AU2762802A - Transgenic non-human animals capable of producing heterologous antibodies - Google Patents

Description

S&F Ref: 273787D5

AUSTRALIA

PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT

ORIGINAL

Name and Address of Applicant: Actual Inventor(s): Address for Service: Invention Title: GenPharm International, Inc.

2375 Garcia Avenue Mountain View California 94043 United States of America Nils Lonberg, Robert M. Kay Spruson Ferguson St Martins Tower,Level 31 Market Street Sydney NSW 2000 (CCN 3710000177) Transgenic Non-Human Animals Capable of Producing Heterologous Antibodies The following statement is a full description of this invention, including the best method of performing it known to me/us:- 5845c Transgenic Non-human Animals Capable of Producing Heterologous Antibodies Cross-Reference to Related Applications This application is a further application to 13182/99 which is incorporated herein by reference.

Technical Field The invention relates to transgenic non-human animals capable of producing heterologous antibodies, transgenes used to produce such transgenic animals, transgenes capable of functionally rearranging a heterologous D gene in V-D-J recombination, immortalised B-cells capable of producing heterologous antibodies, methods and transgenes for producing heterologous antibodies of multiple isotypes, methods and transgenes for producing heterologous antibodies wherein a variable region sequence comprises somatic mutation as compared to germline rearranged variable region sequences, transgenic nonhuman animals which produce antibodies having a human primary sequence and which 15 bind to human antigens, hybridomas made from B cells of such transgenic animals, and monoclonal antibodies expressed by such hybridomas.

Background of the Invention One of the major impediments facing the development of in vivo therapeutic and diagnostic applications for monoclonal antibodies in humans is the intrinsic immunogenicity 20 of non-human immunoglobulins. For example, when immunocompetent human patients are administered therapeutic doses of rodent monoclonal antibodies, the patients produce antibodies against the rodent immunoglobulin sequences; these human anti-mouse antibodies (HAMA) neutralise the therapeutic antibodies and can cause acute toxicity.

Hence, it is desirable to produce human immunoglobulins that are reactive with specific 25 human antigens that are promising therapeutic and/or diagnostic targets. However, producing human immunoglobulins that bind specifically with human antigens is problematic.

The present technology for generating monoclonal antibodies involves pre-exposing, or priming, an animal (usually a rat or mouse) with antigen, harvesting B-cells from that animal, and generating a library of hybridoma clones. By screening a hybridoma population for antigen binding specificity (idiotype) and also screening for immunoglobulin class (isotype), it is possible to select hybridoma clones that secrete the desired antibody.

However, when present methods for generating monoclonal antibodies are applied for the purpose of generating human antibodies that have binding specificities for human antigens, obtaining B-lymphocytes which produce human immunoglobulins a serious obstacle, since humans will typically not make immune responses against self-antigens.

Hence, present methods of generating human monoclonal antibodies that are specifically reactive with human antigens are clearly insufficient. It is evident that the same [I:\DAYLIB\libc]OI I immunoglobulins a serious obstacle, since humans will typically not make immune responses against self-antigens.

Hence, present methods of generating human monoclonal antibodies that are specifically reactive with human antigens are clearly insufficient. It is evident that the same limitations on generating monoclonal antibodies to authentic self antigens apply where non-human species are used as the source of B-cells for making the hybridoma.

The construction of transgenic animals harbouring a functional heterologous immunoglobulin transgene are a method by which antibodies reactive with self antigens may be produced. However, in order to obtain expression of therapeutically useful antibodies, or hybridoma clones producing such antibodies, the transgenic animal must produce transgenic B cells that are capable of maturing through the B lymphocyte development pathway, such maturation requires the presence of surface IgM on the transgenic B cells, however isotypes other than IgM are desired for therapeutic uses. Thus, there is a need for transgenes and animals harbouring such transgenes that are able to undergo functional V-D-J rearrangement to generate recombinational diversity and junctional diversity.

Further, such transgenes and transgenic animals preferably include cis-acting sequences that facilitate isotype switching from a first isotype that is required for B cell maturation to a subsequent isotype that has superior therapeutic utility.

A number of experiments have reported the use of transfected cell lines to determine the specific DNA sequences required for Ig gene rearrangement (reviewed by Lewis and Gellert (1989), Cell, 59, 585-588). Such reports have identified putative sequences and concluded that the accessibility of these sequences to the recombinase enzymes used for rearrangement is modulated by transcription (Yancopoulos and Alt (1985), Cell, 40, 271-281). The sequences for V(D)J joining are reportedly a highly conserved, near-palindromic heptamer and a less well conserved AT-rich nanomer separated by a spacer of either 12 or 23 bp (Tonegawa (1983), Nature, 302, 575-581; Hesse, et al. (1989), Genes in Dev., 3, 1053-1061). Efficient recombination reportedly occurs only between sites containing recombination signal sequences with different length spacer regions.

Ig gene rearrangement, though studied in tissue culture cells, has not been extensively examined in transgenic mice. Only a handful of reports have been published describing rearrangement test constructs introduced into mice [Buchini, et al. (1987), Nature, 326, 409-411 (unrearranged chicken X transgene); Goodhart, et al. (1987) Proc. Natl. Acad. Sci. USA, 84, 4229-4233) (unrearranged rabbit K gene); and Bruggemann, et al. (1989), Proc. Natl. Acad. Sci. USA, 86, 6709-6713 (hybrid mouse-human heavy chain)]. The results of such experiments, however, have been variable, in some cases, producing incomplete or minimal rearrangement of the transgene.

(N:\LIBC]01115:ais 2 of Further, a variety of biological functions of antibody molecules are exerted by the FC portion of molecules, such as the interaction with mast cells or basophils through Fce, and binding of complement by FCi or FCy, it further is desirable to generate a functional diversity of antibodies of a given specificity by variation of isotype.

Although transgenic animals have been generated that incorporate transgenes encoding one or more chains of a heterologous antibody, there have been no reports of heterologous transgenes that undergo successful isotype switching. Transgenic animals that cannot switch isotypes are limited to producing heterologous antibodies of a single isotype, and more specifically are limited to producing an isotype that is essential for B cell maturation, such as IgM and possibly IgD, which may be of limited therapeutic utility. Thus, there is a need for heterologous immunoglobulin transgenes and transgenic animals that are capable of switching from an isotype needed for B cell development to an isotype that has a desired characteristic for therapeutic use.

Based on the foregoing, it is clear that a need exists for methods of efficiently producing heterologous antibodies, eg. antibodies encoded by genetic sequences of a first species that are produced in a second species. More particularly, there is a need in the art for heterologous immunoglobulin transgenes and transgenic animals that are capable of undergoing functional V-D-J gene rearrangement that incorporates all or a portion of a D gene segment which contributes to recombinational diversity. Further, there is a need in the art for transgenes and transgenic animals that can support V-D-J recombination and isotype switching so that functional B cell development may occur, and therapeutically useful heterologous antibodies may be produced. There is also a need for a source of B cells which can be used to make hybridomas that produce monoclonal antibodies for therapeutic or diagnostic use in the particular species for which they are designed. A heterologous immunoglobulin transgene capable of functional V-D-J recombination and/or capable of isotype switching could fulfil these needs.

In accordance with the foregoing object transgenic nonhuman animals are provided which are capable of producing a heterologous antibody, such as a human antibody.

Further, it is an object to provide B-cells from such transgenic animals which are capable of expressing heterologous antibodies wherein such B-cells are immortalised to provide a source of a monoclonal antibody specific for a particular antigen.

In accordance with this foregoing object, it is a further object of the invention to provide hybridoma cells that are capable of producing such heterologous monoclonal antibodies.

IN:\LIBC]01115:ais 3 of Still further, it is an object herein to provide heterologous unrearranged and rearranged immunoglobulin heavy and light chain transgenes useful for producing the aforementioned non-human transgenic animals.

Still further, it is an object herein to provide methods to disrupt endogenous immunoglobulin loci in the transgenic animals.

Still further, it is an object herein to provide methods to induce heterologous antibody production in the aforementioned transgenic non-human animal.

A further object of the invention is to provide methods to generate an immunoglobulin variable region gene segment repertoire that is used to construct one or more transgenes of the invention.

The references discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention.

15 Summary of the Invention Transgenic nonhuman animals are provided which are capable of producing a heterologous antibody, such as a human antibody. Such heterologous antibodies may be of various isotypes, including: IgG1, lgG2, lgG3, lgG4, IgM, IgA1, lgA2, IgAsec, IgD, of IgE. In order for such transgenic nonhuman animals to make an immune response, it is necessary for the transgenic B cells and pre-B cells to produce surface-bound immunoglobulin, particularly of the IgM (or possibly IgD) isotype, in order to effectuate B cell development and antigen-stimulated maturation. Such expression of an IgM (or IgD) surface-bound immunoglobulin is only required during the antigen-stimulated maturation phase of B cell development, and mature B cells may produce other isotypes, although only a single switched isotype may be produced at a time.

Typically, a cell of the B-cell lineage will produce only a single isotype at a time, although cis or trans alternative RNA splicing, such as occurs naturally with the ps (secreted t) and pM (membrane-bound t) forms, and the Vt and 6 immunoglobulin chains, may lead to the contemporaneous expression of multiple isotypes by a single cell. Therefore, in order to produce heterologous antibodies of multiple isotypes, specifically the therapeutically useful IgG, IgA, and IgE isotypes, it is necessary that isotype switching occur. Such isotype switching may be classical class-switching or may result from one or more non-classical isotype switching mechanisms.

The invention provides heterologous immunoglobulin transgenes and transgenic nonhuman animals harbouring such transgenes, wherein the transgenic animal is capable of producing heterologous antibodies of multiple isotypes by undergoing isotype switching. Classical isotype switching occurs by recombination events Which involve at least one switch sequence region in the transgene. Non- [N:\LIBCJO1115:ais 4 of classical isotype switching may occur by, for example, homologous recombination between human and human 2, sequences (8-associated deletion). Alternative non-classical switching mechanisms, such as intertransgene and/or interchromosomal recombination, among others, may occur and effectuate isotype switching. Such transgenes and transgenic nonhuman animals produce a first immunoglobulin isotype that is necessary for antigen-stimulated B cell maturation and can switch to encode and produce one or more subsequent heterologous isotypes that have therapeutic and/or diagnostic utility. Transgenic nonhuman animals of the invention are thus able to produce, in one embodiment, IgG, IgA, and/or IgE antibodies that are encoded by human immunoglobulin genetic sequences and which also bind specific human antigens with high affinity.

The invention also encompasses B-cells from such transgenic animals that are capable of expressing heterologous antibodies of various isotypes, wherein such B-cells are immortalised to provide a source of a monoclonal antibody specific for a particular antigen. Hybridoma cells that are derived from such B-cells can serve as one source of such heterologous monoclonal antibodies.

The invention provides heterologous unrearranged and rearranged immunoglobulin heavy and light chain transgenes capable of undergoing isotype switching in vivo in the aforementioned non-human transgenic animals or in explanted lymphocytes of the B-cell lineage from such transgenic animals. Such isotype switching may occur spontaneously or be induced by treatment of the transgenic animal or explanted B-lineage lymphocytes with agents that promote isotype switching, such as T-cell-derived lymphokines IL-4 and IFNy).

Still further, the invention includes methods to induce heterologous antibody production in the aforementioned transgenic non-human animal, wherein such antibodies may be of various isotypes. These methods include producing an antigen-stimulated immune response in a transgenic nonhuman animal for the generation of heterologous antibodies, particularly heterologous antibodies of a switched isotype IgG, IgA, and IgE).

This invention provides methods whereby the transgene contains sequences that effectuate isotype switching, so that the heterologous immunoglobulins produced in the transgenic animal and monoclonal antibody clones derived from the B-cells of said animal may be of various isotypes.

This invention further provides methods that facilitate isotype switching of the transgene, so that switching between particular isotypes may occur at much higher or lower frequencies or in different temporal orders than typically occurs in germline immunoglobulin loci. Switch regions may be grafted from various CH genes and ligated to other CH genes in a transgene construct; such grafted switch sequences will typically function independently of the associated CH gene so that switching in the transgene construct will typically be a function of the origin of the associated IN:\LIBCj01115:ais 5 of switch regions. Alternatively, or in combination with switch sequences, deletion sequences may be linked to various CH genes to effect non-classical switching by deletion of sequences between two 6-associated deletion sequences.

Thus, a transgene may be constructed so that a particular CH gene is linked to a different switch sequence and thereby is switched to more frequently than occurs when the naturally associated switch region is used.

This invention also provides methods to determine whether isotype switching of transgene sequences has occurred in a transgenic animal containing an immunoglobulin transgene.

The invention provides immunoglobulin transgene constructs and methods for producing immunoglobulin transgene constructs, some of which contain a subset of germline immunoglobulin loci sequences (which may include deletions). The invention includes a specific method for facilitated cloning and construction of immunoglobulin transgenes, involving a vector that employs unique Xhol and Sail restriction sites flanked by two unique Notl sites. This method exploits the complementary termini of Xhol and Sail restrictions sites and is useful for creating large constructs by ordered concatemerisation of restriction fragments in a vector.

The transgenes of the invention include a heavy chain transgene comprising DNA encoding at least one variable gene segment, one diversity gene segment, one joining gene segment and one constant region gene segment. The immunoglobulin light chain transgene comprises DNA encoding at least one variable gene segment, one joining gene segment and one constant region gene segment. The gene segments encoding the light and heavy chain gene segments are heterologous to the transgenic non-human animal in that they are derived from, or correspond tot DNA encoding immunoglobulin heavy and light chain gene segments from a species not consisting of the transgenic non-human animal. In one aspect of the invention, the transgene is constructed such that the individual gene segments are unrearranged, ie., not rearranged so as to encode a functional immunoglobulin light or heavy chain. Such unrearranged transgenes permit recombination of the gene segments (functional rearrangement) and expression of the resultant rearranged immunoglobulin heavy and/or light chains within the transgenic non-human animal when said animal is exposed to antigen.

In one aspect of the invention, heterologous heavy and light immunoglobulin transgenes comprise relatively large fragments of unrearranged heterologous DNA.

Such fragments typically comprise a substantial portion of the C, J (and in the case of heavy chain, D) segments from a heterologous immunoglobulin locus. In addition, such fragments also comprise a substantial portion of the variable gene segments.

In one embodiment, such transgene constructs comprise regulatory sequences, eg. promoters, enhancers, class switch regions, recombination signals [N:\LIBC]01115:ais 6 of and the like, corresponding to sequences derived from the heterologous DNA.

Alternatively, such regulatory sequences may be incorporated into the transgene from the same or a related species of the non-human animal used in the invention.

For example, human immunoglobulin gene segments may be combined in a transgene with a rodent immunoglobulin enhancer sequence for use in a transgenic mouse.

In a method of the invention, a transgenic non-human animal containing germline unrearranged light and heavy immunoglobulin transgenes that undergo VDJ joining during D-cell differentiation is contacted with an antigen to induce production of a heterologous antibody in a secondary repertoire B-cell.

Also included in the invention are vectors and methods to disrupt the endogenous immunoglobulin loci in the non-human animal to be used in the invention. Such vectors and methods utilise a transgene, preferably positivenegative selection vector, which is constructed such that it targets the functional disruption of a class of gene segments encoding a heavy and/or light immunoglobulin chain endogenous to the non-human animal used in the invention.

.Such endogenous gene segments include diversity, joining and constant region gene segments. In this aspect of the invention, the positive-negative selection.

vector is contacted with at least one embryonic stem cell of a non-human animal after which cells are selected wherein the positive-negative selection vector has integrated into the genome of the non-human animal by way of homologous recombination. After transplantation, the resultant transgenic non-human animal is substantially incapable of mounting an immunoglobulin-mediated immune response as a result of homologous integration of the vector into chromosomal DNA. Such immune deficient non-human animals may thereafter be used for study of immune deficiencies or used as the recipient of heterologous immunoglobulin heavy and light chain transgenes.

The invention also provides vectors, methods, and compositions useful for suppressing the expression of one or more species of immunoglobulin chain(s), without disrupting an endogenous immunoglobulin locus. Such methods are useful for suppressing expression of one or more endogenous immunoglobulin chains while permitting the expression of one or more transgene-encoded immunoglobulin chains. Unlike genetic disruption of an endogenous immunoglobulin chain locus, suppression of immunoglobulin chain expression does not require the timeconsuming breeding that is needed to establish transgenic animals homozygous for a disrupted endogenous Ig locus. An additional advantage of suppression as compared to engognous Ig gene disruption is that, in certain embodiments, chain suppression is reversible within an individual animal. For example, Ig chain suppression may be accomplished with: transgenes encoding and expressing antisense RNA that specifically hybridises to an endogenous Ig chain gene [NALIBCO1115:ais 7 of sequence, antisense oligonucleotides that specifically hybridise to an endogenous Ig chain gene sequence, and immunoglobulins that bind specifically to an endogenous Ig chain polypeptide.

The invention provides transgenic non-human animals comprising: a homozygous pair of functionally disrupted endogenous heavy chain alleles, a homozygous pair of functionally disrupted endogenous light chain alleles, at least one copy of a heterologous immunoglobulin heavy chain transgene, and at least one copy of a heterologous immunoglobulin heavy chain transgene, wherein said animal makes an antibody response following immunisation with an antigen, such as a human antigen CD4). The invention also provides such a transgenic nonhuman animal wherein said functionally disrupted endogenous heavy chain allele is a JH region homologous recombination knockout, said functionally disrupted endogenous light chain allele is a J, region homologous recombination knockout, said heterologous immunoglobulin heavy chain transgene is the HC1 or HC2 human minigene transgene, said heterologous light chain transgene is the KC2 or KCle human K transgene, and wherein said antigen is a human antigen.

SThe invention also provides various embodiments for suppressing, ablating, and/or functionally disrupting the endogenous nonhuman immunoglobulin loci.

The invention also provides transgenic mice expressing both human sequence heavy chains and chimeric heavy chains comprising a human sequence heavy chain variable region and a murine sequence heavy chain constant region.

Such chimeric heavy chains are generally produced by trans-switching between a functionally rearranged human transgene and an endogenous murine heavy chain constant region yl, y2a, y2b, y 3 Antibodies comprising such chimeric heavy chains, typically in combination with a transgene-encoded human sequence light chain or endogenous murine light chain, are formed in response to immunisation :with a predetermined antigen. The transgenic mice of these embodiments can comprise B cells which produce (express) a human sequence heavy chain at a first timepoint and trans-switch to produce (express) a chimeric heavy chain composed of a human variable region and a murine constant region yl, y2a, y2b, y3) at a second (subsequent) timepoint; such human sequence and chimeric heavy chains are incorporated into functional antibodies with light chains; such antibodies are present in the serum of such transgenic mice. Thus, to restate: the transgenic mice of these embodiments can comprise B cells which express a human sequence heavy chain and subsequently switch (via trans-switching or cis-switching) to express a chimeric or isotype-switched heavy chain composed of a human variable region and a alternative constant region murine yl, y2a, y2b, y3; human y, a, such human sequence and chimeric or isotype-switched heavy chains are incorporated into functional antibodies With light chains (human or mouse); such antibodies are present in the serum of such transgenic mice.

[N:\LIBC]01115:ais 8 of The references discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention.

Brief Description of the Figures Reference is made to Figs. 1 to 45 of application 33284/93 which are incorporated herein by reference.

Fig. 46 shows ELISA results for monoclonal antibodies reactive with CEA and non-CEA antigens showing the specificity of antigen binding.

Fig. 47 shows the DNA sequences of 10 cDNAs amplified by PCR to amplify transcripts having a human VDJ and a murine constant region sequence.

Fig. 48 shows ELISA results for various dilutions of serum obtained from mice bearing both a human heavy chain minilocus transgene and a human K minilocus transgene; the mouse was immunised with human CD4 and the data shown 15 represents antibodies reactive with human CD4 and possessing human K, human jI or human y epitopes, respectively.

Fig. 49 shows relative distribution of lymphocytes staining for human pt or mouse pt as determined by FACS for three mouse genotypes.

Fig. 50 shows relative distribution of lymphocytes staining for human K or mouse K as determined by FACS for three mouse genotypes.

J* Fig. 51 shows relative distribution of lymphocytes staining for mouse X as determined by FACS for three mouse genotypes.

Fig. 52 shows relative distribution of lymphocytes staining for mouse or human K as determined by FACS for four mouse genotypes.

Fig. 53 shows the amounts of human human y, human K, mouse t, mouse mouse K, and mouse X chains in the serum of unimmunised 0011 mice.

Fig. 54 shows a scatter plot showing the amounts of human t, human y, human K, mouse t, mousey, mouse K, and mouse chains in the serum of unimmunised 0011 mice of various genotypes.

Fig. 55 shows the titres of antibodies comprising human ti, human y or human K chains in anti-CD4 antibodies in the serum taken at three weeks or seven weeks post-immunisation following immunisation of a 0011 mouse with human CD4.

Fig. 56 shows a schematic representation of the human heavy chain minilocus transgenes pHC1 and pHC2, and the light chain minilocus transgenes pKC1, pKCle, and the light chain minilocus transgene created by homologous recombination between pKC2 and Co4 at the site indicated.

Fig. 57 shows a linkage map of the murine X light chain locus as taken from Storb et al. (1989) op.cit.; the stippled boxes represent a pseudogene.

[N:\LIBCl01115:ais 9 of Fig. 58 shows a schematic representation of inactivation of the murine locus by homologous gene targeting.

Fig. 59 schematically shows the structure of a homologous recombination targeting transgene for deleting genes, such as heavy chain constant region genes.

Fig. 60 shows a map of the BALB/c murine heavy chain locus as taken from Immunoglobulin Genes, Honjo, T, Alt, FW, and Rabbits TH (eds.) Academic Press, NY (1989) p. 129. Structural genes are shown by closed boxes in the top line; second and third lines show restriction sites with symbols indicated.

Fig. 61 shows a nucleotide sequence of mouse heavy chain locus a constant region gene.

Fig. 62 shows the construction of a frameshift vector (plasmid B) for introducing a two bp frameshift into the murine heavy chain locus J 4 gene.

Fig. 63 shows isotype specific response of transgenic animals during hyperimmunisation. The relative levels of reactive human t and yl are indicated by a colorimetric ELISA assay (y-axis). We immunised three 7-10 week old male HC1 line 57 transgenic animals (#1991, #2356, #2357), in a homozygous JHD background, by intraperitoneal injections of CEA in Freund's adjuvant. The figure depicts binding of 250 fold dilutions of pooled serum (collected prior to each injection) to CEA coated microtitre wells.

Fig. 64A and 64B show expression of transgene encoded yl isotype mediated .by class switch recombination. The genomic structure of integrated transgenes in two different human yl expressing hybridomas is consistent with recombination between the jt and yl switch regions. Fig. 64A shows a Southern blot of Pacl/Sfil *digested DNA isolated from three transgene expressing hybridomas. From left to right: clone 92-09A-5H1-5, human yl/VL; clone 92-90A-4G2-2, human clone 92-09A-4F7-A5-2, human yl7f/. All three hybridomas are derived from a 7 month old male mouse hemizygous for the HC1-57 integration, and homozygous for the JHD disruption (mouse #1991). The blot is hybridised with a probe derived from a 2.3kb Bglll/Sfil DNA fragment spanning the 3 half of the human yl switch region.

No switch product is found in the t expressing hybridoma, while the two yl expressing hybridomas, 92-09A-5H1-5 and 92-09A-4G2-2, contain switch products resulting in Pacl/Sfil fragments of 5.1 and 5.3kb respectively, Fig. 64B is a diagram of two possible deletional mechanisms by which a class switch from p to yl can occur. The human j. gene is flanked by 400bp direct repeats (a t and .Ep) which can recombine to delete p. Class switching by this mechanism will always generate a 6.4kb Pacl/Sfil fragment, while class switching by recombination between the Ip and the yl switch regions will generate a Pacl/Sfil fragment between 4 and 7kb, with size variation between individual switch events. The two yl expressing hybridomas examined in Fig. 64A appear to have undergone recombination between the and y1 switch regions.

IN:\LIBC101115:ais 10 of Fig. 65 shows chimeric human/mouse immunoglobulin heavy chains generated by trans-switching. cDNA clones of trans-switch products were generated by reverse transcription and PCR amplification of a mixture of spleen and lymph node RNA isolated from a hyperimmunised HC1 transgenic-JHD mouse (#2357; see legend to Fig. 63 for description of animal and immunisation schedule). The partial nucleotide sequence of 10 randomly picked clones is shown.

Lower case letters indicate germline encoded, capital letters indicate nucleotides that cannot be assigned to known germline sequences; these may be somatic mutations, N nucleotides, or truncated D segments. Both face type indicates mouse y sequences.

Figs. 66A and 66B show that the rearranged VH251 transgene undergoes somatic mutation in a hyperimmunised. The partial nucleotide sequence of IgG heavy chain variable region cDNA clones from CH1 line 26 mice exhibiting Fig. 66A primary and Fig. 66B secondary responses to antigen. Germline sequence is shown at the top; nucleotide changes from germline are given for each clone. A period indicates identity with germline sequence, capital letters indicate no identified germline origin. The sequences are grouped according to J segment usage. The germline sequence of each of the J segments if shown. Lower case letters within CDR3 sequences indicate identity to known D segment included in the HC1 transgene. The assigned D segments are indicated at the end of each sequence. Unassigned sequences could be derived from N region addition or somatic mutation; or in some cases they are simply too short to distinguish random N nucleotides from known D segments. Fig. 66A primary response: 13 randomly picked VH251-yl cDNA clones. A 4 week old female HC1 line 26-JHD mouse (#2599) was given a single injection of KLH and complete Freund's adjuvant; S.spleen cell RNA was isolated 5 days later. The overall frequency of-somatic ;mutations within the V segment is 0.06% (2/3,198bp). Fig. 66B secondary response: 13 randomly picked VH251-yl cDNA clones. A 2 month old female HC1 line 26-JHD mouse (#3204) was given 3 injections of HEL and Freund's adjuvant over one month (a primary injection with complete adjuvant and boosts with incomplete at one week and 3 weeks); spleen and lymph node RNA was isolated 4 months later. The overall frequency of somatic mutations within the V segment is 1.6% (52/3,198 bp).

Figs. 67A and 67B show that extensive somatic mutation is confined to yl sequences: somatic mutation and class switching occur within the same population of B cells. Partial nucleotide sequence of VH251 cDNA clones isolated from spleen and lymph node cells of HC1 line 57 transgenic-JHD mouse (#2357) hyperimmunised against CEA (see Fig. 63 for immunisation schedule). Fig. 67A: IgM: 23 randomly picked VH251- cDNA clones. Nucleotide sequence of 156 bp segment including CDRs 1 and 2 surrounding residues. The overall level of somatic [NALIBC]O111:ais 11 of mutation is 0.1% (5/3,744 bp). Fig 67B: IgG: 23 randomly picked VH251-yl cDNA clones. Nucleotide sequence of segment including CDRs 1 through 3 and surrounding residues. The overall frequency of somatic mutation within the V segment is 1.1% (65/5,658 bp). For comparison with the p sequences in Fig. 67A: the mutation frequency for first 156 nucleotides is 1.1% (41/3,588 bp). See legend to Figs. 66A and 66B for explanation of symbols.

Fig. 68 indicates that VH51P1 and VH56P1 show extensive somatic mutation of in an unimmunised mouse. The partial nucleotide sequence of IgG heavy chain variable region cDNA clones from a 9 week old, unimmunised female HC2 line 2550 transgenic-JHD mouse (#5250). The overall frequency of somatic mutation with the 19 VH56pl segments is 2.2% (101/4, 674 bp). The overall frequency of somatic mutation within the single VH51pl segment is 2. 0% (5/246 bp). See legend to Figs. 66A and 66B for explanation of symbols.

