AU2022205243A1

AU2022205243A1 - Microorganisms for producing 1,4-butanediol and methods related thereto

Info

Publication number: AU2022205243A1
Application number: AU2022205243A
Authority: AU
Inventors: Anthony P. Burgard; Robin E. Osterhout; Priti Pharkya; Jun Sun
Original assignee: Genomatica Inc
Current assignee: Genomatica Inc
Priority date: 2011-06-22
Filing date: 2022-07-14
Publication date: 2022-08-18

Abstract

The invention provides non-naturally occurring microbial organisms comprising a 1,4-butanediol (BDO), 4-hydroxybutyryl-CoA, 4-hydroxybutanal or putrescine pathway comprising at least one exogenous nucleic acid encoding a BDO, 4 hydroxybutyryl-CoA, 4- hydroxybutanal or putrescine pathway enzyme expressed in a sufficient amount to produce BDO, 4-hydroxybutyryl-CoA, 4-hydroxybutanal or putrescine and further optimized for expression of BDO. The invention additionally provides methods of using such microbial organisms to produce BDO, 4 hydroxybutyryl-CoA, 4-hydroxybutanal or putrescine.

Description

I

MICROORGANISMS FOR PRODUCING 1,4-BUTANEDIOL AND METHODS RELATED THERETO

[001] This application is a divisional application of Australian Application No. 2020202162, which itself is a divisional application of Australian Application No. 2018200160, which itself is a divisional application of Australian Application No. 2015249173, which is itself a divisional application of Australian Application No. 2013203163, which is itself a divisional application of Australian Application No. 2012272856 and claims the benefit of priority of United States Provisional application serial No. 61/500,120, filed June 22, 2011, and United States Provisional application serial No. 61/502,837, filed June 29, 2011, the entire contents of each of which are incorporated herein by reference.

[002] Incorporated herein by reference is the Sequence Listing being concurrently submitted via EFS-Web as an ASCII text file named 12956-144-228SEQLISTTXT, created June 21, 2012, and being 227,782 bytes in size.

[003] This invention relates generally to in silico design of organisms and engineering of organisms, more particularly to organisms having 1,4-butanediol, 4-hydroxybutyryl-CoA, 4-hydroxybutanal or putrescine biosynthesis capability.

BACKGROUND OF THE INVENTION

[004] The compound 4-hydroxybutanoic acid (4-hydroxybutanoate, 4-hydroxybutyrate, 4-HB) is a 4-carbon carboxylic acid that has industrial potential as a building block for various commodity and specialty chemicals. In particular, 4-HB has the potential to serve as a new entry point into the 1,4-butanediol family of chemicals, which includes solvents, resins, polymer precursors, and specialty chemicals. 1,4-Butanediol (BOO) is a polymer intermediate and industrial solvent. BDO is currently produced from petrochemical precursors, primarily acetylene, maleic anhydride, and propylene oxide.

[005] For example, acetylene is reacted with 2 molecules of formaldehyde in the Reppe synthesis reaction (Kroschwitz and Grant, Encyclopedia of Chen. Tech., John Wiley and Sons, Inc., New York (1999)), followed by catalytic hydrogenation to form 1,4-butanediol. It has been estimated that 90% of the acetylene produced in the U.S. is consumed for butanediol production. Alternatively, it can be formed by esterification and catalytic hydrogenation of maleic anhydride, which is derived from butane. Downstream, butanediol can be further

transformed; for example, by oxidation to y-butyrolactone, which can be further converted to pyrrolidone and N-methyl-pyrrolidone, or hydrogenolysis to tetrahydrofuran. These compounds have varied uses as polymer intermediates, solvents, and additives, and have a combined market of nearly 2 billion lb/year.

[006] It is desirable to develop a method for production of these chemicals by alternative means that not only substitute renewable for petroleum-based feedstocks, and also use less energy- and capital-intensive processes. The Department of Energy has proposed 1,4-diacids, and particularly succinic acid, as key biologically-produced intermediates for the manufacture of the butanediol family of products (DOE Report, "Top Value-Added Chemicals from Biomass", 2004). However, succinic acid is costly to isolate and purify and requires high temperatures and pressures for catalytic reduction to butanediol.

[007] Thus, there exists a need for alternative means for effectively producing commercial quantities of 1,4-butanediol and its chemical precursors. The present invention satisfies this need and provides related advantages as well.

SUMMARY OF THE INVENTION

[008] The invention provides non-naturally occurring microbial organisms containing a 1,4-butanediol (BDO), 4-hydroxybutanal (4-HBal), 4-hydroxybutyryl-CoA (4-HBCoA) and/or putrescine pathway comprising at least one exogenous nucleic acid encoding a BDO, 4-HBal and/or putrescine pathway enzyme expressed in a sufficient amount to produce BDO, 4-HBal, 4-HBCoA and/or putrescine. The microbial organisms can be further optimized for expression of BDO, 4-HBal, 4-HBCoA and/or putrescine. The invention additionally provides methods of using such microbial organisms to produce BDO, 4-HBal, 4-HBCoA and/or putrescine.

BRIEF DESCRIPTION OF THE DRAWINGS

[009] Figure 1 is a schematic diagram showing biochemical pathways to 4 hydroxybutyurate (4-HB) and to 1,4-butanediol production. The first 5 steps are endogenous to E. coli, while the remainder can be expressed heterologously. Enzymes catalyzing the biosynthetic reactions are: (1) succinyl-CoA synthetase; (2) CoA-independent succinic semialdehyde dehydrogenase or succinate reductase; (3) a-ketoglutarate dehydrogenase; (4) glutamate:succinate semialdehyde transaminase; (5) glutamate decarboxylase; (6) CoA dependent succinic semialdehyde dehydrogenase; (7) 4-hydroxybutanoate dehydrogenase; (8) a-ketoglutarate decarboxylase; (9) 4-hydroxybutyryl CoA:acetyl-CoA transferase; (10) butyrate kinase; (11) phosphotransbutyrylase; (12) aldehyde dehydrogenase; (13) alcohol dehydrogenase.

[010] Figure 2 is a schematic diagram showing homoserine biosynthesis in E. coli.

[011] Figure 3 shows the production of 4-HB in glucose minimal medium using E. coli strains harboring plasmids expressing various combinations of 4-HB pathway genes. (a) 4 HB concentration in culture broth; (b) succinate concentration in culture broth; (c) culture OD, measured at 600 nm. Clusters of bars represent the 24 hour, 48 hour, and 72 hour (if measured) timepoints. The codes along the x-axis indicate the strain/plasmid combination used. The first index refers to the host strain: 1, MG1655 lacIQ; 2, MG1655 AgabD lacIQ; 3, MG1655 AgabD AaldA lacIQ. The second index refers to the plasmid combination used: 1, pZE13-0004-0035 and pZA33-0036; 2, pZE13-0004-0035 and pZA33-001On; 3, pZE13 0004-0008 and pZA33-0036; 4, pZE13-0004-0008 and pZA33-001On; 5, Control vectors pZE13 and pZA33.

[012] Figure 4 shows the production of 4-HB from glucose in E. coli strains expressing a-ketoglutarate decarboxylase from Mycobacterium tuberculosis. Strains 1-3 contain pZE13 0032 and pZA33-0036. Strain 4 expresses only the empty vectors pZE13 and pZA33. Host strains are as follows: 1 and 4, MG1655 lacIQ; 2, MG1655 AgabD lacIQ; 3, MG1655 AgabD AaldA lacIQ. The bars refer to concentration at 24 and 48 hours.

[013] Figure 5 shows the production of BDO from 10 mM 4-HB in recombinant E. coli strains. Numbered positions correspond to experiments with MG1655 lacIQ containing pZA33-0024, expressing cat2 from P. gingivalis, and the following genes expressed on pZE13: 1, none (control); 2, 0002; 3, 0003; 4, 0003n; 5, 0011; 6, 0013; 7, 0023; 8, 0025; 9, 0008n; 10, 0035. Gene numbers are defined in Table 6. For each position, the bars refer to aerobic, microaerobic, and anaerobic conditions, respectively. Microaerobic conditions were created by sealing the culture tubes but not evacuating them.

[014] Figure 6 shows the mass spectrum of 4-HB and BDO produced by MG1655 lacIQ pZE13-0004-0035-0002 pZA33-0034-0036 grown in M9 minimal medium supplemented with 4 g/L unlabeled glucose (a, c, e, and g) uniformly labeled 1 3 C-glucose (b, d, f, and h). (a) and (b), mass 116 characteristic fragment of derivatized BDO, containing 2 carbon atoms; (c) and (d), mass 177 characteristic fragment of derivatized BDO, containing 1 carbon atom; (e) and (f), mass 117 characteristic fragment of derivatized 4-HB, containing 2 carbon atoms; (g) and (h), mass 233 characteristic fragment of derivatized 4-HB, containing 4 carbon atoms.

[015] Figure 7 is a schematic process flow diagram of bioprocesses for the production of y-butyrolactone. Panel (a) illustrates fed-batch fermentation with batch separation and panel (b) illustrates fed-batch fermentation with continuous separation.

[016] Figures 8A and 8B show exemplary 1,4-butanediol (BDO) pathways. Figure 8A shows BDO pathways from succinyl-CoA. Figure 8B shows BDO pathways from alpha ketoglutarate.

[017] Figures 9A-9C show exemplary BDO pathways. Figure 9A and 9B show pathways from 4-aminobutyrate. Figure 9C shows a pathway from acetoactyl-CoA to 4 aminobutyrate.

[018] Figure 10 shows exemplary BDO pathways from alpha-ketoglutarate.

[019] Figure 11 shows exemplary BDO pathways from glutamate.

[020] Figure 12 shows exemplary BDO pathways from acetoacetyl-CoA.

[021] Figure 13 shows exemplary BDO pathways from homoserine.

[022] Figures 14 shows the nucleotide and amino acid sequences of E. coli succinyl CoA synthetase. Figure 14A shows the nucleotide sequence (SEQ ID NO:46) of the E. coli sucCD operon. Figures 14B (SEQ ID NO:47) and 14C (SEQ ID NO:48) show the amino acid sequences of the succinyl-CoA synthetase subunits encoded by the sucCD operon.

[023] Figure 15 shows the nucleotide and amino acid sequences of Mycobacterium bovis alpha-ketoglutarate decarboxylase. Figure 15A shows the nucleotide sequence (SEQ ID NO:49) of Mycobacterium bovis sucA gene. Figure 15B shows the amino acid sequence (SEQ ID NO:50) of M. bovis alpha-ketoglutarate decarboxylase.

[024] Figure 16 shows biosynthesis in E. coli of 4-hydroxybutyrate from glucose in minimal medium via alpha-ketoglutarate under anaerobic (microaerobic) conditions. The host strain is ECKh-401. The experiments are labeled based on the upstream pathway genes present on the plasmid pZA33 as follows: 1) 4hbd-sucA; 2) sucCD-sucD-4hbd; 3) sucCD sucD-4hbd-sucA.

[025] Figure 17 shows biosynthesis in E. coli of 4-hydroxybutyrate from glucose in minimal medium via succinate and alpha-ketoglutarate. The host strain is wild-type

MG1655. The experiments are labeled based on the genes present on the plasmids pZE13 and pZA33 as follows: 1) empty control vectors 2) empty pZE13, pZA33-4hbd; 3) pZE13 sucA, pZA33-4hbd.

[026] Figure 18 A shows the nucleotide sequence (SEQ ID NO:51) of CoA-dependent succinate semialdehyde dehydrogenase (sucD) from Porphyromonasgingivalis, and Figure 18B shows the encoded amino acid sequence (SEQ ID NO:52).

[027] Figure 19A shows the nucleotide sequence (SEQ ID NO:53) of 4-hydroxybutyrate dehydrogenase (4hbd) from Porphymonas gingivalis, and Figure 19B shows the encoded amino acid seqence (SEQ ID NO:54).

[028] Figure 20A shows the nucleotide sequence (SEQ ID NO:55) of 4-hydroxybutyrate CoA transferase (cat2) from Porphyromonasgingivalis, and Figure 20B shows the encoded amino acid sequence (SEQ ID NO:56).

[029] Figure 21A shows the nucleotide sequence (SEQ ID NO:57) of phosphotransbutyrylase (ptb) from Clostridium acetobutylicum, and Figure 21B shows the encoded amino acid sequence (SEQ ID NO:58).

[030] Figure 22A shows the nucleotide sequence (SEQ ID NO:59) of butyrate kinase (buk1) from Clostridium acetobutylicum, and Figure 22B shows the encoded amino acid sequence (SEQ ID NO:60).

[031] Figure 23 shows alternative nucleotide sequences for C. acetobutylicum 020 (phosphtransbutyrylase) with altered codons for more prevalent E. coli codons relative to the C. acetobutylicum native sequence. Figures 23A-23D (020A-020D, SEQ ID NOS:61-64, respectively) contain sequences with increasing numbers of rare E. coli codons replaced by more prevalent codons (A<B<C<D).

[032] Figure 24 shows alternative nucleotide sequences for C. acetobuytlicum 021 (butyrate kinase) with altered codons for more prevalent E. coli codons relative to the C. acetobutylicum native sequence. Figures 24A-24D (021A-021B, SEQ ID NOS:65-68, respectively) contain sequences with increasing numbers of rare E. coli codons replaced by more prevalent codons (A<B<C<D).

[033] Figure 25 shows improved expression of butyrate kinase (BK) and phosphotransbutyrylase (PTB) with optimized codons for expression in E. coli. Figure 25A shows sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) stained for proteins with Coomassie blue; lane 1, control vector with no insert; lane 2, expression of C. acetobutylicum native sequences in E. coli; lane 3, expression of 020B-021B codon optimized PTB-BK; lane 4, expression of 020C-021C codon optimized PTB-BK. The positions of BK and PTB are shown. Figure 25B shows the BK and PTB activities of native C. acetobutylicum sequence (2021n) compared to codon optimized 020B-021B (2021B) and 020C-021C (2021C).

[034] Figure 26 shows production of BDO and gamma-butyrylactone (GBL) in various strains expressing BDO producing enzymes: Cat2 (034); 2021n; 2021B; 2021C.

[035] Figure 27A shows the nucleotide sequence (SEQ ID NO:69) of the native Clostridium biejerinckiiald gene (025n), and Figure 27B shows the encoded amino acid sequence (SEQ ID NO:70).

[036] Figures 28A-28D show alternative gene sequences for the Clostridium beijerinckii ald gene (025A-025D, SEQ ID NOS:71-74, respectively), in which increasing numbers of rare codons are replaced by more prevalent codons (A<B<C<D).

[037] Figure 29 shows expression of native C. beijerinckiiald gene and codon optimized variants; no ins (control with no insert), 025n, 025A, 025B, 025C, 025D.

[038] Figure 30 shows BDO or BDO and ethanol production in various strains. Figure shows BDO production in strains containing the native C. beijerinckii ald gene (025n) or variants with optimized codons for expression in E. coli (025A-025D). Figure 30B shows production of ethanol and BDO in strains expressing the C. acetobutylicum AdhE2 enzyme (002C) compared to the codon optimized variant 025B. The third set shows expression of P. gingivalissucD (035). In all cases, P. gingivalisCat2 (034) is also expressed.

[039] Figure 31A shows the nucleotide sequence (SEQ ID NO:75) of the adh Igene from Geobacillus thermoglucosidasius,and Figure 31B shows the encoded amino acid sequence (SEQ ID NO:76).

[040] Figure 32A shows the expression of the Geobacillus thermoglucosidasiusadh1 gene in E. coli. Either whole cell lysates or supernatants were analyzed by SDS-PAGE and stained with Coomassie blue for plasmid with no insert, plasmid with 083 (Geotrichum capitatum N-benzyl-3-pyrrolidinol dehydrogenase) and plasmid with 084 (Geobacillus thermoglucosidasiusadh1) inserts. Figure 32B shows the activity of 084 with butyraldehyde (diamonds) or 4-hydroxybutyraldehyde (squares) as substrates.

[041] Figure 33 shows the production of BDO in various strains: plasmid with no insert; 025B, 025B-026n; 025B-026A; 025B-026B; 025B-026C; 025B-050; 025B-052; 025B-053; 025B-055; 025B-057; 025B-058; 025B-071; 025B-083; 025B-084; PTSlacO-025B; PTSlacO-025B-026n.

[042] Figure 34 shows a plasmid map for the vector pRE118-V2.

[043] Figure 35 shows the sequence (SEQ ID NO:77) of the ECKh-138 region encompassing the aceF and lpdA genes. The K. pneumonia lpdA gene is underlined, and the codon changed in the Glu354Lys mutant shaded.

[044] Figure 36 shows the protein sequence comparison of the native E. coli pdA (SEQ ID NO:78) and the mutant K. pneumonialpdA (SEQ ID NO:79).

[045] Figure 37 shows 4-hydroxybutyrate (left bars) and BDO (right bars) production in the strains AB3, MG1655 AldhA and ECKh-138. All strains expressed E. coli sucCD, P. gingivalissucD, P. gingivalis 4hbd on the medium copy plasmid pZA33, and P. gingivalis Cat2, C. acetobutylicum AdhE2 on the high copy plasmid pZE13.

[046] Figure 38 shows the nucleotide sequence (SEQ ID NO:80) of the 5' end of the aceE gene fused to the pflB-p6 promoter and ribosome binding site (RBS). The 5' italicized sequence shows the start of the aroP gene, which is transcribed in the opposite direction from the pdh operon. The 3' italicized sequence shows the start of the aceE gene. In upper case: pflB RBS. Underlined: FNR binding site. In bold: pflB-p6 promoter sequence.

[047] Figure 39 shows the nucleotide sequence (SEQ ID NO:81) in the aceF-pdA region in the strain ECKh-456.

[048] Figure 40 shows the production of 4-hydroxybutyrate, BDO and pyruvate (left to right bars, respectively) for each of strains ECKh-439, ECKh-455 and ECKh-456.

[049] Figure 41A shows a schematic of the recombination sites for deletion of the mdh gene. Figure 41B shows the sequence (nucleotide sequence, SEQ ID NO: 82; amino acid sequence, SEQ ID NO: 83) of the PCR product of the amplification of chloramphenicol resistance gene (CAT) flanked by FRT sites and homology regions from the mdh gene from the plasmid pKD3.

[050] Figure 42 shows the sequence (SEQ ID NO:84) of the arcA deleted region in strain ECKh-401.

[051] Figure 43 shows the sequence (SEQ ID NO:85) of the region encompassing a mutated gitA gene of strain ECKh-422.

[052] Figure 44 shows the citrate synthase activity of wild type gtA gene product and the R163L mutant. The assay was performed in the absence (diamonds) or presence of 0.4 mM NADH (squares).

[053] Figure 45 shows the 4-hydroxybutyrate (left bars) and BDO (right bars) production in strains ECKh-401 and ECKh-422, both expressing genes for the complete BDO pathway on plasmids.

[054] Figure 46 shows central metabolic fluxes and associated 95% confidence intervals from metabolic labeling experiments. Values are molar fluxes normalized to a glucose uptake rate of 1 mmol/hr. The result indicates that carbon flux is routed through citrate synthase in the oxidative direction and that most of the carbon enters the BDO pathway rather than completing the TCA cycle.

[055] Figure 47 shows extracellular product formation for strains ECKh-138 and ECKh 422, both expressing the entire BDO pathway on plasmids. The products measured were acetate (Ace), pyruvate (Pyr), 4-hydroxybutyrate (4HB), 1,4-butanediol (BDO), ethanol (EtOH), and other products, which include gamma-butyrolactone (GBL), succinate, and lactate.

[056] Figure 48 shows the sequence (SEQ ID NO:86) of the region following replacement of PEP carboxylase (ppc) by H. influenzae phosphoenolpyruvate carboxykinase (pepck). The pepck coding region is underlined.

[057] Figure 49 shows growth of evolved pepCK strains grown in minimal medium containing 50 mM NaHCO 3

.

[058] Figure 50 shows product formation in strain ECKh-453 expressing P. gingivalis Cat2 and C. beijerinckii Ald on the plasmid pZS*13. The products measured were 1,4 butanediol (BDO), pyruvate, 4-hydroxybutyrate (4HB), acetate, y-butyrolactone (GBL) and ethanol.

[059] Figure 51 shows BDO production of two strains, ECKh-453 and ECKh-432. Both contain the plasmid pZS*13 expressing P. gingivalis Cat2 and C. beierinckii Ald. The cultures were grown under microaerobic conditions, with the vessels punctured with 27 or 18 gauge needles, as indicated.

[060] Figure 52 shows the nucleotide sequence (SEQ ID NO:87) of the genomic DNA of strain ECKh-426 in the region of insertion of a polycistronic DNA fragment containing a promoter, sucCD gene, sucD gene, 4hbd gene and a terminator sequence.

[061] Figure 53 shows the nucleotide sequence (SEQ ID NO:88) of the chromosomal region of strain ECKh-432 in the region of insertion of a polycistronic sequence containing a promoter, sucA gene, C. kluyveri 4hbd gene and a terminator sequence.

[062] Figure 54 shows BDO synthesis from glucose in minimal medium in the ECKh 432 strain having upstream BDO pathway encoding genes intregrated into the chromosome and containing a plasmid harboring downstream BDO pathway genes.

[063] Figure 55 shows a PCR product (SEQ ID NO:89) containing the non phosphotransferase (non-PTS) sucrose utilization genes flanked by regions of homology to the rrnCregion.

[064] Figure 56 shows a schematic diagram of the integrations site in the rrnC operon.

[065] Figure 57 shows average product concentration, normalized to culture OD600, after 48 hours of growth of strain ECKh-432 grown on glucose and strain ECKh-463 grown on sucrose. Both contain the plasmid pZS*13 expressing P. gingivalis Cat2 and C. beijerinckii Ald. The data is for 6 replicate cultures of each strain. The products measured were 1,4-butanediol (BDO), 4-hydroxybutyrate (4HB), y-butyrolactone (GBL), pyruvate (PYR) and acetate (ACE) (left to right bars, respectively).

[066] Figure 58 shows exemplary pathways to 1,4-butanediol from succcinyl-CoA and alpha-ketoglutarate. Abbreviations: A) Succinyl-CoA reductase (aldehyde forming), B) Alpha-ketoglutarate decarboxylase, C) 4-Hydroxybutyrate dehydrogenase, D) 4 Hydroxybutyrate reductase, E) 1,4-Butanediol dehydrogenase.

[067] Figure 59A shows the nucleotide sequence (SEQ ID NO:90) of carboxylic acid reductase from Nocardia iowensis (GNM_720), and Figure 59B shows the encoded amino acid sequence (SEQ ID NO:91).

[068] Figure 60A shows the nucleotide sequence (SEQ ID NO:92) of phosphpantetheine transferase, which was codon optimized, and Figure 60B shows the encoded amino acid sequence (SEQ ID NO:93).

[069] Figure 61 shows a plasmid map of plasmid pZS*-13S-720 72lopt.

[070] Figures 62A and 62B show pathways to 1,4-butanediol from succinate, succcinyl CoA, and alpha-ketoglutarate. Abbreviations: A) Succinyl-CoA reductase (aldehyde forming), B) Alpha-ketoglutarate decarboxylase, C) 4-Hydroxybutyrate dehydrogenase, D) 4 Hydroxybutyrate reductase, E) 1,4-Butanediol dehydrogenase, F) Succinate reductase, G) Succinyl-CoA transferase, H) Succinyl-CoA hydrolase, I) Succinyl-CoA synthetase (or Succinyl-CoA ligase), J) Glutamate dehydrogenase, K) Glutamate transaminase, L) Glutamate decarboxylase, M) 4-aminobutyrate dehydrogenase, N) 4-aminobutyrate transaminase, 0) 4-Hydroxybutyrate kinase, P) Phosphotrans-4-hydroxybutyrylase, Q) 4 Hydroxybutyryl-CoA reductase (aldehyde forming), R) 4-hydroxybutyryl-phosphate reductase, S) Succinyl-CoA reductase (alcohol forming), T) 4-Hydroxybutyryl-CoA transferase, U) 4-Hydroxybutyryl-CoA hydrolase, V) 4-Hydroxybutyryl-CoA synthetase (or 4-Hydroxybutyryl-CoA ligase), W) 4-Hydroxybutyryl-CoA reductase (alcohol forming), X) Alpha-ketoglutarate reductase, Y) 5-Hydroxy-2-oxopentanoate dehydrogenase, Z) 5 Hydroxy-2-oxopentanoate decarboxylase, AA) 5-hydroxy-2-oxopentanoate dehydrogenase (decarboxylation).

[071] Figure 63 shows pathways to putrescine from succinate, succcinyl-CoA, and alpha-ketoglutarate. Abbreviations: A) Succinyl-CoA reductase (aldehyde forming), B) Alpha-ketoglutarate decarboxylase, C) 4-Aminobutyrate reductase, D) Putrescine dehydrogenase , E) Putrescine transaminase, F) Succinate reductase, G) Succinyl-CoA transferase, H) Succinyl-CoA hydrolase, I) Succinyl-CoA synthetase (or Succinyl-CoA ligase), J) Glutamate dehydrogenase, K) Glutamate transaminase, L) Glutamate decarboxylase, M) 4-Aminobutyrate dehydrogenase, N) 4-Aminobutyrate transaminase, 0) Alpha-ketoglutarate reductase, P) 5-Amino-2-oxopentanoate dehydrogenase, Q) 5-Amino-2 oxopentanoate transaminase, R) 5-Amino-2-oxopentanoate decarboxylase, S) Ornithine dehydrogenase, T) Ornithine transaminase, U) Ornithine decarboxylase.

[072] Figure 64A shows the nucleotide sequence (SEQ ID NO:94) of carboxylic acid reductase from Mycobacterium smegmatis mc(2)155 (designated 890), and Figure 64B shows the encoded amino acid sequence (SEQ ID NO:95).

[073] Figure 65A shows the nucleotide sequence (SEQ ID NO:96) of carboxylic acid reductase from Mycobacterium avium subspeciesparatuberculosisK-10 (designated 891), and Figure 65B shows the encoded amino acid sequence (SEQ ID NO:97).

[074] Figure 66A shows the nucleotide sequence (SEQ ID NO:98) of carboxylic acid reductase from Mycobacterium marinum M (designated 892), and Figure 66B shows the encoded amino acid sequence (SEQ ID NO:99).

[075] Figure 67A shows the nucleotide sequence (SEQ ID NO:100) of carboxylic acid reductase designated 891GA, and Figure 67B shows the encoded amino acid sequence (SEQ ID NO:101).

[076] Figure 68 shows the reverse TCA cycle for fixation of CO 2 on carbohydrates as substrates. The enzymatic transformations are carried out by the enzymes as shown.

[077] Figure 69 shows the pathway for the reverse TCA cycle coupled with carbon monoxide dehydrogenase and hydrogenase for the conversion of syngas to acetyl-CoA.

[078] Figure 70 shows Western blots of 10 micrograms ACS90 (lane 1), ACS91 (lane2), Mta98/99 (lanes 3 and 4) cell extracts with size standards (lane 5) and controls of M. thermoacetica CODH (Moth_1202/1203) or Mtr (Moth_1197) proteins (50, 150, 250, 350, 450, 500, 750, 900, and 1000 ng).

[079] Figure 71 shows CO oxidation assay results. Cells (M. thermoacetica or E. coli with the CODH/ACS operon; ACS90 or ACS91 or empty vector: pZA33S) were grown and extracts prepared. Assays were performed at 55oC at various times on the day the extracts were prepared. Reduction of methylviologen was followed at 578 nm over a 120 see time course.

[080] Figures 72A and 72B show exemplary pathways to 1,4-butanediol. Figure 72A shows the pathways for fixation of C02 to acetyl-CoA using the reductive TCA cycle. Figure 72B shows exemplary pathways for the biosynthesis of 1,4-butanediol and 4 hydroxybutyrate from acetyl-CoA; the enzymatic transformations shown are carried out by the following enzymes: 1) Acetoacetyl-CoA thiolase (AtoB), 2) 3-Hydroxybutyryl-CoA dehydrogenase (Hbd), 3) Crotonase (Crt), 4) Crotonyl-CoA hydratase (4-Budh), 5) 4 hydroxybutyryl-CoA reductase (alcohol forming), 6) 4-hydroxybutyryl-CoA reductase (aldehyde forming), 7) 1,4-butanediol dehydrogenase, 8) 4-Hydroxybutyryl-CoA transferase, 4-Hydroxybutyryl-CoA synthetase, 4-Hydroxybutyryl-CoA hydrolase, or Phosphotrans-4 hydroxybutyrylase/4-Hydroxybutyrate kinase, and 9) 4-Hydroxybutyrate reductase.

[081] Figures 73A and 73B show exemplary pathways to 4-hydroxybutyrate and gamma-butyrolactone. Figure 73A shows the pathways for fixation of C02 to acetyl-CoA using the reductive TCA cycle. Figure 73B shows exemplary pathways for the biosynthesis of gamma-butyrolactone and 4-hydroxybutyrate from acetyl-CoA; the enzymatic transformations shown are carried out by the following enzymes: 1) Acetoacetyl-CoA thiolase (AtoB), 2) 3-Hydroxybutyryl-CoA dehydrogenase (Hbd), 3) Crotonase (Crt), 4) Crotonyl-CoA hydratase (4-Budh), 5) 4-Hydroxybutyryl-CoA transferase, hydrolase or synthetase, 6) Phosphotrans-4-hydroxybutyrylase, 7) 4-Hydroxybutyrate kinase, 8) spontaneous or enzyme catalyzed, and 9) spontaneous or enzyme catalyzed.

[082] Figures 74A and 74B show exemplary pathways to 1,4-butanediol and gamma butyrolactone. Figure 74A shows the pathways for fixation of C02 to alpha-ketoglutarate, succinate and succinyl-CoA using the reductive TCA cycle. Figure 74B shows exemplary pathways for the biosynthesis of 1,4-butanediol, 4-hydroxybutyrate and gamma butyrolactone from alpha-ketoglutarate, succinate and succinyl-CoA ; the enzymatic transformations shown are carried out by the following enzymes: A. Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase), B. Succinyl-CoA reductase (aldehyde forming), C. 4-Hydroxybutyrate dehydrogenase, D. 4-Hydroxybutyrate kinase, E. Phosphotrans-4-hydroxybutyrylase, F. 4-Hydroxybutyryl-CoA reductase (aldehyde forming), G. 1,4-butanediol dehydrogenase, H. Succinate reductase, I. Succinyl-CoA reductase (alcohol forming), J. 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase, K. 4-

Hydroxybutyrate reductase, L. 4-Hydroxybutyryl-phosphate reductase, M. 4 Hydroxybutyryl-CoA reductase (alcohol forming), N. Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4 aminobutyrate dehydrogenase and/or 4-aminobutyrate transaminase), 0. 4-Hydroxybutyryl CoA hydrolase or spontaneous.

DETAILED DESCRIPTION OF THE INVENTION

[083] The present invention is directed to the design and production of cells and organisms having biosynthetic production capabilities for 4-hydroxybutanoic acid (4-HB), y butyrolactone, 1,4-butanediol (BDO), 4-hydroxybutanal (4-HBal), 4-hydroxybutyryl-CoA (4 HBCoA) and/or putrescine. The invention, in particular, relates to the design of microbial organisms capable of producing BDO, 4-HBal, 4-HBCoA and/or putrescine by introducing one or more nucleic acids encoding a BDO, 4-HBal, 4-HBCoA and/or putrescine pathway enzyme.

[084] In one embodiment, the invention utilizes in silico stoichiometric models of Escherichiacoli metabolism that identify metabolic designs for biosynthetic production of 4 hydroxybutanoic acid (4-HB), 1,4-butanediol (BDO), 4-HBal, 4-HBCoA and/or putrescine. The results described herein indicate that metabolic pathways can be designed and recombinantly engineered to achieve the biosynthesis of 4-HBal, 4-HBCoA or 4-HB and downstream products such as 1,4-butanediol or putrescine in Escherichiacoli and other cells or organisms. Biosynthetic production of 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine, for example, for the in silico designs can be confirmed by construction of strains having the designed metabolic genotype. These metabolically engineered cells or organisms also can be subjected to adaptive evolution to further augment 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine biosynthesis, including under conditions approaching theoretical maximum growth.

[085] In certain embodiments, the 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine biosynthesis characteristics of the designed strains make them genetically stable and particularly useful in continuous bioprocesses. Separate strain design strategies were identified with incorporation of different non-native or heterologous reaction capabilities into E. coli or other host organisms leading to 4-HB and 1,4-butanediol producing metabolic pathways from either CoA-independent succinic semialdehyde dehydrogenase or succinate reductase, succinyl-CoA synthetase and CoA-dependent succinic semialdehyde dehydrogenase, or glutamate:succinic semialdehyde transaminase. In silico metabolic designs were identified that resulted in the biosynthesis of 4-HB in both E.coli and yeast species from each of these metabolic pathways. The 1,4-butanediol intermediate y butyrolactone can be generated in culture by spontaneous cyclization under conditions at pH<7.5, particularly under acidic conditions, such as below pH 5.5, for example, pH<7, pH<6.5, pH<6, and particularly at pH<5.5 or lower.

[086] Strains identified via the computational component of the platform can be put into actual production by genetically engineering any of the predicted metabolic alterations which lead to the biosynthetic production of 4-HB, 1,4-butanediol or other intermediate and/or downstream products. In yet a further embodiment, strains exhibiting biosynthetic production of these compounds can be further subjected to adaptive evolution to further augment product biosynthesis. The levels of product biosynthesis yield following adaptive evolution also can be predicted by the computational component of the system.

[087] In other specific embodiments, microbial organisms were constructed to express a 4-HB biosynthetic pathway encoding the enzymatic steps from succinate to 4-HB and to 4 HB-CoA. Co-expression of succinate coenzyme A transferase, CoA-dependent succinic semialdehyde dehydrogenase, NAD-dependent 4-hydroxybutyrate dehydrogenase and 4 hydroxybutyrate coenzyme A transferase in a host microbial organism resulted in significant production of 4-HB compared to host microbial organisms lacking a 4-HB biosynthetic pathway. In a further specific embodiment, 4-HB-producing microbial organisms were generated that utilized a-ketoglutarate as a substrate by introducing nucleic acids encoding a ketoglutarate decarboxylase and NAD-dependent 4-hydroxybutyrate dehydrogenase.

[088] In another specific embodiment, microbial organisms containing a 1,4-butanediol (BDO) biosynthetic pathway were constructed that biosynthesized BDO when cultured in the presence of 4-HB. The BDO biosynthetic pathway consisted of a nucleic acid encoding either a multifunctional aldehyde/alcohol dehydrogenase or nucleic acids encoding an aldehyde dehydrogenawse and an alcohol dehydrogenase. To support growth on 4-HB substrates, these BDO-producing microbial organisms also expressed 4-hydroxybutyrate CoA transferase or 4-butyrate kinase in conjunction with phosphotranshydroxybutyrlase. In yet a further specific embodiment, microbial organisms were generated that synthesized BDO through exogenous expression of nucleic acids encoding a functional 4-HB biosynthetic pathway and a functional BDO biosynthetic pathway. The 4-HB biosynthetic pathway consisted of succinate coenzyme A transferase, CoA-dependent succinic semialdehyde dehydrogenase, NAD-dependent 4-hydroxybutyrate dehydrogenase and 4-hydroxybutyrate coenzyme A transferase. The BDO pathway consisted of a multifunctional aldehyde/alcohol dehydrogenase. Further described herein are additional pathways for production of BDO (see Figures 8-13).

[089] In a further embodiment, described herein is the cloning and expression of a carboxylic acid reductase enzyme that functions in a 4-hydroxybutanal, 4-hydroxybutyryl CoA or 1,4-butanediol metabolic pathway. Advantages of employing a carboxylic acid reductase as opposed to an acyl-CoA reductase to form 4-hydroxybutyraldehyde (4 hydroxybutanal) include lower ethanol and GBL byproduct formation accompanying the production of BDO. Also disclosed herein is the application of carboxylic acid reductase as part of additional numerous pathways to produce 1,4-butanediol and putrescine from the tricarboxylic acid (TCA) cycle metabolites, for example, succinate, succinyl-CoA, and/or alpha-ketoglutarate.

[090] As used herein, the term "non-naturally occurring" when used in reference to a microbial organism or microorganism of the invention is intended to mean that the microbial organism has at least one genetic alteration not normally found in a naturally occurring strain of the referenced species, including wild-type strains of the referenced species. Genetic alterations include, for example, modifications introducing expressible nucleic acids encoding metabolic polypeptides, other nucleic acid additions, nucleic acid deletions and/or other functional disruption of the microbial organism's genetic material. Such modifications include, for example, coding regions and functional fragments thereof, for heterologous, homologous or both heterologous and homologous polypeptides for the referenced species. Additional modifications include, for example, non-coding regulatory regions in which the modifications alter expression of a gene or operon. Exemplary metabolic polypeptides include enzymes or proteins within a biosynthetic pathway for a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine family of compounds.

[091] A metabolic modification refers to a biochemical reaction that is altered from its naturally occurring state. Therefore, non-naturally occurring microorganisms can have genetic modifications to nucleic acids encoding metabolic polypeptides or, functional fragments thereof. Exemplary metabolic modifications are disclosed herein.

[092] As used herein, the term "isolated" when used in reference to a microbial organism is intended to mean an organism that is substantially free of at least one component as the referenced microbial organism is found in nature. The term includes a microbial organism that is removed from some or all components as it is found in its natural environment. The term also includes a microbial organism that is removed from some or all components as the microbial organism is found in non-naturally occurring environments. Therefore, an isolated microbial organism is partly or completely separated from other substances as it is found in nature or as it is grown, stored or subsisted in non-naturally occurring environments. Specific examples of isolated microbial organisms include partially pure microbes, substantially pure microbes and microbes cultured in a medium that is non naturally occurring.

[093] As used herein, the terms "microbial," "microbial organism" or "microorganism" are intended to mean any organism that exists as a microscopic cell that is included within the domains of archaea, bacteria or eukarya. Therefore, the term is intended to encompass prokaryotic or eukaryotic cells or organisms having a microscopic size and includes bacteria, archaea and eubacteria of all species as well as eukaryotic microorganisms such as yeast and fungi. The term also includes cell cultures of any species that can be cultured for the production of a biochemical.

[094] As used herein, the term "4-hydroxybutanoic acid" is intended to mean a 4 hydroxy derivative of butyric acid having the chemical formulaC 4H30 3 and a molecular mass of 104.11 g/mol (126.09 g/mol for its sodium salt). The chemical compound 4 hydroxybutanoic acid also is known in the art as 4-HB, 4-hydroxybutyrate, gamma hydroxybutyric acid or GHB. The term as it is used herein is intended to include any of the compound's various salt forms and include, for example, 4-hydroxybutanoate and 4 hydroxybutyrate. Specific examples of salt forms for 4-HB include sodium 4-HB and potassium 4-HB. Therefore, the terms 4-hydroxybutanoic acid, 4-HB, 4-hydroxybutyrate, 4 hydroxybutanoate, gamma-hydroxybutyric acid and GHB as well as other art recognized names are used synonymously herein.

[095] As used herein, the term "monomeric" when used in reference to 4-HB is intended to mean 4-HB in a non-polymeric or underivatized form. Specific examples of polymeric 4 HB include poly-4-hydroxybutanoic acid and copolymers of, for example, 4-HB and 3-HB.

A specific example of a derivatized form of 4-HB is 4-HB-CoA. Other polymeric 4-HB forms and other derivatized forms of 4-HB also are known in the art.

[096] As used herein, the term "y-butyrolactone" is intended to mean a lactone having the chemical formula C 4 H 60 2 and a molecular mass of 86.089 g/mol. The chemical compound y-butyrolactone also is know in the art as GBL, butyrolactone, 1,4-lactone, 4 butyrolactone, 4-hydroxybutyric acid lactone, and gamma-hydroxybutyric acid lactone. The term as it is used herein is intended to include any of the compound's various salt forms.

[097] As used herein, the term "1,4-butanediol" is intended to mean an alcohol derivative of the alkane butane, carrying two hydroxyl groups which has the chemical formula C4 H 10 0 2 and a molecular mass of 90.12 g/mol. The chemical compound 1,4 butanediol also is known in the art as BDO and is a chemical intermediate or precursor for a family of compounds referred to herein as BDO family of compounds.

[098] As used herein, the term "4-hydroxybutanal" is intended to mean an aledehyde having the chemical formula C 4 H302 and a molecular mass of 88.10512 g/mol. The chemical compound 4-hydroxybutanal (4-HBal) is also known in the art as 4-hydroxybutyraldehyde.

[099] As used herein, the term "putrescine" is intended to mean a diamine having the chemical formula C 4 H 12 N 2 and a molecular mass of 88.15148 g/mol. The chemical compound putrescine is also known in the art as 1,4-butanediamine, 1,4-diaminobutane, butylenediamine, tetramethylenediamine, tetramethyldiamine, and 1,4-butylenediamine.

[0100] As used herein, the term "tetrahydrofuran" is intended to mean a heterocyclic organic compound corresponding to the fully hydrogenated analog of the aromatic compound furan which has the chemical formula C 4 HsO and a molecular mass of 72.11 g/mol. The chemical compound tetrahydrofuran also is known in the art as THF, tetrahydrofuran, 1,4 epoxybutane, butylene oxide, cyclotetramethylene oxide, oxacyclopentane, diethylene oxide, oxolane, furanidine, hydrofuran, tetra-methylene oxide. The term as it is used herein is intended to include any of the compound's various salt forms.

[0101] As used herein, the term "CoA" or "coenzyme A" is intended to mean an organic cofactor or prosthetic group (nonprotein portion of an enzyme) whose presence is required for the activity of many enzymes (the apoenzyme) to form an active enzyme system.

Coenzyme A functions in certain condensing enzymes, acts in acetyl or other acyl group transfer and in fatty acid synthesis and oxidation, pyruvate oxidation and in other acetylation.

[0102] As used herein, the term "substantially anaerobic" when used in reference to a culture or growth condition is intended to mean that the amount of oxygen is less than about % of saturation for dissolved oxygen in liquid media. The term also is intended to include sealed chambers of liquid or solid medium maintained with an atmosphere of less than about 1% oxygen.

[0103] The non-naturally occurring microbal organisms of the invention can contain stable genetic alterations, which refers to microorganisms that can be cultured for greater than five generations without loss of the alteration. Generally, stable genetic alterations include modifications that persist greater than 10 generations, particularly stable modifications will persist more than about 25 generations, and more particularly, stable genetic modifications will be greater than 50 generations, including indefinitely.

[0104] Those skilled in the art will understand that the genetic alterations, including metabolic modifications exemplified herein are described with reference to a suitable source or host organism such as E. coli, yeast, or other organisms disclosed herein and their corresponding metabolic reactions or a suitable source organism for desired genetic material such as genes encoding enzymes for their corresponding metabolic reactions for a desired metabolic pathway. However, given the complete genome sequencing of a wide variety of organisms and the high level of skill in the area of genomics, those skilled in the art will readily be able to apply the teachings and guidance provided herein to essentially all other organisms. For example, the E. coli metabolic alterations exemplified herein can readily be applied to other species by incorporating the same or analogous encoding nucleic acid from species other than the referenced species. Such genetic alterations include, for example, genetic alterations of species homologs, in general, and in particular, orthologs, paralogs or nonorthologous gene displacements.

[0105] An ortholog is a gene or genes that are related by vertical descent and are responsible for substantially the same or identical functions in different organisms. For example, mouse epoxide hydrolase and human epoxide hydrolase can be considered orthologs for the biological function of hydrolysis of epoxides. Genes are related by vertical descent when, for example, they share sequence similarity of sufficient amount to indicate they are homologous, or related by evolution from a common ancestor. Genes can also be considered orthologs if they share three-dimensional structure but not necessarily sequence similarity, of a sufficient amount to indicate that they have evolved from a common ancestor to the extent that the primary sequence similarity is not identifiable. Genes that are orthologous can encode proteins with sequence similarity of about 25% to 100% amino acid sequence identity. Genes encoding proteins sharing an amino acid similarity less that 25% can also be considered to have arisen by vertical descent if their three-dimensional structure also shows similarities. Members of the serine protease family of enzymes, including tissue plasminogen activator and elastase, are considered to have arisen by vertical descent from a common ancestor.

[0106] Orthologs include genes or their encoded gene products that through, for example, evolution, have diverged in structure or overall activity. For example, where one species encodes a gene product exhibiting two functions and where such functions have been separated into distinct genes in a second species, the three genes and their corresponding products are considered to be orthologs. For the production, including growth-coupled production, of a biochemical product, those skilled in the art will understand that the orthologous gene harboring the metabolic activity to be introduced or disrupted is to be chosen for construction of the non-naturally occurring microorganism. An example of orthologs exhibiting separable activities is where distinct activities have been separated into distinct gene products between two or more species or within a single species. A specific example is the separation of elastase proteolysis and plasminogen proteolysis, two types of serine protease activity, into distinct molecules as plasminogen activator and elastase. A second example is the separation of mycoplasma 5'-3' exonuclease and Drosophila DNA polymerase III activity. The DNA polymerase from the first species can be considered an ortholog to either or both of the exonuclease or the polymerase from the second species and vice versa.

[0107] In contrast, paralogs are homologs related by, for example, duplication followed by evolutionary divergence and have similar or common, but not identical functions. Paralogs can originate or derive from, for example, the same species or from a different species. For example, microsomal epoxide hydrolase (epoxide hydrolase I) and soluble epoxide hydrolase (epoxide hydrolase II) can be considered paralogs because they represent two distinct enzymes, co-evolved from a common ancestor, that catalyze distinct reactions and have distinct functions in the same species. Paralogs are proteins from the same species with significant sequence similarity to each other suggesting that they are homologous, or related through co-evolution from a common ancestor. Groups of paralogous protein families include HipA homologs, luciferase genes, peptidases, and others.

[0108] A nonorthologous gene displacement is a nonorthologous gene from one species that can substitute for a referenced gene function in a different species. Substitution includes, for example, being able to perform substantially the same or a similar function in the species of origin compared to the referenced function in the different species. Although generally, a nonorthologous gene displacement will be identifiable as structurally related to a known gene encoding the referenced function, less structurally related but functionally similar genes and their corresponding gene products nevertheless will still fall within the meaning of the term as it is used herein. Functional similarity requires, for example, at least some structural similarity in the active site or binding region of a nonorthologous gene product compared to a gene encoding the function sought to be substituted. Therefore, a nonorthologous gene includes, for example, a paralog or an unrelated gene.

[0109] Therefore, in identifying and constructing the non-naturally occurring microbial organisms of the invention having 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine biosynthetic capability, those skilled in the art will understand with applying the teaching and guidance provided herein to a particular species that the identification of metabolic modifications can include identification and inclusion or inactivation of orthologs. To the extent that paralogs and/or nonorthologous gene displacements are present in the referenced microorganism that encode an enzyme catalyzing a similar or substantially similar metabolic reaction, those skilled in the art also can utilize these evolutionally related genes.

[0110] Orthologs, paralogs and nonorthologous gene displacements can be determined by methods well known to those skilled in the art. For example, inspection of nucleic acid or amino acid sequences for two polypeptides will reveal sequence identity and similarities between the compared sequences. Based on such similarities, one skilled in the art can determine if the similarity is sufficiently high to indicate the proteins are related through evolution from a common ancestor. Algorithms well known to those skilled in the art, such as Align, BLAST, Clustal W and others compare and determine a raw sequence similarity or identity, and also determine the presence or significance of gaps in the sequence which can be assigned a weight or score. Such algorithms also are known in the art and are similarly applicable for determining nucleotide sequence similarity or identity. Parameters for sufficient similarity to determine relatedness are computed based on well known methods for calculating statistical similarity, or the chance of finding a similar match in a random polypeptide, and the significance of the match determined. A computer comparison of two or more sequences can, if desired, also be optimized visually by those skilled in the art. Related gene products or proteins can be expected to have a high similarity, for example, 25% to 100% sequence identity. Proteins that are unrelated can have an identity which is essentially the same as would be expected to occur by chance, if a database of sufficient size is scanned (about 5%). Sequences between 5% and 24% may or may not represent sufficient homology to conclude that the compared sequences are related. Additional statistical analysis to determine the significance of such matches given the size of the data set can be carried out to determine the relevance of these sequences.

[0111] Exemplary parameters for determining relatedness of two or more sequences using the BLAST algorithm, for example, can be as set forth below. Briefly, amino acid sequence alignments can be performed using BLASTP version 2.0.8 (Jan-05-1999) and the following parameters: Matrix: 0 BLOSUM62; gap open: 11; gap extension: 1; x_dropoff: 50; expect: 10.0; wordsize: 3; filter: on. Nucleic acid sequence alignments can be performed using BLASTN version 2.0.6 (Sept-16-1998) and the following parameters: Match: 1; mismatch: -2; gap open: 5; gap extension: 2; x-dropoff: 50; expect: 10.0; wordsize: 11; filter: off. Those skilled in the art will know what modifications can be made to the above parameters to either increase or decrease the stringency of the comparison, for example, and determine the relatedness of two or more sequences.

[0112] Disclosed herein are non-naturally occurring microbial biocatalyst or microbial organisms including a microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway that includes at least one exogenous nucleic acid encoding 4 hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate:succinic semialdehyde transaminase, alpha-ketoglutarate decarboxylase, or glutamate decarboxylase, wherein the exogenous nucleic acid is expressed in sufficient amounts to produce monomeric 4-hydroxybutanoic acid (4-HB). 4-hydroxybutanoate dehydrogenase is also referred to as 4-hydroxybutyrate dehydrogenase or 4-HB dehydrogenase. Succinyl-CoA synthetase is also referred to as succinyl-CoA synthase or succinyl-CoA ligase.

[0113] Also disclosed herein is a non-naturally occurring microbial biocatalyst or microbial organism including a microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway having at least one exogenous nucleic acid encoding 4 hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, or a-ketoglutarate decarboxylase, wherein the exogenous nucleic acid is expressed in sufficient amounts to produce monomeric 4-hydroxybutanoic acid (4-HB).

[0114] The non-naturally occurring microbial biocatalysts or microbial organisms can include microbial organisms that employ combinations of metabolic reactions for biosynthetically producing the compounds of the invention. The biosynthesized compounds can be produced intracellularly and/or secreted into the culture medium. Exemplary compounds produced by the non-naturally occurring microorganisms include, for example, 4 hydroxybutanoic acid, 1,4-butanediol and y-butyrolactone.

[0115] In one embodiment, a non-naturally occurring microbial organism is engineered to produce 4-HB. This compound is one useful entry point into the 1,4-butanediol family of compounds. The biochemical reactions for formation of 4-HB from succinate, from succinate through succinyl-CoA or from a-ketoglutarate are shown in steps 1-8 of Figure 1.

[0116] It is understood that any combination of appropriate enzymes of a BDO, 4-HBal, 4-HBCoA and/or putrescine pathway can be used so long as conversion from a starting component to the BDO, 4-HBal, 4-HBCoA and/or putrescine product is achieved. Thus, it is understood that any of the metabolic pathways disclosed herein can be utilized and that it is well understood to those skilled in the art how to select appropriate enzymes to achieve a desired pathway, as disclosed herein.

[0117] In another embodiment, disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, or 4-hydroxybutyryl-

CoA dehydrogenase (see Example VII Table 17). The BDO pathway further can comprise 4 hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4 butanediol dehydrogenase.

[0118] It is understood by those skilled in the art that various combinations of the pathways can be utilized, as disclosed herein. For example, in a non-naturally occurring microbial organism, the nucleic acids can encode 4-aminobutyrate CoA transferase, 4 aminobutyryl-CoA hydrolase, or 4-aminobutyrate-CoA ligase; 4-aminobutyryl-CoA oxidoreductase (deaminating) or 4-aminobutyryl-CoA transaminase; and 4-hydroxybutyryl CoA dehydrogenase. Other exemplary combinations are specifically describe below and further can be found in Figures 8-13. For example, the BDO pathway can further comprise 4 hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4 butanediol dehydrogenase.

[0119] Additionally disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4 aminobutyryl-CoA reductase, 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase (see Example VII and Table 18), and can further comprise 1,4-butanediol dehydrogenase. For example, the exogenous nucleic acids can encode 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, or 4-aminobutyrate-CoA ligase; 4-aminobutyryl-CoA reductase (alcohol forming); and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase. In addition, the nucleic acids can encode. 4-aminobutyrate CoA transferase, 4-aminobutyryl CoA hydrolase, or 4-aminobutyrate-CoA ligase; 4-aminobutyryl-CoA reductase; 4 aminobutan-1-ol dehydrogenase; and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4 aminobutan-1-ol transaminase.

[0120] Also disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase

(deaminating), 4-aminobutan-1-ol transaminase, [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4-aminobutanolyl)oxy]phosphonic acid transaminase, 4 hydroxybutyryl-phosphate dehydrogenase, or 4-hydroxybutyraldehyde dehydrogenase (phosphorylating) (see Example VII and Table 19). For example, the exogenous nucleic acids can encode 4-aminobutyrate kinase; 4-aminobutyraldehyde dehydrogenase (phosphorylating); 4-aminobutan-1-ol dehydrogenase; and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase. Alternatively, the exogenous nucleic acids can encode 4-aminobutyrate kinase; [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating) or [(4-aminobutanolyl)oxy]phosphonic acid transaminase; 4 hydroxybutyryl-phosphate dehydrogenase; and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating).

[0121] Additionally disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising alpha-ketoglutarate 5-kinase, 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha-ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2-oxopentanoic acid decarboxylase, or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) (see Example VIII and Table 20). The BDO pathway can further comprise 4-hydroxybutyryl CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase. For example, the exogenous nucleic acids can encode alpha-ketoglutarate 5 kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5 dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid decarboxylase. Alternatively, the exogenous nucleic acids can encode alpha-ketoglutarate 5-kinase; 2,5 dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). Alternatively, the exogenous nucleic acids can encode alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid decarboxylase. In another embodiment, the exogenous nucleic acids can encode alpha ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). Alternatively, the exogenous nucleic acids can encode alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5-hydroxy-2-oxopentanoic acid decarboxylase. In yet another embodiment, the exogenous nucleic acids can encode alpha-ketoglutarate CoA transferase, alpha ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation).

[0122] Further disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5-kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5-hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) (see Example IX and Table 21). For example, the exogenous nucleic acids can encode glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl-CoA reductase; glutamate-5-semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2 oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). Alternatively, the exogenous nucleic acids can encode glutamate 5 kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); glutamate-5 semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). In still another embodiment, the exogenous nucleic acids can encode glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl-CoA reductase (alcohol forming); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5 hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). In yet another embodiment, the exogenous nucleic acids can encode glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2 oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation).

[0123] Also disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl-CoA A-isomerase, or 4-hydroxybutyryl-CoA dehydratase (see Example X and Table 22). For example, the exogenous nucleic acids can encode 3 hydroxybutyryl-CoA dehydrogenase; 3-hydroxybutyryl-CoA dehydratase; vinylacetyl-CoA A-isomerase; and 4-hydroxybutyryl-CoA dehydratase.

[0124] Further disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4 hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2 enoyl-CoA ligase, 4-hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4 hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase (see Example XI and Table 23). For example, the exogenous nucleic acids can encode homoserine deaminase; 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2 enoyl-CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase; 4-hydroxybut-2-enoyl-CoA reductase. Alternatively, the exogenous nucleic acids can encode homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4-hydroxybut-2-enoyl-CoA reductase. In a further embodiment, the exogenous nucleic acids can encode homoserine deaminase; 4-hydroxybut-2-enoate reductase; and 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4 hydroxybutyryl-CoA ligase. Alternatively, the exogenous nucleic acids can encode homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4-hydroxybut-2-enoyl-CoA reductase.

[0125] Further disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BOD, the BDO pathway comprising succinyl-CoA reductase (alcohol forming), 4 hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, 4-hydroxybutanal dehydrogenase (phosphorylating) (see Table 15). Such a BDO pathway can further comprise succinyl-CoA reductase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

[0126] Additionally disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising glutamate dehydrogenase, glutamate transaminase, 4 aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, 4 hydroxybutanal dehydrogenase (phosphorylating)(see Table 16). Such a BDO pathway can further comprise alpha-ketoglutarate decarboxylase, 4-hydroxybutyrate dehydrogenase, 4 hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4 hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

[0127] The pathways described above are merely exemplary. One skilled in the art can readily select appropriate pathways from those disclosed herein to obtain a suitable BDO pathway or other metabolic pathway, as desired.

[0128] The invention provides genetically modified organisms that allow improved production of a desired product such as BDO by increasing the product or decreasing undesirable byproducts. As disclosed herein, the invention provides a non-naturally occurring microbial organism, comprising a microbial organism having a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO. In one embodiment, the microbial organism is genetically modified to express exogenous succinyl-CoA synthetase (see

Example XII). For example, the succinyl-CoA synthetase can be encoded by an Escherichia coli sucCD genes.

[0129] In another embodiment, the microbial organism is genetically modified to express exogenous alpha-ketoglutarate decarboxylase (see Example XIII). For example, the alpha ketoglutarate decarboxylase can be encoded by the Mycobacterium bovis sucA gene. In still another embodiment, the microbial organism is genetically modified to express exogenous succinate semialdehyde dehydrogenase and 4-hydroxybutyrate dehydrogenase and optionally 4-hydroxybutyryl-CoA/acetyl-CoA transferase (see Example XIII). For example, the succinate semialdehyde dehydrogenase (CoA-dependent), 4-hydroxybutyrate dehydrogenase and 4-hydroxybutyryl-CoA/acetyl-CoA transferase can be encoded by Porphyromonas gingivalis W83 genes. In an additional embodiment, the microbial organism is genetically modified to express exogenous butyrate kinase and phosphotransbutyrylase (see Example XIII). For example, the butyrate kinase and phosphotransbutyrylase can be encoded by Clostridiumacetobutilicum buki andptb genes.

[0130] In yet another embodiment, the microbial organism is genetically modified to express exogenous 4-hydroxybutyryl-CoA reductase (see Example XIII). For example, the 4-hydroxybutyryl-CoA reductase can be encoded by Clostridium beijerinckii ald gene. Additionally, in an embodiment of the invention, the microbial organism is genetically modified to express exogenous 4-hydroxybutanal reductase (see Example XIII). For example, the 4-hydroxybutanal reductase can be encoded by Geobacillus thermoglucosidasiusadh1 gene. In another embodiment, the microbial organism is genetically modified to express exogenous pyruvate dehydrogenase subunits (see Example XIV). For example, the exogenous pyruvate dehydrogenase can be NADH insensitive. The pyruvate dehydrogenase subunit can be encoded by the Klebsiellapneumonia lpdA gene. In a particular embodiment, the pyruvate dehydrogenase subunit genes of the microbial organism can be under the control of a pyruvate formate lyase promoter.

[0131] In still another embodiment, the microbial organism is genetically modified to disrupt a gene encoding an aerobic respiratory control regulatory system (see Example XV). For example, the disruption can be of the arcA gene. Such an organism can further comprise disruption of a gene encoding malate dehydrogenase. In a further embodiment, the microbial organism is genetically modified to express an exogenous NADH insensitive citrate synthase(see Example XV). For example, the NADH insensitive citrate synthase can be encoded by gltA, such as an R163L mutant of gltA. Instill another embodiment, the microbial organism is genetically modified to express exogenous phosphoenolpyruvate carboxykinase (see Example XVI). For example, the phosphoenolpyruvate carboxykinase can be encoded by an Haemophilus influenza phosphoenolpyruvate carboxykinase gene.

[0132] It is understood that any of a number of genetic modifications, as disclosed herein, can be used alone or in various combinations of one or more of the genetic modifications disclosed herein to increase the production of BDO in a BDO producing microbial organism. In a particular embodiment, the microbial organism can be genetically modified to incorporate any and up to all of the genetic modifications that lead to increased production of BDO. In a particular embodiment, the microbial organism containing a BDO pathway can be genetically modified to express exogenous succinyl-CoA synthetase; to express exogenous alpha-ketoglutarate decarboxylase; to express exogenous succinate semialdehyde dehydrogenase and 4-hydroxybutyrate dehydrogenase and optionally 4-hydroxybutyryl CoA/acetyl-CoA transferase; to express exogenous butyrate kinase and phosphotransbutyrylase; to express exogenous 4-hydroxybutyryl-CoA reductase; and to express exogenous 4-hydroxybutanal reductase; to express exogenous pyruvate dehydrogenase; to disrupt a gene encoding an aerobic respiratory control regulatory system; to express an exogenous NADH insensitive citrate synthase; and to express exogenous phosphoenolpyruvate carboxykinase. Such strains for improved production are described in Examples XII-XIX. It is thus understood that, in addition to the modifications described above, such strains can additionally include other modifications disclosed herein. Such modifications include, but are not limited to, deletion of endogenous lactate dehydrogenase (ldhA), alcohol dehydrogenase (adhE), and/or pyruvate formate lyase (pflB)(see Examples XII-XIX and Table 28).

[0133] Additionally provided is a microbial organism in which one or more genes encoding the exogenously expressed enzymes are integrated into the fimD locus of the host organism (see Example XVII). For example, one or more genes encoding a BDO pathway enzyme can be integrated into the fimD locus for increased production of BDO. Further provided is a microbial organism expressing a non-phosphotransferase sucrose uptake system that increases production of BDO.

[0134] Although the genetically modified microbial organisms disclosed herein are exemplified with microbial organisms containing particular BDO pathway enzymes, it is understood that such modifications can be incorporated into any microbial organism having a BDO, 4-HBal, 4-HBCoA and/or putrescine pathway suitable for enhanced production in the presence of the genetic modifications. The microbial organisms of the invention can thus have any of the BDO, 4-HBal, 4-HBCoA and/or putrescine pathways disclosed herein. For example, the BDO pathway can comprise 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-butyrate kinase, phosphotransbutyrylase, alpha-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or an aldehyde/alcohol dehydrogenase (see Figure 1). Alternatively, the BDO pathway can comprise 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, or 4-hydroxybutyryl-CoA dehydrogenase (see Table 17). Such a BDO pathway can further comprise 4-hydroxybutyryl CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase

[0135] Additionally, the BDO pathway can comprise 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4-aminobutan-1-ol dehydrogenase, 4 aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase (see Table 18). Also, the BDO pathway can comprise 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4-aminobutan-1-ol transaminase, [(4 aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4 aminobutanolyl)oxy]phosphonic acid transaminase, 4-hydroxybutyryl-phosphate dehydrogenase, or 4-hydroxybutyraldehyde dehydrogenase (phosphorylating) (see Table 19). Such a pathway can further comprise 1,4-butanediol dehydrogenase.

[0136] The BDO pathway can also comprise alpha-ketoglutarate 5-kinase, 2,5 dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2 oxopentanoic acid decarboxylase, or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation)(see Table 20). Such a BDO pathway can further comprise 4- hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4 butanediol dehydrogenase. Additionally, the BDO pathway can comprise glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5-kinase, glutamate-5 semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5 semialdehyde reductase, glutamyl-CoA reductase (alcohol forming), 2-amino-5 hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5-hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation)(see Table 21). Such a BDO pathway can further comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4 butanediol dehydrogenase.

[0137] Additionally, the BDO pathway can comprise 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl-CoA A-isomerase, or 4 hydroxybutyryl-CoA dehydratase (see Table 22). Also, the BDO pathway can comprise homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase, 4 hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase (see Table 23). Such a BDO pathway can further comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase.

[0138] The BDO pathway can additionally comprise succinyl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4 hydroxybutanal dehydrogenase (phosphorylating) (see Table 15). Such a pathway can further comprise succinyl-CoA reductase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase. Also, the BDO pathway can comprise glutamate dehydrogenase, 4 aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4 hydroxybutanal dehydrogenase (phosphorylating)(see Table 16). Such a BDO pathway can further comprise alpha-ketoglutarate decarboxylase, 4-hydroxybutyrate dehydrogenase, 4 hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4- hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

[0139] The invention additionally provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4 hydroxybutanal, the 4-hydroxybutanal pathway comprising succinyl-CoA reductase (aldehyde forming); 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (see Figure 58, steps A-C-D). The invention also provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate decarboxylase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (Figure 58, steps B-C-D).

[0140] The invention further provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4 hydroxybutanal, the 4-hydroxybutanal pathway comprising succinate reductase; 4 hydroxybutyrate dehydrogenase, and 4-hydroxybutyrate reductase (see Figure 62, steps F-C D). In yet another embodiment, the invention provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase or glutamate transaminase and glutamate decarboxylase and 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4 hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (see Figure 62, steps B or ((J or K)-L-(M or N))-C-D).

[0141] The invention also provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4 hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate reductase; 5 hydroxy-2-oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate decarboxylase (see Figure 62, steps X-Y-Z). In yet another embodiment, the invention provides a non- naturally occurring microbial organism, comprising a 4-hydroxybutyryl-CoA pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutyryl-CoA pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutyryl-CoA, the 4 hydroxybutyryl-CoA pathway comprising alpha-ketoglutarate reductase; 5-hydroxy-2 oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate dehydrogenase (decarboxylation) (see Figure 62, steps X-Y-AA).

[0142] The invention additionally provides a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising succinate reductase; 4-aminobutyrate dehydrogenase or 4 aminobutyrate transaminase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps F-M/N-C-D/E). In still another embodiment, the invention provides a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate decarboxylase; 4-aminobutyrate dehydrogenase or 4 aminobutyrate transaminase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps B-M/N-C-D/E). The invention additionally provides a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising glutamate dehydrogenase or glutamate transaminase; glutamate decarboxylase; 4 aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps J/K-L-C-D/E).

[0143] The invention provides in another embodiment a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate reductase; 5 amino-2-oxopentanoate dehydrogenase or 5-amino-2-oxopentanoate transaminase; 5-amino 2-oxopentanoate decarboxylase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps O-P/Q-R-D/E). Also provided is a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate reductase; 5-amino-2 oxopentanoate dehydrogenase or 5-amino-2-oxopentanoate transaminase; ornithine dehydrogenase or ornithine transaminase; and ornithine decarboxylase (see Figure 63, steps O-P/Q-S/T-U).

[0144] In an additional embodiment, the invention provides a non-naturally occurring microbial organism having a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, wherein the non-naturally occurring microbial organism comprises at least one exogenous nucleic acid encoding an enzyme or protein that converts a substrate of any of the pathways disclosed herein (see, for example, the Examples and Figures 1, 8-13, 58, 62, 63 and 72-74). In an exmemplary embodiment for producing BDO, the microbial organism can convert a substrate to a product selected from the group consisting of succinate to succinyl-CoA; succinyl-CoA to succinic semialdehyde; succinic semialdehyde to 4-hydroxybutrate; 4-hydroxybutyrate to 4-hydroxybutyryl-phosphate; 4-hydroxybutyryl-phosphate to 4-hydroxtbutyryl-CoA; 4 hydroxybutyryl-CoA to 4-hydroxybutanal; and 4-hydroxybutanal to 1,4-butanediol. In a pathway for producing 4-HBal, a microbial organism can convert, for example, succinate to succinic semialdehyde; succinic semialdehyde to 4-hydroxybutyrate; and 4-hydroxybutyrate to 4-hydroxybutanal. Such an organism can additionally include activity to convert 4 hydroxybutanal to 1,4-butanediol in order to produce BDO. Yet another pathway for producing 4-HBal can be, for example, alpha-ketoglutarate to succinic semialdehyde; succinic semialdehyde to 4-hydroxybutyrate; and 4-hydroxybutyrate to 4-hydroxybutanal. An alternative pathway for producing 4-HBal can be, for example, alpha-ketoglutarate to 2,5 dioxopentanoic acid; 2,5-dioxopentanoic acid to 5-hydroxy-2-oxopentanooic acid; and 5 hydroxy-2-oxopentanoic acid to 4-hydroxybutanal. An exemplary 4-hydroxybutyryl-CoA pathway can be, for example, alpha-ketoglutarate to 2,5-dioxopentanoic acid; 2,5 dioxopentanoic acid to 5-hydroxy-2-oxopentanoic acid; and 5-hydroxy-2-oxopentanoic acid to 4-hydroxybutyryl-CoA. An exemplary putrescine pathway can be, for example, succinate to succinyl-CoA; succinyl-CoA to succinic semialdehyde; succinic semialdehyde to 4 aminobutyrate; 4-aminobutyrate to 4-aminobutanal; and 4-aminobutanal to putrescine. An alternative putrescine pathway can be, for example, succinate to succinic semialdehyde; succinic semialdehyde to 4-aminobutyrate; 4-aminobutyrate to 4-aminobutanal; and 4 aminobutanal to putrescine. One skilled in the art will understand that these are merely exemplary and that any of the substrate-product pairs disclosed herein suitable to produce a desired product and for which an appropriate activity is available for the conversion can be readily determined by one skilled in the art based on the teachings herein. Thus, the invention provides a non-naturally occurring microbial organism containing at least one exogenous nucleic acid encoding an enzyme or protein, where the enzyme or protein converts the substrates and products of a pathway (see Figures 1, 8-13, 58, 62, 63 and 72-74).

[0145] While generally described herein as a microbial organism that contains a 4-HB, 4 HBal, 4-HBCoA, BDO or putrescine pathway, it is understood that the invention additionally provides a non-naturally occurring microbial organism comprising at least one exogenous nucleic acid encoding a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme or protein expressed in a sufficient amount to produce an intermediate of a 4-HB, 4-HBal, 4 HBCoA, BDO or putrescine pathway. For example, as disclosed herein, 4-HB, 4-HBal, 4 HBCoA, BDO and putrescine pathways are exemplified in Figures 1, 8-13, 58, 62, 63 and 72 74). Therefore, in addition to a microbial organism containing, for example, a BDO pathway that produces BDO, the invention additionally provides a non-naturally occurring microbial organism comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme, where the microbial organism produces a BDO pathway intermediate as a product rather than an intermediate of the pathway. In one exemplary embodiment as shown in Figure 62, for example, the invention provides a microbial organism that produces succinyl-CoA, succinic semialdehyde, 4-hydroxybutyrate, 4-hydroxybutyryl-phosphate, 4-hydroxybutyryl-CoA, or 4 hydroxybutanal as a product rather than an intermediate. Another exemplary embodiment includes, for example, a microbial organism that produces alpha-ketoglutarate, 2,5 dioxopentanoic acid, 5-hydroxy-2-oxopentanoic acid, or 4-hydroxybutanal as a product rather than an intermediate. An exemplary embodiment in a putrescine pathway includes, for example, a microbial organism that produces glutamate, 4-aminobutyrate, or 4-aminobutanal as a product rather than an intermediate. An alternative embodiment in a putrescine pathway can be, for example, a microbial organism that produces 2,5-dioxopentanoate, 5-amino-2 oxopentanoate, or ornithine as a product rather than an intermediate.

[0146] It is understood that any of the pathways disclosed herein, as described in the Examples and exemplified in the Figures, including the pathways of Figures 1, 8-13, 58, 62, 63 and 72-74), can be utilized to generate a non-naturally occurring microbial organism that produces any pathway intermediate or product, as desired. As disclosed herein, such a microbial organism that produces an intermediate can be used in combination with another microbial organism expressing downstream pathway enzymes to produce a desired product. However, it is understood that a non-naturally occurring microbial organism that produces a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate can be utilized to produce the intermediate as a desired product.

[0147] This invention is also directed, in part to engineered biosynthetic pathways to improve carbon flux through a central metabolism intermediate en route to 1,4-butanediol, 4 hydroxybutyrate and/or gamma-butyrolactone or other products or intermediates disclosed herein. The present invention provides non-naturally occurring microbial organisms having one or more exogenous genes encoding enzymes that can catalyze various enzymatic transformations en route to 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone or other products or intermediates disclosed herein. In some embodiments, these enzymatic transformations are part of the reductive tricarboxylic acid (RTCA) cycle and are used to improve product yields, including but not limited to, from carbohydrate-based carbon feedstock.

[0148] In numerous engineered pathways, realization of maximum product yields based on carbohydrate feedstock is hampered by insufficient reducing equivalents or by loss of reducing equivalents and/or carbon to byproducts. In accordance with some embodiments, the present invention increases the yields of 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone by (i) enhancing carbon fixation via the reductive TCA cycle, and/or (ii) accessing additional reducing equivalents from gaseous carbon sources and/or syngas components such as CO, C02, and/or H2. In addition to syngas, other sources of such gases include, but are not listed to, the atmosphere, either as found in nature or generated.

[0149] The C02-fixing reductive tricarboxylic acid (RTCA) cycle is an endergenic anabolic pathway of C02 assimilation which uses reducing equivalents and ATP (Figure 68). One turn of the RTCA cycle assimilates two moles of C02 into one mole of acetyl-CoA, or four moles of C02 into one mole of oxaloacetate. This additional availability of acetyl-CoA improves the maximum theoretical yield of product molecules derived from carbohydrate based carbon feedstock. Exemplary carbohydrates include but are not limited to glucose, sucrose, xylose, arabinose and glycerol.

[0150] In some embodiments, the reductive TCA cycle, coupled with carbon monoxide dehydrogenase and/or hydrogenase enzymes, can be employed to allow syngas, C02, CO,

H2, and/or other gaseous carbon source utilization by microorganisms. Synthesis gas (syngas), in particular is a mixture of primarily H2 and CO, sometimes including some amounts of C02, that can be obtained via gasification of any organic feedstock, such as coal, coal oil, natural gas, biomass, or waste organic matter. Numerous gasification processes have been developed, and most designs are based on partial oxidation, where limiting oxygen avoids full combustion, of organic materials at high temperatures (500-15O0oC) to provide syngas as a 0.5:1-3:1 H2/CO mixture. In addition to coal, biomass of many types has been used for syngas production and represents an inexpensive and flexible feedstock for the biological production of renewable chemicals and fuels. Carbon dioxide can be provided from the atmosphere or in condensed from, for example, from a tank cylinder, or via sublimation of solid C02. Similarly, CO and hydrogen gas can be provided in reagent form and/or mixed in any desired ratio. Other gaseous carbon forms can include, for example, methanol or similar volatile organic solvents.

[0151] The components of synthesis gas and/or other carbon sources can provide sufficient C02, reducing equivalents, and ATP for the reductive TCA cycle to operate. One turn of the RTCA cycle assimilates two moles of C02 into one mole of acetyl-CoA and requires 2 ATP and 4 reducing equivalents. CO and/or H2 can provide reducing equivalents by means of carbon monoxide dehydrogenase and hydrogenase enzymes, respectively. Reducing equivalents can come in the form of NADH, NADPH, FADH, reduced quinones, reduced ferredoxins, reduced flavodoxins and reduced thioredoxins. The reducing equivalents, particularly NADH, NADPH, and reduced ferredoxin, can serve as cofactors for the RTCA cycle enzymes, for example, malate dehydrogenase, fumarate reductase, alpha ketoglutarate:ferredoxin oxidoreductase (alternatively known as 2-oxoglutarate:ferredoxin oxidoreductase, alpha-ketoglutarate synthase, or 2-oxoglutarate synthase), pyruvate:ferredoxin oxidoreductase and isocitrate dehydrogenase. The electrons from these reducing equivalents can alternatively pass through an ion-gradient producing electron transport chain where they are passed to an acceptor such as oxygen, nitrate, oxidized metal ions, protons, or an electrode. The ion-gradient can then be used for ATP generation via an ATP synthase or similar enzyme.

[0152] The reductive TCA cycle was first reported in the green sulfur photosynthetic bacterium Chlorobium limicola (Evans et al., Proc. Natl. Acad. Sci. U.S.A. 55:928-934 (1966)). Similar pathways have been characterized in some prokaryotes (proteobacteria, green sulfur bacteria and thermophillic Knallgas bacteria) and sulfur-dependent archaea (Hugler et al., J. Bacteriol. 187:3020-3027 (2005; Hugler et al., Environ. Microbiol. 9:81-92 (2007). In some cases, reductive and oxidative (Krebs) TCA cycles are present in the same organism (Hugler et al., supra (2007); Siebers et al., J. Bacteriol. 186:2179-2194 (2004)). Some methanogens and obligate anaerobes possess incomplete oxidative or reductive TCA cycles that may function to synthesize biosynthetic intermediates (Ekiel et al., J. Bacteriol. 162:905-908 (1985); Wood et al., FEMSMicrobiol. Rev. 28:335-352 (2004)).

[0153] The key carbon-fixing enzymes of the reductive TCA cycle are alpha ketoglutarate:ferredoxin oxidoreductase, pyruvate:ferredoxin oxidoreductase and isocitrate dehydrogenase. Additional carbon may be fixed during the conversion of phosphoenolpyruvate to oxaloacetate by phosphoenolpyruvate carboxylase or phosphoenolpyruvate carboxykinase or by conversion of pyruvate to malate by malic enzyme.

[0154] Many of the enzymes in the TCA cycle are reversible and can catalyze reactions in the reductive and oxidative directions. However, some TCA cycle reactions are irreversible in vivo and thus different enzymes are used to catalyze these reactions in the directions required for the reverse TCA cycle. These reactions are: (1) conversion of citrate to oxaloacetate and acetyl-CoA, (2) conversion of fumarate to succinate, and (3) conversion of succinyl-CoA to alpha-ketoglutarate. In the TCA cycle, citrate is formed from the condensation of oxaloacetate and acetyl-CoA. The reverse reaction, cleavage of citrate to oxaloacetate and acetyl-CoA, is ATP-dependent and catalyzed by ATP-citrate lyase, or citryl CoA synthetase and citryl-CoA lyase. Alternatively, citrate lyase can be coupled to acetyl CoA synthetase, an acetyl-CoA transferase, or phosphotransacetylase and acetate kinase to form acetyl-CoA and oxaloacetate from citrate. The conversion of succinate to fumarate is catalyzed by succinate dehydrogenase while the reverse reaction is catalyzed by fumarate reductase. In the TCA cycle succinyl-CoA is formed from the NAD(P)+ dependent decarboxylation of alpha-ketoglutarate by the alpha-ketoglutarate dehydrogenase complex. The reverse reaction is catalyzed by alpha-ketoglutarate:ferredoxin oxidoreductase.

[0155] An organism capable of utilizing the reverse tricarboxylic acid cycle to enable production of acetyl-CoA-derived products on 1) CO, 2)CO 2 and H 2 ,3) CO andC0 2,4) synthesis gas comprising CO and H 2, and 5) synthesis gas or other gaseous carbon sources comprising CO,CO 2 , and H 2 can include any of the following enzyme activities: ATP-citrate lyase, citrate lyase, aconitase, isocitrate dehydrogenase, alpha-ketoglutarate:ferredoxin oxidoreductase, succinyl-CoA synthetase, succinyl-CoA transferase, fumarate reductase, fumarase, malate dehydrogenase, acetate kinase, phosphotransacetylase, acetyl-CoA synthetase, acetyl-CoA transferase, pyruvate:ferredoxin oxidoreductase, NAD(P)H:ferredoxin oxidoreductase, carbon monoxide dehydrogenase, hydrogenase, and ferredoxin (see Figure 69). Enzymes and the corresponding genes required for these activities are described herein.

[0156] Carbon from syngas or other gaseous carbon sources can be fixed via the reverse TCA cycle and components thereof. Specifically, the combination of certain carbon gas utilization pathway components with the pathways for formation of 1,4-butanediol, 4 hydroxybutyrate and/or gamma-butyrolactone from acetyl-CoA results in high yields of these products by providing an efficient mechanism for fixing the carbon present in carbon dioxide, fed exogenously or produced endogenously from CO, into acetyl-CoA.

[0157] In some embodiments, a 1,4-butanediol, 4-hydroxybutyrate and/or gamma butyrolactone pathway in a non-naturally occurring microbial organism of the invention can utilize any combination of (1) CO, (2)C0 2 , (3) H 2 , or mixtures thereof to enhance the yields of biosynthetic steps involving reduction, including addition to driving the reductive TCA cycle.

[0158] In some embodiments a non-naturally occurring microbial organism having an 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway includes at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme. The at least one exogenous nucleic acid is selected from an ATP-citrate lyase, citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, a fumarate reductase, isocitrate dehydrogenase, aconitase, and an alpha-ketoglutarate:ferredoxin oxidoreductase; and at least one exogenous enzyme selected from a carbon monoxide dehydrogenase, a hydrogenase, a NAD(P)H:ferredoxin oxidoreductase, and a ferredoxin, expressed in a sufficient amount to allow the utilization of (1) CO, (2) C0 2, (3) H2 , (4)CO2 and H 2 , (5) CO andC0 2 , (6) CO and H 2 , or (7) COCO2 ,

and H2 .

[0159] In some embodiments a method includes culturing a non-naturally occurring microbial organism having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway also comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme. The at least one exogenous nucleic acid is selected from an ATP-citrate lyase, citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, a fumarate reductase, isocitrate dehydrogenase, aconitase, and an alpha-ketoglutarate:ferredoxin oxidoreductase. Additionally, such an organism can also include at least one exogenous enzyme selected from a carbon monoxide dehydrogenase, a hydrogenase, a NAD(P)H:ferredoxin oxidoreductase, and a ferredoxin, expressed in a sufficient amount to allow the utilization of (1) CO, (2) C0 2

, (3) H 2 , (4) CO2 and H 2 , (5) CO and C02 , (6) CO and H 2 , or (7) CO, C0 2 , and H2 to produce a product.

[0160] In some embodiments a non-naturally occurring microbial organism having an 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone a reductive TCA pathway enzyme expressed in a sufficient amount to enhance carbon flux through acetyl-CoA. The at least one exogenous nucleic acid is selected from an ATP-citrate lyase, citrate lyase, a citryl CoA synthetase, a citryl-CoA lyase, a fumarate reductase, a pyruvate:ferredoxin oxidoreductase, isocitrate dehydrogenase, aconitase, and an alpha-ketoglutarate:ferredoxin oxidoreductase.

[0161] In some embodiments a non-naturally occurring microbial organism having an 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway includes at least one exogenous nucleic acid encoding an enzyme expressed in a sufficient amount to enhance the availability of reducing equivalents in the presence of carbon monoxide and/or hydrogen, thereby increasing the yield of redox-limited products via carbohydrate-based carbon feedstock. The at least one exogenous nucleic acid is selected from a carbon monoxide dehydrogenase, a hydrogenase, an NAD(P)H:ferredoxin oxidoreductase, and a ferredoxin. In some embodiments, the present invention provides a method for enhancing the availability of reducing equivalents in the presence of carbon monoxide or hydrogen thereby increasing the yield of redox-limited products via carbohydrate-based carbon feedstock, such as sugars or gaseous carbon sources, the method includes culturing this non-naturally occurring microbial organism under conditions and for a sufficient period of time to produce 1,4-butanediol, 4 hydroxybutyrate and/or gamma-butyrolactone.

[0162] In some embodiments, the non-naturally occurring microbial organism having an 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway includes two exogenous nucleic acids, each encoding a reductive TCA pathway enzyme. In some embodiments, the non-naturally occurring microbial organism having a 1,4-butanediol, 4- hydroxybutyrate and/or gamma-butyrolactone pathway includes three exogenous nucleic acids each encoding a reductive TCA pathway enzyme. In some embodiments, the non naturally occurring microbial organism includes three exogenous nucleic acids encoding an ATP-citrate lyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase. In some embodiments, the non-naturally occurring microbial organism includes three exogenous nucleic acids encoding a citrate lyase, or a citryl-CoA synthetase or a citryl-CoA lyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase. In some embodiments, the non-naturally occurring microbial organism includes four exogenous nucleic acids encoding a pyruvate:ferredoxin oxidoreductase; a phosphoenolpyruvate carboxylase or a phosphoenolpyruvate carboxykinase, a CO dehydrogenase; and an H 2 hydrogenase. In some embodiments, the non-naturally occurring microbial organism includes two exogenous nucleic acids encoding a CO dehydrogenase and an H2 hydrogenase.

[0163] In some embodiments, the non-naturally occurring microbial organisms having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway further include an exogenous nucleic acid encoding an enzyme selected from a pyruvate:ferredoxin oxidoreductase, an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, an acetate kinase, a phosphotransacetylase, an acetyl-CoA synthetase, an NAD(P)H:ferredoxin oxidoreductase, and combinations thereof.

[0164] In some embodiments, the non-naturally occurring microbial organism having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway further includes an exogenous nucleic acid encoding an enzyme selected from carbon monoxide dehydrogenase, acetyl-CoA synthase, ferredoxin, NAD(P)H:ferredoxin oxidoreductase and combinations thereof.

[0165] In some embodiments, the non-naturally occurring microbial organism having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway utilizes a carbon feedstock selected from (1) CO, (2) C02, (3) CO 2 and H2 , (4) CO and H 2 , or (5) CO, CO 2 ,

and H2 . In some embodiments, the non-naturally occurring microbial organism having a 1,4 butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway utilizes hydrogen for reducing equivalents. In some embodiments, the non-naturally occurring microbial organism having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway utilizes

CO for reducing equivalents. In some embodiments, the non-naturally occurring microbial organism having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway utilizes combinations of CO and hydrogen for reducing equivalents.

[0166] In some embodiments, the non-naturally occurring microbial organism having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway further includes one or more nucleic acids encoding an enzyme selected from a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a pyruvate carboxylase, and a malic enzyme.

[0167] In some embodiments, the non-naturally occurring microbial organism having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway further includes one or more nucleic acids encoding an enzyme selected from a malate dehydrogenase, a fumarase, a fumarate reductase, a succinyl-CoA synthetase, and a succinyl-CoA transferase.

[0168] In some embodiments, the non-naturally occurring microbial organism having a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway further includes at least one exogenous nucleic acid encoding a citrate lyase, an ATP-citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, an acetate kinase, a phosphotransacetylase, an acetyl-CoA synthetase, and a ferredoxin.

[0169] It is understood by those skilled in the art that the above-described pathways for increasing product yield can be combined with any of the pathways disclosed herein, including those pathways depicted in the figures. One skilled in the art will understand that, depending on the pathway to a desired product and the precursors and intermediates of that pathway, a particular pathway for improving product yield, as discussed herein above and in the examples, or combination of such pathways, can be used in combination with a pathway to a desired product to increase the yield of that product or a pathway intermediate.

[0170] It is understood by those skilled in the art that the above-described pathways for increasing product yield can be combined with any of the pathways disclosed herein, including those pathways depicted in the figures. One skilled in the art will understand that, depending on the pathway to a desired product and the precursors and intermediates of that pathway, a particular pathway for improving product yield, as discussed herein above and in the examples, or combination of such pathways, can be used in combination with a pathway to a desired product to increase the yield of that product or a pathway intermediate.

[0171] In one embodiment, the invention provides a non-naturally occurring microbial organism, comprising a microbial organism having a 1,4-butanediol pathway comprising at least one exogenous nucleic acid encoding a 1,4-butanediol pathway enzyme expressed in a sufficient amount to produce 1,4-butanediol. Such a microbial organism can further comprise (i) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein the at least one exogenous nucleic acid is selected from an ATP-citrate lyase, citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase; (ii) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein the at least one exogenous nucleic acid is selected from a pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an H2 hydrogenase; or (iii) at least one exogenous nucleic acid encodes an enzyme selected from a CO dehydrogenase, an H2 hydrogenase, and combinations thereof.

[0172] In such microbial organisms, a 1,4-butanediol pathway can comprise a pathway of any of those disclosed herein, including the figures. For example, a 1,4-BDO pathway can be selected from (a) 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA dependent succinic semialdehyde dehydrogenase, and a-ketoglutarate decarboxylase; (b) 4 hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-butyrate kinase, phosphotransbutyrylase, a-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase and an aldehyde/alcohol dehydrogenase; (c) (i) an a-ketoglutarate decarboxylase, or an a-ketoglutarate dehydrogenase and a CoA-dependent succinic semialdehyde dehydrogenase, or a glutamate:succinate semialdehyde transaminase and a glutamate decarboxylase; (ii) a 4-hydroxybutanoate dehydrogenase; (iii) a 4-hydroxybutyryl CoA:acetyl-CoA transferase, or a butyrate kinase and a phosphotransbutyrylase; (iv) an aldehyde dehydrogenase; and (v) an alcohol dehydrogenase; (d) 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, and 4 hydroxybutyryl-CoA dehydrogenase; (e) 4-aminobutyrate CoA transferase, 4-aminobutyryl CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4-aminobutan-1-ol dehydrogenase, 4-aminobutan 1-ol oxidoreductase (deaminating) and 4-aminobutan-1-ol transaminase; (f) 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4-aminobutan-1-ol transaminase, [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4 aminobutanolyl)oxy]phosphonic acid transaminase, 4-hydroxybutyryl-phosphate dehydrogenase, and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating); (g) alpha ketoglutarate 5-kinase, 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl CoA hydrolase, alpha-ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5 hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2-oxopentanoic acid decarboxylase, and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (h) glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5-kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5-hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (i) 3 hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl-CoA A-isomerase, or 4-hydroxybutyryl-CoA dehydratase; (j) homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4 hydroxybut-2-enoyl-CoA ligase, 4-hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4 hydroxybut-2-enoyl-CoA reductase; (k) succinyl-CoA reductase (alcohol forming), 4 hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating); (1) glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4 hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating); (m) 4-aminobutyrate kinase; 4-aminobutyraldehyde dehydrogenase (phosphorylating); 4-aminobutan-1-ol dehydrogenase; and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase; (n) 4-aminobutyrate kinase; [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating) or [(4 aminobutanolyl)oxy]phosphonic acid transaminase; 4-hydroxybutyryl-phosphate dehydrogenase; and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating); (o) alpha ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5-hydroxy-2-oxopentanoic acid decarboxylase; (p) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (q) alpha ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid decarboxylase; (r) alpha-ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (s) alpha-ketoglutarate CoA transferase, alpha ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase; 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid decarboxylase; (t) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase; 5-hydroxy-2 oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (u) glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl CoA ligase; glutamyl-CoA reductase (alcohol forming); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5 hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (v) glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2 oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (w) glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl CoA ligase; glutamyl-CoA reductase; glutamate-5-semialdehyde reductase; 2-amino-5 hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2 oxopentanoic acid dehydrogenase (decarboxylation); (x) glutamate 5-kinase; glutamate-5 semialdehyde dehydrogenase (phosphorylating); glutamate-5-semialdehyde reductase; 2 amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5 hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (y) homoserine deaminase; 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut 2-enoyl-CoA ligase; 4-hydroxybut-2-enoyl-CoA reductase; (z) homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4- hydroxybut-2-enoyl-CoA reductase; (aa) homoserine deaminase; 4-hydroxybut-2-enoate reductase; and 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4 hydroxybutyryl-CoA ligase; (bb) (i) alpha-ketoglutarate decarboxylase; or alpha ketoglutarate dehydrogenase and CoA-dependent succinate semialdehyde dehydrogenase; or glutamate:succinate semialdehyde transaminase and glutamate decarboxylase; (ii) 4 hydroxybutyrate dehydrogenase; (iii) 4-hydroxybutyryl-CoA transferase; or 4 hydroxybutyrate kinase and phosphotrans-4-hydroxybutyrylase; (iv) 4-hydroxybutyryl-CoA reductase; and (v) 4-hydroxybutyraldehyde reductase; or aldehyde/alcohol dehydrogenase; (cc) (i) alpha-ketoglutarate decarboxylase; or succinyl-CoA synthetase and CoA-dependent succinate semialdehyde dehydrogenase; (ii) 4-hydroxybutyrate dehydrogenase; (iii) 4 hydroxybutyryl-CoA transferase; or 4-hydroxybutyrate kinase and phosphotrans-4 hydroxybutyrylase; and (iv) aldehyde dehydrogenase; and alcohol dehydrogenase; or aldehyde/alcohol dehydrogenase; (dd) (i) alpha-ketoglutarate decarboxylase; or glutamate dehydrogenase; glutamate decarboxylase; and deaminating 4-aminobutyrate oxidoreductase or 4-aminobutyrate transaminase; or alpha-ketoglutarate dehydrogenase and CoA-dependent succinate semialdehyde dehydrogenase; (ii) 4-hydroxybutyrate dehydrogenase; and (iii) 4 hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; 4-hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase; or 4-hydroxybutyrate kinase; phosphorylating 4-hydroxybutanal dehydrogenase; and 4-hydroxybutyraldehyde reductase; or 4-hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; and alcohol forming 4 hydroxybutyryl-CoA reductase; or 4-hydroxybutyryl-CoA transferase or 4-hydroxybutyryl CoA hydrolase or 4-hydroxybutyryl-CoA ligase; 4-hydroxybutyryl-CoA reductase; and 4 hydroxybutyraldehyde reductase; or 4-hydroxybutyryl-CoA transferase or 4-hydroxybutyryl CoA hydrolase or 4-hydroxybutyryl-CoA ligase; and alcohol forming 4-hydroxybutyryl-CoA reductase; (ee) (i) glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase; glutamyl-CoA reductase; and glutamate-5-semialdehyde reductase; or glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase; and alcohol forming glutamyl-CoA reductase; or glutamate 5-kinase; phosphorylating glutamate-5-semialdehyde dehydrogenase; and glutamate-5-semialdehyde reductase; (ii) deaminating 2-amino-5 hydroxypentanoic acid oxidoreductase or 2-amino-5-hydroxypentanoic acid transaminase; and (iii) 5-hydroxy-2-oxopentanoic acid decarboxylase; and 4-hydroxybutyraldehyde reductase; or decarboxylating 5-hydroxy-2-oxopentanoic acid dehydrogenase; 4 hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase; or decarboxylating -hydroxy-2-oxopentanoic acid dehydrogenase and alcohol forming 4-hydroxybutyryl-CoA reductase; (ff) succinyl-CoA reductase (aldehyde forming); 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase; and optionally 1,4-butandiol dehydrogenase; (gg) alpha-ketoglutarate decarboxylase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase; and optionally 1,4-butandiol dehydrogenase; (hh) succinate reductase; 4-hydroxybutyrate dehydrogenase, and 4-hydroxybutyrate reductase; and optionally 1,4-butandiol dehydrogenase; (ii) alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase or glutamate transaminase and glutamate decarboxylase and 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-hydroxybutyrate dehydrogenase; and 4 hydroxybutyrate reductase; and optionally 1,4-butandiol dehydrogenase; (jj) alpha ketoglutarate reductase; 5-hydroxy-2-oxopentanoate dehydrogenase; and 5-hydroxy-2 oxopentanoate decarboxylase; and optionally 1,4-butandiol dehydrogenase; (kk) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; and 4-hydroxybutyryl-CoA reductase (alcohol forming) (see Figure 72 reactions 1, 2, 3, 4 and 5); (11) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; 4-hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (see Figure 72 reactions 1, 2, 3 , 4, 6 and 7); (mm) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl CoA hydratase; 4-Hydroxybutyryl-CoA transferase, 4-Hydroxybutyryl-CoA synthetase, 4 Hydroxybutyryl-CoA hydrolase, or Phosphotrans-4-hydroxybutyrylase/4-Hydroxybutyrate kinase; 4-Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase (Figure 72 reactions 1, 2, 3, 4, 8, 9 and 7); (nn) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylasel; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (Figure 74 reactions H, C, D, E, F and G); (oo) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate kinase; 4-Hydroxybutyryl-phosphate reductase; and 1,4-butanediol dehydrogenase (Figure 74 reactions H, C , D, L and G); (pp) Succinate reductase; 4 Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase (Figure 74 reactions H, C, K +and G); (qq) Succinate reductase; 4 Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl CoA synthetase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming) (Figure 74 reactions H, C, J and M); (rr) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (Figure 74 reactions

H, C, J, F and G); (ss) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming) (Figure 74 reactions H, C, D, E and M); (tt) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (Figure 74 reactions A, B, C, D, E, F and G); (uu) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; 4-Hydroxybutyryl-phosphate reductase; and 1,4-butanediol dehydrogenase (Figure 74 reactions A, B, C, D, L and G); (vv) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase (Figure 74 reactions A, B, C, K and G); (ww) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming) (Figure 74 reactions A, B, C, J and M); (xx) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (Figure 74 reactions A, B, C, J, F and G); (yy) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4 Hydroxybutyryl-CoA reductase (alcohol forming) (Figure 74 reactions A, B, C, D, E and M);

(zz) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (Figure 74 reactions N, C, D, E, F and G); (aaa) Alpha ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4-aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; 4 Hydroxybutyryl-phosphate reductase; and 1,4-butanediol dehydrogenase (Figure 74 reactions

N, C, D, L and G); (bbb) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4-aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase (Figure 74 reactions N, C, K and G); (ccc) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming) (Figure 74 reactions N, C, J and M);

[0173] (ddd) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (Figure 74 reactions N, C, J, F and G); (eee) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming) (Figure 74 reactions N, C, D, E and M); (ff)Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4 Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (Figure 74 reactions A, I, D, E, F and G); (ggg) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate kinase; 4 Hydroxybutyryl-phosphate reductase; and 1,4-butanediol dehydrogenase (Figure 74 reactions A, I, D, L and G); (hhh) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase (Figure 74 reactions A, I, K and G); (iii) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming) (Figure 74 reactions A, I, J and M); (jjj) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyryl-CoA transferase, or 4-

Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase (Figure 74 reactions A, I, J, F and G); (kkk) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4 Hydroxybutyryl-CoA reductase (alcohol forming) (Figure 74 reactions A, I, D, E and M); and (111) any of the pathways that produce 1,4-butanediol as shown in any of Figures 1, 8-13, 58, 62, 63 or 72-74.

[0174] In a further embodiment, such a microbial organism of the invention comprising (i) can further comprise an exogenous nucleic acid encoding an enzyme selected from a pyruvate:ferredoxin oxidoreductase, an aconitase, an isocitrate dehydrogenase, a succinyl CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, an acetate kinase, a phosphotransacetylase, an acetyl-CoA synthetase, an NAD(P)H:ferredoxin oxidoreductase, ferredoxin, and combinations thereof. In additiona, amicrobial organism comprising (ii) can further comprise an exogenous nucleic acid encoding an enzyme selected from an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, and combinations thereof.

[0175] In yet another embodiment, such a microbial organism can comprise two, three, four, five, six or seven exogenous nucleic acids each encoding a 1,4-butanediol pathway enzyme. For example, such a microbial organism can comprise exogenous nucleic acids encoding each of the enzymes of a pathway, for example, a particular pathway as disclosed herein, including those shown in figures 1, 8-13, 58, 62, 63 and 72-74. A microbial organism can comprise more than one pathway, if desired, which can be useful to increase the yield of a desired product.

[0176] In a further embodiment, a microbial organism comprising pathways (a), (b) or (c) further comprises an enzyme selected from succinyl-CoA synthetase, exogenous CoA dependent succinic semialdehyde dehydrogenase or exogenous succinyl-CoA synthetase and exogenous CoA-dependent succinic semialdehyde dehydrogenase. In still a further embodiment, a microbial organism comprising pathway (d), (g), (h), (i), () further comprises an enzyme selected from 4-hydroxybutyryl-CoA reductase (alcohol forming), 4 hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase. Additionally, a microbial organism comprising pathway (e) or (f) can further comprise 1,4-butanediol dehydrogenase. In yet a further embodiment, a microbial organism comprising pathway (k) can further comprise succinyl-CoA reductase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase. Still further, a microbial organism comprising pathway (1) further comprises alpha-ketoglutarate decarboxylase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4 hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4 butanediol dehydrogenase. Such additional pathway steps are disclosed herein.

[0177] In yet another embodiment of the invention, a microbial organism can comprise two, three, four or five exogenous nucleic acids each encoding enzymes of (i), (ii) or (iii). For example, a microbial organism comprising (i) can comprise three exogenous nucleic acids encoding ATP-citrate lyase or citrate lyase, a fumarate reductase, and an alpha ketoglutarate:ferredoxin oxidoreductase; a microbial organism comprising (ii) can comprise five exogenous nucleic acids encoding pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an H2 hydrogenase; or a microbial organism comprising (iii) can comprise two exogenous nucleic acids encoding CO dehydrogenase and H 2 hydrogenase. The invention additionally provides methods for producing 1,4-butanediol by culturing such non-naturally occurring microbial organisms under conditions and for a sufficient period of time to produce 1,4-butanediol.

[0178] The invention additionally provides a non-naturally occurring microbial organism, comprising a microbial organism having a 4-hydroxybutyrate pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutyrate pathway enzyme 4 hydroxybutyrate expressed in a sufficient amount to produce 4-hydroxybutyrate. Such a non naturally occurring microbial organism can further comprise (i) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from an ATP-citrate lyase, citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, a fumarate reductase, and an alpha ketoglutarate:ferredoxin oxidoreductase; (ii) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from a pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an H2 hydrogenase; or (iii) at least one exogenous nucleic acid encodes an enzyme selected from a CO dehydrogenase, an H 2 hydrogenase, and combinations thereof. In such a microbial organism the 4-hydroxybutyrate pathway can comprise a pathway from any of those disclosed herein, including in the figures, for example, any of Figures 1, 8-13, 58, 62, 63 or 72-74.

