AU2319902A - Plant like starches and the method of making them in hosts - Google Patents

Description

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT Name of Applicants Actual Inventors Address for Service: Invention Title: Exseed Genetics, LLC.

Hanping GUAN and Peter L. KEELING CULLEN CO Patent Trade Mark Attorneys, 239 George Street Brisbane QId 4000 Australian Plant Like Starches and the Method of Making Them in Hosts Details of Associated Parent Application Australian 68828/98 Patent Application The following statement is a full description of this invention, including the best method of performing it, known to us: This invention has been divided from the specification of Australian Patent Application No. 68828/98.

BACKGROUND FIELD OF INVENTION This invention relates to hosts containing constructs with genes from the starch pathway. More specifically the present invention relates to bacterial hosts that form plant like starches. Additionally the present invention relates to plant hosts that have genes from the starch pathway. The invention further relates to the starches produced by said hosts.

BACKGROUND DESCRIPTION OF PRIOR ART The starch using industry includes diverse industries such as candy makers, makers of adhesives and paints, gravy makers, paper producers, etc. Since the demand for starch, (which is formed of amylose and amylopectin), has been dramatically increasing for specialized food S* and industrial uses, efforts have been undertaken to tailor the quantity and quality of starch for specific food and industrial uses.

This industry has overtime looked for a number of different starches having, high viscosity, lower viscosity, higher gelling strength and lower gelling strength, different boiling points etc. Each starch tailored for a number of uses. The industry has utilized mutant starches that have less amylopectin and mutant starches with more amylose for tailored specifications.

For example the increased amylose starch has been used in the gelled candy making area. And the industry has used the increased amylopectin starches formed by mutants such as wx and wx su2 containing little amylose and mostly amylopectin for thicken foods like pudding, pies, gravies, frozen foods and batters, stews, canned foods and baby food. Additionally the mutant starches of different types have usefulness as adhesives and as sizing.

The other method used to address the industry needs for tailored starch is the use of chemical modification of the starch. Chemical derivation of the starch are produced by chemically reacting the starch with the monofunctional reagents to introduce the substituents such as phosphate, acetate, succinate groups to stabilize the starch. Unfortunately, these types of starches can be subjected to government regulation and additionally have less acceptance generally due to the added cost of the starch.

Starch is the major form in which carbohydrates are stored in biological systems. Plant starch in chloroplasts is transitory and storage starch accumulates in storage organs of many plant. Starch can be found in all organs of most higher plants including leaves stems and roots and fruits and embryo and endosperm. In addition to higher plants starch, similar polysaccharide (glycogen) has been found in bacteria. Many bacteria produce a reserve S polysaccharide similar to the glycogen found in animals.

0: 0* Storage polysaccharide has been classified as being in two groups, group one has storage in the cytsol of the cell and the second group within the plastid. Escherichia coli produces a polysaccharide within the cytsol. Starch producing plants typically store starch in the plastids. Typical starch bearing plants include cassava, potato, corn, peas, rice, wheat, barley. The main starch storing tissue of corn, rice wheat and barley and oats, the cereal grains, is the endosperm.

Starches are also classified by the plant source, for example cereal starches are from cereal grains such as maize, rice, wheat, barley, oats and sorghum; tuber and root starch are from potatoes and yams and cassava.

The pathway of starch synthesis is not well understood. Generally, as noted above starch from plants, consists of two major components: amylose and amylopectin. These intertwine in the starch granule of the plants. Amylose is a linear polymer of alpha 1 -4 bonded anhydroglucose units while amylopectin is a branched polymer comprised of linear chains alpha 1-4 linked anhydroglucose units with branches resulting from alphal-6 linkages between the linear chains. It has been known for sometime that mutant genes in starch bearing plants can be expressed and that the properties of the starch can be altered. The proportion of the two components and their structures in the mutant primarily determine the physical-chemical properties of the starch.

Thus the lack of a clear understanding of the starch synthesis pathway and the difficulty of employing mutants limited the industry to the use of existing and producible mutant starches (cereals containing mutant starch can show a tremendous yield penalty in field environments) or to the chemical modification that could be made to the starch. In the last decade the industry has been studying the effects of certain starch genes in plants and bacteria in an attempt to more clearly understand starch synthesis.. Since the late 80's it has been possible to transform plants and bacteria to contain isolated genes. In response to this the industry has transformed potatoes with a bacterial gene GS and with starch soluble synthase III gene in the antisense (forming a mutant). As part of these potato starch experiments bacteria has been transformed with certain potato starch genes. For example the SSSIII gene from potato was transformed into E.coli deficient in glgA gene. The effect of glgC and branching enzyme I and I in combination in a mutant E.coli has also been studied and glycogen like product was reported.

The starch industry that is commercial does not have a particular interest in the production of glycogen which is the polysaccharide produced by bacteria and animals the health care industry may have some such interest). The industry has thus not yet been able to generate tailored starches at reasonable prices through plant gene transformation. There remains a need for the industry to find new starches that are useful due to their changed characteristics such as lower viscosity and new starches that are useful because of their higher viscosity and new methods of producing such starches.

Glycogen synthesis in E. coli and starch synthesis in higher plants have similar pathways involving ADPGIc pyrophosphorylase, starch synthase,(SS) or glycogen synthase and branching enzyme It has been suggested that ADPGlc pyrophosphorylase plays a pivotal role in regulating the amount of starch synthesized, while starch synthase and starch branching enzyme primarily determine the starch structure. Multiple forms of SBE and SS have been identified in many plants including maize, rice, pea and potato. In addition to the waxy gene coding for granule bound starch synthase (GBSS), three genes coding for the other forms of SS have been isolated from maize endosperm. Maize is the only cereal crop from which the genes coding for the five forms of SS have been isolated. Clearly a number of these sequences are published and known to those of skill in the art. Genes coding for maize SBE have also been cloned and characterized. Previous reports have demonstrated that maize SBEI has a higher rate of branching amylose than SBEII and preferentially transfers longer chains, while SBEII shows a higher rate of branching amylopectin and preferentially transfers shorter chains. In comparison with SBE, less is known about the specificities and functions of multiple forms of SS. In Waxy maize, which lacks GBSS, only amylopectin is synthesized and amylose is missing. Therefore, it is generally accepted that GBSS, encoded by waxy gene, is primarily responsible for the synthesis of amylose. Study of waxy mutation in Chlamedomonas reinhardtii has suggested that GBSS is also involved in amylopectin synthesis. Although it has been reported that Chlamedomonas reinhardtii SSII controls the synthesis of intermediate size glucans of amylopectin in Chlamedomonas, direct evidence for the functions of SS in higher plants is still missing. Antisense technology has been used to study the functions of SS in potato, however, the results are inconclusive.

C

In an article written by Hanping Guan et al., entitled AMaize Branching Enzyme Catalyzes Synthesis of Glycogen-like Polysaccharide in gig B-deficient Escherichia coli@.

Published in Proc. Natl. Acad. Sci. USA, Vol. 92, pp. 964-967, February 1995 Plant Biology a specific glycogen like polysaccharide from a transformed E coli was reported. This article taught the transformation of an E coli bacteria with maize BEI and BEII. These enzymes were transformed into two E coli hosts. One of the bacterial hosts was a wild type and the other was a mutant. The mutation to the bacteria was the reduction of the activity of glycogen BE in the AC71(glgB-) so that the mutant was essentially free of BE activity. The paper analyzed the debranched alpha-glucan isolated from the four different transformants. The first host was E.

coli containing glgB and the second host was the AC71 without any transformed genes then AC71 transformed with maize BEII, and then AC71 with maize BEI then AC71 with maize BEI and BEII. The resultant polysaccharide products were analyzed by HPLC, by chain length and relative peak area and by mole distribution of chains. The study led to the understanding that BEII could play a role in synthesis of the short chains of amylopectin and BEI could be involved with the longer chains of amylopectin. The paper also noted that the mutant host AC71 produced more chains with chain length of 6 then did the wild type E. Coli. The paper also noted that the maize BE and the GS of the host did not produce amylopectin like polysaccharides. The article suggested that the concerted action of GS with different BE=s could play an important role in determining the final structure of the polysaccharide synthesized. The article by Guan ends by suggesting that his study had established the basis for studying the concerted actions of BE and SS in a bacterial model system.

The expression of E coli GS (glycogen synthases) in potatoes showed a large incidence of highly branched starch. This result was published in an article in Plant Physiol. 104,1159- 1166 by Shewaker et al. This potato does not appear to be of much commercial use at this time.

The industry still needs the option of producing plant like starches in a fermentation process from bacteria and thus without the necessity of breeding and growing environment sensitive plants; and, the option of producing plants that generate the specific tailored starch through a plant host. And the industry needs altered and new starches that are cereal like starches or root and tuber like starches in large quantities and inexpensively thus avoiding having to use chemical modification of starch. The industry needs a host that can be readily transformed to supply different starches tailored to the industry=s need. Specifically the industry needs a host that supplies various different starches including those not capable of being made in plants or bacteria presently.

OBJECTS AND ADVANTAGES SAccordingly, several objects and advantages of the invention are to produce plant like starch through the process of fermentation.

Additional objects and advantages are the production of new starches in plants.

Still further objects and advantages will become apparent from a consideration of the ensuing description and accompanying drawings.

Another object of the present invention is the synthesis of polysaccharides including amylose, amylopectin in E. coli, and/or fungal and yeast by plant starch synthesizing enzymes including SS, SBE, bacterial branching enzyme, glycogen synthase and other enzymes in other living organism.

Yet another object of my invention is using each or combination of these enzymes or 6 modified enzymes studied in this patent to produce or to improve polysaccharides in any living organism including starch synthesis in plants.

SUMMARY OF THE INVENTION The invention provides DNA constructs in a host that include most of the genes in the starch pathway of a plant such that the host produces a plant like polysaccharide. And in one embodiment produces maize starch including slightly different embodiments that make specific maize mutant like starch in a non plant host. This invention encompasses a bacterial host containing a combination of two or more of such genes SSI, SSSIIa, SSIIb, SSSIII, GBSS, BEI and BEII when the combination does not form glycogen like material. This invention encompasses a plant host transformed with any of the following maize genes or a plant host having a combination of two or more of the following maize genes SSI, SSIIa, SSIIb, SSSIII, GBSS, BEI and BEII in a hybrid or an inbred rice plant.

Additionally the present invention includes new'polysaccharide produced by a transformed host. The host having a wildtype, which does not produce the new polysaccharide, the transformed host expressing at least two exogenous starch synthesis genes, the genes are selected from a group consisting of starch synthesis genes such as SSI SSIIa, SSIIb, SSIII, GBSS and optionally including at least one of the BEI and BEII genes wherein the transformed host is capable of producing such new polysaccharide.

The invention also covers a new polysaccharide wherein the host also expresses the exogenous genes selected from the following group consisting of bacterial glycogen inducing genes are selected from the group glgA, glgB, glgC and any mutants thereof. Or wherein the host also expresses the exogenous genes selected from the following group consisting of plant granule bound enzymes. And the new polysaccharide wherein the starch synthesis genes are selected from the group consisting of BEI and BEII.

The present invention broadly encompasses a host containing a transformed Gig C gene and at least one of the starch branching enzymes genes in a host in combination with at least one other transformed starch gene wherein the host produces a polysaccharide product. And a host containing transformed bacterial gene and at least one of the non starch branching enzymes selected from the group consisting of debranching enzymes and soluble starch synthase A method of producing polysaccharides which are non glycogen like in a host comprising transforming a host capable of being used in a fermentation process, with genes selected from the group which produce starch synthesizing enzymes, or glycogen synthesizing enzymes such that the host produces nonglycogen like starch, and employing the host in a fermentation process that produces polysaccharides. The host is bacteria, or a fungal or a yeast. Additionally the method of this invention includes the use of bacterial genes also such as the glycogen synthesizing genes including the glgC, glgA, glgB genes. A method wherein the genes which produce starch synthesizing enzymes include genes encoding for starch soluble synthases I, IIa, IIb and SS III (dull). A method wherein the genes which produce starch synthesizing enzymes include genes encoding for starch debranching enzyme and branching enzymes. The invention covers the modified starch synthesizing enzymes including the N-terminally truncated SS.

o0 In other word the invention covers a host transformed to carry a gene active in glycogen production, and at least one nonstarch branching gene active in the production of at least one of the following polysaccharides amylopectin and amylose in its original host. The host can be a monocot or a dicot plant. The host can be a cereal bearing plant. Or the host can be a bacteria.

More specifically the invention includes a host wherein at least one nonstarch genes active in the production of at least one of the following polysaccharides, amylopectin and amylose in its original plant, is selected from the group consisting of starch soluble starch synthase I, lia, IIb, III genes and debranching enzyme gene (sul), GBSS gene, sh2 gene and bt2 gene. A host including at least one of the starch branching enzyme genes such as BEI gene, BEII gene.

The present invention can also be described as a host transformed to carry a gene active in ADPG production, and at least one starch gene active in the production of at least one of the following polysaccharides amylopectin and amylose in its original host wherein the host 8 produces polysaccharides that are plant like starch and not glycogen like.

Additionally the host can be transformed to carry a pyrophosphorylase gene, and glycogen synthase gene.

The scope of the present invention includes a host deficient in alpha 1,4 glucan synthesizing ability and alpha 1,4-1,6 branching enzyme capability transformed to express at least one a plant starch soluble synthesis gene. And the host can also include being transformed to express at least one gene encoding for debranching enzyme, and/or a gene encoding for starch soluble synthase I, starch soluble synthase enzyme Iia, IIb, starch soluble synthase enzyme III. This host can including being transformed to express at least one gene encoding for starch branching enzyme.

This invention also includes the production of a glycogen like material in plants.

Attached hereto are a number of plasmids described by the figures and by table one, that are part of the present invention and are claimed herein. One such example is the plasmid wherein the plasmid is in a carrier host and the plasmid contains the SSIIa gene with the n terminus (SEQ ID NO:1) GENVMNVIVV and wherein the gene is approximately 1561 base pairs in length. The invention includes mutant hosts such as mutant plants like waxy rice and potatoes and corn as example and wherein the host is a mutant E. Coli, or fungus.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows a graph which gives the relative peak area in percent and the chain length of glycogen and starch soluble synthase I (SSI), starch soluble synthase II (SSIIa), starch soluble synthase lib (SSIIb). Thus this shows the specificities of Maize SS=s in chain elongation.

FIG. 2 shows plasmid pEXSC-MBEI with 7661 base pairs and promoter T7 and a Kanamycin gene and glgC and the maize starch branching enzyme I (MBEI).

FIG. 3 shows plasmid pEXSC3C with 7461 base pairs and promoter T7 and ampicillin gene and the maize starch soluble synthase gene lia. pEXS3c is the 1082 bp Nde I-EcoRI fragment containing the N-terminus of MSSSIIa (from MSSIIa in pBSK) subcloned into the Nde I-EcoRI sites of pEXS3a, replacing the N-terminus of IIA-2 with the longer IIa Nterminus. MSSIIa is the mature maize SSIIa and is 2090 bp long. The following sites are not contained in the MSSIIc insert: Apa I, BglII, Eco V, Not, Spe I, and Xba I. The N-terminus of this plasmid is (SEQ ID NO:2) AEAEAGGKD.

FIG. 4 shows plasmid pEXSC-MBEI-MBEII with 9971 base pairs and promoter T7 and a Kanamycin gene and glgC and the maize starch branching enzyme I (MBEI) and the maize starch branching enzyme II (MBEII).

S• FIG. 5 shows plasmid pEXSC-MBEII with 7521 base pairs and promoter T7 and a Kanamycin gene and glgC and the maize starch branching enzyme II (MBEII).

FIG. 6 shows plasmid pEXSC-3a with 7990 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the maize N-terminally truncated starch synthase gene IIa (MSSIIa-2). The N-terminal sequence is (SEQ ID NO:61) GENVMNVI.

o FIG. 7 shows plasmid pEXSC-8 with 7079 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the maize starch soluble synthase gene I and version I- 2.(MSSI-2), An N-terminally truncated SSI.

FIG. 8 shows plasmid pEXSC-9 with 7551 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the maize starch soluble synthase gene IIb (SSIIb).

The N-terminal sequence is (SEQ ID NO:10) AAAPAGEE.

FIG. 9 shows plasmid pEXSC-10 with 7211 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the maize starch soluble synthase gene I, the full length SSI. The N-terminal sequence is (SEQ ID NO:11) CVAELSREGPA FIG. 10 shows plasmid pEXSCA with 6738 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the glgA gene.

FIG. 11 shows plasmid pEXSC9a with 7240 base pairs and promoter T7 and ampicillin gene and the maize starch soluble synthase gene IIb-2 (Maize SS IIb-2), an N-terminallytruncated SSIIb. The N-terminal sequence is (SEQ ID NO:12) MNVVVVASECAP.

FIG. 12 shows plasmid pEXSWX with 6968 base pairs and promoter T7 and an ampicillin gene and the N-terminally-truncated maize WX (maize granular bound starch synthase). The N-terminal sequence for wx is (SEQ ID NO:13) ASAGMNVVFVGAEMA.

FIG. 13 shows plasmid pEXSWX2 with 6980 base pairs and promoter T7 and an ampicillin gene and the N-terminally-truncated maize WX termed as wx2. The N-terminus of wx2 is (SEQ ID NO:14) MNVVFVGAEMA.

FIG. 14 shows plasmid pEXSC9 with 7780 base pairs and promoter T7 and ampicillin gene and E. coli glgC gene and the maize starch soluble synthase genellb (Maize SS lib).

FIG. 15 shows plasmid pEXSC10d with 7112 base pairs and promoter T7 and ampicillin gene, E. coli glgC gene and the N-terminally-truncated maize starch soluble synthase gene I termed as Maize SSI-3). The N-terminus of maize SSI-3 is (SEQ ID NO:15) MSIVFTGEASPYA.

.FIG. 16 shows plasmid pEXS10 with 5300 base pairs and promoter T7 and ampicillin gene and the full length maize starch soluble synthase gene I termed as Maize SS I.

FIG. 17 shows plasmid pEXS8 with 7259 base pairs and promoter T7 and ampicillin gene and the N-terminally-truncated maize starch synthase gene I termed as SSI-2. The Nterminal sequence is (SEQ ID NO:16) CVAELSRDLGLEPEG.

FIG. 18 shows plasmid pEXSCA1 with 5128 base pairs and promoter T7 and ampicillin gene and the glgA. pESCAl is a 1551 bp SpeI-Sac I fragment containing glgA (from glgA in pBSK) subcloned into the Xba I- Sac I sites ofp ET-23d which is commercially available from Novagen in Madision Wisconsin under catalog number 69748-1 and called ET- 23d(+) DNA.

11 FIG. 19 shows the spectrum of the iodine glucan complex of the product produced by the host containing the glgC and glgA, and the pEXSC9, pEXSC3, pEXSC8, pEXSCwx the X-axis is listing nm and the Y axis is reading absorbance.

FIG. 20 shows the spectrum of the iodine glucan complex of the product produced by the host transformed with plasmids containing the glgC, the BEI, the BEII genes and glgA; glgC, the BEI, the BEII genes and maize SSI, SSI-2 and glgC, the BEI, the BEII genes and maize SSIIb, and glgC, the BEI, the BEII genes and maize SSIIa-2, and glgC, the BEI, the BEII genes, the X-axis is listing nm and the Y axis is reading absorbance.

FIG. 21 shows the product produced by the host in small bottles including the product o* from the host containing glgC, the BEI, the BEII genes and maize SS=s genes. Encoded as (ClgC, the BEI, the BEII and maize SSI-2 genes and pEXSC encoded as (CIII+ gl+8), gC, the BEI the BEII and maize SSI -2 genes and pEXSC9 encoded as (C-I-II+9),glgC, the glgC, the BEI, the BEll and maize SSI genes and pEXSC9 encoded as (C-I-II+9),glgC, the BEI, the BEII and maize SSIIb genes and pEXSC3a encoded as (C-I-II+3a), glgC, the BEI, the BEII and maize SSIIa-2 genes and pEXSCWX encoded as (C-I-II+WX),glgC, the BEI, the BEII and maize waxy genes and pEXSCA1 encoded as (C-I-II+Al), containing maize BEI, BEII and E.coli glgA genes. potato dextrin, waxy maize starch, corn amylopectin, rice starch, corn starch, pEXSC8.

FIG. 22 shows pExs-trc has 4178 base pairs with the trc promoter and the ampicillin gene. PEXS trc is pTrc99A-Ndel which has been mutagenixed. (Nco I site in multiple cloning site ofp Trc99A-Ndel is mutagenixed to Nde I using primers EXS63 AND EXS64.) pEXS-trc contains only one Nde I site and no Nco I sites. The following sites are not contained in pEXS-trc; Bgl II, Cla I, Nco I, Not I, Sac II, SnaB I, Spe I, and Xho I.

FIG; 23 shows pEXS-trc3 has 4129 base pairs with the trc promoter and the ampicillin gene in partial and the Kanamycin gene. The pEXS-trc3 is pEXS-trcl cut with BglI (filled in)- Sca I and religated, deleting most of the Amp gene (304 nt from the 5" end remain). The following sites are Not contained in p EXS-trc3: Apa I, BgI II, Eco V, Nco I, Not I, SnaB I, and Spe I.

12 FIG. 24 shows the plasmid pEXS 102 having 7190 base pairs, adapted for plant transformation containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the Waxy 2 gene and the nos terminator and the ampicillin gene.

FIG. 25 shows the plasmid pEXS 103 having 6607 base pairs, adapted for plant use containing the maize 10KD zein promoter,the gene coding for the maize starch synthase I transit peptide and the Waxy 2 gene and the nos terminator and the ampicillin gene.

FIG. 26 shows the plasmid pEXS 101 having 6979 base pairs, adapted for plant use containing the maize 10KD zein promoter, the gene coding for the maize starch synthase I S transit peptide and the gig B gene and the nos terminator and the ampicillin gene.

FIG. 27 shows the plasmid pEXS 100 having 7557 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the gig B gene and the nos terminator and the ampicillin gene.

FIG. 28 shows the plasmid pEXS 101 having 6273 base pairs, adapted for plant use containing the maize 1OKD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the gig A gene and the nos terminator and the ampicillin gene.

FIG. 29 shows the plasmid pEXS 66 having 6001 base pairs, adapted for plant use containing the maize 10KD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the gig C 3 gene and the nos terminator and the ampicillin gene.

FIG. 30 shows the plasmid pEXS 65 having 6373 base pairs, adapted for plant use containing the maize 10KD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the maize waxy gene and the nos terminator and the ampicillin gene.

FIG. 31 shows the plasmid pEXS 64 having 7073 base pairs, adapted for plant use containing the maize 10KD zein promoter,the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase IIa gene and the nos terminator and the ampicillin gene.

FIG. 32 shows the plasmid pEXS 63 having 6473 base pairs, adapted for plant use containing the maize 10KD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase IIa gene and the nos terminator and the ampicillin gene.

FIG. 33 shows the plasmid pEXS 62 having 6773 base pairs, adapted for plant use containing the maize 1OKD zein promoter,the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase I-2 gene and the nos terminator and the ampicillin gene FIG. 34 shows the plasmid pEXS 61 having 7013 base pairs, adapted for plant use containing the maize 10KD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase IIb gene and the nos terminator and the ampicillin gene.

FIG. 35 shows the plasmid pEXS 59 having 6858 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the E.coli glgA gene and the nos terminator and the ampicillin gene FIG. 36 shows the plasmid pEXS 58 having 7658 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase IIa gene and the nos terminator and the ampicillin gene.

FIG. 37 shows the plasmid pEXS 56 having 6586 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the glg C 3 gene and the nos terminator and the ampicillin gene.

14 FIG. 38 shows the plasmid pEXS 54 having 7658 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the Maize SS Ia gene and the nos terminator and the ampicillin gene.

FIG. 39 shows the plasmid pEXS 53 having 7058 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the maize starch soluble synthase IIa-2 gene and the nos terminator and the ampicillin gene.

.e FIG. 40 shows the plasmid pEXS 52 having 7358 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and maize starch soluble synthase I-2 gene and the nos terminator and the ampicillin gene.

FIG. 41 shows the plasmid pEXS 51 having 7398 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and maize starch soluble synthase IIb gene and the nos terminator and the ampicillin gene.

FIG. 42 shows photograph of eleven products of altered starch produced with the present invention. The titled are encoded C-I-II-the glgC gene and the BEI and the BEII genes the following number or alternatively designation means pEXS-and the number. Thus C-I- II=the glgC gene and the BEI and the BEII and EXS-10 plasmid that contains the gene SSI, having the N-terminus shown in Table 1.

FIG. 43 shows the DNA sequence (SEQ ID NO:33) and the protein sequence (SEQ ID NO:34) for glgA having 1488 base pairs.

FIG. 44 shows the DNA sequence (SEQ ID NO:35) and the protein sequence (SEQ ID NO:36) for glgB having 2361 base pairs.

FIG. 45a shows the DNA and amino acid sequences (SEQ ID Nos: 38 37 respectively) for Zea mays 10-kDa zein gene having 2562 base pairs.

FIG. 45b shows the DNA and amino acid sequences (SEQ ID Nos. 39 37 respectively) for Zea mays 10-kDa zein portion of the gene used as the promoter in a number of the plasmids discussed herein.

FIG. 46 shows the DNA sequence (SEQ ID NO:40) and the protein sequence (SEQ ID Nos:41, 76 77) for glgC3 (glgC 3 having 1328 base pairs containing two mutations P295D, K296E. This is a mutant of the wild type glgC gene.

FIG. 47 shows the DNA sequence (SEQ ID NO:42) and the protein sequence (SEQ ID NO: 43) for glgC (glgC) having 1328 base pairs.

9.

FIG. 48 shows the DNA sequence (SEQ ID NO:44) and the protein sequence (SEQ ID NO:45) for glgCwt (glgCwt) having 1328 base pairs. This is the glgC gene that is found in nature.

FIG. 49 shows the DNA sequence (SEQ ID NO:46) and the protein sequence (SEQ ID NO:47) for the maize waxy gene denoted wx herein.

FIG. 50 shows the DNA sequence (SEQ ID NO:48) and the protein sequence (SEQ ID NO:49) for the maize starch soluble synthase IIb encoding gene having 2423 base pairs.

FIG. 51 shows the DNA sequence (SEQ ID NO:50) and the protein sequence

(SEQ

ID NO:51) for the maize starch soluble synthase IIa.

FIG. 52 shows the DNA sequence (SEQ ID NO:52) and the protein sequence (SEQ ID NO:53) for the maize starch soluble synthase 1-2 having 1749 base pairs.

FIG. 53 shows the DNA sequence (SEQ ID NO:55) and the protein sequence (SEQ ID NOs:54 and 70-75) for the maize branching enzyme II.

16 FIG. 54 shows the DNA sequence (SEQ ID NO:57) and the protein sequence (SEQ ID NO:56) for the maize branching enzyme I.

FIG. 55 shows the DNA sequence (SEQ ID NO:58) and the protein sequence (SEQ ID NO:59) (153) for the transit peptide portion of the maize starch soluble synthase I.

FIG. 56, PCR analysis of transgenic rice plants. The genomic DNA isolated from rice plants were PCR amplified using specific primers for the inserted gene. The specific bands were identified on 1% agarose gel compared with non-transgenic rice plant.

0..

0FIG. 57. Activity staining of starch synthase on renaturing SDS-PAGE gel with Iodine solution: The positive staining of maize SSI-2 indicated the expression of maize SSI-2 in transgenic rice plants.

