AU2763302A - Megsin protein - Google Patents

Description

S&F Ref. 501244DI

AUSTRALIA

PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT

ORIGINAL

Name and Address of Applicants: Toshio Miyata.

4-2-3-101, Higashinaruse, Isehara-shi Kanagawa. 259-1117 Japan Kiyoshi Kurokawa Ichigayahills 401,49, Ichigaya Yanagi-cho, Shinjuku-ku Tokyo 162-0061 Japan Actual Inventor(s): Address for Service: Invention Title: Toshio Miyata Spruson Ferguson St Martins Tower,Level 31 Market Street Sydney NSW 2000 (CCN 3710000177) Megsin Protein The following statement is a full description of this invention, including the best method of performing it known to me/us:- 5845c Megsin Protein Technical Field The present invention belongs to the field of genetic engineering and specifically relates to a gene isolated from renal cells.

Background Art Sixty trillion various cells in vivo essentially comprise identical genomic DNA. For the normal physiological functions, the expression of these genes is strictly controlled by signals received by cell lines and cells. Therefore, elucidation of genes expressed specifically in each cell type is very important.

A mesangial cell plays a pivotal role in maintaining the structure and function of a glomerulus and is a target of disorders for each type of nephritis. For example, proliferation of mesangial cells and accumulation of extracellular mesangial matrix are thought to be the first step developing glomerulosclerosis in a patient suffering from various glomerular diseases such as chronic nephritis and diabetic nephritis. Therefore, identification of genes expressed specifically in mesangial cells 15 and elucidation of its function are helpful for understanding biological characteristics of mesangial cells and the causes of diseases relating to mesangial cells, and in turn, treating or diagnosing diseases relating to mesangial cells.

Thyl antigen is known as a marker for mesangial cells in rats. However, this gene is not specific to mesangial cells and is not expressed in human mesangial cells (Miyata T. et al., Immunology, 1989, 67: 531-533; and Miyata T. et al., Immunology, 1990, 69: 391-395). Mesangial i cells are known to express a smooth muscle actin when activated, but this gene is also not specific to mesangial cells. Any genes expressed specifically in mesangial cells have not been reported.

Disclosure of the Invention An objective of the present invention is to isolate a gene expressed specifically in mesangial cells.

The current inventors isolated mRNA from in vitro cultures of human mesangial cells to construct a cDNA library of 3' side. Sequences of numerous clones were randomly determined from the cDNA library and compared with the known nucleotide sequences of cDNA clones of 3' side obtained from various organs and cells to determine the clones expressed specifically in mesangial cells. One clone which appeared the most frequently in the mesangial cells was selected, and its full length cDNA was isolated (the expression product was named as MEGSIN) by RACE method to determine the whole nucleotide sequence and express the said cDNA in E. coli (SEQ ID NO: 1 and SEQ ID NO: 2 show the nucleotide sequence of human MEGSIN cDNA and the deduced amino acid sequence, respectively). The homology search in amino acid sequences with SwissProt data base revealed that MEGSIN belongs to SERPIN super family Carrell et al., Trends Biochem Sci. 10, 20, 1985; R. Carrell et al., Cold Spring Harbor Symp. Quant. Biol. 52, 527, 1987; E. K. O. Kruithof et al., Blood 86, 4007, 1995, J. Potempa et al., J. Biol. Chem. 269, 15957, 1994; and E. Remold-O'Donnell FEBS Let. 315, 105, 1993). The topography detected by Northern CO8175 blotting confirmed that the expression of MEGSIN was weak in human fibroblasts, smooth muscle cells, endothelial cells, and keratinocytes, and was specifically in mesangial cells. The comparison of MEGSIN expression level in renal tissues from the IgA nephropathy patients and the normal people revealed that the expression level of MEGSIN in the IgA nephropathy patients was significantly larger. Anti-MEGSIN polyclonal antibody and monoclonal antibody were prepared. In addition, the inventors confirmed the structures of mouse and rat MEGSIN homologues. The nucleotide sequences of cDNA of mouse MEGSIN and rat MEGSIN are shown in SEQ ID NO: 3 and SEQ ID NO: 5, respectively, and the deduced amino acid sequences for these are shown in SEQ ID NO: 4 and SEQ ID NO: 6, respectively.

The present invention specifically relates to the followings.

A protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6, or a protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6 in which one or more amino acids are replaced, deleted, added, and/or inserted, and functionally equivalent to the protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ 15 ID NO: 4, or SEQ ID NO: 6 The protein of comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6.

A DNA encoding the protein of The DNA of comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: A DNA hybridising with a DNA comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5 under the stringent condition, and encoding the protein of or the protein functionally equivalent thereto.

A vector comprising the DNA of any one of and A transformed cell expressibly comprising the DNA of any one of and A method for producing the protein of the method comprising culturing the transformed cell of and collecting an expression product of the DNA of any one of and An antibody binding to the protein of (10) The antibody of which recognises an epitope of a protein comprising an amino acid sequence selected from amino acid sequences of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.

(11) The antibody of wherein the antibody is a monoclonal antibody.

(12) An immunoassay method for measuring the protein of or its fragment, the method comprising immunologically binding the antibody of any one of (10) and to the protein of or its fragment.

(13) A reagent for an immunoassay for the protein of or its fragment, comprising the antibody of any one of (10) and (11).

C08175 (14) A method for detecting mesangial proliferative nephropathy, the method comprising measuring the protein of or its fragment contained in biological samples and comparing the measured amount with that obtained from normal samples.

A transgenic nonhuman vertebrate, wherein the expression level of the gene encoding MEGSIN is modified.

(16) The transgenic nonhuman vertebrate of wherein the nonhuman vertebrate is a mouse.

(17) The transgenic nonhuman vertebrate of which is a knockout mouse wherein expression of the gene encoding MEGSIN is inhibited.

A full length cDNA library often comprises the sequences with different 5' ends in the same transcript due to the partial degradation of mRNA and the incomplete synthesis of the first strand.

In addition, the nucleotide sequence of the 3' end is difficult to determine by the chain termination method using general primers due to the gap of primer extension on poly A random prime cDNA library used for constructing EST data base is useful for finding a novel gene, however, can 15 not be used for obtaining typical sequences of genes because it is not clear whether two partial sequences form different parts of a gene, or different transcripts. Therefore the present inventors S:.o used 3'-directed cDNA library. Through this method, unstable cloning efficiency reflecting the size of cDNA can be avoided. The sequence at the 3' region is typical, and the sequence data of about 200 to 300bp are large enough for investigating the characteristics of a gene.

The DNA encoding human MEGSIN of the present invention can be obtained by preparing mRNA from mesangial cells and converting them to the double stranded cDNA by the known methods. mRNA can be prepared by, for example, the guanidine isothiocyanate-cesium chloride method (Chirwin, et al., Biochemistry 18, 5294, 1979), and the treatment with a surfactant and phenol in the presence of deoxyribonuclease (Berger Birkenmeier, Biochemistry 18, 5143, 1979), etc. Poly RNA can be prepared from total RNA by, for example, the affinity chromatography using such a carrier bound to oligo (dT) as Sepharose, cellulose, latex particles, etc. DNA (cDNA) complementary to the mRNA can be obtained by treating RNA obtained in the above manner as a template with reverse transcriptase using oligo (dT) complementary to poly strand at 3' end a random primer, or a synthetic oligonucleotide corresponding to a part of amino acid sequence of MEGSIN as primers. Hybrid mRNA-cDNA strand thus obtained can be converted to a double stranded cDNA by replacing the mRNA with a DNA strand by, for example, treating with E. coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase.

The DNA can be cloned by RT-PCR method using poly RNA from mesangial cells as a template, primers synthesised based on the human MEGSIN gene nucleotide sequence.

Alternatively, without using PCR, the target cDNA can be obtained by directly screening a cDNA library with a probe synthesised based on human MEGSIN gene nucleotide sequence. The gene of the present invention can be selected by confirming the nucleotide sequence of the gene among C08175 the genes obtained by these methods. For mouse and rat MEGSIN, cDNA can be obtained by the same method.

Mouse and rat MEGSIN cDNA can be isolated as follows. mRNA is extracted from tissues of a mouse or rat, or cultured mesangial cells using three kinds of probes based on from the above human MEGSIN cDNA, which are a relatively highly conserved region (197-380 A. a relatively less conserved region (1-196 A. compared with genes of other SERPIN super family protein, and full length cDNA of MEGSIN open reading frame (1-380 A. to construct a cDNA library.

Colony hybridisation is then performed using the above library or a commercially available cDNA library (Funakoshi) Alternatively, as similar to the probe preparation above, primers can be designed based on a relatively highly conserved region (197-380 A. and a relatively less conserved region (1-196 A. and RT-PCR can be conducted using mRNA extracted from tissues of a mouse or rat, or cultured mesangial cells for cloning to obtain mouse or rat MEGSIN cDNA.

The genome can be obtained by conducting plaque hybridisation method using a commercially available library (Funakoshi) in the same manner as in the case of obtaining the human genome.

15 Human MEGSIN genome can be obtained by plaque hybridisation method (refer to Shin Saibou Kougaku Jikken (New Cell Biotechnology Experiment) Protocols, Shujun-sha, pp79-92) using the whole region of known MEGSIN cDNA open reading frame (1143bp) or using as a probe each exon-intron part obtained by amplifying human genomic DNA through PCR method using a part of cDNA as primers as a probe, and a genomic library obtained by inserting DNA partially digested genomic DNA prepared from human B lymphoblast with Sau3 into phage vector EMBL3, .i or by inserting a human X chromosome library into phage vector Charon 35 (refer to Blood, vol. 83, No. 11, 1994, pp3126-3131). A sequence of 5' UT region of the control region sequence can be determined by 5' RACE method (5'-Full RACE Core Set, following Takara's protocol) using human cultured mesangial cell-derived mRNA or human renal mRNA (purchased from Clontech) as a template.

The gene of the present invention can also be produced by following the standard methods using chemical synthesis of nucleic acids, such as phosphoamidite method (Mattencci, M. D. Caruthers, M. H. J. Am. Chem. Soc. 103, 3185,1981), phosphite triester method (Hunkapiller, M. et al., Nature 310, 105, 1984).

An eukaryotic gene often shows polymorphism, like human interferon gene, and one or more amino acids may be replaced by this polymorphism with maintaining activities of a protein. In general, activities of proteins can be often maintained even if one or more amino acids are modified. Therefore, any gene encoding a protein obtained by using the artificially modified gene encoding an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6 is included in this invention as long as the protein possesses the function typical to the gene of the present invention. The present invention includes any protein in which an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6 is artificially modified as long as it has characteristics of the proteins of the present invention.

C08175 The proteins of the present invention comprise an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6, or the amino acid sequences in which one or more amino acids are replaced, deleted, added, and/or inserted, and belong to the SERPIN super family. The SERPIN super family means proteins whose amino acid sequence is at least 20% identical to primary serine protease inhibitors in blood, such as antithrombin III, heparin cofactor II, alantitrypsin, al-antichymotrypsin, protein C inhibitor, a2-plasmin inhibitor, C1 inhibitor, etc., and which does not necessarily show serine protease inhibitory activity (refer to R. Carrell et al., Trends Biochem. Sci. 10, 20, 1985; R. Carrell et al., Cold Spring Harbor Symp. Quant. Biol. 52, 527, 1987; E. K. O. Kruithof et al., Blood 86, 4007, 1995, J. Potempa et al., J. Biol. Chem. 269, 15957, 1994; and E. Remold-O'Donnell. FEBS Let. 315,105, 1993).

The proteins of the present invention include a "protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6, or the amino acid sequence in which one or more amino acids are replaced, deleted, or added, and/or inserted, and expressed weakly in human fibroblasts, smooth muscle cells, endothelial cells, keratinocytes, and expressed in 15 mesangial cells." Alternatively, the proteins of the invention include a "protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6, or the amino acid sequence in which one or more amino acids in these amino acid sequences are replaced, deleted, added, and/or inserted, and strongly expressed especially in mammalian mesangial cells." Moreover, the :proteins of the present invention include a "protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6, or the amino acid sequence in which one or more amino :i acids are replaced, deleted, added, and/or inserted, and comprising serine protease inhibitory activity," etc. These analogues are all encompassed by MEGSIN of the present invention.

Therefore, not only human, rat, and mouse MEGSIN which structure is specifically described, but also the homologues of other species structurally or functionally equivalent to these are included in the current invention.

The DNA of the present invention includes DNAs encoding these proteins. The DNAs *encoding these proteins can be cDNA, genomic DNA, or synthetic DNA.

The codons for desired amino acids themselves are well-known, can be optionally selected, and can be determined by following the standard method by, for example, considering the frequency of use of codons in hosts to be used (Grantham, R. et al. Nucleic Acids Res. 9, r43, 1981). Therefore, the present invention includes DNAs modified by degeneration of codons.

These partial modifications of codons of nucleic acid sequence can be performed by site specific mutagenesis using primers composed of synthetic oligonucleotide encoding desired modification following standard methods (Mark, D. F. et al. Proc. Natl. Acad. Sci. U. S. A. 81, 5662, 1984).

Any DNA hybridising with DNA containing the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 5, and encoding a protein that typically functions as MEGSIN of the present invention, can be included in the DNA of the present invention. A sequence capable of hybridising C08175 with the above sequences under the stringent condition is thought to have the activities similar to a protein encoded by the above sequences.

The nucleotide sequences of DNAs of the present invention, including mutants, can be used for various purposes based on known techniques.

Other prokaryotic or eukaryotic hosts can be transformed by inserting the gene encoding MEGSIN cloned as described above into an appropriate vector. Moreover, the gene can be expressed in each host cell by introducing an appropriate promoter and sequences relating to the phenotypic expression into the vector. As an expression vector, for example, pET-3 (Studier Moffatt, J. Mol. Biol. 189, 113, 1986), etc. for E. coli, pEF-BOS (Nucleic Acids Research 18, 5322, 1990) and pSV2-gpt (Mulligan Berg, Proc. Natl. Acad. Sci. U. S. A. 78, 2072, 1981), etc. for COS cells, and pVY1 (W089/03874), etc. for CHO cells can be used. The target proteins can be expressed as a fusion protein derived from a fusion gene between a target gene and a gene encoding other polypeptide. Such fusion proteins can easily be purified and separated to isolate a desired protein.

15 Escherichia coli can be used asprokaryotic host cells in the expression system of the present invention. Saccharomyces cerevisiae, etc. can be used as host cells among eukaryotic organisms.

Examples of mammalian host cells include COS cells, CHO cells, BHK cells, etc. The transformants of the current invention can be cultured under appropriately selected culturing condition suitable for host cells.

MEGSIN can be produced by culturing the transformants transformed with the gene encoding the target MEGSIN, and recovering it from the microbial cells or the culture supernatant.