[0179] In a particular embodiment, a microbial organism comprising a 4-hydroxybutyrate pathway can be selected from (a) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3 Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; and 4 Hydroxybutyryl-CoA transferase, 4-Hydroxybutyryl-CoA synthetase, 4-Hydroxybutyryl CoA hydrolase, or Phosphotrans-4-hydroxybutyrylase/4-Hydroxybutyrate kinase (Figure 72 reactions 1, 2, 3, 4 and 8); (b) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3 Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; and 4 Hydroxybutyryl-CoA transferase, hydrolase or synthetase (Figure 73 reactions 1, 2, 3, 4 and ); (c) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyrate kinase (Figure 73 reactions 1, 2, 3, 4, 6 and 7); (d) Succinate reductase; and 4-Hydroxybutyrate dehydrogenase (Figure 74 reactions H and C); (e) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); and 4-Hydroxybutyrate dehydrogenase (Figure 74 reactions A, B and C); (f) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); and 4-Hydroxybutyrate dehydrogenase (Figure 74 reactions N and C); (g) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); and Succinyl-CoA reductase (alcohol forming) (Figure 74 reactions A and I); (h) acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase, a 3-hydroxybutyryl-CoA dehydrogenase, a crotonase, a crotonyl-CoA hydratase, a 4-hydroxybutyryl-CoA transferase, a phosphotrans-4-hydroxybutyrylase, and a 4-hydroxybutyrate kinase; (i) 4 hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, and a-ketoglutarate decarboxylase; () (i) an a-ketoglutarate decarboxylase, or an a-ketoglutarate dehydrogenase and a CoA-dependent succinic semialdehyde dehydrogenase, or a glutamate:succinate semialdehyde transaminase and a glutamate decarboxylase; (ii) a 4-hydroxybutanoate dehydrogenase; (k) succinyl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating); (1) glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4 hydroxybutanal dehydrogenase (phosphorylating); (m) homoserine deaminase; 4 hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2 enoyl-CoA ligase; 4-hydroxybut-2-enoyl-CoA reductase; (n) homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4 hydroxybut-2-enoyl-CoA reductase; (o) homoserine deaminase; 4-hydroxybut-2-enoate reductase; and 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4 hydroxybutyryl-CoA ligase; (p) succinyl-CoA reductase (aldehyde forming); and 4 hydroxybutyrate dehydrogenase; (q) alpha-ketoglutarate decarboxylase; and 4 hydroxybutyrate dehydrogenase; (r) succinate reductase; and 4-hydroxybutyrate dehydrogenase; (s) alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase or glutamate transaminase and glutamate decarboxylase and 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; and 4-hydroxybutyrate dehydrogenase; and (t) a 4 hydroxybutyrate pathway selected from any of the pathways that produce 4-hydroxybutyrate as shown in any of Figures 1, 8-13, 58, 62, 63 or 72-74.

[0180] Such a microbial organism comprising (i) can further comprise an exogenous nucleic acid encoding an enzyme selected from a pyruvate:ferredoxin oxidoreductase, an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, an acetate kinase, a phosphotransacetylase, an acetyl-CoA synthetase, an NAD(P)H:ferredoxin oxidoreductase, ferredoxin, and combinations thereof. In addition, a microbial organism comprising (ii) can further comprise an exogenous nucleic acid encoding an enzyme selected from an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, and combinations thereof.

[0181] In a particular embodiment, the microbial organism can comprise exogenous nucleic acids encoding each of the enzymes selected from the pathway enzymes producing 4 hydroxybutyrate pathway enzymes as shown in any of Figures 1, 8-13,58, 62, 63 or 72-74. Such microbial organisms can also comprise two, three, four or five exogenous nucleic acids each encoding enzymes of (i), (ii) or (iii). For example, a microbial organism comprising (i) can comprise three exogenous nucleic acids encoding ATP-citrate lyase or citrate lyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase; a microbial organism comprising (ii) can comprise five exogenous nucleic acids encoding pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an H2 hydrogenase; or a microbial organism comprising (iii) can comprise two exogenous nucleic acids encoding CO dehydrogenase and H2 hydrogenase. The invention additionally provides a method for producing 4-hydroxybutyrate, by culturing the non-naturally occurring microbial organisms under conditions and for a sufficient period of time to produce 4-hydroxybutyrate.

[0182] The invention also provides a non-naturally occurring microbial organism, comprising a microbial organism having a gamma-butyrolactone pathway comprising at least one exogenous nucleic acid encoding a gamma-butyrolactone pathway enzyme expressed in a sufficient amount to produce gamma-butyrolactone. Such a microbial organism can further comprise (i) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from an ATP-citrate lyase, citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase; (ii) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from a pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an H2 hydrogenase; or (iii) at least one exogenous nucleic acid encodes an enzyme selected from a CO dehydrogenase, an H 2 hydrogenase, and combinations thereof. Such microbial organisms can comprise, for example, a pathway selected from any of the pathways that produce gamma-butryolactone as shown in Figures 1, 8-13, 58, 62, 63 or 72-74. As disclosed herein, both 4-hydroxybutyryl CoA and 4-hydroxybutyryl phosphate can be enzymatically or can spontaneously chemically convert to gamma-butyrolactone. Therefore, it is understood that any of the pathways disclosed herein that produce 4-hydroxybytyryl-CoA or 4-hydroxybutyryl phosphate can be used to produce gamma-butyrolactone using enzymatic and/or chemical conversion.

[0183] In such microbial organisms, a gamma-butyroloactone pathway can comprise a pathway selected from, for example, (a) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; and spontaneous or enzyme catalyzed (Figure 73 reactions 1, 2, 3, 4 and 8); (b) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; Phosphotrans-4-hydroxybutyrylase; amd spontaneous or enzyme catalyzed (Figure 73 reactions 1, 2, 3, 4, 6 and 9); (c) Succinate reductase; 4 Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4 hydroxybutyrylase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous (Figure 74 reactions H, C, D, E and0); (d) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4 Hydroxybutyryl-CoA hydrolase or spontaneous (Figure 74 reactions H, C, J and 0); (e) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous (Figure 74 reactions A, B, C, D, E and 0); (f) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4 Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl-CoA hydrolase or spontaneous (Figure 74 reactions A, B, C, J and0); (g) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4-aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous (Figure 74 reactions N, C, D, E and 0); (h) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4-aminobutyrate transaminase); 4 Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl CoA synthetase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous (Figure 74 reactions N, C, J and0); (i) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate kinase; Phosphotrans 4-hydroxybutyrylase; 4-Hydroxybutyryl-CoA hydrolase or spontaneous (Figure 74 reactions A, I, D, E and0); (j) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous (Figure 74 reactions A, I, J and0); (k) alpha-ketoglutarate reductase; 5-hydroxy-2 oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate dehydrogenase (decarboxylation) (1) 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA dependent succinic semialdehyde dehydrogenase, and a-ketoglutarate decarboxylase; (m) 4- hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-butyrate kinase, phosphotransbutyrylase, a-ketoglutarate decarboxylase; (n) (i) an a-ketoglutarate decarboxylase, or an a-ketoglutarate dehydrogenase and a CoA-dependent succinic semialdehyde dehydrogenase, or a glutamate:succinate semialdehyde transaminase and a glutamate decarboxylase; (ii) a 4-hydroxybutanoate dehydrogenase; (iii) a 4-hydroxybutyryl CoA:acetyl-CoA transferase, or a butyrate kinase and a phosphotransbutyrylase; (o) 4 aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, and 4-hydroxybutyryl-CoA dehydrogenase; (p) 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating) and 4-aminobutan-1-ol transaminase; (q) 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4-aminobutan-1-ol transaminase, [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4-aminobutanolyl)oxy]phosphonic acid transaminase, 4 hydroxybutyryl-phosphate dehydrogenase, and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating); (r) alpha-ketoglutarate 5-kinase, 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha-ketoglutaryl-CoA ligase, alpha ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2-oxopentanoic acid decarboxylase, and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (s) glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5 kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl-CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5 hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (t) 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl-CoA A-isomerase, or 4 hydroxybutyryl-CoA dehydratase; (u) homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4 hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2- enoyl-CoA ligase, 4-hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4 hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase; (v) succinyl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating); (w) glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating); (x) 4-aminobutyrate kinase; 4-aminobutyraldehyde dehydrogenase (phosphorylating); 4-aminobutan-1-ol dehydrogenase; and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase; (y) 4-aminobutyrate kinase; [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating) or [(4-aminobutanolyl)oxy]phosphonic acid transaminase; 4 hydroxybutyryl-phosphate dehydrogenase; and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating); (z) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5-hydroxy-2-oxopentanoic acid decarboxylase; (aa) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha ketoglutaryl-CoA reductase (alcohol forming); and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (bb) alpha-ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5 hydroxy-2-oxopentanoic acid decarboxylase; (cc) alpha-ketoglutarate 5-kinase; 2,5 dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (dd) alpha ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase; 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid decarboxylase; (ee) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase; 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (ff) glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl-CoA reductase (alcohol forming); 2-amino-5 hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2 oxopentanoic acid dehydrogenase (decarboxylation); (gg) glutamate 5-kinase; glutamate-5 semialdehyde dehydrogenase (phosphorylating); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5- hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (hh) glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl-CoA reductase; glutamate-5-semialdehyde reductase; 2 amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5 hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (ii) glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); glutamate-5-semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5 hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); (j) homoserine deaminase; 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut 2-enoyl-CoA ligase; 4-hydroxybut-2-enoyl-CoA reductase; (kk) homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4-hydroxybut-2-enoyl-CoA reductase; (11) homoserine deaminase; 4 hydroxybut-2-enoate reductase; and 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl CoA hydrolase, or 4-hydroxybutyryl-CoA ligase; (mm) (i) alpha-ketoglutarate decarboxylase; or alpha-ketoglutarate dehydrogenase and CoA-dependent succinate semialdehyde dehydrogenase; or glutamate:succinate semialdehyde transaminase and glutamate decarboxylase; (ii) 4-hydroxybutyrate dehydrogenase; (iii) 4-hydroxybutyryl-CoA transferase; or 4-hydroxybutyrate kinase and phosphotrans-4-hydroxybutyrylase; and (iv) 4 hydroxybutyryl-CoA reductase; (nn) (i) alpha-ketoglutarate decarboxylase; or succinyl-CoA synthetase and CoA-dependent succinate semialdehyde dehydrogenase; (ii) 4 hydroxybutyrate dehydrogenase; (iii) 4-hydroxybutyryl-CoA transferase; or 4 hydroxybutyrate kinase and phosphotrans-4-hydroxybutyrylase; (oo) (i) alpha-ketoglutarate decarboxylase; or glutamate dehydrogenase; glutamate decarboxylase; and deaminating 4 aminobutyrate oxidoreductase or 4-aminobutyrate transaminase; or alpha-ketoglutarate dehydrogenase and CoA-dependent succinate semialdehyde dehydrogenase; (ii) 4 hydroxybutyrate dehydrogenase; and (iii) 4-hydroxybutyrate kinase; phosphotrans-4 hydroxybutyrylase; 4-hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase; or 4-hydroxybutyrate kinase; phosphorylating 4-hydroxybutanal dehydrogenase; and 4-hydroxybutyraldehyde reductase; or 4-hydroxybutyrate kinase; phosphotrans-4 hydroxybutyrylase; and alcohol forming 4-hydroxybutyryl-CoA reductase; or 4 hydroxybutyryl-CoA transferase or 4-hydroxybutyryl-CoA hydrolase or 4-hydroxybutyryl CoA ligase; 4-hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase; or 4- hydroxybutyryl-CoA transferase or 4-hydroxybutyryl-CoA hydrolase or 4-hydroxybutyryl CoA ligase; and alcohol forming 4-hydroxybutyryl-CoA reductase; (pp) (i) glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase; glutamyl-CoA reductase; and glutamate-5-semialdehyde reductase; or glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase; and alcohol forming glutamyl-CoA reductase; or glutamate 5-kinase; phosphorylating glutamate-5-semialdehyde dehydrogenase; and glutamate-5-semialdehyde reductase; (ii) deaminating 2-amino-5-hydroxypentanoic acid oxidoreductase or 2-amino-5-hydroxypentanoic acid transaminase; and (iii) 5-hydroxy-2 oxopentanoic acid decarboxylase; and 4-hydroxybutyraldehyde reductase; or decarboxylating -hydroxy-2-oxopentanoic acid dehydrogenase; 4-hydroxybutyryl-CoA reductase; and 4 hydroxybutyraldehyde reductase; or decarboxylating 5-hydroxy-2-oxopentanoic acid dehydrogenase and alcohol forming 4-hydroxybutyryl-CoA reductase; (qq) a gamma butyrolactone pathway comprising a pathway selected from any of the pathways that produce 4-hydroxybutyryl-CoA or 4-hydroxybutyryl phosphate as shown in Figures 1, 8-13, 58, 62-63 or 72-74, wherein gamma-butyrolactone is produced enzymatically or by spontaneous chemical conversion.

[0184] In a particular embodiment, a microbial organism comprising (i) can further comprise an exogenous nucleic acid encoding an enzyme selected from a pyruvate:ferredoxin oxidoreductase, an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, an acetate kinase, a phosphotransacetylase, an acetyl-CoA synthetase, an NAD(P)H:ferredoxin oxidoreductase, ferredoxin, and combinations thereof. Additionally, a microbial organism comprising (ii) can further comprise an exogenous nucleic acid encoding an enzyme selected from an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, and combinations thereof.

[0185] In a particular embodiment, a microbial organism can comprise two, three, four, five, six or seven exogenous nucleic acids each encoding a gamma-butyrolactone pathway enzyme. For example, a microbial organism can comprise exogenous nucleic acids encoding each of the enzymes selected from a gamma-butyrolactone pathway shown in any of Figures 1, 8-13, 58, 62, 63, or 72-74, in particular pathways that produce 4-hydroxybutyryl-CoA and/or 4-hydroxybutyryl phosphate. Additionally, such a microbial organism can comprise two, three, four or five exogenous nucleic acids each encoding enzymes of (i), (ii) or (iii).

For example, such a microbial organism can comprising (i) can comprise three exogenous nucleic acids encoding ATP-citrate lyase or citrate lyase, a fumarate reductase, and an alpha ketoglutarate:ferredoxin oxidoreductase; a microbial organism comprising (ii) can comprise five exogenous nucleic acids encoding pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an H2 hydrogenase; or a microbial organism comprising (iii) can comprise two exogenous nucleic acids encoding CO dehydrogenase and H 2 hydrogenase. The invention additionally provides methods for producing gamma-butyrolactone by culturing the non-naturally occurring microbial organism under conditions and for a sufficient period of time to produce gamma-butyrolactone.

[0186] In some embodiments, the carbon feedstock and other cellular uptake sources such as phosphate, ammonia, sulfate, chloride and other halogens can be chosen to alter the isotopic distribution of the atoms present in 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone or any 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway intermediate. The various carbon feedstock and other uptake sources enumerated above will be referred to herein, collectively, as "uptake sources." Uptake sources can provide isotopic enrichment for any atom present in the product 1,4-butanediol, 4 hydroxybutyrate and/or gamma-butyrolactone or 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway intermediate, or for side products generated in reactions diverging away from a 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone pathway. Isotopic enrichment can be achieved for any target atom including, for example, carbon, hydrogen, oxygen, nitrogen, sulfur, phosphorus, chloride or other halogens.

[0187] In some embodiments, the uptake sources can be selected to alter the carbon-12, carbon-13, and carbon-14 ratios. In some embodiments, the uptake sources can be selected to alter the oxygen-16, oxygen-17, and oxygen-18 ratios. In some embodiments, the uptake sources can be selected to alter the hydrogen, deuterium, and tritium ratios. In some embodiments, the uptake sources can selected to alter the nitrogen-14 and nitrogen-15 ratios. In some embodiments, the uptake sources can be selected to alter the sulfur-32, sulfur-33, sulfur-34, and sulfur-35 ratios. In some embodiments, the uptake sources can be selected to alter the phosphorus-31, phosphorus-32, and phosphorus-33 ratios. In some embodiments, the uptake sources can be selected to alter the chlorine-35, chlorine-36, and chlorine-37 ratios.

[0188] In some embodiments, the isotopic ratio of a target atom can be varied to a desired ratio by selecting one or more uptake sources. An uptake source can be derived from a natural source, as found in nature, or from a man-made source, and one skilled in the art can select a natural source, a man-made source, or a combination thereof, to achieve a desired isotopic ratio of a target atom. An example of a man-made uptake source includes, for example, an uptake source that is at least partially derived from a chemical synthetic reaction. Such isotopically enriched uptake sources can be purchased commercially or prepared in the laboratory and/or optionally mixed with a natural source of the uptake source to achieve a desired isotopic ratio.. In some embodiments, a target isotopic ratio of an uptake source can be obtained by selecting a desired origin of the uptake source as found in nature For example, as discussed herein, a natural source can be a biobased derived from or synthesized by a biological organism or a source such as petroleum-based products or the atmosphere. In some such embodiments, a source of carbon, for example, can be selected from a fossil fuel derived carbon source, which can be relatively depleted of carbon-14, or an environmental or atmospheric carbon source, such asC0 2,which can possess a larger amount of carbon-14 than its petroleum-derived counterpart.

[0189] Isotopic enrichment is readily assessed by mass spectrometry using techniques known in the art such as Stable Isotope Ratio Mass Spectrometry (SIRMS) and Site-Specific Natural Isotopic Fractionation by Nuclear Magnetic Resonance (SNIF-NMR). Such mass spectral techniques can be integrated with separation techniques such as liquid chromatography (LC) and/or high performance liquid chromatography (HPLC).

[0190] The unstable carbon isotope carbon-14 or radiocarbon makes up for roughly 1 in 101 carbon atoms in the earth's atmosphere and has a half-life of about 5700 years. The stock of carbon is replenished in the upper atmosphere by a nuclear reaction involving cosmic rays and ordinary nitrogen (1 4N). Fossil fuels contain no carbon-14, as it decayed long ago. Burning of fossil fuels lowers the atmospheric carbon-14 fraction, the so-called "Suess effect".

[0191] Methods of determining the isotopic ratios of atoms in a compound are well known to those skilled in the art. Isotopic enrichment is readily assessed by mass spectrometry using techniques known in the art such as accelerated mass spectrometry (AMS), Stable Isotope Ratio Mass Spectrometry (SIRMS) and Site-Specific Natural Isotopic Fractionation by Nuclear Magnetic Resonance (SNIF-NMR). Such mass spectral techniques can be integrated with separation techniques such as liquid chromatography (LC), high performance liquid chromatography (HPLC) and/or gas chromatography, and the like.

[0192] In the case of carbon, ASTM D6866 was developed in the United States as a standardized analytical method for determining the biobased content of solid, liquid, and gaseous samples using radiocarbon dating by the American Society for Testing and Materials (ASTM) International. The standard is based on the use of radiocarbon dating for the determination of a product's biobased content. ASTM D6866 was first published in 2004, and the current active version of the standard is ASTM D6866-11 (effective April 1, 2011). Radiocarbon dating techniques are well known to those skilled in the art, including those described herein.

[0193] The biobased content of a compound is estimated by the ratio of carbon-14 (14C) to carbon-12 ( 1 2 C). Specifically, the Fraction Modern (Fm) is computed from the expression: Fm = (S-B)/(M-B), where B, S and M represent the1 4 C/1 2 C ratios of the blank, the sample and the modern reference, respectively. Fraction Modern is a measurement of the deviation of the 1 4 C/ 1 2C ratio of a sample from "Modern." Modern is defined as 95% of the radiocarbon concentration (in AD 1950) of National Bureau of Standards (NBS) Oxalic Acid I (i.e., standard reference materials (SRM) 4990b) normalized to6 1 3 CVpDB=-19 per mil (Olsson, The use of Oxalic acid as a Standard. in, Radiocarbon Variations and Absolute Chronology, Nobel Symposium, 12th Proc., John Wiley & Sons, New York (1970)). Mass spectrometry results, for example, measured by ASM, are calculated using the internationally agreed upon definition of 0.95 times the specific activity of NBS Oxalic Acid I (SRM 4990b) normalized to 6 13 CVPDB=-19 permil. This is equivalent to an absolute (AD 1950) 1 4 C/ 1 2 C ratio of 1.176 0.010 x 10-12 (Karlen et al., Arkiv Geofysik, 4:465-471 (1968)). The standard calculations take into account the differential uptake of one istope with respect to another, for example, the preferential uptake in biological systems ofC1 2 over C13 over C1 4 , and these corrections are reflected as a Fm corrected for 613.

[0194] An oxalic acid standard (SRM 4990b or HOx 1) was made from a crop of 1955 sugar beet. Although there were 1000 lbs made, this oxalic acid standard is no longer commercially available. The Oxalic Acid II standard (HOx 2; N.I.S.T designation SRM 4990 C) was made from a crop of 1977 French beet molasses. In the early 1980's, a group of 12 laboratories measured the ratios of the two standards. The ratio of the activity of Oxalic acid II to 1 is 1.2933+0.001 (the weighted mean). The isotopic ratio of HOx II is -17.8 per mille.

ASTM D6866-11 suggests use of the available Oxalic Acid II standard SRM 4990 C (Hox2) for the modern standard (see discussion of original vs. currently available oxalic acid standards in Mann, Radiocarbon,25(2):519-527 (1983)). A Fm= 0% represents the entire lack of carbon-14 atoms in a material, thus indicating a fossil (for example, petroleum based) carbon source. A Fm= 100%, after correction for the post-1950 injection of carbon-14 into the atmosphere from nuclear bomb testing, indicates an entirely modern carbon source. As described herein, such a "modern" source includes biobased sources.

[0195] As described in ASTM D6866, the percent modern carbon (pMC) can be greater than 100% because of the continuing but diminishing effects of the 1950s nuclear testing programs, which resulted in a considerable enrichment of carbon-14 in the atmosphere as described in ASTM D6866-11. Because all sample carbon-14 activities are referenced to a "pre-bomb" standard, and because nearly all new biobased products are produced in a post bomb environment, all pMC values (after correction for isotopic fraction) must be multiplied by 0.95 (as of 2010) to better reflect the true biobased content of the sample. A biobased content that is greater than 103% suggests that either an analytical error has occurred, or that the source of biobased carbon is more than several years old.

[0196] ASTM D6866 quantifies the biobased content relative to the material's total organic content and does not consider the inorganic carbon and other non-carbon containing substances present. For example, a product that is 50% starch-based material and 50% water would be considered to have a Biobased Content = 100% (50% organic content that is 100% biobased) based on ASTM D6866. In another example, a product that is 50% starch-based material, 25% petroleum-based, and 25% water would have a Biobased Content = 66.7% (75% organic content but only 50% of the product is biobased). In another example, a product that is 50% organic carbon and is a petroleum-based product would be considered to have a Biobased Content = 0% (50% organic carbon but from fossil sources). Thus, based on the well known methods and known standards for determining the biobased content of a compound or material, one skilled in the art can readily determine the biobased content and/or prepared downstream products that utilize of the invention having a desired biobased content.

[0197] Applications of carbon-14 dating techniques to quantify bio-based content of materials are known in the art (Currie et al., NuclearInstruments and Methods in Physics Research B, 172:281-287 (2000)). For example, carbon-14 dating has been used to quantify bio-based content in terephthalate-containing materials (Colonna et al., Green Chemistry, 13:2543-2548 (2011)). Notably, polypropylene terephthalate (PPT) polymers derived from renewable 1,3-propanediol and petroleum-derived terephthalic acid resulted in Fm values near 30% (i.e., since 3/11 of the polymeric carbon derives from renewable 1,3-propanediol and 8/11 from the fossil end member terephthalic acid) (Currie et al., supra, 2000). In contrast, polybutylene terephthalate polymer derived from both renewable 1,4-butanediol and renewable terephthalic acid resulted in bio-based content exceeding 90% (Colonna et al., supra, 2011).

[0198] Accordingly, in some embodiments, the present invention provides 1,4 butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or a 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine pathway intermediate that has a carbon-12, carbon-13, and carbon-14 ratio that reflects an atmospheric carbon, also referred to as environmental carbon, uptake source. For example, in some aspects the 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or a 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate can have an Fm value of at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least %, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least %, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or as much as 100%. In some such embodiments, the uptake source is CO 2 . In some embodiments, the present invention provides 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or a 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate that has a carbon-12, carbon-13, and carbon-14 ratio that reflects petroleum based carbon uptake source. In this aspect, the 1,4-butanediol, 4-hydroxybutyrate, gamma butyrolactone and/or putrescine or a 1,4-butanediol, 4-hydroxybutyrate, gamma butyrolactone and/or putrescine intermediate can have an Fm value of less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 2% or less than 1%. In some embodiments, the present invention provides 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine or a 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate that has a carbon-12, carbon-13, and carbon-14 ratio that is obtained by a combination of an atmospheric carbon uptake source with a petroleum-based uptake source. Using such a combination of uptake sources is one way by which the carbon-12, carbon-13, and carbon-14 ratio can be varied, and the respective ratios would reflect the proportions of the uptake sources.

[0199] Further, the present invention relates to biologically produced 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine or 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate as disclosed herein, and to the products derived therefrom, wherein the 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or a 1,4-butanediol, 4-hydroxybutyrate, gamma butyrolactone and/or putrescine intermediate has a carbon-12, carbon-13, and carbon-14 isotope ratio of about the same value as the CO 2 that occurs in the environment. For example, in some aspects the invention provides bioderived 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine or a bioderived 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate having a carbon-12 versus carbon-13 versus carbon-14 isotope ratio of about the same value as the CO 2 that occurs in the environment, or any of the other ratios disclosed herein. It is understood, as disclosed herein, that a product can have a carbon-12 versus carbon-13 versus carbon-14 isotope ratio of about the same value as the CO 2 that occurs in the environment, or any of the ratios disclosed herein, wherein the product is generated from bioderived 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine or a bioderived 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate as disclosed herein, wherein the bioderived product is chemically modified to generate a final product. Methods of chemically modifying a bioderived product of 1,4-butanediol, 4-hydroxybutyrate, gamma butyrolactone and/or putrescine, or an intermediate thereof, to generate a desired product are well known to those skilled in the art, as described herein. The invention further provides plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycraTM, nylons, and the like, having a carbon-12 versus carbon-13 versus carbon-14 isotope ratio of about the same value as the

CO 2 that occurs in the environment, wherein the plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycra T M , nylons, and the like, are generated directly from or in combination with bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or a bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate as disclosed herein.

[0200] 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine are chemicals used in commercial and industrial applications. Non-limiting examples of such applications include production of plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycra TM nylons, and the like. Moreover, 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine are also used as a raw material in the production of a wide range of products including plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycra TM nylons, and the like. Accordingly, in some embodiments, the invention provides biobased plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycraTM, nylons, and the like, comprising one or more bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate produced by a non-naturally occurring microorganism of the invention or produced using a method disclosed herein.

[0201] As used herein, the term "bioderived" means derived from or synthesized by a biological organism and can be considered a renewable resource since it can be generated by a biological organism. Such a biological organism, in particular the microbial organisms of the invention disclosed herein, can utilize feedstock or biomass, such as, sugars or carbohydrates obtained from an agricultural, plant, bacterial, or animal source. Alternatively, the biological organism can utilize atmospheric carbon. As used herein, the term "biobased" means a product as described above that is composed, in whole or in part, of a bioderived compound of the invention. A biobased or bioderived product is in contrast to a petroleum derived product, wherein such a product is derived from or synthesized from petroleum or a petrochemical feedstock.

[0202] In some embodiments, the invention provides plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycra T M , nylons, and the like, comprising bioderived 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine or bioderived 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate, wherein the bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate includes all or part of the 1,4-butanediol, 4-hydroxybutyrate, gamma butyrolactone and/or putrescine or 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate used in the production of plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycra T M , nylons, and the like,. Thus, in some aspects, the invention provides a biobased plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane polyurea copolymers, referred to as spandex, elastane orLycra T M , nylons, and the like, comprising at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or 100% bioderived 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine or bioderived 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate as disclosed herein. Additionally, in some aspects, the invention provides a biobased plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycra T M , nylons, and the like, wherein the 1,4-butanediol, 4 hydroxybutyrate, gamma-butyrolactone and/or putrescine or 1,4-butanediol, 4- hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate used in its production is a combination of bioderived and petroleum derived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or 1,4-butanediol, 4-hydroxybutyrate, gamma butyrolactone and/or putrescine intermediate. For example, a biobased plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane-polyurea copolymers, referred to as spandex, elastane orLycra T M , nylons, and the like, can be produced using 50% bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine and 50% petroleum derived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or other desired ratios such as 60%/40%, 70%/30%, 80%/20%, 90%/10%, %/5%, 100%/0%, 40%/60%, 30%/70%, 20%/80%, 10%/90% of bioderived/petroleum derived precursors, so long as at least a portion of the product comprises a bioderived product produced by the microbial organisms disclosed herein. It is understood that methods for producing plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide) and polyurethane polyurea copolymers, referred to as spandex, elastane orLycra T M , nylons, and the like, using the bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine or bioderived 1,4-butanediol, 4-hydroxybutyrate, gamma-butyrolactone and/or putrescine intermediate of the invention are well known in the art.

[0203] The invention is described herein with general reference to the metabolic reaction, reactant or product thereof, or with specific reference to one or more nucleic acids or genes encoding an enzyme associated with or catalyzing the referenced metabolic reaction, reactant or product. Unless otherwise expressly stated herein, those skilled in the art will understand that reference to a reaction also constitutes reference to the reactants and products of the reaction. Similarly, unless otherwise expressly stated herein, reference to a reactant or product also references the reaction and that reference to any of these metabolic constitutes also references the gene or genes encoding the enzymes that catalyze the referenced reaction, reactant or product. Likewise, given the well known fields of metabolic biochemistry, enzymology and genomics, reference herein to a gene or encoding nucleic acid also constitutes a reference to the corresponding encoded enzyme and the reaction it catalyzes as well as the reactants and products of the reaction.

[0204] The production of 4-HB via biosynthetic modes using the microbial organisms of the invention is particularly useful because it can produce monomeric 4-HB. The non naturally occurring microbial organisms of the invention and their biosynthesis of 4-HB and BDO family compounds also is particularly useful because the 4-HB product can be (1) secreted; (2) can be devoid of any derivatizations such as Coenzyme A; (3) avoids thermodynamic changes during biosynthesis; (4) allows direct biosynthesis of BDO, and (5) allows for the spontaneous chemical conversion of 4-HB to y-butyrolactone (GBL) in acidic pH medium. This latter characteristic also is particularly useful for efficient chemical synthesis or biosynthesis of BDO family compounds such as 1,4-butanediol and/or tetrahydrofuran (THF), for example.

[0205] Microbial organisms generally lack the capacity to synthesize 4-HB and therefore any of the compounds disclosed herein to be within the 1,4-butanediol family of compounds or known by those in the art to be within the 1,4-butanediol family of compounds. Moreover, organisms having all of the requisite metabolic enzymatic capabilities are not known to produce 4-HB from the enzymes described and biochemical pathways exemplified herein. Rather, with the possible exception of a few anaerobic microorganisms described further below, the microorganisms having the enzymatic capability to use 4-HB as a substrate to produce, for example, succinate. In contrast, the non-naturally occurring microbial organisms of the invention can generate 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine as a product. As described above, the biosynthesis of 4-HB in its monomeric form is not only particularly useful in chemical synthesis of BDO family of compounds, it also allows for the further biosynthesis of BDO family compounds and avoids altogether chemical synthesis procedures.

[0206] The non-naturally occurring microbial organisms of the invention that can produce 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine are produced by ensuring that a host microbial organism includes functional capabilities for the complete biochemical synthesis of at least one 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrscine biosynthetic pathway of the invention. Ensuring at least one requisite 4-HB, 4-HBal, 4-HBCoA or BDO biosynthetic pathway confers 4-HB biosynthesis capability onto the host microbial organism.

[0207] Several 4-HB biosynthetic pathways are exemplified herein and shown for purposes of illustration in Figure 1. Additional 4-HB and BDO pathways are described in Figures 8-13. One 4-HB biosynthetic pathway includes the biosynthesis of 4-HB from succinate (the succinate pathway). The enzymes participating in this 4-HB pathway include CoA-independent succinic semialdehyde dehydrogenase and 4-hydroxybutanoate dehydrogenase. In this pathway, CoA-independent succinic semialdehyde dehydrogenase (succinate reductase) catalyzes the reverse reaction to the arrow shown in Figure 1. Another 4-HB biosynthetic pathway includes the biosynthesis from succinate through succinyl-CoA (the succinyl-CoA pathway). The enzymes participating in this 4-HB pathway include succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase and 4 hydroxybutanoate dehydrogenase. Three other 4-HB biosynthetic pathways include the biosynthesis of 4-HB from a-ketoglutarate (the a-ketoglutarate pathways). Hence, a third 4 HB biosynthetic pathway is the biosynthesis of succinic semialdehyde through glutamate:succinic semialdehyde transaminase, glutamate decarboxylase and 4 hydroxybutanoate dehydrogenase. A fourth 4-HB biosynthetic pathway also includes the biosynthesis of 4-HB from a-ketoglutarate, but utilizes a-ketoglutarate decarboxylase to catalyze succinic semialdehyde synthesis. 4-hydroxybutanoate dehydrogenase catalyzes the conversion of succinic semialdehyde to 4-HB. A fifth 4-HB biosynthetic pathway includes the biosynthesis from a-ketoglutarate through succinyl-CoA and utilizes a-ketoglutarate dehydrogenase to produce succinyl-CoA, which funnels into the succinyl-CoA pathway described above. Each of these 4-HB biosynthetic pathways, their substrates, reactants and products are described further below in the Examples. As described herein, 4-HB can further be biosynthetically converted to BDO by inclusion of appropriate enzymes to produce BDO (see Example). Thus, it is understood that a 4-HB pathway can be used with enzymes for converting 4-HB to BDO to generate a BDO pathway.

[0208] As disclosed herein, the product 4-hydroxybutyrate, as well as other intermediates and/or products, such as succinate, are carboxylic acids, which can occur in various ionized forms, including fully protonated, partially protonated, and fully deprotonated forms. Accordingly, the suffix "-ate," or the acid form, can be used interchangeably to describe both the free acid form as well as any deprotonated form, in particular since the ionized form is known to depend on the pH in which the compound is found. It is understood that carboxylate products or intermediates includes ester forms of carboxylate products or pathway intermediates, such as 0-carboxylate and S-carboxylate esters. 0- and S carboxylates can include lower alkyl, that is C1 to C6, branched or straight chain carboxylates. Some such 0- or S-carboxylates include, without limitation, methyl, ethyl, n propyl, n-butyl, i-propyl, sec-butyl, and tert-butyl, pentyl, hexyl 0- or S-carboxylates, any of which can further possess an unsaturation, providing for example, propenyl, butenyl, pentyl, and hexenyl 0- or S-carboxylates. O-carboxylates can be the product of a biosynthetic pathway. Exemplary 0-carboxylates accessed via biosynthetic pathways can include, without limitation, methyl 4-hydroxybutyrate, ethyl 4-hydroxybutyrate, and n-propyl 4 hydroxybutyrate. Other biosynthetically accessible O-carboxylates can include medium to long chain groups, that is C7-C22, 0-carboxylate esters derived from fatty alcohols, such heptyl, octyl, nonyl, decyl, undecyl, lauryl, tridecyl, myristyl, pentadecyl, cetyl, palmitolyl, heptadecyl, stearyl, nonadecyl, arachidyl, heneicosyl, and behenyl alcohols, any one of which can be optionally branched and/or contain unsaturations. O-carboxylate esters can also be accessed via a biochemical or chemical process, such as esterification of a free carboxylic acid product or transesterification of an 0- or S-carboxylate. S-carboxylates are exemplified by CoA S-esters, cysteinyl S-esters, alkylthioesters, and various aryl and heteroaryl thioesters.

[0209] The non-naturally occurring microbial organisms of the invention can be produced by introducing expressible nucleic acids encoding one or more of the enzymes participating in one or more 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathways. Depending on the host microbial organism chosen for biosynthesis, nucleic acids for some or all of a particular 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway can be expressed. For example, if a chosen host is deficient in one or more enzymes in a desired biosynthetic pathway, for example, the succinate to 4-HB pathway, then expressible nucleic acids for the deficient enzyme(s), for example, both CoA-independent succinic semialdehyde dehydrogenase and 4-hydroxybutanoate dehydrogenase in this example, are introduced into the host for subsequent exogenous expression. Alternatively, if the chosen host exhibits endogenous expression of some pathway enzymes, but is deficient in others, then an encoding nucleic acid is needed for the deficient enzyme(s) to achieve 4-HB, 4-HBal, 4 HBCoA, BDO or putrescine biosynthesis. For example, if the chosen host exhibites endogenous CoA-independent succinic semialdehyde dehydrogenase, but is deficient in 4 hydroxybutanoate dehydrogenase, then an encoding nucleic acid is needed for this enzyme to achieve 4-HB biosynthesis. Thus, a non-naturally occurring microbial organism of the invention can be produced by introducing exogenous enzyme or protein activities to obtain a desired biosynthetic pathway or a desired biosynthetic pathway can be obtained by introducing one or more exogenous enzyme or protein activities that, together with one or more endogenous enzymes or proteins, produces a desired product such as 4-HB, 4-HBal, 4 HBCoA, BDO and/or putrescine.

[0210] In like fashion, where 4-HB biosynthesis is selected to occur through the succinate to succinyl-CoA pathway (the succinyl-CoA pathway), encoding nucleic acids for host deficiencies in the enzymes succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase and/or 4-hydroxybutanoate dehydrogenase are to be exogenously expressed in the recipient host. Selection of 4-HB biosynthesis through the a-ketoglutarate to succinic semialdehyde pathway (the a-ketoglutarate pathway) can utilize exogenous expression for host deficiencies in one or more of the enzymes for glutamate:succinic semialdehyde transaminase, glutamate decarboxylase and/or 4-hydroxybutanoate dehydrogenase, or a ketoglutarate decarboxylase and 4-hydroxybutanoate dehydrogenase. One skilled in the art can readily determine pathway enzymes for production of 4-HB or BDO, as disclosed herein.

[0211] Depending on the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway constituents of a selected host microbial organism, the non-naturally occurring microbial organisms of the invention will include at least one exogenously expressed 4-HB, 4-HB, 4-HBCoA, BDO or putrescine pathway-encoding nucleic acid and up to all encoding nucleic acids for one or more 4-HB or BDO biosynthetic pathways. For example, 4-HB, 4 HBal, 4-HBCoA, BDO or putrescine biosynthesis can be established in a host deficient in a pathway enzyme or protein through exogenous expression of the corresponding encoding nucleic acid. In a host deficient in all enzymes or proteins of a 4-HB, 4-HB, 4-HBCoA, BDO or putrescine pathway, exogenous expression of all enzyme or proteins in the pathway can be included, although it is understood that all enzymes or proteins of a pathway can be expressed even if the host contains at least one of the pathway enzymes or proteins. If desired, exogenous expression of all enzymes or proteins in a pathway for production of 4-HB, 4-HB, 4-HBCoA, BDO or putrescine can be included. For example, 4-HB biosynthesis can be established from all five pathways in a host deficient in 4-hydroxybutanoate dehydrogenase through exogenous expression of a 4-hydroxybutanoate dehydrogenase encoding nucleic acid. In contrast, 4-HB biosynthesis can be established from all five pathways in a host deficient in all eight enzymes through exogenous expression of all eight of CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate:succinic semialdehyde transaminase, glutamate decarboxylase, a-ketoglutarate decarboxylase, a-ketoglutarate dehydrogenase and 4 hydroxybutanoate dehydrogenase.

[0212] Given the teachings and guidance provided herein, those skilled in the art will understand that the number of encoding nucleic acids to introduce in an expressible form will, at least, parallel the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway deficiencies of the selected host microbial organism. Therefore, a non-naturally occurring microbial organism of the invention can have one, two, three, four, five, six, seven, eight or up to all nucleic acids encoding the enzymes disclosed herein constituting one or more 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathways. In some embodiments, the non naturally occurring microbial organisms also can include other genetic modifications that facilitate or optimize 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthesis or that confer other useful functions onto the host microbial organism. One such other functionality can include, for example, augmentation of the synthesis of one or more of the 4-HB pathway precursors such as succinate, succinyl-CoA, a-ketoglutarate, 4-aminobutyrate, glutamate, acetoacetyl-CoA, and/or homoserine.

[0213] Generally, a host microbial organism is selected such that it produces the precursor of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, either as a naturally produced molecule or as an engineered product that either provides de novo production of a desired precursor or increased production of a precursor naturally produced by the host microbial organism. For example, succinyl-CoA, a-ketoglutarate, 4-aminobutyrate, glutamate, acetoacetyl-CoA, and homoserine are produced naturally in a host organism such as E. coli. A host organism can be engineered to increase production of a precursor, as disclosed herein. In addition, a microbial organism that has been engineered to produce a desired precursor can be used as a host organism and further engineered to express enzymes or proteins of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway.

[0214] In some embodiments, a non-naturally occurring microbial organism of the invention is generated from a host that contains the enzymatic capability to synthesize 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. In this specific embodiment it can be useful to increase the synthesis or accumulation of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway product to, for example, drive 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway reactions toward 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production. Increased synthesis or accumulation can be accomplished by, for example, overexpression of nucleic acids encoding one or more of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzymes disclosed herein. Over expression of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme or enzymes can occur, for example, through exogenous expression of the endogenous gene or genes, or through exogenous expression of the heterologous gene or genes. Therefore, naturally occurring organisms can be readily generated to be non-naturally 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing microbial organisms of the invention through overexpression of one, two, three, four, five, six and so forth up to all nucleic acids encoding 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway enzymes. In addition, a non-naturally occurring organism can be generated by mutagenesis of an endogenous gene that results in an increase in activity of an enzyme in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway.

[0215] In particularly useful embodiments, exogenous expression of the encoding nucleic acids is employed. Exogenous expression confers the ability to custom tailor the expression and/or regulatory elements to the host and application to achieve a desired expression level that is controlled by the user. However, endogenous expression also can be utilized in other embodiments such as by removing a negative regulatory effector or induction of the gene's promoter when linked to an inducible promoter or other regulatory element. Thus, an endogenous gene having a naturally occurring inducible promoter can be up-regulated by providing the appropriate inducing agent, or the regulatory region of an endogenous gene can be engineered to incorporate an inducible regulatory element, thereby allowing the regulation of increased expression of an endogenous gene at a desired time. Similarly, an inducible promoter can be included as a regulatory element for an exogenous gene introduced into a non-naturally occurring microbial organism (see Examples).

[0216] "Exogenous" as it is used herein is intended to mean that the referenced molecule or the referenced activity is introduced into the host microbial organism. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material such as by integration into a host chromosome or as non-chromosomal genetic material such as a plasmid. Therefore, the term as it is used in reference to expression of an encoding nucleic acid refers to introduction of the encoding nucleic acid in an expressible form into the microbial organism. When used in reference to a biosynthetic activity, the term refers to an activity that is introduced into the host reference organism. The source can be, for example, a homologous or heterologous encoding nucleic acid that expresses the referenced activity following introduction into the host microbial organism. Therefore, the term "endogenous" refers to a referenced molecule or activity that is present in the host. Similarly, the term when used in reference to expression of an encoding nucleic acid refers to expression of an encoding nucleic acid contained within the microbial organism. The term "heterologous" refers to a molecule or activity derived from a source other than the referenced species whereas "homologous" refers to a molecule or activity derived from the host microbial organism. Accordingly, exogenous expression of an encoding nucleic acid of the invention can utilize either or both a heterologous or homologous encoding nucleic acid.

[0217] It is understood that when more than one exogenous nucleic acid is included in a microbial organism that the the more than one exogenous nucleic acids refers to the referenced encoding nucleic acid or biosynthetic activity, as discussed above. It is further understood, as disclosed herein, that such more than one exogenous nucleic acids can be introduced into the host microbial organism on separate nucleic acid molecules, on polycistronic nucleic acid molecules, or a combination thereof, and still be considered as more than one exogenous nucleic acid. For example, as disclosed herein a microbial organism can be engineered to express two or more exogenous nucleic acids encoding a desired pathway enzyme or protein. In the case where two exogenous nucleic acids encoding a desired activity are introduced into a host microbial organism, it is understood that the two exogenous nucleic acids can be introduced as a single nucleic acid, for example, on a single plasmid, on separate plasmids, can be integrated into the host chromosome at a single site or multiple sites, and still be considered as two exogenous nucleic acids. Similarly, it is understood that more than two exogenous nucleic acids can be introduced into a host organism in any desired combination, for example, on a single plasmid, on separate plasmids, can be integrated into the host chromosome at a single site or multiple sites, and still be considered as two or more exogenous nucleic acids, for example three exogenous nucleic acids. Thus, the number of referenced exogenous nucleic acids or biosynthetic activities refers to the number of encoding nucleic acids or the number of biosynthetic activities, not the number of separate nucleic acids introduced into the host organism.

[0218] Sources of encoding nucleic acids for a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme can include, for example, any species where the encoded gene product is capable of catalyzing the referenced reaction. Such species include both prokaryotic and eukaryotic organisms including, but not limited to, bacteria, including archaea and eubacteria, and eukaryotes, including yeast, plant, insect, animal, and mammal, including human. Exemplary species for such sources include, for example, Escherichia coli, Saccharomyces cerevisiae, Saccharomyces kluyveri, Clostridium kluyveri, Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium saccharoperbutylacetonicum, Clostridiumperfringens, Clostridium difficile, Clostridium botulinum, Clostridium tyrobutyricum, Clostridium tetanomorphum, Clostridium tetani, Clostridiumpropionicum, Clostridiumaminobutyricum, Clostridiumsubterminale, Clostridiumsticklandii, Ralstonia eutropha, Mycobacterium bovis, Mycobacterium tuberculosis, Porphyromonasgingivalis, Arabidopsisthaliana, Thermus thermophilus, Pseudomonas species, including Pseudomonas aeruginosa, Pseudomonasputida,Pseudomonas stutzeri, Pseudomonasfluorescens,Homo sapiens, Oryctolagus cuniculus, Rhodobacterspaeroides, Thermoanaerobacterbrockii, Metallosphaerasedula, Leuconostoc mesenteroides, Chloroflexus aurantiacus,Roseiflexus castenholzii, Erythrobacter,Simmondsia chinensis, Acinetobacter species, including Acinetobacter calcoaceticusand Acinetobacter baylyi, Porphyromonasgingivalis, Sulfolobus tokodaii, Sulfolobus solfataricus, Sulfolobus acidocaldarius,Bacillus subtilis, Bacillus cereus, Bacillus megaterium, Bacillus brevis, Bacillus pumilus, Rattus norvegicus, Klebsiella pneumonia, Klebsiella oxytoca, Euglena gracilis, Treponema denticola, Moorella thermoacetica, Thermotoga maritima, Halobacteriumsalinarum, Geobacillus stearothermophilus,Aeropyrumpernix, Sus scrofa, Caenorhabditiselegans, Corynebacteriumglutamicum, Acidaminococcusfermentans,Lactococcus lactis, Lactobacillusplantarum, Streptococcus thermophilus, Enterobacteraerogenes, Candida, Aspergillus terreus, Pedicoccuspentosaceus, Zymomonas mobilus, Acetobacter pasteurians, Kluyveromyces lactis, Eubacterium barkeri, Bacteroidescapillosus, Anaerotruncus colihominis, Natranaerobiusthermophilusm, Campylobacterjejuni,Haemophilus influenzae, Serratiamarcescens, Citrobacteramalonaticus, Myxococcus xanthus, Fusobacterium nuleatum, Penicillium chrysogenum, marine gamma proteobacterium, butyrate-producing bacterium, Nocardia iowensis, Nocardiafarcinica,Streptomyces griseus, Schizosaccharomycespombe, Geobacillus thermoglucosidasius,Salmonella typhimurium, Vibrio cholera, Heliobacterpylori,Nicotiana tabacum, Oryza sativa, Haloferax mediterranei,Agrobacterium tumefaciens, Achromobacter denitrificans, Fusobacterium nucleatum, Streptomyces clavuligenus, Acinetobacter baumanii, Mus musculus, Lachancea kluyveri, Trichomonas vaginalis, Trypanosoma brucei, Pseudomonas stutzeri, Bradyrhizobiumjaponicum,Mesorhizobium loti, Bos taurus, Nicotianaglutinosa, Vibrio vulnificus, Selenomonas ruminantium, Vibrio parahaemolyticus,Archaeoglobusfulgidus,

Haloarculamarismortui,Pyrobaculum aerophilum, Mycobacterium smegmatis MC2 155, Mycobacterium avium subsp. paratuberculosisK-10, Mycobacterium marinum M, Tsukamurella paurometabolaDSM 20162, Cyanobium PCC7001, Dictyostelium discoideum AX4, and others disclosed herein or available as source organisms for corresponding genes (see Examples). For example, microbial organisms having 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic production are exemplified herein with reference to E. coli and yeast hosts. However, with the complete genome sequence available for now more than 550 species (with more than half of these available on public databases such as the NCBI), including 395 microorganism genomes and a variety of yeast, fungi, plant, and mammalian genomes, the identification of genes encoding the requisite 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic activity for one or more genes in related or distant species, including for example, homologues, orthologs, paralogs and nonorthologous gene displacements of known genes, and the interchange of genetic alterations between organisms is routine and well known in the art. Accordingly, the metabolic alterations allowing biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and other compounds of the invention described herein with reference to a particular organism such as E. coli or yeast can be readily applied to other microorganisms, including prokaryotic and eukaryotic organisms alike. Given the teachings and guidance provided herein, those skilled in the art will know that a metabolic alteration exemplified in one organism can be applied equally to other organisms.

[0219] In some instances, such as when an alternative 4-HB, 4-HBal, BDO or putrescine biosynthetic pathway exists in an unrelated species, 4-HB, 4-HBal, BDO or putrescine biosynthesis can be conferred onto the host species by, for example, exogenous expression of a paralog or paralogs from the unrelated species that catalyzes a similar, yet non-identical metabolic reaction to replace the referenced reaction. Because certain differences among metabolic networks exist between different organisms, those skilled in the art will understand that the actual gene usage between different organisms may differ. However, given the teachings and guidance provided herein, those skilled in the art also will understand that the teachings and methods of the invention can be applied to all microbial organisms using the cognate metabolic alterations to those exemplified herein to construct a microbial organism in a species of interest that will synthesize 4-HB, such as monomeric 4-HB, 4-HBal, BDO or putrescine.

[0220] Host microbial organisms can be selected from, and the non-naturally occurring microbial organisms generated in, for example, bacteria, yeast, fungus or any of a variety of other microorganisms applicable to fermentation processes. Exemplary bacteria include species selected from Escherichiacoli, Klebsiella oxytoca, Anaerobiospirillum succiniciproducens,Actinobacillus succinogenes, Mannheimia succiniciproducens, Rhizobium etli, Bacillus subtilis, Corynebacteriumglutamicum, Gluconobacteroxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillusplantarum, Streptomyces coelicolor, Clostridiumacetobutylicum, Pseudomonasfluorescens, and Pseudomonasputida. Exemplary yeasts orfungi include species selectedfrom Saccharomyces cerevisiae, Schizosaccharomycespombe, Kluyveromyces lactis, Kluyveromyces marxianus, Aspergillus terreus, Aspergillus niger, Pichiapastoris, Rhizopus arrhizus, Rhizobus oryzae, and the like. E. coli is a particularly useful host organisms since it is a well characterized microbial organism suitable for genetic engineering. Other particularly useful host organisms include yeast such as Saccharomyces cerevisiae. It is understood that any suitable microbial host organism can be used to introduce metabolic and/or genetic modifications to produce a desired product.

[0221] Methods for constructing and testing the expression levels of a non-naturally occurring 4-HB-, 4-HBal-, 4-HBCoA-, BDO-, or putrescine-producing host can be performed, for example, by recombinant and detection methods well known in the art. Such methods can be found described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, MD (1999). 4-HB and GBL can be separated by, for example, HPLC using a Spherisorb 5 ODS1 column and a mobile phase of 70% 10 mM phosphate buffer (pH=7) and 30% methanol, and detected using a UV detector at 215 nm (Hennessy et al. 2004, J. Forensic Sci. 46(6):1-9). BDO is detected by gas chromatography or by HPLC and refractive index detector using an Aminex HPX-87H column and a mobile phase of 0.5 mM sulfuric acid (Gonzalez-Pajuelo et al., Met. Eng. 7:329-336 (2005)).

[0222] Exogenous nucleic acid sequences involved in a pathway for production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be introduced stably or transiently into a host cell using techniques well known in the art including, but not limited to, conjugation, electroporation, chemical transformation, transduction, transfection, and ultrasound transformation. For exogenous expression in E. coli or other prokaryotic cells, some nucleic acid sequences in the genes or cDNAs of eukaryotic nucleic acids can encode targeting signals such as an N-terminal mitochondrial or other targeting signal, which can be removed before transformation into prokaryotic host cells, if desired. For example, removal of a mitochondrial leader sequence led to increased expression in E. coli (Hoffmeister et al., J. Biol. Chem. 280:4329-4338 (2005)). For exogenous expression in yeast or other eukaryotic cells, genes can be expressed in the cytosol without the addition of leader sequence, or can be targeted to mitochondrion or other organelles, or targeted for secretion, by the addition of a suitable targeting sequence such as a mitochondrial targeting or secretion signal suitable for the host cells. Thus, it is understood that appropriate modifications to a nucleic acid sequence to remove or include a targeting sequence can be incorporated into an exogenous nucleic acid sequence to impart desirable properties. Furthermore, genes can be subjected to codon optimization with techniques well known in the art to achieve optimized expression of the proteins.

[0223] An expression vector or vectors can be constructed to harbor one or more 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway and/or one or more biosynthetic encoding nucleic acids as exemplified herein operably linked to expression control sequences functional in the host organism. Expression vectors applicable for use in the microbial host organisms of the invention include, for example, plasmids, phage vectors, viral vectors, episomes and artificial chromosomes, including vectors and selection sequences or markers operable for stable integration into a host chromosome. Additionally, the expression vectors can include one or more selectable marker genes and appropriate expression control sequences. Selectable marker genes also can be included that, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media. Expression control sequences can include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like which are well known in the art. When two or more exogenous encoding nucleic acids are to be co expressed, both nucleic acids can be inserted, for example, into a single expression vector or in separate expression vectors. For single vector expression, the encoding nucleic acids can be operationally linked to one common expression control sequence or linked to different expression control sequences, such as one inducible promoter and one constitutive promoter. The transformation of exogenous nucleic acid sequences involved in a metabolic or synthetic pathway can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis such as Northern blots or polymerase chain reaction (PCR) amplification of mRNA, or immunoblotting for expression of gene products, or other suitable analytical methods to test the expression of an introduced nucleic acid sequence or its corresponding gene product. It is understood by those skilled in the art that the exogenous nucleic acid is expressed in a sufficient amount to produce the desired product, and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art and as disclosed herein.

[0224] The non-naturally occurring microbial organisms of the invention are constructed using methods well known in the art as exemplified herein to exogenously express at least one nucleic acid encoding a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme in sufficient amounts to produce 4-HB, such as monomeric 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. It is understood that the microbial organisms of the invention are cultured under conditions sufficient to produce 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. Exemplary levels of expression for 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine enzymes in each pathway are described further below in the Examples. Following the teachings and guidance provided herein, the non-naturally occurring microbial organisms of the invention can achieve biosynthesis of 4-HB, such as monomeric 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine resulting in intracellular concentrations between about 0.1-200 mM or more, for example, 0.1-25 mM or more. Generally, the intracellular concentration of 4-HB, such as monomeric 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine is between about 3-150 mM or more, particularly about 5-125 mM or more, and more particularly between about 8-100 mM, for example, about 3-20mM, particularly between about 5-15 mM and more particularly between about 8-12 mM, including about 10 mM, 20 mM, 50 mM, 80 mM or more. Intracellular concentrations between and above each of these exemplary ranges also can be achieved from the non-naturally occurring microbial organisms of the invention. In particular embodiments, the microbial organisms of the invention, particularly strains such as those disclosed herein (see Examples XII-XIX and Table 28), can provide improved production of a desired product such as 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine by increasing the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and/or decreasing undesirable byproducts. Such production levels include, but are not limited to, those disclosed herein and including from about 1 gram to about 25 grams per liter, for example about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or even higher amounts of product per liter.

[0225] In addition to the culturing and fermentation conditions disclosed herein, growth condition for achieving biosynthesis of BDO, 4-HB, 4-HBCoA, 4-HBal and/or putrescine can include the addition of an osmoprotectant to the culturing conditions. In certain embodiments, the non-naturally occurring microbial organisms of the invention can be sustained, cultured or fermented as described herein in the presence of an osmoprotectant. Briefly, an osmoprotectant refers to a compound that acts as an osmolyte and helps a microbial organism as described herein survive osmotic stress. Osmoprotectants include, but are not limited to, betaines, amino acids, and the sugar trehalose. Non-limiting examples of such are glycine betaine, praline betaine, dimethylthetin, dimethylslfonioproprionate, 3 dimethylsulfonio-2-methylproprionate, pipecolic acid, dimethylsulfonioacetate, choline, L carnitine and ectoine. In one aspect, the osmoprotectant is glycine betaine. It is understood to one of ordinary skill in the art that the amount and type of osmoprotectant suitable for protecting a microbial organism described herein from osmotic stress will depend on the microbial organism used. The amount of osmoprotectant in the culturing conditions can be, for example, no more than about 0.1 mM, no more than about 0.5 mM, no more than about 1.0 mM, no more than about 1.5 mM, no more than about 2.0 mM, no more than about 2.5 mM, no more than about 3.0 mM, no more than about 5.0 mM, no more than about 7.0 mM, no more than about 10mM, no more than about 50mM, no more than about OOmM or no more than about 500mM.

[0226] In some embodiments, culture conditions include anaerobic or substantially anaerobic growth or maintenance conditions. Exemplary anaerobic conditions have been described previously and are well known in the art. Exemplary anaerobic conditions for fermentation processes are described herein and are described, for example, in U.S. publication 2009/0047719, filed August 10, 2007. Any of these conditions can be employed with the non-naturally occurring microbial organisms as well as other anaerobic conditions well known in the art. Under such anaerobic conditions or substantially anaerobic, the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producers can synthesize 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine at intracellular concentrations of 5-10 mM or more as well as all other concentrations exemplified herein. It is understood that, even though the above description refers to intracellular concentrations, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing microbial organisms can produce 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intracellularly and/or secrete the product into the culture medium.

[0227] The culture conditions can include, for example, liquid culture procedures as well as fermentation and other large scale culture procedures. As described herein, particularly useful yields of the biosynthetic products of the invention can be obtained under anaerobic or substantially anaerobic culture conditions.

[0228] As described herein, one exemplary growth condition for achieving biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine includes anaerobic culture or fermentation conditions. In certain embodiments, the non-naturally occurring microbial organisms of the invention can be sustained, cultured or fermented under anaerobic or substantially anaerobic conditions. Briefly, anaerobic conditions refers to an environment devoid of oxygen. Substantially anaerobic conditions include, for example, a culture, batch fermentation or continuous fermentation such that the dissolved oxygen concentration in the medium remains between 0 and 10% of saturation. Substantially anaerobic conditions also includes growing or resting cells in liquid medium or on solid agar inside a sealed chamber maintained with an atmosphere of less than 1% oxygen. The percent of oxygen can be maintained by, for example, sparging the culture with an N2/CO2 mixture or other suitable non-oxygen gas or gases.

[0229] The invention also provides a non-naturally occurring microbial biocatalyst including a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthetic pathways that include at least one exogenous nucleic acid encoding 4 hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4 hydroxybutyrate:CoA transferase, glutamate:succinic semialdehyde transaminase, glutamate decarboxylase, CoA-independent aldehyde dehydrogenase, CoA-dependent aldehyde dehydrogenase or alcohol dehydrogenase, wherein the exogenous nucleic acid is expressed in sufficient amounts to produce 1,4-butanediol (BDO). 4-Hydroxybutyrate:CoA transferase also is known as 4-hydroxybutyryl CoA:acetyl-CoA transferase. Additional 4-HB or BDO pathway enzymes are also disclosed herein (see Examples and Figures 8-13).

[0230] The invention further provides non-naturally occurring microbial biocatalyst including a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthetic pathways, the pathways include at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-butyrate kinase, phosphotransbutyrylase, a-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or an aldehyde/alcohol dehydrogenase, wherein the exogenous nucleic acid is expressed in sufficient amounts to produce 1,4-butanediol (BDO).

[0231] Non-naturally occurring microbial organisms also can be generated which biosynthesize BDO. As with the 4-HB producing microbial organisms of the invention, the BDO producing microbial organisms also can produce intracellularly or secret the BDO into the culture medium. Following the teachings and guidance provided previously for the construction of microbial organisms that synthesize 4-HB, additional BDO pathways can be incorporated into the 4-HB producing microbial organisms to generate organisms that also synthesize BDO and other BDO family compounds. The chemical synthesis of BDO and its downstream products are known. The non-naturally occurring microbial organisms of the invention capable of BDO biosynthesis circumvent these chemical synthesis using 4-HB as an entry point as illustrated in Figure 1. As described further below, the 4-HB producers also can be used to chemically convert 4-HB to GBL and then to BDO or THF, for example. Alternatively, the 4-HB producers can be further modified to include biosynthetic capabilities for conversion of 4-HB and/or GBL to BDO.

[0232] The additional BDO pathways to introduce into 4-HB producers include, for example, the exogenous expression in a host deficient background or the overexpression of one or more of the enzymes exemplified in Figure 1 as steps 9-13. One such pathway includes, for example, the enzyme activies necessary to carryout the reactions shown as steps 9, 12 and 13 in Figure 1, where the aldehyde and alcohol dehydrogenases can be separate enzymes or a multifunctional enzyme having both aldehyde and alcohol dehydrogenase activity. Another such pathway includes, for example, the enzyme activities necessary to carry out the reactions shown as steps 10, 11, 12 and 13 in Figure 1, also where the aldehyde and alcohol dehydrogenases can be separate enzymes or a multifunctional enzyme having both aldehyde and alcohol dehydrogenase activity. Accordingly, the additional BDO pathways to introduce into 4-HB producers include, for example, the exogenous expression in a host deficient background or the overexpression of one or more of a 4 hydroxybutyrate:CoA transferase, butyrate kinase, phosphotransbutyrylase, CoA-independent aldehyde dehydrogenase, CoA-dependent aldehyde dehydrogenase or an alcohol dehydrogenase. In the absence of endogenous acyl-CoA synthetase capable of modifying 4 HB, the non-naturally occurring BDO producing microbial organisms can further include an exogenous acyl-CoA synthetase selective for 4-HB, or the combination of multiple enzymes that have as a net reaction conversion of 4-HB into 4-HB-CoA. As exemplified further below in the Examples, butyrate kinase and phosphotransbutyrylase exhibit BDO pathway activity and catalyze the conversions illustrated in Figure 1 with a 4-HB substrate. Therefore, these enzymes also can be referred to herein as 4-hydroxybutyrate kinase and phosphotranshydroxybutyrylase respectively.

[0233] Exemplary alcohol and aldehyde dehydrogenases that can be used for these in vivo conversions from 4-HB to BDO are listed below in Table 1.

Table 1. Alcohol and Aldehyde Dehydrogenases for Conversion of 4-HB to BDO.

ALCOHOL DEHYDROGENASES ec:1.1.1.41 isocitrate dehydrogenase (NAD+) ec:1.1.1.42 isocitrate dehydrogenase ec:1.1.1.1 alcohol dehydrogenase (NADP+) ec:1.1.1.2 alcohol dehydrogenase(NADP+) ec:1.1.1.54 allyl-alcohol dehydrogenase ec:1.1.1.2 alcoh dehydrogenase dol NADP+) ec:1.1.1.55 lactaldehyde reductase (NADPH) ec:1.1.1.4 (R,R)-butanedioldehydrogenase ec:1.1.1.56 ribitol 2-dehydrogenase ec:1.1.1.5 acetoin dehydrogenase ec:1.1.1.59 3-hydroxypropionate ec:1.1.1.6 glyceroldehydrogenase dehydrogenase ec:1.1.1.7 propanediol-phosphate ec:1.1.1.60 2-hydroxy-3-oxopropionate dehydrogenasereuts ec:1.1.1.8 glycerol-3-phosphate reductase dehydrogenase (NAD+) ec:1.1.1.61 4-hydroxyburate ec:1.1.1.11 D-arabinitol 4-dehydrogenase dehydrogenase ec:1.1.1.12 L-arabinitol 4-dehydrogenase ec:1.1.1.66 omega-hydroxydecanoate ec:1.1.1.13 L-arabinitol 2-dehydrogenase dehydrogenase ec:1.1.1.14 L-iditol 2-dehydrogenase ec:1.1.1.67 mannitol 2-dehydrogenase ec:1.1.1.15 D-iditol 2-dehydrogenase ec:1.1.1.71 alcohol dehydrogenase ec:1.1.1.16 galactitol 2-dehydrogenase [NAD(P)+] ec:1.1.1.16 gaatitol 2-dhrogae ec:1.1.1.72 glycerol dehydrogenase ec:1.1.1.17 mannitol-1-phosphate5- (NADP+) dehydrogenase ec:1.1.1.73 octanol dehydrogenase ec:1.1.1.18 inositol2-dehydrogenase ec:1.1.1.75 (R)-aminopropanol ec:1.1.1.21 aldehyde reductasedeyrgns ec:1.1.1.23 histidinol dehydrogenase dehydrogenase ec:1.1.1.26 glyoxylate reductase ec:1.1.1.77 lactaldehyde reductase ec:1.1.1.27 L-lactate dehydrogenase ec:1.1.1.78 methylglyoxal reductase ec:1.1.1.28 D-lactate dehydrogenase (et ec:1.1.1.29 glycerate dehydrogenase (NADH-dependent) ec:1.1.1.29 glyc dehydro ase ec:1.1.1.79 glyoxylate reductase (NADP+) ec:1.1.1.30 3-hydroxybutyrate ec:1.1.1.80 isopropanol dehydrogenase dehydrogenase(ND+ ec:1.1.1.31 3 -hydroxyisobutyrate (NADP+) dehydrogenase ec:1.1.1.81 hydroxypyruvate reductase ec:1.1.1.35 3-hydoxyacyl-CoA ec:1.1.1.82 malate dehydrogenase (NADP+) dehydrogenase ec:1.1.1.83 D-malate dehydrogenase ec:1.1.1.36 acetoacetyl-CoAreductase (decarboxylating) ec:1.1.1.36 aeceyCoAedtase ec:1.1.1.84 dimethylmalate dehydrogenase ec:1.1.1.37 malate dehydrogenase ec:1.1.1.85 3-isopropylmalate dehydrogenase ec:1.1.1.38 malatedehydrogenase ec:1.1.1.86 ketol-acid reductoisomerase (oxaloacetate-decarboxylating) ec:1.1.1.87 homoisocitrate dehydrogenase ec:1.1.1.39 malatedehydrogenase ec:1.1.1.88 hydroxymethylglutaryl-CoA (decarboxylating)reuts ec:1.1.1.40 malate dehydrogenase reductase (oxaloacetate-decarboxylating) (NADP+) ec:1.1.1.90 aryl-alcoholdehydrogenase ec:1.1.1.91 aryl-alcohol dehydrogenase ec:1.1.1.222 (R)-4-hydroxyphenyllactate (NADP+) dehydrogenase ec:1.1.1.92 oxaloglycolate reductase ec:1.1.1.223 isopiperitenol dehydrogenase (decarboxylating) ec:1.1.1.226 4 ec:1.1.1.94 glycerol-3-phosphate dehydrogenase hydroxycyclohexanecarboxylate dehydrogenase

[NAD(P)+] ec:1.1.1.229 diethyl 2-methyl-3-oxosuccinate ec:1.1.1.95 phosphoglycerate dehydrogenase reductase ec:1.1.1.97 3-hydroxybenzyl-alcohol ec:1.1.1.237 hydroxyphenylpyruvate dehydrogenase reductase ec:1.1.1.101 acylglycerone-phosphate ec:1.1.1.244 methanol dehydrogenase reductase ec:1.1.1.245 cyclohexanol dehydrogenase ec:1.1.1.103 L-threonine 3-dehydrogenase ec:1.1.1.250 D-arabinitol 2-dehydrogenase ec:1.1.1.104 4-oxoproline reductase ec:1.1.1.251 galactitol 1-phosphate 5 ec:1.1.1.105 retinol dehydrogenase dehydrogenase ec:1.1.1.110 indolelactate dehydrogenase ec:1.1.1.255 mannitol dehydrogenase ec:1.1.1.112 indanol dehydrogenase ec:1.1.1.256 fluoren-9-ol dehydrogenase ec:1.1.1.113 L-xylose 1-dehydrogenase ec:1.1.1.257 4 ec:1.1.1.129 L-threonate 3-dehydrogenase (hydroxymethyl)benzenesulfonate dehydrogenase ec:1.1.1.137 ribitol-5-phosphate 2- ec:1.1.1.258 6-hydroxyhexanoate dehydrogenase dehydrogenase ec:1.1.1.138 mannitol 2-dehydrogenase ec:1.1.1.259 3-hydroxypimeloyl-CoA (NADP+) dehydrogenase ec:1.1.1.140 sorbitol-6-phosphate 2- ec:1.1.1.261 glycerol-1-phosphate dehydrogenase dehydrogenase [NAD(P)+] ec:1.1.1.142 D-pinitol dehydrogenase ec:1.1.1.265 3-methylbutanal reductase ec:1.1.1.143 sequoyitol dehydrogenase ec:1.1.1.283 methylglyoxal reductase ec:1.1.1.144 perillyl-alcohol dehydrogenase (NADPH-dependent) ec:1.1.1.156 glycerol 2-dehydrogenase ec:1.1.1.286 isocitrate-homoisocitrate (NADP+) dehydrogenase ec:1.1.1.157 3-hydroxybutyryl-CoA ec:1.1.1.287 D-arabinitol dehydrogenase dehydrogenase (NADP+) ec:1.1.1.163 cyclopentanol dehydrogenase butanol dehydrogenase ec:1.1.1.164 hexadecanol dehydrogenase ec:1.1.1.165 2-alkyn-1-ol dehydrogenase ALDEHYDE DEHYDROGENASES ec:1.1.1.166 hydroxycyclohexanecarboxylate ec:1.2.1.2 formate dehydrogenase dehydrogenase ec:1.2.1.3 aldehyde dehydrogenase (NAD+) ec:1.1.1.167 hydroxymalonate dehydrogenase ec:1.2.1.4 aldehyde dehydrogenase ec:1.1.1.174 cyclohexane-1,2-diol (NADP+) dehydrogenase ec:1.2.1.5 aldehyde dehydrogenase ec:1.1.1.177 glycerol-3-phosphate 1- [NAD(P)+] dehydrogenase (NADP+) ec:1.2.1.7 benzaldehyde dehydrogenase ec:1.1.1.178 3-hydroxy-2-methylbutyryl-CoA (NADP+) dehydrogenase ec:1.2.1.8 betaine-aldehyde dehydrogenase ec:1.1.1.185 L-glycol dehydrogenase ec:1.2.1.9 glyceraldehyde-3-phosphate ec:1.1.1.190 indole-3-acetaldehyde reductase dehydrogenase (NADP+) (NADH) ec:1.2.1.10 acetaldehyde dehydrogenase ec:1.1.1.191 indole-3-acetaldehyde reductase (acetylating) (NADPH) ec:1.2.1.11 aspartate-semialdehyde ec:1.1.1.192 long-chain-alcohol dehydrogenase dehydrogenase ec:1.2.1.12 glyceraldehyde-3-phosphate ec:1.1.1.194 coniferyl-alcohol dehydrogenase dehydrogenase (phosphorylating) ec:1.1.1.195 cinnamyl-alcohol dehydrogenase ec:1.2.1.13 glyceraldehyde-3-phosphate ec:1.1.1.198 (+)-borneol dehydrogenase dehydrogenase (NADP+) (phosphorylating) ec:1.1.1.202 1,3-propanediol dehydrogenase ec:1.2.1.15 malonate-semialdehyde ec:1.1.1.207 (-)-menthol dehydrogenase dehydrogenase ec:1.1.1.208 (+)-neomenthol dehydrogenase ec:1.2.1.16 succinate-semialdehyde ec:1.1.1.216 farnesol dehydrogenase dehydrogenase [NAD(P)+] ec:1.1.1.217 benzyl-2-methyl-hydroxybutyrate ec:1.2.1.17 glyoxylate dehydrogenase dehydrogenase (acylating) ec:1.2.1.18 malonate-semialdehyde ec:1.2.1.45 4-carboxy-2-hydroxymuconate dehydrogenase (acetylating) 6-semialdehyde dehydrogenase ec:1.2.1.19 aminobutyraldehyde ec:1.2.1.46 formaldehyde dehydrogenase dehydrogenase ec:1.2.1.47 4 ec:1.2.1.20 glutarate-semialdehyde trimethylammoniobutyraldehyde dehydrogenase dehydrogenase ec:1.2.1.48 long-chain-aldehyde ec:1.2.1.21 glycolaldehyde dehydrogenase dehydrogenase ec:1.2.1.22 lactaldehyde dehydrogenase ec:1.2.1.49 2-oxoaldehyde dehydrogenase ec:1.2.1.23 2-oxoaldehyde dehydrogenase (NADP+) (NAD+) ec:1.2.1.51 pyruvate dehydrogenase ec:1.2.1.24 succinate-semialdehyde (NADP+) dehydrogenase ec:1.2.1.52 oxoglutarate dehydrogenase ec:1.2.1.25 2-oxoisovalerate dehydrogenase (NADP+) (acylating) ec:1.2.1.53 4-hydroxyphenylacetaldehyde ec:1.2.1.26 2,5-dioxovalerate dehydrogenase dehydrogenase ec:1.2.1.27 methylmalonate-semialdehyde ec:1.2.1.57 butanal dehydrogenase dehydrogenase (acylating) ec:1.2.1.58 phenylglyoxylate dehydrogenase ec:1.2.1.28 benzaldehyde dehydrogenase (acylating) (NAD+) ec:1.2.1.59 glyceraldehyde-3-phosphate ec:1.2.1.29 aryl-aldehyde dehydrogenase dehydrogenase (NAD(P)+) (phosphorylating) ec:1.2.1.30 aryl-aldehyde dehydrogenase ec:1.2.1.62 4-formylbenzenesulfonate (NADP+) dehydrogenase ec:1.2.1.31 L-aminoadipate-semialdehyde ec:1.2.1.63 6-oxohexanoate dehydrogenase dehydrogenase ec:1.2.1.64 4-hydroxybenzaldehyde ec:1.2.1.32 aminomuconate-semialdehyde dehydrogenase dehydrogenase ec:1.2.1.65 salicylaldehyde dehydrogenase ec:1.2.1.36 retinal dehydrogenase ec:1.2.1.66 mycothiol-dependent ec:1.2.1.39 phenylacetaldehyde formaldehyde dehydrogenase dehydrogenase ec:1.2.1.67 vanillin dehydrogenase ec:1.2.1.41 glutamate-5-semialdehyde ec:1.2.1.68 coniferyl-aldehyde dehydrogenase dehydrogenase ec:1.2.1.42 hexadecanaldehydrogenase ec:1.2.1.69 fluoroacetaldehyde (acylating) dehydrogenase ec:1.2.1.43 formate dehydrogenase (NADP+) ec:1.2.1.71 succinylglutamate-semialdehyde dehydrogenase

[0234] Other exemplary enzymes and pathways are disclosed herein (see Examples). Furthermore, it is understood that enzymes can be utilized for carry out reactions for which the substrate is not the natural substrate. While the activity for the non-natural substrate may be lower than the natural substrate, it is understood that such enzymes can be utilized, either as naturally occurring or modified using the directed evolution or adaptive evolution, as disclosed herein (see also Examples).

[0235] BDO production through any of the pathways disclosed herein are based, in part, on the identification of the appropriate enzymes for conversion of precursors to BDO. A number of specific enzymes for several of the reaction steps have been identified. For those transformations where enzymes specific to the reaction precursors have not been identified, enzyme candidates have been identified that are best suited for catalyzing the reaction steps.

Enzymes have been shown to operate on a broad range of substrates, as discussed below. In addition, advances in the field of protein engineering also make it feasible to alter enzymes to act efficiently on substrates, even if not a natural substrate. Described below are several examples of broad-specificity enzymes from diverse classes suitable for a BDO pathway as well as methods that have been used for evolving enzymes to act on non-natural substrates.

[0236] A key class of enzymes in BDO pathways is the oxidoreductases that interconvert ketones or aldehydes to alcohols (1.1.1). Numerous exemplary enzymes in this class can operate on a wide range of substrates. An alcohol dehydrogenase (1.1.1.1) purified from the soil bacterium Brevibacterium sp KU 1309 (Hirano et al., J. Biosc. Bioeng. 100:318-322 (2005)) was shown to operate on a plethora of aliphatic as well as aromatic alcohols with high activities. Table 2 shows the activity of the enzyme and its Km on different alcohols. The enzyme is reversible and has very high activity on several aldehydes also (Table 3).

Table 2. Relative activities of an alcohol dehydrogenase from Brevibacterium sp KU to oxidize various alcohols.

Substrate Relative Activity Km (0%) (mM) 2-Phenylethanol 100* 0.025 (S)-2-Phenylpropanol 156 0.157 (R)-2-Phenylpropanol 63 0.020 Bynzyl alcohol 199 0.012 3-Phenylpropanol 135 0.033 Ethanol 76 1-Butanol 111 1-Octanol 101 1-Dodecanol 68 1-Phenylethanol 46 1 2-Propanol 54 1

*The activity of 2-phenylethanol, corresponding to 19.2 U/mg, was taken as 100%.

Table 3. Relative activities of an alcohol dehydrogenase from Brevibacterium sp KU 1309 to reduce various carbonyl compounds.

Substrate Relative Activity Km (%) (mM) Phenylacetaldehyde 100 0.261 2-Phenylpropionaldehyde 188 0.864 1-Octylaldehyde 87 Acetophenone 0

[0237] Lactate dehydrogenase (1.1.1.27) from Ralstonia eutropha is another enzyme that has been demonstrated to have high activities on several 2-oxoacids such as 2-oxobutyrate, 2 oxopentanoate and 2-oxoglutarate (a C5 compound analogous to 2-oxoadipate) (Steinbuchel and Schlegel, Eur. J. Biochem. 130:329-334 (1983)). Column 2 in Table 4 demonstrates the activities of ldhA from R. eutropha (formerly A. eutrophus) on different substrates (Steinbuchel and Schlegel, supra, 1983).

Table 4. The in vitro activity of R. eutropha ldhA (Steinbuchel and Schlegel, supra, 1983) on different substrates and compared with that on pyruvate.

Substrate Activity (%) of L(+)-lactate L(+)-lactate D(-)-lactate dehydrogenase dehydrogenase dehydrogenase from A. from rabbit from L. eutrophus muscle leichmanii Glyoxylate 8.7 23.9 5.0 Pyruvate 100.0 100.0 100.0 2-Oxobutyrate 107.0 18.6 1.1 2-Oxovalerate 125.0 0.7 0.0 3-Methyl-2- 28.5 0.0 0.0 oxobutyrate 3-Methyl-2- 5.3 0.0 0.0 oxovalerate 4-Methyl-2- 39.0 1.4 1.1 oxopentanoate Oxaloacetate 0.0 33.1 23.1 2-Oxoglutarate 79.6 0.0 0.0 3-Fluoropyruvate 33.6 74.3 40.0

[0238] Oxidoreductases that can convert 2-oxoacids to their acyl-CoA counterparts (1.2.1) have been shown to accept multiple substrates as well. For example, branched-chain 2-keto-acid dehydrogenase complex (BCKAD), also known as 2-oxoisovalerate dehydrogenase (1.2.1.25), participates in branched-chain amino acid degradation pathways, converting 2-keto acids derivatives of valine, leucine and isoleucine to their acyl-CoA derivatives and C02. In some organisms including Rattus norvegicus (Paxton et al., Biochem. J. 234:295-303 (1986)) and Saccharomyces cerevisiae (Sinclair et al., Biochem. Mol Biol. Int. 32:911-922 (1993), this complex has been shown to have a broad substrate range that includes linear oxo-acids such as 2-oxobutanoate and alpha-ketoglutarate, in addition to the branched-chain amino acid precursors.

[0239] Members of yet another class of enzymes, namely aminotransferases (2.6.1), have been reported to act on multiple substrates. Aspartate aminotransferase (aspAT) from Pyrococcus fursious has been identified, expressed in E. coli and the recombinant protein characterized to demonstrate that the enzyme has the highest activities towards aspartate and alpha-ketoglutarate but lower, yet significant activities towards alanine, glutamate and the aromatic amino acids (Ward et al., Archaea 133-141 (2002)). In another instance, an aminotransferase indentified from Leishmania mexicana and expressed in E. coli (Vernal et al., FEMS Microbiol. Lett. 229:217-222 (2003)) was reported to have a broad substrate specificity towards tyrosine (activity considered 100% on tyrosine), phenylalanine (90%), tryptophan (85%), aspartate (30%), leucine (25%) and methionine (25%), respectively (Vernal et al., Mol. Biochem. Parasitol 96:83-92 (1998)). Similar broad specificity has been reported for a tyrosine aminotransferase from Trypanosoma cruzi, even though both of these enzymes have a sequence homology of only 6%. The latter enzyme can accept leucine, methionine as well as tyrosine, phenylalanine, tryptophan and alanine as efficient amino donors (Nowicki et al., Biochim. Biophys. Acta 1546: 268-281 (2001)).

[0240] CoA transferases (2.8.3) have been demonstrated to have the ability to act on more than one substrate. Specifically, a CoA transferase was purified from Clostridium acetobutylicum and was reported to have the highest activities on acetate, propionate, and butyrate. It also had significant activities with valerate, isobutyrate, and crotonate (Wiesenborn et al., Appl. Environ. Microbiol. 55:323-329 (1989)). In another study, the E. coli enzyme acyl-CoA:acetate-CoA transferase, also known as acetate-CoA transferase (EC 2.8.3.8), has been shown to transfer the CoA moiety to acetate from a variety of branched and linear acyl-CoA substrates, including isobutyrate (Matthies and Schink, App. Environm. Microbiol. 58:1435-1439 (1992)), valerate (Vanderwinkel et al., Biochem. Biophys. Res Commun. 33:902-908 (1968b)) and butanoate (Vanderwinkel et al., Biochem. Biophys. Res Commun. 33:902-908(1968a).

[0241] Other enzyme classes additionally support broad substrate specificity for enzymes. Some isomerases (5.3.3) have also been proven to operate on multiple substrates. For example, L-rhamnose isomerase from Pseudomonas stutzeri catalyzes the isomerization between various aldoalses and ketoses (Yoshida et al., J. Mol. Biol. 365:1505-1516 (2007)). These include isomerization between L-rhamnose and L-rhamnulose, L-mannose and L fructose, L-xylose and L-xylulose, D-ribose and D-ribulose, and D-allose and D-psicose.

[0242] In yet another class of enzymes, the phosphotransferases (2.7.1), the homoserine kinase (2.7.1.39) from E. coli that converts L-homoserine to L-homoserine phosphate, was found to phosphorylate numerous homoserine analogs. In these substrates, the carboxyl functional group at the R-position had been replaced by an ester or by a hydroxymethyl group (Huo and Viola, Biochemistry 35:16180-16185 (1996)). Table 5 demonstrates the broad substrate specificity of this kinase.

Table 5. The substrate specificity of homoserine kinase.

Substrate kcat % kcat Km (mM) kcat/Km L-homoserine 18.3 0.1 100 0.14 0.04 184 17 D-homoserine 8.3 1.1 32 31.8 7.2 0.26 0.03 L-aspartate P- 2.1 0.1 8.2 0.28 0.02 7.5 0.3 semialdehyde L-2-amino-1,4- 2.0 0.5 7.9 11.6 6.5 0.17 0.06 butanediol L-2-amino-5- 2.5 0.4 9.9 1.1 0.5 2.3 0.3 hydroxyvalerate L-homoserine methyl 14.7 2.6 80 4.9 2.0 3.0 0.6 ester L-homoserine ethyl 13.6 0.8 74 1.9 0.5 7.2 1.7 ester L-homoserine 13.6 1.4 74 1.2 0.5 11.3 1.1 isopropyl ester L-homoserine n- 14.0 0.4 76 3.5 0.4 4.0 1.2 propyl ester L-homoserine isobutyl 16.4 0.8 84 6.9 1.1 2.4 0.3 ester L-homserine n-butyl 29.1 1.2 160 5.8 0.8 5.0 0.5 ester

[0243] Another class of enzymes useful in BDO pathways is the acid-thiol ligases (6.2.1). Like enzymes in other classes, certain enzymes in this class have been determined to have broad substrate specificity. For example, acyl CoA ligase from Pseudomonas putida has been demonstrated to work on several aliphatic substrates including acetic, propionic, butyric, valeric, hexanoic, heptanoic, and octanoic acids and on aromatic compounds such as phenylacetic and phenoxyacetic acids (Fernandez-Valverde et al., Appl. Environ. Microbiol. 59:1149-1154 (1993)). A related enzyme, malonyl CoA synthetase (6.3.4.9) from Rhizobium trifolii could convert several diacids, namely, ethyl-, propyl-, allyl-, isopropyl-, dimethyl-, cyclopropyl-, cyclopropylmethylene-, cyclobutyl-, and benzyl-malonate into their corresponding monothioesters (Pohl et al., J. Am. Chem. Soc. 123:5822-5823 (2001)). Similarly, decarboxylases (4.1.1) have also been found with broad substrate ranges. Pyruvate decarboxylase (PDC), also termed keto-acid decarboxylase, is a key enzyme in alcoholic fermentation, catalyzing the decarboxylation of pyruvate to acetaldehyde. The enzyme isolated from Saccharomyces cerevisiae has a broad substrate range for aliphatic 2-keto acids including 2-ketobutyrate, 2-ketovalerate, and 2-phenylpyruvate (Li and Jordan, Biochemistry 38:10004-10012 (1999)). Similarly, benzoylformate decarboxylase has a broad substrate range and has been the target of enzyme engineering studies. The enzyme from Pseudomonas putida has been extensively studied and crystal structures of this enzyme are available (Polovnikova et al., Biochemistry 42:1820-1830 (2003); Hasson et al., Biochemistry 37:9918-9930 (1998)). Branched chain alpha-ketoacid decarboxylase (BCKA) has been shown to act on a variety of compounds varying in chain length from 3 to 6 carbons (Oku and Kaneda, J. Biol. Chem. 263:18386-18396 (1998); Smit et al., Appl. Environ. Microbiol. 71:303-311 (2005b)). The enzyme in Lactococcus lactis has been characterized on a variety of branched and linear substrates including 2-oxobutanoate, 2-oxohexanoate, 2 oxopentanoate, 3-methyl-2-oxobutanoate, 4-methyl-2-oxobutanoate and isocaproate (Smit et al., Appl. Environ. Microbiol. 71:303-311 (2005a).

[0244] Interestingly, enzymes known to have one dominant activity have also been reported to catalyze a very different function. For example, the cofactor-dependent phosphoglycerate mutase (5.4.2.1) from Bacillus stearothermophilus and Bacillus subtilis is known to function as a phosphatase as well (Rigden et al., Protein Sci. 10:1835-1846 (2001)). The enzyme from B. stearothermophilus is known to have activity on several substrates, including 3-phosphoglycerate, alpha-napthylphosphate, p-nitrophenylphosphate, AMP, fructose-6-phosphate, ribose-5-phosphate and CMP.

[0245] In contrast to these examples where the enzymes naturally have broad substrate specificities, numerous enzymes have been modified using directed evolution to broaden their specificity towards their non-natural substrates. Alternatively, the substrate preference of an enzyme has also been changed using directed evolution. Therefore, it is feasible to engineer a given enzyme for efficient function on a natural, for example, improved efficiency, or a non-natural substrate, for example, increased efficiency. For example, it has been reported that the enantioselectivity of a lipase from Pseudomonas aeruginosa was improved significantly (Reetz et al., Agnew. Chem. Int. Ed Engl. 36:2830-2832 (1997)). This enzyme hydrolyzed p-nitrophenyl 2-methyldecanoate with only 2% enantiomeric excess (ee) in favor of the (S)-acid. However, after four successive rounds of error-prone mutagenesis and screening, a variant was produced that catalyzed the requisite reaction with 81% ee (Reetz et al., Agnew. Chem. Int. Ed Engl. 36:2830-2832 (1997)).

[0246] Directed evolution methods have been used to modify an enzyme to function on an array of non-natural substrates. The substrate specificity of the lipase in P. aeruginosa was broadened by randomization of amino acid residues near the active site. This allowed for the acceptance of alpha-substituted carboxylic acid esters by this enzyme (Reetz et al., Agnew. Chem. Int. Ed Engl. 44:4192-4196 (2005)). In another successful modification of an enzyme, DNA shuffling was employed to create an Escherichia coli aminotransferase that accepted P-branched substrates, which were poorly accepted by the wild-type enzyme (Yano et al., Proc. Nat. Acad. Sci. U.S.A. 95:5511-5515 (1998)). Specifically, at the end of four rounds of shuffling, the activity of aspartate aminotransferase for valine and 2-oxovaline increased by up to five orders of magnitude, while decreasing the activity towards the natural substrate, aspartate, by up to 30-fold. Recently, an algorithm was used to design a retro aldolase that could be used to catalyze the carbon-carbon bond cleavage in a non-natural and non-biological substrate, 4-hydroxy-4-(6-methoxy-2-naphthyl)-2-butanone (Jiang et al., Science 319:1387-1391 (2008)). These algorithms used different combinations of four different catalytic motifs to design new enzyme, and 20 of the selected designs for experimental characterization had four-fold improved rates over the uncatalyzed reaction (Jiang et al., Science 319:1387-1391 (2008)). Thus, not only are these engineering approaches capable of expanding the array of substrates on which an enzyme can act, but they allow the design and construction of very efficient enzymes. For example, a method of DNA shuffling (random chimeragenesis on transient templates or RACHITT) was reported to lead to an engineered monooxygenase that had an improved rate of desulfurization on complex substrates as well as 20-fold faster conversion of a non-natural substrate (Coco et al., Nat. Biotechnol. 19:354-359 (2001)). Similarly, the specific activity of a sluggish mutant triosephosphate isomerase enzyme was improved up to 19-fold from 1.3 fold (Hermes et al., Proc. Nat. Acad. Sci. U.S.A. 87:696-700 1990)). This enhancement in specific activity was accomplished by using random mutagenesis over the whole length of the protein and the improvement could be traced back to mutations in six amino acid residues.

[0247] The effectiveness of protein engineering approaches to alter the substrate specificity of an enzyme for a desired substrate has also been demonstrated in several studies. Isopropylmalate dehydrogenase from Thermus thermophilus was modified by changing residues close to the active site so that it could now act on malate and D-lactate as substrates (Fujita et al., Biosci. Biotechnol. Biochem. 65:2695-2700 (2001)). In this study as well as in others, it was pointed out that one or a few residues could be modified to alter the substrate specificity. For example, the dihydroflavonol 4-reductase for which a single amino acid was changed in the presumed substrate-binding region could preferentially reduce dihydrokaempferol (Johnson et al., Plant. J. 25:325-333 (2001)). The substrate specificity of a very specific isocitrate dehydrogenase from Escherichia coli was changed form isocitrate to isopropylmalate by changing one residue in the active site (Doyle et al., Biochemistry :4234-4241 (2001)). Similarly, the cofactor specificity of a NAD+-dependent 1,5 hydroxyprostaglandin dehydrogenase was altered to NADP+ by changing a few residues near the N-terminal end (Cho et al., Arch. Biochem. Biophys. 419:139-146 (2003)). Sequence analysis and molecular modeling analysis were used to identify the key residues for modification, which were further studied by site-directed mutagenesis.

[0248] Numerous examples exist spanning diverse classes of enzymes where the function of enzyme was changed to favor one non-natural substrate over the natural substrate of the enzyme. A fucosidase was evolved from a galactosidase in E. coli by DNA shuffling and screening (Zhang et al., Proc. Natl Acad. Sci. U.S.A. 94:4504-4509 (1997)). Similarly, aspartate aminotransferase from E. coli was converted into a tyrosine aminotransferase using homology modeling and site-directed mutagenesis (Onuffer and Kirsch, Protein Sci., 4:1750 1757 (1995)). Site-directed mutagenesis of two residues in the active site of benzoylformate decarboxylase from P. putida reportedly altered the affinity (Km) towards natural and non natural substrates (Siegert et al., Protein Eng Des Sel 18:345-357 (2005)). Cytochrome c peroxidase (CCP) from Saccharomyces cerevisiae was subjected to directed molecular evolution to generate mutants with increased activity against the classical peroxidase substrate guaiacol, thus changing the substrate specificity of CCP from the protein cytochrome c to a small organic molecule. After three rounds of DNA shuffling and screening, mutants were isolated which possessed a 300-fold increased activity against guaiacol and up to 1000-fold increased specificity for this substrate relative to that for the natural substrate (Iffland et al., Biochemistry 39:10790-10798 (2000)).

[0249] In some cases, enzymes with different substrate preferences than either of the parent enzymes have been obtained. For example, biphenyl-dioxygenase-mediated degradation of polychlorinated biphenyls was improved by shuffling genes from two bacteria,

Pseudomonas pseudoalcaligens and Burkholderia cepacia (Kumamaru et al., Nat. Biotechnol. 16:663-666 (1998)). The resulting chimeric biphenyl oxygenases showed different substrate preferences than both the parental enzymes and enhanced the degradation activity towards related biphenyl compounds and single aromatic ring hydrocarbons such as toluene and benzene which were originally poor substrates for the enzyme.

[0250] In addition to changing enzyme specificity, it is also possible to enhance the activities on substrates for which the enzymes naturally have low activities. One study demonstrated that amino acid racemase from P. putida that had broad substrate specificity (on lysine, arginine, alanine, serine, methionine, cysteine, leucine and histidine among others) but low activity towards tryptophan could be improved significantly by random mutagenesis (Kino et al., Appl. Microbiol. Biotechnol. 73:1299-1305 (2007)). Similarly, the active site of the bovine BCKAD was engineered to favor alternate substrate acetyl-CoA (Meng and Chuang, Biochemistry 33:12879-12885 (1994)). An interesting aspect of these approaches is that even if random methods have been applied to generate these mutated enzymes with efficacious activities, the exact mutations or structural changes that confer the improvement in activity can be identified. For example, in the aforementioned study, the mutations that facilitated improved activity on tryptophan was traced back to two different positions.

[0251] Directed evolution has also been used to express proteins that are difficult to express. For example, by subjecting horseradish peroxidase to random mutagenesis and gene recombination, mutants were identified that had more than 14-fold higher activity than the wild type (Lin et al., Biotechnol. Prog. 15:467-471 (1999)).

[0252] Another example of directed evolution shows the extensive modifications to which an enzyme can be subjected to achieve a range of desired functions. The enzyme lactate dehydrogenase from Bacillus stearothermophilus was subjected to site-directed mutagenesis, and three amino acid substitutions were made at sites that were believed to determine the specificity towards different hydroxyacids (Clarke et al., Biochem. Biophys. Res. Commun. 148:15-23 (1987)). After these mutations, the specificity for oxaloacetate over pyruvate was increased to 500 in contrast to the wild type enzyme that had a catalytic specificity for pyruvate over oxaloacetate of 1000. This enzyme was further engineered using site-directed mutagenesis to have activity towards branched-chain substituted pyruvates (Wilks et al., Biochemistry 29:8587-8591 (1990)). Specifically, the enzyme had a 55-fold improvement in Kcat for alpha-ketoisocaproate. Three structural modifications were made in the same enzyme to change its substrate specificity from lactate to malate. The enzyme was highly active and specific towards malate (Wilks et al., Science 242:1541-1544 (1988)). The same enzyme from B. stearothermophilus was subsequently engineered to have high catalytic activity towards alpha-keto acids with positively charged side chains, such as those containing ammonium groups (Hogan et al., Biochemistry 34:4225-4230 (1995)). Mutants with acidic amino acids introduced at position 102 of the enzyme favored binding of such side chain ammonium groups. The results obtained proved that the mutants showed up to 25 fold improvements in kcat/Km values for omega-amino-alpha-keto acid substrates. Interestingly, this enzyme was also structurally modified to function as a phenyllactate dehydrogenase instead of a lactate dehydrogenase (Wilks et al., Biochemistry 31:7802-7806 1992). Restriction sites were introduced into the gene for the enzyme which allowede a region of the gene to be excised. This region coded for a mobile surface loop of the polypeptide (residues 98-110) which normally seals the active site from bulk solvent and is a major determinant of substrate specificity. The variable length and sequence loops were inserted so that hydroxyacid dehydrogenases with altered substrate specificities were generated. With one longer loop construction, activity with pyruvate was reduced one million-fold but activity with phenylpyruvate was largely unaltered. A switch in specificity (kcat/Km) of 390,000-fold was achieved. The 1700:1 selectivity of this enzyme for phenylpyruvate over pyruvate is that required in a phenyllactate dehydrogenase. The studies described above indicate that various approaches of enzyme engineering can be used to obtain enzymes for the BDO pathways as disclosed herein.

[0253] As disclosed herein, biosynthetic pathways to 1,4-butanediol from a number of central metabolic intermediates are can be utilized, including acetyl-CoA, succinyl-CoA, alpha-ketoglutarate, glutamate, 4-aminobutyrate, and homoserine. Acetyl-CoA, succinyl CoA and alpha-ketoglutarate are common intermediates of the tricarboxylic acid (TCA) cycle, a series of reactions that is present in its entirety in nearly all living cells that utilize oxygen for cellular respiration and is present in truncated forms in a number of anaerobic organisms. Glutamate is an amino acid that is derived from alpha-ketoglutarate via glutamate dehydrogenase or any of a number of transamination reactions (see Figure 8B). 4 aminobutyrate can be formed by the decarboxylation of glutamate (see Figure 8B) or from acetoacetyl-CoA via the pathway disclosed in Figure 9C. Acetoacetyl-CoA is derived from the condensation of two acetyl-CoA molecules by way of the enzyme, acetyl-coenzyme A acetyltransferase, or equivalently, acetoacetyl-coenzyme A thiolase. Homoserine is an intermediate in threonine and methionine metabolism, formed from oxaloacetate via aspartate. The conversion of oxaloacetate to homoserine requires one NADH, two NADPH, and one ATP.

[0254] Pathways other than those exemplified above also can be employed to generate the biosynthesis of BDO in non-naturally occurring microbial organisms. In one embodiment, biosynthesis can be achieved using a L-homoserine to BDO pathway (see Figure 13). This pathway has a molar yield of 0.90 mol/mol glucose, which appears restricted by the availability of reducing equivalents. A second pathway synthesizes BDO from acetoacetyl-CoA and is capable of achieving the maximum theoretical yield of 1.091 mol/mol glucose (see Figure 9). Implementation of either pathway can be achieved by introduction of two exogenous enzymes into a host organism such as E. coli, and both pathways can additionally complement BDO production via succinyl-CoA. Pathway enzymes, thermodynamics, theoretical yields and overall feasibility are described further below.

[0255] A homoserine pathway also can be engineered to generate BDO-producing microbial organisms. Homoserine is an intermediate in threonine and methionine metabolism, formed from oxaloacetate via aspartate. The conversion of oxaloacetate to homoserine requires one NADH, two NADPH, and one ATP (Figure 2). Once formed, homoserine feeds into biosynthetic pathways for both threonine and methionine. In most organisms, high levels of threonine or methionine feedback to repress the homoserine biosynthesis pathway (Caspi et al., Nucleic Acids Res. 34:D511-D516 (1990)).

[0256] The transformation of homoserine to 4-hydroxybutyrate (4-HB) can be accomplished in two enzymatic steps as described herein. The first step of this pathway is deamination of homoserine by a putative ammonia lyase. In step 2, the product alkene, 4 hydroxybut-2-enoate is reduced to 4-HB by a putative reductase at the cost of one NADH. 4 HB can then be converted to BDO.

[0257] Enzymes available for catalyzing the above transformations are disclosed herein. For example, the ammonia lyase in step 1 of the pathway closely resembles the chemistry of aspartate ammonia-lyase (aspartase). Aspartase is a widespread enzyme in microorganisms, and has been characterized extensively (Viola, R.E., Mol. Biol. 74:295-341 (2008)). The crystal structure of the E. coli aspartase has been solved (Shi et al., Biochemistry 36:9136-

9144 (1997)), so it is therefore possible to directly engineer mutations in the enzyme's active site that would alter its substrate specificity to include homoserine. The oxidoreductase in step 2 has chemistry similar to several well-characterized enzymes including fumarate reductase in the E. coli TCA cycle. Since the thermodynamics of this reaction are highly favorable, an endogenous reductase with broad substrate specificity will likely be able to reduce 4-hydroxybut-2-enoate. The yield of this pathway under anaerobic conditions is 0.9 mol BDO per mol glucose.