FIG. 58 SSI-1, SSI-2 and SSI-3 construct diagram. Three forms of SSI were constructed in the pET expression system (see Methods). pExsl0a encodes SSI-1 (SEQ ID NO:62), the full length maize SSI (583 amino acids). pExs8 encodes a truncated SSI, SSI-2 (SEQ ID NO:60), with amino acids #8-52 deleted from the N-terminus of SSI-1. pExsld encodes the most truncated form of SSI, SSI-3 (SEQ ID NO:63), with the first 93 amino acids deleted from SSI-1. A depiction of the waxy gene, encoding GBSS, is also included for C' comparison (SEQ ID NO:64). The amino acid motif (SEQ ID NO:17) KS/TGGL, the putative binding site for ADPGlc, is indicated by the triangles. The KS/TGGL motif (SEQ ID NO:17) is located 18 amino acids from the N-terminus in GBSS, while the motif is 106 amino acids from the N-terminus in maize SSI. Drawing not to scale.

FIG. 59. SSIIa-1 and SSIIa-2 construct diagram. Two forms of SSIIa were constructed in the pET expression system. pExs3c encodes SSIIb-1 (SEQ ID NO:65), the putative full length maize SSIIb. N-terminal sequencing of SSIIa-1 revelaed that the polypeptide chain started at amino acid so the length of SSIIa-1 is 669 amino acids.

pExs3a encodes a truncated form of SSIIa, SSIIa-2 (SEQ ID NO:66), with the first 176 Nterminal amino acids deleted from SSIIa (493 amino acids total). A depiction of the waxy gene, encoding GBSS, is also included for comparison (SEQ ID NO:64). The amino acid motif (SEQ ID NO:17) KTGGL, the putative binding site for ADPGlc, is indicated by the triangles. The KTGGL motif (SEQ ID NO:17) is located 18 amino acids from the Nterminus in GBSS, while the motif is 194 amino acids from the N-terminus in maize SSIIa.

17 FIG. 60. SSIIb-1 and SSIIb-2 construct diagram. Two forms of SSIIb were constructed in the pET expression system (see Methods). pExs9 encodes SSIIb-1 (SEQ ID NOs:67 68 respectively), the putative full length maize SSIIb. N-terminal sequencing of SSIIb-1 revealed that the polypeptide chain started at amino acid so the length of SSIIb-1 is 637 amino acids. pExs9a encodes a truncated form of SSIIb, SSIIb-2 (SEQ ID NO:69), with the first 144 N-terminal amino acids deleted from SSIIb (492 amino acids total). A depiction of the waxy gene, encoding GBSS, is also included for comparison (SEQ ID NO:64). The amino acid motif (SEQ ID NO:17) KTGGL, the putative binding site for ADPGlc, is indicated by the triangles. The KTGGL motif (SEQ ID NO: 17) is located 18 amino acids from the N-terminus in GBSS, while the motif is 158 amino acids from the N- *terminus in maize SSIIb.

FIG. 61. Temperature Curves for SSI enzymes. All assay components, except enzyme and [U-14C]-ADPGlc, were mixed and then preincubated at each temperature .for 3 minutes *O before addition of enzyme and ADPGlc. For all assays, the final concentration of ADPGlc was 3 mM, while amylopectin was 6 mg/ml. Each point is an average of three separate determinations.

0 FIG.62. Temperature Optima of SSIa-1 and SSIIa-2. All assay components, except enzyme and [U-14C]-ADPGlc, were mixed and then preincubated at each temperature for 3 minutes before addition of enzyme and ADPGlc. For assays in the presence of 0.5 M citrate, mg/ml amylopectin was used as primer. For assays without citrate, 10 mg/ml amylopectin was used. For all assays, the concentration of [U-14C]-ADPGlc was 3 mM. Each point is an average of three separate determinations.

FIG. 63. Temperature Optima of SSIIb-1 and SSIIb-2. All assay components, except enzyme and [U-'4C]ADPGlc, were mixed and then preincubated at each temperature for 3 minutes before addition of enzyme and ADPGlc. For all assays, the concentration of [U- "4C]ADPGlc was 3 mM and the concentration of glycogen was 40 mg/ml. Each point is an average of three separate determinations.

PREFERRED EMBODIMENT DESCRIPTION Gene shall mean the entire gene sequence or any mutations or varieties of the codon that produce the desired activity in the host or alternatively the section or sections of the gene sequence necessary to produce the desired activity in the host. For example glgC gene shall mean glgC, 6 glgC 3 and other mutants that produce the desired activity in the host. Starch synthase gene shall mean full length SS, N-terminally-truncated SS or mutated SS with starch synthase activity.

Glycogen like-shall mean polysaccharide material such as those produced as the main starch product by E.coli in its native state and by the hosts as taught in the above described S. paper by Hanping Guan.

Non Glycogen like- shall mean polysaccharide material which is plant like and is not produced as the main starch product by E.coli in its native state and by the hosts as taught in the above described paper by Hanping Guan.

Plant like starch- is non glycogen like.

Transformed gene-shall mean a gene that was somewhere in the lineage of the plant or bacteria introduced into the plant by means other than nature. Thus the progeny of a transformed host would continue to contain a transformed gene.

Transformed host- shall mean any organism containing one or more of the novel plasmids and/or a novel combination of starch synthetic genes discussed herein.

Within this application a number of different protocols have been employed to designate the same gene or synthase. MSS#=maize soluble starch synthase, SS#will likewise mean starch synthase though not necessarily maize. STS#will also designate soluble starch synthase.

GBSS=granule bound starch synthase. SBE#=starch branching enzyme, MBE= maize starch branching enzyme, MSBE#=maize starch branching enzyme, and BE#=starch branching enzyme.

The present invention broadly encompasses transforming hosts such as bacteria or plants with plant starch synthetic genes that produce a non glycogen like material (a bacteria containing BEI and BEII from maize produces a glycogen like material). Starch bearing plants and organisms hereinafter are referred to as the host. One of the primary aspects of this invention is the generation of plant like starch from a bacterial host and the production of altered starch in a plant host. The present invention has been exemplified in both bacteria and in transformed rice plants. The host can contain though it is not a limitation, an unlimited supply of ADPG from the addition of the glgC gene (the bacterial gene) to the plant.

Additionally the present invention encompasses plasmids that contain the maize genes and/or "i the bacterial genes in a construct adapted for use in a bacteria and constructs adapted for use in o a plant. The plasmids in the plant construct preferably containing an active promoter :recognized by the plant, a transit peptide, and the cleavage site that permits the protein to cleave from the transit peptide when crossing into the amyloplast in the plant. The plasmids used in the rice transformation specifically encompassed the maize 10 kd zein promoter, and the transit peptide from the maize SSI gene in the constructs adapted for plant use. The present invention also encompasses the plant producing the altered starch in the starch storage section Vo° of the plant or within the host cell and the altered starch itself. Additionally the present invention encompasses the combination of a number of starch genes in combination being active in a host such that the host produces differing non glycogen polysaccharides. Still further the present invention encompasses a method of making plant like starch in a bacterial host and the method of making altered plant like starch (altered in relationship to the type or amount of starch that the host makes without the constructs containing the genes), in a plant.

Yet another object of the present invention is the addition of a gene that encodes for the substrate ADPG used to form starch.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in a plant and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase I or its mutant form. The present invention also encompasses the combination of a promoter adapted for use in a plant and optionally a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase I or its mutant form, and at least one gene encoding for branching enzyme transformed into a plant host.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in a plant and a gene encoding for ADPGlc pyrophosphorylase, preferably a bacterial gene, and a gene encoding for starch synthase Iia or its mutant form. The present invention also encompasses the combination of a promoter adapted for use in a plant and optionally a gene encoding for ADPGlc pyrophosphorylase, and a gene encoding for starch synthase lia or its mutant form, and at least one gene encoding for branching enzyme transformed in to a plant host.

The present invention encompasses a plasmid having a promoter adapted for use in a plant and a gene encoding for ADPGlc pyrophosphorylase, preferably a bacterial gene. and a gene encoding for starch synthase IIb and its mutant form. The present invention also encompasses the combination for a promoter adapted of use in a plant and an optional gene encoding for ADPGlc pyrophosphorylase, and a gene encoding for starch synthase IIb or its mutant form and at least one gene encoding for branching enzyme transformed in to a plant host.

The present invention encompasses a plasmid having a promoter adapted for use in a plant and a gene encoding for Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa, starch synthase IIb, DU1. The present invention also encompasses the combination of a promoter adapted for use in a plant and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa, starch synthase Iib and DU1, and at least one gene encoding for branching enzyme transformed in to a plant host.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in a plant and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa, IIb and starch synthase III (DU1). The present invention also encompasses the combination of a promoter adapted for use in a plant and an optional gene encoding for ADPGlc pyrophosphorylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa, IIb starch synthase III(DU1), and at least one gene encoding for branching enzyme, and at least one gene encoding for the debranching enzyme transformed in to a plant host.

The present invention encompasses a plasmid or combination of plasmids in the host having a promoter adapted for use in a bacteria or yeast and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase I.

The present invention also encompasses the combination of a promoter adapted for use in a bacteria or yeast and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase I, and at least one gene encoding for branching enzyme transformed in to a bacteria or yeast host.

The present invention encompasses a plasmid or combination of plasmids in the host having a promoter adapted for use in a bacteria or yeast and a gene encoding for Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase IIa.

The present invention also encompasses the combination of a promoter adapted for use in a S bacteria or yeast and optionally a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase IIa, and at least one gene encoding for branching enzyme transformed in to a bacteria or yeast host.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in a bacteria or yeast, and a maize gene encoding for starch synthase III(DUI). The present invention also encompasses the combination of a promoter adapted for use in a bacteria or yeast and an optional gene.encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase III, and at least one gene encoding for branching enzyme transformed in to a bacteria or yeast host.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in bacteria or in yeast and a gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa,IIb, starch synthase III(DUl). The present invention also encompasses the combination of a promoter adapted for 22 use in bacteria or in yeast and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa,IIb, starch synthase III, and at least one gene encoding for branching enzyme transformed in to bacteria or into yeast hosts.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in bacteria or in yeast and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa,IIb, starch synthase III The present invention also encompasses the combination of a promoter adapted for use in bacteria or in yeast and a gene encoding for Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa,IIb, starch synthase III(DUl), and at least one gene encoding for branching enzyme, and at least one gene encoding for the debranching enzyme transformed in to a bacteria or into a yeast host.

The present invention encompasses the truncated versions of the SSI and the SSII and the SSIII genes that still provide protein that is sufficient to make the polysaccharide.

o By transforming different combinations of SS and SBE into E. coli HPG204(DE3) or G6MD3 defective in GS and GBE, we obtained the first evidence that maize SSI, SSII and SSIII have different specificities in the size of glucans synthesized see fig one.. Herein, we present the model system to produce differing polysaccharides from hosts with SS and SBE in E.coli by metabolic engineering. We also demonstrated that the truncated forms of SS had different Vmax, temperature stability and kinetic properties (Table, Fig).

We also demonstrated that transformation of starch synthase and/or branching enzyme in E .coli resulted in production of polysaccharides differing in size and structure. These polysaccharides can be used in food and nonfood industries to replace and/or complement starch functionalities. A large amount of these polysaccharides can be produced with fermentation technology.

Starch biosynthesis in higher plants and glycogen biosynthesis in E. coli have similar reactions which use adenosine diphosphate glucose (ADPGlc) as a substrate. This similarity allows us to use plant starch synthase (SS) and starch branching enzyme (SBE) to complement the functions of glycogen synthase (GS) and glycogen branching enzyme (GBE) in E. coli G6MD3, which is deficient in GS and GBE. Transformation of E.coli glgC gene and maize starch synthase gene in E.coli G6MD3 produced linear a 1,4 glucan similar to amylose.

coexpression of the glgC, maize starch synthase and maize branching enzyme produced branched polysaccharides. However, distinct properties of plant starch branching enzyme and starch synthase make it possible to synthesize different polysaccharides in E.coli. While maize SSI preferentially synthesis short chains (dp 6 15), SSII and SSIII preferentially transferred long chains (dp 24) and intermediate chains (dp 16 24) respectively. Transformation of different maize starch synthases, E. coli glycogen synthase (glgA) and/or maize branching enzymes into E.coli HPG96 or E. coli G6MD3 resulted in the synthesis of different sizes of o e polysaccharide with DP 500-4000.These polysaccharides synthesized in E .coli by maize SS have different physical-chemical properties than polysaccharides synthesized in natural organisms including starch from plant sources and glycogen from animals. The polysaccharide can be used in food and nonfood industries to replace and/ or complement starch functionalities. A large amount of these polysaccharide can be produced by fermentation technology. The following materials were employed in the construction of the present invention some of the starting material are commercially available from Novagen in Madision Wisconsin ET-23d(+) DNA under catalog number 69748-1 and BL21(DE3) under catalog number 69387-1; ET-21 DNA under catalog number 697401.

Plant Hosts The following plasmids have been transformed into rice plants Transgenic 1, MSTSIA(pExs52) and glgC 3 (pExs66), MSTSIIa and glgC 3 (pExs53 and pExs56). The second group of rice transformatns contain MSTSIIc and glgC 3 (pExs54 and pExs56).The third group of transformation: transgenic 5 MSTSIII and glgC 3 pExs 61 and pExs 66); transgenic 6 Mwx glgC 3 p-Exs65 and pExs66). Generally see figures 25-41 for plasmid maps and figure 43-55 for sequences used in the plasmid. Additionally, glgA and glgB and glgC were combined and transformed into rice. This is combining the rice plants starch pathway with the gene encoding for ADPG and the genes encoding for at least one of the following enzymes, SSI, SSII, SSIII, Debranching enzymes, BEI, BEII, GBSS (wx).

These plasmids could have been transformed into other cereals such as corn, wheat, barley, oats, sorghum, milo in substantially the plasmid that is shown in the figures for the plant host. The promoter could be the waxy gene which is published, other additional zein promoters are known and could be used as the promoter. The promoter used herein is described in Figures 45aand Additionally these plasmid with little additional work could be transformed into dicots such as potatoes, sweet potato, taro, yam, lotus cassava, peanuts, peas, soybean, beans, chickpeas. The promoter could be selected to target the starch storage area of the particular dicots (some are roots some are tubers). Various method of transforming monocots and dicots are known in the industry and the method of transforming the genes is not critical to the present e invention. The plasmid can be introduced into Agrobacterium tumefaciens by the freeze-thaw Smethodof An et al.(1988) Binary vectors. In Plant Molecular Biology Manual A3, S.B. Gelvin and R.A. Schilperoot,eds (Dordrecht, The Netherlands: Kluwer Academic Publishers), pp. 1- 19. Preparation of Agrobacteruim inoculum carrying the construct and inoculation of plant material regeneration of shoots, and rooting of shoots are described in Edwards et al. (1995).

Biochemical and molecular characterization of a novel starch synthase from potatoes. Plant J.

8, 283-294. Additionally promoters for different dicots are known particularly 35sCaMV and Monsanto has also published a promoter that is useful in potatoes called a patatin promoter.

A number of monocots are also starch bearing plants but until about a decade ago monocots were difficult to develop transformants. The most prominent methods of transformation presently used in monocots is the gunning of micro projectiles into the plants or using Agrobacterium and subsequent regeneration of the plants from the transformed materials.

Various tissues and cells can now be transformed with plasmids into monocot hosts. In fact there are teaching from at least five ago on methods of transforming not only callus but also cotyledons. The methods of transforming plants and selecting for the transformants with either selectable or screen able markers are also well known. The use of the marker in the same plasmid and the use of the markers in a separate plasmid that is co transformed into the host are well known in the art by those of ordinary skill in the art. The biotechnology methods of forming plasmids and transforming plants are listed in the book entitled AShort Protocols In Molecular Biology@, 3rd ed. Published in 1995 by JOHN WILEY& Sons, Inc. Additionally, methods of transforming with the gun and with protoplasts are taught in a number of issued patents to Dekalb and Agracetus and Ciba.

PREFERRED EMBODIMENT OPERATION EXAMPLE 1 Construction of the E. coli expression vector.

The expression vector pExs2 was derived from pET-23d (Novagen) and pGP1-2 The expression vectors pExs-trc and pExs-trc3 were derived from pTrc99a (Pharmacia) and pGP1-2. The BglII/PstI fragment (2192 bp) containing the pBR322 origin of replication was Sdeleted from pET-23d and replaced with the BamHI/PstI fragment (3 kb) containing origin pl5A and kanamycin resistance gene from pGP1-2. This process generated plasmid pEXS1 containing both ampicillin and kanamycin resistance genes. The ampicillin resistance gene was inactivated by deletion of the Seal BglI fragment (360 bp, BglI end was filled in and blunt- Send ligated with Seal end). Inactivation of the ampicillin resistance gene in pEXS generated the expression plasmid pEXS2, containing the T7 promoter, T7 terminator, kanamycin e resistance gene and pl5A origin of replication. Plasmid pTrc99a was digested with Nde 1, filled in with kelnow fragment and blunt-end ligated to remove NdeI site. A Ndel site was introduced at the NcoI site by mutagenesis to generate plasmid pExs-trc. The BglI and PvuII fragment(2.48 kb) in pExs-trc containing the pBR322 origin of replication was replaced by BglI/BamHI (filled in with Klenow fragment) fragment (3 kb) containing origin pl5A and kanamycin resistance gene from pGP1-2 to generate pExs-trc2. The ampicillin resistance gene was inactivated by deletion of the Scal BglI fragment (360 bp, BglI end was filled in and blunt-end ligated with Scal end). Inactivation of the ampicillin resistance gene in pExs-trc2 generated the expression plasmid pExs-trc3.

Construction of expression plasmids for maize SS. For expression of maize SS in E.

coli, The PCR method was used to modify the N-terminus of maize SS using the following nucleotides (SEQ ID NOs: 18-30 respectively, in order of appearance) primer Exs4 (5'CAAGAATGCTGCGGGAGTC-3'), primer Exs23 AAGTCGACATATGTGCGTCGCGGAGCTGAGCAG-3'), primer Exs 57 GGGCCCCATATGAGCATTGTCTTTGTAACCGG-3'), primer Exsl 26 CTCGGGCCCATATGGGGGAGAATGTTATGA3'), primer Exs2 GAGGCATCAATGAACACAAAGTCGi-3'), Primer Exs33 GAAGGGCCCCATATG<3CTGAGGCTGAGGCCGGGCAA~pG- 3 primer Exs 16 TrGGATCCATATGGGAGCTGCGGT1-GCATrGGG..3') and primer Exsl7 CCTGCGGGCTCTGGCTTCACC), primer Exs 55 TTGGATCCATATGAACGTCGTCGTGGTGGCTTC..3'), primer 56 GCATACCATGGAACCTCAACAGC-3'), primer 53 GGTACCATATGAACGTCGTCTTCGGCG..3'), primer Exs 54 *GACAGGCCCGTAGATCTTCTCC-3'), primer Exs -wx *TTGGTACCATATGGCCAGCGCCGCCGGCATGACG-3') Primer Exs 4 'paired respectively with primer Exs23 and Exs 57 was to modify the N-terminus of maize SSSI gene to generate pExs-1O and pExs-ld. Primer Exs2 paired individually with primer Exs33 and Exsl was to ffiodify the N-terminus of maize SSSII to generate pExs3c and pExs3a. Primer Exs1 7 paired individually with primer Exsl6 and Exs55 was to modify the N-terminus of maize- 555111 to generate pExs-9 and pExs-9a. Primer Exs54 paired individually with primer Exs-wx and Exs53 was used to modify the N-terminus of maize GBSS to generate pExs-wx and pExswx2. The modified N-terminus was recombined with the rest of the SS gene in pBluescript SK plasmid. The reconstructed of maize SS was subcloned from pBluescript Sk to the NdeI/NotI 0 0000 sites of the expression vector pET-21a (Novagen) pExs-trc, pExs-trc3 (maps are attached, *.Table I shows the N-terminal sequence of SSS).

EXAMPLE 2 Construction of expression plasmids for E. coli ADPGlc pyrophosphorylase,

BE

and maize SBE.

E. coli glgB gene was excised from plasmid pQPl2 The BstXlI (filled in) HindII fragment containing the glgB ribosome binding site and the full length glgB gene was cloned at the SinaI site of pBluescriptSK- (Stratagene). The glgB gene in pBluscriptSK- was subsequently cloned into pEXS2 at the XbaI Sall sites to generate plasmid pEXSB. Primer G (SEQ ID NO:31) (5'-GAAGATCTGGCAGGGACCTGCACAC..3') and primer H (SEQ ID NO:32) (5'-GGACTAGTGCATTATCGCTCCTGTIfTAT-3') were used to PCT the E. Coli glgC gene coding for ADPGlc pyrophosphorylase from plasmid pOP 12. A BglII site and a SpeI site introduced by PCT to the N-terminal and C-terminal site respectively, were used to clone the PCR product into pBluscript SK- at the BamHI and Spel sites. The glgC gene including its own ribosome binding site was subcloned into expression plasmid pEXS2 at the XbaI (filled in with Klenow fragment) and NotI site to generate plasmid pEXSc. The genes coding for mature maize SBEI and SBEII along with a ribosome binding site were subcloned from plasmids pET- 23d-SBEI and pET-23d-SBEII into the plasmid pEXSc at the Spel site to form the plasmids pEXSc-SBEI and pEXSc-SBEII. The gene coding for mature maize SBEII including a ribosome binding site was cloned into pEXSc-SBEI at the XbaI/NotI sites to form plasmid pEXSc-SBEI-SBEII. E.coli glgc gene and genes encoding maize SBEI and SBEII were also cloned in plasmid pExs-trc and pExs-trc3 respectively and together as described for pExs2.

EXAMPLE 3 Isolation ofE. coli HPG204 deficient in GBE and GS activities Homologous recombination was used for the strain construction. This was done according to the method described by Hamilton et al Journal of Bacteriology, 1989, .171:4617-4622.) A temperature-sensitive pSC101 replicon was used to facilitate the selection.

The gene coding for spectinomycin adenyltransferase was inserted at PvuII sites in plasmid pOP12 to form plasmid HPG9 which has spectinomycin resistance and has C-terminus of glgB gene and N-terminus of glgA gene deleted. The DNA fragment B=SA= with Spectinomycin resistant gene inserted between partial truncated glgB and glgA was subcloned into plasmid pMAK705 at Xbal site containing temperature sensitive replicon (Hamilton et al. Journal of Bacteriology, 1989, 171:4617-4622.) to form Plasmid pMak705B=SA=. Plasmid pMak705B=SA= was transformed into TG1 cell. After the transformed cell was cultured in 3 mL LB with 100 mg/mL Spectinomycin at room temperature overnight, the cells were plated on LB agar plate containing 100 mg/mL spectinomycin and incubated at 44 0 C overnight.

Single colonies were inoculated on LB agar plate containing 100 mg/mL spectinomycin and 0.2% glucose and incubated at 44 0 C and at 37 0 C overnight. The colonies at 37 0 C were stained with iodine. The colony with negative staining was selected and grown in 100 mL LB at 37 0

C

overnight. The cells were harvested and homogenized in an extraction buffer for assaying glycogen synthase and branching enzyme activities. The cell lacking glgA and glgB activities was named as HPG204 [F-traD36 LacI D(glgBXCA) D(LacZ)M15proAB*/SupED (hsdMmk, McrB)thiD(lac-proAB),Spectinomycin, ChloramphenicolR .The IDE3 28 lysogenization kit fromNovagen was used for site specific integration of 1DE3 prophage into E. coli HPG204 to form E. coli HPG204(DE3)[ was DThe lysate was prepared with Plvir and its transduction into E. coli BL21 (DE3) [F=traD36 Lacl D(glgBXCA) (hsdM-mcrB)5(rk rn McrB')thiD(lac-proAB),Spectinomycin

R

Chloramphenicol R EXAMPLE 4 Expression of maize SS and SBE in E. coli.

Plasmid pExs-2 and pExs-trc3 has kanamycin resistance and pl5A origin of replication.

It is compatible with plasmid pET21a, pExs-trc, pTrc99A containing pBR322 origin.

S: Expression plasmids pExs-2 and pET-21a were used to express SS and SBE in E. coli HPG204(DE3). Expression plasmids pExs-trc and pExs-trc3 were used for expression in E.

coli G6MD3. This made it possible to transform different combinations of maize SS and SBE S. in E. coli HPG204(DE3), or G6MD3 which is deficient in GS and GBE activity. An overnight culture of cells transformed with maize SS and SBE was diluted 1:20 in fresh LB containing 0.2 glucose, 100 mg/mL ampicillin and 50 mg/mL kanamycin. The cells were 0. grown at 37 0 C for about 2 h to A600nm -0.6 before the expression of maize SBE and/or SS was induced by adding isopropyl b-D-thiogalactoside to 0.5 mM. Following growth at 25 0 C for 4 h, the cells were harvested in a refrigerated centrifuge.

EXAMPLE Isolation of highly branched a-glucan from E. coli.

Cell pellet (30 g) was resuspended and lysed by sonication in 150 mL 50 mM trisacetate buffer (pH 7.5) containing 10 mM EDTA and 5 mM DTT. After a fraction of the homogenate was saved for assaying the STS and SBE activities, the homogenate was centrifuged at 20, 000g for 50 min at 4 0 C. After collecting the supernatant, the pellet was resuspended in 150 mL water and boiled for 15 min with occasional stirring. The resuspension was centrifuged at 20, 00Og for 30 at room temperature. After collecting the supernatant, the pellet was washed again with 100 mL water as above. 0.1 volumes of 50% Trichloric acid (TCA) were added to the pooled fractions. After storing on ice for 30 min, the precipitate was spun down at 15,000g for 20 min, then washed with 30 mL 5% TCA and centrifuged as above.

The supernatant and wash were pooled and one volume of absolute ethanol was added. After storing on ice for 30 min, the polysaccharide was collected by centrifuging at 15, 000g for min. The polysaccharide was redissolved in water and precipitated with ethanol. This step was repeated twice. The pellet was washed with methanol twice, acetone twice and dried over silica gel at room temperature.

EXAMPLE 6 Isolation of linear a 1,4 polysaccharide from coli 9** Resuspend 50 grams of cell pellet in 250 mL of 50 mM Tris acetate buffer, pH containing 10 mM EDTA and 5 mM DTT. Sonicate for 3 minutes (45 seconds/time, output S 8, repeat 4 times with 30 seconds interval). The homogenate is centrifuged at 12,000 rpm (SA1500) for 50 minutes. The supernatant is checked with iodine staining and discarded.

(Same 1 mL homogenate and 1 mL supernatant for enzyme assay. The pellet is resuspended extracted in 100 mL DMSO. Extract the polysaccharide by heating and stirring in boiling water bath for 15 min. Let it cool down to below 40 OC and centrifuge at 12,000 rpm for 30 min at room temperature. The supernatant is pooled. The pellet is extracted two more times with 100 S mL DMSO. Equal volume of absolute ethanol is added into the pooled supematant, mixed and stored on ice for 30 minutes. Centrifuge at 12,000 rpm for 30 min at 4 OC The pellet is redissolved in 20 mL DMSO by heating in boiling water bath. 80 mL water is added and mixed well. After adding 10 mL butanol to the solution, the solution is mixed and stored at 0 OC for one hr (mix once a while). Centrifuge at 12000 rpm for 30 min at 4 0 C. Repeat the step once.