It can be purified into a substantially pure protein. MEGSIN, a target protein of the present invention, can be separated and purified by the separation and purification methods commonly used for proteins, and the method is not particularly limited. MEGSIN can be separated and purified by, for example, appropriately selecting and combining various chromatographies.

Besides the methods descried above, the gene of the present invention, the recombinant vector comprising the gene, the transformants carrying the vector and the production of MEGSIN using gene manipulation can be manipulated by the standard method described in "Molecular Cloning A Laboratory Manual" (Cold Spring Harbor Laboratory, N. In addition, a probe for detecting a MEGSIN gene can be designed based on the nucleotide sequence of SEQ IN NO. 1, SEQ IN NO. 3, or SEQ IN NO. 5. Moreover, primers for amplifying DNA and RNA containing these nucleotide sequences can be designed. It is routine for a person skilled in the art to design probes and primers based on a given sequence An oligonucleotide comprising a designed nucleotide sequence can be chemically synthesised. These oligonucleotides can be used for the hybridisation assay of various formats, or for the synthetic reaction of nucleic acids, such as PCR, if appropriately labelled. An oligonucleotide used as a probe or a primer has at least 15 bases, and preferably 25 to 50 bases.

C08175 A promoter region and an enhancer region of MEGSIN gene existing in genome can be obtained based on the cDNA nucleotide sequence of MEGSIN of the present invention.

Specifically, these control regions can be obtained by the same method as described in unexamined published Japanese patent application (JP-A) No. Hei 6-181767, The Journal of Immunology, 1995, 155, 2477-2486, Proc. Natl. Acad. Sci. USA, 1995, 92, 3561-3565 etc. Herein, a promoter region means DNA region existing upstream of a transcription initiation site to control the expression of a gene, and an enhancer region means DNA region existing in an intron or 3' noncoding region to control expression of a gene.

Specifically, a promoter region can be obtained, for example, by the following method.

1) A promoter region of MEGSIN is cloned from a human genomic library using 5' end site of cDNA of MEGSIN as a probe.

2) MEGSIN gene is digested with restriction enzyme to obtain a DNA comprising the promoter region at the upstream region (2 to 5kbp) containing a translation initiation codon of MEGSIN gene and determine the nucleotide sequence. The transcription initiation site is determined using poly (A)-RNA prepared from human mesangial cells as a template, by the primer elongation method using primer DNA selected from cDNA sequence at 5' end site of MEGSIN gene. A site possibly comprising the promoter activity is predicted by searching transcription factor binding sequence from the nucleotide sequence.

3) The DNA fragment excluding the coding region of MEGSIN gene from the DNA obtained in 2) is subcloned in a plasmid, and a chloramphenicol acetyl transferase (CAT) gene or a luciferase gene is ligated as a reporter gene at 2 to 5kbp downstream of the DNA fragment to construct a reporter plasmid. Similarly, DNA fragments corresponding to various sites upstream of MEGSIN gene, in which 5' and 3' end sites are stepwise removed, are prepared by digestion with restriction enzymes or by PCR to include possible promoter regions. The CAT gene or the luciferase gene is ligated as a reporter gene at downstream of these DNA fragments to construct a reporter plasmid.

4) A promoter region upstream of MEGSIN gene is obtained by measuring CAT or luciferase .i activity in animal cells transformed with the reporter plasmid prepared in 3).

A 3' noncoding region and an enhancer region having an enhancer activity in introns can be obtained by cloning genomic genes of human MEGSIN from a human genomic library using MEGSIN cDNA as a probe in the same manner as described above for the promoter.

Transcription factors controlling the expression of MESGSIN gene can be obtained by the known methods, for example, those described in "Shin Saibou Kougaku Jikken (New Cell Biology Experiment) Protocols, Shujun-sha," "Biomanual series 5 Tensha Inshi Kenkyu-hou (studies on transcription factors), Yodo-sha," "DNA Cell Biology, 13, 731-742, 1994," such as affinity chromatography, South-western method, footprinting method, gel shift method, or one-hybrid method. Herein, a transcription factor means a factor controlling the transcription of MEGSIN gene, including a transcription initiation factor that induces the transcription initiation reaction and a transcription control factor that up- or downregulates transcription. Affinity chromatography can be C08175 performed by applying a nucleic extract to an affinity column in which promoter and enhancer regions obtained above are immobilised on Sepharose or latex beads, washing the column, eluting Sthe binding transcription factor using a DNA comprising the same sequence as that immobilised in the column, and recovering the transcription factor controlling the expression of MEGSIN gene.

In the case of South-western method, cDNA is inserted into an E. coli expression vector such as Agtl 1, to synthesise a fusion protein with 3-galactosidase. The fusion protein is adsorbed on a nitrocellulose membrane, and a phage which synthesises the fusion protein showing binding activities is selected using radiolabelled DNA fragments of promoter and enhancer regions as probes to obtain the transcription factor controlling the expression of MEGSIN gene.

The present invention also provides an antibody recognising MEGSIN. The antibody of the present invention includes, for example, an antibody to the protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6. An antibody (for example, a polyclonal antibody, a monoclonal antibody) or an antiserum against MEGSIN or a partial peptide of MEGSIN of the present invention can be produced by a known method for producing an antibody 15is and antiserum, using MEGSIN of the present invention, a partial peptide of MEGSIN of the present invention, or a fusion protein such as His-Tag-MEGSIN or MBP-MEGSIN of the present invention as a antigen. A monoclonal antibody can be produced by, for example, the following method.

°The MEGSIN of the present invention or a partial peptide of MEGSIN of the present invention is administered alone or together with a carrier or diluent to a warm-blooded animal at the site capable of producing an antibody. To enhance the antibody productivity, the complete Freund's i adjuvant or incomplete Freund's adjuvant can be administered together with the antigen.

Immunisation is performed every one to six weeks, a total of about 2 to 10 times, in general.

Warm-blooded animals to be used are, for example, a monkey, rabbit, dog, guinea pig, mouse, rat, sheep, goat, and domestic fowl, and preferably a mouse and rat. Monoclonal antibody-producing cells can be prepared by selecting immunised warm-blooded animals such as mice, in which an antibody titre is detected, obtaining spleen or lymph node from the animals 2 to 5 days after the final immunisation, and fusing the antibody producing cells contained in these tissues with myeloma cells to obtain monoclonal antibody-producing hybridoma. The antibody titre in antiserum can be measured by reacting the labelled MEGSIN described below with antiserum, and measuring an activity of the label binding to the antibody. Cell fusion can be performed by a known method, for example, the method of Kohler and Milstein (Nature, 256, 495, 1975). Polyethylene glycol (PEG), Sendai virus, etc. can be used as a fusion enhancer, and PEG is preferable.

Examples of myeloma cells include X-63Ag8, NS-1, P3U1, SP2/0, AP-1, etc., and X-63Ag8 is preferably used. The ratio of the number of antibody- producing cells (splenic cells) to that of myeloma cells is 1:20 to 20: 1. Cells can be fused efficiently by adding PEG (preferably PEG1000 to PEG6000) at the concentration of about 10 to 80 and incubating for 1 to 10 min at 20 to 40 0

C,

preferably at 30 to 37 0 C. Anti-MEGSIN antibody-producing hybridoma can be screened by various methods, for example, the method in which the hybridoma culture supernatant is added to a solid C08175 phase (for example, a microplate) on which MEGSIN antigen is adsorbed directly or with a carrier, and anti-immunoglobulin antibody labelled with a radioactive substance or an enzyme (When cells used for cell fusion are derived from a mouse, anti-mouse immunoglobulin antibody is used.) or protein A is added thereto, and anti-MEGSIN monoclonal antibody binding to the solid phase is detected, the method in which the hybridoma culture supernatant is added to a solid phase on which anti-immunoglobulin antibody or protein A is adsorbed, and MEGSIN labelled with a radioactive substance or an enzyme is added thereto, and anti-MEGSIN monoclonal antibody binding to the solid phase is detected.

Anti-MEGSIN monoclonal antibody can be selected and cloned by known methods or modified methods thereof using usually a culture medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, and thymidine). Any medium for selection, cloning, and culturing can be used as long as hybridoma can grow therein,. For example, RPMI 1640 medium (Dainippon Pharmaceutical Co., Ltd.) containing 1 to 20%, preferably 10 to 20% of foetal bovine serum, GIT medium (Wako Pure Chemicals) containing 1 to 10% foetal bovine serum, or serum-free medium 15. for hybridoma culturing (SFM-101, Nissui Pharmaceutical Co., Ltd.) can be used. Incubation temperature is generally 20 to 40 0 C, preferably about 37 0 C. Incubation time is generally 5 days to 3 weeks and preferably 1 to 2 weeks. Incubation is performed under the 5% carbon dioxide gas in general. The antibody titre of the hybridoma culture supernatant can be determined in the same manner as described above for the measurement of anti-MEGSIN antibody titre in the antiserum.

Cloning can be generally conducted by known methods, for example, semisolid agar method, or limiting dilution method. A cloned hybridoma is cultured preferably in a serum-free medium, thereby producing an optimal amount of an antibody in the supernatant. Preferably, a target monoclonal antibody can be obtained in ascites.

A monoclonal antibody of the present invention does not crossreact with other proteins other than MEGSIN by selecting those capable of recognising epitopes specific to MEGSIN. In general, an epitope specific to a protein is composed of at least 7 or more continuous amino acid residues, preferably 10 to 20 amino acids in an amino acid sequence of the protein. Therefore, a monoclonal antibody recognising an epitope composed of peptides having an amino acid sequence selected from the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6, and composed of at least 7 continuous amino acid residues can be the monoclonal antibody specific to MEGSIN of the present invention. Conserved amino acid sequences among the amino acid sequences of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 can be selected to choose epitopes common in the MEGSIN family. If a region contains amino acid sequences specific to all sequences, a monoclonal antibody capable of recognising different species can be selected.

An anti-MEGSIN monoclonal antibody can be separated and purified by the separation and purification method of immunoglobulin commonly used for the separation and purification of polyclonal antibodies. The known purification methods include, for example, salting out, alcohol precipitation, isoelectric point precipitation, electrophoresis, adsorption and desorption method by C08175 ion exchanger (for example, DEAE), ultra centrifugation, gel filtration, or specific purification method whereby antibody is exclusively collected by, for example, an antigen binding solid phase or active adsorbent, such as Protein A or Protein G, and the binding is dissociated to obtain the antibody.

Monoclonal antibodies and polyclonal antibodies recognising MEGSIN of the present invention, obtained in such a manner, can be used for the diagnosis and treatment for diseases relating to mesangial cells. Examples of a method for measuring MEGSIN with these antibodies include an sandwich assay comprising reacting MEGSIN with an antibody binding to an insoluble carrier and a labelled antibody and detecting MEGSIN in the sandwiched complex produced by the reaction, or a competition method comprising competitively reacting labelled human urine-derived MEGSIN and human urine-derived MEGSIN in a sample with an antibody to measure human urinederived MEGSIN in a samples based on labelled antigen amount reacted with the antibody.

The measurement of human urine-derived MEGSIN by the sandwich method is conducted by the 2 step method in which an immobilised antibody is reacted with human urine-derived MEGSIN, unreacted materials are completely removed by washing, and a labelled antibody is added to form 15 a complex of the immobilised antibody, the labelled human urine-derived MEGSIN antibody, or one step method in which the immobilised antibody, the labelled antibody, and human urine-derived MEGSIN are mixed at the same time.

Examples of an insoluble carrier used for the measurement include, for example, polystyrene, polyethylene, polypropylene, polyvinyl chloride, polyester, polyacrylate, nylon, polyacetal, synthetic resin such as fluoride resin, etc., polysaccharides such as cellulose, agarose, etc., glass, metals, etc. The form of an insoluble carrier can be varied and includes tray, spheroid, fibre, stick, board, container, cell, test tube, etc. The antibody-adsorbed carrier should be stored at a cool place in the presence of appropriate preservatives, such as sodium azide.

Antibodies can be immobilised by known chemical binding or physical adsorption methods.

Chemical binding methods include, for example, a method using glutaraldehyde, the maleimide method using N-succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate, N-succinimidyl-2maleimidoacetate, etc., and the carbodiimide method using 1-ethyl-3-(3dimethylaminopropyl)carbodiimide hydrochloride, etc. In addition, the maleimidobenzoyl-Nhydroxysuccinimidoester method, the N-succimidyl-3-(2-pyridyldithio)propionate method, the bisdiazolated benzidine method, and dipalmityllysine method. Alternatively, the complex produced by reacting two different antibodies against a substance to be detected and an epitope is captured with the third antibody immobilised by the above method.

Any label useful for immunoassay can be used without being limited. Specifically, enzymes, fluorescent substances, luminescent substances, radioactive substances, metal chelates, etc. can be used. Preferable labelling enzymes are, for example, peroxidase, alkaline phosphatase, 1-Dgalactosidase, malate dehydrogenase, Staphylococcus nuclease, delta-5-steroid isomerase, aglycerol phosphate dehydrogenase, triosephosphate isomerase, horseradish peroxidase, asparaginase, glucose oxidase, ribonuclease, urease, catalase, glucose-6-phosphate C08175 dehydrogenase, glucoamylase, and acetylcholine esterase, etc.. Preferable fluorescent substances include, for example, fluorescein isothiocyanate, phycobiliprotein, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, and orthophthalaldehyde. Preferable luminescent substances include, for example, isoluminol, lucigenin, luminol, aromatic acridinium ester, imidazole, acridinium salt and its modified ester, luciferin, luciferase, and aequorine. Preferable radioactive substances include, for example, 1251, 1271, 1311, 140, 3 H, 32p, 35S, etc.

The method for binding the above labels is known. Specifically, direct and indirect labelling can be used. The common direct labelling is the method in which an antibody or an antibody fragment is chemically covalent-bound with a label using a crosslinking agent. Crosslinking agents include N,N'-orthophenylenedimaleimide, 4-(N-maleimidomethyl) cyclohexanoate N-succinimide ester, 6-maleimidohexanoate N-succinimide ester, 4,4'-dithiopyridine, and other known crosslinking agents. The crosslinking agent can be reacted with enzymes and antibodies by the known methods depending on the characteristics of the crosslinking agent. An example of the indirect labelling method comprises binding an antibody to a low molecular weight hapten such as biotin, 15 dinitrophenyl, pyridoxal, or fluorescamine, and indirectly labelling the antibody with the binding partner to the hapten. Avidin and streptoavidin can be used as a recognition ligand for biotin, whereas dinitrophenyl, pyridoxal, or fluorescamine are labelled with antibodies recognising these haptens. Horseradish peroxidase can be used as a enzyme for labelling antibodies. This enzyme is useful because it can react with many substrates and be easily bound to antibodies by the periodate method. Occasionally, as an antibody, their fragments, for example, Fab', Fab, F(ab')2 are used. Both polyclonal and monoclonal antibodies can be labelled with an enzyme by the same method. Enzyme-labelled antibodies obtained using the above crosslinking agent can be purified by the known methods such as affinity chromatography, etc. to serve in a more sensitive immunoassay system. Purified enzyme-labelled antibodies are stored with a preservative such as thimerosal and a stabiliser such as glycerol. Labelled antibodies can be lyophilised and stored in the cool and dark place for a long time.