[0258] The succinyl-CoA pathway was found to have a higher yield due to the fact that it is more energetically efficient. The conversion of one oxaloacetate molecule to BDO via the homoserine pathway will require the expenditure of 2 ATP equivalents. Because the conversion of glucose to two oxaloacetate molecules can generate a maximum of 3 ATP molecules assuming PEP carboxykinase to be reversible, the overall conversion of glucose to BDO via homoserine has a negative energetic yield. As expected, if it is assumed that energy can be generated via respiration, the maximum yield of the homoserine pathway increases to 1.05 mol/mol glucose which is 96% of the succinyl-CoA pathway yield. The succinyl-CoA pathway can channel some of the carbon flux through pyruvate dehydrogenase and the oxidative branch of the TCA cycle to generate both reducing equivalents and succinyl-CoA without an energetic expenditure. Thus, it does not encounter the same energetic difficulties as the homoserine pathway because not all of the flux is channeled through oxaloacetate to succinyl-CoA to BDO. Overall, the homoserine pathway demonstrates a high-yielding route to BDO.

[0259] An acetoacetate pathway also can be engineered to generate BDO-producing microbial organisms. Acetoacetate can be formed from acetyl-CoA by enzymes involved in fatty acid metabolism, including acetyl-CoA acetyltransferase and acetoacetyl-CoA transferase. Biosynthetic routes through acetoacetate are also particularly useful in microbial organisms that can metabolize single carbon compounds such as carbon monoxide, carbon dioxide or methanol to form acetyl-CoA.

[0260] A three step route from acetoacetyl-CoA to 4-aminobutyrate (see Figure 9C) can be used to synthesize BDO through acetoacetyl-CoA. 4-Aminobutyrate can be converted to succinic semialdehyde as shown in Figure 8B. Succinic semialdehyde, which is one reduction step removed from succinyl-CoA or one decarboxylation step removed from a ketoglutarate, can be converted to BDO following three reductions steps (Figure 1). Briefly, step 1 of this pathway involves the conversion of acetoacetyl-CoA to acetoacetate by, for example, the E. coli acetoacetyl-CoA transferase encoded by the atoA and atoD genes (Hanai et al., Appl. Environ. Microbiol. 73: 7814-7818 (2007)). Step 2 of the acetoacetyl-CoA biopathway entails conversion of acetoacetate to 3-aminobutanoate by an O aminotransferase. The o-amino acid:pyruvate aminotransferase (o-APT) from Alcaligens denitrificans was overexpressed in E. coli and shown to have a high activity toward 3 aminobutanoate in vitro (Yun et al., Appl. Environ. Microbiol. 70:2529-2534 (2004)).

[0261] In step 2, a putative aminomutase shifts the amine group from the 3- to the 4 position of the carbon backbone. An aminomutase performing this function on 3 aminobutanoate has not been characterized, but an enzyme from Clostridium sticklandii has a very similar mechanism. The enzyme, D-lysine-5,6-aminomutase, is involved in lysine biosynthesis.

[0262] The synthetic route to BDO from acetoacetyl-CoA passes through 4 aminobutanoate, a metabolite in E. coli that is normally formed from decarboxylation of glutamate. Once formed, 4-aminobutanoate can be converted to succinic semialdehyde by 4 aminobutanoate transaminase (2.6.1.19), an enzyme which has been biochemically characterized.

[0263] One consideration for selecting candidate enzymes in this pathway is the stereoselectivity of the enzymes involved in steps 2 and 3. The o-ABT in Alcaligens denitrificans is specific to the L-stereoisomer of 3-aminobutanoate, while D-lysine-5,6 aminomutase likely requires the D-stereoisomer. If enzymes with complementary stereoselectivity are not initially found or engineered, a third enzyme can be added to the pathway with racemase activity that can convert L-3-aminobutanoate to D-3-aminobutanoate. While amino acid racemases are widespread, whether these enzymes can function on O amino acids is not known.

[0264] The maximum theoretical molar yield of this pathway under anaerobic conditions is 1.091 mol/mol glucose. In order to generate flux from acetoacetyl-CoA to BDO it was necessary to assume that acetyl-CoA:acetoacetyl-CoA transferase is reversible. The function of this enzyme in E. coli is to metabolize short-chain fatty acids by first converting them into thioesters.

[0265] While the operation of acetyl-CoA:acetoacetyl-CoA transferase in the acetate consuming direction has not been demonstrated experimentally in E. coli, studies on similar enzymes in other organisms support the assumption that this reaction is reversible. The enzyme butyryl-CoA:acetate:CoA transferase in gut microbes Roseburia sp. and F. prasnitzii operates in the acetate utilizing direction to produce butyrate (Duncan et al., Appl. Environ. Microbiol 68:5186-5190 (2002)). Another very similar enzyme, acetyl:succinate CoA transferase in Trypanosoma brucei, also operates in the acetate utilizing direction. This reaction has a ArxnG close to equilibrium, so high concentrations of acetate can likely drive the reaction in the direction of interest. At the maximum theoretical BDO production rate of 1.09 mol/mol glucose simulations predict that E. coli can generate 1.098 mol ATP per mol glucose with no fermentation byproducts. This ATP yield should be sufficient for cell growth, maintenance, and production. The acetoacetatyl-CoA biopathway is a high-yielding route to BDO from acetyl-CoA.

[0266] Therefore, in addition to any of the various modifications exemplified previously for establishing 4-HB biosynthesis in a selected host, the BDO producing microbial organisms can include any of the previous combinations and permutations of 4-HB pathway metabolic modifications as well as any combination of expression for CoA-independent aldehyde dehydrogenase, CoA-dependent aldehyde dehydrogenase or an alcohol dehydrogenase or other enzymes disclosed herein to generate biosynthetic pathways for GBL and/or BDO. Therefore, the BDO producers of the invention can have exogenous expression of, for example, one, two, three, four, five, six, seven, eight, nine, or up to all enzymes corresponding to any of the 4-HB pathway and/or any of the BDO pathway enzymes disclosed herein.

[0267] Design and construction of the genetically modified microbial organisms is carried out using methods well known in the art to achieve sufficient amounts of expression to produce BDO. In particular, the non-naturally occurring microbial organisms of the invention can achieve biosynthesis of BDO resulting in intracellular concentrations between about 0.1-200 mM or more, such as about 0.1-25 mM or more, as discussed above. For example, the intracellular concentration of BDO is between about 3-20mM, particularly between about 5-15 mM and more particularly between about 8-12 mM, including about 10 mM or more. Intracellular concentrations between and above each of these exemplary ranges also can be achieved from the non-naturally occurring microbial organisms of the invention.

As with the 4-HB producers, the BDO producers also can be sustained, cultured or fermented under anaerobic conditions.

[0268] The invention further provides a method for the production of 4-HB. The method includes culturing a non-naturally occurring microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway comprising at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate:succinic semialdehyde transaminase, -ketoglutarate decarboxylase, or glutamate decarboxylase under substantially anaerobic conditions for a sufficient period of time to produce monomeric 4-hydroxybutanoic acid (4-HB). The method can additionally include chemical conversion of 4-HB to GBL and to BDO or THF, for example.

[0269] Additionally provided is a method for the production of 4-HB. The method includes culturing a non-naturally occurring microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway including at least one exogenous nucleic acid encoding 4 hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase or a-ketoglutarate decarboxylase under substantially anaerobic conditions for a sufficient period of time to produce monomeric 4-hydroxybutanoic acid (4 HB). The 4-HB product can be secreted into the culture medium.

[0270] Further provided is a method for the production of BDO. The method includes culturing a non-naturally occurring microbial biocatalyst or microbial organism, comprising a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthetic pathways, the pathways including at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-hydroxybutyrate kinase, phosphotranshydroxybutyrylase, a-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or an aldehyde/alcohol dehydrogenase for a sufficient period of time to produce 1,4-butanediol (BDO). The BDO product can be secreted into the culture medium.

[0271] Additionally provided are methods for producing BDO by culturing a non naturally occurring microbial organism having a BDO pathway of the invention. The BDO pathway can comprise at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, or 4-hydroxybutyryl CoA dehydrogenase (see Example VII and Table 17).

[0272] Alternatively, the BDO pathway can compre at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4 aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating) or 4 aminobutan-1-ol transaminase (see Example VII and Table 18).

[0273] In addition, the invention provides a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4-aminobutan-1-ol transaminase, [(4 aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4 aminobutanolyl)oxy]phosphonic acid transaminase, 4-hydroxybutyryl-phosphate dehydrogenase, or 4-hydroxybutyraldehyde dehydrogenase (phosphorylating) (see Example VII and Table 19).

[0274] The invention further provides a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising alpha-ketoglutarate 5-kinase, 2,5 dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2 oxopentanoic acid decarboxylase, or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation)(see Example VIII and Table 20).

[0275] The invention additionally provides a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5-kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl-CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5-hydroxypentanoic acid transaminase, 5-hydroxy-2 oxopentanoic acid decarboxylase, 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation)(see Example IX and Table 21).

[0276] The invention additionally includes a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising 3-hydroxybutyryl-CoA dehydrogenase, 3 hydroxybutyryl-CoA dehydratase, vinylacetyl-CoA A-isomerase, or 4-hydroxybutyryl-CoA dehydratase (see Example X and Table 22).

[0277] Also provided is a method for producing BDO, comprising culturing a non naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4 hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2 enoyl-CoA ligase, 4-hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4 hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase (see Example XI and Table 23).

[0278] The invention additionally provides a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising succinyl-CoA reductase (alcohol forming), 4 hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, 4-hydroxybutanal dehydrogenase (phosphorylating). Such a BDO pathway can further comprise succinyl-CoA reductase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4 hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

[0279] Also provided is a method for producing BDO, comprising culturing a non naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4 hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, 4-hydroxybutanal dehydrogenase (phosphorylating).

[0280] The invention additionally provides methods of producing a desired product using the genetically modified organisms disclosed herein that allow improved production of a desired product such as BDO by increasing the product or decreasing undesirable byproducts. Thus, the invention provides a method for producing 1,4-butanediol (BDO), comprising culturing the non-naturally occurring microbial organisms disclosed herein under conditions and for a sufficient period of time to produce BDO. In one embodiment, the invention provides a method of producing BDO using a non-naturally occurring microbial organism, comprising a microbial organism having a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO. In one embodiment, the microbial organism is genetically modified to express exogenous succinyl-CoA synthetase (see Example XII). For example, the succinyl-CoA synthetase can be encoded by an Escherichia coli sucCD genes.

[0281] In another embodiment, the microbial organism is genetically modified to express exogenous alpha-ketoglutarate decarboxylase (see Example XIII). For example, the alpha ketoglutarate decarboxylase can be encoded by the Mycobacterium bovis sucA gene. In still another embodiment, the microbial organism is genetically modified to express exogenous succinate semialdehyde dehydrogenase and 4-hydroxybutyrate dehydrogenase and optionally 4-hydroxybutyryl-CoA/acetyl-CoA transferase (see Example XIII). For example, the succinate semialdehyde dehydrogenase (CoA-dependent), 4-hydroxybutyrate dehydrogenase and 4-hydroxybutyryl-CoA/acetyl-CoA transferase can be encoded by Porphyromonas gingivalis W83 genes. In an additional embodiment, the microbial organism is genetically modified to express exogenous butyrate kinase and phosphotransbutyrylase (see Example XIII). For example, the butyrate kinase and phosphotransbutyrylase can be encoded by Clostridium acetobutilicum bukI and ptb genes.

[0282] In yet another embodiment, the microbial organism is genetically modified to express exogenous 4-hydroxybutyryl-CoA reductase (see Example XIII). For example, the 4-hydroxybutyryl-CoA reductase can be encoded by Clostridium beijerinckii ald gene. Additionally, in an embodiment of the invention, the microbial organism is genetically modified to express exogenous 4-hydroxybutanal reductase (see Example XIII). For example, the 4-hydroxybutanal reductase can be encoded by Geobacillus thermoglucosidasius adh1 gene. In another embodiment, the microbial organism is genetically modified to express exogenous pyruvate dehydrogenase subunits (see Example XIV). For example, the exogenous pyruvate dehydrogenase can be NADH insensitive. The pyruvate dehydrogenase subunit can be encoded by the Klebsiella pneumonia lpdA gene. In a particular embodiment, the pyruvate dehydrogenase subunit genes of the microbial organism can be under the control of a pyruvate formate lyase promoter.

[0283] In still another embodiment, the microbial organism is genetically modified to disrupt a gene encoding an aerobic respiratory control regulatory system (see Example XV). For example, the disruption can be of the arcA gene. Such an organism can further comprise disruption of a gene encoding malate dehydrogenase. In a further embodiment, the microbial organism is genetically modified to express an exogenous NADH insensitive citrate synthase(see Example XV). For example, the NADH insensitive citrate synthase can be encoded by gltA, such as an R163L mutant of gltA. In still another embodiment, the microbial organism is genetically modified to express exogenous phosphoenolpyruvate carboxykinase (see Example XVI). For example, the phosphoenolpyruvate carboxykinase can be encoded by an Haemophilus influenza phosphoenolpyruvate carboxykinase gene. It is understood that strains exemplified herein for improved production of BDO can similarly be used, with appropriate modifications, to produce other desired products, for example, 4 hydroxybutyrate or other desired products disclosed herein.

[0284] The invention additionally provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4 hydroxybutanal pathway comprising succinyl-CoA reductase (aldehyde forming); 4 hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (see Figure 58, steps A-C D). The invention also provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate decarboxylase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (Figure 58, steps B-C-D).

[0285] The invention further provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4 hydroxybutanal pathway comprising succinate reductase; 4-hydroxybutyrate dehydrogenase, and 4-hydroxybutyrate reductase (see Figure 62, steps F-C-D). In yet another embodiment, the invention provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase or glutamate transaminase and glutamate decarboxylase and 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (see Figure 62, steps B or ((J or K)-L-(M or N))-C-D).

[0286] The invention also provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4 hydroxybutanal pathway comprising alpha-ketoglutarate reductase; 5-hydroxy-2 oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate decarboxylase (see Figure 62, steps X-Y-Z). The invention furthur provides a method for producing 4-hydroxybutyryl CoA by culturing a non-naturally occurring microbial organism, comprising a 4 hydroxybutyryl-CoA pathway comprising at least one exogenous nucleic acid encoding a 4 hydroxybutyryl-CoA pathway enzyme expressed in a sufficient amount to produce 4 hydroxybutyryl-CoA, the 4-hydroxybutyryl-CoA pathway comprising alpha-ketoglutarate reductase; 5-hydroxy-2-oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate dehydrogenase (decarboxylation) (see Figure 62, steps X-Y-AA).

[0287] The invention additionally provides a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising succinate reductase; 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4 aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps F-M/N-C-D/E). In still another embodiment, the invention provides a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate decarboxylase; 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps B-M/N-C-D/E). The invention additionally provides a method for producing putrescine by culturing a non naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising glutamate dehydrogenase or glutamate transaminase; glutamate decarboxylase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps J/K-L-C-D/E).

[0288] The invention provides in another embodiment a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate reductase; 5-amino-2-oxopentanoate dehydrogenase or 5-amino-2 oxopentanoate transaminase; 5-amino-2-oxopentanoate decarboxylase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps O-P/Q-R-D/E). Also provided is a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate reductase; 5 amino-2-oxopentanoate dehydrogenase or 5-amino-2-oxopentanoate transaminase; ornithine dehydrogenase or ornithine transaminase; and ornithine decarboxylase (see Figure 63, steps O-P/Q-S/T-U). It is understood that a microbial organism comprising any of the pathways disclosed herein can be used to produce a a desired product or intermediate, including 4-HB, 4-HBal, BDO or putrescine.

[0289] It is understood that, in methods of the invention, any of the one or more exogenous nucleic acids can be introduced into a microbial organism to produce a non naturally occurring microbial organism of the invention. The nucleic acids can be introduced so as to confer, for example, a 4-HB, BDO, THF or GBL biosynthetic pathway onto the microbial organism. Alternatively, encoding nucleic acids can be introduced to produce an intermediate microbial organism having the biosynthetic capability to catalyze some of the required reactions to confer 4-HB, BDO, THF or GBL biosynthetic capability. For example, a non-naturally occurring microbial organism having a 4-HB biosynthetic pathway can comprise at least two exogenous nucleic acids encoding desired enzymes, such as the combination of 4-hydroxybutanoate dehydrogenase and a-ketoglutarate decarboxylase; 4 hydroxybutanoate dehydrogenase and CoA-independent succinic semialdehyde dehydrogenase; 4-hydroxybutanoate dehydrogenase and CoA-dependent succinic semialdehyde dehydrogenase; CoA-dependent succinic semialdehyde dehydrogenase and succinyl-CoA synthetase; succinyl-CoA synthetase and glutamate decarboxylase, and the like. Thus, it is understood that any combination of two or more enzymes of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the invention. Similarly, it is understood that any combination of three or more enzymes of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the invention, for example, 4-hydroxybutanoate dehydrogenase, a-ketoglutarate decarboxylase and CoA dependent succinic semialdehyde dehydrogenase; CoA-independent succinic semialdehyde dehydrogenase and succinyl-CoA synthetase; 4-hydroxybutanoate dehydrogenase, CoA dependent succinic semialdehyde dehydrogenase and glutamate:succinic semialdehyde transaminase, and so forth, as desired, so long as the combination of enzymes of the desired biosynthetic pathway results in production of the corresponding desired product.

[0290] Similarly, for example, with respect to any one or more exogenous nucleic acids introduced to confer BDO production, a non-naturally occurring microbial organism having a BDO biosynthetic pathway can comprise at least two exogenous nucleic acids encoding desired enzymes, such as the combination of 4-hydroxybutanoate dehydrogenase and a ketoglutarate decarboxylase; 4-hydroxybutanoate dehydrogenase and 4-hydroxybutyryl CoA:acetyl-CoA transferase; 4-hydroxybutanoate dehydrogenase and butyrate kinase; 4 hydroxybutanoate dehydrogenase and phosphotransbutyrylase; 4-hydroxybutyryl CoA:acetyl-CoA transferase and aldehyde dehydrogenase; 4-hydroxybutyryl CoA:acetyl CoA transferase and alcohol dehydrogenase; 4-hydroxybutyryl CoA:acetyl-CoA transferase and an aldehyde/alcohol dehydrogenase, 4-aminobutyrate-CoA transferase and 4 aminobutyryl-CoA transaminase; 4-aminobutyrate kinase and 4-aminobutan-1-ol oxidoreductase (deaminating), and the like. Thus, it is understood that any combination of two or more enzymes of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the invention. Similarly, it is understood that any combination of three or more enzymes of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the invention, for example, 4-hydroxybutanoate dehydrogenase, a ketoglutarate decarboxylase and 4-hydroxybutyryl CoA:acetyl-CoA transferase; 4 hydroxybutanoate dehydrogenase, butyrate kinase and phosphotransbutyrylase; 4 hydroxybutanoate dehydrogenase, 4-hydroxybutyryl CoA:acetyl-CoA transferase and aldehyde dehydrogenase; 4-hydroxybutyryl CoA:acetyl-CoA transferase, aldehyde dehydrogenase and alcohol dehydrogenase; butyrate kinase, phosphotransbutyrylase and an aldehyde/alcohol dehydrogenase; 4-aminobutyryl-CoA hydrolase, 4-aminobutyryl-CoA reductase and 4-amino butan-1-ol transaminase; 3-hydroxybutyryl-CoA dehydrogenase, 3 hydroxybutyryl-CoA dehydratase and 4-hydroxybutyryl-CoA dehydratase, and the like. Similarly, any combination of four, five or more enzymes of a biosynthetic pathway as disclosed herein can be included in a non-naturally occurring microbial organism of the invention, as desired, so long as the combination of enzymes of the desired biosynthetic pathway results in production of the corresponding desired product.

[0291] Any of the non-naturally occurring microbial organisms described herein can be cultured to produce and/or secrete the biosynthetic products of the invention. For example, the 4-HB producers can be cultured for the biosynthetic production of 4-HB. The 4-HB can be isolated or be treated as described below to generate GBL, THF and/or BDO. Similarly, the BDO producers can be cultured for the biosynthetic production of BDO. The BDO can be isolated or subjected to further treatments for the chemical synthesis of BDO family compounds, as disclosed herein.

[0292] The growth medium can include, for example, any carbohydrate source which can supply a source of carbon to the non-naturally occurring microorganism. Such sources include, for example, sugars such as glucose, sucrose, xylose, arabinose, galactose, mannose, fructose and starch. Other sources of carbohydrate include, for example, renewable feedstocks and biomass. Exemplary types of biomasses that can be used as feedstocks in the methods of the invention include cellulosic biomass, hemicellulosic biomass and lignin feedstocks or portions of feedstocks. Such biomass feedstocks contain, for example, carbohydrate substrates useful as carbon sources such as glucose, sucrose, xylose, arabinose, galactose, mannose, fructose and starch. Given the teachings and guidance provided herein, those skilled in the art will understand that renewable feedstocks and biomass other than those exemplified above also can be used for culturing the microbial organisms of the invention for the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and other compounds of the invention.

[0293] Accordingly, given the teachings and guidance provided herein, those skilled in the art will understand that a non-naturally occurring microbial organism can be produced that secretes the biosynthesized compounds of the invention when grown on a carbon source such as a carbohydrate. Such compounds include, for example, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and any of the intermediates metabolites in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathways and/or the combined 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathways. All that is required is to engineer in one or more of the enzyme activities shown in Figure1 to achieve biosynthesis of the desired compound or intermediate including, for example, inclusion of some or all of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathways. Accordingly, the invention provides a non-naturally occurring microbial organism that secretes 4-HB when grown on a carbohydrate, secretes BDO when grown on a carbohydrate and/or secretes any of the intermediate metabolites shown in Figures 1, 8-13, 58, 62, 63 or 72-74 when grown on a carbohydrate. A BDO producing microbial organisms of the invention can initiate synthesis from, for example, succinate, succinyl-CoA, a-ketogluterate, succinic semialdehyde, 4-HB, 4 hydroxybutyrylphosphate, 4-hydroxybutyryl-CoA (4-HB-CoA) and/or 4 hydroxybutyraldehyde.

[0294] In some embodiments, culture conditions include anaerobic or substantially anaerobic growth or maintenance conditions. Exemplary anaerobic conditions have been described previously and are well known in the art. Exemplary anaerobic conditions for fermentation processes are described below in the Examples. Any of these conditions can be employed with the non-naturally occurring microbial organisms as well as other anaerobic conditions well known in the art. Under such anaerobic conditions, the 4-HB, 4-HBal, 4 HBCoA, BDO or putrescine producers can synthesize monomeric 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, respectively, at intracellular concentrations of 5-10 mM or more as well as all other concentrations exemplified previously.

[0295] A number of downstream compounds also can be generated for the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing non-naturally occurring microbial organisms of the invention. With respect to the 4-HB producing microbial organisms of the invention, monomeric 4-HB and GBL exist in equilibrium in the culture medium. The conversion of 4 HB to GBL can be efficiently accomplished by, for example, culturing the microbial organisms in acid pH medium. A pH less than or equal to 7.5, in particular at or below pH 5.5, spontaneously converts 4-HB to GBL.

[0296] The resultant GBL can be separated from 4-HB and other components in the culture using a variety of methods well known in the art. Such separation methods include, for example, the extraction procedures exemplified in the Examples as well as methods which include continuous liquid-liquid extraction, pervaporation, membrane filtration, membrane separation, reverse osmosis, electrodialysis, distillation, crystallization, centrifugation, extractive filtration, ion exchange chromatography, size exclusion chromatography, adsorption chromatography, and ultrafiltration. All of the above methods are well known in the art. Separated GBL can be further purified by, for example, distillation.

[0297] Another down stream compound that can be produced from the 4-HB producing non-naturally occurring microbial organisms of the invention includes, for example, BDO. This compound can be synthesized by, for example, chemical hydrogenation of GBL. Chemical hydrogenation reactions are well known in the art. One exemplary procedure includes the chemical reduction of 4-HB and/or GBL or a mixture of these two components deriving from the culture using a heterogeneous or homogeneous hydrogenation catalyst together with hydrogen, or a hydride-based reducing agent used stoichiometrically or catalytically, to produce 1,4-butanediol.

[0298] Other procedures well known in the art are equally applicable for the above chemical reaction and include, for example, WO No. 82/03854 (Bradley, et al.), which describes the hydrogenolysis of gamma-butyrolactone in the vapor phase over a copper oxide and zinc oxide catalyst. British Pat. No. 1,230,276, which describes the hydrogenation of gamma-butyrolactone using a copper oxide-chromium oxide catalyst. The hydrogenation is carried out in the liquid phase. Batch reactions also are exemplified having high total reactor pressures. Reactant and product partial pressures in the reactors are well above the respective dew points. British Pat. No. 1,314,126, which describes the hydrogenation of gamma butyrolactone in the liquid phase over a nickel-cobalt-thorium oxide catalyst. Batch reactions are exemplified as having high total pressures and component partial pressures well above respective component dew points. British Pat. No. 1,344,557, which describes the hydrogenation of gamma-butyrolactone in the liquid phase over a copper oxide-chromium oxide catalyst. A vapor phase or vapor-containing mixed phase is indicated as suitable in some instances. A continuous flow tubular reactor is exemplified using high total reactor pressures. British Pat. No. 1,512,751, which describes the hydrogenation of gamma butyrolactone to 1,4-butanediol in the liquid phase over a copper oxide-chromium oxide catalyst. Batch reactions are exemplified with high total reactor pressures and, where determinable, reactant and product partial pressures well above the respective dew points. U.S. Pat. No. 4,301,077, which describes the hydrogenation to 1,4-butanediol of gamma butyrolactone over a Ru-Ni-Co-Zn catalyst. The reaction can be conducted in the liquid or gas phase or in a mixed liquid-gas phase. Exemplified are continuous flow liquid phase reactions at high total reactor pressures and relatively low reactor productivities. U.S. Pat. No. 4,048,196, which describes the production of 1,4-butanediol by the liquid phase hydrogenation of gamma-butyrolactone over a copper oxide-zinc oxide catalyst. Further exemplified is a continuous flow tubular reactor operating at high total reactor pressures and high reactant and product partial pressures. And U.S. Patent No. 4,652,685, which describes the hydrogenation of lactones to glycols.

[0299] A further downstream compound that can be produced form the 4-HB producing microbial organisms of the invention includes, for example, THF. This compound can be synthesized by, for example, chemical hydrogenation of GBL. One exemplary procedure well known in the art applicable for the conversion of GBL to THF includes, for example, chemical reduction of 4-HB and/or GBL or a mixture of these two components deriving from the culture using a heterogeneous or homogeneous hydrogenation catalyst together with hydrogen, or a hydride-based reducing agent used stoichiometrically or catalytically, to produce tetrahydrofuran. Other procedures well know in the art are equally applicable for the above chemical reaction and include, for example, U.S. Patent No. 6,686,310, which describes high surface area sol-gel route prepared hydrogenation catalysts. Processes for the reduction of maleic acid to tetrahydrofuran (THF) and 1,4-butanediol (BDO) and for the reduction of gamma butyrolactone to tetrahydrofuran and 1,4-butanediol also are described.

[0300] The culture conditions can include, for example, liquid culture procedures as well as fermentation and other large scale culture procedures. As described further below in the Examples, particularly useful yields of the biosynthetic products of the invention can be obtained under anaerobic or substantially anaerobic culture conditions.

[0301] Suitable purification and/or assays to test for the production of 4-HB, 4-HBal, 4 HBCoA, BDO or putrescine can be performed using well known methods. Suitable replicates such as triplicate cultures can be grown for each engineered strain to be tested. For example, product and byproduct formation in the engineered production host can be monitored. The final product and intermediates, and other organic compounds, can be analyzed by methods such as HPLC (High Performance Liquid Chromatography), GC-MS (Gas Chromatography-Mass Spectroscopy) and LC-MS (Liquid Chromatography-Mass Spectroscopy) or other suitable analytical methods using routine procedures well known in the art. The release of product in the fermentation broth can also be tested with the culture supernatant. Byproducts and residual glucose can be quantified by HPLC using, for example, a refractive index detector for glucose and alcohols, and a UV detector for organic acids (Lin et al., Biotechnol. Bioeng. 90:775-779 (2005)), or other suitable assay and detection methods well known in the art. The individual enzyme or protein activities from the exogenous DNA sequences can also be assayed using methods well known in the art.

[0302] The 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine product can be separated from other components in the culture using a variety of methods well known in the art. Such separation methods include, for example, extraction procedures as well as methods that include continuous liquid-liquid extraction, pervaporation, membrane filtration, membrane separation, reverse osmosis, electrodialysis, distillation, crystallization, centrifugation, extractive filtration, ion exchange chromatography, size exclusion chromatography, adsorption chromatography, and ultrafiltration. All of the above methods are well known in the art.

[0303] The invention further provides a method of manufacturing 4-HB. The method includes fermenting a non-naturally occurring microbial organism having a 4 hydroxybutanoic acid (4-HB) biosynthetic pathway comprising at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate:succinic semialdehyde transaminase, a-ketoglutarate decarboxylase, or glutamate decarboxylase under substantially anaerobic conditions for a sufficient period of time to produce monomeric 4-hydroxybutanoic acid (4-HB), the process comprising fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation, or continuous fermentation and continuous separation.

[0304] The culture and chemical hydrogenations described above also can be scaled up and grown continuously for manufacturing of 4-HB, 4-HBal, 4-HBCoA, GBL, BDO and/or THF or putrescine. Exemplary growth procedures include, for example, fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation, or continuous fermentation and continuous separation. All of these processes are well known in the art. Employing the 4-HB producers allows for simultaneous 4-HB biosynthesis and chemical conversion to GBL, BDO and/or THF by employing the above hydrogenation procedures simultaneous with continuous cultures methods such as fermentation. Other hydrogenation procedures also are well known in the art and can be equally applied to the methods of the invention.

[0305] Fermentation procedures are particularly useful for the biosynthetic production of commercial quantities of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. Generally, and as with non-continuous culture procedures, the continuous and/or near-continuous production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine will include culturing a non-naturally occurring

4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing organism of the invention in sufficient nutrients and medium to sustain and/or nearly sustain growth in an exponential phase. Continuous culture under such conditions can be include, for example, 1 day, 2, 3, 4, , 6 or 7 days or more. Additionally, continuous culture can include 1 week, 2, 3, 4 or 5 or more weeks and up to several months. Alternatively, organisms of the invention can be cultured for hours, if suitable for a particular application. It is to be understood that the continuous and/or near-continuous culture conditions also can include all time intervals in between these exemplary periods. It is further understood that the time of culturing the microbial organism of the invention is for a sufficient period of time to produce a sufficient amount of product for a desired purpose.

[0306] Fermentation procedures are well known in the art. Briefly, fermentation for the biosynthetic production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or other 4-HB, 4 HBal, 4-HBCoA, BDO or putrescine derived products, including intermediates, of the invention can be utilized in, for example, fed-batch fermentation and batch separation; fed batch fermentation and continuous separation, or continuous fermentation and continuous separation. Examples of batch and continuous fermentation procedures well known in the art are exemplified further below in the Examples.

[0307] In addition to the above fermentation procedures using the 4-HB, 4-HBal, 4 HBCoA, BDO or putrescine producers of the invention for continuous production of substantial quantities of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, including monomeric 4-HB, respectively, the 4-HB producers also can be, for example, simultaneously subjected to chemical synthesis procedures to convert the product to other compounds or the product as described previously for the chemical conversion of monomeric 4-HB to, for example, GBL, BDO and/or THF. The BDO producers can similarly be, for example, simultaneously subjected to chemical synthesis procedures as described previously for the chemical conversion of BDO to, for example, THF, GBL, pyrrolidones and/or other BDO family compounds. In addition, the products of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producers can be separated from the fermentation culture and sequentially subjected to chemical or enzymatic conversion to convert the product to other compounds, if desired, as disclosed herein.

[0308] Briefly, hydrogenation of GBL in the fermentation broth can be performed as described by Frost et al., Biotechnology Progress 18: 201-211 (2002). Another procedure for hydrogenation during fermentation include, for example, the methods described in, for example, U.S. Patent No. 5,478,952. This method is further exemplified in the Examples below.

[0309] Therefore, the invention additionally provides a method of manufacturing y butyrolactone (GBL), tetrahydrofuran (THF) or 1,4-butanediol (BDO). The method includes fermenting a non-naturally occurring microbial organism having 4-hydroxybutanoic acid (4 HB) and/or 1,4-butanediol (BDO) biosynthetic pathways, the pathways comprise at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, glutamate:succinic semialdehyde transaminase, alpha-ketoglutarate decarboxylase, glutamate decarboxylase, 4 hydroxybutanoate kinase, phosphotransbutyrylase, CoA-independent 1,4-butanediol semialdehyde dehydrogenase, CoA-dependent 1,4-butanediol semialdehyde dehydrogenase, CoA-independent 1,4-butanediol alcohol dehydrogenase or CoA-dependent 1,4-butanediol alcohol dehydrogenase, under substantially anaerobic conditions for a sufficient period of time to produce 1,4-butanediol (BDO), GBL or THF, the fermenting comprising fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation, or continuous fermentation and continuous separation.

[0310] In addition to the biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and other products of the invention as described herein, the non-naturally occurring microbial organisms and methods of the invention also can be utilized in various combinations with each other and with other microbial organisms and methods well known in the art to achieve product biosynthesis by other routes. For example, one alternative to produce BDO other than use of the 4-HB producers and chemical steps or other than use of the BDO producer directly is through addition of another microbial organism capable of converting 4-HB or a 4 HB product exemplified herein to BDO.

[0311] One such procedure includes, for example, the fermentation of a 4-HB producing microbial organism of the invention to produce 4-HB, as described above and below. The 4 HB can then be used as a substrate for a second microbial organism that converts 4-HB to, for example, BDO, GBL and/or THF. The 4-HB can be added directly to another culture of the second organism or the original culture of 4-HB producers can be depleted of these microbial organisms by, for example, cell separation, and then subsequent addition of the second organism to the fermentation broth can utilized to produce the final product without intermediate purification steps. One exemplary second organism having the capacity to biochemically utilize 4-HB as a substrate for conversion to BDO, for example, is Clostridium acetobutylicum (see, for example, Jewell et al., Current Microbiology, 13:215-19 (1986)).

[0312] Thus, such a procedure includes, for example, the fermentation of a microbial organism that produces a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate. The 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate can then be used as a substrate for a second microbial organism that converts the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate to 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. The 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate can be added directly to another culture of the second organism or the original culture of the 4-HB, 4-HBal, 4-HBCoA BDO or putrescine pathway intermediate producers can be depleted of these microbial organisms by, for example, cell separation, and then subsequent addition of the second organism to the fermentation broth can be utilized to produce the final product without intermediate purification steps.

[0313] In other embodiments, the non-naturally occurring microbial organisms and methods of the invention can be assembled in a wide variety of subpathways to achieve biosynthesis of, for example, 4-HB and/or BDO as described. In these embodiments, biosynthetic pathways for a desired product of the invention can be segregated into different microbial organisms and the different microbial organisms can be co-cultured to produce the final product. In such a biosynthetic scheme, the product of one microbial organism is the substrate for a second microbial organism until the final product is synthesized. For example, the biosynthesis of BDO can be accomplished as described previously by constructing a microbial organism that contains biosynthetic pathways for conversion of one pathway intermediate to another pathway intermediate or the product, for example, a substrate such as endogenous succinate through 4-HB to the final product BDO. Alternatively, BDO also can be biosynthetically produced from microbial organisms through co-culture or co-fermentation using two organisms in the same vessel. A first microbial organism being a 4-HB producer with genes to produce 4-HB from succinic acid, and a second microbial organism being a BDO producer with genes to convert 4-HB to BDO. For example, the biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be accomplished by constructing a microbial organism that contains biosynthetic pathways for conversion of one pathway intermediate to another pathway intermediate or the product. Alternatively, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine also can be biosynthetically produced from microbial organisms through co culture or co-fermentation using two organisms in the same vessel, where the first microbial organism produces a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate and the second microbial organism converts the intermediate to 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine.

[0314] Given the teachings and guidance provided herein, those skilled in the art will understand that a wide variety of combinations and permutations exist for the non-naturally occurring microbial organisms and methods of the invention together with other microbial organisms, with the co-culture of other non-naturally occurring microbial organisms having subpathways and with combinations of other chemical and/or biochemical procedures well known in the art to produce 4-HB, BDO, GBL and THF products of the invention.

[0315] It is understood that, in methods of the invention, any of the one or more exogenous nucleic acids can be introduced into a microbial organism to produce a non naturally occurring microbial organism of the invention. The nucleic acids can be introduced so as to confer, for example, a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway onto the microbial organism. Alternatively, encoding nucleic acids can be introduced to produce an intermediate microbial organism having the biosynthetic capability to catalyze some of the required reactions to confer 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic capability. For example, a non-naturally occurring microbial organism having a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway can comprise at least two exogenous nucleic acids encoding desired enzymes or proteins, such as the combination of enzymes as disclosed herein (see Examples and Figures 1, 8-13, 58, 62, 63 or 72-74), and the like. Thus, it is understood that any combination of two or more enzymes or proteins of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the invention. Similarly, it is understood that any combination of three or more enzymes or proteins of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the invention, for example,], and so forth, as desired and disclosed herein, so long as the combination of enzymes and/or proteins of the desired biosynthetic pathway results in production of the corresponding desired product. Similarly, any combination of four or more enzymes or proteins of a biosynthetic pathway as disclosed herein can be included in a non-naturally occurring microbial organism of the invention, as desired, so long as the combination of enzymes and/or proteins of the desired biosynthetic pathway results in production of the corresponding desired product.

[0316] The invention additionally provides carboxylic acid reductase variants. CAR variants were generated and tested for activity. In a particular embodiment, a carboxylic acid reductase can comprise an amino acid sequence having an amino acid substitution selected from E16K; Q95L; LIOM; Al01IT; K823E; T941S; H15Q; D198E; G446C; S392N; F699L; V8831; F467S; T987S; R12H; V295G; V295A; V295S; V295T; V295C; V295V; V295L; V2951; V295M; V295P; V295F; V295Y; V295W; V295D; V295E; V295N; V295Q; V295H; V295K; V295R; M296G; M296A; M296S; M296T; M296C; M296V; M296L; M2961; M296M; M296P; M296F; M296Y; M296W; M296D; M296E; M296N; M296Q; M296H; M296K; M296R; G297G; G297A; G297S; G297T; G297C; G297V; G297L; G2971; G297M; G297P; G297F; G297Y; G297W; G297D; G297E; G297N; G297Q; G297H; G297K; G297R; G391G; G391A; G391S; G391T; G391C; G391V; G391L; G3911; G391M; G391P; G391F; G391Y; G391W; G391D; G391E; G391N; G391Q; G391H; G391K; G391R; G421G; G421A; G421S; G421T; G421C; G421V; G421L; G4211 G421M; G421P; G421F; G421Y; G421W; G421D; G421E; G421N; G421Q; G421H; G421K; G421R; D413G; D413A; D413S; D413T; D413C; D413V; D413L; D4131; D413M; D413P; D413F; D413Y; D413W; D413D; D413E; D413N; D413Q; D413H; D413K; D413R; G414G; G414A; G414S; G414T; G414C; G414V; G414L; G4141; G414M; G414P; G414F; G414Y; G414W; G414D; G414E; G414N; G414Q; G414H; G414K; G414R; Y415G; Y415A; Y415S; Y415T; Y415C; Y415V; Y415L; Y4151; Y415M; Y415P; Y415F; Y415Y; Y415W; Y415D; Y415E; Y415N; Y415Q; Y415H; Y415K; Y415R; G416G; G416A; G416S; G416T; G416C; G416V; G416L; G4161; G416M; G416P; G416F; G416Y; G416W; G416D; G416E; G416N; G416Q; G416H; G416K; G416R; S417G; S417A; S417S; S417T; S417C; S417V S417L; S4171; S417M; S417P; S417F; S417Y; S417W; S417D; S417E; S417N; S417Q; S417H; S417K; and S417R, or combinations thereof. The amino acid positions correspond to amino acid positions of sequence of Figure 67B, or equivalent positions in a homologous CAR sequence. It is further understood that a CAR variant includes a combination of one or more of the amino acid substitutions, so long as the variant with multiple amino acid substitutions exhibits measurable CAR activity, as disclosed herein.

[0317] To generate better producers, metabolic modeling can be utilized to optimize growth conditions. Modeling can also be used to design gene knockouts that additionally optimize utilization of the pathway (see, for example, U.S. patent publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466, and U.S. Patent No. 7,127,379). Modeling analysis allows reliable predictions of the effects on cell growth of shifting the metabolism towards more efficient production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine.

[0318] One computational method for identifying and designing metabolic alterations favoring biosynthesis of a desired product is the OptKnock computational framework (Burgard et al., Biotechnol. Bioeng. 84:647-657 (2003)). OptKnock is a metabolic modeling and simulation program that suggests gene deletion or disruption strategies that result in genetically stable microorganisms which overproduce the target product. Specifically, the framework examines the complete metabolic and/or biochemical network of a microorganism in order to suggest genetic manipulations that force the desired biochemical to become an obligatory byproduct of cell growth. By coupling biochemical production with cell growth through strategically placed gene deletions or other functional gene disruption, the growth selection pressures imposed on the engineered strains after long periods of time in a bioreactor lead to improvements in performance as a result of the compulsory growth coupled biochemical production. Lastly, when gene deletions are constructed there is a negligible possibility of the designed strains reverting to their wild-type states because the genes selected by OptKnock are to be completely removed from the genome. Therefore, this computational methodology can be used to either identify alternative pathways that lead to biosynthesis of a desired product or used in connection with the non-naturally occurring microbial organisms for further optimization of biosynthesis of a desired product.

[0319] Briefly, OptKnock is a term used herein to refer to a computational method and system for modeling cellular metabolism. The OptKnock program relates to a framework of models and methods that incorporate particular constraints into flux balance analysis (FBA) models. These constraints include, for example, qualitative kinetic information, qualitative regulatory information, and/or DNA microarray experimental data. OptKnock also computes solutions to various metabolic problems by, for example, tightening the flux boundaries derived through flux balance models and subsequently probing the performance limits of metabolic networks in the presence of gene additions or deletions. OptKnock computational framework allows the construction of model formulations that allow an effective query of the performance limits of metabolic networks and provides methods for solving the resulting mixed-integer linear programming problems. The metabolic modeling and simulation methods referred to herein as OptKnock are described in, for example, U.S. publication 2002/0168654, filed January 10, 2002, in International Patent No. PCT/USO2/00660, filed January 10, 2002, and U.S. publication 2009/0047719, filed August 10, 2007.

[0320] Another computational method for identifying and designing metabolic alterations favoring biosynthetic production of a product is a metabolic modeling and simulation system termed SimPheny@. This computational method and system is described in, for example, U.S. publication 2003/0233218, filed June 14, 2002, and in International Patent Application No. PCT/US03/18838, filed June 13, 2003. SimPheny@ is a computational system that can be used to produce a network model in silico and to simulate the flux of mass, energy or charge through the chemical reactions of a biological system to define a solution space that contains any and all possible functionalities of the chemical reactions in the system, thereby determining a range of allowed activities for the biological system. This approach is referred to as constraints-based modeling because the solution space is defined by constraints such as the known stoichiometry of the included reactions as well as reaction thermodynamic and capacity constraints associated with maximum fluxes through reactions. The space defined by these constraints can be interrogated to determine the phenotypic capabilities and behavior of the biological system or of its biochemical components.

[0321] These computational approaches are consistent with biological realities because biological systems are flexible and can reach the same result in many different ways. Biological systems are designed through evolutionary mechanisms that have been restricted by fundamental constraints that all livi ng systems must face. Therefore, constraints-based modeling strategy embraces these general realities. Further, the ability to continuously impose further restrictions on a network model via the tightening of constraints results in a reduction in the size of the solution space, thereby enhancing the precision with which physiological performance or phenotype can be predicted.

[0322] Given the teachings and guidance provided herein, those skilled in the art will be able to apply various computational frameworks for metabolic modeling and simulation to design and implement biosynthesis of a desired compound in host microbial organisms. Such metabolic modeling and simulation methods include, for example, the computational systems exemplified above as SimPheny@ and OptKnock. For illustration of the invention, some methods are described herein with reference to the OptKnock computation framework for modeling and simulation. Those skilled in the art will know how to apply the identification, design and implementation of the metabolic alterations using OptKnock to any of such other metabolic modeling and simulation computational frameworks and methods well known in the art.

[0323] The methods described above will provide one set of metabolic reactions to disrupt. Elimination of each reaction within the set or metabolic modification can result in a desired product as an obligatory product during the growth phase of the organism. Because the reactions are known, a solution to the bilevel OptKnock problem also will provide the associated gene or genes encoding one or more enzymes that catalyze each reaction within the set of reactions. Identification of a set of reactions and their corresponding genes encoding the enzymes participating in each reaction is generally an automated process, accomplished through correlation of the reactions with a reaction database having a relationship between enzymes and encoding genes.

[0324] Once identified, the set of reactions that are to be disrupted in order to achieve production of a desired product are implemented in the target cell or organism by functional disruption of at least one gene encoding each metabolic reaction within the set. One particularly useful means to achieve functional disruption of the reaction set is by deletion of each encoding gene. However, in some instances, it can be beneficial to disrupt the reaction by other genetic aberrations including, for example, mutation, deletion of regulatory regions such as promoters or cis binding sites for regulatory factors, or by truncation of the coding sequence at any of a number of locations. These latter aberrations, resulting in less than total deletion of the gene set can be useful, for example, when rapid assessments of the coupling of a product are desired or when genetic reversion is less likely to occur.

[0325] To identify additional productive solutions to the above described bilevel OptKnock problem which lead to further sets of reactions to disrupt or metabolic modifications that can result in the biosynthesis, including growth-coupled biosynthesis of a desired product, an optimization method, termed integer cuts, can be implemented. This method proceeds by iteratively solving the OptKnock problem exemplified above with the incorporation of an additional constraint referred to as an integer cut at each iteration. Integer cut constraints effectively prevent the solution procedure from choosing the exact same set of reactions identified in any previous iteration that obligatorily couples product biosynthesis to growth. For example, if a previously identified growth-coupled metabolic modification specifies reactions 1, 2, and 3 for disruption, then the following constraint prevents the same reactions from being simultaneously considered in subsequent solutions. The integer cut method is well known in the art and can be found described in, for example, Burgard et al., Biotechnol. Prog. 17:791-797 (2001). As with all methods described herein with reference to their use in combination with the OptKnock computational framework for metabolic modeling and simulation, the integer cut method of reducing redundancy in iterative computational analysis also can be applied with other computational frameworks well known in the art including, for example, SimPheny@.

[0326] The methods exemplified herein allow the construction of cells and organisms that biosynthetically produce a desired product, including the obligatory coupling of production of a target biochemical product to growth of the cell or organism engineered to harbor the identified genetic alterations. Therefore, the computational methods described herein allow the identification and implementation of metabolic modifications that are identified by an in silico method selected from OptKnock or SimPheny@. The set of metabolic modifications can include, for example, addition of one or more biosynthetic pathway enzymes and/or functional disruption of one or more metabolic reactions including, for example, disruption by gene deletion.

[0327] As discussed above, the OptKnock methodology was developed on the premise that mutant microbial networks can be evolved towards their computationally predicted maximum-growth phenotypes when subjected to long periods of growth selection. In other words, the approach leverages an organism's ability to self-optimize under selective pressures. The OptKnock framework allows for the exhaustive enumeration of gene deletion combinations that force a coupling between biochemical production and cell growth based on network stoichiometry. The identification of optimal gene/reaction knockouts requires the solution of a bilevel optimization problem that chooses the set of active reactions such that an optimal growth solution for the resulting network overproduces the biochemical of interest (Burgard et al., Biotechnol. Bioeng. 84:647-657 (2003)).

[0328] An in silico stoichiometric model of E. coli metabolism can be employed to identify essential genes for metabolic pathways as exemplified previously and described in, for example, U.S. patent publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466, and in U.S. Patent No. 7,127,379. As disclosed herein, the OptKnock mathematical framework can be applied to pinpoint gene deletions leading to the growth coupled production of a desired product. Further, the solution of the bilevel OptKnock problem provides only one set of deletions. To enumerate all meaningful solutions, that is, all sets of knockouts leading to growth-coupled production formation, an optimization technique, termed integer cuts, can be implemented. This entails iteratively solving the OptKnock problem with the incorporation of an additional constraint referred to as an integer cut at each iteration, as discussed above.

[0329] The methods exemplified above and further illustrated in the Examples below allow the construction of cells and organisms that biosynthetically produce, including obligatory couple production of a target biochemical product to growth of the cell or organism engineered to harbor the identified genetic alterations. In this regard, metabolic alterations have been identified that result in the biosynthesis of 4-HB and 1,4-butanediol. Microorganism strains constructed with the identified metabolic alterations produce elevated levels of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine compared to unmodified microbial organisms. These strains can be beneficially used for the commercial production of 4-HB, BDO, THF, GBL, 4-HBal, 4-HBCoA or putrescine, for example, in continuous fermentation process without being subjected to the negative selective pressures.

[0330] Therefore, the computational methods described herein allow the identification and implementation of metabolic modifications that are identified by an in silico method selected from OptKnock or SimPheny@. The set of metabolic modifications can include, for example, addition of one or more biosynthetic pathway enzymes and/.or functional disruption of one or more metabolic reactions including, for example, disruption by gene deletion.

[0331] It is understood that modifications which do not substantially affect the activity of the various embodiments of this invention are also included within the definition of the invention provided herein. Accordingly, the following examples are intended to illustrate but not limit the present invention.

[0332] Any of the non-naturally occurring microbial organisms described herein can be cultured to produce and/or secrete the biosynthetic products of the invention. For example, the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producers can be cultured for the biosynthetic production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine.

[0333] For the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, the recombinant strains are cultured in a medium with carbon source and other essential nutrients. It is highly desirable to maintain anaerobic conditions in the fermenter to reduce the cost of the overall process. Such conditions can be obtained, for example, by first sparging the medium with nitrogen and then sealing the flasks with a septum and crimp-cap. For strains where growth is not observed anaerobically, microaerobic conditions can be applied by perforating the septum with a small hole for limited aeration. Exemplary anaerobic conditions have been described previously and are well-known in the art. Exemplary aerobic and anaerobic conditions are described, for example, in U.S. publication 2009/0047719, filed August 10, 2007. Fermentations can be performed in a batch, fed-batch or continuous manner, as disclosed herein.

[0334] If desired, the pH of the medium can be maintained at a desired pH, in particular neutral pH, such as a pH of around 7 by addition of a base, such as NaOH or other bases, or acid, as needed to maintain the culture medium at a desirable pH. The growth rate can be determined by measuring optical density using a spectrophotometer (600 nm), and the glucose uptake rate by monitoring carbon source depletion over time.

[0335] In addition to renewable feedstocks such as those exemplified above, the 4-HB, 4 HBal, 4-HBCoA, BDO or putrescine producing microbial organisms of the invention also can be modified for growth on syngas as its source of carbon. In this specific embodiment, one or more proteins or enzymes are expressed in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing organisms to provide a metabolic pathway for utilization of syngas or other gaseous carbon source.

[0336] Synthesis gas, also known as syngas or producer gas, is the major product of gasification of coal and of carbonaceous materials such as biomass materials, including agricultural crops and residues. Syngas is a mixture primarily of H2 and CO and can be obtained from the gasification of any organic feedstock, including but not limited to coal, coal oil, natural gas, biomass, and waste organic matter. Gasification is generally carried out under a high fuel to oxygen ratio. Although largely H2 and CO, syngas can also include C02 and other gases in smaller quantities. Thus, synthesis gas provides a cost effective source of gaseous carbon such as CO and, additionally, C02.

[0337] The Wood-Ljungdahl pathway catalyzes the conversion of CO and H2 to acetyl CoA and other products such as acetate. Organisms capable of utilizing CO and syngas also generally have the capability of utilizing C02 and C02/H2 mixtures through the same basic set of enzymes and transformations encompassed by the Wood-Ljungdahl pathway. H2 dependent conversion of C02 to acetate by microorganisms was recognized long before it was revealed that CO also could be used by the same organisms and that the same pathways were involved. Many acetogens have been shown to grow in the presence of C02 and produce compounds such as acetate as long as hydrogen is present to supply the necessary reducing equivalents (see for example, Drake, Acetogenesis, pp. 3-60 Chapman and Hall, New York, (1994)). This can be summarized by the following equation:

2 CO2 + 4 H2 + n ADP + n Pi -> CH3COOH + 2 H20 + n ATP

[0338] Hence, non-naturally occurring microorganisms possessing the Wood-Ljungdahl pathway can utilize C02 and H2 mixtures as well for the production of acetyl-CoA and other desired products.

[0339] The Wood-Ljungdahl pathway is well known in the art and consists of 12 reactions which can be separated into two branches: (1) methyl branch and (2) carbonyl branch. The methyl branch converts syngas to methyl-tetrahydrofolate (methyl-THF) whereas the carbonyl branch converts methyl-THF to acetyl-CoA. The reactions in the methyl branch are catalyzed in order by the following enzymes or proteins: ferredoxin oxidoreductase, formate dehydrogenase, formyltetrahydrofolate synthetase, methenyltetrahydrofolate cyclodehydratase, methylenetetrahydrofolate dehydrogenase and methylenetetrahydrofolate reductase. The reactions in the carbonyl branch are catalyzed in order by the following enzymes or proteins: methyltetrahydrofolate:corrinoid protein methyltransferase (for example, AcsE), corrinoid iron-sulfur protein, nickel-protein assembly protein (for example, AcsF), ferredoxin, acetyl-CoA synthase, carbon monoxide dehydrogenase and nickel-protein assembly protein (for example, CooC). Following the teachings and guidance provided herein for introducing a sufficient number of encoding nucleic acids to generate a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, those skilled in the art will understand that the same engineering design also can be performed with respect to introducing at least the nucleic acids encoding the Wood-Ljungdahl enzymes or proteins absent in the host organism. Therefore, introduction of one or more encoding nucleic acids into the microbial organisms of the invention such that the modified organism contains the complete Wood-Ljungdahl pathway will confer syngas utilization ability.

[0340] Additionally, the reductive (reverse) tricarboxylic acid cycle is and/or hydrogenase activities can also be used for the conversion of CO, C02 and/or H2 to acetyl CoA and other products such as acetate. Organisms capable of fixing carbon via the reductive TCA pathway can utilize one or more of the following enzymes: ATP citrate-lyase, citrate lyase, aconitase, isocitrate dehydrogenase, alpha-ketoglutarate:ferredoxin oxidoreductase, succinyl-CoA synthetase, succinyl-CoA transferase, fumarate reductase, fumarase, malate dehydrogenase, NAD(P)H:ferredoxin oxidoreductase, carbon monoxide dehydrogenase, and hydrogenase. Specifically, the reducing equivalents extracted from CO and/or H2 by carbon monoxide dehydrogenase and hydrogenase are utilized to fix C02 via the reductive TCA cycle into acetyl-CoA or acetate. Acetate can be converted to acetyl-CoA by enzymes such as acetyl-CoA transferase, acetate kinase/phosphotransacetylase, and acetyl-CoA synthetase. Acetyl-CoA can be converted to the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine precursors, glyceraldehyde-3-phosphate, phosphoenolpyruvate, and pyruvate, by pyruvate:ferredoxin oxidoreductase and the enzymes of gluconeogenesis. Following the teachings and guidance provided herein for introducing a sufficient number of encoding nucleic acids to generate a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, those skilled in the art will understand that the same engineering design also can be performed with respect to introducing at least the nucleic acids encoding the reductive TCA pathway enzymes or proteins absent in the host organism. Therefore, introduction of one or more encoding nucleic acids into the microbial organisms of the invention such that the modified organism contains the complete reductive TCA pathway will confer syngas utilization ability.

[0341] Accordingly, given the teachings and guidance provided herein, those skilled in the art will understand that a non-naturally occurring microbial organism can be produced that secretes the biosynthesized compounds of the invention when grown on a carbon source such as a carbohydrate. Such compounds include, for example, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and any of the intermediate metabolites in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway. All that is required is to engineer in one or more of the required enzyme or protein activities to achieve biosynthesis of the desired compound or intermediate including, for example, inclusion of some or all of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathways. Accordingly, the invention provides a non-naturally occurring microbial organism that produces and/or secretes 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine when grown on a carbohydrate or other carbon source and produces and/or secretes any of the intermediate metabolites shown in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway when grown on a carbohydrate or other carbon source. The 4-HB, 4 HBal, 4-HBCoA, BDO or putrescine producing microbial organisms of the invention can initiate synthesis from an intermediate in a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, as disclosed herein.

[0342] To generate better producers, metabolic modeling can be utilized to optimize growth conditions. Modeling can also be used to design gene knockouts that additionally optimize utilization of the pathway (see, for example, U.S. patent publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466, and U.S. Patent No. 7,127,379). Modeling analysis allows reliable predictions of the effects on cell growth of shifting the metabolism towards more efficient production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine.

[0343] One computational method for identifying and designing metabolic alterations favoring biosynthesis of a desired product is the OptKnock computational framework (Burgard et al., Biotechnol. Bioeng. 84:647-657 (2003)). OptKnock is a metabolic modeling and simulation program that suggests gene deletion strategies that result in genetically stable microorganisms which overproduce the target product. Specifically, the framework examines the complete metabolic and/or biochemical network of a microorganism in order to suggest genetic manipulations that force the desired biochemical to become an obligatory byproduct of cell growth. By coupling biochemical production with cell growth through strategically placed gene deletions or other functional gene disruption, the growth selection pressures imposed on the engineered strains after long periods of time in a bioreactor lead to improvements in performance as a result of the compulsory growth-coupled biochemical production. Lastly, when gene deletions are constructed there is a negligible possibility of the designed strains reverting to their wild-type states because the genes selected by OptKnock are to be completely removed from the genome. Therefore, this computational methodology can be used to either identify alternative pathways that lead to biosynthesis of a desired product or used in connection with the non-naturally occurring microbial organisms for further optimization of biosynthesis of a desired product.

[0344] Briefly, OptKnock is a term used herein to refer to a computational method and system for modeling cellular metabolism. The OptKnock program relates to a framework of models and methods that incorporate particular constraints into flux balance analysis (FBA) models. These constraints include, for example, qualitative kinetic information, qualitative regulatory information, and/or DNA microarray experimental data. OptKnock also computes solutions to various metabolic problems by, for example, tightening the flux boundaries derived through flux balance models and subsequently probing the performance limits of metabolic networks in the presence of gene additions or deletions. OptKnock computational framework allows the construction of model formulations that allow an effective query of the performance limits of metabolic networks and provides methods for solving the resulting mixed-integer linear programming problems. The metabolic modeling and simulation methods referred to herein as OptKnock are described in, for example, U.S. publication 2002/0168654, filed January 10, 2002, in International Patent No. PCT/US02/00660, filed January 10, 2002, and U.S. publication 2009/0047719, filed August 10, 2007.

[0345] Another computational method for identifying and designing metabolic alterations favoring biosynthetic production of a product is a metabolic modeling and simulation system termed SimPheny@. This computational method and system is described in, for example, U.S. publication 2003/0233218, filed June 14, 2002, and in International Patent Application No. PCT/US03/18838, filed June 13, 2003. SimPheny@ is a computational system that can be used to produce a network model in silico and to simulate the flux of mass, energy or charge through the chemical reactions of a biological system to define a solution space that contains any and all possible functionalities of the chemical reactions in the system, thereby determining a range of allowed activities for the biological system. This approach is referred to as constraints-based modeling because the solution space is defined by constraints such as the known stoichiometry of the included reactions as well as reaction thermodynamic and capacity constraints associated with maximum fluxes through reactions. The space defined by these constraints can be interrogated to determine the phenotypic capabilities and behavior of the biological system or of its biochemical components.

[0346] These computational approaches are consistent with biological realities because biological systems are flexible and can reach the same result in many different ways. Biological systems are designed through evolutionary mechanisms that have been restricted by fundamental constraints that all living systems must face. Therefore, constraints-based modeling strategy embraces these general realities. Further, the ability to continuously impose further restrictions on a network model via the tightening of constraints results in a reduction in the size of the solution space, thereby enhancing the precision with which physiological performance or phenotype can be predicted.

[0347] Given the teachings and guidance provided herein, those skilled in the art will be able to apply various computational frameworks for metabolic modeling and simulation to design and implement biosynthesis of a desired compound in host microbial organisms. Such metabolic modeling and simulation methods include, for example, the computational systems exemplified above as SimPheny@ and OptKnock. For illustration of the invention, some methods are described herein with reference to the OptKnock computation framework for modeling and simulation. Those skilled in the art will know how to apply the identification, design and implementation of the metabolic alterations using OptKnock to any of such other metabolic modeling and simulation computational frameworks and methods well known in the art.

[0348] The methods described above will provide one set of metabolic reactions to disrupt. Elimination of each reaction within the set or metabolic modification can result in a desired product as an obligatory product during the growth phase of the organism. Because the reactions are known, a solution to the bilevel OptKnock problem also will provide the associated gene or genes encoding one or more enzymes that catalyze each reaction within the set of reactions. Identification of a set of reactions and their corresponding genes encoding the enzymes participating in each reaction is generally an automated process, accomplished through correlation of the reactions with a reaction database having a relationship between enzymes and encoding genes.

[0349] Once identified, the set of reactions that are to be disrupted in order to achieve production of a desired product are implemented in the target cell or organism by functional disruption of at least one gene encoding each metabolic reaction within the set. One particularly useful means to achieve functional disruption of the reaction set is by deletion of each encoding gene. However, in some instances, it can be beneficial to disrupt the reaction by other genetic aberrations including, for example, mutation, deletion of regulatory regions such as promoters or cis binding sites for regulatory factors, or by truncation of the coding sequence at any of a number of locations. These latter aberrations, resulting in less than total deletion of the gene set can be useful, for example, when rapid assessments of the coupling of a product are desired or when genetic reversion is less likely to occur.

[0350] To identify additional productive solutions to the above described bilevel OptKnock problem which lead to further sets of reactions to disrupt or metabolic modifications that can result in the biosynthesis, including growth-coupled biosynthesis of a desired product, an optimization method, termed integer cuts, can be implemented. This method proceeds by iteratively solving the OptKnock problem exemplified above with the incorporation of an additional constraint referred to as an integer cut at each iteration. Integer cut constraints effectively prevent the solution procedure from choosing the exact same set of reactions identified in any previous iteration that obligatorily couples product biosynthesis to growth. For example, if a previously identified growth-coupled metabolic modification specifies reactions 1, 2, and 3 for disruption, then the following constraint prevents the same reactions from being simultaneously considered in subsequent solutions. The integer cut method is well known in the art and can be found described in, for example, Burgard et al., Biotechnol. Prog. 17:791-797 (2001). As with all methods described herein with reference to their use in combination with the OptKnock computational framework for metabolic modeling and simulation, the integer cut method of reducing redundancy in iterative computational analysis also can be applied with other computational frameworks well known in the art including, for example, SimPheny@.

[0351] The methods exemplified herein allow the construction of cells and organisms that biosynthetically produce a desired product, including the obligatory coupling of production of a target biochemical product to growth of the cell or organism engineered to harbor the identified genetic alterations. Therefore, the computational methods described herein allow the identification and implementation of metabolic modifications that are identified by an in silico method selected from OptKnock or SimPheny@. The set of metabolic modifications can include, for example, addition of one or more biosynthetic pathway enzymes and/or functional disruption of one or more metabolic reactions including, for example, disruption by gene deletion.

[0352] As discussed above, the OptKnock methodology was developed on the premise that mutant microbial networks can be evolved towards their computationally predicted maximum-growth phenotypes when subjected to long periods of growth selection. In other words, the approach leverages an organism's ability to self-optimize under selective pressures. The OptKnock framework allows for the exhaustive enumeration of gene deletion combinations that force a coupling between biochemical production and cell growth based on network stoichiometry. The identification of optimal gene/reaction knockouts requires the solution of a bilevel optimization problem that chooses the set of active reactions such that an optimal growth solution for the resulting network overproduces the biochemical of interest (Burgard et al., Biotechnol. Bioeng. 84:647-657 (2003)).

[0353] An in silico stoichiometric model of E. coli metabolism can be employed to identify essential genes for metabolic pathways as exemplified previously and described in, for example, U.S. patent publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466, and in U.S. Patent No. 7,127,379. As disclosed herein, the OptKnock mathematical framework can be applied to pinpoint gene deletions leading to the growth coupled production of a desired product. Further, the solution of the bilevel OptKnock problem provides only one set of deletions. To enumerate all meaningful solutions, that is, all sets of knockouts leading to growth-coupled production formation, an optimization technique, termed integer cuts, can be implemented. This entails iteratively solving the OptKnock problem with the incorporation of an additional constraint referred to as an integer cut at each iteration, as discussed above.

[0354] As disclosed herein, a nucleic acid encoding a desired activity of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway can be introduced into a host organism. In some cases, it can be desirable to modify an activity of a 4-HB, 4-HBal, 4-HBCoA BDO or putrescine pathway enzyme or protein to increase production of 4-HB, 4-HBal, 4-HBCoA BDO or putrescine. For example, known mutations that increase the activity of a protein or enzyme can be introduced into an encoding nucleic acid molecule. Additionally, optimization methods can be applied to increase the activity of an enzyme or protein and/or decrease an inhibitory activity, for example, decrease the activity of a negative regulator.

[0355] One such optimization method is directed evolution. Directed evolution is a powerful approach that involves the introduction of mutations targeted to a specific gene in order to improve and/or alter the properties of an enzyme. Improved and/or altered enzymes can be identified through the development and implementation of sensitive high-throughput screening assays that allow the automated screening of many enzyme variants (for example, >104). Iterative rounds of mutagenesis and screening typically are performed to afford an enzyme with optimized properties. Computational algorithms that can help to identify areas of the gene for mutagenesis also have been developed and can significantly reduce the number of enzyme variants that need to be generated and screened. Numerous directed evolution technologies have been developed (for reviews, see Hibbert et al., Biomol.Eng 22:11-19 (2005); Huisman and Lalonde, In Biocatalysis in the pharmaceutical and biotechnology industries pgs. 717-742 (2007), Patel (ed.), CRC Press; Otten and Quax. Biomol.Eng 22:1-9 (2005).; and Sen et al., Appl Biochem.Biotechnol 143:212-223 (2007)) to be effective at creating diverse variant libraries, and these methods have been successfully applied to the improvement of a wide range of properties across many enzyme classes. Enzyme characteristics that have been improved and/or altered by directed evolution technologies include, for example: selectivity/specificity, for conversion of non-natural substrates; temperature stability, for robust high temperature processing; pH stability, for bioprocessing under lower or higher pH conditions; substrate or product tolerance, so that high product titers can be achieved; binding (Km), including broadening substrate binding to include non-natural substrates; inhibition (Ki), to remove inhibition by products, substrates, or key intermediates; activity (kcat), to increases enzymatic reaction rates to achieve desired flux; expression levels, to increase protein yields and overall pathway flux; oxygen stability, for operation of air sensitive enzymes under aerobic conditions; and anaerobic activity, for operation of an aerobic enzyme in the absence of oxygen.

[0356] A number of exemplary methods have been developed for the mutagenesis and diversification of genes to target desired properties of specific enzymes. Such methods are well known to those skilled in the art. Any of these can be used to alter and/or optimize the activity of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme or protein. Such methods include, but are not limited to EpPCR, which introduces random point mutations by reducing the fidelity of DNA polymerase in PCR reactions (Pritchard et al., J Theor.Biol. 234:497-509 (2005)); Error-prone Rolling Circle Amplification (epRCA), which is similar to epPCR except a whole circular plasmid is used as the template and random 6-mers with exonuclease resistant thiophosphate linkages on the last 2 nucleotides are used to amplify the plasmid followed by transformation into cells in which the plasmid is re-circularized at tandem repeats (Fujii et al., Nucleic Acids Res. 32:e145 (2004); and Fujii et al., Nat. Protoc. 1:2493-2497 (2006)); DNA or Family Shuffling, which typically involves digestion of two or more variant genes with nucleases such as Dnase I or EndoV to generate a pool of random fragments that are reassembled by cycles of annealing and extension in the presence of DNA polymerase to create a library of chimeric genes (Stemmer, Proc Natl Acad Sci USA 91:10747-10751 (1994); and Stemmer, Nature 370:389-391 (1994)); Staggered Extension (StEP), which entails template priming followed by repeated cycles of 2 step PCR with denaturation and very short duration of annealing/extension (as short as 5 sec) (Zhao et al., Nat. Biotechnol. 16:258-261 (1998)); Random Priming Recombination (RPR), in which random sequence primers are used to generate many short DNA fragments complementary to different segments of the template (Shao et al., Nucleic Acids Res 26:681-683 (1998)).

[0357] Additional methods include Heteroduplex Recombination, in which linearized plasmid DNA is used to form heteroduplexes that are repaired by mismatch repair (Volkov et al, Nucleic Acids Res. 27:e18 (1999); and Volkov et al., Methods Enzymol. 328:456-463 (2000)); Random Chimeragenesis on Transient Templates (RACHITT), which employs Dnase I fragmentation and size fractionation of single stranded DNA (ssDNA) (Coco et al., Nat. Biotechnol. 19:354-359 (2001)); Recombined Extension on Truncated templates (RETT), which entails template switching of unidirectionally growing strands from primers in the presence of unidirectional ssDNA fragments used as a pool of templates (Lee et al., J. Molec. Catalysis 26:119-129 (2003)); Degenerate Oligonucleotide Gene Shuffling (DOGS), in which degenerate primers are used to control recombination between molecules; (Bergquist and Gibbs, Methods Mol.Biol 352:191-204 (2007); Bergquist et al., Biomol.Eng 22:63-72 (2005); Gibbs et al., Gene 271:13-20 (2001)); Incremental Truncation for the Creation of Hybrid Enzymes (ITCHY), which creates a combinatorial library with 1 base pair deletions of a gene or gene fragment of interest (Ostermeier et al., Proc. Natl. Acad. Sci. USA 96:3562-3567 (1999); and Ostermeier et al., Nat. Biotechnol. 17:1205-1209 (1999)); Thio Incremental Truncation for the Creation of Hybrid Enzymes (THIO-ITCHY), which is similar to ITCHY except that phosphothioate dNTPs are used to generate truncations (Lutz et al., Nucleic Acids Res 29:E16 (2001)); SCRATCHY, which combines two methods for recombining genes, ITCHY and DNA shuffling (Lutz et al., Proc. Natl. Acad. Sci. USA 98:11248-11253 (2001)); Random Drift Mutagenesis (RNDM), in which mutations made via epPCR are followed by screening/selection for those retaining usable activity (Bergquist et al., Biomol. Eng. 22:63-72 (2005)); Sequence Saturation Mutagenesis (SeSaM), a random mutagenesis method that generates a pool of random length fragments using random incorporation of a phosphothioate nucleotide and cleavage, which is used as a template to extend in the presence of "universal" bases such as inosine, and replication of an inosine containing complement gives random base incorporation and, consequently, mutagenesis

(Wong et al., Biotechnol. J. 3:74-82 (2008); Wong et al., Nucleic Acids Res. 32:e26 (2004); and Wong et al., Anal. Biochem. 341:187-189 (2005)); Synthetic Shuffling, which uses overlapping oligonucleotides designed to encode "all genetic diversity in targets" and allows a very high diversity for the shuffled progeny (Ness et al., Nat. Biotechnol. 20:1251-1255 (2002)); Nucleotide Exchange and Excision Technology NexT, which exploits a combination of dUTP incorporation followed by treatment with uracil DNA glycosylase and then piperidine to perform endpoint DNA fragmentation (Muller et al., Nucleic Acids Res. 33:e117 (2005)).

[0358] Further methods include Sequence Homology-Independent Protein Recombination (SHIPREC), in which a linker is used to facilitate fusion between two distantly related or unrelated genes, and a range of chimeras is generated between the two genes, resulting in libraries of single-crossover hybrids (Sieber et al., Nat. Biotechnol. 19:456-460 (2001)); Gene Site Saturation Mutagenesis TM (GSSM T M ), in which the starting materials include a supercoiled double stranded DNA (dsDNA) plasmid containing an insert and two primers which are degenerate at the desired site of mutations (Kretz et al., Methods Enzymol. 388:3-11 (2004)); Combinatorial Cassette Mutagenesis (CCM), which involves the use of short oligonucleotide cassettes to replace limited regions with a large number of possible amino acid sequence alterations (Reidhaar-Olson et al. Methods Enzymol. 208:564 586 (1991); and Reidhaar-Olson et al. Science 241:53-57 (1988)); Combinatorial Multiple Cassette Mutagenesis (CMCM), which is essentially similar to CCM and uses epPCR at high mutation rate to identify hot spots and hot regions and then extension by CMCM to cover a defined region of protein sequence space (Reetz et al., Angew. Chem. Int. Ed Engl. 40:3589 3591 (2001)); the Mutator Strains technique, in which conditional ts mutator plasmids, utilizing the mutD5 gene, which encodes a mutant subunit of DNA polymerase III, to allow increases of 20 to 4000-X in random and natural mutation frequency during selection and block accumulation of deleterious mutations when selection is not required (Selifonova et al., Appl. Environ. Microbiol. 67:3645-3649 (2001)); Low et al., J. Mol. Biol. 260:359-3680 (1996)).

[0359] Additional exemplary methods include Look-Through Mutagenesis (LTM), which is a multidimensional mutagenesis method that assesses and optimizes combinatorial mutations of selected amino acids (Rajpal et al., Proc. Natl. Acad. Sci. USA 102:8466-8471 (2005)); Gene Reassembly, which is a DNA shuffling method that can be applied to multiple genes at one time or to create a large library of chimeras (multiple mutations) of a single gene (Tunable GeneReassembly TM (TGR T M) Technology supplied by Verenium Corporation), in Silico Protein Design Automation (PDA), which is an optimization algorithm that anchors the structurally defined protein backbone possessing a particular fold, and searches sequence space for amino acid substitutions that can stabilize the fold and overall protein energetics, and generally works most effectively on proteins with known three-dimensional structures (Hayes et al., Proc. Natl. Acad. Sci. USA 99:15926-15931 (2002)); and Iterative Saturation Mutagenesis (ISM), which involves using knowledge of structure/function to choose a likely site for enzyme improvement, performing saturation mutagenesis at chosen site using a mutagenesis method such as Stratagene QuikChange (Stratagene; San Diego CA), screening/selecting for desired properties, and, using improved clone(s), starting over at another site and continue repeating until a desired activity is achieved (Reetz et al., Nat. Protoc. 2:891-903 (2007); and Reetz et al., Angew. Chem. Int. Ed Engl. 45:7745-7751 (2006)).

[0360] Any of the aforementioned methods for mutagenesis can be used alone or in any combination. Additionally, any one or combination of the directed evolution methods can be used in conjunction with adaptive evolution techniques, as described herein.

[0361] It is understood that modifications which do not substantially affect the activity of the various embodiments of this invention are also provided within the definition of the invention provided herein. Accordingly, the following examples are intended to illustrate but not limit the present invention.

EXAMPLEI Biosynthesis of 4-Hydroxybutanoic Acid

[0362] This example describes exemplary biochemical pathways for 4-HB production.

[0363] Previous reports of 4-HB synthesis in microbes have focused on this compound as an intermediate in production of the biodegradable plastic poly-hydroxyalkanoate (PHA) (U.S. Patent No. 6,117,658). The use of 4-HB/3-HB copolymers over poly-3 hydroxybutyrate polymer (PHB) can result in plastic that is less brittle (Saito and Doi, Intl. J. Biol. Macromol.16:99-104 (1994)). The production of monomeric 4-HB described herein is a fundamentally distinct process for several reasons: (1) the product is secreted, as opposed to PHA which is produced intracellularly and remains in the cell; (2) for organisms that produce hydroxybutanoate polymers, free 4-HB is not produced, but rather the Coenzyme A derivative is used by the polyhydroxyalkanoate synthase; (3) in the case of the polymer, formation of the granular product changes thermodynamics; and (4) extracellular pH is not an issue for production of the polymer, whereas it will affect whether 4-HB is present in the free acid or conjugate base state, and also the equilibrium between 4-HB and GBL.

[0364] 4-HB can be produced in two enzymatic reduction steps from succinate, a central metabolite of the TCA cycle, with succinic semialdehyde as the intermediate (Figure 1). The first of these enzymes, succinic semialdehyde dehydrogenase, is native to many organisms including E. coli, in which both NADH- and NADPH-dependent enzymes have been found (Donnelly and Cooper, Eur. J. Biochem. 113:555-561 (1981); Donnelly and Cooper, J. Bacteriol. 145:1425-1427 (1981); Marek and Henson, J. Bacteriol.170:991-994 (1988)). There is also evidence supporting succinic semialdehyde dehydrogenase activity in S. cerevisiae (Ramos et al., Eur. J. Biochem. 149:401-404 (1985)), and a putative gene has been identified by sequence homology. However, most reports indicate that this enzyme proceeds in the direction of succinate synthesis, as shown in Figure 1 (Donnelly and Cooper, supra; Lutke-Eversloh and Steinbuchel, FEMS Microbiol. Lett. 181:63-71 (1999)), participating in the degradation pathway of 4-HB and gamma-aminobutyrate. Succinic semialdehyde also is natively produced by certain microbial organisms such as E. coli through the TCA cycle intermediate a-ketogluterate via the action of two enzymes: glutamate:succinic semialdehyde transaminase and glutamate decarboxylase. An alternative pathway, used by the obligate anaerobe Clostridium kluyveri to degrade succinate, activates succinate to succinyl-CoA, then converts succinyl-CoA to succinic semialdehyde using an alternative succinic semialdehyde dehydrogenase which is known to function in this direction (Sohling and Gottschalk, Eur. J. Biochem. 212:121-127 (1993)). However, this route has the energetic cost of ATP required to convert succinate to succinyl-CoA.

[0365] The second enzyme of the pathway, 4-hydroxybutanoate dehydrogenase, is not native to E. coli or yeast but is found in various bacteria such as C. kluyveri and Ralstonia eutropha (Lutke-Eversloh and Steinbuchel, supra; Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996); Valentin et al., Eur. J. Biochem. 227:43-60 (1995); Wolff and Kenealy, Protein Expr. Purif. 6:206-212 (1995)). These enzymes are known to be NADH-dependent, though NADPH-dependent forms also exist. An additional pathway to 4-HB from alpha ketoglutarate was demonstrated in E. coli resulting in the accumulation of poly(4- hydroxybutyric acid) (Song et al., Wei Sheng Wu Xue.Bao. 45:382-386 (2005)). The recombinant strain required the overexpression of three heterologous genes, PHA synthase (R. eutropha), 4-hydroxybutyrate dehydrogenase (R. eutropha) and 4-hydroxybutyrate:CoA transferase (C. kluyveri), along with two native E. coli genes: glutamate:succinic semialdehyde transaminase and glutamate decarboxylase. Steps 4 and 5 in Figure 1 can alternatively be carried out by an alpha-ketoglutarate decarboxylase such as the one identified in Euglena gracilis (Shigeoka et al., Biochem. J. 282(Pt2):319-323 (1992); Shigeoka and Nakano, Arch. Biochem. Biophys. 288:22-28 (1991); Shigeoka and Nakano, Biochem J. 292(Pt 2):463-467 (1993)). However, this enzyme has not previously been applied to impact the production of 4-HB or related polymers in any organism.

[0366] The microbial production capabilities of 4-hydroxybutyrate were explored in two microbes, Escherichia coli and Saccharomyces cerevisiae, using in silico metabolic models of each organism. Potential pathways to 4-HB proceed via a succinate, succinyl-CoA, or alpha ketoglutarate intermediate as shown in Figure 1.

[0367] A first step in the 4-HB production pathway from succinate involves the conversion of succinate to succinic semialdehyde via an NADH- or NADPH-dependant succinic semialdehyde dehydrogenase. In E. coli, gabD is an NADP-dependant succinic semialdehyde dehydrogenase and is part of a gene cluster involved in 4-aminobutyrate uptake and degradation (Niegemann et al.,. Arch. Microbiol. 160:454-460 (1993); Schneider et al., J. Bacteriol. 184:6976-6986 (2002)). sad is believed to encode the enzyme for NAD-dependant succinic semialdehyde dehydrogenase activity (Marek and Henson, supra). S. cerevisiae contains only the NADPH-dependant succinic semialdehyde dehydrogenase, putatively assigned to UGA2 , which localizes to the cytosol (Huh et al., Nature 425:686-691 (2003)). The maximum yield calculations assuming the succinate pathway to 4-HB in both E. coli and S. cerevisiae require only the assumption that a non-native 4-HB dehydrogenase has been added to their metabolic networks.

[0368] The pathway from succinyl-CoA to 4-hydroxybutyrate was described in U.S. Patent No. 6,117,658 as part of a process for making polyhydroxyalkanoates comprising 4 hydroxybutyrate monomer units. Clostridium kluyveri is one example organism known to possess CoA-dependant succinic semialdehyde dehydrogenase activity (Sohling and Gottschalk, supra; Sohling and Gottschalk, supra). In this study, it is assumed that this enzyme, from C. kluyveri or another organism, is expressed in E. coli or S. cerevisiae along with a non-native or heterologous 4-HB dehydrogenase to complete the pathway from succinyl-CoA to 4-HB. The pathway from alpha-ketoglutarate to 4-HB was demonstrated in E. coli resulting in the accumulation of poly(4-hydroxybutyric acid) to 30% of dry cell weight (Song et al., supra). As E. coli and S. cerevisiae natively or endogenously possess both glutamate:succinic semialdehyde transaminase and glutamate decarboxylase (Coleman et al., J. Biol. Chem. 276:244-250 (2001)), the pathway from AKG to 4-HB can be completed in both organisms by assuming only that a non-native 4-HB dehydrogenase is present.

EXAMPLE II Biosynthesis of 1,4-Butanediol from Succinate and Alpha-ketoglutarate

[0369] This example illustrates the construction and biosynthetic production of 4-HB and BDO from microbial organisms. Pathways for 4-HB and BDO are disclosed herein.

[0370] There are several alternative enzymes that can be utilized in the pathway described above. The native or endogenous enzyme for conversion of succinate to succinyl CoA (Step 1 in Figure 1) can be replaced by a CoA transferase such as that encoded by the catl gene C. kluyveri (Sohling and Gottschalk, Eur.J Biochem. 212:121-127 (1993)), which functions in a similar manner to Step 9. However, the production of acetate by this enzyme may not be optimal, as it might be secreted rather than being converted back to acetyl-CoA. In this respect, it also can be beneficial to eliminate acetate formation in Step 9. As one alternative to this CoA transferase, a mechanism can be employed in which the 4-HB is first phosphorylated by ATP and then converted to the CoA derivative, similar to the acetate kinase/phosphotransacetylase pathway in E. coli for the conversion of acetate to acetyl-CoA. The net cost of this route is one ATP, which is the same as is required to regenerate acetyl CoA from acetate. The enzymes phosphotransbutyrylase (ptb) and butyrate kinase (bk) are known to carry out these steps on the non-hydroxylated molecules for butyrate production in C. acetobutylicum (Cary et al., Appl Environ Microbiol 56:1576-1583 (1990); Valentine, R. C. and R. S. Wolfe, J Biol Chem. 235:1948-1952 (1960)). These enzymes are reversible, allowing synthesis to proceed in the direction of 4-HB.

[0371] BDO also can be produced via alpha-ketoglutarate in addition to or instead of through succinate. A described previously, and exemplified further below, one pathway to accomplish product biosynthesis is with the production of succinic semialdehyde via alpha ketoglutarate using the endogenous enzymes (Figure 1, Steps 4-5). An alternative is to use an alpha-ketoglutarate decarboxylase that can perform this conversion in one step (Figure 1, Step 8; Tian et al., Proc Natl Acad Sci U S.A 102:10670-10675 (2005)).

[0372] For the construction of different strains of BDO-producing microbial organisms, a list of applicable genes was assembled for corroboration. Briefly, one or more genes within the 4-HB and/or BDO biosynthetic pathways were identified for each step of the complete BDO-producing pathway shown in Figure 1, using available literature resources, the NCBI genetic database, and homology searches. The genes cloned and assessed in this study are presented below in in Table 6, along with the appropriate references and URL citations to the polypeptide sequence. As discussed further below, some genes were synthesized for codon optimization while others were cloned via PCR from the genomic DNA of the native or wild type organism. For some genes both approaches were used, and in this case the native genes are indicated by an "n" suffix to the gene identification number when used in an experiment. Note that only the DNA sequences differ; the proteins are identical.

Table 6. Genes expressed in host BDO-producting microbial organisms.

Gene ID Reaction Gene Source Enzyme name Link to protein sequence Reference number number name organism (Fig. 1)

0001 9 Cat2 Clostridium 4-hydroxybutyrate ncbi.nlm.nih.gov/entrez/viewe 1 kluyveri coenzyme A r.fcgi?db=nuccore&id=12281 DSM 555 transferase 00 0002 12/13 adhE Clostridium Aldehyde/ alcohol ncbi.nlm.nih.gov/entrez/viewe 2 acetobutylicu dehydrogenase r.fcgi?db=protein&val=15004 m ATCC 824 739 0003 12/13 adhE2 Clostridium Aldehyde/ alcohol ncbi.nlm.nih.gov/entrez/viewe 2 acetobutylicu dehydrogenase r.fcgi?val=NP_149325.1 m ATCC 824 0004 1 Cati Clostridium Succinate ncbi.nlm.nih.gov/entrez/viewe 1 kluyveri coenzyme A r.fcgi?db=nuccore&id=12281 DSM 555 transferase 00 0008 6 sucD Clostridium Succinic ncbi.nlm.nih.gov/entrez/viewe 1 kluyveri semialdehyde r.fcgi?db=nuccore&id=12281 DSM 555 dehydrogenase 00 (CoA-dependent) 0009 7 4-HBd Ralstonia 4-hydroxybutyrate ncbi.nlm.nih.gov/entrez/viewe 2 eutropha H16 dehydrogenase r.fcgi?val=YP_726053.1 (NAD-dependent) 0010 7 4-HBd Clostridium 4-hydroxybutyrate ncbi.nlm.nih.gov/entrez/viewe 1 kluyveri dehydrogenase r.fcgi?db=nuccore&id=12281 DSM 555 (NAD-dependent) 00 0011 12/13 adhE E. coli Aldehyde/ alcohol shigen.nig.ac.jp/ecoli/pec/gen dehydrogenase es.List.DetailAction.do?from ListFlag=true&featureType=1 &orfld=1219 0012 12/13 yqhD E. coli Aldehyde/ alcohol shigen.nig.ac.jp/ecoli/pec/gen dehydrogenase es.List.DetailAction.do

0013 13 bdhB Clostridium Butanol ncbi.nlm.nih.gov/entrez/viewe 2 acetobutylicu dehydrogenase II r.fcgi?val=NP_349891.1 m ATCC 824 0020 11 ptb Clostridium Phospho- ncbi.nlm.nih.gov/entrez/viewe 2 acetobutylicu transbutyrylase r.fcgi?db=protein&id=158963 m ATCC 824 27 0021 10 buk1 Clostridium Butyrate kinase I ncbi.nlm.nih.gov/entrez/viewe 2 acetobutylicu r.fcgi?db=protein&id=201373 m ATCC 824 34 0022 10 buk2 Clostridium Butyrate kinase II ncbi.nlm.nih.gov/entrez/viewe 2 acetobutylicu r.fcgi?db=protein&id=201374 m ATCC 824 15 0023 13 adhEm isolated from Alcohol (37)d} metalibrary dehydrogenase of anaerobic sewage digester microbial consortia 0024 13 adhE Clostridium Alcohol genome.jp/dbget thermocellum dehydrogenase bin/www bget?cth:Cthe 0423 0025 13 ald Clostridium Coenzyme A- ncbi.nlm.nih.gov/entrez/viewe (31)d} beiferinckii acylating aldehyde r.fcgi?db=protein&id=490366 dehydrogenase 81 0026 13 bdhA Clostridium Butanol ncbi.nlm.nih.gov/entrez/viewe 2 acetobutylicu dehydrogenase r.fcgi?val=NP_349892.1 m ATCC 824 0027 12 bld Clostridium Butyraldehyde ncbi.nlm.nih.gov/entrez/viewe 4 saccharoperb dehydrogenase r.fcgi?db=protein&id=310753 utylacetonicu 83 M 0028 13 bdh Clostridium Butanol ncbi.nlm.nih.gov/entrez/viewe 4 saccharoperb dehydrogenase r.fcgi?db=protein&id=124221 utylacetonicu 917 M 0029 12/13 adhE Clostridium Aldehyde/ alcohol genome.jp/dbget tetani dehydrogenase bin/www bget?ctc:CTC01366 0030 12/13 adhE Clostridium Aldehyde/ alcohol genome.jp/dbget perfringens dehydrogenase bin/www bget?cpe:CPE2531 0031 12/13 adhE Clostridium Aldehyde/ alcohol genome.jp/dbget difficile dehydrogenase bin/www bget?cdf:CD2966 0032 8 sucA Mycobacteriu a-ketoglutarate ncbi.nlm.nih.gov/entrez/viewe 5 m bovis decarboxylase r.fcgi?val=YP_977400.1 BCG, Pasteur 0033 9 cat2 Clostridium 4-hydroxybutyrate ncbi.nlm.nih.gov/entrez/viewe aminobutyric coenzyme A r.fcgi?db=protein&val=62493 um transferase 16 0034 9 cat2 Porphyromon 4-hydroxybutyrate ncbi.nlm.nih.gov/entrez/viewe as gingivalis coenzyme A r.fcgi?db=protein&val=34541 W83 transferase 558 0035 6 sucD Porphyromon Succinic ncbi.nlm.nih.gov/entrez/viewe as gingivalis semialdehyde r.fcgi?val=NP_904963.1 W83 dehydrogenase (CoA-dependent) 0036 7 4-HBd Porphyromon NAD-dependent ncbi.nlm.nih.gov/entrez/viewe as gingivalis 4-hydroxybutyrate r.fcgi?val=NP_904964.1 W83 dehydrogenase 0037 7 gbd Uncultured 4-hydroxybutyrate ncbi.nlm.nih.gov/entrez/viewe 6 bacterium dehydrogenase r.fcgi?db=nuccore&id=59161

68

0038 1 sucCD E. coli Succinyl-CoA shigen.nig.ac.jp/ecoli/pec/gen synthetase es.List.DetailAction.do

Sohling and Gottschalk, Eur. J. Biochem. 212:121-127 (1993); Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996) 2 Nolling et al., J., J. Bacteriol. 183:4823-4838 (2001) 3 Pohlmann et al., Nat. Biotechnol. 24:1257-1262 (2006) 4 Kosaka et al., Biosci. Biotechnol. Biochem. 71:58-68 (2007)

Brosch et al., Proc. Natl. Acad. Sci. U.S.A. 104:5596-5601 (2007) 6 Henne et al., Appl. Environ. Microbiol. 65:3901-3907 (1999)

[0373] Expression Vector Construction for BDO pathway. Vector backbones and some strains were obtained from Dr. Rolf Lutz of Expressys (expressys.de/). The vectors and strains are based on the pZ Expression System developed by Dr. Rolf Lutz and Prof. Hermann Bujard (Lutz, R. and H. Bujard, Nucleic Acids Res 25:1203-1210 (1997)). Vectors obtained were pZE13luc, pZA33luc, pZS*l3luc and pZE22luc and contained the luciferase gene as a stuffer fragment. To replace the luciferase stuffer fragment with a lacZ-alpha fragment flanked by appropriate restriction enzyme sites, the luciferase stuffer fragment was first removed from each vector by digestion with EcoRI and XbaI. The lacZ-alpha fragment was PCR amplified from pUC19 with the following primers:

lacZalpha-RI 5'GACGAATTCGCTAGCAAGAGGAGAAGTCGACATGTCCAATTCACTGGCCGT CGTTTTAC3' (SEQ ID NO:1)

lacZalpha 3'BB 5'-GACCCTAGGAAGCTTTCTAGAGTCGACCTATGCGGCATCAGAGCAGA-3' (SEQ ID NO:2).

[0374] This generated a fragment with a 5' end of EcoRI site, NheI site, a Ribosomal Binding Site, a SalI site and the start codon. On the 3' end of the fragment contained the stop codon, XbaI, HindlIl, and AvrII sites. The PCR product was digested with EcoRI and AvrII and ligated into the base vectors digested with EcoRI and XbaI (XbaI and AvrII have compatible ends and generate a non-site). Because NheI and XbaI restriction enzyme sites generate compatible ends that can be ligated together (but generate a NheI/XbaI non-site that is not digested by either enzyme), the genes cloned into the vectors could be "Biobricked" together (http://openwetware.org/wiki/Synthetic_Biology:BioBricks). Briefly, this method allows joining an unlimited number of genes into the vector using the same 2 restriction sites

(as long as the sites do not appear internal to the genes), because the sites between the genes are destroyed after each addition.

[0375] All vectors have the pZ designation followed by letters and numbers indication the origin of replication, antibiotic resistance marker and promoter/regulatory unit. The origin of replication is the second letter and is denoted by E for ColE1, A for pI5A and S for pSC101 based origins. The first number represents the antibiotic resistance marker (1 for Ampicillin, 2 for Kanamycin, 3 for Chloramphenicol, 4 for Spectinomycin and 5 for Tetracycline). The final number defines the promoter that regulated the gene of interest (1 for PLtetO-1, 2 for PLlacO-1, 3 for PAllacO-1, and 4 for Plac/ara-1). The MCS and the gene of interest follows immediately after. For the work discussed here we employed two base vectors, pZA33 and pZE13, modified for the biobricks insertions as discussed above. Once the gene(s) of interest have been cloned into them, resulting plasmids are indicated using the four digit gene codes given in Table 6; e.g., pZA33-XXXX-YYYY-...

[0376] Host Strain Construction. The parent strain in all studies described here is E. coli K-12 strain MG1655. Markerless deletion strains in adhE, gabD, and aldA were constructed under service contract by a third party using the redET method (Datsenko, K. A. and B. L. Wanner, Proc Natl Acad Sci U S.A 97:6640-6645 (2000)). Subsequent strains were constructed via bacteriophage P1 mediated transduction (Miller, J. Experiments in Molecular Genetics, Cold Spring Harbor Laboratories, New York (1973)). Strain C600Z1 (laciq, PN25 tetR, SpR, lacY1, leuB6,mcrB+, supE44, thi-1, thr-1, tonA21) was obtained from Expressys and was used as a source of a lacIq allele for P1 transduction. Bacteriophage Plvir was grown on the C600Z1 E. coli strain, which has the spectinomycin resistance gene linked to the laclq. The P1 lysate grown on C600Z1 was used to infect MG1655 with selection for spectinomycin resistance. The spectinomycin resistant colonies were then screened for the linked lacIq by determining the ability of the transductants to repress expression of a gene linked to a PAllacO-1 promoter. The resulting strain was designated MG1655 lacq. A similar procedure was used to introduce lacIQ into the deletion strains.

[0377] Production of 4-HB From Succinate. For construction of a 4-HB producer from succinate, genes encoding steps from succinate to 4-HB and 4-HB-CoA (1, 6, 7, and 9 in Figure 1) were assembled onto the pZA33 and pZE13 vectors as described below. Various combinations of genes were assessed, as well as constructs bearing incomplete pathways as controls (Tables 7 and 8). The plasmids were then transformed into host strains containing lacIQ, which allow inducible expression by addition of isopropyl P-D-1 thiogalactopyranoside (IPTG). Both wild-type and hosts with deletions in genes encoding the native succinic semialdehyde dehydrogenase (step 2 in Figure 1) were tested.

[0378] Activity of the heterologous enzymes were first tested in in vitro assays, using strain MG1655 lacIQ as the host for the plasmid constructs containing the pathway genes. Cells were grown aerobically in LB media (Difco) containing the appropriate antibiotics for each construct, and induced by addition of IPTG at1 mM when the optical density (OD600) reached approximately 0.5. Cells were harvested after 6 hours, and enzyme assays conducted as discussed below.

[0379] In Vitro Enzyme Assays. To obtain crude extracts for activity assays, cells were harvested by centrifugation at 4,500 rpm (Beckman-Coulter, Allegera X-15R) for 10 min. The pellets were resuspended in 0.3 mL BugBuster (Novagen) reagent with benzonase and lysozyme, and lysis proceeded for 15 minutes at room temperature with gentle shaking. Cell free lysate was obtained by centrifugation at 14,000 rpm (Eppendorf centrifuge 5402) for 30 min at 4oC. Cell protein in the sample was determined using the method of Bradford et al., Anal. Biochem. 72:248-254 (1976), and specific enzyme assays conducted as described below. Activities are reported in Units/mg protein, where a unit of activity is defined as the amount of enzyme required to convert 1 gmol of substrate in 1 min. at room temperature. In general, reported values are averages of at least 3 replicate assays.

[0380] Succinyl-CoA transferase (Catl) activity was determined by monitoring the formation of acetyl-CoA from succinyl-CoA and acetate, following a previously described procedure Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996). Succinyl-CoA synthetase (SucCD) activity was determined by following the formation of succinyl-CoA from succinate and CoA in the presence of ATP. The experiment followed a procedure described by Cha and Parks, J. Biol. Chem. 239:1961-1967 (1964). CoA-dependent succinate semialdehyde dehydrogenase (SucD) activity was determined by following the conversion of NAD to NADH at 340 nm in the presence of succinate semialdehyde and CoA (Sohling and Gottschalk, Eur. J. Biochem. 212:121-127 (1993)). 4-HB dehydrogenase (4 HBd) enzyme activity was determined by monitoring the oxidation of NADH to NAD at 340 nm in the presence of succinate semialdehyde. The experiment followed a published procedure Gerhardt et al. Arch. Microbiol. 174:189-199 (2000). 4-HB CoA transferase (Cat2) activity was determined using a modified procedure from Scherf and Buckel, Appl.

Environ. Microbiol. 57:2699-2702 (1991). The formation of 4-HB-CoA or butyryl-CoA formation from acetyl-CoA and 4-HB or butyrate was determined using HPLC.

[0381] Alcohol (ADH) and aldehyde (ALD) dehydrogenase was assayed in the reductive direction using a procedure adapted from several literature sources (Durre et al., FEMS Microbiol. Rev. 17:251-262 (1995); Palosaari and Rogers, J. Bacteriol. 170:2971-2976 (1988) and Welch et al., Arch. Biochem. Biophys. 273:309-318 (1989). The oxidation of NADH is followed by reading absorbance at 340 nM every four seconds for a total of 240 seconds at room temperature. The reductive assays were performed in 100 mM MOPS (adjusted to pH 7.5 with KOH), 0.4 mM NADH, and from I to 50 tl of cell extract. The

reaction is started by adding the following reagents: 100 tl of 100 mM acetaldehyde or

butyraldehyde for ADH, or 100 tl of 1 mM acetyl-CoA or butyryl-CoA for ALD. The Spectrophotometer is quickly blanked and then the kinetic read is started. The resulting slope of the reduction in absorbance at 340 nM per minute, along with the molar extinction coefficient of NAD(P)H at 340 nM (6000) and the protein concentration of the extract, can be used to determine the specific activity.

[0382] The enzyme activity of PTB is measured in the direction of butyryl-CoA to butyryl-phosphate as described in Cary et al. J. Bacteriol. 170:4613-4618 (1988). It provides inorganic phosphate for the conversion, and follows the increase in free CoA with the reagent ,5'-dithiobis-(2-nitrobenzoic acid), or DTNB. DTNB rapidly reacts with thiol groups such as free CoA to release the yellow-colored 2-nitro-5-mercaptobenzoic acid (TNB), which absorbs at 412 nm with a molar extinction coefficient of 14,140 M cm-1. The assay buffer contained 150 mM potassium phosphate at pH 7.4, 0.1 mM DTNB, and 0.2 mM butyryl CoA, and the reaction was started by addition of 2 to 50 gL cell extract. The enzyme activity of BK is measured in the direction of butyrate to butyryl-phosphate formation at the expense of ATP. The procedure is similar to the assay for acetate kinase previously described Rose et al., J. Biol. Chem. 211:737-756 (1954). However we have found another acetate kinase enzyme assay protocol provided by Sigma to be more useful and sensitive. This assay links conversion of ATP to ADP by acetate kinase to the linked conversion of ADP and phosphoenol pyruvate (PEP) to ATP and pyruvate by pyruvate kinase, followed by the conversion of pyruvate and NADH to lactate and NAD+ by lactate dehydrogenase. Substituting butyrate for acetate is the only major modification to allow the assay to follow BK enzyme activity. The assay mixture contained 80 mM triethanolamine buffer at pH 7.6,

200 mM sodium butyrate, 10 mM MgCl2, 0.1 mM NADH, 6.6 mM ATP, 1.8 mM phosphoenolpyruvate. Pyruvate kinase, lactate dehydrogenase, and myokinase were added according to the manufacturer's instructions. The reaction was started by adding 2 to 50 gL cell extract, and the reaction was monitored based on the decrease in absorbance at 340 nm indicating NADH oxidation.

[0383] Analysis of CoA Derivatives by HPLC. An HPLC based assay was developed to monitor enzymatic reactions involving coenzyme A (CoA) transfer. The developed method allowed enzyme activity characterization by quantitative determination of CoA, acetyl CoA (AcCoA), butyryl CoA (BuCoA) and 4-hydroxybutyrate CoA (4-HBCoA) present in in-vitro reaction mixtures. Sensitivity down to low M was achieved, as well as excellent resolution of all the CoA derivatives of interest.

