AU2920602A - Compounds and methods for therapy and diagnosis of lung cancer - Google Patents

Description

AUSTRALIA

PATENTS ACT 1990 DIVISIONAL APPLICATION NAME OF APPLICANT: Corixa Corporation ADDRESS FOR SERVICE: DAVIES COLLISON CAVE Patent Attorneys 1 Little Collins Street Melbourne, 3000.

INVENTION TITLE: "Compounds and methods for therapy and diagnosis of lung cancer" The following statement is a full description of this invention, including the best method of performing it known to us: Q:\oper\kbmn3 113949-99 di.do-3(1)3)2 -1- COMPOUNDS AND METHODS FOR THERAPY AND DIAGNOSIS OF LUNG CANCER This application is a divisional of Australian Patent Application No. 30949/99, the entire contents of which are incorporated herein by reference.

TECHNICAL FIELD The present invention relates generally to compositions and methods for the treatment and diagnosis of lung cancer. The invention is more specifically related to nucleotide sequences that are preferentially expressed in lung tumor tissue, together with polypeptides encoded by such nucleotide sequences. The inventive nucleotide sequences and polypeptides may be used in vaccines and pharmaceutical compositions for the treatment and diagnosis of lung cancer.

BACKGROUND OF THE INVENTION Lung cancer is the primary cause of canc :r death among both men and women in the with an estimated 172,000 new cases being reported in 1994. The five-year survival rate among all lung cancer patients, regardless of the stage of disease at diagnosis. is only 13%. This contrasts with a five-year survival rate of 46% among cases detected while the disease is still localized. However, only 16% of lung cancers are discovered before the disease has spread.

Early detection is difficult since clinical symptoms are often not seen until the disease has reached an advanced stage. Currently, diagnosis is aided by the use of chest xrays, analysis of the type of cells contained in sputum and fiberoptic examination of the bronchial passages. Treatment regimens are determined by the type and stage of the cancer, and include surgery, radiation therapy and/or chemotherapy. In spite of considerable research into therapies for the disease, lung cancer remains difficult to treat.

Accordingly, there remains a need in the art for improved vaccines, treatment methods and diagnostic techniques for lung cancer.

SUMMARY OF THE INVENTION Briefly stated, the present invention provides compounds and methods for the therapy of lung. cancer. In a first aspect, isolated polynucleotide molecules encoding lung 2 tumor polypeptides are provided, such polynucleotide molecules comprising a nucleotide sequence selected from the group consisting of: sequences provided in SEQ ID NO: 1-3, 6-8, 10-13, 15-27, 29, 30, 32, 34-49, 51, 52, 54, 55, 57-59, 61-69, 71, 73, 74, 77, 78, 80-82, 84, 86-96, 107-109, 111, 113, 125, 127, 128, 129, 131-133, 142, 144, 148-151, 153, 154, 157, 158, 160, 167, 168 and 171; sequences complementary to a sequence provided in SEQ ID NO: 1-3, 6-8, 10-13, 15-27, 29, 30, 32, 34-49, 51, 52, 54, 55, 57-59, 61-69, 71, 73, 74, 77, 78, 80-82, 84, 86-96, 107-109, 111, 113, 125, 127, 128, 129, 131-133, 142, 144, 148-151, 153, 154, 157, 158, 160, 167, 168 and 171; and sequences that hybridize to a sequence of or under moderately stringent conditions.

In a second aspect, isolated polypeptides are provided that comprise at least an immunogenic portion of a lung tumor protein or a variant thereof. In specific embodiments, such polypeptides comprise an amino acid sequence encoded by a polynucleotide molecule comprising a nucleotide sequence selected from the group consisting of sequences recited in SEQ ID NO: 1-3, 6-8, 10-13, 15-27, 29, 30, 32, 34-49, 51, 52, 54, 55, 57-59, 61-69, 71, 73, 74, 77, 78, 80-82, 84, 86-96, 107-109, 111, 113, 125, 127, 128, 129, 131-133, 142, 144, 148- 151, 153, 154, 157, 158, 160, 167, 168 and 171; sequences complementary to a sequence provided in SEQ ID NO: 1-3, 6-8, 10-13, 15-27, 29, 30, 32, 34-49, 51, 52, 54, 55, 57-59, 61- 69, 71, 73, 74, 77, 78, 80-82, 84, 86-96, 107-109, 111, 113, 125, 127, 128, 129, 131-133, 142, 144, 148-151, 153, 154, 157, 158, 160, 167, 168 and 171; and sequences that hybridize to a sequence of or under moderately stringent conditions.

In related aspects, expression vectors comprising the inventive polynucleotide molecules, together with host cells transformed or transfected with such expression vectors are provided. In preferred embodiments, the host cells are selected from the group consisting of E. coli, yeast and mammalian cells.

In another aspect, fusion proteins comprising a first and a second inventive polypeptide or, alternatively, an inventive polypeptide and a known lung tumor antigen, are provided.

The present invention further provides pharmaceutical compositions comprising one or more of the above polypeptides, fusion proteins or polynucleotide molecules and a physiologically acceptable carrier, together with vaccines comprising one or more such polypeptides, fusion proteins or polynucleotide molecules in combination with an immune response enhancer.

In related aspects, the present invention provides methods for inhibiting the development of lung cancer in a patient, comprising administering to a patient an effective amount of at least one of the above pharmaceutical compositions and/or vaccines.

Additionally, the present invention provides methods for immunodiagnosis of lung cancer, together with kits for use in such methods. Polypeptides are disclosed which comprise at least an immunogenic portion of a lung tumor protein or a variant of said protein that differs only in conservative substitutions and/or modifications, wherein the lung tumor protein comprises an amino acid sequence encoded by a polynucleotide molecule having a sequence selected from the group consisting of nucleotide sequences recited in SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171, and variants thereof. Such polypeptides may be usefully employed in the diagnosis and monitoring of lung cancer.

In one specific aspect of the present invention, methods are provided for detecting lung cancer in a patient, comprising: contacting a biological sample obtained from a patient with a binding agent that is capable of binding to one of the above polypeptides; and detecting in the sample a protein or polypeptide that binds to the binding agent. In preferred embodiments, the binding agent is an antibody, most preferably a monoclonal antibody.

In related aspects, methods are provided for monitoring the progression of lung cancer in a patient, comprising: contacting a biological sample obtained from a patient with a binding agent that is capable of binding to one of the above polypeptides; (b) determining in the sample an amount of a protein or polypeptide that binds to the binding agent; repeating steps and and comparing the amounts of polypeptide detected in steps and Within related aspects, the present invention provides antibodies, preferably monoclonal antibodies, that bind to the inventive polypeptides, as well as diagnostic kits comprising such antibodies, and methods of using such antibodies to inhibit the development of lung cancer.

The present invention further provides methods for detecting lung cancer comprising: obtaining a biological sample from a patient; contacting the sample with a first and a second oligonucleotide primer in a polymerase chain reaction, at least one of the oligonucleotide primers being specific for a polynucleotide molecule that encodes one of the above polypeptides; and detecting in the sample a polynucleotide sequence that amplifies in the presence of the first and second oligonucleotide primers. In a preferred embodiment, at least one of the oligonucleotide primers comprises at least about 10 contiguous nucleotides of a polynucleotide molecule including a sequence selected from the group consisting of SEQ ID NO: 1-109, 111 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171.

In a further aspect, the present invention provides a method for detecting lung cancer in a patient comprising: obtaining a biological sample from the patient; (b) contacting the sample with an oligonucleotide probe specific for a polynucleotide molecule that encodes one of the above polypeptides; and detecting in the sample a polynucleotide sequence that hybridizes to the oligonucleotide probe. Preferably, the oligonucleotide probe comprises at least about 15 contiguous nucleotides of a polynucleotide molecule having a partial sequence selected from the group consisting of SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154,157, 158, 160, 162-164, 167, 168 and 171.

In related aspects, diagnostic kits comprising the above oligonucleotide probes or primers are provided.

In yet a further aspect, methods for the treatment of lung cancer in a patient are provided, the methods comprising obtaining PBMC from the patient, incubating the PBMC with a polypeptide of the present invention (or a polynucleotide that encodes such a polypeptide) to provide incubated T cells and administering the incubated T cells to the patient. The present invention additionally provides methods for the treatment of lung cancer that comprise incubating antigen presenting cells with a polypeptide of the present invention (or a polynucleotide that encodes such a polypeptide) to provide incubated antigen presenting cells and administering the incubated antigen presenting cells to the patient. In certain embodiments, the antigen presenting cells are selected from the group consisting of dendritic cells and macrophages. Compositions for the treatment of lung cancer comprising T cells or antigen presenting cells that have been incubated with a polypeptide or polynucleotide of the present invention are also provided. These and other aspects of the present invention will become apparent upon reference to the following detailed description. All references disclosed herein are hereby incorporated by reference in their entirety as if each was incorporated individually.

DETAILED DESCRIPTION OF THE INVENTION As noted above, the present invention is generally directed to compositions and methods for the therapy and diagnosis of lung cancer. The compositions described herein include polypeptides, fusion proteins and polynucleotide molecules. Also included within the present invention are molecules (such as an antibody or fragment thereof) that bind to the inventive polypeptides. Such molecules are referred to herein as "binding agents." In one aspect, the subject invention discloses polypeptides comprising an immunogenic portion of a human lung tumor protein, wherein the lung tumor protein includes an amino acid sequence encoded by a polynucleotide molecule including a sequence selected from the group consisting of nucleotide sequences recited in SEQ ID NO: 1-109,, 111, 113 115-151, 153, 154,157, 158, 160, 162-164, 167, 168 and 171, the complements of said nucleotide sequences, and variants of such sequences. As used herein, the term "polypeptide" encompasses amino acid chains of any length, including full length proteins, wherein the amino acid residues are linked by covalent peptide bonds. Thus, a polypeptide comprising a portion of one of the above lung tumor proteins may consist entirely of the portion, or the portion may be present within a larger polypeptide that contains additional sequences. The additional sequences may be derived from the native protein or may be heterologous, and such sequences may (but need not) be immunoreactive and/or antigenic.

As detailed below, such polypeptides may be isolated from lung tumor tissue or prepared by synthetic or recombinant means.

As used herein, an "immunogenic portion" of a lung tumor protein is a portion that is capable of eliciting an immune response in a patient inflicted with lung cancer and as such binds to antibodies present within sera from a lung cancer patient. Such immunogenic portions generally comprise at least about 5 amino acid residues, more preferably at least about 10, and most preferably at least about 20 amino acid residues. Immunogenic portions of the proteins described herein may be identified in antibody binding assays. Such assays may generally be performed using any of a variety of means known to those of ordinary skill in the art, as described, for example, in Harlow and Lane, Antibodies: A Laboratory Manual.

Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988. For example, a polypeptide may be immobilized on a solid support (as described below) and contacted with patient sera to allow binding of antibodies within the sera to the immobilized polypeptide. Unbound sera may then be removed and bound antibodies detected using, for example, 2 I-labeled Protein A. Alternatively, a polypeptide may be used to generate monoclonal and polyclonal antibodies for use in detection of the polypeptide in blood or other fluids of lung cancer patients. Methods for preparing and identifying immunogenic portions of antigens of known sequence are well known in the art and include those summarized in Paul. Fundamental Immunology, 3 rd ed., Raven Press, 1993, pp. 243-247.

The term "polynucleotide(s)," as used herein, means a single or doublestranded polymer of deoxyribonucleotide or ribonucleotide bases and includes DNA and corresponding RNA molecules, including HnRNA and mRNA molecules, both sense and anti-sense strands, and comprehends cDNA, genomic DNA and recombinant DNA, as well as wholly or partially synthesized polynucleotides. An HnRNA molecule contains introns and corresponds to a DNA molecule in a generally one-to-one manner. An mRNA molecule corresponds to an HnRNA and DNA molecule from which the introns have been excised. A polynucleotide may consist of an entire gene, or any portion thereof. Operable anti-sense polynucleotides may comprise a fragment of the corresponding polynucleotide, and the definition of "polynucleotide" therefore includes all such operable anti-sense fragments.

The compositions and methods of the present invention also encompass variants of the above polypeptides and polynucleotides. A polypeptide "variant," as used herein, is a polypeptide that differs from the recited polypeptide only in conservative substitutions and/or modifications, such that the therapeutic, antigenic and/or immunogenic properties of the polypeptide are retained. In a preferred embodiment, variant polypeptides differ from an identified sequence by substitution, deletion or addition of five amino acids or fewer. Such variants may generally be identified by modifying one of the above polypeptide sequences, and evaluating the antigenic properties of the modified polypeptide using, for example, the representative procedures described herein. Polypeptide variants preferably exhibit at least about 70%, more preferably at least about 90% and most preferably at least about 95% identity (determined as describe below) to the identified polypeptides.

As used herein, a "conservative substitution" is one in which an amino acid is substituted for another amino acid that has similar properties, such that one skilled in the art of peptide chemistry would expect the secondary structure and hydropathic nature of the polypeptide to be substantially unchanged. In general, the following groups of amino acids represent conservative changes: ala, pro, gly, glu, asp, gin, asn, ser, thr; cys, ser, tyr, thr; val, ile, leu, met, ala, phe; lys, arg, his; and phe, tyr, trp, his.

Variants may also, or alternatively, contain other modifications, including the deletion or addition of amino acids that have minimal influence on the antigenic properties, secondary structure and hydropathic nature of the polypeptide. For example, a polypeptide may be conjugated to a signal (or leader) sequence at the N-terminal end of the protein which co-translationally or post-translationally directs transfer of the protein. The polypeptide may also be conjugated to a linker or other sequence for ease of synthesis, purification or identification of the polypeptide poly-His), or to enhance binding of the polypeptide to a solid support. For example, a polypeptide may be conjugated to an immunoglobulin Fc region.

A nucleotide "variant" is a sequence that differs from the recited nucleotide sequence in having one or more nucleotide deletions, substitutions or additions. Such modifications may be readily introduced using standard mutagenesis techniques, such as oligonucleotide-directed site-specific mutagenesis as taught, for example, by Adelman et al.

(DNA, 2:183, 1983). Nucleotide variants may be naturally occurring allelic variants, or nonnaturally occurring variants. Variant nucleotide sequences preferably exhibit at least about more preferably at least about 80% and most preferably at least about 90% identity (determined as described below) to the recited sequence.

The antigens provided by the present invention include variants that are encoded by polynucleotide sequences which are substantially homologous to one or more of the polynucleotide sequences specifically recited herein. "Substantial homology," as used herein, refers to polynucleotide sequences that are capable of hybridizing under moderately stringent conditions. Suitable moderately stringent conditions include prewashing in a solution of 5X SSC, 0.5% SDS, 1.0 mM EDTA (pH hybridizing at 50 0 C-65 0 C, 5X SSC.

overnight or, in the event of cross-species homology, at 45 0 C with 0.5X SSC; followed by washing twice at 65 0 C for 20 minutes with each of 2X, 0.5X and 0.2X SSC containing 0.1% SDS. Such hybridizing polynucleotide sequences are also within the scope of this invention, as are nucleotide sequences that, due to code degeneracy, encode an immunogenic polypeptide that is encoded by a hybridizing polynucleotide sequence.

Two nucleotide or polypeptide sequences are said to be "identical" if the sequence of nucleotides or amino acid residues in the two sequences is the same when aligned for maximum correspondence as described below. Comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. A "comparison window" as used herein, refers to a segment of at least about 20 contiguous positions, usually 30 to about 75, 40 to about in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.

Optimal alignment of sequences for comparison may be conducted using the Megalign program in the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison, WI), using default parameters. This program embodies several alignment schemes described in the following references: Dayhoff, M.O. (1978) A model of evolutionary change in proteins Matrices for detecting distant relationships. In Dayhoff, M.O. Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington

DC

Vol. 5, Suppl. 3, pp. 345-358; Hein J. (1990) Unified Approach to Alignment and Phylogenes pp. 626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, CA; Higgins, D.G. and Sharp, P.M. (1989) Fast and sensitive multiple sequence alignments on a microcomputer CABIOS 5:151-153; Myers, E.W. and Muller W. (1988) Optimal alignments in linear space CABIOS 4:11-17; Robinson, E.D. (1971) Comb. Theor 11:105: Santou, N.

Nes, M. (1987) The neighbor joining method. A new method for reconstructing phylogenetic trees Mol. Biol. Evol. 4:406-425; Sneath, P.H.A. and Sokal, R.R. (1973) Numerical Taxonomy the Principles and Practice of Numerical Taxonomy, Freeman Press, San Francisco, CA; Wilbur, W.J. and Lipman, D.J. (1983) Rapid similarity searches of nucleic acid and protein data banks Proc. Natl. Acad., Sci. USA 80:726-730.

Preferably, the "percentage of sequence identity" is determined by comparing two optimally aligned sequences over a window of comparison of at least 20 positions, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions gaps) of 20 percent or less, usually 5 to 15 percent, or 10 to 12 percent, as compared to the reference sequences (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid bases or amino aCid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (i.e.

the window size) and multiplying the results by 100 to yield the percentage of sequence identity.

Also included in the scope of the present invention are alleles of the genes encoding the nucleotide sequences recited in herein. As used herein, an "allele" or "allellic sequence" is an alternative form of the gene which may result from at least one mutation in the nucleic acid sequence. Alleles may result in altered mRNAs or polypeptides whose structure or function may or may not be altered. Any given gene may have none, one. or many allelic forms. Common mutational changes which give rise to alleles are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone or in combination with the others, one or more times in a given sequence.

For lung tumor polypeptides with immunoreactive properties, variants may, alternatively, be identified by modifying the amino acid sequence of one of the above polypeptides, and evaluating the immunoreactivity of the modified polypeptide. For lung tumor polypeptides useful for the generation of diagnostic binding agents, a variant may be identified by evaluating a modified polypeptide for the ability to generate antibodies that detect the presence or absence of lung cancer. Such modified sequences may be prepared and tested using, for example, the representative procedures described herein.

The lung tumor polypeptides of the present invention, and polynucleotide molecules encoding such polypeptides, may be isolated from lung tumor tissue using any of a variety of methods well known in the art. Polynucleotide sequences corresponding to a gene (or a portion thereof) encoding one of the inventive lung tumor proteins may be isolated from a lung tumor cDNA library using a subtraction technique as described in detail below.

Examples of such polynucleotide sequences are provided in SEQ ID NO: 1-109,111,113 115- 151, 153. 154, 157, 158, 160, 162-164, 167, 168 and 171. Partial polynucleotide sequences thus obtained may be used to design oligonucleotide primers for the amplification of fulllength polynucleotide sequences from a human genomic DNA library or from a lung tumor cDNA library in a polymerase chain reaction (PCR), using techniques well known in the art (see, for example, Mullis et al., Cold Spring Harbor Symp. Quant. Biol. 51:263, 1987; Erlich ed., PCR Technology, Stockton Press, NY, 1989). For this approach, sequence-specific primers may be designed based on the nucleotide sequences provided herein and may be purchased or synthesized.

An amplified portion may be used to isolate a full length gene from a suitable library a lung tumor cDNA library) using well known techniques. Within such techniques, a library (cDNA or genomic) is screened using one or more polynucleotide probes or primers suitable for amplification. Preferably, a library is size-selected to include larger molecules. Random primed libraries may also be preferred for identifying 5' and upstream regions of genes. Genomic libraries are preferred for obtaining introns and extending 5' sequences.

For hybridization techniques, a partial sequence may be labeled by nicktranslation or end-labeling with 32 P) using well known techniques. A bacterial or bacteriophage library is then screened by hybridizing filters containing denatured bacterial colonies (or lawns containing phage plaques) with the labeled probe (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, 1989). Hybridizing colonies or plaques are selected and expanded, and the DNA is isolated for further analysis. cDNA clones may be analyzed to determine the amount of additional sequence by, for example, PCR using a primer from the partial sequence and a primer from the vector. Restriction maps and partial sequences may be generated to identify one or more overlapping clones. The complete sequence may then be determined using standard techniques, which may involve generating a series of deletion clones. The resulting overlapping sequences are then assembled into a single contiguous sequence. A full length cDNA molecule can be generated by ligating suitable fragments, using well known techniques.

Alternatively, there are numerous amplification techniques for obtaining a full length coding sequence from a partial cDNA sequence. Within such techniques, amplification is generally performed via PCR. Any of a variety of commercially available kits may be used to perform the amplification step. Primers may be designed using techniques well known in the art (see, for example, Mullis et al., Cold Spring Harbor Symp.

Quant. Biol. 51:263, 1987; Erlich ed., PCR Technology, Stockton Press, NY. 1989). and software well known in the art may also be employed. Primers are preferably 22-30 nucleotides in length, have a GC content of at least 50% and anneal to the target sequence at temperatures of about 68 0 C to 72 0 C. The amplified region may be sequenced as described above, and overlapping sequences assembled into a contiguous sequence.

One such amplification technique is inverse PCR (see Triglia et al., Nucl.

Acids Res. 16:8186, 1988), which uses restriction enzymes to generate a fragment in the known region of the gene. The fragment is then circularized by intramolecular ligation and used as a template for PCR with divergent primers derived from the known region. Within an alternative approach, sequences adjacent to a partial sequence may be retrieved by amplification with a primer to a linker sequence and a primer specific to a known region. The amplified sequences are typically subjected to a second round of amplification with the same linker primer and a second primer specific to the known region. A variation on this procedure, which employs two primers that initiate extension in opposite directions from the known sequence, is described in WO 96/38591. Additional techniques include capture PCR (Lagerstrom et al., PCR Methods Applic. 1:111-19, 1991) and walking PCR (Parker et al., Nucl. Acids. Res. 19:3055-60, 1991). Transcription-Mediated Amplification, or TMA is another method that may be utilized for the amplification of DNA, rRNA, or mRNA, as described in Patent No. PCT/US91/03184. This autocatalytic and isothermic non-PCR based method utilizes two primers and two enzymes: RNA polymerase and reverse transcriptase.

One primer contains a promoter sequence for RNA polymerase. In the first amplification, the promoter-primer hybridizes to the target rRNA at a defined site. Reverse transcriptase creates a DNA copy of the target rRNA by extension from the 3'end of the promoter-primer. The RNA in the resulting complex is degraded and a second primer binds to the DNA copy. A new strand of DNA is synthesized from the end of the primer by reverse transcriptase creating double stranded DNA. RNA polymerase recognizes the promoter sequence in the DNA template and initiates transcription. Each of the newly synthesized RNA amplicons re-enters the TMA process and serves as a template for a new round of replication leading to the expotential expansion of the RNA amplicon. Other methods employing amplification may also be employed to obtain a full length cDNA sequence.

In certain instances, it is possible to obtain a full length cDNA sequence by analysis of sequences provided in an expressed sequence tag (EST) database, such as that available from GenBank. Searches for overlapping ESTs may generally be performed using well known programs NCBI BLAST searches), and such ESTs may be used to generate a contiguous full length sequence.

Once a polynucleotide sequence encoding a polypeptide is obtained, the polypeptide may be produced recombinantly by inserting the polynucleotide sequence into an expression vector and expressing the polypeptide in an appropriate host. Any of a variety of expression vectors known to those of ordinary skill in the art may be employed to express recombinant polypeptides of this invention. Expression may be achieved in any appropriate host cell that has been transformed or transfected with an expression vector containing a polynucleotide molecule that encodes the recombinant polypeptide. Suitable host cells include prokaryotes, yeast, insect and higher eukaryotic cells. Preferably, the host cells employed are E. coli, yeast or a mammalian cell line, such as COS or CHO cells. The polynucleotide sequences expressed in this manner may encode naturally occurring polypeptides, portions of naturally occurring polypeptides, or other variants thereof.

Supematants from suitable host/vector systems which secrete the recombinant polypeptide may first be concentrated using a commercially available filter. The concentrate may then be applied to a suitable purification matrix, such as an affinity matrix or ion exchange resin.

Finally, one or more reverse phase HPLC steps can be employed to further purify the recombinant polypeptide.

The lung tumor polypeptides disclosed herein may also be generated by synthetic means. In particular, synthetic polypeptides having fewer than about 100 amino acids, and generally fewer than about 50 amino acids, may be generated using techniques well known to those of ordinary skill in the art. For example, such polypeptides may be synthesized using any of the commercially available solid-phase techniques, such as the Merrifield solid-phase synthesis method, where amino acids are sequentially added to a growing amino acid chain (see, for example, Merrifield, J. Am. Chem. Soc. 85:2149-2146, 1963). Equipment for automated synthesis of polypeptides is commercially available from suppliers such as Perkin Elmer/Applied BioSystems Division (Foster City, CA). and may be operated according to the manufacturer's instructions.

In addition, lung tumor antigens may be identified by T cell expression cloning. One source of tumor specific T cells is from surgically excised tumors from human patients. In one method for isolating and characterizing tumor specific T cells, the excised tumor is minced and enzymatically digested for several hours to release tumor cells and infiltrating lymphocytes (tumor infiltrating T cells, or TILs). The cells are washed in HBSS buffer and passed over a Ficoll (100%/75%/HBSS) discontinuous gradient to separate tumor cells a-.d lymphocytes from non-viable cells. Two bands are harvested from the interfaces; the upper band at the 75%/HBSS interface contains predominantly tumor cells, while the lower band at the 100%/75%/HBSS interface contains a majority of lymphocytes. The TILs are expanded in culture by techniques well known in the art, but preferably in culture media supplemented with 10 ng/ml IL-7 and 100 U/ml IL-2, or alternatively, cultured and expanded in tissue culture plates that have been pre-adsorbed with anti-CD3 monoclonal antibody (OKT3). The resulting TIL cultures are analyzed by FACS to confirm that the vast majority are CD8+ T cells of gated population).

In addition, the tumor cells are also expanded in culture using standard techniques well known in the art to establish a tumor cell line, which is later confirmed to be lung carcinoma cells by immunohistochemical analysis. The tumor cell line is transduced with a retroviral vector to express human CD80. The tumor cell line is further characterized by FACS analysis to confirm the strong expression levels of CD80, class I and II MHC molecules.

The specificity of the TIL lines to lung tumor is confirmed by INF-y and/or TNF-ca cytokine release assays. For example, TIL cells from day 21 cultures are co-cultured with either autologous or allogeneic tumor cells, EBV-immortalized LCL, or control cell lines Daudi and K562 and the culture supernatant monitored by ELISA for the presence of cytokines. The expression of these specific cytokines in the presence of tumor or negative control cells indicates whether the TIL lines are tumor specific and potentially recognizing tumor antigen presented by the autologous MHC molecules.

The characterized tumor-specific TIL lines can be expanded and cloned by methods well known in the art. For example, the TIL lines may be expanded to suitable numbers for T cell expression cloning by using soluble anti-CD3 antibody in culture with irradiated EBV transformed LCLs and PBL feeder cells in the presence of 20 U/ml IL-2.

Clones from the expanded TIL lines can be generated by standard limiting dilution techniques. In particular, TIL cells are seeded at 0.5 cells/well in a 96-well U bottom plate and stimulated with CD-80-transduced autologous tumor cells, EBV transformed LCL, and PBL feeder cells in the presence of 50 U/ml IL-2. These clones may be further analyzed for tumor specificity by 5 "Cr microcytotoxicity and IFN-y bioassays. Additionally, the MHC restriction element recognized by the TIL clones may be determined by antibody blocking studies well known in the art.

The CTL lines or clones described above may be employed to identify tumor specific antigens. For example, autologous fibroblasts or LCL from a patient may be transfected or transduced with polynucleotide fragments derived from a lung tumor cDNA library to generate target cells expressing tumor polypeptides. The target cells expressing tumor polypeptides in the context of MHC will be recognized by the CTL line or clone resulting in T-cell activation, which can be monitored by cytokine detection assays. The tumor gene being expressed by the target cell and recognized by the tumor-specific CTL is then isolated by techniques described above. In general, regardless of the method of preparation, the polypeptides disclosed herein are prepared in an isolated, substantially pure form the polypeptides are homogenous as determined by amino acid composition and primary sequence analysis). Preferably, the polypeptides are at least about 90% pure, more preferably at least about 95% pure and most preferably at least about 99% pure. In certain preferred embodiments, described in more detail below, the substantially pure polypeptides are incorporated into pharmaceutical compositions or vaccines for use in one or more of the methods disclosed herein.

In a related aspect, the present invention provides fusion proteins comprising a first and a second inventive polypeptide or, alternatively, a polypeptide of the present invention and a known lung tumor antigen, together with variants of such fusion proteins.

The fusion proteins of the present invention may (but need not) include a linker peptide between the first and second polypeptides.

A polynucleotide sequence encoding a fusion protein of the present invention is constructed using known recombinant DNA techniques to assemble separate polynucleotide sequences encoding the first and second polypeptides into an appropriate expression vector. The 3' end of a DNA sequence encoding the first polypeptide is ligated, with or without a peptide linker, to the 5' end of a DNA sequence encoding the second polypeptide so that the reading frames of the sequences are in phase to permit mRNA translation of the two DNA sequences into a single fusion protein that retains the biological activity of both the first and the second polypeptides.

A peptide linker sequence may be employed to separate the first and the second polypeptides by a distance sufficient to ensure that each polypeptide folds into its secondary and tertiary structures. Such a peptide linker sequence is incorporated into the fusion protein using standard techniques well known in the art. Suitable peptide linker sequences may be chosen based on the following factors: their ability to adopt a flexible extended conformation; their inability to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides; and the lack of hydrophobic or charged residues that might react with the polypeptide functional epitopes. Preferred peptide linker sequences contain Gly, Asn and Ser residues. Other near neutral amino acids, such as Thr and Ala may also be used in the linker sequence. Amino acid sequences which may be usefully employed as linkers include those disclosed in Maratea et al., Gene 40:39-46, 1985; Murphy et al., Proc. Natl. Acad. Sci. USA 83:8258-8262, 1986; U.S. Patent No. 4,935,233 and U.S. Patent No. 4,751,180. The linker sequence may be from 1 to about amino acids in length. Peptide sequences are not required when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.

The ligated polynucleotide sequences are operably linked to suitable transcriptional or translational regulatory elements. The regulatory elements responsible for expression of polynucleotide are located only 5' to the DNA sequence encoding the first polypeptides. Similarly, stop codons require to end translation and transcription termination signals are only present 3' to the DNA sequence encoding the second polypeptide.

Fusion proteins are also provided that comprise a polypeptide of the present invention together with an unrelated immunogenic protein. Preferably the immunogenic protein is capable of eliciting a recall response. Examples of such proteins include tetanus, tuberculosis and hepatitis proteins (see, for example, Stoute et al. New Engl. J. Med., 336:86- 91 (1997)).

Polypeptides of the present invention that comprise an immunogenic portion of a lung tumor protein may generally be used for therapy of lung cancer, wherein the polypeptide stimulates the patient's own immune response to lung tumor cells. The present invention thus provides methods for using one or more of the compounds described herein (which may be polypeptides, polynucleotide molecules or fusion proteins) for immunotherapy of lung cancer in a patient. As used herein, a "patient" refers to any warmblooded animal, preferably a human. A patient may be afflicted with disease, or may be free of detectable disease. Accordingly, the compounds disclosed herein may be used to treat lung cancer or to inhibit the development of lung cancer. The compounds are preferably administered either prior to or following surgical removal of primary tumors and/or treatment by administration of radiotherapy and conventional chemotherapeutic drugs.

In these aspects, the inventive polypeptide is generally present within a pharmaceutical composition or a vaccine. Pharmaceutical compositions may comprise one or more polypeptides, each of which may contain one or more of the above sequences (or variants thereof), and a physiologically acceptable carrier. The vaccines may comprise one or more such polypeptides and a non-specific immune-response enhancer, wherein the nonspecific immune response enhancer is capable of eliciting or enhancing an immune response to an exogenous antigen. Examples of non-specific-immune response enhancers include adjuvants, biodegradable microspheres polylactic galactide) and liposomes (into which the polypeptide is incorporated). Pharmaceutical compositions and vaccines may also contain other epitopes of lung tumor antigens, either incorporated into a fusion protein as described above a single polypeptide that contains multiple epitopes) or present within a separate polypeptide.

Alternatively, a pharmaceutical composition or vaccine may contain polynucleotide encoding one or more of the above polypeptides and/or fusion proteins, such that the polypeptide is generated in situ. In such pharmaceutical compositions and vaccines, the polynucleotide may be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression systems, bacteria and viral expression systems. Appropriate nucleic acid expression systems contain the necessary polynucleotide sequences for expression in the patient (such as a suitable promoter).

Bacterial delivery systems involve the administration of a bacterium (such as Bacillus- Calmette-Guerrin) that expresses an epitope of a lung cell antigen on its cell surface. In a preferred embodiment, the polynucleotides may be introduced using a viral expression system vaccinia or other pox virus, retrovirus, or adenovirus), which may involve the use of a non-pathogenic (defective), replication competent virus. Suitable systems are disclosed, for example, in Fisher-Hoch et al., PNAS 86:317-321, 1989; Flexner et al., Ann. N.Y. Acad. Sci.

569:86-103, 1989; Flexner et al., Vaccine 8:17-21, 1990; U.S. Patent Nos. 4,603,112, 4,769,330, and 5,017,487; WO89/01973; U.S. Patent No. 4,777,127; GB 2,200,651; EP 0,345,242; WO 91/02805; Berkner, Biotechniques 6:616-627, 1988; Rosenfeld et al., Science 252:431-434, 1991; Kolls et al., PNAS 91:215-219, 1994; Kass-Eisler et al., PNAS 90:11498-11502, 1993; Guzman et al., Circulation 88:2838-2848, 1993; and Guzman et al., Cir. Res. 73:1202-1207, 1993. Techniques for incorporating polynucleotide into such expression systems are well known to those of ordinary skill in the art. The polynucleotides may also be "naked," as described, for example, in published PCT application WO 90/11092, and Ulmer et al., Science 259:1745-1749, 1993, reviewed by Cohen, Science 259:1691-1692, 1993. The uptake of naked polynucleotides may be increased by coating the polynucleotides onto biodegradable beads, which are efficiently transported into the cells.

Routes and frequency of administration, as well as dosage, will vary from individual to individual and may parallel those currently being used in immunotherapy of other diseases. In general, the pharmaceutical compositions and vaccines may be administered by injection intracutaneous, intramuscular, intravenous or subcutaneous), intranasally by aspiration) or orally. Between 1 and 10 doses may be administered over a 3-24 week period. Preferably, 4 doses are administered, at an interval of 3 months, and booster administrations may be given periodically thereafter. Alternate protocols may be appropriate for individual patients. A suitable dose is an amount of polypeptide or polynucleotide that is effective to raise an immune response (cellular and/or humoral) against lung tumor cells in a treated patient. A suitable immune response is at least 10-50% above the basal untreated) level. In general, the amount of polypeptide present in a dose (or produced in situ by the polynucleotide molecule(s) in a dose) ranges from about 1 pg to about 100 mg per kg of host, typically from about 10 pg to about I mg, and preferably from about 100 pg to about 1 jlg. Suitable dose sizes will vary with the size of the patient, but will typically range from about 0.01 mL to about 5 mL.

While any suitable carrier known to those of ordinary skill in the art may be employed in the pharmaceutical compositions of this invention, the type of carrier will vary depending on the mode of administration. For parenteral administration, such as subcutaneous injection, the carrier preferably comprises water, saline, alcohol, a lipid, a wax and/or a buffer. For oral administration, any of the above carriers or a solid carrier, such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, and/or magnesium carbonate, may be employed. Biodegradable microspheres polylactic glycolide) may also be employed as carriers for the pharmaceutical compositions of this invention. Suitable biodegradable microspheres are disclosed, for example, in U.S.

Patent Nos. 4,897,268 and 5,075,109.

Any of a variety of immune-response enhancers may be employed in the vaccines of this invention. For example, an adjuvant may be included. Most adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a nonspecific stimulator of immune response, such as lipid A, Bordella pertussis or Mycobacterium tuberculosis. Such adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, MI) and Merck Adjuvant 65 (Merck and Company, Inc., Rahway.

NJ).Polypeptides and polynucleotides disclosed herein may also be employed in adoptive immunotherapy for the treatment of cancer. Adoptive immunotherapy may be broadly classified into either active or passive immunotherapy. In active immunotherapy, treatment relies on the in vivo stimulation of the endogenous host immune system to react against tumors with the administration of immune response-modifying agents (for example, tumor vaccines, bacterial adjuvants, and/or cytokines).

In passive immunotherapy, treatment involves the delivery of biologic reagents with established tumor-immune reactivity (such as effector cells or antibodies) that can directly or indirectly mediate antitumor effects and does not necessarily depend on an intact host immune system. Examples of effector cells include T lymphocytes (for example, CD8+ cytotoxic T-lymphocyte, CD4+ T-helper, gamma/delta T lymphocytes, tumorinfiltrating lymphocytes), killer cells (such as Natural Killer cells, lymphokine-activated killer cells), B cells, or antigen presenting cells (such as dendritic cells and macrophages) expressing the disclosed antigens. The polypeptides disclosed herein may also be used to generate antibodies or anti-idiotypic antibodies (as in U.S. Patent No. 4,918,164), for passive immunotherapy.

The predominant method of procuring adequate numbers of T-cells for adoptive immunotherapy is to grow immune T-cells in vitro. Culture conditions for expanding single antigen-specific T-cells to several billion in number with retention of antigen recognition in vivo are well known in the art. These in vitro culture conditions typically utilize intermittent stimulation with antigen, often in the presence of cytokines, such as IL-2, and non-dividing feeder cells. As noted above, the immunoreactive polypeptides described herein may be used to rapidly expand antigen-specific T cell cultures in order to generate sufficient number of cells for immunotherapy. In particular, antigen-presenting cells, such as dendritic, macrophage, monocyte, fibroblast, or B-cells, may be pulsed with immunoreactive polypeptides, or polynucleotide sequence(s) may be introduced into antigen presenting cells, using a variety of standard techniques well known in the art. For example.

antigen presenting cells may be transfected or transduced with a polynucleotide sequence, wherein said sequence contains a promoter region appropriate for increasing expression, and can be expressed as part of a recombinant virus or other expression system. Several viral vectors may be used to transduce an antigen presenting cell, including pox virus, vaccinia virus, and adenovirus; also, antigen presenting cells may be transfected with polynucleotide sequences disclosed herein by a variety of means, including gene-gun technology, lipidmediated delivery, electroporation, osmotic shock, and particlate delivery mechanisms, resulting in efficient and acceptable expression levels as determined by one of ordinary skill in the art. For cultured T-cells to be effective in therapy, the cultured T-cells must be able to grow and distribute widely and to survive long term in vivo. Studies have demonstrated that cultured T-cells can be induced to grow in vivo and to survive long term in substantial numbers by repeated stimulation with antigen supplemented with IL-2 (see, for example, Cheever, et al, "Therapy With Cultured T Cells: Principles Revisited, Immunological Reviews, 157:177, 1997).

The polypeptides disclosed herein may also be employed to generate and/or isolate tumor-reactive T-cells, which can then be administered to the patient. In one technique, antigen-specific T-cell lines may be generated by in vivo immunization with short peptides corresponding to immunogenic portions of the disclosed polypeptides. The resulting antigen specific CD8+ CTL clones may be isolated from the patient, expanded using standard tissue culture techniques, and returned to the patient.

Alternatively, peptides corresponding to immunogenic portions of the polypeptides may be employed to generate tumor reactive T cell subsets by selective in vitro stimulation and expansion of autologous T cells to provide antigen-specific T cells which may be subsequently transferred to the patient as described, for example, by Chang et al, (Crit. Rev. Oncol. Hematol., 22(3), 213, 1996). Cells of the immune system, such as T cells, may be isolated from the peripheral blood of a patient, using a commercially available cell separation system, such as CellPro Incorporated's (Bothell, WA) CEPRATETM system (see U.S. Patent No. 5,240,856; U.S. Patent No. 5,215,926; WO 89/06280; WO 91/16116 and WO 92/07243). The separated cells are stimulated with one or more of the immunoreactive polypeptides contained within a delivery vehicle, such as a microsphere, to provide antigenspecific T cells. The population of tumor antigen-specific T cells is then expanded using standard techniques and the cells are administered back to the patient.

In other embodiments, T-cell and/or antibody receptors specific for the polypeptides disclosed herein can be cloned, expanded, and transferred into other vectors or effector cells for use in adoptive immunotherapy. In particular, T cells may be transfected with the appropriate genes to express the variable domains from tumor specific monoclonal antibodies as the extracellular recognition elements and joined to the T cell receptor signaling chains, resulting in T cell activation, specific lysis, and cytokine release. This enables the T cell to redirect its specificity in an MHC-independent manner. See for example. Eshhar, Z., Cancer Immunol nmmunother, 45(3-4):131-6, 1997 and Hwu, et al, Cancer Res, 55(15):3369-73, 1995. Another embodiment may include the transfection of tumor antigen specific alpha and beta T cell receptor chains into alternate T cells, as in Cole. DJ, et al, Cancer Res, 55(4):748-52, 1995.

In a further embodiment, syngeneic or autologous dendritic cells may be pulsed with peptides corresponding to at least an immunogenic portion of a polypeptide disclosed herein. The resulting antigen-specific dendritic cells may either be transferred into a patient, or employed to stimulate T cells to provide antigen-specific T cells which may, in turn, be administered to a patient. The use of peptide-pulsed dendritic cells to generate antigen-specific T cells and the subsequent use of such antigen-specific T cells to eradicate tumors in a murine model has been demonstrated by Cheever et al, Immunological Reviews.

157:177, 1997).

Furthermore, vectors expressing the disclosed polynucleotides may be introduced into stem cells taken from the patient and clonally propagated in vitro for autologous transplant back into the same patient.

Additionally, vectors expressing the disclosed polynucleotides may be introduced into stem cells taken from the patient and clonally propagated in vitro for autologous transplant back into the same patient. Polypeptides and fusion proteins of the present invention may also, or alternatively, be used to generate binding agents, such as antibodies or fragments thereof, that are capable of detecting metastatic human lung tumors.

Binding agents of the present invention may generally be prepared using methods known to those of ordinary skill in the art, including the representative procedures described herein.

Binding agents are capable of differentiating between patients with and without lung cancer, using the representative assays described herein. In other words, antibodies or other binding agents raised against a lung tumor protein, or a suitable portion thereof, will generate a signal indicating the presence of primary or metastatic lung cancer in at least about 20% of patients afflicted with the disease, and will generate a negative signal indicating the absence of the disease in at least about 90% of individuals without primary or metastatic lung cancer.

Suitable portions of such lung tumor proteins are portions that are able to generate a binding agent that indicates the presence of primary or metastatic lung cancer in substantially all at least about 80%, and preferably at least about 90%) of the patients for which lung cancer would be indicated using the full length protein, and that indicate the absence of lung cancer in substantially all of those samples that would be negative when tested with full length protein. The representative assays described below, such as the two-antibody sandwich assay, may generally be employed for evaluating the ability of a binding agent to detect metastatic human lung tumors.

The ability of a polypeptide prepared as described herein to generate antibodies capable of detecting primary or metastatic human lung tumors may generally be evaluated by raising one or more antibodies against the polypeptide (using, for example, a representative method described herein) and determining the ability of such antibodies to detect such tumors in patients. This determination may be made by assaying biological samples from patients with and without primary or metastatic lung cancer for the presence of a polypeptide that binds to the generated antibodies. Such test assays may be performed, for example, using a representative procedure described below. Polypeptides that generate antibodies capable of detecting at least 20% of primary or metastatic lung tumors by such procedures are considered to be useful in assays for detecting primary or metastatic human lung tumors. Polypeptide specific antibodies may be used alone or in combination to improve sensitivity.

Polypeptides capable of detecting primary or metastatic human lung tumors may be used as markers for diagnosing lung cancer or for monitoring disease progression in patients. In one embodiment, lung cancer in a patient may be diagnosed by evaluating a biological sample obtained from the patient for the level of one or more of the above polypeptides, relative to a predetermined cut-off value. As used herein, suitable "biological samples" include blood, sera, urine and/or lung secretions.

The level of one or more of the above polypeptides may be evaluated using any binding agent specific for the polypeptide(s). A "binding agent," in the context of this invention, is any agent (such as a compound or a cell) that binds to a polypeptide as described above. As used herein, "binding" refers to a noncovalent association between two separate molecules (each of which may be free in solution) or present on the surface of a cell or a solid support), such that a "complex" is formed. Such a complex may be free or immobilized (either covalently or noncovalently) on a support material. The ability to bind may generally be evaluated by determining a binding constant for the formation of the complex. The binding constant is the value obtained when the concentration of the complex is divided by the product of the component concentrations. In general, two compounds are said to "bind" in the context of the present invention when the binding constant for complex formation exceeds about 10' L/mol. The binding constant may be determined using methods well known to those of ordinary skill in the art.

Any agent that satisfies the above requirements may be a binding agent. For example, a binding agent may be a ribosome with or without a peptide component, an RNA molecule or a peptide. In a preferred embodiment, the binding partner is an antibody, or a fragment thereof. Such antibodies may be polyclonal, or monoclonal. In addition, the antibodies may be single chain, chimeric, CDR-grafied or humanized. Antibodies may be prepared by the methods described herein and by other methods well known to those of skill in the art.

There are a variety of assay formats known to those of ordinary skill in the art for using a binding partner to detect polypeptide markers in a sample. See, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988. In a preferred embodiment, the assay involves the use of binding partner immobilized on a solid support to bind to and remove the polypeptide from the remainder of the sample. The bound polypeptide may then be detected using a second binding partner that contains a reporter group. Suitable second binding partners include antibodies that bind to the binding partner/polypeptide complex. Alternatively, a competitive assay may be utilized, in which a polypeptide is labeled with a reporter group and allowed to bind to the immobilized binding partner after incubation of the binding partner with the sample. The extent to which components of the sample inhibit the binding of the labeled polypeptide to the binding partner is indicative of the reactivity of the sample with the immobilized binding partner.

The solid support may be any material known to those of ordinary skill in the art to which the antigen may be attached. For example, the solid support may be a test well in a microtiter plate or a nitrocellulose or other suitable membrane. Alternatively, the support may be a bead or disc, such as glass, fiberglass, latex or a plastic material such as polystyrene or polyvinylchloride. The support may also be a magnetic particle or a fiber optic sensor, such as those disclosed, for example, in U.S. Patent No. 5,359,681. The binding agent may be immobilized on the solid support using a variety of techniques known to those of skill in the art, which are amply described in the patent and scientific literature. In the context of the present invention, the term "immobilization" refers to both noncovalent association, such as adsorption, and covalent attachment (which may be a direct linkage between the antigen and functional groups on the support or may be a linkage by way of a cross-linking agent).

Immobilization by adsorption to a well in a microtiter plate or to a membrane is preferred. In such cases, adsorption may be achieved by contacting the binding agent, in a suitable buffer, with the solid support for a suitable amount of time. The contact time varies with temperature, but is typically between about 1 hour and about 1 day. In general, contacting a well of a plastic microtiter plate (such as polystyrene or polyvinylchloride) with an amount of binding agent ranging from about 10 ng to about 10 rig, and preferably about 100 ng to about 1 ig, is sufficient to immobilize an adequate amount of binding agent.

Covalent attachment of binding agent to a solid support may generally be achieved by first reacting the support with a bifunctional reagent that will react with both the support and a functional group, such as a hydroxyl or amino group, on the binding agent. For example, the binding agent may be covalently attached to supports having an appropriate polymer coating using benzoquinone or by condensation of an aldehyde group on the support with an amine and an active hydrogen on the binding partner (see. Pierce Immunotechnology Catalog and Handbook, 1991, at A12-A13).

In certain embodiments, the assay is a two-antibody sandwich assay. This assay may be performed by first contacting an antibody that has been immobilized on a solid support, commonly the well of a microtiter plate, with the sample, such that polypeptides within the sample are allowed to bind to the immobilized antibody. Unbound sample is then removed from the immobilized polypeptide-antibody complexes and a second antibody (containing a reporter group) capable of binding to a different site on the polypeptide is added. The amount of second antibody that remains bound to the solid support is then determined using a method appropriate for the specific reporter group.

More specifically, once the antibody is immobilized on the support as described above, the remaining protein binding sites on the support are typically blocked.

Any suitable blocking agent lknown to those of ordinary skill in the art, such as bovine serum albumin or Tween 20TM (Sigma Chemical Co., St. Louis, MO). The immobilized antibody is then incubated with the sample, and polypeptide is allowed to bind to the antibody. The sample may be diluted with a suitable diluent, such as phosphate-buffered saline (PBS) prior to incubation. In general, an appropriate contact time incubation time) is that period of time that is sufficient to detect the presence of polypeptide within a sample obtained from an individual with lung cancer. Preferably, the contact time is sufficient to achieve a level of binding that is at least about 95% of that achieved at equilibrium between bound and unbound polypeptide. Those of ordinary skill in the art will recognize that the time necessary to achieve equilibrium may be readily determined by assaying the level of binding that occurs over a period of time. At room temperature, an incubation time of about 30 minutes is generally sufficient.

Unbound sample may then be removed by washing the solid support with an appropriate buffer, such as PBS containing 0.1% Tween 20TM. The second antibody, which contains a reporter group, may then be added to the solid support. Preferred reporter groups include enzymes (such as horseradish peroxidase), substrates, cofactors, inhibitors, dyes, radionuclides, luminescent groups, fluorescent groups and biotin. The conjugation of antibody to reporter group may be achieved using standard methods known to those of ordinary skill in the art.

The second antibody is then incubated with the immobilized antibodypolypeptide complex for an amount of time sufficient to detect the bound polypeptide. An appropriate amount of time may generally be determined by assaying the level of binding that occurs over a period of time. Unbound second antibody is then removed and bound second antibody is detected using the reporter group. The method employed for detecting the reporter group depends upon the nature of the reporter group. For radioactive groups, scintillation counting or autoradiographic methods are generally appropriate. Spectroscopic methods may be used to detect dyes, luminescent groups and fluorescent groups. Biotin may be detected using avidin, coupled to a different reporter group (commonly a radioactive or fluorescent group or an enzyme). Enzyme reporter groups may generally be detected by the addition of substrate (generally for a specific period of time), followed by spectroscopic or other analysis of the reaction products.

To determine the presence or absence of lung cancer, the signal detected from the reporter group that remains bound to the solid support is generally compared to a signal that corresponds a predetermined cut-off value. In one preferred embodiment, the cut-off value is the average mean signal obtained when the immobilized antibody is incubated with samples from patients without lung cancer. In general, a sample generating a signal that is three standard deviations above the predetermined cut-off value is considered positive for lung cancer. In an alternate preferred embodiment, the cut-off value is determined using a Receiver Operator Curve, according to the method of Sackett et al., Clinical Epidemiology: A Basic Science for Clinical Medicine, Little Brown and Co., 1985, p. 106-7. Briefly, in this embodiment, the cut-off value may be determined from a plot of pairs of true positive rates sensitivity) and false positive rates (100%-specificity) that correspond to each possible cut-off value for the diagnostic test result. The cut-off value on the plot that is the closest to the upper left-hand corner the value that encloses the largest area) is the most accurate cut-off value, and a sample generating a signal that is higher than the cut-off value determined by this method may be considered positive. Alternatively, the cut-off value may be shifted to the left along the plot, to minimize the false positive rate, or to the right, to minimize the false negative rate. In general, a sample generating a signal that is higher than the cut-off value determined by this method is considered positive for lung cancer.

In a related embodiment, the assay is performed in a flow-through or strip test format, wherein the antibody is immobilized on a membrane, such as nitrocellulose. In the flow-through test, polypeptides within the sample bind to the immobilized antibody as the sample passes through the membrane. A second, labeled antibody then binds to the antibodypolypeptide complex as a solution containing the second antibody flows through the membrane. The detection of bound second antibody may then be performed as described above. In the strip test format, one end of the membrane to which antibody is bound is immersed in a solution containing the sample. The sample migrates along the membrane through a region containing second antibody and to the area of immobilized antibody.

Concentration of second antibody at the area of immobilized antibody indicates the presence of lung cancer. Typically, the concentration of second antibody at that site generates a pattern, such as a line, that can be read visually. The absence of such a pattern indicates a negative result. In general, the amount of antibody immobilized on the membrane is selected to generate a visually discernible pattern when the biological sample contains a level of polypeptide that would be sufficient to generate a positive signal in the two-antibody sandwich assay, in the format discussed above. Preferably, the amount of antibody immobilized on the membrane ranges from about 25 ng to about 1 Gg, and more preferably from about 50 ng to about 500 ng. Such tests can typically be performed with a very small amount of biological sample.

Of course, numerous other assay protocols exist that are suitable for use with the antigens or antibodies of the present invention. The above descriptions are intended to be exemplary only.

In another embodiment, the above polypeptides may be used as markers for the progression of lung cancer. In this embodiment, assays as described above for the diagnosis of lung cancer may be performed over time, and the change in the level of reactive polypeptide(s) evaluated. For example, the assays may be performed every 24-72 hours for a period of 6 months to 1 year, and thereafter performed as needed. In general, lung cancer is progressing in those patients in whom the level of polypeptide detected by the binding agent increases over time. In contrast, lung cancer is not progressing when the level of reactive polypeptide either remains constant or decreases with time.