Fig. 69. Double transgenic mice with disrupted endogenous Ig loci contain human IgMK positive B cells. FACS of cells isolated from spleens of 4 mice with different genotypes. Left column: control mouse (#9944, 6 wk old female o. heterozygous wild-type mouse heavy and z-light chain loci, nontransgenic). Second column: human heavy chain transgenic (#9877, 6 wk old female HC2 line 2550 homozygous for disrupted mouse heavy and K- light chain loci, hemizygous for HC2 transgene). Third column: human K-light chain transgenic (#9878, 6 wk old female KCo4 line 4437 homozygous for disrupted mouse heavy and K-light chain loci, hemizygous for KCo4 transgene). Right column: double transgenic (#9879, 6 wk old female JH-/-m HC2 line 2550 KCo4 line 4437 homozygous for disrupted mouse heavy and Kk-light chain loci, hemizygous for HC2 and KCo4 transgenes). Top row: spleen cells stained for expression of mouse X light chain axis) and human K light chain (y-axis). Second row: spleen cells stained for expression of human I heavy chain (x-axis) and human K light chain (y-axis). Third row: spleen cells stained for expression of mouse jt heavy chain (x-axis) and mouse K light chain (yaxis). Bottom row: histogram of spleen cells stained for expression of mouse B220 antigen (log fluorescence: x-axis; cell number: y-axis). For each of the two colour panels, the relative number of cells in each of the displayed quadrants is given as percent of a e-parameter gate based on propidium iodide staining and light scatter.

The fraction of B220+ cells in each of the samples displayed in the bottom row is given as a percent of the lymphocyte light scatter gate.

Fig. 70. Secreted immunoglobulin levels in the serum of double transgenic mice. Human y, and K, and mouse y and 6 from 18 individual HC2/KCo4 double transgenic mice homozygous for endogenous heavy and K-light chain locus disruption. Mice: HC2 line 2550 copies of HC2 per integration), KCo4 line 4436 (1-2 copies of KCo4 per integration); HC2 line 2550, KCo4 line 4437 [N:\LIBC]01115:ais 12 of copies of KCo4 per integration); HC2 line 2550, KCo4 line 4583 copies of KCo4 per integration); HC2 line 2572 (30-50 copies of HC2 per integration, KCo4 line 4437; HC2 line 5467 (20-30 copies of HC2 per integration, KCo4 line 4437.

Figs. 71A and 71B show human antibody responses to human antigens. Fig.

71A: Primary response to recombinant human soluble CD4. Levels of human IgM and human K light chain are reported for prebleed and post-immunisation serum from four double transgenic mice. Fig. 71B: Switching to human IgG occurs in vivo. Human IgG (circles) was detected with peroxidase conjugated polyclonal anti-human IgG used in the presence of 1.5 p/mL excess IgE, K and 1% normal mouse serum to inhibit non-specific cross-reactivity. Human K light chain (squares) was detected using a peroxidase conjugated polyclonal anti-human K reagent in the presence of 1% normal mouse serum. A representative result from one mouse (#9344; HC2 line 2550, KCo4 line 4436) is shown. Each point represents an 15 average of duplicate wells minus background absorbance.

Fig. 72 shows FACS analysis of human PBL with a hybridoma supernatant that discriminates human CD4+ lymphocytes from human CD8+ lymphocytes.

Fig. 73 shows human a-CD4 IgM anti IgG in transgenic mouse serum.

Fig. 74 shows competition binding experiments comparing a transgenic mouse a-human CD4 hybridoma monoclonal, 2C11-8, to the RPA-TA and Leu-3A monoclonals.

Fig. 75 shows production data for Ig expression of cultured 2C11-8 hybridoma.

Reference is made to Tables. 1 to 9 of application 33284/93 which are incorporated herein by reference.

Table 10 shows the genotypes of several 0011 mice.

Table 11 shows transgene V and J segment usage.

Table 12 shows the occurrence of somatic mutation in the HC2 heavy chain transgene in transgenic mice.

Detailed Description As has been discussed supra, it is desirable to produce human immunoglobulins that are reactive With specific human antigens that are promising therapeutic and/or diagnostic targets. However, producing human immunoglobulins that bind specifically With human antigens is problematic.

First, the immunised animal that serves as the source of B cells must make an immune response against the presented antigen. In order for an animal to make an immune response, the antigen presented must be foreign and the animal must not be tolerant to the antigen. Thus, for example, if it is desired to produce a human monoclonal antibody with an idiotype that binds to a human protein, self-tolerance will prevent an immunised human from making a substantial immune response to [N:\LIBC]01115:ais 13 of the human protein, since the only epitopes of the antigen that may be immunogenic will be those that result from polymorphism of the protein within the human population (allogeneic epitopes).

Second, if the animal that serves as the source of B-cells for forming a hybridoma (a human in the illustrative given example) does make an immune response against an authentic self antigen, a severe autoimmune disease may result in the animal. Where humans would be used as a source of B-cells for a hybridoma, such autoimmunisation would be considered unethical by contemporary standards. Thus, developing hybridomas secreting human immunoglobulin chains specifically reactive with predetermined human antigens is problematic, since a reliable source of human antibody-secreting B cells that can evoke an antibody response against predetermined human antigens is needed.

One methodology that can be used to obtain human antibodies that are specifically reactive with human antigens is the production of a transgenic mouse harbouring the human immunoglobulin transgene constructs of this invention.

Briefly, transgenes containing all or portions of the human immunoglobulin heavy and light chain loci, or transgenes containing synthetic "miniloci" (described infra, and in copending applications USSN. 07/990,860, filed 16 December 1992, USSN.

07/810,279 filed 17 December 1991, USSN 07/904,068 filed 23 June 1992; USSN 20 07/853,408, filed 18 March 1992, USSN 07/574,748 filed August 29, 1990, USSN 07/575,962 filed August 31, 1990, and PCT/US91/06185 filed August 28, 1991, Seach incorporated herein by reference) which comprise essential functional elements of the human heavy and light chain loci, are employed to produce a transgenic nonhuman animal. Such a transgenic nonhuman animal will have the capacity to produce immunoglobulin chains that are encoded by human immunoglobulin genes, and additionally will be capable of making an immune response against human antigens. Thus, such transgenic animals can serve as a source of immune sera reactive with specified human antigens, and B-cells from such transgenic animals can be fused with myeloma cells to produce hybridomas that secrete monoclonal antibodies that are encoded by human immunoglobulin genes and which are specifically reactive with human antigens.

The production of transgenic mice containing various forms of immunoglobulin genes has been reported previously. Rearranged mouse immunoglobulin heavy or light chain genes have been used to produce transgenic mice. In addition, functionally rearranged human Ig genes including the [I or yl constant region have been expressed in transgenic mice. However, experiments in which the transgene comprises unrearranged (V-D-J or V-J not rearranged) immunoglobulin genes have been variable, in some cases, producing incomplete or minimal rearrangement of the transgene. However, there are no published N:\LIBCj01115:ais 14 of examples of either rearranged or unrearranged immunoglobulin transgenes which undergo successful isotype switching between CH genes within a transgene.

The invention also provides a method for identifying candidate hybridomas which secrete a monoclonal antibody comprising a human immunoglobulin chain consisting essentially of a human VDJ sequence in polypeptide linkage to a human constant region sequence. Such candidate hybridomas are identified from a pool of hybridoma clones comprising: hybridoma clones that express immunoglobulin chains consisting essentially of a human VDJ region and a human constant region, and trans-switched hybridomas that express heterohybrid immunoglobulin chains consisting essentially of a human VDJ region and a murine constant region.

The supernatant(s) of individual or pooled hybridoma clones is contacted with a predetermined antigen, typically an antigen which is immobilised by adsorption onto a solid substrate a microtitre well), under binding conditions to select antibodies having the predetermined antigen binding specificity. An antibody that specifically binds to human constant regions is also contacted with the hybridoma supernatant and predetermined antigen under binding conditions so that the antibody selectively binds to at least one human constant region epitope but substantially does not bind to murine constant region epitopes; thus forming complexes consisting essentially of hybridoma supernatant (transgenic monoclonal 20 antibody) bound to a predetermined antigen and to an antibody that specifically binds human constant regions (and which may be labelled with a detectable label Sor reporter). Detection of the formation of such complexes indicates hybridoma clones or pools which express a human immunoglobulin chain.

25 Definitions As used herein, the term "antibody" refers to a glycoprotein comprising at least two light polypeptide chains and two heavy polypeptide chains. Each of the heavy and light polypeptide chains contains a variable region (generally the amino terminal portion of the polypeptide chain) which contains a binding domain which interacts with antigen. Each of the heavy and light polypeptide chains also comprises a constant region of the polypeptide chains (generally the carboxyl terminal portion) which may mediate the binding of the immunoglobulin to host tissues or factors including various cells of the immune system, some phagocytic cells and the first component (Clq) of the classical complement system.

As used herein, a "heterologous antibody" is defined in relation to the transgenic non-human organism producing such an antibody. It is defined as an antibody having an amino acid sequence or an encoding DNA sequence corresponding to that found in an organism not consisting of the transgenic nonhuman animal, and generally from a species other than that of the transgenic nonhuman animal.

[N:\LIBC]01115:ais 15 of As used herein, a "heterohybrid antibody" refers to an antibody having a light and heavy chains of different organismal origins. For example, an antibody having a human heavy chain associated with a murine light chain is a heterohybrid antibody.

As used herein, "isotype" refers to the antibody class IgM or IgG 1 that is encoded by heavy chain constant region genes.

As used herein, "isotype switching" refers to the phenomenon by which the class, or isotype, of an antibody changes from one Ig class to one of the other Ig classes.

As used herein, "nonswitched isotype" refers to the isotypic class of heavy chain that is produced when no isotype switching has taken place; the CH gene encoding the nonswitched isotype is typically the first CH gene immediately downstream from the functionally rearranged VDJ gene.

As used herein, the term "switch sequence" refers to those DNA sequences responsible for switch recombination. A "switch donor" sequence, typically a Ip switch region, will be 5' upstream) of the construct region to be deleted during the switch recombination. The "switch acceptor" region will be between the construct region to be deleted and the replacement constant region y, e etc.).

As there is no specific site where recombination always occurs, the final gene sequence will typically not be predictable from the construct.

As used herein, "glycosylation pattern" is defined as the pattern of Scarbohydrate units that are covalently attached to a protein, more specifically to an immunoglobulin protein. A glycosylation pattern of a heterologous antibody can be characterised as being substantially similar to glycosylation patterns which occur naturally on antibodies produced by the species of the nonhuman transgenic animal, when one of ordinary skill in the art would recognise the glycosylation pattern of the heterologous antibody as being more similar to said pattern of glycosylation in the species of the nonhuman transgenic animal than to the species from which the CH genes of the transgene were derived.

As used herein, "specific binding" refers to the property of the antibody: to bind to a predetermined antigen with an affinity of at least 1 x 10 7

M

1 and to preferentially bind to the predetermined antigen with an affinity that is at least twofold greater than its affinity for binding to a non-specific antigen BSA, casein) other than the predetermined antigen or a closely-related antigen.

The term "naturally-occurring" as used herein as applied to an object refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally-occurring.

[N:\LIBC]01115:ais 16 of The term "rearranged" as used herein refers to a configuration of a heavy chain or light chain immunoglobulin locus wherein a V segment is positioned immediately adjacent to a D-J or J segment in a conformation encoding essentially a complete VH or VL domain, respectively. A rearranged immunoglobulin gene locus can be identified by comparison to germline DNA; a rearranged locus will have at least one recombined heptamer/nonamer homology element.

The term "unrearranged" or "germline configuration" as used herein in reference to a V segment refers to the configuration wherein the V segment is not recombined so as to be immediately adjacent to a D or J segment.

For nucleic acids, the term "substantial homology" indicates that two nucleic acids, or designated sequences thereof, when optimally aligned and compared, are identical, with appropriate nucleotide insertions or deletions, in at least about of the nucleotides, usually at least about 90% to 95t, and more preferably at least about 98 to 99.5% of the nucleotides. Alternatively, substantial homology exists when the segments will hybridise under selective hybridisation conditions, to the complement of the strand. The nucleic acids may be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form. A nucleic acid is "isolated" e° or "rendered substantially pure" when purified away from other cellular components or other contaminants, eg., other cellular nucleic acids or proteins, by standard 20 techniques, including alkaline/SDS treatment, CsCI banding, column chromatography, agarose gel electrophoresis and others well known in the art.

See, F. Ausubel, et al., ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley-lnterscience, New.York 1987 The nucleic acid compositions of the present invention, while often in a native sequence (except for modified restriction sites and the like), from either cDNA, genomic or mixtures may be mutated, thereof in accordance with standard techniques to provide gene sequences. For coding sequences, these mutations, may affect amino acid sequence as desired. In particular, DNA sequences substantially homologous to or derived from native V, D, J, constant, switches and other such sequences described herein are contemplated (where "derived" indicates that a sequence is identical or modified from another sequence).

A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence. With respect to transcription regulatory sequences, operably linked means that the DNA sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. For switch sequences, operably linked indicates that the sequences are capable of effecting switch recombination.

IN\LIBC]O1115:ais 17 of Transgenic Nonhuman Animals Capable of Producing Heterologous Antibodies The design of a transgenic non-human animal that responds to foreign antigen stimulation with a heterologous antibody repertoire, requires that the heterologous immunoglobulin transgenes contained within the transgenic animal function correctly throughout the pathway of B-cell development. In a preferred embodiment, correct function of a heterologous heavy chain transgene includes isotype switching. Accordingly, the transgenes of the invention are constructed so as to produce isotype switching and one or more of the following: high level and cell-type specific expression, functional gene rearrangement, activation of and response to allelic exclusion, expression of a sufficient primary repertoire, signal transduction, somatic hypermutation, and domination of the transgene antibody locus during the immune response.

As will be apparent from the following disclosure, not all of the foregoing criteria need be met. For example, in those embodiments wherein the endogenous immunoglobulin loci of the transgenic animal are functionally disrupted, the transgene need not activate allelic exclusion. Further, in those embodiments wherein the transgene comprises a functionally rearranged heavy and/or light chain Simmunoglobulin gene, the second criteria of functional gene rearrangement is unnecessary, at least for that transgene which is already rearranged. For background on molecular immunology, see, Fundamental Immunology, 2nd edition (1989), Paul William ed. Raven Press, NY, which is incorporated herein by reference.

In one aspect of the invention, transgenic non-human animals are provided that contain rearranged, unrearranged or a combination of rearranged and 25 unrearranged heterologous immunoglobulin heavy and light chain transgenes in the germline of the transgenic animal. Each of the heavy chain transgenes *comprises at least one CH gene. In addition, the heavy chain transgene may contain functional isotype switch sequences, which are capable of supporting isotype switching of a heterologous transgene encoding multiple CH genes in Bcells of the transgenic animal. Such switch sequences may be those which occur naturally in the germline immunoglobulin locus from the species that serves as the source of the transgene CH genes, or such switch sequences may be derived from those which occur in the species that is to receive the transgene construct (the transgenic animal). For example, a human transgene construct that is used to produce a transgenic mouse may produce a higher frequency of isotype switching events if it incorporates switch sequences similar to those that occur naturally in the mouse heavy chain locus, as presumably the mouse switch sequences are optimised to function with the mouse switch recombinase enzyme system, whereas the human switch sequences are not. Switch sequences made be isolated and cloned by conventional cloning methods, or may be synthesised de novo from [N:\LIBCI01115:ais 18 of overlapping synthetic oligonucleotides designed on the basis of published sequence information relating to immunoglobulin switch region sequences (Mills et al., Nucl. Acids Res. 18: 7305-7316 (1991); Sideras et al., Intl. Immunol.

1:631_642 (1989), which are incorporated herein by reference).

For each of the foregoing transgenic animals, functionally rearranged heterologous heavy and light chain immunoglobulin transgenes are found in a significant fraction of the B-cells of the transgenic animal (at least 10 percent).

The transgenes of the invention include a heavy chain transgene comprising DNA encoding at least one variable gene segment, one diversity gene segment, one joining gene segment and at least one constant region gene segment. The immunoglobulin light chain transgene comprises DNA encoding at least one variable gene segment, one joining gene segment and at least one constant region gene segment. The gene segments encoding the light and heavy chain gene segments are heterologous to the transgenic non-human animal in that they are derived from, or correspond to, DNA encoding immunoglobulin heavy and light chain gene segments from a species not consisting of the transgenic non-human animal. In one aspect of the invention, the transgene is constructed such that the individual gene segments are unrearranged, ie., not rearranged so as to encode a functional immunoglobulin light or heavy chain. Such unrearranged transgenes support recombination of the V, D, and J gene segments (functional rearrangement) and preferably support incorporation of all or a portion of a D region gene segment in the resultant rearranged immunoglobulin heavy chain within the transgenic non-human animal when exposed to antigen.

In an alternate embodiment, the transgenes comprise an unrearranged "mini- 25 locus". Such transgenes typically comprise a substantial portion of the C, D, and J segments as well as a subset of the V gene segments. In such transgene constructs, the various regulatory sequences, eg. promoters, enhancers, class switch regions, splice-donor and splice-acceptor sequences for RNA processing, recombination signals and the like, comprise corresponding sequences derived from the heterologous DNA. Such regulatory sequences may be incorporated into the transgene from the same or a related species of the non-human animal used in the invention. For example, human immunoglobulin gene segments may be combined in a transgene with a rodent immunoglobulin enhancer sequence for use in a transgenic mouse. Alternatively, synthetic regulatory sequences may be incorporated into the transgene, wherein such synthetic regulatory sequences are not homologous to a functional DNA sequence that is known to occur naturally in the genomes of mammals. Synthetic regulatory sequences are designed according to consensus rules, such as, for example, those specifying the permissible sequences of a splice-acceptor site or a promoter/enhancer motif. For example, a minilocus comprises a portion of the genomic immunoglobulin locus having at least [N:\LIBC]01115:ais 19 of one internal not at a terminus of the portion) deletion of a non-essential DNA portion intervening sequence; intron or portion thereof) as compared to the naturally-occurring germline Ig locus.

The invention also includes transgenic animals containing germ line cells having a heavy and light transgene wherein one of the said transgenes contains rearranged gene segments with the other containing unrearranged gene segments.

In the preferred embodiments, the rearranged transgene is a light chain immunoglobulin transgene and the unrearranged transgene is a heavy chain immunoglobulin transgene.

The Structure and Generation of Antibodies The basic structure of all immunoglobulins is based upon a unit consisting of two light polypeptide chains and two heavy polypeptide chains. Each light chain comprises two regions known as the variable light chain region and the constant light chain region. Similarly, the immunoglobulin heavy chain comprises two regions designated the variable heavy chain region and the. constant heavy chain region.

r The constant region for the heavy or light chain is encoded by genomic sequences referred to as heavy or light constant region gene (CH) segments. The use of a particular heavy chain gene segment defines the class of immunoglobulin.

S. 20 For example, in humans, the ,u constant region gene segments define the IgM class of antibody whereas the use of a y, y2, y3 or y4 constant region gene segment defines the IgG class of antibodies as well as the IgG subclasses IgG1 through lgG4. Similarly, the use of a al or a2 constant region gene segment defines the IgA class of antibodies as well as the subclasses IgA1 and lgA2. The 8 and E 25 constant region gene segments define the IgD and IgE antibody classes, respectively.

The variable regions of the heavy and light immunoglobulin chains together contain the antigen binding domain of the antibody. Because of the need for diversity in this region of the antibody to permit binding to a wide range of antigens, the DNA encoding the initial or primary repertoire variable region comprises a number of different DNA segments derived from families of specific variable region gene segments. In the case of the light chain variable region, such families comprise variable gene segments and joining gene segments. Thus, the initial variable region of the light chain is encoded by one V gene segment and one J gene segment each selected from the family of V and J gene segments contained in the genomic DNA of the organism. In the case of the heavy chain variable region, the DNA encoding the initial or primary repertoire variable region of the heavy chain comprises one heavy chain V gene segment, one heavy chain diversity gene segment and one J gene segment, each selected from the (N:\LIBCI01115:ais 20 of appropriate V, D and J families of immunoglobulin gene segments in genomic

DNA.

In order to increase the diversity of sequences that contribute to forming antibody binding sites, it is preferable that a heavy chain transgene include cisacting sequences that support functional V-D-J rearrangement that can incorporate all or part of a D region gene sequence in a rearranged V-D-J gene sequence.

Typically, at least about 1 percent of expressed transgene-encoded heavy chains (or mRNAs) include recognisable D region sequences in the V region. Preferably, at least about 10 percent of transgene-encoded V regions include recognisable D region sequences, more preferably at least about 30 percent, and most preferably more than 50 percent include recognisable D region sequences.

A recognisable D region sequence is generally at least about eight consecutive nucleotides corresponding to a sequence present in a D region gene segment of a heavy chain transgene and/or the amino acid sequence encoded by such D region nucleotide sequence. For example, if a transgene includes the D region gene DHQ52, a transgene-encoded mRNA containing the sequence TAACTGGG-3' located in the V region between a V gene segment sequence and a J gene segment sequence is recognisable as containing a D region sequence, specifically a DHQ52 sequence. Similarly, for example, if a transgene includes the D region gene DHQ52, a transgene-encoded heavy chain polypeptide containing the amino acid sequence -DAF- located in the V region between a V gene segment amino acid sequence and a J gene segment amino acid sequence may be recognisable as containing a D region sequence, specifically a DHQ52 sequence.

However, since D region segments may be incorporated in VDJ joining to various 25 extents and in various reading frames, a comparison of the D region area of a heavy chain variable region to the D region segments present in the transgene is necessary to determine the incorporation of particular D segments. Moreover, potential exonuclease digestion during recombination may lead to imprecise V-D and D-J joints during V-D-J recombination.

However, because of somatic mutation and N-region addition, some D region sequences may be recognisable but may not correspond identically to a consecutive D region sequence in the transgene. For example, a nucleotide sequence 5'-CTAAXTGGGG-3', where X is A, T, or G, and which is located in a heavy chain V region and flanked by a V region gene sequence and a J region gene sequence, can be recognised as corresponding to the DHQ52 sequence CTAACTGGG-3'. Similarly, for example, the polypeptide sequences -DAFDI-, DYFDY-, or -GAFDI- located in a V region and flanked on the amino-terminal side by an amino acid sequence encoded by a transgene V gene sequence and flanked on the carboxy terminal side by an amino acid sequence encoded by a transgene J gene sequence is recognisable as a D region sequence.

[N:\LIBC]01115:ais 21 of Therefore, because somatic mutation and N-region addition can produce mutations in sequences derived from a transgene D region, the following definition is provided as a guide for determining the presence of a recognisable D region sequence. An amino acid sequence or nucleotide sequence is recognisable as a D region sequence if: the sequence is located in a V region and is flanked on one side by a V gene sequence (nucleotide sequence or deduced amino acid sequence) and on the other side by a J gene sequence (nucleotide sequence or deduced amino acid sequence) and the sequence is substantially identical or substantially similar to a known D gene sequence (nucleotide sequence or encoded amino acid sequence).

The term "substantial identity" as used herein denotes a characteristic of a polypeptide sequence or nucleic acid sequence, wherein the polypeptide sequence has at least 50 percent sequence identity compared to a reference sequence, and the nucleic acid sequence has at least 70 percent sequence identity compared to a reference sequence. The percentage of sequence identity is calculated excluding small deletions or additions which total less than 35 percent of the reference sequence. The reference sequence may be a subset of a larger sequence, such as an entire D gene; however, the reference sequence is at least 8 nucleotides long in the case of polynucleotides, and at least 3 amino residues long in the case of a polypeptide. Typically, the reference sequence is at least 8 to 12 nucleotides or at S"least 3 to 4 amino acids, and preferably the reference sequence is 12 to nucleotides or more, or at least 5 amino acids.

oo The term "substantial similarity" denotes a characteristic of an polypeptide sequence, wherein the polypeptide sequence has at least 80 percent similarity to a reference sequence. The percentage of sequence similarity is calculated by scoring identical amino acids or positional conservative amino acid substitutions as similar.

A positional conservative amino acid substitution is one that can result from a single nucleotide substitution; a first amino acid is replaced by a second amino acid where a codon for the first amino acid and a codon for the second amino acid can 3o differ by a single nucleotide substitution. Thus, for example, the sequence -Lys-Glu- Arg-Val- is substantially similar to the sequence -Asn-Asp-Ser-Val-, since the codon sequence -AAA-GAA-AGA-GW can be mutated to -AAC-GAC-AGC-GW -by introducing only 3 substitution mutations, single nucleotide substitutions in three of the four original codons. The reference sequence may be a subset of a larger sequence, such as an entire D gene; however, the reference sequence is at least 4 amino residues long. Typically, the reference sequence is at least 5 amino acids, and preferably the reference sequence is 6 amino acids or more.

The Primary Repertoire The process for generating DNA encoding the heavy and light chain immunoglobulin genes occurs primarily in developing B-cells. Prior to the joining of N:\LIBCjO1115:ais 22 of various immunoglobulin gene segments, the V, D, J and constant gene segments are found, for the most part, in clusters of V, D, J and C gene segments in the precursors of primary repertoire B-cells. Generally, all of the gene segments for a heavy or light chain are located in relatively close proximity on a single chromosome. Such genomic DNA prior to recombination of the various immunoglobulin gene segments is referred to herein as "unrearranged" genomic DNA. During B-cell differentiation, one of each of the appropriate family members of the V, D, J (or only V and J in the case of light chain genes) gene segments are recombined to form functionally rearranged heavy and light immunoglobulin genes.

Such functional rearrangement is of the variable region segments to form DNA encoding a functional variable region. This gene segment rearrangement process appears to be sequential. First, heavy chain D-to-J joints are made, followed by heavy chain V-to-DJ joints and light chain V-to-J joints. The DNA encoding this initial form of a functional variable region in a light and/or heavy chain is referred to as "functionally rearranged DNA" or "rearranged DNA". In the case of the heavy chain, such DNA is referred to as "rearranged heavy chain DNA" and in the case of the light chain, such DNA is referred to as "rearranged light chain DNA". Similar language is used to describe the functional rearrangement of the transgenes of the invention.

The recombination of variable region gene segments to form functional heavy and light chain variable regions is mediated by recombination signal sequences (RSS's) that flank recombinationally competent V, D and J segments. RSS's necessary and sufficient to direct recombination, comprise a dyad-symmetric heptamer, an AT-rich nonamer and an intervening spacer region of either 12 or 23 25 base pairs. These signals are conserved among the different loci and species that carry out D-J (or V-J) recombination and are functionally interchangeable. See Oettinger, et al. (1990), Science, 248, 1517-1523 and references cited therein. The heptamer comprises the sequence CACAGTG or its analogue followed by a spacer of unconserved sequence and then a nonamer having the sequence ACAAAAACC or its analogue. These sequences are found on the J, or downstream side, of each V and D gene segment. Immediately preceding the germline D and J segments are again two recombination signal sequences, first the nonamer and then the heptamer again separated by an unconserved sequence. The heptameric and nonameric sequences following a VL, VH or D segment are complementary to those preceding the JL, D or JH segments with which they recombine. The spacers between the heptameric and nonameric sequences are either 12 base pairs long or between 22 and 24 base pairs long.

In addition to the rearrangement of V, D and J segments, further diversity is generated in the primary repertoire of immunoglobulin heavy and light chain by way of variable recombination between the V and J segments in the light chain and [N:\LIBC]01115:ais 23 of between the D and J segments of the heavy chain. Such variable recombination is generated by variation in the exact place at which such segments are joined. Such variation in the light chain typically occurs within the last codon of the V gene segment and the first codon of the J segment. Similar imprecision in joining occurs on the heavy chain chromosome between the D and JH segments and may extend over as many as 10 nucleotides. Furthermore, several nucleotides may be inserted between the D and JH and between the VH and D gene segments which are not encoded by genomic DNA. The addition of these nucleotides is known as N-region diversity.

After VJ and/or VDJ rearrangement, transcription of the rearranged variable region and one or more constant region gene segments located downstream from the rearranged variable region produces a primary RNA transcript which upon appropriate RNA splicing results in an mRNA which encodes a full length heavy or light immunoglobulin chain. Such heavy and light chains include a leader signal sequence to effect secretion through and/or insertion of the immunoglobulin into the transmembrane region of the B-cell. The DNA encoding this signal sequence is contained within the first exon of the V segment used to form the variable region of the heavy or light immunoglobulin chain. Appropriate regulatory sequences are also present in the mRNA to control translation of the mRNA to produce the encoded o 20 heavy and light immunoglobulin polypeptides which upon proper association with each other form an antibody molecule.

The net effect of such rearrangements in the variable region gene segments and the variable recombination which may occur during such joining, is the production of a primary antibody repertoire. Generally, each B-cell which has f* 25 differentiated to this stage, produces a single primary repertoire antibody. During this differentiation process, cellular events occur which suppress the functional rearrangement of gene segments other than those contained within the functionally rearranged Ig gene. The process by which diploid B-cells maintain such monospecificity is termed allelic exclusion.