[0384] Chemical and sample preparation was performed as follows. Briefly, CoA, AcCoA, BuCoA and all other chemicals, were obtained from Sigma-Aldrich. The solvents, methanol and acetonitrile, were of HPLC grade. Standard calibration curves exhibited excellent linearity in the 0.01-lmg/mL concentration range. Enzymatic reaction mixtures contained 100mM Tris HCl buffer (pH 7), aliquots were taken at different time points, quenched with formic acid (0.04% final concentration) and directly analyzed by HPLC.

[0385] HPLC analysis was performed using an Agilent 1100 HPLC system equipped with a binary pump, degasser, thermostated autosampler and column compartment, and diode array detector (DAD), was used for the analysis. A reversed phase column, Kromasil 100 um C18, 4.6x15Omm (Peeke Scientific), was employed. 25mM potassium phosphate (pH 7) and methanol or acetonitrile, were used as aqueous and organic solvents at 1mL/min flow rate. Two methods were developed: a short one with a faster gradient for the analysis of well-resolved CoA, AcCoA and BuCoA, and a longer method for distinguishing between closely eluting AcCoA and 4-HBCoA. Short method employed acetonitrile gradient (0min %, 6min - 30%, 6.5min - 5%, 10min - 5%) and resulted in the retention times 2.7, 4.1 and 5.5min for CoA, AcCoA and BuCoA, respectively. In the long method methanol was used with the following linear gradient: Omin - 5%, 20 min - 35%, 20.5min - 5%, 25min - 5 %. The retention times for CoA, AcCoA, 4-HBCoA and BuCoA were 5.8, 8.4, 9.2 and 16.0 min, respectively. The injection volume was 5pL, column temperature 30°C, and UV absorbance was monitored at 260nm.

[0386] The results demonstrated activity of each of the four pathway steps (Table 7), though activity is clearly dependent on the gene source, position of the gene in the vector, and the context of other genes with which it is expressed. For example, gene 0035 encodes a succinic semialdehyde dehydrogenase that is more active than that encoded by 0008, and 0036 and 0010n are more active 4-HB dehydrogenase genes than 0009. There also seems to be better 4-HB dehydrogenase activity when there is another gene preceding it on the same operon.

Table 7. In vitro enzyme activities in cell extracts from MG1655 lacIQ containing the plasmids expressing genes in the 4-HB-CoA pathway. Activities are reported in Units/mg protein, where a unit of activity is defined as the amount of enzyme required to convert 1 gmol of substrate in 1 min. at room temperature.

Sample# pZE13 (a) pZA33 (b) OD600 Cell Prot (c) Cat1 SucD 4HBd Cat2 1 cat1(0004) 2.71 6.43 1.232 0.00 2 cat (0004)-sucD (0035) 2.03 5.00 0.761 2.57 3 cat1(0004)-sucD (0008) 1.04 3.01 0.783 0.01 4 sucD (0035) 2.31 6.94 2.32 5 sucD (0008) 1.10 4.16 0.05 6 4hbd(0009) 2.81 7.94 0.003 0.25 7 4hbd(0036) 2.63 7.84 3.31 8 4hbd(0010n) 2.00 5.08 2.57 9 at1 (0004)-sucD (0035) 4hbd (0009) 2.07 5.04 0.600 1.85 0.01 10 cat1 (0004)-sucD (0035) 4hbd(0036) 2.08 5.40 0.694 1.73 0.41 11 cat1 (0004)-sucD (0035) 4hbd(OO10n) 2.44 4.73 0.679 2.28 0.37 12 cat1 (0004)-sucD (0008) 4hbd(0009) 1.08 3.99 0.572 -0.01 0.02 13 cat1 (0004)-sucD (0008) 4hbd(0036) 0.77 2.60 0.898 -0.01 0.04 14 cat1 (0004)-sucD (0008) 4hbd (0010n) 0.63 2.47 0.776 0.00 0.00 15 cat2 (0034) 2.56 7.86 1.283 16 cat2(0034)-4hbd(0036) 3.13 8.04 24.86 0.993 17 cat2(0034)-4hbd(OO10n) 2.38 7.03 7.45 0.675 18 4hbd(0036)-cat2(0034) 2.69 8.26 2.15 7.490 19 4hbd(OO10n)-cat2(0034) 2.44 6.59 0.59 4.101

Genes expressed from Plac on pZE13, a high-copy plasmid with colE1 origin and ampicillin resistance. Gene identification numbers are as given in Table 6 Genes expressed from Plac on pZA33, a medium-copy plasmid with pACYC origin and chloramphenicol resistance. (c) Cell protein given as mg protein per mL extract.

[0387] Recombinant strains containing genes in the 4-HB pathway were then evaluated for the ability to produce 4-HB in vivo from central metabolic intermediates. Cells were grown anaerobically in LB medium to OD600 of approximately 0.4, then induced with 1 mM IPTG. One hour later, sodium succinate was added to 10 mM, and samples taken for analysis following an additional 24 and 48 hours. 4-HB in the culture broth was analyzed by GC-MS as described below. The results indicate that the recombinant strain can produce over 2 mM 4-HB after 24 hours, compared to essentially zero in the control strain (Table 8).

Table 8. Production of 4-HB from succinate in E. coli strains harboring plasmids expressing various combinations of 4-HB pathway genes.

24 Hours 48 Hours Sample # Host Strain pZE13 pZA33 OD600 4HB, pM 4HB norm. (a) OD600 4HB, pM 4HB norm. (a) 1 MG1655|aclq cat1 (0004)-sucD (0035) 4hbd (0009) 0.47 487 1036 1.04 1780 1711 2 MG1655Iaclq cat1 (0004)-sucD (0035) 4hbd(0027) 0.41 111 270 0.99 214 217 3 MG1655Iaclq cat1 (0004)-sucD (0035) 4hbd (0036) 0.47 863 1835 0.48 2152 4484 4 MG1655|aclq cat1 (0004)-sucD (0035) 4hbd (0010n) 0.46 956 2078 0.49 2221 4533 5 MG1655Iaclq cat1 (0004)-sucD (0008) 4hbd (0009) 0.38 493 1296 0.37 1338 3616 6 MG1655Iaclq cat1(0004)-sucD (0008) 4hbd(0027) 0.32 26 81 0.27 87 323 7 MG1655Iaclq cat1 (0004)-sucD (0008) 4hbd (0036) 0.24 506 2108 0.31 1448 4672 8 MG1655Iaclq cat1 (0004)-sucD (0008) 4hbd (0010n) 0.24 78 324 0.56 233 416 9 MG1655 laclq gabD cat1 (0004)-sucD (0035) 4hbd (0009) 0.53 656 1237 1.03 1643 1595 10 MG1655 laclq gabD cat1 (0004)-sucD (0035) 4hbd(0027) 0.44 92 209 0.98 214 218 11 MG1655 laclq gabD cat1 (0004)-sucD (0035) 4hbd (0036) 0.51 1072 2102 0.97 2358 2431 12 MG1655 laclq gabD cat1 (0004)-sucD (0035) 4hbd (0010n) 0.51 981 1924 0.97 2121 2186 13 MG1655 laclq gabD cat1 (0004)-sucD (0008) 4hbd(0009) 0.35 407 1162 0.77 1178 1530 14 MG1655 laclq gabD cat1 (0004)-sucD (0008) 4hbd (0027) 0.51 19 36 1.07 50 47 15 MG1655 laclq gabD cat1 (0004)-sucD (0008) 4hbd (0036) 0.35 584 1669 0.78 1350 1731 16 MG1655 laclq gabD cat1 (0004)-sucD (0008) 4hbd (0010n) 0.32 74 232 0.82 232 283 17 MG1655 laclq vector only vector only 0.8 1 2 1.44 3 2 18 MG1655 laclq gabD vector only vector only 0.89 1 2 1.41 7 5

(a) Normalized 4-HB concentration, tM/OD600 units

[0388] An alternate to using a CoA transferase (catl) to produce succinyl-CoA from succinate is to use the native E. coli sucCD genes, encoding succinyl-CoA synthetase. This gene cluster was cloned onto pZE13 along with candidate genes for the remaining steps to 4 HB to create pZE13-0038-0035-0036.

[0389] Production of 4-HB from Glucose. Although the above experiments demonstrate a functional pathway to 4-HB from a central metabolic intermediate (succinate), an industrial process would require the production of chemicals from low-cost carbohydrate feedstocks such as glucose or sucrose. Thus, the next set of experiments was aimed to determine whether endogenous succinate produced by the cells during growth on glucose could fuel the 4-HB pathway. Cells were grown anaerobically in M9 minimal medium (6.78 g/L Na2HPO4, 3.0 g/L KH2PO4, 0.5 g/L NaCl, 1.0 g/L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2) supplemented with 20 g/L glucose, 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS) to improve the buffering capacity, 10 tg/mL thiamine, and the appropriate antibiotics. 0.25 mM IPTG was added when OD600 reached approximately 0.2, and samples taken for 4-HB analysis every 24 hours following induction. In all cases 4-HB plateaued after 24 hours, with a maximum of about 1 mM in the best strains (Figure 3a), while the succinate concentration continued to rise (Figure 3b). This indicates that the supply of succinate to the pathway is likely not limiting, and that the bottleneck may be in the activity of the enzymes themselves or in NADH availability. 0035 and 0036 are clearly the best gene candidates for CoA-dependent succinic semialdehyde dehydrogenase and 4-HB dehydrogenase, respectively. The elimination of one or both of the genes encoding known (gabD) or putative (aldA) native succinic semialdehyde dehydrogenases had little effect on performance. Finally, it should be noted that the cells grew to a much lower OD in the 4-HB-producing strains than in the controls (Figure 3c).

[0390] An alternate pathway for the production of 4-HB from glucose is via a ketoglutarate. We explored the use of an a-ketoglutarate decarboxylase from Mycobacterium tuberculosis Tian et al., Proc. Natl. Acad. Sci. USA 102:10670-10675 (2005) to produce succinic semialdehyde directly from a-ketoglutarate (step 8 in Figure 1). To demonstrate that this gene (0032) was functional in vivo, we expressed it on pZE13 in the same host as 4-HB dehydrogenase (gene 0036) on pZA33. This strain was capable of producing over 1.0 mM 4 HB within 24 hours following induction with 1 mM IPTG (Figure 4). Since this strain does not express a CoA-dependent succinic semialdehyde dehydrogenase, the possibility of succinic semialdehyde production via succinyl-CoA is eliminated. It is also possible that the native genes responsible for producing succinic semialdehyde could function in this pathway (steps 4 and 5 in Figure 1); however, the amount of 4-HB produced when the pZE13-0032 plasmid was left out of the host is the negligible.

[0391] Production of BDO from 4-HB. The production of BDO from 4-HB required two reduction steps, catalyzed by dehydrogenases. Alcohol and aldehyde dehydrogenases (ADH and ALD, respectively) are NAD+/H and/or NADP+/H-dependent enzymes that together can reduce a carboxylic acid group on a molecule to an alcohol group, or in reverse, can perform the oxidation of an alcohol to a carboxylic acid. This biotransformation has been demonstrated in wild-type Clostridium acetobutylicum (Jewell et al., Current Microbiology, 13:215-19 (1986)), but neither the enzymes responsible nor the genes responsible were identified. In addition, it is not known whether activation to 4-HB-CoA is first required (step 9 in Figure 1), or if the aldehyde dehydrogenase (step 12) can act directly on 4-HB. We developed a list of candidate enzymes from C. acetobutylicum and related organisms based on known activity with the non-hydroxylated analogues to 4-HB and pathway intermediates, or by similarity to these characterized genes (Table 6). Since some of the candidates are multifunctional dehydrogenases, they could potentially catalyze both the NAD(P)H dependent reduction of the acid (or CoA-derivative) to the aldehyde, and of the aldehyde to the alcohol. Before beginning work with these genes in E. coli, we first validated the result referenced above using C. acetobutylicum ATCC 824. Cells were grown in Schaedler broth (Accumedia, Lansing, MI) supplemented with 10 mM 4-HB, in an anaerobic atmosphere of % C02, 10% H2, and 80% N2 at 30oC. Periodic culture samples were taken, centrifuged, and the broth analyzed for BDO by GC-MS as described below. BDO concentrations of 0.1 mM, 0.9 mM, and 1.5 mM were detected after 1 day, 2 days, and 7 days incubation, respectively. No BDO was detected in culture grown without 4-HB addition. To demonstrate that the BDO produced was derived from glucose, we grew the best BDO producing strain MG1655 lacIQ pZE13-0004-0035-0002 pZA33-0034-0036 in M9 minimal medium supplemented with 4 g/L uniformly labeled 13C-glucose. Cells were induced at OD of 0.67 with 1 mM IPTG, and a sample taken after 24 hours. Analysis of the culture supernatant was performed by mass spectrometry.

[0392] Gene candidates for the 4-HB to BDO conversion pathway were next tested for activity when expressed in the E. coli host MG1655 lacIQ. Recombinant strains containing each gene candidate expressed on pZA33 were grown in the presence of 0.25 mM IPTG for four hours at 37oC to fully induce expression of the enzyme. Four hours after induction, cells were harvested and assayed for ADH and ALD activity as described above. Since 4-HB-CoA and 4-hydroxybutyraldehyde are not available commercially, assays were performed using the non-hydroxylated substrates (Table 9). The ratio in activity between 4-carbon and 2 carbon substrates for C. acetobutylicum adhE2 (0002) and E. coli adhE (0011) were similar to those previously reported in the literature a Atsumi et al., Biochim. Biophys. Acta. 1207:1-11 (1994).

Table 9. In vitro enzyme activities in cell extracts from MG1655 lacIl containing pZA33 expressing gene candidates for aldehyde and alcohol dehydrogenases. Activities are expressed in tmol min-' mg cell protein 1 . N.D., not determined. Aldehyde dehydrogenase Alcoholdehydrogenase Gene Substrate Butyryl-CoA Acetyl-CoA Butyraldehyde Acetaldehyde 0002 0.0076 0.0046 0.0264 0.0247 0003n 0.0060 0.0072 0.0080 0.0075 0011 0.0069 0.0095 0.0265 0.0093 0013 N.D. N.D. 0.0130 0.0142 0023 0.0089 0.0137 0.0178 0.0235 0025 0 0.0001 N.D. N.D. 0026 0 0.0005 0.0024 0.0008

[0393] For the BDO production experiments, cat2 from Porphyromonasgingivalis W83 (gene 0034) was included on pZA33 for the conversion of 4-HB to 4-HB-CoA, while the candidate dehydrogenase genes were expressed on pZE13. The host strain was MG1655 lacIQ. Along with the alcohol and aldehyde dehydrogenase candidates, we also tested the ability of CoA-dependent succinic semialdehyde dehydrogenases (sucD) to function in this step, due to the similarity of the substrates. Cells were grown to an OD of about 0.5 in LB medium supplemented with 10 mM 4-HB, induced with 1 mM IPTG, and culture broth samples taken after 24 hours and analyzed for BDO as described below. The best BDO production occurred using adhE2 from C. acetobutylicum, sucD from C. kluyveri, or sucD from P. gingivalis (Figure 5). Interestingly, the absolute amount of BDO produced was higher under aerobic conditions; however, this is primarily due to the lower cell density achieved in anaerobic cultures. When normalized to cell OD, the BDO production per unit biomass is higher in anaerobic conditions (Table 10).

Table 10. Absolute and normalized BDO concentrations from cultures of cells expressing adhE2 from C. acetobutylicum, sucD from C. kluyveri, or sucD from P. gingivalis (data from experiments 2, 9, and 10 in Figure 3), as well as the negative control (experiment 1).

Gene Conditions BDO OD BDO/OD expressed (pM) (600nm) none Aerobic 0 13.4 0 none Microaerobic 0.5 6.7 0.09 none Anaerobic 2.2 1.26 1.75 0002 Aerobic 138.3 9.12 15.2 0002 Microaerobic 48.2 5.52 8.73 0002 Anaerobic 54.7 1.35 40.5 0008n Aerobic 255.8 5.37 47.6 0008n Microaerobic 127.9 3.05 41.9 0008n Anaerobic 60.8 0.62 98.1 0035 Aerobic 21.3 14.0 1.52 0035 Microaerobic 13.1 4.14 3.16 0035 Anaerobic 21.3 1.06 20.1

[0394] As discussed above, it may be advantageous to use a route for converting 4-HB to 4-HB-CoA that does not generate acetate as a byproduct. To this aim, we tested the use of phosphotransbutyrylase (ptb) and butyrate kinase (bk) from C. acetobutylicum to carry out this conversion via steps 10 and 11 in Figure 1. The native ptb/bk operon from C.

acetobutylicum (genes 0020 and 0021) was cloned and expressed in pZA33. Extracts from cells containing the resulting construct were taken and assayed for the two enzyme activities as described herein. The specific activity of BK was approximately 65 U/mg, while the specific activity of PTB was approximately 5 U/mg. One unit (U) of activity is defined as conversion of 1 gM substrate in 1 minute at room temperature. Finally, the construct was tested for participation in the conversion of 4-HB to BDO. Host strains were transformed with the pZA33-0020-0021 construct described and pZE13-0002, and compared to use of cat2 in BDO production using the aerobic procedure used above in Figure 5. The BK/PTB strain produced 1 mM BDO, compared to 2 mM when using cat2 (Table 11). Interestingly, the results were dependent on whether the host strain contained a deletion in the native adhE gene.

Table 11. Absolute and normalized BDO concentrations from cultures of cells expressing adhE2 from C. acetobutylicum in pZE13 along with either cat2 from P. gingivalis (0034) or the PTB/BK genes from C. acetobutylicum on pZA33. Host strains were either MG1655 lacIQ or MG1655 AadhE lacIQ.

Genes Host Strain (pM) (60n) BDO/OD

0034 MG1655 lacIQ 0.827 19.9 0.042 0020+0021 MG1655 lacIQ 0.007 9.8 0.0007

0034 MG1655 AadhE 2.084 12.5 0.166 lacI2 0020+0021 MG1655 AadhE 0.975 18.8 0.052 ______________lacIQ _____ _____

[0395] Production of BDO from Glucose. The final step of pathway corroboration is to express both the 4-HB and BDO segments of the pathway in E. coli and demonstrate production of BDO in glucose minimal medium. New plasmids were constructed so that all the required genes fit on two plamids. In general, catI, adhE, and sucD genes were expressed from pZE13, and cat2 and 4-HBd were expressed from pZA33. Various combinations of gene source and gene order were tested in the MG1655 lacIQ background. Cells were grown anaerobically in M9 minimal medium (6.78 g/L Na 2HPO 4, 3.0 g/L KH 2 PO 4 , 0.5 g/L NaCl, 1.0 g/L NH 4 Cl, 1mIM MgSO 4 , 0.1 mM CaCl 2) supplemented with 20 g/L glucose, 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS) to improve the buffering capacity, 10 gg/mL thiamine, and the appropriate antibiotics. 0.25 mM IPTG was added approximately 15 hours following inoculation, and culture supernatant samples taken for BDO, 4-HB, and succinate analysis 24 and 48 hours following induction. The production of BDO appeared to show a dependency on gene order (Table 12). The highest BDO production, over 0.5 mM, was obtained with cat2 expressed first, followed by 4-HBd on pZA33, and catl followed by P. gingivalis sucD on pZE13. The addition of C. acetobutylicum adhE2 in the last position on pZE13 resulted in slight improvement. 4-HB and succinate were also produced at higher concentrations.

Table 12. Production of BDO, 4-HB, and succinate in recombinant E. coli strains expressing combinations of BDO pathway genes, grown in minimal medium supplemented with 20 g/L glucose. Concentrations are given in mM. 24 Hours 48 Hours Sample pZE13 pZA33 Induction OD OD600nm Su 4HB BDO OD600nm Su 4HB BDO 1 catl(0004)-sucD(0035) 4hbd (0036)-cat2(0034) 0.92 1.29 5.44 1.37 0.240 1.24 6.42 1.49 0.280 2 cat1(0004)-sucD(0008N) 4hbd (0036)-cat2(0034) 0.36 1.11 6.90 1.24 0.011 1.06 7.63 1.33 0.011 3 adhE(0002)-catl(0004)-sucD(0035) 4hbd (0036)-cat2(0034) 0.20 0.44 0.34 1.84 0.050 0.60 1.93 2.67 0.119 4 catl(0004)-sucD(0035)-adhE(0002) 4hbd (0036)-cat2(0034) 1.31 1.90 9.02 0.73 0.073 1.95 9.73 0.82 0.077 adhE(0002)-catl(0004)-sucD(0008N) 4hbd (0036)-cat2(0034) 0.17 0.45 1.04 1.04 0.008 0.94 7.13 1.02 0.017 6 catl(0004)-sucD(0008N)-adhE(0002) 4hbd (0036)-cat2(0034) 1.30 1.77 10.47 0.25 0.004 1.80 11.49 0.28 0.003 7 catl(0004)-sucD(0035) cat2(0034)-4hbd(0036) 1.09 1.29 5.63 2.15 0.461 1.38 6.66 2.30 0.520 8 cat1(0004)-sucD(0008N) cat2(0034)-4hbd(0036) 1.81 2.01 11.28 0.02 0.000 2.24 11.13 0.02 0.000 9 adhE(0002)-catl(0004)-sucD(0035) cat2(0034)-4hbd(0036) 0.24 1.99 2.02 2.32 0.106 0.89 4.85 2.41 0.186 catl(0004)-sucD(0035)-adhE(0002) cat2(0034)-4hbd(0036) 0.98 1.17 5.30 2.08 0.569 1.33 6.15 2.14 0.640 11 adhE(0002)-catl(0004)-sucD(0008N) cat2(0034)-4hbd(0036) 0.20 0.53 1.38 2.30 0.019 0.91 8.10 1.49 0.034 12 catl(0004)-sucD(0008N)-adhE(0002) cat2(0034)-4hbd(0036) 2.14 273 12.07 0.16 0.000 3.10 11.79 0.17 0.002 13 vector only vector only 2.11 2.62 9.03 0.01 0.000 3.00 12.05 0.01 0.000

[0396] Analysis of BDO, 4-HB and succinate by GCMS. BDO, 4-HB and succinate in fermentation and cell culture samples were derivatized by silylation and quantitatively analyzed by GCMS using methods adapted from literature reports ((Simonov et al., J. Anal Chem.59:965-971 (2004)). The developed method demonstrated good sensitivity down to 1 M, linearity up to at least 25mM, as well as excellent selectivity and reproducibility.

[0397] Sample preparation was performed as follows: 100pL filtered (0.2m or 0.45 m syringe filters) samples, e.g. fermentation broth, cell culture or standard solutions, were dried down in a Speed Vac Concentrator (Savant SVC-1O0H) for approximately 1 hour at ambient temperature, followed by the addition of 20 pL 10mM cyclohexanol solution, as an internal standard, in dimethylformamide. The mixtures were vortexed and sonicated in a water bath (Branson 3510) for 15 min to ensure homogeneity. 100 pL silylation derivatization reagent, N,O-bis(trimethylsilyl)triflouro-acetimide (BSTFA) with 1% trimethylchlorosilane, was added, and the mixture was incubated at 70°C for 30 min. The derivatized samples were centrifuged for 5 min, and the clear solutions were directly injected into GCMS. All the chemicals and reagents were from Sigma-Aldrich, with the exception of BDO which was purchased from J.T.Baker.

[0398] GCMS was performed on an Agilent gas chromatograph 6890N, interfaced to a mass-selective detector (MSD) 5973N operated in electron impact ionization (ElI) mode has been used for the analysis. A DB-5MS capillary column (J&W Scientific, Agilent Technologies), 30m x 0.25mm i.d. x 0.25 pm film thickness, was used. The GC was operated in a split injection mode introducing 1 L of sample at 20:1 split ratio. The injection port temperature was 250 0C. Helium was used as a carrier gas, and the flow rate was maintained at 1.0 mL/min. A temperature gradient program was optimized to ensure good resolution of the analytes of interest and minimum matrix interference. The oven was initially held at 800 C for 1min, then ramped to 1200 C at 2C/min, followed by fast ramping to 320C at100°C/min and final hold for 6min at 320 0C. The MS interface transfer line was maintained at 280C. The data were acquired using 'lowmass' MS tune settings and 30-400 m/z mass-range scan. The total analysis time was 29 min including 3 min solvent delay. The retention times corresponded to 5.2, 10.5, 14.0 and 18.2 min for BSTFA-derivatized cyclohexanol, BDO, 4 HB and succinate, respectively. For quantitative analysis, the following specific mass fragments were selected (extracted ion chromatograms): m/z 157 for internal standard cyclohexanol, 116 for BDO, and 147 for both 4-HB and succinate. Standard calibration curves were constructed using analyte solutions in the corresponding cell culture or fermentation medium to match sample matrix as close as possible. GCMS data were processed using Environmental Data Analysis ChemStation software (Agilent Technologies).

[0399] The results indicated that most of the 4-HB and BDO produced were labeled with 13C (Figure 6, right-hand sides). Mass spectra from a parallel culture grown in unlabeled glucose are shown for comparison (Figure 6, left-hand sides). Note that the peaks seen are for fragments of the derivatized molecule containing different numbers of carbon atoms from the metabolite. The derivatization reagent also contributes some carbon and silicon atoms that naturally-occurring label distribution, so the results are not strictly quantitative.

[0400] Production of BDO from 4-HB using alternate pathways. The various alternate pathways were also tested for BDO production. This includes use of the native E. coli SucCD enzyme to convert succinate to succinyl-CoA (Table 13, rows 2-3), use of alpha-ketoglutarate decarboxylase in the alpha-ketoglutarate pathway (Table 13, row 4), and use of PTB/BK as an alternate means to generate the CoA-derivative of 4HB (Table 13, row 1). Strains were constructed containing plasmids expressing the genes indicated in Table 13, which encompass these variants. The results show that in all cases, production of 4-HB and BDO occurred (Table 13).

Table 13. Production of BDO, 4-HB, and succinate in recombinant E. coli strains genes for different BDO pathway variants, grown anaerobically in minimal medium supplemented with g/L glucose, and harvested 24 hours after induction with 0.1 mM IPTG. Concentrations are given in mM.

Genes on pZE13 Genes on pZA33 Succinate 4-HB BDO

0002+0004+0035 0020n-0021n-0036 0.336 2.91 0.230 0038+0035 0034-0036 0.814 2.81 0.126 0038+0035 0036-0034 0.741 2.57 0.114 0035+0032 0034-0036 5.01 0.538 0.154

EXAMPLE III Biosynthesis of 4-Hydroxybutanoic Acid, y-Butyrolactone and 1,4-Butanediol

[0401] This Example describes the biosynthetic production of 4-hydroxybutanoic acid, y butyrolactone and 1,4-butanediol using fermentation and other bioprocesses.

[0402] Methods for the integration of the 4-HB fermentation step into a complete process for the production of purified GBL, 1,4-butanediol (BDO) and tetrahydrofuran (THF) are described below. Since 4-HB and GBL are in equilibrium, the fermentation broth will contain both compounds. At low pH this equilibrium is shifted to favor GBL. Therefore, the fermentation can operate at pH 7.5 or less, generally pH 5.5 or less. After removal of biomass, the product stream enters into a separation step in which GBL is removed and the remaining stream enriched in 4-HB is recycled. Finally, GBL is distilled to remove any impurities. The process operates in one of three ways: 1) fed-batch fermentation and batch separation; 2) fed-batch fermentation and continuous separation; 3) continuous fermentation and continuous separation. The first two of these modes are shown schematically in Figure 7. The integrated fermentation procedures described below also are used for the BDO producing cells of the invention for biosynthesis of BDO and subsequent BDO family products.

[0403] Fermentation protocol to produce 4-HB/GBL (batch): The production organism is grown in a 1OL bioreactor sparged with an N2/CO2 mixture, using 5 L broth containing 5 g/L potassium phosphate, 2.5 g/L ammonium chloride, 0.5 g/L magnesium sulfate, and 30 g/L corn steep liquor, and an initial glucose concentration of 20 g/L. As the cells grow and utilize the glucose, additional 70% glucose is fed into the bioreactor at a rate approximately balancing glucose consumption. The temperature of the bioreactor is maintained at 30 degrees C. Growth continues for approximately 24 hours, until 4-HB reaches a concentration of between 20-200 g/L, with the cell density being between 5 and 10 g/L. The pH is not controlled, and will typically decrease to pH 3-6 by the end of the run. Upon completion of the cultivation period, the fermenter contents are passed through a cell separation unit (e.g., centrifuge) to remove cells and cell debris, and the fermentation broth is transferred to a product separations unit. Isolation of 4-HB and/or GBL would take place by standard separations procedures employed in the art to separate organic products from dilute aqueous solutions, such as liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of 4-HB/GBL. The resulting solution is then subjected to standard distillation methods to remove and recycle the organic solvent and to provide GBL (boiling point 204-205oC) which is isolated as a purified liquid.

[0404] Fermentation protocol to produce 4-HB/GBL (fully continuous): The production organism is first grown up in batch mode using the apparatus and medium composition described above, except that the initial glucose concentration is 30-50 g/L. When glucose is exhausted, feed medium of the same composition is supplied continuously at a rate between 0.5 L/hr and 1 L/hr, and liquid is withdrawn at the same rate. The 4-HB concentration in the bioreactor remains constant at 30-40 g/L, and the cell density remains constant between 3-5 g/L. Temperature is maintained at 30 degrees C, and the pH is maintained at 4.5 using concentrated NaOH and HCl, as required. The bioreactor is operated continuously for one month, with samples taken every day to assure consistency of 4-HB concentration. In continuous mode, fermenter contents are constantly removed as new feed medium is supplied. The exit stream, containing cells, medium, and products 4-HB and/or GBL, is then subjected to a continuous product separations procedure, with or without removing cells and cell debris, and would take place by standard continuous separations methods employed in the art to separate organic products from dilute aqueous solutions, such as continuous liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of 4-HB/GBL. The resulting solution is subsequently subjected to standard continuous distillation methods to remove and recycle the organic solvent and to provide GBL (boiling point 204-205oC) which is isolated as a purified liquid.

[0405] GBL Reduction Protocol: Once GBL is isolated and purified as described above, it will then be subjected to reduction protocols such as those well known in the art (references cited) to produce 1,4-butanediol or tetrahydrofuran (THF) or a mixture thereof. Heterogeneous or homogeneous hydrogenation catalysts combined with GBL under hydrogen pressure are well known to provide the products 1,4-butanediol or tetrahydrofuran (THF) or a mixture thereof. It is important to note that the 4-HB/GBL product mixture that is separated from the fermentation broth, as described above, may be subjected directly, prior to GBL isolation and purification, to these same reduction protocols to provide the products 1,4 butanediol or tetrahydrofuran or a mixture thereof. The resulting products, 1,4-butanediol and THF are then isolated and purified by procedures well known in the art.

[0406] Fermentation and hydrogenation protocol to produce BDO or THF directly (batch): Cells are grown in a 10L bioreactor sparged with an N2/CO2 mixture, using 5 L broth containing 5 g/L potassium phosphate, 2.5 g/L ammonium chloride, 0.5 g/L magnesium sulfate, and 30 g/L corn steep liquor, and an initial glucose concentration of 20 g/L. As the cells grow and utilize the glucose, additional 70% glucose is fed into the bioreactor at a rate approximately balancing glucose consumption. The temperature of the bioreactor is maintained at 30 degrees C. Growth continues for approximately 24 hours, until 4-HB reaches a concentration of between 20-200 g/L, with the cell density being between 5 and 10 g/L. The pH is not controlled, and will typically decrease to pH 3-6 by the end of the run. Upon completion of the cultivation period, the fermenter contents are passed through a cell separation unit (e.g., centrifuge) to remove cells and cell debris, and the fermentation broth is transferred to a reduction unit (e.g., hydrogenation vessel), where the mixture 4-HB/GBL is directly reduced to either 1,4-butanediol or THF or a mixture thereof. Following completion of the reduction procedure, the reactor contents are transferred to a product separations unit. Isolation of 1,4-butanediol and/or THF would take place by standard separations procedures employed in the art to separate organic products from dilute aqueous solutions, such as liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of 1,4-butanediol and/or THF. The resulting solution is then subjected to standard distillation methods to remove and recycle the organic solvent and to provide 1,4 butanediol and/or THF which are isolated as a purified liquids.

[0407] Fermentation and hydrogenation protocol to produce BDO or THF directly (fully continuous): The cells are first grown up in batch mode using the apparatus and medium composition described above, except that the initial glucose concentration is 30-50 g/L. When glucose is exhausted, feed medium of the same composition is supplied continuously at a rate between 0.5 L/hr and 1 L/hr, and liquid is withdrawn at the same rate. The 4-HB concentration in the bioreactor remains constant at 30-40 g/L, and the cell density remains constant between 3-5 g/L. Temperature is maintained at 30 degrees C, and the pH is maintained at 4.5 using concentrated NaOH and HCl, as required. The bioreactor is operated continuously for one month, with samples taken every day to assure consistency of 4-HB concentration. In continuous mode, fermenter contents are constantly removed as new feed medium is supplied. The exit stream, containing cells, medium, and products 4-HB and/or GBL, is then passed through a cell separation unit (e.g., centrifuge) to remove cells and cell debris, and the fermentation broth is transferred to a continuous reduction unit (e.g., hydrogenation vessel), where the mixture 4-HB/GBL is directly reduced to either 1,4 butanediol or THF or a mixture thereof. Following completion of the reduction procedure, the reactor contents are transferred to a continuous product separations unit. Isolation of 1,4 butanediol and/or THF would take place by standard continuous separations procedures employed in the art to separate organic products from dilute aqueous solutions, such as liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of 1,4-butanediol and/or THF. The resulting solution is then subjected to standard continuous distillation methods to remove and recycle the organic solvent and to provide 1,4-butanediol and/or THF which are isolated as a purified liquids.

[0408] Fermentation protocol to produce BDO directly (batch): The production organism is grown in a 10L bioreactor sparged with an N2/CO2 mixture, using 5 L broth containing 5 g/L potassium phosphate, 2.5 g/L ammonium chloride, 0.5 g/L magnesium sulfate, and 30 g/L corn steep liquor, and an initial glucose concentration of 20 g/L. As the cells grow and utilize the glucose, additional 70% glucose is fed into the bioreactor at a rate approximately balancing glucose consumption. The temperature of the bioreactor is maintained at 30 degrees C. Growth continues for approximately 24 hours, until BDO reaches a concentration of between 20-200 g/L, with the cell density generally being between and 10 g/L. Upon completion of the cultivation period, the fermenter contents are passed through a cell separation unit (e.g., centrifuge) to remove cells and cell debris, and the fermentation broth is transferred to a product separations unit. Isolation of BDO would take place by standard separations procedures employed in the art to separate organic products from dilute aqueous solutions, such as liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of BDO. The resulting solution is then subjected to standard distillation methods to remove and recycle the organic solvent and to provide BDO (boiling point 228-229oC) which is isolated as a purified liquid.

[0409] Fermentation protocol to produce BDO directly (fully continuous): The production organism is first grown up in batch mode using the apparatus and medium composition described above, except that the initial glucose concentration is 30-50 g/L. When glucose is exhausted, feed medium of the same composition is supplied continuously at a rate between 0.5 L/hr and 1 L/hr, and liquid is withdrawn at the same rate. The BDO concentration in the bioreactor remains constant at 30-40 g/L, and the cell density remains constant between 3-5 g/L. Temperature is maintained at 30 degrees C, and the pH is maintained at 4.5 using concentrated NaOH and HCl, as required. The bioreactor is operated continuously for one month, with samples taken every day to assure consistency of BDO concentration. In continuous mode, fermenter contents are constantly removed as new feed medium is supplied. The exit stream, containing cells, medium, and the product BDO, is then subjected to a continuous product separations procedure, with or without removing cells and cell debris, and would take place by standard continuous separations methods employed in the art to separate organic products from dilute aqueous solutions, such as continuous liquid liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of BDO. The resulting solution is subsequently subjected to standard continuous distillation methods to remove and recycle the organic solvent and to provide BDO (boiling point 228-229oC) which is isolated as a purified liquid (mpt 20°C).

EXAMPLE IV Exemplary BDO Pathways

[0410] This example describes exemplary enzymes and corresponding genes for 1,4 butandiol (BDO) synthetic pathways.

[0411] Exemplary BDO synthetic pathways are shown in Figures 8-13. The pathways depicted in Figures 8-13 are from common central metabolic intermediates to 1,4-butanediol. All transformations depicted in Figures 8-13 fall into the 18 general categories of transformations shown in Table 14. Below is described a number of biochemically characterized candidate genes in each category. Specifically listed are genes that can be applied to catalyze the appropriate transformations in Figures 9-13 when cloned and expressed in a host organism. The top three exemplary genes for each of the key steps in

Figures 9-13 are provided in Tables 15-23 (see below). Exemplary genes were provided for the pathways depicted in Figure 8 are described herein.

Table 14. Enzyme types required to convert common central metabolic intermediates into 1,4-butanediol. The first three digits of each label correspond to the first three Enzyme Commission number digits which denote the general type of transformation independent of substratespecificity.

Label Function 1.1.1.a Oxidoreductase (ketone to hydroxyl or aldehyde to alcohol) 1.1.1.c Oxidoreductase (2 step, acyl-CoA to alcohol) 1.2.1.b Oxidoreductase (acyl-CoA to aldehyde) 1.2.1.c Oxidoreductase (2-oxo acid to acyl-CoA, decarboxylation) 1.2.1.d Oxidoreductase (phosphorylating/dephosphorylating) 1.3.1.a Oxidoreductase operating on CH-CH donors 1.4.1.a Oxidoreductase operating on amino acids 2.3.1.a Acyltransferase (transferring phosphate group) 2.6.1.a Aminotransferase 2.7.2.a Phosphotransferase, carboxyl group acceptor 2.8.3.a Coenzyme-A transferase 3.1.2.a Thiolester hydrolase (CoA specific) 4.1.1.a Carboxy-lyase 4.2.1.a Hydro-lyase 4.3.1.a Ammonia-lyase 5.3.3.a Isomerase 5.4.3.a Aminomutase 6.2.1.a Acid-thiol ligase

1.1.1.a - Oxidoreductase (aldehyde to alcohol or ketone to hydroxyl)

[0412] Aldehyde to alcohol. Exemplary genes encoding enzymes that catalyze the conversion of an aldehyde to alcohol, that is, alcohol dehydrogenase or equivalently aldehyde reductase, include alrA encoding a medium-chain alcohol dehydrogenase for C2-C14 (Tani et al. Appl.Environ.Microbiol. 66:5231-5235 (2000)), ADH2 from Saccharomyces cerevisiae (Atsumi et al. Nature 451:86-89 (2008)), yqhD from E. coli which has preference for molecules longer than C(3) (Sulzenbacher et al. JournalofMolecular Biology 342:489-502 (2004)), and bdh I and bdhII from C. acetobutylicum which converts butyryaldehyde into butanol (Walter et al. JournalofBacteriology 174:7149-7158 (1992)). The protein sequences for each of these exemplary gene products, if available, can be found using the following GenBank accession numbers:

Gene Accession No. GI No. Organism airA BAB12273.1 9967138 Acinetobacter sp. Strain M-1 ADH2 NP_014032.1 6323961 Saccharymyces cerevisiae yqhD NP_417484.1 16130909 Escherichiacoli bdh I NP_349892.1 15896543 Clostridiumacetobutylicum bdhII NP_349891.1 15896542 Clostridiumacetobutylicum

[0413] Enzymes exhibiting 4-hydroxybutyrate dehydrogenase activity (EC 1.1.1.61) also fall into this category. Such enzymes have been characterized in Ralstonia eutropha (Bravo et al. J.ForensicSci. 49:379-387 (2004), Clostridium kluyveri (Wolff et al. Protein Expr.Purif 6:206-212 (1995)) and Arabidopsis thaliana(Breitkreuz et al. J.Biol.Chem. 278:41552-41556 (2003)).

Gene Accession No. GI No. Organism 4hbd YP_726053.1 113867564 Ralstonia eutropha H16 4hbd L21902.1 146348486 Clostridium kluyveri DSM 555 4hbd Q94B07 75249805 Arabidopsis thaliana

[0414] Another exemplary enzyme is 3-hydroxyisobutyrate dehydrogenase which catalyzes the reversible oxidation of 3-hydroxyisobutyrate to methylmalonate semialdehyde. This enzyme participates in valine, leucine and isoleucine degradation and has been identified in bacteria, eukaryotes, and mammals. The enzyme encoded by P84067 from Thermus thermophilus HB8 has been structurally characterized (Lokanath et al. JMol Biol 352:905-17 (2005)). The reversibility of the human 3-hydroxyisobutyrate dehydrogenase was demonstrated using isotopically-labeled substrate (Manning et al. Biochem J231:481-484 (1985)). Additional genes encoding this enzyme include 3hidh in Homo sapiens (Hawes et al. Methods Enzymol. 324:218-228 (2000)) and Oryctolagus cuniculus (Chowdhury et al. Biosci.BiotechnolBiochem. 60:2043-2047 (1996); Hawes et al. Methods Enzymol. 324:218 228 (2000)), mmsb in Pseudomonas aeruginosa,and dhat in Pseudomonasputida (Aberhart et al. J Chem.Soc. [Perkin 1] 6:1404-1406 (1979); Chowdhury et al. Biosci.Biotechnol Biochem. 67:438-441 (2003); Chowdhury et al. Biosci.BiotechnolBiochem. 60:2043-2047 (1996)).

Gene Accession No. GI No. Organism P84067 P84067 75345323 Thermus thermophilus mmsb P28811.1 127211 Pseudomonasaeruginosa dhat Q59477.1 2842618 Pseudomonasputida 3hidh P31937.2 12643395 Homo sapiens 3hidh P32185.1 416872 Oryctolagus cuniculus

Several 3-hydroxyisobutyrate dehydrogenase enzymes have also been shown to convert malonic semialdehyde to 3-hydroxyproprionic acid (3-HP). Three gene candidates exhibiting this activity are mmsB from Pseudomonas aeruginosa PAO1(62), mmsB from Pseudomonas putida KT2440 (Liao et al., US Publication 2005/0221466) and mmsB from Pseudomonas putida E23 (Chowdhury et al., Biosci.Biotechnol.Biochem. 60:2043-2047 (1996)). An enzyme with 3-hydroxybutyrate dehydrogenase activity in AlcaligenesfaecalisM3A has also been identified (Gokam et al., US Patent No. 7,393,676; Liao et al., US Publication No. 2005/0221466). Additional gene candidates from other organisms including Rhodobacter spaeroidescan be inferred by sequence similarity.

Gene Accession No. GI No. Organism mmsB AAA25892.1 151363 Pseudomonas aeruginosa mmsB NP_252259.1 15598765 Pseudomonas aeruginosa PAOI mmsB NP_746775.1 26991350 Pseudomonasputida KT2440 mmsB JC7926 60729613 Pseudomonasputida E23 orfBi AAL26884 16588720 Rhodobacter spaeroides

[0415] The conversion of malonic semialdehyde to 3-HP can also be accomplished by two other enzymes: NADH-dependent 3-hydroxypropionate dehydrogenase and NADPH dependent malonate semialdehyde reductase. An NADH-dependent 3-hydroxypropionate dehydrogenase is thought to participate in beta-alanine biosynthesis pathways from propionate in bacteria and plants (Rathinasabapathi, B. JournalofPlant Pathology 159:671 674 (2002); Stadtman, E. R. J.Am.Chem.Soc. 77:5765-5766 (1955)). This enzyme has not been associated with a gene in any organism to date. NADPH-dependent malonate semialdehyde reductase catalyzes the reverse reaction in autotrophic C02 -fixing bacteria. Although the enzyme activity has been detected in Metallosphaerasedula, the identity of the gene is not known (Alber et al. J.Bacteriol. 188:8551-8559 (2006)).

[0416] Ketone to hydroxyl. There exist several exemplary alcohol dehydrogenases that convert a ketone to a hydroxyl functional group. Two such enzymes from E. coli are encoded by malate dehydrogenase (mdh) and lactate dehydrogenase (ldhA). In addition, lactate dehydrogenase from Ralstonia eutropha has been shown to demonstrate high activities on substrates of various chain lengths such as lactate, 2-oxobutyrate, 2-oxopentanoate and 2 oxoglutarate (Steinbuchel and. Schlegel, Eur.J.Biochem. 130:329-334 (1983)). Conversion of alpha-ketoadipate into alpha-hydroxyadipate can be catalyzed by 2-ketoadipate reductase, an enzyme reported to be found in rat and in human placenta (Suda et al. Arch.Biochem.Biophys. 176:610-620 (1976); Suda et al. Biochem.Biophys.Res.Commun. 77:586-591 (1977)). An additional candidate for this step is the mitochondrial 3 hydroxybutyrate dehydrogenase (bdh) from the human heart which has been cloned and characterized (Marks et al. J.Biol.Chem. 267:15459-15463 (1992)). This enzyme is a dehydrogenase that operates on a 3-hydroxyacid. Another exemplary alcohol dehydrogenase converts acetone to isopropanol as was shown in C. beijerinckii (Ismaiel et al. J.Bacteriol. 175:5097-5105 (1993)) and T. brockii (Lamed et al. Biochem. J. 195:183-190 (1981); Peretz and Burstein Biochemistry 28:6549-6555 (1989)).

Gene Accession No. GI No. Organism mdh AAC76268.1 1789632 Escherichiacoli ldhA NP_415898.1 16129341 Escherichiacoli ldh YP_725182.1 113866693 Ralstonia eutropha bdh AAA58352.1 177198 Homo sapiens adh AAA23199.2 60592974 Clostridium beijerinckiiNRRL B593 adh P14941.1 113443 Thermoanaerobacterbrockii HTD4

[0417] Exemplary 3-hydroxyacyl dehydrogenases which convert acetoacetyl-CoA to 3 hydroxybutyryl-CoA include hbd from C. acetobutylicum (Boynton et al. Journal of Bacteriology 178:3015-3024 (1996)), hbd from C. beijerinckii (Colby et al. Apple Environ.Microbiol58:3297-3302 (1992)), and a number of similar enzymes from Metallosphaerasedula (Berg et al. Archaea. Science 318:1782-1786 (2007)).

Gene Accession No. GI No. Organism hbd NP_349314.1 15895965 Clostridiumacetobutylicum hbd AAM14586.1 20162442 Clostridium beijerinckii Msed_1423 YP_001191505 146304189 Metallosphaerasedula Msed_0399 YP_001190500 146303184 Metallosphaerasedula

Msed_0389 YP001190490 146303174 Metallosphaerasedula Msed_1993 YP_001192057 146304741 Metallosphaerasedula

1.1.1.c - Oxidoredutase (2 step, acyl-CoA to alcohol)

[0418] Exemplary 2-step oxidoreductases that convert an acyl-CoA to alcohol include those that transform substrates such as acetyl-CoA to ethanol (for example, adhE from E. coli (Kessler et al. FEBS.Lett. 281:59-63 (1991)) and butyryl-CoA to butanol (for example, adhE2 from C. acetobutylicum (Fontaine et al. J.Bacteriol. 184:821-830 (2002)). In addition to reducing acetyl-CoA to ethanol, the enzyme encoded by adhE in Leuconostoc mesenteroides has been shown to oxide the branched chain compound isobutyraldehyde to isobutyryl-CoA (Kazahaya et al. J.Gen.Appl.Microbiol. 18:43-55 (1972); Koo et al. Biotechnol Lett. 27:505 510 (2005)).

Gene Accession No. GI No. Organism adhE NP415757.1 16129202 Escherichiacoli adhE2 AAK09379.1 12958626 Clostridium acetobutylicum adhE AAV66076.1 55818563 Leuconostoc mesenteroides

[0419] Another exemplary enzyme can convert malonyl-CoA to 3-HP. An NADPH dependent enzyme with this activity has characterized in Chloroflexus aurantiacuswhere it participates in the 3-hydroxypropionate cycle (Hugler et al., J.Bacteriol. 184:2404-2410 (2002); Strauss and Fuchs, Eur.J.Biochem. 215:633-643 (1993)). This enzyme, with a mass of 300 kDa, is highly substrate-specific and shows little sequence similarity to other known oxidoreductases (Hugler et al., J.Bacteriol. 184:2404-2410 (2002)). No enzymes in other organisms have been shown to catalyze this specific reaction; however there is bioinformatic evidence that other organisms may have similar pathways (Klatt et al., Environ.Microbiol. 9:2067-2078 (2007)). Enzyme candidates in other organisms including Roseiflexus castenholzii, Erythrobacter sp. NAP] and marine gamma proteobacterium HTCC2080 can be inferred by sequence similarity.

Gene Accession No. GI No. Organism mcr AAS20429.1 42561982 Chloroflexus aurantiacus Rcas_2929 YP_001433009.1 156742880 Roseiflexus castenholzii NAPJ_02720 ZP_01039179.1 85708113 Erythrobactersp. NAP] MGP2080_00535 ZP_01626393.1 119504313 marine gamma proteobacterium HTCC2080

[0420] Longer chain acyl-CoA molecules can be reduced by enzymes such as the jojoba (Simmondsia chinensis) FAR which encodes an alcohol-forming fatty acyl-CoA reductase. Its overexpression in E. coli resulted in FAR activity and the accumulation of fatty alcohol (Metz et al. PlantPhysiology 122:635-644 ) 2000)).

Gene Accession No. GI No. Organism FAR AAD38039.1 5020215 Simmondsia chinensis

1.2.1.b - Oxidoreductase (acyl-CoA to aldehyde)

[0421] Several acyl-CoA dehydrogenases are capable of reducing an acyl-CoA to its corresponding aldehyde. Exemplary genes that encode such enzymes include the Acinetobacter calcoaceticus acr1 encoding a fatty acyl-CoA reductase (Reiser and Somerville, J. Bacteriology 179:2969-2975 (1997)), the Acinetobacter sp. M-1 fatty acyl CoA reductase (Ishige et al. Appl.Environ.Microbiol. 68:1192-1195 (2002)), and a CoA- and NADP- dependent succinate semialdehyde dehydrogenase encoded by the sucD gene in Clostridium kluyveri (Sohling and Gottschalk JBacteriol 178:871-80 (1996); Sohling and Gottschalk JBacteriol. 178:871-880 (1996)). SucD of P. gingivalis is another succinate semialdehyde dehydrogenase (Takahashi et al. J.Bacteriol. 182:4704-4710 (2000)). The enzyme acylating acetaldehyde dehydrogenase in Pseudomonassp, encoded by bphG, is yet another as it has been demonstrated to oxidize and acylate acetaldehyde, propionaldehyde, butyraldehyde, isobutyraldehyde and formaldehyde (Powlowski et al. JBacteriol. 175:377 385 (1993)).

Gene Accession No. GI No. Organism acr1 YP_047869.1 50086359 Acinetobacter calcoaceticus acr1 AAC45217 1684886 Acinetobacter baylyi acr1 BAB85476.1 18857901 Acinetobacter sp. Strain M-1 sucD P38947.1 730847 Clostridium kluyveri sucD NP_904963.1 34540484 Porphyromonasgingivalis bphG BAA03892.1 425213 Pseudomonas sp

[0422] An additional enzyme type that converts an acyl-CoA to its corresponding aldehyde is malonyl-CoA reductase which transforms malonyl-CoA to malonic semialdehyde. Malonyl-CoA reductase is a key enzyme in autotrophic carbon fixation via the 3-hydroxypropionate cycle in thermoacidophilic archael bacteria (Berg et al. Science 318:1782-1786 (2007); Thauer, R. K. Science 318:1732-1733 (2007)). The enzyme utilizes

NADPH as a cofactor and has been characterized in Metallosphaeraand Sulfolobus spp (Alber et al. J.Bacteriol. 188:8551-8559 (2006); Hugler et al. J.Bacteriol. 184:2404-2410 (2002)). The enzyme is encoded by Msed_0709 in Metallosphaerasedula (Alber et al. J.Bacteriol. 188:8551-8559 (2006); Berg et al. Science 318:1782-1786 (2007)). A gene encoding a malonyl-CoA reductase from Sulfolobus tokodaii was cloned and heterologously expressed in E. coli (Alber et al. J.Bacteriol. 188:8551-8559 (2006)). Although the aldehyde dehydrogenase functionality of these enzymes is similar to the bifunctional dehydrogenase from Chloroflexus aurantiacus,there is little sequence similarity. Both malonyl-CoA reductase enzyme candidates have high sequence similarity to aspartate-semialdehyde dehydrogenase, an enzyme catalyzing the reduction and concurrent dephosphorylation of aspartyl-4-phosphate to aspartate semialdehyde. Additional gene candidates can be found by sequence homology to proteins in other organisms including Sulfolobus solfataricus and Sulfolobus acidocaldarius.

Gene Accession No. GI No. Organism Msed_0709 YP_001190808.1 146303492 Metallosphaerasedula mcr NP_378167.1 15922498 Sulfolobus tokodaii asd-2 NP_343563.1 15898958 Sulfolobus solfataricus Saci_2370 YP_256941.1 70608071 Sulfolobus acidocaldarius

1.2.1.c - Oxidoreductase (2-oxo acid to acyl-CoA, decarboxylation)

[0423] Enzymes in this family include 1) branched-chain 2-keto-acid dehydrogenase, 2) alpha-ketoglutarate dehydrogenase, and 3) the pyruvate dehydrogenase multienzyme complex (PDHC). These enzymes are multi-enzyme complexes that catalyze a series of partial reactions which result in acylating oxidative decarboxylation of 2-keto-acids. Each of the 2-keto-acid dehydrogenase complexes occupies key positions in intermediary metabolism, and enzyme activity is typically tightly regulated (Fries et al. Biochemistry 42:6996-7002 (2003)). The enzymes share a complex but common structure composed of multiple copies of three catalytic components: alpha-ketoacid decarboxylase (El), dihydrolipoamide acyltransferase (E2) and dihydrolipoamide dehydrogenase (E3). The E3 component is shared among all 2-keto-acid dehydrogenase complexes in an organism, while the El and E2 components are encoded by different genes. The enzyme components are present in numerous copies in the complex and utilize multiple cofactors to catalyze a directed sequence of reactions via substrate channeling. The overall size of these dehydrogenase complexes is very large, with molecular masses between 4 and 10 million Da (that is, larger than a ribosome).

[0424] Activity of enzymes in the 2-keto-acid dehydrogenase family is normally low or limited under anaerobic conditions in E. coli. Increased production of NADH (or NADPH) could lead to a redox-imbalance, and NADH itself serves as an inhibitor to enzyme function. Engineering efforts have increased the anaerobic activity of the E. coli pyruvate dehydrogenase complex (Kim et al. Appl.Environ.Microbiol. 73:1766-1771 (2007); Kim et al. J.Bacteriol. 190:3851-3858 ) 2008); Zhou et al. Biotechnol.Lett. 30:335-342 (2008)). For example, the inhibitory effect of NADH can be overcome by engineering an H322Y mutation in the E3 component (Kim et al. J.Bacteriol. 190:3851-3858 (2008)). Structural studies of individual components and how they work together in complex provide insight into the catalytic mechanisms and architecture of enzymes in this family (Aevarsson et al. Nat.Struct.Biol. 6:785-792 (1999); Zhou et al. Proc.Natl.Acad.Sci.U.S.A. 98:14802-14807 (2001)). The substrate specificity of the dehydrogenase complexes varies in different organisms, but generally branched-chain keto-acid dehydrogenases have the broadest substrate range.

[0425] Alpha-ketoglutarate dehydrogenase (AKGD) converts alpha-ketoglutarate to succinyl-CoA and is the primary site of control of metabolic flux through the TCA cycle (Hansford, R. G. Curr. Top.Bioenerg. 10:217-278 (1980)). Encoded by genes sucA, sucB and lpd in E. coli, AKGD gene expression is downregulated under anaerobic conditions and during growth on glucose (Park et al. Mol.Microbiol. 15:473-482 (1995)). Although the substrate range of AKGD is narrow, structural studies of the catalytic core of the E2 component pinpoint specific residues responsible for substrate specificity (Knapp et al. J.Mol.Biol. 280:655-668 (1998)). The Bacillus subtilis AKGD, encoded by odhAB (El and E2) and pdhD (E3, shared domain), is regulated at the transcriptional level and is dependent on the carbon source and growth phase of the organism (Resnekov et al. Mol.Gen.Genet. 234:285-296 (1992)). In yeast, the LPD1 gene encoding the E3 component is regulated at the transcriptional level by glucose (Roy and Dawes J.Gen.Microbiol. 133:925-933 (1987)). The E l component, encoded by KGD1, is also regulated by glucose and activated by the products of HAP2 and HAP3 (Repetto and Tzagoloff Mol.Cell Biol. 9:2695-2705 (1989)). The AKGD enzyme complex, inhibited by products NADH and succinyl-CoA, is well studied in mammalian systems, as impaired function of has been linked to several neurological diseases (Tretter and dam-Vizi Philos.Trans.R.Soc.Lond B Biol.Sci. 360:2335 2345 (2005)).

Gene Accession No. GI No. Organism sucA NP_415254.1 16128701 Escherichiacoli str. K12 substr. MG1655 sucB NP_415255.1 16128702 Escherichiacoli str. K12 substr. MG1655 lpd NP_414658.1 16128109 Escherichiacoli str. K12 substr. MG1655 odhA P23129.2 51704265 Bacillus subtilis odhB P16263.1 129041 Bacillus subtilis pdhD P21880.1 118672 Bacillus subtilis KGDJ NP_012141.1 6322066 Saccharomyces cerevisiae KGD2 NP_010432.1 6320352 Saccharomyces cerevisiae LPD1 NP 116635.1 14318501 Saccharomyces cerevisiae

[0426] Branched-chain 2-keto-acid dehydrogenase complex (BCKAD), also known as 2 oxoisovalerate dehydrogenase, participates in branched-chain amino acid degradation pathways, converting 2-keto acids derivatives of valine, leucine and isoleucine to their acyl CoA derivatives and CO 2 . The complex has been studied in many organisms including Bacillus subtilis (Wang et al. Eur.J.Biochem. 213:1091-1099 (1993)), Rattus norvegicus (Namba et al. J.Biol.Chem. 244:4437-4447 (1969)) and Pseudomonasputida (Sokatch J.Bacteriol. 148:647-652 (1981)). In Bacillus subtilis the enzyme is encoded by genes pdhD (E3 component), bfmBB (E2 component), bfmBAA and bfmBAB (E l component) (Wang et al. Eur.J.Biochem. 213:1091-1099 (1993)). In mammals, the complex is regulated by phosphorylation by specific phosphatases and protein kinases. The complex has been studied in rat hepatocites (Chicco et al. J.Biol.Chem. 269:19427-19434 (1994)) and is encoded by genes Bckdha (E l alpha), Bckdhb (E l beta), Dbt (E2), and Dld (E3). The E l and E3 components of the Pseudomonasputida BCKAD complex have been crystallized (Aevarsson et al. Nat.Struct.Biol. 6:785-792 (1999); Mattevi Science 255:1544-1550 (1992)) and the enzyme complex has been studied (Sokatch et al. J.Bacteriol. 148:647-652 (1981)). Transcription of the P. putida BCKAD genes is activated by the gene product of bkdR (Hester et al. Eur.J.Biochem. 233:828-836 (1995)). In some organisms including Rattus norvegicus (Paxton et al. Biochem.J. 234:295-303 (1986)) and Saccharomyces cerevisiae (Sinclair et al. Biochem.Mol.Biol.Int. 31:911-922 (1993)), this complex has been shown to have a broad substrate range that includes linear oxo-acids such as 2-oxobutanoate and alpha ketoglutarate, in addition to the branched-chain amino acid precursors. The active site of the bovine BCKAD was engineered to favor alternate substrate acetyl-CoA (Meng and Chuang, Biochemistry 33:12879-12885 (1994)).

Gene Accession No. GI No. Organism bfmBB NP_390283.1 16079459 Bacillus subtilis bfmBAA NP_390285.1 16079461 Bacillus subtilis bfmBAB NP_390284.1 16079460 Bacillus subtilis pdhD P21880.1 118672 Bacillus subtilis lpdV P09063.1 118677 Pseudomonasputida bkdB P09062.1 129044 Pseudomonasputida bkdAl NP_746515.1 26991090 Pseudomonasputida bkdA2 NP_746516.1 26991091 Pseudomonasputida Bckdha NP_036914.1 77736548 Rattus norvegicus Bckdhb NP_062140.1 158749538 Rattus norvegicus Dbt NP_445764.1 158749632 Rattus norvegicus Dld NP 955417.1 40786469 Rattus norvegicus

[0427] The pyruvate dehydrogenase complex, catalyzing the conversion of pyruvate to acetyl-CoA, has also been extensively studied. In the E. coli enzyme, specific residues in the E l component are responsible for substrate specificity (Bisswanger, H. JBiol Chem. 256:815-822 (1981); Bremer, J. Eur.JBiochem. 8:535-540 (1969); Gong et al. JBiol Chem. 275:13645-13653 (2000)). As mentioned previously, enzyme engineering efforts have improved the E. coli PDH enzyme activity under anaerobic conditions (Kim et al. Appl.Environ.Microbiol. 73:1766-1771 (2007); Kim J.Bacteriol. 190:3851-3858 (2008); Zhou et al. Biotechnol.Lett. 30:335-342 (2008)). In contrast to the E. coli PDH, the B. subtilis complex is active and required for growth under anaerobic conditions (Nakano J.Bacteriol. 179:6749-6755 (1997)). The Klebsiellapneumoniae PDH, characterized during growth on glycerol, is also active under anaerobic conditions (Menzel et al. J.Biotechnol. 56:135-142 (1997)). Crystal structures of the enzyme complex from bovine kidney (Zhou et al. Proc.Natl.Acad.Sci.U.S.A. 98:14802-14807 (2001)) and the E2 catalytic domain from Azotobacter vinelandii are available (Mattevi et al. Science 255:1544-1550 (1992)). Some mammalian PDH enzymes complexes can react on alternate substrates such as 2 oxobutanoate, although comparative kinetics of Rattus norvegicus PDH and BCKAD indicate that BCKAD has higher activity on 2-oxobutanoate as a substrate (Paxton et al. Biochem.J. 234:295-303 (1986)).

Gene Accession No. GI No. Organism aceE NP_414656.1 16128107 Escherichiacoli str. K12 substr. MG1655 aceF NP_414657.1 16128108 Escherichiacoli str. K12 substr. MG1655 lpd NP_414658.1 16128109 Escherichiacoli str. K12 substr. MG1655 pdhA P21881.1 3123238 Bacillus subtilis pdhB P21882.1 129068 Bacillus subtilis pdhC P21883.2 129054 Bacillus subtilis pdhD P21880.1 118672 Bacillus subtilis aceE YP_001333808.1 152968699 Klebsiella pneumonia MGH78578 aceF YP_001333809.1 152968700 Klebsiella pneumonia MGH78578 lpdA YP_001333810.1 152968701 Klebsiella pneumonia MGH78578 Pdhal NP_001004072.2 124430510 Rattus norvegicus Pdha2 NP_446446.1 16758900 Rattus norvegicus Dat NP_112287.1 78365255 Rattus norvegicus DId NP_955417.1 40786469 Rattus norvegicus

[0428] As an alternative to the large multienzyme 2-keto-acid dehydrogenase complexes described above, some anaerobic organisms utilize enzymes in the 2-ketoacid oxidoreductase family (OFOR) to catalyze acylating oxidative decarboxylation of 2-keto-acids. Unlike the dehydrogenase complexes, these enzymes contain iron-sulfur clusters, utilize different cofactors, and use ferredoxin or flavodixin as electron acceptors in lieu of NAD(P)H. While most enzymes in this family are specific to pyruvate as a substrate (POR) some 2-keto acid:ferredoxin oxidoreductases have been shown to accept a broad range of 2-ketoacids as substrates including alpha-ketoglutarate and 2-oxobutanoate (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2002); Zhang et al. J.Biochem. 120:587-599 (1996)). One such enzyme is the OFOR from the thermoacidophilic archaeon Sulfolobus tokodaii 7, which contains an alpha and beta subunit encoded by gene ST2300 (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2002); Zhang et al. J.Biochem. 120:587-599 (1996)). A plasmid-based expression system has been developed for efficiently expressing this protein in E. coli (Fukuda et al. Eur.J.Biochem. 268:5639-5646 (2001)) and residues involved in substrate specificity were determined (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74 (2002)). Two OFORs from Aeropyrum pernix str. K1 have also been recently cloned into E. coli, characterized, and found to react with a broad range of 2-oxoacids (Nishizawa et al. FEBS Lett. 579:2319-2322 (2005)). The gene sequences of these OFOR candidates are available, although they do not have GenBank identifiers assigned to date. There is bioinformatic evidence that similar enzymes are present in all archaea, some anaerobic bacteria and amitochondrial eukarya (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2005)). This class of enzyme is also interesting from an energetic standpoint, as reduced ferredoxin could be used to generate NADH by ferredoxin-NAD reductase (Petitdemange et al. Biochim.Biophys.Acta 421:334-337 (1976)). Also, since most of the enzymes are designed to operate under anaerobic conditions, less enzyme engineering may be required relative to enzymes in the 2-keto-acid dehydrogenase complex family for activity in an anaerobic environment.

Gene Accession No. GI No. Organism ST2300 NP_378302.1 15922633 Sulfolobus tokodaii 7

1.2.1.d - Oxidoreductase (phosphorylating/dephosphorylating)

[0429] Exemplary enzymes in this class include glyceraldehyde 3-phosphate dehydrogenase which converts glyceraldehyde-3-phosphate into D-glycerate 1,3 bisphosphate (for example, E. coli gapA (Branlant and Branlant Eur.J.Biochem. 150:61 66(1985)), aspartate-semialdehyde dehydrogenase which converts L-aspartate-4 semialdehyde into L-4-aspartyl-phosphate (for example, E. coli asd (Biellmann et al. Eur.J.Biochem. 104:53-58 (1980)), N-acetyl-gamma-glutamyl-phosphate reductase which converts N-acetyl-L-glutamate-5-semialdehyde into N-acetyl-L-glutamyl-5-phosphate (for example, E. coli argC (Parsot et al. Gene 68:275-283 (1988)), and glutamate-5-semialdehyde dehydrogenase which converts L-glutamate-5-semialdehyde into L-glutamyl-5-phospate (for example, E. coliproA (Smith et al. J.Bacteriol. 157:545-551 (1984)).

Gene Accession No. GI No. Organism gapA PA9B2.2 71159358 Escherichiacoli asd NP417891.1 16131307 Escherichiacoli argC NP418393.1 16131796 Escherichiacoli proA NP 414778.1 16128229 Escherichiacoli

1.3.1.a - Oxidoreductase operating on CH-CH donors

[0430] An exemplary enoyl-CoA reductase is the gene product of bcd from C. acetobutylicum (Atsumi et al. Metab Eng (2007); Boynton et al. JournalofBacteriology 178:3015-3024 (1996), which naturally catalyzes the reduction of crotonyl-CoA to butyryl CoA. Activity of this enzyme can be enhanced by expressing bcd in conjunction with expression of the C. acetobutylicum etfAB genes, which encode an electron transfer flavoprotein. An additional candidate for the enoyl-CoA reductase step is the mitochondrial enoyl-CoA reductase from E. gracilis(Hoffmeister et al. JournalofBiological Chemistry 280:4329-4338 (2005)). A construct derived from this sequence following the removal of its mitochondrial targeting leader sequence was cloned in E. coli resulting in an active enzyme (Hoffmeister et al., supra, (2005)). This approach is well known to those skilled in the art of expressing eukarytotic genes, particularly those with leader sequences that may target the gene product to a specific intracellular compartment, in prokaryotic organisms. A close homolog of this gene, TDE0597, from the prokaryote Treponema denticola represents a third enoyl-CoA reductase which has been cloned and expressed in E. coli (Tucci and Martin FEBSLetters 581:1561-1566 (2007)).

Gene Accession No. GI No. Organism bcd NP349317.1 15895968 Clostridium acetobutylicum etfA NP349315.1 15895966 Clostridium acetobutylicum etfR NP349316.1 15895967 Clostridium acetobutylicum TER Q5EU90.1 62287512 Euglena gracilis TDE0597 NP_971211.1 42526113 Treponema denticola

[0431] Exemplary 2-enoate reductase (EC 1.3.1.31) enzymes are known to catalyze the NADH-dependent reduction of a wide variety of a, -unsaturated carboxylic acids and aldehydes (Rohdich et al. J.Biol.Chem. 276:5779-5787 (2001)). 2-Enoate reductase is encoded by enr in several species of Clostridia(Giesel and Simon Arch Microbiol. 135(1): p. 51-57 (2001) including C. tyrobutyricum, and C. thermoaceticum (now called Moorella thermoaceticum) (Rohdich et al., supra, (2001)). In the recently published genome sequence of C. kluyveri, 9 coding sequences for enoate reductases have been reported, out of which one has been characterized (Seedorf et al. ProcNatl Acad Sci U. S. A. 105(6):2128-33 (2008)). The enr genes from both C. tyrobutyricum and C. thermoaceticum have been cloned and sequenced and show 59% identity to each other. The former gene is also found to have approximately 75% similarity to the characterized gene in C. kluyveri (Giesel and Simon Arch Microbiol 135(1):51-57 (1983)). It has been reported based on these sequence results that enr is very similar to the dienoyl CoA reductase in E. coli (fadH) (163 Rohdich et al., supra (2001)). The C. thermoaceticum enr gene has also been expressed in an enzymatically active form in E. coli (163 Rohdich et al., supra (2001)).

Gene Accession No. GI No. Organism fadH NP_417552.1 16130976 Escherichiacoli enr ACA54153.1 169405742 Clostridium botulinum A3 str enr CAA71086.1 2765041 Clostridium tyrobutyricum enr CAA76083.1 3402834 Clostridium kluyveri enr YP430895.1 83590886 Moorella thermoacetica

1.4.1.a - Oxidoreductase operating on amino acids

[0432] Most oxidoreductases operating on amino acids catalyze the oxidative deamination of alpha-amino acids with NAD+ or NADP+ as acceptor. Exemplary oxidoreductases operating on amino acids include glutamate dehydrogenase (deaminating), encoded by gdhA, leucine dehydrogenase (deaminating), encoded by ldh, and aspartate dehydrogenase (deaminating), encoded by nadX. The gdhA gene product from Escherichia coli (Korber et al. J.Mol.Biol. 234:1270-1273 (1993); McPherson and Wootton Nucleic.Acids Res. 11:5257-5266 (1983)), gdh from Thermotoga maritima (Kort et al. Extremophiles 1:52 (1997); Lebbink, et al. J.Mol.Biol. 280:287-296 (1998)); Lebbink et al. J.Mol.Biol. 289:357-369 (1999)), and gdhA1 from Halobacteriumsalinarum (Ingoldsby et al. Gene 349:237-244 (2005)) catalyze the reversible interconversion of glutamate to 2-oxoglutarate and ammonia, while favoring NADP(H), NAD(H), or both, respectively. The ldh gene of Bacillus cereus encodes the LeuDH protein that has a wide of range of substrates including leucine, isoleucine, valine, and 2-aminobutanoate (Ansorge and Kula Biotechnol Bioeng. 68:557-562 (2000); Stoyan et al. J.Biotechnol 54:77-80 (1997)). The nadXgene from Thermotoga maritime encoding for the aspartate dehydrogenase is involved in the biosynthesis of NAD (Yang et al. J.Biol.Chem. 278:8804-8808 (2003)).

Gene Accession No. GI No. Organism gdhA P00370 118547 Escherichiacoli gdh P96110.4 6226595 Thermotoga maritima gdhA1 NP_279651.1 15789827 Halobacteriumsalinarum ldh P0A393 61222614 Bacillus cereus nadX NP 229443.1 15644391 Thermotoga maritime

[0433] The lysine 6-dehydrogenase (deaminating), encoded by lysDH gene, catalyze the oxidative deamination of the v-amino group of L-lysine to form 2-aminoadipate-6

semialdehyde, which in turn nonenzymatically cyclizes to form Al-piperideine-6-carboxylate

(Misono and Nagasaki J.Bacteriol. 150:398-401 (1982)). The lysDH gene from Geobacillus stearothermophilusencodes a thermophilic NAD-dependent lysine 6-dehydrogenase (Heydari et al. Apple Environ.Microbiol70:937-942 (2004)). In addition, the lysDH gene from Aeropyrum pernix K1 is identified through homology from genome projects.

Gene Accession No. GI No. Organism lysDH AB052732 13429872 Geobacillus stearothermophilus lysDH NP_147035.1 14602185 Aeropyrum pernix K ldh P0A393 61222614 Bacillus cereus

2.3.1.a - Acyltransferase (transferring phosphate group)

[0434] Exemplary phosphate transferring acyltransferases include phosphotransacetylase, encoded by pta, and phosphotransbutyrylase, encoded by ptb. The pta gene from E. coli encodes an enzyme that can convert acetyl-CoA into acetyl-phosphate, and vice versa (Suzuki, T. Biochim.Biophys.Acta 191:559-569 (1969)). This enzyme can also utilize propionyl-CoA instead of acetyl-CoA forming propionate in the process (Hesslinger et al. Mol.Microbiol27:477-492 (1998)). Similarly, the ptb gene from C. acetobutylicum encodes an enzyme that can convert butyryl-CoA into butyryl-phosphate (Walter et al. Gene 134(1): p. 107-11 (1993)); Huang et al. JMol MicrobiolBiotechnol 2(1): p. 33-38 (2000). Additional ptb genes can be found in butyrate-producing bacterium L2-50 (Louis et al. J.Bacteriol. 186:2099-2106 (2004)) and Bacillus megaterium (Vazquez et al. Curr.Microbiol42:345-349 (2001)).

Gene Accession No. GI No. Organism pta NP_416800.1 16130232 Escherichiacoli ptb NP_349676 15896327 Clostridium acetobutylicum ptb AAR19757.1 38425288 butyrate-producing bacterium L2-50 ptb CAC07932.1 10046659 Bacillus megaterium

2.6.1.a - Aminotransferase

[0435] Aspartate aminotransferase transfers an amino group from aspartate to alpha ketoglutarate, forming glutamate and oxaloacetate. This conversion is catalyzed by, for example, the gene products of aspC from Escherichia coli (Yagi et al. FEBS Lett. 100:81-84 (1979); Yagi et al. Methods Enzymol. 113:83-89 (1985)), AAT2 from Saccharomyces cerevisiae (Yagi et al. JBiochem. 92:35-43 (1982)) and ASP5 from Arabidopsis thaliana(48,

108, 225 48. de la et al. PlantJ46:414-425 (2006); Kwok and Hanson JExp.Bot. 55:595 604 (2004); Wilkie and Warren ProteinExpr.Purif 12:381-389 (1998)). Valine aminotransferase catalyzes the conversion of valine and pyruvate to 2-ketoisovalerate and alanine. The E. coli gene, avtA, encodes one such enzyme (Whalen and Berg J.Bacteriol. 150:739-746 (1982)). This gene product also catalyzes the amination of a-ketobutyrate to generate a-aminobutyrate, although the amine donor in this reaction has not been identified (Whalen and Berg J.Bacteriol. 158:571-574 (1984)). The gene product of the E. coli serC catalyzes two reactions, phosphoserine aminotransferase and phosphohydroxythreonine aminotransferase (Lam and Winkler J.Bacteriol. 172:6518-6528 (1990)), and activity on non phosphorylated substrates could not be detected (Drewke et al. FEBS.Lett. 390:179-182 (1996)).

Gene Accession No. GI No. Organism aspC NP_415448.1 16128895 Escherichiacoli AA T2 P23542.3 1703040 Saccharomyces cerevisiae ASP5 P46248.2 20532373 Arabidopsis thaliana avtA YP026231.1 49176374 Escherichiacoli serC NP415427.1 16128874 Escherichiacoli

[0436] Cargill has developed a beta-alanine/alpha-ketoglutarate aminotransferase for producing 3-HP from beta-alanine via malonyl-semialdehyde (PCT/US2007/076252 (Jessen et al)). The gene product of SkPYD4 in Saccharomyces kluyveri was also shown to preferentially use beta-alanine as the amino group donor (Andersen et al. FEBS.J. 274:1804 1817 (2007)). SkUGA1 encodes a homologue of Saccharomyces cerevisiaeGABA aminotransferase, UGA1 (Ramos et al. Eur.J.Biochem. 149:401-404 (1985)), whereas SkPYD4 encodes an enzyme involved in both p-alanine and GABA transamination (Andersen et al. FEBS.J. 274:1804-1817 (2007)). 3-Amino-2-methylpropionate transaminase catalyzes the transformation from methylmalonate semialdehyde to 3-amino-2 methylpropionate. The enzyme has been characterized in Rattus norvegicus and Sus scrofa and is encoded by Abat (Kakimoto et al. Biochim.Biophys.Acta 156:374-380 (1968); Tamaki et al. Methods Enzymol. 324:376-389 (2000)). Enzyme candidates in other organisms with high sequence homology to 3-amino-2-methylpropionate transaminase include Gta-1 in C. elegans and gabT in Bacillus subtilus. Additionally, one of the native GABA aminotransferases in E. coli, encoded by gene gabT, has been shown to have broad substrate specificity (Liu et al. Biochemistry 43:10896-10905 (2004); Schulz et al. Apple Environ

Microbiol 56:1-6 (1990)). The gene product ofpuuE catalyzes the other 4-aminobutyrate transaminase in E. coli (Kurihara et al. J.Biol.Chem. 280:4602-4608 (2005)).

Gene Accession No. GI No. Organism SkyPYD4 ABF58893.1 98626772 Saccharomyces kluyveri SkUGAJ ABF58894.1 98626792 Saccharomyces kluyveri UGA1 NP_011533.1 6321456 Saccharomyces cerevisiae Abat P50554.3 122065191 Rattus norvegicus Abat P80147.2 120968 Sus scrofa Gta-1 Q21217.1 6016091 Caenorhabditiselegans gabT P94427.1 6016090 Bacillus subtilus gabT P22256.1 120779 Escherichiacoli K12 puuE NP 415818.1 16129263 Escherichiacoli K12

[0437] The X-ray crystal structures of E. coli 4-aminobutyrate transaminase unbound and bound to the inhibitor were reported (Liu et al. Biochemistry 43:10896-10905 (2004)). The substrates binding and substrate specificities were studied and suggested. The roles of active site residues were studied by site-directed mutagenesis and X-ray crystallography (Liu et al. Biochemistry 44:2982-2992 (2005)). Based on the structural information, attempt was made to engineer E. coli 4-aminobutyrate transaminase with novel enzymatic activity. These studies provide a base for evolving transaminase activity for BDO pathways.

2.7.2.a - Phosphotransferase, carboxyl group acceptor

[0438] Exemplary kinases include the E. coli acetate kinase, encoded by ackA (Skarstedt and Silverstein J.Biol.Chem. 251:6775-6783 (1976)), the C. acetobutylicum butyrate kinases, encoded by buk1 and buk2 (Walter et al. Gene 134(1):107-111 (1993) (Huang et al. JMol MicrobiolBiotechnol 2(1):33-38 (2000)], and the E. coli gamma-glutamyl kinase, encoded by proB (Smith et al. J.Bacteriol. 157:545-551 (1984)). These enzymes phosphorylate acetate, butyrate, and glutamate, respectively. The ackA gene product from E. coli also phosphorylates propionate (Hesslinger et al. Mol.Microbiol 27:477-492 (1998)).

Gene Accession No. GI No. Organism ackA NP_416799.1 16130231 Escherichiacoli buki NP_349675 15896326 Clostridium acetobutylicum buk2 Q97111 20137415 Clostridium acetobutylicum proB NP 414777.1 16128228 Escherichiacoli

2.8.3.a - Coenzyme-A transferase

[0439] In the CoA-transferase family, E. coli enzyme acyl-CoA:acetate-CoA transferase, also known as acetate-CoA transferase (EC 2.8.3.8), has been shown to transfer the CoA moiety to acetate from a variety of branched and linear acyl-CoA substrates, including isobutyrate (Matthies and Schink Appl Environ Microbiol 58:1435-1439 (1992)), valerate (Vanderwinkel et al. Biochem.Biophys.Res Commun. 33:902-908 (1968)) and butanoate (Vanderwinkel, supra (1968)). This enzyme is encoded by atoA (alpha subunit) and atoD (beta subunit) in E. coli sp. K12 (Korolev et al. Acta Crystallogr.DBiol Crystallogr. 58:2116-2121 (2002); Vanderwinkel, supra (1968)) and actA and cg0592 in Corynebacterium glutamicum A TCC 13032 (Duncan et al. Apple Environ Microbiol 68:5186-5190 (2002)). Additional genes found by sequence homology include atoD and atoA in Escherichiacoli UT189.

Gene Accession No. GI No. Organism atoA P76459.1 2492994 Escherichiacoli K12 atoD P76458.1 2492990 Escherichiacoli K12 actA YP_226809.1 62391407 Corynebacteriumglutamicum A TCC 13032 cg0592 YP 224801.1 62389399 Corynebacteriumglutamicum A TCC 13032 atoA ABE07971.1 91073090 Escherichiacoli UT189 atoD ABE07970.1 91073089 Escherichiacoli UT189

[0440] Similar transformations are catalyzed by the gene products of cat1, cat2, and cat3 of Clostridium kluyveri which have been shown to exhibit succinyl-CoA, 4-hydroxybutyryl CoA, and butyryl-CoA acetyltransferase activity, respectively (Seedorf et al. Proc Natl Acad Sci U.S.A. 105(6):2128-2133 (2008); Sohling and Gottschalk JBacteriol 178(3):871-880 (1996)].

Gene Accession No. GI No. Organism cat] P38946.1 729048 Clostridium kluyveri cat2 P38942.2 1705614 Clostridium kluyveri cat3 EDK35586.1 146349050 Clostridium kluyveri

[0441] The glutaconate-CoA-transferase (EC 2.8.3.12) enzyme from anaerobic bacterium Acidaminococcusfermentansreacts with diacid glutaconyl-CoA and 3-butenoyl-CoA (Mack and Buckel FEBS Lett. 405:209-212 (1997)). The genes encoding this enzyme are gctA and gctB. This enzyme has reduced but detectable activity with other CoA derivatives including glutaryl-CoA, 2-hydroxyglutaryl-CoA, adipyl-CoA and acrylyl-CoA (Buckel et al. Eur.J.Biochem. 118:315-321 (1981)). The enzyme has been cloned and expressed in E. coli (Mac et al. Eur.J.Biochem. 226:41-51 (1994)).

Gene Accession No. GI No. Organism gctA CAA57199.1 559392 Acidaminococcusfermentans gctB CAA57200.1 559393 Acidaminococcusfermentans

3.1.1.a Hydroxyacylhydrolase

[0442] Figure 64B is the transformation of 4-hydroxybutyrate to GBL. This step can be catalyzed by enzymes in the 3.1.1 family that act on carboxylic ester bonds molecules for the interconversion between cyclic lactones and the open chain hydroxycarboxylic acids. The 1,4-lacton hydroxyacylhydrolase (EC 3.1.1.25), also known as 1,4-lactonase or gamma lactonase, is specific for 1,4-lactones with 4-8 carbon atoms. It does not hydrolyze simple aliphatic esters, acetylcholine, or sugar lactones. The gamma lactonase in human blood and rat liver microsomes was purified (Fishbein et al., JBiol Chem 241:4835-4841 (1966)) and the lactonase activity was activated and stabilized by calcium ions (Fishbein et al., JBiol Chem 241:4842-4847 (1966)). The optimal lactonase activities were observed at pH 6.0, whereas high pH resulted in hydrolytic activities (Fishbein and Bessman, JBiol Chem 241:4842-4847 (1966)). The following genes have been annotated as 1,4-lactonase and can be utilized to catalyze the transformation of 4-hydroxybutyrate to GBL, including a lactonase from Fusariumoxysporum (Zhang et al., Appl MicrobiolBiotechnol 75:1087-1094 (2007)). The protein sequences for each of these exemplary gene products, if available, can be found using the following GenBank accession numbers shown below.

Gene Accession No. GI No. Organism xccb100 2516 YP 001903921.1 188991911 Xanthomonas campestris An16g06620 CAK46996.1 134083519 Aspergillus niger BAA34062 BAA34062.1 3810873 Fusariumoxysporum

[0443] Additionally, it has been reported that lipases such as Candida antarcticalipase B can catalyze the lactonization of 4-hydroxybutyrate to GBL (Efe et al., Biotechnol Bioeng 99:1392-1406 (2008)). Therefore, the following genes coding for lipases can also be utilized for Step AB in Figure 1. The protein sequences for each of these exemplary gene products, if available, can be found using the following GenBank accession numbers shown below.

Gene Accession No. GI No. Organism ca/B P41365.1 1170790 Candidaantarctica lipB P41773.1 1170792 Pseudomonasfluorescens estA P37957.1 7676155 Bacillus subtilis

3.1.2.a - Thiolester hydrolase (CoA specific)

[0444] In the CoA hydrolase family, the enzyme 3-hydroxyisobutyryl-CoA hydrolase is specific for 3-HIBCoA and has been described to efficiently catalyze the desired transformation during valine degradation (Shimomura et al. JBiol Chem 269:14248-14253 (1994)). Genes encoding this enzyme include hibch of Rattus norvegicus (Shimomura et al., supra (1994); Shimomura et al. Methods Enzymol. 324:229-240 (2000) and Homo sapiens (Shimomura et al., supra, 2000). Candidate genes by sequence homology include hibch of Saccharomyces cerevisiae and BC_2292 of Bacillus cereus.

Gene Accession No. GI No. Organism hibch Q5XIE6.2 146324906 Rattus norvegicus hibch Q6NVY1.2 146324905 Homo sapiens hibch P28817.2 2506374 Saccharomyces cerevisiae BC_2292 Q81DR3 81434808 Bacillus cereus

[0445] The conversion of adipyl-CoA to adipate can be carried out by an acyl-CoA hydrolase or equivalently a thioesterase. The top E. coli gene candidate is tesB (Naggert et al. JBiol Chem. 266(17):11044-11050 (1991)] which shows high similarity to the human acot8 which is a dicarboxylic acid acetyltransferase with activity on adipyl-CoA (Westin et al. JBiol Chem 280(46): 38125-38132 (2005). This activity has also been characterized in the rat liver (Deana, Biochem Int. 26(4): p. 767-773 (1992)).

Gene Accession No. GI No. Organism tesB NP414986 16128437 Escherichiacoli acot8 CAA15502 3191970 Homo sapiens acot8 NP570112 51036669 Rattus norvegicus

[0446] Other potential E. coli thiolester hydrolases include the gene products of tesA (Bonner and Bloch, JBiol Chem. 247(10):3123-3133 (1972)), ybgC (Kuznetsova et al., FEMS MicrobiolRev. 29(2):263-279 (2005); Zhuang et al., FEBS Lett. 516(1-3):161-163 (2002))paaI(Song et al., JBiol Chem. 281(16):11028-11038 (2006)), and ybdB (Leduc et al., JBacteriol. 189(19):7112-7126 (2007)).

Gene Accession No. GI No. Organism tesA NP_415027 16128478 Escherichiacoli ybgC NP_415264 16128711 Escherichiacoli paaI NP_415914 16129357 Escherichiacoli ybdB NP415129 16128580 Escherichiacoli

[0447] Several eukaryotic acetyl-CoA hydrolases (EC 3.1.2.1) have broad substrate specificity. The enzyme from Rattus norvegicus brain (Robinson et al. Biochem.Biophys. Res.Commun. 71:959-965 (1976)) can react with butyryl-CoA, hexanoyl-CoA and malonyl CoA.

Gene Accession No. GI No. Organism acot12 NP_570103.1 18543355 Rattus norvegicus

4.1.1.a - Carboxy-lyase

[0448] An exemplary carboxy-lyase is acetolactate decarboxylase which participates in citrate catabolism and branched-chain amino acid biosynthesis, converting 2-acetolactate to acetoin. In Lactococcus lactis the enzyme is composed of six subunits, encoded by gene aldB, and is activated by valine, leucine and isoleucine (Goupil et al. Appl.Environ.Microbiol. 62:2636-2640 (1996); Goupil-Feuillerat et al. J.Bacteriol. 182:5399-5408 (2000)). This enzyme has been overexpressed and characterized in E. coli (Phalip et al. FEBS Lett. 351:95 99 (1994)). In other organisms the enzyme is a dimer, encoded by aldC in Streptococcus thermophilus (Monnet et al. Lett.Appl.Microbiol. 36:399-405 (2003)), aldB in Bacillus brevis (Diderichsen et al. J.Bacteriol. 172:4315-4321 (1990); Najmudin et al. Acta Crystallogr.D.Biol.Crystallogr.59:1073-1075 (2003)) and budA from Enterobacter aerogenes (Diderichsen et al. J.Bacteriol. 172:4315-4321 (1990)). The enzyme from Bacillus brevis was cloned and overexpressed in Bacillus subtilis and characterized crystallographically (Najmudin et al. Acta Crystallogr.D.Biol.Crystallogr.59:1073-1075 (2003)). Additionally, the enzyme from Leuconostoc lactis has been purified and characterized but the gene has not been isolated (O'Sullivan et al. FEMS Microbiol.Lett. 194:245-249 (2001)).

Gene Accession No. GI No. Organism aldB NP_267384.1 15673210 Lactococcus lactis a/dC Q8L208 75401480 Streptococcus thermophilus aldB P23616.1 113592 Bacillus brevis budA P05361.1 113593 Enterobacteraerogenes

[0449] Aconitate decarboxylase catalyzes the final step in itaconate biosynthesis in a strain of Candida and also in the filamentous fungus Aspergillus terreus (Bonnarme et al. J Bacteriol. 177:3573-3578 (1995); Willke and Vorlop Appl Microbiol Biotechnol 56:289-295 (2001)). Although itaconate is a compound of biotechnological interest, the aconitate decarboxylase gene or protein sequence has not been reported to date.

[0450] 4-oxalocronate decarboxylase has been isolated from numerous organisms and characterized. Genes encoding this enzyme include dmpH and dmpE in Pseudomonas sp. (strain 600) (Shingler et al. JBacteriol. 174:711-724 (1992)), xylII and xylIII from Pseudomonasputida (Kato and Asano Arch.Microbiol 168:457-463 (1997); Lian and Whitman J.Am.Chem.Soc. 116:10403-10411 (1994); Stanley et al. Biochemistry 39:3514 (2000)) and ReutB5691 and ReutB5692 from Ralstonia eutrophaJMP134 (Hughes et al. J Bacteriol. 158:79-83 (1984)). The genes encoding the enzyme from Pseudomonas sp. (strain 600) have been cloned and expressed in E. coli (Shingler et al. JBacteriol. 174:711-724 (1992)).

Gene Accession No. GI No. Organism dmpH CAA43228.1 45685 Pseudomonassp. CF600 dmpE CAA43225.1 45682 Pseudomonassp. CF600 xylII YP_709328.1 111116444 Pseudomonasputida xylIII YP_709353.1 111116469 Pseudomonasputida ReutB5691 YP_299880.1 73539513 Ralstonia eutropha JMPJ34 ReutB5692 YP_299881.1 73539514 Ralstonia eutropha JMP134

[0451] An additional class of decarboxylases has been characterized that catalyze the conversion of cinnamate (phenylacrylate) and substituted cinnamate derivatives to the corresponding styrene derivatives. These enzymes are common in a variety of organisms and specific genes encoding these enzymes that have been cloned and expressed in E. coli are: pad1 from Saccharomyces cerevisae (Clausen et al. Gene 142:107-112 (1994)), pdc from Lactobacillusplantarum (Barthelmebs et al. Apple Environ Microbiol 67:1063-1069 (2001); Qi et al. Metab Eng 9:268-276 (2007); Rodriguez et al. J.Agric.FoodChem. 56:3068-3072 (2008)), pofK (pad) from Klebsiella oxytoca (Hashidoko et al. Biosci.Biotech.Biochem. 58:217-218 (1994); Uchiyama et al. Biosci.Biotechnol.Biochem. 72:116-123 (2008)),

Pedicoccuspentosaceus(Barthelmebs et al. ApplEnvironMicrobiol67:1063-1069 (2001)), and padC from Bacillus subtilis and Bacilluspumilus (Lingen et al. ProteinEng 15:585-593 (2002)). A ferulic acid decarboxylase from Pseudomonasfluorescensalso has been purified and characterized (Huang et al. J.Bacteriol. 176:5912-5918 (1994)). Importantly, this class of enzymes have been shown to be stable and do not require either exogenous or internally bound co-factors, thus making these enzymes ideally suitable for biotransformations (Sariaslani,Annu.Rev.Microbiol. 61:51-69 (2007)).

Gene Accession No. GI No. Organism pad1 AB368798 188496948 Saccharomyces cerevisae BAG32372.1 188496949 pdc U63827 1762615,1762616 Lactobacillusplantarum AAC45282.1 pofK (pad) AB330293, 149941607, Klebsiella oxytoca BAF65031.1 149941608 padC AFO17117 2394281,2394282 Bacillus subtilis AAC46254.1 pad AJ276891 11322456,11322458 Pedicoccuspentosaceus CAC16794.1 pad AJ278683 11691809,11691810 Bacilluspumilus CAC18719.1

[0452] Additional decarboxylase enzymes can form succinic semialdehyde from alpha ketoglutarate. These include the alpha-ketoglutarate decarboxylase enzymes from Euglena gracilis(Shigeoka et al. Biochem.J. 282( Pt 2):319-323 (1992); Shigeoka and Nakano Arch.Biochem.Biophys. 288:22-28 (1991); Shigeoka and Nakano Biochem.J. 292 ( Pt 2):463 467 (1993)), whose corresponding gene sequence has yet to be determined, and from Mycobacterium tuberculosis (Tian et al. Proc Natl Acad Sci U.S.A. 102:10670-10675 (2005)). In addition, glutamate decarboxylase enzymes can convert glutamate into 4 aminobutyrate such as the products of the E. coli gadA and gadB genes (De Biase et al. Protein.Expr.Purif8:430-438 (1993)).

Gene Accession No. GI No. Organism kgd 050463.4 160395583 Mycobacterium tuberculosis gadA NP_417974 16131389 Escherichiacoli gadB NP 416010 16129452 Escherichiacoli

Keto-acid decarboxylases

[0453] Pyruvate decarboxylase (PDC, EC 4.1.1.1), also termed keto-acid decarboxylase, is a key enzyme in alcoholic fermentation, catalyzing the decarboxylation of pyruvate to acetaldehyde. This enzyme has a broad substrate range for aliphatic 2-keto acids including 2 ketobutyrate, 2-ketovalerate, 3-hydroxypyruvate and 2-phenylpyruvate (Berg et al. Science 318:1782-1786 (2007)). The PDC from Zymomonas mobilus, encoded bypdc, has been a subject of directed engineering studies that altered the affinity for different substrates (Siegert et al. ProteinEng Des Sel 18:345-357 (2005)). The PDC from Saccharomyces cerevisiaehas also been extensively studied, engineered for altered activity, and functionally expressed in E. coli (Killenberg-Jabs et al. Eur.J.Biochem. 268:1698-1704 (2001); Li and Jordan Biochemistry 38:10004-10012 (1999); ter Schure et al. Appl.Environ.Microbiol. 64:1303 1307 (1998)). The crystal structure of this enzyme is available (Killenberg-Jabs Eur.J.Biochem. 268:1698-1704 (2001)). Other well-characterized PDC candidates include the enzymes from Acetobacterpasteurians(Chandra et al. Arch.Microbiol. 176:443-451 (2001)) and Kluyveromyces lactis (Krieger et al. Eur.J.Biochem. 269:3256-3263 (2002)).

Gene Accession No. GI No. Organism pdc P06672.1 118391 Zymomonas mobilus pdc1 P06169 30923172 Saccharomyces cerevisiae pdc Q8L388 75401616 Acetobacterpasteurians pdcl Q12629 52788279 Kluyveromyces lactis

[0454] Like PDC, benzoylformate decarboxylase (EC 4.1.1.7) has a broad substrate range and has been the target of enzyme engineering studies. The enzyme from Pseudomonas putida has been extensively studied and crystal structures of this enzyme are available (Hasson et al. Biochemistry 37:9918-9930 (1998); Polovnikova et al. Biochemistry 42:1820 1830 (2003)). Site-directed mutagenesis of two residues in the active site of the Pseudomonas putida enzyme altered the affinity (Km) of naturally and non-naturally occuring substrates (Siegert ProteinEng Des Sel 18:345-357 (2005)). The properties of this enzyme have been further modified by directed engineering (Lingen et al. ProteinEng :585-593 (2002)); Lingen Chembiochem 4:721-726 (2003)). The enzyme from Pseudomonas aeruginosa,encoded by mdlC, has also been characterized experimentally (Barrowman et al. FEMS Microbiology Letters 34:57-60 (1986)). Additional gene candidates from Pseudomonas stutzeri, Pseudomonasfluorescensand other organisms can be inferred by sequence homology or identified using a growth selection system developed in Pseudomonasputida(Henning et al. Appl.Environ.Microbiol. 72:7510-7517 (2006)).

Gene Accession No. GI No. Organism mdlC P20906.2 3915757 Pseudomonasputida mdlC Q9HUR2.1 81539678 Pseudomonas aeruginosa dpgB ABN80423.1 126202187 Pseudomonasstutzeri ilvB-1 YP_260581.1 70730840 Pseudomonasfluorescens

4.2.1.a - Hydro-lyase

[0455] The 2-(hydroxymethyl)glutarate dehydratase of Eubacterium barkeriis an exemplary hydro-lyase. This enzyme has been studied in the context of nicotinate catabolism and is encoded by hind (Alhapel et al. ProcNatl Acad Sci USA 103:12341-12346 (2006)). Similar enzymes with high sequence homology are found in Bacteroides capillosus, Anaerotruncus colihominis, and Natranaerobiusthermophilius.

Gene Accession No. GI No. Organism hind ABC88407.1 86278275 Eubacteriumbarkeri BACCAP_02294 ZP02036683.1 154498305 Bacteroides capillosus ATCC 29799 ANACOL_02527 ZP02443222.1 167771169 Anaerotruncus colihominis DSM 17241 NtherDRAFT_2368 ZP02852366.1 169192667 Natranaerobiusthermophilus JW/NM-WN-LF

[0456] A second exemplary hydro-lyase is fumarate hydratase, an enzyme catalyzing the dehydration of malate to fumarate. A wealth of structural information is available for this enzyme and researchers have successfully engineered the enzyme to alter activity, inhibition and localization (Weaver, T. Acta Crystallogr.DBiol Crystallogr. 61:1395-1401 (2005)). Additional fumarate hydratases include those encoded byfumC from Escherichiacoli (Estevez et al. ProteinSci. 11:1552-1557 (2002); Hong and Lee Biotechnol.BioprocessEng. 9:252-255 (2004); Rose and Weaver ProcNatl Acad Sci U S.A 101:3393-3397 (2004)), Campylobacterjejuni(Smith et al. Int.JBiochem.Cell Biol 31:961-975 (1999)) and Thermus thermophilus (Mizobata et al. Arch.Biochem.Biophys. 355:49-55 (1998)), andfumH from Rattus norvegicus (Kobayashi et al. JBiochem. 89:1923-1931(1981)). Similar enzymes with high sequence homology includefuml from Arabidopsis thalianaandfumC from Corynebacteriumglutamicum.

Gene Accession No. GI No. Organism fumC P05042.1 120601 Escherichiacoli K12 fumC 069294.1 9789756 Campylobacterjejuni fumC P84127 75427690 Thermus thermophilus fumH P14408.1 120605 Rattus norvegicus fum1 P93033.2 39931311 Arabidopsis thaliana fumC Q8NRN8.1 39931596 Corynebacteriumglutamicum

[0457] Citramalate hydrolyase, also called 2-methylmalate dehydratase, converts 2 methylmalate to mesaconate. 2-Methylmalate dehydratase activity was detected in Clostridium tetanomorphum, Morganellamorganii, Citrobacteramalonaticusin the context of the glutamate degradation VI pathway (Kato and Asano Arch.Microbiol 168:457-463 (1997)); however the genes encoding this enzyme have not been sequenced to date.

[0458] The gene product of crt from C. acetobutylicum catalyzes the dehydration of 3 hydroxybutyryl-CoA to crotonyl-CoA (Atsumi et al. Metab Eng.; 29 (2007)); Boynton et al. JournalofBacteriology 178:3015-3024 (1996)). The enoyl-CoA hydratases, phaA andphaB, of P. putida are believed to carry out the hydroxylation of double bonds during phenylacetate catabolism; (Olivera et al. Proc Natl Acad Sci USA 95(11):6419-6424(1998)). ThepaaA and paaB from P.fluorescenscatalyze analogous transformations (14 Olivera et al., supra, 1998). Lastly, a number of Escherichiacoli genes have been shown to demonstrate enoyl CoA hydratase functionality including maoC (Park and Lee JBacteriol 185(18):5391-5397 (2003)), paaF(Park and Lee Biotechnol Bioeng. 86(6):681-686 (2004a)); Park and Lee Appl Biochem Biotechnol. 113-116: 335-346 (2004b)); Ismail et al. Eur JBiochem 270(14):p. 3047-3054 (2003), andpaaG(Park and Lee, supra, 2004; Park and Lee supra, 2004b; Ismail et al., supra, 2003).