.i Wlhen a label is an enzyme, its substrate and, if necessary, a colouring agent are used for measuring its activity. When peroxidase is used as an enzyme, H20 2 is used as a substrate solution and 2,2'-azino-di-[3-ethylbenzothiazolinesulfonic acid] ammonium salt (ABTS), aminosalicylic acid, orthtophenylenediamine, 4-aminoantipyrine, or 3,3',5,5'-tetramethylbenzidine, etc. is used as a colouring agent. When alkaline phosphatase is used as an enzyme, orthonitrophenylphosphate, paranitrophenylphosphate, etc. can be used as substrates. When 3-Dgalactosidase is used as an enzyme, fluorescein-di-(3-D-galactopyranoside), 4-methylumbelliferyl- 3-D-galactopyranoside, etc. can be used as substrates. The present invention also includes an immunoassay reagent for MEGSIN, comprising labelled or immobilised monoclonal or polyclonal antibodies, and further includes a kit comprising this reagent and an indicator for detection label and a control sample, etc.

C08175 Any biological samples such as body fluid such as blood plasma, serum, blood, urine, tissue fluid, or cerebrospinal fluid etc. can be used as samples for measuring the MEGSIN of the present invention as long as they contain MEGSIN or its precursor or a fragment. Among these biological samples, especially in urine, MEGSIN can be detected with high frequency, accompanied by proliferation and activation of mesangial cells. Measurement of MEGSIN in urine is useful as a marker for mesangial proliferative nephropathy, such as IgA nephropathy.

In addition, the present invention relates to a transgenic nonhuman vertebrate animal in which the expression level of MEGSIN gene is altered. Herein, MEGSIN gene includes cDNA, genomic DNA, or synthetic DNA encoding MEGSIN. Gene expression includes both steps of transcription and translation. Transgenic animals of the present invention are useful for investigating function and expression control of MEGSIN, clarifying mechanisms of development of diseases relating to human mesangial cells, and developing disease model animals used for screening and testing safety of pharmaceuticals.

In the present invention, MEGSIN gene can be modified so as to artificially increase or 15 decrease its expression level compared with the original gene by introducing mutation such as deletion, substitution, insertion, etc. in a part of some important sites (enhancer, promoter, intron, etc.) which control the normal expression of MEGSIN gene. Such modification alters transcription of MEGSIN gene. On the other hand, translation to proteins can be modified by deleting a part of an exon, or replacing a certain codon with a stop codon by introducing point mutation into coding regions. Such mutation can be introduced by the known methods for obtaining transgenic animals.

Transgenic animals means, in a narrow sense, animals into reproductive cells of which an exogenous gene is artificially introduced by genetic recombination, and in a broad sense, animals into chromosome of which an exogenous gene is stably introduced during an early developmental stage, said gene can be transmitted to the offspring as genotype, including antisense transgenic animals in which the function of a specific gene is inhibited by antisense RNA, animals in which a specific gene is knocked out by using embryonic stem cells (ES cells), and animals into which point mutation DNA is introduced. Transgenic animals used herein include all vertebrates except for human.

Transgenic animals can be prepared by the method comprising mixing a gene with an egg and treating the mixture with calcium phosphate, the microinjection method whereby a gene is directly injected into a nucleus in pronuclear egg by a micropipette under the phase contrast microscope (microinjection method, US 4 873 191), and the method using embryo stem cells (ES cells). Other methods include, for example, the method in which a gene is inserted into a retrovirus vector to infect an egg and the sperm vector method in which a gene is introduced into an egg through sperm, etc. The sperm vector method is a genetic recombination method for introducing an exogenous gene by attaching an exogenous gene into sperm or incorporating an exogenous gene into sperm cells by electroporation, etc. and fertilising an egg Lavitranoet et al., Cell, 57, 717, 1989).

C08175 In vivo Site specific genetic recombination such as cre/lloxP recombinase system of bacteriophage P1, FLP recombinase system of Saccharomyces cerevisiae, etc. can be used. The method for introducing a transgene of a target protein into nonhuman animals using retrovirus has been reported.

Transgenic animals can be prepared by microinjection, for example, in the following manner.

A transgene basically composed of a promoter regulating expression, a gene encoding a specific protein, and polyA signal is provided. Expression pattern and level for all lineages should be confirmed since the expression pattern and level of a specific molecule depend on the promoter activity, and prepared transgenic animals vary among lineages depending on the number of copies and introduction site on chromosomes of an introduced transgene. A sequence of introns to be spliced at upstream of polyA signal may be introduced when the expression level is known to vary depending on noncoding region and splicing. It is important to use a gene as pure as possible for introducing into a fertilised egg. An animal to be used includes a mouse for collecting fertilised eggs (5 to 6 weeks old), male mouse for crossing, pseudopregnant female mouse, vasoligated 15 male mouse, etc.

To efficiently obtain fertilised eggs, ovulation can be induced by gonadotropin, etc. A fertilised egg is collected, and a gene is injected into a male pronucleus of the egg by microinjection using an injection pipette. Animals for returning the treated eggs into an oviduct are prepared (pseudopregnant female mice, etc.), and about 10 to 15 eggs are transplanted per each individual.

Introduction of the transgene into a new-born mouse is confirmed by extracting genomic DNA from the tip of the tail and detecting the transgene by Southern hybridisation or PCR methods, or by the positive cloning method in which a marker gene that is activated only upon homologous recombination is inserted. Expression of the transgene can be confirmed by detecting a transgenederived transcript by Northern hybridisation or RT-PCR methods. Detection by Western blotting method is also possible using a antibody specific to a protein.

A knockout mouse of the present invention is prepared so as to lose the function of MEGSIN gene. A knockout mouse means a transgenic mouse in which a certain gene is destroyed by homologous recombination technology to eliminate its function. A knockout mouse can be prepared by conducting homologous recombination using ES cells and selecting ES cells in which one allele is modified and destroyed. For example, genetically manipulated ES cells are injected into a blastocyst or an 8-cell embryo of an fertilised egg to obtain a chimeric mouse having both cells derived from ES cells and from embryo. A heterozygous mouse in which all of one allele is modified and destroyed can be prepared by crossing a chimeric mouse (chimera means an individual composed of somatic cells derived from two or more fertilised eggs) and a normal mouse.

Crossing of heterozygous mice with each other can produce homozygous mice. A transgenic animal of the present invention includes both heterozygotes and homozygotes.

Homologous recombination means the recombination occurring between two genes whose nucleotide sequences are the same or extremely similar through mechanism of genetic C08175 recombination. Cells with homologous recombination can be selected by PCR. Homologous recombination can be confirmed by performing PCR using as primers sequences of a part of a gene to be inserted and a part of a chromosomal region into which the gene is expectedly inserted and detecting cells producing amplified products. Homologous recombination in the genes expressed in ES cells can be easily screened by known methods or their modified methods, for example, by binding neomycin resistant gene to the introduced gene to make the cells neomycin resistant after the introduction.

Brief Description of the Drawings Figure 1 shows the amino acid sequence of MEGSIN. The underlined part shows "SERPIN" signature. The boxed part and the arrow show reactive site loop (RSL) and putative reaction site, respectively. The two putative hydrophobic regions are indicated by the dotted lines.

Figure 2 shows the comparison of amino acid sequences of MEGSIN with other proteins belonging to SERPIN super family. In panel homologous regions are indicated by the bars.

Gaps between the bars show spaces inserted in database sequences for the optimisation of alignment, and the lines across the bars show the regions where residues are inserted into .database sequences compared with the subject sequence. These sequences are aligned by following the protein scoring matrix pam 250. The scores are shown at the right of the bars (a maximum potential score is 1820). Panel shows the comparison of RSL of SERPIN. P17-P5' o of RSL is aligned (based on numbering by Schecher and Berger). Nonpolar residues are shown by 20 the bold letters. "SCC1," "ILEU," "PAI-2," and "ova" represent squamous epithelial cell carcinoma antigen 1 (SCCA1), elastase inhibitor, plasminogen activator inhibitor-2 (PAI-2), and ovalbumin respectively.

Figure 3 shows the detected MEGSIN transcript by Northern blot analysis. Lane 1 represents mesangial cells, lane 2 promyelocytic leukemia HL-60, lane 3 Hela cells S3, lane 4 25 chronic myeloid leukemia K-562, lane 5 lymphoblastic leukemia MOLT-4, lane 6 Burkitt's lymphoma Raji, lane 7 adenocarcinoma of the large intestine SW480, lane 8 lung cancer A549, and lane 9 melanoma G361. The experiment was conduced as follows. Human Multiple Northern Blot containing 2pg each of poly (A)+RNA derived from heart, brain, placenta, lung, liver, skeletal muscle, kidney, and spleen (Clontech, CA, USA) and Human Cancer Cell Lineage Northern Blot containing 2pg each of poly (A)*RNA derived from promyelocytic leukemia HL-60, Hela cell S3, chronic myeloid leukemia K-562, lymphoblastic leukemia MOLT-4, Burkitt's lymphoma Raji, adenocarcinoma of the large intestine SW480, lung cancer A549, and melanoma G361 (Clontech, CA, USA) were used. RNA was isolated from human mesangial cultured cells, and poly (A) RNA (2pg) was separated by 1% agarose gel containing 2.2M formamide, and transferred onto the blotting filter described above. The filter was hybridised in "Rapid Hyb solution (Amersham)" and washed at 60 0 C to achieve final stringency of 0.1 X SSPE/0.1% SDS.

Figure 4 is a photograph showing the result of RT-PCR. Lane lorepresents mesangial cell, lane 2 smooth muscle cell, lane 3 fibroblast, lane 4 endothelial cell, lane 5 renal epithelial cell, lane C08175 6 keratinocyte, lane 7 monocyte, and lane 8 polymorphonuclear leukocyte (the upper photograph).

The total RNA was isolated from human cultured cells, and reverse transcription was conducted using "T-Primed-First-Strand" kit (Pharmacia Biotech). Amplification by PCR was carried out with cycles using DNA Thermal Cycler (Perkin Elmer). Each cycle was composed of denaturation at 94 0 C for 1 min, annealing at 60 0 C for 2 min, and extension at 72°C for 2 min using oligonucleotide primers of MEGSIN: sense 5'-ATGATCTCAGCATTGTGAATG-3' and antisense ACTGAGGGAGTTGCTTTTCTAc-3'. The estimated size of amplified fragment was 773bp. In order to compare RNA level among different samples, 13 actin was used as the RNA intemal control (the lower photograph). The PCR product was separated by electrophoresis on 1% agarose gel.

Figure 5 is a photograph showing the result of in situ hybridisation, indicating the expression of MEGSIN in mesangial cells in glomeruli from the normal subjects and IgA nephropathy patients.

Panel shows two glomeruli of IgA-N patients (40x magnification). MEGSIN signal was not observed in the uriniferous tubule or mesangial region. Panel is the same photograph of magnification. MEGSIN signal was observed in mesangial region of IgA-N patients. Panel is the same photograph of 200x magnification, showing that mesangial cells are MEGSIN positive but endothelial cells and Bowman's capsule cells are MEGSIN negative.

Figure 6 shows the result of Western blotting using the polyclonal antibody specific to MEGSIN of the present invention. Lane 1 represents MBP, lane 2 MBP-MEGSIN fusion protein, lane 3 MBP-PAI II fusion protein, lane 4 PAl-I, and lane 5 albumin.

20 Figure 7 is a graph showing MEGSIN measured by ELISA in the urine samples. The ordinate shows absorbance at 492 nm, and the abscissa shows the dilution ratio of the urine samples. MEGSIN was not detected in the normal subjects(-o-, and but detected in the urine from IgA nephropathy patients and -A and MBP-MEGSIN(-@-).

Best Mode for Implementing the Invention 25 The present invention is illustrated in detail below with references to examples, but is not to be construed as being limited thereto.

Example 1: Primary culture of human mesangial cells Human glomerular renal mesangial cells were isolated from the normal human kidney excised from a 58 year-old male. Renal cortex was separated under the sterilised condition, minced, and passed through several sieves. Pore diameters of the used sieves were decreased stepwise, and the trapped glomerulus by the sieve at the pore diameter of 75 to 200mm was washed and incubated with 100pg/mL collagenase (Washington Biochemical) at 37 0 C for 20 min.

After washing, the glomerulus was resuspended in medium 199 (Gibco BRL, Gaithersburg, MD) containing 25mM Hepes, 10% Nu-serum (Collaborative Biomedical Products, Bedford, MA), and antibiotics (100mg/mL of penicillin, streptomycin, and Fungizone), and incubated in the 5% CO 2 incubator. At the third passage, mesangial cells were identified based on a series of criteria such as typical morphological characteristics, resistance to trypsin, puromycin, and D-valine, positiveness against immunostaining of actin (Zymed Laboratories, San Francisco, CA), anti-very C08175 late antigen (VLA)-1, 3, 5 (Immunotech), and negativeness against immunostaining of VIII factor (Dako, CA).

Example 2: Isolation of mRNA from human cultured mesangial cells At the sixth passage, total RNA was isolated from human mesangial cells using guanidine isothiocyanate (GTC) method. The confluent culture of the mesangial cells in the medium containing serum of the cells of Example 1 was washed with phosphate buffer saline (PBS), and dissolved in 5.5mM GTC solution. DNA was removed by passing through an 18-gauge needle.

Nuclei and other cell debris were precipitated by centrifugation at 5000 x g for 90 sec. Supernatant was carefully loaded on the layer of caesium trifluoroacetate (CsTFA) and centrifuged at 125 000 x g at 15 0 C for 24 hours. RNA pellet was dissolved in TE buffer. Poly (A) RNA was isolated using oligo dT cellulose column (Pharmacia).

Example 3: Construction of 3'-directed cDNA library cDNA was synthesised using the vector primer based on pUC19 (Norrander J. et al., Gene, 26, 101-106, 1983) with poly RNA as a template. This vector primer DNA comprised the Hincll end and the Pstl end with a T tale, and dam-methylated at the Mbol site (GATC). After synthesising the second strand, the cDNA sequence and the single BamHI site in LacZ gene of the vector were digested with Mbol and BamHI, respectively, and circularision and ligation were conducted at the low DNA concentration. A portion of the ligation mixture was transformed to E.

coli. The obtained transformants were randomly selected and individually dissolved by simply S*.i 20 heating. The inserted sequence of cDNA was amplified by the paired PCR using primers TGTAAAACGACGGCCAGT-3'/SEQ ID NO: 7 and 5'-ACCATGATTACGCCAAGCTTG-3'/SEQ ID NO: 8) flanking the pUC19 cloning site. The obtained short double stranded DNA was used for the cycle sequence determination reaction and analysed by an automatic sequencer.