The Secondary Repertoire B-cell clones expressing immunoglobulins from within the set of sequences comprising the primary repertoire are immediately available to respond to foreign antigens. Because of the limited diversity generated by simple VJ and VDJ joining, the antibodies produced by the so-called primary response are of relatively low affinity. Two different types of B-cells make up this initial response: precursors of primary antibody-forming cells and precursors of secondary repertoire B-cells (Linton et al., Cell 59:1049-1059 (1989)). The first type of B-cell matures into IgMsecreting plasma cells in response to certain antigens. The other B-cells respond to initial exposure to antigen by entering a T-cell dependent maturation pathway.

[N:\LIBC01115:ais 24 of During the T-cell dependent maturation of antigen stimulated B-cell clones, the structure of the antibody molecule on the cell surface changes in two ways: the constant region switches to a non-lgM subtype and the sequence of the variable region can be modified by multiple single amino acid substitutions to produce a higher affinity antibody molecule.

As previously indicated, each variable region of a heavy or light Ig chain contains an antigen binding domain. It has been determined by amino acid and nucleic acid sequencing that somatic mutation during the secondary response occurs throughout the V region including the three complementary determining regions (CDR1, CDR2 and CDR3) also referred to as hypervariable regions 1, 2 and 3 (Kabat et al. Sequences of Proteins of Immunological Interest (1991) US Department of Health and Human services, Washington, DC, incorporated herein by reference. The CDR1 and CDR2 are located within the variable gene segment whereas the CDR3 is largely the result of recombination between V and J gene segments or V, D and J gene segments. Those portions of the variable region which do not consist of CDR1, 2 or 3 are commonly referred to as framework regions designated FR1, FR2, FR3 and FR4. See Fig. 1. During hypermutation, the rearranged DNA is mutated to give rise to new clones with altered Ig molecules.

Those clones with higher affinities for the foreign antigen are selectively expanded by helper T-cells, giving rise to affinity maturation of the expressed antibody. Clonal S"selection typically results in expression of clones containing new mutation within the CDR1, 2 and/or 3 regions. However, mutations outside these regions also occur which influence the specificity and affinity of the antigen binding domain.

Transgenic Non-Human Animals Capable of Producing Heterologous Antibody Transgenic non-human animals in one aspect of the invention are produced by introducing at least one of the immunoglobulin transgenes of the invention (discussed hereinafter) into a zygote or early embryo of a non-human animal. The non-human animals which are used in the invention generally comprise any mammal which is capable of rearranging immunoglobulin gene segments to produce a primary antibody response. Such nonhuman transgenic animals may include, for example, transgenic pigs, transgenic rats, transgenic rabbits, transgenic cattle, and other transgenic animal species, particularly mammalian species, known in the art. A particularly preferred non-human animal is the mouse or other members of the rodent family.

However, the invention is not limited to the use of mice. Rather, any nonhuman mammal which is capable of mounting a primary and secondary antibody response may be used. Such animals include non-human primates, such as chimpanzee, bovine, ovine, and porcine species, other members of the rodent family, eg. rat, as well as rabbit and guinea pig. Particular preferred animals are mouse, rat, rabbit and guinea pig, most preferably mouse.

[N:\LIBCI10115:ais 25 of In one embodiment of the invention, various gene segments from the human genome are used in heavy and light chain transgenes in an unrearranged form. In this embodiment, such transgenes are introduced into mice. The unrearranged gene segments of the light and/or heavy chain transgene have DNA sequences unique to the human species which are distinguishable from the endogenous immunoglobulin gene segments in the mouse genome. They may be readily detected in unrearranged form in the germ line and somatic cells not consisting of B-cells and in rearranged form in B-cells.

In an alternate embodiment of the invention, the transgenes comprise rearranged heavy and/or light immunoglobulin transgenes. Specific segments of such transgenes corresponding to functionally rearranged VDJ or VJ segments, contain immunoglobulin DNA sequences which are also clearly distinguishable from the endogenous immunoglobulin gene segments in the mouse.

Such differences in DNA sequence are also reflected in the amino acid sequence encoded by such human immunoglobulin transgenes as compared to those encoded by mouse B-cells. Thus, human immunoglobulin amino acid sequences may be detected in the transgenic non-human animals of the invention Swith antibodies specific for immunoglobulin epitopes encoded by human immunoglobulin gene segments.

Transgenic B-cells containing unrearranged transgenes from human or other species functionally recombine the appropriate gene segments to form functionally rearranged light and heavy chain variable regions. It will be readily apparent that the antibody encoded by such rearranged transgenes has a DNA and/or amino acid sequence which is heterologous to that normally encountered in the 25 nonhuman animal used to practice the invention.

Unrearranged Transgenes As used herein, an "unrearranged immunoglobulin heavy chain transgene" comprises DNA encoding at least one variable gene segment, one diversity gene segment, one joining gene segment and one constant region gene segment. Each of the gene segments of said heavy chain transgene are derived from, or has a sequence corresponding to, DNA encoding immunoglobulin heavy chain gene segments from a species not consisting of the non-human animal into which said transgene is introduced. Similarly, as used herein, an "unrearranged immunoglobulin light chain transgene" comprises DNA encoding at least one variable gene segment, one joining gene segment and at least one constant region gene segment wherein each gene segment of said light chain transgene is derived from, or has a sequence corresponding to, DNA encoding immunoglobulin light chain gene segments from a species not consisting of the non-human animal into which said light chain transgene is introduced.

[N:\LIBC]01115:ais 26 of Such heavy and light chain transgenes in this aspect of the invention contain the above-identified gene segments in an unrearranged form. Thus, interposed between the V, D and J segments in the heavy chain transgene and between the V and J segments on the light chain transgene are appropriate recombination signal sequences (RSS's). In addition, such transgenes also include appropriate RNA splicing signals to join a constant region gene segment with the VJ or VDJ rearranged variable region.

In order to facilitate isotype switching within a heavy chain transgene containing more than one C region gene segment, eg. Cp and Cyl from the human genome, as explained below "switch regions" are incorporated upstream from each of the constant region gene segments and downstream from the variable region gene segments to permit recombination between such constant regions to allow for immunoglobulin class switching, eg. from IgM to IgG. Such heavy and light immunoglobulin transgenes also contain transcription control sequences including promoter regions situated upstream from the variable region gene segments which typically contain TATA motifs. A promoter region can be defined approximately as a DNA sequence that, when operably linked to a downstream sequence, can produce transcription of the downstream sequence. Promoters may require the presence of additional linked cis-acting sequences in order to produce efficient 20 transcription. In addition, other sequences that participate in the transcription of sterile transcripts are preferably included. Examples of sequences that participate S. in expression of sterile transcripts can be found in the published literature, including Rothman et al., Intl. Immunol. 2:621-627 (1990); Reid et al., Proc. Natl. Acad.

Sci. USA 86:840-844 (1989); Stavnezer et al., Proc. Natl. Acad. Sci. USA 25 85:7704-7708 (1988); and Mills et al., Nucl. Acids Res. 18:7305-7316 (1991), each of which is incorporated herein by reference. These sequences typically include about at least 50 bp immediately upstream of a switch region, preferably about at least 200 bp upstream of a switch region; and more preferably about at least 200-1000 bp or more upstream of a switch region. Suitable sequences occur immediately upstream of the human Sy 1

S

72 Sy3, Sy4, Soa, SC2 and SE switch regions; the sequences immediately upstream of the human Syl, and Sy 3 switch regions can be used to advantage, with Syi generally preferred. Alternatively, or in combination, murine Ig switch sequences may be used; it may frequently be advantageous to employ Ig switch sequences of the same species as the transgenic non-human animal. Furthermore, interferon (IFN) inducible transcriptional regulatory elements, such as IFN-inducible enhancers, are preferably included immediately upstream of transgene switch sequences.

In addition to promoters, other regulatory sequences which function primarily in B-lineage cells are used. Thus, for example, a light chain enhancer sequence situated preferably between the J and constant region gene segments on the light [N:LIBC011115:ais 27 of chain transgene is used to enhance transgene expression, thereby facilitating allelic exclusion. In the case of the heavy chain transgene, regulatory enhancers and also employed. Such regulatory sequences are used to maximise the transcription and translation of the transgene so as to induce allelic exclusion and to provide relatively high levels of transgene expression.

Although the foregoing promoter and enhancer regulatory control sequences have been generically described, such regulatory sequences may be heterologous to the nonhuman animal being derived from the genomic DNA from which the heterologous transgene immunoglobulin gene segments are obtained. Alternately, such regulatory gene segments are derived from the corresponding regulatory sequences in the genome of the non-human animal, or closely related species, which contains the heavy and light transgene.

In the preferred embodiments, gene segments are derived from human beings. The transgenic non-human animals harbouring such heavy and light transgenes are capable of mounting an Ig-mediated immune response to a specific antigen administered to such an animal. B-cells are produced within such an animal which are capable of producing heterologous human antibody. After S: immortalisation, and the selection for an appropriate monoclonal antibody (Mab), eg. a hybridoma, a source of therapeutic human monoclonal antibody is provided.

Such human Mabs have significantly reduced immunogenicity when therapeutically administered to humans.

Although the preferred embodiments disclose the construction of heavy and light transgenes containing human gene segments, the invention is not so limited.

In this regard, it is to be understood that the teachings described herein may be 25 readily adapted to utilise immunoglobulin gene segments from a species other than human beings. For example, in addition to the therapeutic treatment of humans with the antibodies of the invention, therapeutic antibodies encoded by appropriate gene segments may be utilised to generate monoclonal antibodies for use in the veterinary sciences.

Rearranged Transgenes In an alternative embodiment, transgenic nonhuman animals contain functionally at least one rearranged heterologous heavy chain immunoglobulin transgene in the germline of the transgenic animal. Such animals contain primary repertoire B-cells that express such rearranged heavy transgenes. Such B-cells preferably are capable of undergoing somatic mutation when contacted with an antigen to form a heterologous antibody having high affinity and specificity for the antigen. Said rearranged transgenes will contain at least two CH genes and the associated sequences required for isotype switching.

The invention also includes transgenic animals containing germ line cells having heavy and light transgenes wherein one of the said transgenes contains [N:\LIBC]01115:ais 28 rearranged gene segments with the other containing unrearranged gene segments.

In such animals, the heavy chain transgenes shall have at least two CH genes and the associated sequences required for isotype switching.

The invention further includes methods for generating a synthetic variable region gene segment repertoire to be used in the transgenes of the invention. The method comprises generating a population of immunoglobulin V segment DNAs wherein each of the V segment DNAs encodes an immunoglobulin V segment and contains at each end a cleavage recognition site of a restriction endonuclease. The population of immunoglobulin V segment DNAs is thereafter concatenated to form the synthetic immunoglobulin V segment repertoire. Such synthetic variable region heavy chain transgenes shall have at least two CH genes and the associated sequences required for isotype switching.

Isotype Switching In the development of a B lymphocyte, the cell initially produces IgM with a binding specificity determined by the productively rearranged VH and VL regions.

Subsequently, each B cell and its progeny cells synthesise antibodies with the same L and H chain V regions, but they may switch the isotype of the H chain.

The use of y or 6 constant regions is largely determined by alternate splicing, permitting IgM and IgD to be coexpressed in a single cell. The other heavy chain isotypes y, a and e) are only expressed natively after a gene rearrangement event deletes the Cpt and C6 exons. This gene rearrangement process, termed isotype switching, typically occurs by recombination between so called switch segments located immediately upstream of each heavy chain gene (except The individual switch segments are between 2 and 10kb in length, and consist primarily of short 25 repeated sequences. The exact point of recombination differs for individual class switching events. Investigations which have used solution hybridisation kinetics or Southern blotting with cDNA-derived CH probes have confirmed that switching can be associated with loss of CH sequences from the cell.

The switch region of the Lt gene, Sl, is located about 1 to 2kb 5' to the coding sequence and is composed of numerous tandem repeats of sequences of the form (GAGCT)n(GGGGT), where n is usually 2 to 5 but can range as high as 17.

(See T. Nikaido et al. Nature 292:845-848 (1981)).

Similar internally repetitive switch sequences spanning several kilobases have been found 5' of the other CH genes. The Sa region has been sequenced and found to consist of tandemly repeated 80-bp homology units, whereas murine Sy2a, Sy2b, and Sy3 all contain repeated 49-bp homology units very similar to each other. (See, P. Szurek et al., J. Immunol 135:620-626 (1985) and T. Nikaido et al., J. Biol. Chem. 257:7322-7329 (1982), which are incorporated herein by reference.) All the sequenced S regions include numerous occurrences of the pentamers GAGCT and GGGGT that are the basic repeated elements of the Spt gene Nikaido [N:\LIBC]01115:ais 29 of et al., J. Biol. Chem. 257:7322-7329 (1982) which is incorporated herein by reference); in the other S regions these pentamers are not precisely tandemly repeated as in St, but instead are embedded in larger repeat units. The Syl region has an additional higher-order structure: two direct repeat sequences flank each of two clusters of 49-bp tandem repeats. (See M. R. Mowatt et al., J. Immunol.

136:2674-2683 (1986), which is incorporated herein by reference).

Switch regions of human H chain genes have been found to be very similar to their mouse homologues. Indeed, similarity between pairs of human and mouse clones 5' to the CH genes has been found to be confined to the S regions, a fact that confirms the biological significance of these regions.

A switch recombination between p. and a genes produces a composite SC-Sx sequence. Typically, there is no specific site, either in St or in any other S region, where the recombination always occurs.

Generally, unlike the enzymatic machinery of V-J recombination, the switch 15 machinery can apparently accommodate different alignments of the repeated homologous regions of germline S precursors and then join the sequences at different positions within the alignment. (See, T. H. Rabbits et al., Nucleic Acids Res. 9:4509-4524 (1981) and J. Ravetch et al., Proc. Natl. Acad. Sci. USA 77:6734-6738 (1980), which are incorporated herein by reference.) The exact details of the mechanism(s) of selective activation of switching to a particular isotype are unknown. Although exogenous influences such as lymphokines and cytokines might upregulate isotype-specific recombinases, it is also possible that the same enzymatic machinery catalyses switches to all isotypes and that specificity lies in targeting this machinery to specific switch regions.

0 25 The T-cell-derived lymphokines IL-4 and IFNy have been shown to specifically "promote the expression of certain isotypes: in the mouse, IL-4 decreases IgM, IgG2a, lgG2b, and lgG3 expression and increases IgE and IgG1 expression; while IFNy selectively stimulates IgG2a expression and antagonises the IL-4-induced increase in IgE and IgG1 expression (Coffman et al., J. Immunol. 136: 949 (1986) and Snapper et al., Science 236: 944 (1987), which are incorporated herein by reference). A combination of IL-4 and IL-5 promotes IgA expression (Coffman et al., J. Immunol. 139: 3685 (1987), which is incorporated herein by reference).

Most of the experiments implicating T-cell effects on switching have not ruled out the possibility that the observed increase in cells with particular switch recombinations might reflect selection of preswitched or precommitted cells; but the most likely explanation is that the lymphokines actually promote switch recombination.

Induction of class switching appears to be associated with sterile transcripts that initiate upstream of the switch segments (Lutzker et al., Mol. Cell. Biol. 8 :1849 (1988); Stavnezer et al., Proc. Natl. Acad. Sci. USA 85:7704 (1988); Esser (NALIBC01115:ais 30 of and Radbruch, EMBO J. 8:483 (1989); Berton et al., Proc. Natl. Acad. Sci. USA 86:2829 (1989); Rothman et al., Int. Immunol. 2:621 (1990), each of which is incorporated by reference). For example, the observed induction of the yl sterile transcript by IL-4 and inhibition by IFN-y correlates with the observation that IL-4 promotes class switching to yl in B-cells in culture, while IFN-y inhibits yl expression. Therefore, the inclusion of regulatory sequences that affect the transcription of sterile transcripts may also affect the rate of isotype switching. For example, increasing the transcription of a particular sterile transcript typically can be expected to enhance the frequency of isotype switch recombination involving adjacent switch sequences.

For these reasons, it is preferable that transgenes incorporate transcriptional regulatory sequences within about 1-2kb upstream of each switch region that is to be utilised for isotype switching. These transcriptional regulatory sequences preferably include a promoter and an enhancer element, and more preferably 15 include the 5' flanking upstream) region that is naturally associated occurs in germline configuration) with a switch region. This 5' flanking region is typically about at least 50 nucleotides in length, preferably about at least 200 nucleotides in length, and more preferably at least 500-1000 nucleotides.

Although a 5' flanking sequence from one switch region can be operably linked to a different switch region for transgene construction a 5' flanking sequence from the human Syl switch can be grafted immediately upstream of the Sal switch; a murine Syl flanking region can be grafted adjacent to a human yl switch sequence; or the murine Syl switch can be grafted onto the human yl coding region), in some embodiments it is preferred that each switch region incorporated in the transgene construct have the 5' flanking region that occurs Simmediately upstream in the naturally occurring germline configuration.

Monoclonal Antibodies Monoclonal antibodies can be obtained by various techniques familiar to those skilled in the art. Briefly, spleen cells from an animal immunised with a desired antigen are immortalised, commonly by fusion with a myeloma cell (see, Kohler and Milstein, Eur. J. Immunol., 6:511-519 (1976)). Alternative methods of immortalisation include transformation with Epstein Barr Virus, oncogenes, or retroviruses, or other methods well known in the art. Colonies arising from single immortalised cells are screened for production of antibodies of the desired specificity and affinity for the antigen, and yield of the monoclonal antibodies produced by such cells may be enhanced by various techniques, including injection into the peritoneal cavity of a vertebrate host. Various techniques useful in these arts are discussed, for example, in Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York (1988) including: immunisation of animals to produce immunoglobulins; production of monoclonal antibodies; labelling [N:\LIBC01115:ais 31 of immunoglobulins for use as probes; immunoaffinity purification; and immunoassays.

The Transgenic Primary Repertoire A. The Human immunoglobulin Loci An important requirement for transgene function is the generation of a primary antibody repertoire that is diverse enough to trigger a secondary immune response for a wide range of antigens. The rearranged heavy chain gene consists of a signal peptide exon, a variable region exon and a tandem array of multi-domain constant region regions, each of which is encoded by several exons. Each of the constant region genes encode the constant portion of a different class of immunoglobulins.

During B-cell development, V region proximal constant regions are deleted leading to the expression of new heavy chain classes. For each heavy chain class, alternative patterns of RNA splicing give rise to both transmembrane and secreted immunoglobulins.

15 The human heavy, chain locus is estimated to consist of approximately 200 V gene segments (current data supports the existence of about 50-100 V gene segments) spanning 2 Mb, approximately 30 D gene segments spanning about 40kb, six J segments clustered within a 3kb span, and nine constant region gene segments spread out over approximately 300kb. The entire locus spans approximately 2.5 Mb of the distal portion of the long arm of chromosome 14.

SB. Gene Fragment Transgenes 1. Heavy Chain Transgene I n a preferred embodiment, immunoglobulin heavy and light chain transgenes comprise unrearranged genomic DNA from humans. In the case of the heavy chain, a preferred transgene comprises a Notl fragment having a length between 670 to 830kb. The length of this fragment is ambiguous because the 3' restriction site has not been accurately mapped. It is known, however, to reside between the al and yac gene segments. This fragment contains members of all six of the known VH families, the D and J gene segments, as well as the p, 8, y3, yl and al constant regions (Berman et al., EMBO J. 7:727-738 (1988), which is incorporated herein by reference). A transgenic mouse line containing this transgene correctly expresses a heavy chain class required for B-cell development (IgM) and at least one switched heavy chain class (IgG1), in conjunction with a sufficiently large repertoire of variable regions to trigger a secondary response for most antigens.

2. Light Chain Transgene A genomic fragment containing all of the necessary gene segments and regulatory sequences from a human light chain locus may be similarly constructed.

Such transgenes are constructed as described in the Examples and in copending application, entitled "Transgenic Non-Human Animals Capable of Producing Heterologous Antibodies," filed August 29, 1990, under USSN 07/574,748.

[N:\LIBC]01115:ais 32 of C. Transgenes Generated Intracellularly by In Vivo Recombination It is not necessary to isolate the all or part of the heavy chain locus on a single DNA fragment. Thus, for example, the 670-830kb Notl fragment from the human immunoglobulin heavy chain locus may be formed in vivo in the non-human animal during transgenesis. Such in vivo transgene construction is produced by introducing two or more overlapping DNA fragments into an embryonic nucleus of the non-human animal. The overlapping portions of the DNA fragments have DNA sequences which are substantially homologous. Upon exposure to the recombinases contained within the embryonic nucleus, the overlapping DNA fragments homologously recombined in proper orientation to form the 670-830kb Notl heavy chain fragment.

In vivo transgene construction can be used to form any number of immunoglobulin transgenes which because of their size are otherwise difficult, or impossible, to make or manipulate by present technology. Thus, in vivo transgene 15 construction is useful to generate immunoglobulin transgenes which are larger than DNA fragments which may be manipulated by YAC vectors (Murray and Szostak, Nature 305 :189-193 (1983)). Such in vivo transgene construction may be used to introduce into a non-human animal substantially the entire immunoglobulin loci from a species not consisting of the transgenic non-human animal.

In addition to forming genomic immunoglobulin transgenes, in vivo homologous recombination may also be utilised to form "mini-locus" transgenes as described in the Examples.

In the preferred embodiments utilising in vivo transgene construction, each overlapping DNA fragment preferably has an overlapping substantially homologous DNA sequence between the end portion of one DNA fragment and the end portion of a second DNA fragment. Such overlapping portions of the DNA fragments preferably comprise about 500 bp to about 2000 bp, most preferably 1.0kb to Homologous recombination of overlapping DNA fragments to form transgenes in vivo is further described in commonly assigned US Patent Application entitled "Intracellular Generation of DNA by Homologous Recombination of DNA Fragments" filed August 29, 1990, under USSN 07/574,747.

D. Minilocus Transgenes As used herein, the term "immunoglobulin minilocus" refers to a DNA sequence (which may be within a longer sequence), usually of less than about 150kb, typically between about 25 and 100kb, containing at least one each of the following: a functional variable gene segment, a functional joining region segment, at least one functional constant region gene segment, and--if it is a heavy chain minilocus--a functional diversity region segment, such that said DNA sequence contains at least one substantial discontinuity a deletion, [N:\LIBC]01115:ais 33 of usually of at least about 2 to 5kb, preferably 10-25kb or more, relative to the homologous genomic DNA sequence). A light chain minilocus transgene will be at least 25kb in length, typically 50 to 60kb. A heavy chain transgene will typically be about 70 to 80kb in length, preferably at least about 60kb with two constant regions operably linked to switch regions. Furthermore, the individual elements of the minilocus are preferably in the germline configuration and capable of undergoing gene rearrangement in the pre-B cell of a transgenic animal so as to express functional antibody molecules with diverse antigen specificities encoded entirely by the elements of the minilocus. Further, a heavy chain minilocus comprising at least two CH genes and the requisite switching sequences is typically capable of undergoing isotype switching, so that functional antibody molecules of different immunoglobulin classes will be generated. Such isotype switching may occur in vivo in B-cells residing within the transgenic nonhuman animal, or may occur in cultured cells of the B-cell lineage which have been explanted from the transgenic 15 nonhuman animal.

In an alternate preferred embodiment, immunoglobulin heavy chain transgenes comprise one or more of each of the VH, D, and JH gene segments and two or more of the CH genes. At least one of each appropriate type gene segment is incorporated into the minilocus transgene. With regard to the CH segments for the heavy chain transgene, it is preferred that the transgene contain at least one P gene segment and at least one other constant region gene segment, more preferably a y gene segment, and most preferably y 3 or yl. This preference is to allow for class switching between IgM and IgG forms of the encoded immunoglobulin and the production of a secretable form of high affinity non-lgM immunoglobulin. Other constant region gene segments may also be used such as those which encode for the production of IgD, IgA and IgE.

Those skilled in the art will also construct transgenes wherein the order of occurrence of heavy chain CH genes will be different from the naturally-occurring spatial order found in the germline of the species serving as the donor of the CH genes.

Additionally, those skilled in the art can select CH genes from more than one individual of a species allogeneic CH genes) and incorporate said genes in the transgene as supernumerary CH genes capable of undergoing isotype switching; the resultant transgenic nonhuman animal may then, in some embodiments, make antibodies of various classes including all of the allotypes represented in the species from which the transgene CH genes were obtained.

Still further, those skilled in the art can select CH genes from different species to incorporate into the transgene. Functional switch sequences are included with each CH gene, although the switch sequences used are not necessarily those which occur naturally adjacent to the CH gene. Interspecies CH gene combinations [N:\LIBC]01115:ais 34 of will produce a transgenic nonhuman animal which may produce antibodies of various classes corresponding to CH genes from various species. Transgenic nonhuman animals containing interspecies CH transgenes may serve as the source of B-cells for constructing hybridomas to produce monoclonals for veterinary uses.

The heavy chain J region segments in the human comprise six functional J segments and three pseudo genes clustered in a 3kb stretch of DNA. Given its relatively compact size and the ability to isolate these segments together with the ti gene and the 5' portion of the 6 gene on a single 23kb SFil/Spel fragment (Sado et al., Biochem. Biophys. Res. Comm. 154:264271 (1988), which is incorporated herein by reference), it is preferred that all of the J region gene segments be used in the mini-locus construct. since this fragment spans the region between the i. and 6 genes, it is likely to contain all of the 3' cis-linked regulatory elements required for t expression. Furthermore, because this fragment includes the entire J region, it contains the heavy chain enhancer and the Ht switch region (Mills et al., Nature 15 306: 809 (1983); Yancopoulos and Alt, Ann. Rev. Immunol. 4:339-368 (1986) t which are incorporated herein by reference). It also contains the transcription start sites which trigger VDJ joining to form primary repertoire B-cells (Yancopoulos and Alt, Cell 40:271-281 (1985), which is incorporated herein by reference).

Alternatively, a 36kb BssHII/Spell fragment, which includes part on the D region, may be used in place of the 23kb Sfil/Spell fragment. The use of such a fragment increases the amount of 5' flanking sequence to facilitate efficient D-to-J joining.

The human D region consists of 4 homologous 9kb subregions, linked in tandem (Siebenlist, et al. (1981), Nature, 294, 631-635). Each subregion contains up to 10 individual D segments. Some of these segments have been mapped and are shown in Fig. 4. Two different strategies are used to generate a mini-locus D region. The first strategy involves using only those D segments located in a short contiguous stretch of DNA that includes one or two of the repeated D subregions. A candidate is a single 15kb fragment that contains 12 individual D segments. This piece of DNA consists of 2 contiguous EcoRI fragments and has been completely sequenced (Ichihara, et al. (1988), EMBO 7, 4141-4150). Twelve D segments should be sufficient for a primary repertoire. However, given the dispersed nature of the D region, an alternative strategy is to ligate together several non-contiguous D-segment containing fragments, to produce a smaller piece of DNA with a greater number of segments. Additional D-segment genes can be identified, for example, by the presence of characteristic flanking nonamer and heptamer sequences, supra, and by reference to the literature.

At least one, and preferably more than one V gene segment is used to construct the heavy chain minilocus transgene. Rearranged or unrearranged V segments with or without flanking sequences can be isolated as described in copending applications, USSN 07/574,748 filed August 29, 1990, PCT/US91/06185 [N:\LIBC]01115:ais 35 of filed August 28, 1991, and USSN 07/810,279 filed December 17, 1991, each of which is incorporated herein by reference.

Rearranged or unrearranged V segments, D segments, J segments, and C genes, with or without flanking sequences, can be isolated as described in copending applications USSN 07/574,748 filed August 29, 1990 and PCT/US91/06185 filed August 28, 1991.

A minilocus light chain transgene may be similarly constructed from the human X or K immunoglobulin locus. Thus, for example, an immunoglobulin heavy chain minilocus transgene construct, eg., of about 75kb, encoding V, D, J and constant.region sequences can be formed from a plurality of DNA fragments, with each sequence being substantially homologous to human gene sequences.

Preferably, the sequences are operably linked to transcription regulatory sequences and are capable of undergoing rearrangement. With two or more appropriately placed constant region sequences [t and y) and switch regions, S 15 switch recombination also occurs. An exemplary light chain transgene construct can be formed similarly from a plurality of DNA fragments, substantially homologous to human DNA and capable of undergoing rearrangement, as described in copending application, USSN 07/574,748 filed August 29, 1990.

E. Transgene constructs Capable of Isotype Switching Ideally, transgene constructs that are intended to undergo class switching should include all of the cis-acting sequences necessary to regulate sterile transcripts. Naturally occurring switch regions and upstream promoters and regulatory sequences IFN-inducible elements) are preferred cis-acting sequences that are included in transgene constructs capable of isotype switching.