Gene Accession No. GI No. Organism maoC NP415905.1 16129348 Escherichiacoli paaF NP_415911.1 16129354 Escherichiacoli paaG NP 415912.1 16129355 Escherichiacoli crt NP_349318.1 15895969 Clostridium acetobutylicum paaA NP_745427.1 26990002 Pseudomonasputida paaB NP 745426.1 26990001 Pseudomonasputida phaA ABF82233.1 106636093 Pseudomonasfluorescens phaB ABF82234.1 106636094 Pseudomonas fluorescens

[0459] The E. coli genesfadA andfadB encode a multienzyme complex that exhibits ketoacyl-CoA thiolase, 3-hydroxyacyl-CoA dehydrogenase, and enoyl-CoA hydratase activities (Yang et al. Biochemistry 30(27): p. 6788-6795 (1991); Yang et al. JBiol Chem 265(18): p. 10424-10429 (1990); Yang et al. JBiol Chem 266(24): p. 16255 (1991); Nakahigashi and Inokuchi Nucleic Acids Res 18(16): p. 4937 (1990)). ThefadI andfadJ genes encode similar functions and are naturally expressed only anaerobically (Campbell et al. MolMicrobiol 47(3): p. 793-805 (2003). A method for producing poly[(R)-3 hydroxybutyrate] in E. coli that involves activatingfadB (by knocking out a negative regulator,fadR) and co-expressing a non-native ketothiolase (phaA from Ralstonia eutropha) has been described previously (Sato et al. JBiosciBioeng 103(1): 38-44 (2007)). This work clearly demonstrates that a p-oxidation enzyme, in particular the gene product offadB which encodes both 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities, can function as part of a pathway to produce longer chain molecules from acetyl-CoA precursors.

Gene Accession No. GI No. Organism fadA YP_026272.1 49176430 Escherichiacoli fadB NP_418288.1 16131692 Escherichiacoli fadI NP_416844.1 16130275 Escherichiacoli fadJ NP_416843.1 16130274 Escherichiacoli fadR NP_415705.1 16129150 Escherichiacoli

4.3.1.a - Ammonia-lyase

[0460] Aspartase (EC 4.3.1.1), catalyzing the deamination of aspartate to fumarate, is a widespread enzyme in microorganisms, and has been characterized extensively (Viola, R. E. Adv.Enzymol.Relat Areas Mol.Biol 74:295-341 (2000)). The crystal structure of the E. coli aspartase, encoded by aspA, has been solved (Shi et al. Biochemistry 36:9136-9144 (1997)). The E. coli enzyme has also been shown to react with alternate substrates aspartatephenylmethylester, asparagine, benzyl-aspartate and malate (Ma et al. Ann N. YAcad Sci 672:60-65 (1992)). In a separate study, directed evolution was been employed on this enzyme to alter substrate specificity (Asano et al. Biomol.Eng 22:95-101 (2005)). Enzymes with aspartase functionality have also been characterized in Haemophilus influenzae (Sjostrom et al. Biochim.Biophys.Acta 1324:182-190 (1997)), Pseudomonasfluorescens (Takagi et al. J.Biochem. 96:545-552 (1984)), Bacillus subtilus (Sjostrom et al. Biochim.Biophys.Acta 1324:182-190 (1997)) and Serratia marcescens (Takagi and Kisumi J Bacteriol. 161:1-6 (1985)).

Gene Accession No. GI No. Organism aspA NP_418562 90111690 Escherichiacoli K12 subsp. MG1655 aspA P44324.1 1168534 Haemophilus influenzae aspA P07346.1 114273 Pseudomonasfluorescens ansB P26899.1 114271 Bacillus subtilus aspA P33109.1 416661 Serratia marcescens

[0461] 3-methylaspartase (EC 4.3.1.2), also known as beta-methylaspartase or 3 methylaspartate ammonia-lyase, catalyzes the deamination of threo-3-methylasparatate to mesaconate. The 3-methylaspartase from Clostridium tetanomorphum has been cloned, functionally expressed in E. coli, and crystallized (Asuncion et al. Acta Crystallogr.DBiol Crystallogr. 57:731-733 (2001); Asuncion et al. JBiol Chem. 277:8306-8311 (2002); Botting et al. Biochemistry 27:2953-2955 (1988); Goda et al. Biochemistry 31:10747-10756 (1992). In Citrobacteramalonaticus, this enzyme is encoded by BAA28709 (Kato and Asano Arch.Microbiol 168:457-463 (1997)). 3-Methylaspartase has also been crystallized from E. coli YG1002 (Asano and Kato FEMSMicrobiolLett. 118:255-258 (1994)) although the protein sequence is not listed in public databases such as GenBank. Sequence homology can be used to identify additional candidate genes, including CTC02563 in C. tetani and ECs0761 in Escherichiacoli 0157:H7.

Gene Accession No. GI No. Organism MAL AAB24070.1 259429 Clostridium tetanomorphum BAA28709 BAA28709.1 3184397 Citrobacteramalonaticus CTC02563 NP_783085.1 28212141 Clostridium tetani ECs0761 BAB34184.1 13360220 Escherichiacoli 0157:H7 str. Sakai

[0462] Ammonia-lyase enzyme candidates that form enoyl-CoA products include beta alanyl-CoA ammonia-lyase (EC 4.3.1.6), which deaminates beta-alanyl-CoA, and 3 aminobutyryl-CoA ammonia-lyase (EC 4.3.1.14). Two beta-alanyl-CoA ammonia lyases have been identified and characterized in Clostridiumpropionicum (Herrmann et al. FEBS J. 272:813-821 (2005)). No other beta-alanyl-CoA ammonia lyases have been studied to date, but gene candidates can be identified by sequence similarity. One such candidate is MXAN_43 85 in Myxococcus xanthus.

Gene Accession No. GI No. Organism ac12 CAG29275.1 47496504 Clostridiumpropionicum acli CAG29274.1 47496502 Clostridiumpropionicum MXAN_4385 YP_632558.1 108756898 Myxococcus xanthus

5.3.3.a - Isomerase

[0463] The 4-hydroxybutyryl-CoA dehydratases from both Clostridium aminobutyrium and C. kluyveri catalyze the reversible conversion of 4-hydroxybutyryl-CoA to crotonyl-CoA and posses an intrinsic vinylacetyl-CoA A-isomerase activity (Scherf and Buckel Eur.J Biochem. 215:421-429 (1993); Scherf et al. Arch.Microbiol 161:239-245 (1994)). Both native enzymes were purified and characterized, including the N-terminal amino acid sequences (Scherf and Buckel, supra, 1993; Scherf et al., supra, 1994). The abfD genes from C. aminobutyrium and C. kluyveri match exactly with these N-terminal amino acid sequences, thus are encoding the 4-hydroxybutyryl-CoA dehydratases/vinylacetyl-CoA A isomerase. In addition, the abfD gene from PorphyromonasgingivalisATCC 33277 is identified through homology from genome projects.

Gene Accession No. GI No. Organism abfD YP_001396399.1 153955634 Costridium kluyveriDSM555 abfD P55792 84028213 Clostridium aminobutyricum abfD YP_001928843 188994591 PorphyromonasgingivalisA TCC 33277

5.4.3.a - Aminomutase

[0464] Lysine 2,3-aminomutase (EC 5.4.3.2) is an exemplary aminomutase that converts lysine to (3S)-3,6-diaminohexanoate, shifting an amine group from the 2- to the 3- position. The enzyme is found in bacteria that ferment lysine to acetate and butyrate, including as Fusobacteriumnuleatum (kamA) (Barker et al. J.Bacteriol. 152:201-207 (1982)) and Clostridiumsubterminale (kamA) (Chirpich et al. J.Biol.Chem. 245:1778-1789 (1970)). The enzyme from Clostridium subterminale has been crystallized (Lepore et al. Proc.Natl.Acad.Sci.U.S.A 102:13819-13824 (2005)). An enzyme encoding this function is also encoded by yodO in Bacillus subtilus (Chen et al. Biochem.J. 348 Pt 3:539-549 (2000)). The enzyme utilizes pyridoxal 5'-phosphate as a cofactor, requires activation by S Adenosylmethoionine, and is stereoselective, reacting with the only with L-lysine. The enzyme has not been shown to react with alternate substrates.

Gene Accession No. GI No. Organism yodO 034676.1 4033499 Bacillus subtilus kamA Q9XBQ8.1 75423266 Clostridium subterminale kamA Q8RHX4 81485301 Fusobacteriumnuleatum subsp. nuleatum

[0465] A second aminomutase, beta-lysine 5,6-aminomutase (EC 5.4.3.3), catalyzes the next step of lysine fermentation to acetate and butyrate, which transforms (3S)-3,6 diaminohexanoate to (3S,5S)-3,5-diaminohexanoate, shifting a terminal amine group from the 6- to the 5- position. This enzyme also catalyzes the conversion of lysine to 2,5 diaminohexanoate and is also called lysine-5,6-aminomutase (EC 5.4.3.4). The enzyme has been crystallized in Clostridium sticklandii (kamD, kamE) (Berkovitch et al. Proc.Natl.Acad.Sci.U.S.A 101:15870-15875 (2004)). The enzyme from Porphyromonas gingivalis has also been characterized (Tang et al. Biochemistry 41:8767-8776 (2002)).

Gene Accession No. GI No. Organism kamD AAC79717.1 3928904 Clostridium sticklandii kamE AAC79718.1 3928905 Clostridium sticklandii kamD NC_002950.2 34539880,34540809 Porphyromonasgingivalis W83 kamE NC_002950.2 34539880,34540810 Porphyromonas gingivalis W83

[0466] Ornithine 4,5-aminomutase (EC 5.4.3.5) converts D-ornithine to 2,4 diaminopentanoate, also shifting a terminal amine to the adjacent carbon. The enzyme from Clostridiumsticklandii is encoded by two genes, oraE and oraS, and has been cloned, sequenced and expressed in E. coli (Chen et al. J.Biol.Chem. 276:44744-44750 (2001)). This enzyme has not been characterized in other organisms to date.

Gene Accession No. GI No. Organism oraE AAK72502 17223685 Clostridium sticklandii oraS AAK72501 17223684 Clostridium sticklandii

[0467] Tyrosine 2,3-aminomutase (EC 5.4.3.6) participates in tyrosine biosynthesis, reversibly converting tyrosine to 3-amino-3-(4-hdyroxyphenyl)propanoate by shifting an amine from the 2- to the 3- position. In Streptomyces globisporus the enzyme has also been shown to react with tyrosine derivatives (Christenson et al. Biochemistry 42:12708-12718 (2003)). Sequence information is not available.

[0468] Leucine 2,3-aminomutase (EC 5.4.3.7) converts L-leucine to beta-leucine during leucine degradation and biosynthesis. An assay for leucine 2,3-aminomutase detected activity in many organisms (Poston, J. M. Methods Enzymol. 166:130-135 (1988)) but genes encoding the enzyme have not been identified to date.

[0469] Cargill has developed a novel 2,3-aminomutase enzyme to convert L-alanine to alanine, thus creating a pathway from pyruvate to 3-HP in four biochemical steps (Liao et al., U.S. Publication No. 2005-0221466).

6.2.1.a - Acid-thiol ligase

[0470] An exemplary acid-thiol ligase is the gene products of sucCD of E. coli which together catalyze the formation of succinyl-CoA from succinate with the concaminant consumption of one ATP, a reaction which is reversible in vivo (Buck et al. Biochemistry 24(22): p. 6245-6252 (1985)). Additional exemplary CoA-ligases include the rat dicarboxylate-CoA ligase for which the sequence is yet uncharacterized (Vamecq et al. Biochem J. 230(3): p. 683-693 (1985)), either of the two characterized phenylacetate-CoA ligases from P. chrysogenum (Lamas-Maceiras et al. Biochem J395(1):147-155 (2006); Wang et al. Biochem Biophys Res Commun, 360(2):453-458 (2007)), the phenylacetate-CoA ligase from Pseudomonasputida(Martinez-Blanco et al. JBiol Chem. 265(12):7084-7090 (1990)), and the 6-carboxyhexanoate-CoA ligase from Bacillus subtilis (Bower et al. J Bacteriol 178(14):4122-4130 (1996)).

Gene Accession No. GI No. Organism sucC NP_415256.1 16128703 Escherichiacoli sucD AAC73823.1 1786949 Escherichiacoli phl CAJ15517.1 77019264 Penicillium chrysogenum ph/B ABS19624.1 152002983 Penicillium chrysogenum paaF AAC24333.2 22711873 Pseudomonasputida bioW NP_390902.2 50812281 Bacillus subtilis

EXAMPLE V Exemplary BDO Pathway from Succinyl-CoA

[0471] This example describes exemplary BDO pathways from succinyl-CoA.

[0472] BDO pathways from succinyl-CoA are described herein and have been described previously (see U.S. application serial No. 12/049,256, filed March 14, 2008, and PCT application serial No. US08/57168, filed March 14, 2008, each of which is incorporated herein by reference). Additional pathways are shown in Figure 8A. Enzymes of such exemplary BDO pathways are listed in Table 15, along with exemplary genes encoding these enzymes.

[0473] Briefly, succinyl-CoA can be converted to succinic semialdehyde by succinyl CoA reductase (or succinate semialdehyde dehydrogenase) (EC 1.2.1.b). Succinate semialdehyde can be converted to 4-hydroxybutyrate by 4-hydroxybutyrate dehydrogenase (EC 1.1.1.a), as previously described. Alternatively, succinyl-CoA can be converted to 4 hydroxybutyrate by succinyl-CoA reductase (alcohol forming) (EC 1.1.1.c). 4 Hydroxybutyrate can be converted to 4-hydroxybutyryl-CoA by 4-hydroxybutyryl-CoA transferase (EC 2.8.3.a), as previously described, or by 4-hydroxybutyryl-CoA hydrolase (EC 3.1.2.a) or 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) (EC 6.2.1.a). Alternatively, 4-hydroxybutyrate can be converted to 4-hydroxybutyryl-phosphate by 4 hydroxybutyrate kinase (EC 2.7.2.a), as previously described. 4-Hydroxybutyryl-phosphate can be converted to 4-hydroxybutyryl-CoA by phosphotrans-4-hydroxybutyrylase (EC 2.3.1.a), as previously described. Alternatively, 4-hydroxybutyryl-phosphate can be converted to 4-hydroxybutanal by 4-hydroxybutanal dehydrogenase (phosphorylating) (EC 1.2.1.d). 4-Hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4 hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b). Alternatively, 4-hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4 hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). 4-Hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a), as previously described.

14 -Il

~r -o

-~ cc

U 0,0

cnc 4 2'

0c oc cc

-Z -Z

- ) CA 00 C0 0r 0r L) < m -r) r) -r) -r .- r) mj

C15] cot']' C

'

4 A' C C C

cc cc cc

CCF

oZ -Z-- Z

Lr cc

-~ ~ -C4 -C4 -C4 ~ ~

-4 - Z4 Z Z

-0C

CCC5

C' C'] CA CIA

cc cc.c

C15~

0 00

u o t

Al 4

000

A, E

ct~9

4 4]

-ct co I 701

cc cc cc

EXAMPLE VI Additional Exemplary BDO Pathways from Alpha-ketoglutarate

[0474] This example describes exemplary BDO pathways from alpha-ketoglutarate.

[0475] BDO pathways from succinyl-CoA are described herein and have been described previously (see U.S. application serial No. 12/049,256, filed March 14, 2008, and PCT application serial No. US08/57168, filed March 14, 2008, each of which is incorporated herein by reference). Additional pathways are shown in Figure 8B. Enzymes of such exemplary BDO pathways are listed in Table 16, along with exemplary genes encoding these enzymes.

[0476] Briefly, alpha-ketoglutarate can be converted to succinic semialdehyde by alpha ketoglutarate decarboxylase (EC 4.1.1.a), as previously described. Alternatively, alpha ketoglutarate can be converted to glutamate by glutamate dehydrogenase (EC 1.4.1.a). 4 Aminobutyrate can be converted to succinic semialdehyde by 4-aminobutyrate oxidoreductase (deaminating) (EC 1.4.1.a) or 4-aminobutyrate transaminase (EC 2.6.1.a). Glutamate can be converted to 4-aminobutyrate by glutamate decarboxylase (EC 4.1.1.a). Succinate semialdehyde can be converted to 4-hydroxybutyrate by 4-hydroxybutyrate dehydrogenase (EC 1.1.1.a), as previously described. 4-Hydroxybutyrate can be converted to 4-hydroxybutyryl-CoA by 4-hydroxybutyryl-CoA transferase (EC 2.8.3.a), as previously described, or by 4-hydroxybutyryl-CoA hydrolase (EC 3.1.2.a), or 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) (EC 6.2.1.a). 4-Hydroxybutyrate can be converted to 4-hydroxybutyryl-phosphate by 4-hydroxybutyrate kinase (EC 2.7.2.a). 4 Hydroxybutyryl-phosphate can be converted to 4-hydroxybutyryl-CoA by phosphotrans-4 hydroxybutyrylase (EC 2.3.1.a), as previously described. Alternatively, 4-hydroxybutyryl phosphate can be converted to 4-hydroxybutanal by 4-hydroxybutanal dehydrogenase (phosphorylating) (EC 1.2.1.d). 4-Hydroxybutyryl-CoA can be converted to 4 hydroxybutanal by 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b), as previously described. 4-Hydroxybutyryl-CoA can be converted to 1,4 butanediol by 4-hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). 4 Hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a), as previously described.

- Ht

~~ ~L0) r) m~c

m hr) m

r)~

011 Ell 0 Z J 0

-0 C15 cut,

C15 ct 0 ct0

;w C15C]

In 4 C- C- Cio

4

L0 -

cc cc cc

Iz~ Z~ -Z -Z -Z Z

-Z - -Z -Z

Lr -- 11C~

0., I- I- m r r r CA 000 0

C44 -C4 C0 --

0 0 0 0

u 0t

0701 ' 01

ctc

~070

cvj

4 t0

Ci Ci 0

CA0

0 -C4

t --

0,

C1

4 A' 4 A' ICE

4 A' 4A' 4 A

0 C .

cc cc c

000

0 0 0 cc m

= CC

.~En

C'cc

C']5 I 4

ct ct

C C

o o o 0o

0-Z

0t

o U

EXAMPLE VII BDO Pathways from 4-Aminobutyrate

[0477] This example describes exemplary BDO pathwayd from 4-aminobutyrate.

[0478] Figure 9A depicts exemplary BDO pathways in which 4-aminobutyrate is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 17, along with exemplary genes encoding these enzymes.

[0479] Briefly, 4-aminobutyrate can be converted to 4-aminobutyryl-CoA by 4 aminobutyrate CoA transferase (EC 2.8.3.a), 4-aminobutyryl-CoA hydrolase (EC 3.1.2.a), or 4-aminobutyrate-CoA ligase (or 4-aminobutyryl-CoA synthetase) (EC 6.2.1.a). 4 aminobutyryl-CoA can be converted to 4-oxobutyryl-CoA by 4-aminobutyryl-CoA oxidoreductase (deaminating) (EC 1.4.1.a) or 4-aminobutyryl-CoA transaminase (EC 2.6.1.a). 4-oxobutyryl-CoA can be converted to 4-hydroxybutyryl-CoA by 4 hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.a). 4-hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4-hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). Alternatively, 4-hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4 hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b). 4 hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a).

lo lo

w It ~ .'Ell

6 CA 0 cc cc~ 0 r CJ< .2 Lr rJ rj CC Lr -r) 0 M~ , L m -r) L)Lr -r cc0

0tC5 t

0 0 0 0

C.0 -Q

gt 0

C.)]

2 CC' C" C '

cc~~

PLO

Ei - ~ .5 E! u El C15m

0 Z

0r CJA

m m m 4 cc

Lr)~k m C Lr) Lr

C']5

C5C'] C']

5 0 C15 H H u~ -c

CA -cc

4 4

701~ 4

C'15

4- A- 4 A4A'

-0 C15

cc0c c0

[0480] Enzymes for another exemplary BDO pathway converting 4-aminobutyrate to BDO is shown in Figure 9A. Enzymes of such an exemplary BDO pathway are listed in Table 18, along with exemplary genes encoding these enzymes.

[0481] Briefly, 4-aminobutyrate can be converted to 4-aminobutyryl-CoA by 4 aminobutyrate CoA transferase (EC 2.8.3.a), 4-aminobutyryl-CoA hydrolase (EC 3.1.2.a) or 4-aminobutyrate-CoA ligase (or 4-aminobutyryl-CoA synthetase) (EC 6.2.1.a). 4 aminobutyryl-CoA can be converted to 4-aminobutan-1-ol by 4-aminobutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). Alternatively, 4-aminobutyryl-CoA can be converted to 4 aminobutanal by 4-aminobutyryl-CoA reductase (or 4-aminobutanal dehydrogenase) (EC 1.2.1.b), and 4-aminobutanal converted to 4-aminobutan-1-ol by 4-aminobutan-1-ol dehydrogenase (EC 1.1.1.a). 4-aminobutan-1-ol can be converted to 4-hydroxybutanal by 4 aminobutan-1-ol oxidoreductase (deaminating) (EC 1.4.1.a) or 4-aminobutan-1-ol transaminase (EC 2.6.1.a). 4-hydroxybutanal can be converted to 1,4-butanediol by 1,4 butanediol dehydrogenase (EC 1.1.1.a).

lot lo 0 0t

, _ -Z -Z

00) ojCA

-0C

C'15

C.0

C CC' C']

7 I L-w- -

-Ct

- ~C15

CAA

0 -C4

4 40

-0 ct 0

ct cot

40 4

C't

C']t I I 4 lotG C~CF oo C .s- .C15. . . m u

0 en

.- a m m cc mae

4 cc

kI I

Nc o u C,5

e'n 0 '-4 en en C' on a - eno 0t 0 zt

O en Qq 4 4'

o C'] C

8

cce

os os s-

[0482] Figure 9B depicts exemplary BDO pathway in which 4-aminobutyrate is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 19, along with exemplary genes encoding these enzymes.

[0483] Briefly, 4-aminobutyrate can be converted to [(4-aminobutanolyl)oxy] phosphonic acid by 4-aminobutyrate kinase (EC 2.7.2.a). [(4-aminobutanolyl)oxy] phosphonic acid can be converted to 4-aminobutanal by 4-aminobutyraldehyde dehydrogenase (phosphorylating) (EC 1.2.1.d). 4-aminobutanal can be converted to 4-aminobutan-1-ol by 4-aminobutan-1-ol dehydrogenase (EC 1.1.1.a). 4-aminobutan-1-ol can be converted to 4-hydroxybutanal by 4 aminobutan-1-ol oxidoreductase (deaminating) (EC 1.4.1.a) or 4-aminobutan-1-ol transaminase (EC 2.6.1.a). Alternatively, [(4-aminobutanolyl)oxy] phosphonic acid can be converted to [(4-oxobutanolyl)oxy] phosphonic acid by [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating) (EC 1.4.1.a) or [(4-aminobutanolyl)oxy]phosphonic acid transaminase(EC2.6.1.a). [(4-oxobutanolyl)oxy] phosphonic acid can be converted to 4 hydroxybutyryl-phosphate by 4-hydroxybutyryl-phosphate dehydrogenase (EC 1.1.1.a). 4 hydroxybutyryl-phosphate can be converted to 4-hydroxybutanal by 4-hydroxybutyraldehyde dehydrogenase (phosphorylating) (EC 1.2.1.d). 4-hydroxybutanal can be converted to 1,4 butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a).

-t C

C15

-Q -Q -Z -Z -z -Z I -Z

S - cr) cc CA~C

5 U 4tC54 C,5 A4

C.0

9z C) C5

rtco

C- in CA

r- enCA 1 C

L2w

0 0

C5S C5

o o £-a -e 0

*CF CC , c

m m <= <=

n n N0 N

00 - 0

e a - en -

C .5 C1 tb ct a tb

ct0CA 4 -0 cotM en5

4 4 t oa 15

q o- oCo

0,c

00-Z -Z-Z- -Z

cc

00 0 0ccU 0 Acc - Q~ Lr) Lk

01 0 C1 05 ctJ cut

0 0 0 0

CA 5

4 4 tn 0 15r 5t

CA CA

0

o U 0 ".5

0 Ak r

CAC o

eo

ct'

00t

4N

H qos

[0484] Figure 9C shows an exemplary pathway through acetoacetate.

EXAMPLE VIII Exemplary BDO Pathways from Alpha-ketoglutarate

[0485] This example describes exemplary BDO pathways from alpha-ketoglutarate.

[0486] Figure 10 depicts exemplary BDO pathways in which alpha-ketoglutarate is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 20, along with exemplary genes encoding these enzymes.

[0487] Briefly, alpha-ketoglutarate can be converted to alpha-ketoglutaryl-phosphate by alpha-ketoglutarate 5-kinase (EC 2.7.2.a). Alpha-ketoglutaryl-phosphate can be converted to 2,5-dioxopentanoic acid by 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating) (EC 1.2.1.d). 2,5-dioxopentanoic acid can be converted to 5-hydroxy-2 oxopentanoic acid by 2,5-dioxopentanoic acid reductase (EC 1.1.1.a). Alternatively, alpha ketoglutarate can be converted to alpha-ketoglutaryl-CoA by alpha-ketoglutarate CoA transferase (EC 2.8.3.a), alpha-ketoglutaryl-CoA hydrolase (EC 3.1.2.a) or alpha ketoglutaryl-CoA ligase (or alpha-ketoglutaryl-CoA synthetase) (EC 6.2.1.a). Alpha ketoglutaryl-CoA can be converted to 2,5-dioxopentanoic acid by alpha-ketoglutaryl-CoA reductase (or 2,5-dioxopentanoic acid dehydrogenase) (EC 1.2.1.b). 2,5-Dioxopentanoic acid can be converted to 5-hydroxy-2-oxopentanoic acid by 5-hydroxy-2-oxopentanoic acid dehydrogenase. Alternatively, alpha-ketoglutaryl-CoA can be converted to 5-hydroxy-2 oxopentanoic acid by alpha-ketoglutaryl-CoA reductase (alcohol forming) (EC 1.1.1.c). 5 hydroxy-2-oxopentanoic acid can be converted to 4-hydroxybutanal by 5-hydroxy-2 oxopentanoic acid decarboxylase (EC 4.1.1.a). 4-hydroxybutanal can be converted to 1,4 butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a). 5-hydroxy-2-oxopentanoic acid can be converted to 4-hydroxybutyryl-CoA by 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) (EC 1.2.1.c).

C)

C, Cc

Z Z A

C) oo - o

o C, C,--o

CC)

C), &q lcoc Il C) C)C C) C-o

CiA -0 C) C o e )

cz

C) ot lot c r)C) C) C C)C ) C ) -

ct LA ~ ote ~

4..o ~WD -) C) '5 .j olot

-Z Z, -- CA

r-- C ,6 <='0 -~r < )

Lr) r) L) L) r- - -- L) C Lr) m

-C4

U5- -0 C5 1 C15 tb C t 0

C15 C'5 'C5'

I I'- CC

C1 0t ct

u~ -t u0 -z u 0t ~A

C m~ 0

CA0 000

-C0

cut, 0nc

C'] C

C15 C15

C15 -C'

q -. 05 tc

Ci0

C', -C -Z -Z

m0cL)L)L)c 000 - 0

Co00 C0 C0 , m 0

cn cn-c0 0

C15 A5 C'] C.

C15

L )~. C15C

-ct~ J~ 0t

C15

C'] C'] 1

EXAMPLE IX Exemplary BDO Pathways from Glutamate

[0488] This example describes exemplary BDO pathways from glutamate.

[0489] Figure 11 depicts exemplary BDO pathways in which glutamate is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 21, along with exemplary genes encoding these enzymes.

[0490] Briefly, glutamate can be converted to glutamyl-CoA by glutamate CoA transferase (EC 2.8.3.a), glutamyl-CoA hydrolase (EC 3.1.2.a) or glutamyl-CoA ligase (or glutamyl-CoA synthetase) (EC 6.2.1.a). Alternatively, glutamate can be converted to glutamate-5-phosphate by glutamate 5-kinase (EC 2.7.2.a). Glutamate-5-phosphate can be converted to glutamate-5-semialdehyde by glutamate-5-semialdehyde dehydrogenase (phosphorylating) (EC 1.2.1.d). Glutamyl-CoA can be converted to glutamate-5 semialdehyde by glutamyl-CoA reductase (or glutamate-5-semialdehyde dehydrogenase) (EC 1.2.1.b). Glutamate-5-semialdehyde can be converted to 2-amino-5-hydroxypentanoic acid by glutamate-5-semialdehyde reductase (EC 1.1.1.a). Alternatively, glutamyl-CoA can be converted to 2-amino-5-hydroxypentanoic acid by glutamyl-CoA reductase (alcohol forming) (EC 1.1.1.c). 2-Amino-5-hydroxypentanoic acid can be converted to 5-hydroxy-2 oxopentanoic acid by 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) (EC 1.4.1.a) or2-amino-5-hydroxypentanoic acid transaminase (EC 2.6.1.a). 5-Hydroxy-2 oxopentanoic acid can be converted to 4-hydroxybutanal by 5-hydroxy-2-oxopentanoic acid decarboxylase (EC 4.1.1.a). 4-Hydroxybutanal can be converted to 1,4-butanediol by 1,4 butanediol dehydrogenase (EC 1.1.1.a). Alternatively, 5-hydroxy-2-oxopentanoic acid can be converted to 4-hydroxybutyryl-CoA by 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) (EC 1.2.1.c).

01

-Z Z 0

- cc

CJ 0r CA 00

cc cc

C. 0 t0 -C0 0.

C.), 2 C0 cc0

- t -t r.

- -- cc tC, -- ~- 0C 2c

Z - - - - -Z.,

ooo cc 0 0 0 0cc

-0C

-05 0 0 A, 0 0

~u C'15'

C15

ct ct c

C15e a o I U .9 C15) o.

e o S e o - - - oo

0Z -Z

oA m 0 C e CA 0 0A Ca

Coooo o5

mUmoC' oo omo]ee e oC ] - C']

. e et

ct U, t8 ;

I Icen '

-k.--- o -- o

C5 _5; en C'] C1 ,

U- '0 o t oNOA e - N ee.s A

I0 o

- o o e o eco

C o C

Hz 0 i o

to to

tC 9 c 0t --

CAC Cr) 00 m c 4 4 mocLr r or 00 00 00 0-~ A Lr Lr = ; 1C0r r

C m00

C15]

C'15 cot u

-0 ) C15C1 Crr C

EXAMPLE X Exemplary BDO from Acetoacetyl-CoA

[0491] This example describes an exemplary BDO pathway from acetoacetyl-CoA.

[0492] Figure 12 depicts exemplary BDO pathways in which acetoacetyl-CoA is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 22, along with exemplary genes encoding these enzymes.

[0493] Briefly, acetoacetyl-CoA can be converted to 3-hydroxybutyryl-CoA by 3 hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.a). 3-Hydroxybutyryl-CoA can be converted to crotonoyl-CoA by 3-hydroxybutyryl-CoA dehydratase (EC 4.2.1.a). Crotonoyl-CoA can be converted to vinylacetyl-CoA by vinylacetyl-CoA A-isomerase (EC 5.3.3.3). Vinylacetyl CoA can be converted to 4-hydroxybutyryl-CoA by 4-hydroxybutyryl-CoA dehydratase (EC 4.2.1.a). 4-Hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4-hydroxybutyryl CoA reductase (alcohol forming) (EC 1.1.1.c). Alternatively, 4-hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b). 4-Hydroxybutanal can be converted to 1,4-butanediol by 1,4 butanediol dehydrogenase (EC 1.1.1.a).

~ 0 H HEll

0z 0 r m0 0 0 0 0 oL)c cc0 Lr) m <=C C m ~

0r 0 r

5

0 C100

4 A'

70

4 4

0w

C5

oo - 0

4 8

CA4 0 cct e

CA 00

oc ccc

-C -C -C4

en, C c

C15 I: CJC: C15

C en sp p C

4 C 4 4

INe N >zct 7 7

1 4A'14A' I ogoo

F C-5

EXAMPLE XI Exemplary BDO Pathway from Homoserine

[0494] This example describes an exemplary BDO pathway from homoserine.

[0495] Figure 13 depicts exemplary BDO pathways in which homoserine is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 23, along with exemplary genes encoding these enzymes.

[0496] Briefly, homoserine can be converted to 4-hydroxybut-2-enoate by homoserine deaminase (EC 4.3.1.a). Alternatively, homoserine can be converted to homoserine-CoA by homoserine CoA transferase (EC 2.8.3.a), homoserine-CoA hydrolase (EC 3.1.2.a) or homoserine-CoA ligase (or homoserine-CoA synthetase) (EC 6.2.1.a). Homoserine-CoA can be converted to 4-hydroxybut-2-enoyl-CoA by homoserine-CoA deaminase (EC 4.3.1.a). 4 Hydroxybut-2-enoate can be converted to 4-hydroxybut-2-enoyl-CoA by 4-hydroxybut-2 enoyl-CoA transferase (EC 2.8.3.a), 4-hydroxybut-2-enoyl-CoA hydrolase (EC 3.1.2.a), or 4 hydroxybut-2-enoyl-CoA ligase (or 4-hydroxybut-2-enoyl-CoA synthetase) (EC 6.2.1.a). Alternatively, 4-hydroxybut-2-enoate can be converted to 4-hydroxybutyrate by 4 hydroxybut-2-enoate reductase (EC 1.3.1.a). 4-Hydroxybutyrate can be converted to 4 hydroxybutyryl-coA by 4-hydroxybutyryl-CoA transferase (EC 2.8.3.a), 4-hydroxybutyryl CoA hydrolase (EC 3.1.2.a), or 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) (EC 6.2.1.a). 4-Hydroxybut-2-enoyl-CoA can be converted to 4-hydroxybutyryl CoA by 4-hydroxybut-2-enoyl-CoA reductase (EC 1.3.1.a). 4-Hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4-hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). Alternatively, 4-hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4 hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b). 4 Hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a).

C1 C15 C15 tb -0 C

L wc -Z ~ - c~

-Lr

00 4 r) r- C0.,

CC]

C'15

LW '0 r 4. 9z~

LW '

9z~

0 0 C

0., 0., cc 4 0

0 0 co0o o t

71 715 C5

CA 4~ -ri 0 0r m*L0) CA CA Lr cc 0r CA L 'Lo0 m~ -L-r)

40 4

(C']

F C'3

Ell C15 u0

m~ -r cc 0' o Lr CJCc r M Lr

-~Lr m<* Lr) m

C,

0 +

CC' C C'] C'

0Z -Z

00 Lr C J cc C'0 ~ C'0 CC- ~

0r 0 0 - r) r0 C I r m~ Lr *r) *r) 0

FC'3 u u-Ct u~

00 04 0 00 C0 00 CJ D CI m = w .-.-- o0

-C4

4C 4 C'5

C'] C' t \ 0~ C' CC'CCCC' C] ct

cpti~ C']i

00 q 00 0 q

EXAMPLE XII BDO Producing Strains Expressing Succinyl-CoA Synthetase

[0497] This example desribes increased production of BDO in BDO producing strains expressing succinyl-CoA synthetase.

[0498] As discussed above, succinate can be a precursor for production of BDO by conversion to succinyl-CoA (see also W02008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). Therefore, the host strain was genetically modified to overexpress the E. coli sucCD genes, which encode succinyl-CoA synthetase. The nucleotide sequence of the E. coli sucCD operon is shown in Figure 14A, and the amino acid sequences for the encoded succinyl-CoA synthetase subunits are shown in Figures 14B and 14C. Briefly, the E. coli sucCD genes were cloned by PCR from E. coli chromosomal DNA and introduced into multicopy plasmids pZS*13, pZA13, and pZE33 behind the PAllacO-1 promoter (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)) using standard molecular biology procedures.

[0499] The E. coli sucCD genes, which encode the succinyl-CoA synthetase, were overexpressed. The results showed that introducing into the strains sucCD to express succinyl-CoA synthetase improved BDO production in various strains compared to either native levels of expression or expression of cat1, which is a succinyl-CoA/acetyl-CoA transferase. Thus, BDO production was improved by overexpressing the native E. coli sucCD genes encoding succinyl-CoA synthetase.

EXAMPLE XIII Expression of Heterologous Genes Encoding BDO Pathway Enzymes

[0500] This example describes the expression of various non-native pathway enzymes to provide improved production of BDO.

[0501] Alpha-ketoglutarate decarboxylase. The Mycobacterium bovis sucA gene encoding alpha-ketoglutarate decarboxylase was expressed in host strains. Overexpression of M. bovis sucA improved BDO production (see also W02008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). The nucleotide and amino acid sequences of M. bovis sucA and the encoded alpha-ketoglutarate decarboxylase are shown in Figure 15.

[0502] To construct the M. bovis sucA expressing strains, fragments of the sucA gene encoding the alpha-ketoglutarate decarboxylase were amplified from the genomic DNA of Mycobacterium bovis BCG (ATCC 19015; American Type Culture Collection, Manassas VA) using primers shown below. The full-length gene was assembled by ligation reaction of the four amplified DNA fragments, and cloned into expression vectors pZS*13 and pZE23 behind the PAIIaco-1 promoter (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)). The nucleotide sequence of the assembled gene was verified by DNA sequencing.

Primers for fragment 1:

5'-ATGTACCGCAAGTTCCGC-3'(SEQ ID NO:3)

5'-CAATTTGCCGATGCCCAG-3'(SEQ ID NO:4)

Primers for fragment 2:

5'-GCTGACCACTGAAGACTTTG-3'(SEQ ID NO:5)

5'-GATCAGGGCTTCGGTGTAG-3'(SEQ ID NO:6)

Primers for fragment 3:

5'-TTGGTGCGGGCCAAGCAGGATCTGCTC-3'(SEQ ID NO:7)

5'-TCAGCCGAACGCCTCGTCGAGGATCTCCTG-3'(SEQ ID NO:8)

Primers for fragment 4:

5'-TGGCCAACATAAGTTCACCATTCGGGCAAAAC-3'(SEQ ID NO:9)

5'-TCTCTTCAACCAGCCATTCGTTTTGCCCG-3'(SEQ ID NO:10)

[0503] Functional expression of the alpha-ketoglutarate decarboxylase was demonstrated using both in vitro and in vivo assays. The SucA enzyme activity was measured by following a previously reported method (Tian et al., Proc. Natl. Acad. Sci. USA 102:10670-10675 (2005)). The reaction mixture contained 50 mM potassium phosphate buffer, pH 7.0, 0.2 mM thiamine pyrophosphate, 1 mM MgCl 2 , 0.8 mM ferricyanide, 1 mM alpha-ketoglutarate and cell crude lysate. The enzyme activity was monitored by the reduction of ferricyanide at 430 nm. The in vivo function of the SucA enzyme was verified using E. coli whole-cell culture. Single colonies of E. coli MG1655 lacIq transformed with plasmids encoding the SucA enzyme and the 4-hydroxybutyrate dehydrogenase (4Hbd) was inoculated into 5 mL of LB medium containing appropriate antibiotics. The cells were cultured at 37C overnight aerobically. A 200 uL of this overnight culture was introduced into 8 mL of M9 minimal medium (6.78 g/L Na2HPO 4 , 3.0 g/L KH 2PO 4 , 0.5 g/L NaCl, 1.0 g/L NH 4 Cl, 1 mM MgSO 4

, 0.1 mM CaCl 2) supplemented with 20 g/L glucose, 100 mM 3-(N morpholino)propanesulfonic acid (MOPS) to improve the buffering capacity, 10 tg/mL thiamine, and the appropriate antibiotics. Microaerobic conditions were established by initially flushing capped anaerobic bottles with nitrogen for 5 minutes, then piercing the septum with a 23G needle following inoculation. The needle was kept in the bottle during growth to allow a small amount of air to enter the bottles. The protein expression was induced with 0.2 mM isopropyl P-D-1-thiogalactopyranoside (IPTG) when the culture reached mid-log growth phase. As controls, E. coli MG1655 lacIq strains transformed with only the plasmid encoding the 4-hydroxybutyrate dehydrogenase and only the empty vectors were cultured under the same condition (see Table 23). The accumulation of 4 hydroxybutyrate (4HB) in the culture medium was monitored using LCMS method. Only the E. coli strain expressing the Mycobacterium alpha-ketoglutarate decarboxylase produced significant amount of 4HB (see Figure 16).

Table 24. Three strains containing various plasmid controls and encoding sucA and 4 hydroxybutyratedehydrogenase.

Host pZE13 pZA33 1 MG1655 IacIq vector vector 2 MG1655 IacIq vector 4hbd 3 MG1655 IacIq sucA 4hbd

[0504] A separate experiment demonstrated that the alpha-ketoglutarate decarboxylase pathway functions independently of the reductive TCA cycle. E. coli strain ECKh-401 (AadhE AldhA ApflB AlpdA::K.p.lpdA322 Amdh AarcA) was used as the host strain. All the three constructs contained the gene encoding 4HB dehydrogenase (4Hbd). Construct 1 also contained the gene encoding the alpha-ketoglutarate decarboxylase (sucA). Construct 2 contained the genes encoding the succinyl-CoA synthetase (sucCD) and the CoA-dependent succinate semialdehyde dehydrogenase (sucD), which are required for the synthesis of 4HB via the reductive TCA cycle. Construct 3 contains all the genes from 1 and 2. The three E. coli strains were cultured under the same conditions as described above except the second culture was under the micro-aerobic condition. By expressing the SucA enzyme, construct 3 produced more 4HB than construct 2, which relies on the reductive TCA cycle for 4HB synthesis (see Figure 17).

[0505] Further support for the contribution of alpha-ketoglutarate decarboxylase to production of 4HB and BDO was provided by flux analysis experiments. Cultures of ECKh 432, which contains both sucCD-sucD and sucA on the chromosome, were grown in M9 minimal medium containing a mixture of 1-13C-glucose (60%) and U-13C-glucose (40%). The biomass was harvested, the protein isolated and hydrolyzed to amino acids, and the label distribution of the amino acids analyzed by gas chromatography-mass spectrometry (GCMS) as described previously (Fischer and Sauer, Eur. J. Biochem. 270:880-891 (2003)). In addition, the label distribution of the secreted 4HB and BDO was analyzed by GCMS as described in W02008115840 A2. This data was used to calculate the intracellular flux distribution using established methods (Suthers et al., Metab. Eng. 9:387-405 (2007)). The results indicated that between 56% and 84% of the alpha-ketoglutarate was channeled through alpha-ketoglutarate decarboxylase into the BDO pathway. The remainder was oxidized by alpha-ketoglutarate dehydrogenase, which then entered BDO via the succinyl CoA route.

[0506] These results demonstrate 4-hydroxybutyrate producing strains that contain the sucA gene from Mycobacterium bovis BCG expressed on a plasmid. When the plasmid encoding this gene is not present, 4-hydroxybutyrate production is negligible when sucD (CoA-dependant succinate semialdehyde dehydrogenase) is not expressed. The M. bovis gene is a close homolog of the Mycobacterium tuberculosis gene whose enzyme product has been previously characterized (Tian et al., supra, 2005).

[0507] Succinate semialdehyde dehydrogenase (CoA-dependent), 4-hydroxybutyrate dehydrogenase, and 4-hydroxybutyryl-CoA/acetyl-CoA transferase. The genes from Porphyromonasgingivalis W83 can be effective components of the pathway for 1,4 butanediol production (see also W02008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). The nucleotide sequence of CoA-dependent succinate semialdehyde dehydrogenase (sucD) from Porphyromonasgingivalis is shown in Figure 18A, and the encoded amino acid sequence is shown in Figure 18B. The nucleotide sequence of 4-hydroxybutyrate dehydrogenase (4hbd) from Porphymonas gingivalisis shown in Figure 19A, and the encoded amino acid seqence is shown in Figure 19B. The nucleotide sequence of 4-hydroxybutyrate CoA transferase (cat2) from Porphyromonasgingivalisis shown in Figure 20A, and the encoded amino acid sequence is shown in Figure 20B.

[0508] Briefly, the genes from Porphyromonasgingivalis W83 encoding succinate semialdehyde dehydrogenase (CoA-dependent) and 4-hydroxybutyrate dehydrogenase, and in some cases additionally 4-hydroxybutyryl-CoA/acetyl-CoA, were cloned by PCR from P. gingivalis chromosomal DNA and introduced into multicopy plasmids pZS*13, pZA13, and pZE33 behind the PAllacO-1 promoter (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)) using standard molecular biology procedures. These plasmids were then introduced into host strains.

[0509] The Porphyromonasgingivalis W83 genes were introduced into production strains as described above. Some strains included only succinate semialdehyde dehydrogenase (CoA-dependant) and 4-hydroxybutyrate dehydrogenase without 4 hydroxybutyryl-CoA/acetyl-CoA transferase.

[0510] Butyrate kinase and phosphotransbutvlase. Butyrate kinase (BK) and phosphotransbutyrylase (PTB) enzymes can be utlized to produce 4-hydroxybutyryl-CoA (see also W02008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). In particular, the Clostridium acetobutylicum genes, buk1 and ptb, can be utilized as part of a functional BDO pathway.

[0511] Initial experiments involved the cloning and expression of the native C. acetobutylicum PTB (020) and BK (021) genes in E. coli. Where required, the start codon and stop codon for each gene were modified to "ATG" and "TAA," respectively, for more optimal expression in E. coli. The C. acetobutylicum gene sequences (020N and 02IN) and their corresponding translated peptide sequences are shown in Figures 21 and 22.

[0512] The PTB and BK genes exist in C. acetobutylicum as an operon, with the PTB (020) gene expressed first. The two genes are connected by the sequence "atta aagttaagtg gaggaatgtt aac" (SEQ ID NO:11) that includes a re-initiation ribosomal binding site for the downstream BK (021) gene. The two genes in this context were fused to lac-controlled promoters in expression vectors for expression in E. coli (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)).

[0513] Expression of the two proteins from these vector constructs was found to be low in comparison with other exogenously expressed genes due to the high incidence of codons in the C. acetobutylicum genes that occur only rarely in E. coli. Therefore new 020 and 021 genes were predicted that changed rare codons for alternates that are more highly represented in E. coli gene sequences. This method of codon optimization followed algorithms described previously (Sivaraman et al., Nucleic Acids Res. 36:e16(2008)). This method predicts codon replacements in context with their frequency of occurrence when flanked by certain codons on either side. Alternative gene sequences for 020 (Figure 23) and 021 (Figure 24) were determined in which increasing numbers of rare codons were replaced by more prevalent codons (A<B<C<D) based on their incidence in the neighboring codon context. No changes in actual peptide sequence compared to the native 020 and 021 peptide sequences were introduced in these predicted sequences.

[0514] The improvement in expression of the BK and PTB proteins resulting from codon optimization is shown in Figure 25A. Expression of the native gene sequences is shown in lane 2, while expression of the 020B-021B and 020C-021C is shown in lanes 3 and 4, respectively. Higher levels of protein expression in the codon-optimized operons 020B-021B (2021B) and 020C-021C (2021C) also resulted in increased activity compared to the native operon (202In) in equivalently-expressed E. coli crude extracts (Figure 25B).

[0515] The codon optimized operons were expressed on a plasmid in strain ECKh-432 (AadhE AldhA ApflB AlpdA::K.p.lpdA322 Amdh AarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd) along with the C. acetobutylicum aldehyde dehydrogenase to provide a complete BDO pathway. Cells were cultured in M9 minimal medium containing 20 g/L glucose, using a 23G needle to maintain microaerobic conditions as described above. The resulting conversion of glucose to the final product BDO was measured. Also measured was the accumulation of gamma-butyrylactone (GBL), which is a spontaneously rearranged molecule derived from 4Hb-CoA, the immediate product of the PTB-BK enzyme pair. Figure 26 shows that expression of the native 2021n operon resulted in comparable BDO levels to an alternative enzyme function, Cat2 (034), that is capable of converting 4HB and free CoA to 4HB-CoA. GBL levels of 034 were significantly higher than 202In, suggesting that the former enzyme has more activity than PTB-BK expressed from the native genes. However levels of both BDO and GBL were higher than either 034 or 202In when the codon-optimized variants 2021B and 2021C were expressed, indicating that codon optimization of the genes for PTB and BK significantly increases their contributions to BDO synthesis in E. coli.

[0516] These results demonstrate that butyrate kinase (BK) and phosphotransbutyrylase (PTB) enzymes can be employed to convert 4-hydroxybutyrate to 4-hydroxybutyryl-CoA.

This eliminates the need for a transferase enzyme such as 4-hydoxybutyryl-CoA/Acetyl-CoA transferase, which would generate one mole of acetate per mol of 4-hydroxybutyryl-CoA produced. The enzymes from Clostridiumacetobutylicum are present in a number of engineered strains for BDO production.

[0517] 4-hydroxvbutvrl-CoA reductase. The Clostridium beijerinckii ald gene can be utilized as part of a functional BDO pathway (see also W02008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). TheClostridium beijerinckiiald can also be utilized to lower ethanol production in BDO producing strains. Additionally, a specific codon-optimized ald variant (GNM0025B) was found to improve BDO production.

[0518] The native C. beijerinckiiald gene (025n) and the predicted protein sequence of the enzyme are shown in Figure 27. As was seen for the Clostridium acetobutylicum PTB and BK genes, expression of the native C. beijerinckiiald gene was very low in E. coli. Therefore, four codon-optimized variants for this gene were predicted. Figures 28A-28D show alternative gene sequences for 025, in which increasing numbers of rare codons are replaced by more prevalent codons (A<B<C<D) based on their incidence in the neighboring codon context (25A, P=0.05; 25B, P=0.1; 25C, P=0.15; 25D, P=1). No changes in actual peptide sequence compared to the native 025 peptide sequence were introduced in these predictions. Codon optimization significantly increased expression of the C. beijerinckiiald (see Figure 29), which resulted in significantly higher conversion of glucose to BDO in cells expressing the entire BDO pathway (Figure 30A).

[0519] The native and codon-optimized genes were expressed on a plasmid along with P. gingivalis Cat2, in the host strain ECKh-432 (AadhE AldhA ApflB AlpdA::K.p.lpdA322

Amdh AarcA gltAR163L AackA fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd), thus containing a complete BDO pathway. Cells were cultured microaerobically in M9 minimal medium containing 20 g/L glucose as described above. The relative production of BDO and ethanol by the C. beijerinckiiAld enzyme (expressed from codon-optimized variant gene 025B) was compared with the C. acetobutylicum AdhE2 enzyme (see Figure 30B). The C. acetobutylicum AdhE2 enzyme (002C) produced nearly 4 times more ethanol than BDO. In comparison, the C. beijerinckii Ald (025B) (in conjunction with an endogenous ADH activity) produced equivalent amounts of BDO, yet the ratio of BDO to ethanol production was reversed for this enzyme compared to 002C. This suggests that the C. beierinckiiAld is more specific for 4HB-CoA over acetyl-coA than the C. acetobutylicum AdhE2, and therefore the former is the preferred enzyme for inclusion in the BDO pathway.

[0520] The Clostridium beijerinckiiald gene (Toth et al., Appl. Environ. Microbiol. :4973-4980 (1999)) was tested as a candidate for catalyzing the conversion of 4 hydroxybutyryl-CoA to 4-hydroxybutanal. Over fifty aldehyde dehydrogenases were screened for their ability to catalyze the conversion of 4-hydroxybutyryl-CoA to 4 hydroxybutyraldehyde. The C. beijerinckii ald gene was chosen for implementation into BDO-producing strains due to the preference of this enzyme for 4-hydroxybutyryl-CoA as a substrate as opposed to acetyl-CoA. This is important because most other enzymes with aldehyde dehydrogenase functionality (for example, adhE2 from C. acetobutylicum (Fontaine et al., JBacteriol. 184:821-830 (2002)) preferentially convert acetyl-CoA to acetaldehyde, which in turn is converted to ethanol. Utilization of the C. beijerinckiigene lowers the amount of ethanol produced as a byproduct in BDO-producing organisms. Also, a codon optimized version of this gene expresses very well in E. coli (Sivaraman et al., Nucleic Acids Res. 36:e16 (2008)).

[0521] 4-hydroxybutanal reductase. 4-hydroxybutanal reductase activity of adh1 from Geobacillus thermoglucosidasius(M1OEXG) was utilized. This led to improved BDO production by increasing 4-hydroxybutanal reductase activity over endogenous levels.

[0522] Multiple alcohol dehydrogenases were screened for their ability to catalyze the reduction of 4-hydroxybutanal to BDO. Most alcohol dehydrogenases with high activity on butyraldehyde exhibited far lower activity on 4-hydroxybutyraldehyde. One notable exception is the adh1 gene from Geobacillus thermoglucosidasiusM1OEXG (Jeon et al., J. Biotechnol. 135:127-133 (2008)) (GNMOO84), which exhibits high activity on both 4 hydroxybutanal and butanal.

[0523] The native gene sequence and encoded protein sequence if the adh1 gene from Geobacillus thermoglucosidasiusare shown in Figure 31. The G. thermoglucosidasiusald1 gene was expressed in E. coli.

[0524] The Adh1 enzyme (084) expressed very well from its native gene in E. coli (see Figure 32A). In ADH enzyme assays, the E. coli expressed enzyme showed very high reductive activity when butyraldehyde or 4HB-aldehyde were used as the substrates (see

Figure 32B). The Km values determined for these substrates were 1.2 mM and 4.0 mM, respectively. These activity values showed that the Adh1 enzyme was the most active on reduction of 4HB-aldehyde of all the candidates tested.

[0525] The 084 enzyme was tested for its ability to boost BDO production when coupled with the C. beierinckiiald. The 084 gene was inserted behind the C. beijerinckiiald variant 025B gene to create a synthetic operon that results in coupled expression of both genes. Similar constructs linked 025B with other ADH candidate genes, and the effect of including each ADH with 025B on BDO production was tested. The host strain used was ECKh-459 (AadhE ldhA ApflB AlpdA::fnr-pflB6-K.p.lpdA322 Amdh AarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd fimD:: C. acetobutylicum buk, C. acetobutylicum ptb), which contains the remainder of the BDO pathway on the chromosome. The 084 ADH expressed in conjunction with 025B showed the highest amount of BDO (right arrow in Figure 33) when compared with 025B only (left arrow in Figure 33) and in conjunction with endogenous ADH functions. It also produced more BDO than did other ADH enzymes when paired with 025B, indicated as follows: 026A C, codon-optimized variants of Clostridium acetobutylicum butanol dehydrogenase; 050, Zymomonas mobilis alcohol dehydrogenaseI; 052, Citrobacterfreundii1,3-propanediol dehydrogenase; 053, Lactobacillusbrevis 1,3-propanediol dehydrogenase; 057, Bacteroides fragilis lactaldehyde reductase; 058, E. coli 1,3-propanediol dehydrogenase; 071, Bacillus subtilis 168 alpha-ketoglutarate semialdehyde dehydrogenase. The constructs labeled "PT5lacO" are those in which the genes are driven by the PT5acO promoter. In all other cases, the PAllacO-1 promoter was used. This shows that inclusion of the 084 ADH in the BDO pathway increased BDO production.

EXAMPLE XIV BDO Producing Strains Expressing Pyruvate Dehydrogenase

[0526] This example describes the utilization of pyruvate dehydrogenase (PDH) to enhance BDO production. Heterologous expression of the Klebsiella pneumonialpdA gene was used to enhance BDO production.

[0527] Computationally, the NADH-generating conversion of pyruvate to acetyl-CoA is required to reach the maximum theoretical yield of 1,4-butanediol (see also W02008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351; WO 2008/018930; Kim et al., Appl. Environ. Microbiol. 73:1766-1771 (2007); Kim et al., J.

Bacteriol. 190:3851-3858 (2008); Menzel et al., J. Biotechnol. 56:135-142 (1997)). Lack of PDH activity was shown to reduce the maximum anaerobic theoretical yield of BDO by 11% if phosphoenolpyruvate carboxykinase (PEPCK) activity cannot be attained and by 3% if PEPCK activity can be attained. More importantly, however, absence of PDH activity in the OptKnock strain #439, described in WO 2009/023493 and U.S. publication 2009/0047719, which has the knockout of ADHEr, ASPT, LDH_D, MDH and PFLi, would reduce the maximum anaerobic yield of BDO by 54% or by 43% if PEPCK activity is absent or present, respectively. In the presence of an external electron acceptor, lack of PDH activity would reduce the maximum yield of the knockout strain by 10% or by 3% assuming that PEPCK activity is absent or present, respectively.

[0528] PDH is one of the most complicated enzymes of central metabolism and is comprised of 24 copies of pyruvate decarboxylase (E1) and 12 molecules of dihydrolipoyl dehydrogenase (E3), which bind to the outside of the dihydrolipoyl transacetylase (E2) core. PDH is inhibited by high NADH/NAD, ATP/ADP, and Acetyl-CoA/CoA ratios. The enzyme naturally exhibits very low activity under oxygen-limited or anaerobic conditions in organisms such as E. coli due in large part to the NADH sensitivity of E3, encoded by lpdA. To this end, an NADH-insensitive version of the lpdA gene from Klebsiella pneumonia was cloned and expressed to increase the activity of PDH under conditions where the NADH/NAD ratio is expected to be high.

[0529] Replacement of the native lydA. The pyruvate dehydrogenase operon of Klebsiellapneumoniaeis between 78 and 95% identical at the nucleotide level to the equivalent operon of E. coli. It was shown previously that K. pneumoniae has the ability to grow anaerobically in presence of glycerol (Menzel et al., J. Biotechnol. 56:135-142 (1997); Menzel et al., Biotechnol. Bioeng. 60:617-626 (1998)). It has also been shown that two mutations in the lpdA gene of the operon of E. coli would increase its ability to grow anaerobically (Kim et al.. Apple. Environ. Microbiol. 73:1766-1771 (2007); Kim et al., J. Bacteriol. 190:3851-3858 (2008)). The /pdA gene of K. pneumonia was amplified by PCR using genomic DNA (ATCC700721D) as template and the primers KP-lpdA-Bam (5' acacgcggatccaacgtcccgg-3')(SEQ ID NO:12) and KP-pdA-Nhe (5'-agcggctccgctagccgcttatg 3')(SEQ ID NO:13). The resulting fragment was cloned into the vector pCR-BluntII-TOPO (Invitrogen; Carlsbad CA), leading to plasmid pCR-KP-pdA.

[0530] The chromosomal gene replacement was performed using a non-replicative plasmid and the sacB gene from Bacillus subtilis as a means of counterselection (Gay et al., J. Bacteriol. 153:1424-1431 (1983)). The vector used is pRE118 (ATCC87693) deleted of the oriT and IS sequences, which is 3.6 kb in size and carrrying the kanamycin resistance gene. The sequence was confirmed, and the vector was called pRE118-V2 (see Figure 34).

[0531] The E. coli fragments flanking the /pdA gene were amplified by PCR using the combination of primers: EC-aceF-Pst (5'-aagccgttgctgcagctcttgagc-3')(SEQ ID NO:14)

+ EC-aceF-Bam2 (5'-atctccggcggtcggatccgtcg-3')(SEQ ID NO:15) and EC-yacH-Nhe (5' aaagcggctagccacgccgc-3')(SEQ ID NO:16) + EC-yacH-Kpn (5'-attacacgaggtacccaacg 3')(SEQ ID NO:17). A BamiHI-XbaI fragment containing the pdA gene of K. pneumonia was isolated from plasmid pCR-KP-lpdA and was then ligated to the above E. coli fragments digested with PstI +BamHI and NheI-KpnI respectively, and the pRE118-V2 plasmid digested with KpnI and PstI. The resulting plasmid (called pRE118-M2.1 lpdA yac) was subjected to Site Directed Mutagenesis (SDM) using the combination of primers KP-pdA HisTyr-F (5'- atgctggcgtacaaaggtgtcc-3')(SEQ ID NO:18) and (5'-ggacacctttgtacgccagcat 3')(SEQ ID NO:19) for the mutation of the His 322 residue to a Tyr residue or primers KP lpdA-GluLys-F (5'-atcgcctacactaaaccagaagtgg-3')(SEQ ID NO:20) and KP-pdA-GluLys-R (5'-ccacttctggtttagtgtaggcgat-3')(SEQ ID NO:21) for the mutation of the residue Glu 354 to Lys residue. PCR was performed with the Polymerase Pfu Turbo (Stratagene; San Diego CA). The sequence of the entire fragment as well as the presence of only the desired mutations was verified. The resulting plasmid was introduced into electro competent cells of E. coli AadhE::Frt-AldhA::Frt by transformation. The first integration event in the chromosome was selected on LB agar plates containing Kanamycin (25 or 50 mg/L). Correct insertions were verified by PCR using 2 primers, one located outside the region of insertion and one in the kanamycin gene (5'-aggcagttccataggatggc-3')(SEQ ID NO:22). Clones with the correct insertion were selected for resolution. They were sub-cultured twice in plain liquid LB at the desired temperature and serial dilutions were plated on LB-no salt-sucrose % plates. Clones that grew on sucrose containing plates were screened for the loss of the kanamycin resistance gene on LB-low salt agar medium and the pdA gene replacement was verified by PCR and sequencing of the encompassing region. Sequence of the insertion region was verified, and is as described below. One clone (named 4-4-P1) with mutation Glu354Lys was selected. This clone was then transduced with P1 lysate of E. coli APflB::Frt leading to strain ECKh-138 (AadhE AldhA ApflB AlpdA::K.p.lpdA322).

[0532] The sequence of the ECKh-138 region encompassing the aceF andlpdA genes is shown in Figure 35. The K. pneumonialpdA gene is underlined, and the codon changed in the Glu354Lys mutant shaded. The protein sequence comparison of the native E. coli pdA and the mutant K. pneumonia lpdA is shown in Figure 36.

[0533] To evaluate the benefit of using K. pneumoniaelpdA in a BDO production strain, the host strains AB3 and ECKh-138 were transformed with plasmids expressing the entire BDO pathway from strong, inducible promoters. Specifically, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd were expressed on the medium copy plasmid pZA33, and P. gingivalis Cat2 and C. acetobutylicum AdhE2 were expressed on the high copy plasmid pZE13. These plasmids have been described in the literature (Lutz and H. Bujard, Nucleic Acids Res 25:1203-1210 (1997)), and their use for BDO pathway expression is described in Example XIII and W02008/115840.

[0534] Cells were grown anaerobically at 370 C in M9 minimal medium (6.78 g/L Na2 HPO 4, 3.0 g/L KH 2 PO 4 , 0.5 g/L NaCl, 1.0 g/L NH 4 Cl, 1 mM MgSO 4 , 0.1 mM CaC 2

) supplemented with 20 g/L glucose, 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS) to improve the buffering capacity, 10 tg/mL thiamine, and the appropriate antibiotics. Microaerobic conditions were established by initially flushing capped anaerobic bottles with nitrogen for 5 minutes, then piercing the septum with a 23G needle following inoculation. The needle was kept in the bottle during growth to allow a small amount of air to enter the bottles. 0.25 mM IPTG was added when OD600 reached approximately 0.2 to induce the pathway genes, and samples taken for analysis every 24 hours following induction. The culture supernatants were analyzed for BDO, 4HB, and other by-products as described in Example II and in W02008/115840. BDO and 4HB production in ECKh-138 was significantly higher after 48 hours than in AB3 or the host used in previous work, MG1655 AldhA (Figure 37).

[0535] PDH promoter replacement. It was previously shown that the replacement of the pdhR repressor by a transcriptional fusion containing the Fnr binding site, one of the pflB promoters, and its ribosome binding site (RBS), thus leading to expression of the aceEF-lpd operon by an anaerobic promoter, should increase pdh activity anaerobically (Zhou et al., Biotechnol. Lett. 30:335-342 (2008)). A fusion containing the Fnr binding site, the pflB-p6 promoter and an RBS binding site were constructed by overlapping PCR. Two fragments were amplified, one using the primers aceE-upstream-RC (5'- tgacatgtaacacctaccttctgtgcctgtgccagtggttgtgtgatatagaag-3')(SEQ ID NO:23) and pflBp6-Up Nde (5'- ataataatacatatgaaccatgcgagttacgggcctataagccaggcg-3')(SEQ ID NO:24) and the other using primers aceE-EcoRV-EC (5'- agtttttcgatatctgcatcagacaccggcacattgaaacgg 3')(SEQ ID NO:25) and aceE-upstream (5' ctggcacaggcacagaaggtaggtgttacatgtcagaacgtttacacaatgacgtggatc-3')(SEQ ID NO:26). The tw fragments were assembled by overlapping PCR, and the final DNA fragment was digested with the restriction enzymes NdeI and BamHI. This fragment was subsequently introduced upstream of the aceE gene of the E. coli operon using pRE118-V2 as described above. The replacement was done in strains ECKh-138 and ECKh-422. The nucleotide sequence encompassing the 5' region of the aceE gene was verified and is shown in Figure 37. Figure 37 shows the nucleotide sequence of 5' end of the aceE gene fused to the pflB-p6 promoter and ribosome binding site (RBS). The 5' italicized sequence shows the start of the aroP gene, which is transcribed in the opposite direction from the pdh operon. The 3' italicized sequence shows the start of the aceE gene. In upper case: pflB RBS. Underlined: FNR binding site. In bold: pflB-p6 promoter sequence.

[0536] lodA promoter replacement. The promoter region containing the fnr binding site, the pflB-p6 promoter and the RBS of the pflB gene was amplified by PCR using chromosomal DNA template and primers aceF-pflBp6-fwd (5' agacaaatcggttgccgtttgttaagccaggcgagatatgatctatatc-3')(SEQ ID NO:27) and lpdA-RBS-B-rev (5'-gagttttgatttcagtactcatcatgtaacacctaccttcttgctgtgatatag-3')(SEQ ID NO:28). Plasmid 2-4a was amplified by PCR using primers B-RBS-lpdA fwd (5' ctatatcacagcaagaaggtaggtgttacatgatgagtactgaaatcaaaactc-3')(SEQ ID NO:29) and pflBp6 aceF-rev (5'- gatatagatcatatctcgcctggcttaacaaacggcaaccgatttgtct-3')(SEQ ID NO:30). The two resulting fragments were assembled using the BPS cloning kit (BPS Bioscience; San Diego CA). The resulting construct was sequenced verified and introduced into strain ECKh 439 using the pRE118-V2 method described above. The nucleotide sequence encompassing the aceF-lpdA region in the resulting strain ECKh-456 is shown in Figure 39.

[0537] The host strain ECKh-439 (AadhE AldhA ApfB AlpdA::K.p.lpdA322 Amdh

AarcA gltAR163L ackA fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd), the construction of which is described below, and the pdhR and lpdA promoter replacement derivatives ECKh-455 and ECKh-456, were tested for BDO production. The strains were transformed with pZS*13 containing P. gingivalis Cat2 and C.

beijerinckiiAld to provide a complete BDO pathway. Cells were cultured in M9 minimal medium supplemented with 20 g/L glucose as described above. 48 hours after induction with 0.2 mM IPTG, the concentrations of BDO, 4HB, and pyruvate were as shown in Figure 40. The promoter replacement strains produce slightly more BDO than the isogenic parent.

[0538] These results demonstrated that expression of pyruvate dehydrogenase increased production of BDO in BDO producing strains.

EXAMPLE XV BDO Producing Strains Expressing Citrate Synthase and Aconitase

[0539] This example describes increasing activity of citrate synthase and aconitase to increase production of BDO. An R163L mutation into gtA was found to improve BDO production. Additionally, an arcA knockout was used to improve BDO production.

[0540] Computationally, it was determined that flux through citrate synthase (CS) and aconitase (ACONT) is required to reach the maximum theoretical yield of 1,4-butanediol (see also W02008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). Lack of CS or ACONT activity would reduce the maximum theoretical yield by 14% under anaerobic conditions. In the presence of an external electron acceptor, the maximum yield is reduced by 9% or by 6% without flux through CS or ACONT assuming the absence or presence of PEPCK activity, respectively. As with pyruvate dehydrogenase (PDH), the importance of CS and ACONT is greatly amplified in the knockout strain background in which ADHEr, ASPT, LDHD, MDH and PFLi are knocked out (design #439)(see WO 2009/023493 and U.S. publication 2009/0047719, which is incorporated herein by reference).

[0541] The minimal OptKnock strain design described in WO 2009/023493 and U.S. publication 2009/0047719 had one additional deletion beyond ECKh-138, the mdh gene, encoding malate dehydrogenase. Deletion of this gene is intended to prevent flux to succinate via the reductive TCA cycle. The mdh deletion was performed using the X red homologeous recombination method (Datsenko and Wanner, Proc. Nat. Acad. Sci. USA 97:6640-6645 (2000)). The following oligonucleotides were used to PCR amplify the chloramphenicol resistance gene (CAT) flanked by FRT sites from pKD3:

S-mdh-Kan 5'- TAT TGT GCA TAC AGA TGA ATT TTT ATG CAA ACA GTC AGC CCT GAA GAA GGG TGT AGG CTG GAG CTG CTT C -3'(SEQ ID NO:31)

AS-mdh-Kan 5'- CAA AAA ACC GGA GTC TGT GCT CCG GTT TTT TAT TAT CCG CTA ATC AAT TAC ATA TGA ATA TCC TCC TTA G -3'(SEQ ID NO:32).

[0542] Underlined regions indicate homology to pKD3 plasmid and bold sequence refers to sequence homology upstream and downstream of the mdh ORF. After purification, the PCR product was electroporated into ECKh-138 electrocompetent cells that had been transformed with pRedET (tet) and prepared according to the manufacturer's instructions (genebridges.com/gb/pdf/KOO1% 2 0Q0%20E%/20BAC%/2OModification%/2OKit-version2.6

2007-screen.pdf). The PCR product was designed so that it integrated into the ECKh-138 genome at a region upstream of the mdh gene, as shown in Figure 41.

[0543] Recombinants were selected for chloramphenicol resistance and streak purified. Loss of the mdh gene and insertion of CAT was verified by diagnostic PCR. To remove the CAT gene, a temperature sensitive plasmid pCP20 containing a FLP recombinase (Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)) was transformed into the cell at 300 C and selected for ampicillin resistance (AMP). Transformants were grown nonselectively at 42 0C overnight to thermally induce FLP synthesis and to cause lose of the plasmid. The culture was then streak purified, and individual colonies were tested for loss of all antibiotic resistances. The majority lost the FRT-flanked resistance gene and the FLP helper plasmid simultaneously. There was also a "FRT" scar leftover. The resulting strain was named ECKh-172.

[0544] CS and ACONT are not highly active or highly expressed under anaerobic conditions. To this end, the arcA gene, which encodes for a global regulator of the TCA cycle, was deleted. ArcA works during microaerobic conditions to induce the expression of gene products that allow the activity of central metabolism enzymes that are sensitive to low oxygen levels, aceE, pflB and adhE. It was shown that microaerobically, a deletion in arcA/arcB increases the specific activities of ldh, icd, gltA, mdh, and gdh genes (Salmon et al., J. Biol. Chem. 280:15084-15096 (2005); Shalel-Levanon et al., Biotechnol. Bioeng. 92(2):147-159 (2005). The upstream and downstream regions of the arcA gene of E. coli MG1655 were amplified by PCR using primers ArcA-up-EcoRI (5' ataataatagaattcgtttgctacctaaattgccaactaaatcgaaacagg -3')(SEQ ID NO:33) with ArcA-up-KpnI (5'-tattattatggtaccaatatcatgcagcaaacggtgcaacattgccg -3')(SEQ ID NO:34) and ArcA-down EcoRI (5'-tgatctggaagaattcatcggctttaccaccgtcaaaaaaaacggcg -3')(SEQ ID NO:35) with ArcA down-PstI (5'-ataaaaccctgcagcggaaacgaagttttatccatttttggttacctg -3')(SEQ ID NO:36), respectively. These fragments were subsequently digested with the restriction enzymes EcoRI and KpnI (upstream fragment) and EcoRI and PstI (downstream). They were then ligated into the pREI18-V2 plasmid digested with PstI and KpnI, leading to plasmid pRE118-AarcA. The sequence of plasmid pRE118-AarcA was verified. pRE118-AarcAwas introduced into electro-competent cells of E. coli strain ECKh-172 (AadhE AldhA ApflB

AlpdA::K.p.lpdA322 Amdh). After integration and resolution on LB-no salt-sucrose plates as described above, the deletion of the arcA gene in the chromosome of the resulting strain ECKh-401 was verified by sequencing and is shown in Figure 42.

[0545] The gltA gene of E. coli encodes for a citrate synthase. It was previously shown that this gene is inhibited allosterically by NADH, and the amino acids involved in this inhibition have been identified (Pereira et al., J. Biol. Chem. 269(1):412-417 (1994); Stokell et al., J. Biol. Chem. 278(37):35435-35443 (2003)). The gltA gene of E. coli MG1655 was amplified by PCR using primers gltA-up (5'- ggaagagaggctggtacccagaagccacagcagga 3')(SEQ ID NO:37) and gltA-PstI (5'-gtaatcactgcgtaagcgccatgccccggcgttaattc -3')(SEQ ID NO:38). The amplified fragment was cloned into pRE118-V2 after digestion with KpnI and PstI. The resulting plasmid was called pRE118-gltA. This plasmid was then subjected to site directed mutagensis (SDM) using primers R163L-f (5'- attgccgcgttcctcctgctgtcga-3')(SEQ ID NO:39) and R163L-r (5'-cgacagcaggaggaacgcggcaat -3')(SEQ ID NO:40) to change the residue Arg 163 to a Lys residue. The sequence of the entire fragment was verified by sequencing. A variation of theX red homologeous recombination method (Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)) was used to replace the native gltA gene with the R163L mutant allele without leaving a Frt scar. The general recombination procedure is the same as used to make the mdh deletion described above. First, the strain ECKh-172 was made streptomycin resistant by introducing an rpsL null mutation using the X red homologeous recombination method. Next, a recombination was done to replace the entire wild-type gltA coding region in this strain with a cassette comprised of a kanamycin resistance gene (kanR) and a wild-type copy of the E. coli rpsL gene. When introduced into an E. coli strain harboring an rpsL null mutation, the cassette causes the cells to change from resistance to the drug streptomycin to streptomycin sensitivity. DNA fragments were then introduced that included each of the mutant versions of the gltA gene along with appropriate homologous ends, and resulting colony growth was tested in the presence of streptomycin. This selected for strains in which the kanR/rpsL cassette had been replaced by the mutant gltA gene. Insertion of the mutant gene in the correct locus was confirmed by PCR and DNA sequencing analyses. The resulting strain was called ECKh 422, and has the genotype AadhE AldhA ApflB AlpdA::K.p.lpdA322 Amdh AarcA gltAR163L. The region encompassing the mutated gitA gene of strain ECKh-422 was verified by sequencing, as shown in Figure 43.

[0546] Crude extracts of the strains ECKh-401 and the gltAR163L mutant ECKh-422 were then evaluated for citrate synthase activity. Cells were harvested by centrifugation at 4,500 rpm (Beckman-Coulter, Allegera X-15R; Fullerton CA) for 10 min. The pellets were resuspended in 0.3 mL BugBuster (Novagen/EMD; San Diego CA) reagent with benzonase and lysozyme, and lysis proceeded for 15 minutes at room temperature with gentle shaking. Cell-free lysate was obtained by centrifugation at 14,000 rpm (Eppendorf centrifuge 5402; Hamburg Germany) for 30 min at 40 C. Cell protein in the sample was determined using the method of Bradford (Bradford, Anal. Biochem. 72:248-254 (1976)).

[0547] Citrate synthase activity was determined by following the formation of free coenzyme A (HS-CoA), which is released from the reaction of acetyl-CoA with oxaloacetate. The free thiol group of HS-CoA reacts with 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB) to form 5-thio-2-nitrobenzoic acid (TNB). The concentration of TNB is then monitored spectrophotometrically by measuring the absorbance at 410 nm (maximum at 412 nm). The assay mixture contained 100 mM Tris/HCl buffer (pH 7.5),20 mM acetyl-CoA, 10 mM DTNB, and 20 mM oxaloacetate. For the evaluation of NADH inhibition, 0.4 mM NADH was also added to the reaction. The assay was started by adding 5 microliters of the cell extract, and the rate of reaction was measured by following the absorbance change over time. A unit of specific activity is defined as the gmol of product converted per minute per mg protein.

[0548] Figure 44 shows the citrate synthase activity of wild type gtA gene product and the R163L mutant. The assay was performed in the absence or presence of 0.4 mM NADH.

[0549] Strains ECKh-401 and ECKh-422 were transformed with plasmids expressing the entire BDO pathway. E. coli sucCD, P. gingivalissucD, P. gingivalis 4hbd, and M. bovis sucA were expressed on the low copy plasmid pZS*13, and P. gingivalis Cat2 and C. acetobutylicum AdhE2 were expressed on the medium copy plasmid pZE23. Cultures of these strains were grown microaerobically in M9 minimal medium supplemented with 20 g/L glucose and the appropriate antibiotics as described above. The 4HB and BDO concentrations at 48 hours post-induction averaged from duplicate cultures are shown in Figure 45. Both are higher in ECKh-422 than in ECKh-401, demonstrating that the enhanced citrate synthase activity due to the gltA mutation results in increased flux to the BDO pathway.

[0550] The host strain modifications described in this section were intended to redirect carbon flux through the oxidative TCA cycle, which is consistent with the OptKnock strain design described in WO 2009/023493 and U.S. publication 2009/0047719. To demonstrate that flux was indeed routed through this pathway, 1 3 C flux analysis was performed using the strain ECKh-432, which is a version of ECKh-422 in which the upstream pathway is integrated into the chromosome (as described in Example XVII). To complete the BDO pathway, P. gingivalis Cat2 and C. beijerinckiiAld were expressed from pZS*13. Four parallel cultures were grown in M9 minimal medium (6.78 g/L Na 2HPO 4 , 3.0 g/L KH 2 PO 4

, 0.5 g/L NaCl, 1.0 g/L NH 4 Cl, 1 mM MgSO 4 , 0.1 mM CaCl 2 ) containing 4 g/L total glucose of four different labeling ratios ( 1-1 3C, only the first carbon atom in the glucose molecule is labeled with 1 3 C; uniform- 1 3C, all carbon atoms are 13C):

1. 80 mol% unlabeled, 20 mol% uniform-1 3 C

2. 10 mol% unlabeled, 90 mol% uniform-1 3 C

3. 90 mol0 % -13 C, 10 mol0 % uniform 13C

4. 40 mol% -13 C, 60 mol0 % uniform 13C

[0551] Parallel unlabeled cultures were grown in duplicate, from which frequent samples were taken to evaluate growth rate, glucose uptake rate, and product formation rates. In late exponential phase, the labeled cultures were harvested, the protein isolated and hydrolyzed to amino acids, and the label distribution of the amino acids analyzed by gas chromatography mass spectrometry (GCMS) as described previously (Fischer and Sauer, Eur. J. Biochem. 270:880-891 (2003)). In addition, the label distribution of the secreted 4HB and BDO in the broth from the labeled cultures was analyzed by GCMS as described in W02008115840. This data was collectively used to calculate the intracellular flux distribution using established methods (Suthers et al., Metab. Eng. 9:387-405 (2007)). The resulting central metabolic fluxes and associated 95% confidence intervals are shown in Figure 46. Values are molar fluxes normalized to a glucose uptake rate of 1 mmol/hr. The result indicates that carbon flux is routed through citrate synthase in the oxidative direction, and that most of the carbon enters the BDO pathway rather than completing the TCA cycle. Furthermore, it confirms there is essentially no flux between malate and oxaloacetate due to the mdh deletion in this strain.

[0552] The advantage of using a knockout strain such as strains designed using OptKnock for BDO production (see WO 2009/023493 and U.S. publication 2009/0047719) can be observed by comparing typical fermentation profiles of ECKh-422 with that of the original strain ECKh-138, in which BDO is produced from succinate via the reductive TCA cycle (see Figure 47). Fermentations were performed with IL initial culture volume in 2L Biostat B+ bioreactors (Sartorius; Cedex France) using M9 minimal medium supplemented with 20 g/L glucose. The temperature was controlled at 370 C, and the pH was controlled at 7.0 using 2 M NH 40H or Na 2 CO 3 . Cells were grown aerobically to an OD600 of approximately 10, at which time the cultures were induced with 0.2 mM IPTG. One hour following induction, the air flow rate was reduced to 0.02 standard liters per minute for microaerobic conditions. The agitation rate was set at 700 rpm. Concentrated glucose was fed to maintain glucose concentration in the vessel between 0.5 and 10 g/L. Both strains were transformed with plasmids bearing the entire BDO pathway, as in the examples above. In ECKh-138, acetate, pyruvate, and 4HB dominate the fermentation, while with ECKh-422 BDO is the major product.

EXAMPLE XVI BDO Strains Expression Phosphoenolpyruvate Carboxykinase

[0553] This example describes the utilization of phosphoenolpyruvate carboxykinase (PEPCK) to enhance BDO production. The Haemophilus influenza PEPCK gene was used for heterologous expression.

[0554] Computationally, it was demonstrated that the ATP-generating conversion of oxaloacetate to phosphoenolpyruvate is required to reach the maximum theoretical yield of 1,4-butanediol (see also W02008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). Lack of PEPCK activity was shown to reduce the maximum theoretical yield of BDO by 12% assuming anaerobic conditions and by 3% assuming an external electron acceptor such as nitrate or oxygen is present.

[0555] In organisms such as E. coli, PEPCK operates in the gluconeogenic and ATP consuming direction from oxaloacetate towards phosphoenolpyruvate. It has been hypothesized that kinetic limitations of PEPCK of E. coli prevent it from effectively catalyzing the formation of oxaloacetate from PEP. PEP carboxylase (PPC), which does not generate ATP but is required for efficient growth, is naturally utilized by E. coli to form oxaloacetate from phosphoenolpyruvate. Therefore, three non native PEPCK enzymes (Table 25) were tested for their ability to complement growth of a PPC mutant strain of E. coli in glucose minimal media.

Table 25. Sources of phosphoenolpyruvate carboxykinase sequences.

PEPCK Source Strain Accession Number, GenBank Reference Sequence Haemophilus influenza NC 000907.1 Actinobacillus succinogenes YP 001343536.1 Mannheimia succiniciproducens YP 089485.1

[0556] Growth complementation studies involved plasmid based expression of the candidate genes in Appc mutant E.coli JW3978 obtained from the Keio collection (Baba et al., Molecular Systems Biology 2:2006.0008 (2006)). The genes were cloned behind the PAllacO-1 promoter in the expression vectors pZA23 (medium copy) and pZE13 (high copy). These plasmids have been described previously (Lutz and Bujard, Nucleic Acids Res. :1203-1210 (1997)), and their use in expression BDO pathway genes has been described previously in W02008115840.

[0557] Pre-cultures were grown aerobically in M9 minimal media with 4g/L glucose. All pre-cultures were supplemented with aspartate (2mM) to provide the Appc mutants with a source for generating TCA cycle intermediates independent of PEPCK expression. M9 minimal media was also used in the test conditions with 4g/L glucose, but no aspartate was added and IPTG was added to 0.5 mM. Table 26 shows the results of the growth complementation studies.

Table 26. Complementation of Appc mutants with PEPCK from H. influenzae, A. succinogenes and M. succinoproducenswhen expressed from vectors pZA23 or pZE13.

H.influenzae pZA23BB 40 0.950 App cControl pZA23BB 40 0.038 A.succinogenes pZA23BB 40 0.055 M. succinoroducens pZA23BB 40 0.214

A.succinogenes pZE13BB 40 0.041 M. succinoproducens pZE13BB 40 0.024 Appe Control pZE13BB 40 0.042

[0558] Haemophilus influenza PEPCK was found to complement growth in Appc mutant E. coli best among the genes that were tested in the plasmid based screening. This gene was then integrated into the PPC locus of wild-type E. coli (MG1655) using the SacB counter selection method with pRE118-V2 discussed above (Gay et al., J. Bacteriol. 153:1424-1431 (1983)). PEPCK was integrated retaining the E. coli native PPC promoter, but utilizing the non-native PEPCK terminator. The sequence of this region following replacement of ppc by H. influenzae pepck is shown in Figure 48. The pepck coding region is underlined.

[0559] Techniques for adaptive evolution were applied to improve the growth rate of the E. coli mutant (Appc::H. inf pepCK). M9 minimal media with 4 g/L glucose and 50mM sodium bicarbonate was used to culture and evolve this strain in an anaerobic environment. The high sodium bicarbonate concentration was used to drive the equilibrium of the PEPCK reaction toward oxaloacetate formation. To maintain exponential growth, the culture was diluted 2-fold whenever an OD600 of 0.5 was achieved. After about 100 generations over 3 weeks of adaptive evolution, anaerobic growth rates improved from about 8h to that of wild type, about 2h. Following evolution, individual colonies were isolated, and growth in anaerobic bottles was compared to that of the initial mutant and wild-type strain (see Figure 49). M9 medium with 4 g/L glucose and 50 mM sodium bicarbonate was used.

[0560] The ppc/pepck gene replacement procedure described above was then repeated, this time using the BDO-producing strains ECKh-432 (AadhE AldhA ApflB

AlpdA::K.p.lpdA322 Amdh AarcA gltAR163L AackA fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd) and ECKh-439 as the hosts. These strains contain the TCA cycle enhancements discussed above as well as the upstream pathway integrated in the chromosome. ECKh-439 is a derivative of ECKh-432 that has the ackA gene deleted, which encodes acetate kinase. This deletion was performed using the sacB counterselection method described above.

[0561] The Appc::H. infpepCK derivative of ECKh-439, called ECKh-453, was run in a fermentation. The downstream BDO pathway was supplied by pZS*13 containing P. gingivalis Cat2 and C. beijerinckiiAld. This was performed with 1L initial culture volume in

2L Biostat B+ bioreactors (Sartorius) using M9 minimal medium supplemented with 20 g/L glucose and 50 mM NaHCO 3 . The temperature was controlled at 370 C, and the pH was controlled at 7.0 using 2 M NH 40H or Na2 CO 3 . Cells were grown aerobically to an OD600 of approximately 2, at which time the cultures were induced with 0.2 mM IPTG. One hour following induction, the air flow rate was reduced to 0.01 standard liters per minute for microaerobic conditions. The agitation rate was initially set at 700 rpm. The aeration rate was gradually increased throughout the fermentation as the culture density increased. Concentrated glucose solution was fed to maintain glucose concentration in the vessel between 0.5 and 10 g/L. The product profile is shown in Figure 50. The observed phenotype, in which BDO and acetate are produced in approximately a one-to-one molar ratio, is highly similar to that predicted in WO 2009/023493 for design #439 (ADHEr, ASPT, LDH_D, MDH, PFLi). The deletion targeting the ASPT reaction was deemed unnecessary as the natural flux through aspartate ammonia-lyase is low.

[0562] A key feature of OptKnock strains is that production of the metabolite of interest is generally coupled to growth, and further, that, production should occur during exponential growth as well as in stationary phase. The growth coupling potential of ECKh-432 and ECKh-453 was evaluated by growth in microaerobic bottles with frequent sampling during the exponential phase. M9 medium containing 4 g/L glucose and either 10mM NaHCO 3 (for ECKh-432) or 50 mM NaHCO 3 (for ECKh-453) was used, and 0.2 mM IPTG was included from inoculation. 18G needles were used for microaerobic growth of ECKh-432, while both 18G and 27G needles were tested for ECKh-453. The higher gauge needles result in less aeration. As shown in Figure 51, ECKh-432 does not begin producing BDO until 5 g/L glucose has been consumed, corresponding to the onset of stationary phase. ECKh-453 produces BDO more evenly throughout the experiment. In addition, growth coupling improves as the aeration of the culture is reduced.

EXAMPLE XVII Integration of BDO Pathway Encoding Genes at Specific Integration Sites

[0563] This example describes integration of various BDO pathway genes into the fimD locus to provide more efficient expression and stability.

[0564] The entire upstream BDO pathway, leading to 4HB, has been integrated into the E. coli chromosome at the fimD locus. The succinate branch of the upstream pathway was integrated into the E. coli chromosome using theX red homologeous recombination method

(Datsenko and Wanner, Proc. Nat. Acad. Sci. USA 97:6640-6645 (2000)). The recipient E.

coli strain was ECKh-422 (AadhE AldhA ApflB AlpdA::K.p.lpdA322 Amdh AarcA gltAR163L). A polycistronic DNA fragment containing a promoter, the sucCD gene, the sucD gene and the 4hbd gene and a terminator sequence was inserted into the AflIII site of the pKD3 plasmid. The following primers were used to amplify the operon together with the chloramphenicol marker from the plasmid. The underlined sequences are homologeous to the target insertion site.

'-GTTTGCACGCTATAGCTGAGGTTGTTGTCTTCCAGCAACGTACCGTATACAA TAGGCGTATCACGAGGCCCTTTC-3'(SEQ ID NO:41) '-GCTACAGCATGTCACACGATCTCAACGGTCGGATGACCAATCTGGCTGGTAT GGGAATTAGCCATGGTCC-3'(SEQ ID NO:42)

[0565] Following DpnI treatment and DNA electrophoresis, the purified PCR product was used to transform E. coli strain harboring plasmid pKD46. The candidate strain was selected on plates containing chloramphenicol. Genomic DNA of the candidate strain was purified. The insertion sequence was amplified and confirmed by DNA sequencing. The chloramphenicol-resistant marker was removed from chromosome by flipase. The nucleotide sequence of the region after insertion and marker removal is shown in Figure 52.

[0566] The alpha-ketoglutarate branch of the upstream pathway was integrated into the chromosome by homologeous recombination. The plasmid used in this modification was derived from vector pREI18-V2, as referenced in Example XIV, which contains a kanamycin-resistant gene, a gene encoding the levansucrase (sacB) and a R6K conditional replication ori. The integration plasmid also contained a polycistronic sequence with a promoter, the sucA gene, the C. kluyveri 4hbd gene, and a terminator being inserted between two 1.5-kb DNA fragments that are homologeous to the flanking regions of the target insertion site. The resulting plasmid was used to transform E. coli strain. The integration candidate was selected on plates containing kanamycin. The correct integration site was verified by PCR. To resolve the antibiotic marker from the chromosome, the cells were selected for growth on medium containing sucrose. The final strain was verified by PCR and DNA sequencing. The nucleotide sequence of the chromosomal region after insertion and marker removal is shown in Figure 53.

[0567] The resulting upstream pathway integration strain ECKh-432 was transformed with a plasmid harboring the downstream pathway genes. The construct was able to produce BDO from glucose in minimal medium (see Figure 54).

EXAMPLE XVIII Use of a Non-Phosphotransferase Sucrose Uptake System to Reduce Pyruvate Byproduct Formation

[0568] This example describes the utilization of a non-phosphotransferase (PTS) sucrose uptake system to reduce pyruvate as a byproduct in the conversion of sucrose to BDO.

[0569] Strains engineered for the utilization of sucrose via a phosphotransferase (PTS) system produce significant amounts of pyruvate as a byproduct. Therefore, the use of a non PTS sucrose system can be used to decrease pyruvate formation because the import of sucrose would not be accompanied by the conversion of phosphoenolpyruvate (PEP) to pyruvate. This will increase the PEP pool and the flux to oxaloacetate through PPC or PEPCK.

[0570] Insertion of a non-PTS sucrose operon into the rrnCregion was performed. To generate a PCR product containing the non-PTS sucrose genes flanked by regions of homology to the rrnCregion, two oligos were used to PCR amplify the csc genes from MachlTM (Invitrogen, Carlsbad, CA). This strain is a descendent of W strain which is an E. coli strain known to be able to catabolize sucrose (Orencio-Trejo et al., Biotechnology Biofuels 1:8 (2008)). The sequence was derived from E. coli W strain KO1 (accession AY314757) (Shukla et al., Biotechnol. Lett. 26:689-693 (2004)) and includes genes encoding a sucrose permease (cscB), D-fructokinase (cscK), sucrose hydrolase (cscA), and a Lac related sucrose-specific repressor (cscR). The first 53 amino acids of cscR was effectively removed by the placement of the AS primer. The sequences of the oligos were: rrnC 23S del S -CSC 5'-TGT GAG TGA AAG TCA CCT GCC TTA ATA TCT CAA AAC TCA TCT TCG GGT GAC GAA ATA TGG CGT GAC TCG ATA C-3'(SEQ ID NO:43) and rmC 23S del AS -CSC 5'-TCT GTA TCA GGC TGA AAA TCT TCT CTC ATC CGC CAA AAC AGC TTC GGC GTT AAG ATG CGC GCT CAA GGA C-3'(SEQ ID NO:44). Underlined regions indicate homology to the csc operon, and bold sequence refers to sequence homology upstream and downstream of the rrnCregion. The sequence of the entire PCR product is shown in Figure 55.

[0571] After purification, the PCR product was electroporated into MG1655 electrocompetent cells which had been transformed with pRedET (tet) and prepared according to manufacturer's instructions (genebridges.com/gb/pdf/KOO1 % 20Q%20E%20BAC%2OModification%2OKit-version2.6 2007-screen.pdf). The PCR product was designed so that it integrated into genome into the rrnCregion of the chromosome. It effectively deleted 191 nucleotides upstream of rrlC (23S rRNA), all of the rrlCrRNA gene and 3 nucleotides downstream of rrlC and replaced it with the sucrose operon, as shown in Figure 56.

[0572] Transformants were grown on M9 minimal salts medium with 0.4% sucrose and individual colonies tested for presence of the sucrose operon by diagnostic PCR. The entire rrnC::crcAKB region was transferred into the BDO host strain ECKh-432 by P1 transduction (Sambrook et al., Molecular Cloning: A LaboratoryManual, Third Ed., Cold Spring Harbor Laboratory, New York (2001), resulting in ECKh-463 (AadhE AldhA ApflB

AlpdA::K.p.lpdA322 Amdh AarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd rrnC::cscAKB). Recombinants were selected by growth on sucrose and verified by diagnostic PCR.

[0573] ECKh-463 was transformed with pZS*13 containing P. gingivalis Cat2 and C. beijerinckiiAld to provide a complete BDO pathway. Cells were cultured in M9 minimal medium (6.78 g/L Na2 HPO4, 3.0 g/L KH 2PO 4, 0.5 g/L NaCl, 1.0 g/L NH 4Cl, 1 mM MgSO 4 , 0.1 mM CaCl2) supplemented with 10 g/L sucrose. 0.2 mM IPTG was present in the culture from the start. Anaerobic conditions were maintained using a bottle with 23G needle. As a control, ECKh-432 containing the same plasmid was cultured on the same medium, except with 10 g/L glucose instead of sucrose. Figure 57 shows average product concentration, normalized to culture OD600, after 48 hours of growth. The data is for 6 replicate cultures of each strain. This demonstrates that BDO production from ECKh-463 on sucrose is similar to that of the parent strain on sucrose.

EXAMPLE XIX Summary of BDO Producing Strains

[0574] This example describes various BDO producting strains.

Table 27 summarizes various BDO producing strains disclosed above in Examples XII XVIII.

Table 27. Summary of various BDO production strains.

Strain Host Host chromosome Host Description Plasmid-based # Strain

1 AldhA Single deletion E. coli sucCD, P. gingivalis derivative of E. sucD, P. gingivalis 4hbd, P. coli MG1655 gingivalis Cat2, C. acetobutylicum AdhE2 2 AB3 AadhE AldhA ApflB Succinate E. coli sucCD, P. gingivalis producing strain; sucD, P. gingivalis 4hbd, P. derivative of E. gingivalis Cat2, C. coli MG1655 acetobutylicum AdhE2 3 ECKh- AadhE AldhA ApflB Improvement of E. coli sucCD, P. gingivalis 138 AlpdA::K.p.lpdA322 lpdA to increase sucD, P. gingivalis 4hbd, P. pyruvate gingivalis Cat2, C. dehydrogenase acetobutylicum AdhE2 flux 4 ECKh- AadhE AldhA ApflB E. coli sucCD, P. gingivalis 138 AlpdA::K.p.lpdA322 sucD, P. gingivalis 4hbd, C. acetobutylicum buk1, C. acetobutylicum ptb, C. acetobutylicum AdhE2 5 ECKh- AadhE AldhA ApflB Deletions in mdh E. coli sucCD, P. gingivalis 401 AlpdA::K.p.lpdA322 Amdh and arcA to direct sucD, P. gingivalis 4hbd, P. AarcA flux through gingivalis Cat2, C. oxidative TCA acetobutylicum AdhE2 cycle 6 ECKh- AadhE AldhA ApflB M. bovis sucA, E. coli sucCD, 401 AlpdA::K.p.lpdA322 Amdh P. gingivalis sucD, P. AarcA gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2 7 ECKh- AadhE AldhA ApflB Mutation in citrate E. coli sucCD, P. gingivalis 422 AlpdA::K.p.lpdA322 Amdh synthase to sucD, P. gingivalis 4hbd, P. AarcA gltAR163L improve anaerobic gingivalis Cat2, C. activity acetobutylicum AdhE2 8 ECKh- AadhE AldhA ApflB M. bovis sucA, E. coli sucCD, 422 AlpdA::K.p.lpdA322 Amdh P. gingivalis sucD, P. AarcA gltAR163L gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2 9 ECKh- AadhE AldhA ApflB M. bovis sucA, E. coli sucCD, 422 AlpdA::K.p.lpdA322 Amdh P. gingivalis sucD, P. AarcA gltAR163L gingivalis 4hbd, P. gingivalis Cat2, C. beijerinckii Ald 10 ECKh- AadhE AldhA ApflB Succinate branch P. gingivalis Cat2, C 426 AlpdA::K.p.lpdA322 Amdh of upstream beiferinckii Ald AarcA gltAR163L fimD:: E. coli pathway integrated sucCD, P. gingivalis sucD, P. into ECKh-422 gingivalis 4hbd 11 ECKh- AadhE AldhA ApflB Succinate and P. gingivalis Cat2, C 432 alpha- beijerinckii Ald

AlpdA::K.p.1pdA322 Amdh ketoglutarate AarcA gltAR163L fimD:: E. coli upstream pathway sucCD, P. gingivalis sucD, P. branches gingivalis 4hbd fimD:: M bovis integrated into sucA, C kluyveri 4hbd ECKh-422 12 ECKh- AadhE AldhA ApflB C. acetobutylicum buk1, C. 432 AlpdA::K.p.lpdA322 Amdh acetobutylicum ptb, C. AarcA gltAR163L fimD:: E. coli beiferinckii Ald sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M bovis sucA, C. kluyveri 4hbd 13 ECKh- AadhE AldhA ApflB Acetate kinase P. gingivalis Cat2, C 439 AlpdA::K.p.lpdA322 Amdh deletion of ECKh- beiferinckii Ald AarcA gltAR163L AackA 432 fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C kluyveri 4hbd 14 ECKh- AadhE AldhA ApflB Acetate kinase P. gingivalis Cat2, C 453 AlpdA::K.p.lpdA322 Amdh deletion and beiferinckii Ald AarcA gltAR163L AackA PPC/PEPCK Appc::H.i.ppck fimD:: E. coli replacement of sucCD, P. gingivalis sucD, P. ECKh-432 gingivalis 4hbd fimD:: M bovis sucA, C. kluyveri 4hbd ECKh- AadhE AldhA ApflB AlpdA::fnr- Replacement of P. gingivalis Cat2, C 456 pflB6-K.p.1pdA322 Amdh AarcA lpdA promoter beiferinckii Ald gltAR163L fimD:: E. coli with anaerobic sucCD, P. gingivalis sucD, P. promoter in gingivalis 4hbd fimD:: M bovis ECKh-432 sucA, C. kluyveri 4hbd 16 ECKh- AadhE AldhA ApflB AlpdA:: Replacement of P. gingivalis Cat2, C 455 K.p.1pdA322 ApdhR:: fnr-pflB6 pdhR and aceEF beiferinckii Ald Amdh AarcA gltAR163L fimD:: promoter with E. coli sucCD, P. gingivalis anaerobic sucD, P. gingivalis 4hbd fimD:: promoter in M. bovis sucA, C. kluyveri 4hbd ECKh-432 17 ECKh- AadhE AldhA ApflB AlpdA:: Integration of C. beijerinckii Ald 459 K.p.1pdA322 Amdh AarcA BK/PTB into gltAR163L fimD:: E. coli ECKh-432 sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M bovis sucA, C kluyveri 4hbd fimD:: C. acetobutylicum buki, C. acetobutylicum ptb 18 ECKh- AadhE AldhA ApflB AlpdA:: C. beijerinckii Ald, G. 459 K.p.1pdA322 Amdh AarcA thermoglucosidasiusadh1 gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M bovis sucA, C kluyveri 4hbd fimD:: C. acetobutylicum buk, C. acetobutylicum ptb 19 ECKh- AadhE AldhA ApflB Non-PTS sucrose P. gingivalis Cat2, C 463 AlpdA::K.p.1pdA322 Amdh genes inserted into beiferinckii Ald AarcA gltAR163L fimD:: E. coli ECKh-432 sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M bovis sucA, C. kluyveri 4hbd rrnC::cscAKB 20 ECKh- AadhE AldhA ApflB C. acetobutylicum buk, C. 463 AlpdA::K.p.1pdA322 Amdh acetobutylicum ptb, C. AarcA gltAR163L fimD:: E. coli beiferinckii Ald sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M bovis sucA, C. kluyveri 4hbd rrnC::cscAKB

[0575] The strains summarized in Table 27 are as follows. Strain 1: Single deletion derivative of E. coli MG1655, with deletion of endogenous IdhA; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2. Strain 2: Host strain AB3, a succinate producing strain, derivative of E. coli MG1655, with deletions of endogenous adhEIdhA pflB; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2.