Example 4: Isolation of genes expressed specifically in mesangial cells 25 In order to identify genes expressed specifically in mesangial cells, the present inventors conducted large scale DNA sequencing and data processing by computers. Transcripts in the various different cells and organs could be simultaneously compared Yasuda et al., submitted; K. Matsubara et al., Gene. 135, 265, 1993; K. Okubo et al., Nat. Gen. 2, 173, 1992). Large scale DNA sequencing of the 3'-directed cDNA library of human cultured mesangial cells was conducted, and randomly selected 1836 clones were sequenced for their partial sequences. The sequence homology among clones was mutually compared, and further compared with that in DNA data bank GenBank using FASTA program. mRNA from various organs and cells were analysed using dot blot to select clones expressed specifically in mesangial cells. Among clones detected exclusively in the mesangial cell cDNA library, the major clone was obtained. This clone contained 0.3% of total mRNA.

Example 5: Cloning of full length strand by 5' Race method The following experiment was carried out using "5'-Full RACE Core Set" (Takara). To a microtube were added 4.0pL of poly RNA (0.5pg/pL) prepared from human cultured C08175 mesangial cells, 1.5pL of 10x RT buffer, 0.5 IL of RNase inhibitor (40 U/pL), 1pL of AMV Reverse Transcriptase XL (5U/pL), 1pL of 5' end phosphorylated RT primer PTCAGAGAGGTCATTC/SEQ ID NO: 9, 200 pmol/pL). The mixture was made up to 15pL with 7pL of RNase Free dH20. This reaction mixture was set in "Takara PCR Thermal Cycler" (Takara) and incubated at 300C for min, at 50°C for 60 min, 80°C for 2 min, and at 40°C for 10 min to obtain the first strand cDNA.

A 15pL aliquot of the reaction mixture was added to a 0.5pL microtube containing 15pL of X hybrid RNA denaturation buffer and 45pL of H 2 0. RNaseH (pL) was added thereto, and reacted at 30°C for 1 hour. After the completion of the reaction, 150pL of ethanol was added thereto, cooled at -70°C for 30 min, and centrifuged to remove supernatant and collect precipitate.

To the obtained precipitate were added 81L of 5 X RNA (ssDNA) ligation buffer, 20pL of PEG #600, and 12pL of H 2 0 It was mixed well. T4 ligase (lpL) was added thereto, and reacted at 16°C for 15 hours to obtain the circularised single strand cDNA.

The obtained circularised single strand cDNA was diluted 10 fold with TE buffer and used as a template for the first PCR. The reaction mixture contained 5pL of 10 X LA PCR buffer II (Mg 2 plus), 8pL of dNTP mixture (2.5mM), 0.5pL of first PCR S1 primer :i /SEQ ID NO: 10, 20pmol/pL), 0.5pL of first PCR Al primer (5'-AGATTCTTGAGCTCAGAT /SEQ ID NO: 11, 20pmol/pL), and 0.5pL of TaKaRa LA Taq TM (5U/pL), which was made up to 50pL with sterilised water. It was set in "Takara PCR Thermal Cycler" and reacted under the condition with cycles of 94°C for 30 sec, 600C for 30 sec, and 720C for 2 min after heated at 94°C for 3 min.

20 The reaction mixture containing 1pL of the first PCR product as a template, 5pL of 10 X LA PCR TM buffer II (Mg 2 plus), 8pL of dNTP mixture (2.5mM), 0.5pL of the second PCR S2 primer (5'-AATGGTGGCATAAACATG /SEQ ID NO: 12, 20pmol/pL), 0.5pL of the second PCR A2 primer ACAGACAAATTGAACTTC /SEQ ID NO: 13, 20pmol/pL), and 0.5pL of TaKaRa LA Taq TM which was made up to 50pL with sterilised water, was set in "Takara PCR Thermal Cycler." The 25 reaction was conducted under the condition with 30 cycles of 940C for 30 sec, 60°C for 30 sec, and 720C for 2 min.

The obtained bands were confirmed by the 0.75% agarose gel electrophoresis and 1 pL from the product was subcloned using "Original TA Cloning Kit" (Invitrogen). The obtained plasmid was named as "pCR-942-5.3." The nucleotide sequence of the inserted gene fragment was sequenced by the dideoxy termination method.

The obtained nucleotide sequence contained about 600 nucleotides encoding the N-end of the gene product and about 400 nucleotides as the 5' noncoding region. The putative initiation codon ATG was coincident with the consensus sequence that provides the longest open reading frame (satisfying "the first ATG rule"). The nucleotide sequence of MEGSIN cDNA and the deduced amino acid sequence of MEGSIN were shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

C08175 Example 6: Expression of protein In order to obtain a gene comprising coding regions, PCR reaction was conducted with of poly (A)+RNA (0.5pg/pL) from human cultured mesangial cells as a template, and the primers designed so as to encode the coding regions, that is, the primer comprising the initiation codon with the restriction enzyme EcoRI recognition sequence at the 5' end GAATTCATGGCCTCCCTTGCTGCAGCAAA/SEQ ID NO: 14), and the primer with the stop codon and the Sail recognition sequence (5'-GTCGACTTATCAAGGGCAAGAAACTTTGCC/SEQ ID NO: 15). The reaction mixture contained 5pL of 10 X Ex Taq buffer, 8pL of dNTP mixture (2.5mM), 0.5pL of the PCR primer (5'-GTCGACTTATCAAGGGCAAGAAACTTTGcc, 20pmol/pL), 0.5pL of the first PCR Al primer (5'-GAATTCCATGGCCTCCCTTGCTGCAGCAAA, 20pmol/pL), and 0.5pL of TaKaRa Ex Taq TM which was made up to 50pL with sterilised water, and set in "Takara PCR Thermal Cycler" to react under the condition with 30 cycles of 94 0 C for 1 min, 60 0 C for 2 min, and 72 0 C for 2 min. The amplification was confirmed by 0.75% agarose gel electrophoresis, and 1pL of the reactant was subcloned using "Original TA Cloning Kit" (Invitrogen). The obtained plasmid was named as pCR-942CD-11/2. E. coli JM 109 transformed with pCR-942CD-11/2 has been deposited at National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (Accession No. FERM BP-6518). This plasmid was digested with EcoRI and Sail. The inserted gene was ligated with EcoRI- and Salldigested pMAL-c (New England Biolab), an expression vector for maltose binding protein-fusion 20 protein, through T4 ligase, and E. coli XL1-Blue was transformed with this product. After 18 hours, the ampicillin resistant cells were added to 3mL of LB medium and cultured for 18 hours. The plasmid was extracted by the miniprep method, and confirmed by the restriction enzymes to obtain expression vector pMAL-MEGSIN. E. coli XL1-Blue transformed with pMAL-MEGSIN has been internationally deposited at National Institute of Bioscience and Human-Technology, Agency of 25 Industrial Science and Technology, Ministry of International Trade and Industry (Accession No.

FERM BP-6517).

International deposit of E. coli JM 109 transformed with pCR-942CD-11/2: Address and Name of depositary institution Name: National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry Address: 1-3, Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan (zip code: 305-0046) Date of deposition (Original date of deposition) September 22, 1997 Accession No. FERM BP-6518 International deposit of E. coli XL1-Blue transformed with pMAL-MEGSIN: Address and name of depositary institution Name: National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry Address: 1-3, Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan (zip code: 305-0046) C08175 Date of deposition (Original date of deposit) September 22, 1997 Accession No. FERM BP-6517 E. coli XL-Blue transformed with pMAL-MEGSIN was added to 10mL of LB medium containing 100pg/mL ampicillin, and cultured at 370C for 18 hours with shaking. This cultured medium was added to 1 litre of Rich medium (containing 10g of tryptone, 5g of yeast extract, 5g of NaCI, 2g of glucose, and 100pg/mL ampicillin) and cultured at 370C with shaking. When the culture medium reached about 0.40D (A600) measured by a turbidimeter, 3mL of 0.1M IPTG (1.41g of isopropyl-P-D-thiogalactoside diluted with 50mL of water) was added thereto, and further cultured at 370C with shaking. After 2 hours, the cells were collected by centrifugation (4000 X g, 20 min), and 50mL of lysis buffer (10mM Na2HPO 4 30mM NaCI, 0.25% Tween20, pH7.0) was added. The cells were well suspended, frozen at -80oC for 18 hours, and sonicated (SONIFIER 250: BRANSON) to destroy cells. NaCI was added thereto to 0.5M and centrifuged (10000 X g, 30 min) to collect supernatant. of 0.25% Tween 20/column buffer was added to the supernatant, and the mixture was loaded onto the column filled with 30mL of amylose resin equilibrated with 0.25% Tween 20/column buffer (0.25% Tween 20, 10mM phosphoric acid, 0.5M NaCI, pH7.2). The column was washed with 100mL of 0.25% Tween 20/column buffer at lmL/min flow rate, and then with 150mL of column buffer. The fusion protein binding to the amylose resin was eluted with 50mL of column buffer containing 10mM maltose. This was concentrated to about 1mg/mL by a ultrafiltration device (Amicon stirred-cell concentrator).

20 The fused maltose binding protein can be digested and removed by the enzymes through the following method. The protein solution is added to a dialysis tube (molecular weight cutoff: 3500) and dialysed against factor Xa buffer (20mM Tris-CI, 100mM NaCI, 2mM CaCI2, and 1mM sodium azide). Ten microlitres of factor Xa (200pL/mL) is added to 200pL of the dialyzate (1mg/mL), and the mixture is reacted for 24 hours at room temperature to specifically digest the biding site 25 between the maltose binding protein and the target protein. After digestion, the target protein can be obtained by purification through gel filtration chromatography, ion exchange column chromatography, etc.

S. MBP Target protein-

CTCGGGATCGAGGGAGGATTTCAGAATTCATGGCC----

LeuGlylleGluGlyArgIleSerGluPheMetAla---

T

Factor Xa recognition site Example 7: Function analysis of mesangial specific gene (1) Amino acid homology search on SwissProt data base by FASTA program revealed that this gene product was highly homologous to the proteins belonging to SERPIN (serine protease inhibitor) super family Carrell et al., Trends Biochem. Sci. 10, 20, 1985; R. Carrell et al., Cold Spring Harbor Symp. Quant. Biol. 52, 527, 1987; E. K. O. Kruithof et al., Blood 86, 4007, 1995; J.

Potempa et al., J. Biol. Chem. 269, 15957, 1994; and E. Remold-O'Donnell., FEBS Let. 315, 105, C08175 1993). SERPIN super family is a structurally relating protein group and generally functions as an extracellular irreversible serine protease inhibitor. Squamous epithelial cell carcinoma antigen 1 (SCCA1) showed the highest homology to the mesangial specific gene (41.2% identity), followed by the other proteins of SERPIN super family, SCCA2 leukocyte esterase inhibitor and plasminogen activator inhibitor 2 (PAI-2) The present inventors named this gene as MEGSIN (mesangial cell-specific gene with a homology to serpin).

The amino acid sequence of MEGSIN was subjected to motif-search (Figure First, it was found that the characteristic of SERPIN existed at the COOH end. Four putative N-glycosylated sites existed. Obvious NH 2 end signal peptide sequence was not detected, but two hydrophobic regions existed in ahelix A (amino acids 1 to 16) and ahelix B (amino acids 27 to 44). These are thought to play an important role in transfer of SERPIN von Heijne et al., J. Biol. Chem. 266, 15240, 1991; D. Belin, Thromb. Haemost. 70, 144, 1993; and D. Belin et al., EMBO J. 15, 468, 1996).. Some of SERPIN family proteins may be secreted by a non-degradable internal signal sequence in ahelix A and ahelix B, or exists as a dualistic molecule existing in cytoplasm D. Ye et al., J. Biol. Chem. 263, 4869, 1988; A. Wohlwend et al., J. Immunol. 139, 1278, 1987; A.

Wohlwend etal., J. Exp. Med. 165, 320, 1987; C. Genton etal., J. Cell Biol. 104, 705, 1987; and P.

Mlkus et al., Eur. J. Biochem. 218, 1071, 1993). Comparison with other proteins of SERPIN super family indicated that amino acids 334 to 352 corresponded to the reactive site loop (RSL) (P16-p5') C. Hopkins et al., Science 265, 1893, 1994; K. Aertgeerts et al., Nature Struct. Biol. 2, 891, 20 1995; P. A. Patston et al., FEBS Let. 383, 87, 1996; and H. T. Wright, BioEssays. 18, 453, 1996) (Figure Although some of SERPIN do not inhibit protease, transport hormones, or control blood pressure. There are three evidences showing that MEGSIN is a protease inhibitor. First, Peven residue of RSL in MEGSIN is not electrically charged, small, and nonpolar. These are characteristics of SERPIN protease inhibitors. Second, SERPIN protease inhibitors comprise the 25 sequence of "Ala-Ala (Thr)-Ala-Ala" at the NH 2 end region of RSL (P12-P9), called hinge region.

P12-P9 of RSL in MEGSIN is "ATAA." The P17-P8 sequence of RSL in MEGSIN (EGTEATAAT) is actually coincident with the consensus sequence (EGTEAAAAT) of SERPIN protease inhibitors.

Third, Psheet region exists just before the NH2 end region of RSL. This is essential for protease inhibition and limits the size and electrical charge of amino acids in the hinge region for achieving appropriate change of conformation. MEGSIN conserves this P sheet region.

Residues flanking the bond which is deduced to be easily cleaved in RSL (P1 and P'1) are Lys-GIn, and are supposed to be important for determining substrate specificity E. Creighton et al., J. Mol. Biol. 194, 11, 1987; P. Gettins et al., BioEssays. 15, 461, 1993; P. E. Stein et al., Struct.

Biol. 2, 96, 1995). Any other SERPIN protease inhibitors having the sequence relating to this site are not known. SERPIN, such as Kunitz type bovine basic protease inhibitor, comprises Lys at P1 and strongly inhibits trypsin. The target serine protease of MEGSIN is, therefore, presumably lysine cleaving protease.

C08175 Example 8: Function analysis of MEGSIN Distribution in tissues MEGSIN was analysed by Northern blot as follows. RNA was isolated from human mesangial cultured cells. Poly (A) RNA (5pg) from the cultured cells was separated by 1% agarose gel containing 2.2M formamide, and transferred onto a nitrocellulose filter. The filter was hybridised in Rapid Hyb solution (Amersham, Arlington Heights, IL). The blot was washed at 60 0

C

with final stringency of 0.1X SSPE/0.1% SDS.