About at least 50 basepairs, preferably about at least 200 basepairs, and more i preferably at least 500 to 1000 basepairs or more of sequence immediately upstream of a switch region, preferably a human yl switch region, should be operably linked to a switch sequence, preferably a human yl switch sequence.

Further, switch regions can be linked upstream of (and adjacent to) CH genes that do not naturally occur next to the particular switch region. For example, but not for limitation, a human yl switch region may be linked upstream from a human X2 CH gene, or a murine y1 switch may be linked to a human CH gene. An alternative method for obtaining non-classical isotype switching 5-associated deletion) in transgenic mice involves the inclusion of the 400 bp direct repeat sequences (GC and sp) that flank the human t gene (Yasui et al., Eur. J. Immunol. 19:1399 (1989)). Homologous recombination between these two sequences deletes the p gene in IgD-only B-cells. Heavy chain transgenes can be represented by the following formulaic description: 2 )]q where: (N:\LIBC]01115:ais 36 of VH is a heavy chain variable region gene segment, D is a heavy chain D (diversity) region gene segment, JH is a heavy chain J (joining) region gene segment, So is a donor region segment capable of participating in a recombination event with the Sa acceptor region segments such that isotype switching occurs, C 1 is a heavy chain constant region gene segment encoding an isotype utilised in for B cell development t or T is a cis-acting transcriptional regulatory region segment containing at least a promoter, SA is an acceptor region segment capable of participating in a recombination event with selected SD donor region segments, such that isotype switching occurs, C 2 is a heavy chain constant region gene segment encoding an isotype other than p yi, Y2, Y3, 74, a2 or x, y, z, m, n, pt and q are integers. x is 1-100, n is 0-10, y is 1-50, p is 1-10, z is 1-50, q is 0m is 0-10. Typically, when the transgene is capable of isotype switching, q must be at least 1, m is at least 1, n is at least 1, and m is greater than or equal to n.

VH, D, SD, C 1 T, SA, and Cz segments may be selected from various 15 species, preferably mammalian species, and more preferably from human and *murine germline DNA.

VH segments may be selected from various species, but are preferably o selected from SH segments that occur naturally in the human germline, such as S* VH251. Typically about 2 VH gene segments are included, preferably about 4 VH segments are included, and most preferably at least about 10 VH segments are included.

At least one D segment is typically included, although at least 10 D segments are preferably included, and some embodiments include more than ten D segments. Some preferred embodiments include human D segments.

Typically at least one JH segment is incorporated in the transgene, although it is preferable to include about six JH segments, and some preferred embodiments include more than about six JH segments. Some preferred embodiments include human JH segments, and further preferred embodiments include six human JH segments and no nonhuman JH segments.

So segments are donor regions capable of participating in recombination events With the SA segment of the transgene. For classical isotype switching, SD and SA are switch regions such as Sy~, Sy2, Sy3, Sy4, Sa2, and Preferably the switch regions are murine or human, more preferably So is a human or murine S, and SA is a human or murine Sy,. For nonclassical isotype switching (6associated deletion), SD and SA are preferably the 400 basepair direct repeat sequences that flank the human p gene.

C1 segments are typically R1 or s genes, preferably a p gene, and more preferably a human or murine t gene.

T segments typically include S' flanking sequences that are adjacent to naturally occurring ie., germline) switch regions. T segments typically at least about [N:\LIBC]01115:ais 37 of at least 50 nucleotides in length, preferably about at least 200 nucleotides in length, and more preferably at least 500-1000 nucleotides in length. Preferably T segments are 5' flanking sequences that occur immediately upstream of human or murine switch regions in a germline configuration. It is also evident to those of skill in the art that T segments may comprise cis-acting transcriptional regulatory sequences that do not occur naturally in an animal germline viral enhancers and promoters such as those found in SV40, adenovirus, and other viruses that infect eukaryotic cells).

C2 segments are typically 1, 72, 73, 7, Y4a, 2 or s CH gene, preferably a human CH gene of these isotypes, and more preferably a human y1, or s 3 gene. Murine Y2a and Y2b may also be used, as may downstream switched) isotype genes form various species. Where the heavy chain transgene contains an immunoglobulin heavy chain minilocus, the total length of the transgene will be typically 150 kilo basepairs or less.

15 In general, the transgene will be other than a native heavy chain Ig locus.

Thus, for example, deletion of unnecessary regions or substitutions with corresponding regions from other species will be present.

F. Methods for Determining Functional Isotype Switching in Ig Transgenes The occurrence of isotype switching in a transgenic nonhuman animal may be identified by any method known to those in the art. Preferred embodiments include the following, employed either singly or in combination: 1. detection of mRNA transcripts that contain a sequence homologous to at least one transgene downstream CH gene other than 8 and an adjacent sequence homologous to a transgene VH-DH-JH rearranged gene; such detection may be by Northern hybridisation, S1 nuclease protection assays, PCR amplification, cDNA cloning, or other methods; 2. detection in the serum of the transgenic animal, or in supernatants of cultures of hybridoma cells made from B-cells of the transgenic animal, of immunoglobulin proteins encoded by downstream CH genes, where such proteins can also be shown by immunochemical methods to comprise a functional variable region; 3. detection, in DNA from B-cells of the transgenic animal or in genomic DNA from hybridoma cells, of DNA rearrangements consistent with the occurrence of isotype switching in the transgene, such detection may be accomplished by Southern blot hybridisation, PCR amplification, genomic cloning, or other method; or 4. identification of other indicia of isotype switching, such as production of sterile transcripts, production of characteristic enzymes involved in switching (eg., "switch recombinase"), or other manifestations that may be detected, measured, or observed by contemporary techniques.

[N:\LIBC]01115:ais 38 of Because each transgenic line may represent a different site of integration of the transgene, and a potentially different tandem array of transgene inserts, and because each different configuration of transgene and flanking DNA sequences can affect gene expression, it is preferable to identify and use lines of mice that express high levels of human immunoglobulins, particularly of the IgG isotype, and contain the least number of copies of the transgene. Single copy transgenics minimise the potential problem of incomplete allelic expression. Transgenes are typically integrated into host chromosomal DNA, most usually into germline DNA and propagated by subsequent breeding of germline transgenic breeding stock animals. However, other vectors and transgenic methods known in the present art or subsequently developed may be substituted as appropriate and as desired by a practitioner.

Trans-switching to endogenous nonhuman heavy chain constant region genes can occur and produce chimeric heavy chains and antibodies comprising 15 such chimeric human/mouse heavy chains. Such chimeric antibodies may be desired for certain uses described herein or may be undesirable.

G. Functional Disruption of Endogenous Immunoglobulin Loci The expression of successfully rearranged immunoglobulin heavy and light transgenes is expected to have a dominant effect by suppressing the rearrangement of the endogenous immunoglobulin genes in the transgenic nonhuman animal. However, another way to generate a nonhuman that is devoid of endogenous antibodies is by mutating the endogenous immunoglobulin loci. Using embryonic stem cell technology and homologous recombination, the endogenous immunoglobulin repertoire can be readily eliminated. The following describes the functional description of the mouse immunoglobulin loci. The vectors and methods disclosed, however, can be readily adapted for use in other non-human animals.

Briefly, this technology involves the inactivation of a gene, by homologous recombination, in a pluripotent cell line that is capable of differentiating into germ cell tissue. A DNA construct that contains an altered, copy of a mouse immunoglobulin gene is introduced into the nuclei of embryonic stem cells. In a portion of the cells, the introduced DNA recombines with the endogenous copy of the mouse gene, replacing it with the altered copy. Cells containing the newly engineered genetic lesion are injected into a host mouse embryo, which is reimplanted into a recipient female. Some of these embryos develop into chimeric mice that possess germ cells entirely derived from the mutant cell line. Therefore, by breeding the chimeric mice it is possible to obtain a new line of mice containing the introduced genetic lesion (reviewed by Capecchi (1989), Science, 244, 1288- 1292).

Because the mouse X locus contributes to only 5% of the immunoglobulins, inactivation of the heavy chain and/or K-light chain loci is sufficient. There are three IN:\LIBC101115:ais 39 of ways to disrupt each of these loci, deletion of the J region, deletion of the J-C intron enhancer, and disruption of constant region coding sequences by the introduction of a stop codon. The last option is the most straightforward, in terms of DNA construct design. Elimination of the gene disrupts B-cell maturation thereby preventing class switching to any of the functional heavy chain segments. The strategy for knocking out these loci is outlined below.

To disrupt the mouse p. and K genes, targeting vectors are used based on the design employed by Jaenisch and co-workers (Zijlstra, et al. (1989), Nature, 342, 435-438) for the successful disruption of the mouse p2-microglobulin gene. The neomycin resistance gene (neo), from the plasmid pMCIneo is inserted into the coding region of the target gene. The pMClneo insert uses a hybrid viral promoter/enhancer sequence to drive neo expression. This promoter is active in embryonic stem cells. Therefore, neo can be used as a selectable marker for integration of the knock-out construct. The HSV thymidine kinase (tk) gene is S. 15 added to the end of the construct as a negative selection marker against random insertion events (Zijlstra, et al., supra.).

A preferred strategy for disrupting the heavy chain locus is the elimination of the J region. This region is fairly compact in the mouse, spanning only 1.3kb. To S"* construct a gene targeting vector, a 15kb Kpnl fragment containing all of the secreted A constant region exons from mouse genomic library is isolated. The 1.3kb J region is replaced with the 1.1kb insert from pMCIneo. The HSV tk gene is then added to the 5' end of the Kpnl fragment. Correct integration of this construct, via homologous recombination, will result in the replacement of the mouse JH region with the neo gene. Recombinants are screened by PCR, using a primer based on the neo gene and a primer homologous to mouse sequences 5' of the Kpnl site in the D region.

Alternatively, the heavy-chain locus is knocked out by disrupting the coding region of the p gene. This approach involves the same 15kb Kpnl fragment used in the previous approach. The 1.1kb insert from pMClneo is inserted at a unique BamHI site in exon II, and the HSV tk gene added to the 3' Kpnl end. Double crossover events on either side of the neo insert, that eliminate the tk gene, are then selected for. These are detected from pools of selected clones by PCR amplification. One of the PCR primers is derived from neo sequences and the other from mouse sequences outside of the targeting vector. The functional disruption of the mouse immunoglobulin loci is presented in the Examples.

G. Suppressing Expression of Endogenous Immunoglobulin Loci In addition to functional disruption of endogenous Ig loci, an alternative method for preventing the expression of an endogenous Ig locus is suppression.

Suppression of endogenous Ig genes may be accomplished with antisense RNA IN:\LIBC]01115:ais 40 of produced from one or more integrated transgenes, by antisense oligonucleotides, and/or by administration of antisera specific for one or more endogenous Ig chains.

Antisense Polynucleotides Antisense RNA transgenes can be employed to partially or totally knock-out expression of specific genes (Pepin et al. (1991) Nature 355: 725; Helene., C. and Toulme, J. (1990) Biochimica BioPhys. Acta 1049: 99; Stout, J. and Caskey, T.

(1990) Somat. Cell Mol. Genet. 16: 369; Munir et al. (1990) Somat. Cell Mol.

Genet. 16: 383, each of which is incorporated herein by reference).

"Antisense polynucleotides" are polynucleotides that: are complementary to all or part of a reference sequence, such as a sequence of an endogenous Ig CH or CL region, and which specifically hybridise to a complementary target sequence, such as a chromosomal gene locus or a Ig mRNA. Such complementary antisense polynucleotides may include nucleotide substitutions, additions, deletions, or transpositions, so long as specific hybridisation to the relevant target S 15 sequence is retained as a functional property of the polynucleotide.

Complementary antisense polynucleotides include soluble antisense RNA or DNA ;oligonucleotides which can hybridise specifically to individual mRNA species and prevent transcription and/or RNA processing of the mRNA species and/or translation of the encoded polypeptide (Ching et al., Proc. Natl. Acad. Sci. USA 86:10006-10010 (1989); Broder et al., Ann. Int. Med.

113:604-618 (1990); Loreau et al., FEBS Letters 274:53-56 (1990); Holcenberg et al., W091/11535; USSN 07/530,165 ("New human CRIPTO gene"); W091/09865; W091/04753; W090/13641; and EP 386563, each of which is incorporated herein by reference). An antisense sequence is a polynucleotide sequence that is complementary to at least one immunoglobulin gene sequence of at least about contiguous nucleotides in length, typically at least 20 to 30 nucleotides in length, and preferably more than about 30 nucleotides in length. However, in some embodiments t antisense sequences may have substitutions, additions or deletions as compared to the complementary immunoglobulin gene sequence, so long as specific hybridisation is retained as a property of the antisense polynucleotide.

Generally, an antisense sequence is complementary to an endogenous immunoglobulin gene sequence that encodes, or has the potential to encode after DNA rearrangement, an immunoglobulin chain. In some cases, sense sequences corresponding to an immunoglobulin gene sequence may function to suppress expression, particularly by interfering with transcription.

The antisense polynucleotides therefore inhibit production of the encoded polypeptide(s). In this regard, antisense polynucleotides that inhibit transcription and/or translation of one or more endogenous Ig loci can alter the capacity and/or specificity of a non-human animal to produce immunoglobulin chains encoded by endogenous Ig loci.

[N:\LIBC011 15:ais 41 of Antisense polynucleotides may be produced from a heterologous expression cassette in a transfectant cell or transgenic cell, such as a transgenic pluripotent hematopoietic stem cell used to reconstitute all or part of the hematopoietic stem cell population of an individual, or a transgenic nonhuman animal. Alternatively, the antisense polynucleotides may comprise soluble oligonucleotides that are administered to the external milieu, either in culture medium in vitro or in the circulatory system or interstitial fluid in vivo. Soluble antisense polynucleotides present in the external milieu have been shown to gain access to the cytoplasm and inhibit translation of specific mRNA species. In some embodiments the antisense polynucleotides comprise methylphosphonate moieties, alternatively phosphorothiolates or O-methylribonucleotides may be used, and chimeric oligonucleotides may also be used (Dagle et al. (1990) Nucleic Acids Res. 18: 4751). For some applications, antisense oligonucleotides may comprise polyamide nucleic acids (Nielsen et al. (1991) Science 254: 1497). For general methods S. 15 relating to antisense polynucleotides, see Antisense RNA and DNA, (1988), D.A.

Melton, Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).

Antisense polynucleotides complementary to one or more sequences are employed to inhibit transcription, RNA processing, and/or translation of the cognate mRNA species and thereby effect a reduction in the amount of the respective encoded polypeptide. Such antisense polynucleotides can provide a therapeutic function by inhibiting the formation of one or more endogenous Ig chains in vivo.

Whether as soluble antisense oligonucleotides or as antisense RNA transcribed from an antisense transgene, the antisense polynucleotides of this invention are selected so as to hybridise preferentially to endogenous Ig sequences at physiological conditions in vivo. Most typically, the selected antisense polynucleotides will not appreciably hybridise to heterologous Ig sequences encoded by a heavy or light chain transgene of the invention the antisense oligonucleotides will not inhibit transgene Ig expression by more than about 25 to percent).

Antiserum Suppression Partial or complete suppression of endogenous Ig chain expression can be produced by injecting mice with antisera against one or more endogenous Ig chains (Weiss et al. (1984) Proc. Natl. Acad. Sci. (USA) 81 211, which is incorporated herein by reference). Antisera are selected so as to react specifically with one or more endogenous murine) Ig chains but to have minimal or no cross-reactivity with heterologous Ig chains encoded by an Ig transgene of the invention. Thus, administration of selected antisera according to a schedule as typified by that of Weiss et al. op.cit. will suppress endogenous Ig chain expression but permits expression of heterologous Ig chain(s) encoded by a transgene of the present invention. Suitable antibody sources for antibody comprise: [N:\LIBCjO1115:ais 42 of monoclonal antibodies, such as a monoclonal antibody that specifically binds to a murine t, y, K, or X chains but does not react with the human immunoglobulin chain(s) encoded by a human Ig transgene of the invention; mixtures of such monoclonal antibodies, so that the mixture binds with multiple epitopes on a single species of endogenous Ig chain, with multiple endogenous Ig chains murine p and murine y, or with multiple epitopes and multiple chains or endogenous immunoglobulins; polyclonal antiserum or mixtures thereof, typically such antiserum/antisera is monospecific for binding to a single species of endogenous Ig chain murine murine y, murine K, murine X) or to multiple species of endogenous Ig chain, and most preferably such antisera possesses negligible binding to human immunoglobulin chains encoded by a transgene of the invention; and/or a mixture of polyclonal antiserum and monoclonal antibodies binding to a single or multiple species of endogenous Ig chain, and most preferably possessing 15 negligible binding to human immunoglobulin chains encoded by a transgene of the .i invention. Generally, polyclonal antibodies are preferred, and such substantially monospecific polyclonal antibodies can be advantageously produced from an antiserum raised against human immunoglobulin(s) by pre-adsorption with antibodies derived from the nonhuman animal species murine) and/or, for example, by affinity chromatography of the antiserum or purified fraction thereof on S*.i an affinity resin containing immobilised human Ig (wherein the bound fraction is enriched for the desired anti-human Ig in the antiserum; the bound fraction is typically eluted with conditions of low pH or a chaotropic salt solution).

0° Cell separation and/or complement fixation can be employed to provide the enhancement of antibody-directed cell depletion of lymphocytes expressing endogenous murine) immunoglobulin chains. In one embodiment, for example, antibodies are employed for ex vivo depletion of murine Ig-expressing explanted hematopoietic cells and/or B-lineage lymphocytes obtained from a transgenic mouse harbouring a human Ig transgene. Thus, hematopoietic cells and/or B-lineage lymphocytes are explanted from a transgenic nonhuman animal harbouring a human Ig transgene (preferably harbouring both a human heavy chain transgene and a human light chain transgene) and the explanted cells are incubated with an antibody (or antibodies) which binds to an endogenous immunoglobulin murine p and/or K) and lacks substantial binding to human immunoglobulin chains encoded by the transgene(s). Such antibodies are referred to as "suppression antibodies" for clarity. The explanted cell population is selectively depleted of cells which bind to the suppression antibody(ies); such depletion can be accomplished by various methods, such as physical separation to remove suppression antibody-bound cells from unbound cells (eg., the suppression antibodies may be bound to a solid support or magnetic bead to [N:\LIBC]01115:ais 43 of immobilise and remove cells binding to the suppression antibody), antibodydependent cell killing of cells bound by the suppression antibody by ADCC, by complement fixation, or by a toxin linked to the suppression antibody), and (3) clonal anergy induced by the suppression antibody, and the like.

Frequently, antibodies used for antibody suppression of endogenous Ig chain production will be capable of fixing complement. It is frequently preferable that such antibodies may be selected so as to react well with a convenient complement source for ex vivo/in vitro depletion, such as rabbit or guinea pig complement. For in vivo depletion, it is generally preferred that the suppressor antibodies possess effector functions in the nonhuman transgenic animal species; thus, a suppression antibody comprising murine effector functions ADCC and complement fixation) generally would be preferred for use in transgenic mice.

In one variation, a suppression antibody that specifically binds to a predetermined endogenous immunoglobulin chain is used for ex vivo/in vitro depletion of lymphocytes expressing an endogenous immunoglobulin. A cellular explant lymphocyte sample) from a transgenic nonhuman animal harbouring a S. human immunoglobulin transgene is contacted with a suppression antibody and cells specifically binding to the suppression antibody are depleted by Simmobilisation, complement fixation, and the like), thus generating a cell 20 subpopulation depleted in cells expressing endogenous (nonhuman) immunoglobulins lymphocytes expressing murine Ig). The resultant depleted lymphocyte population (T cells, human Ig-positive B-cells, etc.) can be transferred into a immunocompatible MHC-compatible) nonhuman animal of the same species and which is substantially incapable of producing endogenous antibody SCID mice, RAG-1 or RAG-2 knockout mice). The reconstituted animal (mouse) can then be immunised with an antigen (or reimmunised with an antigen used to immunise the donor animal from which the explant was obtained) to obtain high-affinity (affinity matured) antibodies and B-cells producing such antibodies.

Such B-cells may be used to generate hybridomas by conventional cell fusion and screened. Antibody suppression can be used in combination with other endogenous Ig inactivation/suppression methods JH knockout, CH knockout, D-region ablation, antisense suppression, compensated frameshift inactivation).

Complete Endogenous Ig Locus Inactivation In certain embodiments, it is desirable to effect complete inactivation of the endogenous Ig loci so that hybrid immunoglobulin chains comprising a human variable region and a non-human murine) constant region cannot be formed by trans-switching between the transgene and endogenous Ig sequences).

Knockout mice bearing endogenous heavy chain alleles with are functionally disrupted in the JH region only frequently exhibit trans-switching, typically wherein a rearranged human variable region (VDJ) encoded by a transgene is expressed as a [N:\LIBCj01115:ais 44 of fusion protein linked to an endogenous murine constant region, although other trans-switched junctions are possible. To overcome this potential problem, it is generally desirable to completely inactivate the endogenous heavy chain locus by any of various methods, including but not limited to the following: functionally disrupting and/or deleting by homologous recombination at least one and preferably all of the endogenous heavy chain constant region genes, mutating at least one and preferably all of the endogenous heavy chain constant region genes to encode a termination codon (or frameshift) to produce a truncated or frameshifted product (if trans-switched), and other methods and strategies apparent to those of skill in the art. Deletion of a substantial portion or all of the heavy chain constant region genes and/or D-region genes may be accomplished by various methods, including sequential deletion by homologous recombination targeting vectors, especially of the "hit-and-run" type and the like. Similarly, functional disruption and/or deletion of at least one endogenous light chain locus K) to ablate endogenous light chain constant region genes is often preferable.

*Frequently, it is desirable to employ a frameshifted transgene wherein the Sheterologous transgene comprises a frameshift in the J segment(s) and a compensating frameshift to regenerate the original reading frame) in the initial region amino-terminal coding portion) of one or more (preferably all) of the 20 transgene constant region genes. Trans-switching to an endogenous IgH locus constant gene (which does not comprise a compensating frameshift) will result in a truncated or missense product that results in the trans-switched B cell being deleted or non-selected, thus suppressing the trans-switched phenotype.

Antisense suppression and antibody suppression may also be used to effect a substantially complete functional inactivation of endogenous Ig gene product expression murine heavy and light chain sequences) and/or trans-switched antibodies human variable/murine constant chimeric antibodies).

Various combinations of the inactivation and suppression strategies may be used to effect essentially total suppression of endogenous murine) Ig chain expression.

Trans-Switching In some variations, it may be desirable to produce a trans-switched immunoglobulin. For example, such trans-switched heavy chains can be chimeric a non-murine (human) variable region and a murine constant region).

Antibodies comprising such chimeric trans-switched immunoglobulins can be used for a variety of applications where it is desirable to have a non-human murine) constant region for retention of effector functions in the host, for the presence of murine immunological determinants such as for binding of a secondary antibody which does not bind human constant regions). For one example, a human variable region repertoire may possess advantages as compared to the murine variable [N:\LIBC]01115:ais 45 of region repertoire with respect to certain antigens. Presumably the human VH, D, JH, VL, and JL genes have been selected for during evolution for their ability to encode immunoglobulins that bind certain evolutionarily important antigens; antigens which provided evolutionary selective pressure for the murine repertoire can be distinct from those antigens which provided evolutionary pressure to shape the human repertoire. Other repertoire advantages may exist, making the human variable region repertoire advantageous when combined with a murine constant region (eg., a trans-switched murine) isotype. The presence of a murine constant region can afford advantages over a human constant region. For example, a murine X constant region linked to a human variable region by trans-switching may provide an antibody which possesses murine effector functions ADCC, murine complement fixation) so that such a chimeric antibody (preferably monoclonal) which is reactive with a predetermined antigen human IL-2 receptor) may be tested in a mouse disease model, such as a mouse model of graft-versus-host disease wherein the T lymphocytes in the mouse express a functional human IL-2 receptor. Subsequently, the human variable region encoding sequence may be isolated by PCR amplification or cDNA cloning from the source (hybridoma clone)) and spliced to a sequence encoding a desired human constant region to 2encode a human sequence antibody more suitable for human therapeutic uses 20 where immunogenicity is preferably minimised. The polynucleotide(s) having the resultant fully human encoding sequence(s) can be expressed in a host cell (eg., from an expression vector in a mammalian cell) and purified for pharmaceutical formulation. For some applications, the chimeric antibodies may be used directly without replacing the murine constant region with a human constant region. Other variations and uses of trans- switched chimeric antibodies will be evident to those of skill in the art.

The present invention provides transgenic nonhuman animals containing B lymphocytes which express chimeric antibodies, generally resulting from transswitching between a human heavy chain transgene and an endogenous murine heavy chain constant region gene. Such chimeric antibodies comprise a human sequence variable region and a murine constant region, generally a murine switched non-i, non-6) isotype. The transgenic nonhuman animals capable of making chimeric antibodies to a predetermined antigen are usually also competent to make fully human sequence antibodies if both human heavy chain and human light chain transgenes encoding human variable and human constant region genes are integrated. Most typically, the animal is homozygous for a functionally disrupted heavy chain locus and/or light chain locus but retains one or more endogenous heavy chain constant region gene(s) capable of trans-switching y, a, s) and frequently retains a cis-linked enhancer. Such a mouse is immunised with a predetermined antigen, usually in combination with an adjuvant, and an immune [N:\LIBC]01115:ais 46 of response comprising a detectable amount of chimeric antibodies comprising heavy chains composed of human sequence variable regions linked to murine constant region sequences is produced. Typically, the serum of such an immunised animal can comprise such chimeric antibodies at concentrations of about at least 1 pg/mL, often about at least 10 pg/mL, frequently at least 30 p.g/mL, and up to 50 to 100 tg/mL or more. The antiserum containing antibodies comprising chimeric human variable/mouse constant region heavy chains typically also comprises antibodies which comprise human variable/human constant region (complete human sequence) heavy chains. Chimeric trans-switched antibodies usually comprise a chimeric heavy chain composed of a human variable region and a murine constant region (typically a murine gamma) and a human transgene-encoded light chain (typically kappa) or a murine light chain (typically lambda in a kappa knockout background). Such chimeric trans-switched antibodies generally bind to a predetermined antigen the immunogen) with an affinity of about at least 1 x 107 M 1 preferably with an affinity of about at least 5 x 107 M 1 more preferably with an affinity of at least 1 x 10 8

M

1 to 1 x 10 9

M-

1 or more. Frequently, the predetermined antigen is a human protein, such as for example a human cell surface antigen CD4, CD8, IL-2 receptor, EGF receptor, PDGF receptor), other human biological macromolecule thrombomodulin, protein C, S 20 carbohydrate antigen, sialyl Lewis antigen, L-selectin), or nonhuman disease associated macromolecule bacterial LPS, virion capsid protein or envelope glycoprotein) and the like.

The invention provides transgenic nonhuman animals comprising a genome comprising: a homozygous functionally disrupted endogenous heavy chain locus comprising at least one murine constant region gene capable of transo. switching in cis linkage to a functional switch recombination sequence and Stypically to a functional enhancer), a human heavy chain transgene capable of rearranging to encode end express a functional human heavy chain variable region and capable of trans-switching having a cis-linked RSS); optionally further comprising a human light chain kappa) transgene capable of rearranging to encode a functional human light chain variable region and expressing a human sequence light chain; optionally further comprising a homozygous functionally disrupted endogenous light chain locus preferably K and and optionally further comprising a serum comprising an antibody comprising a chimeric heavy chain composed of a human sequence variable region encoded by a human transgene and a murine constant region sequence encoded by an endogenous murine heavy chain constant region gene (eg.,yl, y2a, y2b, y3).

Such transgenic mice may further comprise a serum comprising chimeric antibodies which bind a predetermined human antigen CD4, CD8, CEA) With an affinity of about at least 1 x 104 M 1 preferably with an affinity of about at least [N:\LIBC]01115:ais 47 of x 10 4

M-

1 more preferably with an affinity of at least 1 x 10 7

M-

1 to 1 x 10 9

M

1 or more. Frequently, hybridomas can be made wherein the monoclonal antibodies produced thereby have an affinity of at least 8 x10 7

M

1 Chimeric antibodies comprising a heavy chain composed of a murine constant region and a human variable region, often capable of binding to a nonhuman antigen, may also be present in the serum or as an antibody secreted from a hybridoma.