The pellet is redissolved in 90 mL hot water by heating in boiling water bath. Insoluble materials are immediately removed by centrifugation at room temperature. Add 10 mL butanol to the supernatant, stay at 0 OC for 1 hr and centrifuge at 12000 rpm for 30 min at 4 oC. Repeat the step once. The amylose precipitate is redissolved in 90 mL hot water by heating, and 10 mL butanol are added to the solution. After storing at 40 oC on ice for one hour, it is centrifuged at 4 OC for 30 min. Repeat the step once. The pellet is redissolved in 100 mL 10% butanol by heating. The amylose is stored at 0 OC and precipitated by centrifuging at 12000 rpm for min at 4 OC. The pellet is washed with 25 mL methanol 3 times and with acetone once. Dry over silica gel.

EXAMPLE 7 Enzyme assays mL of supernatant were used to assay STS and SBE activities as previously described (Preiss) with minor modification. The reaction mixture for STS contained 100 mM Bicine buffer, 10 mg/mL glycogen, 0.5 mg/mL BSA, 0.5 M sodium citrate, 25 mM potassium acetate, mM GSH, 3 mM [14C]ADPGlc (500 dpm/nmol) and enzyme in a final volume of 0.1 mL.

The reaction was carried out at 25 0 C for 15 min and terminated by boiling for 2 min. The unincorporated [14C]ADPGlc was separated with Dowex anion exchange column (200-400 mesh, Sigma Chemical One unit of activity is defined as 1 nmol Glc incorporated into the a-glucan per min at 25 0 C. SBE activity was determined by phosphorylase stimulation assay.

One unit of activity is defined as 1 mmol Glc incorporated into the a-glucan per min at 30 0

C.

Example 8 Enzyme purification For the recombinant SS purification, the cell pellet was resuspended in sonication buffer mM Tris-acetate, pH 7.5, 10 mM EDTA, and 5 mM DTT; 7 ml buffer per gram of cell mass), and cells were lysed using a Fisher 550 Sonic Dismembrator with 5 x 1 min. bursts with sec. intervals. The homogenate was centrifuged at 9600g for 30 minutes. SSI in the supernatant was then precipitated by slowly adding neutralized saturated ammonium sulfate to saturation. After stirring on ice for an additional 50 minutes, proteins were collected by centrifugation at 12700g for 45 minutes. The protein pellet was then redissolved in buffer A mM Tris, pH 7.5, 1 mM EDTA, and 5 mM DTT) containing 0.1 M KCl and dialyzed against the same buffer, with one change of buffer. After dialysis, the sample was centrifuged at 13000g for 20 minutes to remove insoluble materials. The resulting supernatant was loaded onto an amylose affinity column pre-equilibrated with dialysis buffer, and the flow through was collected. The column was washed with 10 column volumes of buffer A containing 0.1 M KCI, and then with buffer A containing 0.5 M KCI and 0.5 M maltose, collecting fractions during both washes. The active fractions were pooled and dialyzed overnight against buffer A, with one change of buffer. The next day, the amylose column sample was filtered and applied to a mono Q 5/5 FPLC column (Pharmacia). After washing with buffer A, a 20 ml 0-0.4 M KCl gradient was employed. The active fractions were electrophoresed on an 8% SDS-PAGE gel (31) to determine the purity of SSI in those fractions; the fractions which were apparently homogeneous were pooled and concentrated using a Centricon-30 spin column (Amicon).

Table 1. Expression of maize starch synthases in Escherichla coi BL21 (DE3).

Plasmids Maize strch synthase- N-terminus Protein Specific Activ~tes* genes (mgtnL) (unitslmng Protein) pET21a Native plasmi 1.8 0.009 PE(S-3a SSIla-2 GENVMVNVIVV 2.8 0.069 (SEQ ID NO: I)pEX(S-3c SSIla AEAEAGGKD 2.8 0.28 (SEQ ID NO:2).

DEXS-ld 581-3 MSIFVTGEA 3.0 0.23 (SEQ ID N03).

P EXS-8 S81-2 GDLGLEPEG 1.9 0.097 (SEQ ID NO:4) CVAELSREG 1.2 0.043 *.(SEQ ID 20 pEXS-9 SSlb GSVGAALRSY 1.8 0.515 .(SEQ ]D NO:6) pE(S-9a SSIlb-2 MNVVASEC 2.6 0.36 (SEQ ID NO:7) pEXS-wx GBSS (waxy) ASAGMVNVVFV 2 0.033 5 SQ O8 GSS(2) MNWFV.GAEM 2.2 0.32 (SEQ ID NO:9) *One unit activity is defined as one ftmol glucose incorporated into a-1,4 glucan per minute at 257C using 5 mg/mL glycogen as primer.

S

S S *5 S S S S S S S *S 55 Table 2. Propertle! Plasmid Prote (Mglri pExsCA pExsC-9 pExsC-3a 13.3 pExsC-8 12.6 pExsC-wx 15.2 pExsC-l-II pExs9 7.84 pExsC-I-lI pExs3a 13.61 pExsC-I-lI pExs8 11.95 pExsC-l-11 pExsl10 8.9 pExsC-I-lI pExswx 11.7 pExsC--II pExsAl 11 3of polysaccharides synthesized in STS activity BE activity L) (/mprotein) (u/mg protein) .0015 .0032 0.002 0.08 0.011 0.042 .0094 .007 0.13 In E. coi.

Imax (nm) 580 585 600 580 600 480 530 525 500 450 4.11 1.56 3.33 3.65 5.4

DP

700 1007 983 435 836 2333 3616 1689 3174 2970 CL Yield (mg dry wt/g wet cell) 10.6 3.3 35.8 4.1 53 31.8 7.4 15.6 9.1 19 22 36 17.5 131 16.6 24.5 14.8 33.8 4.48 475 3940 14 28.9 9 9 9 9 9 9 9 9* *9 99 Table 3. Properties listed by degree of DP of polysaccharides synthesized In E coi.

Plasmid Protein STS activity BE activity Imax DP CL Yield (Mg/mL) (u/mg protein) (u/mg protein) (nm) in dru uutln UUM cell) pExsC-l-lI pExsAl pExsC-l-ll pExs3a 13.61 pExsC-l-ll pExs108.9 pExsC-l-ll pExswxl 1.7 pExsC-l-ll pExs9 pExsC-I-ll pExs8 pExsC-9 pExsC-3a pExsC-wx pExsCA pExsC-8 0.13 4.48 475 0.011 .0094 .007 1.56 3.65 5.4 530 500 450 3616 3174 2970 7.84 11.95 13.3 15.2 0.08 0.042 4.71 3.33 .0015 0.002 .0032 480 525 585 600 600 580 580 3940 14 22 16.6 14.8 2333 19 1689 17.

1007 35.

983 53 836 15.

700 10.

435 31.

36 24.5 33.8 5 8 6 131 4.1 9.1 3.3 7.4 28.9 12.6

S

S

S *5* S

S..

S S S .55 S S S S S Table 4. PropertieE Plasmid Protel (Mg/nf cell) pExsC-3a 13.3 pExsC-wx 15.2 pExsC-9 pExsCA pExsC-8 12.6 pExsC-l-ll pExs3a 13.61 pExsC-I-1l pExs8 11.95 pExsC-l-lI pExslO 8.9 pExsC-l-Il pExs9 7.84 pExsC-l-ll pExsAl 11 pExsC-I-iI pExswx 11.7 listed by degree of Xmax of polysaccharides synthesized in E coi.

in STS activity BE activity Xmax DP CL Yield iL) (u/mg protein) (u/mg protein) (nm) mg dry wt/g wet .0015 0.002 .0032 0.011 0.042 .0094 0.08 0.13 .007 1.56 3.33 3.65 4.71 4.48 5.4 600 600 585 580 580 530 525 500 480 475 450 983 836 1007 700 435 3616 1689 3174 2333 3940 2970 53 15.6 35.8 10.6 31.8 22 17.5 16.6 19 14 14.8 9.1 4.1 3.3 7.4 36 131 24.5 28.9 33.8

A

S S A A A A

A..

A

A

A

A A A A A

A

A A A

A

Table 5. Properties Plasmid Protei (Mg/rr cell) pExsC-3a 13.3 pExsC-9 pExsC-8 12.6 pExsC-t-lI pExs3a 13.61 pExsC-l-lI pExs9 7.84 pExsC-I-ll pExs8 11.95 pExsC-l-ll pExslO 8.9 pExsC-wx 15.2 pExsC-l-ll pExswx 11.7 pExsC-l-Il pExsAl 11 pExsCA listed by degree of CL of polysaccharldes synthesized In E. coil.

n STS activity BE activity kmax OP CL Yield iL) (u/mg protein) (u/mg protein) (nm) mg dry wt/g wet .0015 .0032 0.011 0.08 0.042 .0094 0.002 007 0.13 1.56 4.71 3.33 3.65 5.4 4.48 600 585 580 530 480 525 500 600 450 475 580 983 1007 435 3616 2333 1689 3174 836 2970 3940 700 53 35.8 31.8 22 19 17.5 16.6 15.6 14.8 14 10.6 4.1 7.4 36 131 24.5 9.1 33.8 28.9 3.3 Table 6. Purificalion Tables/or SSI-1, SSI-2, and SSI-3.

ssI-1 Homogenate Supernatant 0-40% (NEWS 4 Amylose column monoQ column volume (ml) 630 570 48 17 0.27 total mg protein 4347 2622 494 2.6 0.26 activity U/mg 0.018 0.020 0.058 5.03 12.2 total units 76.2 53.0 28.7 11.3 purification (fold) 3.2 279 677 0..0S 3.2 SSI-2 Homogenate Supernatant 0-40% WW..

2 S0 4 Amylose column monoQ column volume (ml) 380 320 48 17.5 1.0 total mg activity protein U/mg 2797 0.0356 2118 0.0340 466 0.133 1.2 22.6 0.325 17.2 total Units 99.6 72.0 61.8 26.5 5.6 purification (fold) 1 1 3.7 634 483 S S SSI-3 Homogenate Supernatant 0-40% (NH 4 2 S0 4 Amylose column monoQ column volume (ml) 1300 1100 237 63 3.6 total mg protein 16770 9790 2204 30 3.1 activity U/mg 0.23 0.31 1.5 22.4 30.5 total Units 3900 3080 3294 668 93 purification (fold) 1 1.3 97 132 Notes: Assays performed during the course of purification contained 10 mgIlI glycogen and 3 mM

[U-

1 'C]-ADPGlc. Assays were performed at room temperature in the presence of 0.5 M citrate. 1 Unit 1 pgmol [J- 14 C]-glucose transferred per min.

Table 7. Primer Kinetics for SSl enzymes Amylopectin SSI-3 SSI-2

MUI-

citrate Km VMaz citrate K, VMax 240 26.3 230 13.2 45 0.5 60 0.3 230 50 33.4 2.1 68 3 9.94 0.18 150 22.5 0.6 120 Glycogen SSI-3SSI-2SSI-1 citrate 43.4 2.5 45.6 3.3 39.0 2.2 citrate 41.4 2.9 45.5 1.5 26.1 1.4 Notes., Assays were performed at 37 0 C as described in the Materials and TMethods. Data are expressed as the average of three independent determinations along with the standard deviation. K. are expressed as p9g/ml primer and are in j.Lmol/Inin/mg protein. ADPGlc 3 mMIV in all assays.

'Because saturating glycogen concentrations could not be obtained, a standard 20 mg/mId glycogen was used to compare enzyme rates for that primer.

Table 8. ADPGc Kineticsfor STSI enzymes. Assays and data evaluation are as i Table II K. are expressed as mM ADPGlc and V. are i limo~rnin/mg protein. 5 mg/ml amylopectin was used as primer for all assays.

STSI-3 STSI-2 STSI-1 citrate X:- 0.33 0.07 Via 26.4 1.4 citrate; K. 0.62 0.04 V. 14.7 1.3 0.32:t 0.02 32.6 ±0.8 0.25 0.04 11.7 0.7 0.18±0.02 18.0 0.24 ±0.02 6.38 ±0.88 Tabl 9. Pur'fication Tables for SSI~a enzyes. Assays for SSI -7 purlfication contained 10 mg/nil glycogen and 1_5 MM [U-"4CJ-ADPGlc (both are at Saturating concentrations). Assays for SSIIa-1 purification contained 5 mg/mI amylopectin and 3 mM

[U_

14 C]-ADPGlc. Assays were performed at room temperature in the presence of 0.5 M citrate. 1 U 1 ,mol [U- 14 C]-glucose transferred per min.

SS]Ia-2 volume (ml) 300 total mng activity protein U/mg 1620 0.0216 Supernatant total Units 34.8 25.4 purification (fold) 1 Dow* .0.0 9 0 .6 00* Oe.

000.

0-40% (NHILSO 4 Amylose column monoQ column 20 9.3 0.99 1 9.3 45.9 0.9 0.94 4.81 4.5 222 53 419 0.0606 SSIna-1 volume (ml) 335 total mng activity protein U/mg 2613 0.28 total purification Units (fold) 737 1 Supernatant 0-40% (NH 4

SO

4 Amylose column monoQ column 47 427 0.96 409 25 11.5 8.04 1.0 4.8 9.10 92 28.7 44 32.5 Table 10. Prime Kinetics for SSI~ra enzmeS. Assays were performed as described in the Materials and Methods. Data are expressed as the average of three independent determinations along with. the standard deviation. IC. are expressed in pg/mI and are in pimol/min/nig prote in. ADPGlc 3 mM in ail assays. *NA not applicable; enzyme cannot be saturated by primer under these conditions.

Amylopectin SSIIa-2 S 0* 6@ 4 west

C

S. *t S

C

~4 0

C

citrate 270C K Vma= 37-C Km~ 153 ±22 7.82 ±0.63 133 ±18 SSTa-1 182 ±38 24.1 153 ±64 41.1 ±0.2 404 *33 10.5 ±0.3

-NA'

VMZ

1 15.4 0.6 *9* see*~ 6000 citrate .270 C Km 234 30 Vm 2 1 4.31 0.32 37-C K, 1350 220 VmaZ 7.84 0.25 Glycogen SSI~a-2 SSIIa-1 citrate 27-C Km, 50.7 3.8 162 ±17 VmmX 5.53 0.44 14.2 ±0.7 37-C Km 76.9 7.8 350 ±11 =1 11.3 0.7 31.6 ±0.8 Table 11. A.DPGlc Klnetics for SSI~a enzymes. Assays and data evaluations are as in Table IL Concentration of primer in each case was saturating for each enzyme and was determined by the experiments detailed in Table I.K are expressed as mM ADPGlc ad V. are In ILmol/minlmg protein. *NA not applicable, as the enzyme cannot be saturated by primer under these conditions.

with amylopectin as primer SSIIa-2 SST~a-1 citrate 27"C Km, 0.17 0.04 Vms, 4.83 0.42 0.48 0.09 23.0 0.83 0.08 49.1 2.6 37--C Km 0.28 0.01 VmIX 11.4 0.6 citrate 27-C Km 0.27 0.02 Vms: 4.87 t±0.

0.46 0.06 12.1 0.8

-NA*

-NA*

37 0 C Km

VMI,

0.28 0.005 7.86 0.53 with glycogen as primer with lcozen SSIIa-2 SSIa-1 citrate 27 0 C Km 0.16 0.03 0. 19 ±t 0.02 VmIu 4.41 0.21 17.1 t 0.7 37"C Km 0.15 0.03 0.37t± 0.04 VMS% 7.60 0.94 40.1 1.7 Table 12. Purification Tables for SSIDb-2 and SSIDb-1. Assays performed during the course of purification contained 10 mg/ml glycogen and 3 mM [U_ 14 CIADpGlc. Assays were rerformed at room temperature in the presence of 0.5 M citrate. 1 U 1 jimol [U- 4C~glucose transferred per min.

SSIIb-2 Supernatant 0-40% (NH 4 2 S0 4 Amylose column monoQ column volume (ml) 890 190 13 6.6 total mg protein 9256 2660 31.2 16.3 activity U/mg 0.48 1.24 50.6 56.8 total Units 4450 3306 1573 939 purification fold 1 2.6 105 118 SSI1Ib-1 Supernatant 0-40% (NH4)SO 4 Amylose column monoQ column volume

(MI)

365 56 80 0.6 total mg protein 2336 436 10.4 0.28 activity U/mg 0.64 2.35 50.2 60.6 total Units 1533 1030 521 17.6 purification fold 1 3.7 78 94 Table 13. Kinetics for SSI~b enzymes. Assays were performed at 37 0 C as described in the Materials and Methods. Data are expressed as the average of three independent determinations along with the standard deviation. For ADPGIc inetics, Y. are expressed in mM ADPGlc.

ex .pressed as mg/mi Frimer, and 3 mM ADPGlc are in fLmol min7'mg7 protein.

ADPGlc Kinetics For primer Inetics, K. are were used in the assays. V.

SSIIb-2 SSIIb-1 with glycogen 0.32 0.04 0.71 ±0.01 76.8 ±3.2 Vinlla with amylopectin 130 6

KM

VmaI 0.32 ±0.03 90.9 ±4.2 0.40 ±0.02 72.8 ±2.8 Primer Kinetics SSIIb-2 SSIIb-1 glycogen Km 0.36 0.02 0.43 ±0.02 79.5 ±3.3 Vinal amylopectin 120 3 Km 0.26 ±0.04 Vmaz 84.5 ±2.4 0.074± 0.008 67.9 1.7 Table 14. Comparison ofinetic data for expressed SS's. Data for SSI and SSI~a are form Imparl-Radosevich et al., 1998; Imparl-Radosevich Li P, McKean Al, Keeling PL, and Guan HP, submitted for publication. K. for amylopectin and glycogen are epxressed in mg/mi; for ADPGlc are in mM and were determined in the presence of amylopectin and Mcitrate. are in pmol The for glycogen for SSI could not be determined as saturating concentrations of glycogen could not be reached for this enzyme.

0 0 0: o Kinetic Parameter K. for amylopectin K for glycogen SSI-3* SSI-1 SSla-2' SSI~a-1 SSIb-2' SSE~b-1 0.13 0.077 K. for ADPGlc V. (with amylopectin) (with glycogen) 0.33 26.3 43.4 0.28 15.4 11.3 0.15 0.35 0.83 41.1 31.6 0.26 0.36 0.32 84.5 120 0.07 0.43 0.40 67.9 79.5 'denotes N-terminally truncated form of SS, while any SS with the designation SS-l is the fulfl length version of the SS.

Table 15. The starch synthase activities of the chimerical enzymes.

Generation of chimerical enzymes of maize starch synthase: the recombination of N-terminal extensions with C-terminal catalytic domains of starch synthase The gene coding for N-terminal extensions of STSI, STSIla and STSIIb were inserted, in the same or reverse orientation of original N-terminal DNA sequence, in front of the C-terminal catalytic domains of WX2, STSIla and STSIIb, respectively. The chimerical enzymes were expressed in E.coli, and the activities were assayed.

WX2 STSIIa STSIIb C-catalytic domain C-catalytic domain C-catalytic domain STSI N1-WX2 N1-C2 N1-C3 N-extension NRA 9.0 6.6 39.7 89.2 NRA STSIIa N2-WX2 N2-C2 N2-C3 N-extension 9.2 11.2 213.8 8.7 232.5 NRA STSIIb N3-WX2 N3-C2 N3-C3 N-extension NRA NRA 11.2 NRA 400.5 12.0 N1: STSI N-terminal extension; N2: STSIIa N-terminal extension; N3: STSIIb N-terminal extension; WX2: WX2 C-terminal catalytic domain; C2: STSIIa C-terminal catalytic domain; C3: STSIIb C-terminal catalytic domain.

the N-terminal extensions were inserted in front of the C-terminal catalytic domains in same orientation; the N-terminal extensions were inserted in front of the C-terminal catalytic domains in reverse orientation.

Starch synthase enzyme activity: nmol/min mgprotein.

The residue glycogen synthase activity ofBL21(DE3) is 2.6nmol/min mg protein.

NRA--No recombinant available.

47 The photographs listed in the figures 42 and 21 attempt to show the visual differences that are present into the starches as compared to those known in the art.

Description of the starch Corn starch is a milky, slightly thickened gel which is slightly if at all flowable.

Rice starch forms two levels the upper level is a thickened syrup like consistency more flowable then corn starch (less thick then corn starch) opaque milky color (more translucent then corn starch in this level) and a lower level which is a very white glob not transmitting S* much light through this bottom level of material. This lower level is formed in a very thick mass and does not appear flowable.

Corn amylopectin is slightly less white then the top level of rice starch and is a very slightly opaque milky color (more translucent then corn starch) slightly less flowable then the rice top level.

Potato dextrin is the most transparent almost appearing clear but is still opaque white and it is very flowable appearing only slightly less flowable then water.

Waxy Maize starch will flow very slowly and has the consistency of honey. The color is very opaque transmitting little light and the color is only slightly less light then corn starch.

SSI starch made from plasmid pExs-8 has two distinct levels. The top level appears clear and slightly thicker then the flowability of water. The bottom level appears as a precipitate. This sample resembles the ornaments that contain little figures and plastic flakes resembling snowflakes. Like those ornaments when turned upside down the sample appears to be falling snow. However the flakes in this sample appear to be slightly gummy and appear in the first moments of level mixing to form a opaque white liquid.

SSI starch made from a host containing the following two plasmids pExsC BEI BEII and pExs8 is not as clear as the top level ofpExs-8 and appears slightly less thick then pExs-8.

48 It has even more flowability then does Potato Dextrin.

SSIIb starch made from a host containing the following two plasmids pExsC BEI BEII and pExs-9 is not as clear as the top level of pExs-8 and appears slightly less thick then pExs-8.

It has even more flowability then does Potato Dextrin.

WAXY starch made from a host containing the following two plasmids pExsC BEI BEII and pExs-wx is not as clear as the top level of pExs-8 but seems to have a few tiny thread like chains that settle to the bottom and when mixed give the material a slightly more white color and appears slightly less thick then pExs-8. It has even more flowability then does Potato Dextrin.

SSII starch made from a host containing the following two plasmids pExsC BEI BEII and pExs-3a is the color of corn starch and maybe slightly whiter but not as white as the bottom level of pExs8 and definitely transmitting more light through and has the flowability '...characteristic of pExs-8 when mixed.

o .glA starch appears to have a very slight precipitate and is comparable in color to corn amylose pectin and ExsC BEI BEII and pExs-wx. And the flowability is between corn n. amylose and pExsC BEI BEII pExs-wx.

The samples of polysaccharides listed above form groups generally according to color as follows: waxy maize starch and corn starch and pExsC BEI BEII pExs3a and pExsc8 are the whitest group. The flowability characteristics of this group are fairly diverse. With corn starch a lump and Waxy maize starch only slightly flowable and pExsC BEI BEII and pExs- 3a and pExsC-8 more like water then syrup. The second group contains corn amylopectin and pExsC BEI BEII pExs-wx and pExsC BEI BEII and pExs-A1 which are less white and clearer.

The flowability of corn amylopectin is less then the other two members of this group but it is still similar. The last group is the least white and thus the clearest. This group includes pExsC BEI BEII and pExs-8, potato dextrin, pExsC BEI BEII and pExs-10, pExsC BEI BEII and pExs-9. The flowability of this group is also similar to each other.

49 Plant Hosts The following plasmids have been transformed into rice plants. The sequence for the mutant glgC gene is shown in Figure 46. The plasmids are made substantially in a similar manner as described above for the production of bacterial plasmid. Clearly the plasmid maps shown in figures 25-41 and this application and the listed short protocols allow the ordinarily skilled person in the art to make the present plasmids. The following combinations of plasmids have been transformed into rice plants. Additionally combinations of plasmids including the combination that includes all of the maize genes SSI, SSII, SSII, BEI, BEII, and GBSS in one Se* host or alternatively in two host that are then crossed to form a hybrid having the entire complement of up regulated starch genes are being developed. Clearly the ordinarily skilled person in the art could have placed the sequences in the antisense positions to down regulate these genes to the extent that maize genes will down regulate the partial homologous rice genes. The first group of transgenic are group1, including rice transformants (transformed by microprojectile bombardment) containing MSTSI-2 (pExs52) and glgC 3 (pExs66), MSTSIIa-2 and glgC 3 (pExs53 and pExs56). The second group of rice transformants contains MSTSIIa and glgC 3 (pExs54 and pExs56). The third group of transformation contain: transgenic MSTSIIb and glgC 3 (pExs 61 and pExs 66); transgenic 6 Maize wx and glgC 3 pExs65 and .pExs66). Additionally, glgA and glgB and glgC are combined and transformed into rice. This last transformant is combining the rice plants starch pathway with the gene encoding for ADPG pyrophosphorylase and the bacterial genes. The combination of the plasmids encoding for at least one of the following enzymes, SSI, SSIIa, SSIIb, SSIII, Debranching enzymes, BEI, BEII, GBSS (wx)and some or all of the bacterial starch genes is also useful. There ae presently over 300 transformants in the greenhouse.The T1 transgenic rice plants have been screened and characterized (Figure 56, 57). 12 plants have successfully expressed maize SSI-2 in rice seeds.

21 plants have successfully expressed maize SSIIb in rice seeds. We are currently screening rice plants down regulated the rice SS expression by cosuppression and have 400 T2 plants in the greenhouse.

Maize Starch Synthase and its Mutant Forms.

In order to characterize the multiple forms of maize starch synthase, the genes coding for the full length SS and its N-terminally truncated forms were expressed in E.coli,. The recombinant enzymes were purified and kinetically characterized. We have demonstrated that different isoforms and its truncated forms all have distinct properties (Table 6-14, Figure 58- 63). The specific activities (Vmax) of the purified maize SSI-1, SSI-2, and SSI-3 were 22.5, 33.4 and 26.3 :mol glc/min/mg of protein respectively, Our results have clearly indicated that the catalytic center of SSI is not located in its N-terminal extension. However, N-terminal truncation decreased the enzyme affinity for amylopectin, with the K. for amylopectin of the truncated SSI-3 being about 60%-90% higher than that of the full length SSI-1. The effects of N-terminal truncation of SSIIa depend upon the assay conditions used. For both SSIIa-1 and SSIIa-2, the Vm, of each enzyme increased 2-fold upon raising assay temperature from 27 NC to 37 NC (Tables II and III). However, the effect of temperature on ADPGlc affinity was different for SSIIa-1 and SSIIa-2. For the truncated SSIIa-2, the K for ADPGlc was not affected by raising temperature. In contrast, the K. of ADPGlc for the putative full length SSIIa-1 increased 2 fold upon raising the assay temperature from 27 NC to 37 NC (Table III).

Interestingly, the truncated SSIIa-2 exhibited a lower K, for ADPGlc than SSIIa-1 did in all assay conditions used in this study except that they showed similar Km values for ADPGlc S. .when glycogen was used as a primer at 27EC. Although N-terminal truncation of SSIIa appears to lower the Km for ADPGlc under most assay conditions, it also must be noted that the maximal velocity of the truncated SSIIa-2 is decreased by about 2-4 fold when compared to SSIIa-1. The truncated SSIIb-2 was found to be more temperature stable than the longer SSIIb- 1 in the presence of citrate, while little difference was observed in their pH activity profiles.

While the putative full length SSIIb-1 showed a similar Vm, using amylopectin or glycogen as a primer, the N-terminally truncated SSIIb-2 showed a 40% increase in Vm, using glycogen compared with amylopectin as a primer. N-terminal truncation of SSIIb increased its by with amylopectin as a primer. We also demonstrated that kimeric enzymes of maize starch synthase (combining the C-terminal domain of SS with different N-terminal sequences of SS or unrelated sequences would produce a functional enzyme with SS activity and altered properties) (Table Conclusions, Ramifications, and Scope Accordingly, it can be seen that, according to the invention, The starch genes can produce new and altered starch in either host, plant or bacteria. Additionally, polysaccahrides very similar to corn starch can be produced in a bacterial host.

