figure 44. Figure 46 shows a nucleotide sequence (SEQ ID NO: 123) of a native sequence PR0324 cDNA, wherein SEQ ID NO: 123 is a clone designated herein as "UNQ285" and/or "DNA36343-13 10". 35 Figure 47 shows the amino acid sequence (SEQ ID NO: 124) derived from the coding sequence of SEQ ID NO: 123 shown in Figure 46. Figure 48 shows a nucleotide sequence (SEQ ID NO: 131) of a native sequence PR0351 cDNA, wherein SEQ ID NO:131 is a clone designated herein as "UNQ308" and/or "DNA40571-1315". 101 WO 99/46281 PCT/US99/05028 Figure 49 shows the amino acid sequence (SEQ ID NO:132) derived from the coding sequence of SEQ ID NO:131 shown in Figure 48. Figure 50 shows a nucleotide sequence (SEQ ID NO:136) of a native sequence PR0352 cDNA, wherein SEQ ID NO:136 is a clone designated herein as "UNQ309" and/or "DNA41386-1316". Figure 51 shows the amino acid sequence (SEQ ID NO:137) derived from the coding sequence of SEQ ID 5 NO:136 shown in Figure 50. Figure 52 shows a nucleotide sequence (SEQ ID NO: 144) of a native sequence PR0381 cDNA, wherein SEQ ID NO:144 is a clone designated herein as "UNQ322" and/or "DNA44194-1317". Figure 53 shows the amino acid sequence (SEQ ID NO:145) derived from the coding sequence of SEQ ID NO: 144 shown in Figure 52. 10 Figure 54 shows a nucleotide sequence (SEQ ID NO: 149) of a native sequence PR0386 cDNA, wherein SEQ ID NO: 149 is a clone designated herein as "UNQ326" and/or "DNA45415-1318". Figure 55 shows the amino acid sequence (SEQ ID NO: 150) derived from the coding sequence of SEQ ID NO: 149 shown in Figure 54. Figure 56 shows an EST nucleotide sequence designated herein as DNA23350 (SEQ ID NO:151). 15 Figure 57 shows an EST nucleotide sequence designated herein as DNA23536 (SEQ ID NO: 152). Figure 58 shows a nucleotide sequence (SEQ ID NO: 156) of a native sequence PR0540 cDNA, wherein SEQ ID NO:156 is a clone designated herein as "UNQ341" and/or "DNA44189-1322". Figure 59 shows the amino acid sequence (SEQ ID NO: 157) derived from the coding sequence of SEQ ID NO:156 shown in Figure 58. 20 Figure 60 shows a nucleotide sequence (SEQ ID NO: 161) of a native sequence PR0615 cDNA, wherein SEQ ID NO:161 is a clone designated herein as "UNQ352" and/or "DNA48304-1323". Figure 61 shows the amino acid sequence (SEQ ID NO: 162) derived from the coding sequence of SEQ ID NO:161 shown in Figure 60. Figure 62 shows a nucleotide sequence (SEQ ID NO:168) of a native sequence PR0618 cDNA, wherein 25 SEQ ID NO:168 is a clone designated herein as "UNQ354" and/or "DNA49152-1324". Figure 63 shows the amino acid sequence (SEQ ID NO: 169) derived from the coding sequence of SEQ ID NO:168 shown in Figure 62. Figure 64 shows an EST nucleotide sequence designated herein as DNA35597 (SEQ ID NO: 170). Figure 65 shows a nucleotide sequence (SEQ ID NO: 177) of a native sequence PR0719 cDNA, wherein 30 SEQ ID NO:177 is a clone designated herein as "UNQ387" and/or "DNA49646-1327". Figure 66 shows the amino acid sequence (SEQ ID NO: 178) derived from the coding sequence of SEQ ID NO:177 shown in Figure 65. Figure 67 shows a nucleotide sequence (SEQ ID NO: 182) of a native sequence PR0724 cDNA, wherein SEQ ID NO:182 is a clone designated herein as "UNQ389" and/or "DNA49631-1328". 35 Figure 68 shows the amino acid sequence (SEQ ID NO:183) derived from the coding sequence of SEQ ID NO: 182 shown in Figure 67. Figure 69 shows a nucleotide sequence (SEQ ID NO: 189) of a native sequence PR0772 cDNA, wherein SEQ ID NO:189 is a clone designated herein as "UNQ410" and/or "DNA49645-1347". 102 WO 99/46281 PCT/US99/05028 Figure 70 shows the amino acid sequence (SEQ ID NO: 190) derived from the coding sequence of SEQ ID NO:189 shown in Figure 69. Figure 71 shows an EST nucleotide sequence designated herein as DNA43509 (SEQ ID NO:191). Figure 72 shows a nucleotide sequence (SEQ ID NO:195) of a native sequence PRO852 cDNA, wherein SEQ ID NO:195 is a clone designated herein as "UNQ418" and/or "DNA45493-1349". 5 Figure 73 shows the amino acid sequence (SEQ ID NO: 196) derived from the coding sequence of SEQ ID NO: 195 shown in Figure 72. Figure 74 shows a nucleotide sequence (SEQ ID NO:205) of a native sequence PRO853 cDNA, wherein SEQ ID NO:205 is a clone designated herein as "UNQ419" and/or "DNA48227-1350". Figure 75 shows the amino acid sequence (SEQ ID NO:206) derived from the coding sequence of SEQ ID 10 NO:205 shown in Figure 74. Figures 76A-B show a nucleotide sequence (SEQ ID NO:210) of a native sequence PR0860 cDNA, wherein SEQ ID NO:210 is a clone designated herein as "UNQ421" and/or "DNA41404-1352". Figure 77 shows the amino acid sequence (SEQ ID NO:211) derived from the coding sequence of SEQ ID NO:210 shown in Figures 76A-B. 15 Figure 78 shows a nucleotide sequence (SEQ ID NO:215) of a native sequence PR0846 cDNA, wherein SEQ ID NO:215 is a clone designated herein as "UNQ422" and/or "DNA44196-1353". Figure 79 shows the amino acid sequence (SEQ ID NO:216) derived from the coding sequence of SEQ ID NO:215 shown in Figure 78. Figure 80 shows a nucleotide sequence (SEQ ID NO:220) of a native sequence PR0862 cDNA, wherein 20 SEQ ID NO:220 is a clone designated herein as "UNQ424" and/or "DNA52187-1354". Figure 81 shows the amino acid sequence (SEQ ID NO:221) derived from the coding sequence of SEQ ID NO:220 shown in Figure 80. Figure 82 shows a nucleotide sequence (SEQ ID NO:225) of a native sequence PR0864 cDNA, wherein SEQ ID NO:225 is a clone designated herein as "UNQ426" and/or "DNA48328-1355". 25 Figure 83 shows the amino acid sequence (SEQ ID NO:226) derived from the coding sequence of SEQ ID NO:225 shown in Figure 82. Figure 84 shows a nucleotide sequence (SEQ ID NO:230) of a native sequence PR0792 cDNA, wherein SEQ ID NO:230 is a clone designated herein as "UNQ431" and/or "DNA56352-1358". Figure 85 shows the amino acid sequence (SEQ ID NO:231) derived from the coding sequence of SEQ ID 30 NO:230 shown in Figure 84. Figure 86 shows a nucleotide sequence (SEQ ID NO:235) of a native sequence PR0866 cDNA, wherein SEQ ID NO:235 is a clone designated herein as "UNQ435" and/or "DNA53971-1359". Figure 87 shows the amino acid sequence (SEQ ID NO:236) derived from the coding sequence of SEQ ID NO:235 shown in Figure 86. 35 Figure 88 shows a nucleotide sequence (SEQ ID NO:244) of a native sequence PR0871 cDNA, wherein SEQ ID NO:244 is a clone designated herein as "UNQ438" and/or "DNA50919-1361 ". Figure 89 shows the amino acid sequence (SEQ ID NO:245) derived from the coding sequence of SEQ ID NO:244 shown in Figure 88. 103 WO 99/46281 PCTIUS99/05028 Figure 90 shows a nucleotide sequence (SEQ ID NO:253) of a native sequence PR0873 cDNA, wherein SEQ ID NO:253 is a clone designated herein as "UNQ440" and/or "DNA44179-1362". Figure 91 shows the amino acid sequence (SEQ ID NO:254) derived from the coding sequence of SEQ ID NO:253 shown in Figure 90. Figure 92 shows a nucleotide sequence (SEQ ID NO:258) of a native sequence PR0940 cDNA, wherein 5 SEQ ID NO:258 is a clone designated herein as "UNQ477" and/or "DNA54002-1367". Figure 93 shows the amino acid sequence (SEQ ID NO:259) derived from the coding sequence of SEQ ID NO:258 shown in Figure 92. Figure 94 shows a nucleotide sequence (SEQ ID NO:263) of a native sequence PR0941 cDNA, wherein SEQ ID NO:263 is a clone designated herein as "UNQ478" and/or "DNA53906-1368". 10 Figure 95 shows the amino acid sequence (SEQ ID NO:264) derived from the coding sequence of SEQ ID NO:263 shown in Figure 94. Figure 96 shows an EST nucleotide sequence designated herein as DNA6415 (SEQ ID NO:265). Figure 97 shows a nucleotide sequence (SEQ ID NO:269) of a native sequence PR0944 cDNA, wherein SEQ ID NO:269 is a clone designated herein as "UNQ481" and/or "DNA52185-1370". 15 Figure 98 shows the amino acid sequence (SEQ ID NO:270) derived from the coding sequence of SEQ ID NO:269 shown in Figure 97. Figure 99 shows an EST nucleotide sequence designated herein as DNA 14007 (SEQ ID NO:27 1). Figure 100 shows an EST nucleotide sequence designated herein as DNA12773 (SEQ ID NO:272). Figure 101 shows an EST nucleotide sequence designated herein as DNA12746 (SEQ ID NO:273). 20 Figure 102 shows an EST nucleotide sequence designated herein as DNA12834 (SEQ ID NO:274). Figure 103 shows an EST nucleotide sequence designated herein as DNA12846 (SEQ ID NO:275). Figure 104 shows an EST nucleotide sequence designated herein as DNA13104 (SEQ ID NO:276). Figure 105 shows an EST nucleotide sequence designated herein as DNA13259 (SEQ ID NO:277). Figure 106 shows an EST nucleotide sequence designated herein as DNA13959 (SEQ ID NO:278). 25 Figure 107 shows an EST nucleotide sequence designated herein as DNA13961 (SEQ ID NO:279). Figure 108 shows a nucleotide sequence (SEQ ID NO:283) of a native sequence PR0983 cDNA, wherein SEQ ID NO:283 is a clone designated herein as "UNQ484" and/or "DNA53977-1371". Figure 109 shows the amino acid sequence (SEQ ID NO:284) derived from the coding sequence of SEQ ID NO:283 shown in Figure 108. 30 Figure 110 shows an EST nucleotide sequence designated herein as DNA17130 (SEQ ID NO:285). Figure 111 shows an EST nucleotide sequence designated herein as DNA23466 (SEQ ID NO:286). Figure 112 shows an EST nucleotide sequence designated herein as DNA26818 (SEQ ID NO:287). Figure 113 shows an EST nucleotide sequence designated herein as DNA37618 (SEQ ID NO:288). Figure 114 shows an EST nucleotide sequence designated herein as DNA41732 (SEQ ID NO:289). 35 Figure 115 shows an EST nucleotide sequence designated herein as DNA45980 (SEQ ID NO:290). Figure 116 shows an EST nucleotide sequence designated herein as DNA46372 (SEQ ID NO:291). Figure 117 shows a nucleotide sequence (SEQ ID NO:295) of a native sequence PRO1057 cDNA, wherein SEQ ID NO:295 is a clone designated herein as "UNQ522" and/or "DNA57253-1382". 104 WO 99/46281 PCT/US99/05028 Figure 118 shows the amino acid sequence (SEQ ID NO:296) derived from the coding sequence of SEQ ID NO:295 shown in Figure 117. Figure 119 shows a nucleotide sequence (SEQ ID NO:300) of a native sequence PRO1071 cDNA, wherein SEQ ID NO:300 is a clone designated herein as "UNQ528" and/or "DNA58847-1383". Figure 120 shows the amino acid sequence (SEQ ID NO:301) derived from the coding sequence of SEQ ID 5 NO:300 shown in Figure 119. Figure 121 shows a nucleotide sequence (SEQ ID NO:302) of a native sequence PRO1072 cDNA, wherein SEQ ID NO:302 is a clone designated herein as "UNQ529" and/or "DNA58747-1384". Figure 122 shows the amino acid sequence (SEQ ID NO:303) derived from the coding sequence of SEQ ID NO:302 shown in Figure 121. 10 Figure 123 shows an EST nucleotide sequence designated herein as DNA40210 (SEQ ID NO:304). Figure 124 shows a nucleotide sequence (SEQ ID NO:308) of a native sequence PRO1075 cDNA, wherein SEQ ID NO:308 is a clone designated herein as "UNQ532" and/or "DNA57689-1385". Figure 125 shows the amino acid sequence (SEQ ID NO:309) derived from the coding sequence of SEQ ID NO:308 shown in Figure 124. 15 Figure 126 shows an EST nucleotide sequence designated herein as DNA13059 (SEQ ID NO:310). Figure 127 shows an EST nucleotide sequence designated herein as DNA19463 (SEQ ID NO:311). Figure 128 shows a nucleotide sequence (SEQ ID NO:321) of a native sequence PRO181 cDNA, wherein SEQ ID NO:321 is a clone designated herein as "UNQ155" and/or "DNA23330-1390". Figure 129 shows the amino acid sequence (SEQ ID NO:322) derived from the coding sequence of SEQ ID 20 NO:321 shown in Figure 128. Figure 130 shows an EST nucleotide sequence designated herein as DNA13242 (SEQ ID NO:323). Figure 131 shows a nucleotide sequence (SEQ ID NO:329) of a native sequence PRO195 cDNA, wherein SEQ ID NO:329 is a clone designated herein as "UNQ169" and/or "DNA26847-1395". Figure 132 shows the amino acid sequence (SEQ ID NO:330) derived from the coding sequence of SEQ ID 25 NO:329 shown in Figure 131. Figure 133 shows an EST nucleotide sequence designated herein as DNA15062 (SEQ ID NO:33 1). Figure 134 shows an EST nucleotide sequence designated herein as DNA13199 (SEQ ID NO:332). Figure 135 shows a nucleotide sequence (SEQ ID NO:336) of a native sequence PR0865 cDNA, wherein SEQ ID NO:336 is a clone designated herein as "UNQ434" and/or "DNA53974-1401". 30 Figure 136 shows the amino acid sequence (SEQ ID NO:337) derived from the coding sequence of SEQ ID NO:336 shown in Figure 135. Figure 137 shows an EST nucleotide sequence designated herein as DNA37642 (SEQ ID NO:338). Figure 138 shows a nucleotide sequence (SEQ ID NO:345) of a native sequence PRO827 cDNA, wherein SEQ ID NO:345 is a clone designated herein as "UNQ468" and/or "DNA57039-1402". 35 Figure 139 shows the amino acid sequence (SEQ ID NO:346) derived from the coding sequence of SEQ ID NO:345 shown in Figure 138. Figure 140 shows an EST nucleotide sequence designated herein as DNA47751 (SEQ ID NO:347). Figure 141 shows a nucleotide sequence (SEQ ID NO:351) of a native sequence PRO1 114 cDNA, wherein SEQ ID NO:351 is a clone designated herein as "UNQ557" and/or "DNA57033-1403". 105 WO 99/46281 PCTIUS99/05028 Figure 142 shows the amino acid sequence (SEQ ID NO:352) derived from the coding sequence of SEQ ID NO:351 shown in Figure 141. Figure 143 shows an EST nucleotide sequence designated herein as DNA48466 (SEQ ID NO:353). Figure 144 shows a nucleotide sequence (SEQ ID NO:357) of a native sequence PR0237 cDNA, wherein SEQ ID NO:357 is a clone designated herein as "UNQ211" and/or "DNA34353-1428". 5 Figure 145 shows the amino acid sequence (SEQ ID NO:358) derived from the coding sequence of SEQ ID NO:357 shown in Figure 144. Figure 146 shows a nucleotide sequence (SEQ ID NO:362) of a native sequence PR0541 cDNA, wherein SEQ ID NO:362 is a clone designated herein as "UNQ342" and/or "DNA45417-1432". Figure 147 shows the amino acid sequence (SEQ ID NO:363) derived from the coding sequence of SEQ ID 10 NO:362 shown in Figure 146. Figure 148 shows a nucleotide sequence (SEQ ID NO:369) of a native sequence PR0273 cDNA, wherein SEQ ID NO:369 is a clone designated herein as "UNQ240" and/or "DNA39523-1192". Figure 149 shows the amino acid sequence (SEQ ID NO:370) derived from the coding sequence of SEQ ID NO:369 shown in Figure 148. 15 Figure 150 shows a nucleotide sequence (SEQ ID NO:374) of a native sequence PRO701 cDNA, wherein SEQ ID NO:374 is a clone designated herein as "UNQ365" and/or "DNA44205-1285". Figure 151 shows the amino acid sequence (SEQ ID NO:375) derived from the coding sequence of SEQ ID NO:374 shown in Figure 150. Figure 152 shows a nucleotide sequence (SEQ ID NO:379) of a native sequence PR0704 cDNA, wherein 20 SEQ ID NO:379 is a clone designated herein as "UNQ368" and/or "DNA50911-1288". Figure 153 shows the amino acid sequence (SEQ ID NO:380) derived from the coding sequence of SEQ ID NO:379 shown in Figure 152. Figure 154 shows a nucleotide sequence (SEQ ID NO:384) of a native sequence PR0706 cDNA, wherein SEQ ID NO:384 is a clone designated herein as "UNQ370" and/or "DNA48329-1290". 25 Figure 155 shows the amino acid sequence (SEQ ID NO:385) derived from the coding sequence of SEQ ID NO:384 shown in Figure 154. Figure 156 shows a nucleotide sequence (SEQ ID NO:389) of a native sequence PR0707 cDNA, wherein SEQ ID NO:389 is a clone designated herein as "UNQ371" and/or "DNA48306-1291". Figure 157 shows the amino acid sequence (SEQ ID NO:390) derived from the coding sequence of SEQ ID 30 NO:389 shown in Figure 156. Figure 158 shows a nucleotide sequence (SEQ ID NO:394) of a native sequence PR0322 cDNA, wherein SEQ ID NO:394 is a clone designated herein as "UNQ283" and/or "DNA48336-1309". Figure 159 shows the amino acid sequence (SEQ ID NO:395) derived from the coding sequence of SEQ ID NO:394 shown in Figure 158. 35 Figure 160 shows a nucleotide sequence (SEQ ID NO:399) of a native sequence PR0526 cDNA, wherein SEQ ID NO:399 is a clone designated herein as "UNQ330" and/or "DNA44184-1319". Figure 161 shows the amino acid sequence (SEQ ID NO:400) derived from the coding sequence of SEQ ID NO:399 shown in Figure 160. 106 WO 99/46281 PCT/US99/05028 Figure 162 shows a nucleotide sequence (SEQ ID NO:404) of a native sequence PR0531 cDNA, wherein SEQ ID NO:404 is a clone designated herein as "UNQ332" and/or "DNA48314-1320". Figure 163 shows the amino acid sequence (SEQ ID NO:405) derived from the coding sequence of SEQ ID NO:404 shown in Figure 162. Figure 164 shows a nucleotide sequence (SEQ ID NO:409) of a native sequence PR0534 cDNA, wherein 5 SEQ ID NO:409 is a clone designated herein as "UNQ335" and/or "DNA48333-1321". Figure 165 shows the amino acid sequence (SEQ ID NO:410) derived from the coding sequence of SEQ ID NO:409 shown in Figure 164. Figure 166 shows a nucleotide sequence (SEQ ID NO:414) of a native sequence PR0697 cDNA, wherein SEQ ID NO:414 is a clone designated herein as "UNQ361" and/or "DNA50920-1325". 10 Figure 167 shows the amino acid sequence (SEQ ID NO:415) derived from the coding sequence of SEQ ID NO:414 shown in Figure 166. Figure 168 shows a nucleotide sequence (SEQ ID NO:419) of a native sequence PR0717 cDNA, wherein SEQ ID NO:419 is a clone designated herein as "UNQ385" and/or "DNA50988-1326". Figure 169 shows the amino acid sequence (SEQ ID NO:420) derived from the coding sequence of SEQ ID 15 NO:419 shown in Figure 168. Figures 170A-B show a nucleotide sequence (SEQ ID NO:424) of a native sequence PR0731 cDNA, wherein SEQ ID NO:424 is a clone designated herein as "UNQ395" and/or "DNA48331-1329". Figure 171 shows the amino acid sequence (SEQ ID NO:425) derived from the coding sequence of SEQ ID NO:424 shown in Figures 170A-B. 20 Figure 172 shows a nucleotide sequence (SEQ ID NO:429) of a native sequence PR0218 cDNA, wherein SEQ ID NO:429 is a clone designated herein as "UNQ192" and/or "DNA30867-1335". Figure 173 shows the amino acid sequence (SEQ ID NO:430) derived from the coding sequence of SEQ ID NO:429 shown in Figure 172. Figure 174 shows an EST nucleotide sequence designated herein as DNA14472 (SEQ ID NO:431). 25 Figure 175 shows an EST nucleotide sequence designated herein as DNA15846 (SEQ ID NO:432). Figures 176A-B show a nucleotide sequence (SEQ ID NO:436) of a native sequence PR0768 cDNA, wherein SEQ ID NO:436 is a clone designated herein as "UNQ406" and/or "DNA55737-1345". Figure 177 shows the amino acid sequence (SEQ ID NO:437) derived from the coding sequence of SEQ ID NO:436 shown in Figures 176A-B. 30 Figure 178 shows a nucleotide sequence (SEQ ID NO:441) of a native sequence PR0771 cDNA, wherein SEQ ID NO:441 is a clone designated herein as "UNQ409" and/or "DNA49829-1346". Figure 179 shows the amino acid sequence (SEQ ID NO:442) derived from the coding sequence of SEQ ID NO:441 shown in Figure 178. Figures 180A-B show a nucleotide sequence (SEQ ID NO:446) of a native sequence PR0733 cDNA, 35 wherein SEQ ID NO:446 is a clone designated herein as "UNQ411" and/or "DNA52196-1348". Figure 181 shows the amino acid sequence (SEQ ID NO:447) derived from the coding sequence of SEQ ID NO:446 shown in Figures 180A-B. Figure 182 shows a nucleotide sequence (SEQ ID NO:451) of a native sequence PRO162 cDNA, wherein SEQ ID NO:451 is a clone designated herein as "UNQ429" and/or "DNA46965-1356". 107 WO 99/46281 PCT/US99/05028 Figure 183 shows the amino acid sequence (SEQ ID NO:452) derived from the coding sequence of SEQ ID NO:451 shown in Figure 182. Figure 184 shows a nucleotide sequence (SEQ ID NO:453) of a native sequence PR0788 cDNA, wherein SEQ ID NO:453 is a clone designated herein as "UNQ430" and/or "DNA56405-1357". Figure 185 shows the amino acid sequence (SEQ ID NO:454) derived from the coding sequence of SEQ ID 5 NO:453 shown in Figure 184. Figure 186 shows a nucleotide sequence (SEQ ID NO:455) of a native sequence PRO1008 cDNA, wherein SEQ ID NO:455 is a clone designated herein as "UNQ492" and/or "DNA57530-1375". Figure 187 shows the amino acid sequence (SEQ ID NO:456) derived from the coding sequence of SEQ ID NO:455 shown in Figure 186. 10 Figure 188 shows an EST nucleotide sequence designated herein as DNA16508 (SEQ ID NO:457). Figures 189A-B show a nucleotide sequence (SEQ ID NO:458) of a native sequence PRO1012 cDNA, wherein SEQ ID NO:458 is a clone designated herein as "UNQ495" and/or "DNA56439-1376". Figure 190 shows the amino acid sequence (SEQ ID NO:459) derived from the coding sequence of SEQ ID NO:458 shown in Figures 189A-B. 15 Figure 191 shows a nucleotide sequence (SEQ ID NO:463) of a native sequence PRO1014 cDNA, wherein SEQ ID NO:463 is a clone designated herein as "UNQ497" and/or "DNA56409-1377". Figure 192 shows the amino acid sequence (SEQ ID NO:464) derived from the coding sequence of SEQ ID NO:463 shown in Figure 191. Figure 193 shows a nucleotide sequence (SEQ ID NO:465) of a native sequence PRO1017 cDNA, wherein 20 SEQ ID NO:465 is a clone designated herein as "UNQ500" and/or "DNA56112-1379". Figure 194 shows the amino acid sequence (SEQ ID NO:466) derived from the coding sequence of SEQ ID NO:465 shown in Figure 193. Figure 195 shows a nucleotide sequence (SEQ ID NO:467) of a native sequence PR0474 cDNA, wherein SEQ ID NO:467 is a clone designated herein as "UNQ502" and/or "DNA56045-1380". 25 Figure 196 shows the amino acid sequence (SEQ ID NO:468) derived from the coding sequence of SEQ ID NO:467 shown in Figure 195. Figure 197 shows a nucleotide sequence (SEQ ID NO:469) of a native sequence PRO1031 cDNA, wherein SEQ ID NO:469 is a clone designated herein as "UNQ516" and/or "DNA59294-1381". Figure 198 shows the amino acid sequence (SEQ ID NO:470) derived from the coding sequence of SEQ ID 30 NO:469 shown in Figure 197. Figure 199 shows a nucleotide sequence (SEQ ID NO:471) of a native sequence PR0938 cDNA, wherein SEQ ID NO:471 is a clone designated herein as "UNQ475" and/or "DNA56433-1406". Figure 200 shows the amino acid sequence (SEQ ID NO:472) derived from the coding sequence of SEQ ID NO:471 shown in Figure 199. 35 Figure 201 shows a nucleotide sequence (SEQ ID NO:476) of a native sequence PRO1082 cDNA, wherein SEQ ID NO:476 is a clone designated herein as "UNQ539" and/or "DNA53912-1457". Figure 202 shows the amino acid sequence (SEQ ID NO:477) derived from the coding sequence of SEQ ID NO:476 shown in Figure 201. 108 WO 99/46281 PCT/US99/05028 Figure 203 shows a nucleotide sequence (SEQ ID NO:482) of a native sequence PRO1083 cDNA, wherein SEQ ID NO:482 is a clone designated herein as "UNQ540" and/or "DNA50921-1458". Figure 204 shows the amino acid sequence (SEQ ID NO:483) derived from the coding sequence of SEQ ID NO:482 shown in Figure 203. Figure 205 shows an EST nucleotide sequence designated herein as DNA24256 (SEQ ID NO:484). 5 Figure 206 shows a nucleotide sequence (SEQ ID NO:487) of a native sequence PRO200 cDNA, wherein SEQ ID NO:487 is a clone designated herein as "UNQ174" and/or "DNA29101-1122". Figure 207 shows the amino acid sequence (SEQ ID NO:488) derived from the coding sequence of SEQ ID NO:487 shown in Figure 206. Figure 208 shows a nucleotide sequence (SEQ ID NO:495) of a native sequence PR0285 cDNA, wherein 10 SEQ ID NO:495 is a clone designated herein as "DNA40021-1154". Figure 209 shows the amino acid sequence (SEQ ID NO:496) derived from the coding sequence of SEQ ID NO:495 shown in Figure 208. Figures 210A-B show a nucleotide sequence (SEQ ID NO:497) of a native sequence PR0286 cDNA, wherein SEQ ID NO:497 is a clone designated herein as "DNA42663-1154". 15 Figure 211 shows the amino acid sequence (SEQ ID NO:498) derived from the coding sequence of SEQ ID NO:497 shown in Figures 210A-B. Figure 212 shows a nucleotide sequence (SEQ ID NO:505) of a native sequence PR0213-1 cDNA, wherein SEQ ID NO:505 is a clone designated herein as "DNA30943-1-1163-1". Figure 213 shows the amino acid sequence (SEQ ID NO:506) derived from the coding sequence of SEQ ID 20 NO:505 shown in Figure 212. Figure 214 shows a nucleotide sequence (SEQ ID NO:507) of a native sequence PRO1330 cDNA, wherein SEQ ID NO:507 is a clone designated herein as "DNA64907-1163-1". Figure 215 shows the amino acid sequence (SEQ ID NO:508) derived from the coding sequence of SEQ ID NO:507 shown in Figure 214. 25 Figure 216 shows a nucleotide sequence (SEQ ID NO:509) of a native sequence PRO1449 cDNA, wherein SEQ ID NO:509 is a clone designated herein as "DNA64908-1163-1". Figure 217 shows the amino acid sequence (SEQ ID NO:510) derived from the coding sequence of SEQ ID NO:509 shown in Figure 216. Figure 218 shows a nucleotide sequence (SEQ ID NO:514) of a native sequence PR0298 cDNA, wherein 30 SEQ ID NO:514 is a clone designated herein as "UNQ261" and/or "DNA39975-1210". Figure 219 shows the amino acid sequence (SEQ ID NO:515) derived from the coding sequence of SEQ ID NO:514 shown in Figure 218. Figure 220 shows an EST nucleotide sequence designated herein as DNA26832 (SEQ ID NO:516). Figure 221 shows a nucleotide sequence (SEQ ID NO:522) of a native sequence PR0337 cDNA, wherein 35 SEQ ID NO:522 is a clone designated herein as "DNA43316-1237". Figure 222 shows the amino acid sequence (SEQ ID NO:523) derived from the coding sequence of SEQ ID NO:522 shown in Figure 221. Figure 223 shows an EST nucleotide sequence designated herein as DNA42301 (SEQ ID NO:524). 109 WO 99/46281 PCTIUS99/05028 Figure 224 shows a nucleotide sequence (SEQ ID NO:525) of a native sequence PR0403 cDNA, wherein SEQ ID NO:525 is a clone designated herein as "DNA55800-1263". Figure 225 shows the amino acid sequence (SEQ ID NO:526) derived from the coding sequence of SEQ ID NO:525 shown in Figure 224. Figures 226A-B show an EST nucleotide sequence designated herein as DNA34415 (SEQ ID NO:527). 5 Figure 227 shows an EST nucleotide sequence designated herein as DNA49830 (SEQ ID NO:528). Figure 228 shows an EST nucleotide sequence designated herein as DNA49831 (SEQ ID NO:529). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS I. Definitions 10 The terms "PRO polypeptide" and "PRO" as used herein and when immediately followed by a numerical designation refer to various polypeptides, wherein the complete designation (i.e., PRO/number) refers to specific polypeptide sequences as described herein. The terms "PRO/number polypeptide" and "PRO/number" as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein). The PRO polypeptides described herein may be isolated from a variety of sources, such as from human tissue types or from 15 another source, or prepared by recombinant or synthetic methods. A "native sequence PRO polypeptide" comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. The term "native sequence PRO polypeptide" specifically encompasses naturally-occurring truncated or secreted forms of the specific PRO polypeptide (e.g., an 20 extracellular domain sequence), naturally-occurring variant forms (e.g., alternatively spliced forms) and naturally occurring allelic variants of the polypeptide. In various embodiments of the invention, the native sequence PR0213 polypeptide is a mature or full-length native sequence PRO213 polypeptide comprising amino acids 1 to 295 of Figure 2 (SEQ ID NO:2), the native sequence PR0274 polypeptide is a mature or full-length native sequence PR0274 polypeptide comprising amino acids 1 to 492 of Figure 4 (SEQ ID NO:7), the native sequence PR0300 polypeptide 25 is a mature or full-length native sequence PRO300 polypeptide comprising amino acids 1 to 457 of Figure 9 (SEQ ID NO: 19), the native sequence PRO284 polypeptide is a mature or full-length native sequence PR0284 polypeptide comprising amino acids 1 to 285 of Figure 11 (SEQ ID NO:28), the native sequence PR0296 polypeptide is a mature or full-length native sequence PR0296 polypeptide comprising amino acids 1 to 204 of Figure 15 (SEQ ID NO:36), the native sequence PR0329 polypeptide is a mature or full-length native sequence PR0329 polypeptide comprising 30 amino acids 1 to 359 of Figure 20 (SEQ ID NO:45), the native sequence PR0362 polypeptide is a mature or full length native sequence PR0362 polypeptide comprising amino acids 1 to 321 of Figure 22 (SEQ ID NO:52), the native sequence PR0363 polypeptide is a mature or full-length native sequence PR0363 polypeptide comprising amino acids 1 to 373 of Figure 24 (SEQ ID NO:59), the native sequence PR0868 polypeptide is a mature or full length native sequence PR0868 polypeptide comprising amino acids I to 655 of Figure 26 (SEQ ID NO:64), the 35 native sequence PR0382 polypeptide is a mature or full-length native sequence PR0382 polypeptide comprising amino acids 1 to 453 of Figure 28 (SEQ ID NO:69), the native sequence PR0545 polypeptide is a mature or full length native sequence PRO545 polypeptide comprising amino acids 1 to 735 of Figure 30 (SEQ ID NO:74), the native sequence PR0617 polypeptide is a mature or full-length native sequence PR0617 polypeptide comprising amino acids 1 to 67 of Figure 33 (SEQ ID NO:85), the native sequence PRO700 polypeptide is a mature or full-length 110 WO 99/46281 PCT/US99/05028 native sequence PRO700 polypeptide comprising amino acids 1 to 432 of Figure 35 (SEQ ID NO:90). the native sequence PRO702 polypeptide is a mature or full-length native sequence PR0702 polypeptide comprising amino acids 1 to 277 of Figure 37 (SEQ ID NO:97), the native sequence PRO703 polypeptide is a mature or full-length native sequence PRO703 polypeptide comprising amino acids 1 to 730 of Figure 39 (SEQ ID NO:102), the native sequence PRO705 polypeptide is a mature or full-length native sequence PRO705 polypeptide comprising amino acids 1 to 555 5 of Figure 41 (SEQ ID NO:109), the native sequence PR0708 polypeptide is a mature or full-length native sequence PRO708 polypeptide comprising amino acids 1 to 515 of Figure 43 (SEQ ID NO: 114), the native sequence PR0320 polypeptide is a mature or full-length native sequence PR0320 polypeptide comprising amino acids 1 to 338 of Figure 45 (SEQ ID NO: 119), the native sequence PR0324 polypeptide is a mature or full-length native sequence PR0324 polypeptide comprising amino acids 1 to 289 of Figure 47 (SEQ ID NO:124), the native sequence PR0351 10 polypeptide is a mature or full-length native sequence PR0351 polypeptide comprising amino acids 1 to 571 of Figure 49 (SEQ ID NO: 132), the native sequence PRO352 polypeptide is a mature or full-length native sequence PRO352 polypeptide comprising amino acids 1 to 316 of Figure 51 (SEQ ID NO:137), the native sequence PRO381 polypeptide is a mature or full-length native sequence PR0381 polypeptide comprising amino acids 1 to 211 of Figure 53 (SEQ ID NO:145), the native sequence PRO386 polypeptide is a mature or full-length native sequence PRO386 15 polypeptide comprising amino acids 1 to 215 of Figure 55 (SEQ ID NO:150), the native sequence PRO540 polypeptide is a mature or full-length native sequence PRO540 polypeptide comprising amino acids 1 to 412 of Figure 59 (SEQ ID NO: 157), the native sequence PR0615 polypeptide is a mature or full-length native sequence PRO615 polypeptide comprising amino acids 1 to 224 of Figure 61 (SEQ ID NO: 162), the native sequence PR0618 polypeptide is a mature or full-length native sequence PR0618 polypeptide comprising amino acids 1 to 802 of Figure 20 63 (SEQ ID NO: 169), the native sequence PR0719 polypeptide is a mature or full-length native sequence PR0719 polypeptide comprising amino acids 1 to 354 of Figure 66 (SEQ ID NO:178), the native sequence PR0724 polypeptide is a mature or full-length native sequence PRO724 polypeptide comprising amino acids 1 to 713 of Figure 68 (SEQ ID NO: 183), the native sequence PR0772 polypeptide is a mature or full-length native sequence PR0772 polypeptide comprising amino acids 1 to 152 of Figure 70 (SEQ ID NO: 190), the native sequence PR0852 25 polypeptide is a mature or full-length native sequence PR0852 polypeptide comprising amino acids 1 to 518 of Figure 73 (SEQ ID NO: 196), the native sequence PR0853 polypeptide is a mature or full-length native sequence PR0853 polypeptide comprising amino acids 1 to 377 of Figure 75 (SEQ ID NO:206), the native sequence PR0860 polypeptide is a mature or full-length native sequence PR0860 polypeptide comprising amino acids 1 to 985 of Figure 77 (SEQ ID NO:21 1), the native sequence PR0846 polypeptide is a mature or full-length native sequence PR0846 30 polypeptide comprising amino acids 1 to 332 of Figure 79 (SEQ ID NO:216), the native sequence PR0862 polypeptide is a mature or full-length native sequence PR0862 polypeptide comprising amino acids 1 to 146 of Figure 81 (SEQ ID NO:221), the native sequence PR0864 polypeptide is a mature or full-length native sequence PR0864 polypeptide comprising amino acids 1 to 351 of Figure 83 (SEQ ID NO:226), the native sequence PR0792 polypeptide is a mature or full-length native sequence PR0792 polypeptide comprising amino acids 1 to 293 of Figure 35 85 (SEQ ID NO:231), the native sequence PR0866 polypeptide is a mature or full-length native sequence PR0866 polypeptide comprising amino acids 1 to 331 of Figure 87 (SEQ ID NO:236), the native sequence PR0871 polypeptide is a mature or full-length native sequence PR0871 polypeptide comprising amino acids 1 to 472 of Figure 89 (SEQ ID NO:245), the native sequence PR0873 polypeptide is a mature or full-length native sequence PR0873 polypeptide comprising amino acids 1 to 545 of Figure 91 (SEQ ID NO:254), the native sequence PRO940 111 WO 99/46281 PCTIUS99/05028 polypeptide is a mature or full-length native sequence PRO940 polypeptide comprising amino acids 1 to 544 of Figure 93 (SEQ ID NO:259), the native sequence PR0941 polypeptide is a mature or full-length native sequence PR0941 polypeptide comprising amino acids 1 to 772 of Figure 95 (SEQ ID NO:264), the native sequence PR0944 polypeptide is a mature or full-length native sequence PR0944 polypeptide comprising amino acids 1 to 211 of Figure 98 (SEQ ID NO:270), the native sequence PR0983 polypeptide is a mature or full-length native sequence PR0983 5 polypeptide comprising amino acids 1 to 243 of Figure 109 (SEQ ID NO:284), the native sequence PRO1057 polypeptide is a mature or full-length native sequence PRO1057 polypeptide comprising amino acids 1 to 413 of Figure 118 (SEQ ID NO:296), the native sequence PRO1071 polypeptide is a mature or full-length native sequence PRO1071 polypeptide comprising amino acids 1 to 525 of Figure 120 (SEQ ID NO:301), the native sequence PRO1072 polypeptide is a mature or full-length native sequence PRO1072 polypeptide comprising amino acids I to 10 336 of Figure 122 (SEQ ID NO:303), the native sequence PRO1075 polypeptide is a mature or full-length native sequence PRO1075 polypeptide comprising amino acids 1 to 406 of Figure 125 (SEQ ID NO:309), the native sequence PRO181 polypeptide is a mature or full-length native sequence PRO181 polypeptide comprising amino acids I to 144 of Figure 129 (SEQ ID NO:322), the native sequence PRO195 polypeptide is a mature or full-length native sequence PRO195 polypeptide comprising amino acids 1 to 323 of Figure 132 (SEQ ID NO:330), the native sequence 15 PR0865 polypeptide is a mature or full-length native sequence PR0865 polypeptide comprising amino acids 1 to 468 of Figure 136 (SEQ ID NO:337), the native sequence PRO827 polypeptide is a mature or full-length native sequence PR0827 polypeptide comprising amino acids 1 to 124 of Figure 39 (SEQ ID NO:346), the native sequence PRO 1114 polypeptide is a mature or full-length native sequence PRO1114 polypeptide comprising amino acids 1 to 311 of Figure 142 (SEQ ID NO:352), the native sequence PR0237 polypeptide is a mature or full-length native sequence 20 PRO237 polypeptide comprising amino acids 1 to 328 of Figure 145 (SEQ ID NO:358), the native sequence PR0541 polypeptide is a mature or full-length native sequence PR0541 polypeptide comprising amino acids 1 to 500 of Figure 147 (SEQ ID NO:363), the native sequence PR0273 polypeptide is a mature or full-length native sequence PR0273 polypeptide comprising amino acids 1 through 111 of Figure 149 (SEQ ID NO:370), the native sequence PRO701 polypeptide is a mature or full-length native sequence PRO701 polypeptide comprising amino acids 1 to 816 of Figure 25 151 (SEQ ID NO:375), the native sequence PR0704 polypeptide is a full-length or mature native sequence PR0704 polypeptide comprising amino acids 1 or 40 through 348 of Figure 153 (SEQ ID NO:380), the native sequence PRO706 polypeptide is a mature or full-length native sequence PR0706 polypeptide comprising amino acids 1 to 480 of Figure 155 (SEQ ID NO:385), the native sequence PR0707 polypeptide is a full-length or mature native sequence PR0707 polypeptide comprising amino acids 1 or 31 through 916 of Figure 157 (SEQ ID NO:390), the native 30 sequence PR0322 polypeptide is a mature or full-length native sequence PR0322 polypeptide comprising amino acids 24 or 1 to 260 of Figure 159 (SEQ ID NO:395), the native sequence PR0526 polypeptide is a full-length or mature native sequence PRO526 polypeptide comprising amino acids 1 or 27 through 473 of Figure 161 (SEQ ID NO:400), the native sequence PR0531 polypeptide is a mature PROS31 polypeptide comprising amino acids 1 to 789 of Figure 163 (SEQ ID NO:405), the native sequence PR0534 polypeptide is a mature or full-length native sequence PR0534 35 polypeptide comprising amino acids 1 to 360 of Figure 165 (SEQ ID NO:410), the native sequence PR0697 polypeptide is a full-length or mature native sequence PR0697 polypeptide comprising amino acids I or 21 through 295 of Figure 167 (SEQ ID NO:415), the native sequence PR0717 polypeptide is a mature or full-length native sequence PR0717 polypeptide comprising amino acids 1 through 560 of Figure 169 (SEQ ID NO:420), the native sequence PRO731 polypeptide is a full-length or mature native sequence PR0731 polypeptide comprising amino acids 112 WO 99/46281 PCT/US99/05028 1 or 14 through 1184 of Figure 171 (SEQ ID NO:425), the native sequence PR0218 polypeptide is a full-length or mature native sequence PRO218 polypeptide comprising amino acids 1 or 24 through 455 of Figure 173 (SEQ ID NO:430), the native sequence PR0768 polypeptide is a full-length or mature native sequence PR0768 polypeptide comprising amino acids 1 or 34 through 1141 of Figure 177 (SEQ ID NO:437), the native sequence PR0771 polypeptide is a full-length or mature native sequence PR0771 polypeptide comprising amino acids 1 or 17 through 5 436 of Figure 179 (SEQ ID NO:442), the native sequence PR0733 polypeptide is a mature or full-length native sequence PR0733 polypeptide comprising amino acids 24 or 1 through 229 of Figure 181 (SEQ ID NO:447), the native sequence PRO162 polypeptide is a full-length or mature native sequence PRO162 polypeptide comprising amino acids 1 or 27 through 175 of Figure 183 (SEQ ID NO:452), the native sequence PR0788 polypeptide is a full length or mature native sequence PR0788 polypeptide comprising amino acids 1 or 18 through 125 of Figure 185 10 (SEQ ID NO:454), the native sequence PRO1008 polypeptide is a full-length or mature native sequence PRO1008 polypeptide comprising amino acids 1 or 24 through 266 of Figure 187 (SEQ ID NO:456), the native sequence PRO1012 polypeptide is a mature or full-length native sequence PRO1012 polypeptide comprising amino acids 1 through 747 of Figure 190 (SEQ ID NO:459), the native sequence PRO1014 polypeptide is a full-length or mature native sequence PRO1014 polypeptide comprising amino acids 1 or 20 through 300 of Figure 192 (SEQ ID NO:464), 15 the native sequence PRO1017 polypeptide is a full-length or mature native sequence PRO1017 polypeptide comprising amino acids 1 or 32 through 414 of Figure 194 (SEQ ID NO:466), the native sequence PR0474 polypeptide is a mature or full-length native sequence PRO474 polypeptide comprising amino acids 1 through 270 of Figure 196 (SEQ ID NO:468), the native sequence PRO1031 polypeptide is a full-length or mature native sequence PRO1031 polypeptide comprising amino acids 1 or 21 through 180 of Figure 198 (SEQ ID NO:470), the native sequence 20 PR0938 polypeptide is a mature or full-length native sequence PR0938 polypeptide comprising amino acids 1 to 349 of Figure 200 (SEQ ID NO:472), the native sequence PRO1082 polypeptide is a full-length or mature native sequence PRO1082 polypeptide comprising amino acids 1 through 201 of Figure 202 (SEQ ID NO:477), the native sequence PRO1083 polypeptide is a full-length or mature native sequence PRO1083 polypeptide comprising amino acids 1 or 26 through 693 of Figure 204 (SEQ ID NO:483), the native sequence VEGF-E polypeptide is a mature or full-length 25 native sequence VEGF-E polypeptide comprising amino acids 1 through 345 as depicted in Figure 207 (SEQ ID NO:488), the native sequence PR0285 is a mature or full-length native sequence PR0285 polypeptide comprising amino acids 1 to 1049 of Figure 209 (SEQ ID NO:496), the native sequence PR0286 is a mature or full-length native sequence PR0286 polypeptide comprising amino acids 1 to 1041 of Figure 211 (SEQ ID NO:298), the native sequence PRO298 is a mature or full-length native sequence PR0298 comprising amino acids 1 to 364 of Figure 219 30 (SEQ ID NO:515), the native sequence PR0337 is a mature or full-length native sequence human neurotrimin comprising amino acids 1 to 344 of Figure 222 (SEQ ID NO:523), with or without the N-terminal signal sequence (residues 1 to about 28), and with or without the initiating methionine at position 1 and the native sequence PR0403 is a mature or full-length native sequence comprising amino acids 1 to 736 of Figure 225 (SEQ ID NO:526), with or without the initiating methionine at position 1. 35 The PRO polypeptide "extracellular domain" or "ECD" refers to a form of the PRO polypeptide which is essentially free of the transmembrane and cytoplasmic domains. Ordinarily, a PRO polypeptide ECD will have less than 1 % of such transmembrane and/or cytoplasmic domains and preferably, will have less than 0.5% of such domains. It will be understood that any transmembrane domains identified for the PRO polypeptides of the present invention are identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic 113 WO 99/46281 PCTIUS99/05028 domain. The exact boundaries of a transmembrane domain may vary but most likely by no more than about 5 amino acids at either end of the domain as initially identified. Optionally, therefore, an extracellular domain of a PRO polypeptide may contain from about 5 or fewer amino acids on either or the transmembrane domain as initially identified. "PRO polypeptide variant" means an active PRO polypeptide as defined above or below having at least about 5 80% amino acid sequence identity with the full-length native sequence PRO polypeptide sequence as disclosed herein. Such PRO polypeptide variants include, for instance, PRO polypeptides wherein one or more amino acid residues are added, or deleted, at the N- or C-terminus of the full-length native amino acid sequence. Ordinarily, a PRO polypeptide variant will have at least about 80% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, and even more preferably at least about 90% amino acid sequence identity, even more 10 preferably at least about 91 % amino acid sequence identity, even more preferably at least about 92% amino acid sequence identity, even more preferably at least about 93% amino acid sequence identity, even more preferably at least about 94% amino acid sequence identity, even more preferably at least about 95% amino acid sequence identity, yet more preferably at least about 96% amino acid sequence identity, yet more preferably at least about 97% amino acid sequence identity, yet more preferably at least about 98% amino acid sequence identity and most preferably at 15 least about 99% amino acid sequence identity with the amino acid sequence of the full-length native amino acid sequence as disclosed herein. "Percent (%) amino acid sequence identity" with respect to the PRO polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific PRO polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, 20 to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. The preferred software alignment program is BLAST. Those skilled in the art can determine appropriate parameters for measuring alignment, including any 25 algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The % identity values used herein have been generated using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266:460-480 (1996); http://blast.wustl/edu/blast/README.html). Most of the WU-BLAST-2 search parameters were set to the default values. The adjustable parameters were set with the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. The HSP S and HSP 30 S2 parameters, which are dynamic values used by BLAST-2, are established by the program itself depending upon the composition of the sequence of interest and composition of the database against which the sequence is being searched. However, the values may be adjusted to increase sensitivity. A % sequence identity value is determined by the fraction of matching identical residues divided by the total number of residues in the aligned region. "Percent (%) nucleic acid sequence identity" with respect to PRO-encoding nucleic acid sequences identified 35 herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the PRO nucleic acid sequence of interest, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art 114 WO 99/46281 PCT/US99/05028 can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The identity values used herein were generated by the BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively. The term "positives", in the context of sequence comparison performed as described above, includes 5 residues in the sequences compared that are not identical but have similar properties (e.g. as a result of conservative substitutions). The % value of positives is determined by the fraction of residues scoring a positive value in the BLOSUM 62 matrix divided by the total number of residues in the aligned region, as defined above. The term "epitope tagged" where used herein refers to a chimeric polypeptide comprising a PRO polypeptide, or domain sequence thereof, fused to a "tag polypeptide". The tag polypeptide has enough residues to 10 provide an epitope against which an antibody may be made, or which can be identified by some other agent, yet is short enough such that it does not interfere with the activity of the PRO polypeptide of interest. The tag polypeptide preferably is also fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 to about 50 amino acid residues (preferably, between about 10 to about 20 residues). 15 "Isolated," when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In preferred embodiments, the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal 20 or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step. An "isolated" PRO polypeptide-encoding nucleic acid is a nucleic acid molecule that is identified and 25 separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the PRO polypeptide nucleic acid. An isolated PRO polypeptide nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated PRO polypeptide nucleic acid molecules therefore are distinguished from the specific PRO polypeptide nucleic acid molecule as it exists in natural cells. However, an isolated PRO polypeptide nucleic acid molecule includes PRO polypeptide nucleic acid molecules contained in cells 30 that ordinarily express the PRO polypeptide where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells. The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to 35 utilize promoters, polyadenylation signals, and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is 115 WO 99/46281 PCT/US99/05028 operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. 5 The term "antibody" is used in the broadest sense and specifically covers single anti-PRO polypeptide monoclonal antibodies (including agonist, antagonist, and neutralizing antibodies) and anti-PRO polypeptide antibody compositions with polyepitopic specificity. The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. 10 "Active" or "activity" for the purposes herein refers to form(s) of PRO polypeptide which retain the biologic and/or immunologic activities of the specific native or naturally-occurring PRO polypeptide. "Treatment" or "treating" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those prone to have the disorder of those in which the disorder is to be prevented. 15 "Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as sheep, dogs, horses, cats, cows, and the like. Preferably, the mammal herein is a human. "Carriers" as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the 20 physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, 25 or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM, polyethylene glycol (PEG), and PLURONICSTM. The term "agonist" is used to refer to peptide and non-peptide analogs of the native PRO polypeptides (where native PRO polypeptide refers to pro-PRO polypeptide, pre-PRO polypeptide, prepro-PRO polypeptide, or mature PRO polypeptide) of the present invention and to antibodies specifically binding such native PRO 30 polypeptides, provided that they retain at least one biological activity of a native PRO polypeptide. Preferably, the agonists of the present invention retain the qualitative binding recognition properties and receptor activation properties of the native PRO polypeptide. The term "antagonist" is used to refer to a molecule inhibiting a biological activity of a native PRO polypeptide of the present invention wherein native PRO polypeptide refers to pro-PRO polypeptide, pre-PRO 35 polypeptide, prepro-PRO polypeptide, or mature PRO polypeptide. Preferably, the antagonists herein inhibit the binding of a native PRO polypeptide of the present invention to a binding partner. A PRO polypeptide "antagonist" is a molecule which prevents, or interferes with, a PRO antagonist effector function (e.g. a molecule which prevents or interferes with binding and/or activation of a PRO polypeptide receptor by PRO polypeptide). Such molecules can be screened for their ability to competitively inhibit PRO polypeptide receptor activation by monitoring binding 116 WO 99/46281 PCT/US99/05028 of native PRO polypeptide in the presence and absence of the test antagonist molecule, for example. An antagonist of the invention also encompasses an antisense polynucleotide against the PRO polypeptide gene, which antisense polynucleotide blocks transcription or translation of the PRO polypeptide gene, thereby inhibiting its expression and biological activity. "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and 5 generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, 10 it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995). "Stringent conditions" means (1) employing low ionic strength and high temperature for washing, for example, 0.015 sodium chloride/0.0015 M sodium citrate/0. 1% sodium dodecyl sulfate at 50*C, or (2) employing 15 during hybridization a denaturing agent, such as formamide, for example, 50% (vol/vol) formamide with 0.1 % bovine serum albumin/0. 1 % Ficoll/0. 1 % polyvinylpyrrolidone/50 nM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42*C. Another example is use of 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6/8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 pg/ml), 0.1% SDS, and 10% dextran sulfate at 42*C, with washes at 20 42*C in 0.2 x SSC and 0.1% SDS. Yet another example is hybridization using a buffer of 10% dextran sulfate, 2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55 *C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55*C. "Moderately stringent conditions" are described in Sambrook et al., supra, and include the use of a washing solution and hybridization conditions (e.g., temperature, ionic strength, and %SDS) less stringent than described 25 above. An example of moderately stringent conditions is a condition such as overnight incubation at 370C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50*C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc., as necessary to accommodate factors such as probe length and the like. 30 "Southern analysis" or "Southern blotting" is a method by which the presence of DNA sequences in a restriction endonuclease digest of DNA or a DNA-containing composition is confirmed by hybridization to a known, labeled oligonucleotide or DNA fragment. Southern analysis typically involves electrophoretic separation of DNA digests on agarose gels, denaturation of the DNA after electrophoretic separation, and transfer of the DNA to nitrocellulose, nylon, or another suitable membrane support for analysis with a radiolabeled, biotinylated, or enzyme 35 labeled probe as described in sections 9.37-9.52 of Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). "Northern analysis" or "Northern blotting" is a method used to identify RNA sequences that hybridize to a known probe such as an oligonucleotide, DNA fragment, cDNA or fragment thereof, or RNA fragment. The probe is labeled with a radioisotope such as "P, or by biotinylation, or with an enzyme. The RNA to be analyzed is usually 117 WO 99/46281 PCT/US99/05028 electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe, using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al., supra. As used herein, the term "immunoadhesin" designates antibody-like molecules which combine the binding specificity of a heterologous protein (an "adhesin") with the effector functions of immunoglobulin constant domains. 5 Structurally, the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i.e., is "heterologous"), and an immunoglobulin constant domain sequence. The adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand. The immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG-1, IgG-2, IgG-3, 10 or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM. "Chronic" administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time. "Intermittent" administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature. Administration "in combination with" one or more further therapeutic agents includes simultaneous 15 (concurrent) and consecutive administration in any order. As used herein, "vascular endothelial cell growth factor-E," or "VEGF-E," refers to a mammalian growth factor as described herein, including the human amino acid sequence of Figure 207, a sequence which has homology to VEGF and bone morphogenetic protein 1 and which includes complete conservation of all VEGF cysteine residues, which have been shown to be required for biological activity of VEGF. VEGF-E expression includes expression in 20 human fetal bone, thymus, and the gastrointestinal tract. The biological activity of native VEGF-E is shared by any analogue or variant thereof that is capable of promoting selective growth and/or survival of umbilical vein endothelial cells, induces proliferation of pluripotent fibroblast cells, induces immediate early gene c-fos in human endothelial cell lines and causes myocyte hypertrophy in cardiac cells, or which possesses an immune epitope that is immunologically cross-reactive with an antibody raised against at least one epitope of the corresponding native VEGF 25 E. The human VEGF-E herein is active on rat and mouse cells indicating conservation across species. Moreover, the VEGF-E herein is expressed at the growth plate region and has been shown to embrace fetal myocytes. As used herein, "vascular endothelial cell growth factor," or "VEGF," refers to a mammalian growth factor as defined in U.S. Patent 5,332,671. The biological activity of native VEGF is shared by any analogue or variant thereof that is capable of promoting selective growth of vascular endothelial cells but not of bovine corneal endothelial 30 cells, lens epithelial cells, adrenal cortex cells, BHK-21 fibroblasts, or keratinocytes, or that possesses an immune epitope that is immunologically cross-reactive with an antibody raised against at least one epitope of the corresponding native VEGF. The terms "VEGF-E polypeptide" and "VEGF-E" when used herein encompass native sequence VEGF-E polypeptide and VEGF-E polypeptide variants (which are further defined herein). The VEGF-E polypeptides may 35 be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods. Inhibitors of VEGF-E include those which reduce or inhibit the activity or expression of VEGF-E and includes antisense molecules. 118 WO 99/46281 PCT/US99/05028 The abbreviation "KDR" refers to the kinase domain region of the VEGF molecule. VEGF-E has no homology with VEGF in this domain. The abbreviation "FLT-1" refers to the FMS-like tyrosine kinase binding domain which is known to bind to the corresponding FLT-1 receptor. VEGF-E has no homology with VEGF in this domain. "Toll receptor2", "TLR2" and "huTLR2" are used interchangeably, and refer to a human Toll receptor 5 designated as "HuTLR2" by Rock et al., Proc. Natil. Acad. Sci. USA 95, 588-593 (1998). The term "expression vector" is used to define a vector, in which a nucleic acid encoding a PRO polypeptide herein is operably linked to control sequences capable of affecting its expression is a suitable host cells. Vectors ordinarily carry a replication site (although this is not necessary where chromosomal integration will occur). Expression vectors also include marker sequences which are capable of providing phenotypic selection in transformed 10 cells. For example, E. coli is typically transformed using pBR322, a plasmid derived from an E. coli species (Bolivar, et al., Gene 2: 95 [1977]). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells, whether for purposes of cloning or expression. Expression vectors also optimally will contain sequences which are useful for the control of transcription and translation, e.g., promoters and Shine-Dalgarno sequences (for prokaryotes) or promoters and enhancers (for mammalian cells). The 15 promoters may be, but need not be, inducible; even powerful constitutive promoters such as the CMV promoter for mammalian hosts have been found to produce the LHR without host cell toxicity. While it is conceivable that expression vectors need not contain any expression control, replicative sequences or selection genes, their absence may hamper the identification of hybrid transformants and the achievement of high level hybrid immunoglobulin expression. 20 The term "lipopolysaccharide" or "LPS" is used herein as a synonym of "endotoxin." Lipopolysaccharides (LPS) are characteristic components of the outer membrane of Gram-negative bacteria, e.g., Escherichia coli. They consist of a polysaccharide part and a fat called lipid A. The polysaccharide, which varies from one bacterial species to another, is made up of the O-specific chain (built from repeating units of three to eight sugars) and the two-part core. Lipid A virtually always includes two glucosamine sugars modified by phosphate and a variable number of fatty 25 acids. For further information see, for example, Rietschel and Brade, Scientific American August 1992, 54-61. The term "septic shock" is used herein in the broadest sense, including all definitions disclosed in Bone, Ann Intem Med. 114, 332-333 (1991). Specifically, septic shock starts with a systemic response to infection, a syndrome called sepsis. When this syndrome results in hypotension and organ dysfunction, it is called septic shock. Septic shock may be initiated by gram-positive organisms and fungi, as well as endotoxin-containing Gram-negative 30 organisms. Accordingly, the present definition is not limited to "endotoxin shock." The phrases "gene amplification" and "gene duplication" are used interchangeably and refer to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as "amplicon". Usually, the amount of the messenger RNA (mRNA) produced, i.e., the level of gene expression, also increases in the proportion of the number of copies made 35 of the particular gene expressed. "Tumor", as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples 119 WO 99/46281 PCTIUS99/05028 of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, colorectal cancer, endometrial carcinoma, salivary gland carcinoma, kidney cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer. The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells 5 and/or causes destruction of cells. The term is intended to include radioactive isotopes (e.g. 1131, 1125, Y90 and Re186), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof. A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), 10 cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e.g. paclitaxel (Taxol, Bristol-Myers Squibb Oncology, Princeton, NJ), and doxetaxel (Taxotereu, Rhone-Poulenc Rorer, Antony, France), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin, dactinomycin, mitomycins, esperamicins (see U.S. Pat. No. 4,675,187), melphalan and other related nitrogen mustards. Also included in this definition are hormonal 15 agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapristone. A "growth inhibitory agent" when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo. Thus, the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase. Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than 20 S phase), such as agents that induce G1 arrest and M-phase arrest. Classical M-phase blockers include the vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. Those agents that arrest G1 also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. Further information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1, entitled 25 "Cell cycle regulation, oncogens, and antineoplastic drugs "by Murakami et al. (WB Saunders: Philadelphia, 1995), especially p.13. "Doxorubicin" is an athracycline antibiotic. The term cytosinee" is a generic term for proteins released by one cell population which act on another cell as intercellular mediators. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide 30 hormones. Included among the cytokines are growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; and the like. As used herein, the term cytokine includes proteins from natural sources or from recombinant cell culture and biologically active equivalents of the native sequence cytokines. "Immunological cross-reactivity" as used herein means that the candidate polypeptide is capable of 35 competitively inhibiting the qualitative biological activity of a PR0213-1, PRO1330, or PRO1449 polypeptide having this activity with polyclonal antisera raised against the known active PR0213-1, PRO1330, or PRO1449 polypeptide. Such antisera may be prepared in conventional fashion by injecting goats or rabbits, for example, subcutaneously with the known active analogue in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freunds. The immunological cross-reactivity preferably is "specific", which means that the 120 WO 99/46281 PCT/US99/05028 binding affinity of the immunological cross-reactive molecule (e.g., antibody) identified, to the corresponding PR0213-1, PRO1330, or PRO1449 polypeptide is significantly higher (preferably at least about 2-times, more preferably at least about 4-times, even more preferably at least about 6-times, most preferably at least about 8-times higher) than the binding affinity of that molecule to any other known native polypeptide. "Native antibodies" and "native immunoglobulins" are usually heterotetrameric glycoproteins of about 5 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains. Each light chain has a variable domain at one end (VL) and a constant domain at its other end; the constant 10 domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains. The term "variable" refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular 15 antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervariable regions both in the light-chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are called the framework (FR). The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a P-sheet configuration, connected by three CDRs, which form loops connecting, and in 20 some cases forming part of, the P-sheet structure. The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., NIH Publ. No.91-3242, Vol. I, pages 647-669 (1991)). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity. 25 "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies (Zapata et al. , Protein Eng. 8(10): 1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, 30 each with a single antigen-binding site, and a residual "Fc " fragment, a designation reflecting the ability to crystallize readily. Pepsin treatment yields an F(ab')2 fragment that has two antigen-combining sites and is still capable of cross linking antigen. "Fv" is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. 35 It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site. 121 WO 99/46281 PCTIUS99/05028 The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CHI domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between 5 them. Other chemical couplings of antibody fragments are also known. The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequences of their constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, 10 and several of these may be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2. "Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding. For a review of sFv see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg 15 and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994). The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) in the same polypeptide chain (VH - VL). By using a liner that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen 20 binding sites. Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993). An "isolated" antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous 25 or nonproteinaceous solutes. In preferred embodiments, the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one 30 component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. The word "label" when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a "labelled" antibody. The label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration 35 of a substrate compound or composition which is detectable. By "solid phase" is meant a non-aqueous matrix to which the antibody of the present invention can adhere. Examples of solid phases encompassed herein include those formed partially or entirely of glass (e.g., controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones. In certain embodiments, depending on the context, the solid phase can comprise the well of an assay plate; in others it is a 122 WO 99/46281 PCTIUS99/05028 purification column (e.g., an affinity chromatography column). This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149. A "liposome" is a small vesicle composed of various types of lipids, phospholipids and/or surfactant which is useful for delivery of a drug (such as the anti-ErbB2 antibodies disclosed herein and, optionally, a chemotherapeutic agent) to a mammal. The components of the liposome are commonly arranged in a bilayer formation, similar to the 5 lipid arrangement of biological membranes. II. Compositions and Methods of the Invention 1. Full-length PR0213 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 10 referred to in the present application as PR0213. In particular, Applicants have identified and isolated cDNA encoding a PR0213 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that a portion of the PR0213 polypeptide has significant homology with the human growth arrest-specific 6 (gas6) protein. Accordingly, it is presently believed that PR0213 polypeptide disclosed in the present application may have the same or simular activity as does the gas6 protein. 15 2. Full-length PRO274 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0274. In particular, Applicants have identified and isolated cDNA encoding a PR0274 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 20 sequence alignment computer programs, Applicants found that various portions of the PR0274 polypeptide have significant homology with the 7 transmembrane segment receptor proteins and Fn54 protein. Accordingly, it is presently believed that PR0274 polypeptide disclosed in the present application is a newly identified member of the 7 transmembrane segment receptor protein and/or Fn54 protein family. 25 3. Full-length PRO300 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO300. In particular, Applicants have identified and isolated cDNA encoding a PRO300 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PRO300 polypeptide have 30 significant homology with the human Diff 33 protein. Accordingly, it is presently believed that PRO300 polypeptide disclosed in the present application is a newly identified member of the Diff 33 family. 4. Full-length PRO284 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 35 referred to in the present application as PR0284. In particular, Applicants have identified and isolated cDNA encoding a PR0284 polypeptide, as disclosed in further detail in the Examples below. To Applicants present knowledge, the UNQ247 (DNA23318-121 1) nucleotide sequence encodes a novel factor; using BLAST and FastA sequence alignment computer programs, no sequence identities to any known proteins were revealed. 123 WO 99/46281 PCT/US99/05028 5. Full-length PRO296 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0296. In particular, Applicants have identified and isolated cDNA encoding a PR0296 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0296 polypeptide has significant similarity to 5 the sarcoma-amplified SAS protein. Accordingly, it is presently believed that PR0296 polypeptide disclosed in the present application is a newly identified SAS protein homolog. 6. Full-len2th PR0329 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 10 referred to in the present application as PR0329. In particular, Applicants have identified and isolated cDNA encoding a PR0329 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0329 polypeptide has significant similarity to a high affinity immunoglobulin F, receptor. Accordingly, it is presently believed that PR0329 polypeptide disclosed in the present application is a newly identified F. receptor homolog. 15 7. Full-length PR0362 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0362. In particular, Applicants have identified and isolated cDNA encoding a PR0362 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 20 sequence alignment computer programs, Applicants found that the PR0362 polypeptide has significant similarity to the A33 antigen protein as well as the HCAR protein and the NrCAM related cell adhesion molecule. Accordingly, it is presently believed that PR0362 polypeptide disclosed in the present application is a newly A33 antigen and HCAR protein homolog. 25 8. Full-length PR0363 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0363. In particular, Applicants have identified and isolated cDNA encoding a PR0363 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0363 polypeptide has significant similarity to 30 the cell surface protein HCAR. Accordingly, it is presently believed that PR0363 polypeptide disclosed in the present application is a newly HCAR homolog. 9. Full-length PRO868 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 35 referred to in the present application as PR0868. In particular, Applicants have identified and isolated cDNA encoding a PR0868 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence aligmnent computer programs, Applicants found that the PR0868 polypeptide has significant similarity to the tumor necrosis factor receptor. Accordingly, it is presently believed that PR0868 polypeptide disclosed in the present application is a newly identified member of the tumor necrosis factor receptor family of proteins. 124 WO 99/46281 PCT/US99/05028 10. Full-length PRO382 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0382. In particular, Applicants have identified and isolated cDNA encoding a PR0382 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the native PR0382 polypeptide shares significant 5 homology with various serine protease proteins. Applicants have also found that the DNA encoding the PR0382 polypeptide shares significant homology with nucleic acid encoding various serine protease proteins. Accordingly, it is presently believed that PR0382 polypeptide disclosed in the present application is a newly identified serine protease homolog. 10 11. Full-length PR0545 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0545. In particular, Applicants have identified and isolated cDNA encoding a PR0545 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0545 polypeptide have 15 significant homology with the sequences identified designated as; human metalloproteinase ("P_W01825"), mouse meltrin alpha ("S60257"), metalloprotease-disintegrin meltrin-alpha ("GEN13695"), ADAM 13 - Xenopus laevis ("XLU66003_1 "), mouse meltrin beta ("S60258"), rabbit metalloprotease-disintegrin meltrin-beta, ("GEN13696"), human meltrin S ("AF023477_1"), human meltrin precursor ("AF023476_1"), human ADAM 21 ("AF029900_1"), and human ADAM 20 ("AF029899_1 "), thereby indicating that PR0545 may be a novel meltrin protein. 20 Accordingly, it is presently believed that the PR0545 polypeptide disclosed in the present application is a newly identified member of the meltrin family and possesses the cellular adhesiveness typical of the meltrin proteins which comprise both metalloprotease and disintegrin domains. 12. Full-length PR0617 Polypeptides 25 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0617. In particular, Applicants have identified and isolated cDNA encoding a PR0617 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0617 polypeptide shares significant homology with the CD24 protein. Applicants have also found that the DNA encoding the PR0617 polypeptide has significant 30 homology with DNA encoding the CD24 protein. Accordingly, it is presently believed that PR0617 polypeptide disclosed in the present application is a newly identified CD24 homolog. 13. Full-length PRO700 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 35 referred to in the present application as PRO700. In particular, Applicants have identified and isolated cDNA encoding a PRO700 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PRO700 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PRO700 polypeptide possess significant sequence similarity to various protein disulfide isomerases. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced 125 WO 99/46281 PCT/US99/05028 significant sequence similarity between the PRO700 amino acid sequence and the following Dayhoff sequences; polypeptide with protein disulfide isomerase activity, designated as ("PP80664"), human PDI, designated as ("PR51696"), human PDI, designated as (PR25297"), probable protein disulfide isomerase er-60 precursor, designated as ("ER60_SCHMA"), protein disulfide isomerase precursor - Drosophila melanogaster, designated as ("PDIDROME"), protein disulfide-isomerase precursor - Nicotiana tabaccum, designated as ("NTPDIGENE_1"), 5 protein disulfide isomerase - Onchocerca volvulus, designated as ("OVU12440_1 "), human probable protein disulfide isomerase p5 precursor , designated as ("ERP5_HUMAN"), human protein disulfide isomerase-related protein 5, ("HSU79278_1 "), and protein disulfide isomerase precursor / prolyl 4- hydroxy, ("PDI HUMAN"), thereby indicating that PRO700 may be a novel protein disulfide isomerase. Accordingly, it is presently believed that PRO700 polypeptide disclosed in the present application is a newly identified member of the protein disulfide 10 isomerase family and possesses the ability to catalyze the formation of disulfide bonds typical of the protein disulfide isomerase family. 14. Full-length PR0702 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 15 referred to in the present application as PR0702. In particular, Applicants have identified and isolated cDNA encoding a PR0702 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0702 polypeptide has significant similarity to the conglutinin protein. Accordingly, it is presently believed that PR0702 polypeptide disclosed in the present application is a newly identified conglutinin homolog. 20 15. Full-length PR0703 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0703. In particular, Applicants have identified and isolated cDNA encoding a PR0703 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid 25 sequence of the full-length PR0703 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PR0703 polypeptide possess significant sequence similarity to the VLCAS protein, thereby indicating that PRO703 may be a novel VLCAS protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PR0703 amino acid sequence and the following Dayhoff sequences, human mRNA for very-long-chain acyl-CoA, ("D88308"), rat 30 mRNA for very-long-chain acyl-CoA synthetase, ("D85100"), Mus musculus fatty acid transport protein, ("MMU15976"), human very-long-chain acyl-CoA synthetase, ("D88308_1"), Mus musculus very-long-chain acyl-CoA synthetase, ("AF033031_1"), very-long-chain acyl-CoA synthetase - Rattus, ("D85100 1"), rat long-chain fatty acid transport protein, ("FATPRAT"), mouse long-chain fatty acid transport protein, ("FATP MOUSE"), probable long-chain fatty acid transport protein, ("FAT1_YEAST"), and fatty acid transporter protein, 35 ("CHY15839_2") , thereby indicating that PR0703 may be a novel VLCAS. Accordingly, it is presently believed that PRO703 polypeptide disclosed in the present application is a newly identified member of the VLCAS family and possesses the ability to facilitate the cellular transport of long and very long chain fatty acids typical of the VLCAS family. 126 WO 99/46281 PCTIUS99/05028 16. Full-length PR0705 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0705. In particular, Applicants have identified and isolated cDNA encoding a PR0705 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0705 polypeptide has significant similarity to 5 the K-glypican protein. Accordingly, it is presently believed that PR0705 polypeptide disclosed in the present application is a newly identified member of the glypican family of proteoglycan proteins. 17. Full-length PR0708 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 10 referred to in the present application as PR0708. In particular, Applicants have identified and isolated cDNA encoding a PR0708 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0708 polypeptide has significant homology with the aryl sulfatase proteins. Applicants have also found that the DNA encoding the PR0708 polypeptide has significant homology with DNA encoding the aryl sulfatase proteins. Accordingly, it is presently believed that 15 PR0708 polypeptide disclosed in the present application is a newly identified aryl sulfatase homolog. 18. Full-length PRO320 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0320. In particular, Applicants have identified and isolated cDNA 20 encoding a PR0320 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PR0320 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PR0320 polypeptide have significant homology to the fibulin protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0320 amino acid sequence and the following Dayhoff sequences, human fibulin-2 precursor, 25 designated "FBL2_HUMAN", human fibulin-1 isoform a precursor, designated "FBLAHUMAN", ZK783.1 Caenorhabditis elegans, designated "CELZK783_1", human-notch2, designated "HSU77493_1", Nel protein precursor - rattus norvegicus, designated "NELRAT", Mus musculus cell surface protein, designated "D32210_1", mouse (fragment) Notch B protein, designated "A49175", C50H2.3a - Caenorhabditis elegans, designated "CEC50H2_3", MEC-9L - Caenorhabditis elegans, designated "CEU33933_1", and Mus musculus notch 4, 30 designated "10 MMMHC29N7_2", thereby indicating that PR0320 may be a novel fibulin or fibulin-like protein. Accordingly, it is presently believed that PR0320 polypeptide disclosed in the present application is a newly identified member of the fibulin family and possesses biological activity typical of the fibulin family. 19. Full-length PR0324 Polypeptides 35 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0324. In particular, Applicants have identified and isolated cDNA encoding a PR0324 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0324 polypeptide has significant similarity to oxidoreductases. Accordingly, it is presently believed that PR0324 polypeptide disclosed in the present application 127 WO 99/46281 PCT/US99/05028 is a newly identified oxidoreductase homolog. 20. Full-length PR0351 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0351. In particular, Applicants have identified and isolated cDNA 5 encoding a PR0351 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PR0351 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PR0351 polypeptide possess significant sequence similarity to the prostasin protein, thereby indicating that PR0351 may be a novel prostasin protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PR0351 amino 10 acid sequence and the following Dayhoff sequences, "AC003965_1", "CELC07G1_7", "GEN12917", "HEPSHUMAN", "GEN14584", "MCT6_MOUSE", "HSU75329_1", "PLMNERIEU", "TRYBHUMAN", and "PW22987". Accordingly, it is presently believed that PR0351 polypeptide disclosed in the present application is a newly identified member of the prostasin family and possesses properties and activities typical of the prostasin family. 15 21. Full-length PR0352 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0352. In particular, Applicants have identified and isolated cDNA encoding a PR0352 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 20 sequence alignment computer programs, Applicants found that the PR0352 polypeptide has significant similarity to the butyrophilin protein. Accordingly, it is presently believed that PR0352 polypeptide disclosed in the present application is a newly identified butyrophilin homolog. 22. Full-length PR0381 Polypeptides 25 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0381. In particular, Applicants have identified and isolated cDNA encoding a PR0381 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0381 polypeptide has significant similarity to immunophilin proteins. Accordingly, it is presently believed that PR0381 polypeptide disclosed in the present 30 application is a newly identified FKBP immunophilin homolog. 23. Full-length PR0386 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0386. In particular, Applicants have identified and isolated cDNA 35 encoding a PR0386 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0386 polypeptide has significant similarity to the beta-2 subunit of a sodium channel protein. Accordingly, it is presently believed that PR0386 polypeptide disclosed in the present application is homolog of a beta-2 subunit of a sodium channel expressed in mammalian cells. 128 WO 99/46281 PCT/US99/05028 24. Full-length PR0540 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0540. In particular, Applicants have identified and isolated cDNA encoding a PR0540 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PR0540 polypeptide using BLAST and FastA sequence alignment computer programs, 5 suggests that various portions of the PR0540 polypeptide possess significant sequence similarity to the LCAT protein, thereby indicating that PR0540 may be a novel LCAT protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PR0540 amino acid sequence and the following Dayhoff sequences, phosphatidylcholine-sterol acyltransferase, designated "LCATHUMAN", hypothetical 75.4 kd protein, designated "YN84_YEAST", Bacillus licheniformis esterase, 10 designated "BLU35 855_1", macrotetrolide resistance protein - Streptomyces, designated "JH0655", T-cell receptor delta chain precursor, designated "C30583", Rhesus kringle 2, designated "P W07551", RAGE-1 ORF5, designated "HSU46191_3", human Ig kappa chain VKIII-JK3, designated "HSU07466_1", and Alstroemeria inodora reverse transcriptase, designated "ALI223606_1". Accordingly, it is presently believed that PR0540 polypeptide disclosed in the present application is a newly identified member of the LCAT protein family and possesses lipid transport 15 capability typical of the LCAT family. 25. Full-length PR0615 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO615. In particular, Applicants have identified and isolated cDNA 20 encoding a PR0615 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PR0615 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PR0615 polypeptide possess significant sequence similarity to the human synaptogyrin protein, thereby indicating that PR0615 may be a novel synaptogyrin protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the 25 PRO615 amino acid sequence and the following Dayhoff sequences, "AF039085_1", "RNU39549_1", "CELT08A9_8", "FSU62028_1", "S73645", "Y348_MYCPN", "AC000103 5", "", "RT12_LEITA", and "EBVLMP218_1". Accordingly, it is presently believed that PR0615 polypeptide disclosed in the present application is a newly identified member of the synaptogyrin family and possesses activity and properties typical of the synaptogyrin family. 30 26. Full-length PR0618 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO618. In particular, Applicants have identified and isolated cDNA encoding a PR0618 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid 35 sequence of the full-length PR0618 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PRO618 polypeptide possess significant sequence similarity to the enteropeptidase protein, thereby indicating that PR0618 may be a novel enteropeptidase. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PRO618 amino acid sequence and the following Dayhoff sequences, "PW22987", "KALHUMAN", 129 WO 99/46281 PCTIUS99/05028 "AC003965_1", "GEN12917", "ENTKHUMAN", "FAllHUMAN", "HSU75329_1", "PW22986", and "PLMN_HORSE". Accordingly, it is presently believed that PR0618 polypeptide disclosed in the present application is a newly identified member of the enteropeptidase family and possesses catalytic activity typical of the enteropeptidase family. 5 27. Full-length PR0719 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0719. In particular, Applicants have identified and isolated cDNA encoding a PR0719 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PRO719 polypeptide has significant similarity to 10 the lipoprotein lipase H protein. Accordingly, it is presently believed that PR0719 polypeptide disclosed in the present application is a newly identified lipoprotein lipase H homolog. 28. Full-length PR0724 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 15 referred to in the present application as PR0724. In particular, Applicants have identified and isolated cDNA encoding a PR0724 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0724 polypeptide has significant similarity to the human low density lipoprotein (LDL) receptor protein. Accordingly, it is presently believed that PR0724 polypeptide disclosed in the present application is a newly identified LDL receptor homolog. 20 29. Full-length PRO772 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0772. In particular, Applicants have identified and isolated cDNA encoding a PR0772 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 25 sequence alignment computer programs, Applicants found that the PR0772 polypeptide has significant similarity to the human A4 protein. Accordingly, it is presently believed that PR0772 polypeptide disclosed in the present application is a newly identified A4 protein homolog. 30. Full-length PR0852 Polvpeptides 30 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0852. In particular, Applicants have identified and isolated cDNA encoding a PR0852 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0852 polypeptide has significant similarity to various protease proteins. Accordingly, it is presently believed that PRO852 polypeptide disclosed in the present 35 application is a newly identified protease enzyme homolog. 31. Full-length PR0853 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO853. In particular, Applicants have identified and isolated cDNA 130 WO 99/46281 PCTIUS99/05028 encoding a PR0853 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PR0853 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PRO853 polypeptide possess significant sequence similarity to the reductase protein, thereby indicating that PRO853 may be a novel reductase. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PR0853 amino acid 5 sequence and the following Dayhoff sequences, "PW03198", "CEC15H11_6", "MTVO30_12", "PW15759", "S42651", "ATAC00234314", "MTV022_13", "SCU43704_1", "CELE04F6_7", and "ALFA_1". Accordingly, it is presently believed that PR0853 polypeptide disclosed in the present application is a newly identified member of the reductase family and possesses the antioxidant enzymatic activity typical of the reductase family. 10 32. Full-length PR0860 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0860. In particular, Applicants have identified and isolated cDNA encoding a PR0860 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PR0860 polypeptide using BLAST and FastA sequence alignment computer programs, 15 suggests that various portions of the PR0860 polypeptide possess significant sequence similarity to the neurofascin protein, thereby indicating that PR0860 may be a novel neurofascin. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PR0860 amino acid sequence and the following Dayhoff sequences, "AF040990_1", "AF041053_1", "CELZK377_2", "RNU81035_1", "D86983_1", "S26180", "MMBIG2A_1", "S46216", and "RNU68726_1 ". Accordingly, it is presently believed that 20 PRO860 polypeptide disclosed in the present application is a newly identified member of the neurofascin family and possesses the cellular adhesion properties typical of the neurofascin family. 33. Full-length PR0846 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 25 referred to in the present application as PRO846. In particular, Applicants have identified and isolated cDNA encoding a PR0846 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PR0846 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PR0846 polypeptide possess significant sequence similarity to the CMRF35 protein, thereby indicating that PR0846 may be a novel CMRF35 protein. More specifically, an analysis of the 30 Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PR0846 amino acid sequence and the following Dayhoff sequences,"CM35_HUMAN", "AF035963_1", "PIGRRABIT", "AF043724_1", "RNU89744_1", "A52091_1", "S48841", "ELK06A9_3", and "AF049588_1". Accordingly, it is presently believed that PR0846 polypeptide disclosed in the present application is a newly identified member of the CMRF35 protein family and possesses properties typical of the CMRF35 protein family. 35 34. Full-length PRO862 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0862. In particular, Applicants have identified and isolated cDNA encoding a PR0862 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid 131 WO 99/46281 PCTIUS99/05028 sequence of the full-length PR0862 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PR0862 polypeptide possess significant sequence similarity to the lysozyme protein, thereby indicating that PR0862 may be a novel lysozyme protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PR0862 amino acid sequence and the following Dayhoff sequences, "P_P90343", and "LYCHUMAN. Accordingly, it is presently 5 believed that PR0862 polypeptide disclosed in the present application is a newly identified member of the lysozyme family and possesses catalytic activity typical of the lysozyme family. 35. Full-length PR0864 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 10 referred to in the present application as PR0864. In particular, Applicants have identified and isolated cDNA encoding a PR0864 polypeptide, as disclosed in further detail in the Examples below. Analysis of the amino acid sequence of the full-length PR0864 polypeptide using BLAST and FastA sequence alignment computer programs, suggests that various portions of the PR0864 polypeptide possess significant sequence similarity to the Wnt-4 protein, thereby indicating that PR0864 may be a novel Wnt-4 protein. More specifically, an analysis of the Dayhoff database 15 (version 35.45 SwissProt 35) evidenced significant sequence similarity between the PRO864 amino acid sequence and the following Dayhoff sequences, "WNT4_MOUSE", "WNT3_MOUSE", "WN5AHUMAN", "WN7BMOUSE", "WN3AMOUSE", "XLU66288_1", "WN13_HUMAN", "WN5BORYLA", "WNT2_MOUSE", and "WN7AMOUSE". Accordingly, it is presently believed that PRO864 polypeptide disclosed in the present application is a newly identified member of the Wnt-4 protein family and possesses properties typical of the Wnt-4 20 protein family. 36. Full-length PRO792 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO792. In particular, Applicants have identified and isolated cDNA 25 encoding a PRO792 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0792 polypeptide has significant similarity to the CD23 protein. Accordingly, it is presently believed that PRO792 polypeptide disclosed in the present application is a newly identified CD23 homolog. 30 37. Full-length PR0866 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0866. In particular, Applicants have identified and isolated cDNA encoding a PR0866 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0866 polypeptide has significant similarity to 35 various mindin and spondin proteins. Accordingly, it is presently believed that PRO866 polypeptide disclosed in the present application is a newly identified mindin/spondin homolog. 132 WO 99/46281 PCT/US99/05028 38. Full-length PR0871 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO871. In particular, Applicants have identified and isolated cDNA encoding a PRO871 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0871 polypeptide has significant similarity to 5 the CyP-60 protein. Accordingly, it is presently believed that PR0871 polypeptide disclosed in the present application is a newly identified member of the cyclophilin protein family and possesses activity typical of the cyclophilin protein family. 39. Full-length PRO873 Polypeptides 10 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0873. In particular, Applicants have identified and isolated cDNA encoding a PRO873 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0873 polypeptide has significant similarity to a human liver carboxylesterase. Accordingly, it is presently believed that PRO873 polypeptide disclosed in the 15 present application is a newly identified member of the carboxylesterase family and possesses enzymatic activity typical of the carboxylesterase family. 40. Full-length PR0940 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 20 referred to in the present application as PRO940. In particular, Applicants have identified and isolated cDNA encoding a PR0940 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0940 polypeptide has significant similarity to CD33 and the OB binding protein-2. Accordingly, it is presently believed that PR0940 polypeptide disclosed in the present application is a newly CD33 and/or OB binding protein-2 homolog. 25 41. Full-length PR0941 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO941. In particular, Applicants have identified and isolated cDNA encoding a PR0941 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 30 sequence alignment computer programs, Applicants found that the PR0941 polypeptide has significant similarity to one or more cadherin proteins. Accordingly, it is presently believed that PR0941 polypeptide disclosed in the present application is a newly identified cadherin homolog. 42. Full-length PR0944 Polyneptides 35 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0944. In particular, Applicants have identified and isolated cDNA encoding a PR0944 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0944 polypeptide has significant similarity to the CPE-R cell surface protein. Accordingly, it is presently believed that PR0944 polypeptide disclosed in the 133 WO 99/46281 PCT/US99/05028 present application is a newly identified CPE-R homolog. 43. Full-length PR0983 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0983. In particular, Applicants have identified and isolated cDNA 5 encoding a PR0983 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0983 polypeptide has significant similarity to the vesicle-associated protein, VAP-33. Accordingly, it is presently believed that PR0983 polypeptide disclosed in the present application is a newly identified member of the vesicle-associated membrane protein family and possesses activity typical of vesicle-associated membrane proteins. 10 44. Full-length PRO1057 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1057. In particular, Applicants have identified and isolated cDNA encoding a PRO1057 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 15 sequence alignment computer programs, Applicants found that the PRO1057 polypeptide has significant similarity to various protease proteins. Accordingly, it is presently believed that PRO1057 polypeptide disclosed in the present application is a newly identified protease homolog. 45. Full-length PRO1071 Polypeptides 20 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1071. In particular, Applicants have identified and isolated cDNA encoding a PRO1071 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PRO1071 polypeptide has significant similarity to the thrombospondin protein. Accordingly, it is presently believed that PRO1071 polypeptide disclosed in the 25 present application is a newly identified thrombospondin homolog. 46. Full-length PRO1072 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1072. In particular, Applicants have identified and isolated cDNA 30 encoding a PRO1072 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PRO1072 polypeptide has significant similarity to various reductase proteins. Accordingly, it is presently believed that PRO1072 polypeptide disclosed in the present application is a newly identified member of the reductase protein family. 35 47. Full-length PRO1075 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1075. In particular, Applicants have identified and isolated cDNA encoding a PRO1075 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PRO1075 polypeptide has significant similarity 134 WO 99/46281 PCT/US99/05028 to protein disulfide isomerase. Accordingly, it is presently believed that PRO1075 polypeptide disclosed in the present application is a newly identified member of the protein disulfide isomerase family and possesses activity typical of that family. 48. Full-length PRO181 Polypeptides 5 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO181. In particular, Applicants have identified and isolated cDNA encoding a PRO181 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PRO181 polypeptide has significant similarity to the cornichon protein. Accordingly, it is presently believed that PRO181 polypeptide disclosed in the present 10 application is a newly identified cornichon homolog. 49. Full-length PRO195 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO195. In particular, Applicants have identified and isolated cDNA 15 encoding a PRO195 polypeptide, as disclosed in further detail in the Examples below. The PRO195-encoding clone was isolated from a human fetal placenta library using a trapping technique which selects for nucleotide sequences encoding secreted proteins. To Applicants present knowledge, the UNQ169 (DNA26847-1395) nucleotide sequence encodes a novel factor; using BLAST and FastA sequence alignment computer programs, no sequence identities to any known proteins were revealed. 20 50. Full-leng-th PR0865 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0865. In particular, Applicants have identified and isolated cDNA encoding a PR0865 polypeptide, as disclosed in further detail in the Examples below. The PR0865-encoding clone 25 was isolated from a human fetal kidney library using a trapping technique which selects for nucleotide sequences encoding secreted proteins. Thus, the PR0865-encoding clone may encode a secreted factor. To Applicants present knowledge, the UNQ434 (DNA53974-1401) nucleotide sequence encodes a novel factor; using BLAST and FastA sequence alignment computer programs, no sequence identities to any known proteins were revealed. 30 51. Full-lengfth PR0827 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0827. In particular, Applicants have identified and isolated cDNA encoding a PR0827 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0827 polypeptide has significant similarity to 35 VLA-2 and various other integrin proteins. Accordingly, it is presently believed that PR0827 polypeptide disclosed in the present application is a novel integrin protein or splice variant thereof. 135 WO 99/46281 PCTIUS99/05028 52. Full-length PRO1114 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PROl 114. In particular, Applicants have identified and isolated cDNA encoding a PRO1 114 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PRO 1114 polypeptide has significant similarity 5 to the cytokine receptor family of proteins. Accordingly, it is presently believed that PRO 1114 polypeptide disclosed in the present application is a newly identified member of the cytokine receptor family of proteins and possesses activity typical of that family. The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PROl 114 interferon receptor (UNQ557). In particular, cDNA encoding a 10 PRO 1114 interferon receptor polypeptide has been identified and isolated, as disclosed in further detail in the Examples below. It is noted that proteins produced in separate expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed. However, for sake of simplicity, in the present specification the protein encoded by DNA57033-1403 as well as all further native homologues and variants included in the foregoing definition of PRO 1114 interferon receptor, will be 15 referred to as "PRO 1114 interferon receptor", regardless of their origin or mode of preparation. Using the WU-BLAST2 sequence alignment computer program, it has been found that a full-length native sequence PRO1 114 interferon receptor polypeptide (shown in Figure 142 and SEQ ID NO:352) has sequence identity with the other known interferon receptors. Accordingly, it is presently believed that PRO 1114 interferon receptor possesses activity typical of other interferon receptors. 20 53. Full-length PR0237 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0237. In particular, Applicants have identified and isolated cDNA encoding a PR0237 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 25 sequence alignment computer programs, Applicants found that the PR0237 polypeptide has significant similarity to carbonic anhydrase. Accordingly, it is presently believed that PR0237 polypeptide disclosed in the present application is a newly identified carbonic anhydrase homolog. 54. Full-length PR0541 Polypeptides 30 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0541. In particular, Applicants have identified and isolated cDNA encoding a PR0541 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PRO541 polypeptide has significant similarity to a trypsin inhibitor protein. Accordingly, it is presently believed that PR0541 polypeptide disclosed in the present 35 application is a newly identified member of the trypsin inhibitor protein family. 55. Full-length PR0273 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0273. In particular, Applicants have identified and isolated cDNA 136 WO 99/46281 PCTIUS99/05028 encoding a PR0273 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0273 polypeptide have significant sequence identity with various chemokines. Accordingly, it is presently believed that PR0273 polypeptide disclosed in the present application is a newly identified member of the chemokine family and possesses activity typical of the chemokine family. 5 56. Full-length PRO701 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO701. In particular, Applicants have identified and isolated cDNA encoding a PRO701 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 10 sequence alignment computer programs, Applicants found that various portions of the PRO701 polypeptide have significant homology with the neuroligins 1, 2 and 3 and esterases including carboxyesterases and acytlcholinesterases. Accordingly, it is presently believed that PRO701 polypeptide disclosed in the present application is a newly identified member of the neuroligin family and is involved in mediating recognition processes between neurons and/or functions as a cell adhesin molecule as is typical of neuroligins. 15 57. Full-length PRO704 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0704. In particular, Applicants have identified and isolated cDNA encoding a PR0704 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 20 sequence alignment computer programs, Applicants found that various portions of the PR0704 polypeptide have significant homology with the VIP36 and GP36b. Accordingly, it is presently believed that PR0704 polypeptide disclosed in the present application is a newly identified member of the vesicular integral membrane protein family and possesses the ability to bind to sugars and cycle between the plasma membrane and the Golgi typical of this family. 25 58. Full-length PRO706 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0706. In particular, Applicants have identified and isolated cDNA encoding a PR0706 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 30 sequence alignment computer programs, Applicants found that various portions of the PR0706 polypeptide have sequence identity with the human prostatic acid phosphatase precursor and the human lysosomal acid phosphatase precursor. Accordingly, it is presently believed that PR0706 polypeptide disclosed in the present application is a newly identified member of the human prostatic acid phosphatase precursor family and possesses phosphatase typical of the acid phosphatase family. 35 59. Full-length PR0707 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0707. In particular, Applicants have identified and isolated cDNA encoding a PR0707 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 137 WO 99/46281 PCTIUS99/05028 sequence alignment computer programs, Applicants found that various portions of the PR0707 polypeptide have significant homology with cadherins, particularly cadherin FIB3 found in fibroblasts. Accordingly, it is presently believed that PR0707 polypeptide disclosed in the present application is a newly identified member of the cadherin family and possesses cell interaction signaling typical of the cadherin family. 5 60. Full-length PR0322 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0322. In particular, Applicants have identified and isolated cDNA encoding a PR0322 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0322 polypeptide have 10 significant homology with human neuropsin, seine protease, neurosin and trypsinogen. Accordingly, it is presently believed that PR0322 polypeptide disclosed in the present application is a newly identified member of the serine protease family and possesses protease activity typical of this family. It is also believed that PR0322 is involved in hippocampal plasticity and is associated with extracellular matrix modifications and cell migrations. 15 61. Full-length PR0526 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0526. In particular, Applicants have identified and isolated cDNA encoding a PR0526 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0526 polypeptide have 20 significant homology with the acid labile subunit of the insulin-like growth factor complex (ALS), as well carboxypeptidase, SLIT, and platelet glycoprotein V. Accordingly, it is presently believed that PR0526 polypeptide disclosed in the present application is a newly identified member of the leucine-repeat rich superfamily, and possesses protein-protein interaction capabilities typical of this family. 25 62. Full-length PR0531 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0531. In particular, Applicants have identified and isolated cDNA encoding a PR0531 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0531 polypeptide have 30 significant sequence identity and similarity with members of the cadherin superfamily, particularly, protocadherin 3. Accordingly, it is presently believed that PR0531 polypeptide disclosed in the present application is a newly identified member of the cadherin superfamily, and is a protocadherin. PR0531 is a transmembrane protein which has extracellular cadherin motifs. PR0531 is believed to be involved in cell-cell activity, in particular, cell signaling. 35 63. Full-length PR0534 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0534. In particular, Applicants have identified and isolated cDNA encoding a PR0534 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0534 polypeptide have 138 WO 99/46281 PCT/US99/050 2 8 significant identity or similarity with the putative disulfide isomerase erp38 precursor and thioredoxin c-3. Accordingly, it is presently believed that PR0534 polypeptide disclosed in the present application is a newly identified member of the disulfide isomerase family and possesses the ability to recognize and unscramble either intermediate or incorrect folding patterns typical of this family. 5 64. Full-length PR0697 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0697. In particular, Applicants have identified and isolated cDNA encoding a PR0697 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0697 polypeptide have 10 significant identity or similarity with sFRP-2, sFRP-1 and SARP-1, -2 and -3. Accordingly, it is presently believed that PR0697 polypeptide disclosed in the present application is a newly identified member of the sFRP family and possesses activity related to the Wnt signal pathway. 65. Full-length PR0717 Polypeptides 15 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO717. In particular, Applicants have identified and isolated cDNA encoding a PR0717 polypeptide, as disclosed in further detail in the Examples below. To Applicants present knowledge, the UNQ385 (DNA50988-1326) nucleotide sequence encodes a novel factor; using BLAST and FastA sequence alignment computer programs, no significant sequence identities to any known human proteins were 20 revealed. 66. Full-length PR0731 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0731. In particular, Applicants have identified and isolated cDNA 25 encoding a PR0731 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0731 polypeptide have significant homology with the protocadherins 4, 68, 43, 42, 3, and 5. Accordingly, it is presently believed that PRO731 polypeptide disclosed in the present application is a newly identified member of the protocadherin family and possesses cell-cell aggregation or signaling activity or signal transduction involvement typical of this family. 30 67. Full-length PR0218 Plypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO218. In particular, Applicants have identified and isolated cDNA encoding a PRO218 polypeptide, as disclosed in further detail in the Examples below. The PR0218-encoding clone 35 was isolated from a human fetal kidney library. To Applicants present knowledge, the UNQ192 (DNA30867-1335) nucleotide sequence encodes a novel factor; using BLAST and FastA sequence alignment computer programs, no significant sequence identities to any known proteins were revealed. Some sequence identity was found with membrane regulator proteins, indicating that PRO218 may function as a membrane regulator. 139 WO 99/46281 PCT/US99/05028 68. Full-length PR0768 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0768. In particular, Applicants have identified and isolated cDNA encoding a PR0768 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0768 polypeptide have 5 significant homology with integrins, including integrin 7 and 6. Accordingly, it is presently believed that PR0768 polypeptide disclosed in the present application is a newly identified member of the integrin family, either a homologue or a splice variant of integrin 7, and is involved with cell adhesion and communication between muscle cells and the extracellular matrix. 