Generally, such chimeric antibodies can be generated by trans-switching, wherein a human transgene encoding a human variable region (encoded by productive V-D-J rearrangement in vivo) and a human constant region, typically human undergoes switch recombination with a non-transgene immunoglobulin constant gene switch sequence (RSS) thereby operably linking the transgeneencoded human variable region with a heavy chain constant region which is not encoded by said transgene, typically an endogenous murine immunoglobulin heavy chain constant region or a heterologous human) heavy chain constant region encoded on a second transgene. Whereas cis-switching refers to isotype-switching by recombination of RSS elements within a transgene, trans-switching involves recombination between a transgene RSS and an RSS element outside the transgene, often on a different chromosome than the chromosome which harbours S 2"0" the transgene.

20 Trans-switching generally occurs between an RSS of an expressed transgene heavy chain constant region gene and either an RSS of an endogenous murine constant region gene (of a non-p isotype, typically y) or an RSS of a human constant region gene contained on a second transgene, often integrated on a separate chromosome.

When trans-switching occurs between an RSS of a first, expressed transgene heavy chain constant region gene p) and an RSS of a human heavy chain constant region gene contained on a second transgene, a non-chimeric antibody having a substantially fully human sequence is produced. For example and not limitation, a polynucleotide encoding a human heavy chain constant region y1) and an operably linked RSS a y1 RSS) can be introduced transfected) into a population of hybridoma cells generated from a transgenic mouse B-cell (or B cell population) expressing an antibody comprising a transgene-encoded human p chain. The resultant hybridoma cells can be selected for the presence of the introduced polynucleotide and/or for the expression of trans-switched antibody comprising a heavy chain having the variable region (idiotype/antigen reactivity) of the human ,IL chain and having the constant region encoded by the introduced polynucleotide sequence (human yl). Trans-switch recombination between the RSS of the transgene-encoded human p chain and the RSS of the introduced polynucleotide encoding a downstream isotype y1) thereby can generate a trans-switched antibody.

[N:\LIBC]01115:ais 48 of The invention also provides a method for producing such chimeric transswitched antibodies comprising the step of immunising with a predetermined antigen a transgenic mouse comprising a genome comprising: a homozygous functionally disrupted endogenous heavy chain locus comprising at least one murine constant region gene capable of trans-switching y2a, y2b, yl, y3), a human heavy chain transgene capable of rearranging to encode a functional human heavy chain variable region and expressing a human sequence heavy chain and capable of undergoing isotype switching (and/or trans-switching), and optionally further comprising a human light chain kappa) transgene capable of rearranging to encode a functional human light kappa) chain variable region and expressing a human sequence light chain, and optionally further comprising a homozygous functionally disrupted endogenous light chain locus (typically K, preferably both K and and optionally further comprising a serum comprising an antibody comprising a chimeric heavy chain composed of a human sequence variable region encoded by a human transgene and a murine constant region sequence encoded by an endogenous murine heavy chain constant region y2a, y2b, y1, y3).

Affinity Tagging: Selecting for Switched Isotypes Advantageously, trans-switching (and cis-switching) is associated with the S 20 process of somatic mutation. Somatic mutation expands the range of antibody affinities encoded by clonal progeny of a B-cell. For example, antibodies produced by hybridoma cells which have undergone switching (trans- or cis-) represent a broader range of antigen-binding affinities than is present in hybridoma cells which have not undergone switching. Thus, a hybridoma cell population (typically clonal) 25 which expresses a first antibody comprising a heavy chain comprising a first human heavy chain variable region in polypeptide linkage to a first human heavy chain constant region lt) can be screened for hybridoma cell clonal variants which express an antibody comprising a heavy chain containing said first human heavy chain variable region in polypeptide linkage to a second heavy chain constant region a human y, a, or 8 constant region). Such clonal variants can be produced by natural clonal variation producing cis-switching in vitro, by induction of class switching (trans- or cis-) as through the administration of agents that promote isotype switching, such as T-cell-derived lymphokines IL-4 and IFNy), by introduction of a polynucleotide comprising a functional RSS and a heterologous (eg. human) heavy chain constant region gene to serve as a substrate for transswitching, or by a combination of the above, and the like.

Class switching and affinity maturation take place within the same population of B cells derived from transgenic animals of the present invention. Therefore, identification of class-switched B cells (or hybridomas derived therefrom) can be used as a screening step for obtaining high affinity monoclonal antibodies. A variety [N:\LIBCjO1115:ais 49 of of approaches can be employed to facilitate class switching events such as cisswitching (intratransgene switching, trans-switching, or both. For example, a single continuous human genomic fragment comprising both p and y constant region genes with the associated RSS elements and switch regulatory elements (eg., sterile transcript promoter) can be used as a transgene. However, some portions of the desired single contiguous human genomic fragment can be difficult to clone efficiently, such as due to instability problems when replicated in a cloning host or the like; in particular, the region between 6 and y3 can prove difficult to clone efficiently, especially as a contiguous fragment comprising the p gene, y3 gene, a V gene, D gene segments, and J gene segments.

Also for example, a discontinuous human transgene (minigene) composed of a human Ii gene, human y3 gene, a human V gene(s), human D gene segments, and human J gene segments, with one or more deletions of an intervening (intronic) or otherwise nonessential sequence one or more V, D, and/or J segment and/or one or more non-t constant region gene(s)). Such minigenes have several advantages as compared to isolating a single contiguous segment of genomic DNA spanning all of the essential elements for efficient immunoglobulin expression and switching. For example, such a minigene avoids the necessity of isolating large pieces of DNA which may contain sequences Which are difficult to 20 clone unstable sequences, poison sequences, and the like). Moreover, miniloci comprising elements necessary for isotype switching human y sterile transcript promoter) for producing cis- or trans-switching, can advantageously undergo somatic mutation and class switching in vivo. As many eukaryotic DNA sequences can prove difficult to clone, omitting non-essential sequences can prove advantageous.

In a variation, hybridoma clones producing antibodies having high binding affinity at least 1 x 10 7

M-

1 preferably at least 1 x 10 8 M 1 more preferably at least 1 x 10 9

M

1 or greater) are obtained by selecting, from a pool of hybridoma cells derived from B cells of transgenic mice harbouring a human heavy chain transgene capable of isotype switching (see, supra) and substantially lacking endogenous murine heavy chain loci capable of undergoing productive (in-frame) V-D-J rearrangement, hybridomas which express an antibody comprising a heavy chain comprising a human sequence heavy chain variable region in polypeptide linkage to a human (or mouse) non-,U heavy chain constant region; said antibodies are termed "switched antibodies" as they comprise a "switched heavy chain" which is produced as a consequence of cis-switching and/or trans-switching in vivo or in cell culture. Hybridomas producing switched antibodies generally have undergone the process of somatic mutation, and a pool of said hybridomas will generally have a broader range of antigen binding affinities from which hybridoma clones secreting high affinity antibodies can be selected. Typically, hybridomas secreting a human IN:\LIBC]01115:ais 50 of 51 sequence antibody having substantial binding affinity (greater than 1 x 10 7

M

1 to 1 x 108 M 1 for a predetermined antigen and wherein said human sequence antibody comprises human immunoglobulin variable region(s) can be selected by a method comprising a two-step process. One step is to identify and isolate hybridoma cells which secrete immunoglobulins which comprise a switched heavy chain by binding hybridoma cells to an immobilised immunoglobulin which specifically binds a switched heavy chain and does not substantially bind to an unswitched isotype, eg., it). The other step is to identify hybridoma cells which bind to the predetermined antigen with substantial binding affinity by ELISA of hybridoma clone supernatants, FACS analysis using labelled antigen, and the like). Typically, selection of hybridomas which secrete switched antibodies is performed prior to identifying hybridoma cells which bind predetermined antigen. Hybridoma cells which express switched antibodies that have substantial binding affinity for the predetermined antigen are isolated and cultured under suitable growth conditions known in the art, typically as individual selected clones. Optionally, the method comprises the step of culturing said selected clones under conditions suitable for expression of monoclonal antibodies; said monoclonal antibodies are collected and can be administered for therapeutic, prophylactic, and/or diagnostic purposes.

Often, the selected hybridoma clones can serve as a source of DNA or RNA for isolating immunoglobulin sequences which encode immunoglobulins (eg. a variable region) that bind to (or confer binding to) the predetermined antigen.

Subsequently, the human variable region encoding sequence may be isolated (eg., by PCR amplification or cDNA cloning from the source (hybridoma clone)) and spliced to a sequence encoding a desired human constant region to encode a S 25 human sequence antibody more suitable for human therapeutic uses where immunogenicity is preferably minimised. The polynucleotide(s) having the resultant fully human encoding sequence(s) can be expressed in a host cell from an expression vector in a mammalian cell) and purified for pharmaceutical formulation.

Xenoenhancers A heterologous transgene capable of encoding a human immunoglobulin (eg., a heavy chain) advantageously comprises a cis-linked enhancer which is not derived from the mouse genome, and/or which is not naturally associated in cis with the exons of the heterologous transgene. For example, a human K transgene a K minilocus) can advantageously comprise a human VK gene, a human JK gene, a human CK gene, and a xenoenhancer, typically said xenoenhancer comprises a human heavy chain intronic enhancer and/or a murine heavy chain intronic enhancer, typically located between a JK gene and the CK gene, or located downstream of the CK gene. For example, the mouse heavy chain J-H intronic enhancer (Banerji et al. (1983) Cell 33: 729) can be isolated on a 0.9kb Xbal fragment of the plasmid pKVe2 (see, infra). The human heavy chain intronic [N:\LIBC]O1115:ais 51 of enhancer (Hayday et al. (1984) Nature 307: 334) can be isolated as a 1.4kb Mlul/Hindlll fragment (see, infra). Addition of a transcriptionally active xenoenhancer to a transgene, such as a combined xenoenhancer consisting essentially of a human J-H intronic enhancer linked in cis to a mouse J- t intronic enhancer, can confer high levels of expression of the transgene, especially where said transgene encodes a light chain, such as human K. Similarly, a rat 3' enhancer can be advantageously included in a minilocus construct capable of encoding a human heavy chain.

Specific_Preferred Embodiments A preferred embodiment of the invention is an animal containing at least one, typically 2-10, and sometimes 25-50 or more copies of the transgene described in Example 12 pHC1 or pHC2) bred with an animal containing a single copy of a light chain transgene described in Examples 5, 6, 8, or 14, and the offspring bred with the JH deleted animal described in Example 10. Animals are bred to homozygosity for each of these three traits. Such animals have the following genotype: a single copy (per haploid set of chromosomes) of a human heavy chain unrearranged mini-locus (described in Example 12), a single copy (per haploid set of chromosomes) of a rearranged human K light chain construct (described in Example 14), and a deletion at each endogenous mouse heavy chain locus that S 20 removes all of the functional JH segments (described in Example 10). Such animals are bred with mice that are homozygous for the deletion of the JH segments (Examples 10) to produce offspring that are homozygous for the JH deletion and hemizygous for the human heavy and light chain constructs. The resultant animals are injected with antigens and used for production of human 25 monoclonal antibodies against these antigens.

B cells isolated from such an animal are monospecific with regard to the human heavy and light chains because they contain only a single copy of each gene. Furthermore, they will be monospecific with regards to human or mouse heavy chains because both endogenous mouse heavy chain gene copies are nonfunctional by virtue of the deletion spanning the JH region introduced as described in Example 9 and 12. Furthermore, a substantial fraction of the B cells will be monospecific with regards to the human or mouse light chains because expression of the single copy of the rearranged human K light chain gene will allelically and isotypically exclude the rearrangement of the endogenous mouse K and X chain genes in a significant fraction of B-cells.

The transgenic mouse of the preferred embodiment will exhibit immunoglobulin production with a significant repertoire, ideally substantially similar to that of a native mouse. Thus, for example, in embodiments where the endogenous Ig genes have been inactivated, the total immunoglobulin levels will range from about 0.1 to 10 mg/mL of serum, preferably 0.5 to 5 mg/mL, ideally at [N:ALIBCJ011I5:ais 52 of least about 1.0 mg/mL. When a transgene capable of effecting a switch to IgG from IgM has been introduced into the transgenic mouse, the adult mouse ratio of serum IgG to IgM is preferably about 10:1. Of course, the IgG to IgM ratio will be much lower in the immature mouse. In general, greater than about 10%, preferably 40 to 80% of the spleen and lymph node B cells express exclusively human IgG protein.

The repertoire will ideally approximate that shown in a non-transgenic mouse, usually at least about 10% as high, preferably 25 to 50% or more. Generally, at least about a thousand different immunoglobulins (ideally IgG), preferably 104 to 106 or more, will be produced, depending primarily on the number of different V, J and D regions introduced into the mouse genome. These immunoglobulins will typically recognise about one-half or more of highly antigenic proteins, including, but not limited to: pigeon cytochrome C, chicken lysozyme, pokeweed mitogen, bovine serum albumin, keyhole limpit hemocyanin, influenza hemagglutinin, staphylococcus protein A, sperm whale myoglobin, influenza neuraminidase, and lambda repressor protein. Some of the immunoglobulins will exhibit an affinity for preselected antigens of at least about 10 7

M

1 preferably 10 8

M

1 to 10 9

M

1 or greater.

In some embodiments, it may be preferable to generate mice with predetermined repertoires to limit the selection of V genes represented in the 20 antibody response to a predetermined antigen type. A heavy chain transgene having a predetermined repertoire may comprise, for example, human VH genes which are preferentially used in antibody responses to the predetermined antigen type in humans. Alternatively, some VH genes may be excluded from a defined repertoire for various reasons have a low likelihood of encoding high affinity V 25 regions for the predetermined antigen; have a low propensity to undergo somatic mutation and affinity sharpening; or are immunogenic to certain humans).

SThus, prior to rearrangement of a transgene containing various heavy or light chain gene segments, such gene segments may be readily identified, eg. by hybridisation or DNA sequencing, as being from a species of organism other than the transgenic animal.

Although the foregoing describes a preferred embodiment of the transgenic animal of the invention, other embodiments are defined by the disclosure herein and more particularly by the transgenes described in the Examples.

Four categories of transgenic animal may be defined: I. Transgenic animals containing an unrearranged heavy and rearranged light immunoglobulin transgene.

II. Transgenic animals containing an unrearranged heavy and unrearranged light immunoglobulin transgene III. Transgenic animal containing rearranged heavy and an unrearranged light immunoglobulin transgene, and IN:\LIBC]01115:ais 53 of IV. Transgenic animals containing rearranged heavy and rearranged light immunoglobulin transgenes.

Of these categories of transgenic animal, the preferred order of preference is as follows II>I>III>IV where the endogenous light chain genes (or at least the K gene) have been knocked out by homologous recombination (or other method) and I>II>III>IV where the endogenous light chain genes have not been knocked out and must be dominated by allelic exclusion.

Experimental Examples Methods and Materials Transgenic mice are derived according to Hogan, et al., "Manipulating the Mouse Embryo: A Laboratory Manual", Cold Spring Harbor Laboratory, which is incorporated herein by reference.

Embryonic stem cells are manipulated according to published procedures (Teratocarcinomas and embryonic stem cells: a practical approach, E.J. Robertson, ed., IRL Press, Washington, DC, 1987; Zjilstra et al., Nature 342:435-438 (1989); and Schwartzberg et al., Science 246:799-803 (1989), each of which is incorporated herein by reference).

Reference is made to Examples 1 to 21 of application 33284/93 which are incorporated herein by reference.

Example 22 This example demonstrates the successful production of a murine hybridoma clone secreting a monoclonal antibody reactive with a specific immunogen, wherein the monoclonal antibody comprises a human immunoglobulin chain encoded by a human Ig transgene.

Generation of Monoclonal Antibodies Incorporating Human Heavy Chain Transgene Product 1. Immunisation of Mouse Harbouring Human Heavy Chain Transgene A mouse containing a human heavy chain encoding transgene and homozygous for knockout functional disruption) of the endogenous heavy chain locus (see, Example 20, supra) was immunised with purified human CEA, and spleen cells were subsequently harvested after a suitable immune response period. The murine spleen cells were fused with mouse myeloma cells to generate hybridomas using conventional techniques (see, Kohler and Milstein, Eur. J.

Immunol., 6:511-519 (1976); Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York (1988)). The mouse used for immunisation contained a human unrearranged heavy chain minilocus transgene which comprised a single functional VH gene (VH251), human D and J segments, human Vt constant region, and human yl constant region genes. The transgenic line from which it originated was designated HC1-57 (supra).

[N:\LIBC]01115:ais 54 of One hundred g of purified human carcinoembryonic antigen (CEA) (Cyrstal Chem, Chicago, IL or Scripps Labs, San Diego, CA) insolubilised on alum was injected in complete Freund's adjuvant on Day 0, followed by further weekly injections of alum-precipitated CEA in incomplete Freund's adjuvant on Days 7, 14, 21, and 28. An additional 20 jpg of soluble CEA was administered intravenously on Day 83, followed by 50 jpg alum-precipitated CEA in incomplete Freund's adjuvant on Day 92. Human heavy chain responses to CEA were confirmed in serum samples prior to fusion of spleen cells with myleoma cells. The animal was sacrificed on Day 95, the spleen removed and fused with P3X63-Ag8.653 mouse myeloma cells (ATCC CRL 1580, American Type Culture Collection, Rockville, MD) using polyethylene glycol. Two weeks later, supernates from fusion wells were screened for the presence of antibodies specifically reactive with CEA, and which contained human heavy chain ji or y constant region epitopes by ELISA. Briefly, purified human CEA was coated onto PVC microtitre plates at 2.5 Pg/ml, and incubate with culture supernate diluted 1:4 or 1:5 in PBS, 0.5% Tween-20, S, chicken serum. Plates were washed, followed by addition of horseradish S.i peroxidase-conjugated goat antiserum specific for human IgG Fc or rabbit antiserum specific for human IgM Fc5Mu (Jackson Immuno Research, West Grove, PA). Presence of conjugate bound to captured antibody was determined, S 20 after further washing, by the addition of ABTS substrate. Two independent fusion wells were found to contain antibody with substantial binding to CEA. After cloning, both hybridomas were found to be positive for the presence of human pi chain and murine K chain by ELISA. No mouse IgG or IgM were detected using similar assays.

S 25 Subcloning of the two independent parent hybridomas resulted in two clones, designated 92-09A-4F7-A5-2 and 92-09A-1D7-1-7-1. Both lines were deposited with the ATCC Patent Culture Depository under the Budapest Treaty and were assigned ATCC Designation HB 11307 and HB 11308, respectively. Culture supernatants from these cell lines were assessed for specificity by testing for reactivity to several purified target proteins using ELISA. As shown in Fig. 46, ELISA assays for determining the reactivity of the monoclonal antibodies to various antigens demonstrate that only CEA and the CEA-related antigen NCA-2 show significant reactivity, indicating the development of a restricted reactivity for the variable regions of the heterohybrid immunoglobulin molecules.

Example 23 This example demonstrates that a rearranged human VDJ gene encoded by a human Ig minilocus transgene may be transcribed as a transcript which includes an endogenous Ig constant region gene, for example by the mechanism of transswitching, to encode a chimeric human/mouse Ig chain.

[N:\LIBC01115:ais 55 of Identification of Trans-Switch Transcripts Encoding Chimeric Human-Mouse Heavy Chains RNA was isolated from a hyperimmunised HC1 line 57 transgenic mouse homozygous for the endogenous heavy chain J segment deletion (supra). cDNA was synthesised according to Taylor et al. (1993) Nucleic Acids Res. 20: 6287, incorporated herein by reference, and amplified by PCR using the following two primers: 0-149 (human VH251) GCT CGA GTC CAA GGA GTC TGT GCC GAG GTG CAG CTG 0-249 (mouse gamma): GCT CGA GCT GGA CAG GG(A/C) TCC A(G/T)A GTT CCA-3' Oligonucleotide 0-149 is specific for the HC1-encoded variable gene segment VH251, while 0-249 hybridises to both mouse and human gamma sequences with the following order of specificities: mouse yl mouse y2b mouse y3 mouse y2a human yl. DNA sequences from 10 randomly chosen clones generated from the PCR products was determined and is shown in Fig. 47. Two clones comprised human VDJ and mouse yl; four clones comprised human VDJ and mouse y2b; and four clones comprised human VDJ and mouse y3. These results indicate that in a fraction of the transgenic B cells, the transgene-encoded human VDJ recombined 20 into the endogenous murine heavy chain locus by class switching or an analogous recombination.

Example 24 This example describes a method for screening a pool of hybridomas to discriminate clones which encode chimeric human/mouse Ig chains from clones which encode and express a human Ig chain. For example, in a pool of hybridoma clones made from a transgenic mouse comprising a human Ig heavy chain transgene and homozygous for a J region-disrupted endogenous heavy chain locus, hybridoma clones encoding trans-switched human VDJ-murine constant region heavy chains may be identified and separated from hybridoma clones expressing human VDJ-human constant region heavy chains.

Screening Hybridomas to Eliminate Chimeric Ig Chains The screening process involves two stages, which may be conducted singly or optionally in combination: a preliminary ELISA-based screen, and a secondary molecular characterisation of candidate hybridomas. Preferably, a preliminary ELISA-based screen is used for initial identification of candidate hybridomas which express a human VDJ region and a human constant region.

Hybridomas that show positive reactivity with the antigen the immunogen used to elicit the antibody response in the transgenic mouse) are tested using a panel of monoclonal antibodies that specifically react with mouse y, K, and X, and human y, K. Only hybridomas that are positive for human heavy [N:\LIBC01 115:ais 56 of and light chains, as well as negative for mouse chains, are identified as candidate hybridomas that express human immunoglobulin chains. Thus, candidate hybridomas are shown to have reactivity with specific antigen and to possess epitopes characteristic of a human constant region.

RNA is isolated from candidate hybridomas and used to synthesise first strand cDNA. The first strand cDNA is then ligated to a unique single-stranded oligonucleotide of predetermined sequence (oligo-X) using RNA ligase (which ligates single-stranded DNA). The ligated cDNA is then amplified in two reactions by PCR using two sets of oligonucleotide primers. Set H (heavy chain) includes an oligo that specifically anneals to either human t or human yl (depending on the results of the ELISA) and an oligo that anneals to the oligo-X sequence. This prevents bias against detection of particular V segments, including mouse V segments that may have trans-rearranged into the human minilocus. A second set of primers, Set L (light chain), includes an oligo that specifically anneals to human K and an oligo that anneals specifically to oligo-X. The PCR products are molecularly cloned and the DNA sequence of several are determined to ascertain whether the hybridoma is producing a unique human antibody on the basis of sequence comparison to human and murine Ig sequences.

S. Example This example demonstrates production of a transgenic mouse harbouring a human light chain minilocus.

Human K Minilocus transgenic mice KC1 A 13 kb Xhol JK2-KK containing fragment from a phage clone (isolated from a human genomic DNA phage library by hybridisation to a K specific oligonucleotide, supra) was treated with Klenow enzyme and cloned into the Klenow treated Hindlll site of pGPld to produce pK-31. This destroyed the insert Xhol sites and positioned the unique polylinker derived Xhol site at the 5' end next to JK2. A unique polylinker derived Clal site is located between this Xhol site and the inset sequences, while a unique polylinker derived Sail site is located at the 3' end of the insert. A 7.5 kb Xhol fragment, containing JK1 and upstream sequences, was also isolated from a human genomic DNA phage clone (isolated from a human genomic DNA phage library by hybridisation to a K specific oligonucleotide, e.g. supra). This kb Xhol fragment was cloned into the Sail site of pSP72 (Promega, Madison, Wisconsin), thus destroying both Xhol sites and positioning a polylinker Clal site 3' of JK1. Digestion of the resulting clone with Clal released a 4.7 kb fragment containing Jd and 4.5 kb of upstream sequences.

This 4.7 kb fragment was cloned into the Clal site of pK-31 to create pKcor.

The remaining unique 5' Xhol site is derived from polylinker sequences. A 6.5 kb Xhol/Sall DNA fragment containing the unrearranged human Vidll gene segment 65.8 (plasmid p65.8, EXAMPLE 21) was cloned into the Xhol site of pKcor to [N:LIBCjO1115:ais 57 of generate the plasmid pKCI. The Notl insert of pKC1 was microinjected into 1/2 day mouse embryos to generate transgenic mice. Two independent pKC1 derived transgenic lines were established and used to breed mice containing both heavy and light chain miniloci. These lines, KC1-673 and KC1-674, were estimated by Southern blot hybridisation to contain integrations of approximately 1 and 10-20 copies of the transgenes respectively.

KCle The plasmid pMHE1 (EXAMPLES 13 and 18) was digested with BamHI and Hindlll to excise the 2.3 kb insert containing both the mouse and human heavy chain J-[i intronic enhancers. This fragment was Klenow treated, ligated to Sail linkers (New England Biolabs, Beverly, Massachusetts), and cloned into the unique 3' Sail site of pKC1 to generate the plasmid pKCle. The NotI insert of pKCle was microinjected into 1/2 day mouse embryos to generate transgenic mice. Four independent pKCle derived transgenic lines were established and used to breed mice containing both heavy and light chain miniloci. These lines, KC1e-1399, KC1e-1403, KCle-1527, and KC1e-1536, were estimated by Southern blot hybridisation to contain integrations of approximately 20-50, 5-10, 1-5, and copies of the transgene, respectively.

DKC2 20 A 6.8 kb Xhol/Sall DNA fragment containing the unrearranged human VKIII gene segment 65.5 (plasmid p65.5gl, EXAMPLE 21) was cloned into the unique Xhol site of pKC1 to generate the plasmid pKC2. This minilocus transgene contains two different functional V/dll gene segments. The Notl insert of pKC2 was microinjected into 1/2 day mouse embryos to generate transgenic mice. Five 25 independent pKC2 derived transgenic lines were established and used to breed mice containing both heavy and light chain miniloci. These lines, KC2-1573, KC2- 1579, KC2-1588, KC2-1608, and KC2-1610, were estimated by Southern blot hybridisation to contain integrations of approximately 1-5, 10-50, 1-5, 50-100, and 5-20 copies of the transgene, respectively.

Example 26 This example shows that transgenic mice bearing the human K transgene can make an antigen-induced antibody response forming antibodies comprising a functional human X chain.

Antibody Responses Associated with Human Ig K Light Chain A transgenic mouse containing the HC1-57 human heavy chain and KCle human K transgenes was immunised with purified human soluble CD4 (a human glycoprotein antigen). Twenty [Ig of purified human CD4 (NEN Research products, Westwood, MA) insolublised by conjugation to polystyrene latex particles (Polysciences, Warrington, PA) was injected intraperitoneally in saline with [N:\LIBC]01115:ais 58 of dimethyldioctadecyl ammonium bromide (Calbiochem, San Diego, CA) on Day 0, followed by further injections on Day 20 and Day 34.

Retro-orbital bleeds were taken on Days 25 and 40, and screened for the presence of antibodies to CD4, containing human IgM or human IgG heavy chain by ELISA. Briefly, purified human CD4 was coated onto PVC microtitre plates at pg/ml and incubated with culture supernate diluted 1:4/1:5 in PBS, 5% chicken serum. Plates were washed, followed by addition of horseradish peroxidase-conjugated goat antiserum specific for human IgG Fc or rabbit antiserum specific for human IgM Fc5Mu (Jackson ImmunoResearch, Westr Grove, PA). Presence of conjugate bound to captured antibody was determined after further washing by addition of ABTS substrate. Human p reactive with antigen was detected in both bleeds, while there was essentially undetectable y reactivity.

The Day 40 sample was also tested for antigen-reactive human K chain using the same assay with goat anti-human K peroxidase conjugate (Sigma, St. Louis, MO).

CD4-binding K reactivity was detected at this time point. The assay results are shown in Fig. 48.

*Example 27 This example shows the successful generation of mice which are homozygous for functionally disrupted murine heavy and light chain loci (heavy chain and K chain loci) and which concomitantly harbour a human heavy chain .transgene and a human light chain transgene capable of productively rearranging to encode functional human heavy chains and functional human light chains. Such mice are termed "0011" mice, indicating by the two O's in the first two digits that the mice lack functional heavy and light chain loci and indicating by the 1's in the second two digits that the mice are hemizygous for a human heavy chain transgene and a human light chain transgene. This example shows that such 0011 mice are capable of making a specific antibody response to a predetermined antigen, and that such an antibody response can involve isotype switching.