Although the description above contains many specificities, these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention. Various other embodiments and r0e@ ramifications are possible within it's scope. For example, different combinations of the S plasmids in either host for the production of useful plant and useful grain and useful polysaccahrides.

Thus the scope of the invention should be determined by the appended claims and their Slegal equivalents, rather than by the examples given. All references cited herein are incorporated herein in their entirety by reference.

00*9 0905 4 Page(s)01-1 1 are claims pages they appear after the sequence listing SEQUENCE, LISTING <110> Guan, Hanping Keeling, Peter L.

<120> PLANT LIKE STARCHES AND

HOSTS

THE METHOD OF MAKING THEM IN <130> 2461-52 <140> 69/402,254 <141> 1999-10-01 <150> PCT/US98/06660 <151> 1998-04-03 <150> 60/042,939 <151> 1997-04-04 <160> 77 <170> Patentln Ver. 2.1 <210> <211> <212> <213> 1

PRT

Zea mays <400> 1 Gly Glu Asn Val Met Asn Val Ile Val Val 1 5 <210> 2 <211> 9 <212> PRT <213> Zea mays <400> 2 Ala Glu Ala Glu Ala Gly Gly Lys Asp 1 <210> 3 <211> <-212> PRT <213> Zea mays <400> 3 Met Ser Ile Val Phe Val Thr Gly Giu Ala 1 5 <210> <211> <212> <213> 4 9

PRT

Zea mays <400> 4 Gly Asp Leu Gly Leu Glu Pro Giu Gly 1 <210> <211> <212> <213> 9

PRT

Zea mays <400> Cys Val Ala Glu Leu Ser Arg Glu Gly 1 <210> 6 <211> <212> PRT <213> Zea mays <400> 6 Gly Ser Val Gly Ala Ala Leu Arg Ser Tyr 1 5 o* <210> 7 <211> <212> PRT o <213> Zea mays 400>Met Asn Val Val Val Val Ala Ser Glu Cys 0 0 1 5 <210> 8 <211> :<212> PRT <213> Zea mays fooo <400> 8 Ala Ser Ala Gly Met Asn Val Val Phe Val 1 5 <210> 9 <211> <212> PRT 00** <213> Zea mays <400> 9 Met Asn Val Val Phe Val Gly Ala Glu Met 1 5 <210> <211> 8 <212> PRT <2.13> Zea mays <400> Ala Ala Ala Pro Ala Gly Glu Glu 1 <210> 11 <211> 11 <212> PRT <213> Zea mnays <400> 11 Cys Val Ala Glu Leu *Ser Arg Glu Gly Pro Ala 1 5 <210> 12 <211> 12 <212> PRT <213> Zea mays <400> 12 Met Asn Val Val Val Val Ala Ser Glu Cys Ala Pro 1 5 <210> 13 <211> <212> PRT <213> Zea mays <400> 13 Ala Ser Ala Gly Met Asn Val Val Phe Val Gly Ala Glu Met Ala *1 5 10 <210> 14 211> 11 <212> PRT <213> Zea mays <400> 14 Met Asn Val Val Phe Val Gly Ala Glu Met Ala 1 5 :<210> <211> 13 <212> PRT <213> Zea mays <400> Met Ser Ile Val Phe Thr Gly Glu Ala Ser Pro Tyr Ala a1 5 <210> 16 <211> <212> PRT <213> Zea mays <400> 16 Cys Val Ala Glu Leu Ser Arg Asp Leu Gly Leu Giu Pro Glu Gly 1 5 10 <210> 17 <211> <212> PRT <213> Zea mays <220> <221> MODRES <222> (2) <223> Ser or Thr <400> 17 Lys Xaa Gly Gly Leu 1 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 18 caagaatgct gcgggagtc 19 <210> 19 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 19 Saagtcgacat atgtgcgtcg cggagctgag cag 33 <210> <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> gggccccata tgagcattgt ctttgtaacc gg 32 <210> 21 <211> 31 <212> DNA S<213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 21 ctcgggccca tatgggggag aatgttatga a 31 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 22 gaggcatcaa tgaacacaaa gtcg 24 <210> 23 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 23 gaagggcccc atatggctga ggctgaggcc gggggcaag 39 56 <210> 24 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 74 ttggatccat atgggagctg cggttgcatt ggg 33 <210> <211> 21 <212> DNA S* <213> Artificial Sequence <220> 00** <223> Description of Artificial Sequence: primer S<400> cctgcgggct ctggcttcac c 21 <210> 26 <211> 33 <212> DNA S.<213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 26 ttggatccat atgaacgtcg tcgtggtggc ttc 33 <210> 27.

<211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 27 gcataccatg gaacctcaac age 23 <210> 28 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 28 ggtaccatat gaacgtcgtc ttcggcg 27 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 29 gacaggcccg tagatcttct cc 22 <210> <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> ttggtaccat atggccagcg ccgccggcat gaacg <210> 31 <211> <212> DNA I <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 31 gaagatctgg cagggacctg cacac <210> 32 <211> 28 <212> DNA <213> Artificial Sequence S<220> <223> Description of Artificial Sequence: primer <400> 32 ggactagtgc attatcgctc ctgtttat 28 <210> 33 <211> 1488 <212> DNA <213> E. coli <220> <221> CDS <222> (join(1..1431, 1435..1488)) <220> <223> glgA <400> 33 atg cag gtt tta cat gta tgt tca gag atg ttc ccg ctg ctt aaa acc 48 Met Gin Val Leu His Val Cys Ser Glu Met Phe Pro Leu Leu Lys Thr 1 5 10 ggc ggt ctg gct gat gtt att ggg gca tta ccc gca gca caa ate gca 96 Gly Gly Leu Ala Asp Val Ile Gly Ala Leu Pro Ala Ala Gin Ile Ala 25 gac ggc gtt gac get cgc gta ctg ttg cct gca ttt ccc gac att cgc 144 Asp Gly Val Asp Ala Arg Val Leu Leu Pro Ala Phe Pro Asp Ile Arg 40 a a g .eS S.

S

E A 06 S i~.

**to ogt ggc gtg Arg Gly Val gga oat ato Gly His Ile ctg att gac Leu Ile-Asp gat aco aac Asp Thr Asn otg ggg tgg Leu Gly Trp 115 ogt cot gat Arg Pro Asp 130 gog tat ctg Ala Tyr Leu 145 cac aac cta His Asn Leu atc caa ttg Ile Gin Leu gga caa ato Gly Gin Ile 195 acg gcg gtc Thr Ala Val 210 gcc tac ggt Ala Tyr Gly 225 ott too ggc Leu Ser Gly aog gac tta Thr Asp Leu aaa gcg gaa Lys Ala Giu 275 gac gat aaa Asp Asp Lys 290 aaa ggt ctc Lys Giy Leu aoo Thr acg Thr gog Ala tta Leu 100 gt t Vali gtg Val1 gog Ala gc Ala ca Pro 180 to:I Ser ag t Ser atg Met gta Va I ctg Leu 260 aa r- As n g tg Val1 ga t Asp ga t Asp o tg Leu oog Pro ttt Phe ggg Gly gtg Vali gog Ala tat Tyr 165 tgg Trp t to Phe oca Pro gaa Giu ocg Pro 245 ttg Leu aag Lys cog Pro tog Ser gog Ala t tg Leu 70 oat His gto Val1 gca Ala oat His ogo Arg 150 oaa Gin toa Ser o tg Leu aco Thr ggt Gly 230 aa c As n goo Ala ogo Arg Ott Leu gtg Val1 oag Gin 55 ttc Phe otc Leu cat His gaa Giu gog Ala 135 ggg Gly ggc Giy t to Phe aag Lys tao Tyr 215 o tg Leu ggo Gly tog Ser oag Gin ttt Phe 295 otg Leu og t Arg ggg Gly gga Gly ttg Leu ott Leu gca Ala 140 tog Ser oat His ggg Gly tat Tyr ac Thr 220 cao His ato Ile gat Asp atg Met ogt Arg 300 gg t Gly aco tcc gc Thr Ser Ala ggo a t:t tao Gly lie Tyr cog tat oao Pro Tyr His ttt gog ctg Phe Ala Leu 110 oca ttc tgg Pro Phe Trp, ott gog cot Leu Aia Pro ttt act gtg Phe Thr Val 160 atg aat gao Met Asn Asp 175 gaa ttc aao Giu Phe Asn 190 gat cac att Asp His Ile ocg cag ttt Pro Gin Phe gaa ggg ogt Giu Gly Arg 240 agt oca gag Ser Pro Giu 255 ttg gaa gat Leu Giu Asp 270 too aag gtt Ser Lys Val aco ago cag Thr Ser Gin tog gag cag Ser Giu Gin 0..0.

00 305 ggc Giy gg t Giy att Ile gtc Val1 tat Tyr 385 ctt Leu g tc Vai cgg Arg cgg Arg gcg Ala 465 ggg cag Gly Gin ttc ctt Phe Leu ggc- tat Giy Tyr 355 att ctg Ile Leu 370 gga tcg Giy Ser gct gat Aia Asp gcc aat Aia Asn act att Thr Ile 435' ttt gtg Phe Vai 450 gcg aag Aia Lys 320 cag gaa Gin Giu 335 gtt cag Vai Gin gcg gac Aia Asp caa ctt Gin Leu ggt ggg Giy Giy 400 gat ggc Asp Giy 415 ctg tta Leu Leu ctg tgg Leu Trp cag gtc Gin Vai ttt tca Phe Ser acg ctt Thr Leu 495 1008 1056 1104 1152 1200 1248 1296 1344 1392 1440 1498 gga aac gcc Giy Asn Ala 480 34 <2ii> 495 <2i2> PRT <2i3> E. col <223> gigA <400> 34 Met Gin Vai i Giy Giy Leu Asp Giy Vai Arg Giy Vai Giy His Ile t

T

.1 ac atg aat gct ccg ttt aca tat tca tcg ccc yr Met Ala Pro Phe Thr Ser Ser Pro Leu His Vai Cys Ser Giu Met Phe Pro Leu Leu Lys Thr 5 10 Aia Asp Vai Ile Giy Aia Leu Pro Ala Aia Gin Ile Aia 25 Asp Aia Arg Vai Leu Leu Pro Aia Phe Pro Asp Ile Arg 40 Thr Asp Aia Gin Vai Vai Ser Arg Arg Asp Thr Ser Aia 55 Thr Leu Leu Phe Giy His Tyr Asn Gly Vai Giy Ile Tyr Leu Ile Asp Thr Leu Gly Arg Pro 130 Ala Tyr 145 His Asn Ile Gin Gly Gin Thr Aia 210 Ala Tyr 225 Leu Ser Thr Asp Lys Ala Asp Asp 290 Lys Giy 305 Giy Giy Gly Phe Ile Gly Vai Ile 370 Tyr Gly 385 Leu Ala Asp As n Trp 115 Asp Leu Leu Leu Ile 195 Val1 Gly Gly Leu Glu 275 Lys Leu Gin Leu Tyr 355 Leu Ser Asp Ala Leu 100 Val Val1 Ala Ala Pro 180 Ser Ser Met Val Leu 260 As n Val1 Asp Leu Al a 340 His Val1 Lys rhr Pro Phe Giy Val1 Ala Tyr 165 Trp Phe Pro Glu Pro 245 Leu Lys Pro Ser Ala 325 Ala Giu Pro Tyr Val1 A nlZ His Leu Tyr Asp Val Al a His Arg 150 Gin Ser Leu Thr Gly 230 Asn Ala Arg Leu Val1 310 Leu Ala Ala Ser Gly 390 S er His Glu Al a 135 Gly Gly Phe Lys Tyr 215 Leu Gly Ser Gin Phe 295 Leu Leu Ala Phe Arg 375 Thr Asp Thr Met 120 His Arg Met Phe Ala 200 Ala Leu Val Arg Ser 280 Ala Glu G ly Giu Ser 360 Phe Leu Cys Asp 105 Ala Asp Pro Phe Asn 185 Gly Arg Gin Asp Tyr 265 Gin Val1 Ala Ala Tyr 345 His Giu Pro Ser Asp 425 Arg Pro 90 Asn Val Ser Gly Trp His Ala Lys 155 Tyr Ala 170 Ile His Leu Tyr Glu Ile Gin Arg 235 Glu Lys 250 Thr Arg Ile Ala Val Ser Ser Pro 315 Gly Asp 330 Pro Gly Arg Ile Pro Cys Leu Val 395 Leu Giu 410 Arg Asp 125 Gly Val1 His Leu Al a 205 Giu Arg Trp Thr Gly 285 Leu Ser Val1 Val1 Gly 365 Leu Arg Leu Phe 110 Pro Leu Phe Met Glu 190 Asp Pro Glu Ser Leu 270 S er Thr Ser Leu Gly 350 Gly Thr Thr Ala Ala Phe Ala Thr Asn 175 Phe His Gin Gly Pro 255 Glu Lys Ser Glu Gin 335 Val Ala Gin Gly Asp 415 Leu Trp Pro Val1 160 Asp Asn Ile Phe Arg 240 Glu Asp Val1 Gin Gin 320 Giu Gin Asp Leu Gly 400 Gly Gly Ser Pro Tyr His Val Ala Asn Gly Phe Ile Phe Glu Ser Asn Ala Trp Ser Leu Leu 430 61 Arg Thr Ile Arg Arg Ala Phe Val Leu Trp Ser Cys Pro Pro Leu Trp 435 440 445 Arg Phe Val Gin Arg Gin Ala Met Ala Met Asp Phe Gly Trp Gin Val 450 455 460 Ala Ala Lys Ser Tyr Arg Giu Leu Tyr Tyr Arg Ser Lys Phe Ser Gly 465 470 475 480 Asn AlS Tyr Met Asn Ala Pro Phe Thr Tyr Ser Ser Pro Thr Leu 485 490 495 <210> <211> 2361 <212> DNA <213> E. coi <220> <223> gigB <220> <221> CDS <222> (join(i. .2184, 2188. .2280, 2284. .2361)) <400> atg tcc gat cgt atc gat aga gac gtg att aac gcg cta att. gca ggc Met Ser Asp Arg Ile Asp Arg Asp Val Ile Asn Ala Leu Ile Ala Gly 1 5 10 cat ttt gcg gat cct ttt tec gta ctg gga atg cat aaa acc acc gcg His Phe Ala Asp Pro Phe Ser Val Leu Gly Met His Lys Thr Thr Ala 20 25 gga ctg gaa gtc cgt gcc ctt tta ccc gac gct acc gat gtg tgg gtg Gly Leu Giu Val Arg Ala Leu Leu Pro Asp Ala Thr Asp Val Trp Val 40 att gaa ccg aaa acc ggg cgc aaa ctc gca aaa ctg gag tgt ctc gac Ile Giu Pro Lys Thr Gly Arg Lys Leu Ala Lys Leu Giu Cys Leu Asp 50 55 tca cgg gga ttc ttt agc ggc gtc att. ccg cga cgt aag aat ttt ttc Ser Arg Gly Phe Phe Ser Gly Val Ile Pro Arg Arg Lys Asn Phe Phe 70 75 cgc tat cag ttg gct gtt gtc tgg cat ggt cag caa aac ctg att gat Arg Tyr Gin Leu Ala Val Val Trp His Gly Gin Gin Asn Leu Ile Asp 90 gat cct tac cgt ttt ggt ccg cta atc cag gaa atg gat gcc tgg cta Asp Pro Tyr Arg Phe Gly Pro Leu Ile Gin Giu Met Asp Ala Trp Leu 100 105 110 tta tct gaa ggt act cac ctg cgc ccg tat gaa aco tta ggc gcg cat Leu Ser Glu Gly Thr His Leu Arg Pro Tyr Glu Thr Leu Gly Ala His 115 120 125 gca gat act atg gat ggc gtc aca ggt acg cgt ttc tct gtc tgg gct Ala Asp Thr Met Asp Gly Val Thr Gly Thr Arg Phe Ser Val Trp Ala 130 135 140 S.

S

S

cca aac gcc cgt cgg gtc tcg gtg Pro Asn Ala Arg Arg Val Ser Val gtt ggg caa ttc aac tac tgg Val Gly Gin Phe Asn Tyr Trp gac 480 Asp 160 ggt cgc cgt cac ccg atg cgc ctg cgt aaa Gly Arg Arg His Pro Met Arg Leu Arg Lys 165 170 gag agc ggc atc tgg gaa Glu Ser Gly Ile Trp Glu 17S 0* 0* c tg Leu att Ile gaa Glu gaa Glu 225 gcg Ala acc Thr gtg Val1 att Ile c tg Leu 305 t tC Phe gtg Val ggc Gly gac Asp ttC Phe 385 gcg Ala cg t Arg cct Pro 180 aat As n a tg Met g ta Val1 tc t Ser aa t As n 260 gc t Ala cat His cca Pro gcC Al a cac His 340 t tg Leu acg Thr gg t Gly gtc Val1 ggg Gly 420 gg t Gly 185 c tg Leu gcg Al a cgC Arg cac His tac Tyr 265 ttt Phe agt Ser gg t Gly ggt Gly gac Asp 345 ga t Asp tat Tyr tgg Trp tca Ser aac Asn 425 aaa tac Lys Tyr 190 cct tat Pro Tyr 205 tgc ggg Cys Gly aat cag Asn Gin tgg cgt Trp Arg gcc gat Ala Asp 270 gaa cta Glu Leu 285 cag cca Gin Pro gac ttc Asp Phe att ctc Ile Leu gcc gaa Ala Glu 350 ggc tat Gly Tyr 365 gaa gtc Glu Val ttt ggt Phe Gly cgc gac Arg Asp ggg cgc Gly Arg 430 576 624 672 720 768 816 864 912 960 1008 1056 1104 1152 1200 1248 1296 0 ctt gaa gcg att gaa Leu Giu Ala Ile Glu 435 cag gtt tcc ggt gcg Gin Val Ser Gly Ala 450 ggc gtt tct cgt ccg Gly Val Ser Arg Pro 465 tgg aac ctc ggc tgg Trp Asn Leu Gly Trp 485 ccg gtt tat cgt cag Pro Val Tyr Arg Gin 500 tac aac tac act gaa Tyr Asn Tyr Thr Glu 515 gtc cac ggt aaa aaa Val His Giy Lys Lys 530 cag aaa ttc gcg aac Gin Lys Phe Aia Asn 545 ccg ggc aag aaa cta Pro Giy Lys.Lys Leu.

565 gag tgg aac cat gac Glu Trp Asn His Asp 580 gat aac tgg cac cac Asp Asn Trp His His 595 acc tac cgc cac cat Thr Tyr Arg His His 610 ggc ttt gaa tgg ctg Gly Phe Giu Trp Leu 625 ttt gtg cgt cgc gat Phe Val Arg Arg Asp 645 ttt acg ccg gta ccg Phe Thr Pro Vai Pro 660 ggc aaa tgg cgt gaa Gly Lys Trp Arg Glu r,7 Phe Leu Arg 440 gtg aca atg Vai Thr Met 455 cag gat atg Gin Asp Met 470 atg cat gac Met His Asp tat cat cac Tyr His His aac ttc gtc Asn Phe Vai 520 tcg att ctc Ser Ile Leu 535 ctg cgc gcc Leu Arg Ala 550 ctg ttc atg Leu Phe Met gcc agc ctc Ala Ser Leu ggt gtc cag Gly Val Gin 600 aaa gca atg Lys Ala Met 615 gtg gtg gat Val Val Asp 630 aaa gag ggt Lys Giu Gly cgt cat gat Arg His Asp atc ctc aat Ile Leu Asn

AW)I

Asn Thr Asn Arg gag Glu ggt Gly ttg Leu 490 aaa Lys ccg Pro cgc Arg tat Tyr aac Asn 570 tgg Trp ctg Leu gaa Glu aaa Lys gaa Glu 650 cgc Arg gat Asp gag Glu ctg Leu 475 gac Asp ctg Leu ttg Leu atg Met ggc Gly 555 gaa Glu cat His gtg Va1 ctg Leu gaa Glu 635 atc Ile ttc Phe tcc Ser ttc ttg cgt aat acc aac cgt att ctt ggt gag Ile Leu Gly Glu 445 acc gat ttc cct Thr Asp Phe Pro ttc tgg tac aag Phe Trp Tyr Lys 480 atg aag ctc gac Met Lys Leu Asp 495 ttc ggg att ctc Phe Gly lie Leu 510 cat gat gaa gtg His Asp Giu Val 525 ggc gac gca tgg Gly Asp Ala Trp atg tgg gca ttc Met Trp Ala Phe 560 gcc cag ggc cgc Ala Gin Giy Arg 575 ttg gaa ggc ggc Leu Giu Gly Gly 590 gat ctg aac ctc Asp Leu Asn Leu 605 ttt gac ccg tac Phe Asp Pro Tyr tcg gtg ctg atc Ser Vai Leu Ile 640 gtt gcc apt aac Val Ala Ser Asn 655 ata aac cag ccg Ile Asn Gin Pro 670 cac tat cac ggc His Tyr His Gly 1344 1392 1440 1488 1536 1584 1632 1680 1728 1776 1824 1872 1920 1968 2016 2064 2112 agt aat gca Ser Asn Ala ggc aat ggc ggc acg pta Gly Asn Gly Gly Thr Vai cac agc gat gag att gcc apc His Ser Asp Giu Ile Ala Ser 64 690 695 700 cac ggt cgt cag cat tca cta agc ctg acg cta cca ccg ctg gcc act 2160 His Gly Arg Gin His Ser Leu Ser Leu Thr Leu Pro Pro Leu Ala Thr 705 710 715 720 atc tcag ctg gtt cgg gag gca gaa tga cac aac tcg cca ttg gca aac 2208 Ile Trp Leu Val Arg Glu Ala Glu His Asn Ser Pro Leu Ala Asn 725 730 735 ccg ctc-ccc tcg gcg cgc att acg acg gtc agg gcg tca act tca cac 2256 Pro Leu Pro Ser Ala Arg Ile Thr Thr Val Arg Ala Ser Thr Ser His 740 745 750 ttt tct ccg ctc atg ccg agc ggg tag aac tgt gtg tct ttg acg cca 2304 Phe Ser Pro Leu Met Pro Ser Gly Asn Cys Val Ser Leu Thr Pro *755 760 765 *acg gcc agg aac atc gct atg act tgc cag ggc aca gtg gcg aca ttt 23 5 2 Met Ala Arg Asn Ile Ala Met Thr Cys Gin Giy Thr Val Aia Thr Phe 770 775 780 ggc acg gtt 2361 785 <210> 36 <211> 785 *<212> PRT <213> E. coli gigB <400> 36 Met Ser Asp Arg Ile Asp Arg Asp Val Ile Asn Ala Leu Ile Ala Gly *1 5 10 His Phe Ala Asp Pro Phe Ser Val Leu Gly Met His Lys Thr Thr Ala 25 Gl** y Leu Giu Val Arg Ala Leu Leu Pro Asp Ala Thr Asp Val Trp Val 40 Ile Giu Pro Lys Thr Gly Arg Lys Leu Ala Lys Leu Giu Cys Leu Asp 55 Ser Arg Gly Phe Phe Ser Gly Vai Ile Pro Arg Arg Lys Asn Phe Phe 70 75 Arg Tyr Gin Leu Ala Vai Val Trp His Giy Gin Gin Asn Leu Ile Asp 90 Asp Pro Tyr Arg Phe Giy Pro Leu Ile Gin Glu Met Asp Ala Trp Leu 100 105 110 Leu Ser Giu Gly Thr His Leu Arg Pro Tyr Giu Thr Leu Gly Ala His 115 120 125 Ala Asp Thr Met Asp Gly Val Thr Gly Thr Arg Phe Ser Val Trp Ala 130 135 140 Pro Asn Ala Arg Arg Val Ser Val Val Gly Gin Phe Asn Tyr Trp Asp 145 150 155 160 Gly Arg Arg His Pro Met Arg Leu Arg Lys Giu Ser Gly Ile Trp Glu 165 170 175 Leu Phe Ile Pro Gly Ala His Asn 180 Gin Leu Tyr Lys Tyr Giu Met 190 o 0 0* 0 530 535 540 Gin Lys Phe Ala Asn Leu Arg Ala Tyr Tyr Gly Trp Met Trp Ala Phe 545 550 555 560 Pro Gly Lys Lys Leu Leu Phe Met Gly Asn Glu Phe Ala Gin Gly Arg 565 570 575 Glu Trp Asn His Asp Ala Ser Leu Asp Trp His Leu Leu Glu Gly Gly 580 585 590 Asp Asn Trp His His Gly Val Gin Arg Leu Val Arg Asp Leu Asn Leu 595 600 605 Thr Tyr Arg His His Lys Ala Met His Glu Leu Asp Phe Asp Pro Tyr 610 615 620 Gly Phe Glu Trp Leu Val Val Asp Asp Lys Glu Arg Ser Val Leu Ile 625 630 635 640 .Phe Val Arg Arg Asp Lys Glu Gly Asn Glu Ile Ile Val Ala Ser Asn 645 650 655 Phe Thr Pro Val Pro Arg His Asp Tyr Arg Phe Gly Ile Asn Gin Pro 660 665 670 Gly Lys Trp Arg Glu Ile Leu Asn Thr Asp Ser Met His Tyr His Gly 675 680 685 Ser Asn Ala Gly Asn Gly Gly Thr Val His Ser Asp Glu Ile Ala Ser 690 695 700 His Gly Arg Gin His Ser Leu Ser Leu Thr Leu Pro Pro Leu Ala Thr 705 710 715 720 Ile Trp Leu Val Arg Glu Ala Glu His Asn Ser Pro Leu Ala Asn Pro 725 730 735 Leu Pro Ser Ala Arg Ile Thr Thr Val Arg Ala Ser Thr Ser His Phe 740 745 750 Ser Pro Leu Met Pro Ser Gly Asn Cys Val Ser Leu Thr Pro Met Ala 755 760 765 Arg Asn Ile Ala Met Thr Cys Gin Gly Thr Val Ala Thr Phe Gly Thr 770 775 780 Val 785 <210> 37 <211> 150 <212> PRT <213> Zea mays <400> 37 SMet Ala Ala Lys Met Leu Ala Leu Phe Ala Leu Leu Ala Leu Cys Ala 1 5 10 Ser Ala Thr Ser Ala Thr His Ile Pro Gly His Leu Pro Pro Val Met 25 Pro Leu Gly Thr Met Asn Pro Cys Met Gin Tyr Cys Met Met Gin Gin 40 Gly Leu Ala Ser Leu Met Ala Cys Pro Ser Leu Met Leu Gin Gin Leu Leu Ala Leu Pro Leu Gin Thr Met Pro Val Thr Pro Asn Met Met Ser Pro Leu Met Met 90 Met Pro Gin Met Pro Ser Met Met Ser Pro Met Val Leu Cys Asp Ala 115 Ser Met Met Ser Ile Met Met Pro GLin Cys His 1110 Val Ser Gin Ile Leu Gin Gin Gin Pro Phe Met Phe Asn 130 Pro Met Ala Met Ile Pro Pro Met Leu Gin Gin Pro Val Gly Ala Ala <210> 38 <211> 2562 <212> DNA <213> Zea mays 0 00 0 00 .00.