Antibodies for use in the above methods may be prepared by any of a variety of techniques known to those of ordinary skill in the art. See, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988. In one such technique, an immunogen comprising the antigenic polypeptide is initially injected into any of a wide variety of mammals mice, rats, rabbits, sheep and goats). In this step, the polypeptides of this invention may serve as the immunogen without modification.

Alternatively, particularly for relatively short polypeptides, a superior immune response may be elicited if the polypeptide is joined to a carrier protein, such as bovine serum albumin or keyhole limpet hemocyanin. The immunogen is injected into the animal host, preferably according to a predetermined schedule incorporating one or more booster immunizations, and the animals are bled periodically. Polyclonal antibodies specific for the polypeptide may then be purified from such antisera by, for example, affinity chromatography using the polypeptide coupled to a suitable solid support.

Monoclonal antibodies specific for the antigenic polypeptide of interest may be prepared, for example, using the technique of Kohler and Milstein, Eur. J. Immunol.

6:511-519, 1976, and improvements thereto. Briefly, these methods involve the preparation of immortal cell lines capable of producing antibodies having the desired specificity reactivity with the polypeptide of interest). Such cell lines may be produced, for example, from spleen cells obtained from an animal immunized as described above. The spleen cells are then immortalized by, for example, fusion with a myeloma cell fusion partner, preferably one that is syngeneic with the immunized animal. A variety of fusion techniques may be employed. For example, the spleen cells and myeloma cells may be combined with a nonionic detergent for a few minutes and then plated at low density on a selective medium that supports the growth of hybrid cells, but not myeloma cells. A preferred selection technique uses HAT (hypoxanthine, aminopterin, thymidine) selection. After a sufficient time, usually about 1 to 2 weeks, colonies of hybrids are observed. Single colonies are selected and tested for binding activity against the polypeptide. Hybridomas having high reactivity and specificity are preferred.

Monoclonal antibodies may be isolated from the supernatants of growing hybridoma colonies. In addition, various techniques may be employed to enhance the yield, such as injection of the hybridoma cell line into the peritoneal cavity of a suitable vertebrate host, such as a mouse. Monoclonal antibodies may then be harvested from the ascites fluid or the blood. Contaminants may be removed from the antibodies by conventional techniques, such as chromatography, gel filtration, precipitation, and extraction. The polypeptides of this invention may be used in the purification process in, for example, an affinity chromatography step.

Monoclonal antibodies of the present invention may also be used as therapeutic reagents, to diminish or eliminate lung tumors. The antibodies may be used on their own (for instance, to inhibit metastases) or coupled to one or more therapeutic agents.

Suitable agents in this regard include radionuclides, differentiation inducers, drugs, toxins, and derivatives thereof. Preferred radionuclides include 9 0 123, 125, 1311, 86 Re, 'SSRe, 21At, and 2 12 Bi. Preferred drugs include methotrexate, and pyrimidine and purine analogs.

Preferred differentiation inducers include phorbol esters and butyric acid. Preferred toxins include ricin, abrin, diptheria toxin, cholera toxin, gelonin, Pseudomonas exotoxin. Shigella toxin, and pokeweed antiviral protein.

A therapeutic agent may be coupled covalently bonded) to a suitable monoclonal antibody either directly or indirectly via a linker group). A direct reaction between an agent and an antibody is possible when each possesses a substituent capable of reacting with the other. For example, a nucleophilic group, such as an amino or sulfhydryl group, on one may be capable of.reacting with a carbonyl-containing group, such as an anhydride or an acid halide, or with an alkyl group containing a good leaving group a halide) on the other.

Alternatively, it may be desirable to couple a therapeutic agent and an antibody via a linker group. A linker group can function as a spacer to distance an antibody from an agent in order to avoid interference with binding capabilities. A linker group can also serve to increase the chemical reactivity of a substituent on an agent or an antibody, and thus increase the coupling efficiency. An increase in chemical reactivity may also facilitate the use of agents, or functional groups on agents, which otherwise would not be possible.

It will be evident to those skilled in the art that a variety of bifunctional or polyfunctional reagents, both homo- and hetero-functional (such as those described in the catalog of the Pierce Chemical Co., Rockford, IL), may be employed as the linker group.

Coupling may be effected, for example, through amino groups, carboxyl groups, sulfhydryl groups or oxidized carbohydrate residues. There are numerous references describing such methodology, U.S. Patent No. 4,671,958, to Rodwell et al.

Where a therapeutic agent is more potent when free from the antibody portion of the immunoconjugates of the present invention, it may be desirable to use a linker group which is cleavable during or upon internalization into a cell. A number of different cleavable linker groups have been described. The mechanisms for the intracellular release of an agent from these linker groups include cleavage by reduction of a disulfide bond U.S. Patent No. 4,489,710, to Spitler), by irradiation of a photolabile bond U.S. Patent No. 4,625,014, to Senter et by hydrolysis ofderivatized amino acid side chains U.S.

Patent No. 4,638,045, to Kohn et by serum complement-mediated hydrolysis

U.S.

Patent No. 4,671,958, to Rodwell et and acid-catalyzed hydrolysis U.S. Patent No. 4,569,789, to Blattler et al.).

It may be desirable to couple more than one agent to an antibody. In one embodiment, multiple molecules of an agent are coupled to one antibody molecule. In another embodiment, more than one type of agent may be coupled to one antibody.

Regardless of the particular embodiment, immunoconjugates with more than one agent may be prepared in a variety of ways. For example, more than one agent may be coupled directly to an antibody molecule, or linkers which provide multiple sites for attachment can be used.

Alternatively, a carrier can be used.

A carrier may bear the agents in a variety of ways, including covalent bonding either directly or via a linker group. Suitable carriers include proteins such as albumins U.S. Patent No. 4,507,234, to Kato et peptides and polysaccharides such as aminodextran U.S. Patent No. 4,699,784, to Shih et A carrier may also bear an agent by noncovalent bonding or by encapsulation, such as within a liposome vesicle U.S. Patent Nos. 4,429,008 and 4,873,088). Carriers specific for radionuclide agents include radiohalogenated small molecules and chelating compounds. For example, U.S. Patent No.

4,735,792 discloses representative radiohalogenated small molecules and their synthesis. A radionuclide chelate may be formed from chelating compounds that include those containing nitrogen and sulfur atoms as the donor atoms for binding the metal, or metal oxide, radionuclide. For example, U.S. Patent No. 4,673,562, to Davison etal. discloses representative chelating compounds and their synthesis.

A variety of routes of administration for the antibodies and immunoconjugates may be used. Typically, administration will be intravenous, intramuscular, subcutaneous or in the bed of a resected tumor. It will be evident that the precise dose of the antibody/immunoconjugate will vary depending upon the antibody used, the antigen density on the tumor, and the rate of clearance of the antibody.

Diagnostic reagents of the present invention may also comprise polynucleotide sequences encoding one or more of the above polypeptides, or one or more portions thereof.

For example, at least two oligonucleotide primers may be employed in a polymerase chain reaction (PCR) based assay to amplify lung tumor-specific cDNA derived from a biological sample, wherein at least one of the oligonucleotide primers is specific for a polynucleotide molecule encoding a lung tumor protein of the present invention. The presence of the amplified cDNA is then detected using techniques well known in the art, such as gel electrophoresis. Similarly, oligonucleotide probes specific for a polynucleotide molecule encoding a lung tumor protein of the present invention may be used in a hybridization assay to detect the presence of an inventive polypeptide in a biological sample.

As used herein, the term "oligonucleotide primer/probe specific for a polynucleotide molecule" means an oligonucleotide sequence that has at least about preferably at least about 75% and more preferably at least about 90%, identity to the polynucleotide molecule in question. Oligonucleotide primers and/or probes which may be usefully employed in the inventive diagnostic methods preferably have at least about 10-40 nucleotides. In a preferred embodiment, the oligonucleotide primers comprise at least about contiguous nucleotides of a polynucleotide molecule comprising sequence selected from SEQ ID NO: 1-109, 111, 113 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171.

Preferably, oligonucleotide probes for use in the inventive diagnostic methods comprise at least about 15 contiguous oligonucleotides of a polynucleotide molecule comprising a sequence provided in SEQ ID NO: 1-109,111, 113 115-151, 153, 154, 157, 158. 160, 162- 164, 167, 168 and 171. Techniques for both PCR based assays and hybridization assays are well known in the art (see, for example, Mullis et al. Ibid; Ehrlich, Ibid). Primers or probes may thus be used to detect lung tumor-specific sequences in biological samples, including blood, semen, lung tissue and/or lung tumor tissue.

The following Examples are offered by way of illustration and not by way of limitation.

EXAMPLES

Example 1 ISOLATION AND CHARACTERIZATION OF cDNA SEQUENCES ENCODING LUNG TUMOR POLYPEPTIDES This example illustrates the isolation of cDNA molecules encoding lung tumor-specific polypeptides from lung tumor cDNA libraries.

A. Isolation of cDNA Sequences from a Lung Squamous Cell Carcinoma Library A human lung squamous cell carcinoma cDNA expression library was constructed from poly A' RNA from a pool of two patient tissues using a Superscript Plasmid System for cDNA Synthesis and Plasmid Cloning kit (BRL Life Technologies, Gaithersburg, MD) following the manufacturer's protocol. Specifically, lung carcinoma tissues were homogenized with polytron (Kinematica, Switzerland) and total RNA was extracted using Trizol reagent (BRL Life Technologies) as directed by the manufacturer. The poly A' RNA was then purified using an oligo dT cellulose column as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, 1989. First-strand cDNA was synthesized using the NotI/Oligo-dT18 primer.

Double-stranded cDNA was synthesized, ligated with BstXI/EcoRI adaptors (Invitrogen, San Diego, CA) and digested with Notl. Following size fractionation with cDNA size fractionation columns (BRL Life Technologies), the cDNA was ligated into the BstXI/Notl site of pcDNA3.1 (Invitrogen) and transformed into ElectroMax E. coli DHIOB cells (BRL Life Technologies) by electroporation.

Using the same procedure, a normal human lung cDNA expression library was prepared from a pool of four tissue specimens. The cDNA libraries were characterized by determining the number of independent colonies, the percentage of clones that carried insert, the average insert size and by sequence analysis. The lung squamous cell carcinoma library contained 2.7 x 106 independent colonies, with 100% of clones having an insert and the average insert size being 2100 base pairs. The normal lung cDNA library contained 1.4 x 106 independent colonies, with 90% of clones having inserts and the average insert size being 1800 base pairs. For both libraries, sequence analysis showed that the majority of clones had a full length cDNA sequence and were synthesized from mRNA cDNA library subtraction was performed using the above lung squamous cell carcinoma and normal lung cDNA libraries, as described by Hara et al. (Blood, 84:189-199, 1994) with some modifications. Specifically, a lung squamous cell carcinoma-specific subtracted cDNA library was generated as follows. Normal tissue cDNA library (80 pg) was digested with BamHI and XhoI, followed by a filling-in reaction with DNA polymerase Klenow fragment. After phenol-chloroform extraction and ethanol precipitation, the DNA was dissolved in 133 pl of H 2 0, heat-denatured and mixed with 133 tl (133 pig) of Photoprobe biotin (Vector Laboratories, Burlingame, CA). As recommended by the manufacturer, the resulting mixture was irradiated with a 270 W sunlamp on ice for minutes. Additional Photoprobe biotin (67 al) was added and the biotinylation reaction was repeated. After extraction with butanol five times, the DNA was ethanol-precipitated and dissolved in 23 ul HO0 to form the driver DNA.

To form the tracer DNA, 10 pg lung squamous cell carcinoma cDNA library was digested with NotI and Spel, phenol chloroform extracted and passed through Chroma spin-400 columns (Clontech, Palo Alto, CA). Typically, 5 gg of cDNA was recovered after the sizing column. Following ethanol precipitation, the tracer DNA was dissolved in 5 Pl H,0. Tracer DNA was mixed with 15 [l driver DNA and 20 pl of 2 x hybridization buffer M NaCl/10 mM EDTA/50 mM HEPES pH 7.5/0.2% sodium dodecyl sulfate), overlaid with mineral oil, and heat-denatured completely. The sample was immediately transferred into a 68 OC water bath and incubated for 20 hours (long hybridization The reaction mixture was then subjected to a streptavidin treatment followed by phenol/chloroform extraction. This process was repeated three more times. Subtracted DNA was precipitated, dissolved in 12 pl HO, mixed with 8 pl driver DNA and 20 pl of 2 x hybridization buffer, and subjected to a hybridization at 68 OC for 2 hours (short hybridization After removal of biotinylated double-stranded DNA, subtracted cDNA was ligated into NotI/Spel site of chloramphenicol resistant pBCSK' (Stratagene, La Jolla, CA) and transformed into ElectroMax E. coli DHIOB cells by electroporation to generate a lung squamous cell carcinoma specific subtracted cDNA library (herein after referred to as "lung subtraction A second lung squamous cell carcinoma specific subtracted cDNA library (referred to as "lung subtraction II") was generated in a similar way to the lung subtraction library I, except that eight frequently recovered genes from lung subtraction I were included in the driver DNA, and 24,000 independent clones were recovered.

To analyze the subtracted cDNA libraries, plasmid DNA was prepared from 320 independent clones, randomly picked from the subtracted lung squamous cell carcinoma specific libraries. Representative cDNA clones were further characterized by DNA sequencing with a Perkin Elmer/Applied Biosystems Division Automated Sequencer Model 373A and/or Model 377 (Foster City, CA). The cDNA sequences for sixty isolated clones are provided in SEQ ID NO: 1-60. These sequences were compared to known sequences in the gene bank using the EMBL and GenBank databases (release 96). No significant homologies were found to the sequences provided in SEQ ID NO: 2, 3, 19, 38 and 46. The sequences of SEQ ID NO: 1, 6-8, 10-13, 15, 17, 18, 20-27, 29, 30, 32, 34-37, 39-45, 47-49, 51, 52, 54, and 57-59 were found to show some homology to previously identified expressed sequence tags (ESTs). The sequences of SEQ ID NO: 9, 28, 31 and 33 were found to show some homology to previously identified non-human gene sequences and the sequences of SEQ ID NO: 4, 5, 14, 50, 53, 56 and 60 were found to show some homology to gene sequences previously identified in humans.

The subtraction procedure described above was repeated using the above lung squamous cell carcinoma cDNA library as the tracer DNA, and the above normal lung tissue cDNA library and a cDNA library from normal liver and heart (constructed from a pool of one sample of each tissue as described above), plus twenty other cDNA clones that were frequently recovered in lung subtractions I and II, as the driver DNA (lung subtraction

III).

The normal liver and heart cDNA library contained 1.76 x 106 independent colonies, with 100% of clones having inserts and the average insert size being 1600 base pairs. Ten additional clones were isolated (SEQ ID NO: 61-70). Comparison of these cDNA sequences with those in the gene bank as described above, revealed no significant homologies to the sequences provided in SEQ ID NO: 62 and 67. The sequences of SEQ ID NO: 61, 63-66, 68 and 69 were found to show some homology to previously isolated ESTs and the sequence provided in SEQ ID NO: 70 was found to show some homology to a previously identified rat gene.

B. Isolation of cDNA Sequences from a Lung Adenocarcinoma Library A human lung adenocarcinoma cDNA expression library was constructed as described above. The library contained 3.2 x 106 independent colonies, with 100% of clones having an insert and the average insert size being 1500 base pairs. Library subtraction was performed as described above using the normal lung and normal liver and heart cDNA expression libraries described above as the driver DNA. Twenty-six hundred independent clones were recovered.

Initial cDNA sequence analysis from 100 independent clones revealed many ribosomal protein genes. The cDNA sequences for fifteen clones isolated in this subtraction are provided in SEQ ID NO: 71-86. Comparison of these sequences with those in the gene bank as described above revealed no significant homologies to the sequence provided in SEQ ID NO: 84. The sequences of SEQ ID NO: 71, 73, 74, 77, 78 and 80-82 were found to show some homology to previously isolated ESTs, and the sequences of SEQ ID NO: 72, 75, 76, 79, 83 and 85 were found to show some homology to previously identified human genes.

Example 2 DETERMINATION OF TISSUE SPECIFICITY OF LUNG TUMOR POLYPEPTIDES Using gene specific primers, mRNA expression levels for seven representative lung tumor polypeptides described in Example 1 were examined in a variety of normal and tumor tissues using RT-PCR.

Briefly, total RNA was extracted from a variety of normal and tumor tissues using Trizol reagent as described above. First strand synthesis was carried out using 2 pg of total RNA with SuperScript II reverse transcriptase (BRL Life Technologies) at 42 OC for one hour. The cDNA was then amplified by PCR with gene-specific primers. To ensure the semi-quantitative nature of the RT-PCR, P-actin was used as an internal control for each of the tissues examined. 1 l1 of 1:30 dilution of cDNA was employed to enable the linear range amplification of the P-actin template and was sensitive enough to reflect the differences in the initial copy numbers. Using these conditions, the p-actin levels were determined for each reverse transcription reaction from each tissue. DNA contamination was minimized by DNase treatment and by assuring a negative PCR result when using first strand cDNA that was prepared without adding reverse transcriptase.

mRNA Expression levels were examined in five different types of tumor tissue (lung squamous cell carcinoma from 3 patients, lung adenocarcinoma, colon tumor from 2 patients, breast tumor and prostate tumor), and thirteen different normal tissues (lung from 4 donors, prostate, brain, kidney, liver, ovary, skeletal muscle, skin, small intestine, stomach, myocardium, retina and testes). Using a 10-fold amount of cDNA, the antigen LST-S1-90 (SEQ ID NO: 3) was found to be expressed at high levels in lung squamous cell carcinoma and in breast tumor, and at low to undetectable levels in the other tissues examined.

The antigen LST-S2-68 (SEQ ID NO: 15) appears to be specific to lung and breast tumor, however, expression was also detected in normal kidney. Antigens LST-S1- 169 (SEQ ID NO: 6) and LST-S1-133 (SEQ ID NO: 5) appear to be very abundant in lung tissues (both normal and tumor), with the expression of these two genes being decreased in most of the normal tissues tested. Both LST-Sl-169 and LST-S1-133 were also expressed in breast and colon tumors. Antigens LST-S1-6 (SEQ ID NO: 7) and LST-S2-I2-5F (SEQ ID NO: 47) did not show tumor or tissue specific expression, with the expression of LST-S1-28 being rare and only detectable in a few tissues. The antigen LST-S3-7 (SEQ ID NO: 63) showed lung and breast tumor specific expression, with its message only being detected in normal testes when the PCR was performed for 30 cycles. Lower level expression was detected in some normal tissues when the cycle number was increased to 35. Antigen LST- S3-13 (SEQ ID NO: 66) was found to be expressed in 3 out of 4 lung tumors, one breast tumor and both colon tumor samples. Its expression in normal tissues was lower compared to tumors, and was only detected in 1 out of 4 normal lung tissues and in normal tissues from kidney, ovary and retina. Expression of antigens LST-S3-4 (SEQ ID NO: 62) and LST-S3-14 (SEQ ID NO: 67) was rare and did not show any tissue or tumor specificity. Consistent with Northern blot analyses, the RT-PCT results on antigen LAT-S1-A-10A (SEQ ID NO: 78) suggested that its expression is high in lung, colon, stomach and small intestine tissues, including lung and colon tumors, whereas its expression was low or undetectable in other tissues.

A total of 2002 cDNA fragments isolated in lung subtractions I, II and III, described above, were colony PCR amplified and their mRNA expression levels in lung tumor, normal lung, and various other normal and tumor tissues were determined using microarray technology (Synteni, Palo Alto, CA). Briefly, the PCR amplification products were dotted onto slides in an array format, with each product occupying a unique location in the array. mRNA was extracted from the tissue sample to be tested, reverse transcribed, and fluorescent-labeled cDNA probes were generated. The microarrays were probed with the labeled cDNA probes, the slides scanned and fluorescence intensity was measured. This intensity correlates with the hybridization intensity. Seventeen non-redundant cDNA clones showed over-expression in lung squamous tumors, with expression in normal tissues tested (lung, skin, lymph node, colon, liver, pancreas, breast, heart, bone marrow, large intestine, kidney, stomach, brain, small intestine, bladder and salivary gland) being either undetectable, or 10-fold less compared to lung squamous tumors. The determined partial cDNA sequences for the clone L513S are provided in SEQ ID NO: 87 and 88; those for L514S are provided in SEQ ID NO: 89 and 90; those for L516S in SEQ ID NO: 91 and 92; that for L517S in SEQ ID NO: 93; that for L519S in SEQ ID NO: 94; those for L520S in SEQ ID NO: 95 and 96; those for L521S in SEQ ID NO: 97 and 98; that for L522S in SEQ ID NO: 99; that for L523S in SEQ ID NO: 100; that for L524S in SEQ ID NO: 101; that for L525S in SEQ ID NO: 102; that for L526S in SEQ ID NO: 103; that for L527S in SEQ ID NO: 104; that for L528S in SEQ ID NO: 105; that for L529S in SEQ ID NO: 106; and those for L530S in SEQ ID NO: 107 and 108. Additionally, the full-length cDNA sequences for L503S and L514S (variants 1 and are provided in SEQ ID NO: 151, 153 and 154, respectively, with the corresponding predicted amino acid sequence being provided in SEQ ID NO: 152, 155 and 156. Due to polymorphisms, the clone L531S appears to have two forms. A first determined full-length cDNA sequence for L531S is provided in SEQ ID NO: 109, with the corresponding predicted amino acid sequence being provided in SEQ ID NO: 110. A second determined full-length cDNA sequence for L531S is provided in SEQ ID NO: 111, with the corresponding predicted amino acid sequence being provided in SEQ ID NO: 112. The sequence of SEQ ID NO: 111 is identical to that of SEQ ID NO: 109, except that it contains a 27 bp insertion. Similarly, L514S also has two alternatively spliced forms; the first variant cDNA is listed as SEQ ID NO: 153, with the corresponding amino acid sequence as SEQ ID NO: 155. The second variant form of L514S full-length cDNA is referred to as SEQ ID NO: 154, with its corresponding amino acid sequence as SEQ ID NO: 156.

Full length cloning for L524S (SEQ ID NO: 101) yielded two variants (SEQ ID NO: 163 and 164) with the corresponding predicted amino acid sequences (SEQ ID NO: 165 and 166), respectively. Both variants have been shown to encode parathyroid hormonerelated peptide.

Comparison of the sequences of L514S and L531S (SEQ ID NO: 87 and 88, 89 and 90, and 109, respectively) with those in the gene bank, as described above, revealed no significant homologies to known sequences. The sequences of L513S, L516S, L517S, L519S, L520S and L530S (SEQ ID NO: 87 and 88, 91 and 92, 93, 94, 95 and 96, 107 and 108, respectively) were found to show some homology to previously identified ESTs. The sequences of L521S, L522S, L523S, L524S, L525S, L526S, L527S, L528S and L529S (SEQ ID NO: 97 and 98, 99, 99, 101, 102, 103, 104, 105, and 106, respectively) were found to represent known genes. The determined full-length cDNA sequences for L520S is provided in SEQ ID NO: 113, with the corresponding predicted amino acid sequence being provided in SEQ ID NO: 114. Subsequent microarray analysis has shown L520S to be overexpressed in breast tumors in addition to lung squamous tumors.

Further analysis has demonstrated L529S (SEQ ID NO: 106 and 115), L525S (SEQ ID NO: 102 and 120) and L527S (SEQ ID NO: 104) are cytosleletal components and potentially squamous cell specific proteins. L529S is connexin 26, a gap junction protein. It is highly expressed in lung squamous tumor 9688T, and moderately over-expressed in two others. However, lower level expression of connexin 26 is also detectable in normal skin, colon, liver and stomach. The over-expression of connexin 26 in some breast tumors has been reported and a mutated form of L529S may result in over-expression in lung tumors.

L525S is plakophilin 1, a desmosomal protein found in plaque-bearing adhering junctions of the skin. Expression levels for L525S mRNA is highly elevated in three out of four lung squamous tumors tested, and in normal skin. L527S has been identified as keratin 6 isoform, type II 58 Kd keratin, and cytokeratin 13 and shows over-expression in squamous tumors and low expression in normal skin, breast and colon tissues. Notably, keratin and keratin-related genes have been extensively documented as potential markers for lung cancer including CYFRA2.1 (Pastor, et al, Eur. Respir. 10:603-609, 1997). L513S (SEQ ID NO: 87 and 88) shows moderate over-expression in several tumor tissues tested, and encodes a protein that was first isolated as a pemphigus vulgaris antigen.

L520S (SEQ ID NO: 95 and 96) and L521S (SEQ ID NO: 97 and 98) are highly expressed in lung squamous tumors, and L520S is up-regulated in normal salivary gland and L521S is over-expressed in normal skin. Both belong to a family of small proline rich proteins and represent markers for fully differentiated squamous cells. L521S has been described as a specific marker for lung squamous tumor (Hu, et al, Lung Cancer, 20:25- 1998). L515S (SEQ ID NO: 162) encodes IGF-P2 and L516S is an aldose reductase homologue and both are moderately expressed in lung squamous tumors and in normal colon.

Notably, L516S (SEQ ID NO: 91 and 92) is up-regulated in metastatic tumors but not primary lung adenocarcinoma., an indication of its potential role in metatasis and a potential prognostic marker. L522S (SEQ ID NO: 99) is moderately over-expressed in lung squamous tumors with minimum expression in normal tissues. L522S has been shown to belong to a class IV alcohol dehydrogenase, ADH7, and its expression profile suggests it is a squamous cell specific antigen. L523S (SEQ ID NO: 100) is moderately over-expressed in lung squamous tumor, human pancreatic cancer cell lines and pancreatic cancer tissues, suggesting this gene may be a shared antigen between pancreatic and lung squamous cell cancer.

L524S (SEQ ID NO: 101) is over-expressed in the majority of squamous tumors tested and is homolgous with parathyroid hormone-related peptide (PTHrP), which is best known to cause humoral hypercalcaemia associated with malignant tumors such as leukemia, prostate and breast cancer. It is also believed that PTHrP is most commonly associated with squamous carcinoma of lung and rarely with lung adenocarcinoma (Davidson, et al, J. Pathol., 178: 398-401, 1996). L528S (SEQ ID NO: 105) is highly over-expressed in two lung squamous tumors with moderate expression in two other squamous tumors, one lung adenocarcinoma and some normal tissues, including skin, lymph nodes, heart, stomach and lung. It encodes the NMB gene that is similar to the precursor of melanocyte specific gene Pmell7, wfhich is reported to be preferentially expressed in lowmetastatic potential melanoma cell lines. This suggests that L528S may be a shared antigen in both melanoma and lung aquamous cell carcinoma. L526S (SEQ ID NO: 103) is overexpressed in all lung squamous cell tumor tissues tested and has been shown to share homology with a gene (ATM) in which a mutation causes ataxia telangiectasia, a genetic disorder in humans causing a predisposition to cancer, among other symptoms. ATM encodes a protein that activates p53 mediated cell-cycle checkpoint through direct binding and phosphorylation of the p53 molecule. Approximately 40% of lung cancer is associated with p53 mutations, and it is speculated that over-expression of ATM is a result of compensation for loss of p53 function, but it is unknown whether over-expression is the cause of result of lung squamous cell carcinoma. Additionally, expression of L526S (ATM) is also detected in a metastatic but not lung adenocarcinoma, suggesting a role in metastasis.

Example 3 ISOLATION AND CHARACTERIZATION OF LUNG TUMOR POLYPEPTIDES

BY

PCR-BASED SUBTRACTION Eight hundred and fifty seven clones from a cDNA subtraction library, containing cDNA from a pool of two human lung squamous tumors subtracted against eight normal human tissue cDNAs including lung, PBMC, brain, heart, kidney, liver, pancreas, and skin, (Clontech, Palo Alto, CA) were derived and submitted to a first round of PCR amplification. This library was subjected to a second round of PCR amplification, following the manufacturer's protocol. The resulting cDNA fragments were subcloned into the vector P7- Adv vector (Clontech, Palo Alto, CA) and transformed into DH5a E. coli (Gibco, BRL).

DNA was isolated from independent clones and sequenced using a Perkin Elmer/Applied Biosystems Division Automated Sequencer Model 373A.

One hundred and sixty two positive clones were sequenced. Comparison of the DNA sequences of these clones with those in the gene bank using the EMBL and GenBank databases, as described above, revealed no significant homologies to 13 of these clones, hereinafter referred to as Contig 13, 16, 17, 19, 22, 24, 29, 47, 49, 56-59 The determined cDNA sequences for these clones are provided in SEQ ID NO: 125, 127-129, 131-133, 142, 144, 148-150, and 157, respectively. Contigs 1, 3-5, 7-10, 12, 11, 15, 20, 31, 33, 38, 39, 41, 43, 44, 45, 48, 50, 53, 54 (SEQ ID NO: 115-124, 126, 130, 134-141, 143, 145- 147, respectively) were found to show some degree of homology to previously identified DNA sequences. Contig 57 (SEQ ID NO: 149) was found to represent the clone L519S (SEQ ID NO: 94) disclosed in US. Patent Application No. 09/123,912, filed July 27, 1998. To the best of the inventors' knowledge, none of these sequences have been previously shown to be differentially over-expressed in lung tumors.

mRNA expression levels for representative clones in lung tumor tissues, normal lung tissues resting PBMC, salivary gland, heart, stomach, lymph nodes, skeletal muscle, soft palate, small intestine, large intestine, bronchial, bladder, tonsil, kidney, esophagus, bone marrow, colon, adrenal gland, pancreas, and skin, (all derived from human) were determined by RT-PCR as described above. Expression levels using microarray technology, as described above, were examined in one sample of each tissue type unless otherwise indicated.

Contig 3 (SEQ ID NO: 116) was found to be highly expressed in all head and neck squamous cell tumors tested (17/17), and expressed in the majority (8/12) of lung squamous tumors, (high expression in 7/12, moderate in 2/12, and low in 2/12), while showing negative expression for 2/4 normal lung tissues and low expression in the remaining two samples. Contig 3 showed moderate expression in skin and soft palate, and lowered expression levels in resting PBMC, large intestine, salivary gland, tonsil, pancreas, esophagus, and colon. Contig 11 (SEQ ID NO: 124) was found to be expressed in all head and neck squamous cell tumors tested (17/17): highly expressed in 14/17, and moderately expressed in 3/17. Additionally, expression in lung squamous tumors showed high expression in 3/12 and moderate in 4/12. Contig 11 was negative for 3/4 normal lung samples, with the remaining sample having only low expression. Contig 11 showed low to moderate reactivity to salivary gland, soft palate, bladder, tonsil, skin, esophagus, and large intestine. Contig 13 (SEQ ID NO: 125) was found to be expressed in all head and neck squamous cell tumors tested (17/17): highly expressed in 12/17, and moderately expressed in 5/17. Contig 13 was expressed in 7/12 lung squamous tumors, with high expression in 4/12 and moderate expression in three samples. Analysis of normal lung samples showed negative expression for 2/4 and low to moderate expression in the remaining two samples. Contig 13 did show low to moderate reactivity to resting PBMC, salivary gland, bladder, pancreas, tonsil, skin, esophagus, and large intestine, as well as high expression in soft palate. Contig 16 (SEQ ID NO: 127) was found to be moderately expressed in some head and neck squamous cell tumors (6/17) and one lung squamous tumor; while showing no expression in any normal lung samples tested. Contig 16 did show low reactivity to resting PBMC, large intestine, skin, salivary gland, and soft palate. Contig 17 (SEQ ID NO: 128) was shown to be expressed in all head and neck squamous cell tumors tested (17/17): highly expressed in 5/17, and moderately expressed in 12/17. Expression levels in lung squamous tumors showed one tumor sample with high expression and 3/12 with moderate levels. Contig 17 was negative for 2/4 normal lung samples, with the remaining samples having only low expression.

Additionally, low level expression was found in esophagus and soft palate. Contig 19 (SEQ ID NO: 129) was found to be expressed in most head and neck squamous cell tumors tested (11/17): with two samples having high levels, 6/17 showing moderate expression, and low expression being found in 3/17. Testing in lung squamous tumors revealed only moderate expression in 3/12 samples. Expression levels in 2/4 of normal lung samples were negative, the two other samples having only low expression. Contig 19 did show low expression levels in esophagus, resting PBMC, salivary gland, bladder, soft palate, and pancreas.

Contig 22, (SEQ ID NO: 131) was shown to be expressed in most head and neck squamous cell tumors tested (13/17) with high expression in four of these samples, moderate expression in 6/17, and low expression in 3/17. Expression levels in lung squamous tumors were found to be moderate to high for 3/12 tissues tested, with negative expression in two normal lung samples and low expression in two other samples Contig 22 did show low expression in skin, salivary gland and soft palate. Similarly, Contig 24 (SEQ ID NO: 132) was found to be expressed in most head and neck squamous cell tumors tested (13/17) with high expression in three of these samples, moderate expression in 6/17, and low expression in 4/17. Expression levels in lung squamous tumors were found to be moderate to high for 3/12 tissues tested, with negative expression for three normal lung samples and low expression in one sample Contig 24 did show low expression in skin, salivary gland and soft palate. Contig 29 (SEQ ID NO: 133) was expressed in nearly all head and neck squamous cell tumors tested (16/17): highly expressed in 4/17, moderately expressed in 11/17, with low expression in one sample. Also, it was moderately expressed in 3/12 lung squamous tumors, while being negative for 2/4 normal lung samples. Contig 29 showed low to moderate expression in large intestine, skin, salivary gland, pancreas, tonsil, heart and soft palate. Contig 47 (SEQ ID NO: 142) was expressed in most head and neck squamous cell tumors tested (12/17): moderate expression in 10/17, and low expression in two samples. In lung squamous tumors, it was highly expressed in one sample and moderately expressed in two others Contig 47 was negative for 2/4 normal lung samples, with the remaining two samples having moderate expression. Also, Contig 47 showed moderate expression in large intestine, and pancreas, and low expression in skin, salivary gland, soft palate, stomach, bladder, resting PBMC, and tonsil.

Contig 48 (SEQ ID NO: 143) was expressed in all head and neck squamous cell tumors tested (17/17): highly expressed in 8/17 and moderately expressed in 7/17, with low expression in two samples. Expression levels in lung squamous tumors were high to moderate in three samples Contig 48 was negative for one out of four normal lung samples, the remaining showing low or moderate expression. Contig 48 showed moderate expression in soft palate, large intestine, pancreas, and bladder, and low expression in esophagus, salivary gland, resting PBMC, and heart. Contig 49 (SEQ ID NO: 144) was expressed at low to moderate levels in 6/17 head and neck squamous cell tumors tested.

Expression levels in lung squamous tumors were moderate in three samples Contig 49 was negative for 2/4 normal lung samples, the remaining samples showing low expression.

Moderate expression levels in skin, salivary gland, large intestine, pancreas, bladder and resting PBMC were shown, as well as low expression in soft palate, lymph nodes, and tonsil.

Contig 56 (SEQ ID NO: 148) was expressed in low to moderate levels in 3/17 head and neck squamous cell tumors tested, and in lung squamous tumors, showing low to moderate levels in three out of thirteen samples. Notably, low expression levels were detected in one adenocarcinoma lung tumor sample Contig 56 was negative for 3/4 normal lung samples, and showed moderate expression levels in only large intestine, and low expression in salivary gland, soft palate, pancreas, bladder, and resting PBMC. Contig 58, also known as L769P, (SEQ ID NO: 150) was expressed at moderate levels in 11/17 head and neck squamous cell tumors tested and low expression in one additional sample. Expression in lung squamous tumors showed low to moderate levels in three out of thirteen samples. Contig 58 was negative for 3/4 normal lung samples, with one sample having low expression. Moderate expression levels in skin, large intestine, and resting PBMC were demonstrated, as well as low expression in salivary gland, soft palate, pancreas, and bladder. Contig 59 (SEQ ID NO: 157) was expressed in some head, neck, and lung squamous tumors. Low level expression of Contig 59 was also detected in salivary gland and large intestine.

Additionally, the full-length cDNA sequence for Contigs 22, referred to as L763P, is provided in SEQ ID NO: 158, with the corresponding predicted amino acid sequence being provided in SEQ ID NO: 159. Also, the full-length cDNA sequence incorporating Contigs 17, 19, and 24, referred to as L762P, is provided in SEQ ID NO: 160, with the corresponding predicted amino acid sequence being provided in SEQ ID NO: 161.

Further analysis of L762P has determined it to be a type I membrane protein and two additional variants have been sequenced. Variant 1 (SEQ ID NO: 167 and the corresponding amino acid sequence in SEQ ID NO: 169) is an alternatively spliced form of SEQ ID NO: 160 resulting in deletion of 503 nucleotides, as well as deletion of a short segment of the expressed protein. Variant 2 (SEQ ID NO: 168 and the corresponding amino acid sequence in SEQ ID NO: 170) has a two nucleotide deletion at the 3' coding region in comparison to SEQ ID NO: 160, resulting in a secreted form of the expressed protein.

The full-length cDNA sequence for contig 56 (SEQ ID NO: 148), referred to as L773P, is provided in SEQ ID NO: 171, with the predicted amino acid sequence in SEQ ID NO: 172. Subsequent Northern blot analysis of L773P demonstrates this transcript is differentially over-expressed in squamous tumors and detected at approximately 1.6 Kb in primary lung tumor tissue and approximately 1.3 Kb in primary head and neck tumor tissue.

Subsequent microarray analysis has shown Contig 58, also referred to as L769S (SEQ ID NO: 150), to be overexpressed in breast tumors in addition to lung squamous tumors.

Example 4 SYNTHESIS OF POLYPEPTIDES Polypeptides may be synthesized on a Perkin Elmer/Applied Biosystems Division 430A peptide synthesizer using FMOC chemistry with HPTU (O-Benzotriazole- N,N,N',N'-tetramethyluronium hexafluorophosphate) activation. A Gly-Cys-Gly sequence may be attached to the amino terminus of the peptide to provide a method of conjugation, binding to an immobilized surface, or labeling of the peptide. Cleavage of the peptides from the solid support may be carried out using the following cleavage mixture: trifluoroacetic acid:ethanedithiol:thioanisole:water:phenol After cleaving for 2 hours, the peptides may be precipitated in cold methyl-t-butyl-ether. The peptide pellets may then be dissolved in water containing 0.1% trifluoroacetic acid (TFA) and lyophilized prior to purification by C18 reverse phase HPLC. A gradient of 0%-60% acetonitrile (containing 0.1% TFA) in water (containing 0.1% TFA) may be used to elute the peptides. Following lyophilization of the pure fractions, the peptides may be characterized using electrospray or other types of mass spectrometry and by amino acid analysis.

:opcr\kbiMii30949-99 div doc-30/03/)2 -46- From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for the purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that that prior art forms part of the common general knowledge in Australia.

Page(s) L- 7 are claims pages they appear after the sequence listing SEQUENCE LISTING <110> Wang, Tongtong <120> COMPOUjNDS

AND

LUNG CANCER METHODS FOR THERAPY OF <130> 2 l0121.455PC <140>

PCT

<141> 1999-03-16 <160> 172 <170> FastSEQ for Windows version <210> 1 <211> 315 <212> DNA <213> Homo sapien <220> <221> <222> <223> misc feature .(315) n A,T,C- or G.

<400> 1 gcagagacag actggtggtt cagccgccgt gaaactcccg tccatctcca gcagagacaa gttaatacgEc ccgtaaactc naaat~iacaa atagaatcat aaaaaaaaaa aaaaa gaacctggag atgtcacagg cggagga ggc atgzacagtc tzgctgtaat gtgccaaaaa c-agtccgctc tcccaccagg ttctgggg ccttaaaugg agccagctgc ggittacagcg acggttctca gggaagcaarcaaacaclgca aagccceca Cccctcaazg ttatt:azac gggaancc: a ggccacgzga 180 240 300 315 <210> 2 <211> 380 <212> DNA <213> Homo sapien <400> 2 at?-ttaggcct atatatataa cataactttt ctgaaatgag ggacaaac tc t~attggaaa gtaaaaaaaa aagattttgE acaaatacaa aacaacactg tggatgtata ccagtctaga ttttgtcctc aaaaaaaaaa ttacccttgt aaagtttta c.tct9taaug gtgttattgc ttattagcct tgtaactggc tact aaggaa gtggttcagc ggttgaactg ataatzatcc ttgt~aacca actttggggt caaattagta ttttttatctt cggtactcag cactatgaag tcaagcacc:gtgact tat: ttaaagt-a~a tttlttaaz~g actgagazca caaaaca agaaaaaaaa 120 130 240 300 <210> 3 <211> 349 <212> DNA <213> Homzo sapien <220> <221> <222> <223> misc-'feature .(346) n A,T,C or G <400> 3 ttgtaagtat acaattttag catcczcacc atacaccac atacaattgt actttctttg gaagcctcct taatggaatg gacttccaac aatttgatca gcaataattt Ctattnnnag aaaggattaa cactttccaa gatttcata agtcatttlo tatagtgttg annccnggnn atgttattga taacatttaa acaaatatac gtcttgtgct agctgtggaa naaaannann tcattttact t-cctttctaa catagactgt c ttgaggtta atctttaagt annaaa gaatactgca aattgtaagt taatttcatt OCt ttgctt: ttactctata 120 180 240 300 346 <210> 4 <211> 372 <212> DNA <2'13> Homo sapien <220> <221> misc feature <222> (372) <223> n =A,TC or G <400> 4 actagtctca ttaCtccaga tggt::zgtr to-gttttttci tctcttzctcc aagtgtgct agttcaagcc gttcraaaaga tgtggacagt gcacgtgcct aaggantggg tgctttgtga aaaacaaaac aa at-atgctc: aactggrtaoc t tgtggggac ctattgcrta tacgctacat tggataaaac tgcacctt2 zagggtggt: aaccatcct :--ttttgttz: ct--gttttct gnccaaataa t-ggctggg9c: cacagt tc :a tgaacat tag zaaagaccta aggaagaagg cacaccttza tc'czacccat atgtaagcac agaggaaggc Ct tgacgtca gga tgcngg cattttgaaa 120 180 240 300 360 372 <210> <211> 698 <212> DNA <213> Homo sapien <220> <221> misc feature <222> <223> n A,T,C or G <400> actagtanga Oct aacccag g cat aa a goc caatacacac gcacact tgc gacaacctac gacazttagt tntccaaatn natgangtcc ctaaaaccnc cgtanga aga tagaaacact, gttaactgca aatgtagtcc tCatgaactc tagactcaga.

ttT--gcttggc tagtgctottt ctnrgtncngt ctggzottttz ctflctnnang nan-ccncncn gtgt cccgag agaagaggcg agtlttaag ctgatggaac aaaaatacta taagtgaagg tatataccag cgctgcacat cacgccacz-t g--tagacngg ccccct!ncn agtaaggaga ggatact ttc atcatgttccc aataacaggc ctctcataaa aatgat at tc gcatoatgct atctgaaar-c oatcngtcaa zncnncctng gaagctacta agcttcccat aagctaact:g ccaagcctattgggtoggag atatnt:cat gagtgacac: catat taag ngatcccacc -cnqc:nronc ttgattagag gtaactgtat aatcc-acggtatgact tattttgggt ttattccacq cttgtgtata ant ttco-caa tctgtntgtc aanaatnaag cncntgtng 120 180 240 300 360 420 480 540 600 660 gagnoccgcc cccgcggggg gaccccon ttttcccc <210> 6 <211> 740 <212> DNA <213> Homo sapien <220> <221> misc-feature <222> (740) <223> n A,T,C or G <400> 6 actagtcaaa catgtttatc gccaatattt gtgaaact:za qtzc:tqtta aaaaaggt:ct--ttaagcc caantttcatatgccatc cttcctt-taa ac-aggtgtgg aatnacggat gtnnncaact aatgctaaaa ttttuattat-g ct a tatc acact ttata tttccaaata aaaagE tgt t ttcgaactat tcantaatat o agdgaaagc ftgtgaanta gaaaagcotz cgnanaaaqg ccplgCgagcc t aat rt ggga tflttgtgaag atccataaca aggtaaaaat gaatggac:: aatgaccaaa ttaaggaaag cctgaatcat ctattotcata t tnacangaa taacaatctg actgcggtcta ga a aat at tt t tgtgtcttt zttatactac cgaggtctcca ggtctgttaa cat tctaaaa caaaatcatt :c-atttcagc go ccaaacct actttctcot O-agrgt-.ncg 't ltacangaa tttaagtagt tcactaatta atttgtaaga agattotaata ggggco aagg gaaatgcaaa tcccanatgc tnaggcttca gttgccatag tnanagt too tgttatctgt cgaatnatct gtt a rac:Z Oct ataczar gaatatgcac atctgatcaa gagaaaaaaa aaaaaaz: a at at ca:: 09 to-t taac~cg t~tggtnaagc Onatagt: o ncagaaccan ngt tflfntgro 1-20 190 240 300 420 4.30 540 600 660 720 740 <210> 7 <211> 670 <212> DNA <213> Homo sapien <220> <221> misc-feature <222> (670) <223> n A,T,C or G <400> 7 gctggggaqc tcggcatggc agcggccccg gctcgatggc cttgggatgc aggagctgtt ccaaggtgca ctcggtggcc aagacgccac gtcttcttgc cacggggata gtgtggacca cgtcggaga taaaaccatt tgaacactaa aggggagaac tagcnacaag gatgatgtrgg aaacanttcc aarnttcgaag tcctgacaat ggnccttggg nartccaccoc ggtccccgct cCgtggtgc ccggggccac tggagttgcg tgganaanga ott tgt tggc cgcatctggg attaatatct tgactttatt tcaccnaaaz t9tntcacac gcagccatgg ggccctcggc tcagtgagca agcaagaccg acgggcgtcg ccgttggtca atccaagtaa atgtgaggac qCtggantcc gatgccaaga ctcctaaaac Cc-tcagctnc gCggcccgtc cgagttcctg Cctacctcgg aagaaaacaa tcctgaccca tacaaaatgc tgatgggcan aaccccgt:aatgaacatn cccaaaactg gt tgggccag gcgctacgtg gcgcacagcg ggtcttcgac ttatcaagga tttgttacg attgccactg accattocg caaagcaaaa aatat-ct aanccoz:nc 120 180 240 300 360 420 480 540 600 660 670 <210> 8 <211> 689 <212> DNA <213> Homo saoier, <220> <221> misc-feature <222> (689) <223> n A,T,C or G <400> 8 actagtatct aggaatgaac aaataaagta Ccggatttgg cacctagcat tgcctactta gcaacaggaa atr-caaggga tagagcaaag ganaqacagc ctggcagtgc tCctgcccca ttcaccaacc tatracttga gacataznt -cztagtggtt cnntnctncrc nntcnctcnn cccccn-cggn ggacccccct nciczn tann -::ccccgtn aacacct aagc ctinztaccctg agtaaaagag gaaaacctgg gccccctgaa gaaaaagtaa CCCcattacc gcatggcacc aattataata tgactttnaa cnlt ccCccc ttggtccctc nnaaatgnt: ggggtcccc gagcagt tgg ttttattaa ttaacagagc gcaact tggg aaataccatt t tat ngt tt t tagcctgtcc aataaatnag cnctcngtcc agtggaggt t ccccctccca ctaCttgatt aCatatggaa CCaattgaqa ctaggatgag tttgcctggg gatagcaact gtttgCtgcn gtttantttt t ccflnnnt to natggcccc fltcccnicac acaacagagt tgaaagccta caaacccccg ctgactccct gcttcgcag Cgttgaatt tCcaggctgt ctccccccnn gggggggccn ggnntcatcc ctzcaanccci 120 180 240 300 360 420 480 540 600 6 6G 689 <210> 9 <211> 674 <212> DNA <213> Homo sapien <220> <221> misc feature <2:22> (674) <223> n A,T,C or G <400> 9 gtccactctc taaaaaatgc gaaaaaagcg ataaqcctga CCr-tcatgga ttctgaaata aaagttttgt CaaaaaCatt agttaattaC Catctgaata anaaatgtCa aggacccnct crtttgagtgt tcgctctata aggctttttt agggaagtaq aaaaggCttc agagaCaaat ttggtcttca agctgttctg tttgctctgg at attgtgga aaaaaaaagg gCc aCtgtcttac gtggagtaag gCCaccttgg ctatgagaCt: ctgtaacaat tgggccgCag CCaaaggaca tctttcaatt aactagcatt tttCCCCCtC tcgatctact tgtgcactct agCt.cacaCa t aaaggCCag ttCCatttlt tttCaCCtaa agtcttCCtg tactctaggg tcaagttatt attgtcatta tgCttgcatc cngcaaggnc gttttcaac cccaaggcag ttcactgctca Cttagttctc tgaattagca tgatttaaaa ggtatgttgt trggagactg tcatcacatt ttCttttgac catctaatca tttCtagata Caagaraact t agaactgc: CCaataggct gtgtgactac taaaCaacc tgaagacat cctCCacgtg ctgtcatrcat tcctctggga ctgcgctgga 120 180 240 300 360 420 480 540 600 660 674 <210> <211> <212> <213> <220> <221> <222> <223> 346

DNA

Homo sapien misc feature .(346) n A,T,C or G <400> actagtctac t tctgtctgt cct taagtgt ttcttCtttt_ tgtcagat ta aaacagtact tgatagaaag aacaaaaatq ttCtgtcatc Cccttataa tattatctaa t- tctattan cactatacat tactttatag gttcaagtgc attgtaatc caattgaata nnaanngnnn cctattgttt agatggagga atttctgta -tgaaacact tgtaaatact gnnnnacaaa LtLLL.Aj aaaggtctaa acagaaacac gctgctt aa acttgtctta anaaaa aaaatcagcc tactacatiag atttggaatg aaagt cccac cCC!Caata G 0 120 180 240 300 346 <21.0> 11 <211> 602 <212;> DNA <213> Homo sapien <400> 11 actagtaaaa gatcqt aagc tgct-_cc=c ttcaatccca cagt:ttgca ac:,:caczr ctgr::-gaaa tctcggatc gcac:agcrta cacggt S aa ag-cagcat tg tttttgaaaa tarctggaa-, tgacttaagg taat tat aat t c:aaat at c catgagtttt ctcrt gtagaa caaattcggt tactzctgtc ccaaataatc gtttaggtta gtggcattag ttggagagct cgqcatzgca aaaaaaggga a'ttgct taa c tgttctcattcatattz cat at aaaaa cctaatttc aacctactgt Cttt ttatz aaacactggg *atagaaag aazgaagzza :atrsaggc: zaaacaccaa act :aacaat Z:aaaactta CaCtaaaaat tgttagatta tzaaccctct atttttggat at atgc~cta t-aaatcaazt t- :gcctt acagttaagt r:aaataaac St -tccaaaaa ataatgaaat argtatttgt ttaattctta aacagacrcia cttt:gttaa.

ctgtacaatctgtaagitc Ccatt tc: cg tgaaacastrtaaaaaaaaaa 1.3 0 240 600 602 <2~10> 12 <211> 685 <212> DNA <213> Horno sapien <220> <221> misc feature <222> (685) <223> n A,-T,C or G <400> 12 act-agtcctg at-,atcatgg gcatacattt aggtgtttta atatocatat tttagatatg agaccagtgc angtagtgcc aflcanngt ga cfltfltcaat cantnzanta cfnc-cgccgt tgaaagtaca tattgatgga gtaacatgat tcattatgta agt agagc gc ccttaatnta ctgggtggtg Ctcgtaozgtg nagtttcncc ngacaatcga accccgcgcc cS1cnnfccZcg actgaaggca C.Ctaagaaaa tagtagact aaggaattaa aaaaatatag rnaactgtgc CCtccccttg tcacgtggan gtngangcng gtt ttccnfnc cggaccgctc cflflcc gaaagtgt Ca :-aaaaattag gaatatatag ag'caaaggac caaaaatana caggtggccc tctgcccccc t antggganc aactgtccct :ccngnaacc :tCnfntcgzs ggat tttgca actaagcccc ac-gtagt-atn tttgtagttg aactaaaggt tcggaacaga tgaagaactt aggccgnncn gngccnnnac tngccgnnnn ctcflcfcnaa tctaatgttc caaataac: ttgggtatctz tttttattaa agaaaagcat tgccaggcag CCctcacgtg qtnanaagaa gctcc-canaa cflngcccnnc ngggnttttn,- 120 180 240 300 360 420 480 540 600 660 625 <210> <211> <212> <2 13> <220> 13 694