0011/0012 Mice: Endogenous Ig Knockout Human Ig Transgenes Mice which were homozygous for a functionally disrupted endogenous heavy chain locus lacking a functional JH region (designated JHD++ or JHA++) and also harbouring the human HC1 transgene, such as the HC1-26 transgenic mouse line described supra, were interbred with mice homozygous for a functionally disrupted endogenous kappa chain locus lacking a functional JH region (designated here as JKD++ or JKA++; see Example 9) to produce mice homozygous for functionally disrupted heavy chain and kappa chain loci (heavy chain/kappa chain knockouts), designated as JHD++/JKD++ and containing a HC1 transgene. Such mice were produced by interbreeding and selected on the basis of genotype as evaluated by Southern blot of genomic DNA. These mice, designated HC1-26+/JKD++/JHD++ mice, were interbred with mice harbouring a human kappa chain transgene (lines [N:\LIBCO01115:ais 59 of KC2-1610, KC1e-1399, and KC1e-1527; see Example 25), and Southern blot analysis of genomic DNA was used to identify offspring mice homozygous for functionally disrupted heavy and light chain loci and also hemizygous for the HC1 transgene and the KC2 or KCle transgene. Such mice are designated by numbers and were identified as to their genotype, with the following abbreviations: HC1-26+ indicates hemizygosity for the HC1-26 line human heavy chain minilocus transgene integration; JHD++ indicates homozygosity for JH knockout; JKD++ indicates homozygosity for JK knockout; KC2-1610+ indicates hemizygosity for a KC2 human ctransgene integrated as in line KC2-1610; KC1e-1527+ indicates hemizygosity for a KCle human Kctransgene integrated as in line KC1e-1527; KCIe-1399+ indicates hemizygosity for a KCle human Ktransgene integrated as in line KC1e-1399.

The resultant individual offspring were each given a numerical designation 6295, 6907, etc.) and each was evaluated for the presence of JH knockout alleles, JK knockout alleles, HC1-26 transgene, and K transgene (KC2 or KCle) and determined to be either hemizygous or homozygous at each locus.

00 00 0 060 0. 0 .00.

0 a 00 0@ .00.

Goes 00 0 @0

S

Table 10 shows the offspring mice.

number designation, sex, and genotypes of several of the ID No. Se: 6295 M 6907 M 7086 F 7088 F 7397 F 7494 F 7497 M 7648 F 7649 F 7654 F 7655 F 7839 F 7656 F 7777 F We removed x Ig Code 0011 0011 0011 0011 0011 0012 0011 0011 0012 0011 0011 0011 0001 1100 Table Genotype HC1-26+;JHD++;JKD++;KC2-1610+ HCI-26+;JHD++;JKD++;KC1e-1527+ HC1-26+;JHD++;JKD++;KC1e-1399+ HC1-26+;JHD++;JKD++;KC1 e-1399+ HC1-26+;JHD++;JKD++;KC1 e-1527+ HC1-26+;JHD++;JKD++;KC2-1610++ HC1-26+;JHD++;JKD++;KC1e-1399+ HC1-26+;JHD++;JKD++;KC2-1610+ HC1-26+;JHD++;JKD++;KC2-1610++ HC1-26+;JHD++;JKD++;KC2-1610+ HC1-26+;JHD++;JKD++;KC2-1610+ HC1-26+;JHD++;JKD++;KC1e-1399+ HC1-26-;JHD++;JKD++;KC2-1610+ Col-2141-;JHD+;JKD+

S.

00 S

S

00 S @0 00 spleens from three 6 week old female mice. Mouse 7655 was determined by Southern blot hybridisation to be hemizygous for the HC1 (line 26) and KC2 (line 1610) transgene integrations, and homozygous for the JHA and JKA targeted deletions of the mouse [t and KJ regions. Mouse 7656 was determined by Southern blot hybridisation to be hemizygous for the KC2 (line 1610) transgene integration and homozygous for the JHA and JKA targeted deletions of the mouse i and KJ regions. Mouse 7777 was determined by Southern blot hybridisation to be hemizygous for the JHA and JrKA targeted deletions of the mouse L and KJ [N:\LIBCI01115:ais 60 of regions. Because of the recessive nature of these deletions, this mouse should be phenotypically wild-type.

Expression of Endogenous Ig Chains in 0011 Mice FACS analysis using a panel of antibodies reactive with either human i, mouse I, human K, mouse K, or mouse i was used to sort lymphocytes explanted from a wildtype mouse (7777), a 0001 mouse homozygous for heavy chain and kappa knockout alleles and harbouring a human light chain transgene (7656), and a 0011 mouse homozygous for heavy chain and kappa knockout alleles and harbouring a human light chain transgene and a human heavy chain transgene (7655).

We prepared single cell suspensions from spleen and lysed the red cells with

NH

4 CI, as described by Mishell and Shiigi (Mishell, B.B. Shiigi, S.M. (eds) Selected Methods in Cellular Immunology. W.H. Freeman Co., New York, 1980).

The lymphocytes are stained with the following reagents: propidium iodide (Molecular Probes, Eugene, OR), FITC conjugated anti-human IgM (clone 127; Pharmingen, San Diego, CA), FITC conjugated anti-mouse IgM (clone R6- 60.2; Pharmingen, San Diego, CA), phycoerythrin conjugated anti-human IgK (clone HP6062; CalTag, South San Francisco, CA), FITC conjugated anti-mouse Ig? (clone R26-46; Pharmingen, San Diego, CA) FITC conjugated anti-mouse B220 i 20 (clone RA3-6B2; Pharmingen, San Diego, CA), and Cy-Chrome conjugated antimouse B220 (clone RA3-6B2; Pharmingen, San Diego, CA). We analysed the stained cells using a FACScan flow cytometer and LYSIS II software (Becton Dickinson, San Jose, CA). Macrophages and residual red cells are excluded by gating on forward and side scatter. Dead cells are excluded by gating out 25 propidium iodide positive cells. The flow cytometric data in Figs. 49 and confirms the Southern blot hybridisation data and demonstrates that mouse 7655 expresses both human t and human K and relatively little if any mouse p or mouse K. Nevertheless a significant fraction of the B cells (about 70-80%) appear to express hybrid Ig receptors consisting of human heavy and mouse X light chains.

Fig. 49 shows the relative distribution of B cells expressing human p. or mouse p on the cell surface; 0011 mouse (7655) lymphocytes are positive for human p but relatively lack mouse p; 0001 mouse (7656) lymphocytes do not express much human p. or mouse wildtype mouse (7777) lymphocytes express mouse p but lack human p.

Fig. 50 shows the relative distribution of B cells expressing human K or mouse Kon the cell surface; 0011 mouse (7655) lymphocytes are positive for human K but relatively lack mouse K; 0001 mouse (7656) lymphocytes do not express much human K or mouse K; wildtype mouse (7777) lymphocytes express mouse K but lack human K.

[N:\LIBC]01115:ais 61 of Fig. 51 shows the relative distribution of B cells expressing mouse X on the cell surface; 0011 mouse (7655) lymphocytes are positive for mouse X; 0001 mouse (7656) lymphocytes do not express significant mouse X; wildtype mouse (7777) lymphocytes express mouse X but at a relatively lower level than the 0011 mouse (7655).

Fig. 52 shows the relative distribution of B cells positive for endogenous mouse X as compared to human K (transgene-encoded). The upper left panel shows the results of cells from a wildtype mouse possessing functional endogenous heavy and light chain alleles and lacking human transgene(s); the cells are positive for mouse lambda. The upper right panel shows cells from a mouse (#5822) having a K knockout background and harbouring the human K transgene integration of the KCle-1399 line; the cells are positive for human K or mouse X in roughly proportional amounts. The lower left panel shows cells from a mouse (#7132) having a K knockout background and harbouring the human Ktransgene integration of the KC2-1610 line; more cells are positive for mouse X than for human K, possibly indicating that the KC2-1610 transgene integration is less efficient than the KCle-1399 transgene integration.

The lower right panel shows cells from a mouse harbouring a human K minilocus transgene (KCo4) and lacking a functional endogenous murine K allele. The data 20 presented in Fig. 52 also demonstrates the variability of phenotypic expression between transgenes. Such variability indicates the desirability of selecting for individual transgenes and/or transgenic lines which express one or more desired phenotypic features resulting from the integrated transgene isotype switching, high level expression, low murine Ig background). Generally, single or multiple 25 transgene species pKCle, pKC2, KCo4) are employed separately to form multiple individual transgenic lines differing by: transgene, site(s) of transgene integration, and/or genetic background. Individual transgenic lines are examined for desired parameters, such as: capability to mount an immune response to a predetermined antigen, frequency of isotype switching within transgene-encoded constant regions and/or frequency of trans-switching to endogenous murine) Ig constant region genes expression level of transgene-encoded immmunoglobulin chains and antibodies, expression level of endogenous murine) immunoglobulin immunoglobulin sequences, and frequency of productive VDJ and VJ rearrangement. Typically, the transgenic lines which produce the largest concentrations of transgene-encoded human) immunoglobulin chains are selected; preferably, the selected lines produce about at least 40 pg/ml of transgene-encoded heavy chain human t or human X) in the serum of the transgenic animal and/or about at least 100 tg/ml of transgeneencoded light chain human K).

[N:\LIBC101115:ais 62 of Mice were examined for their expression of human and murine immmunoglobulin chains in their unimmunised serum and in their serum following immunisation with a specific antigen, human CD4. Fig. 53 shows the relative expression of human p, human y, murine p, murine y, human K, murine K, and murine chains present in the serum of four separate unimmunised 0011 mice of various genotypes (nt not tested); human K predominates as the most abundant light chain, and human p and murine a (putatively a product of trans-switching) are the most abundant heavy chains, with variability between lines present, indicating the utility of a selection step to identify advantageous genotypic combinations that minimise expression of murine chains while allowing expression of human chains.

Mice #6907 and 7088 show isotype switching (cis-switching within the transgene) from human t to human y.

Fig. 54 shows serum immunoglobulin chain levels for human p (hup), human y (huy), human K (huK), murine p (msp murine y (msy), murine K and murine X (msX) in mice of the various 0011 genotypes.

Specific Antibody Response in 0011 Mice An 0011 mouse (#6295) was immunised with an immunogenic dose of human CD4 according to the following immunisation schedule: Day 0, intraperitoneal injection of 100 pl of CD4 mouse immune serum; Day 1, inject 20 g of human CD4 20 (American Bio-Tech) on latex beads with DDA in 100 p1; Day 15 inject 20 pg of human CD4 (American Bio-Tech) on latex beads with DDA in 100 pl; Day 29 inject 20 pg of human CD4 (American Bio-Tech) on latex beads with DDA in 100 pl; Day .43 inject 20 pg of human CD4 (American Bio-Tech) on latex beads with DDA in 100 t1.

S 25 Fig. 55 shows the relative antibody response to CD4 immunisation at 3 weeks and 7 weeks demonstrating the presence of human p, human K, and human y chains in the anti-CD4 response. Human y chains are present at significantly increased abundance in the 7 week serum, indicating that cis-switching within the heavy chain transgene (isotype switching) is occurring in a temporal relationship similar to that of isotype switching in a wildtype animal.

Fig. 56 shows a schematic compilation of various human heavy chain and light chain transgenes.

Example 28 This example provides for the targeted knockout of the murine X light chain locus. Targeted Inactivation of the Murine Lambda Light Chain Locus Unlike the Ig heavy and kappa light chain loci, the murine VXJX and CX gene segments are not grouped into 3 families arranged in a 5' to 3' array, but instead are interspersed. The most 5' portion consists of two V segments (vX2 and vXX) which are followed, proceeding in a 3' direction, by two constant region exons, each associated with its own J segment (JX2CX2 and the pseudogene JX4CX4). Next is [N:\LIBC]01115:ais 63 of the most extensively used V segment (VX1) which is followed by the second cluster of constant region exons (JX3CX3 and JXICkI,). Overall the locus spans approximate 200 kb, with intervals of -20-90 kb between the two clusters.

Expression of the lambda locus involves rearrangement of VX2 or VXX predominantly to JX2 and only rarely further 3' to JX3 or JX1. VX1 can recombine with both JX3 and J1l. Thus the lambda locus can be mutated in order to fully eliminate recombination and expression of the locus.

The distance between the two lambda gene clusters makes it difficult to inactivate expression of the locus via the generation of a single compact targeted deletion, as was used in inactivating the murine Ig heavy and kappa light chain loci.

Instead, a small single deletion which would eliminate expression lambda light chains spans approximately 120 kb, extending from JX2CX2 to JMICI (Fig. 57).

This removes all of the lambda constant region exons as well as the Vk1 gene segment, ensuring inactivation of the locus.

Replacement type targeting vectors (Thomas and Capecchi (1987) op.cit) are constructed in which the deleted 120 kb is replaced with the selectable marker gene, neo, in a PGK expression cassette. The marker is embedded within genomic lambda sequences flanking the deletion to provide homology to the lambda locus and can also contain the HSV-tk gene, at the end of one of the regions of *i 20 homology, to allow for enrichment for cells which have homologously integrated the vectors. Lambda locus genomic clone sequences are obtained by screening of a strain 129/Sv genomic phage library isogenic to the ES line being targeted, since S...the use of targeting vectors isogenic to the chromosomal DNA being targeted has been reported to enhance the efficiency of homologous recombination. Targeting 25 vectors are constructed which differ in their lengths of homology to the lambda locus. The first vector (vector 1 in Fig. 58) contains the marker gene flanked by total of approximately 8-12 kb of lambda locus sequences. For targeting events in .i which replacement vectors mediate addition or detection of a few kb of DNA this has been demonstrated to be a more than sufficient extent of homology (Hasty et al. (1991) op.cit; Thomas et al.(1992) op.cit.). Vectors with an additional approximately 40-60 kb of flanking lambda sequence are also constructed (vector 2 in Fig. 58). Human Ig miniloci of at least 80 kb are routinely cloned and propagated in the plasmid vector pGP1 (Taylor et al. (1993) op.cit).

An alternative approach for inactivation of the lambda locus employs two independent mutations, for example mutations of the two constant region clusters or of the two V region loci, in the same ES cell. Since both constant regions are each contained within -6 kb of DNA, whereas one of the V loci spans -19 kb, targeting vectors are constructed to independently delete the JX2CX2/JX4CX4 and the JX3CX3/JX1CX1 loci. As shown in Fig. 58, each vector consists of a selectable marker neo or pac) in a PGK expression cassette, surrounded by a total of [N:\LIBC]o0 1 15:ais 64 of 8-12 kb of lambda locus genomic DNA blanking each deletion. The HSV-tk gene can be added to the targeting vectors to enrich for homologous recombination events by positive-negative selection. ES cells are targeted sequentially with the two vectors, such that clones are generated which carry a deletion of one of the constant region loci; these clones are then targeted sequentially with the two vectors, such that clones will be generated which carry a deletion of one of the constant region loci, and these clones are then targeted to generate a deletion of the remaining functional constant region cluster. Since both targeting events are thus being directed to the same cell, it is preferable to use a different selectable marker for the two targetings. In the schematic example shown in Fig. 58, one of the vectors contains the neo gene and the other the pac (puromycin N-acetyl transferase) gene. A third potential dominant selectable marker is the hyg (hygromycin phosphotransferase) gene. Both the pac and hyg genes can be been inserted into the PGK expression construct successfully used for targeting the neo gene into the Ig heavy and kappa light chain loci. Since the two lambda constant region clusters are tightly linked, it is important that the two mutations reside on the same chromosome. There preferably is a 50% probability of mutating the same allele by two independent targeting events, and linkage of the mutations is established by their co-segregation during breeding of chimeras derived from the 20 doubly targeted ES cells.

Example 28 This example provides for the targeted knockout of the murine heavy chain locus.

Targeted Inactivation of the Murine Heavy Chain Locus A homologous recombination gene targeting transgene having the structure shown in Fig. 59 is used to delete at least one and preferably substantially all of the murine heavy chain locus constant region genes by gene targeting in ES cells. Fig.

59 shows a general schematic diagram of a targeting transgene. Segment is a cloned genomic DNA sequence located upstream of the constant region gene(s) to be deleted proximal to the JH genes); segment comprises a positive selection marker, such as pgk-neo; segment is a cloned genomic DNA sequence located downstream of the constant region gene(s) to be deleted (i.e, distal to the constant region gene(s) and JH genes); and segment which is optional, comprises a negative selection marker gene HSV-tk). Fig. 60 shows a map of the murine heavy chain locus as taken from Immunoglobulin Genes, Honjo, T, Alt, FW, and Rabbits TH (eds.) Academic Press, NY (1989) p. 129.

A targeting transgene having a structure according to Fig. 59, wherein: the segment is the 11.5 kb insert of clone JH8.1 (Chen et al. (1993) Int. Immunol.

647) or an equivalent portion comprising about at least 1-4 kb of sequence located upstream of the murine CCi gene, the segment is pgk-neo as (N:\LIBC]01115:ais 65 of described supra, the segment comprises the 1674 bp sequence shown in Fig. 61 or a 4-6 kb insert isolated from a phage clone of the mouse Ca gene isolated by screening a mouse genomic clone library with the end-labelled oligonucleotide having the sequence: 5'-gtg ttg cgt gta tca gct gaa acc tgg aaa cag ggt gac cag-3' and the segment comprises the HSV-tk expression cassette described supra.

Alternatively, a stepwise deletion of one or more heavy chain constant region genes is performed wherein a first targeting transgene comprises homology regions, segments and homologous to sequences flanking a constant region gene or genes, a first species of positive selection marker gene (pgk-neo), and an HSV-tk negative selection marker. Thus, the segment can comprise a sequence of at least about 1-4 kb and homologous to a region located upstream of Cy3 and the segment can comprise a sequence of at least about 1-4 kb and homologous to a region located upstream of Cy2a. This targeting transgene deletes the Cy3, Cyl, Cy2b, and Cy2a genes. This first targeting transgene is introduced into ES cells and correctly targeted recombinants are selected with G418), producing a correctly targeted C region deletion. Negative selection for loss of the HSV-tk cassette is then performed with ganciclovir or FIAU). The resultant correctly targeted first round C deletion recombinants have a heavy chain locus 20 lacking the Cy3, Cyl, Cy2b, and Cy2a genes.

A second targeting transgene comprises homology regions, segments (a) and homologous to sequences flanking a constant region gene or genes, a second species of positive selection marker gene different that the first species gpt or pac), and an HSV-tk negative selection marker. Thus, the segment 25 can comprise a sequence of at least about 1-4 kb and homologous to a region located upstream of CE and the segment can comprise a sequence of at least about 1-4 kb and homologous to a region located upstream of Ca. This targeting transgene deletes the Ce and Caa genes.

This second targeting transgene is introduced into the correctly targeted Cregion recombinant ES cells obtained from the first targeting event. Cells which are correctly targeted for the second knockout event by homologous recombination with the second targeting transgene) are selected for with a selection drug that is specific for the second species of positive selection marker gene mycophenolic acid to select for gpt; puromycin to select for pac).

Negative selection for loss of the HSV-tk cassette is then performed with ganciclovir or FIAU). These resultant correctly targeted second round C region recombinants have a heavy chain locus lacking the Cy3, Cy1, Cy2b, Cy2a, Cc, and Ca genes.

Correctly targeted first-round or second-round recombinant ES cells lacking one or more C region genes are used for blastocyst injections as described (supra) [N:\LIBC]01115:ais 66 of and chimeric mice are produced. Germline transmission of the targeted heavy chain alleles is established, and breeding of the resultant founder mice is performed to generate mice homozygous for C-region knockouts. Such C-region knockout mice have several advantages as compared to JH knockout mice; for one example, C-region knockout mice have diminished ability (or completely lack the ability) to undergo trans-switching between a human heavy chain transgene and an endogenous heavy chain locus constant region, thus reducing the frequency of chimeric human/mouse heavy chains in the transgenic mouse. Knockout of the murine gamma genes is preferred, although [t and delta are frequently also deleted by homologous targeting. C-region knockout can be done in conjunction with other targeted lesions in the endogenous murine heavy chain locus; a C-region deletion can be combined with a JH knockout to preclude productive VDJ rearrangement of the murine heavy chain locus and to preclude or reduce trans-switching between a human heavy chain transgene and the murine heavy chain locus, among others.

For some embodiments, it may be desirable to produce mice which specifically lack one or more C-region genes of the endogenous heavy chain locus, but which retain certain other C-region genes; for example, it may be preferable to retain the murine Ca gene to allow to production of chimeric human/mouse IgA by trans-switching, if such IgA confers an advantageous phenotype and does not substantially interfere 20 with the desired utility of the mice.

Example 29 This example demonstrates ex vivo depletion of lymphocytes expressing an endogenous (murine) immunoglobulin from a lymphocyte sample obtained from a transgenic mouse harbouring a human transgene. The lymphocytes expressing murine Ig are selectively depleted by specific binding to an anti-murine S. immunoglobulin antibody that lacks substantial binding to human immunoglobulins encoded by the transgene(s).

Ex Vivo Depletion of Murine Ig-Expressing B-cells A mouse homozygous for a human heavy chain minilocus transgene (HC2) and a human light chain minilocus transgene (KCo4) is bred with a C57BL/6 (B6) inbred mouse to obtain 2211 mice mice which: are homozygous for a functional endogenous murine heavy chain locus, are homozygous for a functional endogenous murine light chain locus, and which possess one copy of a human heavy chain transgene and one copy of a human light chain transgene). Such 2211 mice also express B6 major and minor histocompatibility antigens. These mice are primed with an immunogenic dose of an antigen, and after approximately one week spleen cells are isolated. B cells positive for murine Ig are removed by solid phasecoupled antibody-dependent cell separation according to standard methods (Wysocki et al. (1978) Proc. Natl. Acad. Sci. 75: 2844; MACS magnetic cell sorting, Miltenyi Biotec Inc., Sunnyvale, CA), followed by antibody-dependent [N:\LIBC]01115:ais 67 of complement-mediated cell lysis (Selected Methods in Cellular Immunology, Mishell BB and Shiigi SM W.H. Freeman and Company, New York, 1980, pp.211-212) to substantially remove residual cells positive for murine Ig. The remaining cells in the depleted sample T cells, B cells positive for human Ig) are injected preferably together with additional anti-murine Ig antibody to deplete arising B cells, into a SCID/B6 or RAG/B6 mouse. The reconstituted mouse is then further immunised for the antigen to obtain antibody and affinity matured cells for producing hybridoma clones.

Example Production of Fully Human Antibodies in Somatic Chimeras A method is described for producing fully human antibodies in somatic chimeric mice. These mice are generated by introduction of embryonic stem (ES) cells, carrying human immunoglobulin (Ig) heavy and light chain transgenes and lacking functional murine Ig heavy and kappa light chain genes, into blastocysts from RAG-1 or RAG-2 deficient mice.

RAG-1 and RAG-2 deficient mice (Mombaerts et al. (1992) Cell 68: 869; Shinkai et al. (1992) Cell 68: 855) lack murine B and T cells due to an inability to initiate VDJ rearrangement and to assemble the gene segments encoding Igs and T cell receptors (TCR). This defect in B and T cell production can be complemented by injection of wild-type ES cells into blastocysts derived from RAG- 2 deficient animals. The resulting chimeric mice produce mature B and T cells S* derived entirely from the injected ES cells (Chen et al. (1993) Proc. Natl. Acad.

Sci. USA 90: 4528).

Genetic manipulation of the injected ES cells is used for introducing defined 25 mutations and/or exogenous DNA constructs into all of the B and/or T cells of-the chimeras. Chen et al. (1993), Proc. Natl. Acad. Sci. USA 90:4528-4532) generated ES cells carrying a homozygous inactivation of the Ig heavy chain locus, which, when injected into RAG blastocysts, produced chimeras which made T cells in the absence of B cells. Transfection of a rearranged murine heavy chain into the mutant ES cells results in the rescue of B cell development and the production of both B and T cells in the chimeras.

Chimeric mice which express fully human antibodies in the absence of murine Ig heavy chain or kappa light chain synthesis can be generated. Human Ig heavy and light chain constructs are introduced into ES cells homozygous for inactivation of both the murine Ig heavy and kappa light chain genes. The ES cells are then injected into blastocysts derived from RAG2 deficient mice. The resulting chimeras contain B cells derived exclusively from the injected ES cells which are incapable of expressing murine Ig heavy and kappa light chain genes but do express human Ig genes.

[N:\LIBC]01115:ais 68 of Generation of ES cells Homozygous for Inactivation of the Immunoglobulin Heavy and Kappa Light Chain Genes Mice bearing inactivated Ig heavy and kappa light chain loci were generated by targeted deletion, in ES cells, of Ig JH and JK/CK sequences, respectively according to known procedures (Chen et al. (1993) EMBO J. 12: 821; and Chen et al. (1993) Int. Immunol. op.cit). The two mutant strains of mice were bred together to generate a strain homozygous for inactivation of both Ig loci. This double mutant strain was used for derivation of ES cells. The protocol used was essentially that described by Robertson (1987, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, p. 71-112, edited by E.J. Robertson, IRL Press). Briefly, blastocysts were generated by natural matings of homozygous double mutant mice. Pregnant females were ovariectomised on day 2.5 of gestation and the "delayed" blastocysts were flushed from the uterus on day 7 of gestation and cultured on feeder cells, to help maintain their undifferentiated state. Stem cells from the inner cell mass of the blastocysts, identifiable by their morphology, were picked, dissociated, and passaged on feeder cells. Cells with a normal karyotype were identified, and male cell lines will be tested for their ability to generate chimeras and contribute to the germ cells of the mouse. Male ES cells are preferable to female lines since a male chimera can produce significantly more 20 offspring.

Introduction of Human Ig Genes into Mouse Ig Heavy and Kappa Light Chain Deficient ES cells Human immunoglobulin heavy and light chain genes are introduced into the mutant ES cells as either minilocus constructs, such as HC2 and KC-C04, or as 25 YAC clones, such as J1.3P. Transfection of ES cells with human Ig DNAs is carried out by techniques such as electroporation or lipofection with a cationic lipid. In order to allow for selection of ES cells which have incorporated the human DNA, a selectable marker either is ligated to the constructs or is co-transfected with the constructs into ES cells. Since the mutant ES cells contain the neomycin phosphotransferse (neo) gene as a result of the gene targeting events which generated the Ig gene inactivations, different selectable markers, such as hygromycin phosphotransferase (hyg) or puromycin N-acetyl transferase (pac), are used to introduce the human Ig genes into the ES cells.

The human Ig heavy and light chain genes can be introduced simultaneously or sequentially, using different selectable markers, into the mutant ES cells.

Following transfection, cells are selected with the appropriate selectable marker and drug-resistant colonies are expanded for freezing and for DNA analysis to verify and analyse the integration of the human gene sequences.

[N:\LIBC]01115:ais 69 of Generation of Chimeras ES clones containing human Ig heavy and light chain genes are injected into RAG-2 blastocysts as described (Bradley, A. (1987), in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, p. 113-151, edited by E.J. Robertson, IRL Press) and transferred into the uteri of pseudopregnant females. Offspring are screened for the presence of human antibodies by ELISA assay of serum samples.

Positive animals are used for immunisation and the production of human monoclonal antibodies.

Example 31 This example describes the introduction, via homologous recombination in ES cells, of a targeted frameshift mutation into the murine heavy chain locus leading to a deletion of B cells which undergo switch recombination. The frameshifted mice are suitable hosts for harbouring non-murine human) transgenes encoding human sequence immunoglobulins.

The novel frameshifted mice can be used for expressing non-murine human) sequence immunoglobulins encoded by heavy chain transgene(s) and/or light chain transgene(s), and for the isolation of hybridomas expressing classswitched, affinity matured, human sequence antibodies from introduced transgenes, among other uses. A frameshift is introduced into one of the four 20 mouse JH gene segments and into the first exon of the mouse p gene. The two introduced frameshift mutations compensate for each other thus allowing for the expression of fully functional murine t heavy chain when a B cell uses the frameshifted JH for a functional VDJ joint. None of the other three JH segments can be used for functional VDJ joining because of the frameshift in which is not compensated in the remaining JH genes. Alternatively, compensating frameshifts can be engineered into multiple murine JH genes.

A mouse homozygous for a compensated, frameshifted immunoglobulin heavy chain allele has an approximately physiological level of peripheral B cells, and an approximately physiological level of serum IgM comprising both murine and human p. However, B cells recruited into germinal centers frequently undergo a class switch to a non-,p isotype. Such a class switch in B cells expressing the endogenous murine p. chain leads to the expression of a non-compensated frameshift mRNA, since the remaining non-pi CH genes do not possess a compensating frameshift. The resulting B cells do not express a B cell receptor and are deleted. Hence, B cells expressing a murine heavy chain are deleted once they reach the stage of differentiation where isotype switching occurs. However, B cells expressing heavy chains encoded by a non-murine human) transgene capable of isotype switching and which does not contain such isotype-restrictive frameshifts are capable of further development, including isotype switching and/or affinity maturation, and the like.