10 69. Full-length PR0771 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0771. In particular, Applicants have identified and isolated cDNA encoding a PR0771 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0771 polypeptide have 15 significant sequence identity and similarity with testican. Accordingly, it is presently believed that PR0771 polypeptide disclosed in the present application is a newly identified member of the testican family and possesses cell signaling, binding, or adhesion properties, typical of this family. 70. Full-length PR0733 Polypeptides 20 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0733. In particular, Applicants have identified and isolated cDNA encoding a PR0733 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0733 polypeptide have significant sequence identity with the T1/ST receptor binding protein. Accordingly, it is presently believed that 25 PRO733 polypeptide disclosed in the present application is a newly identified member of the interleukin-like family binding proteins which may be a cytokine and which may be involved in cell signaling. It is believed that PR0733 is an ApoAIV homologue. 71. Full-length PRO162 Polypeptides 30 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO162. In particular, Applicants have identified and isolated cDNA encoding a PRO162 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PRO162 polypeptide have significant homology with human pancreatitis-associated protein (PAP). Applicants have also found that the DNA 35 encoding the PRO162 polypeptide has significant homology with bovine lithostathine precursor and bovine pancreatic thread protein (PTP). Accordingly, it is presently believed that PRO162 polypeptide disclosed in the present application is a newly identified member of the pancreatitis-associated protein family and possesses activity typical of the pancreatitis-associated protein family. 140 WO 99/46281 PCTIUS99/05028 72. Full-length PR0788 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0788. In particular, Applicants have identified and isolated cDNA encoding a PR0788 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0788 polypeptide have 5 significant homology with the anti-neoplastic urinary protein. Applicants have also found that the DNA encoding the PRO788 polypeptide has significant homology with human E48 antigen, human component B protein, and human prostate stem cell antigen. Accordingly, it is presently believed that PR0788 polypeptide disclosed in the present application is a newly identified member of the anti-neoplastic urinary protein family and possesses anti-neoplastic activity typical of the anti-neoplastic urinary protein family. 10 73. Full-length PRO1008 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1008. In particular, Applicants have identified and isolated cDNA encoding a PRO1008 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 15 sequence alignment computer programs, Applicants found that various portions of the PRO1008 polypeptide have significant sequence identity and similarity with mouse dkk-1 (mdkk-1). Accordingly, it is presently believed that PRO1008 polypeptide disclosed in the present application is a newly identified member of the dkk-1 family and possesses head inducing activity typical of this family. 20 74. Full-length PRO1012 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1012. In particular, Applicants have identified and isolated cDNA encoding a PRO1012 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PRO1012 polypeptide have 25 sequence identity with disulfide isomerase. Accordingly, it is presently believed that PRO1012 polypeptide disclosed in the present application is a newly identified member of the ER retained protein family and possesses activity related to the processing, production and/or folding of polypeptides typical of the disulfide isomerase family. 75. Full-length PRO1014 Polypeptides 30 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1014. In particular, Applicants have identified and isolated cDNA encoding a PRO1014 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PRO1014 polypeptide have sequence identity with reductase and dehydrogenase. Accordingly, it is presently believed that PRO1014 polypeptide 35 disclosed in the present application is a newly identified member of the reductase super family and possesses reduction capabilities typical of this family. 141 WO 99/46281 PCT/US99/05028 76. Full-length PRO1017 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1017. In particular, Applicants have identified and isolated cDNA encoding a PRO1017 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PRO1017 polypeptide have 5 sequence identity with HNK-1 sulfotransferase. Accordingly, it is presently believed that PRO1017 polypeptide disclosed in the present application is a newly identified member of the HNK-1 sulfotransferase family and is involved with the synthesis of HNK-1 carbohydrate epitopes typical of this family. 77. Full-length PRO474 Polypeptides 10 The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0474. In particular, Applicants have identified and isolated cDNA encoding a PR0474 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0474 polypeptide have sequence identity with dehydrogenase, glucose dehydrogenase and oxidoreductase. Accordingly, it is presently 15 believed that PR0474 polypeptide disclosed in the present application is a newly identified member of the dehydrogenase family and is involved in the oxidation of glucose. 78. Full-length PRO1031 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 20 referred to in the present application as PRO1031. In particular, Applicants have identified and isolated cDNA encoding a PRO1031 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PRO1031 polypeptide have sequence identity with IL-17 and CTLA-8. Accordingly, it is presently believed that PRO1031 polypeptide disclosed in the present application is a newly identified member of the cytokine family and thus may be involved in 25 inflammation and/or the immune system. 79. Full-length PR0938 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO938. In particular, Applicants have identified and isolated cDNA 30 encoding a PR0938 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0938 polypeptide has significant similarity to protein disulfide isomerase. Accordingly, it is presently believed that PR0938 polypeptide disclosed in the present application is a newly identified member of the thioredoxin family proteins and possesses activity typical of protein disulfide isomerase. 35 80. Full-length PRO1082 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1082. In particular, Applicants have identified and isolated cDNA encoding a PRO1082 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA 142 WO 99/46281 PCT/US99/05028 sequence alignment computer programs, Applicants found that various portions of the PRO1082 polypeptide have sequence identity with a lectin-like oxidized LDL receptor appearing in the database as "ABO 10710 1". Accordingly, it is presently believed that PRO1082 polypeptide disclosed in the present application is a newly identified member of the LDL receptor family. 5 81. Full-length PRO1083 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO1083. In particular, Applicants have identified and isolated cDNA encoding a PRO1083 polypeptide, as disclosed in further detail in the Examples below. The PRO1083-encoding clone was isolated from a human fetal kidney library using a trapping technique which selects for nucleotide sequences 10 encoding secreted proteins. To Applicants present knowledge, the UNQ540 (DNA50921-1458) nucleotide sequence encodes a novel factor; using BLAST and FastA sequence alignment computer programs, some sequence identity with a 7TM receptor, latrophilin related protein 1 and a macrophage restricted cell surface glycoprotein was shown. The kinase phosphorylation site and G-coupled receptor domain shown in Figure 204 indicate that PRO1083 is a novel member of the 7TM receptor superfamily. 15 82. Full-length PRO200 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as VEGF-E. In particular, Applicants have identified and isolated cDNA encoding a VEGF-E polypeptide, as disclosed in further detail in the Examples below. Using BLAST sequence 20 alignment computer programs, Applicants found that the VEGF-E polypeptide has significant homology with VEGF and bone morphogenetic protein 1. In particular, the cDNA sequence of VEGF-E exhibits 24% amino acid similarity with VEGF and has structural conservation. In addition, VEGF-E contains a N-terminal half which is not present in VEGF and that has 28% homology to bone morphogenetic protein 1. 25 83. Full-length PR0285 and PR0286 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0285 and PR0286 In particular, Applicants have identified and isolated cDNAs encoding PR0285 and PR0286 polypeptides, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the coding sequences of PR0285 30 and PRO286 are highly homologous to DNA sequences HSU88540_1, HSU88878_1, HSU88879_1, HSU88880_1, and HSU88881_1 in the GenBank database. Accordingly, it is presently believed that the PR0285 and PR0286 proteins disclosed in the present application are newly identified human homologues of the Drosophila protein Toll, and are likely to play an important role in adaptive immunity. More specifically, PRO285 and PR0286 may be involved in inflammation, septic shock, 35 and response to pathogens, and play possible roles in diverse medical conditions that are aggravated by immune response, such as, for example, diabetes, ALS, cancer, rheumatoid arthritis, and ulcers. The role of PR0285 and PRO286 as pathogen pattern recognition receptors, sensing the presence of conserved molecular structures present on microbes, is further supported by the data disclosed in the present application, showing that a known human Toll like receptor, TLR2 is a direct mediator of LPS signaling. 143 WO 99/46281 PCTIUS99/05028 84. Full-len2th PR0213-1. PRO1330 and PRO1449 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0213-1, PRO1330 and/or PRO1449. In particular, cDNA encoding a PRO213-1, PRO1330 and/or PRO1449 polypeptide has been identified and isolated, as disclosed in further detail in the Examples below. It is noted that proteins produced in separate expression rounds may be given different PRO 5 numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed. However, for sake of simplicity, in the present specification the protein encoded by DNA30943-1163-1, DNA64907 1163-1 and DNA64908-1163-1 as well as all further native homologues and variants included in the foregoing definition of PR0213-1, PRO1330 and/or PRO1449, will be referred to as "PR0213-1, PRO1330 and/or PRO1449", regardless of their origin or mode of preparation. 10 85. Full-length PR0298 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0298. (It is noted that PR0298 is an arbitrary designation of a protein encoded by the nucleic acid shown in Figure 218, SEQ ID NO: 514, and having the amino acid sequence shown in 15 Figure 219, SEQ ID NO:515. Further proteins having the same amino acid sequence but expressed in different rounds of expression, may be given different "PRO" numbers.) In particular, Applicants have identified and isolated cDNA encoding a PR0298 polypeptide, as disclosed in further detail in the Examples below. Using BLASTX 2.0a8MP-WashU computer program, socring parameters: T= 12, S =68, S2=36, Matrix: BLOSUM62, Applicants found that the PR0298 protein specifically disclosed herein 20 shows a limited (27-38%) sequence identity with the following sequences found in the GenBank database: S59392 (probable membrane protein YLR246w - yeast); S58154 (hypothetical protein SPAC2F7. 10 - yeast); CELF33D1 1_9 (F33D11.9b - Caenorhabditis elegans); Y041_CAEEL (hypothetical 68.7 kd protein zk757.1); CEAC3_5 (AC3.4 Caenorhabditis elegans); S52691 (probable transmembrane protein YDR126w - yeast); ATT12H17_14 (protein Arabidopsis thaliana); S55963 (probable membrane protein YNL326c - yeast); CELC43H6_2 (C43H6.7 25 Caenorhabditis elegans); TMO18A10_14 (A_TMO18A1O.8 - Arabinosa thaliana). 86. Full-length PRO337 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0337. In particular, Applicants have identified and isolated cDNA 30 encoding a PR0337 polypeptide, as disclosed in further detail in the Examples below. Using BLAST, BLAST-2 and FastA sequence alignment computer programs, Applicants found that a full-length native sequence PR0337 has 97% amino acid sequence identity with rat neurotrimin, 85% sequence identity with chicken CEPU, 73% sequence identity with chicken G55, 59% homology with human LAMP and 84% homology with human OPCAM. Accordingly, it is presently believed that PR0337 disclosed in the present application is a newly identified member of the IgLON 35 sub family of the immunoglobulin superfamily and may possess neurite growth and differentiation potentiating properties. 144 WO 99/46281 PCT/US99/05028 87. Full-length PR0403 Polvpeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0403. In particular, Applicants have identified and isolated cDNA encoding a PR0403 polypeptide, as disclosed in further detail in the Examples below. Using a BLAST, BLAST-2 and FastA sequence alignment computer programs, Applicants found that a full-length native sequence PR0403 has 5 94% identity to bovine ECE-2 and 64% identity to human ECE-1. Accordingly is presently believed that PR0403 is a new member of the ECE protein family and may posses ability to catalyze the production of active endothelin. 88. PRO Polypeptide Variants In addition to the full-length native sequence PRO polypeptides described herein, it is contemplated that PRO 10 polypeptide variants can be prepared. PRO polypeptide variants can be prepared by introducing appropriate nucleotide changes into the PRO polypeptide DNA, or by synthesis of the desired PRO polypeptide. Those skilled in the art will appreciate that amino acid changes may alter post-translational processes of the PRO polypeptides, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics. Variations in the native full-length sequence PRO polypeptides or in various domains of the PRO 15 polypeptides described herein, can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Patent No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding the PRO polypeptide that results in a change in the amino acid sequence of the PRO polypeptide as compared with the native sequence PRO polypeptide. Optionally the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains 20 of the PRO polypeptide. Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the PRO polypeptide with that of homologous known protein molecules and minimizing the number of amino acid sequence changes made in regions of high homology. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., 25 conservative amino acid replacements. Insertions or deletions may optionally be in the range of 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity in the in vitro assay described in the Examples below. In particular embodiments, conservative substitutions of interest are shown in Table 1 under the heading of 30 preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 1, or as further described below in reference to amino acid classes, are introduced and the products screened. 145 WO 99/46281 PCT/US99/05028 Table 1 Original Exemplary Preferred Residue Substitutions Substitutions 5 Ala (A) val; leu; ile val Arg (R) lys; gin; asn lys Asn (N) gin; his; lys; arg gln Asp (D) glu glu Cys (C) ser ser 10 Gln (Q) asn asn Glu (E) asp asp Gly (G) pro; ala ala His (H) asn; gin; lys; arg arg Ile (I) leu; val; met; ala; phe; 15 norleucine leu Leu (L) norleucine; ile; val; met; ala; phe ile Lys (K) arg; gin; asn arg Met (M) leu; phe; ile leu 20 Phe (F) leu; val; ile; ala; tyr leu Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp (W) tyr; phe tyr 25 Tyr (Y) trp; phe; thr; ser phe Val (V) ile; leu; met; phe; ala; norleucine leu Substantial modifications in function or immunological identity of the PRO polypeptide are accomplished 30 by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into groups based on common side-chain properties: (1) hydrophobic: norleucine, met, ala, val, leu, ile; 35 (2) neutral hydrophilic: cys, ser, thr; (3) acidic: asp, glu; (4) basic: asn, gln, his, lys, arg; (5) residues that influence chain orientation: gly, pro; and (6) aromatic: trp, tyr, phe. 40 Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non-conserved) sites. The variations can be made using methods known in the art such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res., 45 13:4331 (1986); Zoller et al., Nucl. Acids Res., 1:6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or other known techniques can be performed on the cloned DNA to produce the desired PRO polypeptide variant DNA. 146 WO 99/46281 PCT/US99/05028 Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence. Among the preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine, seine, and cysteine. Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant. Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently 5 found in both buried and exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)]. If alanine substitution does not yield adequate amounts of variant, an isoteric amino acid can be used. 89. Modifications of PRO Polypeptides 10 Covalent modifications of PRO polypeptides are included within the scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of the PRO polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PRO polypeptide. Derivatization with bifunctional agents is useful, for instance, for crosslinking a PRO polypeptide to a water-insoluble support matrix or surface for use in the method for purifying anti-PRO polypeptide antibodies, and 15 vice-versa. Commonly used crosslinking agents include, e.g., 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifinctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides such as bis-N maleimido-1,8-octane and agents such as methyl-3-[(p-azidophenyl)dithio]propioimidate. Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding 20 glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the a-amino groups of lysine, arginine, and histidine side chains [T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group. Another type of covalent modification of the PRO polypeptides included within the scope of this invention 25 comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in a native sequence PRO polypeptide, and/or adding one or more glycosylation sites that are not present in the native sequence PRO polypeptide, and/or alteration of the ratio and/or composition of the sugar residues attached to the glycosylation site(s). 30 Addition of glycosylation sites to the PRO polypeptide may be accomplished by altering the amino acid sequence. The alteration may be made, for example, by the addition of, or substitution by, one or more seine or threonine residues to the native sequence PRO polypeptide (for O-linked glycosylation sites). The PRO polypeptide amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the PRO polypeptide at preselected bases such that codons are generated that will translate into the desired 35 amino acids. Another means of increasing the number of carbohydrate moieties on the PRO polypeptide polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO 87/05330 published 11 September 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981). 147 WO 99/46281 PCT/US99/05028 Removal of carbohydrate moieties present on the PRO polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem., 118:131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo 5 glycosidases as described by Thotakura et al., Meth. Enzymol., 138:350 (1987). Another type of covalent modification of PRO polypeptides of the invention comprises linking the PRO polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337. 10 The PRO polypeptides of the present invention may also be modified in a way to form a chimeric molecule comprising a PRO polypeptide fused to another, heterologous polypeptide or amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of the PRO polypeptide with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the amino- or carboxyl- terminus of the PRO polypeptide. The presence of such epitope-tagged forms of the PRO 15 polypeptide can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the PRO polypeptide to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. In an alternative embodiment, the chimeric molecule may comprise a fusion of the PRO polypeptide with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimeric molecule, such a fusion could be to the Fc region of an IgG molecule. 20 Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3(6):547-553 (1990)]. Other tag 25 polypeptides include the Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al., Science, 255:192-194 (1992)]; an a-tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266:15163 15166 (1991)]; and the T7 gene 10 protein peptide tag [Luitz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393 6397 (1990)]. 30 90. Preparation of PRO Polypeptides The description below relates primarily to production of PRO polypeptides by culturing cells transformed or transfected with a vector containing the desired PRO polypeptide nucleic acid. It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare the PRO polypeptide. For instance, the PRO polypeptide sequence, or portions thereof, may be produced by direct peptide synthesis using solid 35 phase techniques [see, e.g., Stewart et al., Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc., L.:2149-2154 (1963)]. In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions. Various portions of the desired PRO polypeptide may be chemically synthesized separately and combined using chemical or enzymatic methods to 148 WO 99/46281 PCT/US99/05028 produce the full-length PRO polypeptide. A. Isolation of DNA Encoding PRO Polypeptides DNA encoding PRO polypeptides may be obtained from a cDNA library prepared from tissue believed to possess the desired PRO polypeptide mRNA and to express it at a detectable level. Accordingly, human PRO 5 polypeptide DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples. The PRO polypeptide-encoding gene may also be obtained from a genomic library or by oligonucleotide synthesis. Libraries can be screened with probes (such as antibodies to the desired PRO polypeptide or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the 10 cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). An alternative means to isolate the gene encoding the desired PRO polypeptide is to use PCR methodology [Sambrook et al., supra; Dieffenbach et al., PCR Primer:A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)]. 15 The Examples below describe techniques for screening a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like "P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are 20 provided in Sambrook et al., supra. Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined through sequence alignment using computer software programs such as 25 BLAST, ALIGN, DNAstar, and INHERIT which employ various algorithms to measure homology. Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA. 30 B. Selection and Transformation of Host Cells Host cells are transfected or transformed with expression or cloning vectors described herein for PRO polypeptide production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. The culture conditions, such as 35 media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook et al., supra. 149 WO 99/46281 PCT/US99/05028 Methods of transfection are known to the ordinarily skilled artisan, for example, CaPO 4 and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described in Sambrook et al., supra, or electroporation is generally used for prokaryotes or other cells that contain substantial cell-wall barriers. Infection with Agrobacterium tunefaciens is used for transformation of certain plant cells, as described by Shaw et al., Gene, 23:315 (1983) and 5 WO 89/05859 published 29 June 1989. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52:456-457 (1978) can be employed. General aspects of mammalian cell host system transformations have been described in U.S. Patent No. 4,399,216. Transformations into yeast are typically carried out according to the method of Van Solingen et al., J. Bact., 130:946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76:3829 (1979). However, other methods for introducing DNA into cells, such 10 as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g., polybrene, polyornithine, may also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods in Enzymology, 185:527-537 (1990) and Mansour et al., Nature, 336:348-352 (1988). Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include but are not limited to eubacteria, such as Gram-negative or 15 Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635). Other suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serrauia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis (e.g., B. 20 licheniformis 41P disclosed in DD 266,710 published 12 April 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. Various E. coli strains are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110 (ATCC 27,325); and K5 772 (ATCC 53,635). These examples are illustrative rather than limiting. Strain W3 110 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations. Preferably, the host cell secretes minimal amounts 25 of proteolytic enzymes. For example, strain W3 110 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W31 10 strain 1A2, which has the complete genotype tonA ; E. coli W3 110 strain 9E4, which has the complete genotype tonA ptr3; E. coli W3 110 strain 27C7 (ATCC 55,244), which has the complete genotype tonA ptr3 phoA E15 (argF-lac)169 degP ompTkanr; E. coli W31 10 strain 37D6, which has the complete genotype tonA ptr3 phoA E15 (argF-lac)169 degP 30 ompT rbs7 ilvG kan; E. coli W31 10 strain 40B4, which is strain 37D6 with a non-kanamycin resistant degP deletion mutation; and an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August 1990. Alternatively, in vitro methods of cloning, e.g., PCR or other nucleic acid polymerase reactions, are suitable. In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or 35 expression hosts for PRO polypeptide-encoding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces pombe (Beach and Nurse, Nature, 290: 140 [1981]; EP 139,383 published 2 May 1985); Kluyveromyces hosts (U.S. Patent No. 4,943,529; Fleer et al., Bio/Technology, 9: 968-975 (1991)) such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al., J. Baeteriol., 737 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), 150 WO 99/46281 PCT/US99/05028 K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906; Van den Berg et al., Bio/Technology, 8: 135 (1990)), K . thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et al., J. Basic Microbiol., 28: 265-278 [1988]); Candida; Trichoderma reesia (EP 244,234); Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA, 76: 5259-5263 [1979]); Schwanniomyces such as Schwanniomyces occidentalis (EP 394,538 published 31 October 1990); and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium 5 (WO 91/00357 published 10 January 1991), and Aspergillus hosts such as A. nidulans (Ballance et al., Biochem. Biophys. Res. Commun., 112: 284-289 [1983]; Tilburn et al., Gene, 26: 205-221 [1983]; Yelton et al., Proc. Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and A. niger (Kelly and Hynes, EMBO J., 4: 475-479 [1985]). Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and 10 Rhodotorula. A list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982). Suitable host cells for the expression of glycosylated PRO polypeptides are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. 15 More specific examples include monkey kidney CV 1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse mammary tumor (MMT 060562, ATCC CCL51). The 20 selection of the appropriate host cell is deemed to be within the skill in the art. C. Selection and Use of a Replicable Vector The nucleic acid (e.g., cDNA or genomic DNA) encoding a desired PRO polypeptide may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression. Various vectors are publicly available. 25 The vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art. Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing 30 one or more of these components employs standard ligation techniques which are known to the skilled artisan. The PRO polypeptide of interest may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the signal sequence may be a component of the vector, or it may be a part of the PRO polypeptide DNA that is inserted into the vector. The signal 35 sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders. For yeast secretion the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Saccharomyces and Kluyveromyces a-factor leaders, the latter described in U.S. Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal described in WO 90/13646 published 15 November 1990. In 151 WO 99/46281 PCT/US99/05028 mammalian cell expression, mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders. Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2p plasmid origin is 5 suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not 10 available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli. An example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PRO polypeptide nucleic acid, such as DHFR or thymidine kinase. An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980). A suitable selection gene 15 for use in yeast is the trpl gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 1_:157 (1980)]. The trp1 gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4 1 [Jones, Genetics, 85:12 (1977)]. Expression and cloning vectors usually contain a promoter operably linked to the PRO polypeptide nucleic 20 acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the P-lactamase and lactose promoter systems [Chang et al., Nature, 275:615 (1978); Goeddel et al., Nature, 28:544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8:4057 (1980); EP 36,776), and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80:21-25 (1983)]. Promoters for use in bacterial systems also 25 will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding the desired PRO polypeptide. Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3 phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255:2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Reg., 2:149 (1968); Holland, Biochemistry, 17:4900 (1978)], such as enolase, glyceraldehyde-3 phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 30 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for 35 use in yeast expression are further described in EP 73,657. PRO polypeptide transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g., the actin 152 WO 99/46281 PCT/US99/05028 promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems. Transcription of a DNA encoding the desired PRO polypeptide by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription. Many enhancer sequences are now known from 5 mammalian genes (globin, elastase, albumin, a-fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer may be spliced into the vector at a position 5' or 3' to the PRO polypeptide coding sequence, but is preferably located at a site 5' from the promoter. 10 Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO polypeptides. 15 Still other methods, vectors, and host cells suitable for adaptation to the synthesis of PRO polypeptides in recombinant vertebrate cell culture are described in Gething et al., Nature, 293:620-625 (1981); Mantei et al., Nature, 281:40-46 (1979); EP 117,060; and EP 117,058. D. Detecting Gene Amplification/Expression 20 Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA, 7:5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The 25 antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected. Gene expression, alternatively, may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal 30 or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence PRO polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to a PRO polypeptide DNA and encoding a specific antibody epitope. E. Purification of Polypeptide 35 Forms of PRO polypeptides may be recovered from culture medium or from host cell lysates. If membrane bound, it can be released from the membrane using a suitable detergent solution (e.g. Triton-X 100) or by enzymatic cleavage. Cells employed in expression of PRO polypeptides can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents. It may be desired to purify PRO polypeptides from recombinant cell proteins or polypeptides. The following 153 WO 99/46281 PCT/US99/05028 procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope tagged forms of the PRO polypeptide. Various methods of protein purification may be employed and such methods 5 are known in the art and described for example in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). The purification step(s) selected will depend, for example, on the nature of the production process used and the particular PRO polypeptide produced. 91. Uses for PRO Polypeptides 10 Nucleotide sequences (or their complement) encoding the PRO polypeptides of the present invention have various applications in the art of molecular biology, including uses as hybridization probes, in chromosome and gene mapping and in the generation of anti-sense RNA and DNA. PRO polypeptide-encoding nucleic acid will also be useful for the preparation of PRO polypeptides by the recombinant techniques described herein. The full-length native sequence PRO polypeptide-encoding nucleic acid or portions thereof, may be used 15 as hybridization probes for a cDNA library to isolate the full-length PRO polypeptide gene or to isolate still other genes (for instance, those encoding naturally-occurring variants of the PRO polypeptide or PRO polypeptides from other species) which have a desired sequence identity to the PRO polypeptide nucleic acid sequences. Optionally, the length of the probes will be about 20 to about 50 bases. The hybridization probes may be derived from the nucleotide sequence of any of the DNA molecules disclosed herein or from genomic sequences including promoters, 20 enhancer elements and introns of native sequence PRO polypeptide encoding DNA. By way of example, a screening method will comprise isolating the coding region of the PRO polypeptide gene using the known DNA sequence to synthesize a selected probe of about 40 bases. Hybridization probes may be labeled by a variety of labels, including radionucleotides such as 3 P or" S, or enzymatic labels such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems. Labeled probes having a sequence complementary to that of the specific PRO 25 polypeptide gene of the present invention can be used to screen libraries of human cDNA, genomic DNA or mRNA to determine which members of such libraries the probe hybridizes to. Hybridization techniques are described in further detail in the Examples below. The ESTs disclosed in the present application may similarly be employed as probes, using the methods disclosed herein. 30 The probes may also be employed in PCR techniques to generate a pool of sequences for identification of closely related PRO polypeptide sequences. Nucleotide sequences encoding a PRO polypeptide can also be used to construct hybridization probes for mapping the gene which encodes that PRO polypeptide and for the genetic analysis of individuals with genetic disorders. The nucleotide sequences provided herein may be mapped to a chromosome and specific regions of a 35 chromosome using known techniques, such as in situ hybridization, linkage analysis against known chromosomal markers, and hybridization screening with libraries. When the coding sequence for the PRO polypeptide encodes a protein which binds to another protein, the PRO polypeptide can be used in assays to identify its ligands. Similarly, inhibitors of the receptor/ligand binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for peptide 154 WO 99/46281 PCTIUS99/05028 or small molecule inhibitors or agonists of the binding interaction. Screening assays can be designed to find lead compounds that mimic the biological activity of a native PRO polypeptide or a ligand for the PRO polypeptide. Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds. The assays can be performed in a variety of formats, including protein-protein 5 binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art. Nucleic acids which encode a PRO polypeptide or its modified forms can also be used to generate either transgenic animals or "knock out" animals which, in turn, are useful in the development and screening of therapeutically useful reagents. A transgenic animal (e.g., a mouse or rat) is an animal having cells that contain a 10 transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage. A transgene is a DNA which is integrated into the genome of a cell from which a transgenic animal develops. In one embodiment, cDNA encoding a PRO polypeptide of interest can be used to clone genomic DNA encoding the PRO polypeptide in accordance with established techniques and the genomic sequences used to generate transgenic animals that contain cells which express DNA encoding the PRO polypeptide. Methods for generating 15 transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009. Typically, particular cells would be targeted for PRO polypeptide transgene incorporation with tissue-specific enhancers. Transgenic animals that include a copy of a transgene encoding a PRO polypeptide introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding the PRO polypeptide. Such animals can be used as 20 tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression. In accordance with this facet of the invention, an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition. Alternatively, non-human homologues of PRO polypeptides can be used to construct a PRO polypeptide 25 "knock out" animal which has a defective or altered gene encoding the PRO polypeptide of interest as a result of homologous recombination between the endogenous gene encoding the PRO polypeptide and altered genomic DNA encoding the PRO polypeptide introduced into an embryonic cell of the animal. For example, cDNA encoding a PRO polypeptide can be used to clone genomic DNA encoding the PRO polypeptide in accordance with established techniques. A portion of the genomic DNA encoding a PRO polypeptide can be deleted or replaced with another 30 gene, such as a gene encoding a selectable marker which can be used to monitor integration. Typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for a description of homologous recombination vectors]. The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e.g., Li et al., Cell, 69:915 (1992)]. The selected cells are 35 then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal. Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal 155 WO 99/46281 PCT/US99/05028 contain the homologously recombined DNA. Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the PRO polypeptide. When in vivo administration of a PRO polypeptide is employed, normal dosage amounts may vary from about 10 ng/kg to up to 100 mg/kg of mammal body weight or more per day, preferably about 1 pg/kg/day to 10 5 mg/kg/day, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature; see, for example, U.S. Pat. Nos. 4,657,760; 5,206,344; or 5,225,212. It is anticipated that different formulations will be effective for different treatment compounds and different disorders, that administration targeting one organ or tissue, for example, may necessitate delivery in a manner different from that to another organ or tissue. 10 Where sustained-release administration of a PRO polypeptide is desired in a formulation with release characteristics suitable for the treatment of any disease or disorder requiring administration of the PRO polypeptide, microencapsulation of the PRO polypeptide is contemplated. Microencapsulation of recombinant proteins for sustained release has been successfully performed with human growth hormone (rhGH), interferon- (rhIFN- ), interleukin-2, and MN rgpl20. Johnson et al., Nat. Med., 2: 795-799 (1996); Yasuda, Biomed. Ther., 22: 1221 15 1223 (1993); Hora et al., Bio/Technology, 8: 755-758 (1990); Cleland, "Design and Production of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems," in Vaccine Design: The Subunit and Adiuvant Approach, Powell and Newman, eds, (Plenum Press: New York, 1995), pp. 439-462; WO 97/03692, WO 96/40072, WO 96/07399; and U.S Pat. No. 5,654,010. The sustained-release formulations of these proteins were developed using poly-lactic-coglycolic acid 20 (PLGA) polymer due to its biocompatibility and wide range of biodegradable properties. The degradation products of PLGA, lactic and glycolic acids, can be cleared quickly within the human body. Moreover, the degradability of this polymer can be adjusted from months to years depending on its molecular weight and composition. Lewis, "Controlled release of bioactive agents from lactide/glycolide polymer," in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41. 25 For example, for a formulation that can provide a dosing of approximately 80 g/kg/day in mammals with a maximum body weight of 85 kg, the largest dosing would be approximately 6.8 mg of the PRO polypeptide per day. In order to achieve this dosing level, a sustained- release formulation which contains a maximum possible protein loading (15-20% w/w PRO polypeptide) with the lowest possible initial burst (<20%) is necessary. A continuous (zero-order) release of the PRO polypeptide from microparticles for 1-2 weeks is also desirable. In addition, the 30 encapsulated protein to be released should maintain its integrity and stability over the desired release period. PRO213 polypeptides and portions thereof which possess the ability to regulate the growth induction cascade and/or the blood coagulation cascade may also be employed for such purposes both in vivo therapy and in vitro. Those of ordinary skill in the art will well know how to employ PRO213 polypeptides for such uses. PR0274 polypeptides and portions thereof which have homology to 7TM protein and Fn54 may also be 35 useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel 7TM protein and Fn54-like molecules may have relevance to a number of human disorders which involve recognition of ligands and the subsequent signal transduction of information contained within those ligands in order to control cellular processes. Thus, the identification of new 7TM protein and Fn54-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides 156 WO 99/46281 PCT/US99/05028 may also play important roles in biotechnological and medical research as well as in various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0274. PRO300 polypeptides and portions thereof which have homology to Diff 33 may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel Diff 33-like molecules may have relevance to a number of human disorders such as the physiology of cancer. Thus, the identification of new 5 Diff 33-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PRO300. PR0296 polypeptides of the present invention which possess biological activity related to that of the 10 sarcoma-amplified SAS protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0296 polypeptides of the present invention for such purposes. PR0329 polypeptides of the present invention which possess biological activity related to that of immunoglobulin Fc receptor protein or subunit thereof may be employed both in vivo for therapeutic purposes and 15 in vitro. Those of ordinary skill in the art will well know how to employ the PR0329 polypeptides of the present invention for such purposes. PR0362 polypeptides of the present invention which possess biological activity related to that of the A33 antigen protein, HCAR protein or the NrCAM related cell adhesion molecule may be employed both in vivo for therapeutic purposes and in vitro. 20 PR0363 polypeptides of the present invention which possess biological activity related to that of the cell surface HCAR protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0363 polypeptides of the present invention for such purposes. Specifically, extracellular domains derived from the PR0363 polypeptides may be employed therapeutically in vivo for lessening the effects of viral infection. 25 PR0868 polypeptides of the present invention which possess biological activity related to that of the tumor necrosis factor protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0868 polypeptides of the present invention for such purposes. PR0382 polypeptides of the present invention which possess biological activity related to that of the seine protease proteins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the 30 art will well know how to employ the PR0382 polypeptides of the present invention for such purposes. PR0545 polypeptides and portions thereof which have homology to meltrin may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel molecules associated with cellular adhesion may be relevant to a number of human disorders. Given that the meltrin proteins may play an important role in a number of disease processes, the identification of new meltrin proteins and meltrin-like molecules 35 is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research, as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0545. 157 WO 99/46281 PCTIUS99/05028 PR0617 polypeptides of the present invention which possess biological activity related to that of the CD24 protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0617 polypeptides of the present invention for such purposes. PRO700 polypeptides and portions thereof which have homology to protein disulfide isomerase may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel 5 protein disulfide isomerases and related molecules may be relevant to a number of human disorders. Given that formation of disulfide bonds and protein folding play important roles in a number of biological processes, the identification of new protein disulfide isomerases and protein disulfide isomerase-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research, as well as various industrial 10 applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0700. PR0702 polypeptides of the present invention which possess biological activity related to that of the conglutinin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0702 polypeptides of the present invention for such purposes. PR0702 polypeptides having conglutinin activity would be expected to be capable of inhibiting haemagglutinin activity by 15 influenza viruses and/or function as immunoglobulin-independent defense molecules as a result of a complement mediated mechanism. PR0703 polypeptides of the present invention which possess biological activity related to that of the VLCAS protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0703 polypeptides of the present invention for such purposes. 20 PRO703 polypeptides and portions thereof which have homology to VLCAS may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel VLCAS proteins and related molecules may be relevant to a number of human disorders. Thus, the identification of new VLCAS proteins and VLCAS protein-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and 25 medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0703. PRO705 polypeptides of the present invention which possess biological activity related to that of the K glypican protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0705 polypeptides of the present invention for such purposes. 30 PR0708 polypeptides of the present invention which possess biological activity related to that of the aryl sulfatase proteins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0708 polypeptides of the present invention for such purposes. PR0320 polypeptides of the present invention which possess biological activity related to that of the fibulin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will 35 well know how to employ the PR0320 polypeptides of the present invention for such purposes. PR0320 polypeptides and portions thereof which have homology to fibulin may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel fibulin proteins and related molecules may be relevant to a number of human disorders such as cancer or those involving connective tissue, attachment molecules and related mechanisms. Thus, the identification of new fibulin proteins and fibulin 158 WO 99/46281 PCT/US99/05028 protein-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0320. PR0324 polypeptides of the present invention which possess biological activity related to that of 5 oxidoreductases may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0324 polypeptides of the present invention for such purposes. PR0351 polypeptides of the present invention which possess biological activity related to that of the prostasin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0351 polypeptides of the present invention for such purposes. 10 PR0351 polypeptides and portions thereof which have homology to prostasin may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novelprostasin proteins and related molecules may be relevant to a number of human disorders. Thus, the identification of new prostasin proteins and prostasin -like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and 15 medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0351. PR0352 polypeptides of the present invention which possess biological activity related to that of the butyrophilin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0352 polypeptides of the present invention for such purposes. 20 PR0381 polypeptides of the present invention which possess biological activity related to that of one or more of the FKPB immunophilin proteins may be employed both in vivo for therapeutic purposes and in vitro, for example for enhancing immunosuppressant activity and/or for axonal regeneration. Those of ordinary skill in the art will well know how to employ the PR0381 polypeptides of the present invention for such purposes. PR0386 polypeptides of the present invention which possess biological activity related to that of the beta-2 25 subunit of a sodium channel expressed in mammalian cells may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0386 polypeptides of the present invention for such purposes. PR0540 polypeptides of the present invention which possess biological activity related to that of the LCAT protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will 30 well know how to employ the PR0540 polypeptides of the present invention for such purposes. PR0615 polypeptides of the present invention which possess biological activity related to that of the synaptogyrin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0615 polypeptides of the present invention for such purposes. PR0615 polypeptides and portions thereof which have homology to synaptogyrin may also be useful for in 35 vivo therapeutic purposes, as well as for various other applications. The identification of novel synaptogyrin proteins and related molecules may be relevant to a number of human disorders. Thus, the identification of new synaptogyrin proteins and synaptogyrin-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular 159 WO 99/46281 PCTIUS99/05028 scientific and medical interest in new molecules, such as PR0615. PRO618 polypeptides of the present invention which possess biological activity related to that of an enteropeptidase may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO618 polypeptides of the present invention for such purposes. PR0618 polypeptides and portions thereof which have homology to enteropeptidase may also be useful for 5 in vivo therapeutic purposes, as well as for various other applications. The identification of novel enteropeptidase proteins and related molecules may be relevant to a number of human disorders. Thus, the identification of new enteropeptidase proteins and enteropeptidase-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular 10 scientific and medical interest in new molecules, such as PR0618. PRO719 polypeptides of the present invention which possess biological activity related to that of the lipoprotein lipase H protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO719 polypeptides of the present invention for such purposes. PRO724 polypeptides of the present invention which possess biological activity related to that of the human 15 LDL receptor protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0724 polypeptides of the present invention for such purposes. PRO772 polypeptides of the present invention which possess biological activity related to that of the human A4 protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0772 polypeptides of the present invention for such purposes. 20 PR0852 polypeptides of the present invention which possess biological activity related to that of certain protease protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0852 polypeptides of the present invention for such purposes. PR0853 polypeptides of the present invention which possess biological activity related to that of the reductase protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the 25 art will well know how to employ the PR0853 polypeptides of the present invention for such purposes. PR0853 polypeptides and portions thereof which have homology to reductase proteins may also be useful for in vivo therapeutic purposes, as well as for various other applications. Given that oxygen free radicals and antioxidants appear to play important roles in a number of disease processes, the identification of new reductase proteins and reductase-like molecules is of special importance in that such proteins may serve as potential therapeutics 30 for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PRO853. PR0860 polypeptides of the present invention which possess biological activity related to that of the neurofascin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in 35 the art will well know how to employ the PR0860 polypeptides of the present invention for such purposes. PR0860 polypeptides and portions thereof which have homology to neurofascin may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel neurofascin proteins and related molecules may be relevant to a number of human disorders which involve cellular adhesion. Thus, the identification of new neurofascin proteins and neurofascin protein-like molecules is of special importance in that such 160 WO 99/46281 PCT/US99/05028 proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0860. PR0846 polypeptides of the present invention which possess biological activity related to that of the CMRF35 protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the 5 art will well know how to employ the PR0846 polypeptides of the present invention for such purposes. PRO846 polypeptides and portions thereof which have homology to the CMRF35 protein may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel CMRF35 protein and related molecules may be relevant to a number of human disorders. Thus, the identification of new CMRF35 protein and CMRF35 protein-like molecules is of special importance in that such proteins may serve as 10 potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PRO846. PR0862 polypeptides of the present invention which possess biological activity related to that of the lysozyme protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the 15 art will well know how to employ the PRO862 polypeptides of the present invention for such purposes. PR0862 polypeptides and portions thereof which have homology to the lysozyme protein may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel lysozyme proteins and related molecules may be relevant to a number of human disorders. Thus, the identification of new lysozymes and lysozyme-like molecules is of special importance in that such proteins may serve as potential 20 therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0862. PR0864 polypeptides of the present invention which possess biological activity related to that of the Wnt-4 protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will 25 well know how to employ the PR0864 polypeptides of the present invention for such purposes. PR0864 polypeptides and portions thereof which have homology to the Wnt-4 protein may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel Wnt-4 proteins and related molecules may be relevant to a number of human disorders. Thus, the identification of new Wnt-4 protein and Wnt-4 protein-like molecules is of special importance in that such proteins may serve as potential therapeutics 30 for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PRO864. PRO792 polypeptides of the present invention which possess biological activity related to that of the CD23 protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will 35 well know how to employ the PR0792 polypeptides of the present invention for such purposes. PR0866 polypeptides of the present invention which possess biological activity related to that of mindin and/or spondin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0866 polypeptides of the present invention for such purposes. 161 WO 99/46281 PCT/US99/05028 PRO871 polypeptides of the present invention which possess biological activity related to that of the cyclophilin protein family may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0871 polypeptides of the present invention for such purposes. PR0873 polypeptides of the present invention which possess biological activity related to that of carboxylesterases may be employed both in vivo for therapeutic purposes and in vitro. For example, they be used 5 in conjunction with prodrugs to convert the prodrug to its active form (see Danks et al.,supra). They may be used to inhibit parasite infection (see van Pelt et al., supra). Methods for employ the PRO873 polypeptides of the present invention for these, and other purposes will be readily apparent to those of ordinary skill in the art. PRO940 polypeptides of the present invention which possess biological activity related to that of the CD33 protein and/or OB binding protein-2 may be employed both in vivo for therapeutic purposes and in vitro. Those of 10 ordinary skill in the art will well know how to employ the PR0940 polypeptides of the present invention for such purposes. PRO941 polypeptides of the present invention which possess biological activity related to that of a cadherin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0941 polypeptides of the present invention for such purposes. 15 PRO944 polypeptides of the present invention which possess biological activity related to that of the CPE-R protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO944 polypeptides of the present invention for such purposes. PR0944 polypeptides of the present invention that function to bind to Clostridium perfringens enterotoxin (CPE) may find use for effectively treating infection by the CPE endotoxin. 20 PR0983 polypeptides of the present invention which possess biological activity related to that of the vesicle associated membrane protein, VAP-33, may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0983 polypeptides of the present invention for such purposes. PRO1057 polypeptides of the present invention which possess biological activity related to that of protease 25 proteins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO1057 polypeptides of the present invention for such purposes. PRO1071 polypeptides of the present invention which possess biological activity related to that of the thrombospondin protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO1071 polypeptides of the present invention for such purposes. 30 PRO1072 polypeptides of the present invention which possess biological activity related to that of reductase proteins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO1072 polypeptides of the present invention for such purposes. PRO1075 polypeptides of the present invention which possess biological activity related to that of protein disulfide isomerase may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in 35 the art will well know how to employ the PRO 1075 polypeptides of the present invention for such purposes. PRO181 polypeptides of the present invention which possess biological activity related to that of the cornichon protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO181 polypeptides of the present invention for such purposes. 162 WO 99/46281 PCT/US99/05028 PR0827 polypeptides of the present invention which possess biological activity related to that of various integrin proteins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0827 polypeptides of the present invention for such purposes. PRO 1114 polypeptides of the present invention which possess biological activity related to that of the cytokine receptor family of proteins may be employed both in vivo for therapeutic purposes and in vitro. Those of 5 ordinary skill in the art will well know how to employ the PROl 114 polypeptides of the present invention for such purposes. In addition to the above, the PRO 1114 interferon receptor polypeptides may be employed in applications, both in vivo and in vitro, where the ability to bind to an interferon ligand is desired. Such applications will be well within the skill level in the art. 10 PRO237 polypeptides of the present invention which possess biological activity related to that of the carbonic anhydrase protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0237 polypeptides of the present invention for such purposes. PR0541 polypeptides of the present invention which possess biological activity related to that of a trypsin inhibitor protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the 15 art will well know how to employ the PR0541 polypeptides of the present invention for such purposes. PRO273 polypeptides can be used in assays that other chemokines would be used in to perform comparative assays. The results can be used accordingly. PR0701 polypeptides of the present invention which possess biological activity related to that of the neuroligin family may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the 20 art will well know how to employ the PRO701 polypeptides of the present invention for such purposes. PRO701 can be used in assays with neurons and its activity thereon can be compared with that of neuroligins 1, 2 and 3. The results can be applied accordingly. PRO704 polypeptides of the present invention which possess biological activity related to that of vesicular integral membrane proteins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary 25 skill in the art will well know how to employ the PR0704 polypeptides of the present invention for such purposes. PR0704 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PR0704 can be tagged or measured for activity to measure endocytosis activity and thereby used to screen for agents which effect endocytosis. PR0706 polypeptides of the present invention which possess biological activity related to that of the 30 endogenous prostatic acid phosphatase precursor may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0706 polypeptides of the present invention for such purposes. PRO706 can be used in assays with human prostatic acid phosphatase or human lysosomal acid phosphatase and its activity thereon can be compared with that of human prostatic acid phosphatase or human lysosomal acid 35 phosphatase. The results can be applied accordingly. PRO707 polypeptides of the present invention which possess biological activity related to that of cadherins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0707 polypeptides of the present invention for such purposes. 163 WO 99/46281 PCT/US99/05028 PR0707 can be used in assays to determine its activity in relation to other cadherins, particularly cadherin FIB3. The results can be applied accordingly. PR0322 polypeptides of the present invention which possess biological activity related to that of neuropsin may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0322 polypeptides of the present invention for such purposes. 5 PR0322 can be used in assays to determine its activity relative to neuropsin, trypsinogen, serine protease and neurosin, and the results applied accordingly. PR0526 polypeptides of the present invention which possess biological activity related to that of protein protein binding proteins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0526 polypeptides of the present invention for such purposes. 10 Assays can be performed with growth factors and other proteins which are known to form complexes to determine whether PR0526 binds thereto and whether there is increased half-life due to such binding. The results can be used accordingly. PR0531 polypeptides of the present invention which possess biological activity related to that of the protocadherins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the 15 art will well know how to employ the PROS31 polypeptides of the present invention for such purposes. PR0531 can be used in assays against protocadherin 3 and other protocadherins, to determine their relative activities. The results can be applied accordingly. PR0534 polypeptides of the present invention which possess biological activity related to that of the protein disulfide isomerase may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in 20 the art will well know how to employ the PR0534 polypeptides of the present invention for such purposes. PR0534 can be used in assays with protein disulfide isomerase to determine the relative activities. The results can be applied accordingly. PR0697 polypeptides of the present invention which possess biological activity related to that of the sFRP family may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well 25 know how to employ the PR0697 polypeptides of the present invention for such purposes. PR0697 can be used in assays with sFRPs and SARPs to determine the relative activities. The results can be applied accordingly. PR0731 polypeptides of the present invention which possess biological activity related to that of any protocadherin may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art 30 will well know how to employ the PR0731 polypeptides of the present invention for such purposes. PR0731 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PRO768 polypeptides of the present invention which possess biological activity related to that of integrins may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know 35 how to employ the PRO768 polypeptides of the present invention for such purposes. PR0768 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PRO771 polypeptides of the present invention which possess biological activity related to that of the testican protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will 164 WO 99/46281 PCT/US99/05028 well know how to employ the PR0771 polypeptides of the present invention for such purposes. PR0771 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PR0733 polypeptides of the present invention which possess biological activity related to that of the proteins which bind the Tl/ST2 receptor may be employed both in vivo for therapeutic purposes and in vitro. Those of 5 ordinary skill in the art will well know how to employ the PR0733 polypeptides of the present invention for such purposes. PR0733 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PRO162 polypeptides of the present invention which possess biological activity related to that of the 10 pancreatitis-associated protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO162 polypeptides of the present invention for such purposes. PRO 162 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PR0788 polypeptides of the present invention which possess biological activity related to that of the anti 15 neoplastic urinary protein may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0788 polypeptides of the present invention for such purposes. PR0788 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PRO1008 polypeptides of the present invention which possess biological activity related to that of dkk-1 may 20 be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO1008 polypeptides of the present invention for such purposes. PRO1008 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PRO1012 polypeptides of the present invention which possess biological activity related to that of the protein 25 disulfide isomerase may be employed both in vivo and in vitro purposes. Those of ordinary skill in the art will well know how to employ the PRO1012 polypeptides of the present invention for such purposes. PRO1012 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PRO1014 polypeptides of the present invention which possess biological activity related to that of reductase 30 may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO1014 polypeptides of the present invention for such purposes. PRO1014 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. Inhibitors of PRO1014 are particularly preferred. The results can be applied accordingly. PRO1017 polypeptides of the present invention which possess biological activity related to that of 35 sulfotransferase may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO1017 polypeptides of the present invention for such purposes. PRO1017 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. 165 WO 99/46281 PCT/US99/05028 PR0474 polypeptides of the present invention which possess biological activity related to that of dehydrogenase may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO474 polypeptides of the present invention for such purposes. PR0474 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. 5 PRO1031 polypeptides of the present invention which possess biological activity related to that of IL-17 may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO1031 polypeptides of the present invention for such purposes. PRO1031 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. 10 PR0938 polypeptides of the present invention which possess biological activity related to that of protein disulfide isomerase may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PR0938 polypeptides of the present invention for such purposes. PRO1082 polypeptides of the present invention which possess biological activity related to that of the LDL receptor may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will 15 well know how to employ the PRO1082 polypeptides of the present invention for such purposes. PRO1082 can be used in assays with the polypeptides to which they have identity with to determine the relative activities. The results can be applied accordingly. PRO1082 can also be used in assays to identify candidate agents which modulate the receptors. PRO1083 polypeptides of the present invention which possess biological activity related to that of 7TM 20 receptors may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to employ the PRO1083 polypeptides of the present invention for such purposes. In particular PRO1083 can be used in assays to determine candidate agents which control or modulate PRO1083, i.e., have an effect on the receptor. The VEGF-E molecules herein have a number of therapeutic uses associated with survival, proliferation 25 and/or differention of cells. Such uses include the treatment of umbilical vein endothelial cells, in view of the demonstrated ability of VEGF-E to increase survival of human umbilical vein endothelial cells. Treatment may be needed if the vein were subjected to traumata, or situations wherein artificial means are employed to enhance the survival of the umbilical vein, for example, where it is weak, diseased, based on an artificial matrix, or in an artificial environment. Other physiological conditions that could be improved based on the selective mitogenic 30 character of VEGF-E are also included herein. Uses also include the treatment of fibroblasts and myocytes, in view of the demonstrated ability of VEGF-E to induce proliferation of fibroblasts and hypertrophy in myocytes. In particular, VEGF-E can be used in wound healing, tissue growth and muscle generation and regeneration. For the indications referred to above, the VEGF-E molecule will be formulated and dosed in a fashion consistent with good medical practice taking into account the specific disorder to be treated, the condition of the 35 individual patient, the site of delivery of the VEGF-E, the method of administration, and other factors known to practitioners. Thus, for purposes herein, the "therapeutically effective amount" of the VEGF-E is an amount that is effective either to prevent, lessen the worsening of, alleviate, or cure the treated condition, in particular that amount which is sufficient to enhance the survival, proliferation and/or differentiation of the treated cells in vivo. 166 WO 99/46281 PCT/US99/05028 VEGF-E amino acid variant sequences and derivatives that are immunologically crossreactive with antibodies raised against native VEGF are useful in immunoassays for VEGF-E as standards, or, when labeled, as competitive reagents. The VEGF-E is prepared for storage or administration by mixing VEGF-E having the desired degree of purity with physiologically acceptable carriers, excipients, or stabilizers. Such materials are non-toxic to recipients 5 at the dosages and concentrations employed. If the VEGF-E is water soluble, it may be formulated in a buffer such as phosphate or other organic acid salt preferably at a pH of about 7 to 8. If the VEGF-E is only partially soluble in water, it may be prepared as a microemulsion by formulating it with a nonionic surfactant such as Tween, Pluronics, or PEG, e.g., Tween 80, in an amount of 0.04-0.05% (w/v), to increase its solubility. Optionally other ingredients may be added such as antioxidants, e.g., ascorbic acid; low molecular weight 10 (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; and sugar alcohols such as mannitol or sorbitol. 15 The VEGF-E to be used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes). The VEGF-E ordinarily will be stored in lyophilized form or as an aqueous solution if it is highly stable to thermal and oxidative denaturation. The pH of the VEGF-E preparations typically will be about from 6 to 8, although higher or lower pH values may also be appropriate in certain instances. It will be understood that use of certain of the foregoing excipients, carriers, or 20 stabilizers will result in the formation of salts of the VEGF-E. If the VEGF-E is to be used parenterally, therapeutic compositions containing the VEGF-E generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle. Generally, where the disorder permits, one should formulate and dose the VEGF-E for site-specific delivery. 25 This is convenient in the case of wounds and ulcers. Sustained release formulations may also be prepared, and include the formation of microcapsular particles and implantable articles. For preparing sustained-release VEGF-E compositions, the VEGF-E is preferably incorporated into a biodegradable matrix or microcapsule. A suitable material for this purpose is a polylactide, although other polymers of poly-(a-hydroxycarboxylic acids), such as poly-D-(-)-3-hydroxybutyric acid (EP 133,988A), can be used. 30 Other biodegradable polymers include poly(lactones), poly(acetals), poly(orthoesters), or poly(orthocarbonates). The initial consideration here must be that the carrier itself, or its degradation products, is nontoxic in the target tissue and will not further aggravate the condition. This can be determined by routine screening in animal models of the target disorder or, if such models are unavailable, in normal animals. Numerous scientific publications document such animal models. 35 For examples of sustained release compositions, see U.S. Patent No. 3,773,919, EP 58,481A, U.S. Patent No. 3,887,699, EP 158,277A, Canadian Patent No. 1176565, U. Sidman et al., Biopolymers 22, 547 [1983], and R. Langer et al., Chem. Tech. 12, 98 [1982]. When applied topically, the VEGF-E is suitably combined with other ingredients, such as carriers and/or adjuvants. There are no limitations on the nature of such other ingredients, except that they must be pharmaceutically 167 WO 99/46281 PCT/US99/05028 acceptable and efficacious for their intended administration, and cannot degrade the activity of the active ingredients of the composition. Examples of suitable vehicles include ointments, creams, gels, or suspensions, with or without purified collagen. The compositions also may be impregnated into transdermal patches, plasters, and bandages, preferably in liquid or semi-liquid form. For obtaining a gel formulation, the VEGF-E formulated in a liquid composition may be mixed with an 5 effective amount of a water-soluble polysaccharide or synthetic polymer such as polyethylene glycol to form a gel of the proper viscosity to be applied topically. The polysaccharide that may be used includes, for example, cellulose derivatives such as etherified cellulose derivatives, including alkyl celluloses, hydroxyalkyl celluloses, and alkylhydroxyalkyl celluloses, for example, methylcellulose, hydroxyethyl cellulose, carboxymethyl cellulose, hydroxypropyl methylcellulose, and hydroxypropyl cellulose; starch and fractionated starch; agar; alginic acid and 10 alginates; gum arabic; pullullan; agarose; carrageenan; dextrans; dextrins; fructans; inulin; mannans; xylans; arabinans; chitosans; glycogens; glucans; and synthetic biopolymers; as well as gums such as xanthan gum; guar gum; locust bean gum; gum arabic; tragacanth gum; and karaya gum; and derivatives and mixtures thereof. The preferred gelling agent herein is one that is inert to biological systems, nontoxic, simple to prepare, and not too runny or viscous, and will not destabilize the VEGF-E held within it. 15 Preferably the polysaccharide is an etherified cellulose derivative, more preferably one that is well defined, purified, and listed in USP, e.g., methylcellulose and the hydroxyalkyl cellulose derivatives, such as hydroxypropyl cellulose, hydroxyethyl cellulose, and hydroxypropyl methylcellulose. Most preferred herein is methylcellulose. The polyethylene glycol useful for gelling is typically a mixture of low and high molecular weight polyethylene glycols to obtain the proper viscosity. For example, a mixture of a polyethylene glycol of molecular 20 weight 400-600 with one of molecular weight 1500 would be effective for this purpose when mixed in the proper ratio to obtain a paste. The term "water soluble" as applied to the polysaccharides and polyethylene glycols is meant to include colloidal solutions and dispersions. In general, the solubility of the cellulose derivatives is determined by the degree of substitution of ether groups, and the stabilizing derivatives useful herein should have a sufficient quantity of such 25 ether groups per anhydroglucose unit in the cellulose chain to render the derivatives water soluble. A degree of ether substitution of at least 0.35 ether groups per anhydroglucose unit is generally sufficient. Additionally, the cellulose derivatives may be in the form of alkali metal salts, for example, the Li, Na, K, or Cs salts. If methylcellulose is employed in the gel, preferably it comprises about 2-5%, more preferably about 3%, of the gel and the VEGF is present in an amount of about 300-1000 mg per ml of gel. 30 The dosage to be employed is dependent upon the factors described above. As a general proposition, the VEGF-E is formulated and delivered to the target site or tissue at a dosage capable of establishing in the tissue a VEGF-E level greater than about 0.1 ng/cc up to a maximum dose that is efficacious but not unduly toxic. This intra-tissue concentration should be maintained if possible by continuous infusion, sustained release, topical application, or injection at empirically determined frequencies. 35 It is within the scope hereof to combine the VEGF-E therapy with other novel or conventional therapies (e.g., growth factors such as VEGF, aFGF, bFGF, PDGF, IGF, NGF, anabolic steroids, EGF or TGF-a) for enhancing the activity of any of the growth factors, including VEGF-E, in promoting cell proliferation, survival, differentiation and repair. It is not necessary that such cotreatment drugs be included per se in the compositions of this invention, although this will be convenient where such drugs are proteinaceous. Such admixtures are suitably 168 WO 99/46281 PCT/US99/05028 administered in the same manner and for the same purposes as the VEGF-E used alone. The useful molar ratio of VEGF-E to such secondary growth factors is typically 1:0.1-10, with about equimolar amounts being preferred. The compounds of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the PRO polypeptide hereof is combined in admixture with a pharmaceutically acceptable carrier vehicle. Suitable carrier vehicles and their formulation, inclusive of other human 5 proteins, e.g., human serum albumin, are described, for example, in Remington's Pharmaceutical Sciences, 16th ed., 1980, Mack Publishing Co., edited by Oslo et al. the disclosure of which is hereby incorporated by reference. The VEGF-E herein may be administered parenterally to subjects suffering from cardiovascular diseases or conditions, or by other methods that ensure its delivery to the bloodstream in an effective form. Compositions particularly well suited for the clinical administration of VEGF-E hereof employed in the 10 practice of the present invention include, for example, sterile aqueous solutions, or sterile hydratable powders such as lyophilized protein. It is generally desirable to include further in the formulation an appropriate amount of a pharmaceutically acceptable salt, generally in an amount sufficient to render the formulation isotonic. A pH regulator such as arginine base, and phosphoric acid, are also typically included in sufficient quantities to maintain an appropriate pH, generally from 5.5 to 7.5. Moreover, for improvement of shelf-life or stability of aqueous 15 formulations, it may also be desirable to include further agents such as glycerol. In this manner, variant t-PA formulations are rendered appropriate for parenteral administration, and, in particular, intravenous administration. Dosages and desired drug concentrations of pharmaceutical compositions of the present invention may vary depending on the particular use envisioned. For example, in the treatment of deep vein thrombosis or peripheral vascular disease, "bolus" doses, will typically be preferred with subsequent administrations being given to maintain 20 an approximately constant blood level, preferably on the order of about 3 ptg/ml. However, for use in connection with emergency medical care facilities where infusion capability is generally not available and due to the generally critical nature of the underlying disease (e.g., embolism, infarct), it will generally be desirable to provide somewhat larger initial doses, such as an intravenous bolus. For the various therapeutic indications referred to for the compounds hereof, the VEGF-E molecules will 25 be formulated and dosed in a fashion consistent with good medical practice taking into account the specific disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners in the respective art. Thus, for purposes herein, the "therapeutically effective amount" of the VEGF-E molecules hereof is an amount that is effective either to prevent, lessen the worsening of, alleviate, or cure the treated condition, in particular that amount which is sufficient to enhance the survival, proliferation or 30 differentiation of targeted cells in vivo. In general a dosage is employed capable of establishing in the tissue that is the target for the therapeutic indication being treated a level of a VEGF-E hereof greater than about 0.1 ng/cm 3 up to a maximum dose that is efficacious but not unduly toxic. It is contemplated that intra-tissue administration may be the choice for certain of the therapeutic indications for the compounds hereof. The human Toll proteins of the present invention can also be used in assays to identify other proteins or 35 molecules involved in Toll-mediated signal transduction. For example, PR0285 and PR0286 are useful in identifying the as of yet unknown natural ligands of human Tolls, or other factors that participate (directly or indirectly) in the activation of and/or signaling through a human Toll receptor, such as potential Toll receptor associated kinases. In addition, inhibitors of the receptor/ligand binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for -peptide or small molecule inhibitors or agonists of the binding interaction. 169 WO 99/46281 PCTIUS99/0 5 0 2 8 Screening assays can be designed to find lead compounds that mimic the biological activity of a native Toll polypeptide or a ligand for a native Toll polypeptide. Such screening assays will include assays amenable to high throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds. The assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, 5 immunoassays and cell based assays, which are well characterized in the art. In vitro assays employ a mixture of components including a Toll receptor polypeptide, which may be part of fusion product with another peptide or polypeptide, e.g., a tag for detecting or anchoring, etc. The assay mixtures may further comprise (for binding assays) a natural intra- or extracellular Toll binding target (i.e. a Toll ligand, or another molecule known to activate and/or signal through the Toll receptor). While native binding targets may be 10 used, it is frequently preferred to use portion of such native binding targets (e.g. peptides), so long as the portion provides binding affinity and avidity to the subject Toll protein conveniently measurable in the assay. The assay mixture also contains a candidate pharmacological agent. Candidate agents encompass numerous chemical classes, through typically they are organic compounds, preferably small organic compounds, and are obtained from a wide variety of sources, including libraries of synthetic or natural compounds. A variety of other reagents may also be 15 included in the mixture, such as, salts, buffers, neutral proteins, e.g. albumin, detergents, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. In in vitro binding assays, the resultant mixture is incubated under conditions whereby, but for the presence of the candidate molecule, the Toll protein specifically binds the cellular binding target, portion or analog, with a reference binding affinity. The mixture components can be added in any order that provides for the requisite bindings 20 and incubations may be performed at any temperature which facilitates optimal binding. Incubation periods are likewise selected for optimal binding but also minimized to facilitate rapid high-throughput screening. After incubation, the agent-biased binding between the Toll protein and one or more binding targets is detected by any convenient technique. For cell-free binding type assays, a separation step is often used to separate bound from unbound components. Separation may be effected by precipitation (e.g. TCA precipitation, 25 immunoprecipitation, etc.), immobilization (e.g on a solid substrate), etc., followed by washing by, for example, membrane filtration (e.g. Whatman's P-18 ion exchange paper, Polyfiltronic's hydrophobic GFC membrane, etc.), gel chromatography (e.g. gel filtration, affinity, etc.). For Toll-dependent transcription assays, binding is detected by a change in the expression of a Toll-dependent reporter. Detection may be effected in any convenient way. For cell-free binding assays, one of the components 30 usually comprises or is coupled to a label. The label may provide for direct detection as radioactivity, luminescence, optical or electron density, etc., or indirect detection, such as, an epitope tag, an enzyme, etc. A variety of methods may be used to detect the label depending on the nature of the label and other assay components, e.g. through optical or electron density, radiative emissions, nonradiative energy transfers, etc. or indirectly detected with antibody conjugates, etc. 35 Nucleic acid encoding the Toll polypeptides disclosed herein may also be used in gene therapy. In gene therapy applications, genes are introduced into cells in order to achieve in vivo synthesis of a therapeutically effective genetic product, for example for replacement of a defective gene. "Gene therapy" includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA. Antisense 170 WO 99/46281 PCTIUS99/05028 RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo. It has already been shown that short antisense oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane. (Zamecnik et al., Proc. Natl. Acad. Sci. USA 83 4143-4146 [1986]). The oligonucleotides can be modified to enhance their uptake, e.g. by substituting their negatively charged phosphodiester groups by uncharged groups. 5 There are a variety of techniques available for introducing nucleic acids into viable cells. The techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vitro, or in vivo in the cells of the intended host. Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc. The currently preferred in vivo gene transfer techniques include transfection with viral (typically retroviral) 10 vectors and viral coat protein-liposome mediated transfection (Dzau et al., Trends in Biotechnology 11, 205-210 [1993]). In some situations it is desirable to provide the nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc. Where liposomes are employed, proteins which bind to a cell surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e.g. capsid proteins or fragments thereof tropic for 15 a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life. The technique of receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol. Chem. 262, 4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414 (1990). For review of the currently known gene marking and gene therapy protocols see Anderson et al., Science 2.., 808-813 (1992). 20 The various uses listed in connection with the Toll proteins herein, are also available for agonists of the native Toll receptors, which mimic at least one biological function of a native Toll receptor. Neurotrimin as well as other members of the IgLON subfamily of the immunoglobulin superfamily have been identified to have effect upon neural patterning, differentiation, maturation and growth. As a result, PR0337 the human neurotrimin homolog polypeptides would be expected to have utility in diseases which are characterized 25 by neural disfunction. For example, motoneuron disorders such as amyotrophic lateral sclerosis (Lou Gehrig's disease), Bell's palsy, and various conditions involving spinal muscular atrophy, or paralysis. NGF variant formulations of the invention can be used to treat human neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease, epilepsy, multiple sclerosis, Huntington's chorea, Down's Syndrome, nerve deafness, and Meniere's disease. Moreover PR0337 polypeptide may also be used as a cognitive enhancer, to enhance learning 30 particularly in dementia or trauma, such as those associated with the above diseases. Further, PR0337 may be employed to treat neuropathy, and especially peripheral neuropathy. "Peripheral neuropathy" refers to a disorder affecting the peripheral nervous system, most often manifested as one or a combination of motor, sensory, sensorimotor, or autonomic neural dysfunction. The wide variety of morphologies exhibited by peripheral neuropathies can each be attributed uniquely to an equally wide number of causes. For 35 example, peripheral neuropathies can be genetically acquired, can result from a systemic disease, or can be induced by a toxic agent. Examples include but are not limited to diabetic peripheral neuropathy, distal sensorimotor neuropathy, or autonomic neuropathies such as reduced motility of the gastrointestinal tract or atony of the urinary bladder. Examples of neuropathies associated with systemic disease include post-polio syndrome or AIDS-associated neuropathy; examples of hereditary neuropathies include Charcot-Marie-Tooth disease, Refsum's disease, 171 WO 99/46281 PCT/US99/05028 Abetalipoproteinemia, Tangier disease, Krabbe's disease, Metachromatic leukodystrophy, Fabry's disease, and Dejerine-Sottas syndrome; and examples of neuropathies caused by a toxic agent include those caused by treatment with a chemotherapeutic agent such as vincristine, cisplatin, methotrexate, or 3'-azido-3'-deoxythymidine. Correspondingly, neurotrimin antagonists would be expected to have utility in diseases characterized by excessive neuronal activity. 5 Endothelin is generated from inactive intermediates, the big endothelins, by a unique processing event catalyzed by the zinc metalloprotease, endothelin converting enzyme (ECE). ECE was recently cloned, and its structure was shown to be a single pass transmembrane protein with a short intracellular N-terminal and a long extracellular C-terminal that contains the catalytic domain and numerous N-glycosylation sites. ECEs cleave the endothelin propeptide between Trp73 and Va174 producing the active peptide, ET, which appears to function as a 10 local rather than a circulating hormone (Rubanyi, G.M. & Polokoff, M.A., Pharmachological Reviews 46: 325-415 (1994). Thus ECE activity is a potential site of regulation of endothelin production and a possible target for therapeutic intervention in the endothelin system. By blocking ECE activity, it is possible stop the production of ET-1 by inhibiting the conversion of the relatively inactive precursor, big ET-1, to the physiologically active form. ECE-2 is 64% identical to bovine ECE-2 at the amino acid level. ECE-2 is closely related to ECE-1 (63% 15 identical, 80% conserved), neutral endopeptidase 24.11 and the Kell blood group protein. Bovine ECE-2 is a type II membrane-bound metalloproteinase localized in the trans-Golgi network where it acts as an intracellular enzyme converting endogenous big endothelin-1 into active endothelin (Emoto, N. and Yanangisawa, M., J. Biol. Chem. 270: 15262-15268 (1995). The bovine ECE-2 mRNA expression is highest in parts of the brain, cerebral cortex, cerebellum and adrenal medulla. It is expressed at lower levels in mymetrium, testes, ovary, and endothelial cells. 20 Bovine ECE-2 and ECE-1 both are more active on ET-1 as a substrate compared to ET-2 or ET-3, Emoto and Yanangisawa, supra. Human ECE-2 is 736 amino acids in length with a 31 residue amino-terminal tail, a 23 residue transmembrane helix and a 682 carboxy-terminal domain. It is 94% identical to bovine ECE-2 and 64% identical to human ECE- 1. The predicted transmembrane domain is highly conserved between the human and bovine ECE-2 proteins and between 25 human ECE-1 and human ECE-2, as are the putative N-linked glycosylation sites, Cys residues conserved in the neutral endopeptidase 24.11 and the Kell blood group protein family and the putative zinc binding motif. The sequence suggests, that like other members of the NEP-ECE-Kell family, human ECE-2 encodes a type II transmembrane zinc-binding metalloproteinase, which, by extrapolation from what is known about bovine ECE-2, is an intracellular enzyme located within the secretory pathway which processes endogenously produced big ET-1 30 while it is still in the secretory vesicles. Emoto and Yanangisawa, supra. The expression pattern of ECE-2 differs from that observed for ECE-1. Northern blot analysis of mRNA levels indicated low levels of expression of a 3.3 kb transcript in adult brain (highest in the cerebellum, putamen, medulla and temporal lobe, and lower in the cerebral cortex, occipital lobe and frontal lobe), spinal cord, lung and pancreas and higher levels of a 4.5 kb transcript in fetal brain and kidney. The two transcript sizes probably 35 represent the use of alternative polyadenylation sites as has been observed for bovine ECE-2 (Emoto and Yanangisawa, supra) and ECE-1 (Xu et al., Cell 78: 473-485 (1994). PCR on cDNA libraries indicated low levels of expression in fetal brain, fetal kidney, fetal small intestine and adult testis. Fetal liver, fetal lung and adult pancreas were all negative. 172 WO 99/46281 PCT/US99/05028 The endothelin (ET) family of peptides have potent vascular, cardiac and renal actions which may be of pathophysiological importance in many human disease states. ET-1 is expressed as an inactive 212 amino acid prepropeptide. The prepropeptide is first cleaved at Arg52-Cys53 and Arg92-Ala93 and then the carboxy terminal Lys9l and Arg92 are trimmed from the protein to generate the propeptide big ET-1. ECEs then cleave the propeptide between Trp73 and Va174, producing the active peptide, ET, which appears to function as a local rather than a 5 circulating hormone (Rubanyi and Polokoff, Pharma. R. 46: 325-415 (1994). Endothelins may play roles in the pathophysiology of a number of disease states including: 1) cardiovascular diseases (vasospasm, hypertension, myocardial ischemia; reperfusion injury and acute myochardial infarction, stroke (cerebral ischemia), congestive heart failure, shock, atherosclerosis, vascular thickening); 2) kidney disease (acute and chronic renal failure, glomerulonephritis, cirrhosis); 3) lung disease (bronchial asthma, pulmonary hypertension); 10 4) gastrointestinal disorders (gastric ulcer, inflammatory bowel diseases); 5) reproductive disorders (premature labor, dysmenorhea, preeclampsia) and 6) carcinogenesis. Rubanyi & Polokoff, supra. Diseases can be evaluated for the impact of ET upon them by examining: 1) increased production of ETs; 2) increased reactivity to ETs; and/or 3) efficacy of an ET receptor antagonist, antibody or ECE inhibitor. Response to the previous criteria suggest that ETs likely play roles in cerebral vasospasm following subarachnoid hemorrhage, 15 hypertension (fulminant/complications), acute renal failure and congestive heart failure. While inhibitors of ET production or activity have not been used in models of coronary vasospasm, acute myocardial infarction, and atherosclerosis, they do have elevated ET levels and increase reactivity to ETs. Shock and pulmonary hypertension also exhibit elevated ET levels (Rubanyi and Polokoff, supra). Inhibition of ECEs in these conditions may be of therapeutic value. 20 The expression pattern of ECE-2 differs from that observed for ECE-1. ECE-2 was observed at low levels in the adult brain, lung and pancreas and higher levels in fetal brain and kidney by Northern blot analysis (Fig. 8). PCR revealed low levels of expression in additional tissues: fetal lung, fetal small intestine and adult testis. Fetal liver was negative. A similar pattern was reported for bovine ECE-2 (Emoto and Yanangisawa, supra). It is expressed in brain tissues (cerebral cortex, cerebellum and adrenal medulla), myometrium and testis, and in low levels in ovary and very 25 low levels in many other tissues. Bovine ECE-1 (Xu et al, supra) is more widely and more abundantly expressed. It is observed in vascular endothelial cells of most organs and in some parenchymal cells. With the exception for brain, bovine ECE-2 mRNA was present at lower levels than ECE-1. Applicants believe ECE-2 to be a particularly good target for the therapeutic intervention for diseases such as cerebral vasospasm following subarachnoid hemorrhage and stroke. 30 92. Anti-PRO Polypeptide Antibodies The present invention further provides anti-PRO polypeptide antibodies. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies. 35 A. Polvclonal Antibodies The anti-PRO polypeptide antibodies may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent 173 WO 99/46281 PCT/US99/05028 may include the PRO polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be 5 selected by one skilled in the art without undue experimentation. B. Monoclonal Antibodies The anti-PRO polypeptide antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). 10 In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro. The immunizing agent will typically include the PRO polypeptide of interest or a fusion protein thereof. Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells 15 or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103). Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may be cultured in a suitable culture medium that 20 preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells. Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of 25 antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Rockville, Maryland. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol., 13:3001 (1984); Brodeur et al., Monoclonal Antibody 30 Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63]. The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against the PRO polypeptide of interest. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such techniques 35 and assays are known in the art. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., 1_02:220 (1980). After the desired hybridoma cells are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supral. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown 174 WO 99/46281 PCTIUS99/05028 in vivo as ascites in a mammal. The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography. The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in 5 U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells 10 that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison et al., supral or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be substituted for the 15 constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen combining site of an antibody of the invention to create a chimeric bivalent antibody. The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain 20 crosslinking. Alternatively, the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinking. In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art. 25 C. Humanized Antibodies The anti-PRO polypeptide antibodies of the invention may further comprise humanized antibodies or human antibodies. Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies 30 include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework 35 sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., 175 WO 99/46281 PCT/US99/05028 Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)]. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321: 5 522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR 10 residues are substituted by residues from analogous sites in rodent antibodies. Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 15 147(1):86-95 (1991)]. D. Bispecific Antibodies Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for the PRO 20 polypeptide, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit. Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities [Milstein and Cuello, Nature, 305:537-539 (1983)]. Because of the 25 random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991). Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be 30 fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy-chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy chain constant region (CHI) containing the site necessary for light-chain binding present in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host organism. For further details of 35 generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121:210 (1986). E. Heteroconiu2ate Antibodies Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target 176 WO 99/46281 PCT/US99/05028 immune system cells to unwanted cells [U.S. Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. 5 Patent No. 4,676,980. 93. Uses for Anti-PRO Polypeptide Antibodies The anti-PRO polypeptide antibodies of the invention have various utilities. For example, anti-PRO polypeptide antibodies may be used in diagnostic assays for a PRO polypeptide, e.g., detecting its expression in 10 specific cells, tissues, or serum. Various diagnostic assay techniques known in the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted in either heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc. (1987) pp. 147-158]. The antibodies used in the diagnostic assays can be labeled with a detectable moiety. The detectable moiety should be capable of producing, either directly or indirectly, a detectable signal. For example, the 15 detectable moiety may be a radioisotope, such as 3 H, "4C, 32 p," S, oi 25 I, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin, or an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. Any method known in the art for conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter et al., Nature, 144:945 (1962); David et al., Biochemistry, 13:1014 (1974); Pain et al., J. Immunol. Meth., 40:219 (1981); and Nygren, J. 20 Histochem. and Cytochem., 30:407 (1982). Anti-PRO polypeptide antibodies also are useful for the affinity purification of PRO polypeptide from recombinant cell culture or natural sources. In this process, the antibodies against the PRO polypeptide are immobilized on a suitable support, such a Sephadex resin or filter paper, using methods well known in the art. The immobilized antibody then is contacted with a sample containing the PRO polypeptide to be purified, and thereafter 25 the support is washed with a suitable solvent that will remove substantially all the material in the sample except the PRO polypeptide, which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that will release the PRO polypeptide from the antibody. Anti-Toll receptor (i.e., anti-PR0285 and anti-PR0286 antibodies) may also be useful in blocking the biological activities of the respective Toll receptors. The primary function of the family of Toll receptors is believed 30 to be to act as pathogen pattern recognition receptors sensing the presence of conserved molecular pattern present on microbes. Lipopolysaccharides (LPS, also known as endotoxins), potentially lethal molecules produced by various bacteria, bind to the lipopolysaccharide binding protein (LBP) in the blood. The complex formed then activates a receptor known as CD14. There is no consensus in the art about what happens next. According to a hypothesis, CD14 does not directly instruct macrophages to produce cytokines, cell adhesion proteins and enzymes 35 involved in the production of lower molecular weight proinflammatory mediators, rather enables LPS to activate a second receptor. Alternatively, it has been suggested that LPS may activate certain receptors directly, without help from LBP or CD14. The data disclosed in the present application indicate that the human toll-like receptors are signaling receptors that are activated by LPS in an LBP and CD14 responsive manner. As this mechanism, under pathophysiologic conditions can lead to an often fatal syndrome called septic shock, anti-Toll receptor antibodies (just 177 WO 99/46281 PCT/US99/05028 as other Toll receptor antagonists) might be useful in the treatment of septic shock. It is foreseen that the different Toll receptors might recognize different pathogens, e.g., various strains of Gram-negative or Gram-positive bacteria. Accordingly, in certain situations, combination therapy with a mixture of antibodies specifically binding different Toll receptors, or the use of bispecific anti-Toll antibodies may be desirable. It is specifically demonstrated that anti-huTLR2 antibodies are believed to be specifically useful in blocking 5 the induction of this receptor by LPS. As it has been shown that LPS exposure can lead to septic shock (Parrillo, N. Engl. J. Med. 328, 1471-1477 [1993]), anti-huTLR2 antibodies are potentially useful in the treatment of septic shock. The foregoing therapeutic and diagnostic uses listed in connection with the anti-Toll receptor antibodies are also applicable to other Toll antagonists, i.e., other molecules (proteins, peptides, small organic molecules, etc.) that 10 block Toll receptor activation and/or signal transduction mediated by Toll receptors. In view of their therapeutic potentials, the Toll proteins (including variants of the native Toll homologues), and their agonists and antagonists (including but not limited to anti-Toll antibodies) are incorporated in compositions suitable for therapeutic use. Therapeutic compositions are prepared for storage by mixing the active ingredient having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers 15 (Remington's Pharmaceutical Sciences 16th Edition, Osol, A. Ed. 1980) in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as 20 glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt forming counterions such as sodium; and/or nonionic surfactants such as Tween, Pluronics or PEG. The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly 25 (methylmethacylate) microcapsules, respectively), in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences, supra. The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes, prior to or following lyophilization and reconstitution. 30 Therapeutic compositions herein generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle. The route of administration is in accord with known methods, e.g. injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or intralesional routes, topical administration, or by sustained release systems. 35 Suitable examples of sustained release preparations include semipermeable polymer matrices in the form of shaped articles, e.g. films, or microcapsules. Sustained release matrices include polyesters, hydrogels, polylactides (U.S. Patent 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma ethyl-L-glutamate (U. Sidman et al., BiopolymrsA 22 (1): 547-556 [1983]), poly (2-hydroxyethyl-methacrylate) (R. Langer, et al., L Biomed. Mater. Res, 15: 167-277 [19811 and R. Langer, Chem. Tech, 12: 98-105 [1982]), ethylene vinyl acetate 178 WO 99/46281 PCTIUS99/05028 (R. Langer c I., Id.) or poly-D-(-)-3-hydroxybutyric acid (EP 133,988). Sustained release compositions also include liposomes. Liposomes containing a molecule within the scope of the present invention are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. USA 82: 3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA 77: 4030-4034 (1980); EP 52322; EP 36676A; EP 88046; EP 143949; EP 142641; Japanese patent application 83-118008; U.S. patents 4,485,045 and 4,544,545; and EP 102,324. Ordinarily the 5 liposomes are of the small (about 200-800 Angstroms) unilamelar type in which the lipid content is greater than about 30 mol. % cholesterol, the selected proportion being adjusted for the optimal NT-4 therapy. An effective amount of the active ingredient will depend, for example, upon the therapeutic objectives, the route of administration, and the condition of the patient. Accordingly, it will be necessary for the therapist to titer the dosage and modify the route of administration as required to obtain the optimal therapeutic effect. A typical daily 10 dosage might range from about 1 Ig/kg to up to 100 mg/kg or more, depending on the factors mentioned above. Typically, the clinician will administer a molecule of the present invention until a dosage is reached that provides the required biological effect. The progress of this therapy is easily monitored by conventional assays. The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. 15 All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety. EXAMPLES Commercially available reagents referred to in the examples were used according to manufacturer's 20 instructions unless otherwise indicated. The source of those cells identified in the following examples, and throughout the specification, by ATCC accession numbers is the American Type Culture Collection, Rockville, Maryland. EXAMPLE 1: Extracellular Domain Homology Screening to Identify Novel Polypeptides and cDNA Encoding Therefo 25 The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases. The EST databases included public databases (e.g., Dayhoff, GenBank), and proprietary databases (e.g. LIFESEQ