Northern blots of multiple human tissues and of human cancer cell lines were purchased from Clontech (Palo Alto, CA). Northern blot of multiple human tissues includes each 2pg of poly (A) RNA from heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. Northern blot of human cancer cell lines includes each 2pg of poly RNA derived from promyelocytic leukemia HL-60, Hela cell S3, chronic myeloid leukemia K-562, lymphoblastic leukemia MOLT-4, Burkitt's lymphoma Raji, adenocarcinoma of the large intestine SW480, lung cancer A549, and melanoma G361. Hybridisation and washing were conducted in the same manner as described above.

Single transcript was detected in mesangial cultured cells by Northern blot analysis using MEGSIN cDNA probe, but was not detected in other organs or cell lines (Figure MEGSIN transcript was not detected in poly RNA derived form human kidney. This may be because kidney comprises endothelial cells, epithelial cells, and various other cells, and less mesangial cells.

20 Actually, MEGSIN transcript was amplified from renal tissues by RT-PCR. RT-PCR was conducted using total RNA isolated from human cultured cells as a template, with "T-primed-First- Strand Kit" (Pharmacia Biotech). PCR amplification was performed under the condition with cycles of 94 0 C for 1 min, 60 0 C for 2 min, and 72 0 C for 2 min using "DNA Thermal Cycler" (Perkin Elmer Cetus). "5'-ATGATCTCAGCATTGTGAATG-3'/SEQ ID NO: 16" and o* 25 ACTGAGGGAGTTGCTTTTCTAC-3'/SEQ ID NO: 17" were used as a sense primer and an antisense primer, respectively. The estimated size of the amplified fragment was 773bp. In order to compare RNA level among different samples, P-actin was used as an internal RNA control. The PCR products were separated by 1% agarose gel electrophoresis. MEGSIN transcript was not amplified from human fibroblasts, smooth muscle cells, endothelial cells, epithelial cells, or keratinocyte, by RT-PCR (Figure 4).

It is known that cultured mesangial cells acquire new phenotypes when activated and/or proliferate J. Johnson et al., J. Am. Soc. Nephrol. 2 (10 Suppl.), S190, 1992; and J. Floege et al., Kidney Int. 45, 360, 1994). Therefore, MEGSIN expression may be enhanced to the detectable level by Northern blot analysis only when mesangial cells are activated and/or proliferate. The result of in situ hybridisation for human renal tissues (described below) met this hypothesis.

C08175 Example 9: Function analysis of MEGSIN Comparison of expression level between IgA nephropathy patients and normal people Expression of MEGSIN mRNA was examined in human renal tissues obtained from 18 IgA nephropathy (IgA-N) patients and 3 normal subjects by in situ hybridisation. In situ hybridisation was conducted in the same manner as described above (Kidney Int. 52, 111, 1997). The nucleotide sequence of the nucleotide residues 391 st to 428 t of human MEGSIN cDNA was used as a probe. IgA-N patients were divided into 2 groups: patients whose mesangial proliferation was active, but glomerulosclerosis was weak (proliferative phase, and the others whose 30% or more of glomerulus was sclerosed (sclerotic phase, MEGSIN mRNA was detected exclusively in glomeruli both in normal subjects and IgA-N patients (Figure 5A). MEGSIN transcript was localised in mesangial cells in the glomeruli (Figure 5B and Figure 5C). The pretreatment with RNase prior to hybridisation for evaluating signal specificity resulted in the removal of most signals detected by the MEGSIN probe. The competitive experiment using 100 times excessive homologous or unrelating unlabelled oligonucleotides showed that MEGSIN signal disappeared by homologous oligonucleotide competitors, but not by non-homologous oligonucleotides. To quantify expression of MEGSIN mRNA, all nuclei in at least 10 glomeruli selected randomly and the nuclei comprising positive cytoplasm around them (cross section of vessel pole) were counted as blind test to calculate a percentage of the positive cells of whole nuclei. Mann-Whitney U test was used for statistical comparison. The number of MEGSIN positive cells in IgA-N during proliferative phase 20 was significantly higher than that in kidneys of the normal subjects. These findings confirmed the hypothesis proposed by the present inventors that the expression of MEGSIN is enhanced by the activation and/or proliferation of mesangial cells.

Example 10: Production of anti-MEGSIN antibody Production of polyclonal antibody against synthetic peptide of MEGSIN 25 Polyclonal antibodies against MEGSIN were produced using the region comprising low homology with other members of SERPIN family and hydrophilicity. Peptide "H2N-C-S-N-I-V-E- K-Q-L-P-Q-S-T-L-F-R-COOH/SEQ ID NO: 18" comprising cysteine at the N end of 342 nd to 356 t h peptides from the N end of MEGSIN protein was synthesised by solid phase peptide method, purified by high performance liquid chromatography, and bound to keyhole limpet hemocyanine (KLH) using m-maleimidobenzoyl-N-hydroxylsuccinimidoester (MBS). A rabbit was intracutaneously immunised with KLH binding peptide mixed with Freund's complete adjuvant (200pg/individual). The rabbit was additionally immunised with KLH binding peptide mixed with Freund's incomplete adjuvant (200pg peptide/individual) as a booster 2, 4, and 6 weeks after priming. To evaluate reactivity of sera from the blood collected after 44, 59, and 64 days with a synthetic peptide, enzyme-linked immunosorbent assay (ELISA) was conducted. The synthetic peptide was coated on a 96-well microplate (lpg/well), washed, and blocked with bovine serum albumin. Reactivity of the antibodies in samples of sera with various dilution ratios was determined using HRP-conjugated goat anti-rabbit IgG as a secondary antibody and 0-phenylenediamine as a C08175 23 substrate. Absorbance was measured at 492nm after termination of the reaction. Antibody titre was increased by 6800, 20 500, and 25 400 times after 44, 59, and 64 days. The obtained antibody was reacted with the MEGSIN fusion protein by Western blot, demonstrating specificity to MEGSIN protein. Figure 6 shows the result of Western blot (anti peptide 342-356).

Production of polyclonal antibodies against synthetic peptide of MEGSIN Polyclonal antibodies against MEGSIN was produced using the resign comprising low homology with other members of SERPIN family and hydrophilicity in the same manner as in Peptide "H2N-C-F-R-E-M-D-D-N-Q-G-N-G-N-V-F-F-COOH/SEQ ID NO: 19" comprising cysteine at the N end of peptide 16 t to 30th from the N end of MEGSIN protein, Peptide "H2N-c- S-Q-S-G-L-Q-S-Q-L-K-R-V-F-S-D-COOH /SEQ ID NO: 20" comprising cysteine at the N end of peptide 72 n d to 86 th and Peptide "H2N-A-T-G-S-N-I-V-E-K-Q-L-P-Q-S-T-L-C-COOH /SEQ ID NO: 21" comprising cysteine at the C end of peptide 339 th to 354 th from the N end were synthesised by solid phase peptide method. These peptides were bound to bovine thyroglobulin (Sigma) using N-(6-maleimidocaproyloxy) succinimide (EMCS, Dojin Kagaku Kenkyu-syo (Dojindo)), dialyzed against 0.85% NaCI, and mixed well with adjuvant for emulsification, and subcutaneously administered to a rabbit. Three weeks after priming (20pg/individual), the second immunisation (50pg/individual) was performed, and further four immunisations (50, 50, 100, 200pg/individual) were conducted every other week. Freund's complete adjuvant (Difco) was used only for priming, and Freund's incomplete adjuvant (Difco) was used for the rest. Antibody titre in 20 the serum obtained by the blood collection was evaluated by ELISA after 41 and 55 days.

The serially diluted antiserum (100pL) was added to each well of the 96 well microplate coated with 50ng/well of antigen for the first reaction, washed, and reacted with HRP conjugated goat anti-rabbit IgG (Meneki-kagaku Kenkyu-syo (Immunochemistry Institute)) as the second reaction. After washing, orthophenylenediamine (Wako Pure Chemical Industries) was used as a 25 substrate for colouring, and absorbance was measured at 492 nm (SPECTRAmax 250, Molecular Devices).

As a result, antibody titre was increased by 6400 and 51 200 times for peptide and peptide respectively 55 days after the additional immunisation. Antibody titre of peptide (C) was increased 102 400 and 204 800 times 41 and 55 days after the additional immunisation, respectively. Each of the obtained antibodies was confirmed to react with MBP-MEGSIN fusion protein by Western blot, demonstrating specificity to MEGSIN protein. Figure 6 shows the result (peptide 2: 72-86, peptide 3: 339-354). The reaction specific to MBP-MEGSIN fusion protein was observed.

Production of polyclonal antibody against MBP-MEGSIN The concentrated fusion protein MBP-MEGSIN (10mM sodium phosphate, 0.5M NaCI, and maltose) obtained in Example 6 was mixed with the same volume of Freund's complete adjuvant and emulsified well. This emulsion (0.5mL) was subcutaneously administered to a New Zealand White rabbit (female, about 4000g) (20pg/animal). The rabbit was additionally immunised C08175 with MBP-MEGSIN mixed with Freund's incomplete adjuvant, 3 weeks (50pg/animal), 5 weeks 7 weeks (50pg/animal), 9 weeks (100pg/animal), and 11 weeks (200pg/animal) after priming. One week after third immunisation, the blood sample was experimentally collected to measure antibody titre, resulting in increase of 204 800 times. The measurement of antibody titre was conducted by EIA using the 96 well-plate fixed with 50ng/well antigen. Serially diluted antiserum (100pg) was added to each well to conduct the first reaction, and the supernatant was removed. The plate was washed, reacted with anti-rabbit IgG Fab'-HRP (IBL, Japan), washed again, and measured by colouring with OPD (Sigma, USA). The obtained antiserum was confirmed to react specifically with MBP-MEGSIN by Western blot.

Production of monoclonal antibody against MBP-MEGSIN The concentrated fusion protein MBP-MEGSIN (10mM sodium phosphate, 0.5M NaCI, and maltose) obtained in Example 6 was mixed with the same volume of Freund's complete adjuvant and sufficiently emulsified. This emulsion was subcutaneously and intracutaneously administered to three 7 week-old Balb/c mice with 27G injection needles. The mice were immunised using Freund's incomplete adjuvant further 4 times every 7 days (the first immunisation: the second to forth: 10pg/mouse). After four immunisations, a small amount of blood was collected from the tail vein for measuring antibody titre by EIA using the immunoplate coated with 50 ng/well antigen. Accordingly, the splenic cells of the mice were fused with myeloma cell line X-63 Ag8 by the standard method using PEG. Monoclonal antibody producing hybridoma 20 specific to immunogen can be selected by screening using EIA with the 96-well plate coated with immunogen, MBP, BSA, etc.

Example 11: Production of monoclonal antibody against MEGSIN e Production of monoclonal antibody against His-Tag-MEGSIN Expression of His-Tag-MEGSIN To obtain the gene comprising the coding region, total RNA was collected from human cultured mesangial cells using ISOGEN (Nippon Gene). cDNA was synthesised using Super Script II (GIBCO) as a reverse transcriptase. Using a part of this cDNA as a template, primers were designed so as to encode the coding region, that is, the primer EX-MEG1-2 comprising the initiation codon and the recognition sequence of restriction enzyme BamHI added at the 5' end ATCGGATCCATGGCCTCCCTTGCTGCAGCAAATGCAGA-3'/SEQ ID NO: 22) and the primer EX-MEG2- 2 comprising the stop codon and the Hindlll recognition sequence ATAAGCTTTCATCAAGGGCAAGAAACTTTGCCACTGAATAAG-3'/SEQ ID NO: 23). PCR reaction was conducted using these primers and LA Taq (TaKaRa).

Reaction was performed in the reaction mixture containing 2.5pL of 10 X LA Taq buffer, 4pL of dNTP mixture (2.5mM), 2.5pL of 25mM magnesium chloride, 1pL each of 20pM PCR primers EX-MEG1-2 and EX-MEG2-2, 2.5 units of LA Taq, and cDNA, which was made up to 25pL with sterilised water.

C08175 Each reagent was set on Gene Amp PCR System 9700 (Applied Biosystems) and reacted under the condition with 35 cycles of 96°C for 1 min, 60 0 C for 30s, and 720C for 2 min after heating at 960C for 3 min.

After the completion of reaction, PCR product was collected, treated with restriction enzymes BamHI (Takara) and Hindlll (Takara), and subcloned to pUC18 with Ligation Kit ver. I (Takara).

This plasmid was cultured in a small scale, collected with Wizard Plus Miniprep DNA Purification System (Promega) to confirm the gene sequence, and digested with BamHI and Hindlll again to insert into multi cloning site in ptrcHisA (Invitrogen), a vector for protein expression, using Ligation Kit ver. I to obtain ptrcHisA-MEGSIN.

The prepared plasmid was transformed into E. coli JM 109, cultured on LB agar medium with 100pg/mL ampicillin to select ampicillin resistant cells, cultured in 20mL of LB medium with 100pg/mL ampicillin at 370C overnight with shaking, and further cultured in 20L of LB medium with 100g/mL ampicillin at 370C for 3 to 4 hours with shaking. When the absorbance was about 0.50D (A600) (Shimadzu, BIOSPEC-1600), isopropyl-beta-D-thiogalactoside (IPTG: Takara) was added to the final concentration of 1mM, and cultured at 37°C for 3 hours with shaking. The cells were collected by centrifugation, and washed with PBS. The expressed protein was collected using Ni- NTA Spin Kits (QIAGEN). The detail is as follows.

The sample was suspended in 50mL of Buffer A (6M GuHCI, 0.1M Na-phosphate, and 0.01M Tris-HCI, pH8.0), stirred for 1 hour at room temperature, and centrifuged at 10000 g for 15 min at *20 4°C to collect the supernatant. To this supernatant, 8mL of Ni-NTA previously equilibrated with Buffer A was added, stirred for 1 hour at room temperature, and transferred to the column. The column was washed with 80mL of Buffer A, washed with 20mL of Buffer B (8M Urea, 0.1M Naphosphate, and 0.01M Tris-HCI, pH8.0), and eluted with 20mL of Buffer C (8M Urea, 0.1M Naphosphate, and 0.01M Tris-HCI, pH After the expressed protein was collected in the above 25 manner, the eluted fraction was confirmed by SDS-PAGE. The positive fraction was separated by SDS-PAGE and stained with CBB to extract the target band. The extracted band was immersed in Protein Extraction Buffer to elute the protein.

Production of monoclonal antibody against His-Tag-MEGSIN The MEGSIN fusion protein was mixed with the same volume of Freund's complete adjuvant, and emulsified well. The emulsion was subcutaneously and intracutaneously injected to three 7week old Balb/c mice with the 27G injection needle. The mice were further immunised 4 times using Freund's incomplete adjuvant every 7 days after priming. The amounts of antigen applied were 20pg/mouse for the first immunisation and 10g/mouse for the second to forth. A small amount of blood was collected from the tail vein, and antibody titre was measured after the four immunisations. Antibody titre was assayed by ELISA using the 96-well plate coated with the antigen. Accordingly, the mouse splenic cell was fused with myeloma cell line X-63 Ag8 by the standard method using PEG, and screened by ELISA using the 96-well plate coated with C08175 His-Tag-MEGSIN, histidine, or BSA, or Western blot. Monoclonal antibody producing hybridoma specific to immunogen was thus selected.