[N:\LIBC]01115:ais 70 of Therefore, the frameshifted mouse has an impaired secondary response with regard to murine heavy chain p) but a significant secondary response with regard to transgene-encoded heavy chains. If a heavy chain transgene that is capable of undergoing class switching is introduced into this mutant background, the non-lgM secondary response is dominated by transgene expressing B cells. It is thus possible to isolate affinity matured human sequence immunoglobulin expressing hybridomas from these frameshifted mice. Moreover, the frameshifted mice generally possess immunoprotective levels of murine IgM, which may be advantageous where the human heavy chain transgene can encode only a limited repertoire of variable regions.

For making hybridomas secreting human sequence monoclonal antibodies, transgenic mutant mice are immunised; their spleens fused with a myeloma cell line; and the resulting hybridomas screened for expression of the transgene encoded human non-p isotype. Further, the frameshifted mouse may be advantageous over a JH deleted mouse because it will contain a functional p switch sequence adjacent to a transcribed VDJ which serves as an active substrate for cis- switching (Gu et al. (1993) Cell 73: 1155); thus reducing the level of transswitched B cells that express chimeric human/mouse antibodies.

Construction of Frameshift Vectors 20 Two separate frameshift vectors are built. One of the vectors is used to introduce 2 nucleotides at the 3' end of the mouse J4 gene segment, and one of the vectors is used to delete those same two nucleotides from the 5' end of exon 1 of the mouse p gene.

1. JH vector.

25 A 3.4 kb Xhol/EcoRI fragment covering the mouse heavy chain J region and the l intronic enhancer is subcloned into a plasmid vector that contains a neomycin resistance gene as well as a herpes thymidine kinase gene under the control of a phosphoglycerate kinase promoter (tk/neo cassette; Hasty et al., (1991) Nature 350: 243). This clone is then used as a substrate for generating 2 different PCR fragments using the following oligonucleotide primers: o-A1 cca cac tct gca tgc tgc aga agc ttt tct gta -3' o-A2 ggt gac tga ggt acc ttg acc cca gta gtc cag -3' o-A3 ggt tac ctc agt cac cgt ctc ctc aga ggt aag aat ggc ctc -3' o-A4 agg ctc cac cag acc tct cta gac agc aac tac -3' Oligonucleotides o-A1 and o-A2 are used to amplify a 1.2 kb fragment which is digested with Sphl and Kpnl. Oligonucleotides o-A3 and o-A4 are used to amplify a 0.6 kb fragment which is digested with KpnI and Xbal. These two digested fragments are then cloned into Sphl/Xbal digested plasmid A to produce plasmid B.

IN:\LIBCI01115:ais 71 of Plasmid B contains the 2 nucleotide insertion at the end of the J4 and, in addition, contains a new Kpnl site upstream of the insertion. The Kpnl site is used as a diagnostic marker for the insertion.

Additional flanking sequences may be cloned into the 5' Xhol site and the 3' EcoRI site of plasmid B to increase its homologous recombination efficiency. The resulting plasmid is then digested with Sphl, or another restriction enzyme with a single site within the insert, and electroporated into embryonic stem cells which are then selected with G418 as described by Hasty et al. (1991) op.cit. Homologous recombinants are identified by Southern blot hybridisation and then selected with FIAU as described by Hasty et al. to obtain deleted subclones which contain only the 2 base pair insertion and the new Kpnl site in JH4. These are identified by Southern blot hybridisation of Kpnl digested DNA and confirmed by DNA sequence analysis of PCR amplified JH4 DNA.

The resulting mouse contains a JH4 segment that has been converted from the unmutated sequence: TGGGGTCAAGG_ACCTCAGTCACCGTCTCCTCAG_gtaagaatggcctctcc...

TrpGlyGlnGlyThrSerValThrVAISerSerGlu to the mutant sequence: TGGGGTCAAGGTACCTCAGTCACCGTCTCCTCAGAGgtaagaatggcctctcc...

S: 20 TrpGlyGlnGlyThrSerValThrVAISerSerGlu p Exon 1 Vector .i Using similar in vitro mutagenesis methodology described above to engineer S a two base pair insertion into the JH4 gene segment, PCR products and genomic subclones are assembled to create a vector containing a two base pair deletion at 25 the 5' end of the first (t exon. In addition, to mark the mutation, a new Xmnl site is also introduced downstream by changing an A to a G.

The sequence of the unmutated t gene is: ctggtcctcagAGAGTCAGTCCTTCCCAAATGTCTTCCCCCTCGTC...

GluSerGlnSerPheProAsnValPheProLeuVal The sequence of the mutated t gene is: Xmnl ctggtcstcag_ AGTCAGTCCTTCCCGAATGTCTTCCCCCTCGTC...

SerGlnSerPheProAsnValPheProLeuVal The homologous recombination vector containing the mutant sequence is linearised and electroporated into an ES cell line containing the JH4 insertion.

Homologous recombinants are identified from neomycin-resistant clones. Those homologous recombinants that contain the frameshift insertion on the same chromosome as the JH4 insertion are identified by Southern blot hybridisation of Kpnl/BamHI digested DNA. The JH4 insertion is associated with a new Kpnl site that reduces the size of the J- t intron containing Kpnl/BamHI fragment from the wild type 11.3 kb to a mutant 9 kb. The resulting clones are then selected for [N:\LIBC]01115:ais 72 of deletion of the inserted tk/neo cassette using FIAU. Clones containing the mutant I exon are identified by Southern blot hybridisation of Xmnl digested DNA. The mutation is confirmed by DNA sequence analysis of PCR amplified V exonl DNA.

Generation of Frameshifted Mice.

The ES cell line containing both the two base pair insertion in JH4, and the two base pair deletion in tp exon 1, is then introduced into blastocyst stage embryos which are inserted into pseudopregnant females to generate chimeras. Chimeric animals are bred to obtain germline transmission, and the resulting animals are bred to homozygosity to obtain mutant animals homozygous for compensated frameshifted heavy chain loci and having impaired secondary humeral immune responses in B cells expressing murine heavy chains.

A human heavy chain transgene, such as for example pHC1 or pHC2 and the like, may be bred into the murine heavy chain frameshift background by crossbreeding mice harbouring such a human transgene into mice having the frameshifted murine IgH locus. Via interbreeding and backcrossing, mice homozygous at the murine IgH locus for p-compensated frameshifted murine IgH alleles capable of compensated in-frame expression of only murine i and not murine non-p chains) and harbouring at least one integrated copy of a functional i o human heavy chain transgene pHC1 or pHC2) are produced. Such mice may 20 optionally contain knockout of endogenous murine K and/or X loci as described supra, and may optionally comprise a human or other non-murine light chain transgene pKCle, pKC2, and the like).

Alternatively, the human transgene(s) (heavy and/or light) may comprise compensating frameshifts, so that the transgene J gene(s) contain a frameshift that 25 is compensated by a frameshift in the transgene constant region gene(s). Transswitching to the endogenous constant region genes is uncompensated and produces a truncated or nonsense product; B cells expressing such uncompensated trans-switched immunoglobulins are selected against and depleted.

Example 32 Endogenous Heavy Chain Inactivation by D Region Ablation This example describes a positive-negative selection homologous recombination vector for replacing the mouse germline immunoglobulin heavy chain D region with a nonfunctional rearranged VDJ segment. The resulting allele functions within a B cell as a normal non-productive allele, with the allele undergoing intra-allele heavy chain class switching, thereby reducing the level of trans-switching to an active transgene locus.

D Region Targeting Construct An 8-15 kb DNA fragment located upstream of the murine D region is isolated and subcloned from a mouse strain 129 phage library using an oligonucleotide [N:\LIBC]01115:ais 73 of probe comprising approximately 50 consecutive nucleotides of the published sequence for the DFL16.1 segment listed in GenBank. DFL16.1 is the upstream D segment proximal to the V region gene cluster and distal to the constant region gene cluster).

Similarly, a 9.5 kb BamHI fragment containing JH3, JH4, Ei, SI, and the first two coding exons of the p constant region is isolated and subcloned from a mouse strain 129 genomic phage library.

A 5-10 kb rearranged VDJ is then isolated from a mouse hybridoma (any strain) and a synthetic linker containing a stop codon is inserted into the J segment.

The stop linker within the J is preferable to an out-of-frame VDJ junction because of the possibility of V replacement rearrangements.

These three fragments are assembled together with a PGKneo positive selection cassette and a PGKHSVtk negative selection cassette to form a positivenegative selection vector for eliminating the mouse D region in 129-derived ES cells AB1) by homologous recombination. The targeting vector is formed by ligating the 8-15 kb DNA fragment to the positive selection cassette PGKneo), which is itself ligated to the rearranged 5-10 kb rearranged VDJ, which is itself ligated to the 9.5 kb BamHI fragment; the negative selection cassette PGKHSVtk) is then ligated at either end of the targeting construct. The construction S 20 of such a D region targeting vector is shown schematically in Fig. 63.

The D region targeting construct is transferred into AB1 ES cells, positive and negative selection is performed as described above, and correctly targeted ES cells are cloned. The correctly targeted ES cell clones are used for blastocyst injections and chimeric mice are produced. The chimeric mice are bred to produce founder 25 mice harbouring a D-region inactivated heavy chain allele. Interbreeding of offspring is performed to produce homozygotes lacking a functional endogenous heavy chain locus. Such homozygotes are used to crossbreed to mice harbouring human Ig transgenes pHC1, pHC2, pKC2, pKCle, KCo4) to yield (by further backcrossing to the homozygotes lacking a functional D-region) mice lacking a functional endogenous heavy chain locus and harbouring a human heavy transgene (and preferably also a human light chain transgene). In embodiments where some functional endogenous light chain loci remain X loci), it is generally preferred that transgenes contain transcriptional control sequences that direct high level expression of human light chain polypeptides, and thus allow the transgene locus to compete effectively with the remaining endogenous light chain X) loci. For example, the Co4 kappa light chain transgene is generally preferred as compared to pKC1 with regard to the ability to compete effectively with the endogenous X loci in the transgenic animal.

[N:\LIBC]01115:ais 74 of Example 33 This example describes expansion of the human light chain transgene V gene repertoire by co-injection of a human K light chain minilocus and a yeast artificial chromosome comprising a portion of the human VK locus.

Introduction of Functional Human Light Chain V Segments by Co-Injection of VK- Containing a YAC DNA and a K Minilocus An approximately 450 kb YAC clone containing part of the human VK locus was obtained as a non-amplified YAC DNA from clone 4x17E1 of the publicly available ICRF YAC library (Larin et al. (1991) Proc. Natl. Acad. Sci. 88: 4123; Genome Analysis Laboratory, Imperial Cancer Research Fund, London, UK).

The 450 kb YAC clone was isolated without prior amplification by standard pulsedfield gel electrophoresis as per the manufacturer's specifications (CHEF DR-II electrophoresis cell, Bio-Rad Laboratories, Richmond, CA). Six individual pulse field gels were stained with ethidium bromide and the gel material containing the YAC clone DNA was excised from the gel and then embedded in a new (low melting point agarose in standard gel buffer) gel cast in a triangular gel tray. The resulting triangular gel (containing the six excised YAC-containing gel blocks) was extended at the apex with a narrow agarose gel with 2 M NaOAc in addition to the standard electrophoresis buffer. The gel was then placed in an electrophoresis 20 chamber immersed in standard gel buffer.

The Y-shaped gel former rises above the surface of the buffer so that current can only flow to the narrow high salt gel portion. A plexiglas block was placed over the high salt gel slice to prevent diffusion of the NaOAc into the buffer. The YAC DNA was then electrophoresed out of the original excised gel sliced (embedded) 25 and into the narrow high salt gel portion. At the point of transition from the low salt gel to the high salt gel, there is a resistance drop that effectively halts the migration of the DNA at the apex of the triangular gel.

Following electrophoresis and staining with ethidium bromide, the concentrated YAC DNA was cut away from the rest of the gel and the agarose was digested with GELase (EpiCentre Technologies, Madison R Wisconsin). Chloride was then added to the resultant YAC-containing liquid to obtain a density of 1.68 g/ml. This solution was centrifuged at 37,000 rpm for 36 hours to separate the YAC DNA from any contaminating material. 0.5 ml fractions of the resulting density gradient were isolated and the peak DNA fraction was dialyzed against 5 mM Tris (pH 5 mM NaCI, 0.1 M EDTA. Following dialysis, the concentration of the resulting 0.65 ml solution of YAC DNA was found to contain 2 ig/ml of DNA. This YAC DNA was mixed with purified DNA insert from plasmids pKC1B and pKV4 at a ratio of 20:1:1 (micrograms YAC4x17E1:XC1B:XV4). The resulting 2 itg/ml solution was injected into the pronuclei of half-day B6CBF2 embryos, and 95 surviving [N:\LIBC]01115:ais 75 of microinjected embryos were transferred into the oviducts of pseudopregnant females. Twelve mice which developed from the microinjected embryos were born.

Example 34 This example describes class-switching, somatic mutation, and B cell development in immunised transgenic mice homozygous for an inactivated endogenous immunoglobulin locus and containing the HC1 or HC2 heavy chain transgene(s). To demonstrate that a human sequence germline configuration minilocus can functionally replace the authentic locus, we bred a mouse strain lacking endogenous IgH with strains containing human germline-configuration IgH transgenes. The two transgene miniloci, HC1 and HC2, include one and four functional variable (V),segments respectively 10 and 16 diversity segments respectively, all six joining (JH) segments, and both the t and yl constant region segments. The miniloci include human cis-acting regulatory sequences--such as the JH-p intronic enhancer and the tI and yl switch sequences--that are closely linked to the coding segments. They also include an additional enhancer element derived from the 3' end of the rat IgH locus. We crossed HC1 and HC2 transgenic Smice with stem-cell derived mutant mice that lack JH segments (JHD mice) as described (supra) and cannot therefore undergo functional heavy chain rearrangements. The resulting transgenic-JHD mice contain B cells that are dependent on the introduced heavy chain sequences.

S. Immunisations and hybridomas We immunised mice by intraperitoneal injections of 50-100pig of antigen.

Antigens included human carcinoembryonic antigen (CEA; Crystal Chem, Chicago, IL), hen eggwhite lysozyme (HEL; Pierce, Rockford, IL), and keyhole limpet hemocyanin (KLH; Pierce, Rockford, IL). For primary injections we mixed the antigen with complete Freund's adjuvant, for subsequent injections we used incomplete Freund's adjuvant (Gibco BRL, Gaithersburg, MD). We fused spleen cells with the non-secreting mouse myeloma P3X63-Ag8.653 (ATCC, CRL1580).

We assayed serum samples and hybridoma supernatants for the presence of specific and non-specific antibody comprising human heavy chain sequences by ELISA. For detection of non-specific antibodies we coated microtiter wells with human heavy chain isotype specific antibody (mouse MAb a human IgG1, clone HP6069, Calbiochem, La Jolla, CA; mouse MAb a human IgM, clone CH6, The Binding Site, Birmingham, UK) and developed with peroxidase conjugated antisera (horseradish peroxidase conjugated affinity purified fab fragment from polyclonal goat a human IgG(fc), cat 109-036-098; affinity purified horseradish peroxidase conjugated polyclonal rabbit a human IgM(fc), cat 309-035-095. Jackson Immuno Research, West Grove, PA). For detection of antigen-specific antibodies we coated microtiter wells with antigen and developed with peroxidase-conjugated human heavy chain isotype specific antisera. We detected bound peroxidase by incubation [N:\LIBC]01115:ais 76 of with hydrogen peroxide and 2,2'-Azino-bis-(3-Ethylbenzthiazoline-6-Sulfonic Acid, Sigma Chem. Co., St. Louis, MO). The reaction product is measured by absorption at 415 nm, and corrected for absorption at 490 nm.

Flow cytometry We prepared single cell suspensions from spleen, bone marrow, and peritoneal cavity, and lysed red cells with NH 4 CI, as described by Mishell and Shiigi. The lymphocytes are stained with the following reagents: Phycoerythrin conjugated anti-mouse IgK (clone X36; Becton Dickinson, San Jose, CA), FITC conjugated anti-mouse IgD (clone SBA 1, Southern Biotech, AL), FITC conjugated anti-mouse CD5 (clone 53-7.3; Becton Dickinson, San Jose, CA), FITC conjugated anti-mouse IgX (clone R26-46; Pharmingen, San Diego, CA), and Cy-Chrome conjugated anti-mouse B220 (clone RA3-6B2; Pharmingen, San Diego, CA). We analysed the stained cells using a FACScan flow cytometer and LYSIS II software (Becton Dickinson, San Jose, CA). Most macrophages, neutrophils, and residual red cells are excluded by gating on forward and side scatter.

Rescue of B cell compartment In the peritoneal cavity of HC1 transgenic-JHD animals we find normal levels of CD5 B cells and approximately one-quarter the normal level of conventional :i CD5 B cells. The transgenic peritoneal CD5 B cells are similar to the so-called B- 20 1 cells described in normal animals: they are larger than conventional B and T lymphocytes, they express lower levels of B220 than the conventional B cells found in the spleen, and they include a higher proportion of X light chain expressing cells.

Over 90% of the splenic B cells express K, while up to 50% of the peritoneal B cells express X. Thus, while the level of conventional B cells is uniformly reduced in all 25 tissues, the level of B-1, which are reported to have a much greater capacity for self-renewal, appears to be normal in the HC1 transgenic-JHD animals.

Class switching.

In transgenic-JHD mice, repeated exposure to antigen results in the production of human yl antibodies as well as i antibodies. We injected human CEA into transgenic-JHD mice at weekly intervals and monitored the serum levels of antigen-specific IgM and IgG1 over a period of four weeks (Fig. 63). At one week there is a detectable IgM response but no IgG1 response. However, the IgG1 response is greater than the IgM response after two weeks, and it continues to increase while the IgM response remains relatively constant. This pattern--an initial IgM reaction followed by an IgG reaction-- is typical of a secondary immune response; and it suggests that cis-acting sequences included in the transgene may be responding to cytokines that direct class switching. We have considered three possible mechanisms for expression of non-p isotypes, each of which have been discussed in the literature. These mechanisms are: alternative splicing, which does not involve deletion of the pt gene; "8-type" switching, which involved deletion of the [N:\LIBC01115:ais 77 of pt gene via homologous recombination between flanking repeat sequences; and non-homologous recombination between switch regions. The results of our experiments, described below, are indicative of a switch region recombination model.

Two types of non-deletional alternative splicing mechanisms can be invoked to explain an isotype shift. First, it is possible that a single transcript covering both p.

and yl is expressed from the transgene; this transcript could be alternatively spliced in response to cytokines induced by exposure to antigen. Alternative, a cytokine induced sterile transcript initiating upstream of y1 could be trans-spliced to the p transcript. If either of these mechanisms were responsible for the expression of human yl sequences, then we would expect to be able to isolate hybridomas that express both p and yl. However, although we have screened several hundred hybridomas expressing either human [i or human yl, we have not found any such double producer yl1) hybridomas. This indicates that expression of yl is accompanied by deletion of the [i gene.

Deletion of the i gene can be mediated by non-homologous recombination between the [i and yl switch regions, or by homologous recombination between the two flanking 400 bp direct repeats (op and Zp) that are included in the HC1 and HC2 transgenes. Deletional recombination between op and op has been reported 20 to be responsible for the IgD IgM phenotype of some human B cells. While the first mechanism, non-homologous switch recombination, should generate switch products of varying lengths, the second mechanism, oCa and ~CI recombination, .should always generate the same product. We performed a Southern blot analysis of genomic DNA isolated from three hybridomas (Fig. 64A), one expressing p and 25 two expressing yl. We find genomic rearrangements upstream of the transgene yl only in the two the yl switch regions (Fig. 64B). Furthermore, neither of the observed structures is compatible with homologous recombination between op and p. Our results are therefore consistent with a model for yl isotype expression mediated by deletional non-homologous recombination between the transgene encoded p and yl switch regions.

Trans-switching In addition to human yl, we find mouse y in the serum of HC1 and HC2 transgenic-JHD mice. We have also obtained mouse e expressing hybridomas from these animals. Because the non-transgenic homozygous JHD animals do not express detectable levels of mouse immunoglobulins, we attribute the expression of mouse y in the HC1 and HC2 transgenic-JHD animals to the phenomenon of trans-switching. All of the transgenic hybridomas that we have analysed express either mouse or human constant region sequences, but not both. It is therefore unlikely that a trans-splicing mechanism is involved. We used PCR amplification to isolate cDNA clones of trans-switch products, and determined the nucleotide [N:\LIBC]01115:ais 78 of sequence of 10 of the resulting clones (Fig. 65). The 5'oligonucleotide in the PCR amplification is specific for the transgene encoded VH251, and the 3' oligonucleotide is specific for mouse yl, and y2b, and y3 sequences. We find examples of trans-switch products incorporating all three of these mouse constant regions.

Somatic mutation Approximately 1% of the nucleotides within the variable regions of the transswitch products shown in Fig. 7 are not germline encoded. This is presumably due to somatic mutation. Because the mutated sequence has been translocated to the endogenous locus, the cis-acting sequences directing these mutations could be located anywhere 3' of the mouse y switch. However, as we discuss below, we also observe somatic mutation in VDJ segments that have not undergone such translocations; and this result indicates that sequences required by heavy chain somatic mutation are included in the transgene.

To determine if the HC1 and HC2 constructs include sufficient cis-acting sequences for somatic mutation to occur in the transgenic-JHD mice, we isolated and partially sequenced cDNA clones derived from two independent HC1 transgenic lines and one HC2 line. We find that some of the yl transcripts from I transgenic-JHD mice contain V regions with extensive somatic mutations. The S' 20 frequency of these mutated transcripts appears to increase with repeated immunisations. Figs. 66A and 66B show two sets of cDNA sequences: one set is S' derived form an HC1 (line 26) transgenic-JHD mouse that we immunised with a single injection of antigen 5 days before we isolated RNA; the second set is derived from an HC1 (line 26) transgenic-JHD mouse that we hyperimmunised by injecting S* 25 antigen on three different days beginning 5 months before we isolated RNA; the second set is derived from an HC1 (line 26) transgenic-JHD mouse that we hyperimmunised by injecting antigen on three different days beginning 5 months before we isolated RNA. Only 2 of the 13 V regions from the 5 day post-exposure mouse contain any non-germline encoded nucleotides. Each of these V's contains only a single nucleotide change, giving an overall somatic mutation frequency of less than 0.1% for this sample. In contrast, none of the 13 V sequences from the hyperimmunised animal are completely germline, and the overall somatic mutation frequency is 1.6%.

Comparison of p. and yl transcripts isolated from a single tissue sample shows that the frequency of somatic mutations is higher in transgene copies that have undergone a class switch. We isolated and partially sequenced 47 independent [t and y1 cDNA clones from a hyperimmunised CH1 line 57 transgenic-JHD mouse (Fig. 67A and 67B). Most of the p cDNA clones are unmodified relative to the germline sequence, while over half of the yl clones contain multiple non-germline encoded nucleotides. The y1 expressing cells are [N:\LIBC]01115:ais 79 of distinct from the p expressing cells and, while the two processes are not necessarily linked, class switching and somatic mutation are taking place in the same sub-population of B cells.

Although we do not find extensive somatic mutation of the VH251 gene in non-hyperimmunised CH1 transgenic mice, we have found considerable somatic mutation in VH56pl and VH51p1 genes in a naive HC2 transgenic mouse. We isolated spleen and lymph node RNA from an unimmunised 9 week old female HC2 transgenic animal. We individually amplified y1 transcripts that incorporate each of the four V regions in the HC2 transgene using V and yl specific primers.

The relative yields of each of the specific PCR products were VH56p1>)VH51pl>VH4.21>VH251. Although this technique is not strictly quantitative, it may indicate a bias in V segment usage in the HC2 mouse. Fig. 68 shows 23 randomly picked yl cDNA sequences derived from PCR amplifications using an equimolar mix of all four V specific primers. Again we observe a bias toward VH56pl (19/23 clones). In addition, the VH56pl sequences show considerable somatic mutation, with an overall frequency of 2.1% within the V gene segment. Inspection of the CDR3 sequences reveals that although 17 of the 19 individual VH56p1 clones are unique, they are derived from only 7 different VDJ i recombination events. It thus appears that the VH56pl expressing B cells are 20 selected, perhaps by an endogenous pathogen or self antigen, in the naive animal.

It may be relevant that this same gene is over-represented in the human fetal repertoire.

Summary Upstream cis-acting sequences define the functionality of the individual switch 25 regions, and are necessary for class switching. Our observation-- that class switching within the HC1 transgene is largely confined to cells involved in secondary response, and does not occur randomly across the entire B cell population--suggests that the minimal sequences contained with the transgene are sufficient. Because the y sequences included in this construct begin only 116 nucleotides upstream of the start site of the yl sterile transcript, the switch regulatory region is compact.

Our results demonstrate that these important cis-acting regulatory elements are either closely linked to individual y genes, or associated with the 3' heavy chain enhancer included in the HC1 and HC2 transgenes. Because the HC1 and HC2 inserts undergo transgene-autonomous class switching--which can serve as a marker for sequences that are likely to have been somatically mutated--we were able to easily find hypermutated transcripts that did not originate from translocations to the endogenous locus. We found somatically mutated y transcripts in three independent transgenic lines (two HC1 lines and one HC2 line).

It is therefore unlikely that sequences flanking the integration sites of the transgene [N:\LIBC01 115:ais 80 of affect this process; instead, the transgene sequences are sufficient to direct somatic mutation.

Example This example describes the generation of hybridomas from mice homozygous for an inactivated endogenous immunoglobulin locus and containing transgene sequences encoding a human sequence heavy chain and human sequence light chain. The hybridomas described secrete monoclonal antibodies comprising a human sequence heavy chain and a human sequence light chain and bind to a predetermined antigen expressed on T lymphocytes. The example also demonstrates the capacity of the mice to make a human sequence antibody in response to a human-derived immunogen, human CD4, and the suitability of such mice as a source for making hybridomas secreting human sequence monoclonal antibodies reactive with human antigens.

A. Generation of Human Ig Monoclonal Antibodies Derived from HC1 Transgenic Mice Immunised with a Human CD4 Antigen A transgenic mouse homozygous for a functionally disrupted JH locus and Sharbouring a transgene capable of rearranging to encode a human sequence heavy chain and a transgene capable of rearranging to encode a human sequence light chain was immunised. The genotype of the mouse was HC1-26+ KCle-1536 JHD JKD-, indicating homozygosity for murine heavy chain inactivation and the presence of germline copies of the HC1 human sequence heavy chain transgene and the KCle human sequence light chain transgene.

The mouse was immunised with a variant of the EL4 cell line (ATCC) expressing a mouse-human hybrid CD4 molecule encoded by a stably transfected polynucleotide. The expressed CD4 molecule comprises a substantially human-like CD4 sequence. Approximately 5 x 106 cells in 100 |tL of PBS accompanied by 100 tiL of Complete Freund's Adjuvant (CFA) were introduced into the mouse via intraperitoneal injection on Day 0. The inoculation was repeated on Days 7, 14, 21, 28, 60, and 77, with test bleeds on Days 18, 35, and 67. The spleen was removed on Day 81 and approximately 7.2 x 10 7 spleen cells were fused to approximately 1.2 x 107 fusion partner cells (P3x63Ag8.653 cell line; ATCC) by standard methods (PEG fusion) and cultured in RPMI 1640 15 FCS, 4 mM glutamine, 1 mM sodium pyruvate plus HAT and PSN medium. Multiple fusions were performed.

Hybridomas were grown up and supernatants were tested with ELISA for binding to a commercial source of purified recombinant soluble human sequence CD4 expressed in CHO cells (American Bio-Technologies, Inc. (ABT), Cambridge, MA) and/or CD4 obtained from NEN-DuPont. The ABT sample contained a purified kD human CD4 molecule comprised the V 1 through V 3 domains of human CD4.

The recombinant human sequence CD4 (produced in CHO-K1 cells) was adsorbed to the assay plate and used to capture antibody from hybridoma supernatants, the [N:\LIBC]01115:ais 81 of captured antibodies were then evaluated for binding to a panel of antibodies which bind either human human K, human y, murine it, or murine K.