TM

, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altschul and Gish, Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequences 30 to a 6 frame translation of the EST sequences. Those comparisons with a Blast score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, WA; (http://bozeman.mbt.washington.edu/phrap.docs/phrap.html). Using this extracellular domain homology screen, consensus DNA sequences were assembled relative to 35 the other identified EST sequences using phrap. In addition, the consensus DNA sequences obtained were often (but not always) extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above. Based upon the consensus sequences obtained as described above, oligonucleotides were then synthesized and used to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate 179 WO 99/46281 PCT/US99/05028 a clone of the full-length coding sequence for a PRO polypeptide. Forward (A) and reverse (.r) PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe (.p) sequences are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5kbp. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al., Current 5 Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a Nod site, linked with blunt to SalI hemikinased adaptors, cleaved with NotI, sized appropriately by 10 gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique Xhol and NotI sites. EXAMPLE 2: Isolation of cDNA clones by Amylase Screening 15 1. Preparation of oligo dT primed cDNA library mRNA was isolated from a human tissue of interest using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA was used to generate an oligo dT primed cDNA library in the vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). In this procedure, the double stranded cDNA was sized to greater than 1000 bp and the SalI/NotI linkered cDNA was cloned 20 into XhoI/NotI cleaved vector. pRK5D is a cloning vector that has an sp6 transcription initiation site followed by an SfiI restriction enzyme site preceding the XhoI/NotI cDNA cloning sites. 2. Preparation of random primed cDNA library A secondary cDNA library was generated in order to preferentially represent the 5' ends of the primary 25 cDNA clones. Sp6 RNA was generated from the primary library (described above), and this RNA was used to generate a random primed cDNA library in the vector pSST-AMY.0 using reagents and protocols from Life Technologies (Super Script Plasmid System, referenced above). In this procedure the double stranded cDNA was sized to 500-1000 bp, linkered with blunt to NotI adaptors, cleaved with SfiI, and cloned into Sfil/NotI cleaved vector. pSST-AMY.0 is a cloning vector that has a yeast alcohol dehydrogenase promoter preceding the cDNA 30 cloning sites and the mouse amylase sequence (the mature sequence without the secretion signal) followed by the yeast alcohol dehydrogenase terminator, after the cloning sites. Thus, cDNAs cloned into this vector that are fused in frame with amylase sequence will lead to the secretion of amylase from appropriately transfected yeast colonies. 3. Transformation and Detection 35 DNA from the library described in paragraph 2 above was chilled on ice to which was added electrocompetent DH1OB bacteria (Life Technologies, 20 ml). The bacteria and vector mixture was then electroporated as recommended by the manufacturer. Subsequently, SOC media (Life Technologies, 1 ml) was added and the mixture was incubated at 37*C for 30 minutes. The transformants were then plated onto 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37C). Positive colonies were scraped off the plates 180 WO 99/46281 PCT/US99/05028 and the DNA was isolated from the bacterial pellet using standard protocols, e.g. CsCl-gradient. The purified DNA was then carried on to the yeast protocols below. The yeast methods were divided into three categories: (1) Transformation of yeast with the plasmid/cDNA combined vector; (2) Detection and isolation of yeast clones secreting amylase; and (3) PCR amplification of the insert directly from the yeast colony and purification of the DNA for sequencing and further analysis. 5 The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotype: MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL*, SUC*, GAL'. Preferably, yeast mutants can be employed that have deficient post-translational pathways. Such mutants may have translocation deficient alleles in sec7 1, sec72, sec62, with truncated sec7l being most preferred. Alternatively, antagonists (including antisense nucleotides and/or ligands) which interfere with the normal operation of these genes, other proteins implicated in this post translation 10 pathway (e.g., SEC61p, SEC72p, SEC62p, SEC63p, TDJlp or SSAlp-4p) or the complex formation of these proteins may also be preferably employed in combination with the amylase-expressing yeast. Transformation was performed based on the protocol outlined by Gietz et al., Nucl. Acid. Res., 20:1425 (1992). Transformed cells were then inoculated from agar into YEPD complex media broth (100 ml) and grown overnight at 30'C. The YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold 15 Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). The overnight culture was then diluted to about 2 x 106 cells/ml (approx. OD,=0. 1) into fresh YEPD broth (500 ml) and regrown to 1 x 10 cells/mi (approx. ODw=0.4-0.5). The cells were then harvested and prepared for transformation by transfer into GS3 rotor bottles in a Sorval GS3 rotor at 5,000 rpm for 5 minutes, the supernatant discarded, and then resuspended into sterile water, and 20 centrifuged again in 50 ml falcon tubes at 3,500 rpm in a Beckman GS-6KR centrifuge. The supernatant was discarded and the cells were subsequently washed with LiAc/TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li 2 00CCH 3 ), and resuspended into LiAc/TE (2.5 ml). Transformation took place by mixing the prepared cells (100 pl) with freshly denatured single stranded salmon testes DNA (Lofstrand Labs, Gaithersburg, MD) and transforming DNA (1 pg, vol. < 10 pl) in microfuge 25 tubes. The mixture was mixed briefly by vortexing, then 40% PEG/TE (600 pl, 40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li 2