<400> 38 aagcttgcta tatacactct ctttacttga catgtgcgca aaaca ta tag atataaaatg ttcggttgct ttcccgtcgt tgtggtgtaa atgcacgacg tggtaca tat tccgtataca atactcaaaa atatttgtat ccgttccgat atatattaat ggcttatccc tgtctttgtt gcctcagtcg cagccaaga t ccca tat tcc agtactgcat agcaactgtt ctaacatgat tgatgtcgca aacagcagtt agcaaccctt gttgacatgc tttttatatc aatatatttt atatatataa atattatggg aatataagtc atatatctag aaaaactaat caatataatt caaaaaaagg gaatgcataa gataccatcg tgagcgattt ctttctttcc gtatacaagg ggaaaaggaa atgacatacc ttcatatatc acgaaaaagg tgttCtcttc agtgttctta tagcccattg aacgaaactg attatccgtt agtccaagta tttgatgttt ctgatttgaa atttgtcatg ctgaaatcag ctttccaact gcctgcatac cacatatcta gcttgcattg agggcacttg gatgcaacag ggccttaccg gtcaccattg aataatgatg accattcatg tgttggtgct catcgcgtgt tctccctatc agaccttaaa aacacataca acggagggag tggtttttca gtgcagcatc cgtccgttgt aatgtaatat agaagatcaa gtaatgattt gatgttcgat aaaaatactc ttaatgttga atgcgataca acaaatatga atcatatttg agatattaaa tacgagttga ggctagcgag ggtgatttct ggagaagggg gtggtttaaa catattcgaa ttaagtatcc aagattttaa ttatgaaaac ctttgctaaa t tagagaagc ttcagttctg atctataaat ctatactata ttcgctctcc ccaccagtca gggcttgcca c ttcagacga atgatgccga ccacaatgtc t tcaacccaa gcattctaga gactcattat catttttgca ttgtatgtct ttaagtattg tactttatta atcaatcaat cgtgcacgat cggtcaccta gactcctcct ggtaaataaa gtgtCtcttt ggtaatacaa ctatcaattg tttccccttt cacatcagct tgtggccatc atatcataaa gtgataagaa aaaggagtcc gtggtagaat cacggcccat agagatatag gtagtagagg tttgatccgt gatccatatc tatatattta aaatatggaa aataccttta ctacaaattt caagcgccag aggacc tgc t ctctaggaag tagctctttg tgccat tggg gcttgatggc tgccagtgat gcatgatgtc actgcgacgc tggcca tgac tagaaatatt taacaataaa aagcccatta atattcaaaa tatgaatcta gtagattaca atatattacc cgtaaaagaa taaagattca tttgaattac ggcattttgt atattttttt tgatgcctta ttcgaaagtt gttagatgt: agtcctaatg acattctcaa aataaat'to-a caaatattac aacccctttt gtgagagtgt ctgtgatata atctacgtga tttgtcatta ataagagggc ggatcttzat aactttat ag cgattaattt caaggcatct gaccaaatgc aaatcgtottt agatcaatcg caaggacacc tgcaagcgcc taccatgaac gtgtccgtcc gatgccacag accaatggtc cgtctcgcag gat tcca ccc tgtgttgtat acaagtttcc tcctttactc gaatgacaat ttaaaatgct ttgttatttt atgtccaaac gcag tcacgg tgaagagaac ttaggaataa gagaaaacaz tat tcacgtg gctccgagag ctttgtctca cl-ttgtgtta atgccaccga taacaatgac ttatcaaagt attttatctt :-tatagcttg tgcgcg tgga gcgactcata tttgcacgtg gaggtgtaaa taagatctaa ccgtazccgt gaac tcgata cagtctatat tgtgcagatt cgagtcatcc :catczacat cagtccatcg accgccatgg actagtgcga ccatgcatgc ctgatgctgc atgatgacgc ztgccgagca attatgctgc atgttcttac cgaataatga tcttattatc cctaagtccc aaatctagac aaaacgac ta c tc tat tcca attttgaatt tgttggtccc caaaataagg cataagcaaa ggaagcataa aatttacata cttcgaatga t-gcatgggca 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 68 atgtacctct atttataggg acggtgcgac gtacaaattt gtataaaatt atatttttat 2460 tcccaaatcc tatgcatatg tgtcggggac cataattagg ggtaccctca aggctcctaa 2520 ttctcagctg gtaaccccat cagcataaag ctgcaaaggc ct 2562 <210> 39 <211> 1141 <212> DNA <213> Zea mays S S. S

S.

*5

S

S. 55

S

e S. S

S.

<400> .39 aagcttgcta tatacac tct ctttacttga catgtgcgca aaaca ta tag atataaaatg ttcggttgct ttcccgtcgt tatgtggtgt tga tgcacga aatggtacat aatecgtata gtatactcaa taatatttgt atccgttccg ttatatatta ccggcttatc attgtctttg cggcctcagt g ctttctttcc gta Eacaagg ggaaaaggaa atgacatacc ttcatatatc acgaaaaagg tgttctcttc agtgttctta aatagcccat cgaacgaaac atattatccg caagtccaag aatttgatgt atctgatttg atatttgtca atctgaaatc ccctttccaa ttgcctgcat cgcacatatc ttaatgttga atgcgataca acaaatatga atcatatttg agatattaaa tacgagt tga ggctagcgag ggtgatttct tgggagaagg tggtggttta ttcatattcg tattaagtat ttaagatttt aattatgaaa tgctttgcta agttagagaa ctttcagttc acatctataa tactatacta tttccccttt.

cacatcagct tgtggccatc atatcataaa gtgataagaa aaaggagtcc gtggtagaat cacggcccat ggagagatat aagtagtaga aatttgatcc ccgatccata.

aatatatatt aca' aatatgg aaaatacctt gcctacaaat tgcaagcgcc ataggacctg tactctagga gttagatgtt agtcctaatg acattctcaa aataaattta caaatattac aacccctttt gtgagagtgt ccgtgatata agatctacgt ggtt tgtcat gtataagagg tcggatcltt taaactttat aacgattaat tacaaggcat ttgaccaaat agaaatcgtt ctagatcaat agcaaggaca ctttgtgtta atgccaccga taacaa tgac t tat caaag t attttatctt ttatagcttg tgc gcgtgga gcgactcata gatttgcacg tagaggtgta gctaagatct atccgtatcc aggaactcga ttcagtctat cttgtgcaga gccgagtcat tttcatctac cgcagtccat ccaccgccat 120- 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1141 004..

<210> <211> 1328 <212> DNA <213> E. coli <220> <223> gigC3 <220> <221> CDS <222> (join(i. .1293, 1297..1326)) <400> atg gtt agt tta gag aag aac gat cac Met Val Ser Leu Glu Lys Asn Asp His 1 5 atg ttg gcg cgc Met Leu Ala Arg cag ctg Gin Leu cca ttg aaa Pro Leu Lys ctg aag gat Leu Lys Asp gtt gcc ctg ata Val Ala Leu Ile gcg gga gga cgt Ala Gly Gly Arg ggt acc cgc Gly Thr Arg tta acc aat aag cga gca aaa ccg gcc gta cac ttc ggc Leu Thr Asn Lys Arg Ala Lys Pro Ala Val His Phe Gly ggt aag Gly Lys ttc cgc att atc Phe Arg Ile Ile ttt gcg ctg tct aac tgc atc aac tcc Phe Ala Leu Ser Asn Cys Ile Asn Ser ggg Gly atc cgt cgt atg Ile Arg Arg Met gtg atc acc cag Val Ile Thr Gin cag tcc cac act Gin Ser His Thr gtg cag cac att cag cgc ggc tgg tca ttc ttc aat gaa gaa atg aac 69 Val Gin His Ile Gin Arg Gly Trp Ser Phe Phe Asn Giu Giu Met Asn 90 0000 00 00 @00 0* 0 000000 0 00 00 00 0 e *0 0 0* 00 00 0 00

S.

SO 0 0504 St 00 0 0 0050 00 4 0 00 SOt, 0 *000 gag Giu tgg Trp cgt Arg tac Tyr 145 gta Val1 gca Aia g tg Val1 tct Ser gaa Giu 225 ggc Giy cac His tac Tyr ga t Asp cca Pro 305 gat Asp gg t Giy gtc gaa aaa Vai Giu Lys 960 1 08 1056 cgo gtt cgc gtg aat tca ttc tgc aac att gat tco goc gta ttg tta 1104 Arg Val Arg Val Asn Ser Phe Cys Asn Ile Asp Ser Ala Val Leu Leu 355 360 365 cog gaa gta tgg gta ggt cgc tog tgc ogt ctg cgc cgc tgo gtc atc 1152 Pro Giu Val Trp, Val Gly Arg Ser Cys Arg Leu Arg Arg Cys Val Ile 370 375 380 gat cgt got tgt gtt att ccg gaa ggc atg gtg att ggt gaa aao gca 1200 Asp Arg Ala Cys Val Ile Pro Giu Gly Met Val Ile Gly Giu Asn Ala 385 -390 395 400 gag gaa gat gca cgt cgt tto tat ogt tca gaa gaa ggo ato gtg ctg 1248 Giu Giu Asp Ala Arg Arg Phe Tyr Arg Ser Giu Glu Gly Ile Val Leu 405 410 415 gta acg ogo gaa atg ota cgg aag tta ggg cat aaa cag gag cga 1293 *Val Thr Arg Giu Met Leu Arg Lys Leu Gly His Lys Gin Giu Arg *420 425 430 *taa tgo agg ttt tao atg tat gtt cag aga tgt tt 1328 *Cys Arg Phe Tyr Met Tyr Val Gin Arg Cys *435 440 <210> 41 <211> 441 <212> PRT <400> 41 Met Val Ser Leu Giu Lys Asn Asp His Leu Met Leu Ala Arg Gin Leu 1 5 10 Pro Leu Lys Ser Val Ala Leu Ile Leu Ala Gly Gly Arg Gly Thr Arg 25 Leu Lys Asp Leu Thr Asn Lys Arg Ala Lys Pro Ala Val His Phe Gly 40 Gly Lys Phe Arg Ile Ile Asp Phe Ala Leu Ser Asn Cys Ile Asn Ser 55 Gly Ile Arg Arg Met Gly Val Ile Thr Gin Tyr Gin Ser His Thr Leu 70 75 Val Gin His Ile Gin Arg Giy Trp Ser Phe Phe Asn Giu Glu Met Asn 90 Giu Phe Val Asp Leu Leu Pro Ala Gin Gin A-rg Met Lys Gly Giu Asn 100 105 110 Trp Tyr Arg Gly Thr Ala Asp Ala Val Thr Gin. Asn Leu Asp Ile Ile 115 120 125 Arg Arg Tyr Lys Ala Giu Tyr Val Val Ile Leu Ala Gly Asp His Ile 130 135 140 Tyr Lys Gin Asp Tyr Ser Arg Met Leu Ile Asp His Val Giu Lys Gly 145 150 155 160 Val Arg Cys Thr Val Val Cys Met Pro Val Pro Ile Giu Glu Ala Ser 165 170 175 Ala Phe Gly Val Met Ala Vai Asp Giu Asn Asp Lys Thr Ile Giu Phe 180 185 190 Val Glu Lys Pro Ala Asn Pro Pro Ser Met Pro Asn 195 200 Pro Ser Lys Ser Glu 225 Gly His Tyr Asp Pro 305 Asp Gly Arg Pro Asp 385 Glu Val1 Ser Glu Leu Pro 260 Asp Ser Thr Gly Ile 340 Val1 Trp Cys Ala Glu 420 Arg Phe Tyr 435 Met Tyr Val Gin Arg Cys 440 <210> 42 <211> 1328 <212> DNA <213> E. coli <220> <223> glcC <220> <221> CDS <222> (join(1. .1293, 1297. .1326)) <400> 42 atg gtt agt tta gag aag aac gat cac tta atg ttg gcg cgc cag ctg Met Val Ser Leu Glu Lys Asn Asp His Leu Met Leu Ala Arg Gin Leu 1 5 10 cca Pro c tg Leu gg t Gly ggg dly 65 gtg Val1 gag Glu ~gg Trp cgc Arg tao Tyr 145 gca Ala goa Al a gtt Val1 tot Ser gaa Glu 225 ggo Gly cac His tac Tyr ttg Leu aag Lys aag Lys' atc Ile cag Gin ttt Phe tat Tyr og t Arg 130 aag Lys cgt Arg ttt Phe gaa Glu o tg Leu 210 o tg Leu aaa Lys cog Pro tgg Trp aaa Lys ga t Asp ttc Phe og t Arg cac His gto Val1 ogo Arg 115 tat Tyr caa Gin tgc Cys ggo Gly aaa Lys 195 gog Ala ctg Leu ga t Asp ttc Phe ogo Arg tot Ser tta Leu ogo Arg ogt Arg att Ile ga t Asp 100 ggo Gly aaa Lys gac Asp ac Thr gt t Val 180 Oct Pro ag t Ser gaa Giu t tg L eu ccg Pro 260 ga t Asp gtt Val1 acc Thr att Ile a tg Met cag Gin 85 o tg Leu aoo Thr gcg Al a tac Tyr gtt Val1 165 a tg Met got Ala a tg Met gaa Glu att Ile 245 ctc Leu g tg Val1 gc Ala aa t Asn atc Ile Gly 70 ogo Arg org Leu gca Ala gaa Giu tog Ser 150 got Al a gog Ala aao Asn gg t Gly gao Asp 230 000 Pro tot Ser gg t Gly o tg Leu aag Lys gao Asp 55 gtg Val1 ggo Giy ooa Pro ga t Asp tao Tyr 135 og t Arg tgt Cys gtt Val oog Pro ato Ile 215 ga t Asp aag Lys tgc Cys aog Thr ata Ile oga Arg 40 ttt Phe ato Ile tgg Trp goa Al a gog Ala 120 gtg Val1 a tg Met atg Met ga t Asp oog Pro 200 tao Tyr ogo Arg ato Ile g ta Val1 otg Leu o tg Leu 25 goa Ala gog Ala aoo Thr toa Ser oag Gin 105 gro Val1 g tg Val1 ctt Leu oca Pro gag Giu 185 toa Ser gto Val1 ga t Asp aoo Thr oaa Gin 265 gaa Glu gog Al a aaa Lvs otg Leu o ao Gin tto Phe 90 oac Gin, aoo Thr ato Ile ato Ile gta Va -i 170 aao Asn a tg Met ttt Phe gag Glu gaa Giu 250 too Ser go t Ala gga Gly gc Ala aac Asn oag Gin aa t Asn a tg Met aao Asn gog Ala 140 oao H i s att Ile aaa Lys aao Asn gc Ala 220 too Ser gg t Gly ocg Pro tgg Trp og t Arg gta Val1 tgc Cys too Ser gaa Glu aaa Lys oto Leu 125 ggo Gly gtc Val1 gaa Glu att Ile ga t Asp 205 gao Asp ago Ser o tg Leu ga t Asp aaa Lys gg t Gly oao His ato Ile oao His gaa Giu ggg Gly 110 gao Asp gao Asp gaa Giu gaa Giu ato Ile 190 oog Pro tat Tyr oao His goo Ala goo Ala 270 gog Ala aoo Thr tto Phe aao Asn aoct Thr atg Met gaa Glu att Ile oat His aaa Lys goo Ala 175 gaa Glu ago Ser o tg Leu gao Asp tat Tyr 255 gag Giu aao Asn ogo Arg ggo Gly too Ser o tg Leu aao Asn aao Asn ato Ile ato Ile ggo Gly 160 too Ser tto Phe aaa Lys tat Tyr ttt Phe 240 gog Ala oog Pro oto Leu 275 280 285 gat ctg gcc tct gtg gtg ccg gaa ctg gat atg tac gat cgc aat tgg 912 Asp Leu Ala Ser Val Val Pro Giu Leu Asp Met Tyr Asp Arg Asn Trp 290 295 300 cca att cgc acc tac aat gaa tca tta ccg cca gcg aaa ttc gtg cag 960 Pro Ile Arg Thr Tyr Asn Glu Ser Leu Pro Pro Ala Lys Phe Val Gin 305 310 315 320 gat cge tcc ggt agc cac ggg atg acc ctt aac tca ctg gtt tcc ggc 1008 Asp Arg Ser Gly Ser His Gly Met Thr Leu Asn Ser Leu Val Ser Gly 325 330 335 ggt tgt gtg atc tcc ggt tcg gtg gtg gtg cag tcc gtt ctg ttc tcg 1056 Gly Cys Val Ile Ser Gly Ser Val Val Val Gin Ser Val Leu Phe Ser 340 345 350 *cgc gtt cgc gtg aat tca ttc tgc aac att gat tcc gcc gta ttg tta 1104 Arg Val Arg Val Asn Ser Phe Cys Asn Ile Asp Ser Ala Val Leu Leu *355 360 365 *.:ccg gaa gta tgg gta ggt cgc tcg tgc cgt ctg cgc cgc tgc gtc atc 1152 *Pro Giu Val Trp Val Gly Arg Ser Cys Arg Leu Arg Arg Cys Val Ile 370 375 380 gat cgt gct tgt gtt att ccg gaa ggc atg gtg att ggt gaa aac gca 1200 Asp Arg Ala Cys Val Ile Pro Giu Gly Met Val Ile Gly Glu Asn Ala *.:385 390 395 400 gag gaa gat gca cgt cgt ttc tat cgt tca gaa gaa ggc atc gtg ctg 1248 Giu Glu Asp Ala Arg Arg Phe Tyr Arg Ser Glu Giu Gly Ile Val Leu 405 410 415 *gta acg cgc gaa atg cta cgg aag tta ggg cat aaa cag gag cga 1293 Val Thr Arg Glu Met Leu Arg Lys Leu Gly His Lys Gin Glu Arg 420 425 430 taa tgc agg ttt tac atg tat gtc cag aga tgt tt 1328 .Cys Arg Phe Tyr Met Tyr Val Gin Arg Cys 435 440 <210> 43 <211> 441 <212> PRT <213> E. coli <223> glcC <400> 43 Met Val Ser Leu Giu Lys Asn Asp His Leu Met Leu Ala Arg Gin Leu 1 5 10 Pro Leu Lys Ser Val Ala Leu le Leu Ala Gly Gly Arg Gly Thr Arg 25 Leu Lys Asp Leu Thr Asn Lys ?Arg Ala Lys Pro Ala Val His Phe Gly 40 Gly Lys Phe Arg Ile Ile Asp Phe Ala Leu Ser Asn Cys Ile Asn Ser 55 Gly Ile Arg Arg Met Gly Val le Thr Gin Tyr Gin Ser His Thr Leu 70 75 Val Gin His Ile Gin Arg Gly Trp Ser Phe Phe Asn Glu Giu Met Asn 90 Glu Phe Val Asp Leu Leu Pro Ala Gin Gin Arg Met Lys Gly Glu Asn 100 105 110 Trp Arg Tyr 145 Ala Ala Val1 Ser Glu 225 Gly His Tyr Asp Pro 305 Asp Gly Arg Pro Asp 385 Glu Val1 Arg <210> 44 <211> 1328 <212> DNA <213> E. coli <220> <223> glgCwt <220> <221> GDS <222> (join(1..1293, 1297..1326)) <400> 44 atg gtt agt tta gag aag aac gat cac tta atg ttg gcg cgc cag ctg 48 Met Val Ser Leu Glu Lys Asn Asp His Leu Met Leu Ala Arg Gln Leu 1 5 10 cca ttg aaa tct gtt gcc ctg ata ctg gcg gga gga cgt ggt acc cgc 96 Pro Leu Lys Ser Val Ala Leu Ile Leu Ala Gly Gly Arg Gly Thr Arg *0 20 25 ctg aag gat tta acc aat aag cga gca aaa ccg gcc gta cac ttc ggc 144 Leu Lys Asp Leu Thr Asn Lys Arg Ala Lys Pro Ala Val His Phe Gly 40 ggt aag ttc cgc atE atc gac ttt gcg ctg tct aac tgc atc aac tcc 192 Gly Lys Phe Arg Ile Ile Asp Phe Ala Leu Ser Asn Cys Ile Asn Ser 50 55 ggg atc cgt cgt atg ggc gtg atc acc cag tac cag tcc cac act ctg 240 Gly Ile Arg Arg Met Gly Val Ile Thr Gln Tyr Gin Ser His Thr Leu 70 75 gtg cag cac &tt cag cgc ggc tgg tca ttc ttc aat gaa gaa atg aac 288 o Val Gin His Ile Gin Arg Gly Trp Ser Phe Phe Asn Glu Glu Met Asn 90 gag ttt gtc gat ctg ctg cca gca cag cag aga atg aaa ggg gaa aac 336 Glu Phe Val Asp Leu Leu Pro Ala Gin Gin Arg Met Lys Gly Giu Asn 100 105 110 tgg tat cgc ggc acc gca gat gcg gtc acc caa aac ctc gac att atc 384 Trp Tyr Arg Gly Thr Ala Asp Ala Val Thr Gin Asn Leu Asp Ile Ile 115 120 125 cgc cgt tat aaa gcg gaa tac gtg gtg atc ctg gcg ggc gac cat atc 432 Arg Arg Tyr Lys Ala Giu Tyr Val Val Ile Leu Ala Gly Asp His Ile 130 135 140 tac aag caa gac tac tcg cgt atg ctt atc gat cac gtc gaa aaa ggc 480 Tyr Lys Gin Asp Tyr Ser Arg Met Leu Ile Asp His Val Giu Lys Gly 145 150 155 160 gca cgt tgc acc gtt gct tgt atg cca gta ccg att gaa gaa gcc tcc 528 Ala Arg Cys Thr Val Ala Cys Met Pro Val Pro Ile Giu Giu Ala Ser 165 170 175 gca ttt ggc gtE atg gcg gtt gat gag aac gat aaa att atc gaa Etc 576 Ala Phe Gly Val Met Ala Vai Asp Glu Asn Asp Lys Ile Ile Giu Phe 180 185 190 gtt gaa aaa cct gct eac ccg ccg Eca atg ccg aac gat ccg agc aaa 624 Val Glu Lys Pro Ala Asn Pro Pro Ser Met Pro Asn Asp Pro Ser Lys 195 200 205 tct ctg gcg agt atg ggt atc tac gtc ttt gac gcc gac tat ctg tat 672 Ser Leu Ala Ser Met Gly Ile Tyr Val Phe Asp Ala Asp Tyr Leu Tyr 210 215 220 gaa otg ctg gaa gaa gac gat cgc gat gag aac tcc agc cac gac ttt 720 Glu Leu Leu Glu Glu Asp Asp Arg Asp Giu Asn Ser Ser His Asp Phe 225 230 235 240 ggc aaa gat ttg att coo aag ato acc gaa gcc ggt ctg goc tat gcg 768 Gly Lys Asp Leu Ile Pro Lys Ile Thr Glu Ala Gly Leu Ala Tyr Ala 245 250 255 cac ccg ttc ccg otc tot tgc gta oaa too gac cog gat goo gag ccg 816 His Pro Phe Pro Leu Ser Cys Val Gin Ser Asp Pro Asp Ala Giu Pro 260 265 270 tac tgg cgo gat gtg ggt acg otg gaa got tao tgg aaa gcg aac otc 864 Tyr Trp Arg Asp Val Gly Thr Leu Giu Ala Tyr Trp Lys Ala Asn Leu 275 280 285 gat otg gc tot gtg gtg ccg aaa otg gat atg "ti gat cgo aat tgg 912 Asp Leu Ala Ser Val Val Pro Lys Leu Asp Met Tyr Asp Arg Asn Trp 290 295 300 cca att cgo aoo tac aat gaa toa tta ccg cca gog aaa tto gtg oag 960 Pro Ile Arg Thr Tyr Asn Giu Ser Leu Pro Pro Ala Lys Phe Val Gin 305 310 315 320 gat cgo too ggt ago cac ggg atg aoo cct aao toa otg gtt too ggo 1008 Asp Arg Ser Gly Ser His Gly Met Thr Leu Asn Ser Leu Val Ser Gly .325 330 335 ggt tgt gtg ato too ggt tog gtg gtg gtg oag too gtt otg tto tog 1056 Gly Cys Val Ile Ser Gly Ser Val Val Vai Gin Ser Vai Leu Phe Ser 340 345 350 cgc gtt cgo gtg aat toa tto tgo aao att gat too goo gta ttg tta 1104 Arg Val Arg Val Asn Ser Phe Cys Asn lie Asp Ser Ala Val Leu Leu 355 360 365 og gaa gta tgg gta ggt cgo tog tgc cgt otg cgo cgo tgo gto ato 1152 Pro Giu Val Trp Val Gly Arg Ser Cys Arg Leu Arg Arg Cys Val Ile 370 375 380 gat ogt got tgt gtt att ccg gaa ggo atg gtg att ggt gaa aao goa 1200 Asp Arg Ala Cys Val Ile Pro Giu Gly Met Val Ile Gly Giu Asn Ala 385 390 395 400 gag gaa gat goa ogt ogt ttc tat ogt toa gaa gaa ggo ato gtg otg 1248 Glu Giu Asp Ala Arg Arg Phe Tyr Arg Ser Glu Giu Gly Ile Val Leu 405 410 415 gta aog cgo gaa atg ota ogg aag tta ggg oat aaa oag gag oga 1291 Val Thr Arg Giu Met Leu Arg Lys Leu Gly His Lys Gin Giu Arg 420 425 430 taa tgo agg ttt tao atg tat gtt oag aga tgt tt 1328 Cys Arg Phe Tyr Met Tyr Val Gin Arg Cys 435 440 <210> <211> 441 <212> PRT <213> E. coli <223> glgCwt <400> Met Val Ser Leu Glu Lys Asn Asp His Leu Met Leu Ala Arg Gin Leu 1 5 10 Pro Leu Lys Ser Val Ala Leu Ile Leu Ala Gly Gly Arg Gly Thr Arg 25 Leu Lys Asp Leu Thr Asn Lys Arg Ala Lys Pro Ala Val His Phe Gly 40 Gly Lys Phe Arg Ile Ile Asp Phe Ala Leu Ser Asn Cys Ile Asn Ser 55 Gly Ile Arg Arg Met Gly Val Ile Thr Gin Tyr Gin Ser His Thr Leu 70 75 Val Gin His Ile Gin Arg Gly Trp Ser Phe Phe Asn Glu Glu Met Asn S* 85 90 Glu Phe Val Asp Leu Leu Pro Ala Gin Gin Arg Met Lys Gly Glu Asn 100 105 110 S* Trp Tyr Arg Gly Thr Ala Asp Ala Val Thr Gin Asn Leu Asp Ile Ile 115 120 125 Arg Arg Tyr Lys Ala Glu Tyr Val Val Ile Leu Ala Gly Asp His Ile 130 135 140 Tyr Lys Gin Asp Tyr Ser Arg Met Leu Ile Asp His Val Glu Lys Gly 145 150 155 160 Ala Arg Cys Thr Val Ala Cys Met Pro Val Pro Ile Glu Glu Ala Ser 165 170 175 Ala Phe Gly Val Met Ala Val Asp Glu Asn Asp Lys Ile Ile Glu Phe 180 185 190 Val Glu Lys Pro Ala Asn Pro Pro Ser Met Pro Asn Asp Prb Ser Lys 195 200 205 Ser Leu Ala Ser Met Gly Ile Tyr Val Phe Asp Ala Asp Tyr Leu Tyr 210 215 220 Glu Leu Leu Glu Glu Asp Asp Arg Asp Glu Asn Ser Ser His Asp Phe 225 230 235 240 Gly Lys Asp Leu Ile Pro Lys Ile Thr Glu Ala Gly Leu Ala Tyr Ala 245 250 255 His Pro Phe Pro Leu Ser Cys Val Gin Ser Asp Pro Asp Ala Glu Pro 260 265 270 Tyr Trp Arg Asp Val Gly Thr Leu Glu Ala Tyr Trp Lys Ala Asn Leu 275 280 285 Asp Leu Ala Ser Val Val Pro Lys Leu Asp Met Tyr Asp Arg Asn Trp 290 295 300 Pro Ile Arg Thr Tyr Asn Glu Ser Leu Pro Pro Ala Lys Phe Val Gin 305 310 315 320 Asp Arg Ser Gly Ser His Gly Met Thr Leu Asn Ser Leu Val Ser Gly 325 330 335 Gly Cys Val Ile Ser Gly Ser Val Val Val Gin Ser Val Leu Phe Ser 340 345 350 Arg Val Arg Val Asn Ser Phe Cys Asn Ile Asp Ser Ala Val Leu Leu Pro Giu 370 Asp Arg 385 Giu Giu Vai Thr Arg Phe 355 Val Trp Val Giy Arg 375 Ala Cys Val Ile Pro 390 Asp Ala Arg Arg Phe 405 Arg Giu Met Leu Arg 420 Tyr Met Tyr Vai Gin 435 360 365 Ser Cys Arg Leu Arg Arg Cys Val Ile 380 Giu Giy Met Vai Ile Gly Giu Asn Aia 395 400 Tyr Arg Ser Giu Giu Gly Ile Vai Leu 410 415 Lys Leu Giy His Lys Gin Giu Arg Cys 425 430 Arg Cys 440 0e a. a flee S a. a a.e.g 0 C a

C

a5 S S a.