DNA

Hcmo Sapien <221> misc feature <222> (694) <223> rn A,T,C or G <400> 13 cactaq-tcac tcar-tagcqt tttcaatagg acttgacgaa gactggttc acaagaacta cagaacaatt cttaaaatg tttatagttt trttctctgtg tqtgcaaatg tgtgtttgtg gtttactagc tagctttaca atatgccaaa tcaccctctt ttccccccat gctttttgcc taaaaagtag ttctgtatct tcaoatcttgatcattttt tactggtcat ttccctttgg cattagccac ggaaacagcc gangtgttgg ctggcntgat tggt.ccggct gccgccattg ctqactqcac flgccaatg- tttcatgaag angacgctat gggggncana gggccantcg gctcttaagt actaaatgctt acaattgccg accattcttt aaaggat ttc z-tagtttata ca9tctcccag agtgtactac gagccagcag :cagcacaac aatacngcat Z:-:c ccagtagat acgggtagtc tcattgcatt aaaacaatt tccctgaccc acaaaggaat aaccctctgg t ttaacagat tgcatggcac gccatgggac flcfcngtgat tttgtaagaa aaagacact t taggacac-r catCcgtggt gatgacaatt tgggaaggg ggaaagaact cgtccagcat atgggaaana cacgtnzancc- 120 180 240 300 360 420 480 540 600 660 694 <210> !2- <211> 679 <212> DNA <213> H-cmo sapien <220> <221> misc feature <222> (679) <223> n A,T,C or G <400> 14 cagccgcctg catctgtac agtcccgnac ccct cggcc ccaactgcat caaatacccg ctgrcccntgc cazcggacta naganactaa tnacnattnt gcflccctcnt gatccictggtg gcaoctggg acrqttcttc ccatzCtQogg atat-ccact acacgcacaa cnacctgaaa actacycgc gaactgcaat tggccccann aaaggacntn cagaagtctc gaacaatcc cagcgccang cangctnagt cngtncggat nggctccgat tccagcttct ggctccga ggct tcntct ncgatnatgt accnnggatg ggtcggctg Ctcganncct :tccgccagt zagncctcac ftaaacccat rlcgaccCt ca acacaggagt aCtgct gcgg :ggtgatazn gattaaggaa aflccccaccg gggnccc tga SCflccgtgna cccagctgcg catnccggtc CttCtggcrt gaccanganc ctatattccq ggctgtgcaa caccattgaa ncccacggag ggaancncta acaatttaat attcngttcr cgcgccc-c aaaggangca gCCgggattg atctccganc atcggar-ccg gaccccant ataccrgc gg ttttacaagg aangccatcc cncatacatc gatnccacca 120 180 240 300 360 420 480 540 600 660 679 <210> <211> <212> <213> <220> <221> <222> <223> 1 1 695

DNA

Homo sacien miscfeature (695) n A,T,C or G <400> actaczggat aaagccaag gatgctgctc- -=acctccccac catgtacaco aoz:z cacacaact acczaatczgq aagtgtcaac :-gtgtcagga ctaanaaac: ctggz::zga ttaaaaaagg tggcaaatna cnggcccagg tgggatac ccnagttctg tctncanaaa ancncacczc aacttgaaa tgccttccng ncttnaatnt gcctaaaaaa gcat::ctgtc aacacatccc ntccgcttgt ttaaraaaaat cttcctggcc acntttgana ggaaaaaaaa naaccctgga cnaccttccc aggggaqcca tcnttggczq rlcaatnaacntgancztc:a gccngaattc acnatzcnaa gccangacaa Ctttgtttcc agcccngnga nanaacgat: caaatctgtc cflgcctcanc aaattganca aat t tcnt cc naacnccggt ttnanggnca cgactgcntrn ggccccttcc cagtgt taca ncncc Eg9ct:cccca ncaaaaaanc aggcnntggg cc t t cattccn ttttflcactc cgnacanatn aantgaaagc aacnctcg tgrtgtca cntcanncnt naaactcnat aaaz9ccrnga acccac cag ngaa Et :aga c: tccacna ntoraagaaan tgtrnancac nnaaacrlgac 180 240 300 360 420 480 540 600 660 695 <210> 16 <211> 669 <212> DNA <213> Homno sapien <220> <2 21 <222> MisC feature (669) <223> n AT,C or G <400> 16 cgccgaagca t :cccgggcc agaacccc t gcc taoag czggaggczz gagac-.acaa acaagaaccz ctcgctcgc canatctgag tgccctttgca ccgt£ggcg tntcccncc gcaac~cagg cot: ecactcggagagagacc agccaaagag cgac::-cctc cat o-ccaaa g-gtoacctg accaccaagc acgcZ:ccc: gccangagtc tcccacccac ttqtCCCCgr cacagtccccg ggcgaggaga gcaaagczaa atgaagagac qccaaca:ga gaccaca:-cc ttgcgggtag ccctgcccca aggaaacggc ggagcccccg tccccccc gtcccgccat agcaagacao aggccaaata tccaaaaagg agaar-aagca ccaccccaca ccaagttgaa cccgggtcct ncnggtngtg gggcgagccc ccttcccttc grccccagaaa 9 ca gg agaa a c ccaagcc--a gcaaaagtac gctgccaaqz ggatctgccc tgacgctgcc gtgccggccc gctggaaaac angaacc tga tccggt::gcc caagaaaaag gaaqgta.::C goacaaaacc t::cgac:c-n gcangaccag aaagaaac gggc!tctacg ctgccc: Cc aaaacc=:: n ccc::t 120 180 240 300 360 420 480 540 600 660 669 <210> 17 <211> 697 <212> DNA <213> Homo sapien <22 0> <221> misc feature <222> <223> n A,T,C or G <400> 17 gcaaqatatg gacgcgctga gcctgcccan noctaactcn cncnccctccccacnacncc cncnacnncg agncacgcric cccg nc gacaact aag ggagannnac gggancccca cflcflcccng ncnacnacct ntcr~cncga cgn: :zcccg rCC=-r nnr-:ocnc taagaac3a gctggcc-can lcflctcgan .nccagcz: rC cccacccncg ancnccn,.::c cg~fcnCcngc aacgczcc-, gccqncrnzg atnctct act cct900ggcca cccatncc gncccccz.cc gc~cccc ccc ctcnccccc-: c~gCCg--C cz7CCCcz7C qctctagcn cacacaggga acccgnniccn gccnnncccri cagccccccc ccngccc=cccacnacag t 3CC 1: a cnncc3,-Q~jc ctccnggcnn ccntgartnat tncgcc::acn tcnncnzc": ccgcaanct gcC=CCczC9ncncacccac qgnC~naCnOi CCnCnCz=n 120 180 240 300 360 420 4 9 0 540 ccccrngcngn angcngtgcg Cnncangncc gngccgnncn ncaccctccg lccflccgc-cc cgcccactgg gggctcccgc cncgcggntc antccccncc cntncgccca ctritccgntcz cnncnctcnc gctcngcgcn cgccCflccnc c-c 600 660 697 <210> <211> <212> <213> <220> <221> <222> <223> 18 670

DNA

Homo sapien misc-feature .(670) n A,T,C or G <400> 18 ctcctctgaa ctc~acctcca gggacggczg cggccccgtQ ca-c:rtcttc ct -caggarc a aZC:cc!tcc tczcgaccaa gaacgantat gnccacnn ac-inaaaagg tttanccacc gggtgcaga gtgccgcc-gg cccgccgggc gcczacggtg aaccggatcg ctt ggttcca czacaggctc tgct-cangaa cgccgtcrcat ctga t ncc gccaaggactcctaagccgg ~ccaagatc -ccgQ-ggcat cgcgcgaat 2 gtggagtgca gtaccccanc caaagacctla cttcccaaca Z~gtcacgaaa agcocagcca tcOccccatc agcggggc ag agacatggcc gggcacggcc tatattcacc c aggacact a at ctatgaca cagatggtoa tgttccancg tgctcaagaa agt tanccct cctgazaatg aggcgggccg cagaacttga :tzgaagctg,.

acagaaggcg t-Cctgggccg r-cgggccaq at atctccccot aagggc: :tttnggtgoc clgt tgat ccc t-gccntcacgcaccccc acgac :tqcc tgctqagccc qgcncagao 2 anggcczzca acctcoaaaa gcgag -cz:cy ggactacnaa caagtci: aa t cggganc: g aaagcltzaac 120 130 240 300 360 4-2 0 480 54 0 600 660 670 <210> 19 <211> 606 <212> DNA <213> Homo sapien <220> <221> <222> <223> rniSz-feature .(606) n =A,T,C or G <400> 19 actagtgcca tggcctcagt tgtcuccttg ccaggctgtg tcacargcgt tactatgtgc gggca=ctagc gaqc:g-ctgg cagccaaaag tCttztgtct gagacc.: acctcagctc tgtccttggt gctcaactgt ccctggaaag Cctacctgtg ctgtccactg ctclactttta tt:agcc-ttg ctoaatggaa grtt--tgttct ccaggccagt tattgatggg ggttgatttg tactacagcc aaactctgog acgactgtca aggcaqtgtg cacctgggga aagttnagaa tcaattgaaa tctctgaatg ggacaaat tg tctgtgCccg atcctccaac aagcaggaag aggcctcart tctttc-tgag aaggatgta: cattcctagg agt!tattaaa tcgaggagtt gggatggcca gaaagtttag agaagtacgg gc ccaagacc tgcagaggcc cactgtagac :atttgtat Zggccttatz ccaggatczgagoccccag catcattcit actgct cccc tggtgcztcga accggagcza CaagCCC--:g tttcataz:t ctaataag:Cagaatczag7t 120 180 240 300 360 420 480 540 600 606 <210> <211> 44- <212> DNA <213> Homo saoien <400> act-agtaaac cagcgccaga ccaccacagc tgccagaaca cttcaagaat tgaagccaca atricc tttag aaaacaaaat aacagcagca gccgaggaga cgcctgccag tcaaggagtt acaacaacta ccaaggcaac tgtcattcqcc Cttgactgcc gaaacatcag acccccgctc gacggactcg cactgcccaa agaaaaggaa ECttggaaga gacttggct tgcccaaaa tatcagcagc Cctgaggagg ctgctcattg aacc taggca 9t C:tccagaa aa tat actt g ataacagtat gtcgccagca acctgtccaa caggccagac aqcCcccat aagaagctaa catatcgaaa Cttctagcc ggagaatcao actcccaaa aaacactrcac ggcccaggcc catgaacctc agcacagagg ataataaaat 120 240 300 360 420 443 <210> 21 <211> .409 <212> DNA <213> Homo sapien <400> 21 tacc-aaccaa CtcOgtgaata caataacaaa aggaacaagc ta~gtc gagc. gaaagaacaa acagaaacaa aaacagaggc aaggaaggaa ggaaactcta totggggaca cacacccgtc ttgggacgta aataatacct at 7aaac-aac cgccctacatg acacggagaa aaccacccc c cgc--gacgga aaaactcattc caactaaaaa gtgtrgcac-g tagaacaaCa cat act atgc gaggcagtat aatgtctgtg aaa ta a gacaaaaaaa atcar-acaaa tggacgcacc ggrcctct: ggagcgagaci ttcrcactcg caaagaacz aaaaaaaaa agQgcaccac:i tcagaaac:: atgtaacaz!c agac tgaa a gtggcagtza ctgcact cc a 0 240 <210> 22 <211> 649 <212> DNA <213> Homo sapien <220> <221> <222 misc feature .(649) <223> n =A,T,C or G <400> 22 acaaccccca tgataaggac tatttcagtg caaatctaca tcctgaatca agccgaag a agagaga ag ttatatcagt gtc-gaagcag gatgccctcE crgaaattcn ttatccttaag ggtactctgca gaccaacac c agaaaccctg gcagggatgg tgtcacatcc aaagaggaag agtcctgagg ggtgaacaac ccggaatttc cat Zzacctc cacattgcac atttctacag aacctgtqat tacggtgaat gtggcatggc gccggtccct aangagggta aacatcagtci tgttcacttt tatcgatagc taggggcaca cggacaagct atcacaacaa tacctactgtt agcaaatgcc cgttcgttc gggaagtcat ttttttaaac tttaatacac ztgct ttacc tatatctct caggaaaaca aaac.-cccag gacagttcc aacattgc gaaccaccc acgaccctag tgacccagaa cctgcctcca ttctgtaa ccgcacgtcc aac~antcgtat tcccgca gcagaaatc ggaat agcag ttcccccttc ttccagtagt ttnaatgtag atttgatgc cgt tgacaac gctgtttcat gttatctagt 240 540 920 <210> <211> <212> <213> <220> <221> 23 669

DNA

Homo sapien mlSc rfeature <222> (669) <223> n =A,T,C or G <400> 23 actagtgccg taCtggctga tactCtcagt caccagCtct tatcctctga Cagcctttgg tCaCCtgtcg tgcccCcctc CgCaaggtgg tgCtgatgca Ctgacacttc tgctgaagti, Ccaaatgaga atatCCccga gCtgaCCaga gCCggttgac ggaaCagtac cctcaactca gCzctgatct gCgctgtagc agtattacct gtgaagccct flttctaacc aatCcctgca ggaattagar gCtgcctcgg tgtCaagact gtgcaacart ggaggaCaaa gt tggcggc: ttCtCtgcta gCcgctgtca tagtcc!:aac tCCCtccttz: ggaCcaggaa aaattc-ttg CCCCagCagc CCgacacctg gagt cggt gg CtgaaCCggc gagctggtgc gaagagaCtt CCgtctcctC gtgctgCacc attaczcagg gagaaccagt aagatgtcag CaCagCagga aaCCagcga aggagggagt accgagctg agctgggcllt qaacaagt~c tlagagCtca C: Ct cltCct: anggctggog tcagaCtttg gaatgggatc ggaggtgaCa ggtggagact caaacaccac tgaCctgatg cat tagtgag aattt::gcca Ctcgggccag ccc cccaatc gggctCczg 120 180 240 300 360 420 480 540 600 660 669 <210> 24, <211> 442 <212> DNA <213> Horno sapien <400> 24 actaotaCca tcactoccat gatoactatc Ctzacgat gc ggtaatgcac ccigaaagaga gatgatctct gacctaaaaa tcttgacaga catcaagca-: attatc-ag act t tCcc ttgctagtac aaaqccttc gaCqataCct aaaaaaaaga ggatacatgc cagt: toaaa 'tCotttgaaagcacat-cag taCaCaCt::tttcattggc gtatgtccz aa tcccaaaacg at tarag..a ttgtaaagga atttcaaatz ggt acaaCaa Ctt aaaCt-ga attgtgtaaa Zttgtcacca aaaaaaaaca gaaaa: taaa aaaacagagg Qgtcaagatc: taaaattgct cacttaaaaa aaaacaaaaa gacatgC:at caagaaacaa gaaatataqa ggtatgaaat 120 180 240 300 360 420 442 <210> <211> 656 <212> DNA <213> Homno sapien <220> <221> misc feature <222> (656) <223> n A,T,C or G <400> tgcaagtacc CCCCggaatg aczctaatgg agcacctgagg gacaggatgz ct Ct -agCag gggCtgatct atgggacagc at~aaaaatc r-gacatantt czccz~ganac acacactg:tt tacagtgtct ggcagagagt t agaggggag taga:aaagg ctggtaaagg gattacttoc tttccatatactgocccaa Cttagoatgg9 'tCatctacat cgaattttgc tggtgcacca acagccctag tggtatgta:ctctagt tag ggtgctggan rtggcat-occg Cttgccgtag ctacac:zOOc ggagccagcc aqaattggc: acaaaaagtg agatgcctrtc Occagtggt:g ttctctaotg ggtgtcoattg gccatggagg ctcactttta agctctggaa zC=ttgaagg acaaatgana aaacccocc actzatagga:taaaggCta acatgaccac gaagcagcac zoatt-tgaga ancto~aaa Zgogaag~o: cactcto-taa aatagaaatg at~ct~aacz Zgaata3ac caggtgatag cataccr::gg tCCCtt::ggg atgagtgggc: gactoaaca acat-caccat Zattagangg att tocCct gaaclr---oc gtccacgz--t caaaaa 6C 120 180 240 300 360 420 480 54 0 600 6 5 6 <210> 26 <211> 434 <212> DNA <213> Homo sapien <220> <221> <222> <223> misc feature (1 (434) n=A,T,C or G <400> 26 aCtaqactcag actgccacgc: ctaQogtgttt Ccazctatgt acaaaaaaac gczaccaggc caccagggc cCtttgaaac aacaactgaa ttciccaggct gaacaagtta taaccagtac gtcc:zta ctgc:tgaaa aaaaaaaaaa aaaa caaccccaga ttcaaccgt tttagaagca agtaccacat t-tgattgaza tcatctccttc aatatc-.-r aaac acccca ccatctacca gttctggqct gtaaaaggga attgragaaa gccccttgtc 7tatnaaatt catgc'cagaa ggcctcgcga caaaaccaatcttgqcttt taagtagcc:: acctctzcraaactaaccaagtgaagcc caaaaacaaa accatczccc cacttcazctctgttgrczq ctctaac:ggcczcaaa=a 120 18 0 240 300 360 434 <210> 27 <211> 654 <212 DNA <213> Homro sapien <2~20> <221> misc feature <222> (I (654) <22 3> n A,T.C or G <400> 27 actagtccaa caacaaacca tr-catactcc cagaatccca gcagcctctc gaatgtaagg ttc-ttgttcg gtgttga-tt attcaagctg ggc ac aa aa a aattgttaag cacagc caga ggatccatc atcc-ttaca tggattgcag aaaagcagaa gcagccggcc cggctaaatg acaaagaggc tgagccaggc aaattttaaa aanaattta aacacttat-c aggtaccact ttagccacta cat ttcactt acatgccgcc cccaatgtgg acagttcg cagctaatag agganct-zag gcntttatgt agtgtccaga t-gaatccct tgatataaaa aatacgc tat ggctactctca agt tczcaag ggaggt ccga tcattactta cagaaat cat tatggcaaag tataccatgg cccanaanga gcaaaccaag aggataccca tgcttgatga tacccatcctitttcctccc acattctct-g gattccgatc gaccctgaaa gtcttgagaa aaccatagaa gcattaatzt taatgaatat.

agacctt:c= t t aaagaccoq aactcca::iz aattcccazc tttcccaaag gagagataa tcngccar- c anggcaagg 120 180 240 300 360 420 480 540 600 654 <210> 28 <211> 670 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (670) <223> n =A,T,C or G <400> 23 cgtgcacaca t-aczlagogagg atttccacag cztgcacgg:c- acagccc:za: a,~z ggaaagggcg aagcagctta gttcccggtg gtggggccag aggaagatca tatagggaat ttgccaaaac tagtccgtct tac:actaan ctanagttaa agaaaaagnc aaaqatatgt ttcqaactct ctcCtggtgc czCcccCCgc t:ag::ct:: gcgggaaat,- 9traccaatc tcacacacag ttttCtgt ccnagctagt gggataaact.

gcggcagcgg CtCtCtCggc ggcgcccacc ggggacgt :n ctganc t ct aatgaccaac aataagaaaa zgggcaaaag Cfcatgaaaa gagaaaagaa caacggggcg agc: :--agcg cacnctcact gtgacctct tcftatntcg cnacacagc cggcaaaccc aatccagga atgatgggcrflccaaaaacc tcaacatcca gcggggt ccc acctgnctir ccacactccc gtgatgctga fltgatttct caaaaatcgg ac.cccact acrlgccctg ccflcctcaac tgczccccrgc CztCc-agc ggaaatcgag aaaacactca tgtgttztat acntcngctt tnanctt nac ggccnccg: a gggaaagcca 120 180 240 300 360 420 4 S v6 670 ':210> <:211> ':212> <213> <:220> <221> <:222> <:223> 29 551

DNA

?Hcmo sapien miusc -eature n=A,T,C Or G ':400> 29 accagtcctc cacacc-tgr agatcccaac -agocac cc=Cc::ccag Ccac-tgatgg zcagtaccai agq:acrtga cccgac:- taag:Cgtgq cgtaatgaac gtcccagaac aaaacaatag craacgggaa aaaagcgaaa ttg-ggaagac aggaaggaag agaaaagaga aaaaaanaaa a gaatcccc-ct cticacccacg gaaagt art t:gttgcacac ttcagaaat agaaaaagag gaggagcc cc aaaagc: caa gacnaagatc acxacc: Ctca cczgatqa:: tccatcagtt C, zca_ C-ct tg acagcaccag gatacncaa agcagcagca cagcatttgg nctacggacc agca acjtga ctgzagaaaa agaagc-ocg tagcotcaoa tgc~r:ccaaa ggaacatcoa taaggagaaa gnnfncggaag gcggacaaga gcaagaar-ct accc t tCCC:C::ac aaacaaaaaa aganaagatg aagaagaagn ':210> ':211> 684 ':212> DNA <:213> Homo sapien <:220> <:221> misc feature <:222> (684) <:223> n =A,T,C or G ':400> aca:arct-a cgaqactcat gtqa~iagaac agcacctcrc ccacoagaga ggtggtgata aaatgcrcc tagcagaagct cagtactgag aggtnatgag tctgaaaaaa ttcCC: ggaag ctggaccgcc agt::gaaa tqac~gcaaa ttzztgaaga gt::zrtggaa -gt-a gtgqga tczca :gagria gcccgggttg catc=cc ttttgagata atcaatgatg tgtaatcgag gtcttcC~at 9tatacagco aaatagtac:: qgatgazca aat~c-ggan gaagaagcrg aaaaatgcag atagagatgC gcztc: gag: CZ:aaaggga aaagtaatrg ,Lgagtcttca aacagctcac :::Zacaacaz gaz gggaa: tggaaagtgc ctgagt acaa tgcagt ctca caact: tact aattcctcat tcatgccgac gatacact~z cgagcaaga aggaaagaaa tcaaa--caaa gtgtacaacq ggtcatcact agaQac:-',-' ggczcaaa caac::zagaa tacgaaaaaa gtc:cga:g acco z=:ga cgccaaoaa:: ar:catgaaag aagtc:nttcc tgt!tactaca gaaaagaac: atqt ttatrt- acatgcagaa aatatanatg tgtgqtgrgt accgtggatg gaan 660 684 210 <211> <212> <213> <220> <221> <222> <223> 31 654

DNA

Homno saoien misc feature .(654) n =A,T,C or G <400> 31 gcgcagaaaa aacatcztct t ttggcagct acagcotgac c=:2ggtc:t tcacgaccag aaatcrcagag ctatggcaga argatcjttar cacgc:ocac tcaac aaagt ggaaccaata cagaatgacc gtgct:tcca agaataot:ggagacacag ggaaagcaaa tggaagaacgcccaacgca gataggagtz tgactgttgttgtatca tttcagaaac cagaagt:.az gagatcigaag gagaattC::: tagaaggc77 tcagangt r- Itccatcacg aagCCz-au:g cago acaagq tgcaoracagg ctcatttga-: aagcztaata r-at::gt qcga aaaggtgaca g-caaccca :gazgccraq agattcctca gaagattcCa:aaggrcic:q7 ataaagaga' ZCC Ctotcoca -g tc -c ggaacagctg gctaQcgtgc gtcattgaga ggttatcaca gut gtaaacg ~cc:ctgtca catgagtctr7 gtcacagtta Zagggagatat ant tcaggaa C-gaaaaatgc cctgcacatc ttggccgc gagacztaaa ttcteaaaaa 9tcacatgac gaaaacaacr eggaaagcag cc agaggaag caaggaactc aagcctggcc flOcO 300 -:0 600 <210> 32 <211> 673 <212> DNA <213> H-omo sapien <220> misc feature <222> (673) <223> n A,T, C or G <400> 32 acr-agtgaag tatcacctga ttaaagacca aacaaattga gacaaactcc aataaatcaa cccgtgactg tgtgggaaat atacroagga aagangt ccc gaaat Oaaaa cacggacrag aaaaagaaat caccaggagt cacaaggaag aat caaaaga tctatccagc tcaaatacat tctatnagcc aacctgaaaaa tttctactgg aaggtcacca gacgc: -tcaa aaa tctgatacgg tttcattgga caaaatcttzt atctgacac agacacaccz ccaaattaag aattattaaa gagaccgaga aggo ggagaa aattcattga qgagacnccc gacaaaaacg aaaggatz-cg Ctogaaagaag atgacaacaa gttggaaatg :cttgttcgca aaatacacca agaacgaatc acagaagaa: acgggatgaccacgaacaa CtC'ttcaaaa aacctggtgc taaatgatac acggtgtaa!atcaactgc: gtagcacctt aaatcattga attacaggtcr tCtgaagaaa qgtctttat: ctgccagcca catcatcc tactaacatt acttctggtg tcatgtcgta ggaaatactt caaagaaat c tgggagtgcz ctgaaataaa ttgttacaag cgaagatgaa caaaaaaat c 120 180 240 300 360 4:20 480 00 <210> 33 <211> 673 <212> DNA <213> Hcmo sacien <220> <221> misc feature <222> (673) <223> n A,T,C or G <400 actagttatt ggatctgttg gaaggt tgaa tctta~aagta atcacttaga tgaczaaaaa tgaaatcatg gaaactttCatctgcacttaa tIntattttta aatr-c.atcat ttcgctactg tact ttcctc ttrtcttttgg aggagcaggg tgatgcatat aa~gcaagt t tgaacattaa caactttgaz aaagcatatg agaagtctaa aatattgtac ttcaanggca cgcttcagaa gtctcacct~c aaaagatcca tgcattatzt.

caagaggata tgttnaagac at cat attccc gtcagttatt cagtacaaat tatt tatagct trtctattcqg g9tt t.t "cag atcagrcgtgc g~aagcatgtt tatttgcaaa tgaaciatttg ttaagacttt ttgat ttaaa tnattaaaaa acctatctat liggtggggtt gt t agaagtact gagagcc atagtggcag agttcgacat ctaggaactg agaactttt! aacctgctgg ttgggctt-t ggcaaaacc: cttagatgga rttct:aczaa tgattccaag taaccatactaaattataaa catcatctcagtctgagg aactattcat cagtcccaaa gtCgattgan: gaaccacc:: tacacaaatri nantgcacat 120 180 240 300 360 42 0 480 540 6 00 660 673 <210> 34 <211> 684 <212> DNA <213> Homo saoien <220> <221> <222> misc feature .(684) <223> ni A,T,C or G <400> 34 actagtttat tcaagaaaag tgatcagggc tggtgtagca gaccaagciag gaaatcacta ccacagtzct gagccttaac ztcaagagga a-cc-gtgcgg gggcactatt atggctgggt tgcczggttg gaaggtacag gacaattctc agtccaagaa gaatcggatn catttttgac cccqcattat Ctacaacitg gtc'ttccaag ggcagggtgg cncaaaagga atttntttcc aacttactga tccggttcct agacattcga cctgtagtt atagattggc atggagca-ga gtgttcagca gaatgcattg cangatnntt tatgaagtcc gttacaccat tccc ttcctctgttttagtgcagc gaagcag~gg acacacaaga tggac-tttc caqcc ccagg cct tcggaaa accattgctg ctnctatgct: tgCnnccccc tttacctccc cct-aaagc=a taactgca:: tatgaacgt t acgagct cca a at ggt t! c g aatcagaaccaagggcataa gctatttgcz ttntgcaar agagaggc--g ctctcccccc gagtagcaaa tgtcactgatc cttggacaag cctccccZ-C ggttqcaag:tcagcccgc agtnotgag tncczagtan gaaatcaaat ttcaggcnaz agattatgnia 120 180 240 300 360 420 480 540 600 660 684 <210> <211> 614 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (614) <223> n A, T, C or G <400> ac:aczccaa cg-cz-:tgcn aatazttcccc- -ggtagccta ct=C:c cccaoaaggtaagatcg tcactgcatg CaaccCtcgC acggtttctc aaancncgt g ttlccfgtttc gaaggganga cgctctatgt gflcoqancnic aaaaaaaaaa agcaatczgct aaaactggc:rcctgc ttag tgto-gtcaat agcagncanc tcctggccct taantgggat ggganacana gccttcgat aaaa tagacatg tgtctcagtg tgccgtatga gt tggtnagc fccagttctg g~ngtgggcta Ctaccaattg ZctancUtCt Ettcganaca.

Cggttctcttc tftcaacctc cagcccccart !:oazt ggtg caccagcagc nggcctgatt azttggcaa a'ttnntgct cnccantnaa tCCtgtgatc accagggctg canatgacctaaagtanggt gcCt-ccgtcc cgggaanatg aacnatntct gnanatnaca tactggcgt t attcaagcgc tctct tggtc tggccaaatc 9gaccaaagg tact ngggtg oct ttgcang aagattnttn Coot actcgt ctgttgctaa 120 180 240 360 420 480 540 600 614 <210> 36 <211I> 686 2 12-> DNA <213> Homo sapien <220> <221> misc feature <222> (21:"1 (6,96) <223> n A,T,C or IQ <400> 36 gtcorotcggoo cggt:ctooo ctcctcgt(o gactgttgc!t taacctcggt gooaocgga: 999c-1-oaog-T c-go 3gcaqco ct oacotccoo cagtzcgqitc acotgct:g ggoac~cgoo; ggtatttot: aatcagcgcz gagaczggat tagaacattt ggatgccacc aaagcagicta ctcagganat naattgataa ggatattatt atztgtttac aactn~aaaca aaanctaacg tgct-ggtcgc tgc-Ct-tctt ccoaaacac: gctngoc too aooogt go tt tgcaaaaatg ttggggtcta cagcagctgc cctg-gctoat cQgogganag aaat-co :Coactccog :7:otOttqo =:zag caqa ag 2-cocrc at -g cat tggco: g tt a a c aaggtotgtrt agat ttoaca aacacattgt gataactgc: aco coc: ccagcccc ananaaaaca caat:nagaca gctacgcoag3 tggggtgcaa gcctaagtgo caagaacog tcfltntat: cacocco:cc ootaogtqrca cacoazca caccc::zatg ggagatacag cactaaataa gggatgctgt gatttococca taat tgaaca 120 180 240 300 360 420 480 540 600 660 685 <210> 37 <2 11> 681 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (681) <223> n A,T,C or G <400> 37 gagacanacn naacgtcang agaanaaaag =,ngcatgqaa cacctr-oooa cancctgnat aaaggtcgca nataggaaac cacactgagt tgcogaggaa aat tatnc-'natngcicooagcancca caatctgano cnnncagaa tggtgaccnn cnnngatgan ggaaoaccoo o t t actgag nat zgggacz: gcgcccccca tctattoctg agctgctgoo gctgcanaat gootnaccan gnacnggatc OZtgagqq gacanqgoog 7cngcozca =cccat moo: ancaccano: z:oatacaga ggaoct mccc 2r-ggccggcn acaz mnacq cacaanccag flgflccggang acc-cggaog gcacgcga-g cagcnnat:.g tgccac cc: c cgc cca goc tat- o-CoC gcncgatggc acoangacto tggqanooogm tgnogggot.m ggcacnnnct annacnggac ocacoctag Z:Cc:cca oancat ccc:z tnanaccaac cggcgcnggc ggacccctcn aqcnacngan nacnggggct ccccngggtc ggngcaacnc tCtnCaccc cztcggtgnt gtcctccntc aacnaattcc naaanggcgg gccccccngt ttgttcccc 600 660 681 <210> 38 ':211> 687 ':212> DNA <213> Homo sapien <220> <221> <222> misc feature (687) <223> n =A,T,C or G <400> 38 canaaaaaaa aaaacatggc ctcccggcct gtcgtccagaa Qraaggcggga cntgccgggg at cacaaggg cggcgctaac gggggctgtg anaaccgcaa aaggananac ttccacaaan C[acco ccagt: aagtzccr-On cggcacacna aggggangan gcccgcccta ntc--gcttt: c:ccZ-tgcgc cttcctcrna gcncrnngtng aaaccaact aaczgctgtt ctgnztactg cgaaaccagn ggtttrccctc ccggagczca ctnaggccr:: aaanaacgct: gcagccttt: cg-gggaagct ggcanganac gtgaatctcc CCt taanaac ggtccnccgg cngtccc aagctgcgcg cgaggcgcc~c naggcc:L ccc g caaag gggcgcgcng cacagcccan caccgcrtgtc Lgccgcczgc act t: tgt tca cagcttccc a ac ct c z zi atggCgccac cggctcccgc gccgczc Zccccnanac cgaacccgrc agccacnt:: aaaaaancz:c a caqg tcc:c accccaccca tacccnatng ctgtqgcac aagrcggagga C:cz:c cgc ggnqccggcq cacccccgcg ctaaaa tga: ttccc:z-cac tgazrcacqtc ccgtcc= tant:n--:7tac~na aaga 120C 189 '24 0 300 360 420 480 540 600 660 687 <210> 39 <211> 695 <212> DNA <:213> Homno sapien <220> <221> <222> <223> misc feature .(695) n A,T,-C or G <400> 39 actagtctgg cct tagaaaaacg tat~ tgacccctgc gct cttattagtt ata ccaaactttt ttt gttgtzatgg gtac aanaaatcna nga att-tuaaatc ana( nuccaaatct tntl tagaatggcc Cta~ naatatatat ccti acaatag tgtgattcat acagat t agactgt acatgac :ttaact gaaaaaa aggggta acangat :acggca :ggaaac taang tggtccc acataagtag ggaaagggag aggtgctgaa gtagatcatg ccacatgcct tgtttccagt t tngaaant t ccttccgttt: ngtccnttta ttaaaagggg ccaaaatt.:a gtaggacttIc ggataagatt tat tattata ttotgattca catgtgaa~g taaaatttta ttgt tat taa aagntgaca: tggtnctatc act tcttcac ggggnnccac aggng tttcatcaat tctaacat::t gtatacaaca caatttaaaa ttaatgt'caa aaaagcaggg ntggtta:ag r-at ttncccg ggrnntt:gaa nana t naccat:= tcaaaacccfc ctgggctctc ctgctgttgc acactgtaat tttgt :caan cccaaactta ctctgtttag tgacttgtta t. :caancngg qaacaaaac:- <210> 674 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (674) <223> n A,T,C or G <400> actagtagtc agttgggagt tattaaataa cagaaaagaa ttacagaaaa catagccatg tcttagctca tc-ttaaataa gttgraacaa ta~cacaaat tgatcaattc ttztaattttg ttaaatggat caczgacatt at--agganaa antacctccc tggaacgagL c--cczttatt tcant -gggtt gggzattaat aaancttncc gg-traatctg atttgctatt cnaa ggttgctata aaccccggtg attgaaatca gtagtacact cgaacttagg ggaacctata taagtcattc agcacacccc t ccgaantgt ttaaaccgcg nctnancaaa ccttgacttc Ct tgc agt ag aatagtaaag tgggatgcag atgtgtttct atacagtttt tgctt Otcat cct t ca aa c ggatggtaca c-acgaaaagn tcca at zt.ic atttatatga agccatagga gctgct-ctgg rtgcgtct-gaa zctct tctgc cctattcttg ctnaatattc Cccacccaaa acccatatcn ggnaatctzz t ttaggtg atttccac::t cat tcta cczc Ct tt ttatzcc gtgctaatca gtttcgaL gagataaaaa catattczaz accaagcacctccaatt:2 ncctcgc..: zt cat aaa 240 100 360 4i30 67-4 <210> 41 <211> 657 <212> DNA <213> Hcimo sapien <220> <221> <222> <223> mriusc 'Ieat ure 657) n=A,T,C or G <400> 4! gaaacatgca gtgat agccc acctzgggac cctttgggag atnggtnaca acacactcct agcatgggct naaggatggg ccctctatta tttctctgac ttctccngaa agcaccacac cqgaatgtac cctaatgggg gczaaaqcca ngazgttaaa ancanctggt garctgatta ananztttcc aaaatcactg ttagtccttg ctcacctact aCtgtttgaa agtgtcc tag cagagagtat aagggaatgg ntaaggntct aaaggggtgc cttCctggca atatccttgc flccttactac gcatggganc tgaattggta tttt-gcacaa t gc acca a ga agccctagcrtatgtgcctr ant t tgggc g tggaagccat tcccgctcac tgttggaact acttcctcct cagcccaaat aaacctcctcaaagcgacct tgccttcc-aa c-agtggtgac Ctcatggaaa tcttgtcatt ggaagaactc ttttatggga ctggaacacc tganggaata taaaacga tggaattagn tagggatcag aggctgacar acgaccac=c cagcacac-ca tgaaaaantg taaaaacatz agtcttatta ctctaaacc:i gaaatggacc cttntccgz aaaaacc 12 0 240 300 360 420 430 540 600 657 <210> <211> <212> <213> <220> <221> <222> <223> 42 389

DNA

Homno sapien misc feature (389) n =A,T,C or G <400> 42 actagtgctg cgatagctca cagaaagaaa ggccttcacc atzctgaaga tgttgcctgc atatt-ttaag aggaatgtaa cactcctgca acaaaaacca gccaccaggg attcctgttz ccgcgtngtn ctaagaaaaa acaagt-ttgc Ctgtlgcctgt gac -gtgtcc tgtcccgcca gggggttgrtg gggaagggac aaaaaaaaa tgggccttgc cacccaggaa cacaatcaga gacagggaga aaggaaaatc cggtttcctg gagacttcac cgtctttttt aacctccgtt gac? ocagoc acccggattt gtgaatttct caggt!-qcot aattagaaa gcggcagang ttctgaggcc aaaaagatgc taaaagaaaa 120 180 240 300 360 389 <210> 43 <211> 279 <212> DNA <213> Homo sapien <400> 43 act-agtgaca agctcctggu gtaaaggata aaataaga tacrqtgrta gctctttgaa tgtcc:'catc attgcataaa aa!t-aaaacac tr-aaacactg cttaagatcat gt--ctgtcal, tgttcttgaa agctqtitaca aaaaaaaaaa CttCtCgtta aggagatggg c-ctcttag cattcacta: tctagaactt gcatczacz::! ar~ttagacz Z!tctttgtaa acaaaraar-a :gcaacagrg rggat.:ct tgtczga::: aaaaaaaaa 190 <210> 211 <212> <213> <220> <221> <222> <223> 44 449

DNA

Hemo sapien misc feature (449) n A,T,C or G <400> 44 actagtao~ca tCcttctac caacaacaac aacaacaata atazagcct gttttttccc tctacagcct ctttcctctt aagan~tgggc tgtttCngctt gtzggaagaa actcaaacct attt -ttac tggcattaac aactztaaaa gggaaaaaaa aacgttaaaa aatcctaagr ttttttctcc ctcatgctt ggantncgat tcnancccc-a aaaaaaagaa aaaaaaaaa ttgcagaag-, gtaaatcagc tgggaataat agct tcCctg ccnagiggaa ggtgttnrcca atnaaatatt agcttatcat tattctaccc zgtgggctzc "ttgcacgca ncatgctttc t:tttgtcaag gttccactaa taaaaaacaa.

cctaccaagg ttcccaaaz: tgcgttgtgc ccttcttac7c tcacicactzt actttaacaa <210> <211> <212> <213> <220> <221> <222> <223> 559

DNA

Homo sapien misc feature .(559) n C or G <400> aczacitgtgg gggaatcacg gacacttaaa gtcaat~ctgc gaaataat:c ttttat:azaa cac:z:actga agtzttt-Igag tcccagagag ccat:c taug :-caaacattz- caagcac:::: tcgacagccc aqcat tacat caacatgcc:z ctg agrt :a aaccgaac7c cc-cacagc=a ttqaagczz tctgccat t caaacagaz ciaaggcaaoa acatzgc--at tcgactaa::ggcgaagctc trggaaaaaa tgtattt-tgt taactttatc tgatggatat ctazaat-Igt aatattgt atlctagccca ctftcttgca ttgattatga aaaaaaaaaa aaaaaggaa ttnactagaa t:tctacacz agaLz-tqtc tagtattgta tat tctgaat tact t t:tgt acaatatgc tzz-acaagct ct~taactttt aaatiatggga gt taagttaa t tttgt-atat aatactgaag acagggtgaa atatatttta ttaCataaiat atat?-ttq'oa actcgac--a aaaaaaat:atgtgggcaa 300 360 420C 480 540 559 <210> <211> <212> <2 1-i> <220> <222> <223> 46 731

DNA

Homo sapien misc feature n=A,T,C or G <400> 46 ac!a:3:-cta gt~aczatggc tcagctt:ccc act-gtcazgt t-atacat E:g ~ggcaact:g cttrga:t,::c ataagactgc *ttac-aaat:a acgtaactcxg taggnttggg taacaattgt atataagtgta catazacatg cacatatatg tat :zctcc tttgqataag ccacaat acc agratjaaag aar:gtaaaa gtacctzgtta flgccczctct.

tgtcatagat ttgaaactga zatgagatgt tataatacac cacacatat~n ct ototct gc agtct-_atcz tctcazatc:z tgatggttta,: tatcaaagaa gacctgant t gcaaccat--a ata ctatg-.

gtgcagt--t: at at acaca: atcacrtgaqE Ztcactggc t :cggcactc: at taaaac gt:aaattaz ::rgtatctga cct ciatct-a aatananac: ta=ttccat::t Z:a tgrt a tg cagt tat a:a gcatacac:r ttc!-aaagta tztgcaagac tgact:caqc ctaaganaz at otctoac a aaaatgl:ct :aagt c: tcaataatga agtt:=:: gtgtgz at::catat:=aa gtataat:= at-Cttaz: atagcaat:g c taaC rc a :aaagangiz: acticat!toac agaacaagaa .ocatarcoan-I atagttaa::- 63 120 180 240 300 360 420 480 540 E500 660 720 73~1 <210> 47 <211> 64 0 <212> DNA <2 13 Homo sapienl <220> <2.21> misc feature (640) <2-23> n =A,T,C or G <400> 47 tgcgnoccg cgttaataac gt acaccaaa anacoactnc ggaa-caaca:ttggtacg-,c caganat -cqc tacatacntt acanctacac tC aat gag: nt-ciacnr:nZ tttggccctt tcctcaagtc tg~tgacatcc aacaattttt ggacctgtcn ttaczgaaag caatoc caag gtcctcgaaa rcgazgcttg ttzncct tgg ncgacqc-a Ctttgtanga cctgcctgca tttcacc-aat tgatnacccn gcnact aang anagaaacat ccgaacggt nanaagatgc ganaacanac tact: anc?: ftttczr t-ac cac tt tcat t cagggtttt: at-ngattlnc: aaanact-gag gaacaanat gct tct-nnct taataggt cctaanggc: t c: tqgoa a accanatcia aac:9naccc cgccctgaaa tt ant ttg ZCoataccaca ggctnnaana nfltzgaacat:ctagaccacq aat acat :cc tot toanac:at oat Otagc zzgqaan.CZ -cttcccga:: ?-tgcotaaca zcntcna: 0 agtacantct tacacaacc: aggncaac to atggazgc_=: cgcccngaaa acaagz~ccc 120 18a0 240 300 360 420 480 54 0 <210> 48 <211> 257 <212> DNA <213> Homo sapien 48 aczagtatac gaaaatcotaa atatcacttg tgtactcaaa caaaagttgg tz7ttaagc~t.

ccacc:tgag cagccttgga aacctaacct gcctctttta gcacaatcac a-tttctaaa tgattttctt tgttcctgaa aaagtgat-t gtattagttt tacatttgt: ttt ggaaga ttatatttgt atatgtatca tcataaaata tc-aaataaa aagtatcz:zzt agagtgaaaa aaaaaaaaaa aaaaaaa 12,0 180 240 257 <210> <211I I> 212 <2213> <220> <221> <222> <223> 49 652

DNA

Homo saoien misc-feature (652) n =A,T,C or G <400> 49 actagttcag tccacttatgt :gacacza tggoaaaaa taaacttztt tttcaaagc t'tcttt-aaag aacagcangg tttatt-grtat gatgcztttc cgcataactg Oaaactcccc aacttettt ttctcaca cagczatatc t ta'czgaagc ttgtanaata atacagagtg cacaaatgaa gctgaaggag aotcataaat att tctg: at taaaatggc: aaacztocaaa tztttaaagt.

ccaacccatg aactttctca caatttt:gt aaatatccca cagtgtatac cccccttgtc gzataatgac :-acactatca zagaaa9:::: atatgtagat azaattzcc act ttggaga aazgttgct t!ttaaactgt rigataactgc Cctcggttg at.tttcatt~a ttatqaaLt-a aar-aggaaac r:caqa t c 'ggactcatc t t:t Laaz:a r-a tat acat at.-i cagargtgca atlttcaatcz ttctgtgtcg :gcat-Inacc taaccc-Aat:i gcacagczaa at tggaaaga tzgaaaarttc a: :aagaczg catat"::as: aaaccaatat: agttgcaaar a ct: t c: c aa tcg:catt:9a.

2.80 240 300 360 420 480 600 652 <210> <211> <212> <213> <220> <221> <222> <223> so 650

DNA

Homo sapien misc feature (650) n A,T,C or G <400> ttgcgctt~g tg:tgagtaa gactccgtgt 9cttctttL ctccocaaac ggctcc-tgga ccaggactac c::ctggagta at toocant t at-.:ttc:ag aaaggagatg aac:gtgtga t tgggttct: acacaaactc ngccgcctg aa'ct:::a ccto cc aqgzgt 9cc ggct tgtgcc cccaatattc acacttggga tctagaagat t cagacacan ggggaggcag tttttaactq canacaagtg taactgaaca Otgtcacz aaagct gcta -tttC tc tcc z tcaaaaatgc qcaacttC:c acatgggagt -:tgccactg g-aan t:g aa a 9t-agggatan tatagggtc: a at: gtr 1c ctatccccgaa atatgacaag cacagccccaB 9ccaaggtzg ct-gc--ccac gggggtag99cc aaggtqgaa agaatgcttg tzgccataaa ctgagancac gcc goaca ccagat~gt-: ag9gaacactg cc-angaan: 120 ia 0 240 300 420 430 54 0 gcttttataa attatnttcc ttgttanatt tatzttttaa !-tttaatctccc gtitnaactcc ccngggaaaa ggggaaaaaa aaaaaaaaat tctnctaaa cacatgaaca 600 650 <210> 51 <211> 545 <212> DNA <213> Homo sapien <220> <221> <222> <223> misc-feature (545) n A,T,C or G <400> 51 tagcgtgcaa cctganattc qaczcccttt ctc at ggt c gtrlcaaaact ggacanaagg -c-gcncctc ttac:gccat cazc::zC caaaa ccagggtaoc cagctccctc: gggcctcagt taacnttgct gcagaagctc agtcattatt: atatrntctgg cctcacaagg tnatnaaaca tgaagttgg ccaccaagac ttccctccc ggacncaaag actgcctatg tggtatagat -fltggtaagt gggtgnaccg aanaaannaa gtctagggact cagcttgc: cttcatgana tgtngtcatz agaogaanta ccaccc-ntcc cctttgtgcctctcacaac: tgt::agacag ggagattggc acgtggcaca taaaaoaat atctz.Qtat agagaqataq caacc.t t-t: a ca nccazt z -gttgt-cac ngtt-,aaaat Ca: taagcC: gggcaaaccz actacttcc cc tggoa-cz tggacgana:: cCctcazc atcc-t toca 9ttzganazzi aaaaaanaaa 180 240 360 42 0 480 540 545 <210> <4 <220> <221> <222> 52 678

DNA

Homo sapien misc feature (678) <223> n A,T,C or G <400> 52 aczagtagaa gaaccttgcc ggaggaagac gatttggggg ntatctccat rtccantgnn tggnccccnn nccct-cccn ncttccccat ctccntcccc nct-cc-ncncc tccnnccgtt annctctccc Cnctgcaanc flcncgctccz nttcntcnnc cgfntccnttn flflftcctcnn tccccn flfcncnnccc cZtcntcnc cantccatcn flt:t:::tca cacngtcc gcttttgtgc gggagggggg Cflntgtcgcc ncctflcncct cct nanngt c cttctntzcrc gattctcr-cc ccaccctctcn accncccncc cnnfcccnzcc cftfltfccat ctctcacagg gggggcanag tcttccctcg cccccctccg ccaacnccgn cnacntntnc ctccncnnan ccttcgnccc tcccttcncc flfgcgr.ccnt flctfccuncc cgcctaaagt tccgtggggc tcncatc.nga flcfcctccnn cagcaat nnc ctftccacc cantacnctc c~tctcctcc nctcacncz-c cat tgccata tttccctanr ant tantccc cttttntan ncacttnctcc tgccnntnaa cntncttctzc nccnccctrn ccggtntnrc cnccnccn- t gctncccccn 120 240 300 360 420 430 540 600 660 6738 <210> 53 <211> 502 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (502) <223> n =A,T,C or G <400> 53 tgaaoatcct gatgtcgcca tgggccgccg caaaccctac ccaaagtctc gcttctoccg tgacccgggg cggaaaaang caaaantgga agatcaatat gagcagctgt cctctgaagc gtacatgta aaaagtngtg gcrlaagatgc cacgt c atcc gcaucaacaa gatgttgtcc atgcciaagtg Czttggaaa acccanggca atcacgttca tccocaccaa ccgcagaaca gncaafltcca aatttcccgg cc CCCcgcccgt aggtgtccct tgagtctccg cctgnangct ttccatatcc tgtgctgggg ctgtggccag angaacntgt, tgttaccggt gatgccaaaa Ct!ttgtggcc gcccgaatt gggcgcggnt ctgacaggc: 9ggttcacatt na attn a agcat tgtaagaa tccocatt: acatggtgt.

gtgccaacaa ccaccocc-r cccaacaggc gggccaa: tn cctgcccagg 120 180 240 3100 360 420 480 502 <210> 54 <21i> 494 <2121> DNA <213> Hcmo sapien <220> <221> mlisc feature <222> (494) <223> rl A, T, C or G <400> 54 a c ta zCc a a 0aaa aatatg tttaazcgcca aaaait ttcgt::;cctta a7Qa azactg caagaaatt-t ccacatctta atta--gagga =£::taatctt tgtzaaattt t--C::zcagt ccgtzttgaa fl~ggatatga aaaaaaaaaa aaaa Ct taatotac ttgtccacaa traggaaaaa gcgact ccaa ccttaaaca tcatgcagga aggcaacctct cnatnaatcr attacaaag Zt ttcczr-taag acacagc eta gaagaat gag caataat gtt cagttzt tlca ataat ot tta atcagatggg Ct ttgratat 3c c tca g acgagtgaaa tat cacatt ttctz:c acCttgatgt aaatatggtgq aaatcctglt 0gttaacczgt aaagacxat tz agggcagaac tagata cac ttttat--cac acagtaraczg agcatc:tcgu tccaact: ag 120 180 240 300 36 0 420 480 49,1j <210> <211> 606 <212> DNA <213> Hcmo sapien <220> <221> <222> <223> misc-feature (606) n A..T,C or G <400> ac: -actaaaa gatqg: :aagc tgct1:cctt ttcaar-tcca cagt::tgca atcracact:tgz: ::aaaac ttaccal-ccr agcagcattg Z:::Ztcgaaaa ::a-::-tggaat t-taacig t-aat -ataa- '-7-aata:c cga aaac: ccaaataat-' gt -caggtta gtggcat tag ttggagagct cggcattgta aaaaaaggga ttzQnctzaat gt'-ctca:-a cctaa:: t:: aacct:acziqcttttt-Za:t aaacaczog catagaaag aatgaaat et azarnog c: aacaccaaacc-actaaaaat zcgt tagatza t:-aacccatttttga -at atgc:ac aaatcaat::tgQc=c:::: ataacgaa:atgtatz::g:ttaa::z::a aacagaczga Ctt:: ct: cc ttgtacaaz2 tgt :cact 120 180 240 300 360 420 4 9 0 actagctaca aattccgttt catattctac ftaacaattt aaattaactg aaatattcct anatggtcta cttctgtct ataaaaacna aacttgar.tt nccaaaaaaa aaaaaaaaaa aaaaaa <210> 56 <211> 183 <212> DNA <213> Homo sapien <400> 56 actagtataz ttaaacttac aggcttatct gtaatqgtaaa ccaccattt aatgtactgt aattaacatg gttataatac gtacaatcct riccctcatcc catcacacaa ctttt-tzg.

gtgtgataaa ctgattttgg tttgcaataa aaccztgaaa aataaaaaaa aaaaaaaaaa aaa 120 180 133 <210> 57 <211> 622 <212> DNA <213> Homno sapien <220> <221> misc feature <222> (622) <223> n A,T,C or G <400> 57 act agtcact: go agt ggag a aatcagtgag ctgggtcaaa agragaacct g agggat-cttc tctacaanaa gaganaccan atatatattt gaaacct gaa aaact tgaaa actctctctot gtgctgctgg cactgttctlg gctgcatgaa acttctcttz tgagcttgt:: gcagcccttc aagcczctga CZttnaatnt t taaaaccat aaaaaaaaaa Cct tgt aot gtgtacgctg ctcagagctc acoaggccct: cOctctczot tCoctgctgg tttgtcctc!t tttttaatL: ttgagtcttc gaanaaaaat aa aat oaa toaa cacctocc-a cztgatctac :;acagcaaccctcoaaoa t gtoggacaga g-gggttaatg ccntn-aaatg gatatgtct t gztttfcctta tattottoc ctgaottag ccacccocta tgggaatqgg tactggaaco: agacaaagga agcttgacot t ttgaagcnt aaaatccant.