OOCCH

3 , pH 7.5) was added. This mixture was gently mixed and incubated at 30"C while agitating for 30 minutes. The cells were then heat shocked at 42'C for 15 minutes, and the reaction vessel centrifuged in a microfuge at 12,000 rpm for 5-10 seconds, decanted and resuspended into TE (500 pl, 10 mM Tris-HC1, 1 mM EDTA pH 7.5) followed by recentrifugation. The cells were then diluted into TE (1 ml) 30 and aliquots (200 d) were spread onto the selective media previously prepared in 150 mm growth plates (VWR). Alternatively, instead of multiple small reactions, the transformation was performed using a single, large scale reaction, wherein reagent amounts were scaled up accordingly. The selective media used was a synthetic complete dextrose agar lacking uracil (SCD-Ura) prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208 35 210 (1994). Transformants were grown at 30'C for 2-3 days. The detection of colonies secreting amylase was performed by including red starch in the selective growth media. Starch was coupled to the red dye (Reactive Red-120, Sigma) as per the procedure described by Biely et al., Anal. Biochem., 172:176-179 (1988). The coupled starch was incorporated into the SCD-Ura agar plates at a final concentration of 0.15% (w/v), and was buffered with potassium phosphate to a pH of 7.0 (50-100 mM final 181 WO 99/46281 PCT/US99/05028 concentration). The positive colonies were picked and streaked across fresh selective media (onto 150 mm plates) in order to obtain well isolated and identifiable single colonies. Well isolated single colonies positive for amylase secretion were detected by direct incorporation of red starch into buffered SCD-Ura agar. Positive colonies were determined by their ability to break down starch resulting in a clear halo around the positive colony visualized directly. 5 4. Isolation of DNA by PCR Amplification When a positive colony was isolated, a portion of it was picked by a toothpick and diluted into sterile water (30 pl) in a 96 well plate. At this time, the positive colonies were either frozen and stored for subsequent analysis or immediately amplified. An aliquot of cells (5 ptl) was used as a template for the PCR reaction in a 25 d volume 10 containing: 0.5 pl Klentaq (Clontech, Palo Alto, CA); 4.0 pl 10 mM dNTP's (Perkin Elmer-Cetus); 2.5 pl Kentaq buffer (Clontech); 0.25 pl forward oligo 1; 0.25 pl reverse oligo 2; 12.5 pl distilled water. The sequence of the forward oligonucleotide 1 was: 5'-TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT-3' (SEQ ID NO:324) The sequence of reverse oligonucleotide 2 was: 15 5'-CAGGAAACAGCTATGACCACCTGCACACCTGCAAATCCATT-3' (SEQ ID NO:325) PCR was then performed as follows: a. Denature 92'C, 5 minutes b. 3 cycles of: Denature 92'C, 30 seconds 20 Anneal 59*C, 30 seconds Extend 72*C, 60 seconds c. 3 cycles of: Denature 92*C, 30 seconds Anneal 57*C, 30 seconds 25 Extend 72*C, 60 seconds d. 25 cycles of: Denature 92'C, 30 seconds Anneal 55*C, 30 seconds Extend 72*C, 60 seconds 30 e. Hold 4*C The underlined regions of the oligonucleotides annealed to the ADH promoter region and the amylase region, respectively, and amplified a 307 bp region from vector pSST-AMY.0 when no insert was present. Typically, 35 the first 18 nucleotides of the 5' end of these oligonucleotides contained annealing sites for the sequencing primers. Thus, the total product of the PCR reaction from an empty vector was 343 bp. However, signal sequence-fused cDNA resulted in considerably longer nucleotide sequences. Following the PCR, an aliquot of the reaction (5 d) was examined by agarose gel electrophoresis in a 1 % agarose gel using a Tris-Borate-EDTA (TBE) buffering system as described by Sambrook et al., supra. Clones 40 resulting in a single strong PCR product larger than 400 bp were further analyzed by DNA sequencing after purification with a 96 Qiaquick PCR clean-up column (Qiagen Inc., Chatsworth, CA). 182 WO 99/46281 PCT/US99/05028 EXAMPLE 3: Isolation of cDNA Clones Encoding Human PRO213 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA28735. Based on the DNA28735 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0213. 5 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-TGGAGCAGCAATATGCCAGCC-3' (SEQ ID NO:3) reverse PCR primer 5'-TTTCCACTCCTGTCGGGTTGG-3' (SEQ ID NO:4) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28735 sequence which had the following nucleotide sequence 10 hybridization probe 5'-GGTGACACTTGCCAGTCAGATGTGGATGAATGCAGTGCTAGGAGGG-3' (SEQ ID NO:5) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO213 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 15 the cDNA libraries was isolated from human fetal lung tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO213 [herein designated as UNQ187 (DNA30943-1163)] (SEQ ID NO:1) and the derived protein sequence for PR0213. The entire nucleotide sequence of UNQ187 (DNA30943-1163) is shown in Figure 1 (SEQ ID NO: 1). Clone UNQ187 (DNA30943-1163) contains a single open reading frame with an apparent translational initiation site at 20 nucleotide positions 336-338 and ending at the stop codon at nucleotide positions 1221-1223 (Figure 1). The predicted polypeptide precursor is 295 amino acids long (Figure 2). Clone UNQ187 (DNA30943-1163) has been deposited with ATCC. Analysis of the amino acid sequence of the full-length PRO213 polypeptide suggests that a portion of it possesses significant homology to the human growth arrest-specific gene 6 protein. More specifically, an analysis 25 of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0213 amino acid sequence and the following Dayhoff sequences, HSMHC3W5A_6 and B48089. EXAMPLE 4: Isolation of cDNA Clones Encodin2 Human PR0274 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 30 wherein the consensus sequence obtained is herein designated DNA36469. Based on the DNA36469 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0274. ESTs proprietary to Genentech were employed in the consensus assembly. The ESTs are shown in Figures 5-7 and are herein designated DNA17873, DNA36157 and DNA28929, respectively. 35 Pairs of PCR primers (forward and reverse) were synthesized: forward PCR primer 1 (36469.fl) 5'-CTGATCCGGTTCTTGGTGCCCCTG-3' (SEQ ID NO:11) forward PCR primer 2 (36469.f2) 5'-GCTCTGTCACTCACGCTC-3' (SEQ ID NO:12) forward PCR primer 3 (36469.f3) 5'-TCATCTCTTCCCTCTCCC-3' (SEQ ID NO:13) forward PCR primer 4 (36469.f4) 5'-CCTTCCGCCACGGAGTTC-3' (SEQ ID NO:14) 183 WO 99/46281 PCT/US99/05028 reverse PCR primer 1 ( 3 6 469.rl) 5'-GGCAAAGTCCACTCCGATGATGTC-3' (SEQ ID NO:15) reverse PCR primer 2 ( 3 6469.r2) 5'-GCCTGCTGTGGTCACAGGTCTCCG-3' (SEQ ID NO:16) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA36469 sequence which had the following nucleotide sequence hybridization probe (36469.pl) 5 5'-TCGGGGAGCAGGCCTTGAACCGGGGCATTGCTGCTGTCAAGGAGG-3' (SEQ ID NO:17) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0274 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB229). 10 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0274 [herein designated as UNQ241 (DNA39987-1184)] (SEQ ID NO: 1) and the derived protein sequence for PR0274. The entire nucleotide sequence of UNQ241 (DNA39987-1184) is shown in Figure 3 (SEQ ID NO:6). Clone UNQ241 (DNA39987-1184) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 83-85 and ending at the stop codon at nucleotide positions 1559-1561 (Figure 3). The predicted 15 polypeptide precursor is 492 amino acids long (Figure 4), has an estimated molecular weight of about 54,241 daltons and an estimated pl of about 8.21. Clone UNQ241 (DNA39987-1184) has been deposited with ATCC and is assigned ATCC deposit no. 209786. Analysis of the amino acid sequence of the full-length PR0274 polypeptide suggests that it possesses significant homology to the Fn54 protein. More specifically, an analysis of the Dayhoff database (version 35.45 20 SwissProt 35) evidenced significant homology between the PR0274 amino acid sequence and the following Dayhoff sequences, MMFN54S2__1, MMFN54S1_1, CELF48C1_8, CEF38B7_6, PRP3_RAT, INL3_PIG, MTCY07A7_13, YNAXKLEAE, A47234 and HME2_MOUSE. EXAMPLE 5: Isolation of cDNA Clones Encoding Human PRO300 25 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA35930. Based on the DNA35930 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0300. Forward and reverse PCR primers were synthesized: 30 forward PCR primer 1 (35930.fl) 5'-GCCGCCTCATCTTCACGTTCTTCC-3' (SEQ ID NO:20) forward PCR primer 2 (35930.f2) 5'-TCATCCAGCTGGTGCTGCTC-3' (SEQ ID NO:21) forward PCR primer 3 (35930.f3) 5'-CTTCTTCCACTTCTGCCTGG-3' (SEQ ID NO:22) forward PCR primer 4 (35930.f4) 5'-CCTGGGCAAAAATGCAAC-3' (SEQ ID NO:23) reverse PCR primer 1 (35930.rl) 5'-CAGGAATGTAGAAGGCACCCACGG-3' (SEQ ID NO:24) 35 reverse PCR primer 2 (35930.r2) 5'-TGGCACAGATCTTCACCCACACGG-3' (SEQ ID NO:25) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35930 sequence which had the following nucleotide sequence hybridization probe (35930.l) 5'-TGTCCATCATTATGCTGAGCCCGGGCGTGGAGAGTCAGCTCTACAAGCTG-3' (SEQ ID NO:26) 184 WO 99/46281 PCT/US99/05028 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO300 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO300 5 [herein designated as UNQ263 (DNA40625-1189)] (SEQ ID NO:18) and the derived protein sequence for PRO300. The entire nucleotide sequence of UNQ263 (DNA40625-1189) is shown in Figure 8 (SEQ ID NO:18). Clone UNQ263 (DNA40625-1189) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 45-47 and ending at the stop codon at nucleotide positions 1416-1418 (Figure 8). The predicted polypeptide precursor is 457 amino acids long (Figure 9). Clone UNQ263 (DNA40625-1189) has been 10 deposited with ATCC and is assigned ATCC deposit no. 209788. Analysis of the amino acid sequence of the full-length PRO300 polypeptide suggests that portions of it possess significant homology to the Diff 33 protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0300 amino acid sequence and the following Dayhoff sequence, HSU491881. 15 EXAMPLE 6: Isolation of cDNA Clones Encoding Human PR0284 Two cDNA sequences were isolated in the amylase screen described in Example 2 and those cDNA sequences are herein designated DNA12982 (see Figure 12; human placenta-derived) and DNA15886 (see Figure 13; human salivary gland-derived). The DNA12982 and DNA15886 sequences were then clustered and aligned, 20 giving rise to a consensus nucleotide sequence herein designated DNA18832. Based on the DNA18832 consensus sequence, oligonucleotide probes were generated and used to screen a human placenta library (LIB89) prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 253:1278 1280 (1991)), and the cDNA size cut was less than 2800 bp. 25 PCR primers (forward and reverse) were synthesized: forward PCR primer 1 (18832.est.f) 5'-TCGTACAGTTACGCTCTCCC-3' (SEQ ID NO:31) forward PCR primer 2 (18832.f) 5'-CTTGAGGAGCGTCAGAAGCG-3' (SEQ ID NO:32) reverse PCR primer (18832.r) 5'-ATAACGAATGAAGCCTCGTG-3' (SEQ ID NO:33) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA18832 sequence which 30 had the following nucleotide sequence hybridization probe (18832.p) 5'-GCTAATATCTGTAAGACGGCAGCTACAGCAGGCATCATTG-3' (SEQ ID NO:34) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clones 35 encoding the PR0284 gene using the probe oligonucleotide and one of the PCR primers. A full length clone was identified that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 167-169 and ending at the stop codon found at nucleotide positions 1022-1024 (Figure 10; SEQ ID NO:27). The predicted polypeptide precursor is 285 amino acids long, has a calculated molecular weight of approximately 32,190 daltons and an estimated pI of approximately 9.03. Analysis of the full 185 WO 99/46281 PCTIUS99/05028 length PR0284 sequence shown in Figure 11 (SEQ ID NO:28) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 24, transmembrane domains from about amino acid 76 to about amino acid 96 and from about amino acid 171 to about amino acid 195 and a potential N-glycosylation site from about amino acid 153 to about amino acid 156. Clone UNQ247 (DNA23318-121 1) has been deposited with ATCC on April 21, 1998 and is assigned ATCC deposit no. 209787. 5 Analysis of the amino acid sequence of the full-length PR0284 polypeptide suggests that it possesses no significant sequence similarity to any known protein. However, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced some degree of homology between the PR0284 amino acid sequence and the following Dayhoff sequences, JQ0124, CELE04A4_5, AB0064511., AF030162_1, IM23_YEAST, S71194, NIACUCMA, IM17_YEAST, 150479 and HUMZFHP_1. 10 EXAMPLE 7: Isolation of cDNA Clones Encoding Human PR0296 A cDNA sequence isolated in the amylase screen as described in Example 2 above was found, by BLAST and FastA sequence alignment, to have sequence homology to a nucleotide sequence encoding sarcoma-associated protein SAS. This cDNA sequence is herein designated DNA23020 (see Figure 16). The DNA23020 sequence was 15 then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQ T M , Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266:460-480 (1996)). Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into a consensus DNA 20 sequence with the program "phrap" (Phil Green, University of Washington, Seattle, Washington; http://bozeman.mbt.washington.edu/phrap.docs/phrap.html). The consensus sequence obtained therefrom is herein designated DNA35858. Two proprietary Genentech ESTs were employed in the assembly wherein those EST sequences are herein identified as DNA21971 (Figure 17; SEQ ID NO:38) and DNA29037 (Figure 18; SEQ ID NO:39). 25 Based on the DNA35858 consensus sequence, oligonucleotide probes were generated and used to screen a human kidney library (LIB228) library prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Science, 253:1278-1280 (1991)), and the cDNA size cut was less than 2800 bp. PCR primers (forward and reverse) were synthesized: 30 forward PCR primer 1 (35858,f1) 5'-ACCCACGTCTGCGTTGCTGCC-3' (SEQ ID NO:40) forward PCR primer 2 (35858.f2) 5'-GAGAATATGCTGGAGAGG-3' (SEQ ID NO:41) reverse PCR primer (35858.rl) 5'-AGGAATGCACTAGGATTCGCGCGG-3' (SEQ ID NO:42) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35858 sequence which had the following nucleotide sequence 35 hybridization probe (35858.p21) 5'-GGCCCCAAAGGCAAGGACAAAGCAGCTGTCAGGGAACCTCCGCCG-3' (SEQ ID NO:43) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0296 gene using the probe oligonucleotide and one of the PCR primers. 186 WO 99/46281 PCT/US99/05028 A full length clone was identified that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 174-176 and ending at the stop codon found at nucleotide positions 786-788 (Figure 14; SEQ ID NO:35). The predicted polypeptide precursor is 204 amino acids long, has a calculated molecular weight of approximately 22,147 daltons and an estimated pI of approximately 8.37. Analysis of the full length PR0296 sequence shown in Figure 15 (SEQ ID NO:36) evidences the presence of the following: a signal 5 peptide from about amino acid 1 to about amino acid 34 and transmembrane domains from about amino acid 47 to about amino acid 63, from about amino acid 72 to about amino acid 95 and from about amino acid 162 to about amino acid 182. Clone UNQ260 (DNA39979-1213) has been deposited with ATCC on April 21, 1998 and is assigned ATCC deposit no. 209789. Analysis of the amino acid sequence of the full-length PR0296 polypeptide suggests that it possesses 10 significant sequence similarity to the sarcoma-amplified SAS protein, thereby indicating that PR0296 may be a novel SAS homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0296 amino acid sequence and the following Dayhoff sequences, 158391, GEN11061, SSC2BO4_1, HSU81031_2, CD63_RAT, CD63_MOUSE, CD63_HUMAN, AF022813_1, CD63_RABIT and C002_HUMAN. 15 EXAMPLE 8: Isolation of cDNA Clones Encoding Human PR0329 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA35612. Based on the DNA35612 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of 20 interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0329. PCR primers (forward and reverse) were synthesized: forward PCR primer 1 (35612.fl) 5'-TGGGCTGTGTCCTCATGG-3' (SEQ ID NO:46) forward PCR primer 2 (35612.f2) 5'-TTTCCAGCGCCAATTCTC-3' (SEQ ID NO:47) reverse PCR primer 1 (35612.rl) 5'-AGTI'CTTGGACTGTGATAGCCAC-3' (SEQ ID NO:48) 25 reverse PCR primer 2 (35612.r2) 5'-AAACTTGGTTGTCCTCAGTGGCTG-3' (SEQ ID NO:49) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35612 sequence which had the following nucleotide sequence hybridization probe ( 3 5612.p1) 5'-GTGAGGGACCTGTCTGCACTGAGGAGAGCAGCTGCCACACGGAGG-3' (SEQ ID NO:50) 30 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0329 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB6). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0329 35 [herein designated as UNQ291 (DNA40594-1233)] (SEQ ID NO:44) and the derived protein sequence for PR0329. The entire nucleotide sequence of UNQ291 (DNA40594-1233) is shown in Figure 19 (SEQ ID NO:44). Clone UNQ291 (DNA40594-1233) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 9-11 and ending at the stop codon at nucleotide positions 1086-1088 (Figure 19). The predicted polypeptide precursor is 359 amino acids long (Figure 20). The full-length PR0329 protein shown in 187 WO 99/46281 PCTIUS99/05028 Figure 20 has an estimated molecular weight of about 38,899 daltons and a pl of about 5.21. Clone UNQ291 (DNA40594-1233) has been deposited with ATCC on February 5, 1998 and is assigned ATCC deposit no. 209617. Analysis of the amino acid sequence of the full-length PR0329 polypeptide suggests that it possesses significant sequence similarity to a high affinity immunoglobulin Fe receptor protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0329 amino 5 acid sequence and the following Dayhoff sequences, FCG1_HUMAN, FCGO_HUMAN, P_R91439, PR22549, P_R91438, P_W00859, PR20811, P_R22550, HUMCD6406_1 and FCG1_MOUSE. EXAMPLE 9: Isolation of cDNA Clones Encoding Human PR0362 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 10 wherein the consensus sequence obtained is herein designated DNA42257. Based on the DNA42257 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0362. PCR primers (forward and reverse) were synthesized: forward PCR primer 1 (42257.fl) 5'-TATCCCTCCAATTGAGCACCCTGG-3' (SEQ ID NO:53) 15 forward PCR primer 2 (42257.f2) 5'-GTCGGAAGACATCCCAACAAG-3' (SEQ ID NO:54) reverse PCR primer 1 (42257.rl) 5'-CTTCACAATGTCGCTGTGCTGCTC-3' (SEQ ID NO:55) reverse PCR primer 2 (42257.r2) 5'-AGCCAAATCCAGCAGCTGGCTTAC-3' (SEQ ID NO:56) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA42257 sequence which had the following nucleotide sequence 20 hybridization probe (42257.p1) 5'-TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCTGAT-3' (SEQ ID NO:57) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0362 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 25 the cDNA libraries was isolated from human fetal brain tissue (LIB153). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0362 [herein designated as UNQ317 (DNA45416-1251)] (SEQ ID NO:51) and the derived protein sequence for PR0362. The entire nucleotide sequence of UNQ317 (DNA45416-1251) is shown in Figure 21 (SEQ ID NO:51). Clone UNQ317 (DNA45416-1251) contains a single open reading frame with an apparent translational initiation site 30 at nucleotide positions 119-121 and ending at the stop codon at nucleotide positions 1082-1084 (Figure 21). The predicted polypeptide precursor is 321 amino acids long (Figure 22). The full-length PR0362 protein shown in Figure 2 has an estimated molecular weight of about 35,544 daltons and a pl of about 8.51. Analysis of the full-length PR0362 polypeptide as shown in Figure 22 evidences the presence of a glycosaminoglycan attachment site at about amino acid 149 to about amino acid 152 and a transmembrane domain from about amino acid 276 to about amino acid 35 306. Clone UNQ317 (DNA45416-1251) has been deposited with ATCC on February 5, 1998 and is assigned ATCC deposit no. 209620. Analysis of the amino acid sequence of the full-length PR0362 polypeptide suggests that it possesses significant sequence similarity to the A33 antigen protein and the HCAR protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0362 amino acid 188 WO 99/46281 PCT/US99/05028 sequence and the following Dayhoff sequences, AB002341_1, HSU55258_1, HSC7NRCAM 1, RNU81037_1, A33_HUMAN, PW14158, NMNCAMRI_1, HSTITINN2_1, S71824_1 and HSU63041_1. EXAMPLE 10: Isolation of cDNA Clones Encoding Human PR0363 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 5 wherein the consensus sequence obtained is herein designated DNA42828. Based on the DNA42828 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0363. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer (42828.f) 5'-CCAGTGCACAGCAGGCAACGAAGC-3' (SEQ ID NO:60) 10 reverse PCR primer (42828.rl) 5'-ACTAGGCTGTATGCCTGGGTGGGC-3' (SEQ ID NO:61) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA42828 sequence which had the following nucleotide sequence hybridization probe (42828.pl) 5'-GTATGTACAAAGCATCGGCATGGT'GCAGGAGCAGTGACAGGC-3' (SEQ ID NO:62) 15 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0363 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0363 20 [herein designated as UNQ318 (DNA45419-1252)] (SEQ ID NO:58) and the derived protein sequence for PR0363. The entire nucleotide sequence of UNQ318 (DNA45419-1252) is shown in Figure 23 (SEQ ID NO:58). Clone UNQ318 (DNA45419-1252) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 190-192 and ending at the stop codon at nucleotide positions 1309-1311 (Figure 23). The predicted polypeptide precursor is 373 amino acids long (Figure 24). The full-length PR0363 protein shown in 25 Figure 24 has an estimated molecular weight of about 41,281 daltons and a pl of about 8.33. A transmembrane domain exists at amino acids 221 to 254 of the amino acid sequence shown in Figure 24 (SEQ ID NO:59). The PR0363 polypeptide also possesses at least two myelin PO protein domains from about amino acids 15 to 56 and from about amino acids 87 to 116. Clone UNQ318 (DNA45419-1252) has been deposited with ATCC on February 5, 1998 and is assigned ATCC deposit no. 209616. 30 Analysis of the amino acid sequence of the full-length PR0363 polypeptide suggests that it possesses significant sequence similarity to the cell surface protein HCAR, thereby indicating that PR0363 may be a novel HCAR homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0363 amino acid sequence and the following Dayhoff sequences, HS46KDA 1, HSU90716_1, MMCARH_1, MMCARHOM_1, MMU90715_1, A33_HUMAN, PW14146, P_W14158, A42632 35 and B42632. EXAMPLE 11: Isolation of gDNA Clones Encoding Human PR0868 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA38133. Based on the DNA38133 consensus 189 WO 99/46281 PCTIUS99/05028 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0868. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer (38133.fl) 5'-GTAGCAGTGCACATGGGGTGTTGG-3' (SEQ ID NO:65) reverse PCR primer (38133.r1) 5'-ACCGCACATCCTCAGTCTCTGTCC-3' (SEQ ID NO:66) 5 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA38133 sequence which had the following nucleotide sequence hybridization probe (38133.p1) 5'-ACGATGATCGCGGGCTCCCTTCTCCTGCTTGGATTCCTTAGCACCACCAC-3' (SEQ ID NO:67) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 10 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0868 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0868 [herein designated as UNQ437 (DNA52594-1270)] (SEQ ID NO:63) and the derived protein sequence for PR0868. 15 The entire nucleotide sequence of UNQ437 (DNA52594-1270) is shown in Figure 25 (SEQ ID NO:63). Clone UNQ437 (DNA52594-1270) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 325-327 and ending at the stop codon at nucleotide positions 2290-2292 (Figure 25). The predicted polypeptide precursor is 655 amino acids long (Figure 26). The full-length PR0868 protein shown in Figure 26 has an estimated molecular weight of about 71,845 daltons and a pl of about 8.22. Analysis of the full 20 length PR0868 polypeptide sequence demonstrates the presence of conserved cysteine-containing domains from about amino acid 66 to about amino acid 78 and from about amino acid 123 to about amino acid 134 of the sequence shown in Figure 26 (SEQ ID NO:3), a TNFR death domain from about amino acid 85 to about amino acid 110, a FASAmouse death domain block from about amino acid 159 to about amino acid 175 and a transmembrane domain from about amino acid 347 to about amino acid 375. Clone UNQ437 (DNA52594-1270) has been deposited with 25 ATCC on March 17, 1998 and is assigned ATCC deposit no. 209679 Analysis of the amino acid sequence of the full-length PR0868 polypeptide suggests that it possesses significant sequence similarity to the tumor necrosis factor receptor protein, thereby indicating that PR0868 may be a novel member of the tumor necrosis factor receptor family. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0868 amino acid sequence and the 30 following Dayhoff sequences, RNU94330_1, PR99933, PR99945, P_R99950, HSU94332_1, CD40_HUMAN, S63368_1, TNR2_HUMAN, MVU87844_1 AND CVU87837_1. EXAMPLE 12: Isolation of cDNA Clones Encoding Human PR0382 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 35 wherein the consensus sequence obtained is herein designated DNA30892. Based on the DNA30892 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0382. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-TGACATCGCCCTTATGAAGCTGGC-3' (SEQ ID NO:70) 190 WO 99/46281 PCTIUS99/05028 reverse PCR primer 5'-TACACGTCCCTGTGGTTGCAGATC-3' (SEQ ID NO:71) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30892 sequence which had the following nucleotide sequence hybridization probe 5'-CGTTCAATGCAGAAATGATCCAGCCTGTGTGCCTGCCCAACTCTGAAGAG-3' (SEQ ID NO:72) 5 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0382 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0382 10 [herein designated as UNQ323 (DNA45234-1277)] (SEQ ID NO:68) and the derived protein sequence for PR0382. The entire nucleotide sequence of UNQ323 (DNA45234-1277) is shown in Figure 27 (SEQ ID NO:68). Clone UNQ323 (DNA45234-1277) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 126-128 and ending at the stop codon at nucleotide positions 1485-1487 (Figure 27). The predicted polypeptide precursor is 453 amino acids long (Figure 28). The full-length PR0382 protein shown in 15 Figure 28 has an estimated molecular weight of about 49,334 daltons and a pl of about 6.32. Analysis of the native PR0382 amino acid sequence shown in Figure 28 (SEQ ID NO:69) indicates the presence of a putative transmembrane domain from about amino acid 240 to about amino acid 284, a putative signal peptide at about amino acid 1 to about amino acid 20, a putative apple domain at about amino acid 386 to about amino acid 419, a putative Kringle domain at about amino acid 394 to about amino acid 406 and a histidine-containing protease active site at 20 about amino acid 253 to about amino acid 258. Clone UNQ323 (DNA45234-1277) has been deposited with ATCC on March 5, 1998 and is assigned ATCC deposit no. 209654. Analysis of the amino acid sequence of the full-length PR0382 polypeptide suggests that it possess significant homology to serine protease proteins, thereby indicating that PR0382 may be a novel seine protease. Specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology 25 between the PR0382 amino acid sequence and the following Dayhoff sequences, HSU75329_1, ENTKMOUSE, HEPSHUMAN, AF030065_1, HEPSRAT, PLMNPIG, PR89430, PR89435, PLMNHORSE, PLMNBOVIN and PR83959. EXAMPLE 13: Isolation of cDNA Clones Encodin2 Human PR0545 30 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA44706. An EST proprietary to Genentech was employed in the consensus assembly and is herein designated DNA13217 (Figure 31; SEQ ID NO:75). Based on the DNA44706 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for 35 PR0545. Forward and reverse PCR primers were synthesized: forward PCR primer 1 5'-GTCTCAGCACGTGTTCTGGTCTCAGGG-3' (SEQ ID NO:76) forward PCR primer 2 5'-CATGAGCATGTGCACGGC-3' (SEQ ID NO:77) forward PCR primer 3 5'-TACCTGCACGATGGGCAC-3' (SEQ ID NO:78) 191 WO 99/46281 PCTIUS99/05028 forward PCR primer 4 5'-CACTGGGCACCTCCCTTC-3' (SEQ ID NO:79) reverse PCR primer 1 5'-CTCCAGGCTGGTCTCCAAGTCCTTCC-3' (SEQ ID NO:80) reverse PCR primer 2 5'-TCCCTGTFGGACTCTGCAGCTTCC-3' (SEQ ID NO:81) reverse PCR primer 3 5'-CTTCGCTGGGAAGAGTTTG-3' (SEQ ID NO:82) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA44706 5 sequence which had the following nucleotide sequence hybridization probe 5'-GTGCAACCAACAGATACAAACTCTTCCCAGCGAAGAAGCTGAAAAGCGTC-3' (SEQ ID NO:83) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 10 by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0545 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human placenta tissue (LIB90). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0545 [herein designated as UNQ346 (DNA49624-1279)] (SEQ ID NO:73) and the derived protein sequence for PR0545. 15 The entire nucleotide sequence of UNQ346 (DNA49624-1279) is shown in Figure 29 (SEQ ID NO:73). Clone UNQ346 (DNA49624-1279) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 311-313 and ending at the stop codon at nucleotide positions 2516-2518 (Figure 29). The predicted polypeptide precursor is 735 amino acids long (Figure 30). The full-length PR0545 protein shown in Figure 30 has an estimated molecular weight of about 80,177 daltons and a pI of about 7.08. Important regions of 20 the PR0545 amino acid sequence include the signal peptide, corresponding to amino acids 1-28, five potential N-glycosylation sites, from about amino acid 111-114, amino acids 146-149, amino acids 348-351, amino acids 449 452, and amino acids 648-651, and a neutral zinc metallopeptidase, zinc-binding region signature sequence, from about amino acids 344-353. Clone UNQ346 (DNA49624-1279) has been deposited with ATCC and is assigned ATCC deposit no. 209655. 25 EXAMPLE 14: Isolation of cDNA Clones Encoding Human PR0617 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA42798. Based on the DNA42798 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 30 2) for use as probes to isolate a clone of the full-length coding sequence for PR0617. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-ACGGGCACACTGGATCCCAAATG-3' (SEQ ID NO:86) reverse PCR primer 5'-GGTAGAGATGTAGAAGGGCAAGCAAGACC-3' (SEQ ID NO:87) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA42798 35 sequence which had the following nucleotide sequence hybridization probe 5'-GCTCCCTACCCGTGCAGGTTTCTTCA GTTCCTTTAACCAGTATGCCG-3' (SEQ ID NO:88) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones 192 WO 99/46281 PCT/US99/05028 encoding the PR0617 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0617 [herein designated as UNQ353 (DNA48309-1280)] (SEQ ID NO:1) and the derived protein sequence for PRO617. The entire nucleotide sequence of UNQ353 (DNA48309-1280) is shown in Figure 32 (SEQ ID NO:84). 5 Clone UNQ353 (DNA48309-1280) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 723-725 and ending at the stop codon at nucleotide positions 924-926 (Figure 32). The predicted polypeptide precursor is 67 amino acids long (Figure 33). The full-length PR0617 protein shown in Figure 33 has an estimated molecular weight of about 6,981 daltons and a pI of about 7.47. Analygs of the PR0617 amino acid sequence also evidences the existence of a putative signal peptide from about amino acid 15 to about amino acid 10 27 and a putative protein kinase C phosphorylation site from about amino acid 41 to about amino acid 43. Clone UNQ353 (DNA48309-1280) has been deposited on March 5, 1998 with ATCC and is assigned ATCC deposit no. 209656. Analysis of the amino acid sequence of the full-length PR0617 polypeptide suggests that it possesses significant homology to the CD24 protein, thereby indicating that PR0617 may be a novel CD24 homolog. More 15 specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0617 amino acid sequence and the following Dayhoff sequences, CD24_HUMAN, CD24_MOUSE, S15785, CD24_RAT, VGE BPG4, MSE5_HUMAN, HSMHC3W36A_2, MLU15184_8, P R85075, SEPLHUMAN and MTCY63 13. 20 EXAMPLE 15: Isolation of cDNA Clones Encoding Human PRO700 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA30837. Based on the DNA30837 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO700. 25 Forward and reverse PCR primers were synthesized: forward PCR primer 1 5'-ATGTTCTTCGCGCCCTGGTG-3' (SEQ ID NO:91) forward PCR primer 2 5'-CCAAGCCAACACACTCTACAG-3' (SEQ ID NO:92) reverse PCR primer 1 5'-AAGTGGTCGCCTTGTGCAACGTGC-3' (SEQ ID NO:93) reverse PCR primer 2 5'-GGTCAAAGGGGATATATCGCCAC-3' (SEQ ID NO:94) 30 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30837 sequence which had the following nucleotide sequence hybridization probe 5'-GCATGGAAGATGCCAAAGTCTATGTGGCTAAAGTGGACTGCACGGCCCA-3' (SEQ ID NO:95) 35 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PRO700 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). 193 WO 99/46281 PCT/US99/05028 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0700 [herein designated as UNQ364 (DNA46776-1284)] (SEQ ID NO:89) and the derived protein sequence for PRO700. The entire nucleotide sequence of UNQ364 (DNA46776-1284) is shown in Figure 34 (SEQ ID NO:89). Clone UNQ364 (DNA46776-1284) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 33-35 and ending at the stop codon at nucleotide positions 1329-1331 (Figure 34). The 5 predicted polypeptide precursor is 432 amino acids long (Figure 35). The full-length PRO700 protein shown in Figure 35 has an estimated molecular weight of about 47,629 daltons and a pl of about 5.90. Important regions of the amino acid sequence of PRO700 include the signal peptide, corresponding to amino acids from about 1 to 33, regions homologous to disulfide isomerase, corresponding to amino acids from about 82-99, 210-255, and 345-360, a tyrosine kinase phosphorylation site, corresponding to amino acids from about 143-151, and an endoplasmic 10 reticulum targeting sequence, corresponding to amino acids from about 429-432. Clone UNQ364 (DNA46776-1284) has been deposited with ATCC and is assigned ATCC Deposit No. 209721. EXAMPLE 16: Isolation of cDNA Clones Encoding Human PR0702 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 15 wherein the consensus sequence obtained is herein designated DNA36623. Based on the DNA36623 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0702. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer (36623.fl) 5'-CGCTGACTATGTTGCCAAGAGTGG-3' (SEQ ID NO:98) 20 reverse PCR primer (36623.r1) 5'-GATGATGGAGGCTCCATACCTCAG-3' (SEQ ID NO:99) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA36623 sequence which had the following nucleotide sequence hybridization probe (36623,p1) 5'-GTGTTCATTGGCGTGAATGACCTTGAAAGGGAGGGACAGTACATGTTCAC-3' (SEQ ID NO: 100) 25 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0702 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB229). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0702 30 [herein designated as UNQ366 (DNA50980-1286)] (SEQ ID NO:96) and the derived protein sequence for PR0702. The entire nucleotide sequence of UNQ366 (DNA50980-1286) is shown in Figure 36 (SEQ ID NO:96). Clone UNQ366 (DNA50980-1286) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 22-24 and ending at the stop codon at nucleotide positions 853-855 (Figure 36). The predicted polypeptide precursor is 277 amino acids long (Figure 37). The full-length PR0702 protein shown in Figure 37 has 35 an estimated molecular weight of about 30,645 daltons and a pl of about 7.47. Analysis of the full-length native PR0702 amino acid sequence evidences the presence of a putative signal peptide from about amino acid 1 to about amino acid 25, potential N-glycosylation sites from about amino acid 230 to about amino acid 233 and from about amino acid 258 to about amino acid 261 and a C-type lectin domain signature sequence from about amino acid 248 to about amino acid 270. Clone UNQ366 (DNA50980-1286) has been deposited with ATCC on March 31, 1998 and 194 WO 99/46281 PCT/US99/05028 is assigned ATCC deposit no. 209717. Analysis of the amino acid sequence of the full-length PR0702 polypeptide suggests that it possesses significant sequence similarity to the conglutinin protein, thereby indicating that PR0702 may be a novel conglutinin homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0702 amino acid sequence and the following Dayhoff sequences, S32436, PR75642, P 5 _W18780, P_W18781, A53330, AC002528_1, HSPPA21CO_1, CA21_HUMAN, CA14_HUMAN and A61262. EXAMPLE 17: Isolation of cDNA Clones Encoding Human PR0703 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA43047. Based on the DNA43047 consensus 10 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0703. Forward and reverse PCR primers were synthesized: forward PCR primer 5'-GAGAGCCATGGGGCTCCACCTG-3' (SEQ ID NO:103) reverse PCR primer 1 5'-GGAGAATGTGGCCACAAC-3' (SEQ ID NO:104) 15 reverse PCR primer 2 5'-GCCCTGGCACAGTGACTCCATAGACG-3' (SEQ ID NO:105) reverse PCR primer 3 5'-ATCCACTTCAGCGGACAC-3' (SEQ ID NO:106) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA40654 sequence which had the following nucleotide sequence hybridization probe 20 5'-CCAGTGCCAGGATACCTCTCTTCCCCCCAGAGCATAACAGACACG-3' (SEQ ID NO:107) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0703 gene using the probe oligonucleotide and one of the PCR primers. RNA for 25 construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0703 [herein designated as UNQ367 (DNA50913-1287)] (SEQ ID NO: 101) and the derived protein sequence for PR0703. The entire nucleotide sequence of UNQ367 (DNA50913-1287) is shown in Figure 38 (SEQ ID NO:101). Clone UNQ367 (DNA50913-1287) contains a single open reading frame with an apparent translational initiation site 30 at nucleotide positions 115-117 and ending at the stop codon at nucleotide positions 2305-2307 (Figure 38). The predicted polypeptide precursor is 730 amino acids long (Figure 39). The full-length PR0703 protein shown in Figure 39 has an estimated molecular weight of about 78,644 daltons, and a pl of about: 7.65. Important regions of the PR0703 amino acid sequence include the signal peptide, a cAMP- and cGMP-dependent protein kinase phosphorylation site, a CUB domain protein motif, N-glycosylation sites and a putative AMP-binding domain 35 signature. Clone UNQ367 (DNA50913-1287) has been deposited with ATCC and is assigned ATCC deposit no. 209716. 195 WO 99/46281 PCTIUS99/05028 EXAMPLE 18: Isolation of cDNA Clones Encoding Human PR0705 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA43437. Based on the DNA43437 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0705. 5 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-AAGCGTGACAGCGGGCACGTC-3' (SEQ ID NO:110) reverse PCR primer 5'-TGCACAGTCTCTGCAGTGCCCAGG-3' (SEQ ID NO:111) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA43437 sequence which had the following nucleotide sequence 10 hybridization probe (43437.pl) 5'-GAATGCTGGAACGGGCACAGCAAAGCCAGATACTFGCCTG-3' (SEQ ID NO: 112) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0705 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 15 the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0705 [herein designated as UNQ369 (DNA50914-1289)] (SEQ ID NO: 108) and the derived protein sequence for PR0705. The entire nucleotide sequence of UNQ369 (DNA50914-1289) is shown in Figure 40 (SEQ ID NO:108). Clone UNQ369 (DNA50914-1289) contains a single open reading frame with an apparent translational initiation site 20 at nucleotide positions 566-568 and ending at the stop codon at nucleotide positions 2231-2233 (Figure 40). The predicted polypeptide precursor is 555 amino acids long (Figure 41). The full-length PRO705 protein shown in Figure 41 has an estimated molecular weight of about 62,736 daltons and a pl of about 5.36. Analysis of the full length PRO705 sequence as shown in Figure 41 evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 23, a eukaryotic DNA topoisomerase I active site from about amino acid 418 to 25 about amino acid 436, and various regions that show homology to various glypican proteins from about amino acid 237 to about amino acid 279, about amino acid 421 to about amino acid 458, about amino acid 53 to about amino acid 74, about amino acid 466 to about amino acid 504, about amino acid 308 to about amino acid 355, about amino acid 104 to about amino acid 156 and about amino acid 379 to about amino acid 410. Clone UNQ369 (DNA50914-1289) has been deposited with ATCC on March 31, 1998 and is assigned ATCC deposit no.209722. 30 Analysis of the amino acid sequence of the full-length PR0705 polypeptide suggests that it possesses significant sequence similarity to the K-glypican protein, thereby indicating that PR0705 may be a novel glypican protein family member. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0705 amino acid sequence and the following Dayhoff sequences, GPCKMOUSE, GLYPCHICK, GLYPRAT, GLYPHUMAN, GPC2_RAT, GPC5_HUMAN, GPC3_HUMAN, 35 GPC3_RAT, PR30168 and CEC03H12_2. EXAMPLE 19: Isolation of cDNA Clones Encoding Human PR0708 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA34024. Based on the DNA34024 consensus 196 WO 99/46281 PCTIUS99/05028 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0708. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CCCAACCCAACTGTTTACCTCTGG-3' (SEQ ID NO:115) reverse PCR primer 5'-CTCTCTGAGTGTACATCTGTGTGG-3' (SEQ ID NO:116) 5 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA34024 sequence which had the following nucleotide sequence hybridization probe 5'-GCCACCCTACCTCAGAAACTGAAGGAGGTTGGNTATTCAACGCATATGGTCGG-3' (SEQ ID NO: 117) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 10 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0708 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human bone marrow tissue (LIB255). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0708 [herein designated as UNQ372 (DNA48296-1292)] (SEQ ID NO: 113) and the derived protein sequence for PR0708. 15 The entire nucleotide sequence of UNQ372 (DNA48296-1292) is shown in Figures 42A-B (SEQ ID NO: 113). Clone UNQ372 (DNA48296-1292) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 891-893 and ending at the stop codon at nucleotide positions 2436-2438 (Figures 42A-B). The predicted polypeptide precursor is 515 amino acids long (Figure 43). The full-length PR0708 protein shown in Figure 43 has an estimated molecular weight of about 56,885 daltons and a pl of about 6.49. Analysis of 20 the PRO708 amino acid sequence shown in Figure 43 (SEQ ID NO: 114) evidences the existence of a putative signal peptide at about amino acid 1 to about amino acid 37, putative sulfatase signature sequences at about amino acid 120 to about amino acid 132 and about amino acid 168 to about amino acid 177, a putative tyrosine kinase phosphorylation site from about amino acid 163 to about amino acid 169 and potential N-glycosylation sites from about amino acid 157 to about amino acid 160, about amino acid 306 to about amino acid 309 and about amino acid 318 to about amino 25 acid 321. Clone UNQ372 (DNA48296-1292) has been deposited with ATCC on March 11, 1998 and is assigned ATCC deposit no. 209668. Analysis of the amino acid sequence of the full-length PRO708 polypeptide suggests that it possesses significant homology to the aryl sulfatase proteins, thereby indicating that PRO708 may be a novel aryl sulfatase homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant 30 homology between the PRO708 amino acid sequence and the following Dayhoff sequences, ARSBHUMAN, CELC54D2_2, G02857, STSHUMAN, 137186, 137187, GEN12648, CELD1014_7, GA6SHUMAN and SPHMHUMAN. EXAMPLE20: Isolation of cDNA Clones Encoding Human PR0320 35 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA28739. Based on the DNA28739 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO320. 197 WO 99/46281 PCT/US99/05028 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CCTCAGTGGCCACATGCTCATG-3' (SEQ ID NO:120) reverse PCR primer 5'-GGCTGCACGTATGGCTATCCATAG-3' (SEQ ID NO:121) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28739 sequence which had the following nucleotide sequence 5 hybridization probe 5'-GATAAACTGTCAGTACAGCTGTGAAGACACAGAAGAAGGGCCACAGTGCC-3' (SEQ ID NO: 122) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0320 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 10 the cDNA libraries was isolated from human fetal lung tissue (LIB25). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0320 [herein designated as UNQ281 (DNA32284-1307)] (SEQ ID NO: 118) and the derived protein sequence for PR0320. The entire nucleotide sequence of UNQ281 (DNA32284-1307) is shown in Figure 44 (SEQ ID NO: 118). Clone UNQ281 (DNA32284-1307) contains a single open reading frame with an apparent translational initiation site 15 at nucleotide positions 135-137 and ending at the stop codon at nucleotide positions 1149-1151 (Figure 44). The predicted polypeptide precursor is 338 amino acids long (Figure 45). The full-length PR0320 protein shown in Figure 45 has an estimated molecular weight of about 37,143 daltons and a pI of about 8.92. Important regions of the PR0320 amino acid sequence include the signal peptide, corresponding to amino acids 1-21, an EGF-like domain cysteine pattern signature, corresponding to amino acids 80-91, and three calcium-binding EGF-like domains, 20 corresponding to amino acids 103-124, 230-151 and 185-206, respectively. Clone UNQ281 (DNA32284-1307) has been deposited with ATCC and is assigned ATCC deposit no. 209670. EXAMPLE 21: Isolation of cDNA Clones Encoding Human PR0324 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 25 wherein the consensus sequence obtained is herein designated DNA34347. Based on the DNA34347 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0324. PCR primers (forward and reverse) were synthesized: forward PCR primer 1 5'-GCAATGAACTGGGAGCTGC-3' (SEQ ID NO:125) 30 forward PCR primer 2 5'-CTGTGAATAGCATCCTGGG-3' (SEQ ID NO:126) forward PCR primer 3 5'-CTTTCAAGCCACTGGAGGG-3' (SEQ ID NO:127) reverse PCR primer 1 5'-CTGTAGACATCCAAGCTGGTATCC-3' (SEQ ID NO: 128) reverse PCR primer 2 5'-AAGAGTCTGCATCCACACCACTC-3' (SEQ ID NO:129) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA34347 35 sequence which had the following nucleotide sequence hybridization probe 5'-ACCTGACGCTACTATGGGCCGAGTGGCAGGGACGACGCCCAGAATG-3' (SEQ ID NO: 130) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate 198 WO 99/46281 PCT/US99/05028 clones encoding the PR0324 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB6). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0324 [herein designated as UNQ285 (DNA36343-13 10)] (SEQ ID NO: 123) and the derived protein sequence for PR0324. The entire nucleotide sequence of UNQ285 (DNA36343-13 10) is shown in Figure 46 (SEQ ID NO: 123). 5 Clone UNQ285 (DNA36343-1310) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 144-146 and ending at the stop codon at nucleotide positions 1011-1013 (Figure 46). The predicted polypeptide precursor is 289 amino acids long (Figure 47). The full-length PR0324 protein shown in Figure 47 has an estimated molecular weight of about 32,268 daltons and a pI of about 9.21. Analysis of the PRO324 polypeptide sequence shown in Figure 47 (SEQ ID NO: 124) evidence the presence of the following: a signal peptide 10 from about amino acid 1 to about amino acid 31, a transmembrane domain from about amino acid 136 to about amino acid 157, tyrosine kinase phosphorylation sites from about amino acid 106 or about amino acid 107 to about amino acid 113 and regions that are homologous to short-chain alcohol dehydrogenase regions from about amino acid 80 to about amino acid 90, from about amino acid 131 to about amino acid 168, from about amino acid 1 to about amino acid 13 and from about amino acid 176 to about amino acid 185. Clone UNQ285 (DNA36343-1310) has been 15 deposited with ATCC on March 30, 1998 and is assigned ATCC deposit no. 209718. Analysis of the amino acid sequence of the full-length PR0324 polypeptide suggests that it possesses significant sequence similarity to oxidoreductases, thereby indicating that PR0324 may be a novel oxidoreductase homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0324 amino acid sequence and the following Dayhoff sequences, B61209, A69965, 20 YQJQ_BACSU, D69930, S76124, FABGECOLI, C70023, S77280, FABG_VIBHA and MTV013_6. EXAMPLE 22: Isolation of cDNA Clones Encoding Human PR0351 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA35950. Based on the DNA35950 consensus 25 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0351. Forward and reverse PCR primers were synthesized: forward PCR primer 5'-CCTGTGCTGTGCCTCGAGCCTGAC-3' (SEQ ID NO:133) reverse PCR primer 5'-GTGGGCAGCAGTTAGCACCGCCTC-3' (SEQ ID NO: 134) 30 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35950 sequence which had the following nucleotide sequence hybridization probe 5'-GGCTGGCATCATCAGCTTTGCATCAAGCTGTGCCCAGGAGGACGC-3' (SEQ ID NO:135) 35 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0351 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB230). 199 WO 99/46281 PCT/US99/05028 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0351 [herein designated as UNQ308 (DNA40571-1315)] (SEQ ID NO:131) and the derived protein sequence for PR0351. The entire nucleotide sequence of UNQ308 (DNA40571-1315) is shown in Figure 48 (SEQ ID NO:131). Clone UNQ308 (DNA40571-1315) contains two open reading frames with an apparent translational initiation site at nucleotide positions 189-191 and a second open reading frame beginning at nucleotide 470, with the two open reading 5 frames ending at the stop codons at nucleotide positions 363-365 and 2009-2011, respectively (Figure 48). The predicted polypeptide precursor is 571 amino acids long (Figure 49). Important regions of the amino acid sequence of PR0351 include the signal peptide, regions having sequence similarity to serine proteases of the trypsin family, two N-glycosylation sites, and three Kringle domains. Clone UNQ308 (DNA40571-1315) has been deposited with ATCC and is assigned ATCC deposit no. 209784. 10 EXAMPLE 23: Isolation of cDNA Clones Encodine Human PR0352 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA36950. Based on the DNA36950 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of 15 interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0352. PCR primers (forward and reverse) were synthesized: forward PCR primer 1 5'-CTGGCACAGCTCAACCTCATCTGG-3' (SEQ ID NO:138) forward PCR primer 2 5'-GCTGTCTGTCTGTCTCATTG-3' (SEQ ID NO:139) forward PCR primer 3 5'-GGACACAGTATACTGACCAC-3' (SEQ ID NO:140) 20 reverse PCR primer 1 5'-TGCGAACCAGGCAGCTGTAAGTGC-3' (SEQ ID NO:141) reverse PCR primer 2 5'-TGGAAGAAGAGGGTGGTGATGTGG-3' (SEQ ID NO:142) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA36950 sequence which had the following nucleotide sequence hybridization probe 25 5'-CAGCTGACAGACACCAAACAGCTGGTGCACAGTTCACCGAAGGC-3' (SEQ ID NO: 143) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0352 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). 30 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0352 [herein designated as UNQ309 (DNA41386-1316)] (SEQ ID NO: 136) and the derived protein sequence for PR0352. The entire nucleotide sequence of UNQ309 (DNA41386-1316) is shown in Figure 50 (SEQ ID NO:136). Clone UNQ309 (DNA41386-1316) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 152-154 and ending at the stop codon at nucleotide positions 1100-1102 (Figure 50). The 35 predicted polypeptide precursor is 316 amino acids long (Figure 51). The full-length PR0352 protein shown in Figure 2 has an estimated pI of about 4.62. Analysis of the full-length PR0352 sequence evidences the presence of a signal peptide from about amino acid 1 to about amino acid 28, a transmembrane domain from about amino acid 251 to about amino acid 270, potential N-glycosylation sites from about amino acid 91 to about amino acid 94, about amino acid 104 to about amino acid 107, about amino acid 189 to about amino acid 192 and about amino acid 215 200 WO 99/46281 PCT/US99/05028 to about amino acid 218 and a region having homology to immunoglobulins and MHC from about amino acid 217 to about amino acid 234. Clone UNQ309 (DNA41386-1316) has been deposited with ATCC on March 26, 1998 and is assigned ATCC deposit no. 209703. Analysis of the amino acid sequence of the full-length PR0352 polypeptide suggests that it possesses significant sequence similarity to the butyrophilin protein, thereby indicating that PR0352 is a novel butyrophilin 5 homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0352 amino acid sequence and the following Dayhoff sequences, BUTYHUMAN, HSB73_1, GGCD80_1, 146690, A33_HUMAN, PR67988, CD86_MOUSE, P_R71360, B39371 and D50558_1. EXAMPLE 24: Isolation of cDNA Clones Encoding Human PR0381 10 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA39651. Based on the DNA39651 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0381. A pair of PCR primers (forward and reverse) were synthesized: 15 forward PCR primer 5'-CTTTCCTTGCTTCAGCAACATGAGGC-3' (SEQ ID NO:146) reverse PCR primer 5'-GCCCAGAGCAGGAGGAATGATGAGC-3' (SEQ ID NO:147) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA39651 sequence which had the following nucleotide sequence hybridization probe 20 5'-GTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCTTG-3' (SEQ ID NO: 148) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0381 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). 25 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0381 [herein designated as UNQ322 (DNA44194-1317)] (SEQ ID NO: 144) and the derived protein sequence for PR0381. The entire nucleotide sequence of UNQ322 (DNA44194-1317) is shown in Figure 52 (SEQ ID NO:144). Clone UNQ322 (DNA44194-1317) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 174-176 and ending at the stop codon at nucleotide positions 807-809 (Figure 52). The 30 predicted polypeptide precursor is 211 amino acids long (Figure 53). The full-length PR0381 protein shown in Figure 53 has an estimated molecular weight of about 24,172 daltons and a pl of about 5.99. Analysis of the full length PRO381 polypeptide shown in Figure 53 (SEQ ID NO: 145) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20, a potential N-glycosylation site from about amino acid 176 to about amino acid 179, potential casein kinase II phosphorylation sites from about amino acid 143 to about amino 35 acid 146, from about amino acid 156 to about amino acid 159, from about amino acid 178 to about amino acid 181, and from about amino acid 200 to about amino acid 203, an endoplasmic reticulum targeting sequence from about amino acid 208 to about amino acid 211, FKBP-type peptidyl-prolyl cis-trans isomerase sites from about amino acid 78 to about amino acid 114 and from about amino acid 118 to about amino acid 131, EF-hand calcium binding 9ins from about amino acid 191 to about amino acid 203, from about amino acid 184 to about amino acid 203 201 WO 99/46281 PCTIUS99/05028 and from about amino acid 140 to about amino acid 159, and an S-100/ICaBP type calcium binding domain from about amino acid 183 to about amino acid 203. Clone UNQ322 (DNA44194-1317) has been deposited with ATCC on April 28, 1998 and is assigned ATCC deposit no. 209808. Analysis of the amino acid sequence of the full-length PR0381 polypeptide suggests that it possesses significant sequence similarity to FKBP immunophilin proteins, thereby indicating that PR0381 may be a novel FKBP 5 immunophilin homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0381 amino acid sequence and the following Dayhoff sequences, AF040252_1, 149669, PR93551, S71238, CELC05C8_1, CEU27353_1, MIPTRYCR, CEZC455_3, FKB4_HUMAN and 140718. 10 EXAMPLE 25: Isolation of cDNA Clones Encoding Human PR0386 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA40674. Two proprietary Genentech EST sequences were employed in the consensus sequence assembly, wherein those EST sequences are herein designated DNA23350 (Figure 56; SEQ ID NO:151) and DNA23536 (Figure 57; SEQ ID NO:152). Based on the DNA40674 15 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0386. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-ACGGAGCATGGAGGTCCACAGTAC-3' (SEQ ID NO:153) reverse PCR primer 5'-GCACGTTCTCAGCATCACCGAC-3' (SEQ ID NO:154) 20 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA40674 sequence which had the following nucleotide sequence hybridization probe 5'-CGCCTGCCCTGCACCTTCAACTCCTGCTACACAGTGAACCACAAACAGTT-3' (SEQ ID NO: 155) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 25 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0386 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB153). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0386 [herein designated as UNQ326 (DNA45415-1318)] (SEQ ID NO: 149) and the derived protein sequence for PR0386. 30 The entire nucleotide sequence of UNQ326 (DNA45415-1318) is shown in Figure 54 (SEQ ID NO: 149). Clone UNQ326 (DNA45415-1318) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 146-148 and ending at the stop codon at nucleotide positions 791-793 (Figure 54). The predicted polypeptide precursor is 215 amino acids long (Figure 55). The full-length PR0386 protein shown in Figure 55 has an estimated molecular weight of about 24,326 daltons and a pl of about 6.32. Analysis of the full 35 length PR0386 sequence shown in Figure 55 (SEQ ID NO: 150) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20, a transmembrane domain from about amino acid 161 to about amino acid 179, an immunoglobulin-like fold from about amino acid 83 to about amino acid 127 and potential N-glycosylation sites from about amino acid 42 to about amino acid 45, from about amino acid 66 to about amino acid 69 and from about amino acid 74 to about amino acid 77. Clone UNQ326 (DNA45415-1318) has been deposited 202 WO 99/46281 PCTIUS99/05028 with ATCC on April 28, 1998 and is assigned ATCC deposit no. 209810. Analysis of the amino acid sequence of the full-length PR0386 polypeptide suggests that it possesses significant sequence similarity to the sodium channel beta-2 subunit, thereby indicating that PR0386 is a novel homolog thereof. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0386 amino acid sequence and the following Dayhoff sequences, A57843, 5 MYPOHUMAN, GEN14531, JC4024, HS46KDA_1, HSU90716_1, D86996_2, MUSIGLVD 1, DMU42768_1 and S19247. EXAMPLE 26: Isolation of cDNA Clones Encodin2 Human PR0540 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 10 wherein the consensus sequence obtained is herein designated DNA39631. Based on the DNA39631 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0540. Forward and reverse PCR primers were synthesized: forward PCR primer 5'-CTGGGGCTACACACGGGGTGAGG-3' (SEQ ID NO:158) 15 reverse PCR primer 5'-GGTGCCGCTGCAGAAAGTAGAGCG-3' (SEQ ID NO:159) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA40654 sequence which had the following nucleotide sequence hybridization probe 5'-GCCCCAAATGAAAACGGGCCCTACTTCCTGGCCCTCCGCGAGATG-3' 20 (SEQ ID NO: 160) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PRO540 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). 25 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0540 therein designated as UNQ341 (DNA44189-1322)] (SEQ ID NO: 156) and the derived protein sequence for PR0540. The entire nucleotide sequence of UNQ341 (DNA44189-1322) is shown in Figure 58 (SEQ ID NO: 156). Clone UNQ341 (DNA44189-1322) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 21-23 and ending at the stop codon at nucleotide positions 1257-1259 (Figure 58). The 30 predicted polypeptide precursor is 412 amino acids long (Figure 59). The full-length PR0540 protein shown in Figure 59 has an estimated molecular weight of about 46,658 daltons and a pI of about 6.65. Important regions of the amino acid sequence of PRO540 include the signal peptide, potential N-glycosylation sites, a potential lipid substrate binding site, a sequence typical of lipases and seine proteins, and a beta-transducin family Trp-Asp repeat. Clone UNQ341 (DNA44189-1322) has been deposited with ATCC and is assigned ATCC deposit no. 209699. 35 EXAMPLE 27: Isolation of cDNA Clones Encodin2 Human PR0615 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA42240. Based on the DNA42240 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of 203 WO 99/46281 PCTIUS99/05028 interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0615. Forward and reverse PCR primers were synthesized: forward PCR primer 5'-TGGTCTTCGCCTTGATCGTGTrCT-3' (SEQ ID NO:163) forward PCR primer 5'-GTGTACTGAGCGGCGGTTAG-3' (SEQ ID NO:164) reverse PCR primer 5'-CTGAAGGTGATGGCTGCCCTCAC-3' (SEQ ID NO:165) 5 reverse PCR primer 5'-CCAGGAGGCTCATGGGAAAGTCC-3' (SEQ ID NO:166) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA42240 sequence which had the following nucleotide sequence: hybridization probe 5'-CCACGAGTCTAAGCAGATGTACTGCGTGTTCAACCGCAACGAGGATGCCT-3' 10 (SEQ ID NO:167) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0615 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human bone marrow tissue (LIB255). 15 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0615 [herein designated as UNQ352 (DNA48304-1323)] (SEQ ID NO: 161) and the derived protein sequence for PRO615. The entire nucleotide sequence of UNQ352 (DNA48304-1323) is shown in Figure 60 (SEQ ID NO:161). Clone UNQ352 (DNA48304-1323) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 51-53 and ending at the stop codon at nucleotide positions 723-725 (Figure 60). The predicted 20 polypeptide precursor is 224 amino acids long (Figure 61). The full-length PR0615 protein shown in Figure 61 has an estimated molecular weight of about 24,810 daltons and a pI of about 4.75. Important regions of the amino acid sequence of PR0615 include a type II transmembrane domain, corresponding to about amino acids 24-43, other transmembrane domains, corresponding to about amino acids 74-90, 108-126, and 145-161, respectively, and a potential N-glycosylation site, corresponding to about amino acids 97-100. Clone UNQ352 (DNA48304-1323) has 25 been deposited with ATCC and is assigned ATCC deposit no. 209811. EXAMPLE 28: Isolation of cDNA Clones Encoding Human PR0618 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA30900. Based on the DNA30900 consensus 30 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0618. Forward and reverse PCR primers were synthesized: forward PCR primer 5'-TAACAGCTGCCCACTGCTTCCAGG-3' (SEQ ID NO:171) reverse PCR primer 5'-TAATCCAGCAGTGCAGGCCGGG-3' (SEQ ID NO:172) 35 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30900 sequence which had the following nucleotide sequence hybrdization probe 5'-ATGGCCTCCACGGTGCTGTGGACCGTGTTCCTGGGCAAGGTGTGGCAGAA-3' (SEQ ID NO: 173) 204 WO 99/46281 PCT/US99/05028 Screening of the above described library gave rise to the partial cDNA clone designated herein DNA35597 (SEQ ID NO: 170). Extension of this sequence using repeated cycles of BLAST and phrap gave rise to a nucleotide sequence designated herein as DNA43335. Primers based upon the DNA43335 consensus sequence were then prepared as follows. forward PCR primer 5'-TGCCTATGCACTGAGGAGGCAGAAG-3' (SEQ ID NO:174) 5 reverse PCR primer 5'-AGGCAGGGACACAGAGTCCATTCAC-3' (SEQ ID NO:175) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA43335 sequence which had the following nucleotide sequence hybridization probe 5'-AGTATGArTGCCGTGCACCCAGGGCCAGTGGACGATCCAGAACAGGAGG-3' 10 (SEQ ID NO:176) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate full length clones encoding the PR0618 gene using the second probe oligonucleotide and one of the second set of PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB229). 15 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO618 [herein designated as UNQ354 (DNA49152-1324)] (SEQ ID NO: 168) and the derived protein sequence for PRO618. The entire nucleotide sequence of UNQ354 (DNA49152-1324) is shown in Figure 62 (SEQ ID NO: 168). Clone UNQ354 (DNA49152-1324) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 73-75 and ending at the stop codon at nucleotide positions 2479-2481 (Figure 62). The 20 predicted polypeptide precursor is 802 amino acids long (Figure 63). The full-length PR0618 protein shown in Figure 63 has an estimated molecular weight of about 88,846 daltons and a p1 of about 6.41. Important regions of the amino acid sequence of PR0618 include type II transmembrane domain, a sequence typical of a protease, trypsin family, histidine active site, multiple N-glycosylation sites, two sequences typical of a Kringle domain, two regions having sequence similarity to Kallikrein light chain, and a region having sequence similarity to low-density lipoprotein 25 receptor. Clone UNQ354 (DNA49152-1324) has been deposited with ATCC and is assigned ATCC deposit no. 209813. EXAMPLE 29: Isolation of cDNA Clones Encoding Human PR0719 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 30 wherein the consensus sequence obtained is herein designated DNA44851. Based on the DNA44851 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0719. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GTGAGCATGAGCGAGCCGTCCAC-3' (SEQ ID NO:179) 35 reverse PCR primer 5'-GCTATTACAACGGTTCTTGCGGCAGC-3' (SEQ ID NO:180) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA44851 sequence which had the following nucleotide sequence hybridization probe 5'-TTGACTCTCTGGTGAATCAGGACAAGCCGAGITITGCCTTCCAG-3' (SEQ ID NO:181) 205 WO 99/46281 PCT/US99/05028 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO719 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human placenta tissue (LIB90). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0719 5 [herein designated as UNQ387 (DNA49646-1327)} (SEQ ID NO: 177) and the derived protein sequence for PR0719. The entire nucleotide sequence of UNQ387 (DNA49646-1327) is shown in Figure 65 (SEQ ID NO: 177). Clone UNQ387 (DNA49646-1327) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 223-225 and ending at the stop codon at nucleotide positions 1285-1287 (Figure 65). The predicted polypeptide precursor is 354 amino acids long (Figure 66). The full-length PR0719 protein shown in 10 Figure 66 has an estimated molecular weight of about 39,362 daltons and a pI of about 8.35. Analysis of the full length PR0719 sequence evidences the presence of a signal peptide from about amino acid 1 to about amino acid 16 as shown in Figure 66 (SEQ ID NO: 178), a lipase-associated serine-containing active site at about amino acid 163 to about amino acid 172, and two potential N-glycosylation sites from about amino acid 80 to about amino acid 83 and about amino acid 136 to about amino acid 139. Clone UNQ387 (DNA49646-1327) has been deposited with 15 ATCC on March 26, 1998 and is assigned ATCC deposit no. 209705. Analysis of the amino acid sequence of the full-length PRO719 polypeptide suggests that it possesses significant sequence similarity to the lipoprotein lipase H protein, thereby indicating that PR0719 may be a novel lipoprotein lipase homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PRO719 amino acid sequence and the following Dayhoff sequences, 20 LIPLHUMAN, LIPHHUMAN, D83548_1, A24059_1, P_R30740, D88666_1, A43357, A46696, B43357 and A49488. EXAMPLE 30: Isolation of cDNA Clones Encoding Human PR0724 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 25 wherein the consensus sequence obtained is herein designated DNA35603. Based on the DNA35603 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0724. Pairs of PCR primers (forward and reverse) were synthesized: forward PCR primer 1 5'-GGCTGTCACTGTGGAGACAC-3' (SEQ ID NO:184) 30 forward PCR primer 2 5'-GCAAGGTCATTACAGCTG-3' (SEQ ID NO:185) reverse PCR primer I 5'-AGAACATAGGAGCAGTCCCACTC-3' (SEQ ID NO:186) reverse PCR primer 2 5'-TGCCTGCTGCTGCACAATCTCAG-3' (SEQ ID NO:187) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35603 sequence which had the following nucleotide sequence 35 hybridization probe 5'-GGCTATTGCTTGCCTTGGGACAGACCCTGTGGCTTAGGCTCTGGC-3' (SEQ ID NO: 188) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PRO724 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 206 WO 99/46281 PCTIUS99/05028 the cDNA libraries was isolated from human fetal lung tissue (LIB26). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0724 [herein designated as UNQ389 (DNA49631-1328)] (SEQ ID NO: 182) and the derived protein sequence for PR0724. The entire nucleotide sequence of UNQ389 (DNA49631-1328) is shown in Figure 67 (SEQ ID NO:182). Clone UNQ389 (DNA49631-1328) contains a single open reading frame with an apparent translational initiation site 5 at nucleotide positions 546-548 and ending at the stop codon at nucleotide positions 2685-2687 (Figure 67). The predicted polypeptide precursor is 713 amino acids long (Figure 68). The full-length PR0724 protein shown in Figure 68 has an estimated molecular weight of about 76,193 daltons and a pI of about 5.42. Analysis of the full length PR0724 amino acid sequence shown in Figure 68 (SEQ ID NO: 183) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 16, a transmembrane domain from about amino acid 10 442 to about amino acid 462 and LDL receptor class A domain regions from about amino acid 152 to about amino acid 171, about amino acid 331 to about amino acid 350, about amino acid 374 to about amino acid 393 and about amino acid 411 to about amino acid 430. Clone UNQ389 (DNA49631-1328) has been deposited with ATCC on April 28, 1998 and is assigned ATCC deposit no. 209806 Analysis of the amino acid sequence of the full-length PR0724 polypeptide suggests that it possesses 15 significant sequence similarity to the human LDL receptor protein, thereby indicating that PR0724 may be a novel LDL receptor homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0724 amino acid sequence and the following Dayhoff sequences, P_R48547, MMAM2R_1, LRP2_RAT, PR60517, PR47861, P_R05533, A44513_1, A30363, P_R74692 and LMLIPOPHO_1. 20 EXAMPLE 31: Isolation of cDNA Clones Encoding Human PR0772 One cDNA sequence was isolated in the amylase screen described in Example 2, wherein that cDNA sequence is herein designated DNA43509 (see Figure 71). Based on the DNA43509 sequence, oligonucleotide probes were generated and used to screen a human fetal lung library (LIB25) prepared as described in paragraph 1 of 25 Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Science, 2:1278-1280 (1991)), and the cDNA size cut was less than 2800 bp. A pair of PCR primers (forward and reverse) were synthesized based on the DNA43509 sequence: forward PCR primer 5'-CGT1TTGCAGAACCTACTCAGGCAG-3' (SEQ ID NO:192) reverse PCR primer 5'-CCTCCACCAACTGTCAATGTTGTGG-3' (SEQ ID NO:193) 30 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA43509 sequence which had the following nucleotide sequence hybridization probe 5'-AAAGTGCTGCTGCTGGGTCTGCAGACGCGATGGATAACGT-3' (SEQ ID NO: 194) Using the above described primers and library, a full length clone was identified that contained a single open 35 reading frame with an apparent translational initiation site at nucleotide positions 131-133 and ending at the stop codon found at nucleotide positions 587-589 (Figure 69; SEQ ID NO: 189). The predicted polypeptide precursor is 152 amino acids long, has a calculated molecular weight of approximately 17,170 daltons and an estimated pl of approximately 9.62. Analysis of the full-length PR0772 sequence shown in Figure 70 (SEQ ID NO: 190) evidences the presence of the following: a potential type II transmembrane domain from about amino acid 26 to about amino 207 WO 99/46281 PCT/US99/05028 acid 42, other potential transmembrane domains from about amino acid 44 to about amino acid 65, from about amino acid 81 to about amino acid 101 and from about amino acid 109 to about amino acid 129, leucine zipper pattern sequences from about amino acid 78 to about amino acid 99 and from about amino acid 85 to about amino acid 106. Clone UNQ410 (DNA49645-1347) has been deposited with ATCC on April 28, 1998 and is assigned ATCC deposit no. 209809. 5 Analysis of the amino acid sequence of the full-length PR0772 polypeptide suggests that it possesses significant sequence similarity to the human A4 protein, thereby indicating that PR0772 may be a novel A4 protein homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0772 amino acid sequence and the following Dayhoff sequences, HSU93305 1, A4PHUMAN, CELB0454_2, VPUJSRV, CELC12D12_2, OCCMAGRT1, LBPHIG1E_50, YIGKECOLI, 10 S76245 and PR50807. EXAMPLE 32: Isolation of cDNA Clones Encoding Human PR0852 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA34364. Based on the DNA34364 consensus 15 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO852. PCR primers (forward and reverse) were synthesized: forward PCR primer 1 5'-CGCAGAAGCTACAGATTCTCG-3' (SEQ ID NO:197) forward PCR primer 2 5'-GGAAATTGGAGGCCAAAGC-3' (SEQ ID NO:198) 20 forward PCR primer 3 5'-GGATGTAGCCAGCAACTGTG-3' (SEQ ID NO:199) forward PCR primer 4 5'-GCCTTGGCTCGTTCTCTrC-3' (SEQ ID NO:200) forward PCR primer 5 5'-GGTCCTGTGCCTGGATGG-3' (SEQ ID NO:201) reverse PCR primer 1 5'-GACAAGACTACCTCCGTTGGTC-3' (SEQ ID NO:202) reverse PCR primer 2 5'-TGATGCACAGTTCAGCACCTGTTG-3' (SEQ ID NO:203) 25 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA34364 sequence which had the following nucleotide sequence hybridization probe 5'-CGCTCCAAGGGCTTGACGTCACAGTGAAGTACACACAAGGAAGCTG-3' (SEQ ID NO:204) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 30 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0852 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB228). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0852 [herein designated as UNQ418 (DNA45493-1349)] (SEQ ID NO: 195) and the derived protein sequence for PR0852. 35 The entire nucleotide sequence of UNQ418 (DNA45493-1349) is shown in Figure 72 (SEQ ID NO: 195). Clone UNQ418 (DNA45493-1349) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 94-96 and ending at the stop codon at nucleotide positions 16748-1650 (Figure 72). The predicted polypeptide precursor is 518 amino acids long (Figure 73). The full-length PR0852 protein shown in Figure 73 has an estimated molecular weight of about 56,180 daltons and a pl of about 5.08. Analysis of the full 208 WO 99/46281 PCT/US99/05028 length PR0852 sequence shown in Figure 73 (SEQ ID NO: 196) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20, a transmembrane domain from about amino acid 466 to about amino acid 494, potential N-glycosylation sites from about amino acid 170 to about amino acid 173 and about amino acid 366 to about amino acid 369, leucine zipper sequence pattern blocks from about amino acid 10 to about amino acid 31 and from about amino acid 197 to about amino acid 218 and blocks of amino acids having sequence 5 homology to eukaryotic and viral aspartyl proteases from about amino acid 109 to about amino acid 118, from about amino acid 252 to about amino acid 261 and from about amino acid 298 to about amino acid 310. Clone UNQ418 (DNA45493-1349) has been deposited with ATCC on April 28, 1998 and is assigned ATCC deposit no. 209805. Analysis of the amino acid sequence of the full-length PR0852 polypeptide suggests that it possesses significant sequence similarity to various protease proteins, thereby indicating that PR0852 may be a novel protease 10 protein or homolog thereof. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0852 amino acid sequence and the following Dayhoff sequences, PEPCHUMAN, S66516, S66517, PEPECHICK, CATDHUMAN, P_R74207, CARPYEAST, PEP2_RABIT, CATEHUMAN and RENIMOUSE. 15 EXAMPLE 33: Isolation of cDNA Clones Encoding Human PR0853 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA43050. Based on the DNA43050 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0853. 20 Forward and reverse PCR primers were synthesized: forward PCR primer 5'-CTTCATGGCCTTGGACTTGGCCAG-3' (SEQ ID NO:207) reverse PCR primer 5'-ACGCCAGTGGCCTCAAGCTGGTTG-3' (SEQ ID NO:208) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA43050 sequence which had the following nucleotide sequence 25 hybridization probe 5'-CTTTCTGAGCTCTGAGCCACGGTTGGACATCCTCATCCACAATGC-3' (SEQ ID NO:209) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0853 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction 30 of the cDNA libraries was isolated from human fetal kidney tissue (LIB228). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0853 [herein designated as UNQ419 (DNA48227-1350)] (SEQ ID NO:205) and the derived protein sequence for PR0853. The entire nucleotide sequence of UNQ419 (DNA48227-1350) is shown in Figure 74 (SEQ ID NO:205). Clone UNQ419 (DNA48227-1350) contains a single open reading frame with an apparent translational initiation site 35 at nucleotide positions 128-130 and ending at the stop codon at nucleotide positions 1259-1261 (Figure 74). The predicted polypeptide precursor is 377 amino acids long (Figure 75). The full-length PR0853 protein shown in Figure 75 has an estimated molecular weight of about 40,849 daltons and a pI of about 7.98. Important regions of the amino acid sequence of PR0853 include the signal peptide, corresponding to amino acids from about 1 to about 16 of SEQ ID NO:206, the glycosaminoglycan attachment site, corresponding to amino acids from about 46 to about 209 WO 99/46281 PCTIUS99/05028 49 of SEQ ID NO:206, and two sequences typical of the short-chain alcohol dehydrogenase family, corresponding to amino acids from about 37 to about 49 and about 114 to about 124 of SEQ ID NO:206, respectively. Clone UNQ419 (DNA48227-1350) has been deposited with ATCC and is assigned ATCC deposit no. 209812. EXAMPLE 34: Isolation of cDNA Clones Encoding Human PR0860 5 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA38137. Based on the DNA38137 consensu sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0860. Forward and reverse PCR primers were synthesized: 10 forward PCR primer 5'-GAAGGGACCTACATGTGTGTGGCC-3' (SEQ ID NO:212) reverse PCR primer 5'-ACTGACCTTCCAGCTGAGCCACAC-3' (SEQ ID NO:213) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA40654 sequence which had the following nucleotide sequence hybridization probe 15 5'-AGGACTACACGGAGCCTGTGGAGCTTCTGGCTGTGCGAATTCAGCTGGAA-3' (SEQ ID NO:214) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0860 gene using the probe oligonucleotide and one of the PCR primers. RNA for 20 construction of the cDNA libraries was isolated from human fetal lung tissue (LIB26). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0860 [herein designated as UNQ421 (DNA41404-1352)] (SEQ ID NO:210) and the derived protein sequence for PR0860. The entire nucleotide sequence of UNQ421 (DNA41404-1352) is shown in Figures 76A-B (SEQ ID NO:210). Clone UNQ421 (DNA41404-1352) contains a single open reading frame with an apparent translational 25 initiation site at nucleotide positions 58-60 and ending at the stop codon at nucleotide positions 3013-3015 (Figures 76A-B). The predicted polypeptide precursor is 985 amino acids long (Figure 77). The full-length PR0860 protein shown in Figure 77 has an estimated molecular weight of about 105,336 daltons and a pl of about 6.55. Important regions of the amino acid sequence of PR0860 include the transmembrane region corresponding to about amino acids 448-467, the extracellular domain, corresponding to amino acids about 1-447, several N-glycosylation sites, numerous 30 N-myristoylation sites and a sequence typical of phosphotyrosine interaction domain proteins.. Clone UNQ421 (DNA41404-1352) has been deposited with ATCC and is assigned ATCC deposit no. 209844. EXAMPLE 35: Isolation of cDNA Clones Encodin2 Human PRO846 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 35 wherein the consensus sequence obtained is herein designated DNA39949. Based on the DNA39949 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO846. Forward and reverse PCR primers were synthesized: forward PCR primer 5'-CCCTGCAGTGCACCTACAGGGAAG-3' (SEQ ID NO:217) 210 WO 99/46281 PCT/US99/05028 reverse PCR primer 5'-CTGTCTTCCCCTGCTTGGCTGTGG-3' (SEQ ID NO:218) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA39949 sequence which had the following nucleotide sequence hybridization probe 5'-GGTGCAGGAAGGGTGGGATCCTCTTCTCTCGCTGCTCTGGCCACATC-3' 5 (SEQ ID NO:219) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0846 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). 