One hybridoma was subcloned from its culture plate well, designated 1F2.

The 1F2 antibody bound to the ABT CD4 preparation, was positive for human i and human K, and was negative for human y, mouse y, and mouse K.

B. Generation of Human Ig Monoclonal Antibodies Derived from HC2 Transgenic Mice Immunised with Human CD4 and Human IgE.

The heavy chain transgene, HC2, is shown in Fig. 56 and has been described supra (see, Example 34).

The human light chain transgene, KCo4, depicted in Fig. 56 is generated by the cointegration of two individually cloned DNA fragments at a single site in the mouse genome. The fragments comprise 4 functional V, segments, 5J segments, the CK exon, and both the intronic and downstream enhancer elements (see Example 21) (Meyer and Neuberger (1989), EMBO J. 8:1959-1964; Judde and Max (1992), Mol. Cell Biol. 12:5206-5216). Because the two fragments share a 'common 3kb sequence (see Fig. 56), they can potentially integrate into genomic DNA as a contiguous 43kb transgene, following homologous recombination between the overlapping sequences. It has been demonstrated that such recombination events frequently occur upon microinjection of overlapping DNA 20 fragments (Pieper et al. (1992), Nucleic Acids Res. 20:1259-1264). Co-injected DNA's also tend to co-integrate in the zygote, and the sequences contained within the individually cloned fragments would subsequently be jointed by DNA rearrangement during B cell development. Table 11 shows that transgene inserts from at least 2 of the transgenic lines are functional. Examples of VJ junctions S* 25 incorporating each of the 4 transgene encoded V segments, and each of the segments, are represented in this set of 36 clones.

Table 11 line VK65.5 VK65.8 VK65.15 VK65.3 JK1 JK2 JK3 JK4 #4436 0 11 4 3 14 1 0 2 1 #4437 1 3 7 7 5 2 1 7 3 Table 11. Human light chain V and J segment usage in KCo4 transgenic mice. The table shows the number of PCR clones, amplified from cDNA derived from two transgenic lines, which contain the indicated human kappa sequences.

cDNA was synthesised using spleen RNA isolated from w individual KCo4 transgenic mice (mouse #8490, 3 mo., male, KCo4 line 4437; mouse #8867, mo., female, KCo4 line 4436). The cDNA was amplified by PCR using a CK specific oligonucleotide, 5'TAG AAG GAA TTC AGC AGG CAC ACA ACA GAG GCA GTT CCA3', and a 1:3 mixture of the following 2 VK specific oligonucleotides: 5'AGC TTC TCG AGC TCC TGC TGC TCT GTT TCC CAG GTG CC3' and 5'CAG CTT CTC GAG CTC CTG CTA CTC TGG CTC (C,A)CA GAT ACC3'. The PCR product was digested with Xhol and EcoRI, and [N:\LIBC]01115:ais 82 of cloned into a plasmid vector. Partial nucleotide sequences were determined by the dideoxy chain termination method for 18 randomly picked clones from each animal.

The sequences of each clone were compared to the germline sequence of the unrearranged transgene.

Twenty-three light chain minilocus positive and 18 heavy chain positive mice developed from the injected embryos. These mice, and their progeny, were bred with mice containing targeted mutations in the endogenous mouse heavy (strain JHD) and K light chain loci (strain JCKD) to obtain mice containing human heavy and K light chain in the absence of functional mouse heavy and K light chain loci.

These mice contain only AB cells.

Table 12 shows that somatic mutation occurs in the variable regions of the transgene-encoded human heavy chain transcripts of the transgenic mice. Twentythree cDNA clones from a HC2 transgenic mouse were partially sequenced to determine the frequency of non-germline encoded nucleotides within the variable 15 region. The data include only the sequence of V segment codons 17-94 from each clone, and does not include N regions. RNA was isolated from the spleen and lymph node of mouse 5250 (HC2 line 2550 hemizygous, JHD homozygous).

Single-stranded cDNA was synthesised and y transcripts amplified by PCR as described [references]. The amplified cDNA was cloned into plasmid vectors, and 23 randomly picked clones were partially sequenced by the dideoxy chaintermination method. The frequency of PCR-introduced nucleotide changes is estimated from constant region sequence as Table 12: The Variable Regions of Human z Transcripts in HC2 Transgenic Mice Contain Non-Germline-Encoded Nucleotides VH Number Number of non-germline Frequency of non Segment of clones encoded nucleotides germline-encoded nucleotides VH251 0 VH56P1 10 100 2.1 VHSIPI 1 5 VH4.21 3 0 0.0 Flow Cytometry We analysed the stained cells using a FACScan flow cytometer and LYSIS II software (Becton Dickinson, San Jose, CA). Spleen cells were stained with the following reagents: propidium iodide (Molecular Probes, Eugene, OR), phycoerythrin conjugated a-human IgK (clone HP6062; Caltag, S. San Francisco, CA), phycoerythrin conjugated a-mouse IgK (clone 5 X36; Becton Dickinson, San Jose,.CA), FITC conjugated a-mouse IgX (clone R26-46; Pharmingen, San Diego, CA), FITC conjugated a-mouse Ig~i (clone R6-60.2; Pharmingen, San Diego, CA), FITC conjugated a-human Igt (clone G20-127; Pharmingen, San Diego, CA), and Cy-Chrome conjugated a-mouse B220 (clone RA3-6B2; Pharmingen, San Diego,

CA).

[N:\LIBC]01115:ais 83 of Expression of human Ig transgenes Figure 69 shows a flow cytometric analysis of spleen cells from KCo4 and HC2 mice that are homozygous for both the JHD and JCKD mutations. The human sequence HC2 transgene rescued B cell development in the JHD mutant background, restoring the relative number of B220' cells in the spleen to approximately half that of a wild type animal. These B cells expressed cell surface immunoglobulin receptors that used transgene encoded heavy chain. The human KCo4 transgene was also functional, and competed successfully with the intact endogenous k light chain locus. Nearly 95% of the splenic B cells in JHD/JCKD homozygous mutant mice that contain both heavy and light chain human transgenes (double transgenic) expressed completely human cell surface IgMK.

Serum Ig levels were determined by ELISA done as follows: human p1: microtitre wells coated with mouse Mab a human IgM (clone CH6, The Binding Site, Birmingham, UK) and developed with peroxidase conjugated rabbit a human 15 IgM(fc) (cat 309-035-095, Jackson Immuno Research, West Grove, PA). Human y: microtitre wells coated with mouse MAb a human IgG1 (clone HP6069, Calbiochem, La Jolla, CA) and developed with peroxidase conjugated goat a human IgG(fc) (cat 109-036-098, Jackson Immuno Research, West Grove, PA).

Human K: microtitre wells coated with mouse Mab a human IgK (cat 0173, AMAC, Inc. IgK (cat #A7164, Sigma Chem. Co., St. Louis, MO). Mouse y: microtitre wells coated with goat a mouse IgG (cat #115-006-071, Jackson Immuno Research, West Grove, PA). Mouse X: microtitre wells coated with rat MAb a mouse IgX (cat 02171D, Pharmingen, San Diego, CA) and developed with peroxidase conjugated rabbit a mouse IgM(fc) (cat 309-035-095, Jackson Immuno Research, West Grove, PA). Bound peroxidase is detected by incubation with hydrogen peroxide and 2,2'-azino-bis-)3-ethylbenzthiazoline-6-sulfonic acid, Sigma Chem. Co., St. Louis, MO). The reaction product is measured by absorption at 415nm.

The double transgenic mice also express fully human antibodies in the serum.

Figure 70 shows measured serum levels of immunoglobulin proteins for 18 individual double transgenic mice, homozygous for endogenous heavy and kappa light chain inactivations, derived from several different transgenic founder animals.

We found detectable levels of human pI, yl, and K. We have shown supra that the expressed human yl results from authentic class switching by genomic recombination between the transgene and yl switch regions. Furthermore, we have found that intra-transgene class switching was accompanied by somatic mutation of the heavy chain variable regions. In addition to human immunoglobulins, we also found mouse y and X in the serum. The present of mouse k protein is expected because the endogenous locus is completely intact.

We have shown elsewhere that the mouse y expression is a consequence of trans- IN:\LIBC]01115:ais 84 of switch recombination of transgene VDJ segments into the endogenous heavy chain locus. This trans-switching phenomenon, which was originally demonstrated for wild-type heavy chain alleles and rearranged VDJ transgenes (Durdik et al. (1989), Proc. Natl. Acad. Sci. USA 86:2346-2350; Gerstein et al. (1990), Cell 63:537- 548), occurs in the mutant JHD background because the downstream heavy chain constant regions and their respective switch elements are still intact.

The serum concentration of human IgMK in the double transgenic mice was approximately 0.1 mg/mL, with very little deviation between animals or between lines. However, human yl, mouse y, and mouse X levels range from 0.1 to micrograms/mL. The observed variation in y levels between individual animals may be a consequence of the fact that y is an inducible constant region. Expression presumably depends on factors such as the health of the animal, exposure to antigens, and possibly MHC type. The mouse X serum levels are the only parameter that appears to correlate with individual transgenic lines. KCo4 line 4436 15 mice which have the fewest number of copies of the transgene per integration (approximately 1-2 copies) have the highest endogenous X levels, while KCo4 line 4437 mice (10 copies per integration) have the lowest levels. This is consistent with a model in which endogenous X rearranges subsequent to the K transgene, and in which the serum k level is not selected for, but is instead a reflection of the relative size of the precursor B cell pool. Transgene loci containing multiple light chain inserts may have the opportunity to undergo more than one V to J recombination event, with an increased probability that one of them will be functional. Thus high copy lines will have a smaller pool of potential X cells.

Immunisations with human CD4 and IgE To test the ability of the transgenic B cells to participate in an immune response, we immunised double transgenic mice with human protein antigens, and measured serum levels of antigen specific immunoglobulins by ELISA. Mice were immunised with 50 |Ig recombinant sCD4 (cat. 013101, American Bio- Technologies Inc., Cambridge, MA) covalently linked to polystyrene beads (cat 08226, Polysciences Inc., Warrington, PA) in complete Freund's adjuvant by intraperitoneal injection. Each of the mice are homozygous for disruptions of the endogenous |t and K loci, and hemizygous for the human heavy chain transgene HC2 line 2500 and human K light chain transgene KCo4 line 4437.

Methods Serum samples were diluted into microtitre wells coated with recombinant sCD4.

Human antibodies were detected with peroxidase conjugated rabbit a human IgM(fc) (Jackson Immuno Research, West Grove, PA) or peroxidase conjugated goat anti-human IgK (Sigma, St. Louis, MO).

Figure 71A shows the primary response of transgenic mice immunised with recombinant human soluble CD4. All four of the immunised animals show an [N:\LIBC]01115:ais 85 of antigen-specific human IgM response at one week. The CD4-specific serum antibodies comprise both human p heavy chain and human K light chain.

To evaluate the ability of the HC2 transgene to participate in a secondary response, we hyperimmunised the transgenic mice by repeated injection with antigen, and monitored the heavy chain isotype of the induced antibodies. Mice homozygous for the human heavy chain transgene HC2 and human K light chain transgene KCo4 were immunised with 25 pg of human IgEK (The Binding Site, Birmingham, UK) in complete Freund's adjuvant on day 0. Thereafter, animals were injected with IgEK in incomplete Freund's adjuvant at approximately weekly intervals. Serum samples were diluted 1:10, and antigen-specific ELISAs were performed on human IgE, X coated plates.

Figure 71B shows a typical time course of the immune response from these animals: we injected double transgenic mice with human IgE in complete Freund's adjuvant, followed by weekly boosts of IgE in incomplete Freund's adjuvant. The 15 initial human antibody response was IgMK, followed by the appearance of antigen specific human IgGK. The induced serum antibodies in these mice showed no cross-reactivity to human IgM or BSA. The development, over time, of a human IgG.

We have also tested the ability of the heavy chain transgene to undergo class switching in vitro: splenic B cells purified form animals hemizygous for the same 'heavy chain construct (HC2, line 2550) switch from human IgM to human IgG1 in .the presence of LPS and recombinant mouse IL-4. However, in vitro switching did not take place in the presence of LPS and recombinant mouse IL-2, or LPS alone.

In a transgenic mouse immunised with human CD4, human IgG reactivity to the CD4 antigen was detectable at serum concentrations ranging from 2 x 10 2 to 1.6 x 10 4 Identification of Anti-Human CD4 Hybridomas A transgenic mouse homozygous for the human heavy chain transgene HC2 and human K light chain transgene KCo4 were immunised with 20 -g of recombinant human CD4 in complete Freund's adjuvant on day 0. Thereafter, animals were injected with CD4 in incomplete Freund's adjuvant at approximately weekly intervals. Fig. 73 shows human antibody response to human CD4 in serum of the transgenic mouse. Serum samples were diluted 1:50, and antigen-specific ELISAs were performed on human CD4 coated plates. Each line represents individual sample determinations. Solid circles represent IgM, open squares represent IgG. A mouse of line #7494 (0012;HC1-26+;JHD++;JKD++;KC2- 1610++) was immunised on days 0, 13, 20, 28, 33, and 47 with human CD4, and produced anti-human CD4 antibodies comprised of human K and human ji or y.

By day 28, human 1 and human K were found present in the serum. By day 47, the serum response against human CD4 comprised both human V and human [N:\LIBC0 1115:ais 86 of y, as well as human K. On day 50, splenocytes were fused with P3X63-Ag8.653 mouse myeloma cells and cultured. Forty-four out of 700 wells contained human y and/or K anti-human CD4 monoclonal antibodies. Three of these wells were confirmed to contain human y anti-CD4 monoclonal antibodies, but lacked human K chains (presumably expressing mouse Nine of the primary wells contained fully human IgMK anti-CD4 monoclonal antibodies, and were selected for further characterisation. One such hybridoma expressing fully human IgMK anti- CD4 monoclonal antibodies was designated 2C11-8.

Primary hybridomas were cloned by limiting dilution and assessed for secretion of human lt and K monoclonal antibodies reactive against CD4. Five of the nine hybridomas remained positive in the CD4 ELISA. The specificity of these human IgMK monoclonal antibodies for human CD4 was demonstrated by their lack of reactivity with other antigens including ovalbumin bovine serum albumin, human serum albumin, keyhole limpet hemacyanin, and carcinoembryonic antigen. To 15 determine whether these monoclonal antibodies could recognise CD4 on the S.i: surface of cells native CD4), supernatants from these five clones were also tested for reactivity with a CD4+ T cell line, Sup T1. Four of the five human IgMK monoclonal antibodies reacted with these CD4+ cells. To further confirm the specificity of these IgMK monoclonal antibodies, freshly isolated human peripheral blood lymphocytes (PBL) were stained with these antibodies. Supernatants from clones derived from four of the five primary hybrids bound only to CD4+ lymphocytes and not to CD8+ lymphocytes (Figure 72).

Fig. 72 shows reactivity of IgMK anti-CD4 monoclonal antibody with human PBL. Human PBL were incubated with supernatant from each clone or with an isotype matched negative control monoclonal antibody, followed by either a mouse anti-human CD4 monoclonal antibody conjugated to PE (top row) or a mouse antihuman CD8 Ab conjugated to FITC (bottom row). Any bound human IgMK was detected with a mouse anti-human j conjugated to FITC or to PE, respectively.

Representative results for one of the clones, 2C11-8 (right side) and for the control IgMK (left side) are shown. As expected, the negative control IgMK did not react with T cells and the goat anti-human Vt reacted with approximately 10% of P B L, which were presumably human B cells. Good growth and high levels of IgMK anti- CD4 monoclonal antibody production are important factors in choosing a clonal hybridoma cell line for development. Data from one of the hybridomas, 2C11-8, shows that up to 5 pg/cell/d can be produced (Figure 74). Similar results were seen with a second clone. As is commonly observed, production increases dramatically as cells enter stationary phase growth. Fig. 74 shows cell growth and human IgMK anti-CD4 monoclonal antibody secretion in small scale cultures. Replicate cultures were seeded at 2x10 5 cells/mL in a total volume of 2 mL. Every twenty-four hours thereafter for four days, cultures were harvested. Cell growth was determined by [N:\LIBC]01115:ais 87 of counting viable cells and IgMK production was quantitated by an ELISA for total human t (top panel). The production per cell per day was calculated by dividing the amount of IgMK by the cell number (bottom panel). Fig. 75 shows epitope mapping of a human IgMK anti-CD4 monoclonal antibody. Competition binding flow cytometric experiments were used to localise the epitope recognised by the IgMK anti-CD4 monoclonal antibody, 2C11-8. For these studies, the mouse anti-CD4 monoclonal antibodies, Leu3a and RPA-T4, which bind to unique, nonoverlapping epitopes on CD4 were used. PE fluorescence of CD4+ cells preincubated with decreasing concentrations of either RPA-TA or Leu-3a followed by staining with 2C11-8 detected with PE-conjugated goat anti-human IgM. There was concentration-dependent competition for the binding of the human IgMK anti-CD4 monoclonal antibody 2C11-8 by Leu3a but not by RPA-T4 (Figure 75). Thus, the epitope recognised by 2C11-8 was similar to or identical with that recognised by monoclonal antibody Leu3a, but distinct from that recognised by RPA-T4.

s. 15 In summary, we have produced several hybridoma clones that secrete human IgMK monoclonal antibodies that specifically react with native human CD4 and can o be used to discriminate human PBLs into CD4+ and CD4- subpopulations. At least one of these antibodies binds at or near the epitope defined by monoclonal antibody Leu3a. Monoclonal antibodies directed to this epitope have been shown to inhibit a mixed leukocyte response (Engleman et al., J. Exp. Med. (1981) 153:193).

A chimeric version of monoclonal antibody Leu3a has shown some clinical efficacy in patients with mycosis fungoides (Knox et al. (1991) Blood 77:20). The association and dissociation rates of the immunising human CD4 antigen for the monoclonal antibodies secreted by two of the hybridomas, 4E4.2 and 2C5.1, were determined. The experimentally-derived binding constants (Ka) were approximately 9 x 10 7

M

1 and 8 x 10 7

M-

1 for antibodies 4E4.2 and 2C5.1, respectively. These Ka values fall within the range of murine IgG anti-human CD4 antibodies that have been used in clinical trials by others (Chen et al. (1993) Int. Immunol. 6: 647).

The foregoing description of the preferred embodiments of the present invention has been presented for purposes of illustration and description. They are not intended to be exhaustive or to limit the invention to the precise form disclosed, and many modifications and variations are possible in light of the above teaching. It will be apparent that certain changes and modifications may be practiced within the scope of the claims. All publications and patent applications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Commonly assigned applications USSNs 08/209,741 filed 9 Mar 94, 08/165,699 filed 10 Dec 93 and 08/161,739 filed 3 Dec 93, 08/155,301 filed 18 Nov 93, 07/810,279 filed 17 Dec 91, 07/853,408 filed 18 Mar 92, 07/904,068 filed 23 [N:\LIBC]01115:ais 88 of 89 Jun 92, 07/990,860 filed 16 Dec 92, and 08/053,131 filed 26 Apr 93 and W092/03918 and W093/1 2227 are each incorporated herein by reference.

[N:\LIBC]O1 1 15:ais 89 of

Claims (38)

1. A transgenic non-human animal comprising: a homozygous pair of functionally disrupted endogenous heavy chain alleles, a homozygous pair of functionally disrupted endogenous light chain alleles, at least one copy of a heterologous immunoglobulin heavy chain transgene, and at least one copy of a heterologous immunoglobulin heavy chain transgene, and wherein said animal makes an antibody response following immunisation with an antigen.

2. A transgenic non-human animal of Claim 1, wherein said functionally disrupted endogenous heavy chain allele is a JH region homologous recombination knockout, said functionally disrupted endogenous light chain allele is a JK region homologous recombination knockout, said heterologous immunoglobulin heavy chain transgene is the HC1 or HC2 human minigene transgene, said heterologous light chain transgene is the KC2 or KCle human K transgene, and wherein said antigen is a human antigen. 15

3. A transgenic non-human animal of Claim 1, wherein the antibody response comprises a population of antibodies which comprise human p chain- containing immunoglobulins and human y chain-containing immunoglobulins.

4. A transgenic non-human animal of Claim 2, wherein the heterologous antibodies comprise a population of heterologous immunoglobulins which bind specifically to human CD4 with an dissociation constant of approximately 8x 107 M 1

5. A transgenic animal of claim 2 wherein the animal comprises a transgenic mouse having a genotype selected from: HC1-26+;JHD++;JKD++;KC2- 1610++; HC1-26+;JHD++;JKD++;KC2-1610+; HC1-26+;JHD++;JKD++;KCIe- 1527+; and HC1-26+;JHD++;JKD++;KCIe-1399+.

6. A transgenic animal of claim 5 wherein the animal comprises a transgenic mouse having a genotype selected from: HC1-26+;JHD++; JKD++;KCle- 1527+ and HCI-26+;JHD++; JKD++;KCle-1399+, wherein the antibody response comprises a population of antibodies which comprise human [L chain-containing immunoglobulins and human y chain-containing immunoglobulins.

7. A transgenic mouse comprising a genome comprising: a homozygous functionally disrupted endogenous heavy chain locus comprising at least one murine constant region gene comprising a functional switch recombination sequence and capable of trans-switching, and a human heavy chain transgene capable of rearranging to encode a functional human heavy chain variable region and containing a functional switch recombination sequence capable of undergoing trans-switching.

8. A transgenic mouse of claim 7, further comprising a human light chain transgene capable of rearranging to encode a functional human light chain variable region and expressing a human sequence light chain. [I:\DAYLIB\libc]01115.doc:lam

9. A transgenic mouse of claim 7, further comprising a homozygous functionally disrupted endogenous light chain locus.

A transgenic mouse of claim 9, further comprising a serum comprising an antibody comprising a chimeric heavy chain composed of a human sequence variable region encoded by a human transgene and a murine constant region sequence encoded by an endogenous murine heavy chain constant region gene.

11. A transgenic mouse comprising a serum having a detectable amount of a chimeric heavy chain encoded by a sequence produced by trans-switching between a human transgene and an endogenous murine heavy chain constant region gene.

12. A transgenic mouse comprising B cells which produce a human sequence heavy chain at a first timepoint and trans-switch to produce a chimeric heavy chain composed of a human variable region and a murine constant region at a second timepoint. 15

13. A transgenic mouse comprising B cells which produce a chimeric antibody comprising a chimeric heavy chain comprising a human sequence heavy chain variable region and a murine sequence heavy chain constant region.

14. A transgenic mouse of claim 13, wherein said chimeric antibody S. comprises a human sequence light chain.

15. A transgenic mouse of claim 14, wherein the chimeric antibody binds to a predetermined antigen the immunogen) with an affinity of about at least 1 x 10 7 M 1

16. A transgenic mouse of claim 15, wherein the predetermined antigen is human CD4 or human CEA.

17. A transgenic mouse having a genome comprising a human heavy chain S: transgene comprising two human VH gene segments, eight human D gene segments, six human JH gene segments, a human J-p enhancer, a human p switch region, a complete human p CH gene, a human sterile transcript promoter, a human y switch region, a complete human y CH gene, and a heavy chain 3' enhancer, and wherein said unrearranged human heavy chain transgene lacks mouse VH gene segments, mouse D gene segments, mouse JH gene segments, mouse CH genes, mouse switch regions, and a mouse heavy chain enhancer, and wherein B lymphocytes of said transgenic mouse rearrange said unrearranged human heavy chain transgene by V-D-J joining to produce a V-D-J gene joined in-frame encoding a heavy chain variable region expressed in polypeptide linkage to the constant region encoded by said complete human p or complete human y CH gene on said transgene.

18. A transgenic mouse of claim 17, wherein said human heavy chain transgene comprises a 5.3kb Hindlll fragment of a human heavy chain gene locus containing the yl switch region and the first exon of the preswitch sterile transcript, [I:\DAYLIB\libc]01115.doc:lam and wherein said B lymphocytes rearrange said human heavy chain transgene forming a V-D-J gene joined in-frame encoding a heavy chain variable region which is expressed as a human A or human chain in B lymphocytes of said transgenic mouse.

19. A transgenic mouse of claim 18, wherein said transgene further comprises a 0.7kb Xbal/Hindlll fragment of a human heavy chain gene locus, said 0.7kb Xbal/Hindlll fragment consisting essentially of sequences immediately upstream of, and adjacent to said 5.3kb yl fragment and further comprising a neighbouring upstream 3.1kb Xbal fragment of said human heavy chain gene locus.

A transgenic mouse of claim 19, wherein said human heavy chain transgene comprises a human yl constant region including the associated switch region and sterile transcript associated exons, together with approximately 4kb flanking sequences upstream of the sterile transcript initiation site, and a rat heavy 15 chain 3' enhancer that can be PCR amplified with the following oligonucleotide primers: 5' CAG GAT CCA GAT ATC AGT ACC TGA AAC AGG GCT TGC 3' 5' GAG CAT GCA S. CAG GAC CTG GAG CAC ACA CAG CCT TCC 3'.

21. A transgenic mouse of claim 20, wherein said human heavy chain transgene comprises a Notl insert of pHC1.

22. A transgenic mouse of claim 21, wherein said transgenic mouse comprises one intact germline copy of said Notl insert of pHCI and wherein said transgenic mouse expresses both human ji and human yl chains in serum.

23. A transgenic mouse of claim 22, wherein said human heavy chain transgene undergoes isotype switching whereby said V-D-J gene joined in-frame encodes a human heavy chain variable region which is initially expressed in peptide linkage to a human p. constant region and subsequently expressed in peptide linkage to a human y constant region in B lymphocytes of said transgenic mouse.

24. A transgenic mouse comprising an intact integrated germline copy of a Notl insert of pHCI or plGM1, wherein said transgenic mouse expresses human p. and human yl chains in serum, each human p. or human yl chain comprising a variable region consisting essentially of a polypeptide sequence encoded by a human VH gene segment, a human D gene segment, and a human JH gene segment, joined in-frame as a VDJ gene.

25. A transgenic mouse of claim 17, wherein said transgenic mouse further comprises a functionally disrupted endogenous heavy chain locus which lacks mouse JH gene segments.

26. A transgenic mouse having an intact integrated germline copy of a human heavy chain transgene consisting essentially of a Notl insert of pHC1, wherein said transgenic mouse expresses, in its serum, immunoglobulin chains [I:\DAYLIB\Iibc]O I 15.doc lam encoded by said human heavy chain transgene and comprising human or human yl constant regions.

27. A method for producing an antibody comprising a human immunoglobulin in serum of a transgenic mouse, said method comprising the step of immunising with a predetermined antigen a transgenic mouse of claim 17 or claim 25, and collecting serum from said animal after a suitable period for a humoral immune response.

28. A hybridoma comprising a B cell of a transgenic mouse of claim 17 or claim 25 which has been immunised with a predetermined antigen, fused with a second cell capable of immortalising said B cell, wherein the hybridoma produces a monoclonal antibody comprising a human heavy chain and wherein said monoclonal antibody binds to said predetermined antigen.

29. A hybridoma of Claim 28, wherein the predetermined antigen is a human antigen. 15

30. A hybridoma of Claim 29, wherein the human antigen is CEA, CD4, or NCA-2.

31. A hybridoma of Claim 28, wherein the monoclonal antibody binds to a human antigen with an affinity of at least 1 x 10 7 M 1

32. A hybridoma of Claim 28, wherein the hybridoma comprises a functionally disrupted murine immunoglobulin allele.

33. A hybridoma of Claim 31, wherein the monoclonal antibody binds human CD4 with an affinity of approximately 8 x 10 7 M 1

34. A human monoclonal antibody produced by a hybridoma of Claim 28.

35. A human monoclonal antibody of Claim 34, wherein said human antigen is CEA, CD4, or NCA-2.

36. An immunoglobulin heavy chain minilocus transgene that is expressed in B cells of a transgenic nonhuman animal containing at least one integrated copy of a polynucleotide comprising a DNA sequence of the formula: 2 )]q wherein x, y, z, m, n, p, and q are integers and x is 2-100, n is 2-10, y is 2-8, p is 1- z is 1-50, q is 0-50, and m is 0.

37. An immunoglobulin heavy chain transgene of claim 36, wherein said transgene is replicated in a mammalian genome.

38. A transgenic mouse of Claim 17 or Claim 25, wherein said heavy chain transgene is a minilocus. Dated 25 March, 2002 GenPharm International, Inc. Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON [I:\DAYLB\Iibc]0I I