aagatat tan :tgcct~gQ ac aaagaa t ggatccaga tggaggtogg ctatoctgtt gaagggangg anant tcata acatntacacoototaocn taatt-aart:g 120 180 240 300 360 420 480 540 600 622 <210> 58 <211> 433 <212> DNA <213> Homo sapien <400> 58 gaacaaattc tgattggtta gtgtggaagc gttgaaaatt tcctttcagc tgocagtgtc ac--agcttta agctgaacca oatatttgtg actttaatcg tgacagtaaa ccot-gtccat: ttatccacca aagaottcat aaaaaaaaaa aaa tataccgtca gaaagtzac!: gaataatgta ttttatgaat tgCtgcztcag atgaatgoc ttgtgtatca aaaoacttga qctttctccac tcatoccagag ac!oaaataaa ataaaaatat :cotg zct a tcaartaaagt agaaattoa ttgctcataE tgatgttatc tagacco-t t ttatzttgtt: tgtatg':7tto tacattttgca agtaaagga tgtgacagzc gtacotgaaaa to-tcttcaat cgactgaat aactgcaaa 120 180 2 30 0 360 420 433 <210> 59 <211> 649 <212> DNA <213> H-omo sapien <220> <221> <222> misc-f eature (649) <223> n =A,T,C or G <400> S9 accaqttatt toccatttgg ttggcc-atat attaggcgtn gaccct tac ccc taccgat ggctcrtqcaa atcatatgan zacnaaaaat ggang: Egari atcacgccag atc:Qaactltt att--gcattt ggcatgttc tgtct-ctta agauacatag aacgtcccca ggtgggctca gangct agga acaaaaacta go a caaggaz ggcaacaaaa cnggttataa ctctgacgag CCtggagaag ttactgagtzc tttgcaaata gacatataat cgcttgtaat gttcgaggtc gtcaggcatg caCttgaacc atgagacct tcattctaat tgatgctatc tgtctgcgct caagantc ttttctccca aaatcctgtat -ccagoact t agcctggcca gtggcacacg ccaaaangaa gagtgtgaag aagcacctgagcctgc tttatatatrttCtgtaogz tttaaaagcag tgggagacta gcatagcgaa tctgcaaca:z gangc cgca tagcc-ccgg gccgtgctg ccacttcca ctggaczccc a tgtgczttca act tcattz aggtcggtgcz aacrzccc cganczgaac 120 2-so 240 300 420 480 54 0 649 gtztaaaaaa aaaaaaaaa <210> <211> 4 2 <212> DNA <213> Homo sapi~pn <220> <221> misc feature <222> 1; (423) <223> n AT,C or G <400> actagcctcag ac--tggcagt gaagraacg tcttctaz tgtctzacaa aggaacggcc caacccatta aaa gczt~ccagc gataccacca Ctgggctgtt ggcagggcct tgagccggcg atcztttgta tcactgacaa agcctgatgt ttagtgccag cattagzana tcctacaggg t tgtgggcag gtttgtatna aca t ggggaa ccaaaagagc gctgcggc~gg acacaagact ggtgganaaa gctactggcct aacttganct gtgtgcccac aaagaacac: gcagccac~a cngacttcact: acagccttc tgtacgatat gagaccttaa ctggczggaa tctccaagca gaacaaaacz cgaat:gcgg ttcczztggz attagtagag acaaaaaaaa <210> 61 <211> 423 <212> DNA <213> Homno sapien <220> <221> miJsc feature <223> ri A, T, C or G <400> 6i.

c-gggactgga atQcaaagtg3 aagt-c iqaca ctctgagcac gggctcrc::: cgccaczcc t c=czczca ciac::cagag ggagaggccc acccca-ccca goccc::~ agcc:::gc: cagtccgaq tatqcqcgg aatcgggggc cacaggc-.c-: tagccgcac: gcc--aagaac actggatcag ggtanctaca agtggccagg ccttgcctrt gggattctac cctgttccta atttggtgtt gqgggggg gtccctggcc cccttttcca cactncctcc cr-ccngacag caacc~ccct agggcaacl- gggcctggnt ctccncccgn gzgnc rtaaggnctc r-aaaaatgtz annttccc rtgccngggt taaaaaaaga aaaaaccnaa aaa 240 300 360 420 423 <210> 62 <211> 683 <212> DNA <213> Homo sapien <220> <221> <222> misc-feature (68 3) <223> n =A,T,C or G <400> 62 gctgagagagg ggcacggac: gaaaaaaccc caaaagactcgctcaaca cc:taaaggaa cqoccac:: ggccatggtc ggaucaaaaz gtatacttgt tgtccttgga ct ttzttccc cccztcctgtg t--zrggaatatgaacttazt:- t tggggccart: trt'tt ggaa ga t o ttnt-tacztg gqqccccc:ctaaaaaaaa ananannaaa ttcttggac: gggaatgagt: gtccccictga cacggacaaa ggggtcC.Cac atr c c ct cc tct gt t Z:c= naigttcc cc t-aatqaac:: gggn c aca naaaaaan- an zgrtcccaagtcctgc-ttca aaccc agagt acattoonat c~tccaa ccccaaatgc r:caaaatzgt '-fl ncc aa tc c :ggaaaaaa: 7:raaaattt ant tccaazt tggaatoaia agaaaataa ggacaoract a ggaccatggc aaccaaacca ac~itcccczc taattt!:t -a a tact aa tat ttigaacct tgaarncc ctgaac: aa agacgc: :aa gaccca: :ga acacccaagg ntcccacz fltzrt:naac:at aacqcgtt crnatnaageaa ccctnt :ccn 12 0 240 300 360 420 480 540 600 660 683 <210> 63 <211> 731 <212> DNA <213> Homno sapien <220> <221> misc feature- <222> (731) <223> n A, T, C or G <400> 63 actagtcata cccggccctg acggatccgc ccgcgagctc gaaggcgt ng taatattggt cncttacctn Ltccgggaaa gaaacnttt: cczccc-tncc ggnantaaaa c~cctttrn aaaggtgtgc gacctcaagg t cacgccacg accgcatigc:ggggcccgca tnaaaanctg gt--tggntgcatznt-rcaaa tgc~cznnaa tttntgcccc nanant :t: nggtttcncc gcgtcttcga tcatccactt gcctcatcca Ct tcttggaa aant-accaca canaanagcc 9gttacaaag antaaaccaz cantnncccc aaagggnga tccccgacigg cgtggcggtc ggtgcgtgat tgagagccta gccgcgggcc ctcgggcgc CctgCancc aacct--t-tn,ggaattnt:g ZCggggcccc anaatzvt:n 9flggggnnnc t tggcgccac ccccgcgcgg caggtggtgc acaagct tag tatggaang: cctgaaccxg ggaaaacc:: gzaaacccc gggccc-c*--'ttttt:ng n Cttnlcc-c c tcnnaaac tgctgcgaoa tggcgagt tc gcagccgaga cgcocanaaa cctcttgcaa gntgcaocc nccnaaaac.

ccnaaaatzg ncaaaacccz ggaaaanc cc gggncccccn cntn.t rira 120 180 240 300 360 420 480 540 600 660 720 731 <210> 64 <211> 313 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (313) <223> n =A,T,C or G <400> 64 actagttgtg caaaccacga atzagagatg gttgctacac taaagttgat agaaaatatg gactagagat aagtatgaga aaacgttgat cacgtatata aaaaaaaaaa aaa ctgaagaaag atgttgggtc aagaatgcat agaaagctac tatccatagt acgaaaagtg tgtagagaaa catcagaaga: tctaattaag gaataaaatc: ggaaataact carcttagagg Ctctccgaaa tct!-t:gaag gtCtcactaa tgcaacgzct agcagattgc atattaaaoa aatgaaqacn agttaaaa 120 180 240 300 313 <210> <211> <212> <213-> <220> <221> <222> <2)23 420

DNA

Homo saoien misc feature .(420) n A,T,C or G actagttccc tggcaggcaa c agaaagctg gcagtggcag tct-gggaggt tggagggaag gtagatactg ccttaacact ctccgtgctc actaatttat atztgtttta acattttcatacacaaatta atgatattaa gggcttccaa Cttctgtgtc aatctaggcc ccctcctctc tccaggaaa tgcaagtatt aaagcatcca c-tgaggcac:: t agggaggcg t:aac t--g-c tcagccgtgg ggtgtgtga gaccatcacc aacaaagccn gcatgtatgg tgtggc~ccc ctcctgccac ctgcca::cca agacacgagc cttggzzqr-g annnnnaana cagaaagagg cCtT--cctg ccttcccc- agccaggz: t Cgtgtacaat tatcgtzgta nnannngaaa 120 180 240 300 360 420 <210> <211> <212> <213> <220> <221> <222> <223> 66 676

DNA

Homo sapien misc feature (676) n A,T,C or G <400> actaczttcc cc: c aat t tg aaataaactc aacaaggaaraczqttzta caclt t az: agaaacc *66 tat-gatcat:- C act tcat ca acaaatctgg aatcccacaa aggat C tgcg aatgtgagc: tqcttCt ttg aaactcatcc acaagtttt atgcat ct cz tatacctcagc cttacttgtg tatagatnag ttatctgaa:, gaagagtcoca aaatzczgca 1:acc-aataz gctgaggaaa aaacagaaczctt~a-::.3z ga aaaatg gatz:t:tag: aatgtr::cct atggaactag at cag ac aztac~at-,g taaa:t:ctg cagg-z=:caa ggggtgac:z 99 tc a cc tccaacagaa tatcaaaz: taCztggaa ra0 120 180 240 300 360 420 act ccaaccc ctczttaaga ttt:gtoga ccctggaaaa t taaacggaa attqcaaagc zctcagatatc t -anctgta-t agtZcQaattc cttqgaaat aaaaattgga gtttnaaaga aataaacccc rttgttaaat gaagcttacgc aaaanaatca tccgcaggg ctcacttt aaaaanqgaa tt~tcaagccr anttgttaar taaatgggga aaat-gncgaQ naaaaattat ccgttagggt: aactta 480 540 600 660 676 <210> 67 <211> 620 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (620) n A,T,C or G <400> 67 caccza::aaa gaatzgzag acatzccatt ztaggagaaaaa agaz tot agt cccaaao aga cactc::gaa ctaaaaaaaa t c- tat tzcatgqqgc cccon::-Z~ gc:goC!tacc cagczgatag taazgaagqq aaa:ccgatc gc:Ozggg ggaaatcata cgz tcgtt aqgaa at ca aanttatgqg ccczztaaaac aaaaztzt :gga aagaacz::cc aagagcc:::-, gtzacatctg agaacgcat c ttt:atztccg: ggtzaat--aa ttttat tt-t atcctaat t act::tt-raaq tgttgaang ccagcat:: tE c a q t a a c :acgaagct aaactcacac tg-zgcagaac acatc.grtaac acztt tgtzotg cagtgcccac ca c g c-acttcccacc gact:cctrq atacagata actaagaaag gtgccccc~c tcgcaagctg cc--aggaac: atttac:'trg taaaagt tat tc': -z ttgataac: tczgctaa: acicaagacca tact acaaac agzcactaaa aagtttaa-i ggggaaaana ccctaaaaag caaatt a:: ggqaaaaz:c 240 3 00 480 54 0 600 6 <210> <211> <212> <213 <220> <221> <222> <223> 68

DNA

Homo saoien misc feature 1) (551) n A, T,,C or G <400> 68 actagtagct ctaatoctag ttagaacaga gtattcauggt tctgagactg act caccacc tacagc--gat ttaaazctaa cc!tatgrzgct nannnannna qgtacataat accagtat!'t cctctctgtg tgcaatgac-.

tggtgaaactactgatat ggaactcaat tztcatttac cactgaggag aagggctaat caataacttg cccaagggcc ccttccaagg tcaacaagcc ttgaaccttc ctagcattgg nflatcttaat ct att- tctta ctcacac--tc tggccactgg aaaagagt-ta ctgagggggt: -a ct tc a agc c aaaactt-tgt atct: gg-: cc ttaaaccnca acatgcttt ct tagctgta aaatccctag aaggcacgac cagtangtgc caattataaa tagtttatcc tgtngcatat att tt:gcna:atagaccatg agagtctggc: gccggcatt t gggat tt-t tctgggaggg attgttat:zt tat tatattg t CnCCnnnn.

<210> 69 <211> 396 <212> DINA Hrrc saoi-en <220> <221> <222> <223> misc feature .(396) n A,T,C or G <400> 69 cagaaatgga aagcagagtt gcagagtctt cattaaatcc gtatgtggqa tattgaatgt aat.aagcaa atgttaaaag tgtgatacat tttttaagct ggggagccan aaaccaatct aaaaataaat aaaaactatt ttcat-,tccg ttttaccttt taaaaiggata t tttatat-gc tcagttgctt acnatctctt nagaaacttoe tttataaacg tttttttctt tttttttcta -:ttatitaatg gtct tctggt tttgttegcc aaaaaa tctccaaaca ggtaatcccc Ltatctttat ttttcaaaag actttctgttaggacatoca aaaatagaaa tcaaacaaca at tgt acaa gtatnacaca atgggctzz ataaaat:ta 120 180 240 300 360 396 <210> <211> 536 <212> DNA <213> Homo saoien <220> <221> <222> <2'23> misc-feature .(536) n A.T.C or G <400> act agzqcaa Cz: zoaaaqa ggcgtocacag ccactacccc aacagatatt tctgtgactg tcatgtczgt ct:atagtcca aactgtataa aaacaaatat cccctcgtaaa gctggaagag gtt?-tctctt t-ttgtttctc cttgctgact qacctcatt t gctcttatca gaataaaaoit aaacatcgaa agagcccaac caaatgczgc C-ttgctgcaa at ott aact a ttatcacaat ttaaatgnta acattnaaac tagaatttaa aacogcgtt-c agtgaaaat-g tgagcat,-ct aataaaccac :-ccaagccac tttct tcaaa c:tgcrcaoc c=arrigcaat caat taaaaa rcacgct-agcagatatcaa cct-gt:ccc:_ tctgtccat: -I-ttaz caaaaaaatg tcaactgca: cattcaaa: aaaaaaaaaa z:gaagat-atc z-agtggagga cagttqccat tt':taac::c-ra tgttcti-zca tiacagaaaaa ttcagc-zt t ctattczgca aaaaaa <210> 71 <211> 865 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (865) <223> n =A,T,C or G <400> 71 gacaaagcgt teggegaega cccaccaaca accagcgccc ggettaatct nacctctntc ccncaccaag aganaanctg gaaactggtg accaauctgc -ageg~czgga teatganqcca gaagat-ggen aracconcgac ac:ccgctcg aangaa.-ranagaggcag cccaccaacc gcctgnccca cgccaacac egaat tctina gaco-atggac nngazcagqc tgannggc gaeanactrnc ccacogcccg ttZcccacctc caaccgc-ccc gaggaanaag rlctacnoocn zongcz-ncca toe nn aaa o c ccaggcacga gacgacgaag aagtgaa agccctogca cn-aggggccc rlcaatncana ncccacc tggccncctt act -cc a: 0 gccggaaagg agcacganag cgcgc--naga cgggac:gcg -ctetgaact: Cnaacgnaan Eflcaacatng acaanctctc cacgccaagn ganggttc ccncccatnt ttngttgncc aagggtgntt ggat tanang ccnaanaaac aantataaaa cflccttgcgt cnagccgaac cngc=ccccc ggccccctcc c-tgggaactq tgggcncct 9ggg99cccc accatggtnc t Onnact t ri cgncggaacn ctccc naaggggcaa cacnggtggn tccflcggnng ctnnttczcir CCcgggg-cic cgtttcccog ancccrinaat accaactatt accccc~ ztt ntgnatgttt nat cnantng ttantaacqq atocccagaa aactaaaccci gtccoc:-a= tcnf~ c---n cacccgggan 540 600 6560 720 780 840 8 6 <210> 72 <211> 560 <212> DNA <213> Homo saoien <220> <221> <222> <223> misc feature .(560) n A,T,C or G <400> 72 -cctggacttg aaaagacagt cc-atgcccaa tcnaantgct cagc-actgga go acc ac a aa ngcctgtnaa cctgaaa gga actca!tict t tttcc-ntttc tctzgattzcgtccagtgcr o ttC:czggc gggggzgaat gatcnaacag gat :aactctc aaccr:ggtga gaaagcc ccc gaaccccgaa cccaaaaaaa agaacctgac ccngcctcg aactggaaaa gtgatgctna gagggagaca nnngt tgggg aatgggaqaa anaact cccg cgggcggga c ga cc cagogga agrcctac-gag :car-ccgatcc ngaana t gc czttctacat: agganz: t ,ga 7:ganaa--aaa gaccnaaaaa a a n cc7t r-r- t coacgacgrc gaccgcctcc ggaaaaccc tgtggczgca Caaaacc~cc ag an ca aact atggtctgtg aCtgacccric tntczgccncc ZCott acz cOcgccgCfca gangaact-ac gogtccaaac ac--accgocc gtggatiazaa -4n,7an a aa:l cnatrigaga naancgg:::z 24;0 360 420 560 <210> 73 <211> 37) <212> DNA <213> <220> <221> <222> <223> Homo saoien misc feature .(379) n or G <400> 73 ctggggancc ggcggtnngc aaccgcncaa naaacatgcc gnanngaoga acanaacaaa ttggccacrin gtggaattaa ataagngacc ctttattca tnccacgtan agntggaant ttg7czcaaaa aaaaaataa nccatntcnn niaagatatgg ctc nangagc gaaatctggc tctqtattta anttgttgtcgncgcgaagg acgaggaaqa tctcaagcta aaanngt ann aacctc.tcnl t ggact a t tggcaataaa tflgngcttolc atgccgcggg tgttcccctgE tCCCtgnca gzncattzta aanccnciga nngnacaanc gaaggggccc acctnangag taacttct::i gannaaac:: <210> 74 <211> 437 <212> DNA <213> Homo sapien <220> <221> misc-feature <222> (437) <223> n A,T,C or G <400> 74 actagttcag actgccacgc ctaggcgttt ccatctatgc acaaaaaaac gctgccaggt cacc-agggtt Ctc!ttgaaat aaccactgaa tzgzcaggct gaataagtta caaccagtat gtcattgta ctgtctgaaa aaaaaaaaaa aaaaaaa caaccccaa tcaacctgt Ettanaagca agtaccacat tgattgata tcatctcctt aatat t ctt aaatacccca ccatctacca gcitc Ctggt c gtaaaaggga attgtagaaa gtttgtc ctataaaatz catgccagaa ggcct cgcga caaaaccat c att :ggctt taagtagcct actcttt c: aaactaacct aagtgaagtc taaaaacaaa aggat cctgc cacttcatct tCtgttgtgg ct: ctnattgt gCCttaaaaa 120 180 240 300 360 420 437 <210> 757 <211> 579 <212> DNA <213> Homoc sapien <220> <221> <222> <223> misc-feature 1 (5-79) n=A,T,c or G <400> ctcc-atcgcc oac-Ccagcac cctgtgtt!t caaggcgcac tgaaaacaag gacctarttc cctccgtcta cc,-tggggtg gatacatttt gccaagacga atcaccgacc aaaccgtgt gtcagcgacg cctgacct tgac-crgac ccaga gcgtg gaacgggcan c :Zcttcca naaaatcctt C gtgcgggoc aggcgaggc cattcaagag ag-gac: tcgt C at c"aact a Ctggacaag cacttgtgat gatctgcacc acaggtgatc aaaaaaaaaa c-cagcztgaa ccaggtggtc acacc tgcga ccagaccaac 9cc-ctcagc cctaaaataa gcr-tc tcac :tnat:Eact:r aaaaaaaaa acgcagccgg aajaaagaaa gcggggaca a gtgttccaaz aaagccaac cagaagactg gcttcatctc ttctcctccct ccagaatatt ccaccgccga acaagaagric actactrcat C"tctccctca atgatgagc:acaaagtcat cgggct:gtgc aaat::cac tt-ccaaacna 120 180 240 300 360 420 480 540 579 <210> 76 <211> 666 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (666) <223> n A,T,C or G <400> 76 gttt.atccta tc:z:ccaac tccc:9trtc tCcacagtg ttga:gttqt tarigggcagg ttcctagcta ctccatgT:tg ctzac::acag ggac-caggga cagczt-ctcc aacaataaaa taaaaaatat acag::t-acccaaccagtga acaa-zctttt cagatclgtca Cctaataata atggcaacca gctagcctcc.

tgatgcaaca agcacgcggc aaaaat cat a =:-accatac g9ctczttgag :zgtggaac: gaccattotc ggtaacct ct :-cttgtczaaaacactztg :zatct~aca aaaaatzcc7ggcaagagcc aggttttaac tcagaqcaqq tact tatCa!: tttatgacaq cggauatz-c7 atgaaaagga czzcaaar acagtatat:aatzt:t:-:aa lactgcc:c .cttcaggaca gacgtzc:gc:ggac:cv::zz 7- .ttCatagc gaaaanocac: ttctcaataa fcctcactt:c cttaanatct: tacaagatag ccccganatc ttatcgaaac tcattttagg caaatacgan tttzattgtn cgttactitgt ttcaaaattt ggtattgtga atatcaat- a ccacccccat- ctcccatgaa anaaanggga aanggtgaan tCntaarncg ctt aaa <210> 77 <211> 396 <212> DNA <213> Homo sanien <220> <221> misc feature <222> 1) (396) <223> n =A,7,C or 540 600 660 666 <400> 77 ctgcagcccg ggggatccac atcaczzgczc aaaaqtigcac cacariga nza tgccanaar-a tggtccaga cataacangc at:aaazgag aaggagact gaaat7zt:t aaacctcc.ga aacact tcta atgggaacaa taatctacca ztctggtc: aat:zccact-z actgcctccz c!tcagcct-tc at tzatacac aaaaaaaaaa ngctat ttq =tgggat tItgaaaat t:acctgcgag aaCrttaa Bt:ttaaaat:aaaaaa gcagctaatt ggcct tggaa cancczntg gaatgcaaaa attccggtc tcaagtgt-ac ctanattzag aggtazcaza gggctc:::r taaagca tag tgtgactz: c cttaaaacaa <210> 78 <211> 793 <22-2> IDNA <213> HLomo sarien <220O> <221> misc feature <2122> (793) <223> n or G <400> 78 gcazcctagc gaaaaztcca taccacagtc gacccrctcc atataaatcc acacagt cna gcagtttgtc ccaotatgtc ggaagatatt atgaaaaagc tctzcggct gacacctgat ctggz:tcaat aazaatntct cgccgactca gtgccagcat aaacctggag agaggttggg aagacaagca gctttaaaga ctcctcaatc ccaggattat cnaaccatct tctcaagttg tgaaaattga taggtttrgg tntictttctn ggC cacaaagcag gtgggtgagg tCttgctcc-t ccaaaaaaga gtgaccaact acaaaccct aagtgtttgc tggtttatga gtttgttgac ctatgcttac c tna a aat ga a a ccaga aa a ttatgttcac aaacaatnta tgtggccctc ca ca aagga c catctggact gatgattatt tgaaaataaa aacaactgac ccatctctga aaactgcaga attgtaagaa atgtgaaaaa cact atT t t: 'ttcaInt aaatccagag ttgccatqga tcctacaczc tggccaoraga tctcgaccca aactgcccca cagacatatg aagaagc!tct catcac-.tgg atgagtgccc gaaatccaga aattggcaga aaacaccttt ctcctgatgg cagttgaagc cqatatcz tg tacgctc-.gt tgcttgacac aaaaaatcrc cagcct::c!-g tggccat--qz ggaacana!ri aanaaaanan ntt:ttaaaat: gnganczgat ttctaaaaaa 120 180 240 300 360 420 480 540 600 660 780 <210> 79 <211> 456 <212> DNA <213> Homo sapier, <220> <221> misc-feature <222> (456) <223> n A,T,C or G <400> 79 actactatgg ggcgggaggc ctcczt ggag agggactggc gcagczgttg agcacaccta ccct-ccgac cocangacca tgcctctgat cgcangaar: ggggc:ggaa acgggtgrc tgcaagaccg agac~gaggg aanrncccc: gtqacnctca cccacccttc agagctgang a cc act ggt-c ggctact tct gangantgtc gcgtgtgtgz aaancacgtc naaaaaaaaa tcccctaggc ccacctgggg atgcccccac ccccrccct ccgcczttgtg gtgtgtgtgt tgcrlgggtgrc aaaaaa gctcgttctg ctggggatcc ccctgctctc tgcctccctc gctganaatg gtgtgtgtgt gaccatgtc ctccaaagag cactcczcct z cgcacccgc:ctgococtcc ga c atggc a gcnccccc:c cctczccaca 120' 180 240 300 360 42 0 456 <210> <211> 212 <21-.3> <220> <221> <222> <223> 284

DNA

Homno sapien miscfeature (284) n A,T,C or G <400> Cttzc:-a ccZ ctagaaaaga taggtattat taaaaccaaa agtaatgc~c actctagcaa gaatagcatg acc--ocgtac aaacaggaca aataaacaaa tgrgzatata- c gtaacttzgc aaatctattt cttactatga aaaaaaaaaa gtrcatgaaac c-acat aczaa ag ca aat tg atgtr tatgt aaaaaaaaaa tc:gagtt-taa at ctaa aat tggaacc atacrgacaa tgatgtgtcg attaaaaaaa ggaatacaga ttggqaaat a a anra <210> B1 <211> 671 <212> DNA <213> Hcrno sapien <220> <221> misc feature <222> (671) <223> n =A,T,C or G <400> 81 gccaccaaca agcaagcggt gaaaQactgg taczaaaaca tcaaaat ggc ttt :aacgcc attgat tag tgtoacaaag acat:-aagct canaaaggcraaaaaaaaaa ttccaagcta gtgcacacgg ggazatttgg taga atggtg tzc:actgcc gtcattttca tcr::attttt tcaaazaaac ttgaccaaaa qgc:nacaaz ccctgggtac agactcatcg gttggcttlgg ttgaatatcg cctttctgag tgcgtaatga gttagatnat ttatttttac ccccnaggac aatgttqca:gc-99t99tcr ctttgtgcag ttataattra tgat :-agggacata UgtCtaaoac agtrttcgatt rcrtgcacttt aggct tatca aacacacagt: gtgtt C t-aco aaataat::aa tagaagctag ctatctgcca ttgctzgttc agtatataca ttcgacaccoc catttttaao gagattaaaa gtcztcactg-.

atggqatcac cogact!tao'c cnantaacca tgagcatgtci agagtagaaa gtttgt::z= tgt tatzc= tggtaaaccz tggctg--cat at at tot: aaaccaazta.

aaaaaaas-..

12 0 180 240 300 360 420 480 542 6 6 1 <210> 82 <211> 217 <212> DNA <213> <220> <221> <222> <223> Homo sapien misc feature .(217) n A..T,C or G <400> 82 ctgcagatgt ttcrtgaatg agacaacaag tggtozgtgta tctuattagg gagttgtatg aaattc-ttta aaaggaaaaa ctttgtcaaa zzaanaaagt taaagtgcaa t:aatgttca tc:zlqtttct aataaqacaa actttttgt cztcgcttrta tcagtgtata aaacataczg tgtgcztataa caacctaat aaaaaaaaaa aaaaaaa 120 180 217 <210O> 83 <211> 460 <212> DNA <213> Homo sapien <220> <221> <222> <223> misc feature .(460) n or G <400> 83 cgcgagtggg aatggcagac aacggagacg gagtgaaatt cgcgatgzgg cc gggcacc gactgccaaa annataaaac aqcaccaqga aaaccagaca caggagaaga tcc: aagac aggaagagcc cgcgccoatg ttCccggtc aca-cccgtg tctCgggczc tgggggaaac.

acaccctgcc ctggaggatt acccqcaaga ccaccggcct tgccccggga gcancaaana ggaacgaaac cgccagcttc gaccaaagag tcctaccccc zggacacgag gt gggt ct C cattatacaa aaaaaaaaaa tgcacggatz gatnaggcca accat tcaoc gcot cc tca ccacaagc~g gaagggaccc nattatttgt gtzt--:-aagaa agccciaanaa angagaagcg acacc-ccagr cac:argaac -cccccaatcg atgaataatg 120 180 300 360 420 4 <210> <211> <212> <213> <220> <221> <222> <223> 84 323

DNA

Homo sapien misc feature .(323) n A,T,C or G <400> 84 tgqtggacct cggctctgtg gtggtccaan gcaztttgct aactgaagtt tacccganat Qtccctgcgc aacaacnaac cnancatc:c tctagctgac atcztcczgca naaaaaaaaa gagctgctgg ggcttaacgg aacaatctt:: aacccggg cuatcat at c aaa gacgggatct aaaagactat gt cccqgaac aaaggacacc :gggcagaga tgccta'cttc aaataccggc catgaacnrta gtcccagacr: actacanatc t ctC 79aag:: C acc:ccotcaa aacaaacncc c-tgt :tcaat: ataacaattg <210> <211> <212> <213> <220> <221> <222> <223> 771

DNA

Homo sapien Misc feature (771) n A, T, C or G <400> aaactgggta aanagut tac gaaccaaaca attm~ gggct cacacaaaga gtgcgtctcc atr-ggacata atgganggt:accaciactac gttatttata tcgczricant gccacaagct ttgc!:tttn ctcaacactg tcttggctgc act tcgactg tcacacagca aaaagttgtc tcactaaaaa gc-caagaac taqtactczat at catanttt gctntaggtt gcaanttaaa ttllttaaaa aritagaaaaragcagatctg tttgatgtca ctgtcCtgga gctg~gccaat tgtgtacgca ait caagaac agaaagaact ctzatttgtg gct Ctgtta tCCctgtgttz aatzatat LU aaccantaca tcnctagaac ttc-tttgagc gtgCtgctac rtacacagacc gaaggctgtg aatccaaaac atgtaaaaac :gctggggz: Z=tcctggac acatcacatt aactt tc Cat ggggggggaa nccnngt taa rnattCtgaaaa taaaaaccat tccacc:c-tg gtatcC:zca acat caatgc agacttlgggt tgtggctt: ggaggc::-ca .tgcccaat naaattaaac acnaan:t tc taaatatzgg atggtrlagtc aaaaaaaaaa atgctgtacc cggCgaatca tccaaart:tat cat ct C C gaaatatazz cragaataaa cttacaca: 2 natgaag-:: a tgtat ttat ctaaac a t: antttctgca ccnaatggtt a 120 2.80 240 300 36C 420 4 540 600 720 771 <210> 86 <211> 628 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (628) <223> n T,C or G <400> 86 ac!:agtttgc tacatCt cttgcgttag gtaagaatgg aCtatcttaa agctgaagcc agttcataca Ctcaaaacat gtggagaang aaatagatta aatctggggt tgaaattttc gaaatattaa tgCCtacctt ttZcctflggg gacggggaat tccttt,,cnca gtttctiggct cac-ntctgc tttattccca ccaaggaatt naatggnttc Cgaaaagtat aatttCattCaa aaaatatgct ctgaactgta atgtcnaagt tagttttcat tcaatgtgtg ggattattgg cctaccctac ttaatnaant fltcfttgt tat ttttgtc gtgaatcagt tcaaaagaaa gtttctatag atgattggC9 tctgtacatc gtatcagctg aaaatggaaa tgatttancc rttgatgaac caagtlgct ta gtgacccttc angactttat caagccaatt gagggagcaa tttagttnga gactcantiaa gaaaaaagta agaataagaa a aatctCgctt tcaaczaaac ttgtcataag tgttcattgt acatccataa ggttgaagat catcagatCC cacccctttc cttaaagcct aacattttat CC at gcnnac <210> <211> <212> <213> <22!> 87 518

DNA

Hcmo sauien misc feature <222> il-.(518) <223> ni AT,C or G <400> 87 tataacaaca agt agtacag tttteatgg aaacacat!,t ctacagt t-ta ggtcaaaatg naacttaac C aaaancgag -ttr-agaga z Lazactgzt tr!taaaatt caaatecaatt aact-tcaatc acaatgcagc r r'-,nryn Cceatgccat CCCCCgttg gt aot tagc tatggtttaa ttatgcttaa ttcaagccat tCctcttat aaaat cca cctnaatacc aagcagaagc a a aaage aa a zt- atttat cacatatggt aacaagtttt: cctaaaaatt acaacct tta -ct eacggt a o~iztgaacttacaagtttag agggaccc aaatttattzg tcaaaatgta gtgcaaaaaa gatttttzt ttactatage aattgggttt caaatgaagg ctgcattttg cetgtt~Lz=tgcagatcaa tgaaactttaa at-ggtttCoa taagcqgcaa ttat-ggt:it ct ct aaaczz 120 180 240 300 360 420 480 518 <210> 88 <211> 1844 <212> DNA <213> HomeT~ saoien <400> 96 aagacagtoa. accz:agtac C atz tatz gctatt ge: c: ccate-t tc acecr ta tgtg gaaacagaaa taatzcccoEt[ tctcagt aae tagatgt age ttgtaggaat acatagggca taatttt!oaa eet taczt ct taataatgtt aatgcagetc gcacocctacc tccactat tc aecatattea getttcacc-.

ggtgetcete agtgcageag eeatcttagg attgctctte eatgcageta at-tgaaagtt ccaaztttaco tagtaataaa aaaazcaatc t t acacaaaa Zt-tQaaeca aaatrtataa ta:-:::ga aaagca:::: t?--a:getzg tcgaatttg ta-C at agaa gaa gggatctagazco-tgtg ataeauatga aeaaaaeatg azgtgaac gtcaaaaagg aaazzaaacg acc::ageaa :zcgagtcat tc -aCCtget tl etitaetgtat aaacctaaat agaagggtat eczez -ctggt c-gtgette gggagaagct etgccgetgt ae::gtgc: eaaaggtgt a g7 gaaatggg g~zr:atataa tttzaggatga eZ:=tttaa C a:=z3 c aa ataaaagctg eaaaggatz C gaetccgtz~ gage-gct-.g gaagccatat: taeate: ata carCtZ aagaa atceaaagaa ttagtetttg tgtataatga geett:: Ct a atgtattaca gatatggaaa etacagecac aggtttagat ttctggtca: act gac at ~to ataaaatac3 -t ttt tge ggtcctgaag acctgaeta eacagatgag agatcctzgtg eet t c ttc etgcttatge tcagatcc aattttgctg gagagaaat: ettaaaaazz gcataaaat:aeeataaaca aaaaaaaaaa ::zggccr-ag caaaaaaaaa gaaaaaggga at rt t t :--Cacatat agt: tagzat aat at :C ae =aaatagetc O-gzgta: tat C-aaecaaaac agcagcattc gggaati acg -caagcmt tg gtatEaettce tocaagatatti :m:Cagctga gagt-ttzata agatggaatg gaaagaggtc ccagaagt ca ggtgetgetg cageagectg tcaaegggge atgagggtta zcaaagcatt Cat tgttaaa gaaattaaat zzatttgecat Ct-aaaaetat oc taaat cftc aaaaaaaaaa aaaaagttgt aaaaaaaaaa agT:agttgca tactcaagc: Cctcacaata aaataatat:ac:gagCt:CC atrtttaaa gtt-aacaatg gggceaatga cagaaaagta agtaaecc--t aggataataa atgcatgce-a cacccttt:g tcacaagat7 C tCC teet c eaaagtaatc ectaaatatc ggtgecagag eaacaagget gtaagtcctg tcgetetaca aattaaeaac ttaacct-gc czgtagtgga gtgtttttaa gtaaaatgza acziact teat gtzataataa aaaa tqattat:::agaatcacaa gtagag-:: aagggg"taa agagaatzztgtgtat: r t=zcacacg tgtcaa: gag tc!:cgar-: cetagaataac gttggtgaaa at tz t C aag age:tcgacag Cmatgat aq! oemataegaaa attatcaccc ttegttt::-c aagtgttmgt ceeeaeomg cagetggaga ttcaatatc aggaggt Ccc gt etagacca cataac=c'egcttaaaac aaccatgcta atttcaaaaa tctgca:i gtattacaca aacaggcaao- 120 180 240 300 360 4 480 540 600 660 720 780 84C 900 360 1020 1080 1140 1200 1260 1320 1380 1440 1500 1563 1620 1680 740 1-144 <210> <212> D-NA: <213> Homo sapien <220> <221> <222> <2 23> misc feature .(523) n C or G <400> 89 gggataaaaa tgactgttag acaatatgat graqaaaatg tcaccttgtc tttccacatc ctccccactg cagatcccct gccctggcat gacttgaacc actttgatna gaaaacacat ggtgctcaag aaaagtttgc taattgaatg gtggct.caat caat ccacat tcactcacaa ctaagccaga cftacccttc gggattttgc caaccacaga agggaattga agaata-gata aagaatgacti :ctattgatca :-aaggaagaa gatacagaaa 5caqgcct tc c:agagctaa czgggaaag agagaa ant c aatgaaggat rlcnttgaatg ct-attatgt aactagcaaa qgtcctattg cctccagct t acgagganat gagcctttcq cccaaatgc caagggaatt acoc accaggcacot taagacgat C ggtccttctg Cctacccccg 9ggccccc tg anagtggacto cacccgtgcr aatanatcaaa 120 180 240 300 360 420 480 523 <210> <211> <212> <213> 604

DNA

Homo sapien <220> <221> misc feature <~222> (604) <223> n A,T,C or G <400> ccagtatggt gcaaaggaaa ctcacccacc gggagcc-tz ctctttcctc ctggaatgca cactgcat tg aggggtggta accactaatg ccctaattgc cccc ggaatgcaaa tagccaatat aactaaatcc aagggcatgt tctgatcctt attgtttgca gtgataggac cacctgtttg gggagggcag tgaaattccc gattacccca ctgtcgttt caaagtcaaa agaaaatcag ttr-ctcltta acaccciaa gg acggtcaattz: gtaaaatgag attattactg ctnggcaggc gaagctt tcg iatgaaatga agottoagc zctgtcagat cggcacaaca atttcctgcg gattcacat:i aagcctcgga cggatttctcc t-ccagttttc agaagctggg agccagaccg ag tt t at c t aggcctctgc ttcatgtttg gtcgcctcct t-aacttgcta aacttggaag tggggtgaat zcaactgcat attccct'ca agatgtcaazc agagaaccag accacacagc acagaacatg cagtaggaag gttagtgat a cttctctcct taattctcaag tgcaaaazt 120 180 240 300 360 420 480 540 600 <210> 91 <211> 858 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (858) <223> n T, C or G <400> 91 tggcagagtz tctgatg--cz: aataaacat: :9tt*:-:gatc agataagtzg aaaaaazzar caztrtcctta ttcaagccat g-Ctitctcz ca::ctqa 7:cctaat-ga acacacanaa ataaacgtct ttaaataagc agaacctcct: atcccccgg gc:-Ccgcacc tacaacgtcg cccczctcgc cgcagcctga tognagntcc ttcccttcct cc:z:anggg ggaaggtccc aaaacagcac ttggctaaaa gzataatctc ctgcaggaac caat t ogocc Egactgggaa cagct ggcgt arggcgaato cccacgtgac ttctcgcacc tncnaattaa caaagggg ctcgactt::t tgggacatcga accagagat tcgatatcaa tatagcciagt aaccct9Co aatagcg-aan ggacgcgc c cgncacact: C.

gttogoogg nggnt tacng gt ctataaca gtggaggrtag :-caacgaatt gct- t:at gat cgrc atztacgc tt-acccaact agcccgcacc t-gtagcggcg ggcagcgcct tr:tc cccgnn gaccrtngan ggac:aagtt tcacacttca ccaccacac C accgt zgacc gcgctcact g taatcacctt: gatcgccctc cat taaagrcg taccccggt: agctnttaat cccaaaaac: cactgcgatc gcgaagaaag ggact agrgg C cgaggagggg gccgccgtCC gcaacacatzflcaacagttg cggcnaagtg nttcgctttc cgggggncc ttgat-caggg 240 300 360 420 4a80 540 600 660 720 780 840 858 ':210> 92 ':211> 585 <212> DNA <213> Homo sapien <220> <221> misc--feature <222> (585) <223> n A,T,C- or G 92 gtzqaatCtC :ccac'ccatq tagaccgagaa ataL-:cac-aga gaacaaatgz aaaaaataat cca-gcttttg ctgt:_:cctg gcnrinangtg tgcgczccac czgg-gagat: t-=--atc-tta tcgaggtgct aaaccatggc ttattaagca aatcatnann ttcc::ttta~g tgcgaaattg taaaagcctg ttgcccgcc C tatacaggag gccaagc- a grtttagaca ttgaataagg tcaqaaactc naaanannan tgagggrzcaa ttatccggct ggggtgqccta utccantz-cg :uLaagatca aaacaacaazt Cgccaacact nngaagggcg ttgcgcgctt cacaatt ccn at Cgagtgag ggaaacctgt ttcoctgaaa cagcgaac-: tatgttcaac tttttccac:gaggatgt-aa gccgccaccg ggCgt, taat:: cncaacatac ccnactcaca tcgnc tatgact acc tagga::aga tacctoatzca agaucaataa cggtaagc:gagccaagaa Ctaacrtangt 180 24-0 'Z0 0 360 420 480 540 58S <210> <211> <212> ':213> <220> <221> <:222> <223> 93 567

DNA

Homo sapien misc feature (567) n A,T,C or G <400> 93 cggcagtgtt gctgtctgcg agact:gcggc tggcgtgggc ttccctgtac ccaccttccc ccagt-ticct tgrgtgatac attaaattgc tantgtttct ccric'gngga aacrnccccct gt -aanccnt gggccaaanc =--cnncc tc caaaccc ngnaa7-znaa ccnaaccc-c tgtccacc.tt anggaaggga cttgc"Crtcat actaatgC-at t tgaannnnn t t tg9tt -c c: tngttncccg ggaaancczn nzt taaatC.no ggaatctggc accgggggct 9t c t gtanag tCtgctttttt flffllfllfnnfln t z aat tgaaa :gnt-gaaat: z anr.,tg9t t-n a n- ClCncfl tgaactggc:gctgtgaaag gaaccttgtg tgggaaacan nrlnnnnnag ggt:aatzng gttnatccc: an-CzCqggg ccacnnocc gggagoacca atct--ggaac ccggcCaaqC anaaaaatca qgggnOC~CCz ccncntcqc t occacat cc: gtC C ca an cncC.zcca 120 180 240 300 363 420 5" 0 nttcggggaa aaccctntcc gtgccca <210> 94 <211> 620 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (620) <223> n A, T, C or G 567 <400> 94 act agtcaaa catgtttatc gccaatattt gtgaaact ta gttcttgtta ataaggtnaa ttoocaagcc!tgagaatttct atgtctctaa ttt:c-ccttaa agqg:aagg aatgctaaaa ttttattatg ccZ:atact acactttata tto-ccaaata aaaootgttaa tcqaactact cat:aatatc gaaagtacta gtcgtgaaant gtotggga taatttggga ttttgtgaag atccataaca aggtaaaaat gaatggaczz tgaccaaaca taaggaaaac ctgaatc-ato :tccatggcc attcaaaatg gaaaatattt.

ttgtgtcttr zttatactac gaggooitcca ggtctgtt-aa 0 tctaaaaga aaaatcattc c-at ttcact a caaacctggt aaatttt cc tttaagtagt tcactaatca ato tgtaana anatttaaca gggctaagga aatgcaaaaa coo aaatgca aggctcatartgccacanoor ctttttaaaa gttatagtt: cctataco at flaatatgcac atczaatcaa gaagagaao aaaaaot:tat tnactccga:: gggt aaaagc at'cctttarla 120 180 240 300 360 420 480 540 600 620 <210> <211> 473 <212> DNA <213> Homo sapien <220> <221> misc_ feature <222> (470) <223> n T, C or G <400> ctcgacctt-c nactttntgc gaaacatgag agcaggtgaa.

agccatgcca ccaaggt ccc gagccaggat ccaagggcct: tctgcacagc ttaattcang titottaccag acaacccatc ct caaaggt: tgagccaggg go accaaggt gngccaggca ggatgaaccc agct tacang cagaagcaga cagcctccac ccacaacctg ctgtaccaan ccctgancca gcatcaangt tgagcagctg attcttcaaa cctttacccc ctnaggaaat naaacacaaa.

gtccctgagc ggo tgoccaa ccctgaccaa aagaccagaa gagtgngtcc accacctcag atttgttccc flattccagag caggttgtac ggtccctgag ggcttatcaa aagccactato agcatcct:octtcaacagc acaaccaagg ccaggctgta caangtcccz ccaggctaca 120 180 240 300 360 420 470 <210> 96 <211> 660 <212> DNA <213> <220> <221 <222> <223> Homo sapien misc-feature (660) n A,T,C or G <400> 96 ttttr-tttct gcattctctt tgaagacttt gct tzatagt cgtacr gatt cagcatctgg cttctgctga gcctgncaca aaacttgatg ancctgggct gcnnagggac tcattcgaat ctgcttaatt acgtattttt acaaggtcza nggttggctt gctgggcctgr ggaactttgg aagccztggt canggacct t cct tgggncc ggaat taaaa cttcaaczaga caggggctta aggatacaaa cagacaatta cccaagggct gagtgaccgt tgtatccztg caagqciacct tgnCricaacc aaccc-Igggc gcaac ttaat acccrgagca caggattctt zaagagagag agacacagaa t gtct gt gca t-gaaggacat ctcaagaact zgatgcttgc Etrgg ct c a a :-tnagggacc gagggcagag gccgaagacc cagagtgtgc actatggcrtc acagatggga ccaaat tac!t ggctct ggt a ttgatggcac tggctcaqg gggacccccg ct ttggntric caggaaacat agaaaagcca gtgaacaaaa ggggc gagaa agagggtgnc tctgcztggn Cctttgtgta ctggctcagg accttggngn gnacat cctg nancct-tcgc 120 180 240 300 360 420 480 540 600 660 <210> 97 <22.1> 441 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (441) <223> n A,T,C or G <400> 97 g~gaccataic anactatto-c cccagcagca gaaatcaqccc agc:gcca gcccacctj ccaaggtgcc tqagccctqc agrccatgcca cccc-aaggtg agcagaanac caagcagaag agatgctgaa tcccctatcc Ctgtctcccc caaaaaaaaa tct ct tcaca tgcatccczac caggaaccat caccccaaaa cctgagccct taatgtggtc cattctqtgt zcagga ccag 9catcc ccaa zgcctgagcc gccct t caat C a cagc cat g atoragt:ccca ,Cagcagcag aacc iaggag 7taccagccc agt cact oca ccctcgaga t tgcct:gc agcatgagt t caggtgaaac ccc tgccacc aaggttcccag gcaccaqccc gccggccacc aattagcatt 120 190 240 300 360 420 4aI <210> 98 <211> G00 <212> DNA <213> Homo sapien <220> <221> <222> <223> misc feature (600) n A,TC or G <400> 98 gtatt.cctct gcagccctgc tccacctcag gccctgccac caaggtgcct gcagaagtaa cctazcccat aaaagaatgt ggtcttaant tgaaaggcaa cttcacacca atcccaccc gaaccatgca cccaaagtgc gagccctgcc tgtggtcc.ac tctgtgtatg gctatgaagc acaganct ag atgatrccagc ggaccagcca ctcagcttca t ccccaaaac ctgagccctg cttcaatag:agccatgccc agtcccattt ttcttt-ct ttttcagctg tCCCtat -ac ctgttgcagc gcagcagcag caaggagccc cc-agcc-caag cactccagca t tgaggagcc gccttrgcaa[t acacactctg :t-cagaatc cccattEaaa: atgagtt ccc gtgaaacagc zgccacccca gt t ccagagc ccagcccagc cccaccana :-agcattctg agtctctgaa :ctgaagaaa :cnczt caa agcagcagaa cttgccagcc aggtgcctIga cataccaccc agaanaccaa tgctaaatcc tctcccccaa tgaagccaaa agatttaaaa Cttccaaaaaa <210> <211> <212> <213> <220> -21> <222> <223> 99 667

DNA

Homo sapien misc feature (667) n=A,T,C or G <400> 99 actagtgact accatttaaa ggtcctgacg tttctcttgt agtagaagat ttaaagtctt atlttttaag tggagattt t gtataaagat ctatttttta attacatttt cggaaaa aagttcctgg aaaatcagtg ttttgagatc gagagt tccc ttgttgaaga gtgagcacct gct-,ataattcr :-aagaot ttt atagtaaatg catztgaata gaaatcagtz caaagaaatt aaggat ttga caaagtggca tcatctgaaa catagaaccc gggaattagt -atctttzaa aaccagc:gc cat Ztcctag tnaatgttat c.attccatga tgaccrtggac gctacr-caat ggaggt ctgt tcacgt artct t-tataaagaa ataataacaa gaaaacatac tgcagat-aca agrtaatattcrttrttaaaca t-gcanattac cagt tgat aa tcaggacaaa gttgatcatgg gt ctcacaaa ttattaaccct.Cttnatatt cttggartt: ttactcaaaa act taacaca ctitgttatga tgg'gattaa ctcatgtttt gcattcgaac tgaac:9cgag tacaagcata ttataaacat: tttgat -zac tat gtrt qaa a cagatatagc ttggaaacta gtrac:zgg ttaagaaaga 120 180 240 303 360 -123 4 S3 540 60C)3 660 667 <210> 102 <211> 583 <212> LINA <213> Homo sapien <220> <221> misc feature <222> (583) <223> n A,T,C or G <400> 100 gttttgtttg ctttaaaaaa tgtttttctg ctctgaaaac tc-cctagca ctggctttct tgattttttt ctgctggttt ttt act ttta attctatnaa taagatgatc aaaatcactg aagatcaatt aagtttcttt tttatgattt 9gttggattt ccccaatatt aaaattctgt ct ta a agc at ttgaantttt acagtcatgt cctcattctt agacattttg tgtagtttta ttttttcata caggtaagat tgatttttta catattrcac ttggtnattt ggt act crnc tacactgatc atttcaagat aaaatgattt accaaaaaag caatgaaatt gtgtttaagg aaaatataca ttctagcctt ggantatctg catatttgga taaaggacat ga attt ct at aaagtgtttt tgcccttttt: aaaattgcta ccagagcttz catnggtgct ttagttata gttctannct tcc atatataacc acagactaga ccttaatgtt gtcactggat aaatcatgga tctcagtatt gcattat at caaatcatat aaaaaaant a <210> <211> <212> <213> <220> <221> <222> <223> 101 592

DNA

Homo saiuien mZisc feature (592) n A,T,C orG <400> 101 gtggagacgc acaaagagca gggaaacgca aggagcagga ggagtgaccg ggagtgggct gagctcgatt cacggaggca gat'tctgtaa tagtgaacat aaatgcatccg gaataaaact tgaatatttt tttttttgcc attttgtcca ttgatgtatt tztttgtaca taatgcnctt gtgncncnani ttagnggttg gcCgctcaag aaagaaaaaa agaaggggac ttgaaatttt atggaaagta gtctccccca aaggctaatc tat tt tgtaa anatataccaatttaatga acacctggga cggcgaactc cacctgtcctg cagcaganac ttagaaatat ttgctct-atg caattattat atgtatct tg atcaagt ttg atgcctaatt agaaaaagaa gCtctgcctg acacctccac Cctccaagga ttattgtctg aaactgcaca tatcacatc gtgctgctga ttgataaato ttat tatccc aggcaagccc gtzagactct aacgtcgcto catattocag taaata c qt t!tggtcattg accataattt atttctatat acncaatgaa aa 120 180 240 300 360 420 480 540 592 <210> <211> <212> <213> <220> <221> <222> <223> 102 587

DNA

HOMO sapien misc feature .(587) n A,T,C or G <400> 102 cgtcctaagc acttagacta Q-cttatgttc tctggaagaa gggctgtgca ftccggtcag ccaggcggat gcccctt,7:c cctcccacct tcaaanaatg ggcaaccttc caaaactcag gacactgccc attccctctc Zttcctttgaa aaagggcaaa ctztaccagg gcttcnntnt gcctCcactt accnggggcn catcagggaa agtggagacc ggcgggaagg ttaacac::ac aanaacc-ca gggCtgaagc agggcagc-c accgaaaaq taccaaaacnatgccccaaa gaa c acagqa c n-.agrcctt-gg gaaatgcacc ctggcctcct ugggcccagc anact-attag arlgtcacccn gcz:cctccta flcttctcnng aztaanaat ca catccc t c CC CtagggcgCtgcacgtg gcatcccc c cccttgccc:_ ggcaggggc: ggnctcttga n a aa a agaa a gatttttaartcccatc cccCatgcg ~c-ccgctg aac-zacagc g,:ccatgtt ggggaaccaa gract:gggt acccaacctg aaccagagaa tccccac-tng 120 180 240 300 360 420 430 540 587 <210> 103 <211> 496 <212>