10 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0846 [herein designated as UNQ422 (DNA44196-1353)] (SEQ ID NO:215) and the derived protein sequence for PRO846. The entire nucleotide sequence of UNQ422 (DNA44196-1353) is shown in Figure 78 (SEQ ID NO:215). Clone UNQ422 (DNA44196-1353) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 25-27 and ending at the stop codon at nucleotide positions 1021-1023 (Figure 78). The 15 predicted polypeptide precursor is 332 amino acids long (Figure 79). The full-length PR0846 protein shown in Figure 79 has an estimated molecular weight of about 36,143 daltons and a pI of about 5.89. Important regions of the amino acid sequence of PR0846 include the signal peptide, the transmembrane domain, an N-glycosylation site, a sequence typical of fibrinogen beta and gamma chains C-terminal domain, and a sequence typical of Ig like V-type domain as shown in Figure 79. Clone UNQ422 (DNA44196-1353) has been deposited with ATCC and is assigned 20 ATCC deposit no. 209847. EXAMPLE 36: Isolation of cDNA Clones Encoding Human PR0862 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA47370. Based on the DNA47370 consensus 25 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0862. Forward and reverse PCR primers were synthesized: forward PCR primer 5'GGGATCATGTTGTTGGCCCTGGTC-3' (SEQ ID NO:222) reverse PCR primer 5'-GCAAGGCAGACCCAGTCAGCCAG-3' (SEQ ID NO:223) 30 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA47370 sequence which had the following nucleotide sequence hybridization probe 5'-CTGCCTGCTACCCTCCAAGTGAGGCCAAGCTCTACGGTCGTTGTG-3' (SEQ ID NO:225) 35 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0862 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human pancreas tissue (LIB55). 211 WO 99/46281 PCT/US99/05028 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO862 [herein designated as UNQ424 (DNA52187-1354)] (SEQ ID NO:220) and the derived protein sequence for PRO862. The entire nucleotide sequence of UNQ424 (DNA52187-1354) is shown in Figure 80 (SEQ ID NO:220). Clone UNQ424 (DNA52187-1354) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 410-412 and ending at the stop codon at nucleotide positions 848-850 (Figure 80). The 5 predicted polypeptide precursor is 146 amino acids long (Figure 81). The full-length PR0862 protein shown in Figure 81 has an estimated molecular weight of about 16,430 daltons and a pI of about 5.05. Important regions of the amino acid sequence of PR0862 include the signal peptide, an N-myristoylation site, and sequences having similarity to region to Alpha-lactalbumin/lysozyme C proteins as shown in Figure 81. Clone UNQ424 (DNA52187 1354) has been deposited with the ATCC and is assigned ATCC deposit no. 209845. 10 EXAMPLE 37: Isolation of cDNA Clones Encoding Human PR0864 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA40666. Based on the DNA40666 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of 15 interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0864. Forward and reverse PCR primers were synthesized: forward PCR primer 5'-GCTGCAGCTGCAAATTCCACTGG-3' (SEQ ID NO:227) reverse PCR primer 5'-TGGTGGGAGACTGTTTAAATTATCGGCC-3' (SEQ ID NO:228) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA40666 20 sequence which had the following nucleotide sequence hybridization probe 5'-TGCTTCGTCAAGTGCCGGCAGTGCCAGCGGCTCGTGGAGTT-3' (SEQ ID NO:229) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 25 by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0864 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB153). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0864 [herein designated as UNQ426 (DNA48328-1355)) (SEQ ID NO:225) and the derived protein sequence for PR0864. 30 The entire nucleotide sequence of UNQ426 (DNA48328-1355) is shown in Figure 82 (SEQ ID NO:225). Clone UNQ426 (DNA48328-1355) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 37-39 and ending at the stop codon at nucleotide positions 1090-1092 (Figure 82). The predicted polypeptide precursor is 351 amino acids long (Figure 83). The full-length PR0864 protein shown in Figure 83 has an estimated molecular weight of about 39,052 and a pI of about 8.97. Important regions of the amino 35 acid sequence of PR0864 include the signal peptide, two N-glycosylation sites, a Wnt-1 family signature sequence, and sequence regions homologous to Wnt-1 family proteins as shown in Figure 83. Clone UNQ426 (DNA48328 1355) has been deposited with ATCC and is assigned ATCC deposit no. 209843. 212 WO 99/46281 PCT/US99/05028 EXAMPLE 38: Isolation of cDNA Clones Encoding Human PR0792 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA38106. Based on the DNA38106 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0792. 5 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GCGAGAACTGTGTCATGATGCTGC-3' (SEQ ID NO:232) reverse PCR primer 5'-GTTTCTGAGACTCAGCAGCGGTGG-3' (SEQ ID NO:233) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA38106 sequence which had the following nucleotide sequence 10 hybridization probe 5'-CACCGTGTGACAGCGAGAAGGACGGCTGGATCTGTGAGAAAAGGCACAAC-3' (SEQ ID NO:234) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0792 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 15 the cDNA libraries was isolated from human bone marrow tissue (LIB255). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0792 [herein designated as UNQ431 (DNA56352-1358)] (SEQ ID NO:230) and the derived protein sequence for PRO792. The entire nucleotide sequence of UNQ431 (DNA56352-1358) is shown in Figure 84 (SEQ ID NO:230). Clone UNQ431 (DNA56352-1358) contains a single open reading frame with an apparent translational initiation site 20 at nucleotide positions 67-69 and ending at the stop codon at nucleotide positions 946-948 (Figure 84). The predicted polypeptide precursor is 293 amino acids long (Figure 85). The full-length PR0792 protein shown in Figure 85 has an estimated molecular weight of about 32,562 daltons and a pI of about 6.53. Analysis of the full-length PR0792 sequence shown in Figure 85 (SEQ ID NO:231) evidences the presence of the following: a type II transmembrane domain from about amino acid 31 to about amino acid 54, potential N-glycosylation sites from about amino acid 73 25 to about amino acid 76 and from about amino acid 159 to about amino acid 162, a leucine zipper amino acid sequence pattern from about amino acid 102 to about amino acid 123, potential N-myristolation sites from about amino acid 18 to about amino acid 23, from about amino acid 133 to about amino acid 138 and from about amino acid 242 to about amino acid 247 and a C-type lectin domain signature block from about amino acid 264 to about amino acid 287. Clone UNQ431 (DNA56352-1358) has been deposited with ATCC on May 6, 1998 and is assigned ATCC deposit 30 no. 209846. Analysis of the amino acid sequence of the full-length PR0792 polypeptide suggests that it possesses significant sequence similarity to the CD23 protein, thereby indicating that PR0792 may be a novel CD23 homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0792 amino acid sequence and the following Dayhoff sequences, S34198, A07100_1, A05303_1, 35 P_R41689, PP82839, A10871_1, P_R12796, P_R47199, A46274 and PR32188. EXAMPLE 39: Isolation of cDNA Clones Encoding Human PRO866 213 WO 99/46281 PCT/US99/05028 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA44708. Based on the DNA44708 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0866. PCR primers (forward and reverse) were synthesized: 5 forward PCR primer 1 5'-CAGCACTGCCAGGGGAAGAGGG-3' (SEQ ID NO:237) forward PCR primer 2 5'-CAGGACTCGCTACGTCCG-3' (SEQ ID NO:238) forward PCR primer 3 5'-CAGCCCCTTCTCCTCCTTTCTCCC-3' (SEQ ID NO:239) reverse PCR primer 1 5'-GCAGTTATCAGGGACGCACTCAGCC-3' (SEQ ID NO:240) reverse PCR primer 2 5'-CCAGCGAGAGGCAGATAG-3' (SEQ ID NO:241) 10 reverse PCR primer 3 5'-CGGTCACCGTGTCCTGCGGGATG-3' (SEQ ID NO:242) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA44708 sequence which had the following nucleotide sequence hybridization probe 5'-CAGCCCCTTCTCCTCCTTTCTCCCACGTCCTATCTGCCTCTC-3' (SEQ ID NO:243) 15 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0866 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB228). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0866 20 [herein designated as UNQ435 (DNA53971-1359)] (SEQ ID NO:235) and the derived protein sequence for PR0866. The entire nucleotide sequence of UNQ435 (DNA53971-1359) is shown in Figure 86 (SEQ ID NO:235). Clone UNQ435 (DNA53971-1359) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 275-277 and ending at the stop codon at nucleotide positions 1268-1270 (Figure 86). The predicted polypeptide precursor is 331 amino acids long (Figure 87). The full-length PR0866 protein shown in 25 Figure 87 has an estimated molecular weight of about 35,844 daltons and a pI of about 5.45. Analysis of the full length PR0866 sequence shown in Figure 87 (SEQ ID NO:236) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 26. Clone UNQ435 (DNA53971-1359) has been deposited with ATCC on April 7, 1998 and is assigned ATCC deposit no. 209750. Analysis of the amino acid sequence of the full-length PR0866 polypeptide suggests that it possesses 30 significant sequence similarity to the mindin/spondin family of proteins, thereby indicating that PR0866 may be a novel mindin homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0866 amino acid sequence and the following Dayhoff sequences,AB006085._1, AB006084_1, AB006086_1, AF017267_1, CWU42213_1, AC004160_1, CPMICRP_1, S49108, A48569 and 146687. 35 EXAMPLE 40: Isolation of cDNA Clones Encoding Human PRO871 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA40324. Based on the DNA40324 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of 214 WO 99/46281 PCTIUS99/05028 interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0871. PCR primers (forward and reverse) were synthesized: forward PCR primer 1 5'-TGCGGAGATCCTACTGGCACAGGG-3' (SEQ ID NO:246) forward PCR primer 2 5'-CGAGTTAGTCAGAGCATG-3' (SEQ ID NO:247) forward PCR primer 3 5'-CAGATGGTGCTGTTGCCG-3' (SEQ ID NO:248) 5 reverse PCR primer 1 5'-CAACTGGAACAGGAACTGAGATGTGGATC-3' (SEQ ID NO:249) reverse PCR primer 2 5'-CTGGTTCAGCAGTGCAAGGGTCTG-3' (SEQ ID NO:250) reverse PCR primer 3 5'-CCTCTCCGATTAAAACGC-3' (SEQ ID NO:251) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA40324 sequence which had the following nucleotide sequence 10 hybridization probe 5'-GAGAGGACTGGTTGCCATGGCAAATGCTGGTTCTCATGATAATGG-3' (SEQ ID NO:252) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0871 gene using the probe oligonucleotide and one of the PCR primers. RNA for 15 construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0871 [herein designated as UNQ438 (DNA50919-1361)] (SEQ ID NO:244) and the derived protein sequence for PR0871. The entire nucleotide sequence of UNQ438 (DNA50919-1361) is shown in Figure 88 (SEQ ID NO:244). Clone UNQ438 (DNA50919-1361) contains a single open reading frame with an apparent translational initiation site 20 at nucleotide positions 191-193 and ending at the stop codon at nucleotide positions 1607-1609 (Figure 88). The predicted polypeptide precursor is 472 amino acids long (Figure 89). The full-length PRO871 protein shown in Figure 89 has an estimated molecular weight of about 53,847 daltons and a pI of about 5.75. Analysis of the full length PR0871 sequence shown in Figure 89 (SEQ ID NO:245) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 21, potential N-glycosylation sites from about amino acid 109 25 to about amino acid 112 and from about amino acid 201 to about amino acid 204, a cyclophilin-type peptidy-prolyl cis-trans isomerase signature sequence from about amino acid 49 to about amino acid 66 and regions that are homologous to cyclophilin-type peptidy-prolyl cis-trans isomerases from about amino acid 96 to about amino acid 140, from about amino acid 49 to about amino acid 89 and from about amino acid 22 to about amino acid 51. Clone UNQ438 (DNA50919-1361) has been deposited with ATCC on May 6, 1998 and is assigned ATCC deposit no. 30 209848. Analysis of the amino acid sequence of the full-length PR0871 polypeptide suggests that it possesses significant sequence similarity to the cyclophilin family of proteins, thereby indicating that PR0871 may be a novel cyclophilin protein family member. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0871 amino acid sequence and the following Dayhoff sequences, 35 SPBC16H5_5, S64705, YAL5_SCHPO, CYP4_CAEEL, CELC34D4_7, CYPACAEEL, HUMORF006_1, CYPIMYCTU, AF043642 1 and HSSRCYP 1. EXAMPLE 41: Isolation of cDNA Clones Encoding Human PR0873 215 WO 99/46281 PCT/US99/05028 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA39621. Based on the DNA39621 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0873. A pair of PCR primers (forward and reverse) were synthesized: 5 forward PCR primer 5'-AGGTGCCTGCAGGAGTCCTGGGG-3' (SEQ ID NO:255) reverse PCR primer 5'- CCACCTCAGGAAGCCGAAGATGCC-3' (SEQ ID NO:256) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA39621 sequence which had the following nucleotide sequence: hybridization probe 10 5'-GAACGGTACAAGTGGCTGCGCTTrCAGCGAGGACTGTCTGTACCTG-3' (SEQ ID NO:257) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0873 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB229). 15 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0873 [herein designated as UNQ440 (DNA44179-1362)] (SEQ ID NO:253) and the derived protein sequence for PR0873. The entire nucleotide sequence of UNQ440 (DNA44179-1362) is shown in Figure 90 (SEQ ID NO:253). Clone UNQ440 (DNA44179-1362) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 139-141 and ending at the stop codon at nucleotide positions 1774-1776 (Figure 90). The 20 predicted polypeptide precursor is 545 amino acids long (Figure 91). The full-length PR0873 protein shown in Figure 91 has an estimated molecular weight of about 58,934 daltons and a pI of about 9.45. Analysis of the full length PR0873 sequence shown in Figure 91 (SEQ ID NO:254) evidences the presence of the following features: a signal peptide from about amino acid 1 to about amino acid 29; a carboxylesterase type-B serine active site at about amino acid 312 to about amino acid 327; a carboxylesterase type-B signature 2 motif at about amino acid 218 to about 25 amino acid 228; and three potential N-glycosylation sites at about amino acid 318 to about amino acid 321, about amino acid 380 to about amino acid 383, and about amino acid 465 to about amino acid 468. Clone UNQ440 (DNA44179-1362) has been deposited with ATCC on May 6, 1998 and is assigned ATCC deposit no. 209851. Analysis of the amino acid sequence of the full-length PR0873 polypeptide suggests that it possesses significant sequence similarity to a human liver carboxylesterase, thereby indicating that PR0873 may be a novel 30 carboxylesterase. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0873 amino acid sequence and the following Dayhoff sequences: ES 10_RAT, GEN12405, AB010633_1, EST4_RAT, A48809, SASBANAPL, RNU41662_1, RNU22952_1, BALRAT, GEN13522. 35 EXAMPLE 42: Isolation of cDNA Clones Encoding Human PR0940 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA47442. Based on the DNA47442 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO940. 216 WO 99/46281 PCT/US99/05028 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CAAAGCCTGCGCCTGGTCTGTG-3' (SEQ ID NO:260) reverse PCR primer 5'-TTCTGGAGCCCAGAGGGTGCTGAG-3' (SEQ ID NO:262) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA47442 sequence which had the following nucleotide sequence 5 hybridization probe 5'-GGAGCTGCCACCCATTCAAATGGAGCACGAAGGAGAGTTCACCTG-3' (SEQ ID NO:263) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0940 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 10 the cDNA libraries was isolated from human fetal liver tissue (LIB229). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0940 [herein designated as UNQ477 (DNA54002-1367)] (SEQ ID NO:258) and the derived protein sequence for PRO940. The entire nucleotide sequence of UNQ477 (DNA54002-1367) is shown in Figure 92 (SEQ ID NO:258). Clone UNQ477 (DNA54002-1367) contains a single open reading frame with an apparent translational initiation site 15 at nucleotide positions 46-48 and ending at the stop codon at nucleotide positions 1678-1680 (Figure 92). The predicted polypeptide precursor is 544 amino acids long (Figure 93). The full-length PR0940 protein shown in Figure 93 has an estimated molecular weight of about 60,268 daltons and a pI of about 9.53. Analysis of the full length PR0940 sequence shown in Figure 93 (SEQ ID NO:259) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 15, potential N-glycosylation sites from about amino acid 100 20 to about amino acid 103, from about amino acid 297 to about amino acid 300 and from about amino acid 306 to about amino acid 309 and an immunoglobulin and major histocompatibility complex signature sequence block from about amino acid 365 to about amino acid 371. Clone UNQ477 (DNA54002-1367) has been deposited with ATCC on April 7, 1998 and is assigned ATCC deposit no. 209754. Analysis of the amino acid sequence of the full-length PR0940 polypeptide suggests that it possesses 25 significant sequence similarity to CD33 and the OB binding protein-2. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0940 amino acid sequence and the following Dayhoff sequences, CD33_HUMAN, HSU71382_1, HSU71383_1, D86359_1, PGBM_HUMAN, MAGSMOUSE, D86983_1, C22BHUMAN, P_W01002 and HVU24116_1. 30 EXAMPLE 43: Isolation of cDNA Clones Encodin2 Human PR0941 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA35941. An EST sequence proprietary to Genentech was employed in the assembly and is herein designated DNA6415 (Figure 96; SEQ ID NO:265). Based on the DNA35941 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library 35 that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO941. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CTTGACTGTCTCTGAATCTGCACCC-3' (SEQ ID NO:266) reverse PCR primer 5'-AAGTGGTGGAAGCCTCCAGTGTGG-3' (SEQ ID NO:267) 217 WO 99/46281 PCTIUS99/05028 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35941 sequence which had the following nucleotide sequence hybridization probe 5'-CCACTACGGTATTAGAGCAAAAGTTAAAAACCATCATGGTTCCTGGAGCAGC-3' (SEQ ID NO:268) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 5 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0941 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0941 [herein designated as UNQ478 (DNA53906-1368)] (SEQ ID NO:263) and the derived protein sequence for PR0941. 10 The entire nucleotide sequence of UNQ478 (DNA53906-1368) is shown in Figure 94 (SEQ ID NO:263). Clone UNQ478 (DNA53906-1368) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 37-39 and ending at the stop codon at nucleotide positions 2353-2355 (Figure 94). The predicted polypeptide precursor is 772 amino acids long (Figure 95). The full-length PR0941 protein shown in Figure 95 has an estimated molecular weight of about 87,002 daltons and a pI of about 4.64. Analysis of the full 15 length PR0941 sequence shown in Figure 95 (SEQ ID NO:264) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 21, potential N-glycosylation sites from about amino acid 57 to about amino acid 60, from about amino acid 74 to about amino acid 77, from about amino acid 419 to about amino acid 422, from about amino acid 437 to about amino acid 440, from about amino acid 508 to about amino acid 511, from about amino acid 515 to about amino acid 518, from about amino acid 516 to about amino acid 519 and from 20 about amino acid 534 to about amino acid 537, and cadherin extracellular repeated domain signature sequences from about amino acid 136 to about amino acid 146 and from about amino acid 244 to about amino acid 254. Clone UNQ478 (DNA53906-1368) has been deposited with ATCC on April 7, 1998 and is assigned ATCC deposit no. 209747. Analysis of the amino acid sequence of the full-length PR0941 polypeptide suggests that it possesses 25 significant sequence similarity to a cadherin protein, thereby indicating that PR0941 may be a novel cadherin protein family member. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0941 amino acid sequence and the following Dayhoff sequences, 150180, CADACHICK, 150178, GEN12782, CADCHUMAN, PW25637, A38992, PR49731, D38992 and G02678. 30 EXAMPLE 44: Isolation of cDNA Clones Encoding Human PR0944 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA47374. A variety of proprietary Genentech EST sequences were employed in the assembly and are shown in Figures 99-107. Based on the DNA47374 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of 35 interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0944. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CGAGCGAGTCATGGCCAACGC-3' (SEQ ID NO:280) reverse PCR primer 5'-GTGTCACACGTAGTCTT7CCCGCTGG-3' (SEQ ID NO:281) 218 WO 99/46281 PCT/US99/05028 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA47374 sequence which had the following nucleotide sequence hybridization probe 5'-CTGCAGCTGTTGGGCTTCATTCTCGCCTTCCTGGGATGGATCG-3' (SEQ ID NO:282) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 5 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0944 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0944 [herein designated as UNQ481 (DNA52185-1370)] (SEQ ID NO:269) and the derived protein sequence for PR0944. 10 The entire nucleotide sequence of UNQ481 (DNA52185-1370) is shown in Figure 97 (SEQ ID NO:269). Clone UNQ481 (DNA52185-1370) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 219-221 and ending at the stop codon at nucleotide positions 852-854 (Figure 97). The predicted polypeptide precursor is 211 amino acids long (Figure 98). The full-length PR0944 protein shown in Figure 98 has an estimated molecular weight of about 22,744 daltons and a pI of about 8.51. Analysis of the full 15 length PR0944 sequence shown in Figure 98 (SEQ ID NO:270) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 21, transmembrane domains from about amino acid 82 to about amino acid 102, from about amino acid 118 to about amino acid 142 and from about amino acid 161 to about amino acid 187, a potential N-glycosylation site from about amino acid 72 to about amino acid 75, a sequence block having homology to PMP-22/EMP/MP20 family of proteins from about amino acid 70 to about amino acid 111 and a 20 sequence block having homology to ABC-2 type transport system integral membrane protein from about amino acid 119 to about amino acid 133. Clone UNQ481 (DNA52185-1370) has been deposited with ATCC on May 14, 1998 and is assigned ATCC deposit no. 209861. Analysis of the amino acid sequence of the full-length PR0944 polypeptide suggests that it possesses significant sequence similarity to the CPE-R protein, thereby indicating that PR0944 may be a novel CPE-R 25 homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PRO944 amino acid sequence and the following Dayhoff sequences, AB000713 1, AB000714_1, AF035814_1, AF000959_1, HSU89916_1, EMP2_HUMAN, JC5732, CELF53B3_6, PM22_MOUSE and CGU49797_1. 30 EXAMPLE 45: Isolation of cDNA Clones Encoding Human PR0983 A consensus sequence was obtained relative to a variety of EST sequences as described in Example I above, wherein the consensus sequence obtained is herein designated DNA47473. Various proprietary Genentech EST sequences were employed in the assembly, wherein those EST sequences are shown in Figures 110-116. Based on the DNA47473 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that 35 contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0983. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GCACCACCGTAGGTACTTGTGTGAGGC-3' (SEQ ID NO:292) reverse PCR primer 5'-AACCACCAGAGCCAAGAGCCGGG -3' (SEQ ID NO:293) 219 WO 99/46281 PCT/US99/05028 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA47473 sequence which had the following nucleotide sequence hybridization probe 5'-CAGCGGAATCATCGATGCAGGGGCCTCAATTAATGTATCTGTGATGTTAC-3' (SEQ ID NO:294) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 5 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0983 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human bone marrow (LIB256). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0983 [herein designated as UNQ484 (DNA53977-1371)] (SEQ ID NO:283) and the derived protein sequence for PR0983. 10 The entire nucleotide sequence of UNQ484 (DNA53977-1371) is shown in Figure 108 (SEQ ID NO:283). Clone UNQ484 (DNA53977-1371) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 234-236 and ending at the stop codon at nucleotide positions 963-965 (Figure 108). The predicted polypeptide precursor is 243 amino acids long (Figure 109). The full-length PR0983 protein shown in Figure 109 has an estimated molecular weight of about 27,228 daltons and a pl of about 7.43. Analysis of the full 15 length PR0983 sequence shown in Figure 109 (SEQ ID NO:284) evidences the presence of the following features: a putative transmembrane domain from about amino acid 224 to about amino acid 239; a potential N-glycosylation site from about amino acid 68 to about amino acid 71; and three potential N-myristoylation sites from about amino acid 59 to about amino acid 64, from about amino acid 64 to about amino acid 69, and from about amino acid 235 to about amino acid 240. Clone UNQ484 (DNA53977-1371) has been deposited with ATCC on May 14, 1998 and 20 is assigned ATCC deposit no. 209862. Analysis of the amino acid sequence of the full-length PR0983 polypeptide suggests that it possesses significant sequence similarity to the vesicle-associated protein, VAP-33, thereby indicating that PR0983 may be a novel vesicle associated membrane protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0983 amino acid sequence and the following Dayhoff 25 sequences: VP33_APLCA, CELF33D11_12, CELF42G2_2, S50623, YDFCSCHPO, CELF54H5_2, CELZC196_8, CEF57A10_3, MSP3_GLORO, CEC1511_1. EXAMPLE 46: Isolation of cDNA Clones Encoding Human PRO1057 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 30 wherein the consensus sequence obtained is herein designated DNA49808. Based on the DNA49808 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO1057. PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GCATCTGCAGGAGAGAGCGAAGGG-3' (SEQ ID NO:297) 35 reverse PCR primer 5'-CATCGTTCCCGTGAATCCAGAGGC-3' (SEQ ID NO:298) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA49808 sequence which had the following nucleotide sequence hybridization probe 5'-GAAGGGAGGCCTTCCTTTCAGTGGACCCGGGTCAAGAATACCCAC-3' (SEQ ID NO:299) 220 WO 99/46281 PCTIUS99/05028 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO1057 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1057 5 [herein designated as UNQ522 (DNA57253-1382)] (SEQ ID NO:295) and the derived protein sequence for PRO1057. The entire nucleotide sequence of UNQ522 (DNA57253-1382) is shown in Figure 117 (SEQ ID NO:295). Clone UNQ522 (DNA57253-1382) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 275-277 and ending at the stop codon at nucleotide positions 1514-1516 (Figure 117). The predicted polypeptide precursor is 413 amino acids long (Figure 118). The full-length PRO1057 protein shown in 10 Figure 118 has an estimated molecular weight of about 47,070 daltons and a p1 of about 9.92. Analysis of the full length PRO1057 sequence shown in Figure 118 (SEQ ID NO:296) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 16, potential N-glycosylation sites from about amino acid 90 to about amino acid 93, from about amino acid 110 to about amino acid 113 and from about amino acid 193 to about amino acid 196, a glycosaminoglycan attachment site from about amino acid 236 to about amino acid 239 and a seine 15 protease histidine-containing active site from about amino acid 165 to about amino acid 170. Clone UNQ522 (DNA57253-1382) has been deposited with ATCC on May 14, 1998 and is assigned ATCC deposit no. 209867. Analysis of the amino acid sequence of the full-length PRO1057 polypeptide suggests that it possesses significant sequence similarity to various protease proteins, thereby indicating that PRO1057 may be a novel protease. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology 20 between the PRO1057 amino acid sequence and the following Dayhoff sequences,TRYEDROER, P_R14159, A69660, EBN1_EBV, S65494, GEN12688, A51084_1, P_R99571, A57514 and AF003200_1. EXAMPLE 47: Isolation of cDNA Clones Encoding Human PRO1071 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 25 wherein the consensus sequence obtained is herein designated DNA53035. Based on the DNA53035 consensus sequence, it was determined that that consensus sequence shared significant sequence identity with Incyte EST clone no. 2872569, a clone that upon review appeared to encode a full length protein. As such, Incyte EST clone no. 2872569 was purchased and its insert was obtained and sequenced so as to confirm the proper sequence. This sequence is herein designated UNQ528 or DNA58847-1383. 30 DNA sequencing of the clone isolated as described above gave the full-length DNA sequence for PRO1071 [herein designated as UNQ528 (DNA58847-1383)] (SEQ ID NO:300) and the derived protein sequence for PRO1071. The entire nucleotide sequence of UNQ528 (DNA58847-1383) is shown in Figure 119 (SEQ ID NO:300). Clone UNQ528 (DNA58848-1383) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 133-135 and ending at the stop codon at nucleotide positions 1708-1710 (Figure 119). The 35 predicted polypeptide precursor is 525 amino acids long (Figure 120). The full-length PRO1071 protein shown in Figure 120 has an estimated molecular weight of about 58,416 daltons and a pl of about 6.62. Analysis of the full length PRO1071 sequence shown in Figure 120 (SEQ ID NO:301) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 25, a potential N-glycosylation site from about amino acid 251 to about amino acid 254, a thrombospondin-1 homology block from about amino acid 385 to about amino acid 399 221 WO 99/46281 PCT/US99/05028 and von Willibrands factor type C homology blocks from about amino acid 385 to about amino acid 399, from about amino acid 445 to about amino acid 459 and from about amino acid 42 to about amino acid 56. Clone UNQ528 (DNA58847-1383) has been deposited with ATCC on May 20, 1998 and is assigned ATCC deposit no. 209879. Analysis of the amino acid sequence of the full-length PRO1071 polypeptide suggests that it possesses significant sequence similarity to the thrombospondin protein, thereby indicating that PRO1071 may be a novel 5 thrombospondin homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PRO1071 amino acid sequence and the following Dayhoff sequences, AB002364 1, D67076_1, BTPCINPGN_1, CET13H10_1, CEF25H8_5, CEF53B6_2, CEC26C6_6, HSSEMG_1, CET21B6_4 and BTY08561_1. 10 EXAMPLE 48: Isolation of cDNA Clones Encoding Human PRO1072 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA53125. Based on the DNA53125 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO1072. 15 PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CCAGGAAATGCTCCAGGAAGAGCC-3' (SEQ ID NO:305) reverse PCR primer 5'-GCCCATGACACCAAATTGAAGAGTGG-3' (SEQ ID NO:306) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA53125 sequence which had the following nucleotide sequence 20 hybridization probe 5'-AACGCAGGGATCTTCCAGTGCCCTTACATGAAGACTGAAGATGGG-3' (SEQ ID NO:307) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO1072 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 25 the cDNA libraries was isolated from human fetal lung tissue (LIB26). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1072 [herein designated as UNQ529 (DNA58747-1384)] (SEQ ID NO:302) and the derived protein sequence for PRO1072. The entire nucleotide sequence of UNQ529 (DNA58747-1384) is shown in Figure 121 (SEQ ID NO:302). Clone UNQ529 (DNA58747-1384) contains a single open reading frame with an apparent translational initiation site 30 at nucleotide positions 65-67 and ending at the stop codon at nucleotide positions 1073-1075 (Figure 121). The predicted polypeptide precursor is 336 amino acids long (Figure 122). The full-length PRO1072 protein shown in Figure 122 has an estimated molecular weight of about 36,865 daltons and a pl of about 9.15. Analysis of the full length PRO1072 sequence shown in Figure 122 (SEQ ID NO:303) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 21, short-chain alcohol dehydrogenase protein homology blocks 35 from about amino acid 134 to about amino acid 144, from about amino acid 44 to about amino acid 56 and from about amino acid 239 to about amino acid 248 and potential N-glycosylation sites from about amino acid 212 to about amino acid 215 and from about amino acid 239 to about amino acid 242. Clone UNQ529 (DNA58747-1384) has been deposited with ATCC on May 14, 1998 and is assigned ATCC deposit no. 209868. 222 WO 99/46281 PCT/US99/05028 Analysis of the amino acid sequence of the full-length PRO1072 polypeptide suggests that it possesses significant sequence similarity to the reductase family of proteins, thereby indicating that PRO1072 may be a novel reductase. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PRO1072 amino acid sequence and the following Dayhoff sequences, P__W03198, P_W15759, P_R60800, MTVO37_3, CEC15H1l_6, ATAC00234314, MTV022_13, SCU43704_1, OXIRSTRAT AND 5 CELCO1G8_3. EXAMPLE 49: Isolation of cDNA Clones Encoding Human PRO1075 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA34363. Based on the DNA34363 sequence, 10 oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO1075. PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-TGAGAGGCCTCTCTGGAAGTTG-3' (SEQ ID NO:312) forward PCR primer 5'-GTCAGCGATCAGTGAAAGC-3' (SEQ ID NO:313) 15 forward PCR primer 5'-CCAGAATGAAGTAGCTCGGC-3' (SEQ ID NO:314) forward PCR primer 5'-CCGACTCAAAATGCATTGTC-3' (SEQ ID NO:315) forward PCR primer 5'-CATTTGGCAGGAATTGTCC-3' (SEQ ID NO:316) forward PCR primer 5'-GGTGCTATAGGCCAAGGG-3' (SEQ ID NO:317) reverse PCR primer 5'-CTGTATCTCTGGGCTATGTCAGAG-3' (SEQ ID NO:318) 20 reverse PCR primer 5'-CTACATATAATGGCACATGTCAGCC-3' (SEQ ID NO:319) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA34363 sequence which had the following nucleotide sequence hybridization probe 5'-CGTCTTCCTATCCTTACCCGACCTCAGATGCTCCCTTCTGCTCCTG-3' (SEQ ID NO:320) 25 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO1075 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human skin tumor tissue (LIB324). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1075 30 [herein designated as UNQ532 (DNA57689-1385)] (SEQ ID NO:308) and the derived protein sequence for PRO1075. The entire nucleotide sequence of UNQ532 (DNA57689-1385) is shown in Figure 124 (SEQ ID NO:308). Clone UNQ532 (DNA57689-1385) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 137-139 and ending at the stop codon at nucleotide positions 1355-1357 (Figure 124). The predicted polypeptide precursor is 406 amino acids long (Figure 125). The full-length PRO1075 protein shown in 35 Figure 125 has an estimated molecular weight of about 46,927 daltons and a pl of about 5.21. Analysis of the full length PRO1075 sequence shown in Figure 125 (SEQ ID NO:309) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 29, an endoplasmic reticulum targeting sequence from about amino acid 403 to about amino acid 406, a tyrosine kinase phosphorylation site from about amino acid 203 to about amino acid 211 and a sequence block having homology to the thioredoxin family of proteins from about amino acid 223 WO 99/46281 PCT/US99/05028 50 to about amino acid 66. Clone UNQ532 (DNA57689-1385) has been deposited with ATCC on May 14, 1998 and is assigned ATCC deposit no. 209869. Analysis of the amino acid sequence of the full-length PRO1075 polypeptide suggests that it possesses significant sequence similarity to protein disulfide isomerase, thereby indicating that PRO 1075 may be a novel protein disulfide isomerase. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced 5 significant homology between the PRO1075 amino acid sequence and the following Dayhoff sequences, CELC30H7_2, CELC06A6_3, CELF42G8_3, S57942, ER72_CAEEL, CELC07A12_3, CEH06001_4 and P_R51696. EXAMPLE 50: Isolation of cDNA Clones Encoding Human PRO181 10 A cDNA sequence isolated in the amylase screen described in Example 2 above was found, by BLAST and FastA sequence alignment, to have sequence homology to a nucleotide sequence encoding the cornichon protein. This cDNA sequence is herein designated DNA13242 (Figure 130; SEQ ID NO:323). Based on the sequence homology, oligonucleotide probes were generated from the sequence of the DNA13242 molecule and used to screen a human placenta (LIB89) library prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B 15 (pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)), and the cDNA size cut was less than 2800 bp. The oligonucleotide probes employed included: forward PCR primer 5'-GTGCAGCAGAGTGGCTTACA-3' (SEQ ID NO:326) reverse PCR primer 5'-ACTGGACCAATTCTTCTGTG-3' (SEQ ID NO:327) 20 hybridization probe 5'-GATATTCTAGCATATTGTCAGAAGGAAGGATGGTGCAAATTAGCT-3' (SEQ ID NO:328) A full length clone was identified that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 14-16 and ending at the stop codon found at nucleotide positions 446-448 (Figure 128; SEQ ID NO:321). The predicted polypeptide precursor is 144 amino acids long, has a calculated molecular 25 weight of approximately 16,699 daltons and an estimated pI of approximately 5.6. Analysis of the full-length PRO1 81 sequence shown in Figure 129 (SEQ ID NO:322) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20, a putative type II transmembrane domain from about amino acid 11 to about amino acid 31 and other transmembrane domains from about amino acid 57 to about amino acid 77 and from about amino acid 123 to about amino acid 143. Clone UNQ155 (DNA23330-1390) has been deposited with ATCC on April 30 14, 1998 and is assigned ATCC deposit no. 209775. Analysis of the amino acid sequence of the full-length PRO181 polypeptide suggests that it possesses significant sequence similarity to the cornichon protein, thereby indicating that PRO 181 may be a novel cornichon homolog. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PRO181 amino acid sequence and the following Dayhoff sequences, AF022811_1, 35 CETO9E8_3, S64058, YGF4_YEAST, YB60_YEAST, EBU89455_1, SIU36383_3 and PH1371. EXAMPLE 51: Isolation of cDNA Clones Encoding Human PRO 195 A cDNA sequence was isolated in the amylase screen described in Example 2 above and is herein designated DNA13199 (Figure 134; SEQ ID NO:332). The DNA13199 sequence was then compared to a variety 224 WO 99/46281 PCT/US99/05028 of expressed sequence tag (EST) databases which included public EST databases (e.g., GenBank) to identify existing homologies. The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266:460-480 (1996)). Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington; 5 http://bozeman.mbt.washington.edu/phrap.docs/phrap.html). The consensus sequence obtained therefrom is herein designated as DNA22778. Based on the DNA22778 sequence, oligonucleotide probes were generated and used to screen a human placenta library (LIB89) prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 10 (1991)), and the cDNA size cut was less than 2800 bp. PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-ACAAGCTGAGCTGCTGTGACAG-3' (SEQ ID NO:333) reverse PCR primer 5'-TGATTCTGGCAACCAAGATGGC-3' (SEQ ID NO:334) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA22778 sequence which 15 had the following nucleotide sequence hybridization probe 5'-ATGGCCTTGGCCGGAGGTTCGGGGACCGCTTCGGCTGAAG-3' (SEQ ID NO:335) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones 20 encoding the PRO195 gene using the probe oligonucleotide and one of the PCR primers. A full length clone was identified that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 70-72 and ending at the stop codon found at nucleotide positions 1039-1041 (Figure 132; SEQ ID NO:330). The predicted polypeptide precursor is 323 amino acids long, has a calculated molecular weight of approximately 36,223 daltons and an estimated pl of approximately 5.06. Analysis of the full 25 length PRO195 sequence shown in Figure 132 (SEQ ID NO:330) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 31, a transmembrane domain from about amino acid 241 to about amino acid 260 and a potential N-glycosylation site from about amino acid 90 to about amino acid 93. Clone UNQ169 (DNA26847-1395) has been deposited with ATCC on April 14, 1998 and is assigned ATCC deposit no. 209772. 30 Analysis of the amino acid sequence of the full-length PRO195 polypeptide suggests that it possesses no significant sequence similarity to any known protein. However, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced some degree of homology between the PRO195 amino acid sequence and the following Dayhoff sequences, P_P91380, AF035118_1, HUMTROPCS_1, NUODSALTY and E70002. 35 EXAMPLE 52: Isolation of cDNA Clones Encoding Human PRO865 A cDNA sequence isolated in the amylase screen described in Example 2 above was herein designated DNA37642 (Figure 137, SEQ ID NO:338). The DNA37642 sequence was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQV, Incyte Pharmaceuticals, Palo Alto, CA) to identify homologies therebetween. The homology 225 WO 99/46281 PCT/US99/05028 search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266:460-480 (1996)). Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington; http://bozeman.mbt.washington.edu/phrap.docs/phrap.html). The consensus sequence obtained is herein designated 5 DNA48615. Based on the DNA48615 consensus sequence, probes were generated and used to screen a human fetal kidney (LIB227) library prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the SfI site; see, Holmes et al., Science, 253:1278-1280 (1991)), and the cDNA size cut was less than 2800 bp. 10 PCR primers (forward and reverse) were synthesized: forward PCR primer 1 5'-AAGCTGCCGGAGCTGCAATG-3' (SEQ ID NO:339) forward PCR primer 2 5'-TTGCTTCTTAATCCTGAGCGC-3' (SEQ ID NO:340) forward PCR primer 3 5'-AAAGGAGGACTTTCGACTGC-3' (SEQ ID NO:341) reverse PCR primer 1 5'-AGAGATTCATCCACTGCTCCAAGTCG-3' (SEQ ID NO:342) 15 reverse PCR primer 2 5'-TGTCCAGAAACAGGCACATATCAGC-3' (SEQ ID NO:343) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA48615 sequence which had the following nucleotide sequence hybridization probe 5'-AGACAGCGGCACAGAGGTGCTFCTGCCAGGTTAGTGGTTACTTGGATGAT-3' (SEQ ID NO:344) 20 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0865 gene using the probe oligonucleotide and one of the PCR primers. A full length clone was identified that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 173-175 and ending at the stop codon found at nucleotide positions 1577-1579 25 (Figure 135; SEQ ID NO:336). The predicted polypeptide precursor is 468 amino acids long, has a calculated molecular weight of approximately 54,393 daltons and an estimated pI of approximately 5.63. Analysis of the full length PR0865 sequence shown in Figure 136 (SEQ ID NO:337) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 23, potential N-glycosylation sites from about amino acid 280 to about amino acid 283 and from about amino acid 384 to about amino acid 387, a potential amidation site from 30 about amino acid 94 to about amino acid 97, glycosaminoglycan attachment sites from about amino acid 20 to about amino acid 23 and from about amino acid 223 to about amino acid 226, an aminotransferase class-V pyridoxyl phosphate amino acid sequence block from about amino acid 216 to about amino acid 222 and an amino acid sequence block similar to that found in the interleukin-7 protein from about amino acid 338 to about amino acid 343. Clone UNQ434 (DNA53974-1401) has been deposited with ATCC on April 14, 1998 and is assigned ATCC deposit no. 35 209774. Analysis of the amino acid sequence of the full-length PR0865 polypeptide suggests that it possesses no significant sequence similarity to any known protein. However, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced some degree of homology between the PR0865 amino acid sequence and the following Dayhoff sequences, YMNOYEAST, ATFCA4_43, S44168, PW14549 and RABTCRG4_1. 226 WO 99/46281 PCT/US99/05028 EXAMPLE 53: Isolation of cDNA Clones Encoding Human PR0827 A cDNA sequence isolated in the amylase screen described in Example 2 above was found, by BLAST and FastA sequence alignment, to have sequence homology to nucleotide sequences encoding various integrin proteins. This cDNA sequence is herein designated DNA47751 (see Figure 140; SEQ ID NO:347). Based on the sequence homology, probes were generated from the sequence of the DNA47751 molecule and used to screen a human fetal 5 pigment epithelium library (LIB1 13) prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)), and the cDNA size cut was less than 2800 bp. PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-AGGGACAGAGGCCAGAGGACTTC-3' (SEQ ID NO:348) 10 reverse PCR primer 5'-CAGGTGCATATTCACAGCAGGATG-3' (SEQ ID NO:349) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA47751 sequence which had the following nucleotide sequence hybridization probe 5'-GGAACTCCCCTTCGTCACTCACCTGTTCTTGCCCCTGGTGTTCCT-3'(SEQ ID 15 NO:350) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0827 gene using the probe oligonucleotide and one of the PCR primers. A full length clone was identified that contained a single open reading frame with an apparent translational 20 initiation site at nucleotide positions 134-136 and ending at the stop codon found at nucleotide positions 506-508 (Figure 138; SEQ ID NO:345). The predicted polypeptide precursor is 124 amino acids long, has a calculated molecular weight of approximately 13,352 daltons and an estimated pl of approximately 5.99. Analysis of the full length PR0827 sequence shown in Figure 139 (SEQ ID NO:346) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 22, a cell attachment sequence from about amino acid 70 to 25 about amino acid 72, a potential N-glycosylation site from about amino acid 98 to about amino acid 101 and an integrin alpha chain protein homology sequence from about amino acid 67 to about amino acid 81. Clone UNQ468 (DNA57039-1402) has been deposited with ATCC on April 14, 1998 and is assigned ATCC deposit no. 209777. Analysis of the amino acid sequence of the full-length PR0827 polypeptide suggests that it possesses significant sequence similarity to the VLA-2 integrin protein and various other integrin proteins, thereby indicating 30 that PR0827 may be a novel integrin or splice variant thereof. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0240 amino acid sequence and the following Dayhoff sequences, S44142, ITA2_HUMAN, ITAlRAT, ITAlHUMAN, ITA4_HUMAN, ITA9_HUMAN, AF032108_1, ITAMMOUSE, ITA8_CHICK and ITA6_CHICK. 35 EXAMPLE 54: Isolation of cDNA Clones Encoding Human PRO1 114 A cDNA sequence isolated in the amylase screen described in Example 2 was found, by the WU-BLAST2 sequence alignment computer program, to have certain sequence identity to other known interferon receptors. This cDNA sequence is herein designated DNA48466 (Figure 143; SEQ ID NO:352). Based on the sequence identity, probes were generated from the sequence of the DNA48466 molecule and used to screen a human breast carconoma 227 WO 99/46281 PCT/US99/05028 library (LIB135) prepared as described in paragraph I of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)), and the cDNA size cut was less than 2800 bp. The oligonucleotide probes employed were as follows: forward PCR primer 5'-AGGCTTCGCTGCGACTAGACCTC-3' (SEQ ID NO:354) 5 reverse PCR primer 5'-CCAGGTCGGGTAAGGATGGTTGAG-3' (SEQ ID NO:355) hybridization probe 5'-TTTCTACGCATTGATTCCATGTTTGCTCACAGATGAAGTGGCCATTCTGC-3' (SEQ ID NO:356) A full length clone was identified that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 250-252, and a stop signal at nucleotide positions 1183-1185 (Figure 141, SEQ 10 ID NO:351). The predicted polypeptide precursor is 311 amino acids long, has a calculated molecular weight of approximately 35,076 daltons and an estimated pI of approximately 5.04. Analysis of the full-length PRO 1114 interferon receptor sequence shown in Figure 142 (SEQ ID NO:352) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 29, a transmembrane domain from about amino acid 230 to about amino acid 255, potential N-glycosylation sites from about amino acid 40 to about amino acid 43 and from 15 about amino acid 134 to about amino acid 137, an amino acid sequence block having homology to tissue factor proteins from about amino acid 92 to about amino acid 119 and an amino acid sequence block having homology to integrin alpha chain proteins from about amino acid 232 to about amino acid 262. Clone UNQ557 (DNA57033-1403) has been deposited with ATCC on May 27, 1998 and is assigned ATCC deposit no. 209905. An analysis of the Dayhoff database (version 35.45 SwissProt 35), using a WU-BLAST2 sequence aligmnent 20 analysis of the full-length sequence shown in Figure 142 (SEQ ID NO:352), evidenced significant homology between the PRO1114 interferon receptor amino acid sequence and the following Dayhoff sequences: G01418, INRIMOUSE, P_R71035, INGSHUMAN, A26595_1, A26593_1, 156215 and TFHUMAN. EXAMPLE 55: Isolation of cDNA Clones Encoding Human PR0237 25 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA30905. Based on the DNA30905 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0237. PCR primers (forward and reverse) were synthesized: 30 forward PCR primer 5'-TCTGCTGAGGTGCAGCTCATTCAC-3' (SEQ ID NO:359) reverse PCR primer 5'-GAGGCTCTGGAAGATCTGAGATGG-3' (SEQ ID NO:360) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30905 sequence which had the following nucleotide sequence hybridization probe 35 5'-GCCTCTTTGTCAACGTTGCCAGTACCTCTAACCCATTCCTCAGTCGCCTC-3' (SEQ ID NO:361) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0237 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB153). 228 WO 99/46281 PCT/US99/05028 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0237 [herein designated as UNQ211 (DNA34353-1428)] (SEQ ID NO:357) and the derived protein sequence for PR0237. The entire nucleotide sequence of UNQ211 (DNA34353-1428) is shown in Figure 144 (SEQ ID NO:357). Clone UNQ211 (DNA34353-1428) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 586-588 and ending at the stop codon at nucleotide positions 1570-1572 (Figure 144). The 5 predicted polypeptide precursor is 328 amino acids long (Figure 145). The full-length PR0237 protein shown in Figure 145 has an estimated molecular weight of about 36,238 daltons and a pl of about 9.90. Analysis of the full length PR0237 sequence shown in Figure 145 (SEQ ID NO:358) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 23, a transmembrane domain from about amino acid 177 to about amino acid 199, potential N-glycosylation sites from about amino acid 118 to about amino acid 121, from about 10 amino acid 170 to about amino acid 173 and from about amino acid 260 to about amino acid 263 and eukaryotic-type carbonic anhydrase sequence homology blocks from about amino acid 222 to about amino acid 270, from about amino acid 128 to about amino acid 164 and from about amino acid 45 to about amino acid 92. Clone UNQ211 (DNA34353-1428) has been deposited with ATCC on May 12, 1998 and is assigned ATCC deposit no. 209855. Analysis of the amino acid sequence of the full-length PR0237 polypeptide suggests that it possesses 15 significant sequence similarity to the carbonic anhydrase protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0237 amino acid sequence and the following Dayhoff sequences, AF050106_1, OACALP_1, CELD1022_8, CAH2_HUMAN, 1CAC, CAH5_HUMAN, CAHPHUMAN, CAH3_HUMAN, CAH1_HUMAN and 2CAB. 20 EXAMPLE 56: Isolation of cDNA Clones Encodin2 Human PR0541 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA42259. Based on the DNA42259 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO541. 25 PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GGACAGAATTTGGGAGCACACTGG-3' (SEQ ID NO:364) forward PCR primer 5'-CCAAGAGTATACTGTCCTCG-3' (SEQ ID NO:365) reverse PCR primer 5'-AGCACAGATTICTCTACAGCCCCC-3' (SEQ ID NO:366) reverse PCR primer 5'-AACCACTCCAGCATGTACTGCTGC-3' (SEQ ID NO:367) 30 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA42259 sequence which had the following nucleotide sequence hybridization probe 5'-CCATTCAGGTGTTCTGGCCCTGTATGTACACATTATACACAGGTCGTGTG-3' (SEQ ID NO:368) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 35 by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0541 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0541 [herein designated as UNQ342 (DNA45417-1432)] (SEQ ID NO:362) and the derived protein sequence for PRO541. 229 WO 99/46281 PCT/US99/05028 The entire nucleotide sequence of UNQ342 (DNA45417-1432) is shown in Figure 146 (SEQ ID NO:362). Clone UNQ342 (DNA45417-1432) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 469-471 and ending at the stop codon at nucleotide positions 1969-1971 (Figure 146). The predicted polypeptide precursor is 500 amino acids long (Figure 147). The full-length PR0541 protein shown in Figure 147 has an estimated molecular weight of about 56,888 daltons and a pI of about 8.53. Analysis of the full 5 length PR0541 sequence shown in Figure 147 (SEQ ID NO:363) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20, amino acid sequence blocks having homology to extracellular proteins SCP/Tpx-1/Ag5/PR-1/Sc7 from about amino acid 165 to about amino acid 186, from about amino acid 196 to about amino acid 218, from about amino acid 134 to about amino acid 146, from about amino acid 96 to about amino acid 108 and from about amino acid 58 to about amino acid 77 and a potential N-glycosylation site 10 from about amino acid 28 to about amino acid 31. Clone UNQ342 (DNA45417-1432) has been deposited with ATCC on May 27, 1998 and is assigned ATCC deposit no. 209910. Analysis of the amino acid sequence of the full-length PR0541 polypeptide suggests that it possesses significant sequence similarity to a trypsin inhibitor protein, thereby indicating that PR0541 may be a novel trypsin inhibitor. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant 15 homology between the PR0541 amino acid sequence and the following Dayhoff sequences, D45027_1, AB009609_1, JC5308, CRS3_HORSE, TPX1_HUMAN, HELOHELHO, GEN14351, A28112_1, CETO5A1O4 and PW11485. EXAMPLE 57: Isolation of cDNA Clones Encodine Human PR0273 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 20 wherein the consensus sequence obtained is herein designated DNA36465. Based on the DNA36465 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0273. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CAGCGCCCTCCCCATGTCCCTG-3' (SEQ ID NO:371) 25 reverse PCR primer 5'-TCCCAACTGGTTTGGAGTTCCC-3' (SEQ ID NO:372) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA36465 sequence which had the following nucleotide sequence hybridization probe 5'-CTCCGGTCAGCATGAGGCTCCTGGCGGCCGCTGCTCCTGCTGCTG-3' (SEQ ID NO:373) 30 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO273 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0273 35 [herein designated as UNQ240 (DNA39523-1192)] (SEQ ID NO:369) and the derived protein sequence for PR0273. The entire nucleotide sequence of UNQ240 (DNA39523-1192) is shown in Figure 148 (SEQ ID NO:369). Clone UNQ240 (DNA39523-1192) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 167-169 and ending at the stop codon at nucleotide positions 500-502 (Figure 148). The predicted polypeptide precursor is 111 amino acids long (Figure 149). Clone UNQ240 (DNA39523-1192) has been 230 WO 99/46281 PCT/US99/05028 deposited with the ATCC. It is understood that the deposited clone contains the actual sequence and that the sequences provided herein are merely representative based on current sequencing techniques. Moreover, given the sequences provided herein and knowledge of the universal genetic code, the corresponding nucleotides for any given amino acid can be routinely identified and vice versa. Analysis of the amino acid sequence of the full-length PR0273 polypeptide suggests that portions of it 5 possess sequence identity with human macrophage inflammatory protein-2, cytokine-induced neutrophil chemoattractant 2, and neutrophil chemotactic factor 2-beta, thereby indicating that PR0273 is a novel chemokine. As discussed further below, the cDNA was subcloned into a baculovirus vector and expressed in insect cells as a C-terminally tagged IgG fusion protein. N-terminal sequencing of the resultant protein identified the signal sequence cleavage site, yielding a mature polypeptide of 77 amino acids. The mature sequence, showing 31-40% 10 identity to other human CXC chemokines, includes the four canonical cysteine residues but lacks the ELR motif. Northern analysis demonstrates expression at least in the small intestine, colon, spleen, lymph node and kidney. By in situ hybridization, also described in detail below, mRNA is localized to the lamina propria of intestinal villi and to renal tubules. 15 EXAMPLE 58: Isolation of cDNA Clones Encodin2 Human PR0701 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA39848. Based on the DNA39848 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO701. 20 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GGCAAGCTACGGAAACGTCATCGTG-3' (SEQ ID NO:376) reverse PCR primer 5'-AACCCCCGAGCCAAAAGATGGTCAC-3' (SEQ ID NO:377) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA39848 sequence which had the following nucleotide sequence: 25 hybridization probe 5'-GTACCGGTGACCAGGCAGCAAAAGGCAACTATGGGCTCCTGGATCAG-3' (SEQ ID NO:378). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO701 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 30 the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0701 [herein designated as UNQ365 (DNA44205-1285)] (SEQ ID NO:374) and the derived protein sequence for PRO701. The entire nucleotide sequence of UNQ365 (DNA44205-1285) is shown in Figure 150 (SEQ ID NO:374). Clone UNQ365 (DNA44205-1285) contains a single open reading frame with an apparent translational initiation site 35 at nucleotide positions 50-52 and ending at the stop codon at nucleotide positions 2498-3000 (Figure 150). The predicted polypeptide precursor is 816 amino acids long (Figure 151). The full-length PRO701 protein shown in Figure 151 has an estimated molecular weight of about 91,794 daltons, a pl of about 5.88 and NX(S/T) being 4. Clone UNQ365 (DNA44205-1285) has been deposited with the ATCC on March 31, 1998. It is understood that the clone was the correct and actual sequence, wherein the sequences provided herein are representative based on 231 WO 99/46281 PCTIUS99/05028 sequencing techniques. Still regarding the amino acid sequence shown in Figure 151, there is a potential signal peptide cleavage site at about amino acid 25. There are potential N-glycosylation sites at about amino acid positions 83, 511, 716 and 803. The carboxylesterases type-B signature 2 sequence is at about residues 125 to 135. Regions homologous with carboxylesterase type-B are also at about residues 54-74, 197-212 and 221-261. A potential transmembrane region 5 corresponds approximately to amino acids 671 through about 700. The corresponding nucleic acids can be routinely determined from the sequences provided herein. Analysis of the amino acid sequence of the full-length PRO701 polypeptide suggests that it possess significant homology to the neuroligins from rattus norvegicus indicating that PRO701 may be a novel human neuroligin. 10 EXAMPLE 59: Isolation of cDNA Clones Encodin2 Human PR0704 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA43033. Based on the DNA43033 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of 15 interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0704. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CCTTGGGTCGTGGCAGCAGTGG-3' (SEQ ID NO:381); reverse PCR primer 5'-CACTCTCCAGGCTGCATGCTCAGG-3' (SEQ ID NO:382). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA43033 consensus 20 sequence which had the following nucleotide sequence: hybridization probe 5'-GTCAAACGTTCGAGTACTTGAAACGGGAGCACTCGCTGTCGAAGC-3' (SEQ ID NO:383). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones 25 encoding the PR0704 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0704 [herein designated as UNQ368 (DNA50911-1288)] (SEQ ID NO:379) and the derived protein sequence for PR0704. The entire nucleotide sequence of UNQ368 (DNA50911-1288) is shown in Figure 152 (SEQ ID NO:379). 30 Clone UNQ368 (DNA50911-1288) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 8-10 and ending at the stop codon at nucleotide positions 1052-1054 (Figure 152). The predicted polypeptide precursor is 348 amino acids long (Figure 153). The full-length PR0704 protein shown in Figure 153 has an estimated molecular weight of about 39,711 and a pI of about 8.7. Clone UNQ368 (DNA5091 1 1288) has been deposited with the ATCC on March 31, 1998. Regarding the sequence, it is understood that the 35 deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PR0704 polypeptide suggests that portions of it possess significant homology to the vesicular integral membrane protein 36, thereby indicating that PR0704 may be a novel vesicular integral membrane protein. 232 WO 99/46281 PCT/US99/05028 Still analyzing the amino acid sequence of SEQ ID NO:380, the putative signal peptide is at about amino acids 1-39 of SEQ ID NO:380. The transmembrane domain is at amino acids 310-335 of SEQ ID NO:380. A potential N-glycosylation site is at about amino acids 180-183 of SEQ ID NO:380. The corresponding nucleotides can be routinely determined given the sequences provided herein. 5 EXAMPLE 60: Isolation of cDNA Clones Encoding Human PR0706 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA40669. Based on the DNA40669 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0706. 10 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CCAAGCAGCTTAGAGCTCCAGACC-3' (SEQ ID NO:386) reverse PCR primer 5'-TTCCCTATGCTCTGTATTGGCATGG-3' (SEQ ID NO:387) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA40669 sequence which had the following nucleotide sequence 15 hybridization probe 5'-GCCACTTCTGCCACAATGTCAGCTTTCCCTGTACCAGAAATGGCTGTGTT-3' (SEQ ID NO:388) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones 20 encoding the PR0706 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB153). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0706 [herein designated as UNQ370 (DNA48329-1290)] (SEQ ID NO:384) and the derived protein sequence for PR0706. It is understood that the deposited clone contains the actual sequence, and that the sequences provided herein are 25 representative based on current sequencing techniques. The entire nucleotide sequence of UNQ370 (DNA48329-1290) is shown in Figure 154 (SEQ ID NO:384). Clone UNQ370 (DNA48329-1290) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 279-281 and ending at the stop codon at nucleotide positions 1719-1721 (Figure 154). The predicted polypeptide precursor is 480 amino acids long (Figure 155). The full-length PR0706 protein shown in 30 Figure 155 has an estimated molecular weight of about 55,239 daltons and a pI of about 9.30. Clone UNQ370 (DNA48329-1290) has been deposited with the ATCC on April 21, 1998. Still regarding the amino acid sequence shown in Figure 155, there is a potential signal peptide cleavage site at about amino acid 19. There are potential N-glycosylation sites at about amino acid positions 305 and 354. There is a potential tyrosine kinase phosphorylation site at about amino acid position 333. A region homologous with 35 histidine acid phosphatase is at about residues 87-102. The corresponding nucleic acid regions can be routinely determined given the provided sequences, i.e., the codons can be determined from the specifically named amino acids given. Analysis of the amino acid sequence of the full-length PR0706 polypeptide suggests that portions of it possess significant homology to the human prostatic acid phosphatase precursor thereby indicating that PR0706 may 233 WO 99/46281 PCTIUS99/05028 be a novel human prostatic acid phosphatase. EXAMPLE 61: Isolation of cDNA Clones Encoding Human PR0707 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA42775. Based on DNA42775, oligonucleotides 5 were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0707. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-TCCGTCTCTGTGAACCGCCCCAC-3' (SEQ ID NO:391); reverse PCR primer 5'-CTCGGGCGCATTGTCGTTCTGGTC-3' (SEQ ID NO:392). 10 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA42775 sequence which had the following nucleotide sequence: hybridization probe 5'-CCGACTGTGAAAGAGAACGCCCCAGATCCACTTATTCCCC-3' (SEQ ID NO:393). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 15 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0707 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0707 [herein designated as UNQ371 (DNA48306-1291)] (SEQ ID NO:389) and the derived protein sequence for PR0707. 20 The entire nucleotide sequence of UNQ371 (DNA48306-1291) is shown in Figure 156 (SEQ ID NO:389). Clone UNQ371 (DNA48306-1291) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 371-373 and ending at the stop codon at nucleotide positions 3119-3121 of SEQ ID NO:389. The predicted polypeptide precursor is 916 amino acids long (Figure 157). The full-length PR0707 protein shown 25 in Figure 157 has an estimated molecular weight of about 100,204 daltons and a pl of about 4.92. Clone UNQ371 (DNA48306-1291) has been deposited with ATCC on May 27, 1998. It is understood that the clone UNQ371 which is deposited is that which encodes PR0707, and that the sequences herein are merely representations based on known sequencing techniques which may be subject to minor errors. Regarding analysis of the amino acid sequence, the signal sequence appears to be at about 1 through 30 of 30 SEQ ID NO:390. Cadherins extracellular repeated domain signature sequence is at about amino acids 121-131, 230 240, 335-345, 440-450, and 550-560 of SEQ ID NO:390. Tyrosine kinase phosphorylation sites are at about amino acids 124-132 and 580-586 of SEQ ID NO:390. A potential transmembrane domain is at about amino acids 682-715 ± 5. The nucleic acid positions can be derived by referring to the corresponding codon for the named amino acid. 35 Analysis of the amino acid sequence of the full-length PR0707 polypeptide suggests that portions of it possess significant homology to the cadherin FIB3 protein, expressed in human fibroblasts, thereby indicating that PR0707 may be a novel cadherin. 234 WO 99/46281 PCTIUS99/05028 EXAMPLE 62: Isolation of cDNA Clones Encoding Human PR0322 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA48336. Based on the DNA48336 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0322. 5 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CAGCCTACAGAATAAAGATGGCCC-3' (SEQ ID NO:396) reverse PCR primer 5'-GGTGCAATGATCTGCCAGGCTGAT-3' (SEQ ID NO:397) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA48336 consensus sequence which had the following nucleotide sequence: 10 hybridization probe 5'-AGAAATACCTGTGGTTCAGTCCATCCCAAACCCCTGCTACAACAGCAG-3' (SEQ ID NO:398). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0322 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 15 the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0322 [herein designated as UNQ283 (DNA48336-1309)] (SEQ ID NO:394) and the derived protein sequence for PR0322. It is understood that UNQ283 (DNA48336-1309) in fact encodes PR0322, and that SEQ ID NO:394 is a representation of the sequence based on sequencing techniques known in the art. 20 The entire nucleotide sequence of UNQ283 (DNA48336-1309) is shown in Figure 158 (SEQ ID NO:394). Clone UNQ283 (DNA48336-1309) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 166-168 and ending at the stop codon at nucleotide positions 946-948 (Figure 158). The predicted polypeptide precursor is 260 amino acids long (Figure 159). The full-length PR0322 protein shown in Figure 159 has an estimated molecular weight of about 28,028 daltons and a pI of about 7.87. Clone UNQ283 25 (DNA48336-1309) has been deposited with ATCC and is assigned ATCC deposit no. 209669. Regarding the amino acid sequence of Figure 159, a potential N-glycosylation site is at amino acid 110 of SEQ ID NO:395. The serine proteases, trypsin family and histidine active site is identified at amino acids 69 through 74 of SEQ ID NO:395 and the consensus sequence is identified at amino acids 207 through 217 of SEQ ID NO:395. The kringle domain proteins motif is identified at amino acids 205 through 217 of SEQ ID NO:395. The putative 30 signal peptide is encoded at about amino acids 1-23. Analysis of the amino acid sequence of the full-length PR0322 polypeptide suggests that portions of it possess significant homology to neuropsin and other serine proteases, thereby indicating that PR0322 is a novel seine protease related to neuropsin. 35 EXAMPLE 63: Isolation of cDNA Clones Encoding Human PRO526 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA39626. Based on the DNA39626 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0526. 235 WO 99/46281 PCT/US99/05028 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-TGGCTGCCCTGCAGTACCTCTACC-3' (SEQ ID NO:401); reverse PCR primer 5'-CCCTGCAGGTCATTGGCAGCTAGG-3' (SEQ ID NO:402). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA39626 consensus sequence which had the following nucleotide sequence: 5 hybridization probe 5'-AGGCACTGCCTGATGACACCTTCCGCGACCTGGGCAACCTCACAC-3' (SEQ ID NO:403). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0526 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 10 the cDNA libraries was isolated from human fetal liver tissue (LIB228). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0526 [herein designated as UNQ330 (DNA44184-1319)] (SEQ ID NO:399) and the derived protein sequence for PR0526. The entire nucleotide sequence of UNQ330 (DNA44184-1319) is shown in Figure 160 (SEQ ID NO:399). Clone UNQ330 (DNA44184-1319) contains a single open reading frame with an apparent translational initiation site 15 at nucleotide positions 514-516 and ending at the stop codon at nucleotide positions 1933-1935 (Figure 160). The predicted polypeptide precursor is 473 amino acids long (Figure 161). The full-length PR0526 protein shown in Figure 161 has an estimated molecular weight of about 50,708 daltons and a pl of about 9.28. Clone UNQ330 (DNA44184-1319) has been deposited with the ATCC on March 26, 1998. It is understood that the clone contains the actual sequence, whereas the sequences presented herein are representative based on current sequencing 20 techniques. Analysis of the amino acid sequence of the full-length PR0526 polypeptide suggests that portions of it possess significant homology to the leucine repeat rich proteins including ALS, SLIT, carboxypeptidase and platelet glycoprotein V thereby indicating that PR0526 is a novel protein which is involved in protein-protein interactions. Still analyzing SEQ ID NO:400, the signal peptide sequence is at about amino acids 1-26. A leucine zipper 25 pattern is at about amino acids 135-156. A glycosaminoglycan attachment is at about amino acids 436-439. N glycosylation sites are at about amino acids 82-85, 179-182, 237-240 and 423-426. A von Willebrand factor (VWF) type C domain(s) is found at about amino acids 411-425. The skilled artisan can understand which nucleotides correspond to these amino acids based on the sequences provided herein. 30 EXAMPLE 64: Isolation of cDNA Clones Encoding Human PRO531 An ECD database was searched and an expressed sequence tag (EST) from LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA was identified which showed homology to protocadherin 3. Based on this sequence, a search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 2A:460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. 35 Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington; http://bozeman.mbt.washington.edu/phrap.docs/phrap.html). A consensus DNA sequence was assembled relative to other EST sequences using phrap. Based on the consensus sequence obtained, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained 236 WO 99/46281 PCT/US99/05028 the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR053 1. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CTGAGAACGCGCCTGAAACTGTG-3' (SEQ ID NO:406); reverse PCR primer 5'-AGCGTTGTCATTGACATCGGCG-3' (SEQ ID NO:407). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA sequence 5 which had the following nucleotide sequence: hybridization probe 5'-TTAGTTGCTCCAT'CAGGAGGATCTACCCTTCCTCCTGAAATCCGCGGAA-3' (SEQ ID NO:408). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones 10 encoding the PR0531 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB153). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, linked with blunt to Sall hemikinased adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, and cloned in a defined 15 orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique XhoI and NotI sites. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PROS31 [herein designated as UNQ332 (DNA48314-1320)] (SEQ ID NO:404) and the derived protein sequence for PR053 1. The entire representative nucleotide sequence of UNQ332 (DNA48314-1320) is shown in Figure 162 (SEQ 20 ID NO:404). It is understood that the actual sequence is that within the clone deposited with the ATCC as DNA48314-1320. Clone UNQ332 (DNA48314-1320) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 171-173 and ending at the stop codon at nucleotide positions 2565 2567 (Figure 162). The predicted polypeptide precursor is 789 amino acids long (Figure 163). The full-length PRO531 protein shown in Figure 163 has an estimated molecular weight of about 87,552 daltons and a pl of about 25 4.84. Clone UNQ332 (DNA48314-1320) has been deposited with the ATCC on March 26, 1998. Analysis of the amino acid sequence of the full-length PRO531 polypeptide suggests that portions of it possess significant homology to protocadherin 3. Moreover, PR0531 is found in the brain, like other protocadherins, thereby indicating that PRO531 is a novel member of the cadherin superfamily. Still analyzing the amino acid sequence of SEQ ID NO:405, the cadherin extracellular repeated domain 30 signature is found at about amino acids 122-132, 231-241, 336-346, 439-449 and 549-559 of SEQ ID NO:405. An ATP/GTP-binding site motif A (P-loop) is found at about amino acids 285-292 of SEQ ID NO:405. N-glycosylation sites are found at least at about amino acids 567-570, 786-790, 418-421 and 336-339 of SEQ ID NO:405. The signal peptide is at about amino acids 1-26, and the transmembrane domain is at about amino acids 685-712 of SEQ ID NO:405. 35 EXAMPLE 65: Isolation of cDNA Clones Encoding Human PR0534 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA43038. Based on the 43048 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 237 WO 99/46281 PCT/US99/05028 2) for use as probes to isolate a clone of the full-length coding sequence for PR0534. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CACAGAGCCAGAAGTGGCGGAATC-3' (SEQ ID NO:41 1); reverse PCR primer 5'-CCACATGTTCCTGCTCTTGTCCTGG-3' (SEQ ID NO:412). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA43038 5 sequence which had the following nucleotide sequence: hybridization probe 5'-CGGTAGTGACTGTACTCTAGTCCTGT ACACCCCGTGGTGCCG-3' (SEQ ID NO:413). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones 10 encoding the PR0534 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal lung tissue (LIB26). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0534 [herein designated as UNQ335 (DNA48333-1321)] (SEQ ID NO:409) and the derived protein sequence for PR0534. The entire nucleotide sequence of UNQ335 (DNA48333-1321) is shown in Figure 164 (SEQ ID NO:409). 15 Clone UNQ335 (DNA48333-1321) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 87-89 and ending at the stop codon at nucleotide positions 1167-1169 (Figure 164). The predicted polypeptide precursor is 360 amino acids long (Figure 165). The full-length PR0534 protein shown in Figure 165 has an estimated molecular weight of about 39,885 daltons and a pI of about 4.79. Clone UNQ335 (DNA48333-1321) has been deposited with ATCC on March 26, 1998. It is understood that the deposited clone 20 contains the actual sequence, and that the sequences provided herein are representative based on current sequencing techniques. Analysis of the amino acid sequence of the full-length PR0534 polypeptide suggests that portions of it possess significant sequence identity with the protein disulfide isomerase, thereby indicating that PRO534 may be a novel disulfide isomerase. 25 Still analyzing the amino acid sequence of PRO534, the signal peptides is at about amino acids 1-25 of SEQ ID NO:410. The transmembrane domain is at about amino acids 321-340 of SEQ ID NO:410. The disulfide isomerase corresponding region is at amino acids 212-302 of SEQ ID NO:410. The thioredoxin domain is at amino acids 211-227 of SEQ ID NO:410. N-glycosylation sites are at: 165-168, 181-184, 187-190, 194-197, 206-209, 278 281, and 293-296 of SEQ ID NO:410. The corresponding nucleotides can routinely be determined from the 30 sequences provided herein. PRO534 has a transmembrane domain rather than an ER retention peptide like other protein disulfide isomerases. Additionally, PR0534 may have an intron at the 5 prime end. EXAMPLE 66: Isolation of cDNA Clones Encoding Human PR0697 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, 35 wherein the consensus sequence obtained is herein designated DNA43052. Based on this consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0697. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CCTGGCTCGCTGCTGCTGCTC-3' (SEQ ID NO:416); 238 WO 99/46281 PCT/US99/05028 reverse PCR primer 5'-CCTCACAGGTGCACTGCAAGCTGTC-3' (SEQ ID NO:417). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA43052 consensus sequence which had the following nucleotide sequence: hybridization probe 5'-CTCTTCCTCTTTGGCCAGCCCGACTTCTCCTACAAGCGCAGAATTGC-3' (SEQ ID NO:418). 5 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0697 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0697 10 [herein designated as UNQ361 (DNA50920-1325)] (SEQ ID NO:414) and the derived protein sequence for PR0697. The entire nucleotide sequence of UNQ361 (DNA50920-1325) is shown in Figure 166 (SEQ ID NO:414). Clone UNQ361 (DNA50920-1325) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 44-46 and ending at the stop codon at nucleotide positions 929-931 (Figure 166). The predicted polypeptide precursor is 295 amino acids long (Figure 167). The full-length PR0697 protein shown in 15 Figure 167 has an estimated molecular weight of about 33,518 daltons and a pI of about 7.74. Clone UNQ361 (DNA50920-1325) was deposited with the ATCC on March 26, 1998. It is understood that the deposited clone contains the actual sequence, and that the sequences provided herein are representative based on current sequencing techniques. Analysis of the amino acid sequence of the full-length PR0697 polypeptide suggests that portions of it 20 possess significant sequence identity with sFRPs, thereby indicating that PR0697 may be a novel sFRP family member. Still analyzing the amino acid sequence of PR0697, the signal peptides is at about amino acids 1-20 of SEQ ID NO:415. The cystein rich domain, having identity with the frizzled N-terminus, is at about amino acids 6-153 of SEQ ID NO:415. The corresponding nucleotides can routinely be determined from the sequences provided herein. 25 EXAMPLE 67: Isolation of cDNA Clones Encodin2 Human PR0717 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA42829. Based on the DNA42829 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of 30 interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO717. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-AGCTTCTCAGCCCTCCTGGAGCAG-3' (SEQ ID NO:421); reverse PCR primer 5'-CGGGTCAATAAACCTGGACGCTTGG-3' (SEQ ID NO:422). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA42829 consensus 35 sequence which had the following nucleotide sequence: hybridization probe 5'-TATGTGGACCGGACCAAGCACTTCACTGAGGCCACCAAGATTG-3' (SEQ ID NO:423). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones 239 WO 99/46281 PCT/US99/05028 encoding the PR0717 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB229). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0717 [herein designated as UNQ385 (DNA50988-1326)] (SEQ ID NO:419) and the derived protein sequence for PR0717. The entire nucleotide sequence of UNQ385 (DNA50988-1326) is shown in Figure 168 (SEQ ID NO:419). 5 Clone UNQ385 (DNA50988-1326) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 17-19 and ending at the stop codon at nucleotide positions 1697-1699 (Figure 168). The predicted polypeptide precursor is 560 amino acids long (Figure 169). The full-length PR0717 protein shown in Figure 169 has an estimated molecular weight of about 58,427 daltons and a pI of about 6.86. Clone UNQ385 (DNA50988-1326) has been deposited with the ATCC on April 28, 1998. Regarding the sequence, it is understood 10 that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PR0717 polypeptide suggests that PR0717 may be a novel 12 transmembrane receptor. The reverse complement strand of DNA50988 has a stretch that matches identically with human regulatory myosin light strand. 15 Still analyzing the amino acid sequence of SEQ ID NO:420, transmembrane domains are at about amino acids 30-50, 61-79, 98-112, 126-146, 169-182, 201-215, 248-268, 280-300, 318-337, 341-357, 375-387, and 420-441 of SEQ ID NO:420. N-glycosylation sites are at about amino acids 40-43 and 43-46 of SEQ ID NO:420. A glycosaminoglycan attachment site is at about amino acids 468-471 of SEQ ID NO:420. The corresponding nucleotides can be routinely determined given the sequences provided herein. 20 EXAMPLE 68: Isolation of cDNA Clones Encoding Human PRO731 A database was used to search expressed sequence tag (EST) databases. The EST database used herein was the proprietary EST DNA database LIFESEQ