<210> 46 <2ii> 1915 <2i2> DNA <213> Zea mays <220> <221> CDS <222> (join(i..i8i5, 1819..1914)) C. a S a a 5.

S S *SaS a

CS

*0 <400> 46 a tg Met 1 ggC Giy agg Arg agc Ser tcc S er ttc -Phe gac Asp gtc Val1 acc Thr gcg gct ctg gcc acg tcg cag ctc gca acg cgc gcc Ala Thr Arg Ala 384 agg ttc ttc cac tgc tac aag cgc Arg Phe Phe His Cys Tyr Lys Arg 99a gtg gac cgc gtg ttc gtt gac Giy Val Asp Arg Val Phe Val Asp .0.

0 145 cac His tac Tyr agc Ser aac Asn g tc Val1 225 aa c Asn atc Ile gag Giu ggC Gly ggg Gly 305 gag Giu a tg Met gag Giu tcg Ser gag Giu 385 ggC Gly ccg gag Giu aga Gly gga Gly ttc Phe cac His 230 ggC Gly tac Tyr gag Giu gtg Val1 gac Asp 310 ggc Gly a tc Ile agg Arg gcc Ala g tg Val1 390 cag Gin a tg agg gtt tgg Arg Val Trp acc gag gag Thr Giu Giu aac cag ctg Asn Gin Leu 190 agg atc ctg Arg Ile Leu 205 agg gac gtc Arg Asp Val 220 tgc tac ctc Cys Tyr Leu aag acc gct Lys Thr Ala ttc tcc gac Phe Ser Asp 270 ttc gat ttc Phe Asp Phe 285 aac tgg atg Asn Trp Met 300 agc ccc tac Ser Pro Tyr gag ctc gac Glu Leu Asp ggc atg gac Giy Met Asp 350 gtg aag tac Vai Lys Tyr 365 gag gcg ctg Giu Ala Leu 380 Ctg gtg gcg Leu Val Ala atg gcg gcc Met Ala Aia atc gtt ctg 528 576 624 672 720 768 816 864 912 960 1008 1056 1104 1152 1200 1248 1296 Pro Gin Leu Met Giu Met Val Giu Asp Val Gin Ile Val Leu Leu Gly 420 425 430 acg ggc aag aag aag ttc gag cgc atg ctc atg agc gcc gag gag aag 1344 Thr Giy Lys Lys Lys Phe Giu Arg Met Leu Met Ser Ala Giu Giu Lys 435 440 445 ttc cca ggc aag gtg cgc gcc gtg gtc aag ttc aac gcg gcg ctg gcg 1392 Phe Pro Gly Lys Val Arg Ala Val Val Lys Phe Asn Ala Ala Leu Ala 450 455 460 cac cac atc atg gcc ggc gcc gac gtg ctc gcc gtc acc agc cgc ttc 1440 His His Ile Met Ala Gly Ala Asp Val Leu Ala Val Thr Ser Arg Phe 465 470 475 480 gag ccc tgc ggc ctc atc cag ctg cag ggg atg cga tac gga acg ccc 1488 Giu Pro Cys Gly Leu Ile Gin Leu Gin Gly Met Arg Tyr Gly Thr Pro *485 490 495 :::tgc gcc tgc gcg tcc acc ggt gga ctc gtc gac acc atc atc gaa ggc 1536 :500 505 510 aag acc ggg ttc cac atg ggc cgc ctc agc gtc gac tgt aac gtc gtg 1584 Lys Thr Gly Phe His Met Gly Arg Leu Ser Val Asp Cys Asn Val Val 515 520 525 gag ccg gcg gac gtc aag aag gtg gcc acc aca ttg cag cgc gcc atc 1632 Giu Pro Ala Asp Val Lys Lys Val Ala Thr Thr Leu Gin Arg Ala Ile 530 535 540 aag gtg gtc ggc acg ccg gcg tac gag gag atg gtg agg aac tgc atg 1680 **.Lys Val Val Gly Thr Pro Ala Tyr Glu Giu Met Val Arg Asn Cys Met **545 550 555 560 atc cag gat ctc tcc tgg aag ggc cct gcc aag aac tgg gag aac gtg 1728 Ile Gin Asp Leu Ser Trp Lys Gly Pro Ala Lys Asn Trp Giu Asn Val **.565 570 575 ctg ctc agc ctc ggg gtc gcc ggc ggc gag cca ggg gtc gaa ggc gag 1776 Leu Leu Ser Leu Gly Val Ala Gly Gly Giu Pro Gly Val Giu Gly Giu 580 585 590 gag atc geg ccg ctc gcc aag gag aac gtg gcc gcg ccc tga aga gtt 1824 Giu Ile Ala Pro Leu Ala Lys Giu Asn Val Ala Ala Pro Arg Val 595 600 605 cgg cct gca ggg ccc ctg atc tcg cgc gtg gtg caa aga tgt tgg gac 1872 Arg Pro Ala Gly Pro Leu Ile Ser Arg Val Val Gin Arg Cys Trp Asp 610 615 620 atc ttc tta tat atg ctg ttt cgt tta tgt gat atg gac aag t 19;5 Ile Phe Leu Tyr Met Leu Phe Arg Leu Cys Asp Met Asp Lys 625 630 635 <210> 47 <211> 637 <212> PRT <213> Zea mays <400> 47 Met Ala Ala Leu Ala Thr Ser Gin Leu Val Ala Thr Arg Ala Gly Leu 1 5 10 Gly Val Pro Asp Ala Ser Thr Phe Arg Arg Gly Ala Ala Gin Gly Leu Arg Gly Ala Arg Ala Ser Ala Ala Ala Asp Thr Leu Ser Met Arg Thr 40 Ser Ser Phe Asp Val1 Thr Arg 145 His Tyr Ser Asn Val 225 Asn Ile Glu Gly Gly 305 Glu Met Glu Ser Ala Met Gly Asn Asp 125 Tyr Val1 Glu Gln Ile 205 Asp Tyr Thr Ser Asp 285 Trp Pro Leu Met Lys 365 Ala Ala Pro Asn Val Gly Leu Gly His 110 Ala Trp Glu Thr Phe Val Glu Lys 175 Leu Arg 190 Leu Ser Val Val Leu Lys Ala Phe 255 Asp Tyr 270 Phe Ile Met Lys Tyr Tyr Asp Asn 335 Asp Val 350 Tyr Asp Leu Gln 82 Giu Val Gly Leu Pro Val Asp Arg Asn Ile Pro Leu Vai Ala Phe Ile 385 390 395 400 Gly Arg Leu Glu Giu Gin Lys Gly Pro Asp Val Met Ala Ala Ala Ile 405 410 415 Pro Gin Leu Met Glu Met Val Glu Asp Val Gin Ile Val Leu Leu Gly 420 425 430 Thr Gly Lys Lys Lys Phe Giu Arg Met Leu Met Ser Ala Glu Giu Lys 435 440 445 Phe Pro Gly Lys Val Arg Ala Val Val Lys Phe Asn Ala Ala Leu Ala 450 455 460 His His Ile Met Ala Gly Ala Asp Val Leu Ala Val Thr Ser Arg Phe 465 470 475 480 Glu Pro Cys Giy Leu Ile Gin Leu Gin Gly Met Arg Tyr Gly Thr Pro *485 490 495 *Cys Ala Cys Ala Ser Thr Gly Gly Leu Val Asp Thr Ile Ile Giu Gly 500 505 510 Lys Thr Giy Phe His Met Gly Arg Leu Ser Vai Asp Cys Asn Vai Val **:515 520 525 Giu Pro Aia Asp Vai Lys Lys Val Aia Thr Thr Leu Gin Arg Aia Ile 530 535 540 Lys Val Val Gly Thr Pro Ala Tyr Giu Glu Met Val Arg Asn Cys Met *545 550 555 560 Ile Gin Asp Leu Ser Trp Lys Gly Pro Ala Lys Asn Trp Giu Asn Val 565 570 575 Leu Leu Ser Leu Gly Val Ala Giy Gly Glu Pro Gly Val Giu Gly Glu **580 585 590 Giu Ilie Ala Pro Leu Ala Lys Giu Asn Vai Ala Ala Pro Arg Val Arg 595 *600 605 Pro Ala Gly Pro Leu Ilie Ser Arg Val Val Gin Arg Cys Trp Asp Ile 610 615 620 Phe Leu Tyr Met Leu Phe Arg Leu Cys Asp Met Asp Lys 625 630 635 <210> 48 <211> 2423 <212> DNA <213> Zea mays <220> <221> CDS <222> (join(i. .2094, 2098. .2103, 2i07..2304, 2308..2421)) <400> 48 atg ccg ggg gca atc tct tcc tcg tcg tcg gct ttt ctc ctc ccc gtc 48 Met Pro Gly Ala Ile Ser Ser Ser Ser Ser Ala Phe Leu Leu Pro Val 1 5 10 gcg tcq tcc tcg ccg cgg cgc agg cgg ggc agt gtg ggt gct gct ctg 96 Ala Ser Ser Ser Pro Arg Arg Arg Arg Gly Ser Val Gly Ala Ala Leu ggC Gly cgc tog tac Arg Ser Tyr Cgg Arg ocg Pro cag Gin tca Ser gca Ala cog Pro aga Arg 145 gc t Ala got Ala agg Arg gtc Val ctt Leu 225 cac His cgg Arg gaa Giu gta ggC Gly gc Ala gog Ala Oct Pro atg Met gtg Val 130 gaa Glu aga Arg ga t Asp gag Giu gto Val 210 gga Gly cgt Arg ga t Asp gt t Val1 gaa cog Pro ggg Gly ggc Gly ccc Pro oaa Gin 115 tcC Ser atc Ile cog Pro gca Ala ga t Asp 195 g tg Val ga t Asp gt t Val1 tta Leu act Thr 275 gcc cot Pro ggo Gly gc t Ala aat Asn 100 aac Asn gga Giy ga t Asp gtg Val got Ala 180 aat Asn gtg Val gtc Val1 atg Met ggt Gly 260 tat Tyr ct 25 tao agc ggc gcg gag Tyr Ser Gly Ala Glu 40 cag gat gga gog gcg Gin Asp Gly Ala Ala 55 gaa agc gag gag gca Giu Ser Glu Glu Ala 70 gtt cag ggc ago acg Val Gin Gly Ser Thr 85 cot ttg aca tot got Pro Leu Thr Ser Ala 105 gga acg agt ggg ggc Gly Thr Ser Gly Gly 120 ccc aaa gct gat oat Pro Lys Ala Asp His 135 gcc agt gcg gtg aag Ala Ser Ala Val Lys 150 gaa agc ata ggc atc Glu Ser Ile Gly Ile 165 ccg gct aca gat gcg Pro Ala Thr Asp Ala 185 gaa oct ggc oct ttg Glu Pro Gly Pro Leu 200 gct tct gaa tgt gct Ala Ser Glu Cys Ala 215 gtg ggt gct ttg cct Val Gly Ala Leu Pro 230 gtc gtg ata cca aga Jal Val Ile Pro Arg 245 Ita agg aga cgt tac Jal Arg Arg Arg Tyr 265 ttt cac tct tao att The His Ser Tyr Ile 280 :cc tto cgg cac cgg c tg Leu tcg Ser gcg Ala gcc Ala 90 ccg Pro agc Ser cca Pro cca Pro gc t Ala 170 gcg Al a got Ala oct Pro aag Lys tat Tyr 250 aag Lys ga t Asp cac cgg Arg gta Val aag Lys 75 aag Lys sag Lys agc Ser tca Ser gag Glu 155 gaa Glu gcg Ala ggg Gly ttC Phe gc t Al a 235 gga Gly gta Val1 gga Gly sat t tg Leu ogc Arg 60 ago Ser got Ala caa Gin gcg Ala got Ala 140 coo Pro ccg Pro agt Ser ct Pro tgC Cys 220 o tg Leu gag Glu gc t Ala gt t Val1 aa t tgg Trp gos Ala tcC Ser ga t Asp cag Gin 110 acc Thr gtC Val ggt Gly ga t Asp cot Pro 190 gtg Val1 aca Thr agg Arg gcc Ala cag Gin 270 ttt Phe tat gcg Ala gog Ala tcg Ser tct Ser agc Ser gcc Ala acc Thr ga t Asp got Ala 175 tat Tyr a ta Me 7 act Glv, aza 3,-a gaa 255 gatC As p gta Val1 99g Cgg Arg gos Ala too Ser got Al a got Ala gog Ala sag Lys ga t Asp 160 aag Lys gao Asp aac Asn ggc Gly gga Gly 240 gc Al a tca Ser tC Phe gga Val gaa Giu 305 gtt Val1 Gly gtc Val cgc Arg g ta Val 385 ttc Phe gcg Ala a tg Met ata Ile a tg Met 465 tac Tyr aag Lys cca Pro atc Ile g tg Val1 545 Glu Ala 290 aga ttg Arg Leu gag gtt Giu Val aac tta Asn Leu tat cta Tyr Leu 355 tct gtg Ser Val 370 gac gac Asp Asp aaa ctg Lys Leu ggg ctg Gly Leu tgg gag Trp Glu 435 aac cag Asn Gin 450 agc gag Ser Glu acc aac Thr Asn gcc gcc Ala Ala ctg atc Leu Ile 515 atc gcc Ile Ala 530 atg ctg Met Leu Arg a tg Met tg t Cys ga t Asp 345 gac Asp att Ile t tg Leu ggg Giy g tg Val 425 ggC Gly cag Gin gac Asp c tg Leu ggC Gly 5*05 c tg Leu atc Ile gac Asp Gly gc t Aia 320 gat Asp cct Pro gc t Ala cct Pro cac His 400 gc t Ala tac Tyr atc Ile gac Asp gac Asp 480 tgC Cys gtg Val gac Asp C tC Leu cgg Arg 560 960 1008 1056 1104 1152 1200 1248 1296 1344 1392 1440 1488 1 5,36 1584 1632 1680 ttc gag tcg gag cac agc gac aag gtg Phe Glu Ser Glu His Ser Asp Lys Val 565 cgc gcg tgg Arg Ala Trp, gtg ggg ttC tcg Val Gly Phe Ser 570 575 gtg ccc Val Pro ccg tcg Pro Ser tac ggg Tyr Gly 610 gtg gcg Val Ala 625 gac cgc Asp Arg acc acg Thr Thr ggc atg Gly Met gac gtg Asp Val 690 acg cga Thr Arg ttc tcc Phe Ser 720 ggg cga Gly Arg 735 att tgg Ile Trp tga tat Tyr ctg ata Leu Ile c tg Leu c9g Arg 595 acc Thr ccg Pro gcg Ala tac Tyr gcc Ala 675 c tc Leu cgc Arg 705 c tg Leu c99 Arg gcg Ala gaa Giu aa t Asn gcg Ala 580 ttc Phe gtg Val ttc Phe gag Glu cgg Arg 660 gag Glu gtc Val cgc Arg gog Ala tgg Trp ggC Gly acc Thr 9gg Gly 785 cac His gag Glu ccc Pro gac Asp gcg Ala 645 aac Asn gac Asp aag Lys tcc Ser gc t Ala t tg Leu acg Thr 755 gac Asp 770 gag Glu cgc Arg ccg Pro g tg Val ccg Pro 630 aac Asn tac Tyr ctc Leu gcg Ala tgt Cys t tg Leu gcc Ala 740 a tg Met ggc Gly t tg Leu atc acg Ile Thr tgc ggg Cys Gly 600 gtg cac Val His 615 ttc aac Phe Asn cgg atg Arg Met aag gag Lys Glu agc tgg Ser Trp 680 aag tac Lys Tyr 695 cgc agg Arg Arg 710 atg cgt Met Arg 725 tac cgc Tyr Arg atg cca Met Pro gat gga Asp Gly tat gct Tyr Ala gcg Ala 585 c tg Leu gcc Ala gac Asp a tc Ile agc Ser 665 gac Asp cag Gin acc Thr gcg Ala cta Leu ctg Leu ga t Asp ggc Gly aac Asn gtg Val1 acc Thr gac Asp 650 tgg Trp cac His tgg Trp tgg Trp tcg Ser cgt Arg ggc Gly 760 gag Glu 775 gcg Ala cag Gin ggg Gly ggg Gly 635 gcg Ala cgc Arg gcc Al a tga acg Thr cat His cgg Arg 745 acc Thr gcg Ala gac Asp ctc Leu ggg Gly 620 ctc Leu c tc Leu gcc Ala gcc Ala gcg Ala t ta Leu t tg Leu 730 c tg Leu ggg Gly cat His atc Ile tac Tyr 605 c tc Leu ggg Gly tcg Ser tgC Cys gtg Val 685 aat Asn 700 ttt Phe 715 cgc Arg cgt Arg cgc Arg ggc Gly ctg Leu 590 gcc Ala cgg Arg tgg Trp, cac His agg Arg 670 ctg Leu taa aga Arg cgg Arg gcc Ala ggg Gly att Ile c tg Leu atg Met gac Asp acg Thr tgc Cys 655 gcg Ala tat Tyr ttg Leu agg Arg gcg Ala c tg Leu gta Val1 765 t tc Phe 780 a tg Met gcg Al a acg Thr ttc Phe 640 ctC Leu cgc Arg gag Glu gcg Ala ctc Leu gac Asp gga Gly 750 gta Val cca Pro 1728 1776 1824 1872 1920 1968 .2016 2064.

2112 2160 2208 2256 2304 2352 2400 2423 act tta ata tcg cca ctc ctg tta Thr Leu Ile Ser Pro Leu Leu Leu gta ttt ata Val Phe Ile 800 ttg atg gcg gcc gc Leu Met Ala Ala <210> 49 <211> 804 <212> PRT <213> Zea mays <400> 49 Met Pro Gly Ala Ile Ser Ser Ser Ser Ser Ala Phe Leu Leu Pro Val 1 5 10 1C .u Ala Arg Arg Pro 65 Gin Ser Ala Pro Arg 145 Ala Ala Arg Val1 Leu 225 His Arg Glu Val1 Glu 305 Ser Ser Gly 50 Ala Ala Pro Met Val1 130 Giu Arg Asp Giu Val 210 Gly Arg Asp Val1 Giu 290 Arg Ser Tyr Pro Gly Gly Pro Gin 115 Ser Ile Pro Ala Asp 195 Val1 Asp Val Leu Thr 275 Ala Leu Ser Gly Pro Gly Ala Asn 100 Asn Gly Asp Val1 Ala 180 Asn Val Val1 Met Gly 260 Tyr Pro Asp *Pro *Tyr Gin Giu Val 85 Pro Gly Pro Ala Glu 165 Pro Glu Ala Val1 Val1 245 Val Phe Pro Ile Trp 325 Arg Ser Asp Ser 70 Gin Leu Thr Lys Ser 150 Ser Ala Pro Ser Gly 230 Val1 Arg His Phe Leu 310 Arg Arg Gly Ala Gly Ala 55 Glu Glu Gly Ser Thr Ser Ser Gly 120 Ala Asp 135 Ala Val Ile Gly Thr Asp Gly Pro 200 Giu Cys 215 Ala Leu Ile Pro Arg Arg Ser Tyr 280 Arg His 295 Lys Arg Arg 25 Glu Ala Ala Thr Ala 105 Gly His Lys Ile Ala 185 Leu Ala Pro Arg Tyr 265 Ile Arg Met Gly Leu Ser Al a Ala Pro Ser Pro Pro Ala 170 Ala Ala Pro Lys Tyr 250 Lys Asp His Ile Ser Arg Val Lys 75 Lys Lys Ser Ser Glu 155 Glu Ala Gly Phe Ala 235 Gly Val Gly Asn Leu 315 Ala Trp Ala Ser Asp Gin 110 Thr Val Gly Asp Pro 190 Val Thr Arg Ala Gin 270 Phe Tyr Lys Leu Arg Ala Ser Al a Ala Ala Lys Asp 160 Lys Asp Asn Gly Gly 240 Al a Ser Phe Gly Ala 320 Val Giu Val Pro Tyr Ala Pro Cys Gly Gly Thr Val Tyr Gly Asp 335 87 Gly Asn Leu Val Phe Ile Ala Asn Asp Trp His Thr Ala Leu Leu Pro 340 345 350 Val Tyr Leu Lys Ala Tyr Tyr Arg Asp Asn Gly Leu Met Gin Tyr Ala 355 360 365 Arg Ser Val Leu Val Ile His Asn Ile Ala His Gin Gly Arg Gly Pro 370 375 380 Val Asp Asp Phe Val Asn Phe Asp Leu Pro Glu His Tyr Ile Asp His 385 390 395 400 Phe Lys Leu Tyr Asp Asn Ile Gly Gly Asp His Ser Asn Val Phe Ala 405 410 415 I Ala Gly Leu Lys Thr Ala Asp Arg Val Val Thr Val Ser Asn Gly Tyr 420 425 430 t Met Trp Glu Leu Lys Thr Ser Glu Gly Gly Trp Gly Leu His Asp Ile 435 440 445 Ile Asn Gin Asn Asp Trp Lys Leu Gin Gly Ile Val Asn Gly Ile Asp 450 455 460 Met Ser Glu Trp Asn Pro Ala Val Asp Val His Leu His Ser Asp Asp 465 470 475 480 6*b Tyr Thr Asn Tyr Thr Phe Glu Thr Leu Asp Thr Gly Lys Arg Gin Cys 485 490 495 Lys Ala. Ala Leu Gin Arg Gin Leu Gly Leu Gin Val Arg Asp Asp Val 500 505 510 Pro Leu Ile Gly Phe Ile Gly Arg Leu Asp His Gin Lys Gly Val Asp 515 520 525 Ile Ile Ala Asp Ala Ile His Trp Ile Ala Gly Gin Asp Val Gin Leu 530 535 540 Val Met Leu Gly Thr Gly Arg Ala Asp Leu Glu Asp Met Leu Arg Arg 545 550 555 560 Phe Glu Ser Glu His Ser Asp Lys Val Arg Ala Trp Val Gly Phe Ser 565 570 575 Val Pro Leu Ala His Arg Ile Thr Ala Gly Ala Asp Ile Leu Leu Met 580 585 590 Pro Ser Arg Phe Glu Pro Cys Gly Leu Asn Gin Leu Tyr Ala Met Ala 595 600 605 Tyr Gly Thr Val Pro Val Val His Ala Val Gly Gly Leu Arg Asp Thr 610 615 620 Val Ala Pro Phe Asp Pro Phe Asn Asp Thr Gly Leu Gly Trp Thr Phe 625 630 635 640 Asp Arg Ala Glu Ala Asn Arg Met Ile Asp Ala Leu Ser His Cys Leu 645 650 655 Thr Thr Tyr Arg Asn Tyr Lys Glu Ser Trp Arg Ala Cys Arg Ala Arg 660 665 670 Gly Met Ala Glu Asp Leu Ser Trp Asp His Ala Ala Val Leu Tyr Glu 675 680 685 Asp Val Leu Val Lys Ala Lys Tyr Gln Trp, Ala Asn Leu Ala Thr Arg .690 695 700 Arg Arg Ser Cys Arg Arg Thr Trp, Thr Leu Phe Arg Arg Leu Phe Ser 705 710 715 720 Leu Ala Ala Leu Met Arg Ala Ser His Leu Arg Arg Ala Asp Gly Arg 725 730 735 Arg Trp Leu Ala Tyr Arg Leu Arg Arg Leu Arg Ala Leu Gly Ile Trp, 740 745 750 Ala Gly Thr Met Met Pro Leu Gly Thr Gly Ar; Gly Val Val Tyr Glu 755 760 765 *Thr Asp Gly Asp Gly Asp Glu Ala His Gly Ile Phe Pro Leu Ile Asn *770 775 780 Gly Glu Leu Tyr Ala Thr Leu Ile Ser Pro Leu Leu Leu Val Phe Ile 785 790 795 800 *Leu Met Ala Ala <210> <211> 2010 <212> DNA Zea mays <220> <221> CDS <222> (1)..(2010) *<400> gct gag gct gag gcc ggg ggc aag gac gcg cc; ccg gag agg agc ggc 48 Ala Glu Ala Glu Ala Gly Gly Lys Asp Ala Pro Pro Glu Arg Ser Giy 1 5 10 *gac gcc gcc agg ttg ccc cgc gct cgg cgc aat gcg gtc tcc aaa cgg 96 Asp Ala Ala Arg Leu Pro Arg Ala Arg Arg Asn Ala Val Ser Lys Arg 0 0.020 25 agg gat cct ctt cag ccg gtc ggc cgg tac ggc tcc gcg acg gga aac 144 Arg Asp Pro Leu Gin Pro Val Giy Arg Tyr Gly Ser Ala Thr Giy Asn 40 acg gcc agg acc ggc gcc gcg tcc tgc cag aac gcc gca. ttg gcg gac 192 Thr Ala Arg Thr Gly Ala Ala Ser Cys Gin Asri Ala Ala Leu Ala Asp 55 gtt gag atc aag tcc atc gtc gcc gcg cc; ccg acg agc ata gtg aag 240 Val Glu Ilie Lys Ser Ile Val Ala Ala Pro Pro Thr Ser Ile Val Lys 70 -5 ttc cca gcg ccg ggc tac agg atg atc ctt ccz tct ggg gac ata gcg 288 Phe Pro Ala Pro Gly Tyr Arg Met Ile Leu Pro Ser Giy Asp Ile Ala 90 ccg gag act gtc ctc cca gcc ccg aag cca czg cat gaa. tcg cct gcg 336 Pro Giu Thr Val Leu Pro Ala Pro Lys Pro Leu His Giu Ser Pro Ala 100 105 110 gtt gac gga gat tca aat gga att gca cct cct aca gtt gag cca tta 384 Val Asp Giy Asp Ser Asn Gly Ile Ala Pro Pro Thr Val Glu Pro Leu 115 120 125 gta cag gag gcc act Val Gin Giu Ala Thr tgg gat ttc aag aaa tac 130 cct Pro 145 tct Ser aat Asn aaa Lys gcg Ala tat Tyr 225 gga Gly gac Asp ata Ile tgc Cys tgc Cys 305 gca Ala atg Met ggc Gly tac Tyr gac Asp ttt Phe gtt Va1 aca Thr aga Arg 210 gtg Va1 cag Gin ttt Phe tat Tyr aag Lys 290 tac Tyr ctc Leu cag Gin cgt Arg ctt Leu 370 gaa Glu gaa Glu atg Met ggt Gly 195 aga Arg gaa Glu gac Asp gtg Val ggg Gly 275 gtt Val gga Gly ctg Leu tac Tyr ggt Gly 355 caa Gin gcg Ala cat His aac Asn 180 ggt Gly gga Gly gcc Ala Cta Leu ttc Phe 260 gga Gly gct Ala gat Asp cct Pro act Thr 340 cct Pro cat His aag Lys tat Tyr 165 gtg Val ctt Leu cat His ttt Phe gaa Glu 245 att Ile agt Ser gtt Val gga Gly gtt Va1 325 cgc Arg gta Val ttc Phe Trp Asp 135 Phe Lys Lys Tyr gat Asp 150 ggg Gly atc Ile gga Gly cgt Arg gat Asp 230 gtg Val gat Asp agg Arg gag Glu aat Asn 310 tat Tyr tcc Ser gat Asp gag 31u gat Asp gac Asp gtg Val gat Asp gtt Val 215 atg Met aac Asn gcc Ala cag Gin gtt Vai 295 ttg Leu ctg Leu gtc Val gaa Glu ctg Leu 375 tcc Ser aat Asn gtg Val gtt Val 200 atg Met gga Gly tat Tyr CCt Pro gaa Glu 280 cct Pro gtg Val aag Lys Ctc Leu ttc Phe 360 tac Tyr agg Arg gat Asp gct Ala 185 gtg Val gtt Val atc Ile ttc Phe ctt Leu 265 atc Ile tgg Trp ttC Phe gca Ala gtc Val 345 ccg Pro gat Asp gtt ggt Val Gly 155 tct ggg Ser Gly 170 gct gaa Ala Glu gga gct Gly Ala gtg gta Val Val cgg aaa Arg Lys 235 cat gca His Ala 250 ttc cgg Phe Arg atg aag Met Lys cac gtt His Val att gcc Ile Ala 315 tat tac Tyr Tyr 330 ata cat Ile His taC atg Tyr Met ccc gtc Pro Val gca Ala cct Pro tgt Cys tta Leu cca Pro 220 tac Tyr ttt Phe cac His cgc Arg cca Pro 300 aat Asn aga Arg aac Asn gac Asp g9t Gly 380 gat Asp ttg Leu tct Ser ccc Pro 205 agg Arg tac Tyr att Ile cgt Arg atg Met 285 tgc Cys gat Asp gac Asp atc Ile ttg Leu 365 ggc Gly gat Asp gcc Ala cca Pro 190 aag Lys tat Tyr aaa Lys gat Asp caa Gin 270 att Ile ggt Gly tgg Trp Cat His gcc Ala 350 cct Pro gag Glu gct Ala ggg Gly 175 tgg Trp gct Ala ggg Giy gct Ala gga Gly 255 gat Asp ttg Leu ggt Gly cac His ggg Gly 335 cac His gaa Glu cac His ggt Gly 160 gag Glu tgc Cys tta Leu gac Asp gca Ala 240 gtc Val gac Asp ttt Phe gtg Vai act Thr 320 tta Leu cag Gin cac His gcc Ala atc ggt ttt gac gag Ile Gly Phe Asp Glu 140 432 480 528 576 624 672 720 768 816 864 912 960 1008 1056 1104 1152 1200 aac atc ttt gcc gcg Asn Ile Phe Ala Ala ctg aag atg gca gac Leu Lys Met Ala Asp 395 cgg gtg gtg act Arg Val Val Thr agc Ser c tc Leu aac Asn cgg Arg aag Lys 465 cgc Arg aag Lys gac Asp a tg Met gtc Val 545 gtg Val tac Tyr ctc Leu ggg Gly agg Arg 625 C tC Leti gag Glu 1248 1296 1344 1392 1440 1488 1536 1584 1632 1680 1728 1776 1824 1872 1920 1968 2010 660 <210> 51 <211> 670 <212> PRT <213> Zea mays <400> 51 Ala Glu Ala Glu 1 Asp Ala Ala Arg Arg Asp Pro Leu Thr Ala Arg Thr Val Glu Ile Lys Phe Pro Ala Pro Pro Glu Thr Val 100 Val Asp Gly Asp 115 Val Gin Glu Ala 130 Pro Asp Glu Ala 145 Ser Phe Glu His Asn Val Met Asn 180 Lys Thr Gly Gly 195 Ala Arg Arg Gly 210 Tyr Val Glu Ala 225 Gly Gin Asp Leu Asp Phe Val Phe 260 Ile Tyr Gly Gly 275 Cys Lys Val Ala 290 Cys Tyr Gly Asp Ala Gly Gly Lys Asp Ala Pro Pro Glu 5 10 Arg Ser Gly 305 Ala Leu Leu Pro Val Met Gly Tyr Asn 385 Ser Leu Ash Arg Lys 465 Arg Lys Asp Met Val 545 Val.