Example 12: Measurement of MEGSIN in urine by ELISA Urine was collected from the IgA nephropathy patient and centrifuged. The obtained supernatant was concentrated using a ultrafilter for centrifugation (Millipore, Ultrafree, molecular weight cutoff: 5000). Stepwise diluted MBP-MEGSIN or concentrated urine (50pJL) was added into each well of the 96-well plate for ELISA coated with rabbit polyclonal anti-MEGSIN antibody (IgG fraction), kept at 4°C overnight, washed with PBS and blocked with Blockace (Dainippon Pharmaceutical Co., Ltd.). The plate was washed with PBS containing 0.05% Tween (Tween-PBS). The biotin-labelled rabbit polyclonal anti-MEGSIN antibody was added to the plate, and kept at room temperature for 1 hour, and washed with Tween-PBS. The peroxidase-labelled streptoavidin solution (Amersham) (100 mL/well) was added to each well and washed with Tween- PBS, and 100 mL of orthophenylenediamine colouring substrate solution (Wako Pure Chemical) was added to each well. The reaction was conducted for 10 to 30 min in the dark at room temperature, and 50mL of 2M sulfuric acid was added to each well to stop the reaction. The absorbance (492nm) was measured by the microplate reader (SPECTRAmax 250, Molecular Devices) to determine MEGSIN concentration in the urine from calibration curve of a standard solution. The result is shown in Figure 7. MEGSIN was detected in the urine from the IgA nephropathy patients.

20 Example 13: Cloning of rat MEGSIN cDNA Cloning of cDNA by degenerate PCR Using ISOGEN (Nippon Gene) and oligotex, mRNA was extracted from the rat cultured mesangial cells of the 14 th passage. This mRNA was subjected to reverse transcription reaction with reverse transcriptase Super Script II (GIBCO), and the obtained cDNA was used as a 25 template. Based on the cDNA of human MEGSIN, the degenerate primers FY: GTGAATGCTGTGTACTTAAAGGCAANTGN/SEQ ID NO: 24 (corresponding to 172VNAVYFKGK180) and R21: AANAGRAANGGRTCNGC/SEQ ID NO: 25 (R is A or G, corresponding to 357ADHPFLF363) were prepared for the PCR under the condition with 35 cycles of 94°C for 45s (denaturation), 500C for 45s (annealing), and 72 0 C for 2 min (extension) using DNA Thermal Cycler (Perkin Elmer Cetus).

PCR product having the size similar to the expected size (576bp) was inserted into pCRII vector (Clontech) and sequenced by dideoxy method using a DNA automatic sequencer.

The primers specific to the gene were prepared from the clone fragment of rat MEGSIN, and degenerate PCR was conducted again for obtaining the 5' region of rat MEGSIN.

First, the degenerate primer RM-CtermCl: ATGGCNTCNGCNGCNGCNGCNAAYGc/SEQ ID NO: 26 (Y is T or which corresponds to N-terminus of the sequence encoding human MEGSIN, and the reverse primers specific to rat MEGSIN, RM-MR-A2: CGACCTCCAGAGGCAATTCCAGAGAGATCAGCCCTGG/SEQ ID NO: 27 and RM-MR-A1: C08175 27 GTCTTCCAAGCCTACAGATTTCAAGTGGCTCCTC/SEQ ID NO: 28, were prepared. PCR was conducted with RM-CtermC1 and RM-MR-A2 under the condition with 45 cycles of 94 0 C for 550C for 45s, and 72°C for 1 min. Using the obtained PCR product as a template, nested PCR was conducted under the condition with 25 cycles of 94°C for 45s, 55 0 C for 45s, and 72°C for 1 min, with RM-CtermC1 and RM-MR-A2. To enhance the amplification, PCR was further repeated using the same primers under the condition with 25 cycles of 94°C for 30s, 550C for 30s, and 72°C for The obtained PCR product was inserted into pGEM-T-easy vector (Promega), and sequenced by dideoxy method using the DNA automatic sequencer.

Cloning of cDNA by 5' RACE and 3' RACE methods The sequence completely comprising the open reading frame without mutation at the sites of initiation codon and stop codon of MEGSIN was determined. 5'-RACE and 3'-RACE methods were conducted by Marathon cDNA amplification kit (Clontech) using the primers designed based on the sequences obtained above in order to confirm the whole length sequence. For 5'-RACE, two types of gene specific antisense primers, RM-PR01: GCTCAGGGCAGTGAAGATGCTCAGGGAAGA/SEQ ID NO: 29 and RM-PR02: CTGACGTGCACAGTCACCTCGAGCACC/SEQ ID NO: 30 were used. For 3'- RACE, the gene specific sense primer, RM-MR-S3: GAGGTCTCAGAAGAAGGCACTGAGGCAACTGCTGCC/SEQ ID NO: 31 was used. Finally, based on the sequences obtained in such a manner, whole cDNA nucleotide sequence of rat MEGSIN 20 composed of 1229bp shown in SEQ ID NO: 3 was almost completely determined.

To obtain clones comprising open reading frame of the rat MEGSIN, two kinds of gene specific primers, RM-5'UTR-FS2: CTCTATAGGAGACACTTGG/SEQ ID NO: 32 (sense primer) and 3'- UTR-A1: GAAACAAATCAAGCAAAc/SEQ ID NO: 33 (antisense primer), designed from the sequences obtained above, were used. PCR was conducted under the condition with 35 cycles of 25 94°C for 45s (denaturation), 50°C for 45s (annealing), and 720C for 1 min 30 sec (extension). The PCR product of the expected size (about 1300bp) was inserted into pCRII vector to isolate the clones containing the open reading frame of rat MEGSIN.

Example 14: Cloning of mouse MEGSIN cDNA Cloning of cDNA by PCR Using ISOGEN (Nippon Gene), 10pg of total RNA was extracted from mouse cultured mesangial cells of the 9 t passage. From this RNA, first strand cDNA was synthesised using of oligo (dT) primer (Pharmacia) and 200 units of reverse transcriptase Super Script II (GIBCO) by reverse transcription reaction under the condition of 42°C for 50 min and 70°C for min.

Based on the nucleotide sequences of human and rat MEGSIN, degenerate primers MF-1: 5'-GAAATTGAAARCAARCTGASYTTYCAGAAT-3'/SEQ ID NO: 34 (R is A or G, S is C or G, and Y is C or MF-2: 5'-CTGASYTTYCAGAATCTAATGGAMTGGAC-3'/SEQ ID NO: 35 (S is C or G, Y is C or T, and M is A or and MR-4: 5'-GGAYTSAGGRAGTWGCTTTTCWACRATRTT-3'/SEQ ID NO: 36 (S is C or G, Y is C or T, M is A or C, and W is A or were prepared. PCR was conducted using MF-1 C08175 and MR-4 under the condition with 30 cycles with 94°C for 1 min (denaturation), 60°C for 1 min (annealing) and 72 0 C for 30s (extension). Nested PCR was conduced using the obtained PCR product as a template and MF-2 and MR-4, under the same condition of the above to obtain the cDNA fragment of 300bp.

Extension of the 3' region by RACE method Based on the sequences obtained above, the gene specific primers MMF3: GAGGTCTCAGAGGAGGGCACTGAAGCCACTGCTGCC-3'/SEQ ID NO: 37 and MMF4: CCAGTGCAGATCTCTCTGGAATTGCCTCTGGAGGTCGTC-3'/SEQ ID NO: 38 were prepared.

The new cDNA fragment of 127bp was obtained by extending the 3'-region by RACE method (PCR: MMF4 and AP-1, nested PCR: MMF3 and AP-2) using 1.57pg of poly mRNA with Marathon cDNA Amplification Kit (CLONTECH).

Extension of Using 20pg of total RNA and reverse transcriptase SuperScript II (GIBCO), the first strand DNA was synthesised. Using the gene specific primer MMR6: GCCTGTTACTGTATAGGAAACCAAACCG-3'/SEQ ID NO: 39 and degenerate primer based on the nucleotide sequence of rat MEGSIN, DG-RMF1: ATGGCYTCCCTYGCTGCWGCRAATGCAGARTTTKGC-3'/SEQ ID NO: 40 (Y is C or T, W is A or T, R is A or G, and K is G or PCR was conducted to obtain the new cDNA fragment of 5'-region of 720bp, and the total of 1147bp of cDNA nucleotide sequence (SEQ ID NO: 5) was determined.

20 The deduced amino acid sequence based on the obtained cDNA nucleotide sequence (SEQ ID NO: 6) was compared with that of rat (SEQ ID NO: The N-terminus region in the mouse amino acid sequence was coincident with the sequence of 13th or more of rat. This finding suggested that mouse cDNA comprising the translation initiation site at further 5' end.

Example 15: Preparation of transgenic mouse 25 Preparation of pUC-MEGSIN From the human cultured mesangial cells, mRNA was extracted by AGPC method. Using this as a template, RT-PCR was conducted with the sense primer 5' Bam-MEG: ATCGGATCCATGGCCTCCCTTGCT-3'/SEQ ID NO: 41 (containing BamHI restriction site) and the antisense primer 3' Hind-MEG: 5'-ATAAGCTTTCATCATCAAGGGCAAG-3' SEQ ID NO: 42 (containing Hind III restriction site) to amplify the full length open reading frame of MEGSIN.

The obtained PCR product was digested with BamHI and Hindlll, and ligated with pUC 18 (Takara) digested with BamHI and Hindlll to prepare pUC18 inserted with the full length open reading frame of MEGSIN (pUC-MEGSIN). The nucleotide sequence of MEGSIN inserted to pUC18 was confirmed by the dideoxytermination method.

Construction of gene In order to add the oligonucleotide (5'-Gcc Gcc) to upstream of initiation codon in human MEGSIN cDNA, PCR was conducted under the following conditions to synthesise the 211 bp DNA.

C08175 Using pUC-MEGSIN obtained in as a template, PCR was conduced with a set of sense primer B44F: 5'-ATGGATCCGCCGCCATGGCCTCCCTTGCTGCAGCAAATGCAGAG-3'/SEQ ID NO: 43 (containing BamHI site) and antisense primer H30-R: 5'-TATCCTGAGGCAGTGTTAACATGAAG -3' ISEQ ID NO: 44 (containing Hpal site) using TaKaRa EX. Taq. (Takara). Salt was removed by ethanol precipitation, and the restriction site was prepared with BamHI and Hpal to collect the 191bp DNA fragment by the agarose gel electrophoresis.

From pUC-MEGSIN, the 3.5kb fragment containing pUC18 using BamHI and Hapl was obtained, and purified and collected by the agarose gel electrophoresis. By ligating this to the 191bp DNA fragment of the above, the recombinant plasmid carrying human MEGSIN cDNA added with oligonucleotides, that is, pUC-New MEGSIN, was prepared, transformed to E. coli JM 109, and cloned. From pUC-New MEGSIN, the 1.2kb fragment was collected using BamHI and Hindlll through agarose gel electrophoresis. The ends of this fragment were blunted using TaKaRa Blunting Kit (Takara). pBsCAG-2 (constructed by introducing a Sall-Pstl fragment obtained from pCAGGS into the Sail and Pstl restriction sites of pBluescript II SK-) was digested with EcoRI to linearise, blunt-ended with TaKaRa Blunting Kit (Takara), and dephosphorylated by alkaline phosphatase (Takara). To this plasmid, the above described 1.2kb fragment was ligated to prepare the recombinant plasmid, transformed to E. coliJM 109, and cloned. The clone in which the human MEGSIN cDNA was inserted in the same direction as chicken beta-actin promoter was selected by sequencing. This recombinant plasmid was named as pBsCAG-2/MEGSIN.

20 From pBsCAG-2/MEGSIN, the 3.4kb DNA fragment was collected using Sail and Notl by the agarose gel electrophoresis.

Preparation of transgenic mouse %se* To the pronucleus of fertilised egg of the mouse (B6C3F1 X C57/BL), 2pl (2000 copies) of the DNA (3.4kb) prepared in was microinjected, and screening was performed by Southern 25 hybridisation described below.

Genomic DNA was prepared from the tail of the mouse using QIAGEN TISSUE KIT.

Genomic DNA (2pg) was completely digested with Pstl, separated by the 0.8% agarose gel electrophoresis, and transferred to a nylon membrane. The DNA fragment of 1100bp (extracted from pUC-MEGSIN with Pstl and Hindlll and collected by the agarose gel) was hybridised with the 3 2 P]-dCTP labelled probe prepared by Random Primer DNA Labelling Kit Ver. 2 (Takara), at 68 0

C

for 2 hours.

The membrane was washed finally with 0.2 X SSC/0.1% SDS, and autoradiographed. The presence or absence of inserted DNA fragment and the number of copies were determined based on the appearance of the specific 1700bp band. The direction of the inserted DNA fragment when multiple DNA fragments were inserted in tandem was determined by completely digesting 2pg of genomic DNA with EcoRV followed by the same manipulation.

The obtained transgenic mice (FO) were crossed with the normal mice. The newborn mice were screened by the above method to obtain the transgenic mouse F2 mice were obtained C08175 By crossing transgenic mice comprising same heterozygous mutation and the transgenic mice comprising homozygous mutation were screened.