TM

, of Incyte Pharmaceuticals, Palo Alto, CA. Incyte clone 2581326 was herein identified and termed DNA42801. Based on the DNA42801 sequence, oligonucleotides were synthesized: 25 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0731. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GTAAGCACATGCCTCCAGAGGTGC-3' (SEQ ID NO:426); reverse PCR primer 5'-GTGACGTGGATGCTTGGGATGTTG-3' (SEQ ID NO:427). 30 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA42801 sequence which had the following nucleotide sequence: hybridization probe 5'-TGGACACCTTCAGTATTGATGCCAAGACAGGCCAGGTCATTCTGCGTCGA-3' (SEQ ID NO:428). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 35 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0731 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human bone marrow tissue (LIB255). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, linked with blunt to Sall 240 WO 99/46281 PCT/US99/05028 hemikinased adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique XhoI and NotI sites. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0731 [herein designated as UNQ395 (DNA48331-1329)] (SEQ ID NO:424) and the derived protein sequence for PR0731. 5 The entire nucleotide sequence of UNQ395 (DNA48331-1329) is shown in Figures 170A-B (SEQ ID NO:424). Clone UNQ395 (DNA48331-1329) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 329-331 and ending at the stop codon at nucleotide positions 3881-3883 (Figures 170A-B). The predicted polypeptide precursor is 1184 amino acids long (Figure 171). The full-length PR0731 protein shown in Figure 171 has an estimated molecular weight of about 129,022 daltons and a pI of about 5.2. Clone 10 UNQ395 (DNA48331-1329) was deposited with the ATCC on March 31, 1998. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PR0731 polypeptide suggests that portions of it possess significant identity and similarity to members of the protocadherin family, thereby indicating that PR0731 15 may be a novel protocadherin. Still analyzing the amino acid sequence of SEQ ID NO:425, the putative signal peptide is at about amino acids 1-13 of SEQ ID NO:425. The transmembrane domain is at amino acids 719-739 of SEQ ID NO:425. The N glycosylation of SEQ ID NO:425 are as follows: 415-418, 582-586, 659-662, 662-665, and 857-860. The cadherin extracellular repeated domain signatures are at about amino acids (of SEQ ID NO:425): 123-133, 232-242, 340-350, 20 448-458, and 553-563. The corresponding nucleotides can be routinely determined given the sequences provided herein. EXAMPLE 69: Isolation of cDNA Clones Encodine Human PRO218 25 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA17411. Two proprietary Genentech EST sequences were employed in the consensus assembly and are shown in Figure 174 and 175. Based on the DNA17411 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO218. 30 A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-AAGTGGAGCCGGAGCCTTCC-3' (SEQ ID NO:433); reverse PCR primer 5'-TCGTTGTTTATGCAGTAGTCGG-3' (SEQ ID NO:434). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA17411 sequence which had the following nucleotide sequence: 35 hybridization probe 5'-ATTGTTTAAAGACTATGAGATACGTCAGTATGTTGTACAGG-3' (SEQ ID NO:435). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO218 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 241 WO 99/46281 PCT/US99/05028 the cDNA libraries was isolated from human fetal kidney tissue (LIB28). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO218 [herein designated as UNQ192 (DNA30867-1335)] (SEQ ID NO:429) and the derived protein sequence for PRO218. The entire nucleotide sequence of UNQ192 (DNA30867-1335) is shown in Figure 172 (SEQ ID NO:429). Clone UNQ192 (DNA30867-1335) contains a single open reading frame with an apparent translational initiation site 5 at nucleotide positions 150-152 and ending at the stop codon at nucleotide positions 1515-1517 (Figure 172). The predicted polypeptide precursor is 455 amino acids long (Figure 173). The full-length PR0218 protein shown in Figure 173 has an estimated molecular weight of about 52,917 daltons and a pI of about 9.5. Clone UNQ192 (DNA30867-1335) has been deposited with the ATCC on April 28, 1998. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known 10 sequencing techniques. Analysis of the amino acid sequence of the full-length PRO218 polypeptide suggests that PRO218 may be a novel transmembrane protein. Still analyzing the amino acid sequence of SEQ ID NO:430, the putative signal peptide is at about amino acids 1 through 23 of SEQ ID NO:430. Transmembrane domains are potentially at about amino acids 37-55, 81-102, 15 150-168, 288-311, 338-356, 375-398, and 425-444 of SEQ ID NO:430. N-glycosylation sites are at about amino acids 67, 180, and 243 of SEQ ID NO:430. Eukaryotic cobalamin-binding protein is at about amino acids 151-160 of SEQ ID NO:430. The corresponding nucleotides can be routinely determined given the sequences provided herein. EXAMPLE 70: Isolation of cDNA Clones Encodin2 Human PR0768 20 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA43448. Based on the DNA43448 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0768. A pair of PCR primers (forward and reverse) were synthesized: 25 forward PCR primer 5'-GGCTGACACCGCAGTGCTCTTCAG-3' (SEQ ID NO:438); reverse PCR primer 5'-GCTGCTGGGGACTGCAATGTAGCTG-3' (SEQ ID NO:439). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA43448 consensus sequence which had the following nucleotide sequence: hybridization probe 30 5'-CATCCTCCATGTCTCCCATGAGGTCTCTATTGCTCCACGAAGCATC-3' (SEQ ID NO:440). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0768 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human bone marrow tissue (LIB255). 35 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0768 [herein designated as UNQ406 (DNA55737-1345)] (SEQ ID NO:436) and the derived protein sequence for PR0768. The entire nucleotide sequence of UNQ406 (DNA55737-1345) is shown in Figures 176A-B (SEQ ID NO:436). Clone UNQ406 (DNA55737-1345) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 20-22 and ending at the stop codon at nucleotide positions 3443-3445 (Figures 242 WO 99/46281 PCT/US99/05028 176A-B). The predicted polypeptide precursor is 1141 amino acids long (Figure 177). The full-length PR0768 protein shown in Figure 177 has an estimated molecular weight of about 124,671 daltons and a pI of about 5.82. Clone UNQ406 (DNA55737-1345) has been deposited with the ATCC on April 6, 1998. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. 5 Analysis of the amino acid sequence of the full-length PR0768 polypeptide suggests that portions of it possess significant sequence identity and similarity with integrin 7. Still analyzing the amino acid sequence of SEQ ID NO:437, the putative signal peptide is at about amino acids 1-33 of SEQ ID NO:437. The transmembrane domain is at amino acids 1039-1064 of SEQ ID NO:437. N glycosylation sites are at amino acids: 86-89, 746-749, 949-952, 985-988 and 1005-1008 of SEQ ID NO:437. 10 Integrin alpha chain protein domains are identified at about amino acids: 1064-1071, 384-409, 1041-1071, 317-346, 443-465, 385-407, 215-224, 634-647, 85-99, 322-346, 470-479, 442-466, 379-408 and 1031-1047 of SEQ ID NO:437. The corresponding nucleotides can be routinely determined given the sequences provided herein. EXAMPLE 71: Isolation of cDNA Clones Encoding Human PR0771 15 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA43330. Based on the DNA43330 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0771. A pair of PCR primers (forward and reverse) were synthesized: 20 forward PCR primer 5'-CAGCAATATTCAGAAGCGGCAAGGG-3' (SEQ ID NO:443); reverse PCR primer 5'-CATCATGGTCATCACCACCATCATCATC-3' (SEQ ID NO:444). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA43330 consensus sequence which had the following nucleotide sequence: hybridization probe 25 5'-GGTTACTACAAGCCAACACAATGTCATGGCAGTGTTGGACAGTGCTGG-3' (SEQ ID NO:445). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0771 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB28). 30 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0771 [herein designated as UNQ409 (DNA49829-1346)] (SEQ ID NO:441) and the derived protein sequence for PR077 1. The entire nucleotide sequence of UNQ409 (DNA49829-1346) is shown in Figure 178 (SEQ ID NO:441). Clone UNQ409 (DNA49829-1346) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 134-136 and ending at the stop codon at nucleotide positions 1442-1444 (Figure 178). The 35 predicted polypeptide precursor is 436 amino acids long (Figure 179). The full-length PR0771 protein shown in Figure 179 has an estimated molecular weight of about 49,429 daltons and a pl of about 4.8. Clone UNQ409 (DNA49829-1346) has been deposited with the ATCC on April 7, 1998. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. 243 WO 99/46281 PCT/US99/05028 Analysis of the amino acid sequence of the full-length PR0771 polypeptide suggests that portions of it possess significant homology to the testican protein, thereby indicating that PR0771 may be a novel testican homologue. Still analyzing the amino acid sequence of SEQ ID NO:442, the putative signal peptide, leucine zipper pattern, N-myristoylation sites, and thyroglobulin type-1 repeats are also shown in Figure 179. The corresponding 5 nucleotides can be routinely determined given the sequences provided herein. EXAMPLE 72: Isolation of cDNA Clones Encoding Human PR0733 A consensus sequence was obtained relative to a variety of EST sequences as described in Example 1 above, wherein the consensus sequence obtained is herein designated DNA45600. Based on the DNA45600 consensus 10 sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO733. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CCCAGCAGGGATGGGCGACAAGA-3' (SEQ ID NO:448); reverse PCR primer 5'-GTCTTCCAGTTTCATATCCAATA-3' (SEQ ID NO:449). 15 Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA45600 consensus sequence which had the following nucleotide sequence: hybridization probe 5'-CCAGAAGGAGCACGGGGAAGGGCAGCCAGATCTTGTCGCCCAT-3' (SEQ ID NO:450). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 20 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0733 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human bone marrow tissue (LIB255). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0733 [herein designated as UNQ411 (DNA52196-1348)] (SEQ ID NO:446) and the derived protein sequence for PRO733. 25 The entire nucleotide sequence of UNQ411 (DNA52196-1348) is shown in Figures 180A-B (SEQ ID NO:446). Clone UNQ411 (DNA52196-1348) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 106-108 and ending at the stop codon at nucleotide positions 793-795 (Figures 180A-B). The predicted polypeptide precursor is 229 amino acids long (Figure 181). The full-length PR0733 protein shown in Figure 181 has an estimated molecular weight of about 26,017 daltons and a pl of about 4.73. Clone 30 UNQ411 (DNA52196-1348) has been deposited with the ATCC on April 7, 1998. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PR0733 polypeptide suggests that portions of it possess significant sequence identity and similarity to the T1/ST2 receptor binding protein precursor and therefore 35 may have a similar function in cell signaling. If it is a cytokine, it may be useful in the treatment of inflammation and cancer. Still analyzing the amino acid sequence of SEQ ID NO:447, the putative signal peptide, transmembrane domain, N-myristoylation site, and tyrosine kinase site are also shown in Figure 181. The corresponding nucleotides can be routinely determined given the sequences provided herein. 244 WO 99/46281 PCT/US99/05028 EXAMPLE 73: Isolation of cDNA Clones Encoding Human PRO162 An expressed sequence tag (EST) DNA database (Merck/Washington University) was searched and an EST AA397543 was identified which showed homology to human pancreatitis-associated protein. The EST AA397543 cole was purchased and its insert obtained and sequenced and the sequence obtained is shown in Figure 182 (SEQ ID NO:451). 5 The entire nucleotide sequence of PRO162 is shown in Figure 182 (SEQ ID NO:451). DNA sequencing of the clone gave the full-length DNA sequence for PRO162 [herein designated as UNQ429 (DNA56965-1356)] (SEQ ID NO:451) and the derived protein sequence for PRO162. Clone UNQ429 (DNA56965-1356) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 86-88 and ending at the stop codon at nucleotide positions 611-613 (Figure 182). The predicted polypeptide precursor is 175 amino acids long (Figure 10 183). The full-length PRO162 protein shown in Figure 183 has an estimated molecular weight of about 19,330 daltons and a pI of about 7.25. Clone UNQ429 (DNA56965-1356) has been deposited with the ATCC. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PRO162 polypeptide suggests that portions of it 15 possess significant homology to the human pancreatitis-associated protein, thereby indicating that PRO162 may be a novel pancreatitis-associated protein. Still analyzing the amino acid sequence of SEQ ID NO:452, the putative signal peptide is at about amino acids 1-26 of SEQ ID NO:452. A C-type lectin domain signature is at about amino acids 146-171 of SEQ ID NO:452. The corresponding nucleotides can be routinely determined given the sequences provided herein. 20 EXAMPLE 74: Isolation of cDNA Clones Encoding Human PR0788 A consensus DNA sequence (designated herein as DNA49308) was assembled relative to other EST sequences using phrap as described in Example 1 above. Based upon an observed homology between the DNA49308 consensus sequence and the Incyte EST cloOne no. 2777282, the Incyte EST clone no. 2777282 was purchased and 25 its insert obtained and sequenced, which gave the full-length DNA sequence for PR0788 [herein designated as UNQ430 (DNA56405-1357)] (SEQ ID NO:453) and the derived protein sequence for PR0788. Clone UNQ430 (DNA56405-1357) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 84-86 and ending at the stop codon at nucleotide positions 459-461 (Figure 184). The predicted polypeptide precursor is 125 amino acids long (Figure 185). The full-length PR0788 protein shown 30 in Figure 185 has an estimated molecular weight of about 13,115 daltons and a pI of about 5.90. Clone UNQ430 (DNA56405-1357) has been deposited with the ATCC. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Still analyzing Figure 185, a signal peptide is shown at about amino acids 1-17 of SEQ ID NO:454. An N glycosylation site is at about amino acids 46-49 of SEQ ID NO:454. 35 EXAMPLE 75: Isolation of cDNA Clones Encoding Human PRO1008 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated as DNA49804. An EST proprietary to Genentech was employed in the consensus assembly and is herein designated as DNA16508 (Figure 188; SEQ ID NO:457). 245 WO 99/46281 PCT/US99/05028 Based upon an observed homology between the DNA49804 sequence and Merck EST clone no. AA143670, the Merck EST clone no. AA143670 was purchased and its insert obtained and sequenced. That sequence is shown herein in Figure 186 (SEQ ID NO:455). Sequencing gave the full length sequence for PRO1008 [herein designated as UNQ492 (DNA57530-1375)] (SEQ ID NO:455) and the derived protein sequence for PRO1008 were identified. 5 The entire nucleotide sequence of UNQ492 (DNA57530-1375) is shown in Figure 186 (SEQ ID NO:455). Clone UNQ492 (DNA57530-1375) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 138-140 and ending at the stop codon at nucleotide positions 936-938 (Figure 186). The predicted polypeptide precursor is 266 amino acids long (Figure 187). The full-length PRO1008 protein shown in Figure 187 has an estimated molecular weight of about 28,672 daltons and a pl of about 8.85. Clone UNQ492 10 (DNA57530-1375) has been deposited with the ATCC on May 20, 1998. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PRO1008 polypeptide suggests that portions of it possess significant sequence identity and/or similarity with mdkk-1, thereby indicating that PRO1008 may be a novel 15 member of this family and have head inducing activity. Still analyzing the amino acid sequence of SEQ ID NO:456, the putative signal peptide is at about amino acids 1-23 of SEQ ID NO:456. The N-glycosylation site is at about amino acids 256-259 of SEQ ID NO:456, and the fungal zn-(2)-cys(6) binuclear cluster domain is at about amino acids 110-126 of SEQ ID NO:456. The corresponding nucleotides can of all the amino acids can be routinely determined given the sequences provided herein. 20 EXAMPLE 76: Isolation of cDNA Clones Encoding Human PRO1012 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above, wherein the consensus sequence is herein designated DNA49313. Based on the DNA49313 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the 25 sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO1012. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-ACTCCCCAGGCTGTTCACACTGCC-3' (SEQ ID NO:460); reverse PCR primer 5'-GATCAGCCAGCCAATACCAGCAGC-3' (SEQ ID NO:461). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA49313 consensus 30 sequence which had the following nucleotide sequence: hybridization probe 5'-GTGGTGATGATAGAATGCTTTGCCGAATGAAAGGAGTCAACAGCTATCCC-3' (SEQ ID NO:462). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones 35 encoding the PRO1012 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1012 [herein designated as UNQ495 (DNA56439-1376)] (SEQ ID NO:458) and the derived protein sequence for PRO1012. 246 WO 99/46281 PCT/US99/05028 The entire nucleotide sequence of UNQ495 (DNA56439-1376) is shown in Figures 189A-B (SEQ ID NO:458). Clone UNQ495 (DNA56439-1376) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 404-406 and ending at the stop codon at nucleotide positions 2645-2647 (Figures 189A-B). The predicted polypeptide precursor is 747 amino acids long (Figure 190). The full-length PRO1012 protein shown in Figure 190 has an estimated molecular weight of about 86,127 daltons and a pI of about 7.46. Clone 5 UNQ495 (DNA56439-1376) has been deposited with ATCC on May 14, 1998. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PRO1012 polypeptide suggests that portions of it possess sequence identity with disulfide isomerase thereby indicating that PRO1012 may be a novel disulfide 10 isomerase related protein. Still analyzing the amino acid sequence of SEQ ID NO:459, the cytochrome C family heme-binding site signature is at about amino acids 158-163 of SEQ ID NO:459. The Nt-DNAJ domain signature is at about amino acids 77-96 of SEQ ID NO:459. An N-glycosylation site is at about amino acids 484-487 of SEQ ID NO:459. The ER targeting sequence is at about amino acids 744-747 of SEQ ID NO:459. It is understood that the polypeptide and 15 nucleic acids disclosed can be routinely formed with or without, these portions as desired, in alternative embodiments. For example, it may be desirable to produce PRO1012 without the ER targeting sequence. The corresponding nucleotides can be routinely determined given the sequences provided herein. EXAMPLE 77: Isolation of cDNA Clones Encoding Human PRO1014 20 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 abobe, wherein the consensus sequence obtained is herein designated DNA4981 1. Based upon an observed homology between the DNA49811 sequence and Incyte EST clone no. 2612207, Incyte EST clone no. 2612207 was purchased and its insert was obtained and sequenced, wherein the sequence obtained is shown in Figure 191 (SEQ OD NO:463). 25 DNA sequencing gave the full-length DNA sequence for PRO1014 [herein designated as UNQ497 (DNA56409-1377)] (SEQ ID NO:463) and the derived protein sequence for PRO1014. The entire nucleotide sequence of UNQ497 (DNA56409-1377) is shown in Figure 191 (SEQ ID NO:463). Clone UNQ497 (DNA56409-1377) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 66-68 and ending at the stop codon at nucleotide positions 966-968 (Figure 191). The 30 predicted polypeptide precursor is 300 amino acids long (Figure 192). The full-length PRO1014 protein shown in Figure 192 has an estimated molecular weight of about 33,655 daltons and a pI of about 9.31. Clone UNQ497 (DNA56409-1377) has been deposited with the ATCC on May 20, 1998. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. 35 Analysis of the amino acid sequence of the full-length PRO1014 polypeptide suggests that portions of it possess sequence identity with reductase, thereby indicating that PRO1014 may be a novel member of the reductase family. Still analyzing the amino acid sequence of SEQ ID NO:464, the putative signal peptide is at about amino acids 1-19 of SEQ ID NO:464. The cAMP and cGMP dependent protein kinase phosphorylation sites are at about 247 WO 99/46281 PCT/US99/05028 amino acids 30-33 and 58-61 of SEQ ID NO:464. Short chain alcohol dehydrogenase family proteins are at about amino acids 165-202, 37-49, 112-122 and 210-219 of SEQ ID NO:464. The corresponding nucleotides of these domains and any other amino acids provided herein can be routinely determined given the sequences provided herein. EXAMPLE 78: Isolation of cDNA Clones Encodina Human PRO1017 5 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above, wherein that consensus DNA sequence is herein designated DNA53235. Based upon an observed homology between the DNA53235 consensus sequence and the Merck EST clone no. AA243086, the Merck EST clone no. AA243086 was purchased and its insert obtained and sequenced, wherein the sequence obtained is shown in Figure 193 (SEQ ID NO:465). DNA sequencing gave the full-length DNA sequence for PRO1017 [herein 10 designated as UNQ500 (DNA56112-1379)] (SEQ ID NO:465) and the derived protein sequence for PRO1017. The entire nucleotide sequence of UNQ500 (DNA56112-1379) is shown in Figure 193 (SEQ ID NO:465). Clone UNQ500 (DNA56112-1379) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 128-130 and ending at the stop codon at nucleotide positions 1370-1372 (Figure 193). The predicted polypeptide precursor is 414 amino acids long (Figure 194). The full-length PRO1017 protein shown in 15 Figure 194 has an estimated molecular weight of about 48,414 daltons and a pl of about 9.54. Clone UNQ500 (DNA56112-1379) has been deposited with the ATCC. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PRO1017 polypeptide suggests that portions of it 20 possess sequence identity with HNK-1 sulfotransferase, thereby indicating that PRO1017 may be a novel sulfotransferase. Still analyzing the amino acid sequence of SEQ ID NO:466, the putative signal peptide is at about amino acids 1-31 of SEQ ID NO:466. N-glycosylation sites are at about amino acids 134-137, 209-212, 280-283 and 370 273 of SEQ ID NO:466. The TNFR/NGFR family cystein-rich region protein is at about amino acids 329-332 of 25 SEQ ID NO:466. The corresponding nucleotides can be routinely determined given the sequences provided herein. The protein can be secreted. EXAMPLE 2: Isolation of cDNA Clones Encoding Human PR0474 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in 30 Example 1 above, wherein the consensus sequence obtained is herein designated DNA49818. Based upon an observed homology between the DNA49818 consensus sequence and the Merck EST clone no. H77889, the Merck EST clone no. H77889 was purchased and its insert obtained and sequenced, wherein the sequence obtained is herein shown in Figure 195 (SEQ ID NO:467). DNA sequencing gave the full-length DNA sequence for PR0474 [herein designated as UNQ502 (DNA56045-1380)] (SEQ ID NO:467) and the derived protein sequence for PR0474. 35 The entire nucleotide sequence of UNQ502 (DNA56045-1380) is shown in Figure 195 (SEQ ID NO:467). Clone UNQ502 (DNA56045-1380) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 106-108 and ending at the stop codon at nucleotide positions 916-918 (Figure 195). The predicted polypeptide precursor is 270 amino acids long (Figure 196). The full-length PR0474 protein shown in Figure 196 has an estimated molecular weight of about 28,317 daltons and a pl of about 6.0. Clone UNQ502 248 WO 99/46281 PCT/US99/05028 (DNA56045-1380) has been deposited with the ATCC. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Still analyzing the amino acid sequence of SEQ ID NO:468, an N-glycosylation site is at about amino acids 138-141 of SEQ ID NO:468. Short-chain alcohol dehydrogenase family proteins are at about amino acids 10-22, 81 91, 134-171 and 176-185 of SEQ ID NO:468. The corresponding nucleotides can be routinely determined given 5 the sequences provided herein. EXAMPLE 80: Isolation of cDNA Clones Encoding Human PRO1031 An initial consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above, wherein the consensus sequence obtained is herein designated as DNA47332. Based upon an 10 observed homology between the DNA47332 sequence and the Merck EST clone no. W74558, Merck EST clone no. W74558 was purchased and its insert obtained and sequenced, wherein the sequence obtained is shown in Figure 197 (SEQ ID NO:469). DNA sequencing gave the full-length DNA sequence for PRO1031 [herein designated as UNQ516 (DNA59294-1381)] (SEQ ID NO:469) and the derived protein sequence for PRO1031. The entire nucleotide sequence of UNQ516 (DNA59294-1381) is shown in Figure 197 (SEQ ID NO:469). 15 Clone UNQ516 (DNA59294-1381) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 42-44 and ending at the stop codon at nucleotide positions 582-584 (Figure 197). The predicted polypeptide precursor is 180 amino acids long (Figure 198). The full-length PRO1031 protein shown in Figure 198 has an estimated molecular weight of about 20,437 daltons and a pI of about 9.58. Clone UNQ516 (DNA59294-1381) has been deposited with the ATCC. Regarding the sequence, it is understood that the deposited 20 clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Analysis of the amino acid sequence of the full-length PRO1031 polypeptide suggests that it is a novel cytokine. Still analyzing the amino acid sequence of SEQ ID NO:470, the putative signal peptide is at about amino 25 acids 1-20 of SEQ ID NO:470. An N-glycosylation site is at about amino acids 75-78 of SEQ ID NO:470. A region having sequence identity with IL-17 is at about amino acids 96-180. The corresponding nucleotides can be routinely determined given the sequences provided herein. EXAMPLE 81: Isolation of cDNA Clones Encoding Human PR0938 30 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above, wherein that consensus sequence is herein designated DNA49798. Based on the DNA49798 DNA consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0938. A pair of PCR primers (forward and reverse) were synthesized: 35 forward PCR primer 5'-GTCCAGCCCATGACCGCCTCCAAC-3' (SEQ ID NO:473) reverse PCR primer 5'-CTCTCCTCATCCACACCAGCAGCC-3' (SEQ ID NO:474) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA49798 sequence which had the following nucleotide sequence: 249 WO 99/46281 PCT/US99/05028 hybridization probe 5'-GTGGATGCTGAAAT ACGCCCCATGGTGTCCATCCTGCCAGC-3' (SEQ ID NO:475) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0938 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of 5 the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0938 [herein designated as UNQ475 (DNA56433-1406)] (SEQ ID NO:471) and the derived protein sequence for PR0938. The entire nucleotide sequence of UNQ475 (DNA56433-1406) is shown in Figure 199 (SEQ ID NO:471). Clone UNQ475 (DNA56433-1406) contains a single open reading frame with an apparent translational initiation site 10 at nucleotide positions 134-136 and ending at the stop codon at nucleotide positions 1181-1183 (Figure 199). The predicted polypeptide precursor is 349 amino acids long (Figure 200). The full-length PR0938 protein shown in Figure 200 has an estimated molecular weight of about 38,952 daltons and a pI of about 4.34. Analysis of the full length PR0938 sequence shown in Figure 200 (SEQ ID NO:472) evidences the presence of the following features: a signal peptide from amino 1 to about amino acid 22, a transmembrane domain from about amino acid 191 to about 15 amino acid 211, a potential N-glycosylation site from about amino acid 46 to about amino acid 49, a region homologous to disulfide isomerase from about amino acid 56 to about amino acid 72, and a region having sequence identity with flavodoxin proteins from about amino acid 173 to about amino acid 187. Clone UNQ475 (DNA56433-1406) has been deposited with ATCC on May 12, 1998, and is assigned ATCC Accession No. 209857. 20 Analysis of the amino acid sequence of the full-length PR0938 polypeptide suggests that it possesses significant sequence similarity to protein disulfide isomerase, thereby indicating that PR0938 may be a novel protein disulfide isomerase. An analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0938 amino acid sequence and the following Dayhoff sequences, PW03626, P_W03627, P_R70491, GARPPLAFF. XLU85970_1, ACADISPROA_1, IE68_HSVSA, KSU52064_1, U93872_83, 25 PR97866. EXAMPLE 82: Isolation of cDNA Clones Encoding Human PRO1082 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above, wheein the consensus sequence is herein designated DNA38097. Based on this consensus 30 sequence. oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO1082. A set of PCR primers (two forward and one reverse) were synthesized: forward primer 1 5'-GTCCACAGACAGTCATCTCAGGAGCAG-3' (SEQ ID NO:478); forward primer 2 5'-ACAAGTGTCTTCCCAACCTG-3' (SEQ ID NO:479); 35 reverse primer 1 5'-ATCCTCCCAGAGCCATGGTACCTC-3' (SEQ ID NO:480). Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA38097 consensus sequence which had the following nucleotide sequence: hybridization probe 5'-CCAAGGATAGCTGTTGTTTCAGAGAAAGGATCGTGTGCTGCATCTCCTCCT-3' (SEQ ID NO:481). 250 WO 99/46281 PCTIUS99/05028 In order to screen several libraries for a source of a full-length clone. DNA from the libraries was screened by PCR amplification with the PCR primers identified above. A positive library was then used to isolate clones encoding the PRO1082 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1082 5 [herein designated as UNQ539 (DNA53912-1457)] (SEQ ID NO:476) and the derived protein sequence for PRO1082. The entire nucleotide sequence of UNQ539 (DNA53912-1457) is shown in Figure 201 (SEQ ID NO:476). Clone UNQ539 (DNA53912-1457) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 160-162 and ending at the stop codon at nucleotide positions 763-765 (Figure 201). The predicted polypeptide precursor is 201 amino acids long (Figure 202). The full-length PRO1082 protein shown in 10 Figure 202 has an estimated molecular weight of about 22,563 daltons and a pl of about 4.87. Clone UNQ539 (DNA53912-1457) has been deposited with the ATCC. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. Still analyzing the amino acid sequence of SEQ ID NO:477, the transmembrane domain is at about amino 15 acids 45-65 of SEQ ID NO:477. A cAMP- and cGMP-dependent protein kinase phosphorylation site is at about amino acids 197-200 of SEQ ID NO:477. N-myristoylation sites are at about amino acids 35-40 and 151-156 of SEQ ID NO:477. The regions which share sequence identity with the LDL receptor are at about amino acids 34-67 and 70-200 of SEQ ID NO:477. The corresponding nucleotides of these amino acid regions and others can be routinely determined given the sequences provided herein. 20 EXAMPLE 83: Isolation of cDNA Clones Encoding Human PRO1083 A cDNA sequence was identified using the amylase screening technique described in Example 2 above, wherein that cDNA sequence is designated herein as DNA24256 (Figure 205; SEQ ID NO:484). That cDNA sequence was then compared and aligned with other known EST sequencees as described in Example 1 above to 25 obtain a consensus DNA sequence which is designated herein as DNA43422. Based on the DNA 43422 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO1083. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GGCATTGGAGCAGTGCTGGGTG-3' (SEQ ID NO:485); 30 reverse PCR primer 5'-TGGAGGCCTAGATGCGGCTGGACG-3' (SEQ ID NO:486). In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO1083 gene using the reverse PCR primer. RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). 35 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO 1083 [herein designated as UNQ540 (DNA50921-1458)] (SEQ ID NO:482) and the derived protein sequence for PRO1083. The entire nucleotide sequence of UNQ540 (DNA50921-1458) is shown in Figure 203 (SEQ ID NO:482). Clone UNQ540 (DNA50921-1458) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 214-216 and ending at the stop codon at nucleotide positions 2293-2295 (Figure 203). The 251 WO 99/46281 PCT/US99/05028 predicted polypeptide precursor is 693 amino acids long (Figure 204). The full-length PRO1083 protein shown in Figure 204 has an estimated molecular weight of about 77,738 daltons and a pI of about 8.87. Clone UNQ540 (DNA50921-1458) has been deposited with the ATCC. Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. 5 Still analyzing the amino acid sequence of SEQ ID NO:483, the putative signal peptide is at about amino acids 1-25 of SEQ ID NO:483. The transmembrane domains are at about amino acids 382-398, 402-420, 445-468, 473-491, 519-537, 568-590 and 634-657 of SEQ ID NO:483. A microbodies C-terminal targeting signal is at about amino acids 691-693 of SEQ ID NO:483. cAMP- and cGMP-dependent protein kinase phosphorylation sites are at about amino acids 198-201 and 370-373 of SEQ ID NO:483. N-glycosylation sites are at about amino acids 39-42, 10 148-151, 171-174, 234-237, 303-306, 324-227 and 341-344 of SEQ ID NO:483. A G-protein coupled receptor family domain is at about amino acids 475-504 of SEQ ID NO:483. The corresponding nucleotides can be routinely determined given the sequences provided herein. EXAMPLE 84: Isolation of cDNA Clones Encodin2 Human PRO200 15 Probes based on an expressed sequence tag (EST) identified from the Incyte Pharmaceuticals database due to homology with VEGF were used to screen a cDNA library derived from the human glioma cell line G61. In particular, Incyte Clone "INC1302516" was used to generate the following four probes: (SEQ ID NO:489) ACTTCTCAGTGTCCATAAGGG; (SEQ ID NO:490) GAACTAAAGAGAACCGATACCAT CTGGCCAGGTrGTC; 20 (SEQ ID NO:491) CACCACAGCGTTTAACCAGG; and (SEQ ID NO:492) ACAACAGGCACAGTTCCCAC. Nine positives were identified and characterized. Three clones contained the full coding region and were identical in sequence. Partial clones were also identified from a fetal lung library and were identical with the glioma-derived sequence with the exception of one nucleotide change which did not alter the encoded amino acid. 25 EXAMPLE 85: Expression Constructs for PRO200 For mammalian protein expression, the entire open reading frame (ORF) was cloned into a CMV-based expression vector. An epitope-tag (FLAG, Kodak) and Histidine-tag (His8) were inserted between the ORF and stop codon. VEGF-E-His8 and VEGF-E-FLAG were transfected into human embryonic kidney 293 cells by SuperFect 30 (Qiagen) and pulse-labeled for 3 hours with ["Slmethionine and r Cicysteine. Both epitope-tagged proteins co-migrate when 20 microliters of 15-fold concentrated serum-free conditioned medium were electrophoresed on a polyacrylamide gel (Novex) in sodium dodecyl sulfate sample buffer (SDS-PAGE). The VEGF-E-IgG expression plasmid was constructed by cloning the ORF in front of the human Fc (IgG) sequence. The VEGF-E-IgG plasmid was co-transfected with Baculogold Baculovirus DNA (Pharmingen) using 35 Lipofectin (GibcoBRL) into 105 Sf9 cells grown in Hink's TNM-FH medium (JRH Biosciences) supplemented with 10% fetal bovine serum. Cells were incubated for 5 days at 28*C. The supernatant was harvested and subsequently used for the first viral amplification by infecting Sf9 cells at an approximate multiplicity of infection (MOI) of 10. Cells were incubated for 3 days, then supernatant harvested, and expression of the recombinant plasmid determined by binding of 1 ml of supernatant to 30 ul of Protein-A Sepharose CL-4B beads (Pharmacia) followed by subsequent 252 WO 99/46281 PCT/US99/05028 SDS-PAGE analysis. The first amplification supernatant was used to infect a 500 ml spinner culture of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0.1. Cells were treated as above, except harvested supernatant was sterile filtered. Specific protein was purified by binding to Protein-A Sepharose 4 Fast Flow (Pharmacia) column. 5 Example 86: Northern Blot Analyses for PR0200 Blots of human poly(A) + RNA from multiple adult and fetal tissues and tumor cell lines were obtained from Clontech (Palo Alto, CA). Hybridization was carried out using 1 2 P-labeled probes containing the entire coding region and washed in 0.1 x SSC, 0.1% SDS at 63*C. VEGF-E mRNA was detectable in fetal lung, kidney, brain, liver and adult heart, placenta. liver, skeletal 10 muscle, kidney, and pancreas. VEGF-E mRNA was also found in A549 lung adenocarcinoma and HeLa cervical adenocarcinoma cell lines. Examle 87: In Situ Hybridization of Human Fetal Tissue Sections for PR0200 Formalin-fixed, paraffin-embedded human fetal brain, liver, lower limb, small intestine, thyroid, lymph 15 node, thymus, stomach, trachea, skin, spleen, spinal cord, adrenal, placenta, cord, and adult liver, pancreas, lung, spleen, lymph node, adrenal, heart, aorta, and skin were sectioned, deparaffinized, deproteinated in proteinase K (20 ug/ml) for 15 minutes at 37*C, and further processed for in situ hybridization as described by Lu LH and Gillett NA (Cell Vision 1:169-176, 1994). A [a- 3 -P]UTP-labeled antisense riboprobe was generated from a PCR product of 980 bp (primers GGCGGAATCCAACCTGAGTAG and GCGGCTATCCTCCTGTGCTC, SEQ ID NOS: 493 and 20 494, respectively). The slides were dipped in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks. VEGF-E mRNA expression included localization at the growth plate region and embracing fetal myocytes. Example 88: Myocyte Hypertrophy Assay for PRO200 Myocytes from neonatal Harlan Sprague Dawley rat heart ventricle (23 days gestation) were plated in 25 duplicate at 75000 cells/ml in a 96-well plate. Cells were treated for 48h with 2000, 200, 20, or 2 ng/ml VEGF-E-IgG. Myocytes were stained with crystal violet to visualize morphology and scored on a scale of 3 to 7, 3 being nonstimulated and 7 being full-blown hypertrophy. 2000 ng/ ml and 200 ng/ ml VEGF-E caused hypertrophy, scored as a 5. 30 Example 89: Cell Proliferation Assay for PR0200 Mouse embryonic fibroblast C3HlOTl/2 cells (ATCC) were grown in 50:50 Ham's F-12: low glucose DMEM medium containing 10% fetal calf serum (FCS). Cells were plated in duplicate in a 24-well plate at 1000, 2000, and 4000 cells/well. After 48 hours, cells were switched to medium containing 2% FCS and were incubated for 72 hours with 200, 800, or 2000 ng/ml VEGF-E or no growth factor added. 35 Approximately 1.5 fold greater number of cells were measured in the presence of 200 ng/ml VEGF-E as in its absence, at all three cell densities. Example 90: Endothelial Cell Survival Assay for PRO200 253 WO 99/46281 PCT/US99/05028 Human umbilical vein endothelial cells (HUVEC, Cell Systems) were maintained in Complete Media (Cell Systems) and plated in triplicate in serum-free medium (Basic Media from Cell Systems containing 0.1 % BSA) at 20,000 cells/well of a 48-well plate. Cells were incubated for 5 days with 200 or 400 ng/ml VEGF-E-IgG, 100 ng/ml VEGF, 20 ng/ml basic FGF, or no addition. Survival was 2-3 times greater with VEGF-E as compared to lack of growth factor addition. VEGF and 5 basic FGF were included as positive controls. EXAMPLE91: Isolation of cDNA Clones Encoding Human PR0285 A proprietary expressed sequence tag (EST) DNA database (LIFESEQ T M , Incyte Pharmaceuticals, Palo Alto, CA) was searched and an EST (#2243209) was identified which showed homology to the Drosophila Toll protein. 10 Based on the EST, a pair of PCR primers (forward and reverse): TAAAGACCCAGCTGTGACCG (SEQ ID NO:499) ATCCATGAGCCTCTGATGGG (SEQ ID NO: 500), and a probe: ATTATGTCTCGAGGAAAGGGACTGGTTACCAGGGCAGCCAGTTC (SEQ ID NO: 501) 15 were synthesized. mRNA for construction of the cDNA libraries was isolated from human placenta tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA (Fast Track 2). The cDNA was primed with oligo dT containing a Not site, linked with blunt to SalI hemikinased adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, 20 and cloned in a defined orientation into the cloning vector pCR2.1 (Invitrogen, Inc.) using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). The double stranded cDNA was sized to greater than 1000 bp and the cDNA was cloned into BamHI/NotI cleaved vector. pCR2.1 is a commercially available plasmid, designed for easy cloning of PCR fragments, that carries AmpR and KanR genes for selection, and LacZ gene for blue-white selection. 25 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0285 gene using the probe oligonucleotide and one of the PCR primers. A cDNA clone was sequenced in entirety. The entire nucleotide sequence of DNA40021-1154 (encoding PRO285) is shown in Figure 208 (SEQ ID NO:495). Clone DNA40021-1154 contains a single open reading frame 30 with an apparent translational initiation site at nucleotide positions 61-63 (Figure 208). The predicted polypeptide precursor is 1049 amino acids long, including a putative signal peptide at amino acid positions 1-29, a putative transmembrane domain between amino acid positions 837-860, and a leucine zipper pattern at amino acid positions 132-153 and 704-725, respectively. It is noted that the indicated boundaries are approximate, and the actual limits of the indicated regions might differ by a few amino acids. Clone DNA40021-1154 has been deposited with ATCC 35 (designation: DNA40021-1154) and is assigned ATCC deposit no.209389. Based on a BLAST and FastA sequence alignment analysis (using the ALIGN computer program) of the full length sequence is a human analogue of the Drosophila Toll protein, and is homologous to the following human Toll proteins: Toll1 (DNAX# HSU88540-1. which is identical with the random sequenced full-length cDNA #HUMRSC786-1); Toll2 (DNAX# HSU88878-1); Toll3 (DNAX# HSU88879-1): and Toll4 (DNAX# HSU88880-1). 254 WO 99/46281 PCT/US99/05028 EXAMPLE 92: Isolation of cDNA Clones Encoding Human PR0286 A proprietary expressed sequence tag (EST) DNA database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA) was searched and an EST (#694401) was identified which showed homology to the Drosophila Toll protein. Based on the EST, a pair of PCR primers (forward and reverse): 5 GCCGAGACAAAAACGTTCTCC (SEQ ID NO:502) CATCCATGTTCTCATCCATTAGCC (SEQ ID NO: 503), and a probe: TCGACAACCTCATGCAGAGCATCAACCAAAGCAAGAAAACAGTATT (SEQ ID NO: 504) were synthesized. 10 mRNA for construction of the cDNA libraries was isolated from human placenta tissue. This RNA was used to generate an oligo dT primed cDNA library in the vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). pRK5D is a cloning vector that has an sp6 transcription initiation site followed by an Sfil restriction enzyme site preceding the Xhol/NotI cDNA cloning sites. The cDNA was primed with oligo dT containing a Nod site, linked with blunt to SalI hemikinased adaptors, cleaved 15 with Nod, sized to greater than 1000 bp appropriately by gel electrophoresis, and cloned in a defined orientation into XhoI/NotI-cleaved pRK5D. In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0286 gene using the probe oligonucleotide identified above and one of the PCR primers. 20 A cDNA clone was sequenced in entirety. The entire nucleotide sequence of DNA42663-1154 (encoding PRO286) is shown in Figures 210A-B (SEQ ID NO:497). Clone DNA42663-1154 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 57-59 (Figure 211). The predicted polypeptide precursor is 1041 amino acids long, including a putative signal peptide at amino acid positions 1-26, a potential transmembrane domain at amino acid positions 826-848, and leucine zipper patterns at amino acids 130-151, 25 206-227, 662-684, 669-690 and 693-614, respectively. It is noted that the indicated boundaries are approximate, and the actual limits of the indicated regions might differ by a few amino acids. Clone DNA42663-1154 has been deposited with ATCC (designation: DNA42663-1154) and is assigned ATCC deposit no. 209386. Based on a BLAST and FastA sequence alignment analysis (using the ALIGN computer program) of the full length sequence of PR0286, it is a human analogue of the Drosophila Toll protein, and is homologous to the following 30 human Toll proteins: Toll1 (DNAX# HSU88540-1, which is identical with the random sequenced full-length cDNA #HUMRSC786-1); Toll2 (DNAX# HSU88878-1); Toll3 (DNAX# HSU88879-1); and Toll4 (DNAX# HSU88880-1). Example 93: NF-xB Assay for PR0285 and PR0286 As the Toll proteins signal through the NF-xB pathway, their biological activity can be tested in an NF-xB 35 assay. In this assay Jurkat cells are transiently transfected using Lipofectamine reagent (Gibco BRL) according to the manufacturer's instructions. lpg pB2XLuc plasmid, containing NF-KB-driven luciferase gene, is contransfected with ljg pSRaN expression vector with or without the insert encoding PR0285 or PR0286. For a positive control, cells are treated with PMA (phorbol myristyl acetate; 20 ng/ml) and PHA (phytohaemaglutirin. 2g/ml) for three to four hours. Cells are lysed 2 or 3 days later for measurement of luciferase activity using reagents from Promega. 255 WO 99/46281 PCT/US99/05028 EXAMPLE39A: Isolation of cDNA Clones EncodinE Human PR0213-1. PRO1330 and PRO1449 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA28735. Based on the DNA28735 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0213-1, PRO1330 and/or 5 PRO1449. A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-TGGAGCAGCAATATGCCAGCC-3' (SEQ ID NO:511) reverse PCR primer 5'-TIT=CCACTCCTGTCGGGTTGG-3' (SEQ ID NO:512) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28735 sequence which had the following nucleotide sequence: 10 hybridization probe 5'-GGTGACACTTGCCAGTCAGATGTGGATGAATGCAGTGCTAGGAGGG-3' (SEQ ID NO:513) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0213-1, PRO1330 and/or PRO1449 gene using the probe oligonucleotide and one of the PCR 15 primers. RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence encoding PR0213-1, PRO1330 and/or PRO1449 [DNA30943-1-1163-1 (SEQ ID NO:505), DNA64907-1163-1 (SEQ ID NO:507) and DNA64908-1163-1 (SEQ ID NO:509), respectively]. The entire nucleotide sequences corresponding to DNA30943-1-1163-1 (SEQ ID NO:505), DNA64907 20 1163-1 (SEQ ID NO:507) and DNA64908-1163-1 (SEQ ID NO:509), respectively. DNA30943-1163, DNA64907 1163-1 and DNA64908-1163-1 contain a single open reading frame with an apparent translational initiation site at nucleotide positions 336-338, 488-490 and 326-328, respectively, and ending at the stop codon at nucleotide positions 1221-1223, 1307-1309 and 1145-1147, respectively (Figures 212, 214 and 216). The predicted polypeptide precursor is 295, 273 and 273 amino acids long, respectively (Figures 213, 215 and 217). DNA30943-1-1163-1, DNA64907 25 1163-1 and DNA64908-1163-1 have been deposited with ATCC and are assigned ATCC deposit no. 209791, 203242 and 203243, respectively. Analysis of the amino acid sequence of the full-length PR0213-1 polypeptide suggests that a portion of it possess significant homology to the human growth arrest-specific gene 6 protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35) evidenced significant homology between the PR0213 amino 30 acid sequence and the following Dayhoff sequences, HSMHC3W5A_6 and B48089. Additional analysis of the amino acid sequence of the full-length PRO1330 and PRO1449 polypeptide indicates significant identity with notch4. More specifically, an analysis of the Dayhoff database (version 35.130 SwissProt 35) evidenced significant identity between PRO1330 and the following Dayhoff sequences, D86566_1 and NELHUMAN. 35 EXAMPLE 95: Isolation of cDNA Clones EncodinE Human PR0298 A cDNA isolated in the amylase screen described in Example 2 above is herein designated DNA26832 (Figure 220; SEQ ID NO:516). The sequence of DNA26832 was then used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST database 256 WO 99/46281 PCT/US99/05028