DNA

<213> Homo sapien <220> <221> misc feature <222> (496) <223> n A,T,C or G <400> 103 anaggact gg ctgcanccct gcggtgggc accggcaga cccttaacat t-tgcctacag cgggctgacc gangczccc ggaaaagaaa ccctacntgc tggncactgc t ccaccacaa tggaccttan gatataatcc aatztcattc gcaaaaggc g tcccccttct caaaac tctctctcgc anatggaaac ccactccigac ccnacat acc acccatgcaa agtctacac~i CCc tacacac cctacctatc cztctcagzgt: tctgtggtcc cctcc gC ccc nznfgctactcg C CggcattC C 7ggcccccac carttggat: aatgcccaac- Cttgacatca ccgnanggcg ctccgctnac gcccagctac czctggcqa: CCtcaaccaatcagggtz:L ataggcagaac ~ccclacccnt gnt:C7:2ctg anaaagaatt Catctaccac agagtgtagc tgacncac~ca C-cnagggat C 120 240 300 360 420 48 0 4 C;6 <210> 104 <211> 575 <212> DNA <213> Homo sapien <220> <221> misc_feature <222> (575) <223> n A,T,C or G <400> 104 gcacctgctc tcaatccnnc ctatggangt ggtttcnggg ctqttcaact cflgtttgtgt ttctggtg gaagggcrgg gaagtcgcta ttgaaagtng Ztcrtna att tgggat:: ccnatgcngn aaacczcnac cccC--ccaaa aaaagncaan nlcccnaaaac aaaaanccc Cnaaaaccct- tntaaaaaac tctcaccatg atcctccgcc gcggctcttg ccaactggga Ctgggggatc aactnggggc tLaattggcct tgggaagcng ccfltggaagt ngntttggtg gtnaatggcg gccccctcc nnaacagcct gggcttccctcccctcaann tggaangttzg ccfltttcccn gnaanggggg cccccagggaa aaaaa tgcanaaacagaagccgtg tatggaaacg Cttatncraaa gggggttttg ctgggcaa7cacctcaaaa aaaaaac cc aaacaccncc cctctaOccaa gtgtctc- ac gctflaaczct ttggccznigg CtggtQoacc!aaaaaaa7oca aaagr-czc cgaact -gga CCCCcacz: a 120 180 240 300 480 540 575 <210> 10= <211> 619 <212>

DNA

<213> Homo saoien <220> <221> <222> <223> misc-feature (619) n A,T,C or G <400> 105 cactagtagg gcctaaccca tgcataaagc tcaatacaca tgcacacttg gacaacctac gacatttagt ~tccaaat-, aatgaagtcc CtE-aaaacat aagtggtggg <210 <211 <2 12:> <213> atagaaacac ggtl-aactgc caatgtagtc Ctcacgaact ctagactcan tttacttggc tagtgctttt tttgtacagt Ct gg t CCC ctactatatn gaaaaaaaa tgtgtcccga a agaa ga ggc cagtttctaa cctgatggaa aaaaaatact tgagtgaagg tatataccag Cgctgcacat atggcaactt gtt-nanatga gagtaaggag gggatacr-r gatcatgttc caat aacagg actctcataa aatgatattc gcatCgatCgc C atttgaaatc gatca-aaa aattccttt agaagctiact cagct ttcca caagctaact CCcaagcctg atgggtgga atatattcat gagtgacact atatattaag ggattcncct CCCCflcctc acgatzaa tgtaacccia gaatcccacz tggtatgarg gt attttCtggt ttattccatg Cttgtotarta act tccaaaa ctgtttca cgaaaaaana 120 180 240 300 360 420 480 540 600 619 106 506

DNA

Homo sapien <220> <221> <222> <223> misc feat-ure (1506) n A,T,C or ':400> 106 cattggtnct ttcatttgct ntggaagtgt flfatctctaa gccttaaacc angtanagat tatocaaacg gaarantning acancattgt ttccaaatgg atgtcccacc gacctgggta Ctgtunacat gttctggata gtatntcatrcagcncanct aaccccnatc flctcatnitcn aacziagtacc flcccgcatc~g tttgggaat ccattanatn cgctactatn nanangct gt nagtgagaca aatgtttaaa tgtaatgacn gaa aa a aaa aantt ng tgcccccngt antcaattng Ctaltfgtat t nact acgnaan agtranttaa ggCCtgtccc cagtggacaa tantatgata gtcagaggct aaatanggtc cattgtggtc ttcctagtga gtgtaagaaa aacacatctc agctcccnat ggttacttctg catatrtgtt tt:gggttat atagcacctc tggCtcanga tacagactgg ccttttccat 120 180 240 300 360 420 480 506 ':210> 107 <211> 452 ':212>

DNA

<213> Homo sapien <220> rvis-c feature <:222> (452) <:223> n =A ,T,C or G ':400> 107 qtzgagtctg tcZtztgaag ~t taaagacc ctaaggttta gtgqcariaaa tggaaaataa catczaaaaaa ccactEttaaa t a cz~aa aca (g cat: ga taat ctLcczattct caacaggagt ttgcatcacc Ctgtganaac tCccacnga accaaaaaat taagata~ct acaaaac:-c ggtgattzaa gtatcatt-tt ccagtttcccc agcaagaaga tccccttgga caataacc-a aaatgtz:tct: 9cat9tagaq aaaatataaa c:rt-tt t Lac gtccar-crcc zaagtctc.tc taaattCaac ttt-gt: ygt: gcttarr-ac a~tataagar: cggtaagant :ttagggacr: atggc:gctra ttt-gtaaaaa aaatgttcz ct -Cctctc: Ctggt:ttcct ttcactttgt acccatagaa gttgCttaaa 120 180 240 300 .360 420 452 ':210> <211> ':212> ':213> <:220> <:221> <:222> <:223> 109 502

DNA

Homo sapien miSc _feature .(502) n =A,T,C or G <400> 108 atcttcttcc caaaaagaqa ag~aCCncaac tanagcatat aaaatgtccc n a aa aa aagg ctccagaaca aaactccatt accctggnua cttaattagt tnttatttac ttgtagattg gcttctgg-t tgaagcttaa aaaatctatc aaaactttta acatntgcct tt-taacatnc aacatcccac gtagaaggga tttaaEgaaa aaaacttntc aantcttc:ca agncccactt tctaanggtc ct=z-9ccct ca fltattaaatt ccccaaaagc acatatataa aatgrtgtnc azagcgt tat actctgcctn gctaaccgca t~ctanagctt ttattgcacg ccataacaga tacc--:nga aattataaaa ttnaggggat ccatttctgc tttgaqczna actaancztcctaacaaa aagtaccaca agaacattaa ncaathlgaaa taccnngnaa t tanaaacgt ggccactcaa ttgacccct: 120 180 240 300 360 420 480 502 ':210> 109 <211!> 13C2 <212> DNA <213> Homo sapien <400> 109 accgaggtc tcgctaaaat tttgatcttt tcaaagagct ggcatcctga ctgcaactgg ttggaggagg tgtttcactc aaagaggtga ttgagaacac ataagcaaac tcactaatga acatacctct tccttcaaaa gaacctgttg attttgzaaa gaaagcaaaa caaatgaaaa accaagctgg tgctggtgaa aaagaaaata acgatgacac ctagggattc gatggcccctag ccagggcata agttacgatc aaaaccgact agrttcctttg tactgtca t tcatcaggc gacqatcgtt tcrattatgaa ctaaggaaga agagccat tc catacaaaaa agaagacaat tggaagaaag t agaggcggt actcaggaac tggcagtaac catccgcccc acaacgaaccgccatggcat a at zgt ccat t t catcatgga gaagaaaac: cat gg ccc t tgaaaaagac agaagcagt a ttatgaactc acacttagat tgcagccgat aatcaaggac catggtctzat gaaatttcg caacgaccta agataaaaca aaaggtgaat .ctzggctacc gtcatcaccyc tgaggaaggc aggtcatgaa :aacagcatc :gccgctt :ctttcaaac tcacttggcg ccgtcagcac aaatgatggc -ctggggacc~ ;acgaagagct catcaacaat Iaacataacca tatgttgaaa ,gaaagtcgaa ttgttcccag tttaaagggc at ga ata aga actttcccgg agcatgtttg acotcctgaga crgcactcgc atggggargg tc-cgggt:gz accgaggcc g aatgt tcacz ctct tcttcg agcaaaaaac =grggctcac aacatcttct cqa ggagccac :caagaataaa cccaaaagtz acaggctgtt aatattatca agaagac taa atggctctat aatgggacag gcacaagtaa aggact tgca t Qc ttctgcc aactggtaa cccggtttaa gc-gargcct:acgcccagaa :cagctgcca-' acaaccatc gcagatttt

I

aactaccagrt tcgactgag ttcccctgtg ccoct tcccag ggcc-gaagaa tt tgaccgaa tggaaiaaaaa to:catctctg ttcctclggttagcagctcc ggagttt-aag atctgtacag ggccaaaat caacgacar:c gtggactcagu ggc ggaucrac cagtgaocac gtzcc-tozc tggcacaac cttcctgrtc ttctcccttaa guact cat~a 120 180.

240 300 360 420 480 540 600 660 720 780 840 300 960 1020 1080 1140 1200 1260 1308 <210> 110 <211> <212> <213> 391

PRT

Homo sapien Met 1 Lys Gly <400> 110 Asp Ser Leu Glu Leu Lys Ile Leu Thr Gly Ala Val Ser Thr Arg Leu Gly Phe Asp Lys Thr Asn Asp G ly 25 Val1 .10 Asp, Leu Phe Ile Phe Phe Ala Ile Gly Met 40 Val1 Leu Leu Gly Ser Pro Val Arg Gly Ala Glu Thr Lys Thr Ala Ser Ser Ser Gin Leu Glu Glu 55 Glu Phe His Ser 'I I 601 60l Arg Ile Lys Al a Glu Lys Glu Val1 75 Thr Glu Asn Thr Glu Val His GInr Gin Gin Lys Phe Leu 90 As n Glu Ilie Ser 8CsLe L95 Le Thr Asn Asp Thr Tyr Leu 115 His Ala Ser '1y r 100 Phe Glu Leu Asn Ile Thr 105 Leu Arg 7 eU Phe Leu Gin Lys Ty r 120 Asp Asp Tyr Val Glv G luLys 110 Lys Tyr Tyr Aso Glu Se- Leu Glu Pro Val 130 Arg Lys Phe Val Asn Lys Ile Asn 135 Trp Al a 140 Thr 145 Ly s Ser 150 As p Val Glu Ser Asn G1 Lys Asp Leu Phe Pro Gly Ser Ile

I!-

-163 ValI Ser 170 Se Thr vs Leu 175 Leu Val Asn Met Val Tyr Phe Lys Gly Gin Trp Asp Arg Glu Phe Lys Lys Giu Asn 195 Val1 180 Thr Lys Giu Ciu Gin Met Met Thr Lys 200 Gin Tro Met Asn Lys 205 190 Ser Thr Ser Phe Thr Phe Lys Ser 210 Leu Glu Ser His Ser Asp Leu Gin 215 Lys Phe 220 Pro 225 Aso Ala 230 Val1 Ile Leu Gly Ilie 235 Asp Tyr Lys Asn Leu Ser Met Phe 245 Lys Asn 240 Leu Leu Pro Asn 250 Lys Ile Asp Gly Leu Lys Ile Ile Pro Gly His 275 Giu Val Glu Asp 260 Met Ile Ser Pro Leu Val Giu Giu Glu Arg Lys 280 Leu Vai Asn Leu His Leu 285 Trp Thr Ser 270 Pro Arg Phe Ala Met Gly Asp Ser Tyr 290 Met Gly Asp 295 Glu Giu Ala Val Leu 300 Tyr Asp Ala Phe 305 Ser His Lys Ala Asp 315 Leu Ser Gly Met Sly 1 3cSr Gly Ser 320 Leu 325 Glu Ala Gin Lys Phe 330 Al a H i s Ser Ser Phe Ala Val Th r Phe Thr Val 355 Pro Phe Leu 370 Phe Giy Arg 385 G iu 340 Thr Gly Thr Glu Al a 345 His Ala Ala Thr Ser Ala Pro Gly 360 qHis Glu Asn Val Gl.y Ile Sly 350 Cys Asn His Ile Leu Phe Phe Phe Ile Arg Asn Giu Ser As n 380 Phe Ser Ser Pro 390 <210> 111 <211> 1419 <2i2>

DNA

<213> Homo sapien <400> 11' ggagaactat ccagccacca.

ggcgccgt ca ggcaacatct acccgaggag agctcaagaa at tgagaaca ctcactaatg tccttcaaa gatt-ttgtaa acaaatgaaa gtgctggtga actaaggaag cagagccatt ccatataaaa gagaaga taa atggaagaaa ctagaggcgg tactcgggaa gtggcagtaa aaattaagga ccgtctctcc gcactcgact.

tcttttCcc ccaccgcttc taaaggctga cagaagcagt attatgaact aatacttaga atocagccga aaatcaagga acatggttta agaaattttg cctttagctt acaacgacct tagataaaat gaaaggtgaa t-cctggctgc tqtcgtcag =gcaggaacag tcccagctac aaaaacccga tgggtttgat tgtgggcatc ccagttggag agaaaaagag acatcaacaa gaacataacc ttatgttgaa tgaaagt cga cttgttccca ttttaaaggg gatgaataag cac-tttcctg aagcatgttt aagtcctgag tctgcacttg catggggatg ctccgggttg caccgaggct ttaat tgact ggtctcgcta cttttcaaag ttgactgcaa gaggtgtttc gtggtaagaa ttccaaaagt aacaggctgt aaatattatc aagaagatta gatggctcta caatgggaca agcacaagta gaggact tgc gtgcttctgc aaattggtag cCcggt ttg ggcgatgcct tacgcccaa gcagctgcca tatgcttcct aaatcatcat.

agctgaagaa ttggcatggt act ctgaaaa taaaggctga ttttgactga ttggagaaaa atgcatcc attcctgggt ttagtagctc aggagtttaa aatctgtaca a gg cca aa at ccaacgacat agtogactag aggtggagga t cagtgagca agttcctgca Ctggcatagg agttcgttgc ggattcactt aacaaatgat cctcctgggg agagacgaag aggaaaagag aataagcaaa aacatacctc ggaacctgtt tgaaagcaaa taccaagctg gaaagaaaat gatgatgaca tctagggatt cgatggcctg tccagggcat cagt tacqat: caaagccgac cagttcz:t cttuac:t:- 120 180 240 300 360 420 480 540 600 660 720 780 840 900 96C 1020 1080 1140 120C acat ccaccc cacaatgaat tgccatggca aaatcgtcca <210> <211> <212> z2 13> <400> Met Asp Ser 1 Lys GIu Len caggtcatga aaatgttcac tgcaatcatc ccttcctgtt cttcatcag ccaacagcat cctcttctt- ggcagacttcz crtctcctta aqatgatcgtr ttgC7tgcttt tagcaaaaaa caaczaccag t~t--actcat atgattacca ttcttttaaa tggcggctca ctcgcattt 112 400

PRT

Homo sapien 1260 1320 1380 1419 Gl1 Thr Al a Se Len Ser Arg Thr Giln le Gin Gly Lys Gin Lvs Ile Tyr Asp 145 Val Ser Lys Gin 225 Ile Leu Pro Lys Leu 305 Gin Thr 130 Phe 210 Ser Leu Pr-o ITaI 290 -,Ys vys Leu *Asn 115 C Asp Val1 Ser Ser Gin 195 Trp His Gly Asn Lys 275 Asn Ala Ala Phe Thr 0 Arg TIy r As n Lv s Ser 180 Trp M etr Ser Ile Asp 260 Len Len lai !.so n 3 4 0

I

I

V

H

L

3

H

Gly Ala Val Ser Thr Arg Leu Gly Phe 5 10 Lys Thr As n Asp Gly Asn TIe Phe Phe 25 Ala Ile Gly Met IlalI Len Leu Gly Thr 40 45 Leu Gu Glu Val Phe His Ser ui Lys 55 Lys Ala Gin Gin Lys C-l u Val Val1 Arg 75 Ile Clii Asr, Thr AlIa Val H is Gin 85 90 Glu Ile Ser 7YSLe Thr ASn ASC Tyr 105 Lenu Phe G1 v GJ, L\s -hr Tv r i, Ph 120 12S, Val Giu Lys T-y r Ty r H is Ala Ser Ten 135 4 Ala Ala Asp Glu Ser Arg Lys L~ys Ile2 150 153 Thr Asn Giu Lys Ile Lys Asp Leu Phef 165 170 Ser Thr Lys Leu Val Leu Val Asn Met 185 %sp Arg Gin Phe Lys Lys Gin Asn Thr 1 200 205 ksn Lys Ser Thr Ser Lys Ser Val Giln M 215 220 ~he Ser Phe Thr Phe Leu Giu Asp1 Len G 230 235 'ro Tyr Lys Asn Asn Asp Leu 5cr Met P 250 le Asp Gly Leu Gin Lys Ile 7le Asp L 265 2 al Gin TrP Thr Ser Pro Glv H Met G 280 285 is Len Pro Arg Phe Gin Val Glu Asp S 295 300 'Cu Ala Ala Met Gly Mez GCly Aso AlIa P 310 315 Vr Ser Gly Met Ser Ser Gly S=cr Glv L 25 330 s Ser Ser Phe Val Ala Val Th:r Gln G .4 5 3 Asp Len is Ser Pro Arg Cy Glu Thr _eLys G-'n Phe 3mu Pro %sn Ser Pro Asp 175 lah Tvr ~ys Gin ~et Met ln Ala 1 he Val I 255 ys Ilie S 70 in Gi P er Tyr A~ he Ser G 3 en Ty r A 335 iu G iy T P h e- Val1 Al a Lys Al1 G1 r As n L-ys Val I'rc Gly Phe 3Mu ['hr ~er ra so 1,- 'hr Glu Ala Ala Ala Ala Thr Gly Ile Gly 355 360 Gly His Giu Asn Val His Cys Asn His 370 375 His Asn Glu Ser Asn Ser le Leu Phe 385 390 Phe Thr Val Thr Ser Ala pro 365 Pro Phe Leu Phe Phe T 1e Arq 380 Phe Gly Arg Phe Ser Ser pr 395 400 <210> <211> <212> <213> 113 957

DNA

Homno sapien <400> 113 ctcgacctt.

qactttctgc gaaacatgag aacaaatqa agccarigcca agcca age: g ccaaoc ccc aaccaagcgc caaaggtacc agcagaag:a caccczzaagc totccacaca c t ::ggt: rttrc:gczc tc--gcacaac ttaattcagg ttcitaccag aca3acccagc czc:aaaggtt toaaccaggc tacc-aaggtc tgaaccagc ca: ca aagcc agagccatat a7:::-gctgca a ac. g ,rc:z CacCc:gaag c-z:-r-r-rc tgcccatt ggacgaacccagct::acagg cagaagcaga caqCCtccac ccacaaccz-g tc ccaacc Ccrgagccaq aacatcaag cgagcaag CC-:tcaacgg cagacaagcc gtgttaat c~t: a co .aa~cctgcaa tcaggqt::ca aaatcgctrzz: tgagcaqctg aaqaccaaaa aagccactac acccritcaaa cc: :~acccc c-:caggaaat ga a a cacaa a ::cctgagcc g-,:otaccaa 7root :gacca ga:acaccaa 7acr ccagg c:icgagaaac :Qtctg:aa tatccaaaa -gcc~ctgaazi o ::-gaaaa:: teaa-t ccaaa gaoggg::c accacoocag gcccga agatzgtacc ggtccgac aggcttcatz! agtcccgg cccagct. cag caaccaccag cct :g:aa=c cc acoclacc Iaagcaoaaaa cca atgaaaa aaaaaaaaaa acaaccaagg cagcopta aagg:z:cc-r aagt r: =Zoop coaggco ace caoaaacca a:go: oqaca atiacac:: g-aaacgoe:gj aaaaaaa 43J 730 <210> <211> <212> <213> 114 161 PR T horno saoien Me: Gin Phe <400> 114 Ser Ser 'Pvr Gin Gln Gin Val Pro Thr Gin Lys Gin Thr The 10 Gin Thr Pro Pro Pro Gin L1eu Lys Gin Pro Ser 25 Cys Pro Pro Pro Thr Lys Giu Gin Giu Ile Pro Gin Pro Pro Giu Pro Gly Asn Thr Pro Pro His Ser Lys Lys Ile Pro so Gly Cys Glu 55c Glu Gly Cys Thr Lys Lys Thr Lys Val Pro Gly Cys Thr Vai Pro Giu 6 5 Gly Pro s0 Cys Thr Lvs Glu Pro Gly Cys Se r Lys Val Pro Glu Pro Gly Tyr Thr Gly The Ile 115 Giv ?vyr Thr Cys Pro Ser Pro Giu Pro Gly G ly i Ie TLys Val PoAspGi Pr o Giu Gin tA's Phe Pro Giu Val Pro Val 135 Val Thr Pro Pro 120 Pro Ala Ile Lys Gly T'yr Thr _ys 140 Pro Giu Gl,/ Pro Ala Gin- Lys T!,r Lvs G' r 145 Lys <210> <211> <212> <213> <220> <221> <222> 150 115 506

DNA

Homo sapien misc feature .(506), <223> n A,T,,C or G <400> 115 cat tggtnct gccttaaact angcanagat.

atgtaaacg aaatancnng acancattqc tccaaatgg aicgtt :cacc gacugtagta a z: -_gc t ctgtnacact gczctqgata gtaznztcat cagcncanc: aacc: :natc rcic cacnc~cn aacc:agcacc nflcccatc ntggaaazgt tttgggeant ccatranatn cgczac acn nanangc:.- gr nautgacaca aatgttc-aaa zataacaacn gaaaaa .inat ::'ctaa gaaaanrtng tqcccccngrc anccaatrcng c-.gcngtaunact agnaan actc:anrtaa Ogcc Cgrccc caqtggacaa zancacgaca accagaggc: aaatangc::cat :qcgg~Cttcc-aazaa gtocaagaaa aacacatctc agttcccnc:_ ggttatcg cat acc9co: ataocacz:: c ggc: canca c acaniacrco CC: cc c C ca c 120 Igo 300 360 420 480 506 <210> 116 <211> 3079 <212> DNA <213> Horno sapien <400> 116 ggatccccog ggccaaaggg aaagaggtca ct c-gcaggca tgtgcacaaa cagattqcct gcagatcacc cagg tgc tca ccaggacacr gccccagcct atcagt~ctc tgcaccccac ccagcccact caaaaagggg gtccccca ccaccatgc qcat~gcag gtgggcag gtggtqccg gcggagctgg gtatccaaga ccagcatccca gzttccaaa cagaaaaaac aagcgcca oatc!-,ccca aggacoaaac ctcccagagg ggggaatcgc gcatgtaccg gccataccaa ctatggtgaa gaaggcaag accactgtgc taatcatcac catcaccgtc gcaccc ccca tcgccagtc-a catcaccccq tggcggtc ccggagcc cttcaggaac tagtggiat cc ccc :ggaggc ggtcaccgc:gagggc ga ccccccacag gctgagc tag E agggggcgc gcgggczctg cctattttcc gaaaaccctg ttgccccccg tactgggatg tgccccctca gacatacttg ttatttctaa aggtgtgacc agctcgacag cctgggtaac acccactagt agtgtgtc-c tctgtc-Cccc ttcggcagg tacaacczag cggtttqgg ggtctcagcQ ggctcagtg aaccagagtc accgaqgagc agtcccrgccc gaggagcta.

tgagggcttc Zigat agct cit cc-ctagcaca cagcaacctg ctga tggaca gttgtcaata gttccggca ctagcagcgt ctgaacagag 9gg-cagctca crc-C: cgcc acagccacct gccggttct ccggagcgg gcaccagccz: -Ccagc:C:tgc Og9gcc-ccaa Ctctgctgg gtciagctgg gsccc,39at: aagccaaaga ggaaggac aa c cacat t c gccttcccca taaccaaciaa ctgcctggaa gcttccccaa cc cctggc cc tcctttttgg caccaacttg cctgccagga cagct-gcccc cagcccagrt tctgcgtccc ctcgctccac qggcagtcc~ c acc t ccg t9 gggtactzgc gaggatatcc aggcggc: at ccz~aacczg caaaacz:c ac aaggaaaa accrcggccrc: cqgcccaaac acaaaaaaactataaggc:a aagtgtaaga gct ccaaqgg zgtaagagt:: gctgcccaca ttgccaagag agaaagcg: ccaggcatc ctggaagga gctgaqctc: caggaacaag aacttcagca c:cccggc-q atcagcac: a ggctctggag =tcccgcac *:aaatcaac: aacaataac:- 120 180 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 2.320 1380 1440C ttgccz=ctcagcagacccr, tcaccagca gcccggaczc aggazgaaac cagatc tcc agatt-aactc ctgacacccc tcgctaaggt ccctqgtacca cccgcaacac agaccgacaa agcgrgggga tgcaaaaggc ccaaactggc gcaaacccag cctczggata gc: :ggccg gca: :ggcct gagggcgg co-accacctc :zcaaq cqC 9tZZ:azcct czCaagag tcaaaccaac *catcaacaac gctgcaga catCaacaac *agagczgaga caacaagcgc ccacacgaac cacgaagatg agcggc cctc caaggcccag gaccaagcat caagccargag cgccaagaaa gccggcccc caaacaggac cctggacgtg cggaaaagga cgg9cagcggc aggc ::tgcc agggagg qqcaogcttcc ct:cc:cc=99 agcaacccag cc:cgga agccozcatc ctc aggctc aaazcaccaa cagaartgg tcc3cc-caa Igc-gcc-act cc cagggcacca ct:caggaqgc aacacgcagg accaccactg aaggccgagc tcccccgacg cccacggaca catgaggaga gaggagczgc atctczgaga cagccrcocca aaggacgc:za acggezcggc gagaccgcca Qc cagaccag agtggcc-acg ggaggc agca ~ccag:rcg qgcagragcg aagacc::-ca cccac-aaaaa gcagtcccaga ccagcccctg :-ccacaccat: aaCaqaa-c.c~caacaaaac ggagcagcz aaactgcgac accrggacac acccgcgga agaac-gagcc cg-gaggccaa :ggagccgc acaaccgcaa t:gccaaccg agcagacagc gaaccggac at c tgcagaa -igaacaagcc- 3-c t gcgcga c accgcaa -::aacarcc ,ggcggccc z:zggaagcca agg~ct--gg ggcgagcag agagctaaga ::gcccccccc :caagccaac g r C:7 gc-g gycc-cc cgccz~cc:caac, gr:zt:aaa igaacaaagtt Igcagaaccctg rcat cacaggg iagaccctcaag cgcaacgczg gaccgacgca ccagacgcag cccggacccg cagccggaca cggccggca c gacccagagg cgcca c gcg ggccgagctg gcaccaggag gctgccggag cgccgzcaca cagcggaggz cac!co-cacc Ctt cacczuca ccccaacgc accccraca taggcag:cg t~cagaacca ccgcacc: cc gacacaagaa c c c a a. Z ataaccgc;-, cgaaacaa gagccgc cct gaacagcc aacaagcacq aagaaggaca ccgacggacg acgcacgtc gacagcacoa aaagccgagc ggcga cgaccccoagagccq gacgccoacc gaggaggczc c Cca cgaaca agcaga:: cc cqgcaacg agcaqrT~czg agcagc acc aaatccgrcr agccactccz c:caagccac caccccczacaa ct c cj rr'caa~ag-i 1500 1560 162 0 1680 1740 1800 1860 1920 1980 2040 2100 2160 2 220 -23-40 2 400v 2460 2 52 0 2 580G 26-40 2700 2760 2820 2980 2340 3000 30ri0 3079 <2 117 <211> 6921 <212> DNA <213> Homo satpien <400> 117 gaac--ccgacaar-taagata taaaztggaag cgttcctcca gaacgtcccg ccatcccatc gctacccggt ggaaaacagc ggc t aa tgc a agaggaacca gaaczgcgaa tgaaagtgcgg aacacccg ttcatcagtc ctact:ctatg caccaagct agzcazagcc zgaaar agac agcca--cagc caaaaaaaaa cocccartica accac: caca gccaccagc ccaaacaaag actctcc tggc aacgaaaccg gaacacc-agc caggaacccc tgcaagcagc gtccacaac gatcggccga ttcagaatca ggaacaacca cccaccctac tcc::zcaccc gcagaaaccc gacaagaaca gaaaagagac gatcaaaacgt.

gcaaa--caac_ aaact tCtiac aaaacgaca ctaccgggaa aagcgac ga acgagtcca ataoaatIc aagtctaag aagctcct:c actatcaaga tctacatccz ccagacagac cagaacaga caaacaag:a catcagacco: acacagaca tcgcaaaacct acaccgagaa aggratcca tz~aaacgza caaccaaaag t.-c-gatcaaa atgtgcccctg tgaggccac-g CCc~tgccaac cataaacacg accagcaac taatccacaa aggct cagac actcccaaa cgaagtcccga z: gaactc~ gaaaccaaag ca at g cgg c 9gc:gaaaacc: =-acgaaac:: tc-laactaag: t:gCCt ctagaca aaagaaccg gc-ggcaaaacgctatc:tg gcgaacaac:.

gc-cccaccg agaaccgagc aagagcgtag gggccccaa ataacacaac cctgcagaaa aacatcagac ct-ggaaaaag aaagagccgg cz tcaqaaca cZcaac--;g9 aaactgcata acctaaacc qagacr::c accacacaca cccacgcc tgcgccccac aacagtacca caccccggca caaagacaac aagaccczcc tggaaaagga gagaggaaca ctcggctca atgac--tgca aacgaccciaa cagcag=c: tgaaccaag': cat caaaaas aagaagaacaz aatgoaqac-: acaaaaoczaa LcactaQ:73 acart taaCaa- 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 10830 1200 caggtr-acg tcctttaga ccczaaaaa aatagaaatcacagzaaa( a a a at:: cc catgqgacc tgcztggtaai ,gaacatg caaact tac; gtcccuagtz gcagcagagE gcagt accgc ggaacgggt~c cctccz-gaat tcaczaaa ggaagaact-a ggaaaaagac aatigaactat tgccagtg agaacacgac caacagaaag tgaaaaaacci taacacact-c Ltcz-caacaa accz-a:-gcaa acc z::aattgc:gzsgc: gaaaqaatta tgagaaaagc aatccaaagg aaaagt agag ggcagaatca gaaaa: :cag acagacaaaa gaaaaaz caa ccagaacacc gaagcgacgc caggt tgaaa cagaaagatg t cggaagaag cattaggctc gctttgtgaa gcagcaaggg gctgatagcc aaca:oaaa aaacuazacc gac--caagaa caaaaaaat:ctact:gag ccccaZ7:aca accacc:gz:cr:zacagar-a agaaaacaac g gacccagaag t gattggatcc c agtaaaacccg aaacagagca g gaccacgaac a gtgaaacgcc a aggactcgat cattgaaa 4 gcatattcag iggaaagataa i gaggaagaac Iaatgtagaag agggaacltq aggcagctca tctcgcaatc agaaaagat:agaagaaaga ct tgatt tc gaaqcaagaaa tg-tc:gatca aagcagaaag gctu-aacaag tcatztgagg agatcaccrza ctcagagagc qaac~c:aotag catgaaaaag gagaaaaata gaaaaactac catg-agcagt ctcaacgaag gagctzacta gagaazatag gcagacggt acagagcagg aat::ggtaa aagaaagaag ggggagcaga aaagcacaag gttctgtttc atggaaaaatt oac:t gtgtc acaaacatta cagcacatggE cagaagcgtg E catcaat tagt ttcaaaccag agaaacactg ccacagccatt caatzccagc c aQacztgcctg E gc7-aaoaaca E ccac-::cccac gcat tggcaa agcaggtzga tagccacaca aaatggacua Lacaaacaat gaagaatgca atacitgccc: aggctggaaa atctgctr za gtgagt toga tzccgaaggtatatctc:tz aaacca t tct cca tagacgc agttggagaa taagzcaa gaaacaactaa agaaacacat gaaaaataac cacaggctac cagaagaacz aca gagaaa aaaaggc: zg agtzaaac!: t tagtagg-za ar-t-caagaa ggaaact aca :t--ccaz:: ~aaarcg-cca :gCttcaaaa aattggaaa 3gcagaataa :ttt:agagaa :taaagatca at--tcaaag 3rtgaatztaa :tagaaauci: iagttcagct icgaattaca iggaagaatc1 :aatggactc tCttcaaca ~agaacttga ~aacaaatca ~ggltgaaaa Ittttgaaac ;acacct::ca caaagaaaa :accagagc ~gacaaqcac ~aatzgacaa ~taacll:ca--g ~gcagz-arcia ;ta:C:gaaqa atcactgaag aactacCag gttgaatcaa gtgccaaaaa gacct accgg gagttcagca ggt ca ct ot c ggaggagat t gcgtcagaag aagaatggta caqggaggc: gcagaagaca gagagagaag cgaggctaaa aaacacc'- tgattl-ggag ggaagaac:c ag-cagaaaaa tgaaat toag atcatgcagg caaacaclcaq gctgacatau tzttgct-aaaa ggaaaggaac; aztgaatcaa aazaaaq -gC aaga-gaagt-a aaattcacaa gagaaaa:ca taccaaagc: aagtaacgag tgaaaccaa acaaac ac z gctacgcagc aaaaatraaat gcaaaagtg:: cyaatgcggaa acaacaagc:.

cttaaagaccE tggtaaattcE caaagt catc agaaaacl: E aagacagcto: ttaccaaaaa tagaa 4zt9tgaaact: 3acag,,gaag CCa a cacc ca 9tgg9cagcato :ccactcgag a ::gagtitacaga 3Iataaaagac r-gaaac-gaa :at ccat aca azgqatCgcl.. c tactacagag agaaagat: c cagaagra tgc r-atgcagaac gccatggtco gatctcatcta atgacacaat aaaaggtgta gcaacagtc gc-cgaactaa gcagaaaatg aoggcctgaa a gaagccgctc agagct~gccg accagacgaa caacaaaaaa ttgaagctaa .zagtgaaaa Z: =tacataa gcagtaacoc otragatoaac gaac::!-aa:g -ataaacraq ga t a ggccog ac :acaggaa ;acaqaa9:ca gatca :t-aa E 3aaaaaaaaa a :gtgcagaoa c ::aataatcc a :agca aaaa: 9 .caaatgaac a :gcctagaaa a 4aczaacaga a f::gaatgc:-: c :aggtgcaag a Itagaggago a iaacaatcag c lctgaaaatg a lgaacccaaa a :aacagcar-c g :gtca gaaac t iaaatggacc a :&aaaaaaga a ~agzgccagc a 9gqtt:ic a ~aagagaaaa 9 -:aactzt:c a :aagc::ct a a zogz: gaacc :aaacaa z~ acacttacca aggaaaatca acicac:cagc at tcacaacs ztcaagagtatattaaacaggagactt: ttaagaatao aqaaacaaaa aatzgagaaa gtoaagccaa aaacagaac: rtagaagagaa cactcrgaaga acaaatt-aac: caaagcagat aaaaacagaa gagaaaa Cc g=tCCaaca zaacagc -qc ~c-rccagc: acgaaacaaa Qaaagggza laqctqaaga :aaa.:caaa :aaacgcaca cgagazga ~taatga--a :gct-aaaaca igag-aat :ca ;tgaagcac:- ~cctgcataa Lagacc!tggc Loatt :atca:- .caaagaaga Lgttaaataa gatgaccca aaaggagt:tatttcagg aaatOCtaa rtgaacaaat tgaggatga .acagatcaa cacacqccaac~ctggaa gr3-agat g acagat a: ccagcagzca tgagacaaa caau::taa ttqacacc at :_aaaacaaqcacz::o 1260 1320 1380 1440 1500 1560 1620 1680 174 0 1800o 1860 1920 1980 2 0 2100 2160 2220 225 0 2340 2400 2 4 2 52 0 2580 2640 2700 2760 2820 28350 2941) 3000 3060 3120 3180 3240 3300 3360 3420 3480 .3540 3600 3660 3720 3780 3840 3 3 96 0 4 020 40E 0 4 14-'0 4200 4260 4320 4380 4 440 u 450C t-ggactcaag cga t gg ga t c act g tga ct gctgcgacrc gaaagccacc ctcagcggcc ggctgcaaca agttcczaaa agctgtggga aatgctcgac cat tgaccct gaataatocc tcccaataac agagtcccaa graaaacacat ggctztccag ztcagtggaag tacz-=aaaca agcc::agCC gctgagccgg t-gcztagtgag :aczgccc--c tiggcaaaaag ccagcagctg aatgatgtca atatttcgaa aticaa: agaa agatcaaaag taaaaaagcc taaaytaactg ctatcggccac at :gctaagt ct-caaatgg tttcttcaga ctgaaagagc cagcczcaa gatatagtga tct--cacact ttcatcctgt aaaqgggat: catgcacgtt gccaggcact: ggcctaaga tcaattqcag gagagaatca ggttztataa ggagttgc:g tattct tatt a ga ca a aaa g atgagaggca atcttacagtaagcaagc: c cgctttctgt agaaacctga gaagctatgt ggautacac: aaaaagca:: ttagtcccc-a gaaaggatc: cgatgccccg taccgggrgg cqacagtq-cq gtggtggaag tztcagtac: oaggctc-t-cc rtacatatca tc:agaaaaag ctagacag tgcaagcggt a:aucgcagc gctcaaaata tt:z:cactag tttacgtaaa actc:ctcc acgtcacgaa gctgcagcgt cct tctt tgc tgaaagctaa gta::trtccg tcc:taaaaa cagtcaaga C ggtggaac ctgttgaaga ggct tac!: caatagacaa Cttoatcccat accccgaatc: cttctaagaic gtaaacatat ttCgtgt:zCc ttttacatga tgtat tac:ic ttccatt tog tagtaga:a-c tagagaaaaa tttttgaazc tcaatat:a aggaagqccz: agaaaga:::ctg: act aaa aagcccaac: ccgaagct:: aattagcaat ctr~fi gaaz:gc Cgacaggaga aagtaggtat gaaatataar ctgatt:clua gaatttc:ag gaugcaggcz Cgugaat tac gagtaaqctt: CCt-tgaaaa: atgtgggata attgaat-agt gcacca tgga tttagattgc at at taaaat cattatcaat ggct t-agaa taacgaact-E taagctzctg agtt.-agaaa agaatctaca aatggtggcc t tcaggtcag cagaattagg attgrtcagtg ct tggaagcc :ccagaaatzt accatc cagc agaattac-.g qgagaggaac iaaaacaga :at atat otr c:zatgggcat :caagccata C-caca:: zagrac aggg acatagaagc zacaaggat:: aaa :a rza La c;-t7gat: agag a-,gccc:::aq :!zc a c a ca cttotactac agt::catacc gz:aacat act: -aaactgaaa aactczgatzxra gatcat Ctararcaaagaga tzcaaaaaat: otrttaccaca attatgtgt:i .agagfaco aaartccaag ,gacatgagaa aczcttaaca aaagaaaaaa ttggcatttt acatartctg Cttcttgagg tt tcaagc::a cagatitgcca gctc-.gcagc aacacaagag cgaatgrigtg a::t-ccaatoca~aa:Caa oac:t tza eQacqcaggaa acagaactzg 9:cagggt acaaatttzaa gagcacaat:g gttia:g ocacaggr: ac.aaaaaa *Wac taaac z: .cc r-a Z:a: IrCt: ar. acacaag aacrtggcca taaacgata aagatataaa gaaaaagct: acqrcccat: 1 agaggagggg Cccagaac::ggottaogca caattcacaca agcc cc:gao t-tcazz:c~ tagaacca ttgaagacgo cagagaaggc tggaaaatag gtggg9g azgggz-.gt: ttttccocaa atttogar gtl tcaac caa CCgtgztaca ggcaacaa:a EaCtaac:aa caactoacaa at toaczaac tzgattcat~ at=octtac agggC:zaC tcac: a-ac aa tgg 200 c ac~zCQ caaaac:caa acrt C o a ao: :aaaaot gggaca:a:tt agta-.CaCOa augg~cricaa atcaatigic caczaaaazg :acac:g::-a atzgCa=c:cg ctcgc: occa :gcct~T- -t:IC :ctaar:raag aaggatt:c 45 6 0 4620 4680 4740 4800 4860 4920 4980 5040 5100 5116 0 5220 5280 5 3 5400 5460 5520 5760 5820 588 0 5940 6000 6060 6' .2 0 6190 6240 6300 6 360 6420 6480 6 5 4 0 6.000 6 666 0 6720 6780 6840 6900 6921 <210> 118 <211> 946 <212> DNA <213> Homo sacien <400> 118 ct:tzgactg ggctcaggcrctozccatca cagczgtggt gtcggcactg gctzaggcct gt7-qgaggtg gctccagttc ggaggcggca gtt-ccaccaz aagz-actaaa azcgc9c~c:* cacagccoct tc coca::t gacagaaa gcagtcczaz gggtggacaaa cagcaazggc caagracacc taget: :ac g0czta:=z gtczccagrg aacaqctacz agagozatto= accac.zzz:- :z::acac::L zcragcaa z~gatggczao ::z:ccagcao c-oaggazc tcc:::occ..

t gg:: gacc ag Z: C gaagaz: :a: C _ZCgccz:: 3 12e-0 180 240 3 00 3 4 2 0 ggtaaagctg gggar-gaatg *oootagtgccc tcaco too-c gagcacccat -ggaacttca gagcattata ttcaoiaacaa tgaaccccca gcctgtatct atctataaoa act tt oat zgc:caccat CEQ:-actaa aaaa aatgac ctt 0:cact ta cccaggcagt ctgzatgar cao tattOct ctgaocaagtg cagatcaacc attattaatt Otctgctcoo c tttocaco-g atccatqaaa ttctgoccc tttacooc to gcct cc t-tcactgca gcccaaac gcacaacitaa :cactgcto tcr 9ttt-gg cat oaogatg ago go 0coat: gaaaao 09cc tct ozaac-o co ago octat gcaatgcta ggccaaagt 0 aat0co a t0ataco-a!tc caatcaccac -coog a ggc agcggo-zac at aagt: zoo:g gatgtacaaa aaloaaac ag O--gggctzoaa 480 540 5E0 0 660 720 790 840 900 946 aatagttgto ctlaaaagat <210> 119 <21 1> 8948 21.2> DNA <213> Hom.o sapien <400> 11-: tcaacaaccc acaccoaacao ggcooaggoa go ccgcc00 at crccgagcc ggatca-acac tgaccaacgg accagaaoc ccazcc~gga agcctgaat: gtto-cocaC agatcacca gagccc-otoa gaggctacac aaocgttoggg accogcoc actat-ccg agt 0acagga gacagcrooca aggaggagga aggcctooctc aacaagaaag aoatqaacac t~catooogaa catacctgaa cCtg-cagca aat acaagcg CO-Cgtaaccc a acaaaac acaccaagtg tazcao ccc acaaagccat ggcact-actg caacgcggca caoo-aqaaa =.cazCoac c:cacoaca accazoaaoaa cogocootg ggccccoa ccacco coga CO:: 0000:c gcgagzoagcg CC-lzCcccc gct cga ggac:zgctac gctc-: ocag caaa-a tgga ggCcaa ogac goccloggat: taaaz-:catc 0 ogo agagt gtgcgogag ago ocagcag gcaco: ggac ggao::atoaa gaaca:catt gctacograc catacgcatg tgaccaactt Cttaagacg agaaaatgct gggczoccag cctoot ggaa 0 cac:gcag agaco,:acaga gaaaa=zcgtg gtacgtgacg tCC::ocgaac Cttccoo tg catoatgac ggaagatzac 0 ago aagac cgazacccag gacagzgacc act aao Ogaa cgcagcr-cco coggo-cocoog acot cgco-ag 00 OCaC= 00 0?tqOCccccg atgatcocg accagcagga tsgo oaaaccg aaczgctzco qatggaa?_ac caaacagaaa gc acoaca ggctozgco cagcaaacigg cacao oaaca aaaatcaaag aacczccroa caggccacgt gactggagcg agt-aacugg gtcotcaatc cagtagagtz gccoactttc gactccatca cagato-aagg aacttaozaa agcaacaaac cataacgac~g ggccozagag ccactoocci cagaacocacc atagaaaaga acoaaaacaa :ccacaagr aagcat 0 acc acaac7aaaa accaacagag, Ctgocog ca tCoogccooo ooacgacg ccgagoct gg ,0,Z a ct a t I-c 9cacgarguc tocgacag aaaggctoooo gao:r ccgcaoT gggatgagto: Oggagac0gga accaccziagg Oocgacctgcg a agog: coo: coaggqgaa acaagaacac aagttaaaga agcatccaac goatzcto a agttttogya ggaagaagta aactggagaa acaagtctaa ccat oatt 0 acgagrgza:o aogtaca: c g a c:7tc: tctiacatcaa ccaggqccat: tagoogaco:coggaaa:a agacctga: t: :a ca ca aaaatclacaa zaatcooc-c caccccacca U-cccoooo go: ocxcag caacggagC o cggcgcggocaggcacc-aci gago ooagaa Cttgaccaca ccagococaa ggccagctooc caccaaacac cacqggc7 cat ocacaac cgagraaatcz zogagagaatq cacgtagzca: caacatccoc aaaagagctc ttcagacaaa gatcaccaac agagcicgcaci cccctgcgao agaacgagag gaagatgta cagagccctic cctga agga: gcztg90 ccc ,tucaacat: catga agago giacaatocc cgagtacaz tuacaagccic oa cac--icc:c ZOggaaoot,,c:: gcaaqaaaca= gagocacag7 aaccaaaaca zoca t a cc gagcaaazgc aaggqgoaoa Ot'ac'-acz: :qggqgzocc; Carocgog gcgatot?-,acc C acacc000: aazgaczqcoo cagaaacacg aataaqctoa ato-gaggco:zgcactaazco '-ctaccgaaa aagaacaoc aaaat t cagczgaaqc tto act aca aacaacgazic ga gagoaZ o acc-aaaacz aaaaoaca: c::gg cz :oc :a aaa z a 2 0 42-0 430 54, 8410 903 950 1020 1030 1140 1200 12!5)0 132 0 1380 14410 150 1560 1620 1580 1740 1800 18BE0 1_120 198 20410 2 10 0 2)163 2220 2 280C tggagctgca gaagactcgc acigcagat-a acct:ccctci agaatgtgci ttgc-caact! t tcagaaact taagggcact ggctcactgz gact gaaga;cagaactacz accuggact t tagataaaca attatcgtga ac-tcctcaga agaagaacct! tccgaact ao~aactaqa gggt:gattct ccaggact a aaaaitaccaa aaaacctaa cccagtzcaa ggaagtcggc aaazcacccqi acaattga aggagaacct aga-, :gaaa g at~gagcugqc augaaacaga atgattccaa aggacaaaat ctgaaaaaaa a-tctggagac aacagtccct tcaaagcztga aaccaagaaa tcaacatcac gctaccgggc agaggc-tgaa tfcfcaacagca agcT:gagaca atgatgctgc t cgacaaaca tccagtatga L zcaggaaca ctgtgaagga accagaaggc ac aggaagaa '.aaaatcac aggatgaccc ccc-acigaaga aggaacagga aagactaaaag cagagaacct: tcuaaciaag :agcagaccac a gaatgatc cagaggr~ct aggaaaacatr gCtcggcz ggaagaaact iaataaaaaat igaaagcccag aggcaagttc Qatcgactct taactatcag ac~ccatgaaa gcacaatgaa t tgcaccaac aactczgccg gcaagaggct c:acaagr t: z: gatccaaaar: t aagaacaaa agcgiaagct:7 taaqcaaaac act-gacttaL ccaacagaag tggttggcag gt-aaggtt aaaggcaaaa gartaacataaatcztaqa tgzcaagctc cgCC-czcag agaacrgaag ggaggaggct gttzrcaggagt caa~racaac caagaccacc tcagatagac gaacactcta aaaggccacragtcact-cag caaaaccat c aacaaacgac CCtgcagaaa agaactoaca ccaggacatc ggaagaggag gCtggaggaa caacctgacccggcagcag gctgaqgacg aagtotcaaa cagaagctcta gaccaaggag Ccagqaa 9iagccaaczg i gggtct?-CtCicaagcaattc igaaaagtact aatagtgtt attccccaaa gtcgcctgg gact tqaact cagatccac!t ggtgaaaaag agactatggg gcttrtccgca ttcggagatratatc!tggca caact aaag aacataccr-a gicagargttc Zizaagtaaga -:ggaaa~agq !cctggatc agagacctag czagacaagc gagatc gaag aartgactatg aaactagagt _:actgcaoq aaccactac a acgaaaacca aaccagcttg aatgacagca caaaaggcct: caggccatgc gccaagacca gaggccaagc gaggagatca azccaccagc aatctcaccc acccagacca ggctctgagg atacgaacag caggataaaa cggaaatgcc gcaaacagta gcctgagga acgcggt tcc -tgaatcggc gagctggaag cagcagctgg aggcgacgtc C-Ct-cttctq caagctz-act aatgaaagca cactat-gt agcCgaagcg caaa ccagca 3agcactgcaa -accacatcac q ctactaca icagatagcta icagaagacac facctggataa tcaagaagt c ctcagacttc tEcacacagcr acctggagaa agtggctcta ccaacacagt aacgaciacaa at ta tgagcz t caagaggac at acricggc a t-ccgaagag agc:cagact:! agaacctgca aggaac:gaa Qctacggcca ataaaaaaaa accaaczcca c:gaaaaagc aagaac.-cac accaca: actgccgg 9ct:ag agcagcgc~c tzcaggacaa gCC-gc:gga tzagcr-ta aa tcacca:gca gagaaaacag cagagaacct tgtctcagag aggagagcot acaaggagat tggaagatga gtgcoacgga tccactatczaa acaac--zcc :gaagaozaa gcat gagoalg acqcac~cat- toaatc9cca aggtcoaagoc toaaaatc aaazagaaa:z tagaaciaaga azaazcgac: agcaggatg accc:caaaa agtgaaaatcaaccagcz: aatgaagta C: aaa tagc ctaaaggrc agcggaagcz gttgttggcc acagcagcat gacagaccgc acaaa tCaag Zgaccgt aaa ca~gcggtt: accagagaa ccagctggcccazgattcag cat tgaac:a ::ggaagatggccoogagat gaaaaCacaa gagacagcuc aac-aaaagaa aagaaaaaaa oaaagcaaag Latcaaggag g aa--a a a gatiatccatg aagggaaaat cactgagcag -ataazgcag tgaggacaac ~aacaaggag acatgaaaac ~aatcagt::aaaggaagag 3agc-tcarc: caggagggzg 3aaacagcag aagatataag igaaaggtz:a aacgcgaa 3acaataaac lagggtttcc 3aaagagcr-g :ocgccaaa -Cccgaag :aticctaag 2c:gacgqaa ~catttccaq :cjagaggc~q -zz:gcagaac :cazaa aaa:- :gga aCc aacgagctta a aaga a t! Ztggacta: ttatrcacao tacgaaaicca taccgctgtc act atgaaaa caczt:acC tggcaaagga caaczgagga cgccgccaa Ltgaatgagc gtlacaaaaaa ccatacacc: cttacaaga: oaaqctzo: gcca act ccc gcaaagcgz: gaact:gat ct-aatccaga tczgtgoaaaz caarcgtgaaa gaa~atqaaa aggaacaagz caaaaaaaca cgaa: ta :ga aggcgaa aaaaagcaac g000ggcaca at--gagagac gaactgagcaz gacaccgaca= gataccag:c; 3aagaaataa 3aagaaoaca ctggaggt:c caatctctzci aaacaactga :tacaaagag aaactgaaac -aggagaga -agctgcaa7- 4acticctgca 3agcaagcca acaggagtz: iaccagagga= -ag: tactc ~acgcgatag ::gaggccc= ~caaccatc: accg t C 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3300 3360 3540 .3730 3 840 396.0 4 0 8SC 41410 4230 4320 43S0 4563 4620 4680 4740 4800 4860 4920 4920 5040 5 10 0 519-0 522J 5400 54 G3 ttaaoattt aggctct taga aggaaacaga agaggoogga aacaccgcct a atat::cccg gagagaagaa aagragaggtg cagaacgctc atcgaaac ggcrgaggaa ccttgQacaa cattccttcg otttqata ga aggcccaggc acagugccat aaaaaactat ccat caaaaa c=tcaouggg cccgcggct aaaacto ::tg gcagaatcga :-coaaoaat cgtccac:ogu ttaacc.gaczt agaacictorgg agTtcxQc:Qaa caccactgga zgtccaga tgt-.ccaagc cacaQatcgc tagcazataa acgataccaa aagaaagatg agaaacaggc acccagaaac atgaaaccc gatcagatgg ttcaagatgc gcagcc~cag gcagcagcat taagraagat cagacaccct aaat c-ccoat ttczagaggc cacotcagga ctgct---caa cacaggcagt aot3=cccac ccatccgaa atgcccaaaat actcccccat Ccaaccgctt gc:=aatc tClcazaccac acagagagag ggc at a at gagccttctQ ggatgagctg ggagtgtgag caaggaggag cagtcccacg caggcgtaag ccgatatcag ccagactgaa gaaggtgaca act at tgaag gggtgcagga ggccaagaga agctacaggt agczcgggac cacoggttcco aaattccgaz: agt agac gactogacaga ggacccaatc accaca tact ca ga ca act caazoaactg cczc cca ggg c Cat ctacgag aaccca acca ggaagccra7 acgacrcctc cacoaacaag aaccgggggg gaacgggccat aggatcrctcc caucaaggaz gcagacatca caacaaaaa caaagaactg ctccaccaag tattgacaaa cctcactcaa gggcagtggt ttccaccata ggaagaatcg tacagaagg!c tcaggcctgc cgcagtccc agcccaca gaaagaaaaa gggaggtcc: ggggtcata cgacctgc ggtagaagaracccagccc:c tCUC:c ogga accgaa~c: agggaaaazcc aggatrcaag gtgaaaac ca aatcccgcaa aaacagcaaa gctactaaaga agtgagazcg ctggaagarcc agggagar: g tgtgagccga gcaatcicagc gggaagaacct tctaccgccig aagaaa:zaa ggtataac-g ccatogacz gatgaccoat gac-agagaaa cotgcaa-ca gacoco=-ca accaaaaaga ogtcrGC7=0 9tgaccocca gaatccc:c tcaacct oca gccargoaaaa gct actgocct aagagaca: c actgggc a:a gaactcac atoa~accc ttcaatoagg gaccccaaca gaggaaacag Caaaagaa-:a atgtctgtc tgtgagcaao gtggtcctgg ggccttgtzg tttgctgaca gtcagcgatg tccagcuaca agccccacog atagagcagg acaggcggca cagggzgccqa ggctcacg :gqctc-Cac.j gtcoacccg gacggccgcg cccaaaacca at cactacgo tacaacazzic tcct::Z tgagacagga aatcaaagaa aac cc tgga aaccaactc: tcagaata agacagaac aaagact cca czaccaagga at aaacc tag cgot gacac tctatcagcg cactggaaga gagcarc::tgc tcagc c ca ga atccccacg tocgacgaccg c-caczgcaa ccagaaccc caucccqaa aggtcagz ta tgc:crcagz coago:tac: agatc::o::a t accacacat aaaaggcca caaaggagag aactcagtga zzgaagaaaa gqctc:gc aggaagccta aacctgaatg zagatagaaa acaggaag: 0 cgacccccc acgctcttag craa ltcra ac cagccacc 9catcgccga Zccatccaccc :z-gaccaaga 9ggaagag a-.gaggc tgg aagr:ocatqg ccgcacagag aaccaaaaac :gca=cc: c -ccz CCo aatlgagaaa tcagtgc act gcaagacaag agaggcagaa ccc gaac cag aggaaagagaa aacagagac gacacagqtca acagcgcoca ctccaagctg tcagctgac agttgccccct-ccctaag atccc ac0ag t gaac agaag 0 cagcagac a gacagtatcc =ccgcrggaa gc-a aaacat Ogat O:cccga cgtagcagczg a cag aagaga acat -C!oogac oca::cagqrc c acacaauaq L "c3 c,C, at t-cz:t ac cgagc tcaaa aacagaaac cg: actcgc ccttc-a gattocccca ctzacccac Cotcctccc gcg'cagagcg o a aaagcgc qgaagaaata aacaggcagt c:tcgatcag gaaaaatggt cagciccoga cacaaggagc tgacacagaa caqcatcaca aaccacgggc ccggccaccaaaaaagaag ccagcgc: t g aggataacc gc r-3ca a g a c atc~ataag oaa gcclcc coca: -cc=c :ac: Cccc2 a accac-Z tcccaaaagc caggtggtac qcaaggczcc ac-caggcc-ga tggaagacocaagagtcaga aagagaatzg cagttacxaaa catgggtcccc 9tgtctgaccg gacaaaacaa gaaatccag7 ~aaaaazact at 9cct Cc c-tgacr-qt cc tatgcac~cag gtzccaaraag -cccacat::g -37-c c a a gca gtcaca aacgaacgg: acac:aaggtagaaaa "cacaaaac aczgctc c.cc gacaa.cc-cc ztatcagaaq qacccaagtcg ccccaac-:iaa aaagaaaaga cctaaca: accatccao cacata accga: cog gtcggcac-a catgaatcaa agccz: cc: aacctcoaga ~gccagagc aga agcz:gt: agcgtgaac acgtcaCag accgaa=caag accagcagc:cataccauaa rccqt3:mcci: agagca=acc:: a zt iar-: a 5700 5760 3820 5880 5940 6000 6060 6120 618 0 6240 6300 6360 6420 6480 6-540 65600 6660 6720 673G 6840 690.0 7020 70830 7140 72S0 722J 7380 7 44 C 7500 75600 7620 7680 7740 78003 7860 7920 7980 8040 8100 8160 8220 8280 8340 8400 8460 8520 8580 8 640 8700 8760 8820 8880 8940C ggcactag <210> <211> <212> <213> <220> <221> <222> <223> 8948 120 587