Industrial Applicability The present invention provides a DNA expressed specifically in mesangial cells, a protein encoded by the DNA, and an antibody binding to the protein. These are specific to mesangial cells, and useful for, for example, identifying mesangial cells, and detecting abnormalities in mesangial cells. Moreover, this protein would be helpful for clarifying the functions of mesangial cells and in turn, for investigating causes of diseases relating to mesangial cells. This invention is expectedly applicable to the treatment and diagnosis, of diseases relating to mesangial cells.

e* o C08175 Page(s) 3' 32 are claims pages they appear after the sequence listing SEQUENCE LISTING 110O> M IYATA, Toshio KUROKA WA, Kiyoshi <120> Megsin Protein 130> F2-O02PCT <140> <141> 150> J P09-275302 <151> 1997-09-22 <160> 44 <170> Patentin Ver. <210> 1 <21 1> 1143 <212> DNA <213> Homo sapiens <220> <221 CDS <222> .(1140) <400> 1 atg gcc tcc c Met Ala Ser L aga gag atg g Arg Giu Met A ctg agc ctc t Leu Ser Leu P1 gac tcc ctc t~ 30 Asp Ser Leu S4 50 gga tat gga a~ Gly Tyr Gly A~ aaa aga gtt tt Lys Arg Val p1 agc att gtg a~ Ser Ile Val A iC gpc tac att gz Asp Tyr Ile G] 115 gtt gac ttt ac Val Asp Phe T1 130 tgg gtt gaa aa Trp Vai Giu As 145 ggt ggc ata ag tt gct gca eu Ala Ala 5 at gac aat sp Asp Asn 20 tc gct gcc he Ala Ala ct cag att er Gin Ile ac tct tct sn Ser Ser 70 tt tct gat -le Ser Asp it ggg ctt nf Gly Leu ~g tgt gcc u Cys Ala 9g aat cat ir Asn His it gaa aca Giu Thr 150 *c tca tct gca aat gca gag ttt tgc ttc aac Ala Asn Ala Giu Phe Cys Phe Asn caa Gin ctg Leu gat Asp 55 aat Asn ata Ile ttt Phe gaa Giu tta Leu 135 cat His gga Gly gcc Al a 40 aag Lys agt Ser aat As n gct Al a aaa Lys 120 gaa Giu Gly 10 aat gga Asn Giy 25 ctg gtc Leu Vai ttg ctt Leu Leu cag tca Gin Ser gca tcc Ala Ser 90 gaa aaa Giu Lys 105 tta tac Leu Tyr gac act Asp Thr aaa atc Lys Ile aat As n cgc Arg cat His ggg Gly 75 cac His gtg Val1 gat Asp aga Arg aag Lys 155 gtg Val1 ttg Leu gtt Val1 ctc Leu aag Lys tat Tyr gc c Al a cgt Arg 140 aac Asn ttc Phe ggc Gly aac Asn c ag Gin gat Asp ggc Gly aaa Lys 125 aat Asn gtg Val1 ttt Phe gct Ala act Thr tct Ser tat Tyr ttt Phe 110 gtg Val1 att Ile att Ile ctg ttc Leu Phe tcc tct Ser Ser caa gat Gln Asp gcc tca Ala Ser caa ctg Gin Leu gat ctc Asp Leu cat aag His Lys gag cga Glu Arg aat aag Asn Lys ggt gaa Gly Giu 160 gtg tac Val Tyr 175 48 96 144 192 240 288 336 384 432 480 528 gct gta atg gtg Guy Gly Ile Ser Ser Ser Ala Val Met Val ctg gtg aat gct Leu Val Asn Ala C08 175 tte aaa ggc aag tgg caa tea gcc ttc acc aag age gaa acc ata aat 576 Phe Lys Gly Lys Trp Gin Ser Ala Phe Thr Lys Ser Glu Thr Ile Asn 180 185 190 tgc cat ttc aaa tct ccc aag tgc tct ggg aag gca gte gcc atg atg 624 Cys His Phe Lys Ser Pro Lys Cys Ser Gly Lys Ala Val Ala Met Met 195 200 205 cat cag gaa cgg aag ttc aat ttg tct gtt att gag gac cca tca atg 672 His Gin Glu Arg Lys Phe Asn Leu Ser Val Ile Glu Asp Pro Ser Met 210 215 220 aag att ctt gag ctc aga tac aat ggt ggc ata aac atg tac gtt ctg 720 Lys Ile Leu Glu Leu Arg Tyr Asn Gly Gly Ile Asn Met Tyr Val Leu 225 230 235 240 ctg cct gag aat gac etc tct gaa att gaa aac aaa ctg acc ttt cag 768 Leu Pro Glu Asn Asp Leu Ser Glu Ile Glu Asn Lys Leu Thr Phe Gin 245 250 255 aat cta atg gaa tgg acc aat cca agg cga atg acc tct aag tat gtt 816 Asn Leu Met Glu Trp Thr Asn Pro Arg Arg Met Thr Ser Lys Tyr Val 260 265 270 gag gta ttt ttt cct cag ttc aag ata gag aag aat tat gaa atg aaa 864 Glu Val Phe Phe Pro Gin Phe Lys Ile Glu Lys Asn Tyr Glu Met Lys 275 280 285 caa tat ttg aga gcc cta ggg ctg aaa gat atc ttt gat gaa tcc aaa 912 Gin Tyr Leu Arg Ala Leu Gly Leu Lys Asp Ile Phe Asp Glu Ser Lys 290 295 300 gca gat ctc tct ggg att gct tcg ggg ggt cgt ctg tat ata tea agg 960 Ala Asp Leu Ser Gly Ile Ala Ser Gly Gly Arg Leu Tyr Ile Ser Arg 305 310 315 320 atg atg cac aaa tct tac ata gag gtc act gag gag ggc ace gag gct 1008 Met Met His Lys Ser Tyr Ile Glu Val Thr Glu Glu Gly Thr Glu Ala 30 325 330 335 act get gee aca gga agt aat att gta gaa aag caa etc cct cag tec 1056 Thr Ala Ala Thr Gly Ser Asn Ile Val Glu Lys Gin Leu Pro Gin Ser 340 345 350 acg ctg ttt aga get gac cac cca tte cta ttt gtt ate agg aag gat 1104 Thr Leu Phe Arg Ala Asp His Pro Phe Leu Phe Val Ile Arg Lys Asp 355 360 365 gac ate ate tta ttc agt ggc aaa gtt tct tgc cct tga 1143 Asp Ile Ile Leu Phe Ser Gly Lys Val Ser Cys Pro 370 375 380 <210>2 <211> 380 S<212>

PRT

<213> Homo sapiens <400>2 Met Ala Ser Leu Ala Ala Ala Asn Ala Glu Phe Cys Phe Asn Leu Phe 1 5 10 Arg Glu Met Asp Asp Asn Gin Gly Asn Gly Asn Val Phe Phe Ser Ser 25 Leu Ser Leu Phe Ala Ala Leu Ala Leu Val Arg Leu Gly Ala Gin Asp 35 40 Asp Ser Leu Ser Gin Ile Asp Lys Leu Leu His Val Asn Thr Ala Ser 55 Gly Tyr Gly Asn Ser Ser Asn Ser Gin Ser Gly Leu Gin Ser Gin Leu 70 75 Lys Arg Val Phe Ser Asp Ile Asn Ala Ser His Lys Asp Tyr Asp Leu 90 Ser Ile Val Asn Gly Leu Phe Ala Glu Lys Val Tyr Gly Phe His Lys 100 105 110 Asp Tyr Ile Glu Cys Ala Glu Lys Leu Tyr Asp Ala Lys Val Glu Arg 115 120 125 C08175 Val1 Trp 145 Gly Asp Phe Thr Asn 130 Val Giu Asn Glu Gly Ile Ser Phe Lys Gly Lys Cys His P 1 His Gin G 210 Lys Ile L 225 Leu Pro G Asn Leu M Glu Val P 2 Gin Tyr L 290 Aia Asp L 305 Met Met H Thr Ala A Thr Leu P 3 Asp Ile I 370 <210> 3 <21 1> 1229 Trp Ser Lys Leu Asp 245 Trp Pro Aia Gly Ser 325 Gly Ala His Leu 135 Thr His 150 3er Ser 170 Gin Ser Pro Lys Phe Asn 215 Arg Tyr 230 Leu Ser Thr Asn Gin Phe Leu Gly 295 Ile Ala 310 Tyr Ile Ser Asn Asp His 3/15 Giu Asp Thr Arg Arg Asn 140 Gly Lys Ile Lys Asn Val 155 Ala Val Met Val Leu 175 Ala Phe Thr Lys Ser Giu 185 Cys Ser Gly Lys Ala Vai 200 205 Leu Ser Val Ile Giu Asp 220 Asn Giy Gly Ile Asn Met 235 Giu Ile Giu Asn Lys Leu 250 Pro Arg Arg Met Thr Ser 265 Lys Ile Giu Lys Asn Tyr 280 285 Leu Lys Asp Ile Phe Asp 300 Ser Giy Giy Arg Leu Tyr 315 Glu Val Thr Giu Glu Gly 330 Ile Val Giu Lys Gin Leu 345 Pro Phe Leu Phe Val Ile 360 365 Lys Val Ser Cys Pro 380 Ile Asn Lys Ile Gly Glu 160 Val Asn Ala Val Tyr