(LIFESEQ

TM

, Incyte Pharmaceuticals, Palo Alto. CA). The search was performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 469-480 [1996]). Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington; http://bozeman.mbt.washington.edu/phrap.docs/phrap.html). 5 A consensus DNA sequence was assembled relative to other EST sequences using phrap. A consensus sequence was determined, which was then extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above. The extended assembly sequence was designated DNA35861.Based on the DNA35861 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes 10 to isolate a clone of the full-length coding sequence of PR0298. Forward and reverse primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequence is typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5kbp. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al., Current Protocols in Molecular Biology, 15 with the PCR primer pair. A positive library was used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs. PCR primers (forward and reverse) and a hybridization probe were synthesized: forward PCR primer 1 CAACGTGATTTCAAAGCTGGGCTC (SEQ ID NO:517) forward PCR primer 2 GCCTCGTATCAAGAATITCC (SEQ ID NO:518) 20 forward PCR primer 3 AGTGGAAGTCGACCTCCC (SEQ ID NO:519) reverse PCR primer 1 CTCACCTGAAATCTCTCATAGCCC (SEQ ID NO:520) hybridization probe 1 CGCAAAACCCATITTGGGAGCAGGAATTCCAATCATGTCTGTGATGGTGG (SEQ ID NO:521) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened 25 by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0298 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal lung tissue (LIB25). The cDNA libraries used to isolated the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, 30 linked with blunt to Sall hemikinased adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 2:1278-1280 (1991)) in the unique XhoI and NotI sites. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0298 35 (herein designated UNQ261 [DNA39975-1210]) (SEQ ID NO:514), and the derived protein sequence for PR0298 (SEQ ID NO:515). The entire nucleotide sequence of UNQ261 (DNA39975-1210) is shown in Figure 218 (SEQ ID NO:514). Clone DNA39975-1210 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 375-377. The predicted polypeptide precursor is 364 amino acids long. The protein contains four putative 257 WO 99/46281 PCT/US99/05028 transmembrane domains between amino acid positions 36-55 (type II TM), 65-84. 188-208, and 229-245, respectively. A putative N-linked glycosylation site starts at amino acid position 253. In addition, the following features have been identified in the protein sequence: cAMP- and cGMP-dependent protein kinase phosphorylation site, starting at position 8; N-myristoylation sites starting a position 173 and 262, respectively; and a ZP domain between amino acid positions 45-60. Clone DNA39975-1210 has been deposited with ATCC (April 21, 1998) and 5 is assigned ATCC deposit no.209783. EXAMPLE 96: Isolation of cDNA Clones Encoding Human PR0337 A cDNA sequence identified in the amylase screen described in Example 2 above is herein designated DNA42301 (Figure 223, SEQ ID NO:524). The DNA42301 sequence was then compared to other EST sequences 10 using phrap as described in Example 1 above and a consensus sequence designated herein as DNA28761 was identified. Based on this consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence. In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate 15 clones encoding the PR0337 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal brain. A cDNA clone was sequenced in its entirety. The full length nucleotide sequence of DNA43316-1237 is shown in Figure 221 (SEQ ID NO:522). Clone DNA43316-1237 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 134-136 (Figure 221; SEQ ID NO:522). The predicted 20 polypeptide precursor is 344 amino acids long. Clone DNA43316-1237 has been deposited with ATCC and is assigned ATCC deposit no. 209487 Based on a BLAST-2 and FastA sequence alignment analysis of the full-length sequence, PR0337 shows amino acid sequence identity to rat neurotrimin (97%). 25 EXAMPLE 97: Isolation of cDNA Clones Encodina Human PR0403 Introduction: Human thrombopoietin (THPO) is a glycosylated hormone of 352 amino acids consisting of two domains. The N-terminal domain, sharing 50% similarity to erythropoietin, is responsible for the biological activity. The C terminal region is required for secretion. The gene for thrombopoietin (THPO) maps to human chromosome 3q27 30 q28 where the six exons of this gene span 7 kilobase base pairs of genomic DNA (Chang et al., Genomics 26: 636-7 (1995); Foster et al., Proc. Natl. Acad. Sci. USA 91: 13023-7 (1994); Gurney et al., Blood 85: 981-988 (1995). In order to determine whether there were any genes encoding THPO homologues located in close proximity to THPO, genomic DNA fragments from this region were identified and sequenced. Three P1 clones and one PAC clones (Genome Systems Inc., St. Louis. MO; cat. Nos. P1-2535 and PAC-6539) encompassing the THPO locus were 35 isolated and a 140 kb region was sequenced using the ordered shotgun strategy (Chen et al., Genomics 17: 651-656 (1993)), coupled with a PCR-based gap filling approach. Analysis reveals that the region is gene-rich with four additional genes located very close to THPO: tumor necrosis factor-receptor type 1 associated protein 2 (TRAP2) and elongation initiation factor gamma (elF40, chloride channel 2 (CLCN2) and RNA polymerase II subunit hRPB 17. While no THPO homolog was found in the region. four novel genes have been predicted by computer-assisted gene 258 WO 99/46281 PCT/US99/05028 detection (GRAIL)(Xu et al., Gen. Engin. 16: 241-253 (1994), the presence of CpG islands (Cross, S. and Bird, A., Curr. Opin. Genet. & Devel. 5: 109-314 (1995), and homology to known genes (as detected by WU BLAST2.0)(Altschul and Gish, Methods Enzymol. 266: 460-480 (1996) (http://blast.wustl.edu/blast/README.html). Procedures: P1 and PAC clones: 5 The initial human P1 clone was isolated from a genomic P1 library (Genome Systems Inc., St. Louis, MO; cat. no.: P1-2535) screened with PCR primers designed from the THPO genomic sequence (A.L. Gurney, et al., Blood 85: 981-88 (1995). PCR primers were designed from the end sequences derived from this P1 clone were then used to screen P1 and PAC libraries (Genome Systems, Cat. Nos.: P1-2535 & PAC-6539) to identify overlapping clones (PACI, pl.t, and Pl.u). The 3-end sequence from PAC.z was used to define the primers used for the 10 screening of a human BAC library (Genome Systems Inc., St. Louis, MO; Cat. No.: BDTW-4533A). Ordered Shotgun Strategy: The Ordered Shotgun Strategy (OSS) (Chen et al., Genomics 17: 651-656 (1993)) involves the mapping and sequencing of large genomic DNA clones with a hierarchical approach. The P1 or PAC clone was sonicated and the fragments subcloned into lambda vector (ABluestar) (Novagen, Inc., Madison, WI: cat. no. 69242-3). The lambda 15 subclone inserts were isolated by long-range PCR (Barnes, W. Proc. Natl. Acad. Sci. USA 91: 2216-2220 (1994) and the ends sequenced. The lambda-end sequences were overlapped to create a partial map of the original clone. Those lambda clones with overlapping end-sequences were identified, the insets subcloned into a plasmid vector (pUC18 or pUC19, Hoefer Pharmacia Biotech, Inc., San Francisco, CA, Cat. Nos. 27-4949-01 and 27-4951-01) and the ends of the plasmid subclones were sequenced and assembled to generate a contiguous sequence. This directed 20 sequencing strategy minimizes the redundancy required while allowing one to scan for and concentrate on interesting regions. In order to define better the THPO locus and to search for other genes related to the hematopoietin family, five genomic clones were isolated from this region by PCR screening of human P1 and PAC libraries (Genome System, Inc., Cat. Nos.: P1-2535 and PAC-6539). 25 The sizes of the genomic fragments are as follows: Pl.t is 40 kb; Pl.g is 70 kb; Pl.u is 70 kb; PAC.z is 200 kb; and BAC.1 is 80 kb. Approximately 75% (140 kb) of the 190 kb genomic DNA region was sequenced by the Ordered Shotgun Strategy (OSS) (Chen et al., Genomics 17: 651-56 (1993), and assembled into contigs using AutoAssemblerTM (Applied Biosystems, Perkin Elmer, Foster City, CA, cat. no. 903227). The preliminary order of these contigs was determined by manual analysis. There were 47 contigs the 140 kb region. A PCR-based 30 approach to ordering the contigs and filling in the gaps was employed. The following summarizes the number and sizes of the gaps. The 50 kb of sequence unique to BAC. I was sequenced by a total shotgun approach with a ten-fold redundancy. Size of gap number <50bp 13 35 50-150 bp 7 150-300 bp 7 300-1000 bp 10 1000-5000 bp 7 > 5000 bp 2 ((15,000 bp) 259 WO 99/46281 PCT/US99/05028 DNA seguencng: ABI DYE-primerTM chemistry (PE Applied Biosystems. Foster City, CA; Cat. No.: 402112) was used to end-sequence the lambda and plasmid subclones. ABI DYE-terminaterTM chemistry (PE Applied Biosystems, Foster City, CA, Cat. No: 403044) was used to sequence the PCR products with their respective PCR primers. The sequences were collected with an ABI377 instrument. For PCR products larger than lkb, walking primers were used. 5 The sequences of contigs generated by the OSS strategy in AutoAssemblerTM (PE Applied Biosystems, Foster City, CA; Cat. No: 903227) and the gap-filling sequencing trace files were imported into SequencherTM (Gene Codes Corp., Ann Arbor, MI) for overlapping and editing. The sequences generated by the total shotgun strategy were assembled using Phred and Phrap and edited using Consed (http://chimera.biotech.washington.edu/uwgc/projects.htm) and GFP (Genome Reconstruction Manager for Phrap), version 1.2 (http://stork.cellb.bcm.tmc.edu/gfp/). 10 PCR-Based ean filling Stratey: Primers were designed based on the 5- and 3-end sequenced of each contig, avoiding repetitive and low quality sequence regions. All primers were designed to be 19-24-mers with 50-70% G/C content. Oligos were synthesized and gel-purified by standard methods. Since the orientation and order of the contigs were unknown, permutations of the primers were used in the 15 amplification reactions. Two PCR kits were used: first, XL PCR kit (Perkin Elmer, Norwalk, CT; Cat. No.: N8080205), with extension times of approximately 10 minutes; and second, the Taq polymerase PCR kit (Qiagen Inc., Valencia, CA; Cat. No.: 201223) was used under high stringency conditions if smeared or multiple products were observed with the XL PCR kit. The main PCR product from each successful reaction was extracted from a 0.9% low melting agarose gel and purified with the Geneclean DNA Purification kit prior to sequencing. 20 Analysis: The identification and characterization of coding regions was carried out as follows: First, repetitive sequences were masked using RepeatMasker (A.F.A. Smit & P. Green, http://ftp.genome.washington.edu/RM/RMdetails.htm) which screens DNA sequences in FastA format against a library of repetitive elements and returns a masked query sequence. Repeats not masked were identified by comparing 25 the sequence to the GenBank database using WUBLAST2.0 [Altschul, S & Gish, W., Methods Enzymol. 266: 460 480 (1996); http://blast.wustl.edu/blast/README.htnl] and were masked manually. Next, known genes were revealed by comparing the genomic regions against Genentech's protein database using the WUBLAST2.0 algorithm and then annotated by aligning the genomic and cDNA sequences for each gene, respectively, using a Needleman-Wunch (Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970) algorithm to find 30 regions of local identity between sequences. The strategy results in detection of all exons of the five known genes in the region, THPO, TRAP2, elF4g, CLCN2 and hRPB17 (see below). Known genes Mappsto eukaryotic translation initiation factor 4 gamma 3q27-qter 35 thrombopoietin 3q26-q27 chloride channel 2 3q26-qter TNF receptor associated protein 2 not previously mapped RNA polymerase II subunit hRPB17 not previously mapped 260 WO 99/46281 PCT/US99/05028 Finally, novel transcription units were predicted using a number of approaches. CpG islands (S. Cross & Bird, A., Curr. Opin. Genet. Dev. 5: 109-314 (1995) islands were used to define promoter regions and were identified as clusters of sites cleaved by enzymes recognizing GC-rich, 6 or 8-mer palindromic sequences (NotI, Nar, BssHII, Xhol. CpG islands are usually associated with promoter regions of genes. WUBLAST2.0 analysis of short genomic regions (10-20 kb) versus GenBank revealed matches to ESTs. The individual EST sequences (or where 5 possible, their sequence chromatogram files) were retrieved and assembled with Sequencer to provide a theoretical cDNA sequence (DNA36443). GRAIL2 (ApoCom Inc., Knoxville, TN, command line version for the DEC alpha) was used to predict a novel exon. The five known genes in the region served as internal controls for the success of the GRAIL algorithm. Isolation: 10 A partial endothelin converting enzyme-2 (ECE-2) cDNA clone was isolated by first splicing in silico the ECE-2 exons predicted in the genomic sequence to generate a putative sequence (DNA36443). An oligonucleotide probe: GAAGCAGTGCAGCCAGCAGTAGAGAGGCACCTGCTAAGA) (SEQ ID NO:530) was designed and used to screen a human fetal small intestine library (LIB110) and internal PCR primers (36443f1) (ECE2.f:ACGCAGCTGGAGCTGGTCTTAGCA) (SEQ ID NO:531) and (36443rl) (ECE2.r) 15 (GGTACTGGACCCCTAGGGCCACAA) (SEQ ID NO:532) were used to confirm clones hybridizing to the probe prior to sequencing. One positive clone was obtained, however this cDNA (DNA49830) represented a partially spliced transcript containing appropriately spliced exons 1 through 6, followed by intron 6 sequence. The oligo dT primer annealed to a polyA-stretch within an Alu element present in intron 6. An additional ECE-2 cDNA fragment (DNA49831) was obtained by PCR from a human fetal kidney library (LIB227) with primers designed from the 20 presumed cDNA sequence [36443f3: CCTCCCAGCCGAGACCAGTGG (SEQ ID NO:533) and 36443r2: GGTCCTATAAGGGCCAAGACC (SEQ ID NO:534)]. This PCR product extended from exon 13 into the 3' untranslated region in exon 18. A full length endothelin converting enzyme 2 (ECE-2) cDNA clone (DNA55800-1263) was isolated from an oligo-dT-primed human fetal brain library. RNA from human fetal brain tissue (20 weeks gestation, 25 #283005)(SRC175) was isolated by guanidine thiocyanate and 5 stg used to generate double stranded cDNA which w a s cloned into the vector pRK5E. The 3' -primer (pGACTAGTTCTAGATCGCGAGCGGCCGCCCI 11IIIIITT) (SEQ ID NO:535) and the 5 -linker (pCGGACGCGTGGGTCGA) (SEQ ID NO:536) were designed to introduce XhoI and Notd restriction sites. The library was screened with PCR primers [36443pcrfl: CGGCCGTGATGGCTGGTGACG (SEQ ID NO:537) and 30 36443r3: GGCAGACTCCT' CCTATGGG (SEQ ID NO:538)] designed from the partial human ECE-2 cDNA sequences (DNA49830 and DNA49831). PCR products were cloned into the vector pCR2.1-TOPO (Invitrogen Corp., Carlsbad, CA, Cat. No. K4500-01) and sequenced with DYE-terminator chemistry as described above. EXAMPLE 98: Northern Blot and in situ RNA Hybridization Analysis for PR0403 35 Expression of PRO403 mRNA in human tissues was examined by Northern blot analysis. Human polyA + RNA blots derived from human fetal and adult tissues (Clontech, Palo Alto, CA: Cat. Nos. 7760-1, 7756-1 and 7755 1) were hybridized to a [32P-a]dATP-labelled cDNA fragments from probe based on the full length PR0403 cDNA. Blots were incubated with the probes in hybridization buffer (5X SSPE: 2X Denhardt's solution; 100 mg/mL denatured sheared salmon sperm DNA: 50% formamide: 2% SDS) for 18 hours at 42"C, washed to high stringency 261 WO 99/46281 PCT/US99/05028 (0. 1XSSC. 0.1% SDS. 50"C) and autoradiographed. The blots were developed after overnight exposure by phosphorimager analysis (Fuji). PRO403 mRNA transcripts were detected. Analysis of the expression pattern showed the strongest signal of the expected 3.3 kb transcript in adult brain (highest in the cerebellum, putamen, medulla, and temporal lobe, and lower in the cerebral cortex, occipital lobe and frontal lobe), spinal cord, lung and pancreas and higher levels of a 5 4.5 kb transcript in fetal brain and kidney. EXAMPLE 99: Use of PRO Polypeptide-Encoding Nucleic Acid as Hybridization Probes The following method describes use of a nucleotide sequence encoding a PRO polypeptide as a hybridization probe. 10 DNA comprising the coding sequence of of a PRO polypeptide of interest as disclosed herein may be employed as a probe or used as a basis from which to prepare probes to screen for homologous DNAs (such as those encoding naturally-occurring variants of the PRO polypeptide) in human tissue cDNA libraries or human tissue genomic libraries. Hybridization and washing of filters containing either library DNAs is performed under the following high 15 stringency conditions. Hybridization of radiolabeled PRO polypeptide-encoding nucleic acid-derived probe to the filters is performed in a solution of 50% formamide, 5x SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate at 42"C for 20 hours. Washing of the filters is performed in an aqueous solution of 0.lx SSC and 0.1% SDS at 42 0 C. DNAs having a desired sequence identity with the DNA encoding full-length native sequence PRO 20 polypeptide can then be identified using standard techniques known in the art. EXAMPLE 100: Expression of PRO Polypeptides in E. coli This example illustrates preparation of an unglycosylated form of a desired PRO polypeptide by recombinant expression in E. coli. 25 The DNA sequence encoding the desired PRO polypeptide is initially amplified using selected PCR primers. The primers should contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector. A variety of expression vectors may be employed. An example of a suitable vector is pBR322 (derived from E. coli. see Bolivar et al., Gene, 2:95 (1977)) which contains genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzyme and dephosphorylated. The PCR amplified sequences are 30 then ligated into the vector. The vector will preferably include sequences which encode for an antibiotic resistance gene, a trp promoter, a polyhis leader (including the first six STII codons, polyhis sequence, and enterokinase cleavage site), the specific PRO polypeptide coding region, lambda transcriptional terminator, and an argU gene. The ligation mixture is then used to transform a selected E. coli strain using the methods described in Sambrook et al., supra. Transformants are identified by their ability to grow on LB plates and antibiotic resistant 35 colonies are then selected. Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing. Selected clones can be grown overnight in liquid culture medium such as LB broth supplemented with antibiotics. The overnight culture may subsequently be used to inoculate a larger scale culture. The cells are then grown to a desired optical density, during which the expression promoter is turned on. 262 WO 99/46281 PCT/US99/05028 After culturing the cells for several more hours, the cells can be harvested by centrifugation. The cell pellet obtained by the centrifugation can be solubilized using various agents known in the art, and the solubilized PRO polypeptide can then be purified using a metal chelating column under conditions that allow tight binding of the protein. PRO181, PRO195, PRO200, PR0237, PRO273, PR0540, PR0322, PROl017, PRO938, PRO162, 5 PRO 1114, PR0827 and PRO 1008 were expressed in E. coli in a poly-His tagged form, using the following procedure. The DNA encoding the PRO polypeptide was initially amplified using selected PCR primers. The primers contained restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector. and other useful sequences providing for efficient and reliable translation initiation, rapid purification on a metal chelation column, and proteolytic removal with enterokinase. The PCR-amplified, poly-His tagged sequences 10 were then ligated into an expression vector, which was used to transform an E. coli host based on strain 52 (W31 10 fuhA(tonA) lon galE rpoHts(htpRts) cIpP(laclq). Transformants were first grown in LB containing 50 mg/ml carbenicillin at 30*C with shaking until an O.D.600 of 3-5 was reached. Cultures were then diluted 50-100 fold into CRAP media (prepared by mixing 3.57 g (NH 4

)