DNA

Homo saoien misc feature (587) n A, T, C or G <400> 120 cgtcro-aagc acttagacta catcagggaa gaacacagac gggctqtgca ccaggcggazt cctcccacvcl ggcaac~tc gacaczg:-c :"tzc::tgaa ~-zcc a gg gcct ccactt t ct ggaagaa nltccagcaa gcccoctccc :-caaanaatg caaaactc zag a:cccccctc aaagggcaaa gct r znntnt accnggggcn agtggagacc ggcaggaagg ttagcactac aanaacccca gggcrgaagc agggcagcc actgaaaag taccaaaacn atgccccaaa nagtccttgg gaaatgcacc cc ggcct cct gggcccagc anact at tag angtcacccn a-cttttc ta nr-~tctcnng atzaanaac: cacatccczg ccc tagggct gctgcatgzg gcatccccc CCC Z acccz ggcaagggc: ggnctctrga naaaaagaaa gatcc:taac tcccatc C~cczcgca ccccagclc: ggggaaccaa= acccagczc:z aaccaaaa tccccatzrg 3 C 420 48-0 837 <210> 211 <212> 213 <220> <221> <222> 121 619

DNA

Homo sapien misc-feature (01i9) <223> n A,T,C or G <400> 12cactacicagg acaaaaacac gcccaaccca ggtc-aactgc tgcacaaagc caatclcagc tcaacacaca ctcatgaact tgcacacttg ctcactcan gacaacctac tttccggc gacatzcagt tagtgctct tttccaaatt tttgtacagt aatgaagtcc ctggtc-ctc U-ctaaaacat ctactatatn aagtggtggg gaaaaaaaa tgcgtcccga aagaagaggc cagtttctaa cctgatggaa aaaaaat act tgagtgaagg tat ataccag cactgcacat atggcaactz gttnanatga gagtaaggag gggatacctt gatcatgtc caataacagg actctcataa aatgatatcc gcatgatgct atttgaaatc gatcagtaaa aattccttct agaagct act cagc:cttcca caagctaact cccaagcctg atgggtggga atatattcat gagtgacacz atatattaag ggattcncct ccccnccc cc atc:gattca tgtaactgta gaat cccacz tggtatgaca gtatct':gga ttattcca.c cttgtgtaca act tccaaaa ctg-cttggca cgaaaaaana so 12) 180 240 300 360 420 480 >-110 600 6 19 <210-> 122 <211> 1475 <212> DNA <213> Homo sapien <400> 122 c:ccaczctqtc ccoccaacgc cggccccgcgc cctcctccz cagccacrcga qccqczqz::agccccaa czccgqccacc acaagaccc tgctgcgcz: cctgcctczc zgcgtcccz tcgtgagcga ctccaaacgc agcaatgaac ttcaccaagt taaatggagg caaagaaaEr: atggtcactt ggaactctgc tgggcctggg atgtgcaggt gaaaaaagcc ggccccgct t cggccatcta tcagcccttg actiacaucgt tcgaggtgga acgacattgc ctatacagac aqatcac cgg tgactgi tat aagrcaccac gagac:zagg taagctgggg act cttacc ccccagggag cat ctccatc aacacgtg cggagggcag tCtaccgagga cactgtccrc: gaaacataat gggcctaaag Ctcctctcct taagattact caggaggcac ctggqtgatc cztacctggg: aaaccticaE.: cttgctgaag catctgcctg Cttragaaaa gaagctga: t caaaacgctg ggaacccc ccat gga t c ctggatccgc gaaacgggc3 agctggtaaga cccaacaagt cac-Igtgaaa aaggccagca cagcaaacgt tactgcagga Ccgcttgtcc ccagaagaa t gggggagaa t cgggagggc: agcgccacac cgct caaaac ctacacaagg atccct -cca ccctcgatcc gagaact:a tcccaccag tgtgczgcza St Ct 9tzc::: a CCCtgaaaa agrcacacca ccacccgc::agagac:cagg actcctccaa -agataaatc ctgacaccaraccatgccca acccagacaa aagagt-gcartaaaat ttca zcaccaccac ctgtcaccta actgct: cat rcaactccaa actacagcac aggagggcag ataacgacc ccgacr-atct: agtgtcagca aczcacagt g cccaaaaccg acaagc cagg aggaagagaa :Cttgc:ggt aagar tccatcgaac cattcactgg aaaaacctgc gggccggccc cagatctgarccggaggcga ggtgcatgac gtgtggccaa cgagaaccag cgtgtgcgga tgattaccca cacgcaagag tgacacgctt gtgtgcgcag ccaotttc2gc ctatccagag gccccac: ac gaaaacacqat cacgact -:ig cgtctacacg tggcctgrgcc tgtcattr:: tgtcqactgtc tg-caactgcc t a gagggga tgcCtgCCCt gctctrtcagc CCCtagtgcot tgcgcagacg aagac:ctga Ccctggtttg ggcagcctca aagaaggagg gagataaagt gctcaccaca ccatccc9ga acaaacrtg~ cagc:gaaga tacggczczc tccccgccag actgaat tg agagtcr-cac ctctgacg: gcagtcagag 180 240 300 360 420 480 540 600 660 720 780 840 900 960 .1020 1080 1140 1200) 12 62- 1320 1380 14 1475 <210> 123 <211> 2234 <212> DNA <213> Pamo sapien <400> 123 cagcgccggc gccac-catga aaaggcagca tgtgtgtcca gggcagcact cgaggaaagg gtccctcagc cataattact ct aaagccgc tctcctccag attattgggg aggcaccggg gtgatcagcg ctgggtcgct ctaatcctac ctgaagacc tgcctgccct ggaaaagaga ctgatttccc atgctgtgtg cccctcgtct ggatcgccc atccgcagtc cagggcaccac taaqaagagc tcgcgccct:z gaoccctgc: acgaacctca acaagtacz: gtgaaataa ccagcactga aaacgtacca gcaggaaccc ttatc caaga aagaattaaa gagaattcac ggggctctgr ccacacactg caaggcttaa acaaggact a gttccaagga cgatgtataa attCtaccca ac-cgggagt; ctgcrtgaccc gtczctcca tgaaggacaa acaccaaaca ccgct z- taggaata:a ctgccgcacc ggcgcgcz-g Ccaagttcca ctccaacacc taagtcaaaa caccatgggc tgcccacaa agacaaccgg gtgcatcg atttcagtgt caccat cgag cacctacgtg cttcattgat Ct ccaacacg cagcgctgac gggcaggtgt cgatccccag ctatctct-ac :cagcag::zz acagtggaaa aggccgcacg gccaggcgt z agagaa-cggc gczgttg;:: ggcctccac caccgagccg ttcttgcg -cgaactgcg cactgcgca acctgctatg cggccc:gcc tctgatgctc aggcgaccct catgactgcg ggccaaaaga aaccagccct tgtggaggca tacccaaaga caaggggaga acgcttgctc gcg ca g ccat: tttggcacaa ccggaccac cactact acg acagatt zczt actttgactg t acacga gag ctggccc--ct art t t goagct a ga -9c z t: o cgtct accg tcctggtcat actgtctaaa actgcccaaa.

aggggaat ag tgccctggaa ttcagctggg ggtgctat gc cagatggaaa ctctgaggcc ggt ttgccagc gcctcatcag agigaggact a tgaagtttga accacaacga cccggactat gctgcaat tgaaaatoac gctcctgaagt gccagggaga gaat tgtguag tctcacac-: gagggtczc agatac: gCcttc-Cca ccccgacctc gaacgactcc tggaggaaca gaaaot cgga tcacttZ tac ctctcrccacz cctggggaaa gcaggtgggc aaagccctcc ccgctttaag catctacagg cccttgctgg catcgtctac ggtggaaaac cat tgcctq a ca ga cc at: cactcigctcti tgtrgcgaag caccaccaaa ctcagggga ctgggccaot cttaccct-_gg agggaugaaa coa Caacotac cca-caaacc 120 2.80 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 gaacgacaat accaggacgg ggac::gaaqC agagooagcc toooaattag agoocttgg gcatoaggaa agzgtgagta ctgtoatgcc gggt Ozooca acacttc ag agctragttc tatacz:toao toact: tttt agcttr-cacoo tcaggoatag gcctgggtgc tggcltgccca agggcggt c ct gcaggagt ccoogaccg gaagcgtaag ggaucagaga ataacatgt agagctggtg acacagagtg cgtcgacagtg tt- Cactttc at ccaat cot tattttatt ga t ctgactcaac taaaaagggc gtgggcattt caoctgaggt cactaaccoac gtgcigtact tctgazcgzc gtctto:tgg Octaggaacg acatagatgt cactgggtgg tatacttttg acgttactga agggcatct c gtgaggccca ctcttgaggg tt-,cagggcag ,tzgcaoactt aagcctaaar agaggctata ,at tattctg Ccot t tctq ggtqaggaoc at t:t aaa ccagcaactt t':agcatgg cggttgagaa agcttagcoa ggctctgata gtgtgtgggc atzttccttaa cTgticac7 cot: oacgcatgacc gccagttcatc act ootgtac taaaagtgat gaccccto-:. gtcttti: 0: atgaataa::atgtgggazc ttccatoaatgtgagtca act gt gt a ggggccz::: tgtgaccacc Ccttcct:: 0 actgaata::caataaaa:c 1560 1620 1680 174C 1800 1860 1920 1980 2040 210C 2160 2220 2 280 2294 <210> 124 <211> <212> <213-> 956

DNA

Homno saoien <400> 124 gataagttco atcaactggoo o aga: tta ga a ao c, 7tqc 9tag-aootga aaccgcaagg gccaoozaaca atgcaagc2?t aacctggcgg ggoaaoatarg tacaaaatco otgctgqgagg caggogta gc ooaooao~a ogoacacogco tt tccc gcacoaag:tztccaaggt ac:: cagga gaoooo-aggt goocacatcoo: at gotoagga gtgaooctggt tggagataga agacagara a agrgaacagot tgotggatgt gagaggatgo coat tgtgga ooacccgctg ccat otgc atgctcttt tgagacagac gctggartgag gaagcgaooz zggtagCtc gcagagzqgc gotla ca at 00 ccgotaotgo gg000agot t: gaagaogogg ooaoozgaot: agagg: ocag aggaoctcago oacagtorooc gcctoacgac caggcoot-gc c:gaoootcg :aootgaaca scoaatgtg :crtqacoz~g accaagacag aagagt:gaca -agct Zagca a;tgoagotgt ogctgc-gaga =tggagoagg -agtaoaaga gatgaagg Saccco 900c aataaaagct 900 tgagrqct ccagaqoocga agaccga aoacc aagc at gag aaq9at aggaac--gaa 7totoggago:tgaaagcazc cccagatcca tggagoagca agattgcoa.o aagiaaccggc toacttoot ggccaoooag qootoagocc rtgttgacto-a ggaggcc=a=: ctggaca:= ggaggaaa: a zgcoo,-aczo =icagaq =a a 9cgoac:zz ccggcqcaL:, ggggotaa:l gaacc agoc ctacogoto: gaccaoo to: ccgcg-acz-= gaggoacz:a Octgottgctatg e62 122 2 0 3P.; 4 2 54 0 630 7 3 840 900 956 <210> 125 <211> 486 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (486) <223> n A,T,C or G <400> 1257 aaaccatata tagtzgnttoa ao::aaqtat toaattoaot tt~ggaaaaot gottotottottaagtcooa gagotaactt to=g:-ttago cactgtt aoo goat-::agq acatt-atg gotcocatta ottggcatt: tgagaaccot: agitaotatz:aacgtaagoc: aacr-t-agaa :ggtattocat ttor-tttzaat a r zttaFa atr-g aa- tact at ggaacgaa 3gotg-otCci agtC-tZotag ataggctttz tgaccgaat 9 tat accaattoagooa gaacaga--a taccaaa=: agggagaz:2 agcgcaga:: ttggatac--a gagaaagtca rtact tgta Ctatcgccat tttacqaaagc tct:gatgtga attcaaactt tacctctgtt acz:taaagco- aacaac:ta aggcagtagt tttoact 420 480 486 <210> 126 <211> 3552 <212> DNA <213> Homo sapien <400> 126 Cggcaagcag Catoccgatg gCtgctgacc totacctt:c caggtctgca aacgtacaca tctatacaaa ggcact gaag agz::aatct tataaagaa tc,-ggCcq aaatoaacacaaccacc: tcrgz:actaca gg o g a aa tooagcaca gziac:t ca7c atcaact!:g: ctc atgaa agaaga taag aaataraaaat to: tgtaaag caatgaagcg tacagttcargCagazzaaa cgaaaat aga caccattgat aactcccaaa atgtactgga tcaagaatat tcctgatgaa aatcagtaga gaaaaat gcti aoci:gcaaca tacgacttca gggtatagca taaagggaaa agcacogga ot~ozagccaa catzcaaaatq :zacactCtg czcagagtgg gaaataaaaac at t:=cag.cz gt--c g: c gCCgcCgctca ctcgtga:ooaaactagaag gacc:cat qccCagggctq aoygaaacaa acaaaaCaca tattoo Catc gargcagcac a aat gatcggaag toacaCatc gtt::cacag g: ggggg9:9g t-acagca:::i gagcgcaa--ca ataa:qaaag atcacaacag gcatztgtag gatc taatta agacact-ca CCacogaatL ccatttgcta g-tgagggatc gaaaact tag aatggcaatg ga aatt tcag aargagttgt acacttgctg gtagtcatzt cctgtccatg ctgtggagcc ggatttcaag aaattattga aggagtacag ctgctc:tt Cgct ttttcg aacoao agag ggtttttgtg atgaaaggag gact Ootgca cacaat-::a cgCatgota:ggr0: zztotz~a ggcaCCcncc ggccCtggCg tcaqtogtgC Cagacaaaatggtcaagoa ttgcgctatfc cacagaaaga Ctagaczaaac aagagaattt agaactacC tgttttatat aatatgacgt: tgcccccco aaqcaattta Otgtgccac tacaagacat taacacattc aggaaaatc acactgccaa aaatCagcac atgaagaaaa gagata too tgatgaag Cagtggggto gtzcaaggta ggtc aat cat ataatattac tgaacat tga gicaaaccaaa gagctccatttcaccaaagt aatataccat gagttaatct gagtaatac c.tgtattgct, aagat!ttagc tgtgctctgc gtactatggg gaaaCCagac ggggaggaca =ctaaccc-cg CCtaacatr- a a 0 0 9c:gcaa cggcgcccgc o:o-Cgtgcgc t-ggtgaagcc aactggcaga 7oCczgactlt cgacaaqaaa :C;CotC:ctac Eagaaagaaao ::cratoo~tg act coccat o tetcttgaa agacagaac attaacg: 03 at atccg aaargac-aa a::caacgtg i:ggagagcc agacaaaoaa tog: oaagcg c-agag t ga Ca otttgaatoaoaaagatcaac ceaaaa::g aactcccaaa agtoo-tagca agatgtaaat aatggggtat ttatttcagt taatgataca toctat tactgtgtgaata:cagaaaatog aactttagza 5cagcaaaac tat goat: t atcaggaazg cttggaatto tatggacoo a :tC-tggtaaee :g9t: oat:c :cxaaaagteag gttCttttgg ggagcc-gtc: t gcaaaaagg gE Ea a z: ugg agagt--ocraa agatcattzia ctgctaaaac tgtgocaaga tcaataacgtg acta-gaaat t attgct acg aggt:acaga gttttggaca gaaccogazoa cctggCot: gcaccc act t gaaatc:-:ac aat cz acta act eat aaag aacctggaaa gccttgaaca actcct.gcag ggotataaag catga cct: a atcctggata atagacaaag gataatccac accgaca:t, tzogccoaara gctgcgtc 9£ aaaaga actcatccea gcaatotc-:g tgtagagc:: zit aat,-a t atatoacccaaa aaaaatogag ,gaceaczaca aaa,.tgca--t t aat: at geacaca:c CCCtgcCrtog gcctgcat tgatacttaa aaaagtgcratgacgqao:t ccacatggcatcagaaaa 0 ggaga t go gacataac tattltogoac catcaacr cic etgaaaat.a g acagact C: !t0Catac -ttaaca tgataggoeoc t-Cagacaaaa gaatacctaz tc to aacag gcgttoct:tz t tggagta-7a Qagc--ttggr: ccaaataocatatgacoc aaggt toc: gggaggtzoga atgataga: cagaaatac-.

tagctgttga cttctccaga tttcatatca gggccggcca ctcagtgoog caatattac:ttggtgcaac caaacacaa ct a CCaa Ca a ggcaggaaao ctgggcacca gatacac,:ta gatozaa.:a aggaaaaoc 9CC: gat:: o0 120 180 240 4~20 480

C,

~600 -72 0 780 8403 300 960 1020 1080 1140 1200 1260 132 0 1380 1 44 0 1500 1560 1620 1680 1740 1800 1860 1320 1980 2040 2100 216 0 2220 2 9 0 2340 2400 2460 2 52 0 2580 2640 2700 t~ttaaataat ttggaaccca aatttatrtac attagcaqaa qcatgcacaa agaqr tcacagt gctaaagt :caat ctcaccaatt ttaaaacaga ccgctczttt aacaatagcz aaaaataaac gaagactgaa actaccaaat ttttctatag aatattaaa cataotttgt gac:ataac ttgtaaacaa

,A

acaat taggt ttcaacatgt tatattttta caaccggtaa ~tttt tttac aagttatgct aagaaatatt ttaaattaaa tcatttgact gaatatagtt- -tgaaargaga cctacaatag tgagc ctatg at ctttgtcaga atgtatatga aagcaagt tg atctcaaact agatatttta aatatcacat gagt at cacr aatgtt gcag t tggaggcaa ggaaataaat acaaacaagga aaaaaagaga aggaaataQr Cat tctggag :gactttt:t ctcttatcz ccagcactg gtaataaata tat tatgtc atgtgaagaa Czcataaaga aatgtgcta Utgtatgtqt aaatqgtaaa oagcttccta tcctgtccaa gtttccaaaa ctcaatzcc:z tttccaaaaa aattaaggtc tgctagataa tcacttt-aag agtt ttggaa at tggactcagtgccczac at at tat ac aactcgaaat: ggcctggacc: ataatatt aactatac-a gtgaaaaatg tctaaagcatatattagtcc tgataqttta aagaaacaat CCCctactgc gaagtagcaa taatcaatac gagct gggg cttaaaugc:t -tCat aaaa 2760 2320 2830 29-10 3060 3300 3 3 63 34123) 3 4 s0 3 5 43 3 5 s2 <210> 127 <211> 754 <212> DNA 3 Horrno sapien <400> 127 gCCz:::c aaa ggcca cacag gcticaqtg:- Ccatacrtcz Qaasgtga aatgrtatccg gaaaa :aztac acaaaaataa azca:a--ta aaatgcaaag aacc::rtgta ggggagoaca cC-ttt-atggt tggatcatct gaaccaagac tgcaatatcg tc'gtc zcaa agtaaaaccc accaccttuct aataccttta czcatcrtgta aagczgtgcatgatgtzcga acctgcccag tcattaatzz aaazaaa:ga caaccactalg tat ct: act tggttacaat Cttttgartat ctCCtgcat.a tgtcattaaa Cctgctt-tc Ctgtgtcaaz atacccaatc tcaaaatact gcggccgc--c :aatgagaaa cagat.ccagg zac-Ccaa tat a: t.acaaaca aaaagttact agctaataca aggaaaagat g: tcaggcgt ::tI-ttaactc gcactattca aaaatcrtatt C:a t -ctc t t c c ga ag gct aagagag attctatzc rgaa tccaaaaattaar--aat: Zatctat Ccatgttt: ccc tggaatac:c atacact:c caacattaca gaaatsaaaa aaaca :ctg caazac:gaa gaacatcct: ttt:.gc::ca gtaaazggca ttgaczacac tgcaacr:ata at ca tagiata atatacac~a 493 C 754 <210> 128 <211> 374 <212> DNA <213> Homno sapien <400> 128 aagttttgat taaaaaggca gaaggagtaa aattaaagat ttcccctgcc cttagtaagt aaaaaacaga gccaactaat ggt aat-tg aataaaacta taqttaa ggca aac:aaaaa arctg aatgatttta gaaagatgat aactcttgat cat t tccaaa tatgttc-a~a ttataagggc tt-gttcgata agagaaagcia :a-cgtattaa atCttttaaa ttgtgaccc ttcaaagac:cz ItCcctgczaa aacaacticac t-ccataazaa aaaataagaa tatatcecco ttat--taacz: CCt ttzcttaataacatct ccaaqccaa:- <210> <211> <212> <213> 129 546

DNA

Homo saoien <400> 121c acqgtaatg toccagoacy octcautt to aacctggtac gagagtgat o aco: ogago a toagz-gtaac tcggataaaa tatCzct" tc tcgaaa aca: cogocag tgcaa=aaggag gcc: actgaL atacauagca qaca:gcact aat ::cca aggart cca tC ccz:go to cac=aaaggct aatt cgggcrcoocctgagc OOccO-gqaq tgaco oootg ttcaagctat tttctazaa g00: ctggo:acattggcait tccacagtgq aagcgtggoc zgacooggo:i cat ocat cog gaatagagtg aoCoaccatt cat cagcacc caac-tgtggc aaatcatoac zzgggggcac gcggcr-ogag aaagcoccac aaoaitcaCcg tgcagcaaag tqctccatca agtgacagtg aggatgagga agaccogccc gOccggaact 000 gcco g ctzatgcz-ag gagaaaaaa 0 :ocaacigagro c goat taagaa aaatggag~ gggcggccgc 120 180 240 300 360 420 480 540 546 <210> 23*0 <211> SI:6 <212> DNA: <213> lricc sacien <400> accaaccgag gcc:cgca ccgcaogco tgccz::cotgg -ccggaccac otczaagagg ctaocggga acoto- acaga acaoo~aoci cat:: -actgc acogtatr:: gccc:coaat ccagacggtg Cag--:jaaa gco:r-o7acat ac::a-cclaa: gcoa-zataa cccaaocoogo- -acaguoac tggac-aaoc ggaaccccga gggz-crtacc :gcoaata caa':o-ccat aggoctoca acgaaauggg Zgoooaoot-c ago::aacga ggaacoaaca ggtoa-actat goagacacoc ato::cocat cot-Zcat-gcc actagcaag :aaatgagca Lccaagcaac taczgoggaa tooca-agoc acaotgacaa tgta_ccrg ttgaacagtg tata-gtcct gctacaaaiag aga::zcagcg aagiggggagg ggc::gtgac acattgagto tgc:cactgc gcaagccatg tccc:gtcartggtgzgoaa taact-goco gotactot 9 ggaccooo gcaacaacaa tctczacccc tgaagcgtat ccacaacaca gggaccoat": ggO::ccaao goc:acagoc tgtaggazgt gcOccaacg tgacczataca agaoggacca qt!t-7a!-gcag gzagtgatcc; agzazaccz ccc:zcagga caci:::gaga a G: gccaac=:aaa aaccacz: go gaaagagzz: ocacoco: 9 ctggctcc:: gaagccgcg caaactggra gaaaacaca g-taac:cca ccaggtgcc~a g9g9999cac atcgocagggo tgcaarcagqz caqggt! -to aagaocacco tt gcaa ccagaccocg ggto-aaaacc gatgtgat~o acactoicc7: aatotggagc 00 cogcat cc attooagoco gt tgggt aca agactggggc ccagacacag ccaattogoo aacgggttca ~CgC9ggca gqtgaacat-g agt~goc: zco gccggcat ct cca gc agaca cgaagczat cattoaacr: caa:ooocaca gatacagacc gatgcoca aaczaagaa Ccccc cc :agcggagac oCCtCzCgcctz -gcaatgg =azggattccg =aaaatcgc: aagrgtzct0000 zaggaccag :ccoa a aacc a :c--3ogacgc g--cgazcagg g~ctatggca czaccotttca ago: ccaatg :::atzto:gc zgtocttcga :ggaaggtgc acgggotocac zccagoogag gagctacar-a aggggcaao 0 cttggcac gagattgotta :ctacaacga gotgctoagt ccggcaccog gccoagtgaa agaattguga aotgcogacca ago go gac :cac:gtgt, qgtocagc::g qaatogago togaccocag ::toagaacq ::aaqt::ag: a aqaqact gag gtogc--czo gaaaccoag czq=ccaac ztaccggcac ga cc: a 9gggCoc!00go o oactataaz tcaagatgi:c gtocagcgc 99cccgcc ccaccgogcg tggtCtaoag cagacttac o oactctgag tOggaatac tggagoocca ctgocaggat 0090 at occt t:oaggggat cogcacgac gaogcoggag Otot gagcto gcttgtcag ccggoogaca gtgcaaagca t-gcaactojo tzaoaagCc-a cacatcaa gat--acgoag :9:agaga caccccCa cagcg at:: t9goaacopaca agagsaaqg2Qj tgcgacaa::: gactccac: gtct gcaacc ,:tgqaccgG zgczcgcaic: catc -acar g aa :c Ot ::1 gacagacoag accacac:: cat 0ca: cat cgaco gcacccg tgcgcttg tgtaaozg:c gagaar--: 0cocgcac-t acggaggagg gatgccaatg ccctgt ccc=: ggoct: a:: aaoat:za.

caggo: :agg gcztaacacg cc=-:1acc 120 180 240 300 360 420J 480 540 600 6 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2 160C 2 22C -Ctcacaggct catcacuca acactaacat tcctgc-cco aggaggccac aagattagc caagggaaac tgaggacca aao~gagtcgg aagcggaag aatzggagaa aaccaagtc.

ttgaagcaga taggtctta agggagtcag tgatcagtcc attocactotc aagcctgg:t tacagaaactg gaaagaagaE aa7-o-agatca gctgctttcc gtacgggoaa zgccactt acc~acaggc ggacaacaga tcagcc-agaa ggtttcagat gc=acgctcQc tgatgcacag gcagattca acaggaga :z ot ggcca: ggaaaaoacga ac~ggaaag gaaggagc: zcaacacargacogrt:t' cc arga( tgg2agacaa( at:: ctcaac ta oZgggcaa aqact.g g9gagrtct tC~caacaaa Cagaatcicaa caagczcto:: aci::tcaagc ac acctazgg cz:otttaa acaaagcaa gcztgggcat tz agaacacc tc:r:tcctCC tccctCcact tat tatt t-ccoctcata ac: :acaaac to :ttgctca acqctqacag t::cacaact ga a cagagg a: ::ggat-tt a graagg:cgaL -aaCqgcctC -act:agagcag gcagagcz~ c atagatcaag aggcz:gct:ac ggggacatz: aztoccatocoa tgacgcagat, gatggaaaa ggaa -otgga ggaaaaaact cccagrccaca Sgctgaccaga cggaagaagt tgctzgc--gg zgatg00acg atgtcgggaa tgaaagaggt aaaaatgatg acccataata catccttcca1 gagtacctac gagttgatg tta:tttgtc acagaacata agctc-tgggtt gattgcaaca cactccoac-t tcct~gaaagc

S

g atgcagctga a gaccacr-acg a gaaagccacg t r-ccaaacaag c ggtagcccgg c ctggcccagc t cagcacagtctttcaggtazg a accaggcata gcacagcac cgtgccaar__ aaacgcagaa~g gccagtgaca agggcaaaaa gggaactg:a Ctggcctcr:7 gagrttgaca acoagagcca ctgcatctciaz gaagagagoQ c atcctaqc-o a aacacccaa-. c 0gggataca Ta gaacara'--!:- a Za 9 gg:c: g agcact:gact: a caaactgoa=c a caaatgczzt t ttgac:::ar- Ctgtggccag gc::Ccz:ccta c gaacagtqzz qc tgcctgc-.- c~ gcaac :taga g~ aaaattcct ac cgcatcaatg t E agaga a c tgtgtgccag 9c :ctagtgagg aa acaagtgc~zg Z: 7 :gttogcaaga cc :gtgcaca- to Jaozgttgag t :tggo-ggcca ag agccuggcaga aag~gaag L9g99ccaaa C9gc~tca t:ogagt-cac cagtaaca CCttcact ggt3gcgca acggtQgctgt ggcgcaag, agttgacaag ggaggcca, Occgcctcco,- ggattcagi -aaajaagcaaa gaggatocae tggatgagtt caagcg-r-ac Ca: tacagaa tagaaaaac trCgcrtaaaag cagagcacaagaacact taaaaacc:t caagaagc catgaagag aac-cag a agcaaaaaq azaggccqg 'Igaqgccc acl::ggaaac caatgtgac c:aaagag:ga gatcraagga aacarqga :qcagaaa ~gaa-ogct ag 9gztcacaa: cggaccagco :cact ~acaagac Czaa:caa( a 09rto a gca gaciggacCac *g-zgaagaa Zo 9 -aa gaa ':::Z-agca ac ag9Zcja a 9 aozagggCca 99 cgcaoc a:aOgzga aq r-za.3 OttactacaT ct acaCTatgt: t go-t cggatatag t~oaacrta,z: Caggca:ga aattot:co: aaaazacca ttg~co~caca :-acaaccc agggtqtgaa gagczaagga oo~gaaaggo :Z:a aa 9ToCL :oggac:: lcg C a rz: ::atocaaaac :t--cggttt caaaat gata r:aczcaca C:Zoagctgg 'iccattac ctCcatcca:, gctggtgg gacacrtggtg iaacaagca t ttaaaaa .oat~gcaa caaccgciozg =tcocatg ggggcaczrto ::Zt 9goa Z ccagcr-t a atgataac accagzggga aSCzatagt cotaczottgo acoaacaa:- zgttacaaaaa C"t t-cotrgggaa aa agtc:gqc-,, t9 iaQacaact-ga ag gcccgcag -9 C-ttgtggaaa :z caagcggaaa ia caaaaagcgg 'a cagaagaatc ~gggagagaga agaagcactga c agagagtt ro a Cttooctacaq a cgcCZ9ggga g gaaatOctcc a 9cagazggag a gtggaaagao oaat gaa: 0caaqacacaa Lagaagaaa agcoaaccg 0 a::aocac attaacat Cogccac~ zo:co'-a gaccccaaa at-aazzgta o t ttaaa:aa aatgccagaa cat got :t=0 aggcccattoc cat:gacactoo act:coracc gaaaagtgzci aatcc:ac:: atczcctcrC gtcacatcca C0t! ccaaca a cat ag tot: ataaattzaa gt ttacaacc act tttagca attgctggag ZcOtatat:: aaaaaa 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 306-0 312-10 31SO 3240 2300 236 3 420 3480 3540 36 CO 3660 3720 3790 3840 3900 3 96 0 4020 4020 4200 4260 4320 4380 4440 4500 .4560 4620 4680 4740 4800 4860 4920 4980 5 0 5100 5156 <210> 131 <211> 671 <212>

DNA

<213> Hco sao-i-.n <400> 131 aggtc:ggag ggcccacagc t t t tcac-c cggttacaat cctgggcagc caycacgagg tc-cciatgc:- ggtggagtgt ccatzgcact ggttcatccc acaazgaggg caagacccct tgcczagaag ccaat-gggtg aggaratcgc ctagaatatt gaat:c -ctct ttcgccatac cc~gaccctct cctgctcccc cg--gacaccg gagacaggtc ttaaczgcta t cggatgtggg acaccgggaa gtgt tgcaga atcatgac!:c ttgttgacac tgragtcctgt ctgcgagggt cacag:gatg caaac tgaat agaaattgtt aggaagoagag ttcttcaccg cgaagtcc _gaaaataaa ccccgatgaa ttccaacgac tcagaccc atacgaacgt: cacagatgca tagccagatc gccaccccg acaggaagtg aaagtggtca gatgactgtg agtgtgcagc cgccagtgt t caat!ctttgc Z:cgaagagggc tcctgtactt ttgcaaaac ct--ctggtq tagcacacac acccacacc gtcCocaat tcagacccaa CCcact gaaa tcggtccaqg gcacaacaza cttttccz"c acaggacocc cctgCacg:- 12- 0 180 240 300 360 4 480 540 600 660 671 <210> <211> 212 132 590

DNA

Homo sacien <400> 132 ctgaacggaa aagctzatog ct7aczca atz gcttacccac gcztzatccg cagccccaaa ttza::c cag atatatcaaa gaaac-tga acau::tcca =C-caccacc *atzgaaaaa ::gr-a cgcggcaggc caaaaacact a;cacaaataa at::c-aogaa cagc7-aagcc ctgcaagccc tgaaagtgac &tcrtgtgatg tgtgctcacc E ctggag-gaa cuzcaatagc gcaacatat:: cac-agtaac:, cagtggtcct ~Ztatcacc tgggcaccgg agtgacctcla: attCagtga agcggc tcaa tcatcacqtc aitgattuatq cagcc tgaaa gtagat sata cczgagat.:3 -aai:c:aac::ac-t ta caccc cocgcctcca ccagcggaga 7acaggagg Ztcag::aq Zta caggtcia CZt Lagca Z-cggacagc zgaacaatac act cagacct tqataaczcattg-c~ t'taaac::c aatt c: aaatg::aaa cgacac: ato :Cc a t agt: c::gg c c a t c 120 I B 240 3 00 42-0 480 54 0 590 <210> <211> <212> <213> 133 581

DNA

Homno saoien <400> 133 aggtcctgtc cgggggcact actagtgggcc tggagataaa Ctgtcctcat Ctctgcaaag atgc:c-tggg gagctcatgg tgggccaggg atgaatattt gggggagaac agaaaggac tggczggata tctzigtacta aatccaaacc atagctgtct CC.-7agac tctcztccctg ggctgaggag agtatgacat gagaacc ccc act tgtctcc ttcagrcttcc gtggaggagt gagggataaa t gggc tat gg aaaaagoggc gtccagtact ggctaaggca g1-g9ggagag tctggaattc tctaccacca tt:ccccaggt ctccaccaga aattgtgtaa gaaatgat-.t tttaagaacc ctcttlcctgc ggggaggaga gaccagacc: titggggggtg OcCtgtaccc Ct-Ctgtgcac ugggaggctca gagccaaaga caataatgga cacttcctaa ctccagctct cgagaacaggg t tggggaaag tagcczacac tctgt:7:og ggggaczga: attggzagta coggaaca tctct gc cccaa gc:z t tggzcaga 120 180 240 3 00 360 4-20 480 54-'0 581 <210> <211> <212> 213 <220> <221> 134 4797

DNA

Homno sacien msz:fe3 ure <222> (1)..(4797) <223> n C or G <400> 134 ccc aggacca ctgzgtacct ggagcagcag ttcggctac tctccggctc ggc catgcct cac-cctgcct ggggrtcgtga t ccagaaggc ctcactaaga c ctcatcrgc cacagagcca tgtcoaggact acgtggczc rccatccctgg [c.ggaagtgtc tgtgcgcccc gagacaggcc gagc ctagcc gcccagcgc a:cc cc a c ct :gccc a cag gtfcc ccacgaa agiaagggc ccggagcag ggcctzca acg catgcagccc cacc:ccccac ctccagtcag :-taogaaatc.

ctgcgccatc ccaaggcctc atcacccaag aacgttatac gctattIcata ccaaggtccg ttgggtgcac gtagtgcxagc ccc a cagg ac tqaccgccgg ggacaggaaa gc-C!Cctgtgg cacgagagcc t accagaggc cataaagaag ggccc accag cccccccc tacccticccc cacggaat~cq zagggcacca aagtgctgcc gtgcagcaca agacncgcca taatttgccc aggtgcaggt gggggcagtg gccctgtcc gctgc-.gtta cccagggcgc aacctctqga aaaatgggaa gccaaggtgt gggggagaga tgagtagacc ggaagtgacccgttgttgga ggqataagca grcacagaaa gcacctgaca tcaactacc': zczggagcct tccccaacac cacaccccct cccaccggcc aagoagggag gaggccaccc acc-acagcca ggccaccatg acagaogatg ctcccagcaa gagtgggttg zcgtatccct gcagagcagg agagggct cc cagtcatttt caaaatgtgt gagttgatgt ctgagtgggt tggttgctgc ttcacctttg aaccagc ccc gaggtgctgg ggtcagggtg c aagga gcc g ccicgtggggc aaggacgaag aagcccacca c:gCcactcac tgccaccagg tbaooctac cagagctgag gggt aaggtg agcctc tactcctgaaga:c gaggttgtca gtcaggcaac cacccaaccg aggagagccc nctoctgcac ac-ccccc-ca taatacct:-g agctccc:a agcccctuag t caggaaaaa L agcggaaac aaztgggggcc goat aaccac agcttc:cc:ca cacacaa tag tgtccagqza cccccaacc ccacc:Zggaa taggac: ac aggctgtacr cccgacccaa ccacggccca agacctcaac gaggt cczc caaaaggc: cgtccclaacccc caccaggaag acagactaac caaactcaca atttatagct gctttgtatc ggcaagaaog ggtggcaaag tgctggcggt aaacct cagg cagtggatca gaggt gagt:: gqgctgacc-a ccgaactgag z c attct t zg c gcagctacc c aacaggagga taggccccca cacctcaggagc: cca aca t aacc 9ggcccggag agtcccactca catacca tat aagacggctctgggggcccc ctccc-gtgcc gctcccaaaqg atgcrccggag gcaggctcat gaagattat: acctgacaag tccaagctcc ctaaggaga czgaaagctg t tzztcag agcagtcatcT gotc-Tcctag aaao c agc: acccaacaca tg:9 =tgca ggaca Cgcag aqc;cczC ccc ccaaaa geagaccaca ggagc-ccgcc ccc: gcagga tgccaccgag tgggagcag ccggcactcg acaaggcaca tatgagatca atccaaact: cgcggattt actt-ttgtg cccggctttcc atcagggagg gacctggcca ggaqaataca gggggccacco cagccaaggc ctcccccoc tgtg-gccc:g otsagaagag attcc:atgcc acocaz cccag ccaca toaca gctgtcc-agg tccgaccc tagggat-gac ccccaccca tacrgagcac gcaatgccgqa gtgaggtgaa attcaccagg tgacccccga ctcggagc ctccccac:t:.cagggaaac gcc-aaooaag caaggt agca ggagggc gg cccctaagag gcaicctgccc-: tcacagcc-g gg~gc---qc cl *ctcacgg cagrcc cc:7ga acctcccacc cccagccaag agggctgc:u gtgagcgcc gcaggcccc-a ggggccgc:: gagcagaagc gcagcccccg acgctc acac atatccatgc gggccctacg caggagc-_gc acCcaatctg gctgtagtgg ggggcct cac ggggtag:c cactgctt:q ctacctagccc gtgggt!cc:a ccgaaacaaa tgacgcga ~cctgaagaa cc-qacz cCz: agacc a cca c: aa:gcc cc agaggaccca rc cccagcaaa ctgacaact gacqgcaaca gzaczgagcg ggagagaat agQctgcgagc aacaacztca gcctcta :Z t-=caaqgcag cc cacaaaaq gacgoccaaag qccagcaag ac:occc-ac--' cgzggc:cca a~t::cacc aagc zacacaggga ago cggg t c cc ca c cc:ac:cccc cccacgg caccc ca_ aocga c gagcg cccogtcac cgaccctggt ccctaccag ccgaagagtg.

aggctccg cgatcctgct cccgggtca zccccc cctggagCC aggccc ccc :cigggac' r-caczgc a 5 0 i22 240 300 360 4 480 540 6 JO 960 240 2.800 92 0 20430 23 2400 1580 120 19C90 ccatc-tgac gagggggatc ggccgcnqag tcgaczzatt: act-tctgagg tggtcggag ccaaactgg atgtgtgcaa ggctggccag catgcgctca aagtcaatgc tggaatcct cct'cctggaa ggccaagttc attttccaaa ttcctgtac ccac:a=a cc a a cat g attctggttc aggtcacgtaq ccaagcccat gctgzggtca CCt czcac cC tgacaacqtt atvcaccacc agcgtacgac tcggtttc[tc cgactgcttt gctcacacac tggcagggga ttcgcacacg taaattaagt acagcatcag aaaccaaaat cagggatgg tr ccaggctgc gggccatgct tgggactcag cczgcaggct at tgacaagg tccattagct gagtgatagt agtagatt t cgc- -tcgc tcagaaact cagggtccct gztc agccaa ctt:taaazg caac ggaggz ggczgcagag t cacicgactc a agocaaggg tgcacatgac caaactgaag qgacctaaat ctgtagcact caggagu-cac tttcCtct:ag aagttgatzc ggcttaaaaag gtaagct tag actatctztc c t ggggccg gagzgccrtagg ccttoaQaca cacgcccQt c ggtgtclt-:gg cctgtqgczc Cttttzgc:ct-r ccaaatcc-aa Ctct:gtgct:g ggctc-qaa!tc ctgtqtatcct Qggttzazaa gcaaacaaaag gtgclagccga gccagaflncc cgttqgccac aacctg:tc tcgggg-Zgg caagccagag cggczgc--gt cagcctctcc ggcctcatgt tactggtagg tttgtttcgt ttctttgttc ggtatccccc aczttttttt 7:ttgtgtgtt tggtggcccc ccgccctt ccgctgccac gagaggactg ctcctgtggc acagagctgg caccctgggc t gg ca aa act taaactttaa zgtgtgacot :ctggcctt gCztttttot aactgatgtc gtggatggcc 9gcctacccc aacccagggt tcclaTIgtg :9gtatt-c-ga .aaaaggggt gtaggtt cat ggtggtggtt ccaggtccag ctctggagq ggctggaaga accaagcatc ggggaggtct atagcccagt catcttgctt L -ttttttaa gtctcttgag gttctggtgg caagcagtcg gt tggagaag t agggagggc accgtctcca ctctgagcgc cct gggctgg ctacttaatc :ataaaatrag gaccggact:cgtcttrcc': :t tggctgaa aat ttct.gtci ccaqcacagc rncagacacz:: cctqcactza qgccagtc:c tactgcgac: cggctgacca :zgtgtaacg agtctctz: aatctauata agacctzgrtj ccctaatcc-a act agcagaa tttgtcgctc tgttgca tgcct-grtot Z: cccgtq:aaa ggcacQgacc ggggczgcrt:czccatccaa aazcaggaat caataogt:z tct--Zgtgaatg ttztggaaac tgqaaCCzz ttcaacca tagatca acaataaacg ttggc cc 3120 3180 324 0 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 -3960 4020 4080 4 14 0 4200 4260 4320 4.380 4440 4500 4560 4S-23 4630 4740 4797 cc go: cc gtg ggacggtncc gtacz--gtca tzzcgggcaa <210> 135 <211> 2956 <212> DNA <213> Homo sapien <400> 135 tagccgcggg tccccgagtg gtcagagtcg cagtgggaat cgcacgcccg tcgccacccg tggaccccag cagcaagaag ttggctlccct gcagtttggc aggauttcta caaccagaca tcaccacgct ctggtccctc tctczgtggg cctttltcgtctgctggcctt cgtgtccgco tgctgatoct gggccgctc ccatgitatgt gggtgaagtg agczgggcat cgtcgtcggc gcaacaagiga ccggccc gcato-gtgct gc-Ccttotgc agaaccgagc caagagtgtg zgcaggagat gaaggaaaag agctgttccg ctccgcc ocagoa gct gtczggcarz caccgtgca qcagcctg agcacgccau ccccggaccg cgtacccggc ctgacgggtc tacaacactg tgggtccacc tcagtggcca aaccgctztg gtgctcatgg atcarcogt-g tcacccacag atcctca-.cg ctgc:gcz-ga cccgagaactc ctaaagaagc agtcggcaaa taccgccaac aacgct=-t c tatcgccacca ggagcaggag gagcacgagc gcagccagag gcctcatgct gagtcatcaa gctatgggga tot tttctgt gccggcggaa gcttctcgaa totfactacgg c-ctttcgtgg 7ccaggtgt:ccatcat ct: cccctozc :gcgggao :gatgcggga ccatocat: :at r-tac=t: Zgoct ccc accaaacgac ctgagcgga cc acc agcgc Qggctgtggga tgccccccag gagcatcct-g tgggggcatg t~tcaatgczg act gggcaag cctgaccaca ggccctgggc coocctgaac cat cccccC gct cat caac agctaacuzcg gaagaaggtc cgctgt goc cacgagca-:: ta oca ggggg: ogg9a gagcgccgcz aocgctocca gaca'gtgc aaggtracco cccaccacgc attggczcc: atga'cgaacc tcctrzgacia ggctt-Cggc accTcacc ctgc~ccaaccgcaacaggc cccacczcc acgccg:tgt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 114 0 ctqtcgtgtc gctc-t:gtg gtggagcgag c-aggccggcg gaccctgcac tcgccggcat tacctgga: E gggcCct gg cagctgccaE gcttccagta tggttctgtt atgagatcgc agctgt tcca gcctgctlccc aacctgacag ccagaa gaat aaatc-tattc atatcagcc: gagggtggag ctIggacctac gagggc:a caztaggat t cc: Qagacca gccgggttc: ggccctgc tgcaagacat atacctgac tacaaacggc ttaaatggg gactcaggar tt9g=cc at-cacatatt aggczr:qaaa ggccggttgt artc ctatczg cc.catccca tgccgctgca tggqagcaa cttcatcttc tcccggcttc tcccccgggg agcaacccta atgtcagccg aczcaggact agacaagcaa gaatctcctg act aagccc: ga ctaagca tggccacccg rgccccttcc gt--gggagca agutctccct:c aaact: cactg ttatatatat aagccaact tggttqt:a agcgagacag ccag-lccc:c gcttacccaa tgazagtzgg tcgcat tat: gccatactca :aacc agcatcgtgg cacta tggttcatcg r:ggczc ggcttctcca actgga ctgtatggtc cctacc acctacttca aagtc cggcaggggg gagcca gctgattccc aagtgt aggatctctc aggagc agccgggcc!:- Ogggct taacggc:cc aggatt caggttttcac aatttt tqcccacatc- ccaggc gtcagagacac -=gcct cacactaatc gaacta ttctgctggc ctggat catc!-'ctt. c c a ctqgaaagca= gaagg acactgagaa ccacac ctcaaaaaara :ataga ttttggtzauc aaaa gtaaacacac 7acc---c aaacatggtz: :zqaaa aagtaaa:aac attac acacacacc...:az gaatat-ar-ac at:zczt tgtzcaaaaa aacac: ttgaatgtaga aaggaa t cac ~aacc Icctc ~tclt :ctga gcca gagt 'acag t taa ttta z t-ca tgaa ctc acca agag tatr taaa act:c aacc a git gctagcaczg c-ttgtagcc C: t-cagccag aaatttcact cat cat ct', gactaaaggc aagtgataag cgccccagat gcagctgga:tct ccagcca caaaagcaag ttactgatr ccctgaatgg cacccagcza ctacaaagict ccactctagg gggaagggcc accatgagaa cctaccctgt tIacagacact: c-gttact:ta tatggat--ga actgcaacgg z cctc- t1acti t ig a -a r zca ttgtgccagc cc cat aggc ctggagcagc ttcttzgaag ggtccacgt a g~gggcatgti actgtgc:cc cggacct cg acacccgagg caccagcccg gagacctcca gcaatgatg actgtcactc tgttat:t:a: ttccatgca:: atctgtagg tctatcccac ggt-caacc. tcttrtc::z3 agccctccacr gagggc::ar_ tgtgtacaaa aagt tatac: cctaaacaaa ggtagaaa cttagac-: 7 a aa aa aggcat: tat cgtgacac: c 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1860 1920 1930 2 0.40 2L1 C0 2160 2422 0 2 2B% 2340 -A4 2 46--0 2 52 C c- 2640 2730 2760C 2B20 28 <210> 136 <211> 356 <212> DNA <213> Homo sa-pien <400> 136 ggtggagcca aatgaagaaa aagcattgat gatgatgaag tgaccacaca aaacagaacc agtgctactt cagacaacca toaaggaaac tggaacccag agaagagacc ccacattcta atgaagatga attttatctc aggactagac caaggacgac aagcacaccac caagcacaat aagagacaga cagcac cat:.