[0576] Strain 3: Host strain ECKh-138, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiellapneumoniae lpdA with a Glu354Lys mutation at the lpdA locus; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2; strain provides improvement of lpdA to increase pyruvate dehydrogenase flux. Strain 4: Host strain ECKh 138, deletion of endogenous adhE, IdhA, pflB, andlpdA, chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation; plasmid expression E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, C. acetobutylicum buki, C. acetobutylicum ptb, C. acetobutylicum AdhE2.

[0577] Strain 5: Host strain ECKh-401, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiellapneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA; plasmid expression of E. coli sucCD, P. gingivalissucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2; strain has deletions in mdh and arcA to direct flux through oxidative TCA cycle. Strain 6: host strain ECKh-401, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniaelpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA; plasmid expression of M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2.

[0578] Strain 7: Host strain ECKh-422, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiellapneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gitA with gitA Arg163Leu mutant; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2; strain has mutation in citrate synthase to improve anaerobic activity. Strain 8: strain ECKh-422, deletion of endogenous adhE, IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gtA with gtA Arg163Leu mutant; plasmid expression of M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2. Strain 9: host strain ECKh 422, deletion of endogenous adhE, IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gtA with gtA Arg163Leu mutant; plasmid expression of M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis4hbd, P. gingivalis Cat2, C. beierinckiiAld.

[0579] Strain 10: host strain ECKh-426, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniaelpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gitA with gitA Arg163Leu mutant, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd; plasmid expression of P. gingivalis Cat2, C. beijerinckiiAld; strain has succinate branch of upstream pathway integrated into strain ECKh-422 at thefimD locus. Strain 11: host strain ECKh-432, deletion of endogenous adhE, IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gitA with gtA Arg163Leu mutant, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kluyveri 4hbd; plasmid expression of P. gingivalis Cat2, C. beijerinckiiAld; strain has succinate and alpha ketoglutarate upstream pathway branches integrated into ECKh-422. Strain 12: host strain ECKh-432, deletion of endogenous adhE, IdhA, pflB, deletion of endogenous /pdA and chromosomal insertion of Klebsiella pneumoniae pdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gtA with gitA Arg163Leu mutant, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kluyveri 4hbd; plasmid expression of C. acetobutylicum buk, C. acetobutylicum ptb, C. beierinckiiAld.

[0580] Strain 13: host strain ECKh-439, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gitA with gitA Arg163Leu mutant, deletion of endogenous ackA, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kuyveri 4hbd; plasmid expression of P. gingivalis Cat2, C. beijerinckiiAld; strain has acetate kinase deletion in strain ECKh-432. Strain 14: host strain ECKh-453, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gitA with gitA Arg163Leu mutant, deletion of endogenous ackA, deletion of endogenous ppc and insertion of Haemophilus influenza ppck at the ppc locus, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kuyveri 4hbd; plasmid expression of P. gingivalis Cat2, C. beijerinckiiAld; strain has acetate kinase deletion and PPC/PEPCK replacement in strain ECKh-432.

[0581] Strain 15: host strain ECKh-456, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae pdA with a Glu354Lys mutation at the/pdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gitA with gitA Arg163Leu mutant, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kuyveri 4hbd, replacement of pdA promoter with fnr binding site, pflB-p6 promoter and RBS ofpflB; plasmid expression of P. gingivalisCat2, C. beijerinckii Ald; strain has replacement of lpdA promoter with anaerobic promoter in strain ECKh-432. Strain 16: host strain ECKh-455, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous /pdA and chromosomal insertion of Klebsiella pneumoniae/pdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at thefimD locus of

E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kuyveri 4hbdI, replacement ofpdhR and aceEFpromoter with fnr binding site, pflB-p6 promoter and RBS ofpflB; plasmid expression of P. gingivalis Cat2, C. beijerinckiiAld; strain has replacement of pdhR and aceEF promoter with anaerobic promoter in ECKh-432.

[0582] Strain 17: host strain ECKh-459, deletion of endogenous adhE,IdhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniaelpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gitA with gitA Arg163Leu mutant, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kluyveri 4hbd, chromosomal insertion at thefimD locus of C. acetobutylicum buk, C. acetobutylicum ptb; plasmid expression of C. beijerinckiiAld; strain has integration of BK/PTB into strain ECKh-432. Strain 18: host strain ECKh-459, deletion of endogenous adhE, /dhA, pflB, deletion of endogenous /pdA and chromosomal insertion of Klebsiella pneumoniae pdA with a Glu354Lys mutation at the /pdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gitA with gtA Arg163Leu mutant, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kuyveri 4hbd, chromosomal insertion at thefimD locus of C. acetobutylicum buk, C. acetobutylicum ptb; plasmid expression of C. beijerinckiiAld, G. thermoglucosidasiusadh1.

[0583] Strain 19: host strain ECKh-463, deletion of endogenous adhE, dhA, pflB, deletion of endogenous /pdA and chromosomal insertion of Klebsiella pneumoniae pdA with a Glu354Lys mutation at the/pdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of g/tA with g/tA Arg163Leu mutant, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kuyveri 4hbd, insertion at the rrnClocus of non-PTS sucrose operon genes sucrose permease (cscB), D-fructokinase (cscK), sucrose hydrolase (cscA), and a LacI-related sucrose-specific repressor (cscR); plasmid expression of P. gingivalis Cat2, C. beijerinckiiAld; strain has non-PTS sucrose genes inserted into strain ECKh-432. Strain 20: host strain ECKh-463 deletion of endogenous adhE,/dhA, pflB, deletion of endogenous pdA and chromosomal insertion of Klebsiellapneumoniae /pdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gitA Arg163Leu mutant, chromosomal insertion at thefimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at thefimD locus of M. bovis sucA, C. kluyveri 4hbd, insertion at the rrnClocus of non-PTS sucrose operon; plasmid expression of C. acetobutylicum buk, C. acetobutylicum ptb, C. beijerinckii Ald.

[0584] In addition to the BDO producing strains disclosed herein, including those disclosed in Table 27, it is understood that additional modifications can be incorporated that further increase production of BDO and/or decrease undesirable byproducts. For example, a BDO producing strain, or a strain of Table 27, can incorporate additional knockouts to further increase the production of BDO or decrease an undesirable byproduct. Exemplary knockouts have been described previously (see U.S. publication 2009/0047719). Such knockout strains include, but are not limited to, ADHEr, NADH6; ADHEr, PPCK; ADHEr, SUCD4; ADHEr, ATPS4r; ADHEr, FUM; ADHEr, MDH; ADHEr, PFLi, PPCK; ADHEr, PFLi, SUCD4; ADHEr, ACKr, NADH6; ADHEr, NADH6, PFLi; ADHEr, ASPT, MDH; ADHEr, NADH6, PPCK; ADHEr, PPCK, THD2; ADHEr, ATPS4r, PPCK; ADHEr, MDH, THD2; ADHEr, FUM, PFLi; ADHEr, PPCK, SUCD4; ADHEr, GLCpts, PPCK; ADHEr, GLUDy, MDH; ADHEr, GLUDy, PPCK; ADHEr, FUM, PPCK; ADHEr, MDH, PPCK; ADHEr, FUM, GLUDy; ADHEr, FUM, HEXI; ADHEr, HEXI, PFLi; ADHEr, HEXI, THD2; ADHEr, FRD2, LDHD, MDH; ADHEr, FRD2, LDHD, ME2; ADHEr, MDH, PGL, THD2; ADHEr, G6PDHy, MDH, THD2; ADHEr, PFLi, PPCK, THD2; ADHEr, ACKr, AKGD, ATPS4r; ADHEr, GLCpts, PFLi, PPCK; ADHEr, ACKr, ATPS4r, SUCOAS; ADHEr, GLUDy, PFLi, PPCK; ADHEr, ME2, PFLi, SUCD4; ADHEr, GLUDy, PFLi, SUCD4; ADHEr, ATPS4r, LDHD, SUCD4; ADHEr, FUM, HEXI, PFLi; ADHEr, MDH, NADH6, THD2; ADHEr, ATPS4r, MDH, NADH6; ADHEr, ATPS4r, FUM, NADH6; ADHEr, ASPT, MDH, NADH6; ADHEr, ASPT, MDH, THD2; ADHEr, ATPS4r, GLCpts, SUCD4; ADHEr, ATPS4r, GLUDy, MDH; ADHEr, ATPS4r, MDH, PPCK; ADHEr, ATPS4r, FUM, PPCK; ADHEr, ASPT, GLCpts, MDH; ADHEr, ASPT, GLUDy, MDH; ADHEr, ME2, SUCD4, THD2; ADHEr, FUM, PPCK, THD2; ADHEr, MDH, PPCK, THD2; ADHEr, GLUDy, MDH, THD2; ADHEr, HEXI, PFLi, THD2; ADHEr, ATPS4r, G6PDHy, MDH; ADHEr, ATPS4r, MDH, PGL; ADHEr, ACKr, FRD2, LDHD; ADHEr, ACKr, LDHD, SUCD4; ADHEr, ATPS4r, FUM, GLUDy; ADHEr, ATPS4r, FUM, HEXI; ADHEr, ATPS4r, MDH, THD2; ADHEr, ATPS4r, FRD2, LDHD; ADHEr, ATPS4r, MDH, PGDH; ADHEr, GLCpts, PPCK, THD2; ADHEr, GLUDy, PPCK, THD2; ADHEr, FUM, HEXI, THD2; ADHEr, ATPS4r, ME2, THD2; ADHEr, FUM, ME2, THD2; ADHEr, GLCpts, GLUDy,

PPCK; ADHEr, ME2, PGL, THD2; ADHEr, G6PDHy, ME2, THD2; ADHEr, ATPS4r, FRD2, LDHD, ME2; ADHEr, ATPS4r, FRD2, LDHD, MDH; ADHEr, ASPT, LDHD, MDH, PFLi; ADHEr, ATPS4r, GLCpts, NADH6, PFLi; ADHEr, ATPS4r, MDH, NADH6, PGL; ADHEr, ATPS4r, G6PDHy, MDH, NADH6; ADHEr, ACKr, FUM, GLUDy, LDHD; ADHEr, ACKr, GLUDy, LDH_D, SUCD4; ADHEr, ATPS4r, G6PDHy, MDH, THD2; ADHEr, ATPS4r, MDH, PGL, THD2; ADHEr, ASPT, G6PDHy, MDH, PYK; ADHEr, ASPT, MDH, PGL, PYK; ADHEr, ASPT, LDHD, MDH, SUCOAS; ADHEr, ASPT, FUM, LDHD, MDH; ADHEr, ASPT, LDHD, MALS, MDH; ADHEr, ASPT, ICL, LDHD, MDH; ADHEr, FRD2, GLUDy, LDHD, PPCK; ADHEr, FRD2, LDHD, PPCK, THD2; ADHEr, ACKr, ATPS4r, LDHD, SUCD4; ADHEr, ACKr, ACS, PPC, PPCK; ADHEr, GLUDy, LDHD, PPC, PPCK; ADHEr, LDHD, PPC, PPCK, THD2; ADHEr, ASPT, ATPS4r, GLCpts, MDH; ADHEr, G6PDHy, MDH, NADH6, THD2; ADHEr, MDH, NADH6, PGL, THD2; ADHEr, ATPS4r, G6PDHy, GLCpts, MDH; ADHEr, ATPS4r, GLCpts, MDH, PGL; ADHEr, ACKr, LDHD, MDH, SUCD4.

[0585] Table 28 shows the reactions of corresponding genes to be knocked out of a host organism such as E. coli. The corresponding metabolite corresponding to abbreviations in Table 28 are shown in Table 29.

Table 28. Corresponding genes to be knocked out to prevent a particular reaction from occurring in E. coli.

Genes Encoding the Enzyme(s) Reaction Catalyzing Each Abbreviation Reaction Stoichiometry* Reaction& ACKr [c] : ac + atp <==> actp + adp (b3115 or b2296 or b1849) ACS [c]: ac +atp+ coa --> accoa + amp + ppi b4069 ACt6 ac[p] + h[p] <==> ac[c] + h[c] Non-gene associated b478 or bb0356 orb DHEr [c] etoh + nad <==> acald + h + nadh

[c] acald + coa + nad <==> accoa + h + nadh (b1241 or b0351) (b0116 and b0726 AKGD [c] akg + coa + nad --> co2 + nadh + succoa and b0727) ASNS2 [c] asp-L + atp + nh4 --> amp + asn-L + h + ppi b3744 ASPT [c] :asp-L --> fum + nh4 b4139

(((b3736 and b3737 and b3738) and (b3731 and b3732 and b3733 and b3734 and b3735)) adp[c] + (4) h[p] + pi[c] <==> atp[c] + (3) h[c] + or ((b3736 and ATPS4r h2o[c] b3737 and b3738) and (b3731 and b3732 and b3733 and b3734 and b3735) and b3739)) CBMK2 [c] atp + co2 + nh4 <==> adp + cbp + (2) h (b0521 or b0323 or b2874) EDA [c] :2ddg6p --> g3p + pyr b1850 ENO [c] 2pg <==> h2o + pep b2779 FBA [c] fdp <==> dhap + g3p (b2097 or b2925 or b1773) FBP [c] fdp + h2o --> f6p + pi (b4232 or b3925) for[p] + (2) h[c] + q8[c] --> co2[c] + h[p] + q8h2[c] ((b3892 and b3893 FDH2 for[p] + (2) h[c] + mqn8[c] --> co2[c] + h[p] + bb3894an 1475 mql8[c] and b1476))

[c] fum + mql8 --> mqn8 + succ (b4151 and b4152 FRD2 [c] 2dmmql8 + fum --> 2dmmq8 + succ b4153 and

FTHFD [c] :10fthf + h2o --> for + h + thf b1232 FUM [c]:fum+h2o<==>mal-L (b1612orb4122or b1611) G5SD [c] :glu5p + h + nadph --> glu5sa + nadp + pi b0243 G6PDHy [c] :g6p + nadp <==> 6pgl + h + nadph b1852 ((b2417 and bI101 and b2415 and b2416)or(bl817 and bl818 and GLCpts glc-D[p] + pep[c] --> g6p[c] + pyr[c] b1819 and b2415 and b2416)or (b2417 and b1621 and b2415 and b2416)) GLU5K [c] :atp + glu-L --> adp + glu5p b0242 GLUDy [c] : glu-L + h2o + nadp <==> akg + h + nadph + nh4 b1761 (b2904 and b2903 GLYCL [c] :gly + nad + thf --> co2 + mlthf + nadh + nh4 and b2905 and b0116) HEXI [c] :atp + glc-D --> adp + g6p + h b2388 ICL [c] :icit --> glx + succ b4015 LDH D [c] :lac-D + nad <==> h + nadh + pyr (b2133 or bl380) MALS [c] :accoa + glx + h2o --> coa + h + mal-L (b4014 or b2976) MDH [c] :mal-L + nad <==> h + nadh + oaa b3236 ME2 [c] :mal-L + nadp --> co2 + nadph + pyr b2463

MTHFC [c] h2o + methf <==> 10fthf + h b0529

[c] h + mqn8 + nadh --> mql8 + nad NADH12 [c]: h + nadh + q8 --> nad + q8h2 b1109 c]2dmq8 + h + nadh --> 2dmmql8 + nad (4) h[c] + nadh[c] + q8[c] --> (3) h[p] + nad[c] + (b2276 and b2277 q8h2[c] and b2278 and (4) h[c] + mqn8[c] + nadh[c] --> (3) h[p] + mql8[c] + b2279 and b2280 nad[c] and b2281 and NADH6 b2282 and b2283

2dmmq8[c] + (4) h[c] + nadh[c]--> 2dmmql8[c] + (3) 2285b22 a 86 h[p] + nad[c] andb2287 and b2288

) PFK [c] :atp + f6p --> adp + fdp + h (b3916 or b1723) (((b0902 and b0903) and b2579) or PFLi [c] coa + pyr --> accoa + for (b0902 and b0903) or (b0902 and b3114)or(b3951 and b3952)) PGDH [c]: 6pgc + nadp --> co2 + nadph + ru5p-D b2029 PGI [c] : g6p <==> f6p b4025 PGL [c] :6pgl + h2o --> 6pgc + h b0767 PGM [c] :2pg <==> 3pg (b3612 or b4395 or ____ ___ ___ ___ ___ ____ ___ ___ ___ ___ __ b0755)

PPC [c]: co2 + h2o + pep --> h + oaa + pi b3956 PPCK [c] :atp + oaa --> adp + co2 + pep b3403 PRO1z [c] : fad + pro-L --> lpyr5c + fadh2 + h 1014 PYK [c] :adp + h + pep --> atp + pyr b1854 or b1676) PYRt2 h[p] + pyr[p] <==> h[c] + pyr[c] Non-gene associated RPE [c] : ru5p-D <==> xu5p-D (b4301 or b3386) SO4t2 so4[e] <==> so4[p] (b0241 or b0929 or b 1377 or b2215) (b0721 and b0722 SUCD4 [c] :q8 + succ --> fum + q8h2 and b0723 and b0724) SUCOAS [c] :atp + coa + succ <==> adp + pi + succoa (b0728 and b0729) ((b2422 and b2425 and b2424 and atp[c] + h2o[c] + so4[p] --> adp[c] + h[c] + pi[c] + 2423)or(b0763 SULabc atp[c]hoc]o[p and b0764 and b0765)or(b2422 and b2424 and b2423 and b3917)) TAL [c] : g3p + s7p <==> e4p + f6p (b2464 or b0008) THD2 (2) h[p] + nadh[c] + nadp[c] --> (2) h[c] + nad[c] + (b1602 and b1603) nadph[c] I (b3962 or (b1602 THD5 [c] :nad + nadph --> nadh + nadp and b1603)) TPI [c] : dhap <==> g3p b3919

Table 29. Metabolite names corresponding to abbreviations used in Table 28.

Metabolite Abbreviation Metabolite Name 1Ofthf 10-Formyltetrahydrofolate 1pyr5e 1-Pyrroline-5-carboxylate 2ddg6p 2-Dehydro-3-deoxy-D-gluconate 6-phosphate 2dmmq8 2-Demethylmenaguinone 8 2dmmql8 2-Demethylmenaguinol 8 2pg D-Glycerate 2-phosphate 3pg 3-Phospho-D-glycerate 6pgc 6-Phospho-D-gluconate 6pgl 6-phospho-D-glucono-1,5-lactone ac Acetate acald Acetaldehyde accoa Acetyl-CoA actp Acetyl phosphate adp ADP akg -Oxoglutarate amp AMP asn-L L-Asparagine asp-L L-Aspartate atp ATP cbp Carbamoyl phosphate co2 C02 coa Coenzyme A dhap Dihydroxyacetone phosphate e4p D-Erythrose 4-phosphate etoh Ethanol f6p D-Fructose 6-phosphate fad Flavin adenine dinucleotide oxidized fadh2 Flavin adenine dinucleotide reduced fdp D-Fructose 1,6-bisphosphate for Formate fum Fumarate g3p Glyceraldehyde 3-phosphate g6p D-Glucose 6-phosphate glc-D D-Glucose glu5p L-Glutamate 5-phosphate glu5sa L-Glutamate 5-semialdehyde glu-L L-Glutamate glx Glyoxylate gly Glycine h H+ h2o H20 icit Isocitrate lac-D D-Lactate mal-L L-Malate methf 5,10-Methenyltetrahydrofolate mlthf 5,10-Methylenetetrahydrofolate mql8 Menaguinol 8 mqn8 Menaguinone 8 nad Nicotinamide adenine dinucleotide nadh Nicotinamide adenine dinucleotide - reduced nadp Nicotinamide adenine dinucleotide phosphate Nicotinamide adenine dinucleotide phosphate nadph reduced nh4 Ammonium oaa Oxaloacetate pep Phosphoenolpyruvate pi Phosphate ppi Diphosphate pro-L L-Proline pyr Pyruvate q8 Ubiquinone-8 q8h2 Ubiquinol-8 ru5p-D D-Ribulose 5-phosphate s7p Sedoheptulose 7-phosphate so4 Sulfate succ Succinate succoa Succinyl-CoA thf 5,6,7,8-Tetrahydrofolate xu5p-D D-Xylulose 5-phosphate

EXAMPLE XX Exemplary Pathways for Producing BDO

[0586] This example describes exemplary pathways to produce 4-hydroxybutanal (4 HBal) and/or BDO using a carboxylic acid reductase as a BDO pathway enzyme.

[0587] An exemplary pathway for production of BDO includes use of an NAD+ or NADP+ aryl-aldehyde dehydrogenase (E.C.: 1.2.1.29 and 1.2.1.30) to convert 4 hydroxybutyrate to 4-hydroxybutanal and an alcohol dehydrogenase to convert 4 hydroxybutanal to 1,4-butanediol. 4-Hydroxybutyrate can be derived from the tricarboxylic acid cycle intermediates succinyl-CoA and/or alpha-ketoglutarate as shown in Figure 58.

[0588] Aryl-Aldehyde Dehydrogenase (or Carboxylic Acid Reductase). An aryl aldehyde dehydrogenase, or equivalently a carboxylic acid reductase, can be found in Nocardia iowensis. Carboxylic acid reductase catalyzes the magnesium, ATP and NADPH dependent reduction of carboxylic acids to their corresponding aldehydes (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)) and is capable of catalyzing the conversion of 4-hydroxybutyrate to 4-hydroxybutanal. This enzyme, encoded by car, was cloned and functionally expressed in E. coli (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)). Expression of the npt gene product improved activity of the enzyme via post-transcriptional modification. The npt gene encodes a specific phosphopantetheine transferase (PPTase) that converts the inactive apo-enzyme to the active holo-enzyme. The natural substrate of this enzyme is vanillic acid, and the enzyme exhibits broad acceptance of aromatic and aliphatic substrates (Venkitasubramanian et al., in Biocatalysis in the Pharmaceuticaland Biotechnology Industires, ed. R.N. Patel, Chapter 15, pp. 425-440, CRC Press LLC, Boca Raton, FL. (2006)).

GenBank Gene name GI No. Accession No. Organism

car 40796035 AAR9168 1.1 Nocardia iowensis (sp. NRRL 5646) npt 114848891 ABI83656.1 Nocardia iowensis (sp. NRRL 5646)

[0589] Additional car and npt genes can be identified based on sequence homology.

GenBank Gene name GI No. Accession No. Organism fadD9 121638475 YP 978699.1 Mycobacterium bovis BCG BCG 2812c 121638674 YP 978898.1 Mycobacterium bovis BCG nfa20150 54023983 YP 118225.1 NocardiafarcinicaIFM 10152 nfa40540 54026024 YP 120266.1 NocardiafarcinicaIFM 10152 SGR_6790 182440583 YP001828302.1 Streptomyces griseus subsp. SG 9 -griseus NBRC 13350 SGR_665 182434458 YP001822177.1 Streptomyces griseus subsp. - griseus NBRC 13350 MSMEG_2956 YP_887275.1 YP_887275.1 Mycobac u smegmatis

MSMEG_5739 YP_889972.1 118469671 Mycobacterium smegmatis _______________________MC2 155

YP_886985.1 118471293 Mycobac u smegmatis MSMEG_2648

MAP1040c NP_959974.1 41407138 Mycobacterium avium subsp. paratuberculosisK-10 MAP2899c NP_961833.1 41408997 Mycobacterium avium subsp. paratuberculosisK-10 MMAR_2117 YP00185042 183982131 Mycobacterium marinum M 2.1 MMAR_2936 YP00185123 183982939 Mycobacterium marinum M 0.1 MMAR 1916 YP 00185022 183981929_ Mycobacterium marinumM

0.1 TpauDRAFT 33 ZP_04027864 227980601 Tsukamurella paurometabola 060 .1 DSM 20162 TpauDRAFT 20 ZP_04026660 ZP_04026660.1 Tsukamurella paurometabola 920 .1 DSM 20162 CPCC7001_1320 4513250 254431429 Cyanobium PCC7001

DDBDRAFT_0187729 6- 66806417 Dictyostelium discoideum AX4 _ 931.1

[0590] An additional enzyme candidate found in Streptomyces griseus is encoded by the griC and griD genes. This enzyme is believed to convert 3-amino-4-hydroxybenzoic acid to 3-amino-4-hydroxybenzaldehyde as deletion of either griC or griD led to accumulation of extracellular 3-acetylamino-4-hydroxybenzoic acid, a shunt product of 3-amino-4 hydroxybenzoic acid metabolism (Suzuki, et al., J. Antibiot. 60(6):380-387 (2007)). Co expression of griC and griD with SGR_665, an enzyme similar in sequence to the Nocardia iowensis npt, can be beneficial.

Gene GINo GenBank Organism name Accession No. YP_001825755.1 Streptomyces griseus subsp. griC 182438036 griseusNBRC 13350

182438037 YP_001825756.1 Streptomyces griseus subsp. griD griseusNBRC 13350 I 1 3 -

[0591] An enzyme with similar characteristics, alpha-aminoadipate reductase (AAR, EC 1.2.1.31), participates in lysine biosynthesis pathways in some fungal species. This enzyme naturally reduces alpha-aminoadipate to alpha-aminoadipate semialdehyde. The carboxyl group is first activated through the ATP-dependent formation of an adenylate that is then reduced by NAD(P)H to yield the aldehyde and AMP. Like CAR, this enzyme utilizes magnesium and requires activation by a PPTase. Enzyme candidates for AAR and its corresponding PPTase are found in Saccharomyces cerevisiae (Morris et al., Gene 98:141 145 (1991)), Candidaalbicans (Guo et al., Mol. Genet. Genomics 269:271-279 (2003)), and Schizosaccharomycespombe (Ford et al., Curr. Genet. 28:131-137 (1995)). The AAR from S. pombe exhibited significant activity when expressed in E. coli (Guo et al., Yeast 21:1279 1288 (2004)). The AAR from Penicillium chrysogenum accepts S-carboxymethyl-L-cysteine as an alternate substrate, but did not react with adipate, L-glutamate or diaminopimelate (Hijarrubia et al., J. Biol. Chem. 278:8250-8256 (2003)). The gene encoding the P. chrysogenum PPTase has not been identified to date.

GenBank Gene name GI No. Accession No. Organism L YS2 171867 AAA34747.1 Saccharomyces cerevisiae L YS5 1708896 P50113.1 Saccharomyces cerevisiae LYS2 2853226 AAC02241.1 Candida albicans LYS5 28136195 AA026020.1 Candida albicans LysIp 13124791 P40976.3 Schizosaccharomycespombe Lys7p 1723561 Q10474.1 Schizosaccharomycespombe Lys2 3282044 CAA74300.1 Penicillium chrysogenum

[0592] There are several advantages of using carboxylic acid reductase for BDO p.roduction. There are at least two advantages of forming 4-hydroxybutanal from 4 hydroxybutyrate via a carboxylic acid reductase compared to forming 4-hydroxybutanal from an activated version of 4-hydroxybutyrate (for example, 4-hydroxybutyryl-CoA, 4 hydroxybutyryl-Pi) via an acyl-CoA or acyl-phosphate reductase. First, the formation of gamma-butyrolactone (GBL) as a byproduct is greatly reduced. It is believed that the activated versions of 4-hydroxybutyrate cyclize to GBL more readily than unactivated 4 hydroxybutyrate. The use of carboxylic acid reductase eliminates the need to pass through a free activated 4-hydroxybutyrate intermediate, thus reducing the formation of GBL as a byproduct accompanying BDO production. Second, the formation of ethanol as a byproduct is greatly reduced. Ethanol is often formed in varying amounts when an aldehyde- or an alcohol-forming 4-hydroxybutyryl-CoA reductase is used to convert 4-hydroxybutyryl-CoA to 4-hydroxybutanal or 1,4-butanediol, respectively. This is because most, if not all, aldehyde- or alcohol-forming 4-hydroxybutyryl-CoA reductases can accept acetyl-CoA as a substrate in addition to 4-hydroxybutyryl-CoA. Aldehyde-forming enzymes, for example, often catalyze the conversion of acetyl-CoA to acetaldehyde, which is subsequently reduced to ethanol by native or non-native alcohol dehydrogenases. Alcohol-forming 4 hydroxybutyryl-CoA reductases that accept acetyl-CoA as a substrate will convert acetyl CoA directly to ethanol. It appears that carboxylic acid reductase enzymes have far less activity on acetyl-CoA than aldehyde- or alcohol-forming acyl-CoA reductase enzymes, and thus their application for BDO production results in minimal ethanol byproduct formation (see below).

EXAMPLE XXI Biosynthesis of 1,4-Butanediol Using A Carboxylic Acid Reductase Enzyme

[0593] This example describes the generation of a microbial organism that produces 1,4 butanediol using a carboxylic acid reductase enzyme.

[0594] Escherichiacoli is used as a target organism to engineer the pathway for 1,4 butanediol synthesis described in Figure 58. E. coli provides a good host for generating a non-naturally occurring microorganism capable of producing 1,4-butanediol. E. coli is amenable to genetic manipulation and is known to be capable of producing various products, like ethanol, acetic acid, formic acid, lactic acid, and succinic acid, effectively under various oxygenation conditions.

[0595] Integration of 4-Hydroxybutyrate Pathway Genes into Chromosome: Construction of ECKh-432. _The carboxylic acid reductase enzyme was expressed in a strain of E. coli designated ECKh-432 whose construction is described in Example XVII. This strain contained the components of the BDO pathway, leading to 4HB, integrated into the chromosome of E. coli at thefimD locus.

[0596] As described in Example XVII, the succinate branch of the upstream pathway was integrated into the E. coli chromosome using theX red homologeous recombination method (Datsenko and Wanner, Proc. Nat. Acad. Sci. USA 97:6640-6645 (2000)). A polycistronic DNA fragment containing a promoter, the sucCD gene of Escherichiacoli encoding succinyl-CoA ligase, the sucD gene of Porphyromonasgingivalis encoding succinyl-CoA reductase (aldehyde forming) (step A of Figure 58), the 4hbd gene of Porphyromonas gingivalis encoding 4-hydroxybutyrate dehydrogenase (step C of Figure 58), and a terminator sequence was inserted into the AflIII site of the pKD3 plasmid.

[0597] As described in Example XVII, the alpha-ketoglutarate branch of the upstream pathway was integrated into the chromosome by homologeous recombination. The plasmid used in this modification was pRE118-V2 (pRE118 (ATCC87693) deleted of the oriT and IS sequences), which contains a kanamycin-resistant gene, a gene encoding the levansucrase (sacB) and a R6K conditional replication ori. The integration plasmid also contained a polycistronic sequence with a promoter, the sucA gene from Mycobacterium bovis encoding alpha-ketoglutarate decarboxylase (step B of Figure 58), the Clostridium kluyveri 4hbd gene encoding 4-hydroxybutyrate dehydrogenase (step C of Figure 58), and a terminator being inserted between two 1.5-kb DNA fragments that are homologous to the flanking regions of the target insertion site. The resulting plasmid was used to transform E. coli strain. The integration candidate was selected on plates containing kanamycin. The correct integration site was verified by PCR. To resolve the antibiotic marker from the chromosome, the cells were selected for growth on medium containing sucrose. The final strain was verified by PCR and DNA sequencing.

[0598] The recipient E. coli strain was ECKh-422 (AadhE AldhA ApflB

AlpdA::K.p.lpdA322 Amdh AarcA gltAR163L) whose construction is described in Example XV. ECKh-422 contains a mutation gltAR163L leading to NADH-insensitivity of citrate synthase encoded by gltA. It further contains an NADH-insensitive version of the lpdA gene from Klebsiella pneumonia integrated into the chromosome as described below.

[0599] Replacement of the native lpdA was replaced with a NADH-insensitive lpdA from Klebsiella pneumonie, as described in Example XIV. The resulting vector was designated pRE118-V2 (see Figure 34).]

[0600] Cloning and Expression of Carboxylic Acid Reductase and PPTase. To generate an E. coli strain engineered to produce 1,4-butanediol, nucleic acids encoding a carboxylic acid reductase and phosphopantetheine transferase are expressed in E. coli using well known molecular biology techniques (see, for example, Sambrook, supra, 2001; Ausubel supra, 1999). In particular, the car (AAR91681.1) and npt (ABI83656.1) genes were cloned into the pZS*13 vector (Expressys, Ruelzheim, Germany) under the PA1/lacO promoter. The car gene (GNM_720) was cloned by PCR from Nocardia genomic DNA. Its nucleic acid and protein sequences are shown in Figures 59A and 59B, respectively.

[0601] A codon-optimized version of the npt gene (GNM_721) was synthesized by GeneArt (Regensburg, Germany). Its nucleic acid and protein sequences are shown in Figures 60A and 60B, respectively. The resulting vector from cloning GNM_720 and GNM_721 into pZS*13 is shown in Figure 61.

[0602] The plasmid was transformed into ECKh-432 to express the proteins and enzymes required for 1,4-butanediol production. Alternate versions of the plasmid containing only GNM_720 and only GNM_721 were also constructed.

[0603] Demonstration of 1,4-BDO Production using Carboxylic Acid Reductase. Functional expression of the 1,4-butanediol pathway was demonstrated using E. coli whole cell culture. A single colony of E. coli ECKh-432 transformed with the pZS*13 plasmid containing both GNM_720 and GNM_721 was inoculated into 5 mL of LB medium containing appropriate antibiotics. Similarly, single colonies of E. coli ECKh-432 transformed with the pZS*13 plasmids containing either GNM_720 or GNM_721 were inoculated into additional 5 mL aliquots of LB medium containing appropriate antibiotics. Ten mL micro-aerobic cultures were started by inoculating fresh minimal in vivo conversion medium (see below) containing the appropriate antibiotics with 1% of the first cultures.

[0604] Recipe of the minimal in vivo conversion medium (for 1000 mL) is as follows:

final concentration 1M MOPS/KOH buffer 40 mM Glucose (40%) 1% 1OXM9 salts solution iX MgSO4 (1 M) 1 mM trace minerals (x1000) 1x 1M NaHCO3 10 mM

[0605] Microaerobic conditions were established by initially flushing capped anaerobic bottles with nitrogen for 5 minutes, then piercing the septum with an 18G needle following inoculation. The needle was kept in the bottle during growth to allow a small amount of air to enter the bottles. Protein expression was induced with 0.2 mM IPTG when the culture reached mid-log growth phase. This is considered: time = 0 hr. The culture supernatants were analyzed for BDO, 4HB, and other by-products as described above and in W02008115840 (see Table 30).

Table 30. Production of BDO, 4-HB and other products in various strains.

mM tD.:M...::3S:: OD600 OD600 PA SA LA 4HB BDO GBL ETO _

ECKh-432 720 0.420 2.221 6.36 0.00 0.10 7.71 3.03 0.07 >LLOQ ECKh-432 721 0.323 2.574 1.69 0.00 0.00 12.60 0.00 0.00 >LLOQ ECKh-432 720/721 0.378 2.469 1.70 0.00 0.01 4.23 9.16 0.24 1.52

PA = pyruvate, SA = succinate, LA = lactate, 4HB = 4-hydroxybutyrate, BDO= 1,4 butanediol, GBL = gamma-butyrolactone, Etoh = ethanol, LLOQ = lower limit of quantification

[0606] These results demonstrate that the carboxylic acid reductase gene, GNM_720, is required for BDO formation in ECKh-432 and its effectiveness is increased when co expressed with the PPTase, GNM_721. GBL and ethanol were produced in far smaller quantities than BDO in the strains expressing GNM_720 by itself or in combination with GNM_721.

[0607] Additional Pathways to BDO Employing Carboxylic Acid Reductase. It is expected that carboxylic acid reductase can function as a component of many pathways to 1,4-butanediol from the TCA cycle metabolites: succinate, succinyl-CoA, and alpha ketoglutarate. Several of these pathways are disclosed in Figure 62. All routes can lead to theoretical BDO yields greater than or equal to 1 mol/mol assuming glucose as the carbon source. Similar high theoretical yields can be obtained from additional substrates including sucrose, xylose, arabinose, synthesis gas, among many others. It is expected that the expression of carboxylic acid reductase alone or in combination with PPTase (that is, to catalyze steps F and D of Figure 62) is sufficient for 1,4-butanediol production from succinate provided that sufficient endogenous alcohol dehydrogenase activity is present to catalyze steps C and E of Figure 62. Candidate enzymes for steps A through Z of Figure 62 are described in section XXIII.

EXAMPLE XXII Pathways to Putrescine that Employ Carboxylic Acid Reductase

[0608] This example describes exemplary putrescine pathways utilizing carboxylic acid reductase.

[0609] Putrescine, also known as 1,4-diaminobutane or butanediamine, is an organic chemical compound of the formula NH 2(CH 2) 4NH 2 .It can be reacted with adipic acid to yield the polyamide Nylon-4,6, which is marketed by DSM (Heerlen, Netherlands) under the trade name Stanyl TM. Putrescine is naturally produced, for example, by the natural breakdown of amino acids in living and dead organisms. E. coli has been engineered to produce putrescine by overexpressing the native ornithine biosynthetic machinery as well as an ornithine decarboxylase (Qian, et al., Biotechnol. Bioeng. 104(4):651-662 (2009)).

[0610] Figure 63 describes a number of additional biosynthetic pathways leading to the production of putrescine from succinate, succinyl-CoA, or alpha-ketoglutarate and employing a carboxylic acid reductase. Note that none of these pathways require formation of an activated version of 4-aminobutyrate such as 4-aminobutyryl-CoA, which can be reduced by an acyl-CoA reductase to 4-aminobutanal but also can readily cyclize to its lactam, 2 pyrrolidinone (Ohsugi, et al., J. Biol. Chem. 256:7642-7651 (1981)). All routes can lead to theoretical putrescine yields greater than or equal to 1 mol/mol assuming glucose as the carbon source. Similar high theoretical yields can be obtained from additional substrates including sucrose, xylose, arabinose, synthesis gas, among many others. Candidate enzymes for steps A through U of Figure 63 are described in Example XXIII.

EXAMPLE XXIII Exemplary Enzymes for Production of C4 Compounds

[0611] This example describes exemplary enzymes for production of C4 compounds such as 1,4-butanediol, 4-hydroxybutanal and putrescine.

[0612] Enzyme classes. All transformations depicted in Figures 58, 62 and 63 fall into the general categories of transformations shown in Table 31. This example describes a number of biochemically characterized genes in each category. Specifically listed are genes that can be applied to catalyze the appropriate transformations in Figures 58, 62 and 63 when cloned and expressed. The first three digits of each label correspond to the first three Enzyme Commission number digits which denote the general type of transformation independent of substrate specificity.

Table 31. Classes of Enzyme Transformations Depicted in Figures 58, 62 and 63.

LABEL FUNCTION 1.1.1.a Oxidoreductase (oxo to alcohol) 1.1.1.c Oxidoreductase (2 step, acyl-CoA to alcohol) 1.2.1.b Oxidoreductase (acyl-CoA to aldehyde) 1.2.1.c Oxidoreductase (2-oxo acid to acyl-CoA, decarboxylation) 1.2.1.d Oxidoreductase (phosphonate reductase) 1.2.1.e Acid reductase 1.4.1.a Oxidoreductase (aminating) 2.3.1.a Acyltransferase (transferring phosphate group to CoA) 2.6.1.a Aminotransferase 2.7.2.a Phosphotransferase (carboxy acceptor) 2.8.3.a CoA transferase 3.1.2.a CoA hydrolase 4.1.1.a Carboxy-lyase 6.2.1.a CoA synthetase 1.1.1.a

Oxidoreductase (oxo to alcohol)

[0613] Aldehyde to alcohol. Three transformations described in Figures 58, 62 and 63 involve the conversion of an aldehyde to alcohol. These are 4-hydroxybutyrate dehydrogenase (step C, Figures 58 and 62), 1,4-butanediol dehydrogenase (step E, Figures 58 and 62), and 5-hydroxy-2-pentanoic acid (step Y, Figure 62). Exemplary genes encoding enzymes that catalyze the conversion of an aldehyde to alcohol, that is, alcohol dehydrogenase or equivalently aldehyde reductase, include airA encoding a medium-chain alcohol dehydrogenase for C2-C14 (Tani et al. Appl. Environ. Microbiol. 66:5231-5235 (2000)), ADH2 from Saccharomyces cerevisiae (Atsumi et al. Nature 451:86-89 (2008)), yqhD from E. coli, which has preference for molecules longer than C(3) (Sulzenbacher et al. J. Mol. Biol. 342:489-502 (2004)), and bdh I and bdhII from C. acetobutylicum, which converts butyryaldehyde into butanol (Walter et al. J. Bacteriol. 174:7149-7158 (1992)). The protein sequences for each of exemplary gene products can be found using the following GenBank accession numbers:

Gene Accession No. GI No. Organism airA BAB12273.1 9967138 Acinetobacter sp. Strain M-1 ADH2 NP_014032.1 6323961 Saccharymyces cerevisiae yqhD NP417484.1 16130909 Escherichiacoli bdh I NP349892.1 15896543 Clostridium acetobutylicum bdhII NP_349891.1 15896542 Clostridium acetobutylicum

[0614] Enzymes exhibiting 4-hydroxybutyrate dehydrogenase activity (EC 1.1.1.61) also fall into this category. Such enzymes have been characterized in Ralstonia eutropha (Bravo et al. J. ForensicSci. 49:379-387 (2004)), Clostridium kuyveri (Wolff et al., ProteinExpr. Purif 6:206-212 (1995)) and Arabidopsisthaliana(Breitkreuz et al. J. Biol. Chem. 278:41552-41556 (2003)).

Gene Accession No. GI No. Organism 4hbd YP726053.1 113867564 Ralstonia eutropha H16 4hbd EDK35022.1 146348486 Clostridium k/uyveri DSM 555 4hbd Q94B07 75249805 Arabidopsis thaliana

[0615] The adhi gene from Geobacillus thermoglucosidasiusM1OEXG (Jeon et al., J. Biotechnol. 135:127-133 (2008)) was shown to exhibit high activity on both 4- hydroxybutanal and butanal (see above). Thus this enzyme exhibits 1,4-butanediol dehydrogenase activity.

Gene Accession No. GI No. Organism adh1 AAR91477.1 40795502 Geobacillus thermoglucosidasiusM1OEXG

[0616] Another exemplary enzyme is 3-hydroxyisobutyrate dehydrogenase, which catalyzes the reversible oxidation of 3-hydroxyisobutyrate to methylmalonate semialdehyde. This enzyme participates in valine, leucine and isoleucine degradation and has been identified in bacteria, eukaryotes, and mammals. The enzyme encoded by P84067 from Thermus thermophilus HB8 has been structurally characterized (Lokanath et al. J. Mol. Biol. 352:905 17 (2005)). The reversibility of the human 3-hydroxyisobutyrate dehydrogenase was demonstrated using isotopically-labeled substrate (Manning et al., Biochem. J. 231:481-484 (1985)). Additional genes encoding this enzyme include 3hidh in Homo sapiens (Hawes et al., Methods Enzymol. 324:218-228 (2000)) and Oryctolagus cuniculus (Chowdhury et al., Biosci. Biotechnol. Biochem. 60:2043-2047 (1996); Hawes et al. Methods Enzymol. 324:218 228 (2000)), mmsb in Pseudomonas aeruginosa,and dhat in Pseudomonasputida (Aberhart et al., J. Chem. Soc. [Perkin 1] 6:1404-1406 (1979); Chowdhury et al., Biosci. Biotechnol Biochem. 67:438-441 (2003); Chowdhury et al., Biosci. Biotechnol. Biochem. 60:2043-2047 (1996)).

Gene Accession No. GI No. Organism P84067 P84067 75345323 Thermus thermophilus mmsb P28811.1 127211 Pseudomonas aeruginosa dhat Q59477.1 2842618 Pseudomonasputida 3hidh P31937.2 12643395 Homo sapiens 3hidh P32185.1 416872 Oryctolagus cuniculus

[0617] Several 3-hydroxyisobutyrate dehydrogenase enzymes have also been shown to convert malonic semialdehyde to 3-hydroxyproprionic acid (3-HP). Three gene candidates exhibiting this activity are mmsB from Pseudomonas aeruginosaPAO1(62), mmsB from Pseudomonasputida KT2440 (Liao et al., US Publication 2005/0221466) and mmsB from Pseudomonasputida E23 (Chowdhury et al., Biosci. Biotechnol. Biochem. 60:2043-2047 (1996)). An enzyme with 3-hydroxybutyrate dehydrogenase activity in Alcaligenesfaecalis M3A has also been identified (Gokam et al., US Patent No. 7,393,676; Liao et al., US

Publication No. 2005/0221466). Additional gene candidates from other organisms including Rhodobacter spaeroidescan be inferred by sequence similarity.

Gene Accession No. GI No. Organism mmsB AAA25892.1 151363 Pseudomonasaeruginosa mmsB NP_252259.1 15598765 Pseudomonasaeruginosa PAO1 mmsB NP_746775.1 26991350 Pseudomonasputida KT2440 mmsB JC7926 60729613 Pseudomonasputida E23 orfBI AAL26884 16588720 Rhodobacter spaeroides

[0618] The conversion of malonic semialdehyde to 3-HP can also be accomplished by two other enzymes, NADH-dependent 3-hydroxypropionate dehydrogenase and NADPH dependent malonate semialdehyde reductase. An NADH-dependent 3-hydroxypropionate dehydrogenase is thought to participate in beta-alanine biosynthesis pathways from propionate in bacteria and plants (Rathinasabapathi, J PlantPathol. 159:671-674 (2002); Stadtman, J. Am. Chem. Soc. 77:5765-5766 (1955)). This enzyme has not been associated with a gene in any organism to date. NADPH-dependent malonate semialdehyde reductase catalyzes the reverse reaction in autotrophic C02 -fixing bacteria. Although the enzyme activity has been detected in Metallosphaerasedula, the identity of the gene is not known (Alber et al. J. Bacteriol. 188:8551-8559 (2006)).

1.1.1.c Oxidoreductase (2 step, acyl-CoA to alcohol).

[0619] Steps S and W of Figure 62 depict bifunctional reductase enzymes that can form 4-hydroxybutyrate and 1,4-butanediol, respectively. Exemplary 2-step oxidoreductases that convert an acyl-CoA to alcohol include those that transform substrates such as acetyl-CoA to ethanol (for example, adhE from E. coli (Kessler et al., FEBS. Lett. 281:59-63 (1991)) and butyryl-CoA to butanol (for example, adhE2 from C. acetobutylicum (Fontaine et al., J.Bacteriol. 184:821-830 (2002)). The C. acetobutylicum adhE2 gene was shown to convert 4-hydroxybutyryl-CoA to 1,4-butanediol (see above). In addition to reducing acetyl-CoA to ethanol, the enzyme encoded by adhE in Leuconostoc mesenteroides has been shown to oxidize the branched chain compound isobutyraldehyde to isobutyryl-CoA (Kazahaya et al. J., Gen. Appl. Microbiol. 18:43-55 (1972); Koo et al., Biotechnol. Lett. 27:505-510 (2005)).

Gene Accession No. GI No. Organism adhE NP_415757.1 16129202 Escherichiacoli adhE2 AAK09379.1 12958626 Clostridium acetobutylicum adhE AAV66076.1 55818563 Leuconostoc mesenteroides

[0620] Another exemplary enzyme can convert malonyl-CoA to 3-HP. An NADPH dependent enzyme with this activity has characterized in Chloroflexus aurantiacus,where it participates in the 3-hydroxypropionate cycle (Hugler et al., J. Bacteriol. 184:2404-2410 (2002); Strauss and Fuchs, Eur. J. Biochem. 215:633-643 (1993)). This enzyme, with a mass of 300 kDa, is highly substrate-specific and shows little sequence similarity to other known oxidoreductases (Hugler et al., J. Bacteriol. 184:2404-2410 (2002)). No enzymes in other organisms have been shown to catalyze this specific reaction; however there is bioinformatic evidence that other organisms may have similar pathways (Klatt et al., Environ. Microbiol. 9:2067-2078 (2007)). Enzyme candidates in other organisms including Roseiflexus castenholzii, Erythrobactersp. NAP] and marine gamma proteobacterium HTCC2080 can be inferred by sequence similarity.

Gene Accession No. GI No. Organism mcr AAS20429.1 42561982 Chloroflexus aurantiacus Rcas_2929 YP_001433009.1 156742880 Roseiflexus castenholzii NAP]_02720 ZP_01039179.1 85708113 Erythrobactersp. NAP] MGP2080_00535 ZP_01626393.1 119504313 marine gamma proteobacterium HTCC2080

[0621] Longer chain acyl-CoA molecules can be reduced by enzymes such as the jojoba (Simmondsia chinensis) FAR, which encodes an alcohol-forming fatty acyl-CoA reductase. Its overexpression in E. coli resulted in FAR activity and the accumulation of fatty alcohol (Metz et al., PlantPhysiol. 122:635-644 2000)).

Gene Accession No. GI No. Organism FAR AAD38039.1 5020215 Simmondsia chinensis

1.2.1.b Oxidoreductase (acyl-CoA to aldehyde).

[0622] Step A of Figures 58, 62 and 63 involves the conversion of succinyl-CoA to succinate semialdehyde by an aldehyde forming succinyl-CoA reductase. Step Q of Figure 62 depicts the conversion of 4-hydroxybutyryl-CoA to 4-hydroxybutanal by an aldehyde forming 4-hydroxybutyryl-CoA reductase. Several acyl-CoA dehydrogenases are capable of reducing an acyl-CoA to its corresponding aldehyde. Exemplary genes that encode such enzymes include the Acinetobacter calcoaceticusacr1 encoding a fatty acyl-CoA reductase

(Reiser and Somerville, J. Bacteriol. 179:2969-2975 (1997)), the Acinetobacter sp. M-1 fatty acyl-CoA reductase (Ishige et al., Appl. Environ. Microbiol. 68:1192-1195 (2002)), and a CoA- and NADP- dependent succinate semialdehyde dehydrogenase encoded by the sucD gene in Clostridium kluyveri (Sohling and Gottschalk, J. Bacteriol. 178:871-80 (1996); Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996)). SucD of P. gingivalis is another aldehyde-forming succinyl-CoA reductase (Takahashi et al., J.Bacteriol. 182:4704-4710 (2000)). The enzyme acylating acetaldehyde dehydrogenase in Pseudomonas sp, encoded by bphG, is yet another as it has been demonstrated to oxidize and acylate acetaldehyde, propionaldehyde, butyraldehyde, isobutyraldehyde and formaldehyde (Powlowski et al., J. Bacteriol. 175:377-385 (1993)). In addition to reducing acetyl-CoA to ethanol, the enzyme encoded by adhE in Leuconostoc mesenteroides has been shown to oxidize the branched chain compound isobutyraldehyde to isobutyryl-CoA (Koo et al., Biotechnol. Lett. 27:505 510 (2005)). Butyraldehyde dehydrogenase catalyzes a similar reaction, conversion of butyryl-CoA to butyraldehyde, in solventogenic organisms such as Clostridium saccharoperbutylacetonicum(Kosaka et al., Biosci. Biotechnol. Biochem. 71:58-68 (2007)).

Gene Accession No. GI No. Organism

acr1 YP_047869.1 50086359 Acinetobactercalcoaceticus acri AAC45217 1684886 Acinetobacter baylyi acr1 BAB85476.1 18857901 Acinetobacter sp. Strain M-1 sucD P38947.1 730847 Clostridium kluyveri sucD NP_904963.1 34540484 Porphyromonasgingivalis bphG BAA03892.1 425213 Pseudomonas sp adhE AAV66076.1 55818563 Leuconostoc mesenteroides bid AAP42563.1 31075383 Clostridium saccharoperbutylacetonicum

[0623] An additional enzyme type that converts an acyl-CoA to its corresponding aldehyde is malonyl-CoA reductase, which transforms malonyl-CoA to malonic semialdehyde. Malonyl-CoA reductase is a key enzyme in autotrophic carbon fixation via the 3-hydroxypropionate cycle in thermoacidophilic archael bacteria (Berg et al., Science 318:1782-1786 (2007); Thauer, Science 318:1732-1733 (2007)). The enzyme utilizes NADPH as a cofactor and has been characterized in Metallosphaeraand Sulfolobus spp (Alber et al., J. Bacteriol. 188:8551-8559 (2006); Hugler et al., J. Bacteriol. 184:2404-2410 (2002)). The enzyme is encoded by Msed_0709 in Metallosphaerasedula (Alber et al., J

Bacteriol. 188:8551-8559 (2006); Berg et al., Science 318:1782-1786 (2007)). A gene encoding a malonyl-CoA reductase from Sulfolobus tokodaii was cloned and heterologously expressed in E. coli (Alber et al., J. Bacteriol. 188:8551-8559 (2006)). Although the aldehyde dehydrogenase functionality of these enzymes is similar to the bifunctional dehydrogenase from Chloroflexus aurantiacus,there is little sequence similarity. Both malonyl-CoA reductase enzyme candidates have high sequence similarity to aspartate semialdehyde dehydrogenase, an enzyme catalyzing the reduction and concurrent dephosphorylation of aspartyl-4-phosphate to aspartate semialdehyde. Additional gene candidates can be found by sequence homology to proteins in other organisms including Sulfolobus solfataricusand Sulfolobus acidocaldarius. Yet another candidate for CoA acylating aldehyde dehydrogenase is the aid gene from Clostridium bejerinckii(Toth et al., Appl. Environ.Microbiol. 65:4973-4980 (1999)). This enzyme has been reported to reduce acetyl-CoA and butyryl-CoA to their corresponding aldehydes. This gene is very similar to eutE that encodes acetaldehyde dehydrogenase of Salmonella typhimurium and E. coli (Toth et al., Appl. Environ. Microbiol. 65:4973-4980 (1999)).

Gene Accession No. GI No. Organism

Msed_0709 YP_001190808.1 146303492 Metallosphaerasedula mcr NP_378167.1 15922498 Sulfolobus tokodaii asd-2 NP_343563.1 15898958 Sulfolobus solfataricus Saci_2370 YP_256941.1 70608071 Sulfolobus acidocaldarius Ald AAT66436 49473535 Clostridium beijerinckii eutE AAA80209 687645 Salmonella typhimurium eutE P77445 2498347 Escherichiacoli

1.2.1.c Oxidoreductase (2-oxo acid to acyl-CoA, decarboxylation).

[0624] Step AA in Figure 62 depicts the conversion of 5-hydroxy-2-oxopentanoic acid to 4-hydroxybutyryl-CoA. Candidate enzymes for this transformation include 1) branched-chain 2-keto-acid dehydrogenase, 2) alpha-ketoglutarate dehydrogenase, and 3) the pyruvate dehydrogenase multienzyme complex (PDHC). These enzymes are multi-enzyme complexes that catalyze a series of partial reactions which result in acylating oxidative decarboxylation of 2-keto-acids. Each of the 2-keto-acid dehydrogenase complexes occupies key positions in intermediary metabolism, and enzyme activity is typically tightly regulated (Fries et al. Biochemistry 42:6996-7002 (2003)). The enzymes share a complex but common structure composed of multiple copies of three catalytic components: alpha-ketoacid decarboxylase

(E1), dihydrolipoamide acyltransferase (E2) and dihydrolipoamide dehydrogenase (E3). The E3 component is shared among all 2-keto-acid dehydrogenase complexes in an organism, while the El and E2 components are encoded by different genes. The enzyme components are present in numerous copies in the complex and utilize multiple cofactors to catalyze a directed sequence of reactions via substrate channeling. The overall size of these dehydrogenase complexes is very large, with molecular masses between 4 and 10 million Da (that is, larger than a ribosome).

[0625] Activity of enzymes in the 2-keto-acid dehydrogenase family is normally low or limited under anaerobic conditions in E. coli. Increased production of NADH (or NADPH) could lead to a redox-imbalance, and NADH itself serves as an inhibitor to enzyme function. Engineering efforts have increased the anaerobic activity of the E. coli pyruvate dehydrogenase complex (Kim et al. Appl.Environ.Microbiol. 73:1766-1771 (2007); Kim et al. J.Bacteriol. 190:3851-3858 ) 2008); Zhou et al. Biotechnol.Lett. 30:335-342 (2008)). For example, the inhibitory effect of NADH can be overcome by engineering an H322Y mutation in the E3 component (Kim et al. J.Bacteriol. 190:3851-3858 (2008)). Structural studies of individual components and how they work together in complex provide insight into the catalytic mechanisms and architecture of enzymes in this family (Aevarsson et al. Nat.Struct.Biol. 6:785-792 (1999); Zhou et al. Proc.Natl.Acad.Sci.U.S.A. 98:14802-14807 (2001)). The substrate specificity of the dehydrogenase complexes varies in different organisms, but generally branched-chain keto-acid dehydrogenases have the broadest substrate range.

[0626] Alpha-ketoglutarate dehydrogenase (AKGD) converts alpha-ketoglutarate to succinyl-CoA and is the primary site of control of metabolic flux through the TCA cycle (Hansford, R. G. Curr.Top.Bioenerg. 10:217-278 (1980)). Encoded by genes sucA, sucB and lpd in E. coli, AKGD gene expression is downregulated under anaerobic conditions and during growth on glucose (Park et al. Mol.Microbiol. 15:473-482 (1995)). Although the substrate range of AKGD is narrow, structural studies of the catalytic core of the E2 component pinpoint specific residues responsible for substrate specificity (Knapp et al. J.Mol.Biol. 280:655-668 (1998)). The Bacillus subtilis AKGD, encoded by odhAB (El and E2) and pdhD (E3, shared domain), is regulated at the transcriptional level and is dependent on the carbon source and growth phase of the organism (Resnekov et al. Mol.Gen.Genet. 234:285-296 (1992)). In yeast, the LPD1 gene encoding the E3 component is regulated at the transcriptional level by glucose (Roy and Dawes J.Gen.Microbiol. 133:925-933 (1987)). The E l component, encoded by KGD1, is also regulated by glucose and activated by the products of HAP2 and HAP3 (Repetto and Tzagoloff Mol.Cell Biol. 9:2695-2705 (1989)). The AKGD enzyme complex, inhibited by products NADH and succinyl-CoA, is well studied in mammalian systems, as impaired function of has been linked to several neurological diseases (Tretter and dam-Vizi Philos.Trans.R.Soc.LondB Biol.Sci. 360:2335 2345 (2005)).

Gene Accession No. GI No. Organism sucA NP_415254.1 16128701 Escherichiacoli str. K12 substr. MG1655 sucB NP_415255.1 16128702 Escherichiacoli str. K12 substr. MG655 lpd NP_414658.1 16128109 Escherichiacoli str. K12 substr. MG1655 odhA P23129.2 51704265 Bacillus subtilis odhB P16263.1 129041 Bacillus subtilis pdhD P21880.1 118672 Bacillus subtilis KGDI NP_012141.1 6322066 Saccharomyces cerevisiae KGD2 NP_010432.1 6320352 Saccharomyces cerevisiae LPD1 NP_116635.1 14318501 Saccharomyces cerevisiae

[0627] Branched-chain 2-keto-acid dehydrogenase complex (BCKAD), also known as 2 oxoisovalerate dehydrogenase, participates in branched-chain amino acid degradation pathways, converting 2-keto acids derivatives of valine, leucine and isoleucine to their acyl CoA derivatives and CO 2 . The complex has been studied in many organisms including Bacillus subtilis (Wang et al. Eur.J.Biochem. 213:1091-1099 (1993)), Rattus norvegicus (Namba et al. J.Biol.Chem. 244:4437-4447 (1969)) and Pseudomonasputida (Sokatch J.Bacteriol. 148:647-652 (1981)). In Bacillus subtilis the enzyme is encoded by genes pdhD (E3 component), bfmBB (E2 component), bfmBAA and bfmBAB (El component) (Wang et al. Eur.J.Biochem. 213:1091-1099 (1993)). In mammals, the complex is regulated by phosphorylation by specific phosphatases and protein kinases. The complex has been studied in rat hepatocites (Chicco et al. J.Biol.Chem. 269:19427-19434 (1994)) and is encoded by genes Bckdha (E l alpha), Bckdhb (E l beta), Dbt (E2), and Dld (E3). The E l and E3 components of the Pseudomonasputida BCKAD complex have been crystallized (Aevarsson et al. Nat.Struct.Biol. 6:785-792 (1999); Mattevi Science 255:1544-1550 (1992)) and the enzyme complex has been studied (Sokatch et al. J.Bacteriol. 148:647-652 (1981)). Transcription of the P. putida BCKAD genes is activated by the gene product of bkdR (Hester et al. Eur.J.Biochem. 233:828-836 (1995)). In some organisms including Rattus norvegicus (Paxton et al. Biochem.J. 234:295-303 (1986)) and Saccharomyces cerevisiae (Sinclair et al. Biochem.Mol.Biol.Int. 31:911-922 (1993)), this complex has been shown to have a broad substrate range that includes linear oxo-acids such as 2-oxobutanoate and alpha ketoglutarate, in addition to the branched-chain amino acid precursors. The active site of the bovine BCKAD was engineered to favor alternate substrate acetyl-CoA (Meng and Chuang, Biochemistry 33:12879-12885 (1994)).

Gene Accession No. GI No. Organism bfmBB NP_390283.1 16079459 Bacillus subtilis bfmBAA NP_390285.1 16079461 Bacillus subtilis bfmBAB NP_390284.1 16079460 Bacillus subtilis pdhD P21880.1 118672 Bacillus subtilis lpdV P09063.1 118677 Pseudomonasputida bkdB P09062.1 129044 Pseudomonasputida bkdAl NP_746515.1 26991090 Pseudomonasputida bkdA2 NP_746516.1 26991091 Pseudomonasputida Bckdha NP_036914.1 77736548 Rattus norvegicus Bckdhb NP_062140.1 158749538 Rattus norvegicus Dbt NP_445764.1 158749632 Rattus norvegicus Dld NP_955417.1 40786469 Rattus norvegicus

[0628] The pyruvate dehydrogenase complex, catalyzing the conversion of pyruvate to acetyl-CoA, has also been extensively studied. In the E. coli enzyme, specific residues in the El component are responsible for substrate specificity (Bisswanger, H. JBiol Chem. 256:815-822 (1981); Bremer, J. Eur.JBiochem. 8:535-540 (1969); Gong et al. JBiol Chem. 275:13645-13653 (2000)). As mentioned previously, enzyme engineering efforts have improved the E. coli PDH enzyme activity under anaerobic conditions (Kim et al. Appl.Environ.Microbiol. 73:1766-1771 (2007); Kim J.Bacteriol. 190:3851-3858 (2008); Zhou et al. Biotechnol.Lett. 30:335-342 (2008)). In contrast to the E. coli PDH, the B. subtilis complex is active and required for growth under anaerobic conditions (Nakano J.Bacteriol. 179:6749-6755 (1997)). The Klebsiellapneumoniae PDH, characterized during growth on glycerol, is also active under anaerobic conditions (Menzel et al. J.Biotechnol. 56:135-142 (1997)). Crystal structures of the enzyme complex from bovine kidney (Zhou et al. Proc.Natl.Acad.Sci.US.A. 98:14802-14807 (2001)) and the E2 catalytic domain from Azotobacter vinelandii are available (Mattevi et al. Science 255:1544-1550 (1992)). Some mammalian PDH enzymes complexes can react on alternate substrates such as 2 oxobutanoate, although comparative kinetics of Rattus norvegicus PDH and BCKAD indicate that BCKAD has higher activity on 2-oxobutanoate as a substrate (Paxton et al. Biochem.J. 234:295-303 (1986)).

Gene Accession No. GI No. Organism aceE NP_414656.1 16128107 Escherichiacoli str. K12 substr. MG1655 aceF NP_414657.1 16128108 Escherichiacoli str. K12 substr. MG1655 lpd NP_414658.1 16128109 Escherichiacoli str. K12 substr. MG1655 pdhA P2188 1.1 3123238 Bacillus subtilis pdhB P21882.1 129068 Bacillus subtilis pdhC P21883.2 129054 Bacillus subtilis pdhD P21880.1 118672 Bacillus subtilis aceE YP_001333808.1 152968699 Klebsiellapneumonia MGH78578 aceF YP_001333809.1 152968700 Klebsiellapneumonia MGH78578 lpdA YP_001333810.1 152968701 Klebsiellapneumonia MGH78578 Pdhal NP_001004072.2 124430510 Rattus norvegicus Pdha2 NP_446446.1 16758900 Rattus norvegicus Dat NP_112287.1 78365255 Rattus norvegicus Dld NP_955417.1 40786469 Rattus norvegicus

[0629] As an alternative to the large multienzyme 2-keto-acid dehydrogenase complexes described above, some anaerobic organisms utilize enzymes in the 2-ketoacid oxidoreductase family (OFOR) to catalyze acylating oxidative decarboxylation of 2-keto-acids. Unlike the dehydrogenase complexes, these enzymes contain iron-sulfur clusters, utilize different cofactors, and use ferredoxin or flavodixin as electron acceptors in lieu of NAD(P)H. While most enzymes in this family are specific to pyruvate as a substrate (POR) some 2-keto acid:ferredoxin oxidoreductases have been shown to accept a broad range of 2-ketoacids as substrates including alpha-ketoglutarate and 2-oxobutanoate (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2002); Zhang et al. JBiochem. 120:587-599 (1996)).

One such enzyme is the OFOR from the thermoacidophilic archaeon Sulfolobus tokodaii 7, which contains an alpha and beta subunit encoded by gene ST2300 (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2002); Zhang et al. J.Biochem. 120:587-599 (1996)). A plasmid-based expression system has been developed for efficiently expressing this protein in E. coli ( Fukuda et al. Eur.J.Biochem. 268:5639-5646 (2001)) and residues involved in substrate specificity were determined (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74 (2002)). Two OFORs from Aeropyrum pernix str. K1 have also been recently cloned into E. coli, characterized, and found to react with a broad range of 2-oxoacids (Nishizawa et al. FEBS Lett. 579:2319-2322 (2005)). The gene sequences of these OFOR candidates are available, although they do not have GenBank identifiers assigned to date. There is bioinformatic evidence that similar enzymes are present in all archaea, some anaerobic bacteria and amitochondrial eukarya (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2005)). This class of enzyme is also interesting from an energetic standpoint, as reduced ferredoxin could be used to generate NADH by ferredoxin-NAD reductase (Petitdemange et al. Biochim.Biophys.Acta 421:334-337 (1976)). Also, since most of the enzymes are designed to operate under anaerobic conditions, less enzyme engineering may be required relative to enzymes in the 2-keto-acid dehydrogenase complex family for activity in an anaerobic environment.

Gene Accession No. GI No. Organism ST2300 NP_378302.1 15922633 Sulfolobus tokodali 7

1.2.1.d Oxidoreductase (phosphonate reductase).

[0630] The conversion of 4-hydroxybutyryl-phosphate to 4-hydroxybutanal can be catalyzed by an oxidoreductase in the EC class 1.2.1. Aspartate semialdehyde dehydrogenase (ASD, EC 1.2.1.11) catalyzes the NADPH-dependent reduction of 4-aspartyl phosphate to aspartate-4-semialdehyde. ASD participates in amino acid biosynthesis and recently has been studied as an antimicrobial target (Hadfield et al., Biochemistry 40:14475-14483 (2001). The E. coli ASD structure has been solved (Hadfield et al.,. J. Mol. Biol. 289:991-1002 (1999)) and the enzyme has been shown to accept the alternate substrate beta-3-methylaspartyl phosphate (Shames et al., J. Biol. Chem. 259:15331-15339 (1984)). The Haemophilus influenzae enzyme has been the subject of enzyme engineering studies to alter substrate binding affinities at the active site (Blanco et al., Acta Crystallogr. D. Biol. Crystallogr. :1388-1395 (2004); Blanco et al., Acta Crystallogr. D. Biol. Crystallogr. 60:1808-1815

(2004)). Other ASD candidates are found in Mycobacterium tuberculosis (Shafiani et al., J Appl. Microbiol. 98:832-838 (2005), Methanococcusjannaschii(Faehnle et al.,. J. Mo. Biol. 353:1055-1068 (2005)), and the infectious microorganisms Vibrio cholera and Heliobacter pylori (Moore et al., ProteinExpr. Purif 25:189-194 (2002)). A related enzyme candidate is acetylglutamylphosphate reductase (EC 1.2.1.38), an enzyme that naturally reduces acetylglutamylphosphate to acetylglutamate-5-semialdehyde, found in S. cerevisiae (Pauwels et al., Eur. J. Biochem. 270:1014-1024 (2003), B. subtilis (O'Reilly and Devine, Microbiology 140 ( Pt 5):1023-1025 (1994)). and other organisms.

Gene Accession No. GI No. Organism

asd NP417891.1 16131307 Escherichiacoli asd YP248335.1 68249223 Haemophilus influenzae asd AAB49996 1899206 Mycobacterium tuberculosis VC2036 NP231670 15642038 Vibrio cholera asd YP002301787.1 210135348 Heliobacterpylori ARG5,6 NP010992.1 6320913 Saccharomycescerevisiae argC NP389001.1 16078184 Bacillus subtilis

[0631] Other exemplary enzymes in this class include glyceraldehyde 3-phosphate dehydrogenase which converts glyceraldehyde-3-phosphate into D-glycerate 1,3 bisphosphate (for example, E. coli gapA (Branlant and Branlant,. Eur. J. Biochem. 150:61-66 (1985)), N-acetyl-gamma-glutamyl-phosphate reductase which converts N-acetyl-L glutamate-5-semialdehyde into N-acetyl-L-glutamy-5-phosphate (for example, E. coli argC (Parsot et al., Gene 68:275-283 (1988)), and glutamate-5-semialdehyde dehydrogenase, which converts L-glutamate-5-semialdehyde into L-glutamyl-5-phospate (for example, E. coliproA (Smith et al., J Bacteriol. 157:545-551 (1984)). Genes encoding glutamate-5 semialdehyde dehydrogenase enzymes from Salmonella typhimurium (Mahan and Csonka, J. Bacteriol. 156:1249-1262 (1983)) and Campylobacterjejuni(Louie and Chan, Mo. Gen. Genet. 240:29-35 (1993)) were cloned and expressed in E. coli.

Gene Accession No. GI No. Organism gapA POA9B2.2 71159358 Escherichiacoli argC NP418393.1 16131796 Escherichiacoli proA NP414778.1 16128229 Escherichiacoli proA NP459319.1 16763704 Salmonella typhimurium proA P53000.2 9087222 Campylobacterjejuni

1.2.1.e Acid reductase.

[0632] Several steps in Figures 58, 62 and 63 depict the conversion of unactivated acids to aldehydes by an acid reductase. These include the conversion of 4-hydroxybutyrate, succinate, alpha-ketoglutarate, and 4-aminobutyrate to 4-hydroxybutanal, succinate semialdehyde, 2,5-dioxopentanoate, and 4-aminobutanal, respectively. One notable carboxylic acid reductase can be found in Nocardia iowensis which catalyzes the magnesium, ATP and NADPH-dependent reduction of carboxylic acids to their corresponding aldehydes (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)). This enzyme is encoded by the car gene and was cloned and functionally expressed in E. coli (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)). Expression of the npt gene product improved activity of the enzyme via post-transcriptional modification. The npt gene encodes a specific phosphopantetheine transferase (PPTase) that converts the inactive apo-enzyme to the active holo-enzyme. The natural substrate of this enzyme is vanillic acid, and the enzyme exhibits broad acceptance of aromatic and aliphatic substrates (Venkitasubramanian et al., in Biocatalysis in the Pharmaceuticaland Biotechnology Industires, ed. R.N. Patel, Chapter 15, pp. 425-440, CRC Press LLC, Boca Raton, FL. (2006)).

Accession No. GI No. Organism Gene

Nocardia iowensis (sp. NRRL car AAR91681.1 40796035 5646) Nocardia iowensis (sp. NRRL npt AB183656.1 114848891 5646)

[0633] Additional car and npt genes can be identified based on sequence homology.

Gene Accession No. GI No. Organism

fadD9 YP_978699.1 121638475 Mycobacterium bovis BCG BCG_2812c YP_978898.1 121638674 Mycobacterium bovis BCG nfa20150 YP_118225.1 54023983 NocardiafarcinicaIFM 10152 nfa40540 YP_120266.1 54026024 NocardiafarcinicaIFM 10152 Streptomyces griseus subsp. SGR_6790 YP_001828302.1 182440583 griseus NBRC 13350 Streptomyces griseus subsp. SGR_665 YP_001822177.1 182434458 griseus NBRC 13350

[0634] An additional enzyme candidate found in Streptomyces griseus is encoded by the griC and griD genes. This enzyme is believed to convert 3-amino-4-hydroxybenzoic acid to 3-amino-4-hydroxybenzaldehyde as deletion of either griC or griD led to accumulation of extracellular 3-acetylamino-4-hydroxybenzoic acid, a shunt product of 3-amino-4 hydroxybenzoic acid metabolism (Suzuki, et al., J. Antibiot. 60(6):380-387 (2007)). Co expression of griC and griD with SGR_665, an enzyme similar in sequence to the Nocardia iowensis npt, can be beneficial.

Gene Accession No. GI No. Organism

griC 182438036 YP_001825755.1 Streptomyces griseus subsp. griseus NBRC 13350

griD 182438037 YP_001825756.1 Streptomyces griseus subsp. griseus NBRC 13350 Mycobacterium smegmatis MC2 MSMEG_2956 YP_887275.1 YP_887275.1 155

MSMEG_5739 YP_889972.1 118469671 Mycobacterium smegmatis MC2 155

MSMEG_2648 YP_886985.1 118471293 Mycobacterium smegmatis MC2 155

MAP1040c NP_959974.1 41407138 Mycobacterium avium subsp. paratuberculosisK-10

MAP2899c NP_961833.1 41408997 Mycobacterium avium subsp. paratuberculosisK-10

MMAR_2117 YP001850422. 183982131 Mycobacterium marinum M

MMAR_2936 YP_001851230. 183982939 Mycobacteriummarinum M

MMAR_1916 YP_001850220. 183981929 Mycobacterium marinum M

TpauDRAFT_3 ZP04027864.1 227980601 Tsukamurella paurometabolaDSM 3060 20162 TpauDRAFT_2 ZP04026660.1 227979396 Tsukamurella paurometabolaDSM 0920 20162 CPCC7001_13 20 - ZP_05045132.1 254431429 Cyanobium PCC7001 DDBDRAFT_01 XP_636931.1 66806417 Dictyostelium discoideum AX4 87729_

[0635] An enzyme with similar characteristics, alpha-aminoadipate reductase (AAR, EC 1.2.1.31), participates in lysine biosynthesis pathways in some fungal species. This enzyme naturally reduces alpha-aminoadipate to alpha-aminoadipate semialdehyde. The carboxyl group is first activated through the ATP-dependent formation of an adenylate that is then reduced by NAD(P)H to yield the aldehyde and AMP. Like CAR, this enzyme utilizes magnesium and requires activation by a PPTase. Enzyme candidates for AAR and its corresponding PPTase are found in Saccharomyces cerevisiae (Morris et al., Gene 98:141 145 (1991)), Candida albicans (Guo et al., Mol. Genet. Genomics 269:271-279 (2003)), and Schizosaccharomycespombe (Ford et al., Curr. Genet. 28:131-137 (1995)). The AAR from S. pombe exhibited significant activity when expressed in E. coli (Guo et al., Yeast 21:1279 1288 (2004)). The AAR from Penicillium chrysogenum accepts S-carboxymethyl-L-cysteine as an alternate substrate, but did not react with adipate, L-glutamate or diaminopimelate (Hijarrubia et al., J. Biol. Chem. 278:8250-8256 (2003)). The gene encoding the P. chrysogenum PPTase has not been identified to date.

Gene Accession No. GI No. Organism

L YS2 AAA34747.1 171867 Saccharomyces cerevisiae L YS5 P50113.1 1708896 Saccharomyces cerevisiae LYS2 AAC02241.1 2853226 Candida albicans LYS5 AA026020.1 28136195 Candidaalbicans LysIp P40976.3 13124791 Schizosaccharomycespombe Lys7p Q10474.1 1723561 Schizosaccharomycespombe Lys2 CAA74300.1 3282044 Penicilliumchrysogenum

1.4.1.a Oxidoreductase (aminating).

[0636] Glutamate dehydrogenase (Step J, Figures 62 and 63), 4-aminobutyrate dehydrogenase (Step M, Figures 62 and 63), putrescine dehydrogenase (Step D, Figure 63), -amino-2-oxopentanoate dehydrogenase (Step P, Figure 63), and ornithine dehydrogenase (Step S, Figure 63) can be catalyzed by aminating oxidoreductases. Enzymes in this EC class catalyze the oxidative deamination of alpha-amino acids with NAD+ or NADP+ as acceptor, and the reactions are typically reversible. Exemplary oxidoreductases operating on amino acids include glutamate dehydrogenase (deaminating), encoded by gdhA, leucine dehydrogenase (deaminating), encoded by ldh, and aspartate dehydrogenase (deaminating), encoded by nadX. The gdhA gene product from Escherichiacoli (Korber et al., J Mol. Biol. 234:1270-1273 (1993); McPherson and Wootton, Nucleic Acids Res. 11:5257-5266 (1983)), gdh from Thermotoga maritima (Kort et al., Extremophiles 1:52-60 (1997); Lebbink, et al. J. Mol. Biol. 280:287-296 (1998); Lebbink et al. J Mol. Biol. 289:357-369 (1999)), and gdhA1 from Halobacteriumsalinarum(Ingoldsby et al., Gene 349:237-244 (2005)) catalyze the reversible interconversion of glutamate to 2-oxoglutarate and ammonia, while favoring NADP(H), NAD(H), or both, respectively. The ldh gene of Bacillus cereus encodes the LeuDH protein that has a wide of range of substrates including leucine, isoleucine, valine, and 2-aminobutanoate (Ansorge and Kula, Biotechnol. Bioeng. 68:557-562 (2000); Stoyan et al. J. Biotechnol. 54:77-80 (1997)). The nadXgene from Thermotoga maritime encoding for the aspartate dehydrogenase is involved in the biosynthesis of NAD (Yang et al., J Biol. Chem. 278:8804-8808 (2003)).

e Accession No. GI No. Organism gdhA P00370 118547 Escherichiacoli gdh P96110.4 6226595 Thermotoga maritima gdhA1 NP279651.1 15789827 Halobacteriumsalinarum ldh P0A393 61222614 Bacillus cereus nadX NP229443.1 15644391 Thermotoga maritima

[0637] Additional glutamate dehydrogenase gene candidates are found in Bacillus subtilis (Khan et al., Biosci. Biotechnol. Biochem. 69:1861-1870 (2005)), Nicotiana tabacum (Purnell et al., Planta222:167-180 (2005)), Oryza sativa (Abiko et al., Plant Cell Physiol. 46:1724 1734 (2005)), Haloferax mediterranei(Diaz et al., Extremophiles 10:105-115 (2006)) and Halobactreiumsalinarum(Hayden et al., FEMSMicrobiol. Lett. 211:37-41 (2002)). The Nicotianatabacum enzyme is composed of alpha and beta subunits encoded by gdh1 and gdh2 (Purnell et al., Planta222:167-180 (2005)). Overexpression of the NADH-dependent glutamate dehydrogenase was found to improve ethanol production in engineered strains of S. cerevisiae (Roca et al., Appl. Environ. Microbiol. 69:4732-4736 (2003)).

Gene Accession No. GI No. Organism rocG NP391659.1 16080831 Bacillus subtilis gdhl AAR1534.1 38146335 Nicotiana tabacum gdh2 AAR11535.1 38146337 Nicotiana tabacum GDH Q852M0 75243660 Oryza sativa GDH Q977U6 74499858 Haloferax mediterranei GDH P29051 118549 Halobactreiumsalinarum GDH2 NP010066.1 6319986 Saccharomyces cerevisiae

[0638] An exemplary enzyme for catalyzing the conversion of aldehydes to their corresponding primary amines is lysine 6-dehydrogenase (EC 1.4.1.18), encoded by the lysDH genes. The lysine 6-dehydrogenase (deaminating), encoded by lysDH gene, catalyze the oxidative deamination of the E-amino group of L-lysine to form 2-aminoadipate-6 semialdehyde, which in turn nonenzymatically cyclizes to form Al-piperideine-6-carboxylate (Misono and Nagasaki, J. Bacteriol. 150:398-401 (1982)). The lysDH gene from Geobacillus stearothermophilusencodes a thermophilic NAD-dependent lysine 6-dehydrogenase (Heydari et al., Appl. Environ. Microbiol 70:937-942 (2004)). The lysDH gene from Aeropyrum pernix K1 is identified through homology from genome projects. Additional enzymes can be found in Agrobacterium tumefaciens (Hashimoto et al., J. Biochem. 106:76 (1989); Misono and Nagasaki, J. Bacteriol. 150:398-401 (1982)) and Achromobacter denitrificans(Ruldeekulthamrong et al., BMB. Rep. 41:790-795 (2008)).

Gene Accession No. GI No. Organism lysDH BAB39707 13429872 Geobacillus stearothermophilus lysDH NP147035.1 14602185 Aeropyrum pernix K1 lysDH NP353966 15888285 Agrobacterium tumefaciens lysDH AAZ94428 74026644 Achromobacter denitrificans

[0639] An enzyme that converts 3-oxoacids to 3-amino acids is 3,5-diaminohexanoate dehydrogenase (EC 1.4.1.11), an enzyme found in organisms that ferment lysine. The gene encoding this enzyme, kdd, was recently identified in Fusobacterium nucleatum (Kreimeyer et al., J. Biol. Chem. 282:7191-7197 (2007)). The enzyme has been purified and characterized in other organisms (Baker et al., J. Biol. Chem. 247:7724-7734 (1972); Baker and and van der Drift, Biochemistry 13:292-299 (1974)), but the genes associated with these enzymes are not known. Candidates in Myxococcus xanthus, Porphyromonasgingivalis W83 and other sequenced organisms can be inferred by sequence homology.

Gene Accession No. GI No. Organism kdd AAL93966.1 19713113 Fusobacteriumnucleatum mxan_4391 ABF87267.1 108462082 Myxococcus xanthus pg_1069 AAQ66183.1 34397119 Porphyromonasgingivalis

2.3.1.a Acyltransferase (transferring phosphate group to CoA).

[0640] Step P of Figure 62 depicts the transformation of 4-hydroxybutyryl-CoA to 4 hydroxybutyryl-Pi. Exemplary phosphate transferring acyltransferases include phosphotransacetylase, encoded by pta, and phosphotransbutyrylase, encoded by ptb. The pta gene from E. coli encodes an enzyme that can convert acetyl-CoA into acetyl-phosphate, and vice versa (Suzuki, Biochim. Biophys. Acta 191:559-569 (1969)). This enzyme can also utilize propionyl-CoA instead of acetyl-CoA forming propionate in the process (Hesslinger et al., Mol. Microbiol. 27:477-492 (1998)). Similarly, the ptb gene from C. acetobutylicum encodes an enzyme that can convert butyryl-CoA into butyryl-phosphate (Walter et al., Gene 134:107-111 (1993)); Huang et al., JMol. Microbiol. Biotechno.l 2:33-38 (2000). Additional ptb genes can be found in butyrate-producing bacterium L2-50 (Louis et al., J.Bacteriol. 186:2099-2106 (2004)) and Bacillus megaterium (Vazquez et al., Curr. Microbiol. 42:345 349 (2001)).

Gene Accession No. GI No. Organism pta NP_416800.1 16130232 Escherichiacoli ptb NP_349676 15896327 Clostridiumacetobutylicum ptb AAR19757.1 38425288 butyrate-producing bacterium L2-50 ptb CAC07932.1 10046659 Bacillus megaterium

2.6.1. Aminotransferase.

[0641] Aminotransferases reversibly convert an aldehyde or ketone to an amino group. Common amino donor/acceptor combinations include glutamate/alpha-ketoglutarate, alanine/pyruvate, and aspartate/oxaloacetate. Several enzymes have been shown to convert aldehydes to primary amines, and vice versa, such as 4-aminobutyrate, putrescine, and 5 amino-2-oxopentanoate. These enzymes are particularly well suited to carry out the following transformations: Step N in Figures 62 and 63, Steps E and Q in Figure 63. Lysine 6-aminotransferase (EC 2.6.1.36) is one exemplary enzyme capable of forming a primary amine. This enzyme function, converting lysine to alpha-aminoadipate semialdehyde, has been demonstrated in yeast and bacteria. Candidates from Candida utilis (Hammer and Bode, J. Basic Microbiol. 32:21-27 (1992)), Flavobacteriumlutescens (Fujii et al., J. Biochem. 128:391-397 (2000)) and Streptomyces clavuligenus (Romero et al., J. Ind. Microbiol. Biotechnol. 18:241-246 (1997)) have been characterized. A recombinant lysine-6 aminotransferase from S. clavuligenus was functionally expressed in E. coli (Tobin et al., J. Bacteriol. 173:6223-6229 (1991)). The F. lutescens enzyme is specific to alpha-ketoglutarate as the amino acceptor (Soda and Misono, Biochemistry 7:4110-4119 (1968)). Other enzymes which convert aldehydes to terminal amines include the dat gene product in Acinetobacter baumanii encoding 2,4-diaminobutanoate:2-ketoglutarate 4-transaminase (Ikai and Yamamoto, J. Bacteriol. 179:5118-5125 (1997)). In addition to its natural substrate, 2,4- diaminobutyrate, DAT transaminates the terminal amines of lysine, 4-aminobutyrate and ornithine.

Gene Accession No. GI No. Organism lat BAB13756.1 10336502 Flavobacteriumlutescens lat AAA26777.1 153343 Streptomyces clavuligenus dat P56744.1 6685373 Acinetobacter baumanii

[0642] The conversion of an aldehyde to a terminal amine can also be catalyzed by gamma-aminobutyrate transaminase (GABA transaminase or 4-aminobutyrate transaminase). This enzyme naturally interconverts succinic semialdehyde and glutamate to 4-aminobutyrate and alpha-ketoglutarate and is known to have a broad substrate range (Liu et al., Biochemistry 43:10896-10905 2004); Schulz et al., Appl. Environ. Microbiol. 56:1-6 (1990)). The two GABA transaminases in E. coli are encoded by gabT (Bartsch et al., J. Bacteriol. 172:7035 7042 (1990)) and puuE (Kurihara et al., J. Biol. Chem. 280:4602-4608. (2005)). GABA transaminases in Mus musculus, Pseudomonasfluorescens,and Sus scrofa have been shown to react with a range of alternate substrates including 6-aminocaproic acid (Cooper, Methods Enzymol. 113:80-82 (1985); Scott and Jakoby, J. Biol. Chem. 234:932-936 (1959)).

Gene Accession No. GI No. Organism gabT NP_417148.1 16130576 Escherichia coli puuE NP_415818.1 16129263 Escherichia coli abat NP_766549.2 37202121 Mus musculus gabT YP257332.1 70733692 Pseudomonasfluorescens abat NP_999428.1 47523600 Sus scrofa

[0643] Additional enzyme candidates for interconverting aldehydes and primary amines are putrescine transminases or other diamine aminotransferases. The E. coli putrescine aminotransferase is encoded by the ygjG gene, and the purified enzyme also was able to transaminate cadaverine and spermidine (Samsonova et al., BMC Microbiol. 3:2 (2003)). In addition, activity of this enzyme on 1,7-diaminoheptane and with amino acceptors other than 2-oxoglutarate (for example, pyruvate, 2-oxobutanoate) has been reported (Kim, J. Biol. Chem. 239:783-786 (1964); Samsonova et al., BMCMicrobiol. 3:2 (2003)). A putrescine aminotransferase with higher activity with pyruvate as the amino acceptor than alpha ketoglutarate is the spuC gene of Pseudomonasaeruginosa(Lu et al., J. Bacteriol. 184:3765 3773 (2002)).

Gene Accession No. GI No. Organism ygjG NP_417544 145698310 Escherichia coli spuC AAG03688 9946143 Pseudomonas aeruginosa

[0644] Enzymes that transaminate 3-oxoacids include GABA aminotransferase (described above), beta-alanine/alpha-ketoglutarate aminotransferase and 3-amino-2 methylpropionate aminotransferase. Beta-alanine/alpha-ketoglutarate aminotransferase (WO08027742) reacts with beta-alanine to form malonic semialdehyde, a 3-oxoacid. The gene product of SkPYD4 in Saccharomyces kluyveri was shown to preferentially use beta alanine as the amino group donor (Andersen and Hansen, Gene 124:105-109 (1993)). SkUGA1 encodes a homologue of Saccharomyces cerevisiaeGABA aminotransferase, UGA1 (Ramos et al., Eur. J. Biochem. 149:401-404 (1985)), whereas SkPYD4 encodes an enzyme involved in both beta-alanine and GABA transamination (Andersen and Hansen, Gene 124:105-109 (1993)). 3-Amino-2-methylpropionate transaminase catalyzes the transformation from methylmalonate semialdehyde to 3-amino-2-methylpropionate. The enzyme has been characterized in Rattus norvegicus and Sus scrofa and is encoded by Abat (Kakimoto et al., Biochim. Biophys. Acta 156:374-380 (1968); Tamaki et al., Methods Enzymol. 324:376-389 (2000)).

Gene Accession No. GI No. Organism SkyPYD4 ABF58893.1 98626772 Lachancea kluyveri SkUGAJ ABF58894.1 98626792 Lachancea kluyveri UGA1 NP_011533.1 6321456 Saccharomyces cerevisiae Abat P50554.3 122065191 Rattus norvegicus Abat P80147.2 120968 Sus scrofa

[0645] Several aminotransferases transaminate the amino groups of amino acids to form 2-oxoacids. Aspartate aminotransferase is an enzyme that naturally transfers an oxo group from oxaloacetate to glutamate, forming alpha-ketoglutarate and aspartate. Aspartate is similar in structure to OHED and 2-AHD. Aspartate aminotransferase activity is catalyzed by, for example, the gene products of aspC from Escherichiacoli (Yagi et al., FEBS Lett. 100:81-84 (1979); Yagi et al., Methods Enzymol. 113:83-89 (1985)), AAT2 from Saccharomyces cerevisiae (Yagi et al., J. Biochem. 92:35-43 (1982)) and ASP5 from Arabidopsis thaliana(de la Torre et al., PlantJ. 46:414-425 (2006); Kwok and Hanson. J. Exp. Bot. 55:595-604 (2004); Wilkie and Warren, Protein Expr. Purif 12:381-389 (1998)). The enzyme from Rattus norvegicus has been shown to transaminate alternate substrates such as 2-aminohexanedioic acid and 2,4-diaminobutyric acid (Recasens et al., Biochemistry 19:4583-4589 (1980)). Aminotransferases that work on other amino-acid substrates can also be able to catalyze this transformation. Valine aminotransferase catalyzes the conversion of valine and pyruvate to 2-ketoisovalerate and alanine. The E. coli gene, avtA, encodes one such enzyme (Whalen and Berg, J. Bacteriol. 150:739-746 (1982)). This gene product also catalyzes the transamination of a-ketobutyrate to generate a-aminobutyrate, although the amine donor in this reaction has not been identified (Whalen and Berg, J. Bacteriol. 158:571 574 1984)). The gene product of the E. coli serC catalyzes two reactions, phosphoserine aminotransferase and phosphohydroxythreonine aminotransferase (Lam and Winkler, J. Bacteriol. 172:6518-6528 (1990)), and activity on non-phosphorylated substrates could not be detected (Drewke et al., FEBS Lett. 390:179-182 (1996)).

Gene Accession No. GI No. Organism aspC NP415448.1 16128895 Escherichiacoli AA T2 P23542.3 1703040 Saccharomyces cerevisiae ASP5 P46248.2 20532373 Arabidopsis thaliana Got2 P00507 112987 Rattus norvegicus avtA YP026231.1 49176374 Escherichiacoli serC NP415427.1 16128874 Escherichiacoli

[0646] Another enzyme candidate is alpha-aminoadipate aminotransferase (EC 2.6.1.39), an enzyme that participates in lysine biosynthesis and degradation in some organisms. This enzyme interconverts 2-aminoadipate and 2-oxoadipate, using alpha-ketoglutarate as the amino acceptor. Gene candidates are found in Homo sapiens (Okuno et al., Enzyme Protein 47:136-148 (1993)) and Thermus thermophilus (Miyazaki et al., Microbiology 150:2327 2334 (2004)). The Thermus thermophilus enzyme, encoded by lysN, is active with several alternate substrates including oxaloacetate, 2-oxoisocaproate, 2-oxoisovalerate, and 2-oxo-3 methylvalerate.

Gene Accession No. GI No. Organism lysN BAC76939.1 31096548 Thermus thermophilus AadAT 11 Q8N5ZO.2 46395904 Homo sapiens

2.7.2.a Phosphotransferase (carboxy acceptor).

[0647] Phosphotransferase enzymes in the EC class 2.7.2 transform carboxylic acids to phosphonic acids with concurrent hydrolysis of one ATP. Step 0 of Figure 62 involves the conversion of 4-hydroxybutyrate to 4-hydroxybutyryl-phosphate by such an enzyme. Butyrate kinase (EC 2.7.2.7) carries out the reversible conversion of butyryl-phosphate to butyrate during acidogenesis in C. acetobutylicum (Cary et al., Appl. Environ. Microbiol. 56:1576-1583 (1990)). This enzyme is encoded by either of the two buk gene products (Huang et al., J. Mol. Microbiol. Biotechnol. 2:33-38 (2000)). Other butyrate kinase enzymes are found in C. butyricum and C. tetanomorphum (Twarog and Wolfe, J. Bacteriol. 86:112 117 (1963)). Related enzyme isobutyrate kinase from Thermotoga maritima has also been expressed in E. coli and crystallized (Diao et al., Acta Crystallogr.D. Biol. Crystallogr. 59:1100-1102 (2003); Diao and Hasson, J. Bacteriol. 191:2521-2529 (2009)). Aspartokinase catalyzes the ATP-dependent phosphorylation of aspartate and participates in the synthesis of several amino acids. The aspartokinase III enzyme in E. coli, encoded by lysC, has a broad substrate range, and the catalytic residues involved in substrate specificity have been elucidated (Keng and Viola, Arch. Biochem. Biophys. 335:73-81 (1996)). Two additional kinases in E. coli are also good candidates: acetate kinase and gamma-glutamyl kinase. The E. coli acetate kinase, encoded by ackA (Skarstedt and Silverstein, J. Biol. Chem. 251:6775 6783 (1976)), phosphorylates propionate in addition to acetate (Hesslinger et al., Mol. Microbiol. 27:477-492 (1998)). The E. coli gamma-glutamyl kinase, encoded by proB (Smith et al., J. Bacteriol. 157:545-551 (1984)), phosphorylates the gamma carbonic acid group of glutamate.

Gene Accession No. GI No. Organism buki NP_349675 15896326 Clostridiumacetobutylicum buk2 Q97111 20137415 Clostridiumacetobutylicum buk2 Q9X278.1 6685256 Thermotoga maritima lysC NP_418448.1 16131850 Escherichiacoli ackA NP_416799.1 16130231 Escherichiacoli proB NP_414777.1 16128228 Escherichiacoli

[0648] Acetylglutamate kinase phosphorylates acetylated glutamate during arginine biosynthesis. This enzyme is not known to accept alternate substrates; however, several residues of the E. coli enzyme involved in substrate binding and phosphorylation have been elucidated by site-directed mutagenesis (Marco-Marin et al., J. Mol. Biol. 334:459-476 (2003); Ramon-Maiques et al., Structure 10:329-342 (2002)). The enzyme is encoded by argB in Bacillus subtilis and E. coli (Parsot et al., Gene 68:275-283 (1988)), and ARG5,6 in S. cerevisiae (Pauwels et al., Eur. J. Biochem. 270:1014-1024 (2003)). The ARG5,6 gene of

S. cerevisiae encodes a polyprotein precursor that is matured in the mitochondrial matrix to become acetylglutamate kinase and acetylglutamylphosphate reductase.

Gene Accession No. GI No. Organism argB NP418394.3 145698337 Escherichia coli argB NP389003.1 16078186 Bacillus subtilis ARG5,6 NP010992.1 6320913 Saccharomyces cerevisiae

2.8.3.a CoA transferase.

[0649] The gene products of cat1, cat2, and cat3 of Clostridium kluyveri have been shown to exhibit succinyl-CoA (Step G, Figures 62 and 63), 4-hydroxybutyryl-CoA (Step T, Figure 62), and butyryl-CoA acetyltransferase activity, respectively (Seedorf et al., Proc. Natl. Acad. Sci. USA 105:2128-2133 (2008); Sohling and Gottschalk, JBacteriol 178:871 880 (1996)). Similar CoA transferase activities are also present in Trichomonas vaginalis (van Grinsven et al., J. Biol. Chem. 283:1411-1418 (2008)) and Trypanosoma brucei (Riviere et al., J. Biol. Chem. 279:45337-45346 (2004)).

Gene Accession No. GI No. Organism cat] P38946.1 729048 Clostridium kluyveri cat2 P38942.2 1705614 Clostridium kluyveri cat3 EDK35586.1 146349050 Clostridium kluyveri TVAG395550 XP001330176 123975034 Trichomonas vaginalis G3 Tbl1.02.0290 XP828352 71754875 Trypanosoma brucei

[0650] An additionally useful enzyme for this type of transformation is acyl-CoA:acetate CoA transferase, also known as acetate-CoA transferase (EC 2.8.3.8), which has been shown to transfer the CoA moiety to acetate from a variety of branched and linear acyl-CoA substrates, including isobutyrate (Matthies and Schink, Appl. Environ. Microbiol. 58:1435 1439 (1992)), valerate (Vanderwinkel et al., Biochem. Biophys. Res. Commun. 33:902-908 (1968)) and butanoate (Vanderwinkel, supra (1968)). This enzyme is encoded by atoA (alpha subunit) and atoD (beta subunit) in E. coli sp. K12 (Korolev et al., Acta Crystallogr. D Biol. Crystallogr. 58:2116-2121 (2002); Vanderwinkel, supra (1968)). Similar enzymes exist in Corynebacteriumglutamicum ATCC 13032 (Duncan et al., Appl. Environ. Microbiol. 68:5186-5190 (2002)), Clostridium acetobutylicum (Cary et al., Appl. Environ. Microbiol. 56:1576-1583 (1990); Wiesenborn et al., Appl. Environ. Microbiol. 55:323-329 (1989)), and

Clostridium saccharoperbutylacetonicum(Kosaka et al., Biosci. Biotechnol. Biochem. 71:58 68(2007)).

Gene Accession No. GI No. Organism atoA P76459.1 2492994 Escherichiacoli K12 atoD P76458.1 2492990 Escherichiacoli K12 actA YP_226809.1 62391407 Corynebacteriumglutamicum cg0592 YP_224801.1 62389399 Corynebacteriumglutamicum ctfA NP_149326.1 15004866 Clostridium acetobutylicum ctfB NP_149327.1 15004867 Clostridium acetobutylicum ctfA AAP42564.1 31075384 Clostridium saccharoperbutylacetonicum ctfR AAP42565.1 31075385 Clostridium saccharoperbutylacetonicum

[0651] The glutaconate-CoA-transferase (EC 2.8.3.12) enzyme from anaerobic bacterium Acidaminococcusfermentansreacts with diacid glutaconyl-CoA and 3-butenoyl-CoA (Mack and Buckel, FEBS Lett. 405:209-212 (1997)). The genes encoding this enzyme are gctA and gctB. This enzyme has reduced but detectable activity with other CoA derivatives including glutaryl-CoA, 2-hydroxyglutaryl-CoA, adipyl-CoA and acrylyl-CoA (Buckel et al., Eur. J. Biochem. 118:315-321 (1981)). The enzyme has been cloned and expressed in E. coli (Mac et al., Eur.J.Biochem. 226:41-51 (1994)).

3.1.2.a CoA hydrolase.

[0652] Enzymes in the 3.1.2 family hydrolyze acyl-CoA molecules to their corresponding acids. However, such enzymes can be modified to empart CoA-ligase or synthetase functionality if coupled to an energy source such as a proton pump or direct ATP hydrolysis. Several eukaryotic acetyl-CoA hydrolases (EC 3.1.2.1) have broad substrate specificity. For example, the enzyme from Rattus norvegicus brain (Robinson et al., Biochem. Biophys. Res. Commun. 71:959-965 (1976)) can react with butyryl-CoA, hexanoyl-CoA and malonyl-CoA. Though its sequence has not been reported, the enzyme from the mitochondrion of the pea leaf also has a broad substrate specificity, with demonstrated activity on acetyl-CoA, propionyl-CoA, butyryl-CoA, palmitoyl-CoA, oleoyl-CoA, succinyl-CoA, and crotonyl-CoA (Zeiher and Randall, Plant. Physiol. 94:20-27 (1990)). The acetyl-CoA hydrolase, ACH1, from S. cerevisiae represents another candidate hydrolase (Buu et al., J. Biol. Chem. 278:17203-17209 (2003)).