2

SO

4 , 0.71 g sodium citrate-2H20, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL water, as well as 110 mM MPOS, pH 7.3, 0.55% (w/v) glucose and 15 7 mM MgSO 4 ) and grown for approximately 20-30 hours at 30*C with shaking. Samples were removed to verify expression by SDS-PAGE analysis. and the bulk culture is centrifuged to pellet the cells. Cell pellets were frozen until purification and refolding. E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets) was resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium tetrathionate is added to make final 20 concentrations of 0. 1M and 0.02 M, respectively, and the solution was stirred overnight at 4*C. This step results in a denatured protein with all cysteine residues blocked by sulfitolization. The solution was centrifuged at 40,000 rpm in a Beckman Ultracentifuge for 30 min. The supernatant was diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and filtered through 0.22 micron filters to clarify. Depending the clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated in the metal chelate 25 column buffer. The column was washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4*C. Protein concentration was estimated by its absorbance at 280 nm using the calculated extinction coefficient based on its amino acid sequence. The proteins were refolded by diluting sample slowly into freshly prepared refolding buffer consisting of: 30 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. Refolding volumes were chosen so that the final protein concentration was between 50 to 100 micrograms/ml. The refolding solution was stirred gently at 4*C for 12-36 hours. The refolding reaction was quenched by the addition of TFA to a final concentration of 0.4% (pH of approximately 3). Before further purification of the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added to 2-10% final concentration. The refolded protein 35 was chromatographed on a Poros RI/H reversed phase column using a mobile buffer of 0.1 % TFA with elution with a gradient of acetonitrile from 10 to 80%. Aliquots of fractions with A280 absorbance were analyzed on SDS polyacrylamide gels and fractions containing homogeneous refolded protein were pooled. Generally, the properly refolded species of most proteins are eluted at the lowest concentrations of acetonitrile since those species are the most compact with their hydrophobic interiors shielded from interaction with the reversed phase resin. Aggregated 263 WO 99/46281 PCT/US99/05028 species are usually eluted at higher acetonitrile concentrations. In addition to resolving misfolded forms of proteins from the desired form, the reversed phase step also removes endotoxin from the samples. Fractions containing the desired folded PRO proteins were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins were formulated into 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25 Superfine (Pharmacia) resins 5 equilibrated in the formulation buffer and sterile filtered. EXAMPLE 101: Expression of PRO Polypeptides in Mammalian Cells This example illustrates preparation of a glycosylated form of a desired PRO polypeptide by recombinant expression in mammalian cells. 10 The vector, pRK5 (see EP 307,247, published March 15, 1989), is employed as the expression vector. Optionally, the PRO polypeptide-encoding DNA is ligated into pRK5 with selected restriction enzymes to allow insertion of the PRO polypeptide DNA using ligation methods such as described in Sambrook et al., supra. The resulting vector is called pRK5-PRO polypeptide. In one embodiment, the selected host cells may be 293 cells. Human 293 cells (ATCC CCL 1573) are 15 grown to confluence in tissue culture plates in medium such as DMEM supplemented with fetal calf serum and optionally, nutrient components and/or antibiotics. About 10 pg pRK5-PRO polypeptide DNA is mixed with about 1 pg DNA encoding the VA RNA gene [Thimmappaya et al., Cell, L1:543 (1982)] and dissolved in 500 pl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCL. To this mixture is added, dropwise, 500 pul of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO 4 , and a precipitate is allowed to form for 10 minutes at 25"C. The precipitate is 20 suspended and added to the 293 cells and allowed to settle for about four hours at 37"C. The culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds. The 293 cells are then washed with serum free medium, fresh medium is added and the cells are incubated for about 5 days. Approximately 24 hours after the transfections, the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 pCi/ml "S-cysteine and 200 pCi/ml "S -methionine. After a 12 25 hour incubation, the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15% SDS gel. The processed gel may be dried and exposed to film for a selected period of time to reveal the presence of PRO polypeptide. The cultures containing transfected cells may undergo further incubation (in serum free medium) and the medium is tested in selected bioassays. In an alternative technique, PRO polypeptide may be introduced into 293 cells transiently using the dextran 30 sulfate method described by Somparyrac et al., Proc. Nati. Acad. Sci., 12:7575 (1981). 293 cells are grown to maximal density in a spinner flask and 700 pLg pRK5-PRO polypeptide DNA is added. The cells are first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate is incubated on the cell pellet for four hours. The cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 1g/ml bovine insulin and 0.1 pg/ml 35 bovine transferrin. After about four days, the conditioned media is centrifuged and filtered to remove cells and debris. The sample containing expressed PRO polypeptide can then be concentrated and purified by any selected method, such as dialysis and/or column chromatography. In another embodiment, PRO polypeptides can be expressed in CHO cells. The pRK5-PRO polypeptide can be transfected into CHO cells using known reagents such as CaPO 4 or DEAE-dextran. As described above, the 264 WO 99/46281 PCT/US99/05028 cell cultures can be incubated, and the medium replaced with culture medium (alone) or medium containing a radiolabel such as 3 1S-methionine. After determining the presence of PRO polypeptide, the culture medium may be replaced with serum free medium. Preferably, the cultures are incubated for about 6 days, and then the conditioned medium is harvested. The medium containing the expressed PRO polypeptide can then be concentrated and purified by any selected method. 5 Epitope-tagged PRO polypeptide may also be expressed in host CHO cells. The PRO polypeptide may be subcloned out of the pRK5 vector. The subclone insert can undergo PCR to fuse in frame with a selected epitope tag such as a poly-his tag into a Baculovirus expression vector. The poly-his tagged PRO polypeptide insert can then be subcloned into a SV40 driven vector containing a selection marker such as DHFR for selection of stable clones. Finally, the CHO cells can be transfected (as described above) with the SV40 driven vector. Labeling may be 10 performed, as described above, to verify expression. The culture medium containing the expressed poly-His tagged PRO polypeptide can then be concentrated and purified by any selected method, such as by Ni"-chelate affinity chromatography. Stable expression in CHO cells was performed using the following procedure. The proteins were expressed as an IgG construct (immunoadhesin), in which the coding sequences for the soluble forms (e.g. extracellular 15 domains) of the respective proteins were fused to an IgG1 constant region sequence containing the hinge, CH2 and CH2 domains and/or is a poly-His tagged form. Following PCR amplification, the respective DNAs were subcloned in a CHO expression vector using standard techniques as described in Ausubel et al., Current Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression vectors are constructed to have compatible restriction sites 5' and 3' of the DNA 20 of interest to allow the convenient shuttling of cDNA's. The vector used expression in CHO cells is as described in Lucas et al., Nucl. Acids Res. 24: 9 (1774-1779 (1996), and uses the SV40 early promoter/enhancer to drive expression of the cDNA of interest and dihydrofolate reductase (DHFR). DHFR expression permits selection for stable maintenance of the plasmid following transfection. Twelve micrograms of the desired plasmid DNA were introduced into approximately 10 million CHO cells 25 using commercially available transfection reagents Superfect' (Quiagen), Dosper' or Fugene' (Boehringer Mannheim). The cells were grown and described in Lucas et al., supra. Approximately 3 x 104 cells are frozen in an ampule for further growth and production as described below. The ampules containing the plasmid DNA were thawed by placement into water bath and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mLs of media and centrifuged at 1000 rpm 30 for 5 minutes. The supernatant was aspirated and the cells were resuspended in 10 mL of selective media (0.2 sm filtered PS20 with 5% 0.2 pm diafiltered fetal bovine serum). The cells were then aliquoted into a 100 mL spinner containing 90 mL of selective media. After 1-2 days, the cells were transferred into a 250 mL spinner filled with 150 mL selective growth medium and incubated at 37*C. After another 2-3 days, a 250 mL, 500 nL and 2000 mL spinners were seeded with 3 x 10' cells/mL. The cell media was exchanged with fresh media by centrifugation and 35 resuspension in production medium. Although any suitable CHO media may be employed, a production medium described in US Patent No. 5,122,469, issued June 16, 1992 was actually used. 3L production spinner is seeded at 1.2 x 106 cells/mL. On day 0, the cell number pH were determined. On day 1, the spinner was sampled and sparging with filtered air was commenced. On day 2, the spinner was sampled, the temperature shifted to 33*C, and 30 mL of 500 g/L glucose and 0.6 mL of 10% antifoam (e.g., 35% polydimethylsiloxane emulsion. Dow Corning 265 WO 99/46281 PCT/US99/05028 365 Medical Grade Emulsion). Throughout the production, pH was adjusted as necessary to keep at around 7.2. After 10 days, or until viability dropped below 70%, the cell culture was harvested by centrifugtion and filtering through a 0.22 pm filter. The filtrate was either stored at 4*C or immediately loaded onto columns for purification. For the poly-His tagged constructs, the proteins were purified using a Ni-NTA column (Qiagen). Before purification, imidazole was added to the conditioned media to a concentration of 5 mM. The conditioned media was 5 pumped onto a 6 ml Ni-NTA columnn equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCI and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4 C. After loading, the column was washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80*C. 10 Immunoadhesin (Fc containing) constructs of were purified from the conditioned media as follows. The conditioned medium was pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions into tubes containing 275 sL of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted into 15 storage buffer as described above for the poly-His tagged proteins. The homogeneity was assessed by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation. The following PRO polypeptides were successfully transiently expressed in CHO cells: PRO200, PR0320, PRO237, PRO273, PR0337, PRO846, PR0363, PRO322, PRO1083, PR0938, PRO1012, PRO1 114, PRO1008 and PRO1075. 20 The following PRO polypeptides were successfully transiently expressed in COS cells: PRO181, PRO195, PRO200, PR0320, PR0237, PR0273, PR0285, PR0337, PR0526, PR0540. PRO846, PR0362, PRO363, PRO700, PR0707, PR0617, PR0322. PR0719, PRO1083, PR0868, PR0866, PR0768, PR0938, PRO1012, PRO162, PRO1114, PR0827, PRO1008 and PRO1075. The following PRO polypeptides were successfully stably expressed in CHO cells: PRO181, PRO195, 25 PRO200, PR0320, PR0285, PR0337, PR0846, PR0362, PR0363, PR0707, PR0617, PR0322, PRO1083, PR0868, PRO866, PRO1017, PR0792, PR0788, PR0938, PRO1012, PRO162, PRO1114, PR0827, PRO1008, PRO1075 and PROl031. EXAMPLE 102: Expression of PRO Polypeptides in Yeast 30 The following method describes recombinant expression of a desired PRO polypeptide in yeast. First, yeast expression vectors are constructed for intracellular production or secretion of PRO polypeptides from the ADH2/GAPDH promoter. DNA encoding a desired PRO polypeptide, a selected signal peptide and the promoter is inserted into suitable restriction enzyme sites in the selected plasmid to direct intracellular expression of the PRO polypeptide. For secretion, DNA encoding the PRO polypeptide can be cloned into the selected plasmid, 35 together with DNA encoding the ADH2/GAPDH promoter, the yeast alpha-factor secretory signal/leader sequence, and linker sequences (if needed) for expression of the PRO polypeptide. Yeast cells, such as yeast strain AB 110, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gels with 266 WO 99/46281 PCT/US99/05028 Coomassie Blue stain. Recombinant PRO polypeptide can subsequently be isolated and purified by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing the PRO polypeptide may further be purified using selected column chromatography resins. 5 EXAMPLE 103: Expression of PRO Polypeptides in Baculovirus-Infected Insect Cells The following method describes recombinant expression of PRO polypeptides in Baculovirus-infected insect cells. The desired PRO polypeptide is fused upstream of an epitope tag contained with a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (like Fc regions of IgG). A variety of 10 plasmids may be employed, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, the PRO polypeptide or the desired portion of the PRO polypeptide (such as the sequence encoding the extracellular domain of a transmembrane protein) is amplified by PCR with primers complementary to the 5' and 3' regions. The 5' primer may incorporate flanking (selected) restriction enzyme sites. The product is then digested with those selected restriction enzymes and subcloned into the expression vector. 15 Recombinant baculovirus is generated by co-transfecting the above plasmid and BaculoGold TM virus DNA (Pharmingen) into Spodopterafrugiperda ("Sf9") cells (ATCC CRL 1711) using lipofectin (commercially available from GIBCO-BRL). After 4-5 days of incubation at 28"C, the released viruses are harvested and used for further amplifications. Viral infection and protein expression is performed as described by O'Reilley et al., Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford University Press (1994). 20 Expressed poly-his tagged PRO polypeptide can then be purified, for example, by Ni 2 *-chelate affinity chromatography as follows. Extracts are prepared from recombinant virus-infected Sf9 cells as described by Rupert et al., Nature, 362:175-179 (1993). Briefly, Sf9 cells are washed, resuspended in sonication buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl,; 0.1 mM EDTA; 10% Glycerol; 0.1% NP-40; 0.4 M KCl), and sonicated twice for 20 seconds on ice. The sonicates are cleared by centrifugation, and the supernatant is diluted 50-fold in loading buffer 25 (50 mM phosphate, 300 mM NaCl, 10% Glycerol, pH 7.8) and filtered through a 0.45 pm filter. A Ni 2 +-NTA agarose column (commercially available from Qiagen) is prepared with a bed volume of 5 mL, washed with 25 mL of water and equilibrated with 25 mL of loading buffer. The filtered cell extract is loaded onto the column at 0.5 mL per minute. The column is washed to baseline A,8, with loading buffer, at which point fraction collection is started. Next, the column is washed with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% Glycerol, pH 30 6.0), which elutes nonspecifically bound protein. After reaching A,,, baseline again, the column is developed with a 0 to 500 mM Imidazole gradient in the secondary wash buffer. One mL fractions are collected and analyzed by SDS-PAGE and silver staining or western blot with Ni2*-NTA-conjugated to alkaline phosphatase (Qiagen). Fractions containing the eluted His,,-tagged PRO polypeptide are pooled and dialyzed against loading buffer. Alternatively, purification of the IgG tagged (or Fc tagged) PRO polypeptide can be performed using known 35 chromatography techniques, including for instance, Protein A or protein G column chromatography. PRO195. PR0526, PR0540, PRO846, PR0362, PR0363, PR0700, PR0707, PR0322, PR0719, PRO1083, PRO868. PR0866. PR0768, PR0788. PR0938. PR0827 and PROl031 were successfully expressed in baculovirus infected Sf9 insect cells. While the expression was actually performed in a 0.5-2 L scale, it can be readily scaled up for larger (e.g. 8 L) preparations. The proteins were expressed as an IgG construct (immunoadhesin), in 267 WO 99/46281 PCT/US99/05028 which the protein extracellular region was fused to an IgGI constant region sequence containing the hinge, CH2 and CH3 domains and/or in poly-His tagged forms. For expression in baculovirus infected Sf9 cells, following PCR amplification, the respective coding sequences were subcloned into a baculovirus expression vector (pb.PH.IgG for IgG fusions and pb.PH.His.c for poly His tagged proteins), and the vector and Baculogold* baculovirus DNA (Pharmingen) were co-transfected into 105 5 Spodopterafrugiperda ("Sf9") cells (ATCC CRL 1711), using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His are modifications of the commercially available baculovirus expression vector pVL1393 (Pharmingen), with modified polylinker regions to include the His or Fc tag sequences. The cells were grown in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone). Cells were incubated for 5 days at 28*C. The supernatant was harvested and subsequently used for the first viral amplification by infecting Sf9 cells in Hink's TNM-FH medium supplemented 10 with 10% FBS at an approximate multiplicity of infection (MOI) of 10. Cells were incubated for 3 days at 28*C. The supernatant was harvested and the expression of the constructs in the baculovirus expression vector was determined by batch binding of 1 ml of supernatant to 25 mL of Ni-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE analysis comparing to a known concentration of protein standard by Coomassie blue staining. 15 The first viral amplification supernatant was used to infect a spinner culture (500 ml) of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0.1. Cells were incubated for 3 days at 28*C. The supernatant was harvested and filtered. Batch binding and SDS-PAGE analysis was repeated, as necessary, until expression of the spinner culture was confirmed. The conditioned medium from the transfected cells (0.5 to 3 L) was harvested by centrifugation to remove 20 the cells and filtered through 0.22 micron filters. For the poly-His tagged constructs, the protein construct were purified using a Ni-NTA column (Qiagen). Before purification, imidazole was added to the conditioned media to a concentration of 5 mM. The conditioned media were pumped onto a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4*C. After loading, the column was washed with additional equilibration buffer and the protein eluted with equilibration buffer 25 containing 0.25 M imidazole. The highly purified protein was subsequently desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80*C. Immunoadhesin (Fc containing) constructs of proteins were purified from the conditioned media as follows. The conditioned media were pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 30 mM Na phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting I ml fractions into tubes containing 275 mL of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted into storage buffer as described above for the poly-His tagged proteins. The homogeneity of the proteins was verified by SDS polyacrylamide gel (PEG) electrophoresis and N-terminal amino acid sequencing by Edman degradation. 35 PRO81, PRO195, PRO200, PR0320, PRO237, PR0273, PRO285, PR0337. PR0526, PR0540, PRO846, PR0362, PRO363, PRO617, PR0322, PRO1083, PRO868, 768, PR0792, PR0788, PRO162, PRO1114, PR0827, PRO1075 and PRO1031 were successfully expressed in baculovirus infected Hi5 insect cells. While the expression was actually performed in a 0.5-2 L scale, it can be readily scaled up for larger (e.g. 8 L) preparations. For expression in baculovirus-infected Hi5 insect cells, the PRO polypeptide-encoding DNA may be 268 WO 99/46281 PCT/US99/05028 amplified with suitable systems, such as Pfu (Stratagene), or fused upstream (5'-of) of an epitope tag contained with a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (like Fc regions of IgG). A variety of plasmids may be employed, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, the PRO polypeptide or the desired portion of the PRO polypeptide (such as the sequence encoding the extracellular domain of a transmembrane protein) is amplified by PCR with primers 5 complementary to the 5' and 3' regions. The 5' primer may incorporate flanking (selected) restriction enzyme sites. The product is then digested with those selected restriction enzymes and subcloned into the expression vector. For example, derivatives of pVL1393 can include the Fc region of human IgG (pb.PH.IgG) or an 8 histidine (pb.PH.His) tag downstream (3'-of) the NAME sequence. Preferably, the vector construct is sequenced for confirmation. Hi5 cells are grown to a confluency of 50% under the conditions of, 27*C, no C02, NO pen/strep. For each 10 150 mm plate, 30 ug of pIE based vector containing PRO polypeptide is mixed with 1 ml Ex-Cell medium (Media: Ex-Cell 401 + 1/100 L-Glu JRH Biosciences #14401-78P (note: this media is light sensitive)), and in a separate tube, 100 ul of CellFectin (CellFECTIN (GibcoBRL #10362-010) (vortexed to mix)) is mixed with 1 ml of Ex-Cell medium. The two solutions are combined and allowed to incubate at room temperature for 15 minutes. 8 ml of Ex Cell media is added to the 2ml of DNA/CellFECTIN mix and this is layered on Hi5 cells that have been washed once 15 with Ex-Cell media. The plate is then incubated in darkness for 1 hour at room temperature. The DNA/CelIFECTIN mix is then aspirated, and the cells are washed once with Ex-Cell to remove excess CellFECTIN . 30 ml of fresh Ex-Cell media is added and the cells are incubated for 3 days at 28"C. The supernatant is harvested and the expression of the PRO polypeptide in the baculovirus expression vector can be determined by batch binding of 1 ml of supernatent to 25 mL of Ni-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A Sepharose CL-4B 20 beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE analysis comparing to a known concentration of protein standard by Coomassie blue staining. The conditioned media from the transfected cells (0.5 to 3 L) is harvested by centrifugation to remove the cells and filtered through 0.22 micron filters. For the poly-His tagged constructs, the protein comprising the PRO polypeptide is purified using a Ni-NTA column (Qiagen). Before purification, imidazole is added to the conditioned 25 media to a concentration of 5 mM. The conditioned media is pumped onto a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4 0 C. After loading, the column is washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein is subsequently deslated into a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column 30 and stored at -80"C. Immunoadhesin (Fc containing) constructs of proteins are purified from the conditioned media as follows. The conditioned media is pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column is washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately neutralized by collecting I ml fractions into tubes 35 containing 275 mL of 1 M Tris buffer, pH 9. The highly purified protein is subsequently desalted into storage buffer as described above for the poly-His tagged proteins. The homogeneity of PRO polypeptide can be assessed by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation and other analytical procedures as desired or necessary. 269 WO 99/46281 PCT/US99/05028 EXAMPLE 104: Prenaration of Antibodies that Bind to PRO Polypeptides This example illustrates preparation of monoclonal antibodies which can specifically bind to a PRO polypeptide. Techniques for producing the monoclonal antibodies are known in the art and are described, for instance, in Goding, jp=. Immunogens that may be employed include purified PRO polypeptide, fusion proteins containing 5 the PRO polypeptide. and cells expressing recombinant PRO polypeptide on the cell surface. Selection of the immunogen can be made by the skilled artisan without undue experimentation. Mice, such as Balb/c, are immunized with the PRO polypeptide immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally in an amount from 1-100 micrograms. Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into 10 the animal's hind foot pads. The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. Thereafter, for several weeks, the mice may also be boosted with additional immunization injections. Serum samples may be periodically obtained from the mice by retro-orbital bleeding for testing in ELISA assays to detect anti-PRO polypeptide antibodies. After a suitable antibody titer has been detected, the animals "positive" for antibodies can be injected with 15 a final intravenous injection of PRO polypeptide. Three to four days later, the mice are sacrificed and the spleen cells are harvested. The spleen cells are then fused (using 35% polyethylene glycol) to a selected murine myeloma cell line such as P3X63AgU.l, available from ATCC, No. CRL 1597. The fusions generate hybridoma cells which can then be plated in 96 well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids. 20 The hybridoma cells will be screened in an ELISA for reactivity against the PRO polypeptide. Determination of "positive" hybridoma cells secreting the desired monoclonal antibodies against the PRO polypeptide is within the skill in the art. The positive hybridoma cells can be injected intraperitoneally into syngeneic Balb/c mice to produce ascites containing the anti-PRO polypeptide monoclonal antibodies. Alternatively, the hybridoma cells can be grown in tissue 25 culture flasks or roller bottles. Purification of the monoclonal antibodies produced in the ascites can be accomplished using ammonium sulfate precipitation, followed by gel exclusion chromatography. Alternatively, affinity chromatography based upon binding of antibody to protein A or protein G can be employed. EXAMPLE 105: Chimeric PRO Polypeptides 30 PRO polypeptides may be expressed as chimeric proteins with one or more additional polypeptide domains added to facilitate protein purification. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin. and the domain utilized in the FLAGSTM extension/affinity purification system (Immunex Corp., Seattle Wash.). The inclusion of a cleavable linker sequence 35 such as Factor XA or enterokinase (Invitrogen, San Diego Calif.) between the purification domain and the PRO polypeptide sequence may be useful to facilitate expression of DNA encoding the PRO polypeptide. 270 WO 99/46281 PCT/US99/05028 EXAMPLE 106: Purification of PRO Polyvevtides Using Specific Antibodies Native or recombinant PRO polypeptides may be purified by a variety of standard techniques in the art of protein purification. For example, pro-PRO polypeptide, mature PRO polypeptide, or pre-PRO polypeptide is purified by immunoaffinity chromatography using antibodies specific for the PRO polypeptide of interest. In general, an immunoaffinity column is constructed by covalently coupling the anti-PRO polypeptide antibody to an activated 5 chromatographic resin. Polyclonal immunoglobulins are prepared from immune sera either by precipitation with ammonium sulfate or by purification on immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway, N.J.). Likewise, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography on immobilized Protein A. Partially purified immunoglobulin is covalently attached to a chromatographic resin such 10 as CnBr-activated SEPHAROSE" (Pharmacia LKB Biotechnology). The antibody is coupled to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions. Such an immunoaffinity column is utilized in the purification of PRO polypeptide by preparing a fraction from cells containing PRO polypeptide in a soluble form. This preparation is derived by solubilization of the whole cell or of a subcellular fraction obtained via differential centrifugation by the addition of detergent or by other 15 methods well known in the art. Alternatively, soluble PRO polypeptide containing a signal sequence may be secreted in useful quantity into the medium in which the cells are grown. A soluble PRO polypeptide-containing preparation is passed over the immunoaffinity column, and the column is washed under conditions that allow the preferential absorbance of PRO polypeptide (e.g., high ionic strength buffers in the presence of detergent). Then, the column is eluted under conditions that disrupt antibody/PRO 20 polypeptide binding (e.g., a low pH buffer such as approximately pH 2-3, or a high concentration of a chaotrope such as urea or thiocyanate ion), and PRO polypeptide is collected. EXAMPLE 107: Drug Screening This invention is particularly useful for screening compounds by using PRO polypeptides or binding 25 fragment thereof in any of a variety of drug screening techniques. The PRO polypeptide or fragment employed in such a test may either be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the PRO polypeptide or fragment. Drugs are screened against such transformed cells in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding 30 assays. One may measure, for example. the formation of complexes between PRO polypeptide or a fragment and the agent being tested. Alternatively, one can examine the diminution in complex formation between the PRO polypeptide and its target cell or target receptors caused by the agent being tested. Thus, the present invention provides methods of screening for drugs or any other agents which can affect a PRO polypeptide-associated disease or disorder. These methods comprise contacting such an agent with an PRO 35 polypeptide or fragment thereof and assaying (I) for the presence of a complex between the agent and the PRO polypeptide or fragment, or (ii) for the presence of a complex between the PRO polypeptide or fragment and the cell, by methods well known in the art. In such competitive binding assays, the PRO polypeptide or fragment is typically labeled. After suitable incubation, free PRO polypeptide or fragment is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of the particular agent to bind to PRO 271 WO 99/46281 PCTIUS99/05028 polypeptide or to interfere with the PRO polypeptide/cell complex. Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to a polypeptide and is described in detail in WO 84/03564, published on September 13, 1984. Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. As applied to a PRO polypeptide, the peptide test compounds are reacted with 5 PRO polypeptide and washed. Bound PRO polypeptide is detected by methods well known in the art. Purified PRO polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on the solid support. This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding PRO polypeptide specifically compete with a test compound for binding to PRO 10 polypeptide or fragments thereof. In this manner, the antibodies can be used to detect the presence of any peptide which shares one or more antigenic determinants with PRO polypeptide. EXAMPLE 108: Rational Drug Design The goal of rational drug design is to produce structural analogs of biologically active polypeptide of interest 15 (i.e., a PRO polypeptide) or of small molecules with which they interact, e.g., agonists, antagonists, or inhibitors. Any of these examples can be used to fashion drugs which are more active or stable forms of the PRO polypeptide or which enhance or interfere with the function of the PRO polypeptide in vivo (c.f, Hodgson, Bio/Technology, 9: 19-21 (1991)). In one approach, the three-dimensional structure of the PRO polypeptide, or of an PRO polypeptide-inhibitor 20 complex, is determined by x-ray crystallography, by computer modeling or, most typically, by a combination of the two approaches. Both the shape and charges of the PRO polypeptide must be ascertained to elucidate the structure and to determine active site(s) of the molecule. Less often, useful information regarding the structure of the PRO polypeptide may be gained by modeling based on the structure of homologous proteins. In both cases, relevant structural information is used to design analogous PRO polypeptide-like molecules or to identify efficient inhibitors. 25 Useful examples of rational drug design may include molecules which have improved activity or stability as shown by Braxton and Wells, Biochemistry. 11:7796-7801 (1992) or which act as inhibitors, agonists, or antagonists of native peptides as shown by Athauda et al., J. Biochem., 113:742-746 (1993). It is also possible to isolate a target-specific antibody, selected by functional assay, as described above, and then to solve its crystal structure. This approach, in principle, yields a pharmacore upon which subsequent drug 30 design can be based. It is possible to bypass protein crystallography altogether by generating anti-idiotypic antibodies (anti-ids) to a functional, pharmacologically active antibody. As a mirror image of a mirror image, the binding site of the anti-ids would be expected to be an analog of the original receptor. The anti-id could then be used to identify and isolate peptides from banks of chemically or biologically produced peptides. The isolated peptides would then act as the pharmacore. 35 By virtue of the present invention, sufficient amounts of the PRO polypeptide may be made available to perform such analytical studies as X-ray crystallography. In addition, knowledge of the PRO polypeptide amino acid sequence provided herein will provide guidance to those employing computer modeling techniques in place of or in addition to x-ray crystallography. 272 WO 99/46281 PCT/US99/05028 EXAMPLE_109: Ability of PRO Polvoeotides to Inhibit Vascular Endothelial Growth Factor (VEGF) Stimulated Proliferation of Endothelial Cell Growth The ability of various PRO polypeptides to inhibit VEGF stimulated proliferation of endothelial cells was tested. Specifically, bovine adrenal cortical capillary endothelial (ACE) cells (from primary culture, maximum 12-14 passages) were plated on 96-well microtiter plates (Amersham Life Science) at a density of 500 cells/well per 100 5 yL in low glucose DMEM, 10% calf serum, 2 mM glutamine, lx pen/strept and fungizone, supplemented with 3 ng/mL VEGF. Controls were plated the same way but some did not include VEGF. A test sample of the PRO polypeptide of interest was added in a 100 pl volume for a 200 pl final volume. Cells were incubated for 6-7 days at 37'C. The media was aspirated and the cells washed 1x with PBS. An acid phosphatase reaction mixture (100 iL, 0.1M sodium acetate, pH 5.5, 0.1% Triton-100, 10 mM p-nitrophenyl phosphate) was added. After incubation 10 for 2 hours at 37-C, the reaction was stopped by addition of 10 pl IN NaOH. OD was measured on microtiter plate reader at 405 nm. Controls were no cells, cells alone, cells + FGF (5 ng/mL), cells + VEGF (3 ng/mL), cells + VEGF (3 ng/ml) + TGF-p (1 ng/ml), and cells + VEGF (3ng/mL) + LIF (5 ng/mL). (TGF-p at a 1 ng/ml concentration is known to block 70-90% of VEGF stimulated cell proliferation.) The results were assessed by calculating the percentage inhibition of VEGF (3 ng/ml) stimulated cells 15 proliferation, determined by measuring acid phosphatase activity at OD405 nm. (1) relative to cells without stimulation, and (2) relative to the reference TGF-P inhibition of VEGF stimulated activity. The results are indicative of the utility of the PRO polypeptides in cancer therapy and specifically in inhibiting tumor angiogenesis. The PRO polypeptides demonstrated as being capable of inhibiting VEGF stimulated proliferation of endothelial cell growth at various concentrations include PR0200 and PR0320. 20 EXAMPLE 110: Retinal Neuron Survival This example demonstrates that various PRO polypeptides have efficacy in enhancing the survival of retinal neuron cells. Sprague Dawley rat pups at postnatal day 7 (mixed population: glia and retinal neuronal types) are killed 25 by decapitation following CO, anesthesia and the eyes are removed under sterile conditions. The neural retina is dissected away from the pigment epithelium and other ocular tissue and then dissociated into a single cell suspension using 0.25% trypsin in Ca 2 +, Mg 2 +-free PBS. The retinas are incubated at 37'C for 7-10 minutes after which the trypsin is inactivated by adding 1 mil soybean trypsin inhibitor. The cells are plated at 100,000 cells per well in 96 well plates in DMEM/F12 supplemented with N2 and with or without the specific test PRO polypeptide. Cells for 30 all experiments are grown at 37"C in a water saturated atmosphere of 5% CO_ After 2-3 days in culture, cells are stained with calcein AM then fixed using 4% paraformaldehyde and stained with DAPI for determination of total cell count. The total cells (fluorescent) are quantified at 20X objective magnification using CCD camera and NIH image software for MacIntosh. Fields in the well are chosen at random. The effect of various concentration of PRO polypeptides is calculated by dividing the total number of calcein 35 AM positive cells at 2-3 days in culture by the total number of DAPI-labeled cells at 2-3 days in culture. Anything above 30% survival is considered positive. The following PRO polypeptides were positive in this assay: PR0200, PRO540, PR0846 and PRO617. 273 WO 99/46281 PCT/US99/05028 EXAMPLE 111: Rod Photoreceptor Survival This example demonstrates that various PRO polypeptides have efficacy in enhancing the survival of rod photoreceptor cells. Sprague Dawley rat pups at 7 day postnatal (mixed population: glia and retinal neuronal cell types) are killed by decapitation following CO, anesthesis and the eyes are removed under sterile conditions. The neural retina is 5 dissected away form the pigment epithelium and other ocular tissue and then dissociated into a single cell suspension using 0.25% trypsin in Ca 2 *, Mg 2 +-free PBS. The retinas are incubated at 37*C for 7-10 minutes after which the trypsin is inactivated by adding 1 ml soybean trypsin inhibitor. The cells are plated at 100,000 cells per well in 96 well plates in DMEM/F12 supplemented with N2 and with or without the specific test PRO polypeptide. Cells for all experiments are grown at 37*C in a water saturated atmosphere of 5% C02. After 2-3 days in culture, cells are 10 fixed using 4% paraformaldehyde, and then stained using CellTracker Green CMFDA. Rho 4D2 (ascites or IgG 1:100), a monoclonal antibody directed towards the visual pigment rhodopsin is used to detect rod photoreceptor cells by indirect immunofluorescence. The results are reported as % survival: total number of calcein/CellTracker rhodopsin positive cells at 2-3 days in culture, divided by the total number of rhodopsin positive cells at time 2-3 days in culture. The total cells (fluorescent) are quantified at 20x objective magnification using a CCD camera and NIH 15 image software for Macintosh. Fields in the well are chosen at random. With regard to the effect of various concentration of PRO polypeptides, anything above 10% survival is considered positive. The following PRO polypeptides tested positive in this assay: PRO200, PRO540, PRO846 and PR0617. 20 EXAMPLE 112: Ability of PRO Polypeptides to Stimulate the Release of Proteoglycans from Cartilage The ability of various PRO polypeptides to stimulate the release of proteoglycans from cartilage tissue was tested as follows. The metacarphophalangeal joint of 4-6 month old pigs was aseptically dissected, and articular cartilage was removed by free hand slicing being careful to avoid the underlying bone. The cartilage was minced and cultured in 25 bulk for 24 hours in a humidified atmosphere of 95% air, 5% CO, in serum free (SF) media (DME/F12 1:1) woth 0.1% BSA and 100U/ml penicillin and 100pig/ml streptomycin. After washing three times, approximately 100 mg of articular cartilage was aliquoted into micronics tubes and incubated for an additional 24 hours in the above SF media. PRO polypeptides were then added at 1% either alone or in combination with 18 ng/ml interleukin-la, a known stimulator of proteoglycan release from cartilage tissue. The supernatant was then harvested and assayed for 30 the amount of proteoglycans using the 1,9-dimethyl-methylene blue (DMB) colorimetric assay (Farndale and Buttle, Biochem. Biophys. Acta 883:173-177 (1985)). A positive result in this assay indicates that the test polypeptide will find use, for example, in the treatment of sports-related joint problems, articular cartilage defects, osteoarthritis or rheumatoid arthritis. When PR0200 polypeptides were tested in the above assay, the polypeptides demonstrated a marked ability 35 to stimulate release of proteoglycans from cartilage tissue both basally and after stimulation with interleukin-la and at 24 and 72 hours after treatment, thereby indicating that PRO200 polypeptides are useful for stimulating proteoglycan release from cartilage tissue. 274 WO 99/46281 PCT/US99/05028 EXAMPLF 113: In Vitro Antiproliferative Assay The antiproliferative activity of various PRO polypeptides was determined in the investigational, disease oriented in vitro anti-cancer drug discovery assay of the National Cancer Institute (NCI), using a sulforhodamine B (SRB) dye binding assay essentially as described by Skehan et al., J. Nati. Cancer Inst. 82:1107-1112 (1990). The 60 tumor cell lines employed in this study ("the NCI panel"), as well as conditions for their maintenance and culture 5 in vitro have been described by Monks et al., J. Natl. Cancer Inst. 83:757-766 (1991). The purpose of this screen is to initially evaluate the cytotoxic and/or cytostatic activity of the test compounds against different types of tumors (Monks et al., supra; Boyd, Cancer: Princ. Pract. Oncol. Update 3(10):1-12 [1989]). Cells from approximately 60 human tumor cell lines were harvested with trypsin/EDTA (Gibco), washed once, resuspended in IMEM and their viability was determined. The cell suspensions were added by pipet (100 pL 10 volume) into separate 96-well microtiter plates. The cell density for the 6-day incubation was less than for the 2-day incubation to prevent overgrowth. Inoculates were allowed a preincubation period of 24 hours at 37*C for stabilization. Dilutions at twice the intended test concentration were added at time zero in 100 jpL aliquots to the microtiter plate wells (1:2 dilution). Test compounds were evaluated at five half-log dilutions (1000 to 100,000-fold). Incubations took place for two days and six days in a 5% CO, atmosphere and 100% humidity. 15 After incubation, the medium was removed and the cells were fixed in 0.1 ml of 10% trichloroacetic acid at 40*C. The plates were rinsed five times with deionized water, dried, stained for 30 minutes with 0.1 ml of 0.4% sulforhodamine B dye (Sigma) dissolved in 1% acetic acid, rinsed four times with 1 % acetic acid to remove unbound dye, dried, and the stain was extracted for five minutes with 0.1 ml of 10 mM Tris base [tris(hydroxymethyl)aminomethane], pH 10.5. The absorbance (OD) of sulforhodamine B at 492 nm was measured 20 using a computer-interfaced, 96-well microtiter plate reader. A test sample is considered positive if it shows at least 50% growth inhibitory effect at one or more concentrations. The following PRO polypeptides gave positive results in at least one tumor cell line: PRO181, PR0237, PR0526, PR0362 and PR0866. 25 EXAMPLE 114: Gene Amplification This example shows that genes encoding various PRO polypeptides are amplified in the genome of certain human cancers. Amplification is associated with overexpression of the gene product, indicating that the PRO polypeptide is a useful target for therapeutic intervention in certain cancers such as colon, lung and other cancers. Therapeutic agent may take the form of antagonists of PRO polypeptide-encoding genes, for example, murine-human 30 chimeric, humanized or human antibodies against the PRO polypeptide. The starting material for the screen was genomic DNA isolated from a variety cancers. The DNA is quantitated precisely, e.g., fluorometrically. As a negative control, DNA was isolated from the cells of ten normal healthy individuals which was pooled and used as assay controls for the gene copy in healthy individuals (NorHu). The 5' nuclease assay (for example, TaqMan T M ) and real-time quantitative PCR (for example, ABI Prizm 35 7700 Sequence Detection System m (Perkin Elmer, Applied Biosystems Division, Foster City, CA)), were used to find genes potentially amplified in certain cancers. The results were used to determine whether the DNA encoding the PRO polypeptide is over-represented in any of the lung and colon cancers that were screened. The result was reported in Delta CT units. One unit corresponds 1 PCR cycle or approximately a 2-fold amplification relative to normal, two units corresponds to 4-fold, 3 units to 8-fold and so on. Quantitation was obtained using primers and 275 WO 99/46281 PCT/US99/05028 a Taqman" fluorescent derived from the PRO polypeptide-encoding gene. Regions of the PRO polypeptide which are most likely to contain unique nucleic acid sequences and which are least likely to have spliced out introns are preferred for the primer derivation, e.g., 3'-untranslated region. The 5' nuclease assay reaction is a fluorescent PCR-based technique which makes use of the 5' exonuclease activity of Taq DNA polymerase enzyme to monitor amplification in real time. Two oligonucleotide primers are used 5 to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the probe is cleaved by the Taq DNA polymerase enzyme in a template-dependent 10 manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data. The 5' nuclease procedure is run on a real-time quantitative PCR device such as the ABI Prism 7700TM Sequence Detection. The system consists of a thermocyler, laser, charge-coupled device (CCD) camera and 15 computer. The system amplifies samples in a 96-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD. The system includes software for running the intrument and for analyzing the data. 5' Nuclease assay data are initially expressed as Ct, or the threshold cycle. This is defined as the cycle at which the reporter signal accumulates above the background level of fluorescence. The Ct values are used as 20 quantitative measurement of the relative number of starting copies of a particular target sequence in a nucleic acid sample. Genes encoding the following PRO polypeptides were found to be amplified in the above assay: PR0213-1, PRO237, PR0324, PR0351, PR0362, PR0853, PR0615, PRO531, PR0618, PR0772, PR0703, PRO474, PRO1017 and PR0792. 25 EXAMPLE 115: Induction of c-fos in Endothelial Cells Human venous umbilical vein endothelial cells (HUVEC, Cell Systems) in growth media (50:50 without glycine, 1% glutamine, 10mM Hepes, 10% FBS, 10 ng/ml bFGF), were plated on 96-well microtiter plates at a cell density of lx10 4 cells/well. The day after plating, the cells were starved by removing the growth media and treating 30 the cells with 100 I/well test samples and controls (positive control: growth media; negative control: Protein 32). The cells were incubated for 30 minutes at 37*C, in 5% CO 2 . The samples were removed, and the first part of the bDNA kit protocol (Chiron Diagnostics, cat. #6005-037) was followed. Briefly, the amounts of the TM Lysis Buffer and Probes needed for the tests were calculated based on information provided by the manufacturer. The appropriate amounts of thawed Probes were added to the TM Lysis 35 Buffer. The Capture Hybridization Buffer was warmed to room temperature. The bDNA strips were set up in the metal strip holders, and 100 sl of Capture Hybridization Buffer were added to each b-DNA well needed, followed by incubation for at least 30 minutes. The test plates with the cells were removed from the incubator, and the media was gently removed using the vacuum manifold. 100pl of Lysis Hybridization Buffer with Probes were quickly pipetted into each well of the microtiter plates. The plates were then incubated at 55*C for 15 minutes. Upon 276 WO 99/46281 PCT/US99/05028 removal from the incubator, the plates were placed on the vortex mixer with the microtiter adapter head and vortex on the #2 setting for one minute. 80 pl of the lysate were removed and added to the bDNA wells containing the Capture Hybridization Buffer, and pipetted up and down to mix. The plates were incubated at 53*C for at least 16 hours. On the next day, the second part of the bDNA kit protocol was followed. Specifically, the Plates were 5 removed from the incubator and placed on the bench to cool for 10 minutes. The volumes of additions needed were calculated based upon information provided by the manufacturer. An Amplifier Working Solution was prepared by making a 1:100 dilution of the Amplifier Concentrate (20 fm/pl) in AL Hybridization Buffer. The hybridization mixture was removed from the plates and washed twice with Wash A. 50 pl of Amplifier Working Solution were added to each well and the wells were incubated at 53*C for 30 minutes. The plates were then removed from the 10 incubator and allowed to cool for 10 minutes. The Label Probe Working Solution was prepared by making a 1:100 dilution of Label Concentrate (40 pmoles/pAl) in AL Hybridization Buffer. After the 10 minutes cool down period, the amplifier hybridization mixture was removed and the plates washed twice with Wash A. 50pl of Label Probe Working Solution were added to each well and the wells were incubated at 53*C for 15 minutes. After cooling for 10 minutes, the Substrate was warmed to room temperature. Upon addition of 3 pl of Substrate Enhancer to each 15 ml of Substrate needed for the assay, the plates were allowed to cool for 10 minutes, the label hybridization mixture was removed, and the plates were washed twice with Wash A and three-times with Wash D. 50pl of the Substrate Solution with Enhancer were added to each well. The plates were incubated for 30 minutes at 37*C and RLU read in an appropriate luminometer. The replicates were averaged and the coefficient of variation was determined. The measure of activity of 20 the fold increase over the Protein 32 (buffer control) value indicated by chemoluminescence units (RLU). Samples which showed an at least two-fold value over the Protein 32 value were considered positive. PR0938 was positive in the above assay. EXAMPLE 116: Proliferation of Rat Utricular Supporting Cells 25 In an effort to identify PRO polypeptides that act as potent mitogens for inner ear supporting cells which are hair cell progenitors (related to auditory hair cell regeneration), various PRO polypeptides were tested in the following assay. The rat utricular epithelial cell line (UEC-4 cells) are aliquoted into 96 well plates with a density of 3000 cells/well in 200 pl of serum-containing medium at 33"C. After overnight, the cultures are switched to serum-free 30 medium at 37"C and the PRO polypeptide samples are added at various dilutions. After 24h incubation, 3 H-thymidine (1 pCi/well) is aded to the cultures for an additional 24h. The cells are then harvested using a Tomtec cell harvester. Because the epithelial cells are grown on a polylysine substrate, trypsin (1 mg/ml) is added to the culture wells for 30 min at 37"C to lift the cells before cell harvest. Cpm/well are counted with a matrix 9600 gas counter (Packard Instrument Company, Downers Grove, IL). Data is collected from 3 culture wells from each of the experimental 35 groups and expressed as mean ± SEM. A two-tailed, unpaired t-test is used for statistical analysis, as compared to the control group (treatment with TGF-a). Average cpm counts which are at least 30% higher than the control values are considered positive for the assay. The following PRO polypeptides were positive in this assay: PR0337, PR0363 and PRO1012. 277 WO 99/46281 PCT/US99/05028 EXAMPLE 117: In situ Hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations. It may be useful, for example, to identify sites of gene expression, analyze the tissue distribution of transcription, identify and localize viral infection, follow changes in specific mRNA synthesis and aid in chromosome mapping. 5 In situ hybridization was performed following an optimized version of the protocol by Lu and Gillett, Cell Vision 1:169-176 (1994), using PCR-generated "P-labeled riboprobes. Briefly, formalin-fixed, paraffin-embedded human tissues were sectioned, deparaffinized, deproteinated in protease K (20 g/ml) for 15 minutes at 37 C, and further processed for in situ hybridization as described by Lu and Gillett, supra. A ["-P] UTP-labeled antisense riboprobe was generated from a PCR product and hybridized at 55'C overnight. The slides were dipped in Kodak 10 NTB2 nuclear track emulsion and exposed for 4 weeks. "P-Riboprobe synthesis 6.0 tl (125 mCi) of "P-UTP (Amersham BF 1002, SA <2000 Ci/mmol) were speed vac dried. To each tube containing dried 3 P-UTP, the following ingredients were added: 2.0 pl 5x transcription buffer 15 1.0 d DTT (100 mM) 2.0 pl NTP mix (2.5 mM : 10 t; each of 10 mM GTP, CTP & ATP + 10 tl H 2 O) 1.0 d UTP (50 pM) 1.0 pl Rnasin 1.0 tl DNA template (1pig) 20 1.0 Al H 2 O 1.0 d RNA polymerase (for PCR products T3 = AS, T7 = S, usually) The tubes were incubated at 37*C for one hour. 1.0 pl RQ1 DNase were added, followed by incubation at 37'C for 15 minutes. 90 tl TE (10 mM Tris pH 7.6/1mM EDTA pH 8.0) were added, and the mixture was pipetted onto DE81 paper. The remaining solution was loaded in a Microcon-50 ultrafiltration unit, and spun using 25 program 10 (6 minutes). The filtration unit was inverted over a second tube and spun using program 2 (3 minutes). After the final recovery spin, 100 pl TE were added. 1 td of the final product was pipetted on DE81 paper and counted in 6 mil of Biofluor II. The probe was run on a TBE/urea gel. 1-3 pl of the probe or 5 pl of RNA Mrk III were added to 3 pl of loading buffer. After heating on a 95*C heat block for three minutes, the gel was immediately placed on ice. The 30 wells of gel were flushed, the sample loaded, and run at 180-250 volts for 45 minutes. The gel was wrapped in saran wrap and exposed to XAR film with an intensifying screen in -70'C freezer one hour to overnight. 3 P-Hybridization A. Pretreatment of frozen sections The slides were removed from the freezer, placed on aluminium trays and thawed at room temperature for 35 5 minutes. The trays were placed in 55 C incubator for five minutes to reduce condensation. The slides were fixed for 10 minutes in 4% paraformaldehyde on ice in the fume hood, and washed in 0.5 x SSC for 5 minutes, at room temperature (25 ml 20 x SSC + 975 ml SQ H20). After deproteination in 0.5 ptg/ml proteinase K for 10 minutes at 37'C (12.5 pl of 10 mg/mil stock in 250 ml prewarmed RNase-free RNAse buffer), the sections were washed in 0.5 x SSC for 10 minutes at room temperature. The sections were dehydrated in 70%, 95%, 100% ethanol, 2 278 WO 99/46281 PCTIUS99/05028 minutes each. B. Pretreatment of paraffin-embedded sections The slides were deparaffinized, placed in SQ H.0, and rinsed twice in 2 x SSC at room temperature, for 5 minutes each time. The sections were deproteinated in 20 pg/ml proteinase K (500 pl of 10 mg/mil in 250 ml RNase-free RNase buffer; 37'C, 15 minutes) - human embryo, or 8 x proteinase K (100 pl in 250 ml Rnase buffer, 5 37*C, 30 minutes) - formalin tissues. Subsequent rinsing in 0.5 x SSC and dehydration were performed as described above. C. Prehybridization The slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50% formamide) - saturated filter paper. The tissue was covered with 50 d of hybridization buffer (3.75g Dextran Sulfate + 6 ml SQ HO), vortexed 10 and heated in the microwave for 2 minutes with the cap loosened. After cooling on ice, 18.75 ml formamide, 3.75 ml 20 x SSC and 9 ml SQ H 2 0 were added, the tissue was vortexed well, and incubated at 42'C for 1-4 hours. D. Hybridization 1.0 x 106 cpm probe and 1.0 pl tRNA (50 mg/ml stock) per slide were heated at 95 C for 3 minutes. The slides were cooled on ice, and 48 pl hybridization buffer were added per slide. After vortexing, 50 pl "P mix were 15 added to 50 pl prehybridization on slide. The slides were incubated overnight at 55'C. E. Washes Washing was done 2 x 10 minutes with 2xSSC, EDTA at room temperature (400 ml 20 x SSC + 16 ml 0.25M EDTA, Vf=4L), followed by RNaseA treatment at 37'C for 30 minutes (500 pl of 10 mg/ml in 250 ml Rnase buffer = 20 pg/ml), The slides were washed 2 x 10 minutes with 2 x SSC, EDTA at room temperature. The 20 stringency wash conditions were as follows: 2 hours at 55'C, 0.1 x SSC, EDTA (20 ml 20 x SSC + 16 ml EDTA, Vf=4L). F. Oligonucleotides In situ analysis was performed on a variety of DNA sequences disclosed herein. The oligonucleotides employed for these analyses were derived from the nucleotide sequences disclosed herein and generally range from 25 about 40 to 55 nucleotides in length. G. Results In situ analysis was performed on a variety of DNA sequences disclosed herein. The results from these analyses are as follows. (1) DNA29101-1122 (PRO200) 30 Fetal: Lower limb expression in developing lower limb bones at the edge of the cartilagenous anlage (i.e. around the outside edge); in developing tendons, in vascular smooth muscle and in cells embracing developing skeletal muscle myocytes and myotubes. Expression also observed at the epiphyseal growth plate. Lymph node expression in marginal sinus of developing lymph nodes. Thymus expression in the subcapsular region of the thymic cortex, possibly representing either the subcapsular epithelial cells or the proliferating, double negative, thymocytes that are 35 found in this region. Spleen is negative. Trachea expression in smooth muscle. Brain (cerebral cortex) focal expression in cortical neurones. Spinal cord negative. Small intestine expression in smooth muscle. Thyroid generalized expression over thyroid epithelium. Adrenal is negative. Liver expression in ductal plate cells. Stomach expression in mural smooth muscle. Fetal skin expression in basal layer of squamous epithelium. Placenta expression in interstitial cells in trophoblastic villi. Cord expression in wall of arteries and vein. 279 WO 99/46281 PCT/US99/05028 Comments: Expression pattern suggests that PRO200 may be involved in cell differentiation/proliferation. High expression was observed at the following additional sites: Chimp ovary - granulosa cells of maturing follicles, lower intensity signal observed over thecal cells. Chimp parathyroid - high expression over chief cells. Human fetal testis - moderate expression over stromal cells surrounding developing tubules. Human fetal lung - high expression over chondrocytes in developing bronchial tree, and low level expression over branching bronchial 5 epithelium. Specific expression was not observed over the renal cell, gastric and colonic carcinomas. Fetal tissues examined (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb. Adult tissues examined: liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hippocampus(rm), cerebellum(rm), penis, eye, bladder, stomach, gastric carcinoma, 10 colon, colonic carcinoma and chondrosarcoma. Acetominophen induced liver injury and hepatic cirrhosis. (2) DNA30867-1335 (PR0218) Low level expression over numerous epithelia including fetal small intestine, fetal thyroid, chimp gastric epithelium. Expression also seen over malignant cells in a renal cell carcinoma. Expression in fetal brain, over 15 cortex. The distribution does not suggest an obvious function. Human fetal tissues examined (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb. Adult human tissues examined: kidney (normal and end-stage), bladder, adrenal, spleen, lymph node, pancreas, lung, skin, eye (inc. retina), colon, bladder, liver (normal, cirrhotic, acute failure), heart, clear cell carcinoma of kidney, gastric 20 adenocarcinoma, colorectal carcinoma. Non-human primate tissues examined: Chimp tissues: salivary gland, stomach, thyroid, parathyroid, tongue, thymus, ovary, lymph node, peripheral nerve. Rhesus Monkey tissues: cerebral cortex, hippocampus, cerebellum, penis. (3) DNA40021-1154 (PR0285) .25 Low levels of expression observed in the placenta and over hematopoietic cells in the mouse fetal liver. No expression was detected in either human fetal, adult or chimp lymph node and no expression was detected in human fetal or human adult spleen. Fetal tissues examined (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb. Adult tissues examined: liver, kidney, adrenal, myocardium, 30 aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hippocampus(rm), cerebellum(rm), brain infarct (human), cerebritis (human),penis, eye, bladder, stomach, gastric carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid (chimp) ovary (chimp) and chondrosarcoma. Acetominophen induced liver injury and hepatic cirrhosis. 35 (4) DNA39523-1192 (PR0273) Expression over epithelium of mouse embryo skin as well as over basal epithelium and dermis of human fetal skin. Basal epithelial pegs of the squamous mucosa of the chimp tongue are also positive. Expression over a subset of cells in developing glomeruli of fetal kidney, adult renal tubules, and over "thyroidized" epithelium in end stage renal disease, low expression in a renal cell carcinoma, probably over the epithelial cells. Low level expression 280 WO 99/46281 PCT/US99/05028 over stromal cells in fetal lung. Expression over stromal cells in the apical portion of gastric glands. High expression in the lamina propria of the fetal small intestinal villi, normal colonic mucosa and over stromal cells in a colonic carcinoma. Strong expression over benign connective tissue cells in the hylanized stroma of a sarcoma. Expression over stroial cells in the placental villi and the splenic red pulp. In the brain, expression over cortical neurones. Connective tissue surrounding developing bones and over nerve sheath cells in the fetus. Fetal tissues examined 5 (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb. Adult tissues examined: liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hippocampus(rm), eye, stomach, gastric carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid (chimp) ovary (chimp) and chondrosarcoma. Acetominophen induced liver injury and hepatic cirrhosis. 0 Expression was present in many cells in the outer layers (I and II) of the monkey cerebral cortex. A small subset of cells in the deeper cortical layers also expressed mRNA for this chemokine homolog. Scattered cells within the molecular layers of the hippocampus and bordering the inner edge of the dentate gyrus contained chemokine homolog mRNA. No expression was detected within the cerebellar cortex. Chemokine homolog expression is not observed in infarcted brain, where cell death has occurred in the regions where the chemokine homolog normally is 5 expressed. This probe could possibly serve as a marker of a subset of neurons of outer layers of the cerebral cortex and could possibly reveal neuronal migration disorders. Abnormal neuronal migration is a possible cause of some seizure disorders and schizophrenia. In order to gain a better appreciation of the distribution of this mRNA we will test whether the probe will cross-hybridize with mouse brain tissue. Also shows intriguing and specific patterns of hybridization within postnatal day (P)10 and adult mouse ) brains. In one sagittal section of P1O mouse brain, strong signal was observed scattered within the molecular layer of the hippocampus and inner edges of the dentate gyrus. Cells in the presubiculum were moderately labeled; the signal extended in a strong band through outer layers of the retrosplenial cortes to the occipital cortex, where the signal diminished to background levels. A small set of positive neurons were detected in deeper regions of PlO motor cortex; neurons in outer layers of P1O cortex did not exhibit signal above background levels. Moderate hybridization signal was also detected in the inferior colliculus. Chemokine homolog signal in the adult mouse brain was evaluated in three coronal sections at different levels. Strong signal was detected in the septum and in scattered neurons in the pontine nuclei and motor root of the trigeminal nerve; moderate signal was seen in the molecular layers of the hippocampus and outer layers of the retrosplenial cortex. (5) DNA39979-1213 (PR0296) Widespread expression in fetal in adult tissues. Expressed in a variety of fetal and adult epithelia, skeletal and cardiac muscle, developing (including retina) and adult CNS, thymic epithelium, placental villi, hepatocytes in cirrhotic and acetaminophen induced toxicity. Highly expressed in hypertrophic chondrocytes in developing skeletal system.The overall expression pattern, while not completely ovelapping (not expressed in glomeruli, more widely expressed in CNS), is not disimilar to VEGF. A possible role in angiogenesis should therefore be considered. Human fetal tissues examined (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, great vessels, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis, testis and lower limb. Adult human tissues examined: kidney (normal and end-stage), adrenal, spleen, lymph node, pancreas, lung, eye (inc. retina), bladder, liver (normal, cirrhotic, acute failure). Non-human primate tissues 281 WO 99/46281 PCT/US99/05028 examined: Chimp tissues: adrenal. Rhesus Monkey tissues: cerebral cortex, hippocampus, cerebellum. (6) DNA52594-1270 (PRO868) Expression over neuronal cells in fetal dorsal root ganglia, spinal cord, developing enteric neurons, cortical neurons. Low level expression also seen in placental trophoblast. In adult tissues the only site where notable 5 expression was observed was the normal adult prostate; as such it may represent a possible prostate cell surface receptor target antigen. Studies to further characterize the expression in adult tissues seem warranted. Low level expression also observed in a liposarcoma. Fetal tissues examined (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb. Adult human tissues examined: liver, 10 kidney, adrenal, myocardium, aorta, spleen, lung, skin, chondrosarcoma, eye, stomach, gastric carcinoma, colon, colonic carcinoma, renal cell carcinoma, prostate, bladder mucosa and gall bladder. Acetominophen induced liver injury and hepatic cirrhosis. Rhesus tissues examined: cerebral cortex (rm), hippocampus(rm), cerebellum. Chimp tissues examined: thyroid, parathyroid, ovary, nerve, tongue, thymus, adrenal, gastric mucosa and salivary gland. WIG-1(WISP-1), WIG-2 (WISP-2) and WIG-5 (WISP-3) expression in human breast carcinoma and normal breast 15 tissue, Wig-2 in lung carcinoma, and Wig-5 in colon carcinoma. (7) DNA64907-1163 (PRO1330) In human fetal tissues there was strong specific expression over artrerial, venous, capillary and sinusoidal endothelium in all tissues examined, except for fetal brain. In normal adult tissues expression was low to absent, but 20 when present appeared expression was confined to the vasculature. Highest expression in adult tissues was observed regionally in vessels running within the white matter of rhesus brain - the significance of this pattern is unclear. Elevated expression observed in vasculature of many inflamed and diseased tissues, including tumor vasculature. In some of these tissues it was unclear if expression was soley confined to vascular endothelium. In the 15 lung tumors examined no expression was seen over the malignant epithelium, however, vascular expression was observed 25 in many of the tumors and adjacent lung tissue. Moderate, apparently non-specific background, was seen with this probe over hyalinised collagen and sites of tissue necrosis. In the abscence of a sense control, however, it is not possible to be absolutely certain that all of this signal is non-specific. Some signal, also thought to be non-specific, was seen over the chimp gastric mucosa, transitional cell epithelium of human adult bladder and fetal retina. 30 (8) DNA49624-1279 (PR0545) Expression of the ADAM family molecule, ADAM 12 (DNA49624-1279) observed in normal human lung, lung tumor, normal colon and colon carcinoma. (9) DNA59294-1381 (PRO1031) 35 The expression of this IL17 homologue was evaluated in a panel consisting of normal adult and fetal tissues and tissues with inflammation, predominantly chronic lymphocytic inflammation. This panel is designed to specifically evaluate the expression pattern in immune mediated inflammatory disease of novel proteins that modulate T lymphocyte function (stimulatory or inhibitory). This protein when expressed as an Ig-fusion protein was immunostimulatory in a dose dependent fashion in the human mixed lymphocyte reaction (MLR); it caused a 285% 282 WO 99/46281 PCTIUS99/05028 and 147% increase above the baseline stimulation index when utilized at two different concentrations (1.0% and 0.1% of a 560 nM stock). Summary: expression was restricted to muscle, certain types of smooth muscle in the adult and in skeletal and smooth muscle in the human fetus. Expression in adult human was in smooth muscle of tubular organs evaluated including colon and gall bladder. There no expression in the smooth muscle of vessels or bronchi. No adult human skeletal muscle was evaluated. In fetal tissues there was moderate to high diffuse expression in skeletal 5 muscle the axial skeleton and limbs. There was weak expression in the smooth muscle of the intestinal wall but no expression in cardiac muscle. Adult human tissues with expression: Colon. there was low level diffuse expression in the smooth muscle (tunica muscularis) in 5 specimens with chronic inflammatory bowel disease. Gall bladder: there was weak to low level expression in the smooth muscle of the gall bladder. Fetal human tissues with expression: there was moderate diffuse expression in skeletal muscle and weak tolow expression in smooth muscle; there was 10 no expression in fetal heart or any other fetal organ including liver, spleen, CNS, kidney, gut, lung. Human tissues with no expression: lung with chronic granulomatous inflammation and chronic bronchitis (5 patients), peripheral nerve, prostate, heart, placenta, liver (disease multiblock), brain (cerbrum and cerebellum), tonsil (reactive hyperplasia), peripheral lymph node, thymus. (10) DNA45416-1251 (PR0362) 15 The expression of this novel protein was evaluated in a variety of human and non-human primate tissues and was found to be highly restricted. Expression was present only in alveolar macrophages in the lung and in Kupffer cells of the hepatic sinusoids. Expression in these cells was significantly increased when these distinct cell populations were activated. Though these two subpopulations of tissue macrophages are located in different organs, they have similar biological functions. Both types of these phagocytes act as biological filters to remove material from 20 the blood stream or airways including pathogens, senescent cells and proteins and both are capable of secreting a wide variery of important proinflammatory cytokines. In inflamed lung (7 patient samples) expression was prominent in reactive alveolar macrophage cell populations defined as large, pale often vacuolated cells present singly or in aggregates within alveoli and was weak to negative in normal, non-reactive macrophages (single scattered cells of normal size). Expression in alveolar macrophages was increased during inflammation when these cells were both 25 increased in numbers and size (activated). Despite the presence of histocytes in areas of interstial inflammtion and peribronchial lymphoid hyperplasia in these tissues, expression was restricted to alveolar macrophages. Many of the inflamed lungs also had some degree of suppurative inflammation; expression was not present in neutrophilic granulocytes. In liver, there was strong expression in reactive/activated Kupffer cells in livers with acute centrilobular necrosis (acetominophen toxicity) or fairly marked periportal inflammtion. However there was weak 30 or no expression in Kupffer cells in normal liver or in liver with only mild inflammation or mild to moderate lobular hyperplasia/hypertrophy. Thus, as in the lung, there was increased expression in acivated/reative cells. There was no expression of this molecule in histiocytes/macropahges present in inflamed bowel, hyperplastic/reactive tonsil or normal lymph node. The lack of expression in these tissues which all contained histiocytic inflammation or resident macrophage populations strongly supports restricted expression to the unique macrophage subset populations defined 35 as alveolar macrophage and hepatic Kupffer cells. Spleen or bone marrow was not available for evaluation. Human tissues evaluated which had no detectable expression included: Inflammatory bowel disease (7 patient samples with moderate to severe disease), tonsil with reactive hyperplasia, peripheral lymphnode, psoriatic skin (2 patient samples with mild to moderate disease), heart, peripheral nerve. Chimp tissues evaluated which had no detectable expression included: tongue, stomach, thymus. 283 WO 99/46281 PCT/US99/05028 (11) DNA52196-1348 (PR0733) Generalized low level signal in many tissues and in many cell types. While endothelial cell expression was observed it was not a prominent feature in either fetal, normal or diseased tissues. Human tissues: moderate expression over fetal liver (mainly hepatocytes), lung, skin, adrenal and heart. Fetal spleen, small intestine, brain and eye are negative. Adult normal kidney, bladder epithelium, lung, adrenal, pancreas, skin - all negative. Expression 5 in adult human liver (normal and diseased), renal tubules in end-stage renal disease, adipose tissue, sarcoma, colon, renal cell carcinoma, hepatocellular carcinoma, squamous cell carcinoma. Non human primate tissues: chimp salivary gland, vessels, stomach, tongue, peripheral nerve, thymus, lymph node, thyroid and parathyroid. Rhesus spinal cord negative, cortical and hippocampal neurones positive. 10 Deposit of Material The following materials have been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD, USA (ATCC): Material ATCC Dep. No. Deposit Date DNA39987-1184 ATCC 209786 April 21, 1998 15 DNA40625-1189 ATCC 209788 April 21, 1998 DNA23318-1211 ATCC 209787 April 21, 1998 DNA39979-1213 ATCC 209789 April 21, 1998 DNA40594-1233 ATCC 209617 February 5, 1998 DNA45416-1251 ATCC 209620 February 5, 1998 20 DNA45419-1252 ATCC 209616 February 5, 1998 DNA52594-1270 ATCC 209679 March 17, 1998 DNA45234-1277 ATCC 209654 March 5, 1998 DNA49624-1279 ATCC 209655 March 5, 1998 DNA48309-1280 ATCC 209656 March 5, 1998 25 DNA46776-1284 ATCC 209721 March 31, 1998 DNA50980-1286 ATCC 209717 March 31, 1998 DNA50913-1287 ATCC 209716 March 31, 1998 DNA50914-1289 ATCC 209722 March 31, 1998 DNA48296-1292 ATCC 209668 March 11, 1998 30 DNA32284-1307 ATCC 209670 March 11, 1998 DNA36343-1310 ATCC 209718 March 31, 1998 DNA40571-1315 ATCC 209784 April 21, 1998 DNA41386-1316 ATCC 209703 March 26, 1998 DNA44194-1317 ATCC 209808 April 28, 1998 35 DNA45415-1318 ATCC 209810 April 28, 1998 DNA44189-1322 ATCC 209699 March 26, 1998 DNA48304-1323 ATCC 209811 April 28, 1998 DNA49152-1324 ATCC 209813 April 28, 1998 DNA49646-1327 ATCC 209705 March 26, 1998 40 DNA49631-1328 ATCC 209806 April 28, 1998 DNA49645-1347 ATCC 209809 April 28, 1998 DNA45493-1349 ATCC 209805 April 28, 1998 DNA48227-1350 ATCC 209812 April 28, 1998 DNA41404-1352 ATCC 209844 May 6, 1998 45 DNA44196-1353 ATCC 209847 May 6, 1998 DNA52187-1354 ATCC 209845 May 6, 1998 DNA48328-1355 ATCC 209843 May 6, 1998 DNA56352-1358 ATCC 209846 May 6, 1998 DNA53971-1359 ATCC 209750 April 7, 1998 50 DNA50919-1361 ATCC 209848 May 6, 1998 DNA44179-1362 ATCC 209851 May 6, 1998 284 WO 99/46281 PCT/US99/05028 DNA54002-1367 ATCC 209754 April 7, 1998 DNA53906-1368 ATCC 209747 April 7, 1998 DNA52185-1370 ATCC 209861 May 14, 1998 DNA53977-1371 ATCC 209862 May 14, 1998 DNA57253-1382 ATCC 209867 May 14, 1998 5 DNA58847-1383 ATCC 209879 May 20, 1998 DNA58747-1384 ATCC 209868 May 14, 1998 DNA57689-1385 ATCC 209869 May 14, 1998 DNA23330-1390 ATCC 209775 April 14, 1998 DNA26847-1395 ATCC 209772 April 14, 1998 10 DNA53974-1401 ATCC 209774 April 14, 1998 DNA57039-1402 ATCC 209777 April 14, 1998 DNA57033-1403 ATCC 209905 May 27, 1998 DNA34353-1428 ATCC 209855 May 12, 1998 DNA45417-1432 ATCC 209910 May 27, 1998 15 DNA39523-1192 ATCC 209424 October 31, 1997 DNA44205-1285 ATCC 209720 March 31, 1998 DNA50911-1288 ATCC 209714 March 31, 1998 DNA48329-1290 ATCC 209785 April 21, 1998 DNA48306-1291 ATCC 209911 May 27, 1998 20 DNA48336-1309 ATCC 209669 March 11, 1998 DNA44184-1319 ATCC 209704 March 26, 1998 DNA48314-1320 ATCC 209702 March 26, 1998 DNA48333-1321 ATCC 209701 March 26, 1998 DNA50920-1325 ATCC 209700 March 26, 1998 25 DNA50988-1326 ATCC 209814 April 28, 1998 DNA48331-1329 ATCC 209715 March 31, 1998 DNA30867-1335 ATCC 209807 April 28, 1998 DNA55737-1345 ATCC 209753 April 7, 1998 DNA49829-1346 ATCC 209749 April 7, 1998 30 DNA52196-1348 ATCC 209748 April 7, 1998 DNA56965-1356 ATCC 209842 May 6, 1998 DNA56405-1357 ATCC 209849 May 6, 1998 DNA57530-1375 ATCC 209880 May 20, 1998 DNA56439-1376 ATCC 209864 May 14, 1998 35 DNA56409-1377 ATCC 209882 May 20, 1998 DNA56112-1379 ATCC 209883 May 20, 1998 DNA56045-1380 ATCC 209865 May 14, 1998 DNA59294-1381 ATCC 209866 May 14, 1998 DNA56433-1406 ATCC 209857 May 12, 1998 40 DNA53912-1457 ATCC 209870 May 14, 1998 DNA50921-1458 ATCC 209859 May 12, 1998 DNA29101-1122 ATCC 209653 March 5, 1998 DNA40021-1154 ATCC 209389 October 17, 1997 DNA42663-1154 ATCC 209386 October 17, 1997 45 DNA30943-1-1163-1 ATCC 209791 April 21, 1998 DNA64907-1163-1 ATCC 203242 September 9, 1998 DNA64908-1163-1 ATCC 203243 September 9, 1998 DNA39975-1210 ATCC 209783 April 21, 1998 DNA43316-1237 ATCC 209487 November 21, 1997 50 DNA55800-1263 ATCC 209680 March 17, 1998 These deposit were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culture of the deposit for 30 years from the date of deposit. The 55 deposits will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc. and ATCC, which assures permanent and unrestricted availability of the progeny of the 285 WO 99/46281 PCT/US99/05028 culture of the deposit to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC § 122 and the Commissioner's rules pursuant thereto (including 37 CFR § 1.14 with particular reference to 886 OG 638). The assignee of the present application has agreed that if a culture of the materials on deposit should die or 5 be lost or destroyed when cultivated under suitable conditions, the materials will be promptly replaced on notification with another of the same. Availability of the deposited material is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws. The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice 10 the invention. The present invention is not to be limited in scope by the construct deposited, since the deposited embodiment is intended as a single illustration of certain aspects of the invention and any constructs that are functionally equivalent are within the scope of this invention. The deposit of material herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as limiting the scope of the claims to the specific 15 illustrations that it represents. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. 286

Claims (20)

1. Isolated nucleic acid having at least 80% sequence identity to a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:7), Figure 9 (SEQ ID NO:19), Figure 11 (SEQ ID NO:28), Figure 15 (SEQ ID NO:36), Figure 20 (SEQ ID NO:45), Figure 22 (SEQ ID NO:52), Figure 24 (SEQ ID 5 NO:59), Figure 26 (SEQ ID NO:64), Figure 28 (SEQ ID NO:69), Figure 30 (SEQ ID NO:74), Figure 33 (SEQ ID NO:85), Figure 35 (SEQ ID NO:90), Figure 37 (SEQ ID NO:97), Figure 39 (SEQ ID NO: 102), Figure 41 (SEQ ID NO: 109), Figure 43 (SEQ ID NO: 114), Figure 45 (SEQ ID NO: 119), Figure 47 (SEQ ID NO: 124), Figure 49 (SEQ ID NO:132), Figure 51 (SEQ ID NO:137), Figure 53 (SEQ ID NO: 145), Figure 55 (SEQ ID NO:150), Figure 59 (SEQ ID NO:157), Figure 61 (SEQ ID NO:162), Figure 63 (SEQ ID NO:169), Figure 66 (SEQ ID NO: 178), Figure 10 68 (SEQ ID NO:183), Figure 70 (SEQ ID NO: 190), Figure 73 (SEQ ID NO: 196), Figure 75 (SEQ ID NO:206), Figure 77 (SEQ ID NO:211), Figure 79 (SEQ ID NO:216), Figure 81 (SEQ ID NO:221), Figure 83 (SEQ ID NO:226), Figure 85 (SEQ ID NO:231), Figure 87 (SEQ ID NO:236), Figure 89 (SEQ ID NO:245), Figure 91 (SEQ ID NO:254), Figure 93 (SEQ ID NO:259), Figure 95 (SEQ ID NO:264), Figure 98 (SEQ ID NO:270), Figure 109 (SEQ ID NO:284), Figure 118 (SEQ ID NO:296), Figure 120 (SEQ ID NO:301), Figure 122 (SEQ ID NO:303), 15 Figure 125 (SEQ ID NO:309), Figure 129 (SEQ ID NO:322), Figure 132 (SEQ ID NO:330), Figure 136 (SEQ ID NO:337), Figure 139 (SEQ ID NO:346), Figure 142 (SEQ ID NO:352), Figure 145 (SEQ ID NO:358), Figure 147 (SEQ ID NO:363), Figure 149 (SEQ ID NO:370), Figure 151 (SEQ ID NO:375), Figure 153 (SEQ ID NO:380), Figure 155 (SEQ ID NO:385), Figure 157 (SEQ ID NO:390), Figure 159 (SEQ ID NO:395), Figure 161 (SEQ ID NO:400), Figure 163 (SEQ ID NO:405), Figure 165 (SEQ ID NO:410), Figure 167 (SEQ ID NO:415), Figure 169 20 (SEQ ID NO:420), Figure 171 (SEQ ID NO:425), Figure 173 (SEQ ID NO:430), Figure 177 (SEQ ID NO:437), Figure 179 (SEQ ID NO:442), Figure 181 (SEQ ID NO:447), Figure 183 (SEQ ID NO:452), Figure 185 (SEQ ID NO:454), Figure 187 (SEQ ID NO:456), Figure 190 (SEQ ID NO:459), Figure 192 (SEQ ID NO:464), Figure 194 (SEQ ID NO:466), Figure 196 (SEQ ID NO:468), Figure 198 (SEQ ID NO:470), Figure 200 (SEQ ID NO:472), Figure 202 (SEQ ID NO:477), Figure 204 (SEQ ID NO:483), Figure 207 (SEQ ID NO:488), Figure 209 (SEQ ID 25 NO:496), Figure 211 (SEQ ID NO:498), Figure 213 (SEQ ID NO:506), Figure 215 (SEQ ID NO:508), Figure 217 (SEQ ID NO:510), Figure 219 (SEQ ID NO:515), Figure 222 (SEQ ID NO:523) and Figure 225 (SEQ ID NO:526).

2. The nucleic acid sequence of Claim 1, wherein said nucleotide sequence comprises a nucleotide sequence selected from the group consisting of the sequence shown in Figure 1 (SEQ ID NO: 1), Figure

3 (SEQ ID 30 NO:6), Figure 8 (SEQ ID NO:18), Figure 10 (SEQ ID NO:27), Figure 14 (SEQ ID NO:35), Figure 19 (SEQ ID NO:44), Figure 21 (SEQ ID NO:51), Figure 23 (SEQ ID NO:58), Figure 25 (SEQ ID NO:63), Figure 27 (SEQ ID NO:68), Figure 29 (SEQ ID NO:73), Figure 32 (SEQ ID NO:84), Figure 34 (SEQ ID NO:89), Figure 36 (SEQ ID NO:96), Figure 38 (SEQ ID NO: 101), Figure 40 (SEQ ID NO:108), Figure 42 (SEQ ID NO:113), Figure 44 (SEQ ID NO:118), Figure 46 (SEQ ID NO:123), Figure 48 (SEQ ID NO: 131), Figure 50 (SEQ ID NO:136), Figure 52 35 (SEQ ID NO:144), Figure 54 (SEQ ID NO:149), Figure 58 (SEQ ID NO:156), Figure 60 (SEQ ID NO:161), Figure 62 (SEQ ID NO:168), Figure 65 (SEQ ID NO:177), Figure 67 (SEQ ID NO:182), Figure 69 (SEQ ID NO:189), Figure 72 (SEQ ID NO:195), Figure 74 (SEQ ID NO:205), Figure 76 (SEQ ID NO:210), Figure 78 (SEQ ID NO:215), Figure 80 (SEQ ID NO:220), Figure 82 (SEQ ID NO:225), Figure 84 (SEQ ID NO:230), Figure 86 (SEQ ID NO:235), Figure 88 (SEQ ID NO:244), Figure 90 (SEQ ID NO:253), Figure 92 (SEQ ID NO:258), Figure 94 287 WO 99/46281 PCT/US99/05028 (SEQ ID NO:263), Figure 97 (SEQ ID NO:269). Figure 108 (SEQ ID NO:283), Figure 117 (SEQ ID NO:295), Figure 119 (SEQ ID NO:300), Figure 121 (SEQ ID NO:302), Figure 124 (SEQ ID NO:308), Figure 128 (SEQ ID NO:321), Figure 131 (SEQ ID NO:329), Figure 135 (SEQ ID NO:336), Figure 138 (SEQ ID NO:345), Figure 141 (SEQ ID NO:351), Figure 144 (SEQ ID NO:357), Figure 146 (SEQ ID NO:362), Figure 148 (SEQ ID NO:369), Figure 150 (SEQ ID NO:374), Figure 152 (SEQ ID NO:379), Figure 154 (SEQ ID NO:384), Figure 156 (SEQ ID 5 NO:389), Figure 158 (SEQ ID NO:394), Figure 160 (SEQ ID NO:399), Figure 162 (SEQ ID NO:404), Figure 164 (SEQ ID NO:409), Figure 166 (SEQ ID NO:414), Figure 168 (SEQ ID NO:419), Figure 170 (SEQ ID NO:424), Figure 172 (SEQ ID NO:429), Figure 176 (SEQ ID NO:436), Figure 178 (SEQ ID NO:441), Figure 180 (SEQ ID NO:446), Figure 182 (SEQ ID NO:451), Figure 184 (SEQ ID NO:453), Figure 186 (SEQ ID NO:455), Figure 189 (SEQ ID NO:458), Figure 191 (SEQ ID NO:463), Figure 193 (SEQ ID NO:465), Figure 195 (SEQ ID NO:467), 10 Figure 197 (SEQ ID NO:469), Figure 199 (SEQ ID NO:471), Figure 201 (SEQ ID NO:476), Figure 203 (SEQ ID NO:482), Figure 206 (SEQ ID NO:487), Figure 208 (SEQ ID NO:495), Figure 210 (SEQ ID NO:497), Figure 212 (SEQ ID NO:505), Figure 214 (SEQ ID NO:507), Figure 216 (SEQ ID NO:509), Figure 218 (SEQ ID NO:514), Figure 221 (SEQ ID NO:522) and Figure 224 (SEQ ID NO:525). 15 3. The nucleic acid of Claim 1, wherein said nucleotide sequence comprises a nucleotide sequence selected from the group consisting of the full-length coding sequence of the sequence shown in Figure 1 (SEQ ID NO:1), Figure 3 (SEQ ID NO:6), Figure 8 (SEQ ID NO:18), Figure 10 (SEQ ID NO:27), Figure 14 (SEQ ID NO:35), Figure 19 (SEQ ID NO:44), Figure 21 (SEQ ID NO:51), Figure 23 (SEQ ID NO:58), Figure 25 (SEQ ID NO:63), Figure 27 (SEQ ID NO:68), Figure 29 (SEQ ID NO:73), Figure 32 (SEQ ID NO:84), Figure 34 (SEQ ID 20 NO:89), Figure 36 (SEQ ID NO:96), Figure 38 (SEQ ID NO: 101), Figure 40 (SEQ ID NO: 108), Figure 42 (SEQ ID NO:113), Figure 44 (SEQ ID NO:118), Figure 46 (SEQ ID NO: 123), Figure 48 (SEQ ID NO:131), Figure 50 (SEQ ID NO:136), Figure 52 (SEQ ID NO: 144), Figure 54 (SEQ ID NO:149), Figure 58 (SEQ ID NO: 156), Figure 60 (SEQ ID NO:161), Figure 62 (SEQ ID NO: 168), Figure 65 (SEQ ID NO:177), Figure 67 (SEQ ID NO:182), Figure 69 (SEQ ID NO:189), Figure 72 (SEQ ID NO:195), Figure 74 (SEQ ID NO:205), Figure 76 (SEQ ID 25 NO:210), Figure 78 (SEQ ID NO:215), Figure 80 (SEQ ID NO:220), Figure 82 (SEQ ID NO:225), Figure 84 (SEQ ID NO:230), Figure 86 (SEQ ID NO:235), Figure 88 (SEQ ID NO:244), Figure 90 (SEQ ID NO:253), Figure 92 (SEQ ID NO:258), Figure 94 (SEQ ID NO:263), Figure 97 (SEQ ID NO:269), Figure 108 (SEQ ID NO:283), Figure 117 (SEQ ID NO:295), Figure 119 (SEQ ID NO:300), Figure 121 (SEQ ID NO:302), Figure 124 (SEQ ID NO:308), Figure 128 (SEQ ID NO:321), Figure 131 (SEQ ID NO:329), Figure 135 (SEQ ID NO:336), Figure 138 (SEQ ID 30 NO:345), Figure 141 (SEQ ID NO:351), Figure 144 (SEQ ID NO:357), Figure 146 (SEQ ID NO:362), Figure 148 (SEQ ID NO:369), Figure 150 (SEQ ID NO:374), Figure 152 (SEQ ID NO:379), Figure 154 (SEQ ID NO:384), Figure 156 (SEQ ID NO:389), Figure 158 (SEQ ID NO:394), Figure 160 (SEQ ID NO:399), Figure 162 (SEQ ID NO:404), Figure 164 (SEQ ID NO:409), Figure 166 (SEQ ID NO:414), Figure 168 (SEQ ID NO:419), Figure 170 (SEQ ID NO:424), Figure 172 (SEQ ID NO:429), Figure 176 (SEQ ID NO:436), Figure 178 (SEQ ID NO:441), 35 Figure 180 (SEQ ID NO:446), Figure 182 (SEQ ID NO:451), Figure 184 (SEQ ID NO:453), Figure 186 (SEQ ID NO:455), Figure 189 (SEQ ID NO:458), Figure 191 (SEQ ID NO:463), Figure 193 (SEQ ID NO:465), Figure 195 (SEQ ID NO:467), Figure 197 (SEQ ID NO:469), Figure 199 (SEQ ID NO:471), Figure 201 (SEQ ID NO:476), Figure 203 (SEQ ID NO:482), Figure 206 (SEQ ID NO:487), Figure 208 (SEQ ID NO:495), Figure 210 (SEQ ID NO:497), Figure 212 (SEQ ID NO:505), Figure 214 (SEQ ID NO:507), Figure 216 (SEQ ID NO:509), Figure 218 288 WO 99/46281 PCT/US99/05028 (SEQ ID NO:514), Figure 221 (SEQ ID NO:522) or Figure 224 (SEQ ID NO:525).

4. Isolated nucleic acid which comprises the full-length coding sequence of the DNA deposited under accession number ATCC 209791, ATCC 209786, ATCC 209788, ATCC 209787, ATCC 209789, ATCC 209617, ATCC 209620, ATCC 209616, ATCC 209679, ATCC 209654. ATCC 209655, ATCC 209656, ATCC 209721, 5 ATCC 209717, ATCC 209716. ATCC 209722, ATCC 209668, ATCC 209670, ATCC 209718, ATCC 209784, ATCC 209703, ATCC 209808, ATCC 209810, ATCC 209699, ATCC 209811, ATCC 209813, ATCC 209705, ATCC 209806, ATCC 209809, ATCC 209805, ATCC 209812, ATCC 209844, ATCC 209847, ATCC 209845, ATCC 209843, ATCC 209846, ATCC 209750, ATCC 209848, ATCC 209851, ATCC 209754, ATCC 209747, ATCC 209861. ATCC 209862, ATCC 209867, ATCC 209879, ATCC 209868, ATCC 209869, ATCC 209775, 10 ATCC 209772, ATCC 209774, ATCC 209777, ATCC 209905, ATCC 209855, ATCC 209910, ATCC 209424, ATCC 209720, ATCC 209714, ATCC 209785, ATCC 209911, ATCC 209669, ATCC 209704, ATCC 209702, ATCC 209701, ATCC 209700, ATCC 209814, ATCC 209715, ATCC 209807, ATCC 209753, ATCC 209749, ATCC 209748, ATCC 209842, ATCC 209849, ATCC 209880, ATCC 209864, ATCC 209882, ATCC 209883, ATCC 209865, ATCC 209866, ATCC 209857. ATCC 209870, ATCC 209859, ATCC 209653, ATCC 209389, 15 ATCC 209386, ATCC 203242, ATCC 203243, ATCC 209783, ATCC 209487 or ATCC 209680.

5. A vector comprising the nucleic acid of Claim 1.

6. The vector of Claim 5 operably linked to control sequences recognized by a host cell transformed 20 with the vector.

7. A host cell comprising the vector of Claim 5.

8. The host cell of Claim 7 wherein said cell is a CHO cell. 25

9. The host cell of Claim 7 wherein said cell is an E. coli.

10. The host cell of Claim 7 wherein said cell is a yeast cell. 30

11. A process for producing a PRO polypeptides comprising culturing the host cell of Claim 7 under conditions suitable for expression of said PRO polypeptide and recovering said PRO polypeptide from the cell culture.

12. Isolated native sequence PRO polypeptide having at least 80% sequence identity to an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 2 (SEQ ID NO:2), Figure 35 4 (SEQ ID NO:7), Figure 9 (SEQ ID NO:19), Figure 11 (SEQ ID NO:28), Figure 15 (SEQ ID NO:36), Figure 20 (SEQ ID NO:45), Figure 22 (SEQ ID NO:52), Figure 24 (SEQ ID NO:59), Figure 26 (SEQ ID NO:64), Figure 28 (SEQ ID NO:69), Figure 30 (SEQ ID NO:74), Figure 33 (SEQ ID NO:85), Figure 35 (SEQ ID NO:90), Figure 37 (SEQ ID NO:97). Figure 39 (SEQ ID NO:102), Figure 41 (SEQ ID NO:109), Figure 43 (SEQ ID NO:114), Figure 45 (SEQ ID NO:119), Figure 47 (SEQ ID NO:124), Figure 49 (SEQ ID NO:132), Figure 51 (SEQ ID NO:137), 289 WO 99/46281 PCT/US99/05028 Figure 53 (SEQ ID NO: 145), Figure 55 (SEQ ID NO:150), Figure 59 (SEQ ID NO:157), Figure 61 (SEQ ID NO:162), Figure 63 (SEQ ID NO:169), Figure 66 (SEQ ID NO: 178), Figure 68 (SEQ ID NO:183), Figure 70 (SEQ ID NO:190), Figure 73 (SEQ ID NO:196), Figure 75 (SEQ ID NO:206), Figure 77 (SEQ ID NO:211), Figure 79 (SEQ ID NO:216), Figure 81 (SEQ ID NO:221), Figure 83 (SEQ ID NO:226), Figure 85 (SEQ ID NO:231), Figure 87 (SEQ ID NO:236), Figure 89 (SEQ ID NO:245), Figure 91 (SEQ ID NO:254), Figure 93 (SEQ ID NO:259), 5 Figure 95 (SEQ ID NO:264), Figure 98 (SEQ ID NO:270), Figure 109 (SEQ ID NO:284), Figure 118 (SEQ ID NO:296), Figure 120 (SEQ ID NO:301), Figure 122 (SEQ ID NO:303), Figure 125 (SEQ ID NO:309), Figure 129 (SEQ ID NO:322), Figure 132 (SEQ ID NO:330), Figure 136 (SEQ ID NO:337), Figure 139 (SEQ ID NO:346), Figure 142 (SEQ ID NO:352), Figure 145 (SEQ ID NO:358), Figure 147 (SEQ ID NO:363), Figure 149 (SEQ ID NO:370), Figure 151 (SEQ ID NO:375), Figure 153 (SEQ ID NO:380), Figure 155 (SEQ ID NO:385), Figure 157 10 (SEQ ID NO:390), Figure 159 (SEQ ID NO:395), Figure 161 (SEQ ID NO:400), Figure 163 (SEQ ID NO:405), Figure 165 (SEQ ID NO:410), Fiiure 167 (SEQ ID NO:415), Figure 169 (SEQ ID NO:420), Figure 171 (SEQ ID NO:425), Figure 173 (SEQ ID NO:430), Figure 177 (SEQ ID NO:437), Figure 179 (SEQ ID NO:442), Figure 181 (SEQ ID NO:447), Figure 183 (SEQ ID NO:452), Figure 185 (SEQ ID NO:454), Figure 187 (SEQ ID NO:456), Figure 190 (SEQ ID NO:459), Figure 192 (SEQ ID NO:464), Figure 194 (SEQ ID NO:466), Figure 196 (SEQ ID 15 NO:468), Figure 198 (SEQ ID NO:470), Figure 200 (SEQ ID NO:472), Figure 202 (SEQ ID NO:477), Figure 204 (SEQ ID NO:483), Figure 207 (SEQ ID NO:488), Figure 209 (SEQ ID NO:496), Figure 211 (SEQ ID NO:498), Figure 213 (SEQ ID NO:506), Figure 215 (SEQ ID NO:508), Figure 217 (SEQ ID NO:510), Figure 219 (SEQ ID NO:515), Figure 222 (SEQ ID NO:523) and Figure 225 (SEQ ID NO:526). 20

13. Isolated PRO polypeptide having at least 80% sequence identity to the amino acid sequence encoded by the nucleotide deposited under accession number ATCC 209791, ATCC 209786, ATCC 209788, ATCC 209787, ATCC 209789, ATCC 209617, ATCC 209620, ATCC 209616, ATCC 209679, ATCC 209654, ATCC 209655, ATCC 209656, ATCC 209721, ATCC 209717, ATCC 209716, ATCC 209722, ATCC 209668, ATCC 209670, ATCC 209718, ATCC 209784, ATCC 209703, ATCC 209808, ATCC 209810, ATCC 209699, ATCC 209811, 25 ATCC 209813, ATCC 209705, ATCC 209806, ATCC 209809, ATCC 209805, ATCC 209812, ATCC 209844, ATCC 209847, ATCC 209845, ATCC 209843, ATCC 209846, ATCC 209750, ATCC 209848, ATCC 209851, ATCC 209754, ATCC 209747, ATCC 209861, ATCC 209862, ATCC 209867, ATCC 209879, ATCC 209868, ATCC 209869, ATCC 209775, ATCC 209772, ATCC 209774, ATCC 209777, ATCC 209905, ATCC 209855, ATCC 209910, ATCC 209424, ATCC 209720, ATCC 209714, ATCC 209785, ATCC 209911, ATCC 209669, 30 ATCC 209704, ATCC 209702, ATCC 209701, ATCC 209700, ATCC 209814, ATCC 209715, ATCC 209807, ATCC 209753, ATCC 209749, ATCC 209748, ATCC 209842, ATCC 209849, ATCC 209880, ATCC 209864, ATCC 209882, ATCC 209883, ATCC 209865, ATCC 209866, ATCC 209857, ATCC 209870, ATCC 209859, ATCC 209653, ATCC 209389, ATCC 209386, ATCC 203242, ATCC 203243, ATCC 209783, ATCC 209487 or ATCC 209680. 35

14. A chimeric molecule comprising a polypeptide according to Claim 12 fused to a heterologous amino acid sequence.

15. The chimeric molecule of Claim 14 wherein said heterologous amino acid sequence is an epitope 290 WO 99/46281 PCT/US99/05028 tag sequence.

16. The chimeric molecule of Claim 14 wherein said heterologous amino acid sequence is a Fc region of an immunoglobulin. 5

17. An antibody which specifically binds to a PRO polypeptide according to Claim 12.

18. The antibody of Claim 17 wherein said antibody is a monoclonal antibody.

19. An isolated nucleic acid molecule which has at least 80% sequence identity to a nucleic acid which 10 comprises a nucleotide sequence selected from the group consisting of that shown in Figure 5 (SEQ ID NO:8), Figure 6 (SEQ ID NO:9), Figure 7 (SEQ ID NO:10), Figure 12 (SEQ ID NO:29), Figure 13 (SEQ ID NO:30), Figure 16 (SEQ ID NO:37), Figure 17 (SEQ ID NO:38), Figure 18 (SEQ ID NO:39), Figure 31 (SEQ ID NO:75), Figure 64 (SEQ ID NO: 170), Figure 71 (SEQ ID NO:191), Figure 96 (SEQ ID NO:265), Figure 99 (SEQ ID NO:271), Figure 100 (SEQ ID NO:272), Figure 101 (SEQ ID NO:273), Figure 102 (SEQ ID NO:274), Figure 103 (SEQ ID NO:275), 15 Figure 104 (SEQ ID NO:276), Figure 105 (SEQ ID NO:277), Figure 106 (SEQ ID NO:278), Figure 107 (SEQ ID NO:279), Figure 110 (SEQ ID NO:285), Figure 111 (SEQ ID NO:286), Figure 112 (SEQ ID NO:287), Figure 113 (SEQ ID NO:288), Figure 114 (SEQ ID NO:289), Figure 115 (SEQ ID NO:290), Figure 116 (SEQ ID NO:291), Figure 123 (SEQ ID NO:304), Figure 126 (SEQ ID NO:310), Figure 127 (SEQ ID NO:311), Figure 130 (SEQ ID NO:323), Figure 133 (SEQ ID NO:331), Figure 134 (SEQ ID NO:332), Figure 137 (SEQ ID NO:338), Figure 140

20 (SEQ ID NO:347), Figure 143 (SEQ ID NO:353), Figure 174 (SEQ ID NO:431), Figure 175 (SEQ ID NO:432), Figure 188 (SEQ ID NO:457), Figure 205 (SEQ ID NO:484), Figure 220 (SEQ ID NO:516), Figure 223 (SEQ ID NO:524), Figure 226 (SEQ ID NO:527), Figure 227 (SEQ ID NO:528) and Figure 228 (SEQ ID NO:529). 291