:cagtggaac rtgatgtagac ICCCCt cat: ccaggcaact cacctcagtt t caaccacac ccaagccatt agaaatggca caccatgagc cctagtagta tttctagatc cacgggcta: caaatccgga ccactgc:ta at-catgagga c a acgg <210> 137 <211> 356 <212> DNA <213> Homo sapien <220> <221> <222> <223> misc feature (356) n =A,T,C or G <400> 1.37 qcacczggag aagacattlt attataaaz:r:c: agcaat oaaaca gtoactggctl gcccccggaa ctatgtctcc cagcaaggac cclttttco aaagacatcg cgctaaggcc aaanttccag ggacocaaac totggcgcgg cagggcact g agaaactcag gcgaggc aa t acanayggcc aaacacangg ctccatggct aaaaatcaat ttgtgccct gggccggtrio gcataagctt Ctgtttgtgg cctctottatccc tt tacctcgg na taggggan gnttcctgrg tagtotgtgq tcatzcttgt cccgcgacca cccaacttag gggaaa 120 180 240 300 <210> 138 <211> 353 <212> DNA <213> H-omo sapien <400> 138 aggtccagtc ctccacttgg aatagacact tacatttotc tacattgatg tggaaatzgc aatgccagco atoortggcat ctccagccgc gtotttatg: gcatoggagc tcactcagac cctgatuaga tot tgtagga tgctgccacc CCtaaccctc caagcaacat ctcgsco-gsg agtggggagt~g agaaaccacc accacotc-t gagcaggctq cttgtactoo mssmccz:am gcaagggacg tgtccatoo-a gaagaggc: cggtaagt ag tggttoto-tag gcogaat::z tttotc=:Q ctgactctc ccotqatcc cgatctcog ago 120 180 240 300 <210> <211> <212> <213> -139 371

DNA

Homo sapien <400> 1-39 agcgzagtcg cggcacot acacatattc tacacttcaa aaccttggaa a(ggtcactga tttccagtg tczacaaagc actatttgac acagtggatc aggat-tggac ctacccgggc actagtggat c coat Oaaa a agctttagg a a aat Otto a caggtgaga tctgtcoac ggccgcz-_ga caagar-to-a oaa t -c -c a t at tga t zat: a.Lzgar coca agzgggaacoc aagccgaat:t aaagazgaaa gtgaaagz ccagc-acaoo:z aaacaaaca tagqtccgacc acc!otatoca atggaaaaaogtaaagarcgo ggcggcogcc <210O> <211> <212> <213> 140 370

DNA

Homo sapien <400> 140 tagcgtggtc gcggccgagg tgggagccag ggcagatgtt aggaactgco tgagtggrac aatagaggta tttttaggct tgaattccca agccctgcat agttaacacc caaaaaaaaa gcacactggc tccatctocc gcattccccc tttctcttoo atttttgtaa tgtacagcoc aaaaaacctq zt tggaaot gtgtccccgt tggtaacct ?.atggctct cocactococ ccogggco-go agggggctac aaatgtggga ctggoocagc ggtcaaaac tcaccaccta cgctcaaaag tagtgggaaa cc acaagaag ctcatggcag ccctgtagc ataaaaaaat ccgaactoca <210> 141 <211> 371 <212> DNA <213> Homo sapien <400> 141 tacaoggtc accac ogaag tcttcciog :acc-tcac acc atoc t:aczag.oga accicgraagc aotooiaggag ccctcazcca zgtggcaqgaa acagccoaca tcact:=7 aaggagcttc agggccctgg tactcctcca cagaatactc ggagtattca gaqtactcac catcctcagg gggracccgc tcttcctcct ctgcatgaga gacgcggagc acaggcacag cacggagctg ggagccggca gtgcctgcag cataaccagg gaggggtc-gt ga~ccagacq cgatgaactg gccctagcag gcacagcact qactcatcrc ctggcgacct gcccgggcgg cccfctcgaag c 180 240 300 360 371 <210> 142 <211> <212> <213> 343

DNA

Homo sapien <400> 142 acgttttgag gccaatggtg tgtcagaaac ctctttgrga agagcagtct tgaaacactc gtctZcattg gaaacorggat tcttzigggat gtgggcattIc aacacccttt Ctgcagaatztaaaaggaaa tgtttgcttt ttttgtagaa acctttcacat aacccacaga tacaggtgga tat ct tcaca caactcacag ttgcaagcg aaaaactaga ggagaacttc cat: t:agagt: taaaaactag agtrgaacat gacgattgga cagtagcat~t atttgataa gc atggaagcar: tCctztCau tCgCt~atgag ctcagaaacL gcagttt:3aa 7-80 240 300 <210> <211> <212> 143 354

DNA

Homo sapien <400> 143 agg-_ztgacg gcagaaaaac catcaagagt gggataggaa gtggtggagt gtgtcatgaa aaatcccacc atcactvc-tgg agcaaatctc catac--gtt cataaacatt ttacacgcag tcaaaczqtc ggaaagcaca caatatcacc acaggagrta CtttCttitt ctatttcaaa ':gcaactrta ataacaagaa :9t act cgqa at taagagaa Cttttcatta grtgrgt tgga CagagqgC Eia-. gda aga _tatciaaaa :gaccaagcz :tgtgt: rcaa ttaatzagga attgrz:cacy tgggaaa: :a aot~aaaataa cagt-ca atg ttat.-zzat tcau 120 1313 240 354 <210> 144 <211> 353 <212> DNA <213> Homo sapien <400> 144 ggtcaaggac ctgggggacc cctagagcac atctggatct aagatgacag actaagtagg gt-taagttgc ttaactttca gaaaccatgc cccagagaag aggtttgcct gataccagac cccaggtcca cagccccacc attctgccat ttctgtctta gttaagtgac CtgtggCCCC gcagccacat ctggcaaccttagaataat cgatagtctt ,c Ct c tt ta acctcccatg gattctgcag tgcctgccta tlctggtatcc cagaggtggg tggagccagt caggtctctg cagacagoca gagaaczcCC tgggcgttoc aacagatgaa gttccaacc_! C gg 120 180 240 300 353 <210> 145 <211> 371 <212> DNA <213> Homo sapien <400> 145 caget :t gtc ataaacrgqt czggagt:tc tgacgactccc~ctac aatgcacca t c tzc-ctgagac trgc!tagcct ctccgttgaq :_zcac-,zaqc -ttctqt.:cz coacag== at:Q gcactg _tgatcacta zctt::*tgcccaca: qzacc aacgcaaact qcaagaatca aagccaacgqc caagaoaa cgcao~a tcaocaq tggaactgg ggtgccctta taggaccaga ggttgtgttt gctccacc-t ctcgaczccc atgtogagacc- tcggccgcga ccacgc:aag ccgaattcca gcacactggc ggcccgtziac tagcgaatcc q 300 360 371 <210> 146 <211> 3 58 <212> DNA <213> Homno saoien <400> 146 ggtcczccgt caooatagcg ggt acqgaag cggcgaggaa cgagaacaag tggtcacgaa cot: ccca agt-aacaacg accgtctg gtaacagrga :tc:a taaga aaaaccaca gaggtgtcgg gctccaaggc gcc'ccgg aOCtaqaatc ttcttcaagg acgtac:agt ggct tggccc cgaattcatt ggacatcrat zcagaaggcc Cggggttggc catggatctt cagcct ccac gtcggaggga ttggcgatca aggcatccc: atcccccaca ctgggaccza cttcgtctc:aatataaac: acatcaccaa ag~ctgctata r-acgggczoa gcctc 120 180 240 300 355 <210O> 14- <211> 355 <212> DNA <213> Hc.z: saoien <400> 147 ggtz:tgrtac aaaa:gaaga tactazcac gcTc:otga~t gc:zgqctga ttgttracgag caaac::gac t:c: caz aata: gqgaa cagacaacac tztgaacata "-caccaat:: ccgaacagca Ctttgaaaca aacat t:act ac :cgt coca t tocactcaa accaa tggc: ttat oat:to caatctaucc ctgtgaagat: atcctaocca aaaact-zatc acgatoatcc g-.agat:ac::z- aaca!:cat cattatgagg *a:aaacwc:gc ztggcac--c: tccag 6 C 120G 180 240) 300 <210> <211> <212> <213> 148

DNA

Hco saoien <400> 143, aggtczctct c=ocowccc caccutzctt catiar-gcgg agggaatgtg c-cgagggc-t atgtggcagc ccor-cttctt gctgcagcag cczczatcca gaaaagatga gagaagttac act tcttca ctc=:gcc gaagagtgct ctgagaaggt caagtagctc gcct~gaagat agactc:cct agccaagtga gcaacccagc tt-ctctcaca ttgtcctgtt cqacatcaata grggcgacccc agacatgczc cctagccaac tctagaaaga gccctgggag cacagaggaa gagagcttac actt-cccct~t accgcatgag agcgcz-aag ttctcaaact gaagagtcag cattoccag 120 180 240 300 360 369 <210> <211> <212> <213> <220> <221> 1493 6 2

DNA

How.c saoien misc feature 1. (620) n C or G <400>14 actagtcaaa cacgtttatzgccaatat t gtgaaactca ataaggtitaa tttcaagccz gagaatttct acatctctaa ttcccttaa agggtt0aagg aatgczaaaa ttttattatg ccottatatot acacotta tttccaaata aaocitgttaa tcgaactat t cat taa atcc gaaagtacta gtgtoaaanc gtgt tgggga taatttggga ttlttgtgaag atccataaca aggtaaaaat graatggactz tgaccaaaca taaggaaagc ctgaatcatt tttcatggtc atttaaaatQ gaaaatatcz :rtgtcttt i:tataccac zzaggt t r-cca cgtctgttaa :tctaaaaga aaaatcatoc -att t cact a caaacctggc aaat :tccct ttcaagtagt Lcactaatta atzticaana anatttaara gggctaagga aacgcaaaaa cctaaacgca acgctcaugt tgccacantt CZ Ott taaaa gt tat a: t cctatac:tat naazacacac arCtgac :aa gaagaggaag aaaagtr: tat tatcac 0 tat tnactccgat agggtaaacgc actctt :ana 120 130 240 300 360 420 480 540 600 62C <210> <211> <212> <213> 150 371

DNA

Homo sapien <400> 150 ggt00gacca aaac:gcza :cc!ccaac gagcaaccag tatcacc:cc czgtt:ataa atcactgaaaa ccacctogtc tgcatgtacQ aaaactaat ttcagggact catttctaua acacgtataa gg-tgaaattr: atggtar:tg tcat::tttc;- cccagtgaat gacctagaat tzacttttat a acztacoaa a-acctctaac =oga artt.2 0 :::rcaca: a c tacaac =:at goa togccgaroaaa cac::=o yaactc!o:ic tgtagc a: a aaaacacaaat-atacacra Z aaacatat 24 C 371 <2.10> 151 <2'11> 4645 <212> DNA <213> Homo sapien <400> 151 ggactoc- ag ttcctgt -atc gggctggcaa aaccctggag acatgtrta ccggaaaac tcagagctcct gaacagcacg ataacacaga ccacgcgcag ccaccttcga tgctctctct cgcacagttt cgacgtatcc attccactga actaaagaaa aggtgatgac cccacctcc: ctgagcacgt cacggaggtg acgagggaca gattgcccct agtatgtaga agatcccatc aggttggcac tgaattcacg gagggatgaa ccgccgtcca :--cgggccg acgctgcttoc cggatgaaga tagcatcaga cgaagcgccc gtO-zcaccag gatco caga tgaugaactg tggtgaagat caaagaaatcc cgzac aggca acagcaacag aaztioccatc ttc:atatgat aaccgc-t tc -og gagczag coato~cctga tococataaga tticttaagta gazccata:i ccagaaaaaa aatoccca ga gaccagcaga aacagcgtca ccatcacccg ttccagcagt ctctactgcc cag~ggagctg g~lgaagcggt yctagtcatt acaaigaagac acaotcttgt atzttaatca gaggcccgga aagcagcaag aacacacati gtatact"L3ctggaactca caccagcacz aacagct ccc o=oazcaac: c-oaacat:c =gacagcacc z::caattag -:cagaacg ::ggcgcccoo Z ::catoccc: cgagcaccgc aaattgcaaa :-:atccgcgo gccccaacca :gattcgagt agago g-gct Eicaatttcatz :g t a act ::trgtgct:oa -::caac Ot at ocaca: :5qgogoaa ogcagt ac: =aQcacztac tacc:: c tgaa c:o7agcagqc= ccatga:gcg gcaaaggo:! at gatc-aa:ga go:acoa a c c cc z cgt c gcrctacgca caacaccgac ca ago cggc o gacatgcccc catgcctgtc tgagctgaac agaggggaac qgtacctr-ac gtgtaacaac ggaaaccaga -caggaaga O a ca a a a a cla cat o a:c ccgcgacac: ~tctoaccalc tcaaaaacaq caaaatcgaac caacgcco:o: tacaccaaoo accagccc cagccagc: tacccacoco acccggacgt atccagatca tacaaaaaag cgtgaa--c agccatuzocc gagccaccc agttgctcg gatggcaag gacaggaag ggtgatgcta aagaaatcaaa ta3tgaaazgc acaattaaaa acctcaazac agcataaaca act cc:t caa 120 1 3 C 240 300 360 420 480 540G 660 720 780 843 90.3 963C 1023 1080 1140" 1200 12 63 1380 caco:cacazg ccaatgcoo:c gagacatgaE ccticccactc cgaogct ggo atcagattgE gacatgc~at ctoaLtccr: ggggicgagcg cc: gag actga gcaccaaaga Cccaqcc atotgaacctg aczgua gctt Eacagagatcr atacaaatgt aacgcaatc EEtrcggag cagagot :aa ct:aaazacar: a a aact gtag Etraargartg caaacgt= ccactrcoaaa Cacoagacac t taaaaczaa gaa:r-t gaC aor-gr-cat: -oa-aagata aatat:gttt tc:azaaaac agzggtgattr act gcat:car: aacccagt t: agcaagagaE tcaaact ttg Ettl -goat cat :gcacat ggtaatgtgt gtattEtgat aco-,tttttt aarcaagaaac tt=ttttaaa taaatggta aggggaagaa tgctgagggt tagggccttg cooo::actg ataagggta EgO ggcctca ataaacagaa aatoocctcaa t E oaaaaggta tozt: at g acaz=aata itggactcacc icacacoccccE Tcrtgttoac= Igcarccacrtcc czggaagggc gccagacccca Egti a:Egat gtggaaEgac ggagggggag ctaaaagcac ctgacttctz gcaz-ctaatt gccartggcta E czc actEgac ataaatatac aaatgaaaga c z gtct at a tac:acactg gccacatcaa acacoattc atggz::cacg L -:agttt: aacaccogac cEtzatottac a r:7: c -ictac taa7:cga:t: aataaztcagg t C 0 oaatgraa gqzaaatgc:t tczgcatqata tciaaaaa tat t: tt ttt ccccrtccatc aaazctttca ggaaaacacg gcatgcaaat aagcitcccat ggattgcctc tattrttttt atcgtttttg aatgctacaa at:ttgtatg ataagcactg Sga a agc tgr: ttgaataaac gaaatcccog gcz:zacotcz aaaggatagt gc7-caatgca atzicaaagca aat-aacagta tgtacaaaaz aaa7 :aaaa cccacccagg CctccgtartC tgtczagract atggatcatc ar-cc-ggacc agcagtgcct gcrcgc~cgar: rtcaacEEtg tgagcctcac tcctgcEtaa acigggaagga ctgattcg ggtagaagtg t ttcataaaq agtatagattaaattaqagtti Ct cct t cct gag-tgacga t acooc:ca gt Etttczoagt ttggggtgat Cggctgggaa gtcatotatc aatatzaa:: cagattgact gggatgaatg gt'aaatagga ccataaatto- Eottt-tgtt~t gaggcttgtt aaaatarga aaccggcaaa Ecccttaggg tagctgctgr ttaatgacaa gagctctgaa EEtaacttza tgaaaagtgt EtcttcEtgg taEEEtcatg tttaagagg ttaaagagaa taaacttctg t cc t gg tcc ctaggactc tactgtgtct ECatagcagc aagcacagaa gttagot-gaa gagtttcat: tgtgggatat Eaagcaaarcg qatacaEttz gagccagaag aataaacaaa cacoctoc ccacagactrg at: :cacgac Cggcaagtcc acccg caqCot c a ca gtCa g rccaccctccg acacggatgc catgtgagct zct tcaaagc gaagtaagag ctt-taagcct agcaaaaaag catgtzcacc tttgggrtagg acact7tattg zaaggggtat garcgtacaaa aca r:cca c:: attgctrat-at -taatccaoat zgaaaaaaat zaagcacatc agaaaacat aact:Caaata oar: r:a tct atcaotzcaa ta::-graa gotaaaractz tacCOrEtctc gat-.ggtt: agt:: EcagtL aCtacccata tgctzaaaco :at Eccagar: atot toccat aagcgcaaaa utatacattt gatagtggga aaaataccat ggagggaagg tgagrtccrtg caacaagcat t agraagaag caagctatgE.

-atggatt-g COt act ct Octr acocactaoaa aaat: gaaaa zaaatco!-t O-gaatqgr:aa o:aaaagt: :taagcortoa ccaatczaca aaC -a cccact CEC cagca E~cc Ccaag gc gaaaatccct ccacgaar:: tgtggqctcC c-cagacca: tcgccgcaar: CE ECCE at 00 ct: Ectccca gcttacEttt tcaaaactat agtrgggtgt CE Eatactcz gggcattEgag accat E E ttt catgtar-Egg: t ECtEt caac ccattgcoora t Ez tat a Ez tao Eataagaaca Ecttaaaagg a'3taac coo: Ett-gctgcca:z cacar o C -gc: a3gE-- tt Baca aar-gttgaat aaa!tct ttt Ecytt taaag tCtotraagc CCtgtggcaro Egtgqaaaq gacar-gaaag act t-aaacoa ct ttcaaaaa gcattclzggc gggccagcc!: Egtgtgaaat: E Etccagaac ttagtaagaa gaaaguttt at Etcaaagt: gcagct: ttgc acaaactgoo: cagtactat: gcact agcoa- E-gagtgtao-g agtgggC!ooa gqtt[o gr-:: Eacototr7: agggar-atz:: Eatatc:::ggtCE OCt at tz! artgccatr-oa agttootctag iaccaooatoz: gagcaatttoc tcctcoCoCr-t agtgaaacco EcEtoocac aagcaacagc ctctcczaac gct 00: 0CCC caccctaacc agcttgcaa ctcc: :aac~c aagaczataz tar tct:r:a a aaEtztao:tq gaacatatc tot! t: zga t: !tatazacizo tgaca-:::c: aot ooatgtco coat a Cgca :t aaa-:taa r:a caaa ccq a acrgt-or:caa gtcaac::rrt ctgtac: aaa aagca--azar: acc -3at tacaatag aaatzzcac raacoci: gag gtccoacag agagt:ooo: cataacao-ac caagqgorgt ggct. o:aaaa Egcacacttz cacact--gaa taccacartca tEtttoatta tttgt:atac aaacccatta EcoctoacE: caggt aacac aagcoazagca agtagcoagg atggag:c ggagaogt: ttEtC::gQ: rtttrCoatta at: aa:qzzi aaCo 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 204 0 2100 2160 2220 .2280 2340 2400 2460 25 -0 2580 2640 2700 217603 2820 2880 2940 3000 3 120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 38 4 0 3900 3960 4 023 4080 4140 42C 426 0 4320 4380 444-0 4500 4560 4 62J <210> 152 <211> 586 <212> PRT Met 1 Tyr Va1 Leu His Thr Lys Al a G:u 145 G I Ser Leu Leu Arg 225 Leu Asp Ser His G1 u 305 Va1 Thr Leu Ser <213> Hom <400> 152 Leu Tyr Leu Thr Asn Leu Ser Ser Scr Thr Ala Pro Ser Pro Ser Ser Phe Aso Trp Thr Tyr 100 Thr Cys Pro 115 Val lie Arg 130 Val Val Lvs Gy Gin Ie His Ala Gin 180 Val Pro Tyr 195 Tyr Asn Phe 210 Pro Ile Leu Gly Arg Arg Arg Lys Ala 260 Thr Lys Asn 275 Gly Ile Gin 1 290 Leu Val Tyr Lys Ile Lvs ile Giu Thr 340 Gin Lys Gin 355 Pro Pro Leu 370 o sapien Glu 5 Gly Thr Ser Pro Val Ser lie Ala Ara Ala 165 Tvr Glu Met Ile CvS 245 Asp Gly Met Leu Gl 325 Tvr Thr Asn Asn Leu Ser Pro Aia 70 Ser Thr Gin Met Cs 150 Pro Va1 Pro Cys Ile 230 Phe Glu Asp Thr Pro 310 Ser Arg Lyr Lys Asn Ala Gin Thr Gin Phe Ser Giu Pro Gin Leu Pro Tvr 55 -le Phe C-lu ile Pro 135 Pro Ser GIu Pro Asn 215 Va1 Gu Asp Gly Ser 295 Val Leu Gin Ile 37t 375 Asn

T

yr 40 Ala Pro Gin Leu Lvs 120 Val As n Ser Asp GinP 200 Ser Thr Ala Ser Thr 280 Ile Arg Glu Gin1 360 Asn Ser 25 Asn Gin Ser Gin Lvs 105 Vai Tyr n2l5 His Pro 185 Val Ser Leu Arg Ile 265 Lvs Lvs Gly Leu Gin 345 Ser Serf Met Thr Pro Asn Ser 90 Lys Met Lys Glu Leu 170 ile Gly Cys Glu Ile 250 Arg Arg Lys Arg Met 330 Gin Pro Met Asp Asp Ser Thr 75 Ser Leu Thr Lys Leu 155 lie Thr Thr Val Thr 235 Cys Lys Pro Arg lhi 315 Gin Gin Ser Asn Gin His Ser 60 Aso Thr Tyr Pro Ala 140 Se r Ar-- Gly Glu Gly 220 Arg Ala Gin Phe Arg 300 Thr Gin Ser Lys 380 Gin Ala Th r Tyr Ala Cvs Pro 125 Arg Val Arca Phe 205 Gly Asp Cys Gin Arg 285 Ser Tyr Leu His T-r 365 Leu ie Gin Phe Pro Lys Gin 110 Pro His -u Glu Gin 190 Thr Met Gly Pro Va1 270 Gin Pro Glu Le~u Gin 350 GlV 3ro Gin Asn Asp Gly Ser Ile Gin Va1 Phe C ly 175 Ser Thr Asn Gin Cly 255 Ser Asn Asp Met Gin 335 His Asn Ser Asn Ser Al a Pro Ala Ala Cly Thr Asn 1E3 Asn Va I Val Aro Val1 240 Arg Asp Thr Asp Leu 320 His Leu Ser Va

I

Ser G'-n Leu le Asn Pro Gin Gin Arg Asn Ala Leu Thr Pro Thr 390 Gly Pro Asp Gly Met 405 Met Ala Gly Aso Ala Asn 11C 395 Pro Met 410 Met Gly Thr His Me:- 415 Leu Pro Pro Met Asn Gly 420 Ser Leu 425 Ser Ser Pro Thr Gin Ala Pro Pro Leu 435 Tyr Pro Thr Met Pro Ser Thr 440 Val1 His Cys Thr Pro 445 Arg 430 Pro Pro Pro Leu Gly Cys Asp Cys Ser 450 Ser 5cr Ile 455 Phe Ser Phe Leu Ala 460 Leu Cys Leu Aso 465 Gin Tyr 470 Ser Thr Thr Gin Thr Thr Ile Ile Giu Hi s Ty r 485 His Met Asp Asp Leu 490 Gly Ser Leu Lys Ile Pro 495 Giu Gin Phe Leu His Giu 515 Ala Ser Thr 530 Ile Asp Ala Ala Ile Trp Ile Leu Asp His Arg Gin 510 Ser Ser Pro Ser 520 Ser Leu Leu Arg Val Ser Val Val Arg Phe 550 Trp Asn Asp Sc Giu Thr Arg 540 Ile Thr Pro Ser 525 Gly 31 Arg Ser ?he Pro Ser Val1 545 Arg Asp Giu.

Phe Leu Ar g Gin Asn Ph Asp 570 Giu 'S Iy Glu 5603 Ar g Arg Asn Asp Ala 565 Ile Lys Giu Lys G 1n Gin Arg 580 <210> <211> <212> <213> 153 2007

DNA

Homo sapier; <400> 153 gaatzcg-lcg acatagccag tagccagggc ct tgaccaaa atgataaagc acttctggga ccgccaagca tgacagatgg tctcgt ccat tcgcggcgtg tgggagatgt tttttaattc caat acagca agar acccc tgcgtcgt--t ccaaaatcaa agaaaatcag ttcczzttta caccgaagga cggtaatttg aaaatgagaa act gggat::Z ctgctccagg caagaaaaita aactc ggag tgccctggag atcggtggac c c~ctcc caac cCtgggtc'-g caagctggag tggcatcr-cc gcggcccgtg accaatggat t-ccagaggaa atctgctgat ggaagc: to ctacoaaatg aagctzcago ctgttcagat Sggc a ca a ca ttc c zgc g attoacattt qcct-cgqaac c=ctcgggtg gaaagttUctg attacaatgtagcaaaaaat ctccagcgcc agtgccttaa caagataagg aagcacgtgg gtgccgcact atgaccagtg aaagcctctg ggt atctctq tttttaggoc gttttgtcca gagaacictgg aagccagacc cagtt'cact aggcctctgc -Utcatgtcga tcgcctctco aacttgccaQ ttggagctz-c agtaatt~ca 7Utactccact 7z:ggagcaac :tgcagtgag -cggagctga aaggtgtcta aagtgtgtcg t-gtacagcgg t tgacagcaa t-ccgcgtggc atggagatta ztgctgatat aggccgtggg aggctttggg gat:tccctgc gagatgtccaa cagagaacca accacacagc cagaacatuc agtaagaagc ztagtgataa -=.ccacca aac taazco gactctctzo: aggagctcca agcagcgacc ggtggtcaaa tggggccttggggaagczg cctggagaac gggcgaatg ggcctact::-7 ctacacctztg tggagcagoc gctcagtgca qaaagaagtc agcaaagga tictcacccac gggacacct:z CU cU tcc: tggaatgcaa actgcattac; gggtggtaca ctaatggag ctgaaa:::o ggtggctczg agggatatga ggtgacctga ttggtgacca gtggcag-act gtcaaacgac gaggagtact gaaaacttz gctgtaccqa gtctctagca gaagcactaa cgagatgcaa atagccacca caaczaaatc aagggcaztgt tctgactz:: ttgtc-tqcaa tgatagoaca actgtz-tggE ggcagat:acctacocecc 120 180 240 300 360 420 480 540 600 660 770 780 840 300 960 1020 1080 1143 1200 1260 1320 tccag:tcc tcaactgcat tgcaaaattc aaaaatq-aac atcctitgcag agaattl: ct agcatcggaa atazc:aaaat tcagtrttc ttcatgaagt catcuactga gccaccattc cact:atcca ttctQ-caaac ttcta ucttcattcc tatcgtttct cttat:caaag ctgtggttgg gt:caaguca tgccagggcc caaaatccag ggga:cgca gtggggagcg agggtaggga tgtgaaaga caagclcgaca tggcrtaoaca t Ct,,ctacat catattgtaa gtgagtgact aacagtcatc tttatcccao gttgattgac taaaaaaaaa aaaaaaa ocagt:gaact: ggggaacat g Cc-aagattg aat cattc caccagcacg Lgauccactc agggggccca gaggcaggaa gaaggaccca tcgtctca:c -gcctggcac 't ttaagract gtgttcaacg gaagzt tatz ctattaacc ggtggccatt tcgaaaggcgctggaggga ataggacctt: tgctagtt:r acaataagrg t ttaactc:aa aacaagcaca ttztaac: ca ctrgatcctgtggac:z cct t ccagc tagctctagcz aggcctatga tctatat-- Ctcctraatcaataaa- 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 C7 <210> <211> <212> <213> 154 2148

DNA

Homoc sapien <400> 154' gaatcgccq acagccag Ct::gaccaaa acqacaaaac cacctcogg ggcaac::9g C ggcogcccg gtaccaar-gg tctccagagg caatatgctg tgtgc:atag U gccczga ccaac:ctgg ctqcctaC gaaataoicca cazcaaccaa ttCaagggca Ctctctigac caattatttg tggtgatagg acaactiattt gagggcaga t tcccccaggc act t aact atgaacaaaci atttc:gac tcctzato acctqggac gC'CCcc.zCC gt t..agctct ggaaggc:q ct ctCzacat gugaccaat~a caaaaagta aac::tagag acQcC:tggag atc~aztgqac Eqa agcacgt aa~g:cca CCacgaccag cgaaagcCc atggtatctc aat::t-,agg atg:r::gtc atga:cagaa a9ggaacata aacaaacacg ccCtcaattac atatatgtcg aEcc,,aaagc tgtagaaaac CCt~c cCCCCC caacaccgaa acacggtaat ggtaaaatga tatCact ggga agc::ccaglt taaaaaaatg acaaacactg tcat:.:-atga CCtC-attt at tC CC::tcat agt-ctggt aacc aaaatc caaaggtag cZc:ggctta ac7:crgagtaj aatc:zzcat gaaagtccCg actacaqtaragcaaaaaat ctccaacacc agtgccctaai qg'cvctacac cCC C gacaqc tccgcqt; tgazggagac tgtzgccgac caaggccatg caaggc[:t cg aacagtggaa ccatgC atag acaaaccaa CcccciaagcC caaaagcrt c cagctgC:ca ctacggcaca ggaCttcctg ttgattcaca gaaacctcgg tcccCaac~g aacat CC C C gaaatgCtaa agtcatcta ccazC ctgca tcctaC3CCC t!9g9ctcaag caggggatct ggatgaaa gcatctz cta act aacag: c gactaaatga C :-aczccacz :zqqagcaac ::zggagczaa aaa-ggaacc ggc :tgg a ca a aaqgcz-ag cactacacc_: at Cggagcal 9cggaaagaaa caaggtCtcca acagaggagg ggcagtacca ::-cgagaagc acoaaccag agcC-attcCa gacaggcctc acattcatat cggtcgcctc !:,tcaacttCc aact tggaa: gtaagtaatt cat tacaaaa tagagaat: aatzcagt: Cgagccacca =actta tca :cacgccacQ gCagtgaaza aaacaagcg aaaaaaaaaa 0aCtCt=CCt aggagctcaa 50caataacc gcQc: ct.aaa t:gtggcaga acgccaaqcg g:aaaacz z C -aga agc actccgagacgc C:aagacgt caccaagaag -gaaggaggCa C-gggaC CccC aCcqagatgt £ctcagagaa C-gcaccacac t gacagaaca Z:tagtagga tagttagtga tc C t CC t a ccaagcccta "t-CcCaoctga 7Ctggggaac rCgcctcaaga ::aaC:aC: c:gacaac~c aagrtgatcca agggggc g-CCgggaacag =cagaagqac :-aatCgctz cactgc=-za aaaaaaaa ggtgaC--:ga c~ccCccaaq ac c acga CqCccg gatgggara: ca!:tCaaz aacaatacag aaagaCz-aCCgggc agz gCztgczgc aatcczgc: tgcagcaaac ccagggagcc agcicCt C CC tgctggaacg agcactgcaz taagggtggt: ccactaacg atgctgaaat acttcaagr atggtgtzca Ctggaaq:t: cat t: a=a acggqtzggc cz:ccaaaa gaagctgc-ag ccaataac aca C 37 CF 120 180 3 0-C 420 430 720 7.3C 900 960 1 080 1140 1200 1260 1320 1380 1440 150 0 1560 1620 130-80 1740 1800 1360 132 0 19Z8 0 2040 2100 2143 <210> 155 <211> 153 <212> PRT <213> Homo sapien <400> 155 Met Thr Ser Val Arg Val Ala Ala Tyr Phe Glu Asn Phe Leu Ala Ala 1 5 10 Trp Arg Pro Val Lys Ala Ser Asp Gly Asp Tyr Tyr Thr Leu Ala Val 25 Pro Mec Gly Asp Val Pro Met Asp Gly Ile Ser Val Ala Asp Ile Gly 40 Ala Ala Val Ser Ser Ile Phe Asn Ser Pro Glu Glu Phe Leu Gly Lys 55 Ala Val Gly Leu Ser Ala Glu Ala Leu Thr Ile Gin Gin Tyr Ala Aso 70 75 Val Leu Ser Lys Ala Leu Gly Lys Glu Val Arg Asp Ala Lys Ile Thr 90 Pro Glu Ala Phe Glu Lys Leu Gly Phe Pro Ala Ala Lys Glu Ile Ala 100 105 110 Asn Met Cys Arg Phe Tyr Glu Met Lys Pro Asp Arg Asp Val Asn Leu 115 120 125 Thr His Gin Leu Asn Pro Lys Val Lys Ser Phe Ser G1i Phe Ile Ser 130 135 140 Giu Asn Gln Giy Ala Phe Lys Gly Met 14: 150 <210> 156 <211> 128 <212> PRT <213> Homo sapien <400> 156 Met Thr Ser Val Arg Val Ala Ala Tyr Phe Glu Asn Phe Leu Ala Ala 1 5 10 Trp Arg Pro Val Lys Ala Ser Asp Gly Asp Tyr Tyr Thr Leu Ala Val 25 Pro Met Gly Asp Val Pro Met Asp Gly Ile Ser Val Ala Asp Ile Gly 40 Ala Ala Val Ser Ser Ile Phe Asn Ser Pro Glu Glu Phe Leu Gly Lys 55 Ala Val Gly Leu Ser Ala Glu Ala Leu Thr Ile Gin Gin Tyr Ala Asp 70 75 Val Leu Ser Lys Ala Leu Gly Lys Glu Val Arg Asp Ala Lys Thr Ile 90 Cys Ala Ile Asp Asp Gin Lys Thr Val Glu Glu Gly Phe Met Glu Asp 100 105 110 Val Gly Leu Ser Trp Ser Leu Arg Siu His Asp His Val Ala Gly Ala 115 120 125 <210> 157 <211> 424 <212> DNA <213> Homo sapien <220> <221> misc feature <222> (424) <223> n A,T,C or G <400> 157 ctcacagcccg gggga-Iooac ggacacatta cagcagacat aattcagtca ccact-gr~at taczagatt cct:tgtatgc agaagaagga gaaaactgca aaccagaaa cttctccgcn ccczagccat cgaqccagtt t oocrtagcccagtg ggaaa-lataa at taco:cc aaagttttcg tcacaactt: gnatctggct tggocccacg tgrggaatt 7:Ettaaaaaa ccaggaaccc 7:tgaaagctq acaga attga tgtooatc~g aataazacac oat :ggtc!: tttctctc:a tcCagtggg Zgct-cagagg atctacagEC gtctaaggtg ciac:gcuat tacaagac~iacc:c:t-a aaggc:gcza aggt-oagagz; ttCcocaaaa gctgcz:c:: tzcocca: 00 240 G0 4 24 <210> <211> <212> <213> 158 2099

DNA

H{omo sapien <400> 158 cC=ocgg!::aa aaggo gcaag2 aLoo,:ggoagc cqQOcc-::c ccgacacg cccgcaqag aaagoao::: caaacagagc acaaqa -tg otoat gcatc at--caoatt aaagaggtct gcautcgztg ac: :ca'ccg caacaggac: gcgczgctag ogaggaaraga a: agagggg: gcaacc'::ta aaatgtggga aaoraccgrgt gcaaacg:tgt caaaaaaatc atz: agata cgzacoot gcg cC:: Og-ttag "t::gtagg aaaacaagag ggac :ccrg at::a: cag :az: tgac aaaacatgcg gao: Loatcz taogo: taaq gcagogcco0 Cccgcgccag Z:ga 9tgacctccct go: aaacaa: 7:':aat~caa gaaaccotcq gaaacaggac ggggtgtcaa tccgagtcat tcgtctacaa rg'::ccacat tggccatgca agaggaatga cgctgtgg:g tgtatgtgtt Egaccoctg :-tacca-tt: gctacctgct accccaacca qcggtcaaaa ccacaaggag cgaagag: atac -tgctc actac':tgac acaaagtggg gaattgatac :gaaaat at: gtoaaaagtg a9q 00 cc gg-ccgcc~gc agaaaacctg t::zgaatat7 tgcacaccac cagagggatc tcagggataa caaacact=gaccocccg cacact:gcaa ccggctgtgg tgtcrgcctac tLttcaaagac gacc:acacc ttacrtcct- Ccccaacc:tu ta':gat:tot gcrgaaagtg tlgccctaaag tgcaatcaca ac::-ctgtct Lcg--aaatga cat ocat aca aaagrgagcat Eact~tctqa gtttatagg tataaagtaz tagaatcaca gzoa:Z Qcatc 9cctgcccac cOc-gaqcag cgaaaaaaa ccaggcgaca tggotzc-lag tcqccctca': ac~agcgcaa accaccatcg gr-ggc':gccc ccaggacgca 9000:occaac taCaggcacg atagaggaca agcagcat ot tacaatgggt gttgactgct gcgtctgtga tgttttagga gagagraagc ggtcccaag tc-ccagaag Ottcat aat caacgtaatc rgcagtcac:: aaacttatat aaaagatatz ttztataatg ccacaaca:- 9tcz~tt~c aatatacz-! acccqaaacc ccagagcqaa t: :aa ac a cagggaaaa gcactccagz tgga::ggag ggaagogg aggaagtotg aaaatotgzg t-gato: tog: a saccac: og ttaaaaagca accacctgcttatttctag tttgcatgct gatcaaagag agaatgaaat ctaaacatct gcaataccaa aaatagacac aaaza-gt:gg ttgacaqg:: aac--g-t t: tt:at aqgo: actggtct::: ctaaat!:':ag aaacr:tgoaa tactgc::::C tgaac:::o qagcooo=:: gaa-acac-: ggg: gacga= cta':gaco-az caagc ':ca catc::ttaaa ctgggct,: gccaacagag gCttaa:= agcacagacz gaatcago: a caaggcaaaa cct;c.aaac7: ttgac:zaao saac: gstaaqgaa:ztggacq-x::-- 0: tacz:Cz sacz:acaaaact a: zat:- 300 4120 480 540 500 660 730 900 960 1020 :080 7-140 1200 1260 1380 -:00 17403 1360 cagaacagtg actgaaatgt <210> <211> <212> <213> <400> Met Asp Trp

I

Ser Thr Ser Val Met Ile Glu Asp Phe :z0 Tvr Asp His Leu ile Phe Tr Tyr Arg As n Asp Pl-e 115 Glu Gly Ser 1.30 lie Phe Glu 145 Tvr His Leu Leu Val Asp Ile Phe Met 195 Glu Leu Cys 210 Ala Gin Thr 225 Gin Asn Glu Thr Gly Ser Arg Arg Leu 275 Ser Val Ala 290 <210> <211> <212> <213> tggaagcaga aggcttttt" aactcatccg ttcgccaatc attgcaaaca ggatgtgatt gcctcaataa agctcgcccc catcgcttaa aaaaaaaaa 159 291

PRT

Homo sapien 2040 2099- Gly Thr 5 Ile Gly Leu Val Val Cys Ph-= Phe Val Ser His Gi1u 100 Lys Asp Leu Tro Ala Ala Pro Tro 165 Cys Phe 180 Ile Ser Tyr Leu Gin Lys Met Asn 245 Gin Ala 260 Leu Ser Leu His Thr ?he Ile Gly Gly Val Asn Lys His 10 'is Lys Val1 Asn Pro 70 Thr Thr Ile TrD Phe 150 ValI Ile Ala Leu Asn 230 Giu Lys Ser Val Trp Ala Ala 40 Thr Leu 55 Val Ser Pro Ala Thr Arg Giu Asp 120 Thr Tyr 135 Met Tyr Leu Lys Ser Arg Ser Val 200 Leu Lys 215 His Pro Leu Ile His Phe Pro Glu 280 71e 25n -r 35O Va 1 As n Ser LvS 265 :31v Th r G lu Pro Ile Leu 9l0 Phe Lys Qer Phe Gly 170 Thr Cys Cys His Asp 250 Val1 As n Val1 Val G ly Arg 75 Val Ara Lys Scr Tyr 155 Ile Glu Met Phe Ala 235 Ser Lys Thr Tie TrD CI/s Ala Arg 140 Phe Asp Leu Arg 220 Leu Gly Cys As n Phe Gly Lys Trp Met Gly Lys 125 Ph e Leu Pro Th r Leu 205 Arg Lys Gin Ser Leu 285 Ile Asp As n Ala Hi S Val ?he Ty r Cys Val1 190 As n Ser Giu As n Cys 270 Lys Phe Gl 1u Val1 Leu Val1 Lys Arg Arg As n Pro 175 Phe Val1 Lys Ser Ala 255 Val1 Val1 Ara Gin Cys Gin Al a Arg Ile lie Gly 160 Asrn Th r Al a Arg Lys 240 Ile Ile Pro 160 3951

DNA

Hcmo saoien <400> 160 tt:cat~cca tazttoQaaaac czgacacaa: gtacacagca agctcagz -t ga-aa gaggcttctc tacaacatga Oooaaaggag ca::gocaggt totgactoocrtcaagacaai gaacct-cat, Itaccaagag taataataac czggtatggc gggaaaatac ca-ga tcacgE tgagtataac gtIgttoatct ctgtat tatr tgcaactgca aagtacccac atgggatgta qcttcacct gczggatg agaattttat cagcaaagga gctggtt=oa gcotta agaaa gazaztagtg Ca=gtagttca aut oat oacg: oat ciact gatr~aqct tgaa ZaCtc:gataaC tccr:gaaat: caatctaac7: gao: tacacc tcgcgcotcc c~ccatttt to:: aatgcc aczzcottgat cagoataacc cacagoaaao ggagcgaaag tccagctggco aaaag: agaa ocaggot aca taacaatgoo.

gacatttacg aacaoatgaa gtotgctgta acctgcoaaa catt~igctt gaaagagaat taagacccat go-a :aaaat aaat :cttr o aattat~aacgaaacit t 0czggt-tgoo: gggtataa:c t caaacatozE -agcaaaacaE I gcacatcggac :atcoatz0t ca i gccgactat aatgaoaaac *gacaCaCag agtaagc::z tcaataacgt aaccaagaag atcaoaaac-o 00: occacac 7oc-aooaaga t:gatcoca ggactcaaag tactccca gaattzgacg acoacgag acaactcaoc 0: tacaggag agtacgta acqtgaca c:gaacaata aaol:cagotz[ =-taoootzg acoogtoactg gatagagoag t:t-gctqcaa accoacco ggtaatattc tgqgggttta coaccctg gaggaattaa agctatgaaa atz-ttagtaa ttcccacccc agccaoagaa totaacattg gattatctta atr-atagttg ggaacaaaa: gg=Czttgac gcatt:gagtz tggggtaga taaagtaacz tatzttatog aaoco coat zgtaoagaaca taaguooagE I gato-goocat iaggaaatagat tcagaaataE iaacaagaatc fat-gatooata3 cacctaazt", ttgtccatga Ctttcooacat gcatrcrotqt C taaaaa agg toatuca aag cacoaaaoooz Ctgocactt t ggoaaaogo ttgtoazaaat cccagot-aca ccac: czat c tggttgaaaa atgataaqct cca tzgc--c:gt-,_aaagtt aaaao zzaa acgacaz7jat atcccgazo c ot:ag-:-oog cccat oa tc tgOccccaao tgatgazzra ccacaco o:ga gtgczgarogt atggacaata actczat :cc agatgaatgc gccgago cag ccctazoootg taagaazgag aacaatcaaa aaat-o-,oCac tttaacgc cccaggcgcc tattaaaagg tgaoacatca tat: ataaat tacaaaaaca tttgtlao=aC C tagaaaacc too ::aaagg aggoacaaaa gzgaaacaaz IacooCccact:c zgcaattaar iaacoogaagot *aaaaattttE atatgaaaac *caczctacad= cot act ga a atgggoooac aaatgggcaa cot tgaaaaa ata-caoot ot Ott tat ottoacagaaccag t oaooaoagc ac-aggcggt zao agactc z2Caattaac aa-co:aaaaoa aot 3aata ,-zggcaat acg-aaaatac gat oooagga c:o oaagoc= o act g tgya a tagco aatgtg gocagagac 0 zataaaaaat -agootgaaa agggagtcaz zccaaggaaa ctcaggaggc accartgcaaa gacagcacct taaaagtcta gcgaaatcoo gaatggacoo aatacgagca tctgtttato agctttaaca ::ac--ttaac aaatatccaa o-aotaaoaas aocagataaga zaaaaggaac acagoooccaa c a a c aa CC-, at tc rgggagc:c -:caqgtac rcat~t acc iatacc.goccE fgcaaat at cz taoagagggt gataaczcaa toogtoggg aatoaaatta ggtcc: tgoo actcaaata gtggttgaat actgcagoo tttC atga gacaaagtgg cctaaoo-ac agoaatat gaca: oagca aaagc :ratg tact:accca gcagcccoaa gatatoatcaa caatzgaaaa tacacaaata acaucozaaa.ctgaaagtga g9000tgcag aaacagggat ggaga: cccg qatggaaa:::t gtgcar-9toa gotatgtatg tcagzacica Cccttoooag at tat tgaco ggagaagact oagaatatoo oagcaagotg gaaoatcago atggatagga ccocccaatt gcaatogcat aggaaaaaga gtcaaazraa Otttoacazg ggctazgaac gcaaaalaaaa aCat: a iaoctgaagtj gagtaoagcz otgagaatca tatttaatzzc icat-ggaaagc itagtgaco:ga gtggaaaaca cagctgcoa gtgtgttca aagtgacaag ccoaagaaaa gcaccoaaaa tttgtaatgc zcagaagtacaogggactoa tctgtttaat aaoaagccgo ccagt: ocza atooaaaczo_ ctgtao: cag attgaga actccaaroag .agcaaaa acaca-tca c ooagtgcc attzatcac o-tggqoaC. q oagtgacctc aaagagacag tttatcat~r ttacaccgaa atcacto=c taocagg:ta gaaatgagga -gctgggagt Cggaagcogt ttgatcaggg aagatgaot 0 gcatcaggga caaatggaga act cot:aca ctgatcctgt tgatacaaat gagcaaaa catcaaaacz qtagatcaac aaataa--aaa gagcacago.

ggagc 3Qt0: a-,aZ: ca-a 120 -180 240 300 360 420 480 540 6s00 660 72C 730 240 900 960 10 2 10803 13203 1 380( 1-00 1560 162C 800 1860 1920 2040 2100 2220 2280 2340 2400 2460 2520 2 530 2640 2760 2820 288C 2940 300 0 3060 31i2 0 3 13 0 324C 3 3 6 tatgaagccc gaaarctcac atgggtacta gtc gtaagc atgatagcta gttccaatac ggagatacta taatc-ztttc caaggaaata gatcatcgaa ctaacgcaaa tgctaacgct cct -ztctc tttactccc tagcrccttaei atacatgaac accttggaa tccatcaaga aaaat tatct caa7raaaatc qctcttt~ac.- tcttgctat: ttgttatata cagagatct ttcataccgg atcaaaa-cag aatgccttaa atatagottt atgattagct gtt act tacc ttcatc--r ta atttgccttoz r00 tacgaca cOtctaagt ctaaggaaga attcaao taa.

ggctczgttt aagggcaggg atttactct ttaattaaaa aagaggtaac aaggo ctat t tat tgccttg aaagatgtta accaaagaag tttggttaaa gaagggggat tcccOttat acacaaaaaa lttacagat ctttaacaagaatttatrt gttatacgg ttctgago o 0 aggtcagcag taagagtctz atagaggoc ttttaaaa 3420 3480 3540 3600 3660 3720 3780 3840 3900 3951 <210> 161 <211> 943 <212> PRT <213> Hcrno sapien <400> 161 Met: Thr Gin Ara Ser Ile Ala Gl-y Pro Ile Cys Asn Leu Lys Leu Leu Val Ala Leu Ser Ser Glu 10 Leu Phe Val Pro Phe Leu Val Gin Leu Pro Gin Val Pro 25 Asan Aso Asn Giv Glu Asn Gin 55 Ser Phne Tyr Tyr 4.0 C25 fl Glv Leu Leu lie lie Giv Ala Gl1- Ala ie Asn Lys Giu Me: Ile T h r Leu Ile Ser Asa Th.r Glu Ala Phe Leu Phe Asn Al a Al a Lys Ar a Arq P- e Arg Asn Ile Ie= LCu T1 Pro Tyr Thr Trp Lys Ala As- Asn Asn Ser Val Thr Asp 115 Tvr Arg Gly le Lys Gin Glu Ser 105 Gly Giu Lys Ala Tyr Gly Ala His 120 G 1y Aso Asp Pro Tyr 125 Phe Asn Val 1 ie Thr Leu Gin Thr Pro Asr.

Cys Gly Lys Lys Tyr lie 130 Phe Leu His 140 Gly Leu Asa Asp 145 ValI As 'n 150 Trp Thr Ala Gly Tyr 155 Trp Ser Arg Gly Phe Val His Giu 165 Lys Ala H is Leu Arg 170 As n Gly Val Phe Asp Giu Tyr Asn Asn Val Thr Arg 195 Gly Pro Cys Asp 180 Cys Pro Phe T-yr Ile 185 Thr Gly Gin Asn Ser Ser Asp Ile 200 Cys Gv Ile Phe Val1 205 Leu Gin Ile Lys 190 Cys Giu Lys Phe Lys Glu Pro Gin Giu 210 Gly Cys As n 215 As n Ile lie Ser Thr Phe le Ser Thr Gin Met Thr Ala Ser P-h- Met Gin Ser 245 Glu Ser Ser Val Vali 250 Phe Cys Asn Ala Set Thr His Asa Arg Ser Ala Pe 275 Ph roM Gin 260 Ala Pro As-a T eU 265 Aso Asa Gin Met Trp Asp Val Ile As n Gl1v Thr i'j Th r 280 S=ar AlIa Aso Phe 285 Thr Cys Ser Levi 270 His His Set P *ne Set Le-u Leu Pro Przt Pro, Pro 300 Val Glu Ala Gly Asr Lys Met Ala Gli i Phe Ser Ser Ser 385 Glu Leu Va1 Ala Phe 465 Ser Leu Thr Thr Gly 545 Thr q r Val Ala Tyr 625 Thr Leu Ser Val Pro 705 lie Arg Tyr Phe Asn 370 Ala Va1 Va1 Leu Ala 450 Phe Arg diu Va1 Trp 530 Arg Ala Thr rhr Phe 610 Ala Ala Asp Arg His 690 Gly Gln Lys Leu Asp 355 Asp Lys Va1 Thr Ser 435 Pro Va1 Ile Ser Thr 515 Gln Lys Ser Leu Ser 595 Val As Thr Aso Tyr 675 Va1 Ser Met Trp Met 340 Ser Asp Thr Glu Ser 420 Ser Asn Pro Ser Thr 500 Val Ala Tyr Leu Asn 530 Arg Glu Val Val Gly 660 Phe Asn His Asn Ala 325 Glr Lys Arg Asp Lys 405 Gly Gly Leu Asp Ser 485 Gly Asp Ser Tyr Trp 565 Asn Ala Arg Lys Glu 645 Ala Phe His Ala Ala 725 Phe Lys Val Val Cys Leu 310 Asp Arg Leu Leu Gin 330 Ile Val Glu Ile His 345 Gly Glu Ile Arg Ala 360 Lys Leu Leu Val Ser 375 Ile Ser Ile Cys Ser 390 Leu Asn Gly Lys Ala 410 Asp Asp Lvs Leu Leu 425 Ser Thr Ile His Ser 440 Giu Glu Leu -Sc Arg 455 Ile Ser Asn Ser Asn 470 Gly Thr Gly Aso I-- 490 Glu Asn Val Lys Pro 505 Asn Thr Val Glv Asn 520 Gly Pro Pro G1u lie 535 Thr Asn Asn Phe Ile 550 le Pro Gly Thr Ala 570 Thr His His Ser Leu 535 Ser Asn Ser Ala Val 600 Asp Ser Leu His Phe 615 Gln Gly Phe Tyr Pro 630 Pro Glu Thr Gly Asp 650 Gly Ala Asp Val Ile 665 Ser Phe Ala Ala Asn 6830 Ser Pro 5cr Ile Ser 695 Met Tyr Val Pro Gly 710 Pro Arg Lys Ser Val 730 Ser Arg Val Sc: Ser Vail 315 Leu Thr Gln T'yr Gly 395 Tv: Gly Ile L eu Ser 475 Phe His As u Ile Thr 55 Lys Gln Pro Pro Ile Pro Lvs Gly Thr Tyr 715 Gly -,Iy Leu Gln Phe Leu Leu 380 Leu sly Asn Ala Thr 460 Met Gi1n His Thr Leu 540 Asn Pro Ala Pro His 620 Leu Val Asn Arg Pro 700 Thr Arg S1v Aso Val Gin AIa Val Gly 350 His GIn 365 Pro Thr Lys Lys Ser Val Cys Leu 430 Leu Gly PIe Asp GIn His Qin Leu Me Phe Phe Aso T eu Thr 0lv His Leu Lvs 590 Ala Thr 605 Pro Val Asn Ala Thr Leu Asp Gly 670 :yr Scr Al a Asn Asn Gi Sc: ?he Se AlE 335 I1k Ile Thr Gly Met 415 Pro Sc: Leu Ala lie 455 Lys L; x- Pro Phe Tro 575 Va1 Val Met Thr Arg 555 Ile Leu Ser Glv .735 Ser 320 Glu Ala Asn Val Phe 400 Ile Tb: Ser Lys Phe 480 Gin Asn Val Asp Arg 560

T:

Thr G lu Ile Va1 640 Leu Tvr Lvs 11 e As n 720 Glu Leu Gly Val Pro Ala Gly Pro 755 Ile Ile Asp Leu Giu Ala is Pro 760 Asp Vai Phe Pro 765 Leu Cys Lys 770 Thr Val1Lys Val Giu Glu Trp 785 Giu.