Tyr Leu Gly Arg 625 Leu Gin Tyr Arg Giy 355 Leu Gin 370 Ile Phe Arg Gly His Asp Giy Ile 435 Ser Asp 450 Arg Gin Asp Asp Gly Vai Vai Gin 515 Leu Gin 530 Giy Phe Leu Vai Aia Met Arg Asp 595 Trp Thr 610 His Cys Gin Ala 325 Thr Arg 340 Pro Val His Phe Ala Aia Tyr Leu 405 Ile Ile 420 Asp His Gly Tyr Cys Lys Val Pro 485 Asp Ile 500 Leu Val His Leu Ser Val Met Pro 565 Ala Tyr 580 Thr Vai Phe Asp Leu Asp Arg Giy 645 Giu Asp 660 310 Tyr Ser Asp Giu Gly 390 Trp Arg Gin Thr Ala 470 Leu Ile Met Giu Pro 550 Ser Gly Ala Arg Thr 630 Met Leu Lys Ala Vali Glu Leu 375 Leu Giu Ser Giu Asn 455 Ala Leu Giy Leu Arg 535 Met Arg Thr Pro Ala 615 Tyr Ser Leu Val 345.

Phe Pro 360 Tyr Asp Lys Met Leu Lys Asn Asp 425 Trp Asn 440 Tyr Ser Leu Gin Gly Phe Asp Ala 505 Gly Thr 520 Giu His Ala His Phe Glu Val Pro 585 Phe Asp 600 Giu Ala Arg Lys Gin Asp Val Lys 665 T'yr 330 Ile Tyr Pro Ala Thr 410 Trp Pro Leu Arg Ile 490 Met Giy Pro Arg Pro 570 Val Pro Asn Tyr Leu 650 315 Tyr His Met Vai Asp 395 Val Lys Lys Giu Glu 475 Gly Pro Arg Asn Ile 555 Cys Val1 Phe Lys Gly 635 Ser Arg A.sp Gly 380 Arg Giu Ilie Val1 Thr 460 Leu Arg Trp Ala Lys 540 Thr Gly His Gly Leu 620 Glu Trp Asp Ile Leu 365 Giy Vai Giy Asn Asp 445 Leu Giy Leu Ile Asp 525 Val Ala Leu Ala Asp 605 Ilie Ser Asp H~is Ala 350 Pro Giu Vai Gly Gly 430 Val.

Asp Leu Asp Ala 510 Leu Arg Gly Asn Val1 590 Ala Glu Trp His Giy 335 His Giu His Thr Trp 415 Ile His Ala Giu Gly 495 Gly Glu Giy Ala Gin 575 Giy Aia Lys Aia 655 320 Leu Gin His Ala Val 400 Gly Val Leu Gly Val1 480 Gin Gin Arg Trp, Asp 560 Leu Giy Leu Leu Ser 640 Ala Glu Leu Tyr Val Leu Ala Lys Tyr Gin 93 <210> 52 <211> 1749 <212> DNA <213> Zea mays <220> <221> CDS <222> (1)..(1749) <400> 52 tgc gtc gcg gag ctg agc agg gag ggg ccc gcg ccg cgc ccg ctg cca 48 Cys Val Ala Glu Leu Ser Arg Glu Gly Pro Ala Pro Arg Pro Leu Pro :1 5 10 *ccc gcg ctg ctg gcg ccc ccg ctc gtg ccc ggc ttc ctc gcg ccg ccg 96 Pro Ala Leu Leu Ala Pro Pro Leu Val Pro Gly Phe Leu Ala Pro Pro ~20 25 *.*gcc gag ccc acg ggt gag ccg gca tcg acg ccg ccg ccc gtg ccc gac 144 *Ala Glu Pro Thr Gly Glu Pro Ala Ser Thr Pro Pro Pro Val Pro Asp .35 40 gcc ggc ctg ggg gac ctc ggt ctc gaa cct gaa ggg att gct gaa ggt 192 Ala Gly Leu Gly Asp Leu Gly Leu Glu Pro Glu Gly Ile Ala Glu Gly *:50 55 tcc atc gat aac aca gta gtt gtg gca agt gag caa gat tct gag att 240 Ser Ile Asp Asn Thr Val Val Val Ala Ser Glu Gin Asp Ser Glu Ile 70 75 *gtg gtt gga aag gag caa gct cga gct aaa gta aca caa agc att gtc 288 Val Val Gly Lys Glu Gln Ala Arg Ala Lys Val Thr Gin Ser Ile Val S85 90 ttt gta acc ggc gaa gct tct cct tat gca aag tct ggg ggt cta gga 336 Phe Val Thr Gly Glu Ala Ser Pro Tyr Ala Lys Ser Gly Gly Leu Gly *100 105 110 so.gat gtt tgt ggt tca ttg cca gtt gct ctt gct gct cgt ggt cac cgt 384 Asp Val Cys Gly Ser Leu Pro Val Ala Leu Ala Ala Arg Gly His Arg 115 120 125 gtg atg gtt gta atg ccc aga tat tta aat ggt acc tcc gat aag aat 432 Val Met Val Val Met Pro Arg Tyr Leu Asn Gly Thr Ser Asp Lys Asn 130 135 140 tat gca aat gca ttt tac aca gaa aaa cac att cgg att cca tgc ttt 480 Tyr Ala Asn Ala Phe Tyr Thr Glu Lys His Ile Arg Ile Pro Cys Phe 145 150 155 160 ggc ggt gaa cat gaa gtt acc ttc ttc cat gag tat aga gat tca gtt 528 Gly Gly Glu His Glu Val Thr Phe Phe His Glu Tyr Arg Asp Ser Val 165 170 175 gac tgg gtg ttt gtt gat cat ccc tca tat cac aga cct gga aat tta 576 Asp Trp Val Phe Val Asp His Pro Ser Tyr His Arg Pro Gly Asn Leu 180 185 190 tat gga gat aag ttt ggt gct ttt ggt gat aat cag ttc aga tac aca 624 Tyr Gly Asp Lys Phe Gly Ala Phe Gly Asp Asn Gin Phe Arg Tyr Thr 195 200 205 ctc ctt tgc tat gct gca tgt gag gct cct ttg atc ctt gaa ttg gga 672 Leu Leu Cys Tyr Ala Ala Cys Glu Ala Pro Leu Ile Leu Glu Leu Gly 210 215 220 gga tat att tat gga cag aat tgc atg ttt gtt gtc aat gat zgg cat 720 Gly Tyr Ile Tyr Giy Gin Asn Cys Met Phe Vai Vai Asn Asp Trp His 225 230 235 240 gcc agt cta gtg cca gtc ctt ctt gct gca aaa tat aga eca tat ggt 768 Ala Ser Leu Val Pro Val Leu Leu Ala Ala Lys Tyr Arg Prz Tyr Giy 245 250 255 gtt tat aaa gac tcc cgc agc att ctt gta ata cat aai tta gca cat 816 Val Tyr Lys Asp Ser Arg Ser Ile Leu Vai Ile His Asn Leu Ala His 260 265 270 cag ggt gta gag cct gca agc aca tat cct gac ctt ggg ttg =ca cct 864 Gin Gly Val Giu Pro Ala Ser Thr Tyr Pro Asp Leu Gly Leu Pro Pro of a 275 280 285 gaa tgg tat gga gct ctg gag tgg gta ttc cct gaa tgg gcg agg agg 9i2 Giu Trp, Tyr Gly Ala Leu Glu Trp, Val Phe Pro Glu Trp Ala A~rg A'g 290 295 300 cat gcc ctt gac aag ggt gag gca gtt aat ttt ttg aaa gg:- gca gtt 960 *His Ala Leu Asp Lys Gly Giu Ala Vai Asn Phe Leu Lys Gly Aia Vai 305 310 315 320 gtg aca gca gat cga atc gtg act gtc agt aag ggt tat tzg- :gg gag 1008 Val Thr Ala Asp Arg Ile Vai Thr Val Ser Lys Gly Tyr Ser Trp Glu *.:325 330 335 *gtc aca act gct gaa ggt gga cag ggc ctc aat gag ctc C:a agc tcc 1056 Val Thr Thr Ala Giu Gly Giy Gin Gly Leu Asn Giu Leu Le'u Ser Ser 340 345 350 b *aga aag agt gta tta aac gga att gta aat gga att gac: att aat gat 1104 *09Arg Lys Ser Val Leu Asn Giy Ile Val Asn Gly Ile Asp Ile Asn Asp 355 360 365 tgg aac cct gcc aca gac aaa tgt atc ccc tgt cat tat tct gtt gat 1152 *4.Trp Asn Pro Ala Thr Asp Lys Cys Ile Pro Cys His Tyr Ser Val Asp *to370 375 380 gac ctc tct gga aag gcc aaa tgt aaa ggt gca ttg cag aag gag ctg 1200 Asp Leu Ser Gly Lys Ala Lys Cys Lys Gly Aia Leu Gin Lys Slu Leu 385 390 .395 400 ggt tta cct ata agg cct gat gtt cct ctg att ggc ttt att gga agg i248 Gly Leu Pro Ile Arg Pro Asp Val Pro Leu Ile Gly Phe Ile Gly Arg 405 410 415 ttg gat tat cag aaa ggc att gat ctc att caa ctt atc aca cca gat 1296 Leu Asp Tyr Gin Lys Gly Ile Asp Leu Ile Gin Leu Ile Ile ?ro Asp 420 425 430 ctc atg cgg gaa gat gtt caa ttt gtc atg ctt gga tct ggt gac cca 1344 Leu Met Arg Giu Asp Val Gin Phe Val Met Leu Giy Ser Gly Asp Pro 435 440 445 gag ctt gaa gat tgg atg aga tct aca gag tcg atc ttc aag gat aaa 1392 Glu Leu Glu Asp Trp Met Arg Ser Thr Giu Ser Ile Phe Lys Asp Lys 450 455 460 ttt cgt gga tgg gtt gga ttt agt gtt cca gtt tcc cac cga ata act 1440 Phe Arg Giy Trp Val Gly Phe Ser Val Pro Val Ser His Arg Ile Thr 465 470 475 480 gcc ggc tgc gat ata ttg tta atg cca tcc aga ttc gaa cct tgt ggt 1488 Ala Giy Cys Asp Ile Leu Leu Met Pro Ser Arg Phe Giu Pro Cys Gly 485 490 495 ctc aat cag cta tat gct atg cag tat ggc aca gtt cct gtt gtc cat 1536 Leu Asn Gin Leu Tyr Ala Met Gin Tyr Gly Thr Val Pro Val Val His 500 505 510 gca act ggg ggc ctt aga gat acc gtg gag aac ttc aac cct ttc ggt 1584 Ala Thr Gly Gly Leu Arg Asp Thr Val Giu Asn Phe Asn Pro Phe Gly 515 520 525 gag aat gga gag cag ggt aca ggg tgg gca ttc gca ccc cta acc aca 1632 Glu Asn Giy Giu Gin Giy Thr Gly Trp Ala Phe Aia Pro Leu Thr Thr 530 535 540 gaa aac atg ttt gtg gac att gcg aac tgc aat atc tac ata cag gga 1680 9.*Glu Asn Met Phe Val Asp Ile Ala Asn Cys Asn Ilie Tyr Ile Gin Giy 545 550 555 560 aca caa gtc ctc ctg gga agg gct aat gaa gcg agg cat gtc aaa aga 1728 *Thr Gin Val Leu Leu Gly Arg Ala Asn Glu Ala Arg His Val Lys Arg 565 570 575 :ctt cac gtg gga cca tgc cgc 1749 .Leu His Val Gly Pro Cys Arg 580 <210> 53 <211> 583 <2i2> PRT <213> Zea mays <400> 53 Cys Val Ala Giu Leu Ser Arg Glu Gly Pro Ala Pro Arg Pro Leu Pro Pro Ala Leu Leu Ala Pro Pro Leu Val Pro Gly Phe Leu Ala Pro Pro 25 Ala Glu Pro Thr Gly Giu Pro Ala Ser Thr Pro Pro Pro Val Pro Asp 9...35 40 Ala Gly Leu Gly Asp Leu Gly Leu Glu Pro Giu Gly Ile Ala Giu Gly 55 Ser Ile Asp Asn Thr Val Val Val Ala Ser Glu Gin Asp Ser Glu Ile 70 75 Val Val Gly Lys Giu Gin Ala Arg Ala Lys Val Thr Gin Ser Ile Val 90 Phe Val Thr Gly Glu Ala Ser Pro Tyr Ala Lys Ser Gly Gly Leu Gly 100 105 110 Asp Val Cys Gly Ser Leu Pro Val Ala Leu Ala Ala Arg Gly His Arg 115 120 125 Vai Met Val Val Met Pro Arg Tyr Leu Asn Gly Thr Ser Asp Lys Asn 130 135 140 Tyr Ala Asn Ala Phe Tyr Thr Giu Lys His Ile Arg Ile Pro Cys Phe 145 150 155 160 Gly Gly Giu His Giu Val Thr Phe Phe His Glu Tyr Arg Asp Ser Val 165 170 175 Asp Tyr Leu Gly 225 Ala Val1 Gin Glu His 305 Val Val1 Arg Trp Asp 385 Gly Leu Leu Glu Phe 465 Ala Leu Ala Glu Gly Asn 190 Arg Tyr Glu Leu Asp Trp Pro Tyr 255 Leu Ala 270 Leu Pro Ala Arg Gly Ala Ser Trp 335 Leu Ser 350 Ile Asn Ser Val Lys Glu Ile Gly 415 Ile Pro 430 Gly Asp Lys Asp Arg Ile Pro Cys 495 Val Val 510 Pro Phe Leu Thr 530 Glu Asn Met Phe 545 Thr Gin Vai Leu Leu His Val Gly 580 <210> 54 <211> 870 <212> PRT <213> Zea mays 535 540 Val Asp Ile Aia Asn Cys Asn Ile Tyr Ile Gin Gly 550 555 560 Leu Giy Arg Ala Asn Giu Al1a Arg His Val Lys Arg 565 570 575 Pro Cys Arg <400> 54 Met Ala I 1 Pro Arg I Giy LeuI Gly Ala 1 50 Giy Giu J Ser Asp Ala Gly I Pro Pro Gly Tyr 1 130 Arg Ser .1 145 Ser Tyr C Arg Giu I1 Asn Asn 'I Vai Trp C 210 Pro His C 225 Lys Asp E Arg Val 5 Thr Gly Leu Thr Arg Ala Asp Gly Leu Glu 85 Ala Asp 100 Asp Gly Tyr His Ile Asp Lys Phe 165 Ala Pro 180 Asp Pro Ile Phe Ser Arg Ile Pro 245 Ser Gly Ala Val Leu Gly Gly Ala Val Ser Va1 Arg Ala Ser As n Gin Tyr Gly Ser 170 Ala Met Ala Met Tyr 250 Arg Ala 9* Glu Ile Pro Tyr Val Phe 275 Tyr Giu Thr 290 Tyr Val Asn 305 Tyr Asn Ala Ser Phe Gly Gly Thr Pro 355 Gly Leu Leu 370 Thr Leu Asp 385 His Ser Gly Asn Tyr Gly Trp, Trp, Leu 435 Thr Ser Met 450 Asn Phe Asn 465 Tyr Leu Met Vai Thr Ile Val His Asp 515 Ala Asp Lys 530 Met Gly Asp 545 Cys Val Thr Thr Ile Ala Leu Asp Arg 595 Asp His Val Arg Gin 325 His Asp Leu Leu Arg 405 Trp Glu Tyr Tyr Val 485 Giu Gly Ile Val Ala 565 Trp Ser Ile Gin Met 295 Giu Met Thr Lys Asp 375 Gly His Val Lys His 455 Gly Asp Vali Gly Leu 535 Thr Ser Met Pro Pro Pro Giu Arg 315 Giu Aia Asp Ser Thr 395 Trp Leu Phe Gin Asp 475 Giy Pro Arg Ser Arg 555 Aia Met Arg Giu Giu Val Lys 270 Ser Leu Arg Ile 285 Lys Ile Asn Thr Lys Lys Leu Giy 320 Ser Tyr Tyr Gly 335 Ser Ser Arg Phe 350 Ala His Giu Leu 365 Ala Ser Ser Asn Thr His Tyr Phe 400 Ser Arg Leu Phe 415 Ser Asn Ala Arg 430 Phe Asp Giy Vai 445 Thr Phe Thr Giy Asp Aia Vai Val 480 Tyr Pro Giu Ala 495 Phe Ala Leu Pro 510 His Met Ala Val 525 Glu Thr Trp Lys Trp Leu Glu Lys 560 Val Giy Asp Lys 575 Asp Phe Met Ala 590 Ile Ala Leu His 605 600 Lys Met Ile Arg Leu Ile Thr Met Giy Leu Giy Giy Giu Gly Tyr Leu 610 615 620 Asn Phe Met Gly Asn Giu Phe Gly His Pro Giu Trp Ile Asp Phe Pro 625 630 635 640 Arg Gly Pro Gin Arg Leu Pro Ser Gly Lys Phe Ile Pro Sly Asn Asn 645 650 655 Asn Ser Tyr Asp Lys Cys Arg Arg Arg Phe Asp Leu Gly Asp Ala Asp 660 665 670 Tyr Leu Arg Tyr His Gly Met Gin Giu Phe Asp Gin Ala Met Gin His 675 680 685 Leu Giu Gin Lys Tyr Giu Phe Met Thr Ser Asp His Gin Tyr Ile Ser 690 695 700 Arg Lys His Giu Giu Asp Lys Vai Ile Val Phe Giu Lys GSly Asp Leu 705 710 715 720 *Val Phe Val Phe Asn Phe His Cys Asn Asn Ser Tyr Phe Asp Tyr Arg :::725 730 735 I :lie Gly Cys Arg Lys Pro Gly Val Tyr Lys Vai Val Lei- Asp Ser Asp 740 745 750 Ala Gly Leu Phe Gly Giy Phe Ser Arg Ile His His Ala Ala Giu His 755 760 765 .Phe Thr Ala Asp Cys Ser His Asp Asn Arg Pro Tyr Ser Phe Ser Val *.*770 775 780 Tyr Thr Pro Ser Arg Thr Cys Val Val Tyr Ala Pro Val. Giu Arg Gly 785 790 795 800 Thr Arg Cys Cys Ala Ala Cys Val Gly Leu Ser Met Gly Lys Thr Phe 805 810 815 Phe Gin Asn Arg Gin Met His Ala Cys Met Leu Gin Giy Ser Asp Thr *820 825 830 Leu Ile Asp Ala Gly Lys Pro Met His Leu Ala Ala Leu Ser Ser Leu 835 840 845 Phe Ile Asp Leu Gin Gly Val Asn Thr Ser Phe Arg Phe Ser Leu Lys 850 855 860 Lys Lys Lys Lys Lys Leu 865 870 <210> <211> 2640 <212> DNA <213> Zea mays <400> gcgagatggc gttccgggtt tctggggcgg tgctcggtgg ggccgtaagg gctccccgac tcaccggcgg cggggagggt agtctagtct tccggcacac cggcctcttc ttaactcggg 120 gtgctcgagt tggatgttcg gggacgcacg gggccatgcg cgcggcggcc gcggccagga 180 aggcggtcat ggttcctgag ggcgagaatg atggcctcgc atcaagggct gactcggctc 240 aattccagtc ggatgaactg gaggtaccag acatttctga agagacaacg tgcggtgctg 300 gtgtggctga tgctcaagcc ttgaacagag ttcgagtggt ccccccacca agcgatggac 360 aaaaaatatt ccagattgac cccatgttgc aaggctataa gtaccatctt gagtatcggt 420 acagcctcta tagaagaatc cgttcagaca ttgatgaaca tgaaggaggc ttggaagcct 480 tctcccgtag ttatgagaag tttggattta atgccagcgc ggaaggtatc acatatcgag 540 aatgggctcc tggagcattt tctgcagcat tggtgggtga cgtcaacaac tgggatccaa 600 100 atgcagatcg cagatggtac cagggataaa taccatatga cgcaacctaa cggaaccgaa aacttggata t tggatacca tgaagtcttt atagtcatgc attactttca atgggaactg ataagtttga tacaagtaac cagtggttta ccattggtga taggttttga aaagtga tga tagagaagtg t tgcgt t ttg ctcctaccat taggaggaga attttccaag gttatgacaa gtatgcaaga ctgatcacca gagatttggt gttgtcgaaa gatttagcag ggccatattc agtgatagcg ccttcttcca tcga tgc tgg aaggtgtcaa tatgagcaaa atcacctatt ggattcaatt tgggatttat acgaccaaaa gataaacaca caatgcagtg tgtaactaat gattgataga gtcaagtaat cagtggtcca ggaagtttta tggtttccgt atttacgggg cttgatgctg agatgttagt ctatcggatg aacttggaag tgtaacttat gttgatggac tga tcgtggg gggctatctt aggtccgcaa atgtcgtcga gtttgatcag gtatatttcc atttgtgttc gcctggggtg gatccatcac attctcggtt gggtactcgt aaaccggcag aaagcccatg ttaaacatag aatgagtttg cctcatggat ccagcc tgga tatgatcctc tcattgcgga tatgtaaac t caaataatgg ttttttgcgc gcaca tgagc actctggatg cgtggccatc agatttcttc tttgatggtg aacttcaatg gtaaatgatc ggaatgccta catatggctg atgggtgata gctgaaagtc aaggatatgc atagcattac aatttcatgg agacttccaa agatttgacc gcaatgcaac cggaaaca tg aacttccact tataaggtgg gcagccgagc tatacaccaa tgctgcgcgg atgcatgcat catctcgctg agttttcgtt gtgtttggga ctcgtgtaaa tcaagtactc ctgaagaggt tatatgaaac ttagggatga caatccaaga caagtagtcg ttggtttgct ggttgaatgg actggatgtg tctccaatgc tgacccccat agtattttgg taattcatgg catttgccct tggc tgacaa ttgtgcacac a tga t caagc atgatttcat ataagatgat gaaatgagt gtggtaagtt tgggtgatgc atcttgagca aggagga taa gcaacaacag tcttggactc acttcaccgc gcagaacatg catgtgtggg gcatgctaca cgttgtcctc tttcgcttaa aatttttctg ggtgagaatg agtgcaggcc aaagtatgtg aca tgtcgga agtcctccca gcactcatat ttttggtacc agttctcatg ttttgatggt ggattctcgc tagatggtgg gatgtacact ctttgccacc actttatcct tcctgttcac atggattgac actgacaaat attagtcggc ggccctcgat tagacttatc tggacatcct tattccaggg agactatctt aaaatatgaa ggtgattgtg ctattttgac cgacgctgga cgactgttcg tgtcgtctat gctgtcgatg ataaggttct tctatttata aaaaaaaaaa cctaacaatg gataciccat ccaggagaaa ttcaggcatg atgagtagcc agaataaaaa tatggaagct ccagaagatt gatgtggttc acagatacac ctatttaact ctcgaggaat caccacggat gatgtagatg gaggctgtaa gatggtgggg cttctcaagc aggaggtggt gacaagacta agaccttcaa acaa tgggt t gaatggatag aataacaaca aggtatcatg ttcatgacat t tcgaaaagg taccgtattg ctatttggtg catgataata gctccagtgg tgaggaaaaa gatactttaa taagaccttc aaaaaactca 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 <210> 56 <211> 776 <212> PRT <213> Zea mays <400> 56 Ala Thr Val Gin 1 Asp His Leu Pro Asp His Phe Arg Glu Asp Lys Thr Met Thr Ala Lys Ile Tyr Asp Leu Pro Lys Leu Glu Gly Asp Val Ile Phe Lys Lys Gly Ser Tyr Arg Met Lys Arg Phe Leu Giu Ile Glu Glu Asn Glu Gly Leu Glu Ser Phe Lys Gly Tyr Leu Phe Gly Ile Asn Asn Glu Asp Gly Val Tyr Arg Glu Ala Pro Ala Ala Asn Gly Ala Asn 100 Glu Ala Glu Leu Gly Asp Phe Asn Asp Trp His Lys Met Glu Asp Lys Phe Gly Val Trp Ser 110 Ile Lys Ile Asp His Vai Lys 115 Lys Pro Ala Ile His Asn Ser Lys Val Lys Phe Arg Phe Leu His Gly Gly Val Trp Val Asp Arg Ile 101 130 Pro Ala 145 Pro Tyr Phe Lys Ala His Glu Phe 210 Thr Val 225 Gly Tyr Pro Glu Arg Val Asp Gly 290 Phe His 305 Phe Asn Arg Tyr Val Thr Gly Asn 370 Val Tyr 385 Ala Thr Pro Val Ile Pro Trp Ser 450 Glu Lys 465 Asp Lys Ile Arg Gly Val 165 Pro Arg 180 Gly Met Asp Asn Leu Met Val Thr 245 Leu Lys 260 Met Asp Asn Gly Gly Asp Ala Asn 325 Leu Asp 340 Met Leu Gin Glu Met *Leu Val Ala 405 Glu Gly 420 Arg Trp Gly Glu Ile Ala Ile Ala 485 Thr Asp Lys Glu 200 Pro Met Phe Val His 280 Val Tyr Val Met His 360 Ser His Val Gly Tyr 440 His Glu Leu Asp Pro 170 Al a Pro Ile His Val 250 Lys His Gin Lys Arg 330 Asp Gly Asp Met Gly 410 Asp Lys Leu His Asp 490 102 a. a.