S

Leu Phe Ser <212> DNA <213> Rattus rattus <220> <221> ODS <222> (8)..(1147) <400> 3 tttcaaa atq qcc tta Leu tct Ser cga Arg cca Pro caa Gin aaa Lys Met 1 aga Arg ctg Leu gac Asp aga Arg aaa Lys agc Ser gca Al a aac Asn cta Leu gcc Al a cag Gin tca Ser gag Giu C08175 aag age tat Lys Ser Tyr 100 atg gag Met Glu tgt get gaa Cys Ala Glu tac aat get Tyr Asn Ala aaa gtg Lys Val 125 gaa aga gtt Glu Arg Val 115 ttt Phe aca aat gat ata Thr Asn Asp Ile gaa ace aga Glu Thr Arg aat aaa tgg Asn Lys Trp 145 ggg gac age Gly Asp Ser gaa aat gaa Glu Asn Glu age ete age Ser Leu Ser 135 aca eat Thr His 150 tea get Ser Ala aaa tcg Lys Ser gge aaa ate aag Gly Lys Ile Lys ttt aaa att Phe Lys Ile 140 aag gtg ttg Lys Val Leu gtt Val 175 etc Leu 160 tac Tyr gte atg gtg Val Met Val 170 gee tte ace Ala The Thr eta gtg aat get Leu Val Asn Ala ttc aaa ggc Phe Lys Gly aag Lys 180 agg Arg aag agt gat Lys Ser Asp agt tge cat Ser Cys His ttc Phe 195 gaa Glu tct ccc age Ser Pro Ser gga aaa gca Gly Lys Ala gtt aat Val Asn 205 atg atg cat Met Met His egg agg tte Arg Arg Phe tee ace att Ser Thr Ile r r r eca atg eag Pro Met Gin 225 ate atg ttg Ile Met Leu ctt gag eta Leu Giu Leu cat ggt ggc His Gly Gly cag gag eca Gin Giu Pro 220 age atg tac Ser Met Tyr aag ctg agt Lys Leu Ser ccc gag gat Pro Giu Asp tee gaa att Ser Giu Ile tte Phe 255 tat Tyr 240 cag Gin 385 433 481 529 577 625 673 721 769 817 865 913 961 1009 1057 1105 1147 1207 1229 aat eta atg Asn Leu Met aca aat age Thr Asn Ser atg aaa tct Met Lys Ser gtg aat gtg Val Asn Val ttt Phe 275 ccc eag ttc Pro Gin Phe gag aaa gat Glu Lys Asp tat gaa Tyr Glu 285 atg agg age Met Arg Ser ttg aaa tet gta Leu Lys Ser Val gaa gac ate Glu Asp Ile tee agg get Ser Arg Ala 305 tea aag eta Ser Lys Leu ctg tct gga Leu Ser Gly tct gga ggt Ser Gly Gly ttt gtt gag Phe Val Glu 300 etc tat gta Leu Tyr Val gaa ggc ace Glu Gly Thr atg cac aag Met His Lys ata gag gte Ile Giu Val gag Glu 335 gaa Glu 320 gca Ala tea Ser 330 gaa Glu act get gee Thr Aia Ala aca Thr 340 aga Arg agt aae ate gtt Ser Asn Ile Val aag eta ett Lys Leu Leu tee aeg gtg Ser Thr Val ttc Phe 355 ate Ile get gac cgc Ala Asp Arg ctg ttt gte Leu Phe Val aag aat gge Lys Asn Gly tta ttt act ggc Leu Phe Thr Gly gte teg tgt Val Ser Cys tgaaatteta tttggtttte eatacactaa caggcatgaa aattgtaatt ggaagtacat gg '210> 4 <211> 380 <212> PRT gaaacateat aagtgaatag <213> Rattus rattus '400> 4 Met Ala Ser Leu Ala Ala Ala Asn Ala Giu Phe Gly Phe Asp Leu Phe C08175 5/15 1 5 -10 Arg Glu Met Asp Ser Ser Gin Gly Asn Gly Asn Val Phe Phe Ser Ser 25 Leu Ser Ile Phe Thr Ala Leu Ser Leu Ile Arg Leu Gly Ala Arg Gly 35 40 Asp Cys Xaa Arg Gin Ile Asp Lys Ala Leu His Phe Ile Ser Pro Ser 55 Arg Gin Gly Asn Ser Ser Asn Ser Gin Leu Gly Leu Gin Tyr Gin Leu 70 75 Lys Arg Val Leu Ala Asp Ile Asn Ser Ser His Lys Asp Xaa Lys Leu 90 Ser Ile Ala Asn Gly Val Phe Ala Glu Lys Val Phe Asp Phe His Lys 100 105 110 Ser Tyr Met Glu Cys Ala Glu Asn Leu Tyr Asn Ala Lys Val Glu Arg 115 120 125 Val Asp Phe Thr Asn Asp Ile Gin Glu Thr Arg Phe Lys Ile Asn Lys 130 135 140 Trp Ile Glu Asn Glu Thr His Gly Lys Ile Lys Lys Val Leu Gly Asp 145 150 155 160 Ser Ser Leu Ser Ser Ser Ala Val Met Val Leu Val Asn Ala Val Tyr 165 170 175 Phe Lys Gly Lys Trp Lys Ser Ala Phe Thr Lys Ser Asp Thr Leu Ser 180 185 190 Cys His Phe Arg Ser Pro Ser Gly Pro Gly Lys Ala Val Asn Met Met 25 195 200 205 His Gin Glu Arg Arg Phe Asn Leu Ser Thr Ile Gin Glu Pro Pro Met 210 215 220 Gin Ile Leu Glu Leu Gin Tyr His Gly Gly Ile Ser Met Tyr Ile Met 225 230 235 240 30 Leu Pro Glu Asp Asp Leu Ser Glu Ile Glu Ser Lys Leu Ser Phe Gin 245 250 255 Asn Leu Met Asp Trp Thr Asn Ser Arg Lys Met Lys Ser Gin Tyr Val 260 265 270 Asn Val Phe Leu Pro Gin Phe Lys Ile Glu Lys Asp Tyr Glu Met Arg 35 275 280 285 Ser His Leu Lys Ser Val Gly Leu Glu Asp Ile Phe Val Glu Ser Arg 290 295 300 Ala Asp Leu Ser Gly Ile Ala Ser Gly Gly Arg Leu Tyr Val Ser Lys 305 310 315 320 Leu Met His Lys Ser Leu Ile Glu Val Ser Glu Glu Gly Thr Glu Ala 325 330 335 Thr Ala Ala Thr Glu Ser Asn Ile Val Glu Lys Leu Leu Pro Glu Ser 340 345 350 Thr Val Phe Arg Ala Asp Arg Pro Phe Leu Phe Val Ile Arg Lys Asn 355 360 365 Gly Ile Ile Leu Phe Thr Gly Lys Val Ser Cys Pro 370 3'75 380 <210>5 <211> 1147 <212>DNA <213> Mus musculus <220> <221> CDS <222> (1)..(1104) <400> ttc gac tta ttc aga gag atg gat agt agc caa gga aat gga aat gta 48 Phe Asp Leu Phe Arg Glu Met Asp Ser Ser Gin Gly Asn Gly Asn Val 1 5 10 ttc ttc tct tcc ctg agc atc ttc act gcc ctg acc cta atc cgt ctg 96 C08175 6/15 Phe Phe Ser Ser Leu Ser Ile Phe Thr -Ala Leu Thr Leu Ile Arg Leu ggt got cga Gly Ala Arg aac ata cca Asn Ile Pro ggt gao tgt gca Gly Asp Cys Ala ogt cag att gac aag Arg Gin Ile Asp Lys 40 aao tca tot aat aat Asn Ser Ser Asn Asn gca otg cac ttt Aia Leu His Phe cag oca gga ott Gin Pro Giy Leu tca aga caa Ser Arg Gin cag Gin ga t Aso tat Tyr tat Tvr gga Giy 55 gtt Vali caa ttg aaa aga Gin Leu Lys Arg gaa oto ago att Giu Leu Ser Ile oat aag aao tao His Lys Asn Tyr Ott got gao Leu Ala Asp aao Asn toa tot oat Ser Ser His goo aot gga Ala Thr Gly att gag tgt Ile Giu Cys goa gaa aaa Ala Glu Lys gao ttt Asp Phe gaa aao tta Giu Asn Leu aaa gog gaa Lys Vai Giu 115 aaa att aat Lys Ile Asn gtt gao tto Val Asp Phe 105 aa t Asn gat gta oaa Asp Val Gin gat Asp 125 aag Lys tao aat got Tyr Asn Ala 110 aoo aga ttt Thr Arg Phe ato aag aag Ile Lys Lys aaa tgg att Lys Trp Ile gtg Vai 145 aao As n 130 ttg Leu gaa Giu 135 oto Leu gag aoa oat Glu Thr His gga Gly 140 gto Val1 ggo gao ago Gly Asp Ser ago tog tog Ser Ser Ser atg gtg otg Met Val Leu gtg Val1 160 got gtt tao Ala Vai Tyr ggo aaa tgg Gly Lys Trp goo tto aoo Ala Phe Thr aag aot Lys Thr 175 30 gat aoo oto Asp Thr Leu ogt ttt agg Arg 'Phe Arg tot Ser 185 ogg Arg aog tgt oot Thr Cys Pro gtt aat atg Val Asn Met 195 oag ooa ooa Gin Pro Pro oat oaa gaa His Gin Glu ogg Arg 200 gag Glu tto aat ttg Phe Asn Leu tot Ser 205 ggt Gly gga aaa goa Giy Lys Val 190 aoo att oag Thr Ile Gin ggo ata ago Gly Ile Ser 144 192 240 288 336 384 432 480 528 576 624 672 720 768 816 864 912 960 1008 1056 1104 atg oag gtt Met Gin Val atg Met 225 otg Leu 210 tao Tyr ott Leu 215 gag Giu oto oaa tat Leu Gin Tyr att atg otg Ile Met Leu gat ggo ota Asp Gly Leu att gaa ago Ile Giu Ser agt tto oag Ser Phe Gin aat Asn 245 aao Asn atg gao tgg Met Asp Trp agg agg aaa Arg Arg Lys atg aaa Met Lys 255 tot oag tat Ser Gin Tyr tat gaa atg Tyr Giu Met 275 gat gag too Asp Giu Ser gtg ttt oto Val Phe Leu 000 Pro 265 too Ser tto aag ata Phe Lys Ile oao oao ttg His His Leu tta ggo ttg Leu Gly Leu gag aag aat Giu Lys Asn 270 gat ato ttt Asp Ile Phe ggt ogt oto Gly Arg Leu agt goa gat Ser Ala Asp 290 tao gta Tyr Val oto Leu 295 oao His gga att goo Gly Ile Ala toa aag ota Ser Lys Leu aag toa tto Lys Ser Phe gto toa gag Vai Ser Giu 305 ggo Giy aot gaa goo act got goo aoa Thr Giu Ala Thr Aia Ala Thr 325 gaa aat Glu Asn 330 goo gao Ala Asp att gtt gaa Ile Val Giu aag oag Lys Gin 335 ttt gto Phe Val ott oot gag too Leu Pro Giu Ser 340 ato aag aag aat aoa gtg tto aga Thr Val Phe Arg ogo 000 ttt Arg Pro Phe gao ato ato tta ttt aot ggo aaa gtc tot tgt O~t C08175 7/15 Ile Lys Lys Asn Asp Ile Ile Leu Phe Thr Gly Lys Val Ser Cys Pro 355 360 36S tgaaattcga' tttggtttcc tatacagtaa caggcatcaa gaa <210> 6 <21 1 >368 <212> PRT <213> Mus musculus 1147 a. a. a <400> 6 Phe Asp 1 Phe Phe Gly Ala Asn Ile s0 Gin Tyr Asp Tyr Asp Phe Lys Val Lys Ile 130 Vai Leu 145 Asn Aia Asp Thr Val Asn 35 Gin Pro 210 Met Tyr 225 Leu Ser Leu Se r Arg Pro Gin Giu His Giu 115 Asn Giy Val1 Leu Met 195 Pro Ile Phe Tyr Me t 275 Se r Ser G1u Giu Lys 355 Phe Ser Gly Ser Leu Leu Lys 100 Arg Lys Asp Tyr Ser 180 Met Met Met Gin Val1 260 Thr Ser Lys Ala Ser 340 Asn Arg Leu Asp Arg Lys Ser 85 Asn Val1 Trp Ser Phe 165 Cys His Gin Leu As n 245 Asn His Al a Leu Thr 325 Thr Asp Ser Cys Gin Arg 70 Ile Tyr Asp Ile Ser 150 Lys Arg Gin Val1 Pro 230 Leu Val1 His Asp Met 310 Al a Val1 Ile Ile Ala Giy 55- Val1 Al a Ile Phe Giu 135 Leu Gly Phe Giu Leu 215 Giu Met Phe Leu Leu 295 His Ala Phe Ile Phe Arg 40 As n Leu Thr Giu Thr 120 As n Ser Lys Arg Arg 200 Giu Asp Asp Leu Lys 280 Ser Lys Thr Arg Leu 360 Thr 25 Gin Ser Al a Gly Cys 105 Asn Glu Ser Trp Ser 185 Arg Leu Gly Trp Pro 265 Ser Gly Ser Giu Ala 345 Phe Al a Ile Ser Asp Val 90 Al a Asp Thr Ser Lys 170 Pro Phe Gin Leu Thr 250 Gin Leu Ile Phe As n 330 Asp Thr Leu Asp Asn Ile 75 Phe Glu Val1 His Ala 155 Ser Thr Asn Tyr Cys 235 Asn Phe Gly Al a Ile 315 Asn Arg Gly Thr L ys Asn Asn Ala Asn Gin Gly 140 Val1 Al a Cys Leu His 220 Giu Arg Lys Leu Ser 300 Giu Ile Pro Lys *Leu Ala Gin Ser Giu Leu Asp 125 Lys Met Phe Pro Ser 205 Gly Ile Arg Ile Lys 285 Gly Val1 Val Phe Val 365 Ile Leu Pro Ser Lys Tyr 110 Thr Ile Val1 Thr Gly 190 Thr Gly Giu Lys Giu 270 Asp Gly Ser G1u Leu 350 Ser Arg *His Gly His Val1 As n Arg Lys Leu Lys 175 Lys Ile Ile Ser Met 255 Lys Ile Arg Giu Lys 335 Phe Cys Leu Phe Leu Lys Tyr Al a Phe Lys Val1 160 Thr Val1 Gln Ser Lys 240 Lys Asn Phe Leu Giu 320 Gl~n Val1 Pro Giu Met Asp Ser Ser Gln Gly Asn Gly Asn Val Ser Tyr Asp Tyr 305 Gly Leu Ile Gin Giu Giu 290 Val1 Thr Pro Lys <210> 7 <211> 18 '212> DNA C08175 8/15 <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 7 tgtaaaacga cggccagt 18 <210>8 <211>21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 8 accatgatta cgccaagctt g 21 <210>9 <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis 20 <400>9 tcagagaggt cattc <210>10 <211> 18 <212> DNA 25 <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> tcattgatgg gtcctcaa 18 <210> 11 <211>18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400>11 agattcttga gctcagat 18 <210> 12 <211>18 <212> DNA <213> Artificial Sequence C08175 <220> <223> Description of Artificial Sequence: synthesis <400> 12 aatggtggca taaacatg 18 <210> 13 <21 1 >18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 13 acagacaaat tgaacttc 18 <210O> 14 <21 1> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Seq uence: synthesis 20 <400>14 2 gaattcatgg cctcccttgc tgcagcaaa 2 <210> :<21 1 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400>15 tcgacttat caagggcaag aaactttgcc <210> 16 <21 1 >21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 16 atgatctcag cattgtgaat g 21 <210> 17 <21 1> 22 <212> DNA <213> Artificial Sequence <220> C08175 10/15 <223> Description of Artificial Sequence:synthesis <400> 17 actgagggag ttgcttttct ac 22 <210> 18 <211>15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 18 Ser Asn Ile Val Glu Lys Gin Leu Pro Gin Ser Thr Leu Phe Arg 1 5 10 <210> 19 <211> <212>PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400>19 20 Phe Arg Glu Met Asp Asp Asn Gin Gly Asn Gly Asn Val Phe Phe 1 5 10 <210>20 <211>15 <212> PRT <213> Artificial Sequence S: <220> <223> Description of Artificial Sequence:synthesis <400>20 Ser Gin Ser Gly Leu Gin Ser Gin Leu Lys Arg Val Phe Ser Asp 1 5 10 <210>21 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 21 Ala Thr Gly Ser Asn Ile Val Glu Lys Gin Leu Pro Gin Ser Thr Leu 1 5 10 <210>22 <211> 38 <212> DNA <213> Artificial Sequence C08175 11/15 <220> <223> Description of Artificial Sequence:synthesis <400> 22 atcggatcca tggcctccct tgctgcagca aatgcaga 38 <210> 23 <21 1>42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:syn thesis <400> 23 ataagctttc atcaagggca agaaactttg ccactgaata ag 42 <210> 24 <21 1> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Seq uen ce: synthesis <400> 24 gtgaatgctg tgtacttaaa ggcaantgn 29 <210> :<21 1 >17 <212> DNA <213> Artificial Sequence *.25 <220> <223> Description of Artificial Sequence:synthesis <400> :aanagraang grtcngc 17 <210> 26 <21 1 >26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 26 atggcntcng cngcngcngc naaygc 26 <210> 27 <21 1> 37 <212> DNA <213> Artificial Sequence <220> C08 175 12/15 <223> Description of Artificial Sequence: synthesis <:400> 27 cgacctccag aggcaattcc agagagatca gccctgg 37 <210> 28 <21 1>34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Seq uence: synthesis <400> 28 gtcttccaag cctacagatt tcaagtggct cctc 34 '210> 29 '21 1 '212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Seq uence: synthesis '400> 29 ***gctcagggca gtgaagatgc tcagggaaga <210O> '21 1> 27 '212> DNA <213> Artificial Sequence <:220> <223> Description of Artificial Sequence:synthesis <400> ctgacgtgca cagtcacctc gagcacc 27 <210> 31 <21 1> 36 '212> DNA '213> Artificial Sequence <220> '223> Description of Artificial Sequence: synthesis '400> 31 gaggtctcag aagaaggcac tgaggcaact gctgcc 36 '210> 32 '21 1 >19 '212> DNA '213> Artificial Sequence '220> <223> Description of Artificial Sequence:synthesis C08 175 13/15 <400> 32 ctctatagga gacaqttgg 19 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Seq uence: synthesis <400> 33 gaaacaaatc aaagcaaac 1-9 <210> 34 <21 1> <212> DNA <213> Artificial Sequence <220> Description of Artificial Sequence: synthesis <400> 34 gaaattgaaa rcaarctgas yttycagaat <210> <21 1>29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis *25 <400> ctgasyttyc agaatctaat ggamtggac 29 36 :<21 1>30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 36 ggaytsaggr agtwgctttt cwacratrtt <210O> 37 <21 1> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 37 gaggtctcag aggagggcac tgaagccact gctgcc 36 C08 175 14/15 <210O> 38 <21 1> 39 '212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 38 ccagtgcaga tctctctgga attgcctcrg gaggtcgtc 39 <210> 39 <21 1 >28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthesis :000 15 <400> 39 gcctgttact gtataggaaa ccaaaccg 28 '210> <21 1 >36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> atggcytccc tygctgcwgc raatgcagar tttkgc 36 '210O> 41 '21 1> 24 "See '212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Seq uence:syn thesis <400> 41 atcggatcca tggcctccct tgct 24 <210> 42 '21 1> '212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:syn thesis <400> 42 ataagctttc atcatcaagg gcaag '210> 43 C08 175 <21 1 >44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 43 atggatccgc cgccatggcc tcccttgctg cagcaaatgc agag 44 <210> 44 <21 1> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthesis <400> 44 tatcctgagg cagtgttaac atgaag 27 C081

Claims (10)

1. A protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6, or a protein comprising an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6 in which one or more amino acids are replaced, deleted, added, and/or inserted, and functionally equivalent to the protein comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.

2. The protein of claim 1, comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6.

3. A DNA encoding the protein of claim 1.

4. The DNA of claim 3, comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: A DNA hybridising with a DNA comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5 under the stringent condition, and encoding the protein of claim 1 or the protein functionally equivalent thereto. 15 6. A vector comprising the DNA of any one of claims 3, 4, and

7. A transformed cell expressibly comprising the DNA of any one of claims 3, 4, and S8. A method for producing the protein of claim 1, the method comprising culturing the el transformed cell of claim 7 and collecting an expression product of the DNA of any one of claims 3, 4, and %0 20 9. An antibody binding to the protein of claim 1. The antibody of claim 9, which recognises an epitope of a protein comprising an amino acid sequence selected from amino acid sequences of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.

11. The antibody of claim 10, wherein the antibody is a monoclonal antibody. oi0:" 25 12. An immunoassay method for measuring the protein of claim 2 or its fragment, the method comprising immunologically binding the antibody of any one of claims 10 and 11, to the protein of claim 2 or its fragment.

13. A reagent for an immunoassay for the protein of claim 2 or its fragment, comprising the antibody of any one of claims 10 and 11.

14. A method for detecting mesangial proliferative nephropathy, the method comprising measuring the protein of claim 2 or its fragment contained in biological samples and comparing the measured amount with that obtained from normal samples. A transgenic nonhuman vertebrate, wherein the expression level of the gene encoding MEGSIN is modified.

16. The transgenic nonhuman vertebrate of claim 15, wherein the nonhuman vertebrate is a mouse. C08175

17. The transgenic nonhuman vertebrate of claim 16, which is a knockout mouse wherein expression of the gene encoding MEGSIN is inhibited. Dated 22 March, 2002 Toshio Miyata and Kiyoshi Kurokawa Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON e* o* C08175