Gene Accession No. GI No. Organism acot12 NP_570103.1 18543355 Rattus norvegicus ACHI NP_009538 6319456 Saccharomyces cerevisiae

[0653] Another candidate hydrolase is the human dicarboxylic acid thioesterase, acot8, which exhibits activity on glutaryl-CoA, adipyl-CoA, suberyl-CoA, sebacyl-CoA, and dodecanedioyl-CoA (Westin et al., J. Biol. Chem. 280:38125-38132 (2005)) and the closest E. coli homolog, tesB, which can also hydrolyze a broad range of CoA thioesters (Naggert et al., J. Biol. Chem. 266:11044-11050 (1991)). A similar enzyme has also been characterized in the rat liver (Deana, Biochem. Int. 26:767-773 (1992)). Other potential E. coli thioester hydrolases include the gene products of tesA (Bonner and Bloch, J Biol. Chem. 247:3123 3133 (1972)), ybgC (Kuznetsova et al., FEMS Microbiol. Rev. 29:263-279 (2005); Zhuang et al., FEBS Lett. 516:161-163 (2002)), paaI(Song et al., J Biol. Chem. 281:11028-11038 (2006)), and ybdB (Leduc et al., J. Bacteriol. 189:7112-7126 (2007)).

Gene Accession No. GI No. Organism acot8 CAA15502 3191970 Homo sapiens tesB NP_414986 16128437 Escherichiacoli acot8 NP_570112 51036669 Rattus norvegicus tesA NP_415027 16128478 Escherichiacoli ybgC NP_415264 16128711 Escherichiacoli paaI NP_415914 16129357 Escherichiacoli ybdB NP_415129 16128580 Escherichiacoli

[0654] Yet another candidate hydrolase is the glutaconate CoA-transferase from Acidaminococcusfermentans. This enzyme was transformed by site-directed mutagenesis into an acyl-CoA hydrolase with activity on glutaryl-CoA, acetyl-CoA and 3-butenoyl-CoA (Mack and Buckel, FEBS Lett. 405:209-212 (1997)). This indicates that the enzymes encoding succinyl-CoA:3-ketoacid-CoA transferases and acetoacetyl-CoA:acetyl-CoA transferases can also serve as candidates for this reaction step but would likely require certain mutations to change their function.

[0655] Additional hydrolase enzymes include 3-hydroxyisobutyryl-CoA hydrolase which has been described to efficiently catalyze the conversion of 3-hydroxyisobutyryl-CoA to 3 hydroxyisobutyrate during valine degradation (Shimomura et al., J. Biol. Chem. 269:14248 14253 (1994)). Genes encoding this enzyme include hibch of Rattus norvegicus (Shimomura et al., supra (1994); Shimomura et al., Methods Enzymol. 324:229-240 (2000)) and Homo sapiens (Shimomura et al., supra (1994). Candidate genes by sequence homology include hibch of Saccharomyces cerevisiae and BC_2292 of Bacillus cereus.

Gene Accession No. GI No. Organism hibch Q5XIE6.2 146324906 Rattus norvegicus hibch Q6NVY1.2 146324905 Homo sapiens hibch P28817.2 2506374 Saccharomyces cerevisiae BC2292 AP09256 29895975 Bacillus cereus

4.1.1.a Carboxy-lyase.

[0656] Decarboxylation of Alpha-Keto Acids. Alpha-ketoglutarate decarboxylase (Step B, Figures 58, 62 and 63), 5-hydroxy-2-oxopentanoic acid decarboxylase (Step Z, Figure 62), and 5-amino-2-oxopentanoate decarboxylase (Step R, Figure 63) all involve the decarboxylation of an alpha-ketoacid. The decarboxylation of keto-acids is catalyzed by a variety of enzymes with varied substrate specificities, including pyruvate decarboxylase (EC 4.1.1.1), benzoylformate decarboxylase (EC 4.1.1.7), alpha-ketoglutarate decarboxylase and branched-chain alpha-ketoacid decarboxylase.

[0657] Pyruvate decarboxylase (PDC), also termed keto-acid decarboxylase, is a key enzyme in alcoholic fermentation, catalyzing the decarboxylation of pyruvate to acetaldehyde. The enzyme from Saccharomyces cerevisiaehas a broad substrate range for aliphatic 2-keto acids including 2-ketobutyrate, 2-ketovalerate, 3-hydroxypyruvate and 2 phenylpyruvate (Davie et al., J. Biol. Chem. 267:16601-16606 (1992)). This enzyme has been extensively studied, engineered for altered activity, and functionally expressed in E. coli (Killenberg-Jabs et al., Eur. J. Biochem. 268:1698-1704 (2001); Li and Jordan, Biochemistry 38:10004-10012 (1999); ter Schure et al., Appl. Environ. Microbiol. 64:1303-1307 (1998)). The PDC from Zymomonas mobilus, encoded by pdc, also has a broad substrate range and has been a subject of directed engineering studies to alter the affinity for different substrates (Siegert et al., ProteinEng. Des. Sel. 18:345-357 (2005)). The crystal structure of this enzyme is available (Killenberg-Jabs et al., Eur. J. Biochem. 268:1698-1704 (2001)). Other well-characterized PDC candidates include the enzymes from Acetobacter pasteurians (Chandra et al., Arch. Microbiol. 176:443-451 (2001)) and Kluyveromyces lactis (Krieger et al., Eur. J Biochem. 269:3256-3263 (2002)).

Gene Accession No. GI No. Organism pdc P06672.1 118391 Zymomonas mobilus pdc1 P06169 30923172 Saccharomyces cerevisiae pdc AM21208 20385191 Acetobacterpasteurians pdcl Q12629 52788279 Kluyveromyces lactis

[0658] Like PDC, benzoylformate decarboxylase (EC 4.1.1.7) has a broad substrate range and has been the target of enzyme engineering studies. The enzyme from Pseudomonas putida has been extensively studied and crystal structures of this enzyme are available (Hasson et al., Biochemistry 37:9918-9930 (1998); Polovnikova et al., Biochemistry 42:1820 1830 (2003). Site-directed mutagenesis of two residues in the active site of the Pseudomonas putida enzyme altered the affinity (Km) of naturally and non-naturally occurring substrates (Siegert et al., Protein Eng. Des. Sel. 18:345-357 (2005)). The properties of this enzyme have been further modified by directed engineering (Lingen et al., ProteinEng. 15:585-593 (2002); Lingen et al., Chembiochem. 4:721-726 (2003)). The enzyme from Pseudomonas aeruginosa, encoded by mdlC, has also been characterized experimentally (Barrowman et al., FEMSMicrobiol. Lett. 34:57-60 (1986)). Additional gene candidates from Pseudomonas stutzeri, Pseudomonasfluorescensand other organisms can be inferred by sequence homology or identified using a growth selection system developed in Pseudomonasputida (Henning et al., Appl. Environ.Microbiol. 72:7510-7517 (2006)).

Gene Accession No. GI No. Organism mdlC P20906.2 3915757 Pseudomonasputida mdlC Q9HUR2.1 81539678 Pseudomonasaeruginosa dpgB ABN80423.1 126202187 Pseudomonasstutzeri ilvB-1 YP260581.1 70730840 Pseudomonasfluorescens

[0659] A third enzyme capable of decarboxylating 2-oxoacids is alpha-ketoglutarate decarboxylase (KGD). The substrate range of this class of enzymes has not been studied to date. The KDC from Mycobacterium tuberculosis(Tian et al., Proc. Natl. Acad. Sci. USA 102:10670-10675 (2005)) has been cloned and functionally expressed. However, it is not an ideal candidate for strain engineering because it is large (-130 kD) and GC-rich. KDC enzyme activity has been detected in several species of rhizobia including Bradyrhizobium japonicum and Mesorhizobium loti (Green et al., J. Bacteriol. 182:2838-2844 (2000). Although the KDC-encoding gene(s) have not been isolated in these organisms, the genome sequences are available, and several genes in each genome are annotated as putative KDCs. A KDC from Euglena gracilis has also been characterized, but the gene associated with this activity has not been identified to date (Shigeoka and Nakano, Arch. Biochem. Biophys. 288:22-28(1991)). The first twenty amino acids starting from the N-terminus were sequenced (MTYKAPVKDVKFLLDKVFKV; SEQ ID NO:45) (Shigeoka and Nakano, Arch. Biochem. Biophys. 288:22-28 (1991)). The gene can be identified by testing candidate genes containing this N-terminal sequence for KDC activity.

Gene Accession No. GI No. Organism kgd 050463.4 160395583 Mycobacterium tuberculosis kgd NP767092.1 27375563 Bradyrhizobiumjaponicum kgd NP105204.1 13473636 Mesorhizobium loti

[0660] A fourth candidate enzyme for catalyzing this reaction is branched chain alpha ketoacid decarboxylase (BCKA). This class of enzyme has been shown to act on a variety of compounds varying in chain length from 3 to 6 carbons (Oku and Kaneda, J. Biol. Chem. 263:18386-18396 (1988); Smit et al., B. A., J. E. Hylckama Vlieg, W. J. Engels, L. Meijer, J. T. Wouters, and G. Smit. Identification, cloning, and characterization of a Lactococcus lactis branched-chain alpha-keto acid decarboxylase involved in flavor formation. Apple. Environ. Microbiol. 71:303-311 (2005)). The enzyme in Lactococcus lactis has been characterized on a variety of branched and linear substrates including 2-oxobutanoate, 2-oxohexanoate, 2 oxopentanoate, 3-methyl-2-oxobutanoate, 4-methyl-2-oxobutanoate and isocaproate (Smit et al., Appl. Environ. Microbiol. 71:303-311 (2005)). The enzyme has been structurally characterized (Berg et al., Science 318:1782-1786 (2007)). Sequence alignments between the Lactococcus lactis enzyme and the pyruvate decarboxylase of Zymomonas mobilus indicate that the catalytic and substrate recognition residues are nearly identical (Siegert et al., Protein Eng. Des. Sel. 18:345-357 (2005)), so this enzyme would be a promising candidate for directed engineering. Decarboxylation of alpha-ketoglutarateby a BCKA was detected in Bacillus subtilis; however, this activity was low (5%) relative to activity on other branched chain substrates (Oku and Kaneda. Biosynthesis of branched-chain fatty acids in Bacillus subtilis. A decarboxylase is essential for branched-chain fatty acid synthetase. J. Biol. Chem. 263:18386-18396 (1988)), and the gene encoding this enzyme has not been identified to date.

Additional BCKA gene candidates can be identified by homology to the Lactococcus lactis protein sequence. Many of the high-scoring BLASTp hits to this enzyme are annotated as indolepyruvate decarboxylases (EC 4.1.1.74). Indolepyruvate decarboxylase (IPDA) is an enzyme that catalyzes the decarboxylation of indolepyruvate to indoleacetaldehyde in plants and plant bacteria.

Gene Accession No. GI No. Organism kdcA AAS49166.1 44921617 Lactococcus lactis

[0661] Recombinant branched chain alpha-keto acid decarboxylase enzymes derived from the El subunits of the mitochondrial branched-chain keto acid dehydrogenase complex from Homo sapiens and Bos taurus have been cloned and functionally expressed in E. coli (Davie et al., J. Biol. Chem. 267:16601-16606 1992); Wynn et al., J. Biol. Chem. 267:1881 1887 (1992); Wynn et al., J. Biol. Chem. 267:12400-12403 (1992)). In these studies, the authors found that co-expression of chaperonins GroEL and GroES enhanced the specific activity of the decarboxylase by 500-fold (Wynn et al., J. Biol. Chem. 267:12400-12403 (1992)). These enzymes are composed of two alpha and two beta subunits.

Gene Accession No. GI No. Organism BCKDHB NP_898871.1 34101272 Homo sapiens BCKDHA NP_000700.1 11386135 Homo sapiens BCKDHB P21839 115502434 Bos taurus BCKDHA P11178 129030 Bos taurus

[0662] Decarboxylation of Alpha-Keto Acids. Several ornithine decarboxylase (Step U, Figure 63) enzymes also exhibit activity on lysine and other similar compounds. Such enzymes are found in Nicotianaglutinosa (Lee and Cho, Biochem. J. 360:657-665 (2001)), Lactobacillus sp. 30a (Guirard and Snell, J. Biol. Chem. 255:5960-5964 (1980)) and Vibrio vulnificus (Lee et al., J. Biol. Chem. 282:27115-27125 (2007)). The enzymes from Lactobacillus sp. 30a (Momany et al., J. Mol. Biol. 252:643-655 (1995)) and V. vulnificus have been crystallized. The V. vulnificus enzyme efficiently catalyzes lysine decarboxylation, and the residues involved in substrate specificity have been elucidated (Lee et al., J. Biol. Chem. 282:27115-27125 (2007)). A similar enzyme has been characterized in Trichomonas vaginalis, but the gene encoding this enzyme is not known (Yarlett et al., Biochem. J. 293 ( Pt 2):487-493 (1993)).

Gene Accession No. GI No. Organism AF323910.1:1..1299 AAG45222.1 12007488 Nicotiana glutinosa odc] P43099.2 1169251 Lactobacillussp. 30a VV21235 NP763142.1 27367615 Vibrio vulificus

[0663] Glutamate decarboxylase enzymes (Step L, Figures 62 and 63) are also well characterized. Exemplary glutamate decarboxylases can be found in E. coli (De Biase et al., ProteinExpr. Purif 8:430-438 (1996)), S. cerevisiae (Coleman et al., J. Biol. Chem. 276:244 250 (2001)), and Homo sapiens (Bu et al., Proc. Natl. Acad. Sci. USA 89:2115-2119 (1992); Bu and Tobin, Genomics 21:222-228 (1994)).

Gene Accession No. GI No. Organism GAD] NP_000808 58331246 Homo sapiens GAD2 NP_001127838 197276620 Homo sapiens gadA NP_417974 16131389 Escherichiacoli gadB NP416010 16129452 Escherichiacoli GAD] NP_013976 6323905 Saccharomyces cerevisiae

[0664] Lysine decarboxylase (EC 4.1.1.18) catalyzes the decarboxylation of lysine to cadaverine. Two isozymes of this enzyme are encoded in the E. coli genome by genes cadA and ldcC. CadA is involved in acid resistance and is subject to positive regulation by the cadC gene product (Lemonnier and Lane, Microbiology 144 ( Pt 3):751-760 (1998)). CadC accepts hydroxylysine and S-aminoethylcysteine as alternate substrates, and 2 Aminopimelate and 6-ACA act as competitive inhibitors to this enzyme (Sabo et al., Biochemistry 13:662-670 (1974)). Directed evolution or other enzyme engineering methods can be utilized to increase the activity for this enzyme to decarboxylate 2-aminopimelate. The constitutively expressed ldc gene product is less active than CadA (Lemonnier and Lane, Microbiology 144 ( Pt 3):751-760 (1998)). A lysine decarboxylase analogous to CadA was recently identified in Vibrioparahaemolyticus(Tanaka et al., J. Apple. Microbiol. 104:1283 1293 (2008)). The lysine decarboxylase from Selenomonas ruminantium, encoded by ldc, bears sequence similarity to eukaryotic ornithine decarboxylases, and accepts both L-lysine and L-ornithine as substrates (Takatsuka et al., Biosci. Biotechnol. Biochem. 63:1843-1846 (1999)). Active site residues were identified and engineered to alter the substrate specificity of the enzyme (Takatsuka et al., J. Bacteriol. 182:6732-6741 (2000)).

Gene Accession No. GI No. Organism cadA AAA23536.1 145458 Escherichiacoli ldcC AAC73297.1 1786384 Escherichiacoli ldc 050657.1 13124043 Selenomonas ruminantium cadA AB124819.1 44886078 Vibrioparahaemolyticus

6.2.1.a CoA synthetase.

[0665] CoA synthetase or ligase reactions are required by Step I of Figures 62 and 63, and Step V of Figure 62. Succinate or 4-hydroxybutyrate are the required substrates. Exemplary genes encoding enzymes likely to carry out these transformations include the sucCD genes of E. coli, which naturally form a succinyl-CoA synthetase complex. This enzyme complex naturally catalyzes the formation of succinyl-CoA from succinate with the concomitant consumption of one ATP, a reaction which is reversible in vivo (Buck et al., Biochem. 24:6245-6252 (1985)).

Gene Accession No. GI No. Organism sucC NP_415256.1 16128703 Escherichiacoli sucD AAC73823.1 1786949 Escherichiacoli

[0666] Additional exemplary CoA-ligases include the rat dicarboxylate-CoA ligase for which the sequence is yet uncharacterized (Vamecq et al., BiochemicalJ. 230:683-693 (1985)), either of the two characterized phenylacetate-CoA ligases from P. chrysogenum (Lamas-Maceiras et al., Biochem. J. 395:147-155 (2005); Wang et al., Biochem Biophy Res Commun 360(2):453-458 (2007)), the phenylacetate-CoA ligase from Pseudomonasputida (Martinez-Blanco et al., J Biol. Chem. 265:7084-7090 (1990)), and the 6-carboxyhexanoate CoA ligase from Bacilis subtilis (Boweret al., J.Bacteriol. 178(14):4122-4130 (1996)). Additional candidate enzymes are acetoacetyl-CoA synthetases from Mus musculus (Hasegawa et al., Biochim. Biophys. Acta 1779:414-419 (2008)) and Homo sapiens (Ohgami et al., Biochem. Pharmacol. 65:989-994 (2003)), which naturally catalyze the ATP-dependant conversion of acetoacetate into acetoacetyl-CoA. 4-Hydroxybutyryl-CoA synthetase activity has been demonstrated in Metallosphaerasedula (Berg et al., Science 318:1782-1786 (2007)). This function has been tentatively assigned to the Msed_1422 gene.

Gene Accession No. GI No. Organism phl CAJ15517.1 77019264 Penicillium chrysogenum phlB ABS19624.1 152002983 Penicillium chrysogenum paaF AAC24333.2 22711873 Pseudomonasputida bioW NP390902.2 50812281 Bacillus subtilis

AACS NP_084486.1 21313520 Mus musculus AACS NP076417.2 31982927 Homo sapiens Msed_1422 YP_001191504 146304188 Metallosphaerasedula

[0667] ADP-forming acetyl-CoA synthetase (ACD, EC 6.2.1.13) is another candidate enzyme that couples the conversion of acyl-CoA esters to their corresponding acids with the concurrent synthesis of ATP. Several enzymes with broad substrate specificities have been described in the literature. ACD I from Archaeoglobusfulgidus, encoded by AF1211, was shown to operate on a variety of linear and branched-chain substrates including acetyl-CoA, propionyl-CoA, butyryl-CoA, acetate, propionate, butyrate, isobutyryate, isovalerate, succinate, fumarate, phenylacetate, indoleacetate (Musfeldt et al., J. Bacteriol. 184:636-644 (2002)). The enzyme from Haloarculamarismortui(annotated as a succinyl-CoA synthetase) accepts propionate, butyrate, and branched-chain acids (isovalerate and isobutyrate) as substrates, and was shown to operate in the forward and reverse directions (Brasen et al., Arch. Microbiol. 182:277-287 (2004)). The ACD encoded by PAE3250 from hyperthermophilic crenarchaeon Pyrobaculum aerophilum showed the broadest substrate range of all characterized ACDs, reacting with acetyl-CoA, isobutyryl-CoA (preferred substrate) and phenylacetyl-CoA (Brasen et al., supra (2004)). The enzymes from A. fulgidus, H. marismortui and P. aerophilum have all been cloned, functionally expressed, and characterized in E. coli (Musfeldt et al., supra;Brasenet al., supra (2004)).

Gene Accession No. GI No. Organism AF1211 NP070039.1 11498810 ArchaeoglobusfulgidusDSM4304 scs YP135572.1 55377722 HaloarculamarismortuiA TCC 43049 PAE3250 NP560604.1 18313937 Pyrobaculum aerophilum str. IM2

EXAMPLE XXIII Production of BDO Utilizing Carboxylic Acid Reductase

[0668] This example describes the generation of a microbial organism that produces 1,4 butanediol using carboxylic acid reductase enzymes.

[0669] Escherichiacoli is used as a target organism to engineer the pathway for 1,4 butanediol synthesis described in Figure 58. E. coli provides a good host for generating a non-naturally occurring microorganism capable of producing 1,4-butanediol. E. coli is amenable to genetic manipulation and is known to be capable of producing various products, like ethanol, acetic acid, formic acid, lactic acid, and succinic acid, effectively under various oxygenation conditions.

[0670] Integration of 4-Hydroxybutyrate Pathway Genes into Chromosome: Construction of ECKh-432. The carboxylic acid reductase enzymes were expressed in a strain of E. coli designated ECKh-761 which is a descendent of ECKh-432 with additional deletions of the sad and gabD genes encoding succinate semialdehyde dehydrogenase enzymes. This strain contained the components of the BDO pathway, leading to 4HB, integrated into the chromosome of E. coli at thefimD locus as described in Example XXI.

[0671] Cloning and Expression of Carboxylic Acid Reductase and PPTase. To generate an E. coli strain engineered to produce 1,4-butanediol, nucleic acids encoding a carboxylic acid reductase and phosphopantetheine transferase are expressed in E. coli using well known molecular biology techniques (see, for example, Sambrook, supra, 2001; Ausubel supra, 1999). In particular, car genes from Nocardia iowensis (designated 720), Mycobacterium smegmatis mc(2)155 (designated 890), Mycobacterium avium subspecies paratuberculosis K-10 (designated 891) and Mycobacterium marinum M (designated 892) were cloned into pZS*13 vectors (Expressys, Ruelzheim, Germany) under control of PA1/lacO promoters. The npt (ABI83656.1) gene (i.e., 721) was cloned into the pKJL33S vector, a derivative of the original mini-F plasmid vector PML31 under control of promoters and ribosomal binding sites similar to those used in pZS*13.

[0672] The car gene (GNM_720) was cloned by PCR from Nocardia genomic DNA. Its nucleic acid and protein sequences are shown in Figures 59A and 59B, respectively. A codon-optimized version of the npt gene (GNM_721) was synthesized by GeneArt (Regensburg, Germany). Its nucleic acid and protein sequences are shown in Figures 60A and 60B, respectively. The nucleic acid and protein sequences for the Mycobacterium smegmatis mc(2)155 (designated 890), Mycobacterium avium subspecies paratuberculosis K-10 (designated 891) and Mycobacterium marinum M (designated 892) genes and enzymes can be found in Figures 64, 65, and 66, respectively. The plasmids were transformed into ECKh-761 to express the proteins and enzymes required for 1,4-butanediol production.

[0673] Additional CAR variants were generated. A codon optimized version of CAR 891 was generated and designated 891GA. The nucleic acid and amino acid sequences of CAR 891GA are shown in Figures 67A and 67B, respectively. Over 2000 CAR variants were generated. In particular, all 20 amino acid combinations were made at positions V295, M296, G297, G391, G421, D413, G414, Y415, G416, and S417 of the CAR sequence, and additional variants were tested as well (amino acid positions corresponding to amino acid positions of sequence of Figure 67B). Exemplary CAR variants include: E16K; Q95L; LIOM; A1011T; K823E; T941S; H15Q; D198E; G446C; S392N; F699L; V8831; F467S; T987S; R12H; V295G; V295A; V295S; V295T; V295C; V295V; V295L; V2951; V295M; V295P; V295F; V295Y; V295W; V295D; V295E; V295N; V295Q; V295H; V295K; V295R; M296G; M296A; M296S; M296T; M296C; M296V; M296L; M2961; M296M; M296P; M296F; M296Y; M296W; M296D; M296E; M296N; M296Q; M296H; M296K; M296R; G297G; G297A; G297S; G297T; G297C; G297V; G297L; G2971; G297M; G297P; G297F; G297Y; G297W; G297D; G297E; G297N; G297Q; G297H; G297K; G297R; G391G; G391A; G391S; G391T; G391C; G391V; G391L; G3911; G391M; G391P; G391F; G391Y; G391W; G391D; G391E; G391N; G391Q; G391H; G391K; G391R; G421G; G421A; G421S; G421T; G421C; G421V; G421L; G4211 G421M; G421P; G421F; G421Y; G421W; G421D; G421E; G421N; G421Q; G421H; G421K; G421R; D413G; D413A; D413S; D413T; D413C; D413V; D413L; D4131; D413M; D413P; D413F; D413Y; D413W; D413D; D413E; D413N; D413Q; D413H; D413K; D413R; G414G; G414A; G414S; G414T; G414C; G414V; G414L; G4141; G414M; G414P; G414F; G414Y; G414W; G414D; G414E; G414N; G414Q; G414H; G414K; G414R; Y415G; Y415A; Y415S; Y415T; Y415C; Y415V; Y415L; Y4151; Y415M; Y415P; Y415F; Y415Y; Y415W; Y415D; Y415E; Y415N; Y415Q; Y415H; Y415K; Y415R; G416G; G416A; G416S; G416T; G416C; G416V; G416L; G4161; G416M; G416P; G416F; G416Y; G416W; G416D; G416E; G416N; G416Q; G416H; G416K; G416R; S417G; S417A; S417S; S417T; S417C; S417V S417L; S4171; S417M; S417P; S417F; S417Y; S417W; S417D; S417E; S417N; S417Q; S417H; S417K; and S417R.

[0674] The CAR variants were screened for activity, and numerous CAR variants were found to exhibit CAR activity.

[0675] Demonstration of 1,4-BDO Production using Carboxylic Acid Reductase. Functional expression of the 1,4-butanediol pathway was demonstrated using E. coli whole cellculture. Single colonies of E. coli ECKh-761 transformed with the pZS*13 and pKJL33S plasmids containing a car gene and GNM_721, respectively, were inoculated into 5 mL of LB medium containing appropriate antibiotics. Similarly, single colonies of E. coli ECKh 761 transformed with car-containing pZS*13 plasmids and pKJL33S plasmids with no insert were inoculated into additional 5 mL aliquots of LB medium containing appropriate antibiotics. Ten mL micro-aerobic cultures were started by inoculating fresh minimal in vivo conversion medium (see below) containing the appropriate antibiotics with 1.5% of the first cultures.

Recipe of the minimal in vivo conversion medium (for 1000 mL) is as follows:

Final concentration

IM MOPS/KOH buffer 100 mM

Glucose (40%) 1%

10XM9 salts solution iX MgSO4 (1 M) 1 mM trace minerals (x1000) IX 1M NaHCO3 10 mM

[0676] Microaerobic conditions were established by initially flushing capped anaerobic bottles with nitrogen for 5 minutes, then piercing the septum with an 18G needle following inoculation. The needle was kept in the bottle during growth to allow a small amount of air to enter the bottles. Protein expression was induced with 0.2 mM IPTG when the culture reached mid-log growth phase. This is considered: time = 0 hr. The culture supernatants were analyzed for BDO, 4HB, and other by-products as described above and in W02008115840 (see Table 30).

[0677] Table 32 shows the production of various products in the strains expressing various carboxylic acid reductases, including production of BDO.

Table 32. Production of various products in strains expressing various carboxylic acid reductases.

Oh Cm10 Carb100 CarbI00 Strain pKLJ33S pZS*13S pZShc13S OD600 OD600 1 761 034rbs55 no insert 0.54 2.13 5 761 721 720 0.48 1.88 7 761 721 890 0.45 1.63 8 761 721 891 0.48 1.65 9 761 721 892 0.45 1.31 12 761 no insert 720 0.50 1.72 14 761 no insert 890 0.51 1.96

15 761 no insert 891 0.19 2.36 16 761 no insert 892 0.05 1.40 48 h 48 h, mM PA Su La 4HB BDO GBL EtOHEnz 1 10.60 0.00 0.20 8.08 2.40 2.97 0.65 5 3.41 0.00 0.02 6.93 8.53 0.24 1.82 7 0.00 0.00 0.00 6.26 12.30 0.47 5.85 8 2.16 0.00 0.00 7.61 9.08 0.46 2.84 9 0.36 0.00 0.00 5.89 7.83 0.15 2.89 12 8.30 0.00 0.13 9.91 1.99 0.14 0.64 14 2.57 0.00 0.01 9.77 3.53 0.14 1.44 15 1.73 0.00 0.00 9.71 2.68 0.10 0.79 16 0.02 0.00 0.00 10.80 1.30 0.07 0.55

48 h, mM/OD PA SU La 4HB BDO GBL EtOHEnz 1 4.98 0.00 0.09 3.80 1.13 1.40 0.31 5 1.81 0.00 0.01 3.69 4.54 0.13 0.97 7 0.00 0.00 0.00 3.84 7.55 0.29 3.59 8 1.31 0.00 0.00 4.61 5.50 0.28 1.72 9 0.27 0.00 0.00 4.50 5.99 0.12 2.21 12 4.83 0.00 0.07 5.76 1.16 0.08 0.37 14 1.31 0.00 0.01 4.99 1.80 0.07 0.74 15 0.73 0.00 0.00 4.11 1.13 0.04 0.33 16 0.01 0.00 0.00 7.71 0.93 0.05 0.39

[0678] PA = pyruvate, SA= succinate, LA= lactate, 4HB = 4-hydroxybutyrate, BDO = 1,4-butanediol, GBL = gamma-butyrolactone, Etoh = ethanol, LLOQ = lower limit of quantification

[0679] These results show that various carboxylic acid reductases can function in a BDO pathway to produce BDO.

EXAMPLE XXIV 4-Hydroxybutyrate and 1,4-Butanediol Synthesis Pathways

[0680] This example describes exemplary 4-hydroxybutyrate and 1,4-butanediol synthesis pathways, which have also been described herein above.

[0681] Acetoacetyl-CoA thiolase converts two molecules of acetyl-CoA into one molecule each of acetoacetyl-CoA and CoA. Exemplary acetoacetyl-CoA thiolase enzymes include the gene products of atoB from E. coli (Martin et al., Nat. Biotechnol. 21:796-802

(2003), thiA and thiB from C. acetobutylicum (Hanai et al., Appl. Environ. Microbiol. 73:7814-7818 (2007); Winzer et al., J. Mol. Microbiol. Biotechnol. 2:531-541 (2000), and ERG10 from S. cerevisiae (Hiser et al., J. Biol. Chem. 269:31383-31389 (1994). The acetoacetyl-CoA thiolase from Zoogloea ramigerais irreversible in the biosynthetic direction and a crystal structure is available (Merilainen et al., Biochem. 48: 11011-11025 (2009)).

Protein GenBank ID GI number Organism AtoB NP_416728 16130161 Escherichiacoli ThIA NP_349476.1 15896127 Clostridium acetobutylicum ThIB NP_149242.1 15004782 Clostridium acetobutylicum ERGJO NP_015297 6325229 Saccharomyces cerevisiae phbA P07097.4 135759 Zoogloea ramigera

[0682] Acetoacetyl-CoA can also be synthesized from acetyl-CoA and malonyl-CoA by acetoacetyl-CoA synthase (EC 2.3.1.194). This enzyme (FhsA) has been characterized in the soil bacterium Streptomyces sp. CL190 where it participates in mevalonate biosynthesis (Okamura et al, PNAS USA 107:11265-11270 (2010)). As this enzyme catalyzes an essentially irreversible reaction, it is particularly useful for metabolic engineering applications for overproducing metabolites, fuels or chemicals derived from acetoacetyl CoA. For example, the enzyme has been heterologously expressed in organisms that biosynthesize butanol (Lan et al, PNAS USA (2012)) and poly-(3-hydroxybutyrate) (Matsumoto et al, Biosci Biotech Biochem, 75:364-366 (2011). Other acetoacetyl-CoA synthase genes can be identified by sequence homology tofhsA.

Protein GenBank ID GI Number Organism JhsA BAJ83474.1 325302227 Streptomyces sp CL190 AB183750.1:11991..12971 BAD86806.1 57753876 Streptomyces sp. KO-3988 epzT ADQ43379.1 312190954 Streptomyces cinnamonensis ppzT CAX48662.1 238623523 Streptomyces anulatus 03122085 ZP_09840373.1 378817444 Nocardia brasiliensis

[0683] Acetoacetyl-CoA can first be reduced to 3-hydroxybutyryl-CoA by acetoacetyl CoA reductase (ketone reducing). Acetoacetyl-CoA reductase catalyzing the reduction of acetoacetyl-CoA to 3-hydroxybutyryl-CoA participates in the acetyl-CoA fermentation pathway to butyrate in several species of Clostridiaand has been studied in detail (Jones and

Woods, Microbiol. Rev. 50:484-524 (1986)). The enzyme from Clostridium acetobutylicum, encoded by hbd, has been cloned and functionally expressed in E. coli (Youngleson et al., J. Bacteriol. 171:6800-6807 (1989)). Additionally, subunits of two fatty acid oxidation complexes in E. coli, encoded byfadB andfadJ, function as 3-hydroxyacyl-CoA dehydrogenases (Binstockand Schulz, Methods Enzymol. 71 Pt C:403-411 (1981)). Yet other gene candidates demonstrated to reduce acetoacetyl-CoA to 3-hydroxybutyryl-CoA are phbB from Zoogloea ramigera (Ploux et al., Eur. J. Biochem. 174:177-182 (1988) andphaB from Rhodobacter sphaeroides(Alber et al., Mol. Microbiol. 61:297-309 (2006). The former gene candidate is NADPH-dependent, its nucleotide sequence has been determined (Peoples and Sinskey, Mol. Microbiol. 3:349-357 (1989) and the gene has been expressed in E. coli. Substrate specificity studies on the gene led to the conclusion that it could accept 3 oxopropionyl-CoA as a substrate besides acetoacetyl-CoA (Ploux et al., Eur. J. Biochem. 174:177-182 (1988)). Additional gene candidates include Hbd1 (C-terminal domain) and Hbd2 (N-terminal domain) in Clostridium kluyveri (Hillmer and Gottschalk, Biochim. Biophys. Acta 3334:12-23 (1974)) and HSD17B10 in Bos taurus (Wakil et al., J. Biol. Chem. 207:631-638 (1954)).

Protein Genbank ID GI number Organism fadB P21177.2 119811 Escherichiacoli fadJ P77399.1 3334437 Escherichiacoli Hbd2 EDK34807.1 146348271 Clostridium kluyveri Hbdl EDK32512.1 146345976 Clostridium kluyveri hbd P52041.2 Clostridium acetobutylicum HSD17B1O 002691.3 3183024 Bos Taurus phbB P23238.1 130017 Zoogloea ramigera phaB YP_353825.1 77464321 Rhodobacter sphaeroides

[0684] A number of similar enzymes have been found in other species of Clostridiaand in Metallosphaerasedula (Berg et al., Science 318:1782-1786 (2007).

Protein GenBankID GI number Organism hbd NP_349314.1 NP_349314.1 Clostridium acetobutylicum hbd AAM14586.1 AAM14586.1 Clostridium beijerinckii Msed_1423 YP_001191505 YP_001191505 Metallosphaerasedula Msed_0399 YP_001190500 YP_001190500 Metallosphaerasedula Msed_0389 YP_001190490 YP_001190490 Metallosphaerasedula

Msed_1993 YP_001192057 YP_001192057 Metallosphaerasedula

[0685] This Example shows further enzymes that can be used in a 4-hydroxybutyrate pathway. The genes for the first enzyme, acetoacetyl-CoA thiolase are described herein above.

[0686] Exemplary 3-hydroxyacyl dehydrogenases which convert acetoacetyl-CoA to 3 hydroxybutyryl-CoA include hbd from C. acetobutylicum (Boynton et al., J. Bacteriol. 178:3015-3024 (1996), hbd from C. beijerinckii (Colby and Chen, Appl. Environ. Microbiol. 58:3297-3302 (1992), and a number of similar enzymes from Metallosphaerasedula (Berg et al., Science 318:1782-1786 (2007).

Protein GenBank ID GI Number Organism hbd NP_349314.1 15895965 Clostridium acetobutylicum hbd AAM14586.1 20162442 Clostridium beijerinckii Msed_1423 YP_001191505 146304189 Metallosphaerasedula Msed_0399 YP_001190500 146303184 Metallosphaerasedula Msed_0389 YP_001190490 146303174 Metallosphaerasedula Msed_1993 YP_001192057 146304741 Metallosphaerasedula

[0687] The gene product of crt from C. acetobutylicum catalyzes the dehydration of 3 hydroxybutyryl-CoA to crotonyl-CoA (Boynton et al., J. Bacteriol. 178:3015-3024 (1996); Atsumi et al., Metab. Eng. (2007)). Further, enoyl-CoA hydratases are reversible enzymes and thus suitable candidates for catalyzing the dehydration of 3-hydroxybutyryl-CoA to crotonyl-CoA. The enoyl-CoA hydratases, phaA andphaB, of P. putida are believed to carry out the hydroxylation of double bonds during phenylacetate catabolism (Olivera et al., Proc. Nat. Acad. Sci. U.S.A. 95:6419-6424 (1998)). The paaA and paaB from P. fluorescens catalyze analogous transformations (Olivera et al., supra). Lastly, a number of Escherichia coli genes have been shown to demonstrate enoyl-CoA hydratase functionality including maoC, paaF, and paaG (Park and Lee, J Bacteriol. 185:5391-5397 (2003); Park and Lee, Apple. Biochem. Biotechnol. 113-116:335-346 (2004); Park and Yup, Biotechnol. Bioeng. 86:681-686 (2004); Ismail et al., J. Bacteriol. 175:5097-5105 (2003)).

Protein GenBank ID GI Number Organism crt NP349318.1 15895969 Clostridium acetobutylicum paaA NP745427.1 26990002 Pseudomonasputida paaB NP745426.1 26990001 Pseudomonasputida phaA ABF82233.1 106636093 Pseudomonasfluorescens phaB ABF82234.1 106636094 Pseudomonasfluorescens maoC NP_415905.1 16129348 Escherichiacoli paaF NP_415911.1 16129354 Escherichiacoli paaG NP_415912.1 16129355 Escherichiacoli

[0688] Several enzymes that naturally catalyze the reverse reaction (i.e., the dehydration of 4-hydroxybutyryl-CoA to crotonoyl-CoA) in vivo have been identified in numerous species. This transformation is required for 4-aminobutyrate fermentation by Clostridium aminobutyricum (Scherf and Buckel, Eur. J Biochem. 215:421-429 (1993) and succinate ethanol fermentation by Clostridium kluyveri (Scherf et al., Arch. Microbiol. 161:239-245 (1994)). The transformation is also a key step in Archaea, for example, Metallosphaera sedula, as part of the 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway (Berg et al., Science 318:1782-1786 (2007)). This pathway requires the hydration of crotonoyl-CoA to form 4-hydroxybutyryl-CoA. The reversibility of 4 hydroxybutyryl-CoA dehydratase is well-documented (Muh et al., Biochemistry 35:11710 11718 (1996); Friedrich et al., Agnew Chem. Int. Ed. Engl. 47:3254-3257 (2008); Muh et al., Eur. J. Biochem. 248:380-384 (1997) and the equilibrium constant has been reported to be about 4 on the side of crotonoyl-CoA (Scherf and Buckel, Eur. J Biochem. 215:421-429 (1993). This implies that the downstream 4-hydroxybutyryl-CoA dehydrogenase must keep the 4-hydroxybutyryl-CoA concentration low so as to not create a thermodynamic bottleneck at crotonyl-CoA. The reverse reaction of 4-hydroxybutyryl-CoA dehydratase is crotonyl-CoA hydratase.

Protein GenBank ID GI Number Organism A bfD CAB60035 70910046 Clostridium aminobutyricum A bfD YP_001396399 153955634 Clostridium kluyveri Msed_1321 YP_001191403 146304087 Metallosphaerasedula Msed_1220 YP_001191305 146303989 Metallosphaerasedula

[0689] Suitable acetoacetyl-CoA and 4-hydroxybutyryl-CoA transferases are encoded by the gene products of cat], cat2, and cat3 of Clostridium kluyveri. These enzymes have been shown to exhibit succinyl-CoA, 4-hydroxybutyryl-CoA, and butyryl-CoA transferase activity, respectively (Seedorf et al., Proc. Nat. Acad. Sci. USA 105:2128-2133 (2008); Sohling and Gottschalk, JBacteriol 178:871-880 (1996)). Similar CoA transferase activities are also present in Trichomonas vaginalis (van Grinsven et al., J. Biol. Chem. 283:1411-1418 (2008)) and Trypanosoma brucei (Riviere et al., J. Biol. Chem. 279:45337-45346 (2004)). Yet another transferase capable of the desired conversions is butyryl-CoA:acetoacetate CoA transferase. Exemplary enzymes can be found in Fusobacteriumnucleatum (Barker et al., J. Bacteriol. 152(1):201-7 (1982)), Clostridium SB4 (Barker et al., J. Biol. Chem. 253(4):1219 (1978)), and Clostridiumacetobutylicum (Wiesenborn et al., Appl. Environ. Microbiol. (2):323-9 (1989)). Although specific gene sequences were not provided for butyryl CoA:acetoacetate CoA-transferase in these references, the genes FN0272 and FN0273 have been annotated as a butyrate-acetoacetate CoA-transferase (Kapatral et al., J. Bact. 184(7) 2005-2018 (2002)). Homologs in Fusobacteriumnucleatum such as FN1857 and FN1856 also likely have the desired acetoacetyl-CoA transferase activity. FN1857 and FN1856 are located adjacent to many other genes involved in lysine fermentation and are thus very likely to encode an acetoacetate:butyrate CoA transferase (Kreimeyer, et al., J. Biol. Chem. 282 (10) 7191-7197 (2007)). Additional candidates from Porphyrmonasgingivalis and Thermoanaerobactertengcongensis can be identified in a similar fashion (Kreimeyer, et al., J. Biol. Chem. 282 (10) 7191-7197 (2007)). Information related to these proteins and genes is shown below.

Protein GENBANKID GI NUMBER ORGANISM Cat] P38946.1 729048 Clostridium kluyveri Cat2 P38942.2 1705614 Clostridium kluyveri Cat3 EDK35586.1 146349050 Clostridium kluyveri TVAG395550 XP_001330176 123975034 Trichomonas vaginalis G3 Tbll.02.0290 XP_828352 71754875 Trypanosoma brucei FN0272 NP_603179.1 19703617 Fusobacteriumnucleatum FN0273 NP_603180.1 19703618 Fusobacteriumnucleatum FN1857 NP_602657.1 19705162 Fusobacteriumnucleatum FN1856 NP_602656.1 19705161 Fusobacteriumnucleatum PG1066 NP_905281.1 34540802 Porphyromonasgingivalis W83 PG1075 NP_905290.1 34540811 Porphyromonasgingivalis W83 TTE0720 NP_622378.1 20807207 Thermoanaerobacter tengcongensisMB4 TTE0721 NP_622379.1 20807208 Thermoanaerobacter tengcongensisMB4

[0690] An alternative method for removing the CoA moiety from acetoacetyl-CoA or 4 hydroxybutyryl-CoA is to apply a pair of enzymes such as a phosphate-transferring acyltransferase and a kinase to impart acetoacetyl-CoA or 4-hydroxybutyryl-CoA synthetase activity. Exemplary names for these enzymes include phosphotrans-4-hydroxybutyrylase/4 hydroxybutyrate kinase, which can remove the CoA moiety from 4-hydroxybutyryl-CoA, and phosphotransacetoacetylase/acetoacetate kinase which can remove the CoA moiety from acetoacetyl-CoA. This general activity enables the net hydrolysis of the CoA-ester of either molecule with the simultaneous generation of ATP. For example, the butyrate kinase (buk)/phosphotransbutyrylase (ptb) system from Clostridium acetobutylicum has been successfully applied to remove the CoA group from 3-hydroxybutyryl-CoA when functioning as part of a pathway for 3-hydroxybutyrate synthesis (Tseng et al., Appl. Environ. Microbiol. (10):3137-3145 (2009)). Specifically, theptb gene from C. acetobutylicum encodes an enzyme that can convert an acyl-CoA into an acyl-phosphate (Walter et al. Gene 134(1): p. 107-11 (1993)); Huang et al. JMol MicrobiolBiotechnol 2(1): p. 33-38 (2000). Additional ptb genes can be found in butyrate-producing bacterium L2-50 (Louis et al. J.Bacteriol. 186:2099-2106 (2004)) and Bacillus megaterium (Vazquez et al. Curr.Microbiol42:345-349 (2001)). Additional exemplary phosphate-transferring acyltransferases include phosphotransacetylase, encoded by pta. The pta gene from E. coli encodes an enzyme that can convert acetyl-CoA into acetyl-phosphate, and vice versa (Suzuki, T. Biochim.Biophys.Acta 191:559-569 (1969)). This enzyme can also utilize propionyl-CoA instead of acetyl-CoA forming propionate in the process (Hesslinger et al. Mol.Microbiol 27:477-492 (1998)). Information related to these proteins and genes is shown below.

Protein GENBANKID GI NUMBER ORGANISM Pta NP_416800.1 16130232 Escherichiacoli Ptb NP_349676 15896327 Clostridium acetobutylicum Ptb AAR19757.1 38425288 butyrate-producing bacterium L2-50 Ptb CAC07932.1 10046659 Bacillus megaterium

[0691] Exemplary kinases include the E. coli acetate kinase, encoded by ackA (Skarstedt and Silverstein J.Biol.Chem. 251:6775-6783 (1976)), the C. acetobutylicum butyrate kinases, encoded by buk1 and buk2 ((Walter et al. Gene 134(1):107-111 (1993); Huang et al. JMol Microbiol Biotechnol 2(1):33-38 (2000)), and the E. coli gamma-glutamyl kinase, encoded by proB (Smith et al. J.Bacteriol. 157:545-551 (1984)). These enzymes phosphorylate acetate, butyrate, and glutamate, respectively. The ackA gene product from E. coli also phosphorylates propionate (Hesslinger et al. Mol.Microbiol 27:477-492 (1998)). Information related to these proteins and genes is shown below:

Protein GENBANKID GI NUMBER ORGANISM AckA NP_416799.1 16130231 Escherichiacoli Buk] NP_349675 15896326 Clostridium acetobutylicum Buk2 Q97111 20137415 Clostridium acetobutylicum ProB NP414777.1 16128228 Escherichiacoli

[0692] Further enzymes that can be used in a 1,4-butanediol pathway. The genes for acetoacetyl-CoA thiolase, 3-Hydroxybutyryl-CoA dehydrogenase (Hbd), Crotonase (Crt), and Crotonyl-CoA hydratase (4-Budh) are described herein above. Alcohol-forming 4 hydroxybutyryl-CoA reductase enzymes catalyze the 2 reduction steps required to form 1,4 butanediol from 4-hydroxybutyryl-CoA. Exemplary 2-step oxidoreductases that convert an acyl-CoA to alcohol include those that transform substrates such as acetyl-CoA to ethanol (e.g., adhE from E. coli (Kessler et al., FEBS Lett. 281:59-63 (1991)) and butyryl-CoA to butanol (e.g. adhE2 from C. acetobutylicum (Fontaine et al., J. Bacteriol. 184:821-830 (2002)). The adhE2 enzyme from C. acetobutylicum was specifically shown in ref. (WO/2008/115840 (2008)) to produce BDO from 4-hydroxybutyryl-CoA. In addition to reducing acetyl-CoA to ethanol, the enzyme encoded by adhE in Leuconostocmesenteroides has been shown to oxide the branched chain compound isobutyraldehyde to isobutyryl-CoA (Kazahaya et al., J Gen. Apple. Microbiol. 18:43-55 (1972; Koo et al., Biotechnol. Lett. 27:505-510 (2005)).

Protein GenBank ID GI Number Organism adhE NP415757.1 16129202 Escherichiacoli adhE2 AAK09379.1 12958626 Clostridium acetobutylicum adhE AAV66076.1 55818563 Leuconostoc mesenteroides

[0693] Another exemplary enzyme can convert malonyl-CoA to 3-HP. An NADPH dependent enzyme with this activity has characterized in Chloroflexus aurantiacuswhere it participates in the 3-hydroxypropionate cycle (Hugler et al., J Bacteriol. 184:2404-2410 (2002); Strauss and Fuchs, Eur. J. Biochem. 215:633-643 (1993)). This enzyme, with a mass of 300 kDa, is highly substrate-specific and shows little sequence similarity to other known oxidoreductases (Hugler et al., J. Bacteriol. 184:2404-2410 (2002)). No enzymes in other organisms have been shown to catalyze this specific reaction; however there is bioinformatic evidence that other organisms may have similar pathways (Klatt et al., Environ. Microbiol. 9:2067-2078 (2007)). Enzyme candidates in other organisms including Roseflexus castenholzii, Erythrobactersp. NAP] and marine gamma proteobacterium HTCC2080 can be inferred by sequence similarity.

Protein GenBank ID GI Number Organism mcr AAS20429.1 42561982 Chloroflexus aurantiacus Rcas_2929 YP_001433009.1 156742880 Roseiflexus castenholzii NAP!_02720 ZP_01039179.1 85708113 Erythrobactersp. NAP]

MGP2080_00535 ZP_01626393.1 119504313 marine gamma proteobacterium HTCC2080

[0694] An alternative route to BDO from 4-hydroxybutyryl-CoA involves first reducing this compound to 4-hydroxybutanal. Several acyl-CoA dehydrogenases are capable of reducing an acyl-CoA to its corresponding aldehyde. Exemplary genes that encode such enzymes include the Acinetobacter calcoaceticusacr1 encoding a fatty acyl-CoA reductase (Reiser and Somerville, J. Bacteriol. 179:2969-2975 (1997), the Acinetobacter sp. M-1 fatty acyl-CoA reductase (Ishige et al., Appl. Environ. Microbiol. 68:1192-1195 (2002), and a CoA- and NADP- dependent succinate semialdehyde dehydrogenase encoded by the sucD gene in Clostridium kluyveri (Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996); Sohling and Gottschalk, J. Bacteriol. 178:8710880 (1996)). SucD of P. gingivalisis another succinate semialdehyde dehydrogenase (Takahashi et al., J. Bacteriol. 182:4704-4710 (2000)). These succinate semialdehyde dehydrogenases were specifically shown in ref. (WO/2008/115840 (2008)) to convert 4-hydroxybutyryl-CoA to 4-hydroxybutanal as part of a pathway to produce 1,4-butanediol. The enzyme acylating acetaldehyde dehydrogenase in Pseudomonassp, encoded by bphG, is yet another capable enzyme as it has been demonstrated to oxidize and acylate acetaldehyde, propionaldehyde, butyraldehyde, isobutyraldehyde and formaldehyde (Powlowski et al., J. Bacteriol. 175:377-385 (1993)).

Protein GenBank ID GI Number Organism acr] YP047869.1 50086359 Acinetobactercalcoaceticus acr] AAC45217 1684886 Acinetobacter baylyi acr1 BAB85476.1 18857901 Acinetobacter sp. Strain M-1 sucD P38947.1 172046062 Clostridium kluyveri sucD NP904963.1 34540484 Porphyromonasgingivalis bphG BAA03892.1 425213 Pseudomonassp

[0695] These results show that various carboxylic acid reductases can function in a BDO pathway to produce BDO. An additional enzyme type that converts an acyl-CoA to its corresponding aldehyde is malonyl-CoA reductase which transforms malonyl-CoA to malonic semialdehyde. Malonyl-CoA reductase is a key enzyme in autotrophic carbon fixation via the 3-hydroxypropionate cycle in thermoacidophilic archael bacteria (Berg et al., Science 318:1782-1786 (2007); Thauer, Science 318:1732-1733 (2007)). The enzyme utilizes NADPH as a cofactor and has been characterized inMetallosphaeraand Sulfolobus spp (Alber et al., J Bacteriol. 188:8551-8559 (2006); Hugler et al., J. Bacteriol.184:2404 2410 (2002)). The enzyme is encoded by Msed_0709 in Metallosphaerasedula (Alber et al. Mol. Microbiol. 61:297-309 (2006); Berg et al., Science 318:1782-1786 (2007)). A gene encoding a malonyl-CoA reductase from Sulfolobus tokodaii was cloned and heterologously expressed in E. coli (Alber et al., J Bacteriol. 188:8551-8559 (2006)). Although the aldehyde dehydrogenase functionality of these enzymes is similar to the bifunctional dehydrogenase from Chloroflexus aurantiacus,there is little sequence similarity. Both malonyl-CoA reductase enzyme candidates have high sequence similarity to aspartate-semialdehyde dehydrogenase, an enzyme catalyzing the reduction and concurrent dephosphorylation of aspartyl-4-phosphate to aspartate semialdehyde. Additional gene candidates can be found by sequence homology to proteins in other organisms including Sulfolobus solfataricusand Sulfolobus acidocaldarius.Yet another candidate for CoA-acylating aldehyde dehydrogenase is the aid gene from Clostridium beijerinckii(Toth, Appl. Environ. Microbiol. 65:4973-4980 (1999). This enzyme has been reported to reduce acetyl-CoA and butyryl-CoA to their corresponding aldehydes. This gene is very similar to eutE that encodes acetaldehyde dehydrogenase of Salmonella typhimurium and E. coli (Toth, Appl. Environ. Microbiol. :4973-4980 (1999). These proteins are identified below.

Protein GenBank ID GI Number Organism Msed_0709 YP_001190808.1 146303492 Metallosphaerasedula Mcr NP_378167.1 15922498 Sulfolobus tokodaii asd-2 NP_343563.1 15898958 Sulfolobus solfataricus Saci_2370 YP_256941.1 70608071 Sulfolobus acidocaldarius Ald AAT66436 49473535 Clostridium beUerinckii eutE AAA80209 687645 Salmonella typhimurium eutE P77445 2498347 Escherichiacoli

[0696] 4-Hydroxybutyryl-CoA can also be converted to 4-hydroxybutanal in several enzymatic steps, though the intermediate 4-hydroxybutyrate. First, 4-hydroxybutyryl-CoA can be converted to 4-hydroxybutyrate by a CoA transferase, hydrolase or synthetase. Alternately, 4-hydroxybutyryl-CoA can be converted to 4-hydroxybutyrate via a phosphonated intermediate by enzymes with phosphotrans-4-hydroxybutyrylase and 4 hydroxybutyrate kinase. Exemplary candidates for these enzymes are described above.

[0697] Subsequent conversion of 4-hydroxybutyrate to 4-hydroxybutanal is catalyzed by an aryl-aldehyde dehydrogenase, or equivalently a carboxylic acid reductase. Such an enzyme is found in Nocardia iowensis. Carboxylic acid reductase catalyzes the magnesium, ATP and NADPH-dependent reduction of carboxylic acids to their corresponding aldehydes (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)) and is capable of catalyzing the conversion of 4-hydroxybutyrate to 4-hydroxybutanal. This enzyme, encoded by car, was cloned and functionally expressed in E. coli (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)). Expression of the npt gene product improved activity of the enzyme via post-transcriptional modification. The npt gene encodes a specific phosphopantetheine transferase (PPTase) that converts the inactive apo-enzyme to the active holo-enzyme. The natural substrate of this enzyme is vanillic acid, and the enzyme exhibits broad acceptance of aromatic and aliphatic substrates (Venkitasubramanian et al., in Biocatalysis in the Pharmaceuticaland Biotechnology Industires, ed. R.N. Patel, Chapter 15, pp. 425-440, CRC Press LLC, Boca Raton, FL. (2006)).

Gene GI Number GenBank ID Organism name Car 40796035 AAR91681.1 Nocardiaiowensis (sp. NRRL 5646) Npt 114848891 AB183656.1 Nocardiaiowensis (sp. NRRL 5646)

[0698] Additional car and npt genes can be identified based on sequence homology.

Gene name GI Number GenBank ID Oreanism fadD9 121638475 YP_978699.1 Mycobacterium bovis BCG BCG_2812c 121638674 YP_978898.1 Mycobacterium bovis BCG nfa20150 54023983 YP_118225.1 NocardiafarcinicaIFM 10152 nfa40540 54026024 YP_120266.1 NocardiafarcinicaIFM 10152

SGR_6790 182440583 YP_001828302.1 Streptomyces griseus subsp. -__-_griseus NBRC 13350

SGR_665 182434458 YP001822177.1 Streptomyces griseus subsp. griseus NBRC 13350

MSMEG_2956 YP_887275.1 YP_887275.1 Mycobacterium smegmatis MC2 155

MSMEG_5739 YP_889972.1 118469671 Mycobacterium smegmatis MC2 155

MSMEG_2648 YP_886985.1 118471293 Mycobacterium smegmatis MC2 155 NP_959974.1 41407138 Mycobacterium avium subsp. MAP1040c paratuberculosisK-10 NP_961833.1 41408997 Mycobacterium avium subsp. MAP2899c paratuberculosisK-10

MMAR_2117 YP_001850422. 183982131 Mycobacterium marinum M Y 01

MMAR_2936 YP_001851230. 183982939 Mycobacterium marinum M

MMAR_1916 YP_001850220. 183981929 Mycobacterium marinum M

TpauDRAFT_33 ZP04027864.1 227980601 Tsukamurella paurometabola 060 DSM 20162 TpauDRAFT_20 ZP04026660.1 ZP04026660.1 Tsukamurella paurometabola 920 DSM 20162 CPCC7001132 ZP05045132.1 254431429 Cyanobium PCC7001

DDBDRAFT_01 87729 0 XP_636931.1 66806417 Dictyostelium discoideum AX4

[0699] An additional enzyme candidate found in Streptomyces griseus is encoded by the griCand griD genes. This enzyme is believed to convert 3-amino-4-hydroxybenzoic acid to 3-amino-4-hydroxybenzaldehyde as deletion of either griC or griD led to accumulation of extracellular 3-acetylamino-4-hydroxybenzoic acid, a shunt product of 3-amino-4 hydroxybenzoic acid metabolism (Suzuki, et al., J. Antibiot. 60(6):380-387 (2007)). Co expression of griC and griD with SGR_665, an enzyme similar in sequence to the Nocardia iowensis npt, can be beneficial.

Gene GI Number GenBank ID Organism name

182438036 YP001825755.1 Streptomyces griseus subsp. griC g--CgriseusNBRC 13350

Grid 182438037 YP001825756.1 Streptomyces griseus subsp. -i griseus NBRC 13350

[0700] An enzyme with similar characteristics, alpha-aminoadipate reductase (AAR, EC 1.2.1.31), participates in lysine biosynthesis pathways in some fungal species. This enzyme naturally reduces alpha-aminoadipate to alpha-aminoadipate semialdehyde. The carboxyl group is first activated through the ATP-dependent formation of an adenylate that is then reduced by NAD(P)H to yield the aldehyde and AMP. Like CAR, this enzyme utilizes magnesium and requires activation by a PPTase. Enzyme candidates for AAR and its corresponding PPTase are found in Saccharomyces cerevisiae (Morris et al., Gene 98:141 145 (1991)), Candidaalbicans (Guo et al., Mol. Genet. Genomics 269:271-279 (2003)), and Schizosaccharomycespombe (Ford et al., Curr. Genet. 28:131-137 (1995)). The AAR from S. pombe exhibited significant activity when expressed in E. coli (Guo et al., Yeast 21:1279 1288 (2004)). The AAR from Penicillium chrysogenum accepts S-carboxymethyl-L-cysteine as an alternate substrate, but did not react with adipate, L-glutamate or diaminopimelate (Hijarrubia et al., J. Biol. Chem. 278:8250-8256 (2003)). The gene encoding the P. chrysogenum PPTase has not been identified to date.

Gene name GI Number GenBank ID Organism L YS2 171867 AAA34747.1 Saccharomyces cerevisiae L YS5 1708896 P50113.1 Saccharomyces cerevisiae LYS2 2853226 AAC02241.1 Candida albicans LYS5 28136195 AA026020.1 Candida albicans LysIp 13124791 P40976.3 Schizosaccharomycespombe Lys7p 1723561 Q10474.1 Schizosaccharomycespombe Lys2 3282044 CAA74300.1 Penicillium chrysogenum

[0701] Enzymes exhibiting 1,4-butanediol dehydrogenase activity are capable of forming 1,4-butanediol from 4-hydroxybutanal. Exemplary genes encoding enzymes that catalyze the conversion of an aldehyde to alcohol (i.e., alcohol dehydrogenase or equivalently aldehyde reductase) include airA encoding a medium-chain alcohol dehydrogenase for C2-C14 (Tani Apple. Environ. Micro et al. 66:5231-5235 (2000), ADH2 from Saccharomyces cerevisiae (Aoshima et al., Mol. Microbiol. 51:791-798 (2004)), yqhD from E. coli which has preference for molecules longer than C(3) (Sulzenbacher et al., J. Mol. Biol. 342:489-502 (2004), and bdh I and bdh II from C. acetobutylicum which converts butyraldehyde into butanol (Walter et al., J. Bacteriol. 174:7149-7158 (1992)). ADHI from Zymomonas mobilis has been demonstrated to have activity on a number of aldehydes including formaldehyde, acetaldehyde, propionaldehyde, butyraldehyde, and acrolein (Kinoshita, Appl. Microbiol. Biotechnol. 22:249-254 (1985)).

Protein GenBank ID GI Number Organism airA BAB12273.1 9967138 Acinetobacter sp. Strain M-1 ADH2 NP_014032.1 6323961 Saccharymyces cerevisiae yqhD NP_417484.1 16130909 Escherichiacoli bdh I NP_349892.1 15896543 Clostridium acetobutylicum bdh II NP_349891.1 15896542 Clostridium acetobutylicum adhA YP_162971.1 56552132 Zymomonas mobilis

[0702] Enzymes exhibiting 4-hydroxybutyrate dehydrogenase activity (EC 1.1.1.61) also fall into this category. Such enzymes have been characterized in Ralstonia eutropha (Bravo et al., J. ForensicSci. 49:379-387 (2004), Clostridiumkluyveri (Wolff and Kenealy, Protein Expr. Purif. 6:206-212 (1995)) and Arabidopsis thaliana (Breitkreuz et al., J. Biol. Chem. 278:41552-41556 (2003)).

Protein GenBank ID GI Number Organism

4hbd YP_726053.1 113867564 Ralstonia eutropha H16

4hbd L21902.1 146348486 Clostridiumkluyveri DSM 555

4hbd Q94B07 75249805 Arabidopsis thaliana

EXAMPLE XXV Exemplary Hydrogenase and CO Dehydrogenase Enzymes for Extracting Reducing Equivalents from Syngas and Exemplary Reductive TCA Cycle Enzymes

[0703] Enzymes of the reductive TCA cycle useful in the non-naturally occurring microbial organisms of the present invention include one or more of ATP-citrate lyase and three C02-fixing enzymes: isocitrate dehydrogenase, alpha-ketoglutarate:ferredoxin oxidoreductase, pyruvate:ferredoxin oxidoreductase. The presence of ATP-citrate lyase or citrate lyase and alpha-ketoglutarate:ferredoxin oxidoreductase indicates the presence of an active reductive TCA cycle in an organism. Enzymes for each step of the reductive TCA cycle are shown below.

[0704] ATP-citrate lyase (ACL, EC 2.3.3.8), also called ATP citrate synthase, catalyzes the ATP-dependent cleavage of citrate to oxaloacetate and acetyl-CoA. ACL is an enzyme of the RTCA cycle that has been studied in green sulfur bacteria Chlorobium limicola and

Chlorobium tepidum. The alpha(4)beta(4) heteromeric enzyme from Chlorobium limicola was cloned and characterized in E. coli (Kanao et al., Eur. J. Biochem. 269:3409-3416 (2002). The C. limicola enzyme, encoded by aclAB, is irreversible and activity of the enzyme is regulated by the ratio of ADP/ATP. A recombinant ACL from Chlorobium tepidum was also expressed in E. coli and the holoenzyme was reconstituted in vitro, in a study elucidating the role of the alpha and beta subunits in the catalytic mechanism (Kim and Tabita, J. Bacteriol. 188:6544-6552 (2006). ACL enzymes have also been identified in Balnearium lithotrophicum, Sulfurihydrogenibiumsubterraneum and other members of the bacterial phylum Aquificae (Hugler et al., Environ. Microbiol. 9:81-92 (2007)). This acitivy has been reported in some fungi as well. Exemplary organisms include Sordariamacrospora (Nowrousian et al., Curr. Genet. 37:189-93 (2000), Aspergillus nidulans , Yarrowia lipolytica (Hynes andMurray, Eukaryotic Cell, July: 1039-1048, (2010) and Aspergillus niger (Meijeret al. J. Ind. Microbiol. Biotechnol. 36:1275-1280 (2009). Other candidates can be found based on sequence homology. Information related to these enzymes is tabulated below:

Protein GenBank ID GI Number Organism aclA BAB21376.1 12407237 Chlorobium limicola aclB BAB21375.1 12407235 Chlorobium limicola acA AAM72321.1 21647054 Chlorobium tepidum acB AAM72322.1 21647055 Chlorobium tepidum acA AB150076.1 114054981 Balnearium lithotrophicum ac/B ABI50075.1 114054980 Balnearium lithotrophicum acA ABI50085.1 114055040 Sulfurihydrogenibium subterraneum aclB AB150084.1 114055039 Sulfurihydrogenibium subterraneum aclA AAX76834.1 62199504 Sulfurimonas denitrificans aclB AAX76835.1 62199506 Sulfurimonas denitrificans acl XP_504787.1 50554757 Yarrowia lipolytica acl2 XP_503231.1 50551515 Yarrowia lipolytica SPBC1703.07 NP_596202.1 19112994 Schizosaccharomycespombe SPAC22A12.16 NP_593246.1 19114158 Schizosaccharomycespombe acl1 CAB76165.1 7160185 Sordariamacrospora acl2 CAB76164.1 7160184 Sordariamacrospora acA CBF86850.1 259487849 Aspergillus nidulans aclB CBF86848 259487848 Aspergillus nidulans

[0705] In some organisms the conversion of citrate to oxaloacetate and acetyl-CoA proceeds through a citryl-CoA intermediate and is catalyzed by two separate enzymes, citryl CoA synthetase (EC 6.2.1.18) and citryl-CoA lyase (EC 4.1.3.34) (Aoshima, M., Appl. Microbiol. Biotechnol. 75:249-255 (2007). Citryl-CoA synthetase catalyzes the activation of citrate to citryl-CoA. The Hydrogenobacterthermophilus enzyme is composed of large and small subunits encoded by ccsA and ccsB, respectively (Aoshima et al., Mol. Micrbiol. 52:751-761 (2004)). The citryl-CoA synthetase of Aquifex aeolicus is composed of alpha and beta subunits encoded by sucC1 and sucD1 (Hugler et al., Environ. Microbiol. 9:81-92 (2007)). Citryl-CoA lyase splits citryl-CoA into oxaloacetate and acetyl-CoA. This enzyme is a homotrimer encoded by ccl in Hydrogenobacterthermophilus (Aoshima et al., Mol. Microbiol. 52:763-770 (2004)) and aq_150 in Aquifex aeolicus (Hugler et al., supra (2007)). The genes for this mechanism of converting citrate to oxaloacetate and citryl-CoA have also been reported recently in Chlorobium tepidum (Eisen et al., PNAS 99(14): 9509-14 (2002).

Protein GenBank ID GI Number Organism ccsA BAD17844.1 46849514 Hydrogenobacterthermophilus ccsB BAD17846.1 46849517 Hydrogenobacterthermophilus sucCi AAC07285 2983723 Aquifex aeolicus sucD1 AAC07686 2984152 Aquifex aeolicus ccl BAD17841.1 46849510 Hydrogenobacterthermophilus aq_150 AAC06486 2982866 Aquifex aeolicus CT0380 NP_661284 21673219 Chlorobium tepidum CT0269 NP661173.1 21673108 Chlorobium tepidum CT1834 AAM73055.1 21647851 Chlorobium tepidum

[0706] Oxaloacetate is converted into malate by malate dehydrogenase (EC 1.1.1.37), an enzyme which functions in both the forward and reverse direction. S. cerevisiae possesses three copies of malate dehydrogenase, MDHJ (McAlister-Henn and Thompson, J. Bacteriol. 169:5157-5166 (1987), MDH2 (Minard and McAlister-Henn, Mol. Cell. Biol. 11:370-380 (1991); Gibson and McAlister-Henn, J. Biol. Chem. 278:25628-25636 (2003)), and MDH3 (Steffan and McAlister-Henn, J. Biol. Chem. 267:24708-24715 (1992)), which localize to the mitochondrion, cytosol, and peroxisome, respectively. E. coli is known to have an active malate dehydrogenase encoded by mdh.

Protein GenBank ID GI Number Organism MDH1 NP_012838 6322765 Saccharomyces cerevisiae MDH2 NP_014515 116006499 Saccharomyces cerevisiae MDH3 NP_010205 6320125 Saccharomyces cerevisiae Mdh NP417703.1 16131126 Escherichiacoli

[0707] Fumarate hydratase (EC 4.2.1.2) catalyzes the reversible hydration of fumarate to malate. The three fumarases of E. coli, encoded byfumA,fumB andfumC, are regulated under different conditions of oxygen availability. FumB is oxygen sensitive and is active under anaerobic conditions. FumA is active under microanaerobic conditions, and FumC is active under aerobic growth conditions (Tseng et al., J. Bacteriol. 183:461-467 (2001);Woods et al., Biochim. Biophys. Acta 954:14-26 (1988); Guest et al., J. Gen. Microbiol. 131:2971-2984 (1985)). S. cerevisiae contains one copy of a fumarase-encoding gene, FUM1, whose product localizes to both the cytosol and mitochondrion (Sass et al., J. Biol. Chem. 278:45109-45116 (2003)). Additional fumarase enzymes are found in Campylobacterjejuni(Smith et al., Int. J. Biochem. Cell. Biol. 31:961-975 (1999)), Thermus thermophilus (Mizobata et al., Arch. Biochem. Biophys. 355:49-55 (1998)) and Rattus norvegicus (Kobayashi et al., J. Biochem. 89:1923-1931 (1981)). Similar enzymes with high sequence homology includefuml from ArabidopsisthalianaandfumC from Corynebacteriumglutamicum. The MmcBC fumarase from Pelotomaculum thermopropionicumis another class of fumarase with two subunits (Shimoyama et al., FEMS Microbiol. Lett. 270:207-213 (2007)).

Protein GenBank ID GI Number Organism fumA NP_416129.1 16129570 Escherichiacoli fumB NP_418546.1 16131948 Escherichiacoli fumC NP_416128.1 16129569 Escherichiacoli FUM1 NP_015061 6324993 Saccharomyces cerevisiae fumC Q8NRN8.1 39931596 Corynebacteriumglutamicum fumC 069294.1 9789756 Campylobacterjejuni fumC P84127 75427690 Thermus thermophilus fumH P14408.1 120605 Rattus norvegicus MmcB YP_001211906 147677691 Pelotomaculum thermopropionicum

Protein GenBank ID GI Number Organism MmcC YP_001211907 147677692 Pelotomaculum thermopropionicum

[0708] Fumarate reductase catalyzes the reduction of fumarate to succinate. The fumarate reductase of E. coli, composed of four subunits encoded byfrdABCD, is membrane bound and active under anaerobic conditions. The electron donor for this reaction is menaquinone and the two protons produced in this reaction do not contribute to the proton gradient (Iverson et al., Science 284:1961-1966 (1999)). The yeast genome encodes two soluble fumarate reductase isozymes encoded by FRDS1 (Enomoto et al., DNA Res. 3:263 267 (1996)) and FRDS2 (Muratsubaki et al., Arch. Biochem. Biophys. 352:175-181 (1998)), which localize to the cytosol and promitochondrion, respectively, and are used during anaerobic growth on glucose (Arikawa et al., FEMSMicrobiol. Lett. 165:111-116 (1998)).

Protein GenBank ID GI Number Organism FRDS1 P32614 418423 Saccharomyces cerevisiae FRDS2 NP_012585 6322511 Saccharomyces cerevisiae frdA NP_418578.1 16131979 Escherichiacoli frdB NP_418577.1 16131978 Escherichiacoli frdC NP_418576.1 16131977 Escherichiacoli frdD NP_418475.1 16131877 Escherichiacoli

[0709] The ATP-dependent acylation of succinate to succinyl-CoA is catalyzed by succinyl-CoA synthetase (EC 6.2.1.5). The product of the LSCj and LSC2 genes of S. cerevisiae and the sucC and sucD genes of E. coli naturally form a succinyl-CoA synthetase complex that catalyzes the formation of succinyl-CoA from succinate with the concomitant consumption of one ATP, a reaction which is reversible in vivo (Buck et al., Biochemistry 24:6245-6252 (1985)). These proteins are identified below:

Protein GenBank ID GI Number Organism LSCJ NP_014785 6324716 Saccharomyces cerevisiae LSC2 NP_011760 6321683 Saccharomyces cerevisiae sucC NP_415256.1 16128703 Escherichiacoli sucD AAC73823.1 1786949 Escherichiacoli

[0710] Alpha-ketoglutarate:ferredoxin oxidoreductase (EC 1.2.7.3), also known as 2 oxoglutarate synthase or 2-oxoglutarate:ferredoxin oxidoreductase (OFOR), forms alpha ketoglutarate from C02 and succinyl-CoA with concurrent consumption of two reduced ferredoxin equivalents. OFOR and pyruvate:ferredoxin oxidoreductase (PFOR) are members of a diverse family of 2-oxoacid:ferredoxin (flavodoxin) oxidoreductases which utilize thiamine pyrophosphate, CoA and iron-sulfur clusters as cofactors and ferredoxin, flavodoxin and FAD as electron carriers (Adams et al., Archaea. Adv. ProteinChem. 48:101-180 (1996)). Enzymes in this class are reversible and function in the carboxylation direction in organisms that fix carbon by the RTCA cycle such as Hydrogenobacterthermophilus, Desulfobacterhydrogenophilus and Chlorobium species (Shiba et al. 1985; Evans et al., Proc. Natl. Acad. ScI. U.S.A. 55:92934 (1966); Buchanan, 1971). The two-subunit enzyme from H. thermophilus, encoded by korAB, has been cloned and expressed in E. coli (Yun et al., Biochem. Biophys. Res. Commun. 282:589-594 (2001)). A five subunit OFOR from the same organism with strict substrate specificity for succinyl-CoA, encoded byforDABGE, was recently identified and expressed in E. coli (Yun et al. Biochem. Biophys. Res. Commun. 292:280-286 (2002)). The kinetics of CO 2 fixation of both H. thermophilus OFOR enzymes have been characterized (Yamamoto et al., Extremophiles 14:79-85 (2010)). A C0 2-fixing OFOR from Chlorobium thiosulfatophilumhas been purified and characterized but the genes encoding this enzyme have not been identified to date. Enzyme candidates in Chlorobium species can be inferred by sequence similarity to the H. thermophilus genes. For example, the Chlorobium limicola genome encodes two similar proteins. Acetogenic bacteria such as Moorella thermoacetica are predicted to encode two OFOR enzymes. The enzyme encoded by Moth_0034 is predicted to function in the C0 2 -assimilating direction. The genes associated with this enzyme, Moth_0034 have not been experimentally validated to date but can be inferred by sequence similarity to known OFOR enzymes.

[0711] OFOR enzymes that function in the decarboxylation direction under physiological conditions can also catalyze the reverse reaction. The OFOR from the thermoacidophilic archaeon Sulfolobus sp. strain 7, encoded by ST2300, has been extensively studied (Zhang et al., supra, 1996. A plasmid-based expression system has been developed for efficiently expressing this protein in E. coli (Fukuda et al., Eur.J. Biochem. 268:5639-5646 (2001)) and residues involved in substrate specificity were determined (Fukuda and Wakagi, Biochim. Biophys. Acta 1597:74-80 (2002)). The OFOR encoded by Ape1472/Ape1473 from Aeropyrum pernix str. Ki was recently cloned into E. coli, characterized, and found to react with 2-oxoglutarate and a broad range of 2-oxoacids (Nishizawa et al., FEBS Lett. 579:2319 2322 (2005)). Another exemplary OFOR is encoded by oorDABC in Helicobacterpylori (Hughes et al., J. Bacteriol. 180:1119-1128 (1998)). An enzyme specific to alpha ketoglutarate has been reported in Thauera aromatica(Dorner and Boll, J. Bacteriol. 184 (14), 3975-83 (2002). A similar enzyme can be found in Rhodospirillum rubrum by sequence homology. A two subunit enzyme has also been identified in Chlorobium tepidum (Eisen et al., PNAS 99(14): 9509-14 (2002)).

Protein GenBank ID GI Number Organism korA BAB21494 12583691 Hydrogenobacterthermophilus korB BAB21495 12583692 Hydrogenobacterthermophilus forD BAB62132.1 14970994 Hydrogenobacterthermophilus forA BAB62133.1 14970995 Hydrogenobacterthermophilus forB BAB62134.1 14970996 Hydrogenobacterthermophilus forG BAB62135.1 14970997 Hydrogenobacterthermophilus forE BAB62136.1 14970998 Hydrogenobacterthermophilus Clim0204 ACD89303.1 189339900 Chlorobium limicola Clim0205 ACD89302.1 189339899 Chlorobium limicola Clim1123 ACD90192.1 189340789 Chlorobium limicola Clim1124 ACD90193.1 189340790 Chlorobium limicola Moth_1984 YP_430825.1 83590816 Moorella thermoacetica Moth_1985 YP_430826.1 83590817 Moorella thermoacetica Moth_0034 YP_428917.1 83588908 Moorella thermoacetica ST2300 NP_378302.1 15922633 Sulfolobus sp. strain 7

Ape1472 BAA80470.1 5105156 Aeropyrumpernix Ape1473 BAA80471.2 116062794 Aeropyrumpernix oorD NP_207383.1 15645213 Helicobacterpylori (AAC38210.1) (2935178) oorA NP_207384.1 15645214 Helicobacterpylori (AAC38211.1) (2935179) oorB NP_207385.1 15645215 Helicobacterpylori (AAC38212.1) (2935180) oorC NP_207386.1 15645216 Helicobacterpylori (AAC38213.1) (2935181) CT0163 NP_661069.1 21673004 Chlorobium tepidum CT0162 NP_661068.1 21673003 Chlorobium tepidum korA CAA12243.2 19571179 Thauera aromatica korB CAD27440.1 19571178 Thauera aromatica

RruA2721 YP427805.1 83594053 Rhodospirillum rubrum RruA2722 YP_427806.1 83594054 Rhodospirillum rubrum

[0712] Isocitrate dehydrogenase catalyzes the reversible decarboxylation of isocitrate to 2-oxoglutarate coupled to the reduction of NAD(P). IDH enzymes in Saccharomyces cerevisiae and Escherichiacoli are encoded by IDP1 and icd, respectively (Haselbeck and McAlister-Henn, J Biol. Chem. 266:2339-2345 (1991); Nimmo, H.G., Biochem. J. 234:317 2332 (1986)). The reverse reaction in the reductive TCA cycle, the reductive carboxylation of 2-oxoglutarate to isocitrate, is favored by the NADPH-dependent C0 2 -fixing IDH from Chlorobium limicola and was functionally expressed in E. coli (Kanao et al., Eur. J. Biochem. 269:1926-1931 (2002)). A similar enzyme with 95% sequence identity is found in the C. tepidum genome in addititon to some other candidates listed below.

Protein GenBank ID GI Number Organism Icd ACI84720.1 209772816 Escherichiacoli IDPJ AAA34703.1 171749 Saccharomyces cerevisiae ldh BAC00856.1 21396513 Chlorobium limicola lcd AAM71597.1 21646271 Chlorobium tepidum icd NP_952516.1 39996565 Geobactersulfurreducens icd YP_393560. 78777245 Sulfurimonas denitrificans

[0713] In H. thermophilusthe reductive carboxylation of 2-oxoglutarate to isocitrate is catalyzed by two enzymes: 2-oxoglutarate carboxylase and oxalosuccinate reductase. 2 Oxoglutarate carboxylase (EC 6.4.1.7) catalyzes the ATP-dependent carboxylation of alpha ketoglutarate to oxalosuccinate (Aoshima and Igarashi, Mol. Microbiol. 62:748-759 (2006)). This enzyme is a large complex composed of two subunits. Biotinylation of the large (A) subunit is required for enzyme function (Aoshima et al., Mol. Microbiol. 51:791-798 (2004)). Oxalosuccinate reductase (EC 1.1.1.-) catalyzes the NAD-dependent conversion of oxalosuccinate to D-threo-isocitrate. The enzyme is a homodimer encoded by icd in H. thermophilus. The kinetic parameters of this enzyme indicate that the enzyme only operates in the reductive carboxylation direction in vivo, in contrast to isocitrate dehydrogenase enzymes in other organisms (Aoshima and Igarashi, J. Bacteriol. 190:2050-2055 (2008)). Based on sequence homology, gene candidates have also been found in Thiobacillus denitrificansand Thermocrinis albus.

Protein GenBank ID GI Number Organism cfiA BAF34932.1 116234991 Hydrogenobacterthermophilus cifB BAF34931.1 116234990 Hydrogenobacterthermophilus Icd BAD02487.1 38602676 Hydrogenobacterthermophilus Tbd_1556 YP_315314 74317574 Thiobacillus denitrificans Tbd_1555 YP_315313 74317573 Thiobacillus denitrificans Tbd_0854 YP_314612 74316872 Thiobacillus denitrificans Thali0268 YP_003473030 289548042 Thermocrinis albus Thali0267 YP_003473029 289548041 Thermocrinis albus Thali0646 YP_003473406 289548418 Thermocrinis albus

[0714] Aconitase (EC 4.2.1.3) is an iron-sulfur-containing protein catalyzing the reversible isomerization of citrate and iso-citrate via the intermediate cis-aconitate. Two aconitase enzymes are encoded in the E. coli genome by acnA and acnB. AcnB is the main catabolic enzyme, while AcnA is more stable and appears to be active under conditions of oxidative or acid stress (Cunningham et al., Microbiology 143 (Pt 12):3795-3805 (1997)). Two isozymes of aconitase in Salmonella typhimurium are encoded by acnA and acnB (Horswill and Escalante-Semerena, Biochemistry 40:4703-4713 (2001)). The S. cerevisiae aconitase, encoded by ACO, is localized to the mitochondria where it participates in the TCA cycle (Gangloff et al., Mol. Cell. Biol. 10:3551-3561 (1990)) and the cytosol where it participates in the glyoxylate shunt (Regev-Rudzki et al., Mol. Biol. Cell. 16:4163-4171 (2005)).

Protein GenBank ID GI Number Organism acnA AAC7438.1 1787531 Escherichiacoli acnB AAC73229.1 2367097 Escherichiacoli HP0779 NP207572.1 15645398 Helicobacterpylori26695 H16B0568 CAJ95365.1 113529018 Ralstonia eutropha DesfrDRAFT_3783 ZP_07335307.1 303249064 Desulfovibriofructosovorans JJ Suden_1040 ABB44318.1 78497778 Sulfurimonas denitrificans (acnB) Hydth_0755 AD045152.1 308751669 Hydrogenobacter thermophilus CT0543 (acn) AAM71785.1 21646475 Chlorobium tepidum Clim2436 YP001944436.1 189347907 Chlorobium limicola Clim0515 ACD89607.1 189340204 Chlorobium limicola acnA NP460671.1 16765056 Salmonella typhimurium

Protein GenBank ID GI Number Organism acnB NP_459163.1 16763548 Salmonella typhimurium AC01 AAA34389.1 170982 Saccharomyces cerevisiae

[0715] Pyruvate:ferredoxin oxidoreductase (PFOR) catalyzes the reversible oxidation of pyruvate to form acetyl-CoA. The PFOR from Desulfovibrio africanus has been cloned and expressed in E. coli resulting in an active recombinant enzyme that was stable for several days in the presence of oxygen (Pieulle et al., J. Bacteriol. 179:5684-5692 (1997)). Oxygen stability is relatively uncommon in PFORs and is believed to be conferred by a 60 residue extension in the polypeptide chain of the D. africanus enzyme. Two cysteine residues in this enzyme form a disulfide bond that prtotects it against inactivation in the form of oxygen. This disulfide bond and the stability in the presence of oxygen has been found in other Desulfovibrio species also (Vita et al., Biochemistry, 47: 957-64 (2008)). The M. thermoacetica PFOR is also well characterized (Menon and Ragsdale, Biochemistry 36:8484 8494 (1997)) and was shown to have high activity in the direction of pyruvate synthesis during autotrophic growth (Furdui and Ragsdale, J. Biol. Chem. 275:28494-28499 (2000)). Further, E. coli possesses an uncharacterized open reading frame, ydbK, encoding a protein that is 51% identical to the M. thermoaceticaPFOR. Evidence for pyruvate oxidoreductase activity in E. coli has been described (Blaschkowski et al., Eur. J. Biochem. 123:563-569 (1982)). PFORs have also been described in other organisms, including Rhodobacter capsulatas (Yakunin and Hallenbeck, Biochimica et Biophysica Acta 1409 (1998) 39-49 (1998)) and Choloboumtepidum (Eisen et al., PNAS 99(14): 9509-14 (2002)). The five subunit PFOR from H. thermophilus, encoded by porEDABG, was cloned into E. coli and shown to function in both the decarboxylating and C0 2-assimilating directions (Ikeda et al., Biochem Biophys Res Commun. 340:76-82 (2006); Yamamoto et al., Extremophiles 14:79-85 (2010)). Homologs also exist in C. carboxidivoransP7. Several additional PFOR enzymes are described in the following review (Ragsdale, S.W., Chem. Rev. 103:2333-2346 (2003)). Finally, flavodoxin reductases (e.g., fqrB from Helicobacterpylorior Campylobacterjejuni) (St Maurice et al., J. Bacteriol. 189:4764-4773 (2007)) or Rnf-type proteins (Seedorf et al., Proc. Natl. Acad. Sci. U.S.A. 105:2128-2133 (2008); and Herrmann, J. Bacteriol 190:784-791 (2008)) provide a means to generate NADH or NADPH from the reduced ferredoxin generated by PFOR. These proteins are identified below.

Protein GenBank ID GI Number Organism

DesfrDRAFT_0121 ZP_07331646.1 303245362 DesulfovibriofructosovoransJJ

Por CAA70873.1 1770208 Desulfovibrio africanus por YP012236.1 46581428 Desulfovibrio vulgaris str. Hildenborough Dde_3237 ABB40031.1 78220682 DesulfoVibrio desulfuricans G20

Ddes_0298 YP_002478891.1 220903579 Desulfovibrio desulfuricans subsp. desulfuricans str. A TCC 27774

Por YP_428946.1 83588937 Moorella thermoacetica YdbK NP_415896.1 16129339 Escherichiacoli nifJ (CT1628) NP_662511.1 21674446 Chlorobium tepidum CJE1649 YP_179630.1 57238499 Campylobacterjejuni

nifJ ADE85473.1 294476085 Rhodobacter capsulatus porE BAA95603.1 7768912 Hydrogenobacterthermophilus

porD BAA95604.1 7768913 Hydrogenobacterthermophilus

porA BAA95605.1 7768914 Hydrogenobacterthermophilus porB BAA95606.1 776891 Hydrogenobacterthermophilus

porG BAA95607.1 7768916 Hydrogenobacterthermophilus

FqrB YP_001482096.1 157414840 Campylobacterjejuni

HP1164 NP_207955.1 15645778 Helicobacterpylori

RnfC EDK33306.1 146346770 Clostridium kluyveri RnfD EDK33307.1 146346771 Clostridium kluyveri RnfG EDK33308.1 146346772 Clostridium kluyveri RnfE EDK33309.1 146346773 Clostridium kluyveri RnfA EDK33310.1 146346774 Clostridium kluyveri RnfB EDK33311.1 146346775 Clostridium kluyveri

[0716] The conversion of pyruvate into acetyl-CoA can be catalyzed by several other enzymes or their combinations thereof. For example, pyruvate dehydrogenase can transform pyruvate into acetyl-CoA with the concomitant reduction of a molecule of NAD into NADH.

It is a multi-enzyme complex that catalyzes a series of partial reactions which results in acylating oxidative decarboxylation of pyruvate. The enzyme comprises of three subunits: the pyruvate decarboxylase (E1), dihydrolipoamide acyltransferase (E2) and dihydrolipoamide dehydrogenase (E3). This enzyme is naturally present in several organisms, including E. coli and S. cerevisiae. In the E. coli enzyme, specific residues in the El component are responsible for substrate specificity (Bisswanger, H., J. Biol. Chem. 256:815-82 (1981); Bremer, J., Eur. J. Biochem. 8:535-540 (1969); Gong et al., J. Biol. Chem. 275:13645-13653 (2000)). Enzyme engineering efforts have improved the E. coli PDH enzyme activity under anaerobic conditions (Kim et al., J. Bacteriol. 190:3851-3858 (2008); Kim et al., Appl. Environ. Microbiol. 73:1766-1771 (2007); Zhou et al., Biotechnol. Lett. 30:335-342 (2008)). In contrast to the E. coli PDH, the B. subtilis complex is active and required for growth under anaerobic conditions (Nakano et al., J. Bacteriol. 179:6749-6755 (1997)). The Klebsiella pneumoniae PDH, characterized during growth on glycerol, is also active under anaerobic conditions (5). Crystal structures of the enzyme complex from bovine kidney (18) and the E2 catalytic domain from Azotobacter vinelandii are available (4). Yet another enzyme that can catalyze this conversion is pyruvate formate lyase. This enzyme catalyzes the conversion of pyruvate and CoA into acetyl-CoA and formate. Pyruvate formate lyase is a common enzyme in prokaryotic organisms that is used to help modulate anaerobic redox balance. Exemplary enzymes can be found in Escherichia coli encoded by pflB (Knappe and Sawers, FEMS.Microbiol Rev. 6:383-398 (1990)), Lactococcus lactis (Melchiorsen et al., Appl Microbiol Biotechnol 58:338-344 (2002)), and Streptococcusmutans (Takahashi-Abbe et al., Oral.Microbiol Immunol. 18:293-297 (2003)). E. coli possesses an additional pyruvate formate lyase, encoded by tdcE, that catalyzes the conversion of pyruvate or 2-oxobutanoate to acetyl-CoA or propionyl-CoA, respectively (Hesslinger et al., Mol. Microbiol 27:477-492 (1998)). Both pflB and tdcE from E. coli require the presence of pyruvate formate lyase activating enzyme, encoded by pflA. Further, a short protein encoded by yfiD in E. coli can associate with and restore activity to oxygen-cleaved pyruvate formate lyase (Vey et al., Proc.Natl. Acad. Sci. U.S.A. 105:16137-16141 (2008). Note thatpflA andpflB from E. coli were expressed in S. cerevisiae as a means to increase cytosolic acetyl-CoA for butanol production as described in WO/2008/080124]. Additional pyruvate formate lyase and activating enzyme candidates, encoded by pfl and act, respectively, are found in Clostridium pasteurianum(Weidner et al., J Bacteriol. 178:2440-2444 (1996)).

[0717] Further, different enzymes can be used in combination to convert pyruvate into acetyl-CoA. For example, in S. cerevisiae, acetyl-CoA is obtained in the cytosol by first decarboxylating pyruvate to form acetaldehyde; the latter is oxidized to acetate by acetaldehyde dehydrogenase and subsequently activated to form acetyl-CoA by acetyl-CoA synthetase. Acetyl-CoA synthetase is a native enzyme in several other organisms including E. coli (Kumari et al., J. Bacteriol. 177:2878-2886 (1995)), Salmonella enterica (Starai et al., Microbiology 151:3793-3801 (2005); Starai et al., J. Biol. Chem. 280:26200-26205 (2005)), and Moorella thermoacetica (described already). Alternatively, acetate can be activated to form acetyl-CoA by acetate kinase and phosphotransacetylase. Acetate kinase first converts acetate into acetyl-phosphate with the accompanying use of an ATP molecule. Acetyl phosphate and CoA are next converted into acetyl-CoA with the release of one phosphate by phosphotransacetylase. Both acetate kinase and phosphotransacetlyase are well-studied enzymes in several Clostridiaand Methanosarcina thermophila.

[0718] Yet another way of converting pyruvate to acetyl-CoA is via pyruvate oxidase. Pyruvate oxidase converts pyruvate into acetate, using ubiquione as the electron acceptor. In E. coli, this activity is encoded by poxB. PoxB has similarity to pyruvate decarboxylase of S. cerevisiae and Zymomonas mobilis. The enzyme has a thiamin pyrophosphate cofactor (Koland and Gennis, Biochemistry 21:4438-4442 (1982)); O'Brien et al., Biochemistry 16:3105-3109 (1977); O'Brien and Gennis, J. Biol. Chem. 255:3302-3307 (1980)) and a flavin adenine dinucleotide (FAD) cofactor. Acetate can then be converted into acetyl-CoA by either acetyl-CoA synthetase or by acetate kinase and phosphotransacetylase, as described earlier. Some of these enzymes can also catalyze the reverse reaction from acetyl-CoA to pyruvate.

[0719] For enzymes that use reducing equivalents in the form of NADH or NADPH, these reduced carriers can be generated by transferring electrons from reduced ferredoxin. Two enzymes catalyze the reversible transfer of electrons from reduced ferredoxins to NAD(P)*, ferredoxin:NAD* oxidoreductase (EC 1.18.1.3) and ferredoxin:NADP oxidoreductase (FNR, EC 1.18.1.2). Ferredoxin:NADP* oxidoreductase (FNR, EC 1.18.1.2) has a noncovalently bound FAD cofactor that facilitates the reversible transfer of electrons from NADPH to low-potential acceptors such as ferredoxins or flavodoxins (Blaschkowski et al., Eur. J. Biochem. 123:563-569 (1982); Fujii et al., 1977). The HelicobacterpyloriFNR, encoded by HP1164(fqrB), is coupled to the activity of pyruvate:ferredoxin oxidoreductase

(PFOR) resulting in the pyruvate-dependent production of NADPH (St Maurice et al., J Bacteriol. 189(13):4764-4773 (2007)). An analogous enzyme is found in Campylobacter jejuni (St et al., supra, 2007). A ferredoxin:NADP+ oxidoreductase enzyme is encoded in the E. coli genome byfpr (Bianchi et al., JBacteriol. 175:1590-1595 (1993)). Ferredoxin:NAD+ oxidoreductase utilizes reduced ferredoxin to generate NADH from NAD+. In several organisms, including E. coli, this enzyme is a component of multifunctional dioxygenase enzyme complexes. The ferredoxin:NAD+ oxidoreductase of E. coli, encoded by hcaD, is a component of the 3-phenylproppionate dioxygenase system involved in involved in aromatic acid utilization (Diaz et al., J Bacteriol. 180:2915-2923 (1998)). NADH:ferredoxin reductase activity was detected in cell extracts of Hydrogenobacterthermophilus strain TK-6, although a gene with this activity has not yet been indicated (Yoon et al. 2006). NADP oxidoreductase of C. kluyveri, encoded by nfnAB, catalyzes the concomitant reduction of ferredoxin and NAD+ with two equivalents of NADPH (Wang et al., J. Bacteriol. 192: 5115 5123 (2010)). Finally, the energy-conserving membrane-associated Rnf-type proteins (Seedorf et al., Proc. Natl. Acad. Sci. U.S.A. 105:2128-2133 (2008); Herrmann et al., J. Bacteriol. 190:784-791 (2008)) provide a means to generate NADH or NADPH from reduced ferredoxin. Additional ferredoxin:NAD(P)+ oxidoreductases have been annotated in Clostridium carboxydivorans P7 and Clostridiumljungdahli.

Protein GenBank ID GI Number Organism HP1164 NP_207955.1 15645778 Helicobacterpylori RPA3954 CAE29395.1 39650872 Rhodopseudomonaspalustris fpr BAH29712.1 225320633 Hydrogenobacterthermophilus yumC NP_391091.2 255767736 Bacillus subtilis CJE0663 AAW35824.1 57167045 Campylobacterjejuni fpr P28861.4 399486 Escherichiacoi hcaD AAC75595.1 1788892 Escherichiacoli LOC100282643 NP_001149023.1 226497434 Zea mays NfnA YP_001393861.1 153953096 Clostridium kluyveri NfnB YP_001393862.1 153953097 Clostridium kluyveri RnfC EDK33306.1 146346770 Clostridium kluyveri RnfD EDK33307.1 146346771 Clostridium kluyveri RnfG EDK33308.1 146346772 Clostridium kluyveri RnfE EDK33309.1 146346773 Clostridium kluyveri RnfA EDK33310.1 146346774 Clostridium kluyveri RnfB EDK33311.1 146346775 Clostridium kluyveri

CcarbDRAFT_2639 ZP_05392639.1 255525707 ClostridiumcarboxidivoransP7 CcarbDRAFT_2638 ZP_05392638.1 255525706 ClostridiumcarboxidivoransP7 CcarbDRAFT_2636 ZP_05392636.1 255525704 ClostridiumcarboxidivoransP7 CcarbDRAFT_5060 ZP_05395060.1 255528241 ClostridiumcarboxidivoransP7 CcarbDRAFT_2450 ZP_05392450.1 255525514 ClostridiumcarboxidivoransP7 CcarbDRAFT_1084 ZP_05391084.1 255524124 ClostridiumcarboxidivoransP7 CLJU_c11410 ADK14209.1 300434442 Clostridiumljungdahli (RnjB) CLJU_c11400 ADK14208.1 300434441 Clostridiumljungdahli (RnfA) CLJU_c11390 ADK14207.1 300434440 Clostridiumljungdahli (RnfE) CLJU_c11380 ADK14206.1 300434439 Clostridiumljungdahli (RnfG) CLJU_c11370 ADK14205.1 300434438 Clostridiumljungdahli (RnfD) CLJU_c11360 ADK14204.1 300434437 Clostridiumljungdahli (RnfC)

[0720] Ferredoxins are small acidic proteins containing one or more iron-sulfur clusters that function as intracellular electron carriers with a low reduction potential. Reduced ferredoxins donate electrons to Fe-dependent enzymes such as ferredoxin-NADP oxidoreductase, pyruvate:ferredoxin oxidoreductase (PFOR) and 2-oxoglutarate:ferredoxin oxidoreductase (OFOR). The H. thermophilus genefdxl encodes a [4Fe-4S]-type ferredoxin that is required for the reversible carboxylation of 2-oxoglutarate and pyruvate by OFOR and PFOR, respectively (Yamamoto et al., Extremophiles 14:79-85 (2010)). The ferredoxin associated with the Sulfolobus solfataricus 2-oxoacid:ferredoxin reductase is a monomeric dicluster [3Fe-4S][4Fe-4S] type ferredoxin (Park et al., JBiochem Mol Biol. 39:46-54 (2006)). While the gene associated with this protein has not been fully sequenced, the N terminal domain shares 93% homology with the zfx ferredoxin from S. acidocaldarius. The E. coli genome encodes a soluble ferredoxin of unknown physiological function,fdx. Some evidence indicates that this protein can function in iron-sulfur cluster assembly (Takahashi and Nakamura, JBiochem. 126:917-926 (1999)). Additional ferredoxin proteins have been characterized in Helicobacterpylori(Mukhopadhyay et al., JBacteriol. 185:2927-2935 (2003)) and Campylobacterjejuni(van Vliet et al., FEMS Microbiol Lett. 196:189-193 (2001). A 2Fe-2S ferredoxin from Clostridiumpasteurianum has been cloned and expressed in E. coli (Fujinaga and Meyer, Biochemical and Biophysical Research Communications,

192(3):1115-1122 (1993)). Acetogenic bacteria such as Moorella thermoacetica, Clostridium carboxidivoransP7, Clostridiumljungdahli and Rhodospirillum rubrum are predicted to encode several ferredoxins, listed in the table below.

Protein GenBank ID GI Number Organism fdxI BAE02673.1 68163284 Hydrogenobacter thermophilus M11214.1 AAA83524.1 144806 Clostridiumpasteurianum Zfx AAY79867.1 68566938 Sulfolobus acidocalarius Fdx AAC75578.1 1788874 Escherichiacoli hp_0277 AAD07340.1 2313367 Helicobacterpylori fdxA CAL34484.1 112359698 Campylobacterjejuni Moth_0061 ABC18400.1 83571848 Moorella thermoacetica Moth_1200 ABC19514.1 83572962 Moorella thermoacetica Moth_1888 ABC20188.1 83573636 Moorella thermoacetica Moth_2112 ABC20404.1 83573852 Moorella thermoacetica Moth_1037 ABC19351.1 83572799 Moorella thermoacetica CcarbDRAFT_4383 ZP_05394383.1 255527515 Clostridium carboxidivorans P7 CcarbDRAFT_2958 ZP05392958.1 255526034 Clostridium carboxidivorans P7 CcarbDRAFT_2281 ZP05392281.1 255525342 Clostridium carboxidivorans P7 CcarbDRAFT_5296 ZP05395295.1 255528511 Clostridium carboxidivorans P7 CcarbDRAFT_1615 ZP05391615.1 255524662 Clostridium carboxidivorans P7 CcarbDRAFT_1304 ZP05391304.1 255524347 Clostridium carboxidivorans P7 cooF AAG29808.1 11095245 Carboxydothermus hydrogenoformans fdxN CAA35699.1 46143 Rhodobacter capsulatus RruA2264 ABC23064.1 83576513 Rhodospirillum rubrum RruA1916 ABC22716.1 83576165 Rhodospirillum rubrum RruA2026 ABC22826.1 83576275 Rhodospirillum rubrum cooF AAC45122.1 1498747 Rhodospirillum rubrum fdxN AAA26460.1 152605 Rhodospirillum rubrum Alvin_2884 ADC63789.1 288897953 Allochromatium vinosum DSM180 fdx YP002801146.1 226946073 Azotobacter vinelandii DJ CKL_3790 YP001397146.1 153956381 Clostridium kluyveri DSM

555 ferI NP949965.1 39937689 Rhodopseudomonaspalustris CGA009 fdx CAA12251.1 3724172 Thauera aromatica CHY_2405 YP361202.1 78044690 Carboxydothermus hydrogenoformans fer YP_359966.1 78045103 Carboxydothermus hydrogenoformans fer AAC83945.1 1146198 Bacillus subtilis fdxl NP249053.1 15595559 Pseudomonas aeruginosa PA01 yfhL AP_003148.1 89109368 EscherichiacoliK-12 CLJU c00930 ADK13195.1 300433428 Clostridium jungdahli CLJU cOOO0 ADK13115.1 300433348 Clostridium jungdahli CLJU c01820 ADK13272.1 300433505 Clostridium jungdahli CLJU ci7980 ADK14861.1 300435094 Clostridium jungdahli CLJU c17970 ADK14860.1 300435093 Clostridium jungdahli CLJU c22510 ADK15311.1 300435544 Clostridium jungdahli CLJU c26680 ADK15726.1 300435959 Clostridium jungdahli CLJU c29400 ADK15988.1 300436221 Clostridium ljungdahli

[0721] Succinyl-CoA transferase catalyzes the conversion of succinyl-CoA to succinate while transferring the CoA moiety to a CoA acceptor molecule. Many transferases have broad specificity and can utilize CoA acceptors as diverse as acetate, succinate, propionate, butyrate, 2-methylacetoacetate, 3-ketohexanoate, 3-ketopentanoate, valerate, crotonate, 3 mercaptopropionate, propionate, vinylacetate, and butyrate, among others.