a. a a a.

a a .a a Met Ser Asp Leu Gin Lys 515 Tyr Leu Asn 530 Phe Pro Arg 545 Trp Ser Leu Phe Asp Gin Ser Ser Lys 595 Vai Phe Giu 610 Lys Thr Tyr 625 Arg Val Ala Val Gly His Val Pro Glu 675 Ser Pro Pro 690 Ala Gly Arg 705 Ala Giu Ser Lys Giu Ala Pro Ser Asp 755 Thr Ala Cys 770 Leu Gin 500 Pro Ala Ser Pro Thr Ile Asp Arg 505 Met Ile His Phe Phe Met Gly Asn 535 Giu Gly Asn Asn 550 Val Asp Thr Asp 565 Ala Met Asn Ala 580 Gin Ile Val Ser Arg Gly Asp Leu 615 Giu Gly Tyr Lys 630 Leu Asp Ser Asp 645 Asp Vai Asp His 660 Thr Asn Phe Asn Arg Thr Cys Val 695 Arg Leu His Ala 710 Ile Asp Val Lys 725 Thr Ala Gly Gly 740 Gin Asp Thr Lys Ile Ala Phe Leu 775 Ala Leu Gly Gly Asp Gly 525 His Pro Giu Trp Ile Asp 540 Asp Lys Cys Arg Arg Gin 555 560 Tyr Lys Tyr Met Asn Ala 575 Arg Phe Ser Phe Leu Ser 590 Asp Giu Giu Lys Val Ile 605 Phe Asn Phe His Pro Lys 620 Asp Leu Pro Gly Lys Tyr 635 640 Phe Giy Gly His Gly Arg 655 Pro Giu Gly Val Pro Gly 670 Asn Ser Phe Lys Val Leu 685 Gly Ile Ala 510 Val Asp 700 Gly Lys Ser Ser Lys Phe Thr Giu 765 <210> 57 <211> 2763 <212> DNA <213> Zea mays <400> 57 gctgtgcctc gtgtcgccct cttcctcgcc gactccgctt ccgccgccgc ggcgctctcg ctcgcatgct gatcgggcgg caccgccggg gatcgcgggt ggcggcaatg tgcgcctgag 120 tgtgttgtct gtccagtgca aggctcgccg gtcaggggtg cggaaggtca agagcaaatt 180 cgccactgca gctactgtgc aagaagataa aactatggca actgccaaag gcgatgtcga 240 ccatctcccc atatacgacc tggaccccaa gctggagata ttcaaggacc atttcaggta 300 103 ccggatgaaa atctttttct tcgtgaatgg tggtgcaaac tgtcaaaggg tggagta tgg atttggagct taagcatee t gagtggtgaa catacgagca tgcttettte agaggacctc tgttgtccat acaaagcacc tagtcggctg atattggttg gtateatcac ggacaeagc t cttgccagaa agttgatgaa gattgactac tttgactaac tattgttggc gtcagacttg tcacttcatc tggtcaccca cagacgacag tgaccaagcg cgtcagcgac tgttttcaat tgggaaatac tggccacgac cttcaacaac ttaccgtgta gacgtctcca ggaggcaacg taccaaatga agtcctgctc tgcaggcgac ataataatca cagtttgtat t tc agattcetag aaaggctatt geaecctgetg cataagatgg aaacctgcea gttgatcgta ccctatgatg cggccttcaa aagccagcag aataactaca gggtaccatg aaatatcttg agccatgcaa caagagtcct ttcaactatg gatgaattea catggtatca gtggatgcag gcaactgttg ggtgggg ttg ctgaagaata aggagatata gacaaaacta cagcctgctt acaatggcc gaatgga ttg tggagccttg atgaatgcgc atgaacgatg ttccatccca agagtagccc gtggatcact cggcegaac t gacgaagcag gcagagagca gctggtggca agccacgagt tactggacta tggtgtctca ggga tgga tg gtacaggagc agcagaaagg tgaaatttgg cgcaggaggc agaagga taa tccctcacaa ttccagcatt gtgttcattg agcctgctgc taageaeata acacagttca tgacaaattt ttgataaggc gtaataatgt attttcatgc ctaactggga tgtttgatgg atgtggggtt ttgtttacat ttgctgaaga ggtttgacta aagatgactc ctgaaaaatg t tgca t ttc t cacctacaat ttggaggtga actttccaag tggaeac tga tcgatgagag aggaaaagg t agaaaactta tggae tetga tcacgtcgcc cgttcaaagt gggctggacg tcgacgtcaa agaagggatg ccttggtgag gcegccgetg tcaccgagca gatggtgtgt agttcccgtc atcaattgaa gattaataca agagcttatt atttggtgtt ttccaaggtt gattcgttat ggatcctect tccacgta tc tagggaattt gttgatggca ct ttgeggt t acacagtttg cacagatggt gggaga taga ggtattaagg etteegattt tactggaaac gatgcttgca tgtttcaggc tcgcctggca tgagtggtcg catcgcatat cctgatggae tga tcgaggg tggctacttg agaagggaac tcacttgcgg atttteette tattgtcttt cgaggge tac tgctctggtc tgaaggggtg cetttctccg acgtcttcac agcttecaga gaagtttgcg gactggactg gcgeeettgg ggcaggcact attggctatc cagaataaaa gaaaatgagg aacgaggatg ggtgacttca tgg':cgatca aaa-:ttcgct gegaetgttg gcc:ectgaaa tatgaagcce gcagacaatg gttatggagc agcagcaga t ggtttgcgag ttaaatgget ggttatcata tttettcttt gatggagtta taccaggaa t aaccatttaa atgccggtcc atggctatcc atgggtgaaa getgagagc aaggaaatgt attgcactcc aattttatgg aactggagct tacaagtaca ctttegtcgt gaacgtggag aaagtgggat ttcggtggac ccaggggtgc eccgcacct gcgaaagcag gctagtagca cggcagccat gctgceggeg aacggtcctt gcttgtatag tggc tagaeg aaaaacttgt gaagtcttga gaactgtata atgactggaa aaat tgacea ttctacatgg atgcctctaa ggtacacatt atgtaggtat tgt tgceacg attcgtacta caggcacacc ttctgatgga atgatgttgg aactttggga ctaacctgag catcaatgct atttcagttt tgcacaaae t tttgccggcc ctgatagatg tagcgcatac atgatcagtc acactggcat aaaagatgat gaaatgagt t atgataaatg tgaatgcgtt caaagcagat at ttagt tt t gcgatttgcc atggaagagt ccgaaacgaa gtgtggctta agacaggaaa aagaagacaa ccgatcaaga ccctgttagt tcctgtagct cttttctaga tgcatgtgcc tggggggttt 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2763 <210> 58 <211> 153 <212> DNA <213> Zea mays <220> <221> CDS <222> <400> 58 atg gcg acg eec tcg gec gtg ggc gc Met Ala Thr Pro Ser Ala Val Gly Ala 1 5 tgc cte ctc etc gcg egg Cys Leu Leu Leu Ala Arg gcc gcc tgg Ala Ala Trp gcc gcc gte gge Ala Ala Val Gly cgg geg cge ccg Arg Ala Arg Pro egg egg etc Arg Arg Leu cag egc gtg ctg egc cgc egg tge Gin Arg Val Leu Arg Arg Arg Cys 40 gte geg gag ctg age agg gag ggg Val Ala Glu Leu Ser Arg Glu Gly 144 ce cat atg 104 Pro His Met <210> 59 <211> 51 <212> PRT <213> Zea mays <400> 59 Met Ala Thr Pro Ser Ala Val Gly Ala Ala Cys Leu Leu Leu Ala Arg 1 5 10 Ala Ala Trp, Pro Ala Ala Val Gly Asp Arg Ala Arg Pro Arg Arg Leu 25 *Gln Arg Val Leu Arg Arg Arg Cys Val Ala Glu Leu Ser Arg Glu Gly 40 *Pro His Met 0 0 <210> <211> 9 <212> PRT <213> Zea mays <220> <221> MODRES <222> (7) <223> Arg or Asp *<400> Cys Val Ala Glu Leu Ser Xaa Leu Gly <210> 61 8

PRT

<213> Zea mays <400> 61 Gly Glu Asn Val Met Asn Val Ile 1 <210> 62 <211> <212> PRT <213> Zea mays <400> 62 Cys Val Ala Glu Leu Ser Arg Glu Gly Pro 1 5 <210> 63 <211> 8 <212> PRT <213> Zea mays <400> 63 Ser Ile Val Phe Val Thr Gly Glu 1 105 <210> 64 <211> 8 <212> PRT <213> Zea mays <400> 64 Ala Ser Ala Gly Met Asn Val Val 1 <210> <211> 8 <212> PRT <213> Zea mays <400> Ala Glu Ala Glu Ala Gly Gly Lys 1 <210> 66 :<211> 8 <212> PRT <213> Zea mays <400> 66 :Gly Glu Asn Val Met Asn Val Ile 5 0.0.

<210> 67 <211> 9 <212> PRT 0 0 <213> Zea mays <400> 67 Gly Ser Val Gly Ala Ala Leu Arg Ser 0 0. 1 <210> 68 <211> 8 <212> PRT <213> Zea mays <400> 68 Ala Ala Ala Pro Ala Gly Glu Glu 1 <210> 69 <211> 8 <212> PRT <213> Zea mays <400> 69 Met Val Val Val Trp Ala Ser Glu 1 <210> <211> 798 <212> PRT <213> Zea mays 106 <400> Met Ala I 1 ?he Arg Val 5 Ser Gly Ala Val Leu Gly Gly Ala Val 10 Arg Ala C C

C.

C

U

C

C

C

C

CC CC

.C.C

C.

.C.C

Pro Gly Gly Gly Ser Ala Pro Gly Arg 145 Ser Arg Asn Val Pro 225 Lys Glu Tyr Tyr Tyr 305 Tyr Ser Arg Leu Ala Glu Asp Gly Pro Tyr 130 Ser Tyr Glu Asn Trp 210 His Asp Ile Val Glu 290 Val Asn Phe Leu Phe Met Asn Glu Val Ser 115 Lys Asp Glu Trp Trp 195 Glu Gly Ser Pro Phe 275 Thr Asn Ala Gly SThr SLeu Arg Asp Leu Ala 100 Asp Tyr Ile Lys Ala 180 Asp Ile Ser Ile Tyr 260 Arg His Phe Val Tyr 340 Gly Thr Ala Gly Glu 85 Asp Gly His Asp Phe 165 Pro Pro Phe Arg Pro 245 Asp His Val Arg Gin 325 His Gly Arg Ala Leu 70 Val Ala Gin Leu Glu 150 Gly Gly Asn Leu Val 230 Ala Gly Ala Gly Asp 310 Ile Val Gly Gly Ala 55 Ala Pro Gin Lys Glu 135 His Phe Ala Ala Pro 215 Lys Trp Ile Gin Met 295 Glu Met Thr Glu Ala 40 Ala Ser Asp Ala Ile 120 Tyr Glu Asn Phe Asp 200 Asn Val Ile Tyr Pro 280 Ser Val Ala Asn SGly 25 i Arg SAla Arg Ile Leu 105 Phe Arg Gly Ala Ser 185 Arg Asn Arg Lys Tyr 265 Lys Ser Leu Ile Phe 345 Val Arg Ala Ser 90 Asn Gin Tyr Gly Ser 170 Ala Met Ala Met Tyr 250 Asp Arg Pro Pro Gin 330 Phe Gly Lys Asp 75 Glu Arg Ile Ser Leu 155 Ala Ala Ser Asp Asp 235 Ser Pro Pro Glu Arg 315 Glu Ala Cys Ala Ser Glu Val Asp Leu 140 Glu Glu Leu Lys Gly 220 Thr Val Pro Lys Pro 300 Ile His Pro Ser Met Ala Thr Arg Pro 125 Tyr Ala Gly Val Asn 205 Thr Pro Gin Glu Ser 285 Lys Lys Ser Ser Ser Leu Val Phe Arg His Thr Gly Thr His Val Pro Glu Gin Phe Gin Thr Cys Gly Val Val Pro 110 Met Leu Gin Arg Arg Ile Phe Ser Arg 160 Ile Thr Tyr 175 Gly Asp Val 190 Glu Phe Gly Ser Pro Ile Ser Gly Ile 240 Ala Pro Gly 255 Glu Val Lys 270 Leu Arg Ile Ile Asn Thr Lys Leu Gly 320 Tyr Tyr Gly 335 Ser Arg Phe 350 107 Gly Thr Pro Glu Asp Leu Lys Ser Leu Ile Asp Arg Ala His Glu Leu 355 360 365 Gly Leu Leu Val Leu Met Asp Val Val His Ser His Ala Ser Ser Asn 370 375 380 Thr Leu Asp Gly Leu Asn Gly Phe Asp Gly Thr Asp Thr His Tyr Phe 385 390 395 400 His Ser Gly Pro Arg Gly His His Trp Met Trp Asp Ser Arg Leu Phe 405 410 415 Asn Tyr Gly Asn Trp Glu Val Leu Arg Phe Leu Leu Ser Asn Ala Arg 420 425 430 Trp Trp Leu Glu Glu Tyr Lys Phe Asp Gly Phe Arg Phe Asp Gly Val 435 440 445 0* Thr Ser Met Met Tyr Thr His His Gly Leu Gin Val Thr Phe Thr Gly 450 455 460 Asn Phe Asn Glu Tyr Phe Gly Phe Ala Thr Asp Val Asp Ala Val Val 465 470 475 480 Tyr Leu Met Leu Val Asn Asp Leu Ile His Gly Leu Tyr Pro Glu Ala 485 490 495 Val Thr Ile Gly Glu Asp Val Ser Gly Met Pro Thr Phe Ala Leu Pro 500 505 510 Val His Asp Gly Gly Val Gly Phe Asp Tyr Arg Met His Met Ala Val 515 520 525 Ala Asp Lys Trp Ile Asp Leu Leu Lys Gin Ser Asp Glu Thr Trp Lys 530 535 540 Met Gly Asp Ile Val His Thr Leu Thr Asn Arg Arg Trp Leu Glu Lys 545 550 555 560 Cys Val Thr Tyr Ala Glu Ser His Asp Gin Ala Leu Val Gly Asp Lys 565 570 575 Thr Ile Ala Phe Trp Leu Met Asp Lys Asp Met Tyr Asp Phe Met Ala 580 585 590 Leu Asp Arg Pro Ser Thr Pro Thr Ile Asp Arg Gly Ile Ala Leu His 595 600 605 Lys Met Ile Arg Leu Ile Thr Met Gly Leu Gly Gly Glu Gly Tyr Leu 610 615 620 Asn Phe Met Gly Asn Glu Phe Gly His Pro Glu Trp Ile Asp Phe Pro 625 630 635 640 Arg Gly Pro Gin Arg Leu Pro Ser Gly Lys Phe Ile Pro Gly Asn Asn 645 650 655 Asn Ser Tyr Asp Lys Cys Arg Arg Arg Phe Asp Leu Gly Asp Ala Asp 660 665 670 Tyr Leu Arg Tyr His Gly Met Gin Glu Phe Asp Gin Ala Met Gin His 675 680 685 Leu Glu Gin Lys Tyr Glu Phe Met Thr Ser Asp His Gin Tyr Ile Ser 690 695 700 Arg Lys His Glu Glu Asp Lys Val Ile Val Phe Glu Lys Gly Asp Leu 108 705 Val Ile Ala Phe Tyr 785 Phe Val Phe Asn 725 Gly Cys Arg Lys 740 Gly Leu Phe Gly 755 Thr Ala Asp Cys 770 Thr Pro Ser Arg 710 Phe His Cys Asn Asn 730 Pro Gly Val Tyr Lys 745 Gly Phe Ser Arg Ile 760 Ser His Asp Asn Arg 775 Thr Cys Val Val Tyr 790 720 Tyr Phe Asp Tyr Arg 735 Val Leu Asp Ser Asp 750 His Ala Ala Giu His 765 Tyr Ser Phe Ser Val 780 Pro Val Glu S S S. S *00S

S.

0S S 6

S

6* @6 if S if S S. S

S.

*5 6

S.

9006 S. OS 0 5 if..

S.

S S 0@ *065 0 0000 <210> 71 <211> 14 <212> PRT <213> Zea mays <400> 71 Arg Gly Thr Arg cys Cys Ala Ala Cys Val Gly Leu Ser Met 1 5 <210> 72 <211> 16 <212> PRT <213> Zea mays <400> 72 Gly Lys Thr Phe Phe Gin Asn Arg Gin Met His Ala Cys Met Leu Gin 1 5 10 <210> 73 <211> 22 <212> PRT <213> Zea mays <400> 73 Gly Ser Asp Thr Leu Ile Asp Ala Giy Lys Pro Met His Leu Ala Ala 1 5 10 Leu Ser Ser Leu Phe Ile <210> 74 <211> 6 <212> PRT <213> Zea mays <400> 74 Asp Leu Gin Gly Val Asn 1 <210> 109 <211> 13 <212> PRT <213> Zea mays <400> Ser Phe Arg Phe Ser Leu Lys Lys Lys Lys Lys Lys Leu 1 5 <210> 76 <211> 431 <212> PRT <213> E. coli <223> gigC3 <400> 76 Met Val Ser Leu Giu Lys Asn Asp His Leu Met Leu Ala Arg Gin Leu 1 5 10 Pro Leu Lys Ser Val Ala Leu Ile Leu Ala Gly Gly Arg Gly Thr Arg *20 25 Leu Lys Asp Leu Thr Asn Lys Arg Ala Lys Pro Ala Val His Phe Gly 40 Gly Lys Phe Arg Ile Ile Asp Phe Ala Leu Ser Asn Cys Ile Asn Ser 55 Gly Ile Arg Arg Met Gly Val Ile Thr Gin Tyr Gin Ser His Thr Leu 70 75 Val Gin His Ile Gin Arg Gly Trp Ser Phe Phe Asn Giu Giu Met Asn 90 Glu Phe Val Asp Leu Leu Pro Ala Gin Gin Arg Met Lys Gly Glu Asn .oo100 105 110 0 Trp Tyr Arg Gly Thr Ala Asp Ala Val Thr Gin Asn Leu Asp Ile Ile o 115 120 125 oooo o Arg Arg Tyr Lys Ala Giu Tyr Val Val Ile Leu Ala Gly Asp His Ile 130 135 140 Tyr Lys Gin Asp Tyr Ser Arg Met Leu Ile Asp His Val Giu Lys Gly 145 150 155 160 Vai Arg Cys Thr Val Val Cys Met Pro Val Pro Ile Giu Giu Ala Ser 165 170 175 Ala Phe Gly Val met Ala Val Asp Giu Asn Asp Lys Thr Ile Glu Phe 180 185 190 Val Giu Lys Pro Ala Asn Pro Pro Ser Met Pro Asn Asp Pro Ser Lys 195 200 205 Ser Leu Ala Ser Met Gly Ile Tyr Val Phe Asp Ala Asp Tyr Leu Tyr 210 215 220 Giu Leu Leu Giu Glu Asp Asp Arg Asp Glu Asn Ser Ser His Asp Phe 225 230 235 240 Gly Lys Asp Leu Ile Pro Lys Ile Thr Giu Ala Giy Leu Ala Tyr Ala 245 250 255 His Pro Phe Pro Leu Ser Cys Val Gin Ser Asp Pro Asp Ala Giu Pro 260 265 270 110

C

C

C. C Tyr Trp Arg Asp 275 Asp Leu Ala Ser 290 Pro Ile Arg Thr 305 Asp Arg Ser Gly Gly Cys Val Ile 340 Arg Val Arg Val 355 Pro Giu Val Trp 370 Asp Arg Ala Cys 385 Giu Giu Asp Ala Val Thr Arg Glu 420 Val Gly Val Val Tyr Asn 310 Ser His 325 Ser Gly Asri Ser Val Gly Val Ile 390 Arg Arg 405 Met Leu Thr Leu Giu Ala 280 Asp Lys Leu Asp 295 Giu Ser Leu Pro Gly Met Thr Leu 330 Ser Val Val Val 345 Phe Cys Asn Ile 360 Arg Ser Cys Arg 375 Pro Giu Gly Met Phe Tyr Arg Ser 410 Arg Lys Leu Gly 425 Tyr Met Pro 315 Asn Gin Asp Leu Val 395 Giu His Trp, Tyr 300 Ala Ser Ser Ser Arg 380 Ile Giu Lys Lys Aia Asn 285 Asp Arg Asn Lys Phe Val Leu Val Ser 335 Val Leu Phe 350 Ala Val Leu 365 Arg Cys Val Gly Giu Asn Gly Ile Vai 415 Gin Giu Arg 430 <210> 77 <211> <212> PRT <213> E. coli <223> 919C3 <400> 77 Cys Arg Phe Tyr Met Tyr Val Gin Arg Cys 1 5

Claims (29)

1. A method of producing polysaccharides which are non glycogen like in a host comprising: a. transforming a host capable of being used in a fermentation process, with genes selected from the group which produce starch synthesizing enzymes, glycogen synthesizing enzymes such that the host produces nonglycogen like starch, and b. employing the host in a fermentation process wherein the fermentation process produces polysaccharides.

2. A method according to claim 1 wherein the host is bacteria.

3. A host transformed to carry a gene active in glycogen production, and at least one nonstarch branching gene active in the production of at least one of the following polysaccharides amylopectin and amylose in it original host.

4. A host according to claim 3 wherein the host is a monocot. A host according to claim 3 wherein the host is a dicot.

6. A host according to claim 3 wherein the host is a plant.

7. A host according to claim 3 wherein the host is a bacteria.

8. A host according to claim 3 wherein the host is a cereal bearing plant.

9. A host according to claim 3 wherein the bacterial gene is selected from the group consisting ofglgC gene, glgA gene, glgB gene. A host according to claim 3 wherein at least one nonstarch branching genes active in the production of at least one of the following polysaccharides amylopectin and amylose in 112 it original plant is selected from the group consisting of starch soluble starch synthase I, II, III genes and debranching enzyme gene (sul), GBSS gene, sh2 gene and bt2 gene.

11. A host according to claim 3 including at least one of the starch branching enzyme genes.

12. A host according to claim 11 including the starch branching enzyme gene BEI gene.

13. A host according to claim 11 including the starch branching enzyme gene BEII gene. 0 00 1'4. A host according to claim 12 including the starch branching enzyme gene BEII gene. A host transformed to carry a gene active in ADPG production, and at least one starch gene active in the production of at least one of the following polysaccharides amylopectin and amylose in it original host wherein the host produces polysaccharides that are plant like starch and not glycogen like.

16. A host transformed to carry a pyrophosphatase gene, glycogen synthase gene,

17. A host according to claim 1 wherein the gene active in glycogen production is a bacterial gene.

18. A host deficient in alpha 1,4 glucan synthesizing ability and alpha 1,4-1,6 branching enzyme capability transformed to express at least one a plant starch soluble synthesis gene.

19. A host according to claim 18 including being transformed to express at least one gene encoding for debranching enzyme. 113 A host according to claim 18wherein said gene is encoding for starch soluble synthase enzyme I.

21. A host according to claim 18wherein said gene is encoding for starch soluble synthase enzyme II.

22. A host according to claim 18wherein said gene is encoding for starch soluble synthase enzyme III.

23. A host according to claim 18 including being transformed to express at least one gene encoding for starch branching enzyme.

24. A host according to claim 23 wherein the starch branching enzyme is BEI. "25. A host according to claim 23 wherein the starch branching enzyme is BEII.

26. A plasmid wherein said plasmid is in a carrier host and said plasmid contains the SSn gene with the n terminus (SEQ ID NO:1) GENVMNVIV wherein the gene is approximately 1561 base pairs in length.

27. A Plasmid according to claim on e wherein said host is a bacterial host.

28. A host according to claim two wherein the host is a wild type E. Coli.

29. A new'polysaccharide produced by a transformed host comprising: said host having a wildtype, said wildtype of said host does not produce said new polysaccharide, said transformed host expressing at least two exogenous starch synthesis genes, said genes are selected from a group consisting of soluble starch synthesis genes such as SSI SSII SSIII, wherein the transformed host is capable of producing such new polysaccharide. 114 The new polysaccharide of claim 29 wherein said host also expresses the exogenous genes selected from the following group consisting of bacterial glycogen inducing genes.

31. The new polysaccharide of claim 29 wherein said host also expresses the exogenous genes selected from the following group consisting of plant granule bound enzymes.

32. A method according to claim one wherein the host is fungal. O* V, 33. A method according to claim 32 wherein the host is yeast.

34. A method according to claim one wherein said glycogen synthesizing genes include glgC, glgA, glgB genes. A method according to claim one wherein said genes which produce starch 0. synthesizing enzymes include genes encoding for starch soluble synthases I, II, III.

36. A method according to claim one wherein said genes which produce starch enzymes.

37. The new polysaccharide of claim 30 wherein said bacterial glycogen inducing genes are selected from the group consisting of glgC, glgA, glgB.

38. The new polysaccharide of claim 29 wherein said starch synthesis genes are selected from the group consisting of BEI and BEII. DATED this 7 th Day of March 2002 Exseed Genetics, LLC By their Patent Attorneys CULLEN CO