Ala Pro Gly Giu Asp Phe Asp Gin Gly 795 Ile Giu.

780 Gin Gin Thr Leu Ser Ala Thr Ser Tyr 800 Asp Asp Phe Asn lie Arg Met Ser 805 Val1 Lys Ser Leu Gin Asn Thr Ser Lys As n 810 Arg Asn Ala Ile Ile Arg Giu .835 Giu His Gin Le u 820 lle Asn Pro Gin 825 Pro Phe Thr Phe Gin Ile Ser 815 Gin Ala Gly 830 Asn Gl1y Pro Ile Tyr Val Pro Asn Gly His Giu Ser 850 Ala ile His 860 Ser Arg A la Met 865 le Asp 870 Leu Asn Ser Leu.

Ala Val Ser As n Ala Gln Ala Pro Phe le Pro 885 Leu Pro 890 Val1 Ser Asp Pro Val ?:ro AlIa Arg Asp Ile Gl1y ile 915 Arg Lys Lys 930 Tvr' 900 Ile Leu. Lys Gly 905 Val Leu Thr Ala Met: Gly 1Leu Cys Leu Ile Ile 920 Lys Val Thr His His Thr Leu 925 Lys Leu Leu Se Arg Ala Asp Glu Asn Gly Thr 940 <210> 162 <211> 498 <212> DNA <213> Homno sapien <400> 162 tggagaacca catggacagc agcccctcaa gtcgggtatg accagcagat gggcaagggt gaccaccccc tcoaggact ccaccatgcg CCtcccggat ccaactgtga caagcatggc cagcgtgggg agtgctggtg accatccggg gggaccccga gtgcacaccc cagcggat accatgaaca aaggagcrgg agcaagcatc ccctgccaac gagcgggacc ctgtacaacc tgtgaacccc gtgtcatctc tgtcgggcqq z-cgtgrttccg accttggcct aggaactgga ctctggagca tcaaacagtg aacaccggga ttctacaatq gggaggcagt ggagaaggt c ggaqqgczcccaggtcctg cctctactcc gcaagatgtc agctgatcca agcagcagga gc tggccrga actgagcacc aagaagctac gagcg~zatc:: ctgcacatcc t ctclaacggg gggacgzccco ggctc-gcggg 120 180 240 300 360 420 480 498 <210> 163 <211> 1128 <212> DNA <213> Homo sapien <400> 163 gcCacctggc cctcctgatc aaccaacttt cz--ggaagcaa tgcaacggag ac-ggttcag Cctcczgcgg gcgctcggtg atcagctc ct ccatoacaaa acca:: tgat cacaczaaatz actccaagcc ctJcccaac gacgacacac ccagcccacc cagtggagcg gagggztca gggaagtcca cacacagc:g acaaagaacc gcacttgaaa agaggaggtc zcgcggtgtt gccgccgcct: :ccaagat tt aaatcagagc acccgtccq cttgttcrtza ccgagcc~cga cctqctcqaac caaaagagcacggcgacua tacctcoa atttggcz: gggtg Ogt gg gcoaa~acga tacgcoqgc gtat*-::gaac ttctzcctz gtar Jrzra gacara.zgaca 120 180 24.3 300 360 420 gcagatacct cacctgggaa ggcgaaco og acctgtctga aacagagacc tagaaatat t tgctctatga aattattatt tgtatctrEgg tatcaagtat aatgcctaaa ttaaatttgt aactcaggaa gaaaaaoiaaa ctc~lgccr-g cacctccaca ttccaaggac Eat Egtctgt aactgcacat atcacactta tgctgctgaa gtt-gataaat tataattatc aaagaatguc ac~aacaaog ggcaagcccg ttagact:crg acctcgctgg acattgcagg aaacactgta tggccat :gE ccataaczta tctatat t gacacaacaa caaattgartt taataaaata -ggagaccita caaaaacgcaa cagtgactog agctcgattc at tcr-gtaaE aatgcattgg gaaataEtEE :Z:E gcccat :-tEttaaca =agtgtctcta :7:cct Etgtg caaacagcag CCactcaaga ggagcaggaa gagtciggcta acagaggcat agtgaacata aataaaactg t E t t tgcca Egatgtattt taatgcac--: t tttgt ggrt catgtaaaaa aagaaaaaac gaaggggacc tgaaatrtEtc zggaaaqtat tct tCcccat aagctaatcc at.:Etgtaaa tagatataca gaEEEtaatg Eaacagtat t 480 540 600 660 720 780 840 900 960 1020 1080 1128 zaatctaatt acarcatg <210> 164 <211> 1310 <212> DNA <213> Hcmo sapien <400> 164 gggcczggt z tagccctgc gagacctgta tt-att:caga t qt gcttgg ggaaacgatg cgcgqtcccc gtctgaacat- C t c= t cac gzcccctaac tgatgagggc gctcaagaca gaaaaaacgg aaggaccac aaat--ttcag gaaagtatta.

tcccccatcg gctaatccaa ttgtaaacg gatcatacata ttttaatgaa acagtatttt cacaaagaag tcacgaacc aacacaczac agaagcgcc t agaaagcaca cagcggagac zcc:gcgggc caccatog t-ccaaacccc: agatacc:Eaa cccgggaaga Cgaactcgc-z ctgzctgaca cagagacc-t t gaaatattca ctctatgaaa EE atcEat Eat Eatctrggtg tcaagtatgt tgcctaaata aaatttgtaa ctiqactt-cag caggagaac: EtatcaEtga czgatztc=E gttggagrtag Eggttcagca gctcggt gga atgacaaagg cagaaatcCa Ctccccaacac Ctcaaacaaac a a aa ga aagg Ctgcc-ggt: ctccacaac ccaaqgacattcgtctcaa c:gcacattg cacattacc ctgctgaat t tgataaatga taattatcca agaatgtcta aagagggaaac :7-ctggccaa :gcatatalta ccggE Egcta a:agaqcgtc zgtE c gc :!aactc--z:c zacagctgaa aaagaaccac :aacaaoatg -a a gcc!c ggg =agactctgga :-:cgctggag 3- Ztg-c ca g ga t atactcltaaa z:zcattgtaa acaattatt :ctataEtE cacaatgaag aattgat ttt acaaaatata tE CEt C c ttaattagac aaaccatrtt C7 t t Z:gCE c aaE aagt ccC Ogt~gtgEccc cc~c cgcctca caagat.ttac atcagagcta cccgtccgiat gagacgtaca aaacgcaagg gtg3Ctgga Ctcgat: Ecac totgtaatag tgcat!:ggaa araEEEEEEEt ttgtccattg Etgtaacata tgtctctatEcctttgtgcc atctaattac Eaggaggcgg atzigctatg attE:E-cgcta t EtCtggcrcT gaacgcgagc tgCtgagcta aaagagczgc ggcqacgatt ccgagaggt ttgggtctga aagagcagcc agcaggaaaa gtgggccaga ggaggcatcg tgaacatatg taaaactgtc LEE Egccaag atetatt Eat atgcacttt~a ttgtggEtga cgcaaaaata 120 180 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1310 <210> 165 <211> 177 <212> PRT <213> Homo sapien <400> 165 Meti Gin Arg Arg Leu Val Gin Gin o Val Ala Val Phe Val Glu Gi-/ Leu Leu Leu Ser Arg Ser Tyr Ala Val Pro Ser Cys Sly Acg Arg Leu Lys Lvs Ser lie Argc Ala Val Ser -is Gin Leu Leu His Asp Lys G'ly Gir. Aso Leu ArQ Arc: Xc-g SPhe Phe L H i Si Lu e Al a As n Ser Th~r Lys Ser 145 His His Glu Ser Asp T'vr Pro 130 Al a le Lys Asp Lys 115 Gly Trp Ser His Pro Gl u 100 Glu Lys Leu Asp Thr Ala 70 Ser Pro Gly Arg Gin pro Arg Lys Asp Ser 150 Thr Ser 165 Glu As n Tyr Leu Giu 135 Gly Thr Ile Thr Leu Lys 120 Gin Val1 Thr Arg Lys Thr 105 Thr Giu Thr Ser Al a As n 90 Gin Pro Lys Gly Leu 170 Thr 75 His Giu Gly Lys Ser 155 Glu Ser Pro Thr Lys Lys 140 Gly Leu Giu Val As n Lys 125 Arg Leu Asp Val1 Arg Lys 110 Lys Arg Glu Ser Sc r Phe Val1 Lys Thr Gly Arg 175 Pro Glv G lu Gly Arg Aso 160 Arr <210> 166 <211> 177 <212> PRT <213> Hotm <400> 166 Met Gin Arg Arg T-rvr Ala Val Arg Leu Lys Arg Lys Scr Ile Gin Ala Glu Ile His Asn Ser Lys Pro Ser Asp Asp Glu 100 Thr Tyr Lys Glu 115 Lys Pro Gly Lys 130 Ser Ala Trp Leu 145 His Leu 5cr Asp His csapien Leu Ala Asp Thr Ser Giy Gin Arg Asp Thr 165 Val1 Ser Val1 Leu Al a 70 Pro Arg Pro Lys Ser 150 Gln Cys Ser Arg Giu As n Tyr Leu Giu 135 Gly Giu 40 Ar g Ile T hr Leu Lys 120 Gin Val1 Trp Arg 25 H is Ar g Arg Lys Thr 105 Thr Glu Thr Ser Ser Gi1n Phe Aila Asn 90 Gin Pro Lys Gly Leu 170 ValI va I Phe Thr 75 His Clu Cly Lys Ser 155 Clii Ala G'l1u Leu Leu Ser Pro Thr Lys Lys 140 Gly

I

Gly His His Glu Val1 As n Lys 125 Arg Leu Phe Asp Val Lvs Lys Arg Glu 5cr Lys Leu Ser Phe Val1 Lys Thr Gly Arg 175 Arg Gly lI I Pro Cly Gl' Cly Arai Aso 160 Ar~i Ser Thr Thr 5cr Leu Asp Ser <210> <211> <212> <213> <400> 167 3362

DNA

Homo sapien 167 cacaatgtat aaggagca tt t tCagaactc gctcactgca aatgacaact aaatat-aaag agaatcatat tccacacacc taat trccta ccacgaatgg ctacataaat ttttgcgtgt agaaggacgc gcaaagttta aaacctacag tgac ::tcac gcttgcagag agaggczaac tgaaaztcac gctacaccaa tgtaccaoct tgaaaaactg taagc:t-ztt tgCCczqg:l aaatcc::t C: t:ztgga a tgrcaaaczt c caz7ta.-a:tz c tgatgoacga a tcttzagat:: c CCatcrcaaaa t acag-cacct g9 aaaaa:ccac a cgaaa:cctc a aatggacctg a atacaagcaa c cztgtttatcc c gttttaacag c actttaagca g aatazccaaa 9 actaacaaag t cagataagat t ttacactttg g aaagggaagg g tagccocaag c atttagttac ti tacaactgaa g cttgctattt t cttcacrcgta a ttzatgacaa a tttct:aagtr, at taaaaaagaa a ttcaa7:taaa c( gc:z!Zc t aggc~cgoqg a~ ycagcaggcr gcaggtccta ccat tcctgg attaatccc gaagcttcat actttaatac gaaaaqgcaa ctacaataca ctgaatgata gcccacctcc gggcaaaatc gaaaaaggtc acctttatct tCttccgtgg aaccagatqc cacagczttc gctggtgaca agac:ccttc acctrcgtg~g attaacagca aaaacagaca ~atggaaaag lgcaaztgct :caccgcag r ~t"ccaaata rictggagaca t :accatcaat c :agttacgt g aat~actaca c caggaacag c tattgaccz g 'agaagactt t gaacaccca a gcaagctgg c acazcagcc a ggataggaa c ccccaattc t aatgggttt g gaaaaagag~ a tgtctccct t caaattaac a tttacatgg t ccacgaaca a~ taaagucgg a agagaaaag 9g ttgatcaat t gttatatat ai gaaggtaacc ti :tgcc-ttgg ti caaagaaga g :ggzttaaat a~ igggggata t cagtgtgaot ttCtgcaacct gagctggagt aggtacctga tttaccctat ctgccacata atgtcatagt gagggtgcg~g acttaacagc gtt99ggtgt aaattaaagt cttgcc~cca acaatagcac ttgaac!-tcg gcagcct:cag Ccatgaacgg aagggtctg aactacaaca gcat--gccac atgatgaccq :cagctt:,g -ttacggc::c -ac~ccact 9 g cc-Caaatc: c atcaaa,-, .ttcczagca a .gaaaaacac a tgcaggccag: aaataa'ttt 'taaocctgg g 'gaagctgca a gatcagggcz gatgacttt a auccggag a aatggaaaa a tcct'cacag: gatcccaca. c ataggaatc a gaacaag a cttagatat a tcaaaactgz agatz-aaca a ataataaaa a ccagtgtca a agggtaggtc tttCttttcz atttcatat a' ttacacatg a ttaacaata attt-ac::tq tattata-gaz ctoagtr-tg: gtcaacagg g agaql=: a aagxtzac a~ gaactggagg gaagtrc-gtg acactcaa Qaatcagaac :aatgctacc gaaagctaat g-actgactgg aaaaciaggga -ggccacoga gttcgatgag gracaaggct agaaaactgt O-caaaatgca z:aatgcaagt aagtgcatgg c-actgagctt: :ttagt9gctg 39ccgcagaa :Zt--cgacagc aaag!::,gctg :tcagggctt z :atoaatga-a z ~Czzagcact S ~oaaaaatta t -aatagcatg a 'catarttcag C g:2a:z~gtqg9 at--accaat

C

cactggact t aagtagaag a aoactacaa g acaatcCta r.

tatttacgt tC cacatgaaa 9 ctgCtgtatc ctgccagag a tttgcctta t aagagaatg g, agacccatg g attaaaatg c, at,-cttttCl 0 ttattcttt a ggaaagttt g~ zgcattata a~ cttatctg tc tgaagc-cc ti aacc:cact g9 99gtattac ci 7tgcaagtt ti ga'caqttat ac :Cttaacaca r, agaCactaa c' aggaaaataa a~ ctt -ctC Caca gacaatggt CC cat ctcaa aagagaagag aat aacagCa taCggggcac aaacacat Cc tcacgaggcc tacaacaatg ccatctgaca at t attCa9ca accgcatcaa acccacaaccgatgtaatca cc acoC-CCEC gat9tgtcca a t-9a 3.aaagagaga ~tticatatc- ~agaaaagat :tagtgacca ~gC caacaaz .Cacg-,ztz -a c ,cgaaaoca c rataa~-a.. t: agatcatCact taacz7:t:c 9 acaccctga

L

ggaatc:ac c ccatgaaact a cictagcaaa t ctcacccca a ccacagaat

C

taacactgc c tcatcCat a tatagttoc g aacaaaatt a CCtcCCacC a actgagttt t gggtagat t.

aagtaatgt c ttttaCtga g( :cgcctycg Ci 9cagaacag 9g aatgcaaag ci -caatcc a( _tgtctc: ti :Zactccca ti jcccC~ata at atatgaaca ti :CCL9aaa tc a aaqao t iaztcatc::z t acatoaacc.a ttgCCCtaag ataatgac acattaagga tat ct ccac aaataaaaca at99gagatga att tcacacc gagtgttct acaaacctitcaCaggcat agcttttt-aa taatgttcaaagaagCacc cagaccctcc ccacat:c::: gcaagatac tgcagaccc: .:cagagccca tgcccacc=ac ttgaqqtgQ: 4caatga tcactcca: acgaggtC: .caqtagaaZ 99cJJaacoa at t--t g3at 22, rgacaaccca 9ct C tcc agaaac: acatcaaag att Cccacc tatgtzgca caggcgcc:" t tgaaaacia acacatcac C tat aaat a caaaaacat tgtacaata agaaaaccc tttaaacqc gtggaaaaa ga agc aat C tctttacc: catacc= caaagcacc tqccC'caac :a r-::C 120 180) 240 300 360 420j 480 54 0 6CO 720 840 -900 1020 1090 1250 13 1330 15 1620 16190 17-i 181M 192L, 210 2160 22203 22B0 2340 2400 2460 2520 2530 2640 2700 2760 2820 2940 3 000 3060 330 ttttactcct tccottat: tttttaaaag attatcgaac aataaaacca tttgcct tt 3360 3362 <210> 168 <211> 2784 <212> DNA <213> Homo sapien <400> 168 tctgcaccca tattgaaaac ctgacacaat gaggcttctc tgtgactoc tcaagacaat gaacccac taccaagaga taataataac ctggcatagg gggaaaatac cagaacacca tgagtataac gtgt--catz:t crgtaccact tc caactgca aagtacccac atgggatgta qcotcacct gcroacgrg agaa'tttazt cagcaaagga gctggtttca gc: taagaaa gatattagtg caggcca atctaccacgt cacgattgat ccagcttgaa tgtggataat tcotgagatt caatctaact gacttacacc tcgcgcctcc cctccatttt tcttaatgcc aczccttcgat ttt-tttct~c cagcat aagc cacagcaaac ggagcgaaag tccagctggc aaatagaaga aagctacaag acaatgctat tat ttacgtt cacacclaaag cz:Tclgtatc tacaacatg Ctggttgcct gggt-ataatc tcaaacatragagtattt: agcaaaataa gcacatggag acttcat t tca ggccgagtgt aatgacaaac gacatcacag agtaaqct::: tcaataatgz aaccaagaag atcacagact cctcccacat t-ccagcaaga ttgatgcaga gagatcagag tatctgccca ggatctgagg accagcggag acaaztcac: cttacaggag gctttcagta agtacaggtg act gtgggca atattatttg tttcggacag ctgaacaata aactcagctg cctcatcctq actgtcactg gatggagcag tttgctgcaa aCCccagccoggtaa tat to tggggcttta Ccccaccc--g ggaat!:gacoctatgaaaca tttagtaaa: ctoaccccaa ccacagaattaacaztgcc 1cccaaaggag :taait:caga T gattc:catiaggaaatgat tcagaaatat aacaagaat-c atgatcocata cacctaat~t ttqtozatga ctt to: acat gcactz-tgt ttaaagaaag Ucacqcaaa caccaaacct ccgctcracr-t Cccccc:tgr zggcagaagc tt9ttgaaat cccagc: aca ccactatatc tggttgaaaa atgataagct ccattaccct gt:taaagrt gaalttccotc aaaactcaa acgacactat atcctcratgg ctagtct.tg cccatcat~lc tgcccccagc tgatgattta ccacagttga gtgccgatgt atggtagata actctac-.cc agatgaatgc gccgacz:ag atgt:cc ctatoct-gga agaatozaata acatcaaagc atttccacga Latgttcqaa c.aggcqoozo gtatgcacca cat tgcaggt actcccar-:c rgcaat taat aactoaagct aaagat-ttta atatgaaaao caccctacaa oct ac-gaar atgggcccac aaatgggcaa gtcrtoaaaaa ac~caccttz: :::Latct:ct acagaaccag r:oaccacagc agagg7c: ggt zqacaaac~c oocaaat:aac agctaaaaca acotgaatgga ztcttggcaat gggrttatcc C7:tgrt tcca :ggaactgga acctcaccac gtttctagtt acgaaaatac gattccagga tCtgcaagcc c-actot ggaa tgccaatqtg gccagagac:- :ataaaaaat :agcttgaaa agggagt cat tooaaggaaa1 ctcacagaagc ~acctcaaa zagcacctgg aaagt:o.aca gaaazcctca atgoac otga :aCoIaacaa: ggctcagtgt Ctatttgca -tg9ggagctq cctCaggtac tcattt taco atacctgcca gcaaatit c a tacagagggt gat-aact t aa ot ccgr-tg9 aac-caaatza ggt cc:tgcc atctacaata gtggt--gadt atgtgcagcc t cc-atga gacsaaaz-og cotocaact ac gt:gggca: ztg agcaatga-g gacatcaaca aaagctzatg t-gcttaccca gcagccccaa gatat atcaa gacatttctcc: caattgaaaa acgtggcaag tacacaaar-a acagctaagc ctgaaagtga gcctttgtgg aaacagggat ggagatcc-gt gatggaatt:_ gtgcatgtcaE gct atgt atgt tcagtaggcac -tt :tcagt a3ttatzgaoo t agaagac

C

gaat-a~ccaa 3caaaccggc acatcaucca a lgataaoaac t c-caa: c gagtgaactgq acctgaagt t gagtacagc: ctgagaatca tat ttaatoc catggaaag o tagtgactca gt ggaaaaaa cagctggcta gtatgttcaa aagtgacaag cccaagaaaa gc a ccoaaa a tttgtaatgc zcagaagtgc acgggaczaa :cqT t t-3cza aacaagcogoc ocaqtZ:Cga atcgaaaga:: tttgttcaag gctctgtqact :tgtlgctcaa atctggaaga actccaar-ag agcaacataccagtggtcc ittttatcac :tgggcaczQ :agtgacctc iaagagacac; :ttatcccat :tacgctoag actcgaggta Itcactctooc :accaggtza Jaaatgaga :gctgggacz :ggaagot~lt ;at cagggo o ~atgacttt a it Cagggaa iatggagaaa :cttacac:i :atcctoz-=o 120 190 240 300 360 4 480 540 9-60 720 780 840 9 0 960) L020 1080 1140 1200 1260 1320 1330 C 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 ccgccagaoa ttatcttata ttga 2784 <210> 169 <211> 592 <212> PRT <213> Homo sapien <400> 169 Met Thr Gin Arg Ser Ile Ala Gly Pro Ile Cys Asn Leu Lys Phe Val 1 5 10 Thr Leu Leu Val Ala Leu Ser Ser Giu Leu Pro Phe Leu Gly Ala Gly 25 Val Gin Leu Gin Asp Asn Gly Tyr Asn Gly Leu Leu Ile Ala lie Asn 40 Pro Gin Val Pro Giu Asn Gin Asn Leu Ile Ser Asn Ile Lys Glu Met 55 Ile Thr Giu Ala Ser Phe Tyr Leu Phe Asn Ala Thr Lys Arg Arg Val 70 75 The The Arg Asn Ile Lys Ile Leu IIe Pro Ala Thr Tro Ls Ala Asn 90 Asn Asn Ser Lys Tle Lys Gin Glu Ser Tyr Giu Lys Ala Asn Val Ile 100 1'35 110 Val Thr Asp Trp T'r G ly Ala His Gly Asp Asp Pro Tyr Thr Leu Gin 115 120 125 Tyr Ara Gly Cxs Gly Lys Giu Gly Lys Tyr lie His Phe Thr Pro Asn 130 135 140 The Leu Leu Asn Asp Asn Leu Thr Ala Gly Tyr Gly Ser Arg Gly Arg 145 150 1S5 160 Val Phe Val His G u Tro Ala His Leu Arg Trp Gly Val The Asp Gu 165 170 175 Tyr Asn Asn Asp Ls Pro Phe Tyr lIe Asn Gly Gin Asn Gin Ile Lys 180 185 190 Val Thr Arg Cys Ser Ser Asp Ile Thr Gly lie Phe Val Cys Glu Lys 195 200 205 Gly Pro Cys Pro Gin Giu Asn Cys lie Ile Ser Lys Leu Phe Lys Glu 210 215 220 Gly Cys Thr Phe Ile Tyr Asn Ser Thr Gin Asn Ala Thr Ala Ser Ile 225 230 235 240 Met Phe Met Gin Ser Leu Ser Ser Val Val Giu Phe Cys Asn Ala Ser 245 250 255 Thr His Asn Gin Giu Ala Pro Asn Leu Gin Asn Gin Met Cys Ser Leu 260 265 270 Arg Ser Ala TrD Asp Val Ie Thr Asp Ser Ala Asp Phe His His Ser 275 280 285 Phe Pro Met Asn Gly Thr Giu Leu Pro Pro Pro Pro Thr Phe Ser Leu 290 295 300 Val Giu Ala Gly Asp Lys Val Val Cys Leu Val Leu Asp Val Ser Ser 305 310 315 320 Lys Met Ala Giu Ala Asp Arg Leu Leu Gin Leu Gin Gi 1 Ala Ala Glu 325 330 335 Phe Tyr Leu Met GIn ile Vai Glu Ile His Thr Phe Val Gly ile Ala 340 345 350 Ser Phe Asp Ser Lys Gly Giu Ile Arg Ala Gin Leu His Gin Ile Asn 355 360 36 Ser Asn Asp Asp Arg Lys Leu Leu Val Ser Tv- Leu Thr Thr Val 370 Ala Ser 385 Glu Leu Val Ala Phe 465 Ser Leu Thr Thr Gly I Lys Thr Asp IlE 39( Val Val Leu Ala 450 Phe Arg Glu lai L r .r g Va Thr Ser 435 Pro Val Ile Ser Thr 515 Gin Lys 1 Glu Ser 420 Ser As n Pro Ser Thr 500 Val Ala ?yr Ly Gi Giy Leu Asp Ser 485 Giy Asp Ser r'yr Leu Asp Ser Giu lile 470 Gly Glu Asn Gly 375 Ser Asn Asp Thr Glu 455 Ser Thr Asn Thr Pro I 535 395 Ile Cys Ser Gly 380 Leu Gly Lys Ile 440 Leu Asn Gly Val Va! 520 ?ro Ly Leu 425 His Ser Ser Asp Lvs 505 Gly Gi Ala 41C Leu Ser Arg Asn Ile 490 Pro Asn lie Tyr Gly Ile Leu Ser 475 Phe His Aso Ile Gly Asn Ala Thr 460 Met Gin His Thr Leu Lys Lys Giy Phe 400 Ser Vai Met le 415 Cys Leu Pro Thr 430 Leu Gly Ser Ser 445 Gly Gly Leu Lys lie Asp Ala Phe 480 Gin His Ile Gin 445 Gin Leu Lys Asn 510 Met Phe Leu Val 525 Phe Asp Pro Aso Thr Asn Asn Phe Ile Thr Asn Leu Thr Phe Thr Tyr 550 Ala Ser Leu Trp lie 565 T'r Leu Me- Cys Phe <210> 170 <21i> 791 <212> PRT <2i3> Homo sapien Pro Gly Thr His His Aia 585 555 Ala Lys Pro Gly His Tro 570 575 Lys Leu Leu Thr Trp Lys 590 Arg 560 Thr Le <400> 170 Met 1 Thr Val Pro Ile Phe Asn Val1 Tyr Phe 145 Thr Leu Gin Gin Thr Phe Asn Thr Ar 9 130 Let: Gin Leu Leu Va1 Glu Arg Ser Asp 115 Gly Leu Aro Ser 5 Val Ala Gin Asp Pro Glu Ala Ser Asn Ile Lys Ile 100 Tr T yr Cys Gly Asn Asp Ile Leu Asn Asn Phe 70 Lys Lys Gly Lys Asn

ISO

Ala Gly Pro lie Cys Asn Le Lys Phe Val Ser Gly Gin 55 Tyr Ile Gin Ala Glu 135 Leu Ser Tyr 40 Asn Leu Leu Glu His 120 Gly Thr Glu Leu 25 Asn Gly Leu Ile Phe Asn le Pro 90 Ser Tyr 1 0 Gly Asp Lys Tyr Ala Gly Pro Le Ser Ala 75 Ala Glu Asp le Tyr Phe Leu Asn Thr Thr Lys Pro His 140 Le Ile Ile Lys Trp Ala 'yr 125 Phe Ser Gly Ala Ala lie Lys Glu Arg Arg Lys Ala Asn Val 110 Thr Let Thr Pro Arg Gly Gly Asn Met Va1 Asn Ile Gin Asn Val Phe Val His Glu Trp Ala His Let: rg Tro Gy Va h s it: Tyr Va1 dly Gly 225 Asn Thr Pro 210 Cys Asn Asp 180 Arg Cys 195 165 Lys Ser Pro Phe Ser Asp Tyr ile 185 Ile Thr 170 Asn Gly Gly Ile 175 Gin Asn Gin Ile Lys 190 Phe Val Cys Glu Lys 205 200 Cys Pro Gin Giu Asn Cys Ile Ii 215 Thr Phe Ile Tyr Asn Ser Thr G1 e Ser Lvs 230 Met Phe Met Gin Ser Leu Se 245 Thr His Asn Gin Giu Ala Prc Arg Phe Val Ser Pro 290 Glu Al 271 Me Al 305 Lys Met AlE Phe Ser Ser Ser 385 Glu Leu Val Ala Phe 465 Ser Leu Thr Thr Glv 545 Thr Tyr Va I Tyr Phe Asn 370 Ala Val Val Lau Ala 450 Phe Arg Glu Val Trp 530 Arg Ala Thr i Thr Leu Asp 355 Asp Lys Va1 Thr Ser 435 Pro Val Ile Ser rhr 515 GIn Lys SCr Leu 3er 595 260 a Trp 5 t Asn a. G I Glu Met 34- Ser Asp Thr Glu Ser 420 Ser Asn I Pro Ser Thr C 500 Val I Ala Tyr Leu 1 Asn P 580 Arg A As- Gl_ Ast Ala 325 Gir Lys Arg Asp Lvs 405 ly Giv Laeu %sp 3er ~85 31y \so Ier asn i a o Val Thr Lys 310 Asp Ile Gly Lys lIe 390 Leu Asp Ser Glu Ile 470 Gly Clu 1 Asn Gly Thr I 550 Ile Thr Ser I

ILE

Glu 295 Val Arg Val Glu Leu 375 Ser Asn Asp Thr Glu 455 Ser rhr %sn rhr Pro 335 s n )ro i s sn r Ser Val Va 25 D Asn Leu Gli 265 Thr Asp Se, 280 Teu Pro Prc Val Cys Let L eu Leu Glr 33C Glu HisH~ 345 lie Ara Ala 360 Leu V;-l Ser 71= Cs Ser Gly Ls Ala 410 Lys Leu Leu 425 Ile His Ser 440 Leu Ser Arg Asn Ser Asn Gly Asp le 490 Val Lys Pro 505 Val Gly Asn 520 Pro 0Tu Ile Asn Phe Ie Gly T h r Ala 570 His Ser Leu 585 Ser Ala Val 600 220 n Asn Ala 235 1 Giu Phe 0 1 Asn Gin Ala Asp Pro Pro 300 1 Val Leu 315 I Leu Gin Thr Phe Gin Leu Tyr Leu 380 Gly Leu 395 Tyr Gly Gly Asn Ile Ala I 4 Leu Thr C 460 Ser Met I 475 Phe Gin G His His G Asp Thr M 5 Ile Leu P 540 Thr Asn L 555 Lys Pro G Gin Ala L Pro Pro A 6 Leu Thr Cys Met Phe 285 Thr Aso Gin Val His 365 Pro Lys I Scr "vs L 4 4 eu G L45 ly G :ie A ;in H ;ln L 5 let P 'he A .eu T iy H eu L 5 la T Ph Al As Cy 27( Hi PhE Val Ala ly 350 -ys Tal eu ;ly ly .sp .is eu he so hr s ys 90 h,- C Ly a Se n Al 25 s Se 0 Hi Se Se Ala 335 Ile Tle Thr Gly Met 415 Pro Ser Leu Ala Ile 495 Lys Leu Pro Phe Trp 575 Va1 Val 's Glu r lie 240 a Ser r Leu Ser Leu Ser 32C Ala Asr, Val Phe 400 Thr Ser Lys Phe 480 Gin Asn Va1 Asp Arg 560 Thr Thr Ala Phe Val 610 Tyr Ala Asn Glu Arg Asp Ser Leu His Phe Val Lys 625 Thr Gin G30 Pro Phe Tvr Pro Pro His 620 Ile Leu 635 Pro Val Asn Ala Thr Pro Val Met jl Val1 Ala Thr Val Giu 645 Al a Giu Thr Gly Asp 650 Ile Thr Leu Leu Asp Asp Ser Arg Tyr 675 Val His Val Gly 660 Phe Gly Ala Asp Val Lys Asn Asp Gly 670 Ser Arg Leu 655 Ile Tyr Leu Lys Phe Ser Phe Asn Gly Arg Asn His Ser 6S90 Pro Gly Pro 695 Tyr Ile Ser Thr Pro 700 Thr His Ser Ile Ser His Ala 705 Ile Met 710 Pro Val Pro Gly Tyr 715 Gly Ala Asn Gly As n Gin Met Asn Al a 725 Phe Arg Lys Ser Val1 730 Ser Arg Asn Giu Giu Glu 735 Ser Val Arg Lys Trp Leu Gi1v Val 755 le Ile Asp 770 Asp Ser Thr 785 Gly 740 Pnr, Ser Arg Val Gly Gly Ser Phe 750 Pro Ala Gly Pro Asp Val Phe Cys Lys Leu Giu Ala Val Asn Arg Ar g Giy Pro Ile Leu Trp Arg Arg Leu 790 <210> <211> <212> 171 1491

DNA

<213> Homo sapien <400> 171 cctcctgcca gccaagtgaa aagagtgctg caacccagcc tgagaaggtt tctczcacat aagtggctct tgtzctgttg cctgaggacg acaccaacac gactcticctg ggcgaccccg agatttgttc ctaaaagtaa caccatattg attctgcaca agcaagattg cagatqgcag agcaattccc atccfaccaga caattggact atgctgacct gaagtgatcc caaaagatga acatgggagg ccatlggagaa aacttcaacc acaggctgct gtctgcaacc aggtggaatg aaatcaaaag acattgttct tgggcggacc cgaact-cccc aagcacaagc gaaccccagc gtcctggcc-a agagctacaa cagttgactt cagaqgagat ac=czgata tttzt~ctgg gggcactgca tojaggtctgc ctatgc--gqt g~aczggacac aagcz-acagc taagcccatc gacatgctta ctagccaacg ctacgaaagaa ccctgggagt acagaggaag agagcttacc agctctagag tgtttacaat tgtgaagaga gttggtccga ctatcrtatt aaatggaaaa gtgtaaagat ggagatgatc tcatccttac ggttgcctat ggtgctcttg cctgattgc: tgagcagcgc gaaagccata cccccctaat cagaaggccc atcgcctctg ggccggaaaa :ztccccttc ccgcatgaga gcgcttaaga ::tcaaattg aagagt cagg attcctcaga gccgtcaaat aatgaggagc gaagacatat ccagccttgg cattttccag acactatttg acaggat tgg ctcaacaagc t caaccaga agtgctctgg gaggacccag c:gccracc e=tcagacaga uatggcct aa :atccattct :gcgtgtgga z1:-taaatctc zaaagacaat acctctccttc gggagt-gtgc tgtggcagcc ctacagcagc aaaagatgag cttcttcaca tggcaataga aggt tggactctacactc aaaggtcact tgtctgtaaa acacagtgga ccaagtccat cagggct caa gaaaactgct gatcccatcg tcctttgtgc agctgcagcg acgrgcaaz aca .gaaatat ctgatgaaca tggtgacaca rcctgcttgg aattttgrzz atgatgtggg cgagggccc cctcttcttir ctccacccag agaagttaca tggtgctaac agccgggtzc ggccacccga aaagctttgg gaaaaatctt gccaggtgag tctctgtgcc cggggtgt c gtacaaacct ggatttct-gc agaagaacca ctt ggcaaaa tggggttgtg gtntgaatt-c gcgatacttg ttaacataca gagga: goct: cgacttzzaa:: ttcacz-croa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 138C 1440 aaaaattaaa tgctctctcc taaagatcct ccacctaaaa aaaaaaaaaa a <210> 172 <211> 364 <212> PRT <213> Homo sapien <400> 172 Met Trp Gin Pro Leu Phe Phe Lys Trp Leu Leu Ser Cys Cys Pro Gly 1491 is Ser Ser Gin Ile Ala Ala Ala Ala Ser Thr Gin Pro G1i l Asi Se Gl Leu Asn Gly Asn Lvs 145 Val Lys Glu Phe Tyr 225 Arg Tyr Ser His Gly 305 Asn Ile Ala n Thr Pro 1 Ala Ala Asn Ser Ser 131! Asn Ser lie Lys Asn 210 Lys Lys I Ser I Pro N Lys I 290 Val X Val G Aso G Gly P 3 Gin Gly Asn Ile Glu Va1 115 His Leu Val Leu .ys 195 His ?ro eu kla ali rg rai ;iy I 'ro 55 Arc Arc Arc Glu Glu 100 Lys Arg Gin Lys Phe 180 Lys Arg Va1 Leu Leu 260 Leu Fhr la1 la1 eu 140 ro g~ Lvs Pro Phe Ala Gin Arg Pro Leu Pro 165 Aso Asp Leu Cys Asp I 245 Gly Leu C Pro I Leu I Phe C 325 Asn I Ly Arc Val 70 Gl Val Glu Glu Asp 150 Gly Thr Ala Leu %sn 230 The 3er flu la la 110 ;lu rg s

C

C

C

A

L

2

L

P

A

25 Ser Gin Giu Lys Met 40 Glu Leu Thr Ile Pro 55 Pro Lys Ser Lys Ala 75 Phe His His Ile Asp 90 Gly Leu Ala Ile Arg 105 Asp Ile Phe 'I"yr Thr 120 Leu Val Arg Pro Ala 135 Tyr Val Aso Leu Tvr.

155 Alu Giu Val Ile Pro 170 Jal Asp Leu Cys Ala 185 ly Leu Ala Lys Ser 200 lu Met Ile Leu Asn .15 In Val Glu Cys His 235 .ys Lys Ser Lys Asp 250 [is Arg Glu Giu Pro 265 ~sp Pro Val Leu Cys 280 eu Ile Ala Leu Arg 95 ys Ser Tyr Asn Glu 315 he Gin Leu Thr Ser 330 Sn Val Arg Tyr Leu Arc Glr Lei.

Ser Ser Ser Leu 140 Leu Lys Thr lie Lys 220 Pro Ile Trp kla ryr 300 31n 3lu Chr g Glu a Thr I Glu Ala Lys Lys 125 Glu Ile Asp Trp, Gly 205 Pro Tyr Val i Val Leu 2 285 Gin I Arg Glu i Leu I Va Se AlE His Ile 110 Leu Arg His Glu Glu 190 Va1 Gly Phe Leu %sp 270 %la eu e t sp p Asp 1 Thr r Ser Val VaI 95 Ala Tro Ser Phe Asn 175 Ala I Ser Leu Asn Val 1 255 Pro 4 Lys I Gin I Arg G 3 Lys A 335 Ile P Ile Asp His Lys Tvr Asp Ser Leu Pro 160 Gly sn 31n la ~sn ,ys rg ;In !1a he 345 Asn Tyr Pro Phe Ser Asp Glu Tyr

Claims (4)

1. An isolated polynucleotide molecule comprising a nucleotide sequence selected from the group consisting of: sequences provided in SEQ ID NO: 1-3, 6-8, 10-13, 15-27. 29, 30, 32,

34-49, 51, 52, 54, 55, 57-59, 61-69, 71, 73, 74, 77, 78, 80-82, 84, 86- 96, 107-109, 111, 113, 125, 127, 128, 129, 131-133, 142. 144, 148- 151,153, 154, 157, 158, 160, 167, 168 and 171; the complements of sequences provided in SEQ ID NO: 1-3, 6-8, 13, 15-27, 29, 30, 32, 34-49, 51, 52, 54, 55, 57-59, 61-69. 71, 73, 74, 77, 78, 80-82, 84, 86-96, 107-109, 111, 113, 125, 127, 128. 129, 131- 133, 142, 144, 148-151, 153, 154, 157, 158, 160, 167, 168 and 171: and sequences that hybridize to a sequence of or under moderately stringent conditions. 2. An isolated polypeptide comprising an immunogenic portion of a lung tumor protein or a variant thereof, wherein said protein comprises an amino acid sequence encoded by a polynucleotide molecule of claim 1. 3. An isolated polynucleotide molecule comprising a nucleotide sequence encoding the polypeptide of claim 2. 4. An expression vector comprising an isolated polynucleotide molecule of claims 1 or 3. A host cell transformed with the expression vector of claim 4. 6. The host cell of claim 5 wherein the host cell is selected from the group consisting of E. coli, yeast and mammalian cell lines. 7. A pharmaceutical composition comprising the polypeptide of claim 2 and a physiologically acceptable carrier. 8. A vaccine comprising the polypeptide of claim 2 and a non-specific immune response enhancer. 9. The vaccine of claim 8 wherein the non-specific immune response enhancer is an adjuvant. A vaccine comprising an isolated polynucleotide molecule of claims 1 or 3 and a non-specific immune response enhancer. 11. The vaccine of claim 10 wherein the non-specific immune response enhancer is an adjuvant. 12. A pharmaceutical composition for the treatment of lung cancer comprising a polypeptide and a physiologically acceptable carrier, the polypeptide comprising an immunogenic portion of a lung protein or a variant thereof, wherein said protein comprises an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of: sequences recited in SEQ ID NO: 4, 5, 9, 14, 28, 31, 33, 50, 53, 56, 72, 75, 76, 79, 83, 85 97-106, 115-124, 126, 130, 134-141, 143,

145-147 and 162-164; sequences complementary to the sequences of SEQ ID NO: 4, 5, 9, 14, 28, 31, 33, 50, 53, 56, 60, 70, 72, 75, 76, 79, 83, 85, 97-106, 115-124, 126, 130, 134-141, 143, 145-147 and 162-164 and sequences that hybridize to a sequence of or under moderately stringent conditions. 13. A vaccine for the treatment of lung cancer comprising a polypeptide and a non-specific immune response enhancer, said polypeptide comprising an immunogenic portion of a lung protein or a variant thereof, wherein said protein comprises an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of: sequences recited in SEQ ID NO: 4, 5, 9, 14, 28, 31, 33, 50, 53, 56, 72, 75, 76, 79, 83, 85, 97-106, 115-124, 126, 130, 134-141, 143, 145-147 and 162-164; sequences complementary to the sequences of SEQ ID NO: 4, 5, 9, 14, 28, 31, 33, 50, 53, 56, 60, 70, 72, 75, 76, 79, 83, 85, 97-106, 115-124, 126, 130, 134-141, 143, 145-147 and 162-164; and sequences that hybridize to a sequence of or under moderately stringent conditions. 14. A vaccine for the treatment of lung cancer comprising a DNA molecule and a non-specific immune response enhancer, the polynucleotide molecule comprising a sequence selected from the group consisting of: sequences recited in SEQ ID NO: 4, 5, 9, 14, 28, 31, 33, 50, 53, 56, 72, 75, 76, 79, 83, 85, 97-106, 115-124, 126, 130, 134-141, 143, 145-147 and 162-164; sequences complementary to the sequences of SEQ ID NO: 4, 5, 9, 14, 28, 31, 33, 50, 53, 56, 60, 70, 72, 75, 76, 79, 83, 85, 97-106, 115-124, 126, 130, 134-141, 143, 145-147 and 162-164; and sequences that hybridize to a sequence of or under moderately stringent conditions. A method for inhibiting the development of lung cancer in a patient, comprising administering to the patient an effective amount of the pharmaceutical composition of claims 7 or 12. 16. A method for inhibiting the development of lung cancer in a patient, comprising administering to the patient an effective amount of the vaccine of any one of claims 8, 10, 13 or 14. 17. A fusion protein comprising at least one polypeptide according to claim 2. 18. A fusion protein comprising a polypeptide according to claim 2 and a known lung tumor antigen. 19. A pharmaceutical composition comprising a fusion protein according to any one of claims 17-18 and a physiologically acceptable carrier. A vaccine comprising a fusion protein according to any one of claims 17-18 and a non-specific immune response enhancer. 21. The vaccine of claim 20 wherein the non-specific immune response enhancer is an adjuvant. 22. A method for inhibiting the development of lung cancer in a patient, comprising administering to the patient an effective amount of the pharmaceutical composition of claim 19. 23. A method for inhibiting the development of lung cancer in a patient, comprising administering to the patient an effective amount of the vaccine of claim 24. A method for detecting lung cancer in a patient, comprising: contacting a biological sample obtained from the patient with a binding agent which is capable of binding to a polypeptide, the polypeptide comprising an immunogenic portion of a lung protein or a variant thereof, wherein said protein comprises an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of nucleotide sequences recited in SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171 the complements of said nucleotide sequences and sequences that hybridize to a sequence of SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171 under moderately stringent conditions; and detecting in the sample a protein or polypeptide that binds to the binding agent, thereby detecting lung cancer in the patient. The method of claim 24 wherein the binding agent is a monoclonal antibody. 26. The method of claim 25 wherein the binding agent is a polyclonal antibody. 27. A method for monitoring the progression of lung cancer in a patient, comprising: contacting a biological sample obtained from the patient with a binding agent that is capable of binding to a polypeptide, said polypeptide comprising an immunogenic portion of a lung protein or a variant thereof, wherein said protein comprises an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of nucleotide sequences recited in SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171 the complements of said nucleotide sequences and sequences that hybridize to a nucleotide sequence of SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171 under moderately stringent conditions; determining in the sample an amount of a protein or polypeptide that binds to the binding agent; repeating steps and and comparing the amount of polypeptide detected in steps and to monitor the progression of lung cancer in the patient. 28. A monoclonal antibody that binds to a polypeptide comprising an immunogenic portion of a lung protein or a variant thereof, wherein said protein comprises an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of: nucleotide sequences recited in SEQ ID NO: 1-3, 6-8, 10-13, 15-27, 29, 30, 32, 34-49, 51, 52, 54, 55, 57-59, 61-69, 71, 73, 74, 77, 78, 80-82, 84, 86-96, 107-109, 111, 113, 125, 127, 128, 129, 131-133, 142, 144, 148-151, 153, 154, 157. 158, 160, 167, 168 and 171; the complements of said nucleotide sequences; and sequences that hybridize to a nucleotide sequence of SEQ ID NO: 1-3, 6-8, 10-13, 15-27, 29, 30. 32, 34-49, 51, 52, 54, 55, 57-59, 61-69, 71, 73, 74, 77, 78, 80-82, 84, 86-96, 107-109, 111, 113, 125, 127, 128, 129, 131-133, 142, 144, 148-151, 153, 154, 157, 158, 160, 167, 168 or 171 under moderately stringent conditions. 29. A method for inhibiting the development of lung cancer in a patient, comprising administering to the patient a therapeutically effective amount of a monoclonal antibody according to claim 28. The method of claim 29 wherein the monoclonal antibody is conjugated to a therapeutic agent. 31. A method for detecting lung cancer in a patient comprising: obtaining a biological sample from the patient; contacting the sample with at least two oligonucleotide primers in a polymerase chain reaction, wherein at least one of the oligonucleotides is specific for a polynucleotide molecule encoding a polypeptide comprising an immunogenic portion of a lung protein or of a variant thereof, said protein comprising an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of nucleotide sequences recited in SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171 the complements of said nucleotide sequences, and sequences that hybridize to a sequence of SEQ ID NO: 1-109, 111, 113, 115-151. 153, 154, 157, 158, 160, 162-164, 167, 168 or 171 under moderately stringent conditions; and detecting in the sample a polynucleotide sequence that amplifies in the presence of the oligonucleotide primers, thereby detecting lung cancer. 32. The method of claim 31, wherein at least one of the oligonucleotide primers comprises at least about 10 contiguous nucleotides of a polynucleotide molecule comprising a sequence selected from SEQ ID NO: 1-109, 111, 113, 115-151,

153. 154, 157, 158, 160, 162-164, 167, 168 and 171. 33. A diagnostic kit comprising: one or more monoclonal antibodies of claim 28; and a detection reagent. 34. A diagnostic kit comprising: one or more monoclonal antibodies that bind to a polypeptide encoded by a polynucleotide molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, 5, 9, 14, 28, 31, 33, 50, 53, 56, 60, 70, 72, 75, 76, 79, 83, 97-106, 115-124, 126, 130, 134-141, 143, 145-147 and 162-164 the complements of said sequences, and sequences that hybridize to a sequence of SEQ ID NO: 4, 5, 9, 14, 28, 31, 33, 53, 56, 60, 70, 72, 75, 76, 79, 83, 85, 97-106, 115-124, 126, 130, 134-141, 143, 145-147 or 162-164 under moderately stringent conditions; and a detection reagent. The kit of claims 33 or 34 wherein the monoclonal antibodies are immobilized on a solid support. 36. The kit of claim 35 wherein the solid support comprises nitrocellulose, latex or a plastic material. 37. The kit of claims 33 or 34 wherein the detection reagent comprises a reporter group conjugated to a binding agent. 38. The kit of claim 37 wherein the binding agent is selected from the group consisting of anti-immunoglobulins, Protein G, Protein A and lectins. 39. The kit of claim 37 wherein the reporter group is selected from the group consisting of radioisotopes, fluorescent groups, luminescent groups, enzymes, biotin and dye particles. A diagnostic kit comprising at least two oligonucleotide primers, at least one of the oligonucleotide primers being specific for a polynucleotide molecule encoding a polypeptide comprising an immunogenic portion of a lung protein or a variant thereof, said protein comprising an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of nucleotide sequences recited in SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171 the complements of said nucleotide sequences and sequences that hybridize to a sequence of SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164. 167, 168 or 171 under moderately stringent conditions. 41. A diagnostic kit of claim 40 wherein at least one of the oligonucleotide primers comprises at least about 10 contiguous nucleotides of a polynucleotide molecule comprising a sequence selected from SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160. 162-164, 167, 168 and 171. 42. A method for detecting lung cancer in a patient, comprising: obtaining a biological sample from the patient; contacting the biological sample with an oligonucleotide probe specific for a polynucleotide molecule encoding a polypeptide comprising an immunogenic portion of a lung protein or a variant thereof, said protein comprising an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of nucleotide sequences recited in SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154. 157, 158, 160, 162-164, 167, 168 and 171 the complements of said nucleotide sequences, and sequences that hybridize to a sequence of SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 or 171 under moderately stringent conditions; and detecting in the sample a polynucleotide sequence that hybridizes to the oligonucleotide probe, thereby detecting lung cancer in the patient. 43. The method of claim 42 wherein the oligonucleotide probe comprises at least about 15 contiguous nucleotides of a polynucleotide molecule comprising a sequence selected from the group consisting of SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171. 44. A diagnostic kit comprising an oligonucleotide probe specific for a polynucleotide molecule encoding a polypeptide comprising an immunogenic portion of a lung protein or a variant thereof, said protein comprising an amino acid sequence encoded by a polynucleotide molecule comprising a sequence selected from the group consisting of: nucleotide sequences recited in SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158. 160, 162-164, 167, 168 and 171; the complements of said nucleotide sequences; and sequences that hybridize to a sequence of SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 or 171 under moderately stringent conditions. The diagnostic kit of claim 44, wherein the oligonucleotide probe comprises at least about 15 contiguous nucleotides of a polynucleotide molecule comprising a sequence selected from the group consisting of SEQ ID NO: 1-109, 111, 113, 115-151, 153, 154, 157, 158, 160, 162-164, 167, 168 and 171. 46. A method for treating lung cancer in a patient, comprising the steps of: obtaining peripheral blood cells from the patient; incubating the cells in the presence of at least one polypeptide of claim 2, such that T cells proliferate; and administering to the patient the proliferated T cells. 47. A method for treating lung cancer in a patient, comprising the steps of: obtaining peripheral blood cells from the patient; incubating the cells in the presence of at least one polynucleotide of claim 1, such that T cells proliferate; and administering to the patient the proliferated T cells. 48. The method of any one of claims 46 and 47 wherein the step of incubating the T cells is repeated one or more times. 49. The method of any one of claims 46 and 47 wherein step further comprises separating T cells from the peripheral blood cells, and the cells incubated in step are the T cells. The method of any one of claims 46 and 47 wherein step further comprises separating CD4+ cells or CD8+ cells from the peripheral blood cells, and the cells proliferated in step are CD4+ or CD8+ T cells. 51. The method of any one of claims 46 and 47 wherein step further comprises cloning one or more T cells that proliferated in the presence of the polypeptide. 52. A composition for the treatment of lung cancer in a patient, comprising T cells proliferated in the presence of a polypeptide of claim 2, in combination with a pharmaceutically acceptable carrier. 53. A composition for the treatment of lung cancer in a patient, comprising T cells proliferated in the presence of a polynucleotide of claim 1, in combination with a pharmaceutically acceptable carrier. 54. A method for treating lung cancer in a patient, comprising the steps of: incubating antigen presenting cells in the presence of at least one polypeptide of claim 2; Q:opcr\kbmU10949-99 div.doc-31100302 -57- administering to the patient the incubated antigen presenting cells. A method for treating lung cancer in a patient, comprising the steps of: incubating antigen presenting cells in the presence of at least one polynucleotide of claim 1; administering to the patient the incubated antigen presenting cells. 56. The method of claims 54 or 55 wherein the antigen presenting cells are selected from the group consisting of dendritic cells and macrophage cells. 57. A composition for the treatment of lung cancer in a patient. comprising antigen presenting cells incubated in the presence of a polypeptide of claim 2, in combination with a pharmaceutically acceptable carrier. 58. A composition for the treatment if lung cancer in a patient, comprising antigen presenting cells incubated in the presence of a polynucleotide of claim 1, in combination with a pharmaceutically acceptable carrier. DATED this 30TH day of MARCH 2002 CORIXA CORPORATION by DAVIES COLLISON CAVE Patent Attorneys for the Applicant