[0722] The conversion of succinate to succinyl-CoA can be carried by a transferase which does not require the direct consumption of an ATP or GTP. This type of reaction is common in a number of organisms. The conversion of succinate to succinyl-CoA can also be catalyzed by succinyl-CoA:Acetyl-CoA transferase. The gene product of cat] of Clostridium kluyveri has been shown to exhibit succinyl-CoA: acetyl-CoA transferase activity (Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996)). In addition, the activity is present in Trichomonas vaginalis (van Grinsven et al., JBiol Chem. 283:1411-1418 (2008)) and Trypanosoma brucei (Riviere et al., J Biol Chem. 279(44):45337-45346 (2004)). The succinyl-CoA:acetate CoA-transferase from Acetobacter aceti, encoded by aarC,replaces succinyl-CoA synthetase in a variant TCA cycle (Mullins et al., J. Bacteriol. 190(14):4933 4940 (2008)). Similar succinyl-CoA transferase activities are also present in Trichomonas vaginalis (van Grinsven et al., supra 2008), Trypanosoma brucei (Riviere et al., supra 2004) and Clostridium kluyveri (Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996)). The beta-ketoadipate:succinyl-CoA transferase encoded bypcal andpcaJinPseudomonasputida is yet another candidate (Kaschabek et al., J. Bacteriol. 184(1):207-215 (2002). The aforementioned proteins are identified below.

Protein GenBank ID GI Number Organism cat] P38946.1 729048 Clostridium kluyveri TVA G_395550 XP_001330176 123975034 Trichomonas vaginalis G3 Tbll.02.0290 XP_828352 71754875 Trypanosoma brucei pcaI AAN69545.1 24985644 Pseudomonasputida pcaJ NP_746082.1 26990657 Pseudomonasputida aarC ACD85596.1 189233555 Acetobacter aceti

[0723] An additional exemplary transferase that converts succinate to succinyl-CoA while converting a 3-ketoacyl-CoA to a 3-ketoacid is succinyl-CoA:3:ketoacid-CoA transferase (EC 2.8.3.5). Exemplary succinyl-CoA:3:ketoacid-CoA transferases are present in Helicobacterpylori(Corthesy-Theulaz et al., J Biol. Chem. 272(41):25659-25667 (1997)), Bacillus subtilis, and Homo sapiens (Fukao et al., Genomics 68(2):144-151 (2000); Tanaka et al., Mol Hum Reprod. 8(1):16-23 (2002)). The aforementioned proteins are identified below.

Protein GenBank ID GI Number Organism HPAG1_0676 YP_627417 108563101 Helicobacterpylori HPAG1_0677 YP_627418 108563102 Helicobacterpylori ScoA NP_391778 16080950 Bacillus subtilis ScoB NP_391777 16080949 Bacillus subtilis OXCT1 NP_000427 4557817 Homo sapiens OXCT2 NP_071403 11545841 Homo sapiens

[0724] Converting succinate to succinyl-CoA by succinyl-CoA:3:ketoacid-CoA transferase requires the simultaneous conversion of a 3-ketoacyl-CoA such as acetoacetyl CoA to a 3-ketoacid such as acetoacetate. Conversion of a 3-ketoacid back to a 3-ketoacyl CoA can be catalyzed by an acetoacetyl-CoA:acetate:CoA transferase. Acetoacetyl CoA:acetate:CoA transferase converts acetoacetyl-CoA and acetate to acetoacetate and acetyl-CoA, or vice versa. Exemplary enzymes include the gene products of atoAD from E. coli (Hanai et al., Appl Environ Microbiol 73:7814-7818 (2007), ctfAB from C.

acetobutylicum (Jojima et al., Appl Microbiol Biotechnol 77:1219-1224 (2008), andctfAB from Clostridiumsaccharoperbutylacetonicum(Kosaka et al., Biosci.BiotechnolBiochem. 71:58-68 (2007)) are shown below.

Protein GenBank ID GI Number Organism AtoA NP_416726.1 2492994 Escherichiacoli AtoD NP_416725.1 2492990 Escherichiacoli CtfA NP_149326.1 15004866 Clostridium acetobutylicum CtfB NP_149327.1 15004867 Clostridium acetobutylicum CtfA AAP42564.1 31075384 Clostridium saccharoperbutylacetonicum CtfB AAP42565.1 31075385 Clostridium saccharoperbutylacetonicum

[0725] Yet another possible CoA acceptor is benzylsuccinate. Succinyl-CoA:(R) Benzylsuccinate CoA-Transferase functions as part of an anaerobic degradation pathway for toluene in organisms such as Thauera aromatica(Leutwein and Heider, J Bact. 183(14) 4288-4295 (2001)). Homologs can be found in Azoarcus sp. T, Aromatoleum aromaticum EbN1, and GeobactermetallireducensGS-15. The aforementioned proteins are identified below.

Protein GenBank ID GI Number Organism bbsE AAF89840 9622535 Thauera aromatica Bbsf AAF89841 9622536 Thauera aromatica bbsE AAU45405.1 52421824 Azoarcus sp. T bbsF AAU45406.1 52421825 Azoarcus sp. T bbsE YP158075.1 56476486 Aromatoleum aromaticumEbN bbsF YP158074.1 56476485 Aromatoleum aromaticumEbNJ Gmet_1521 YP384480.1 78222733 Geobactermetallireducens GS-15 Gmet_1522 YP384481.1 78222734 Geobactermetallireducens GS-15

[0726] Additionally, ygfH encodes a propionyl CoA:succinate CoA transferase in E. coli (Haller et al., Biochemistry, 39(16) 4622-4629). Close homologs can be found in, for example, Citrobacteryoungae ATCC 29220, Salmonella enterica subsp. arizonaeserovar, and Yersinia intermedia ATCC 29909. The aforementioned proteins are identified below.

Protein GenBank ID GI Number Organism ygfH NP_417395.1 16130821 Escherichia coli str. K-12 substr. MG1655 CIT29204485 ZP03838384.1 227334728 Citrobacteryoungae A TCC 29220

SARI_04582 YP_001573497.1 161506385 Salmonella enterica subsp. arizonae serovar yinteO00114430 ZP_04635364.1 238791727 Yersinia intermedia A TCC 29909

[0727] Citrate lyase (EC 4.1.3.6) catalyzes a series of reactions resulting in the cleavage of citrate to acetate and oxaloacetate. The enzyme is active under anaerobic conditions and is composed of three subunits: an acyl-carrier protein (ACP, gamma), an ACP transferase (alpha), and a acyl lyase (beta). Enzyme activation uses covalent binding and acetylation of an unusual prosthetic group, 2'-(5"-phosphoribosyl)-3-'-dephospho-CoA, which is similar in structure to acetyl-CoA. Acylation is catalyzed by CitC, a citrate lyase synthetase. Two additional proteins, CitG and CitX, are used to convert the apo enzyme into the active holo enzyme (Schneider et al., Biochemistry 39:9438-9450 (2000)). Wild type E. coli does not have citrate lyase activity; however, mutants deficient in molybdenum cofactor synthesis have an active citrate lyase (Clark, FEMSMicrobiol. Lett. 55:245-249 (1990)). The E. coli enzyme is encoded by citEFDand the citrate lyase synthetase is encoded by citC (Nilekani and SivaRaman, Biochemistry 22:4657-4663 (1983)). The Leuconostoc mesenteroides citrate lyase has been cloned, characterized and expressed in E. coli (Bekal et al., J Bacteriol. 180:647-654 (1998)). Citrate lyase enzymes have also been identified in enterobacteria that utilize citrate as a carbon and energy source, including Salmonella typhimurium and Klebsiellapneumoniae (Bott, Arch. Microbiol. 167: 78-88 (1997); Bott and Dimroth, Mol. Microbiol. 14:347-356 (1994)). The aforementioned proteins are tabulated below.

Protein GenBank ID GI Number Organism

citF AAC73716.1 1786832 Escherichiacoli

Cite AAC73717.2 87081764 Escherichiacoli

citD AAC73718.1 1786834 Escherichiacoli

citC AAC73719.2 87081765 Escherichiacoli

citG AAC73714.1 1786830 Escherichiacoli

citX AAC73715.1 1786831 Escherichiacoli

citF CAA71633.1 2842397 Leuconostoc mesenteroides

Cite CAA71632.1 2842396 Leuconostoc mesenteroides

citD CAA71635.1 2842395 Leuconostoc mesenteroides

citC CAA71636.1 3413797 Leuconostoc mesenteroides

Protein GenBank ID GI Number Organism

citG CAA71634.1 2842398 Leuconostoc mesenteroides

citX CAA71634.1 2842398 Leuconostoc mesenteroides

citF NP_459613.1 16763998 Salmonella typhimurium

cite AAL19573.1 16419133 Salmonella typhimurium

citD NP_459064.1 16763449 Salmonella typhimurium

citC NP_459616.1 16764001 Salmonella typhimurium

citG NP_459611.1 16763996 Salmonella typhimurium

citX NP_459612.1 16763997 Salmonella typhimurium

citF CAA56217.1 565619 Klebsiellapneumoniae

cite CAA56216.1 565618 Klebsiellapneumoniae

citD CAA56215.1 565617 Klebsiellapneumoniae

citC BAH66541.1 238774045 Klebsiellapneumoniae

citG CAA56218.1 565620 Klebsiellapneumoniae

citX AAL60463.1 18140907 Klebsiellapneumoniae

[0728] Acetate kinase (EC 2.7.2.1) catalyzes the reversible ATP-dependent phosphorylation of acetate to acetylphosphate. Exemplary acetate kinase enzymes have been characterized in many organisms including E. coli, Clostridium acetobutylicum and Methanosarcinathermophila(Ingram-Smith et al., J. Bacteriol. 187:2386-2394 (2005); Fox and Roseman, J. Biol. Chem. 261:13487-13497 (1986); Winzer et al., Microbioloy 143 (Pt ):3279-3286 (1997)). Acetate kinase activity has also been demonstrated in the gene product of E. colipurT (Marolewski et al., Biochemistry 33:2531-2537 (1994). Some butyrate kinase enzymes (EC 2.7.2.7), for example buk1 and buk2 from Clostridium acetobutylicum, also accept acetate as a substrate (Hartmanis, M.G., J. Biol. Chem. 262:617 621 (1987)).

Protein GenBank ID GI Number Organism ackA NP_416799.1 16130231 Escherichiacoli Ack AAB18301.1 1491790 Clostridium acetobutylicum Ack AAA72042.1 349834 Methanosarcinathermophila purT AAC74919.1 1788155 Escherichiacoli

Protein GenBank ID GI Number Organism buki NP_349675 15896326 Clostridium acetobutylicum buk2 Q97111 20137415 Clostridium acetobutylicum

[0729] The formation of acetyl-CoA from acetylphosphate is catalyzed by phosphotransacetylase (EC 2.3.1.8). The pta gene from E. coli encodes an enzyme that reversibly converts acetyl-CoA into acetyl-phosphate (Suzuki, T., Biochim. Biophys. Acta 191:559-569 (969)). Additional acetyltransferase enzymes have been characterized in Bacillus subtilis (Rado and Hoch, Biochim. Biophys. Acta 321:114-125 (1973), Clostridium kluyveri (Stadtman, E., Methods Enzymol. 1:5896-599 (1955), and Thermotoga maritima (Bock et al., J. Bacteriol. 181:1861-1867 (1999)). This reaction is also catalyzed by some phosphotranbutyrylase enzymes (EC 2.3.1.19) including the ptb gene products from Clostridium acetobutylicum (Wiesenborn et al., App. Environ. Microbiol. 55:317-322 (1989); Walter et al., Gene 134:107-111 (1993)). Additional ptb genes are found in butyrate producing bacterium L2-50 (Louis et al., J. Bacteriol. 186:2099-2106 (2004) and Bacillus megaterium (Vazquez et al., Curr. Microbiol. 42:345-349 (2001).

Protein GenBank ID GI Number Organism Pta NP_416800.1 71152910 Escherichiacoli Pta P39646 730415 Bacillus subtilis Pta A5N801 146346896 Clostridium kluyveri Pta Q9XOL4 6685776 Thermotoga maritima Ptb NP_349676 34540484 Clostridium acetobutylicum Ptb AAR19757.1 butyrate-producing bacterium 38425288 L2-50 Ptb CAC07932.1 10046659 Bacillus megaterium

[0730] The acylation of acetate to acetyl-CoA is catalyzed by enzymes with acetyl-CoA synthetase activity. Two enzymes that catalyze this reaction are AMP-forming acetyl-CoA synthetase (EC 6.2.1.1) and ADP-forming acetyl-CoA synthetase (EC 6.2.1.13). AMP forming acetyl-CoA synthetase (ACS) is the predominant enzyme for activation of acetate to acetyl-CoA. Exemplary ACS enzymes are found in E. coli (Brown et al., J. Gen. Microbiol. 102:327-336 (1977)), Ralstonia eutropha (Priefert and Steinbuchel, J. Bacteriol. 174:6590 6599 (1992)), Methanothermobacterthermautotrophicus(Ingram-Smith and Smith, Archaea 2:95-107 (2007)), Salmonella enterica (Gulick et al., Biochemistry 42:2866-2873 (2003)) and Saccharomyces cerevisiae (Jogl and Tong, Biochemistry 43:1425-1431 (2004)). ADP- forming acetyl-CoA synthetases are reversible enzymes with a generally broad substrate range (Musfeldt and Schonheit, J. Bacteriol. 184:636-644 (2002)). Two isozymes of ADP forming acetyl-CoA synthetases are encoded in the Archaeoglobusfulgidus genome by are encoded by AF1211 and AF1983 (Musfeldt and Schonheit, supra (2002)). The enzyme from Haloarculamarismortui (annotated as a succinyl-CoA synthetase) also accepts acetate as a substrate and reversibility of the enzyme was demonstrated (Brasen and Schonheit, Arch. Microbiol. 182:277-287 (2004)). The ACD encoded by PAE3250 from hyperthermophilic crenarchaeon Pyrobaculum aerophilum showed the broadest substrate range of all characterized ACDs, reacting with acetate, isobutyryl-CoA (preferred substrate) and phenylacetyl-CoA (Brasen and Schonheit, supra (2004)). Directed evolution or engineering can be used to modify this enzyme to operate at the physiological temperature of the host organism. The enzymes from A.fulgidus, H. marismortuiand P. aerophilum have all been cloned, functionally expressed, and characterized in E. coli (Brasen and Schonheit, supra (2004); Musfeldt and Schonheit, supra (2002)). Additional candidates include the succinyl CoA synthetase encoded by sucCD in E. coli (Buck et al., Biochemistry 24:6245-6252 (1985)) and the acyl-CoA ligase from Pseudomonasputida (Femandez-Valverde et al., Appl. Environ. Microbiol. 59:1149-1154 (1993)). The aforementioned proteins are tabulated below.

Protein GenBank ID GI Number Organism acs AAC77039.1 1790505 Escherichiacoli acoE AAA21945.1 141890 Ralstonia eutropha acs] ABC87079.1 86169671 Methanothermobacter thermautotrophicus acs] AAL23099.1 16422835 Salmonella enterica ACS] Q01574.2 257050994 Saccharomyces cerevisiae AF1211 NP_070039.1 11498810 Archaeoglobusfulgidus AF1983 NP_070807.1 11499565 Archaeoglobusfulgidus scs YP_135572.1 55377722 Haloarculamarismortui PAE3250 NP_560604.1 18313937 Pyrobaculum aerophilum str. IM2 sucC NP_415256.1 16128703 Escherichiacoli sucD AAC73823.1 1786949 Escherichiacoli paaF AAC24333.2 22711873 Pseudomonasputida

[0731] The product yields per C-mol of substrate of microbial cells synthesizing reduced fermentation products such as 1,4-butanediol, 4-hydroxybutyrate and/or gamma- butyrolactone, are limited by insufficient reducing equivalents in the carbohydrate feedstock. Reducing equivalents, or electrons, can be extracted from synthesis gas components such as CO and H 2 using carbon monoxide dehydrogenase (CODH) and hydrogenase enzymes, respectively. The reducing equivalents are then passed to acceptors such as oxidized ferredoxins, oxidized quinones, oxidized cytochromes, NAD(P)+, water, or hydrogen peroxide to form reduced ferredoxin, reduced quinones, reduced cytochromes, NAD(P)H, H 2

, or water, respectively. Reduced ferredoxin and NAD(P)H are particularly useful as they can serve as redox carriers for various Wood-Ljungdahl pathway and reductive TCA cycle enzymes.

[0732] Here, we show specific examples of how additional redox availability from CO and/or H2 can improve the yields of reduced products such as 1,4-butanediol, 4 hydroxybutyrate and/or gamma-butyrolactone. The maximum theoretical yield to produce 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone from glucose is 1.09 mol BDO/mol glucose, 1.33 mol 4HB/mol glucose and 1.33 mol GBL/mol glucose under anaerobic conditions. Using reducing equivalents from CO, H 2 and their various combinations in conjunction with carbohydrate feedstocks, such as glucose, yields of all three products can be improved to 2 mole/mole glucose

[0733] When both feedstocks of sugar and syngas are available, the syngas components CO and H 2 can be utilized to generate reducing equivalents by employing the hydrogenase and CO dehydrogenase. The reducing equivalents generated from syngas components will be utilized to power the glucose to 1,4-butanediol, 4-hydroxybutyrate and/or gamma butyrolactone production pathways. Theoretically, all carbons in glucose will be conserved, thus resulting in a maximal theoretical yield to produce 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone from glucose at 2 mole of 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone per mol of glucose under either aerobic or anaerobic conditions.

[0734] As shown in above example, a combined feedstock strategy where syngas is combined with a sugar-based feedstock or other carbon substrate can greatly improve the theoretical yields. In this co-feeding appoach, syngas components H2 and CO can be utilized by the hydrogenase and CO dehydrogenase to generate reducing equivalents, that can be used to power chemical production pathways in which the carbons from sugar or other carbon substrates will be maximally conserved and the theoretical yields improved. For example, improved 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone production from glucose or sugar can be achieved. Such improvements provide environmental and economic benefits and greatly enhance sustainable chemical production.

[0735] Herein below the enzymes and the corresponding genes used for extracting redox from synags components are described. CODH is a reversible enzyme that interconverts CO and CO2 at the expense or gain of electrons. The natural physiological role of the CODH in ACS/CODH complexes is to convert CO2 to CO for incorporation into acetyl-CoA by acetyl CoA synthase. Nevertheless, such CODH enzymes are suitable for the extraction of reducing equivalents from CO due to the reversible nature of such enzymes. Expressing such CODH enzymes in the absence of ACS allows them to operate in the direction opposite to their natural physiological role (i.e., CO oxidation).

[0736] In M. thermoacetica, C. hydrogenoformans, C. carboxidivoransP7, and several other organisms, additional CODH encoding genes are located outside of the ACS/CODH operons. These enzymes provide a means for extracting electrons (or reducing equivalents) from the conversion of carbon monoxide to carbon dioxide. The M. thermoacetica gene (Genbank Accession Number: YP_430813) is expressed by itself in an operon and is believed to transfer electrons from CO to an external mediator like ferredoxin in a "Ping-pong" reaction. The reduced mediator then couples to other reduced nicolinamide adenine dinucleotide phosphate (NAD(P)H) carriers or ferredoxin-dependent cellular processes (Ragsdale, Annals of the New York Academy ofSciences 1125: 129-136 (2008)). The genes encoding the C. hydrogenoformans CODH-II and CooF, a neighboring protein, were cloned and sequenced (Gonzalez and Robb, FEMS Microbiol Lett. 191:243-247 (2000)). The resulting complex was membrane-bound, although cytoplasmic fractions of CODH-II were shown to catalyze the formation of NADPH suggesting an anabolic role (Svetlitchnyi et al., J Bacteriol. 183:5134-5144 (2001)). The crystal structure of the CODH-II is also available (Dobbek et al., Science 293:1281-1285 (2001)). Similar ACS-free CODH enzymes can be found in a diverse array of organisms including Geobactermetallireducens GS-15, Chlorobium phaeobacteroidesDSM 266, Clostridium celluolyticum H 10, Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774, PelobactercarbinolicusDSM 2380, C. jungdahli and Campylobactercurvus 525.92.

Protein GenBank ID GI Number Organism CODH (putative) YP_430813 83590804 Moorella thermoacetica CODH-II (CooS-I) YP_358957 78044574 Carboxydothermus hydrogenoformans CooF YP_358958 78045112 Carboxydothermus hydrogenoformans CODH (putative) ZP_05390164.1 255523193 Clostridium carboxidivorans P7 CcarbDRAFT_0341 ZP_05390341.1 255523371 Clostridium carboxidivorans P7 CcarbDRAFT_1756 ZP_05391756.1 255524806 Clostridium carboxidivorans P7 CcarbDRAFT_2944 ZP_05392944.1 255526020 Clostridium carboxidivorans P7 CODH YP_384856.1 78223109 Geobactermetallireducens GS 15 Cpha266_0148 YP_910642.1 119355998 Chlorobium (cytochrome c) phaeobacteroidesDSM 266 Cpha266_0149 YP_910643.1 119355999 Chlorobium (CODH) phaeobacteroidesDSM 266 Ccel_0438 YP_002504800.1 220927891 Clostridium cellulolyticum H1O Ddes_0382 YP_002478973.1 220903661 Desulfovibrio desulfuricans (CODH) subsp. desulfuricans str. A TCC 27774 Ddes_0381 (CooC) YP_002478972.1 220903660 Desulfovibrio desulfuricans subsp. desulfuricans str. A TCC 27774 Pcar_0057 YP_355490.1 7791767 PelobactercarbinoicusDSM (CODH) 2380 Pcar_0058 YP_355491.1 7791766 PelobactercarbinolicusDSM (CooC) 2380 Pcar_0058 YP_355492.1 7791765 PelobactercarbinolicusDSM (HypA) 2380 CooS (CODH) YP001407343.1 154175407 Campylobactercurvus 525.92 CLJUc09110 ADK13979.1 300434212 Clostridium ljungdahli CLJUc09100 ADK13978.1 300434211 Clostridiumljungdahli CLJUc09090 ADK13977.1 300434210 Clostridium jungdahli

[0737] In some cases, hydrogenase encoding genes are located adjacent to a CODH. In Rhodospirillum rubrum, the encoded CODH/hydrogenase proteins form a membrane-bound enzyme complex that has been indicated to be a site where energy, in the form of a proton gradient, is generated from the conversion of CO and H2 0 to CO2 and H 2 (Fox et al., J Bacteriol. 178:6200-6208 (1996)). The CODH-I of C. hydrogenoformans and its adjacent genes have been proposed to catalyze a similar functional role based on their similarity to the

R. rubrum CODH/hydrogenase gene cluster (Wu et al., PLoS Genet. 1:e65 (2005)). The C. hydrogenoformans CODH-I was also shown to exhibit intense CO oxidation and CO 2 reduction activities when linked to an electrode (Parkin et al., JAm.Chem.Soc. 129:10328 10329 (2007)). The protein sequences of exemplary CODH and hydrogenase genes can be identified by the following GenBank accession numbers.

Protein GenBank ID GI Number Organism CODH-I YP_360644 78043418 Carboxydothermushydrogenoformans (CooS-I) CooF YP_360645 78044791 Carboxydothermushydrogenoformans HypA YP_360646 78044340 Carboxydothermushydrogenoformans CooH YP_360647 78043871 Carboxydothermushydrogenoformans CooU YP_360648 78044023 Carboxydothermushydrogenoformans CooX YP_360649 78043124 Carboxydothermushydrogenoformans CooL YP_360650 78043938 Carboxydothermushydrogenoformans CooK YP_360651 78044700 Carboxydothermushydrogenoformans CooM YP_360652 78043942 Carboxydothermushydrogenoformans CooC YP_360654.1 78043296 Carboxydothermushydrogenoformans CooA-1 YP_360655.1 78044021 Carboxydothermushydrogenoformans CooL AAC45118 1515468 Rhodospirillum rubrum CooX AAC45119 1515469 Rhodospirillum rubrum CooU AAC45120 1515470 Rhodospirillum rubrum CooH AAC45121 1498746 Rhodospirillum rubrum CooF AAC45122 1498747 Rhodospirillum rubrum CODH AAC45123 1498748 Rhodospirillum rubrum (CooS) CooC AAC45124 1498749 Rhodospirillum rubrum CooT AAC45125 1498750 Rhodospirillum rubrum CooJ AAC45126 1498751 Rhodospirillum rubrum

[0738] Native to E. coli and other enteric bacteria are multiple genes encoding up to four hydrogenases (Sawers, G., Antonie Van Leeuwenhoek 66:57-88 (1994); Sawers et al., J Bacteriol. 164:1324-1331 (1985); Sawers and Boxer, Eur.JBiochem. 156:265-275 (1986); Sawers et al., JBacteriol. 168:398-404 (1986)). Given the multiplicity of enzyme activities, E. coli or another host organism can provide sufficient hydrogenase activity to split incoming molecular hydrogen and reduce the corresponding acceptor. E. coli possesses two uptake hydrogenases, Hyd-1 and Hyd-2, encoded by the hyaABCDEFand hybOABCDEFG gene clusters, respectively (Lukey et al., How E. coli is equipped to oxidize hydrogen under different redox conditions, JBiol Chem published online Nov 16, 2009 (285(6):3928-3938 (2010)). Hyd-1 is oxygen-tolerant, irreversible, and is coupled to quinone reduction via the hyaC cytochrome. Hyd-2 is sensitive to 02, reversible, and transfers electrons to the periplasmic ferredoxin hybA which, in turn, reduces a quinone via the hybB integral membrane protein. Reduced quinones can serve as the source of electrons for fumarate reductase in the reductive branch of the TCA cycle. Reduced ferredoxins can be used by enzymes such as NAD(P)H:ferredoxin oxidoreductases to generate NADPH or NADH. They can alternatively be used as the electron donor for reactions such as pyruvate ferredoxin oxidoreductase, AKG ferredoxin oxidoreductase, and 5,10-methylene-H4folate reductase.

Protein GenBank ID GI Number Organism HyaA AAC74057.1 1787206 Escherichiacoli HyaB AAC74058.1 1787207 Escherichiacoli HyaC AAC74059.1 1787208 Escherichiacoli HyaD AAC74060.1 1787209 Escherichiacoli HyaE AAC74061.1 1787210 Escherichiacoli HyaF AAC74062.1 1787211 Escherichiacoli

Protein GenBank ID GI Number Organism HybO AAC76033.1 1789371 Escherichiacoli HybA AAC76032.1 1789370 Escherichiacoli HybB AAC76031.1 2367183 Escherichiacoli HybC AAC76030.1 1789368 Escherichiacoli HybD AAC76029.1 1789367 Escherichiacoli HybE AAC76028.1 1789366 Escherichiacoli HybF AAC76027.1 1789365 Escherichiacoli HybG AAC76026.1 1789364 Escherichiacoli

[0739] The hydrogen-lyase systems of E. coli include hydrogenase 3, a membrane-bound enzyme complex using ferredoxin as an acceptor, and hydrogenase 4 that also uses a ferredoxin acceptor. Hydrogenase 3 and 4 are encoded by the hyc and hyfgene clusters, respectively. Hydrogenase 3 has been shown to be a reversible enzyme (Maeda et al., Appi Microbiol Biotechnol 76(5):1035-42 (2007)). Hydrogenase activity in E. coli is also dependent upon the expression of the hyp genes whose corresponding proteins are involved in the assembly of the hydrogenase complexes (Jacobi et al., Arch.Microbiol 158:444-451 (1992); Rangarajan et al., J. Bacteriol. 190:1447-1458 (2008)).

Protein GenBank ID GI Number Organism HycA NP_417205 16130632 Escherichiacoli HycB NP_417204 16130631 Escherichiacoli HycC NP_417203 16130630 Escherichiacoli HycD NP_417202 16130629 Escherichiacoli HycE NP_417201 16130628 Escherichiacoli HycF NP_417200 16130627 Escherichiacoli HycG NP_417199 16130626 Escherichiacoli HycH NP417198 16130625 Escherichiacoli HycI NP_417197 16130624 Escherichiacoli

Protein GenBank ID GI Number Organism HyfA NP_416976 90111444 Escherichiacoli HyfB NP_416977 16130407 Escherichiacoli HyfC NP_416978 90111445 Escherichiacoli HyfD NP_416979 16130409 Escherichiacoli HyfE NP_416980 16130410 Escherichiacoli HyfF NP_416981 16130411 Escherichiacoli HyfG NP_416982 16130412 Escherichiacoli HyfH NP_416983 16130413 Escherichiacoli Hyff NP_416984 16130414 Escherichiacoli HyfJ NP_416985 90111446 Escherichiacoli HyfR NP_416986 90111447 Escherichiacoli

Protein GenBank ID GI Number Organism HypA NP_417206 16130633 Escherichiacoli HypB NP_417207 16130634 Escherichiacoli HypC NP_417208 16130635 Escherichiacoli HypD NP_417209 16130636 Escherichiacoli HypE NP_417210 226524740 Escherichiacoli HypF NP_417192 16130619 Escherichiacoli

[0740] The M. thermoaceticahydrogenases are suitable for a host that lacks sufficient endogenous hydrogenase activity. M. thermoacetica can grow with CO 2 as the exclusive carbon source indicating that reducing equivalents are extracted from H 2 to enable acetyl CoA synthesis via the Wood-Ljungdahl pathway (Drake, H. L., J. Bacteriol. 150:702-709 (1982); Drake and Daniel, Res. Microbiol. 155:869-883 (2004); Kellum and Drake, J. Bacteriol. 160:466-469 (1984)) (see Figure 68). M. thermoaceticahas homologs to several hyp, hyc, and hyfgenes from E. coli. The protein sequences encoded for by these genes are identified by the following GenBank accession numbers.

[0741] Proteins in M. thermoaceticawhose genes are homologous to the E. coli hyp genes are shown below.

Protein GenBank ID GI Number Organism Moth_2175 YP_431007 83590998 Moorella thermoacetica Moth_2176 YP_431008 83590999 Moorella thermoacetica Moth_2177 YP_431009 83591000 Moorella thermoacetica Moth_2178 YP_431010 83591001 Moorella thermoacetica Moth_2179 YP_431011 83591002 Moorella thermoacetica Moth_2180 YP_431012 83591003 Moorella thermoacetica Moth_2181 YP_431013 83591004 Moorella thermoacetica

[0742] Proteins in M. thermoaceticathat are homologous to the E. coli Hydrogenase 3 and/or 4 proteins are listed in the following table.

Protein GenBank ID GI Number Organism Moth_2182 YP_431014 83591005 Moorella thermoacetica Moth_2183 YP_431015 83591006 Moorella thermoacetica Moth_2184 YP_431016 83591007 Moorella thermoacetica Moth_2185 YP_431017 83591008 Moorella thermoacetica Moth_2186 YP_431018 83591009 Moorella thermoacetica Moth_2187 YP_431019 83591010 Moorella thermoacetica Moth_2188 YP_431020 83591011 Moorella thermoacetica Moth_2189 YP_431021 83591012 Moorella thermoacetica Moth_2190 YP_431022 83591013 Moorella thermoacetica Moth_2191 YP_431023 83591014 Moorella thermoacetica Moth_2192 YP_431024 83591015 Moorella thermoacetica

[0743] In addition, several gene clusters encoding hydrogenase functionality are present in M. thermoacetica and their corresponding protein sequences are provided below.

Protein GenBank ID GI Number Organism Moth_0439 YP_429313 83589304 Moorella thermoacetica Moth_0440 YP_429314 83589305 Moorella thermoacetica Moth_0441 YP_429315 83589306 Moorella thermoacetica Moth 0442 YP_429316 83589307 Moorella thermoacetica Moth_0809 YP_429670 83589661 Moorella thermoacetica Moth_0810 YP_429671 83589662 Moorella thermoacetica Moth_0811 YP_429672 83589663 Moorella thermoacetica Moth_0812 YP_429673 83589664 Moorela thermoacetica Moth_0814 YP_429674 83589665 Moorella thermoacetica Moth_0815 YP_429675 83589666 Moorella thermoacetica Moth_0816 YP_429676 83589667 Moorella thermoacetica Moth_1193 YP_430050 83590041 Moorella thermoacetica Moth_1194 YP_430051 83590042 Moorella thermoacetica Moth_1195 YP_430052 83590043 Moorella thermoacetica Moth_1196 YP_430053 83590044 Moorella thermoacetica Moth_1717 YP_430562 83590553 Moorella thermoacetica Moth 1718 YP_430563 83590554 Moorella thermoacetica Moth_1719 YP_430564 83590555 Moorela thermoacetica Moth_1883 YP_430726 83590717 Moorela thermoacetica Moth_1884 YP_430727 83590718 Moorella thermoacetica Moth_1885 YP_430728 83590719 Moorela thermoacetica Moth_1886 YP_430729 83590720 Moorella thermoacetica Moth_1887 YP_430730 83590721 Moorella thermoacetica Moth_1888 YP_430731 83590722 Moorella thermoacetica Moth_1452 YP_430305 83590296 Moorella thermoacetica Moth_1453 YP_430306 83590297 Moorella thermoacetica Moth_1454 YP_430307 83590298 Moorella thermoacetica

[0744] Ralstonia eutropha H16 uses hydrogen as an energy source with oxygen as a terminal electron acceptor. Its membrane-bound uptake [NiFe]-hydrogenase is an "02 tolerant" hydrogenase (Cracknell, et al. Proc Nat Acad Sci, 106(49) 20681-20686 (2009)) that is periplasmically-oriented and connected to the respiratory chain via a b-type cytochrome (Schink and Schlegel, Biochim. Biophys. Acta, 567, 315-324 (1979); Bernhard et al., Eur. J. Biochem. 248, 179-186 (1997)). R. eutropha also contains an02 -tolerant soluble hydrogenase encoded by the Hox operon which is cytoplasmic and directly reduces NAD+ at the expense of hydrogen (Schneider and Schlegel, Biochim. Biophys. Acta 452, 66-80 (1976); Burgdorf, J Bact. 187(9) 3122-3132(2005)). Soluble hydrogenase enzymes are additionally present in several other organisms including Geobactersulfurreducens (Coppi, Microbiology 151, 1239-1254 (2005)), Synechocystis str. PCC 6803 (Germer, J. Biol. Chem., 284(52), 36462-36472 (2009)), and Thiocapsaroseopersicina(Rakhely, Appl. Environ. Microbiol. (2) 722-728 (2004)). The Synechocystis enzyme is capable of generating NADPH from hydrogen. Overexpression of both the Hox operon from Synechocystis str. PCC 6803 and the accessory genes encoded by the Hyp operon from Nostoc sp. PCC 7120 led to increased hydrogenase activity compared to expression of the Hox genes alone (Germer, J. Biol. Chem. 284(52), 36462-36472 (2009)).

Protein GenBank ID GI Number Organism HoxF NP_942727.1 38637753 Ralstonia eutrophaH16 HoxU NP_942728.1 38637754 Ralstonia eutrophaH16 HoxY NP_942729.1 38637755 Ralstonia eutrophaH16 HoxH NP_942730.1 38637756 Ralstonia eutrophaH16 HoxW NP_942731.1 38637757 Ralstonia eutrophaH16 HoxI NP_942732.1 38637758 Ralstonia eutrophaH16

HoxE NP_953767.1 39997816 Geobactersulfurreducens HoxF NP_953766.1 39997815 Geobactersulfurreducens HoxU NP_953765.1 39997814 Geobactersulfurreducens HoxY NP_953764.1 39997813 Geobactersulfurreducens HoxH NP_953763.1 39997812 Geobactersulfurreducens GSU2717 NP_953762.1 39997811 Geobactersulfurreducens HoxE NP_441418.1 16330690 Synechocystis str. PCC 6803 HoxF NP441417.1 16330689 Synechocystis str. PCC 6803

Unknown NP441416.1 16330688 Synechocystis str. PCC 6803 function HoxU NP_441415.1 16330687 Synechocystis str. PCC 6803 HoxY NP_441414.1 16330686 Synechocystis str. PCC 6803 Unknown NP441413.1 16330685 Synechocystis str. PCC 6803 function Unknown NP441412.1 16330684 Synechocystis str. PCC 6803 function HoxH NP_441411.1 16330683 Synechocystis str. PCC 6803 HypF NP_484737.1 17228189 Nostoc sp. PCC 7120

HypC NP_484738.1 17228190 Nostoc sp. PCC 7120 HypD NP_484739.1 17228191 Nostoc sp. PCC 7120 Unknown NP_484740.1 17228192 Nostoc sp. PCC 7120 function HypE NP_484741.1 17228193 Nostoc sp. PCC 7120 HypA NP484742.1 17228194 Nostoc sp. PCC 7120 HypB NP_484743.1 17228195 Nostoc sp. PCC 7120

HoxlE AAP50519.1 37787351 Thiocapsa roseopersicina HoxIF AAP50520.1 37787352 Thiocapsa roseopersicina HoxlU AAP50521.1 37787353 Thiocapsa roseopersicina HoxlY AAP50522.1 37787354 Thiocapsa roseopersicina HoxlH AAP50523.1 37787355 Thiocapsa roseopersicina

[0745] Genes encoding hydrogenase enzymes from C. ljungdahli are shown below.

Protein GenBank ID GI Number Organism CLJU c20290 ADK15091.1 300435324 Clostridiumljungdahli

CLJU c07030 ADK13773.1 300434006 ClostridiumIjungdahli CLJU c07040 ADK13774.1 300434007 Clostridiumijungdahli CLJU c7O5O ADK13775.1 300434008 Clostridiumijungdahli CLJU c07060 ADK13776.1 300434009 Clostridiumijungdahli CLJU c07070 ADK13777.1 300434010 Clostridiumijungdahli CLJU c07080 ADK13778.1 300434011 ClostridiumIjungdahli

CLJU c14730 ADK14541.1 300434774 ClostridiumIjungdahli CLJU c14720 ADK14540.1 300434773 Clostridiumijungdahli CLJU c14710 ADK14539.1 300434772 Clostridiumijungdahli CLJU c14700 ADK14538.1 300434771 Clostridiumijungdahli

CLJU c28670 ADK15915.1 300436148 ClostridiumIjungdahli CLJU c28660 ADK15914.1 300436147 Clostridiumijungdahli CLJU c28650 ADK15913.1 300436146 Clostridium ijungdahli CLJU c28640 ADK15912.1 300436145 Clostridium ijungdahli

[0746] Several enzymes and the corresponding genes used for fixing carbon dioxide to either pyruvate or phosphoenolpyruvate to form the TCA cycle intermediates, oxaloacetate or malate are described below.

[0747] Carboxylation of phosphoenolpyruvate to oxaloacetate is catalyzed by phosphoenolpyruvate carboxylase. Exemplary PEP carboxylase enzymes are encoded byppc in E. coli (Kai et al., Arch. Biochem. Biophys. 414:170-179 (2003), ppcA in Methylobacterium extorquens AM] (Arps et al., J. Bacteriol. 175:3776-3783 (1993), and ppc in Corynebacteriumglutamicum (Eikmanns et al., Mol. Gen. Genet. 218:330-339 (1989).

Protein GenBank ID GI Number Organism Ppc NP418391 16131794 Escherichiacoli ppcA AAB58883 28572162 Methylobacterium extorquens Ppc ABB53270 80973080 Corynebacteriumglutamicum

[0748] An alternative enzyme for converting phosphoenolpyruvate to oxaloacetate is PEP carboxykinase, which simultaneously forms an ATP while carboxylating PEP. In most organisms PEP carboxykinase serves a gluconeogenic function and converts oxaloacetate to PEP at the expense of one ATP. S. cerevisiae is one such organism whose native PEP carboxykinase, PCK1, serves a gluconeogenic role (Valdes-Hevia et al., FEBS Lett. 258:313 316 (1989). E. coli is another such organism, as the role of PEP carboxykinase in producing oxaloacetate is believed to be minor when compared to PEP carboxylase, which does not form ATP, possibly due to the higher Km for bicarbonate of PEP carboxykinase (Kim et al., Apple. Environ. Microbiol.70:1238-1241 (2004)). Nevertheless, activity of the native E. coli PEP carboxykinase from PEP towards oxaloacetate has been recently demonstrated in ppc mutants of E. coli K-12 (Kwon et al., J. Microbiol. Biotechnol. 16:1448-1452 (2006)). These strains exhibited no growth defects and had increased succinate production at high NaHCO 3

concentrations. Mutant strains of E. coli can adopt Pck as the dominant C02-fixing enzyme following adaptive evolution (Zhang et al. 2009). In some organisms, particularly rumen bacteria, PEP carboxykinase is quite efficient in producing oxaloacetate from PEP and generating ATP. Examples of PEP carboxykinase genes that have been cloned into E. coli include those from Mannheimia succiniciproducens(Lee et al., BiotechnoL Bioprocess Eng. 7:95-99 (2002)), Anaerobiospirillumsucciniciproducens(Laivenieks et al., Appl. Environ. Microbiol. 63:2273-2280 (1997), and Actinobacillus succinogenes (Kim et al. supra). The PEP carboxykinase enzyme encoded by Haemophilus influenza is effective at forming oxaloacetate from PEP.

Protein GenBank ID GI Number Organism PCK NP013023 6322950 Saccharomycescerevisiae pck NP417862.1 16131280 Escherichiacoli pckA YP089485.1 52426348 Mannheimia succiniciproducens

Protein GenBank ID GI Number Organism pckA 009460.1 3122621 Anaerobiospirillum succiniciproducens pckA Q6W6X5 75440571 Actinobacillus succinogenes pckA P43923.1 1172573 Haemophilus influenza

[0749] Pyruvate carboxylase (EC 6.4.1.1) directly converts pyruvate to oxaloacetate at the cost of one ATP. Pyruvate carboxylase enzymes are encoded by PYC1 (Walker et al., Biochem. Biophys. Res. Commun. 176:1210-1217 (1991) and PYC2 (Walker et al., supra) in Saccharomyces cerevisiae, and pyc in Mycobacterium smegmatis (Mukhopadhyay and Purwantini, Biochim. Biophys. Acta 1475:191-206 (2000)).

Protein GenBank ID GI Number Organism PYC1 NP_011453 6321376 Saccharomyces cerevisiae PYC2 NP009777 6319695 Saccharomyces cerevisiae Pyc YP890857.1 118470447 Mycobacterium smegmatis

[0750] Malic enzyme can be applied to convertCO 2 and pyruvate to malate at the expense of one reducing equivalent. Malic enzymes for this purpose can include, without limitation, malic enzyme (NAD-dependent) and malic enzyme (NADP-dependent). For example, one of the E. coli malic enzymes (Takeo, J. Biochem. 66:379-387 (1969)) or a similar enzyme with higher activity can be expressed to enable the conversion of pyruvate andCO 2 tomalate. By fixing carbon to pyruvate as opposed to PEP, malic enzyme allows the high-energy phosphate bond from PEP to be conserved by pyruvate kinase whereby ATP is generated in the formation of pyruvate or by the phosphotransferase system for glucose transport. Although malic enzyme is typically assumed to operate in the direction of pyruvate formation from malate, overexpression of the NAD-dependent enzyme, encoded by maeA, has been demonstrated to increase succinate production in E. coli while restoring the lethal Apfl-AldhA phenotype under anaerobic conditions by operating in the carbon-fixing direction (Stols and Donnelly, Appl. Environ. Microbiol. 63(7) 2695-2701 (1997)). A similar observation was made upon overexpressing the malic enzyme from Ascaris suum in E. coli (Stols et al., Appl. Biochem. Biotechnol. 63-65(1), 153-158 (1997)). The second E. coli malic enzyme, encoded by maeB, is NADP-dependent and also decarboxylates oxaloacetate and other alpha-keto acids (Iwakura et al., J. Biochem. 85(5):1355-65 (1979)).

Protein GenBank ID GI Number Organism maeA NP415996 90111281 Escherichiacoli maeB NP416958 16130388 Escherichiacoli NAD-ME P27443 126732 Ascaris suum

[0751] The enzymes used for converting oxaloacetate (formed from, for example, PEP carboxylase, PEP carboxykinase, or pyruvate carboxylase) or malate (formed from, for example, malic enzyme or malate dehydrogenase) to succinyl-CoA via the reductive branch of the TCA cycle are malate dehydrogenase, fumarate dehydratase (fumarase), fumarate reductase, and succinyl-CoA transferase. The genes for each of the enzymes are described herein above.

[0752] Enzymes, genes and methods for engineering pathways from succinyl-CoA to various products into a microorganism are now known in the art. The additional reducing equivalents obtained from CO and/or H2 , as disclosed herein, improve the yields of 1,4 butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone when utilizing carbohydrate based feedstock. For example, 1,4-butanediol, 4-hydroxybutyrate and/or gamma butyrolactone can be produced as described herein, for example, produced from succinyl CoA via pathways shown in Figure 64B and Figure 8A. Exemplary enzymes for the conversion succinyl-CoA to 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone include those disclosed herein, including the figures.

[0753] Enzymes, genes and methods for engineering pathways from glycolysis intermediates to various products into a microorganism are known in the art. The additional reducing equivalents obtained from CO and H 2, as described herein, improve the yields of all these products on carbohydrates. For example, 1,4-butanediol, 4-hydroxybutyrate and/or gamma-butyrolactone can be produced from the glycolysis intermediate,. Exemplary enzymes for the conversion of to 1,4-butanediol, 4-hydroxybutyrate and/or gamma butyrolactone are described herein.

EXAMPLE XXVI Methods for Handling CO and Anaerobic Cultures

[0754] This example describes methods used in handling CO and anaerobic cultures.

[0755] A. Handling of CO in small quantities for assays and small cultures. CO is an odorless, colorless and tasteless gas that is a poison. Therefore, cultures and assays that utilized CO required special handling. Several assays, including CO oxidation, acetyl-CoA synthesis, CO concentration using myoglobin, and CO tolerance/utilization in small batch cultures, called for small quantities of the CO gas that were dispensed and handled within a fume hood. Biochemical assays called for saturating very small quantities (<2 mL) of the biochemical assay medium or buffer with CO and then performing the assay. All of the CO handling steps were performed in a fume hood with the sash set at the proper height and blower turned on; CO was dispensed from a compressed gas cylinder and the regulator connected to a Schlenk line. The latter ensures that equal concentrations of CO were dispensed to each of several possible cuvettes or vials. The Schlenk line was set up containing an oxygen scrubber on the input side and an oil pressure release bubbler and vent on the other side. Assay cuvettes were both anaerobic and CO-containing. Threfore, the assay cuvettes were tightly sealed with a rubber stopper and reagents were added or removed using gas-tight needles and syringes. Secondly, small (~50 mL) cultures were grown with saturating CO in tightly stoppered serum bottles. As with the biochemical assays, the CO saturated microbial cultures were equilibrated in the fume hood using the Schlenk line setup. Both the biochemical assays and microbial cultures were in portable, sealed containers and in small volumes making for safe handling outside of the fume hood. The compressed CO tank was adjacent to the fume hood.

[0756] Typically, a Schlenk line was used to dispense CO to cuvettes, each vented. Rubber stoppers on the cuvettes were pierced with 19 or 20 gage disposable syringe needles and were vented with the same. An oil bubbler was used with a CO tank and oxygen scrubber. The glass or quartz spectrophotometer cuvettes have a circular hole on top into which a Kontes stopper sleeve, Sz7 774250-0007 was fitted. The CO detector unit was positioned proximal to the fume hood.

[0757] B. Handling of CO in larger quantities fed to large-scale cultures. Fermentation cultures are fed either CO or a mixture of CO and H 2 to simulate syngas as a feedstock in fermentative production. Therefore, quantities of cells ranging from 1 liter to several liters can include the addition of CO gas to increase the dissolved concentration of CO in the medium. In these circumstances, fairly large and continuously administered quantities of CO gas are added to the cultures. At different points, the cultures are harvested or samples removed. Alternatively, cells are harvested with an integrated continuous flow centrifuge that is part of the fermenter.

[0758] The fermentative processes are carried out under anaerobic conditions. In some cases, it is uneconomical to pump oxygen or air into fermenters to ensure adequate oxygen saturation to provide a respiratory environment. In addition, the reducing power generated during anaerobic fermentation may be needed in product formation rather than respiration. Furthermore, many of the enzymes for various pathways are oxygen-sensitive to varying degrees. Classic acetogens such as M. thermoacetica are obligate anaerobes and the enzymes in the Wood-Ljungdahl pathway are highly sensitive to irreversible inactivation by molecular oxygen. While there are oxygen-tolerant acetogens, the repertoire of enzymes in the Wood Ljungdahl pathway might be incompatible in the presence of oxygen because most are metallo-enzymes, key components are ferredoxins, and regulation can divert metabolism away from the Wood-Ljungdahl pathway to maximize energy acquisition. At the same time, cells in culture act as oxygen scavengers that moderate the need for extreme measures in the presence of large cell growth.

[0759] C. Anaerobic chamber and conditions. Exemplary anaerobic chambers are available commercially (see, for example, Vacuum Atmospheres Company, Hawthorne CA; MBraun, Newburyport MA). Conditions included an 02 concentration of 1 ppm or less and 1 atm pure N 2 . In one example, 3 oxygen scrubbers/catalyst regenerators were used, and the chamber included an 02 electrode (such as Teledyne; City of Industry CA). Nearly all items and reagents were cycled four times in the airlock of the chamber prior to opening the inner chamber door. Reagents with a volume >5mL were sparged with pure N 2 prior to introduction into the chamber. Gloves are changed twice/yr and the catalyst containers were regenerated periodically when the chamber displays increasingly sluggish response to changes in oxygen levels. The chamber's pressure was controlled through one-way valves activated by solenoids. This feature allowed setting the chamber pressure at a level higher than the surroundings to allow transfer of very small tubes through the purge valve.

[0760] The anaerobic chambers achieved levels of 02 that were consistently very low and were needed for highly oxygen sensitive anaerobic conditions. However, growth and handling of cells does not usually require such precautions. In an alternative anaerobic chamber configuration, platinum or palladium can be used as a catalyst that requires some hydrogen gas in the mix. Instead of using solenoid valves, pressure release can be controlled by a bubbler. Instead of using instrument-based 02 monitoring, test strips can be used instead.

[0761] D. Anaerobic microbiology. Small cultures were handled as described above for CO handling. In particular, serum or media bottles are fitted with thick rubber stoppers and aluminum crimps are employed to seal the bottle. Medium, such as Terrific Broth, is made in a conventional manner and dispensed to an appropriately sized serum bottle. The bottles are sparged with nitrogen for ~30 min of moderate bubbling. This removes most of the oxygen from the medium and, after this step, each bottle is capped with a rubber stopper (such as Bellco 20 mm septum stoppers; Bellco, Vineland, NJ) and crimp-sealed (Bellco 20 mm). Then the bottles of medium are autoclaved using a slow (liquid) exhaust cycle. At least sometimes a needle can be poked through the stopper to provide exhaust during autoclaving; the needle needs to be removed immediately upon removal from the autoclave. The sterile medium has the remaining medium components, for example buffer or antibiotics, added via syringe and needle. Prior to addition of reducing agents, the bottles are equilibrated for 30 minutes with nitrogen (or CO depending upon use). A reducing agent such as a 100 x 150 mM sodium sulfide, 200 mM cysteine-HC is added. This is made by weighing the sodium sulfide into a dry beaker and the cysteine into a serum bottle, bringing both into the anaerobic chamber, dissolving the sodium sulfide into anaerobic water, then adding this to the cysteine in the serum bottle. The bottle is stoppered immediately as the sodium sulfide solution generates hydrogen sulfide gas upon contact with the cysteine. When injecting into the culture, a syringe filter is used to sterilize the solution. Other components are added through syringe needles, such as B12 (10 tM cyanocobalamin), nickel chloride (NiCl 2 , 20 microM final concentration from a 40 mM stock made in anaerobic water in the chamber and sterilized by autoclaving or by using a syringe filter upon injection into the culture), and ferrous ammonium sulfate (final concentration needed is 100 tM-made as 100-1000x stock solution in anaerobic water in the chamber and sterilized by autoclaving or by using a syringe filter upon injection into the culture). To facilitate faster growth under anaerobic conditions, the 1 liter bottles were inoculated with 50 mL of a preculture grown anaerobically. Induction of the pAl-lacO1 promoter in the vectors was performed by addition of isopropyl -D-1 thiogalactopyranoside (IPTG) to a final concentration of 0.2 mM and was carried out for about 3 hrs.

[0762] Large cultures can be grown in larger bottles using continuous gas addition while bubbling. A rubber stopper with a metal bubbler is placed in the bottle after medium addition and sparged with nitrogen for 30 minutes or more prior to setting up the rest of the bottle. Each bottle is put together such that a sterile filter will sterilize the gas bubbled in and the hoses on the bottles are compressible with small C clamps. Medium and cells are stirred with magnetic stir bars. Once all medium components and cells are added, the bottles are incubated in an incubator in room air but with continuous nitrogen sparging into the bottles.

EXAMPLE XXVII CO oxidation (CODH) Assay

[0763] This example describes assay methods for measuring CO oxidation (CO dehydrogenase; CODH).

[0764] The 7 gene CODH/ACS operon of Moorella thermoaceticawas cloned into E. coli expression vectors. The intact ~10 kbp DNA fragment was cloned, and it is likely that some of the genes in this region are expressed from their own endogenous promoters and all contain endogenous ribosomal binding sites. These clones were assayed for CO oxidation, using an assay that quantitatively measures CODH activity. Antisera to the M. thermoacetica gene products was used for Western blots to estimate specific activity. M. thermoaceticais Gram positive, and ribosome binding site elements are expected to work well in E. coli. This activity, described below in more detail, was estimated to be ~1/50th of the M. thermoacetica specific activity. It is possible that CODH activity of recombinant E. coli cells could be limited by the fact that M. thermoacetica enzymes have temperature optima around 55C. Therefore, a mesophilic CODH/ACS pathway could be advantageous such as the close relative of Moorella that is mesophilic and does have an apparently intact CODH/ACS operon and a Wood-Ljungdahl pathway, Desulfitobacteriumhafniense. Acetogens as potential host organisms include, but are not limited to, Rhodospirillum rubrum, Moorella thermoacetica and Desulfitobacteriumhafniense.

[0765] CO oxidation is both the most sensitive and most robust of the CODH/ACS assays. It is likely that an E. coli-based syngas using system will ultimately need to be about as anaerobic as Clostridial(i.e., Moorella) systems, especially for maximal activity. Improvement in CODH should be possible but will ultimately be limited by the solubility of CO gas in water.

[0766] Initially, each of the genes was cloned individually into expression vectors. Combined expression units for multiple subunits/i complex were generated. Expression in E. coli at the protein level was determined. Both combined M. thermoacetica CODH/ACS operons and individual expression clones were made.

[0767] CO oxidation assay. This assay is one of the simpler, reliable, and more versatile assays of enzymatic activities within the Wood-Ljungdahl pathway and tests CODH (Seravalli et al., Biochemistry 43:3944-3955 (2004)). A typical activity of M. thermoacetica CODH specific activity is 500 U at 55 0 C or ~60U at 250 C. This assay employs reduction of methyl viologen in the presence of CO. This is measured at 578 nm in stoppered, anaerobic, glass cuvettes.

[0768] In more detail, glass rubber stoppered cuvettes were prepared after first washing the cuvette four times in deionized water and one time with acetone. A small amount of vacuum grease was smeared on the top of the rubber gasket. The cuvette was gassed with CO, dried 10 min with a 22 Ga. needle plus an exhaust needle. A volume of 0.98 mlL of reaction buffer (50 mM Hepes, pH 8.5, 2mM dithiothreitol (DTT) was added using a 22 Ga. needle, with exhaust needled, and 100%CO. Methyl viologen (CH 3 viologen) stock was 1 M in water. Each assay used 20 microliters for 20 mM final concentration. When methyl viologen was added, an 18 Ga needle (partial) was used as a jacket to facilitate use of a Hamilton syringe to withdraw the CH 3 viologen. 4 -5 aliquots were drawn up and discarded to wash and gas equilibrate the syringe. A small amount of sodium dithionite (0.1 M stock) was added when making up the CH 3 viologen stock to slightly reduce the CH 3 viologen. The temperature was equilibrated to 55 0C in a heated Olis spectrophotometer (Bogart GA). A blank reaction (CH 3 viologen + buffer) was run first to measure the base rate of CH 3 viologen reduction. Crude E. coli cell extracts of ACS90 and ACS91 (CODH-ACS operon of M. thermoaceticawith and without, respectively, the first cooC). 10 microliters of extract were added at a time, mixed and assayed. Reduced CH3 viologen turns purple. The results of an assay are shown in Table 33.

Table 33. Crude extract CO Oxidation Activities.

ACS90 7.7 mg/rnI ACS9l 11.8 mg/rnI Mta98 .9.8 mg/mI Mta99 11. 2mg/mI

Extract Vol _DI U/mI U/mg ACS90O 10 microliters 0.073 0.376 0.049 ACS91 10microliters 0.096 0.494 0.042 Mta99 10 microliters 0.0031 0.016 0.0014 ACS9O ~ 1lmicroliters 0.099 05 .6 Mta99 25 microliters 0.012 0.025 0.0022 ACS91 25 microliters 0.215 0.443 0.037 Mta98 25 microliters 0.019 0.039 0.004 ACS91 10 microliters 0.129 0.66 0.056

Averages ACS90 0.057 U/mg ACS91 0.045 U/mg Mta99 0.0018 U/mg

[0769] Mta98/Mta99 are E. coli MG1655 strains that express methanol methyltransferase genes from M. thermoacetiaand, therefore, are negative controls for the ACS90 ACS91 E. coli strains that contain M. thermoacetica CODH operons.

[0770] If 1% of the cellular protein is CODH, then these figures would be approximately 1OOX less than the 500 U/mg activity of pure M. thermoacetica CODH. Actual estimates based on Western blots are 0.5% of the cellular protein, so the activity is about 50X less than for M. thermoacetica CODH. Nevertheless, this experiment demonstrates CO oxidation activity in recombinant E. coli with a much smaller amount in the negative controls. The small amount of CO oxidation (CH 3 viologen reduction) seen in the negative controls indicates that E. coli may have a limited ability to reduce CH3 viologen.

[0771] To estimate the final concentrations of CODH and Mtr proteins, SDS-PAGE followed by Western blot analyses were performed on the same cell extracts used in the CO oxidation, ACS, methyltransferase, and corrinoid Fe-S assays. The antisera used were polyclonal to purified M. thermoacetica CODH-ACS and Mtr proteins and were visualized using an alkaline phosphatase-linked goat-anti-rabbit secondary antibody. The Westerns were performed and results are shown in Figure 70. The amounts of CODH in ACS90 and

ACS91 were estimated at 50 ng by comparison to the control lanes. Expression of CODH ACS operon genes including 2 CODH subunits and the methyltransferase were confirmed via Western blot analysis. Therefore, the recombinant E. coli cells express multiple components of a 7 gene operon. In addition, both the methyltransferase and corrinoid iron sulfur protein were active in the same recombinant E. coli cells. These proteins are part of the same operon cloned into the same cells.

[0772] The CO oxidation assays were repeated using extracts of Moorella thermoacetica cells for the positive controls. Though CODH activity in E. coli ACS90 and ACS91 was measurable, it was at about 130 - 150 X lower than the M. thermoaceticacontrol. The results of the assay are shown in Figure 71. Briefly, cells (M. thermoacetica or E. coli with the CODH/ACS operon; ACS90 or ACS91 or empty vector: pZA33S) were grown and extracts prepared as described above. Assays were performed as described above at 550 C at various times on the day the extracts were prepared. Reduction of methylviologen was followed at 578 nm over a 120 see time course.

[0773] These results describe the CO oxidation (CODH) assay and results. Recombinant E. coli cells expressed CO oxidation activity as measured by the methyl viologen reduction assay.

EXAMPLE XXVIIH E. coli CO Tolerance Experiment and CO Concentration Assay (myoglobin assay)

[0774] This example describes the tolerance of E. coli for high concentrations of CO.

[0775] To test whether or not E. coli can grow anaerobically in the presence of saturating amounts of CO, cultures were set up in 120 ml serum bottles with 50 ml of Terrific Broth medium (plus reducing solution, NiC 2 , Fe(II)NH 4SO 4, cyanocobalamin, IPTG, and chloramphenicol) as described above for anaerobic microbiology in small volumes. One half of these bottles were equilibrated with nitrogen gas for 30 min. and one half was equilibrated with CO gas for 30 min. An empty vector (pZA33) was used as a control, and cultures containing the pZA33 empty vector as well as both ACS90 and ACS91 were tested with both N 2 and CO. All were inoculated and grown for 36 hrs with shaking (250 rpm) at 370 C. At the end of the 36 hour period, examination of the flasks showed high amounts of growth in all. The bulk of the observed growth occurred overnight with a long lag.

[0776] Given that all cultures appeared to grow well in the presence of CO, the final CO concentrations were confirmed. This was performed using an assay of the spectral shift of myoglobin upon exposure to CO. Myoglobin reduced with sodium dithionite has an absorbance peak at 435 nm; this peak is shifted to 423 nm with CO. Due to the low wavelength and need to record a whole spectrum from 300 nm on upwards, quartz cuvettes must be used. CO concentration is measured against a standard curve and depends upon the Henry's Law constant for CO of maximum water solubility = 970 micromolar at 200 C and 1 atm.

[0777] For the myoglobin test of CO concentration, cuvettes were washed IOX with water, IX with acetone, and then stoppered as with the CODH assay. N 2 was blown into the cuvettes for ~10 min. A volume of 1 ml of anaerobic buffer (HEPES, pH 8.0, 2mM DT T) was added to the blank (not equilibrated with CO) with a Hamilton syringe. A volume of 10 microliter myoglobin (1I mM-can be varied, just need a fairly large amount) and 1 microliter dithionite (20 mM stock) were added. A CO standard curve was made using CO saturated buffer added at 1 microliter increments. Peak height and shift was recorded for each increment. The cultures tested were pZA33/CO, ACS90/CO, and ACS91/CO. Each of these was added in 1 microliter increments to the same cuvette. Midway through the experiment a second cuvette was set up and used. The results are shown in Table 34.

Table 34. Carbon Monoxide Concentrations, 36 hrs.

Strain and Growth Conditions Final CO concentration (micromolar) pZA33-CO 930

ACS90-CO 638 494 734 883 ave 687 SD 164

ACS91-CO 728 812 760 611 ave. 728 SD 85

[0778] The results shown in Table 34 indicate that the cultures grew whether or not a strain was cultured in the presence of CO or not. These results indicate that E. coli can tolerate exposure to CO under anaerobic conditions and that E. coli cells expressing the CODH-ACS operon can metabolize some of the CO.

[0779] These results demonstrate that E. coli cells, whether expressing CODH/ACS or not, were able to grow in the presence of saturating amounts of CO. Furthermore, these grew equally well as the controls in nitrogen in place of CO. This experiment demonstrated that laboratory strains of E. coli are insensitive to CO at the levels achievable in a syngas project performed at normal atmospheric pressure. In addition, preliminary experiments indicated that the recombinant E. coli cells expressing CODH/ACS actually consumed some CO, probably by oxidation to carbon dioxide.

[0780] Throughout this application various publications have been referenced. The disclosures of these publications in their entireties, including GenBank and GI number publications, are hereby incorporated by reference in this application in order to more fully describe the state of the art to which this invention pertains. Although the invention has been described with reference to the examples provided above, it should be understood that various modifications can be made without departing from the spirit of the invention.

[0781] In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprise" or variations such as "comprises" or "comprising" is used in an inclusive sense, i.e. to specify the presence of the stated feature but not to preclude the presence or addition of further features in various embodiments of the invention.

[0782] It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Australia or any other country.

12956-144-228_SEQLIST.TXT 14 Jul 2022

SEQUENCE LISTING <110> GENOMATICA, INC.

<120> MICROORGANISMS FOR PRODUCING 1,4-BUTANEDIOL AND METHODS RELATED THERETO <130> 12956-144-228 <140> Unassigned <141> Herewith

<150> 61/500,120 2022205243

<151> 2011-06-22 <150> 61/502,837 <151> 2011-06-29

<160> 101 <170> PatentIn version 3.5 <210> 1 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer

<400> 1 gacgaattcg ctagcaagag gagaagtcga catgtccaat tcactggccg tcgttttac 59

<210> 2 <211> 47 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer

<400> 2 gaccctagga agctttctag agtcgaccta tgcggcatca gagcaga 47

<210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 3 atgtaccgca agttccgc 18

<210> 4 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer Page 1

12956-144-228_SEQLIST.TXT 14 Jul 2022

<400> 4 caatttgccg atgcccag 18

<210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic 2022205243

primer <400> 5 gctgaccact gaagactttg 20

<210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 6 gatcagggct tcggtgtag 19

<210> 7 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 7 ttggtgcggg ccaagcagga tctgctc 27

<210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 8 tcagccgaac gcctcgtcga ggatctcctg 30

<210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 9 tggccaacat aagttcacca ttcgggcaaa ac 32 Page 2

12956-144-228_SEQLIST.TXT 14 Jul 2022

<210> 10 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 10 2022205243

tctcttcaac cagccattcg ttttgcccg 29

<210> 11 <211> 27 <212> DNA <213> Clostridium acetobutylicum

<400> 11 attaaagtta agtggaggaa tgttaac 27

<210> 12 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer

<400> 12 acacgcggat ccaacgtccc gg 22

<210> 13 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer

<400> 13 agcggctccg ctagccgctt atg 23

<210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 14 aagccgttgc tgcagctctt gagc 24

<210> 15 <211> 23 <212> DNA <213> Artificial Sequence

Page 3

12956-144-228_SEQLIST.TXT 14 Jul 2022

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 15 atctccggcg gtcggatccg tcg 23

<210> 16 <211> 20 <212> DNA <213> Artificial Sequence 2022205243

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 16 aaagcggcta gccacgccgc 20

<210> 17 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer

<400> 17 attacacgag gtacccaacg 20

<210> 18 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 18 atgctggcgt acaaaggtgt cc 22

<210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 19 ggacaccttt gtacgccagc at 22

<210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer Page 4

12956-144-228_SEQLIST.TXT 14 Jul 2022

<400> 20 atcgcctaca ctaaaccaga agtgg 25

<210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic 2022205243

primer <400> 21 ccacttctgg tttagtgtag gcgat 25

<210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 22 aggcagttcc ataggatggc 20

<210> 23 <211> 55 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 23 tgacatgtaa cacctacctt ctgtgcctgt gccagtggtt gctgtgatat agaag 55

<210> 24 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 24 ataataatac atatgaacca tgcgagttac gggcctataa gccaggcg 48

<210> 25 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 25 agtttttcga tatctgcatc agacaccggc acattgaaac gg 42 Page 5

12956-144-228_SEQLIST.TXT 14 Jul 2022

<210> 26 <211> 60 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 26 2022205243

ctggcacagg cacagaaggt aggtgttaca tgtcagaacg tttacacaat gacgtggatc 60

<210> 27 <211> 49 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 27 agacaaatcg gttgccgttt gttaagccag gcgagatatg atctatatc 49

<210> 28 <211> 54 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 28 gagttttgat ttcagtactc atcatgtaac acctaccttc ttgctgtgat atag 54

<210> 29 <211> 54 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer

<400> 29 ctatatcaca gcaagaaggt aggtgttaca tgatgagtac tgaaatcaaa actc 54

<210> 30 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 30 gatatagatc atatctcgcc tggcttaaca aacggcaacc gatttgtct 49

<210> 31 Page 6

12956-144-228_SEQLIST.TXT 14 Jul 2022

<211> 70 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 31 tattgtgcat acagatgaat ttttatgcaa acagtcagcc ctgaagaagg gtgtaggctg 60 gagctgcttc 70 2022205243

<210> 32 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 32 caaaaaaccg gagtctgtgc tccggttttt tattatccgc taatcaatta catatgaata 60

tcctccttag 70

<210> 33 <211> 51 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer

<400> 33 ataataatag aattcgtttg ctacctaaat tgccaactaa atcgaaacag g 51

<210> 34 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer

<400> 34 tattattatg gtaccaatat catgcagcaa acggtgcaac attgccg 47

<210> 35 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer

<400> 35 tgatctggaa gaattcatcg gctttaccac cgtcaaaaaa aacggcg 47

Page 7

12956-144-228_SEQLIST.TXT 14 Jul 2022

<210> 36 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 36 ataaaaccct gcagcggaaa cgaagtttta tccatttttg gttacctg 48 2022205243

<210> 37 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 37 ggaagagagg ctggtaccca gaagccacag cagga 35

<210> 38 <211> 38 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer

<400> 38 gtaatcactg cgtaagcgcc atgccccggc gttaattc 38

<210> 39 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer <400> 39 attgccgcgt tcctcctgct gtcga 25

<210> 40 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic primer

<400> 40 cgacagcagg aggaacgcgg caat 24

<210> 41 <211> 75 <212> DNA Page 8

12956-144-228_SEQLIST.TXT 14 Jul 2022

<213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer

<400> 41 gtttgcacgc tatagctgag gttgttgtct tccagcaacg taccgtatac aataggcgta 60 tcacgaggcc ctttc 75 2022205243

<210> 42 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 42 gctacagcat gtcacacgat ctcaacggtc ggatgaccaa tctggctggt atgggaatta 60 gccatggtcc 70

<210> 43 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide

<400> 43 tgtgagtgaa agtcacctgc cttaatatct caaaactcat cttcgggtga cgaaatatgg 60

cgtgactcga tac 73

<210> 44 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide

<400> 44 tctgtatcag gctgaaaatc ttctctcatc cgccaaaaca gcttcggcgt taagatgcgc 60

gctcaaggac 70

<210> 45 <211> 20 <212> PRT <213> Euglena gracilis <400> 45 Met Thr Tyr Lys Ala Pro Val Lys Asp Val Lys Phe Leu Leu Asp Lys 1 5 10 15

Val Phe Lys Val Page 9

12956-144-228_SEQLIST.TXT 14 Jul 2022

20

<210> 46 <211> 2036 <212> DNA <213> Escherichia coli <400> 46 atgaacttac atgaatatca ggcaaaacaa ctttttgccc gctatggctt accagcaccg 60 gtgggttatg cctgtactac tccgcgcgaa gcagaagaag ccgcttcaaa aatcggtgcc 120 2022205243

ggtccgtggg tagtgaaatg tcaggttcac gctggtggcc gcggtaaagc gggcggtgtg 180 aaagttgtaa acagcaaaga agacatccgt gcttttgcag aaaactggct gggcaagcgt 240 ctggtaacgt atcaaacaga tgccaatggc caaccggtta accagattct ggttgaagca 300

gcgaccgata tcgctaaaga gctgtatctc ggtgccgttg ttgaccgtag ttcccgtcgt 360 gtggtcttta tggcctccac cgaaggcggc gtggaaatcg aaaaagtggc ggaagaaact 420 ccgcacctga tccataaagt tgcgcttgat ccgctgactg gcccgatgcc gtatcaggga 480

cgcgagctgg cgttcaaact gggtctggaa ggtaaactgg ttcagcagtt caccaaaatc 540 ttcatgggcc tggcgaccat tttcctggag cgcgacctgg cgttgatcga aatcaacccg 600

ctggtcatca ccaaacaggg cgatctgatt tgcctcgacg gcaaactggg cgctgacggc 660

aacgcactgt tccgccagcc tgatctgcgc gaaatgcgtg accagtcgca ggaagatccg 720

cgtgaagcac aggctgcaca gtgggaactg aactacgttg cgctggacgg taacatcggt 780

tgtatggtta acggcgcagg tctggcgatg ggtacgatgg acatcgttaa actgcacggc 840 ggcgaaccgg ctaacttcct tgacgttggc ggcggcgcaa ccaaagaacg tgtaaccgaa 900

gcgttcaaaa tcatcctctc tgacgacaaa gtgaaagccg ttctggttaa catcttcggc 960

ggtatcgttc gttgcgacct gatcgctgac ggtatcatcg gcgcggtagc agaagtgggt 1020 gttaacgtac cggtcgtggt acgtctggaa ggtaacaacg ccgaactcgg cgcgaagaaa 1080

ctggctgaca gcggcctgaa tattattgca gcaaaaggtc tgacggatgc agctcagcag 1140 gttgttgccg cagtggaggg gaaataatgt ccattttaat cgataaaaac accaaggtta 1200 tctgccaggg ctttaccggt agccagggga ctttccactc agaacaggcc attgcatacg 1260

gcactaaaat ggttggcggc gtaaccccag gtaaaggcgg caccacccac ctcggcctgc 1320 cggtgttcaa caccgtgcgt gaagccgttg ctgccactgg cgctaccgct tctgttatct 1380 acgtaccagc accgttctgc aaagactcca ttctggaagc catcgacgca ggcatcaaac 1440

tgattatcac catcactgaa ggcatcccga cgctggatat gctgaccgtg aaagtgaagc 1500 tggatgaagc aggcgttcgt atgatcggcc cgaactgccc aggcgttatc actccgggtg 1560

aatgcaaaat cggtatccag cctggtcaca ttcacaaacc gggtaaagtg ggtatcgttt 1620 cccgttccgg tacactgacc tatgaagcgg ttaaacagac cacggattac ggtttcggtc 1680 agtcgacctg tgtcggtatc ggcggtgacc cgatcccggg ctctaacttt atcgacattc 1740

tcgaaatgtt cgaaaaagat ccgcagaccg aagcgatcgt gatgatcggt gagatcggcg 1800 Page 10

12956-144-228_SEQLIST.TXT 14 Jul 2022

gtagcgctga agaagaagca gctgcgtaca tcaaagagca cgttaccaag ccagttgtgg 1860

gttacatcgc tggtgtgact gcgccgaaag gcaaacgtat gggccacgcg ggtgccatca 1920 ttgccggtgg gaaagggact gcggatgaga aattcgctgc tctggaagcc gcaggcgtga 1980

aaaccgttcg cagcctggcg gatatcggtg aagcactgaa aactgttctg aaataa 2036

<210> 47 <211> 388 2022205243

<212> PRT <213> Escherichia coli <400> 47 Met Asn Leu His Glu Tyr Gln Ala Lys Gln Leu Phe Ala Arg Tyr Gly 1 5 10 15

Leu Pro Ala Pro Val Gly Tyr Ala Cys Thr Thr Pro Arg Glu Ala Glu 20 25 30

Glu Ala Ala Ser Lys Ile Gly Ala Gly Pro Trp Val Val Lys Cys Gln 35 40 45

Val His Ala Gly Gly Arg Gly Lys Ala Gly Gly Val Lys Val Val Asn 50 55 60

Ser Lys Glu Asp Ile Arg Ala Phe Ala Glu Asn Trp Leu Gly Lys Arg 65 70 75 80

Leu Val Thr Tyr Gln Thr Asp Ala Asn Gly Gln Pro Val Asn Gln Ile 85 90 95

Leu Val Glu Ala Ala Thr Asp Ile Ala Lys Glu Leu Tyr Leu Gly Ala 100 105 110

Val Val Asp Arg Ser Ser Arg Arg Val Val Phe Met Ala Ser Thr Glu 115 120 125

Gly Gly Val Glu Ile Glu Lys Val Ala Glu Glu Thr Pro His Leu Ile 130 135 140

His Lys Val Ala Leu Asp Pro Leu Thr Gly Pro Met Pro Tyr Gln Gly 145 150 155 160

Arg Glu Leu Ala Phe Lys Leu Gly Leu Glu Gly Lys Leu Val Gln Gln 165 170 175

Phe Thr Lys Ile Phe Met Gly Leu Ala Thr Ile Phe Leu Glu Arg Asp 180 185 190

Leu Ala Leu Ile Glu Ile Asn Pro Leu Val Ile Thr Lys Gln Gly Asp 195 200 205

Page 11

12956-144-228_SEQLIST.TXT 14 Jul 2022

Leu Ile Cys Leu Asp Gly Lys Leu Gly Ala Asp Gly Asn Ala Leu Phe 210 215 220

Arg Gln Pro Asp Leu Arg Glu Met Arg Asp Gln Ser Gln Glu Asp Pro 225 230 235 240

Arg Glu Ala Gln Ala Ala Gln Trp Glu Leu Asn Tyr Val Ala Leu Asp 245 250 255 2022205243

Gly Asn Ile Gly Cys Met Val Asn Gly Ala Gly Leu Ala Met Gly Thr 260 265 270

Met Asp Ile Val Lys Leu His Gly Gly Glu Pro Ala Asn Phe Leu Asp 275 280 285

Val Gly Gly Gly Ala Thr Lys Glu Arg Val Thr Glu Ala Phe Lys Ile 290 295 300

Ile Leu Ser Asp Asp Lys Val Lys Ala Val Leu Val Asn Ile Phe Gly 305 310 315 320

Gly Ile Val Arg Cys Asp Leu Ile Ala Asp Gly Ile Ile Gly Ala Val 325 330 335

Ala Glu Val Gly Val Asn Val Pro Val Val Val Arg Leu Glu Gly Asn 340 345 350

Asn Ala Glu Leu Gly Ala Lys Lys Leu Ala Asp Ser Gly Leu Asn Ile 355 360 365

Ile Ala Ala Lys Gly Leu Thr Asp Ala Ala Gln Gln Val Val Ala Ala 370 375 380

Val Glu Gly Lys 385

<210> 48 <211> 289 <212> PRT <213> Escherichia coli <400> 48 Met Ser Ile Leu Ile Asp Lys Asn Thr Lys Val Ile Cys Gln Gly Phe 1 5 10 15

Thr Gly Ser Gln Gly Thr Phe His Ser Glu Gln Ala Ile Ala Tyr Gly 20 25 30

Thr Lys Met Val Gly Gly Val Thr Pro Gly Lys Gly Gly Thr Thr His 35 40 45

Leu Gly Leu Pro Val Phe Asn Thr Val Arg Glu Ala Val Ala Ala Thr 50 55 60 Page 12

12956-144-228_SEQLIST.TXT 14 Jul 2022

Gly Ala Thr Ala Ser Val Ile Tyr Val Pro Ala Pro Phe Cys Lys Asp 65 70 75 80

Ser Ile Leu Glu Ala Ile Asp Ala Gly Ile Lys Leu Ile Ile Thr Ile 85 90 95

Thr Glu Gly Ile Pro Thr Leu Asp Met Leu Thr Val Lys Val Lys Leu 100 105 110 2022205243

Asp Glu Ala Gly Val Arg Met Ile Gly Pro Asn Cys Pro Gly Val Ile 115 120 125

Thr Pro Gly Glu Cys Lys Ile Gly Ile Gln Pro Gly His Ile His Lys 130 135 140

Pro Gly Lys Val Gly Ile Val Ser Arg Ser Gly Thr Leu Thr Tyr Glu 145 150 155 160

Ala Val Lys Gln Thr Thr Asp Tyr Gly Phe Gly Gln Ser Thr Cys Val 165 170 175

Gly Ile Gly Gly Asp Pro Ile Pro Gly Ser Asn Phe Ile Asp Ile Leu 180 185 190

Glu Met Phe Glu Lys Asp Pro Gln Thr Glu Ala Ile Val Met Ile Gly 195 200 205

Glu Ile Gly Gly Ser Ala Glu Glu Glu Ala Ala Ala Tyr Ile Lys Glu 210 215 220

His Val Thr Lys Pro Val Val Gly Tyr Ile Ala Gly Val Thr Ala Pro 225 230 235 240

Lys Gly Lys Arg Met Gly His Ala Gly Ala Ile Ile Ala Gly Gly Lys 245 250 255

Gly Thr Ala Asp Glu Lys Phe Ala Ala Leu Glu Ala Ala Gly Val Lys 260 265 270

Thr Val Arg Ser Leu Ala Asp Ile Gly Glu Ala Leu Lys Thr Val Leu 275 280 285

Lys

<210> 49 <211> 3696 <212> DNA <213> Mycobacterium bovis

<400> 49 Page 13

12956-144-228_SEQLIST.TXT 14 Jul 2022

atggccaaca taagttcacc attcgggcaa aacgaatggc tggttgaaga gatgtaccgc 60 aagttccgcg acgacccctc ctcggtcgat cccagctggc acgagttcct ggttgactac 120 agccccgaac ccacctccca accagctgcc gaaccaaccc gggttacctc gccactcgtt 180

gccgagcggg ccgctgcggc cgccccgcag gcacccccca agccggccga caccgcggcc 240 gcgggcaacg gcgtggtcgc cgcactggcc gccaaaactg ccgttccccc gccagccgaa 300 ggtgacgagg tagcggtgct gcgcggcgcc gccgcggccg tcgtcaagaa catgtccgcg 360 2022205243

tcgttggagg tgccgacggc gaccagcgtc cgggcggtcc cggccaagct actgatcgac 420 aaccggatcg tcatcaacaa ccagttgaag cggacccgcg gcggcaagat ctcgttcacg 480

catttgctgg gctacgccct ggtgcaggcg gtgaagaaat tcccgaacat gaaccggcac 540 tacaccgaag tcgacggcaa gcccaccgcg gtcacgccgg cgcacaccaa tctcggcctg 600

gcgatcgacc tgcaaggcaa ggacgggaag cgttccctgg tggtggccgg catcaagcgg 660 tgcgagacca tgcgattcgc gcagttcgtc acggcctacg aagacatcgt acgccgggcc 720 cgcgacggca agctgaccac tgaagacttt gccggcgtga cgatttcgct gaccaatccc 780

ggaaccatcg gcaccgtgca ttcggtgccg cggctgatgc ccggccaggg cgccatcatc 840

ggcgtgggcg ccatggaata ccccgccgag tttcaaggcg ccagcgagga acgcatcgcc 900

gagctgggca tcggcaaatt gatcactttg acctccacct acgaccaccg catcatccag 960 ggcgcggaat cgggcgactt cctgcgcacc atccacgagt tgctgctctc ggatggcttc 1020

tgggacgagg tcttccgcga actgagcatc ccatatctgc cggtgcgctg gagcaccgac 1080

aaccccgact cgatcgtcga caagaacgct cgcgtcatga acttgatcgc ggcctaccgc 1140

aaccgcggcc atctgatggc cgataccgac ccgctgcggt tggacaaagc tcggttccgc 1200 agtcaccccg acctcgaagt gctgacccac ggcctgacgc tgtgggatct cgatcgggtg 1260

ttcaaggtcg acggctttgc cggtgcgcag tacaagaaac tgcgcgacgt gctgggcttg 1320

ctgcgcgatg cctactgccg ccacatcggc gtggagtacg cccatatcct cgaccccgaa 1380

caaaaggagt ggctcgaaca acgggtcgag accaagcacg tcaaacccac tgtggcccaa 1440 cagaaataca tcctcagcaa gctcaacgcc gccgaggcct ttgaaacgtt cctacagacc 1500

aagtacgtcg gccagaagcg gttctcgctg gaaggcgccg aaagcgtgat cccgatgatg 1560 gacgcggcga tcgaccagtg cgctgagcac ggcctcgacg aggtggtcat cgggatgccg 1620

caccggggcc ggctcaacgt gctggccaac atcgtcggca agccgtactc gcagatcttc 1680 accgagttcg agggcaacct gaatccgtcg caggcgcacg gctccggtga cgtcaagtac 1740

cacctgggcg ccaccgggct gtacctgcag atgttcggcg acaacgacat tcaggtgtcg 1800 ctgaccgcca acccgtcgca tctggaggcc gtcgacccgg tgctggaggg attggtgcgg 1860 gccaagcagg atctgctcga ccacggaagc atcgacagcg acggccaacg ggcgttctcg 1920

gtggtgccgc tgatgttgca tggcgatgcc gcgttcgccg gtcagggtgt ggtcgccgag 1980 acgctgaacc tggcgaatct gccgggctac cgcgtcggcg gcaccatcca catcatcgtc 2040

Page 14

12956-144-228_SEQLIST.TXT 14 Jul 2022

aacaaccaga tcggcttcac caccgcgccc gagtattcca ggtccagcga gtactgcacc 2100 gacgtcgcaa agatgatcgg ggcaccgatc tttcacgtca acggcgacga cccggaggcg 2160 tgtgtctggg tggcgcggtt ggcggtggac ttccgacaac ggttcaagaa ggacgtcgtc 2220

atcgacatgc tgtgctaccg ccgccgcggg cacaacgagg gtgacgaccc gtcgatgacc 2280 aacccctaca tgtacgacgt cgtcgacacc aagcgcgggg cccgcaaaag ctacaccgaa 2340 gccctgatcg gacgtggcga catctcgatg aaggaggccg aggacgcgct gcgcgactac 2400 2022205243

cagggccagc tggaacgggt gttcaacgaa gtgcgcgagc tggagaagca cggtgtgcag 2460 ccgagcgagt cggtcgagtc cgaccagatg attcccgcgg ggctggccac tgcggtggac 2520

aagtcgctgc tggcccggat cggcgatgcg ttcctcgcct tgccgaacgg cttcaccgcg 2580 cacccgcgag tccaaccggt gctggagaag cgccgggaga tggcctatga aggcaagatc 2640

gactgggcct ttggcgagct gctggcgctg ggctcgctgg tggccgaagg caagctggtg 2700 cgcttgtcgg ggcaggacag ccgccgcggc accttctccc agcggcattc ggttctcatc 2760 gaccgccaca ctggcgagga gttcacacca ctgcagctgc tggcgaccaa ctccgacggc 2820

agcccgaccg gcggaaagtt cctggtctac gactcgccac tgtcggagta cgccgccgtc 2880

ggcttcgagt acggctacac tgtgggcaat ccggacgccg tggtgctctg ggaggcgcag 2940

ttcggcgact tcgtcaacgg cgcacagtcg atcatcgacg agttcatcag ctccggtgag 3000 gccaagtggg gccaattgtc caacgtcgtg ctgctgttac cgcacgggca cgaggggcag 3060

ggacccgacc acacttctgc ccggatcgaa cgcttcttgc agttgtgggc ggaaggttcg 3120

atgaccatcg cgatgccgtc gactccgtcg aactacttcc acctgctacg ccggcatgcc 3180

ctggacggca tccaacgccc gctgatcgtg ttcacgccca agtcgatgtt gcgtcacaag 3240 gccgccgtca gcgaaatcaa ggacttcacc gagatcaagt tccgctcagt gctggaggaa 3300

cccacctatg aggacggcat cggagaccgc aacaaggtca gccggatcct gctgaccagt 3360

ggcaagctgt attacgagct ggccgcccgc aaggccaagg acaaccgcaa tgacctcgcg 3420

atcgtgcggc ttgaacagct cgccccgctg cccaggcgtc gactgcgtga aacgctggac 3480 cgctacgaga acgtcaagga gttcttctgg gtccaagagg aaccggccaa ccagggtgcg 3540

tggccgcgat tcgggctcga actacccgag ctgctgcctg acaagttggc cgggatcaag 3600 cgaatctcgc gccgggcgat gtcagccccg tcgtcaggct cgtcgaaggt gcacgccgtc 3660

gaacagcagg agatcctcga cgaggcgttc ggctaa 3696

<210> 50 <211> 1231 <212> PRT <213> Mycobacterium bovis <400> 50 Met Ala Asn Ile Ser Ser Pro Phe Gly Gln Asn Glu Trp Leu Val Glu 1 5 10 15

Glu Met Tyr Arg Lys Phe Arg Asp Asp Pro Ser Ser Val Asp Pro Ser Page 15

12956-144-228_SEQLIST.TXT 14 Jul 2022

20 25 30

Trp His Glu Phe Leu Val Asp Tyr Ser Pro Glu Pro Thr Ser Gln Pro 35 40 45

Ala Ala Glu Pro Thr Arg Val Thr Ser Pro Leu Val Ala Glu Arg Ala 50 55 60

Ala Ala Ala Ala Pro Gln Ala Pro Pro Lys Pro Ala Asp Thr Ala Ala 2022205243

65 70 75 80

Ala Gly Asn Gly Val Val Ala Ala Leu Ala Ala Lys Thr Ala Val Pro 85 90 95

Pro Pro Ala Glu Gly Asp Glu Val Ala Val Leu Arg Gly Ala Ala Ala 100 105 110

Ala Val Val Lys Asn Met Ser Ala Ser Leu Glu Val Pro Thr Ala Thr 115 120 125

Ser Val Arg Ala Val Pro Ala Lys Leu Leu Ile Asp Asn Arg Ile Val 130 135 140

Ile Asn Asn Gln Leu Lys Arg Thr Arg Gly Gly Lys Ile Ser Phe Thr 145 150 155 160

His Leu Leu Gly Tyr Ala Leu Val Gln Ala Val Lys Lys Phe Pro Asn 165 170 175

Met Asn Arg His Tyr Thr Glu Val Asp Gly Lys Pro Thr Ala Val Thr 180 185 190

Pro Ala His Thr Asn Leu Gly Leu Ala Ile Asp Leu Gln Gly Lys Asp 195 200 205

Gly Lys Arg Ser Leu Val Val Ala Gly Ile Lys Arg Cys Glu Thr Met 210 215 220

Arg Phe Ala Gln Phe Val Thr Ala Tyr Glu Asp Ile Val Arg Arg Ala 225 230 235 240

Arg Asp Gly Lys Leu Thr Thr Glu Asp Phe Ala Gly Val Thr Ile Ser 245 250 255

Leu Thr Asn Pro Gly Thr Ile Gly Thr Val His Ser Val Pro Arg Leu 260 265 270

Met Pro Gly Gln Gly Ala Ile Ile Gly Val Gly Ala Met Glu Tyr Pro 275 280 285

Ala Glu Phe Gln Gly Ala Ser Glu Glu Arg Ile Ala Glu Leu Gly Ile Page 16

12956-144-228_SEQLIST.TXT 14 Jul 2022

290 295 300

Gly Lys Leu Ile Thr Leu Thr Ser Thr Tyr Asp His Arg Ile Ile Gln 305 310 315 320

Gly Ala Glu Ser Gly Asp Phe Leu Arg Thr Ile His Glu Leu Leu Leu 325 330 335

Ser Asp Gly Phe Trp Asp Glu Val Phe Arg Glu Leu Ser Ile Pro Tyr 2022205243

340 345 350

Leu Pro Val Arg Trp Ser Thr Asp Asn Pro Asp Ser Ile Val Asp Lys 355 360 365

Asn Ala Arg Val Met Asn Leu Ile Ala Ala Tyr Arg Asn Arg Gly His 370 375 380

Leu Met Ala Asp Thr Asp Pro Leu Arg Leu Asp Lys Ala Arg Phe Arg 385 390 395 400

Ser His Pro Asp Leu Glu Val Leu Thr His Gly Leu Thr Leu Trp Asp 405 410 415

Leu Asp Arg Val Phe Lys Val Asp Gly Phe Ala Gly Ala Gln Tyr Lys 420 425 430

Lys Leu Arg Asp Val Leu Gly Leu Leu Arg Asp Ala Tyr Cys Arg His 435 440 445

Ile Gly Val Glu Tyr Ala His Ile Leu Asp Pro Glu Gln Lys Glu Trp 450 455 460

Leu Glu Gln Arg Val Glu Thr Lys His Val Lys Pro Thr Val Ala Gln 465 470 475 480

Gln Lys Tyr Ile Leu Ser Lys Leu Asn Ala Ala Glu Ala Phe Glu Thr 485 490 495

Phe Leu Gln Thr Lys Tyr Val Gly Gln Lys Arg Phe Ser Leu Glu Gly 500 505 510

Ala Glu Ser Val Ile Pro Met Met Asp Ala Ala Ile Asp Gln Cys Ala 515 520 525

Glu His Gly Leu Asp Glu Val Val Ile Gly Met Pro His Arg Gly Arg 530 535 540

Leu Asn Val Leu Ala Asn Ile Val Gly Lys Pro Tyr Ser Gln Ile Phe 545 550 555 560

Thr Glu Phe Glu Gly Asn Leu Asn Pro Ser Gln Ala His Gly Ser Gly Page 17

12956-144-228_SEQLIST.TXT 14 Jul 2022

565 570 575

Asp Val Lys Tyr His Leu Gly Ala Thr Gly Leu Tyr Leu Gln Met Phe 580 585 590

Gly Asp Asn Asp Ile Gln Val Ser Leu Thr Ala Asn Pro Ser His Leu 595 600 605

Glu Ala Val Asp Pro Val Leu Glu Gly Leu Val Arg Ala Lys Gln Asp 2022205243

610 615 620

Leu Leu Asp His Gly Ser Ile Asp Ser Asp Gly Gln Arg Ala Phe Ser 625 630 635 640

Val Val Pro Leu Met Leu His Gly Asp Ala Ala Phe Ala Gly Gln Gly 645 650 655

Val Val Ala Glu Thr Leu Asn Leu Ala Asn Leu Pro Gly Tyr Arg Val 660 665 670

Gly Gly Thr Ile His Ile Ile Val Asn Asn Gln Ile Gly Phe Thr Thr 675 680 685

Ala Pro Glu Tyr Ser Arg Ser Ser Glu Tyr Cys Thr Asp Val Ala Lys 690 695 700

Met Ile Gly Ala Pro Ile Phe His Val Asn Gly Asp Asp Pro Glu Ala 705 710 715 720

Cys Val Trp Val Ala Arg Leu Ala Val Asp Phe Arg Gln Arg Phe Lys 725 730 735

Lys Asp Val Val Ile Asp Met Leu Cys Tyr Arg Arg Arg Gly His Asn 740 745 750

Glu Gly Asp Asp Pro Ser Met Thr Asn Pro Tyr Met Tyr Asp Val Val 755 760 765

Asp Thr Lys Arg Gly Ala Arg Lys Ser Tyr Thr Glu Ala Leu Ile Gly 770 775 780

Arg Gly Asp Ile Ser Met Lys Glu Ala Glu Asp Ala Leu Arg Asp Tyr 785 790 795 800

Gln Gly Gln Leu Glu Arg Val Phe Asn Glu Val Arg Glu Leu Glu Lys 805 810 815

His Gly Val Gln Pro Ser Glu Ser Val Glu Ser Asp Gln Met Ile Pro 820 825 830

Ala Gly Leu Ala Thr Ala Val Asp Lys Ser Leu Leu Ala Arg Ile Gly Page 18

12956-144-228_SEQLIST.TXT 14 Jul 2022

835 840 845

Asp Ala Phe Leu Ala Leu Pro Asn Gly Phe Thr Ala His Pro Arg Val 850 855 860

Gln Pro Val Leu Glu Lys Arg Arg Glu Met Ala Tyr Glu Gly Lys Ile 865 870 875 880

Asp Trp Ala Phe Gly Glu Leu Leu Ala Leu Gly Ser Leu Val Ala Glu 2022205243

885 890 895

Gly Lys Leu Val Arg Leu Ser Gly Gln Asp Ser Arg Arg Gly Thr Phe 900 905 910

Ser Gln Arg His Ser Val Leu Ile Asp Arg His Thr Gly Glu Glu Phe 915 920 925

Thr Pro Leu Gln Leu Leu Ala Thr Asn Ser Asp Gly Ser Pro Thr Gly 930 935 940

Gly Lys Phe Leu Val Tyr Asp Ser Pro Leu Ser Glu Tyr Ala Ala Val 945 950 955 960

Gly Phe Glu Tyr Gly Tyr Thr Val Gly Asn Pro Asp Ala Val Val Leu 965 970 975

Trp Glu Ala Gln Phe Gly Asp Phe Val Asn Gly Ala Gln Ser Ile Ile 980 985 990

Asp Glu Phe Ile Ser Ser Gly Glu Ala Lys Trp Gly Gln Leu Ser Asn 995 1000 1005

Val Val Leu Leu Leu Pro His Gly His Glu Gly Gln Gly Pro Asp 1010 1015 1020

His Thr Ser Ala Arg Ile Glu Arg Phe Leu Gln Leu Trp Ala Glu 1025 1030 1035

Gly Ser Met Thr Ile Ala Met Pro Ser Thr Pro Ser Asn Tyr Phe 1040 1045 1050

His Leu Leu Arg Arg His Ala Leu Asp Gly Ile Gln Arg Pro Leu 1055 1060 1065

Ile Val Phe Thr Pro Lys Ser Met Leu Arg His Lys Ala Ala Val 1070 1075 1080

Ser Glu Ile Lys Asp Phe Thr Glu Ile Lys Phe Arg Ser Val Leu 1085 1090 1095

Glu Glu Pro Thr Tyr Glu Asp Gly Ile Gly Asp Arg Asn Lys Val Page 19

12956-144-228_SEQLIST.TXT 14 Jul 2022

1100 1105 1110

Ser Arg Ile Leu Leu Thr Ser Gly Lys Leu Tyr Tyr Glu Leu Ala 1115 1120 1125

Ala Arg Lys Ala Lys Asp Asn Arg Asn Asp Leu Ala Ile Val Arg 1130 1135 1140

Leu Glu Gln Leu Ala Pro Leu Pro Arg Arg Arg Leu Arg Glu Thr 2022205243

1145 1150 1155

Leu Asp Arg Tyr Glu Asn Val Lys Glu Phe Phe Trp Val Gln Glu 1160 1165 1170

Glu Pro Ala Asn Gln Gly Ala Trp Pro Arg Phe Gly Leu Glu Leu 1175 1180 1185

Pro Glu Leu Leu Pro Asp Lys Leu Ala Gly Ile Lys Arg Ile Ser 1190 1195 1200

Arg Arg Ala Met Ser Ala Pro Ser Ser Gly Ser Ser Lys Val His 1205 1210 1215

Ala Val Glu Gln Gln Glu Ile Leu Asp Glu Ala Phe Gly 1220 1225 1230

<210> 51 <211> 1356 <212> DNA <213> Porphyromonas gingivalis <400> 51 atggaaatca aagaaatggt gagccttgca cgcaaggctc agaaggagta tcaagctacc 60 cataaccaag aagcagttga caacatttgc cgagctgcag caaaagttat ttatgaaaat 120

gcagctattc tggctcgcga agcagtagac gaaaccggca tgggcgttta cgaacacaaa 180 gtggccaaga atcaaggcaa atccaaaggt gtttggtaca acctccacaa taaaaaatcg 240 attggtatcc tcaatataga cgagcgtacc ggtatgatcg agattgcaaa gcctatcgga 300

gttgtaggag ccgtaacgcc gacgaccaac ccgatcgtta ctccgatgag caatatcatc 360 tttgctctta agacctgcaa tgccatcatt attgcccccc accccagatc caaaaaatgc 420 tctgcacacg cagttcgtct gatcaaagaa gctatcgctc cgttcaacgt accggaaggt 480

atggttcaga tcatcgaaga acccagcatc gagaagacgc aggaactcat gggcgccgta 540 gacgtagtag ttgctacggg tggtatgggc atggtgaagt ctgcatattc ttcaggaaag 600

ccttctttcg gtgttggagc cggtaacgtt caggtgatcg tggatagcaa catcgatttc 660 gaagctgctg cagaaaaaat catcaccggt cgtgctttcg acaacggtat catctgctca 720 ggcgaacaga gcatcatcta caacgaggct gacaaggaag cagttttcac agcattccgc 780

aaccacggtg catatttctg tgacgaagcc gaaggagatc gggctcgtgc agctatcttc 840 Page 20

12956-144-228_SEQLIST.TXT 14 Jul 2022

gaaaatggag ccatcgcgaa agatgtagta ggtcagagcg ttgccttcat tgccaagaaa 900

gcaaacatca atatccccga gggtacccgt attctcgttg ttgaagctcg cggcgtagga 960 gcagaagacg ttatctgtaa ggaaaagatg tgtcccgtaa tgtgcgccct cagctacaag 1020

cacttcgaag aaggtgtaga aatcgcacgt acgaacctcg ccaacgaagg taacggccac 1080 acctgtgcta tccactccaa caatcaggca cacatcatcc tcgcaggatc agagctgacg 1140 gtatctcgta tcgtagtgaa tgctccgagt gccactacag caggcggtca catccaaaac 1200 2022205243

ggtcttgccg taaccaatac gctcggatgc ggatcatggg gtaataactc tatctccgag 1260 aacttcactt acaagcacct cctcaacatt tcacgcatcg caccgttgaa ttcaagcatt 1320 cacatccccg atgacaaaga aatctgggaa ctctaa 1356

<210> 52 <211> 451 <212> PRT <213> Porphyromonas gingivalis

<400> 52 Met Glu Ile Lys Glu Met Val Ser Leu Ala Arg Lys Ala Gln Lys Glu 1 5 10 15

Tyr Gln Ala Thr His Asn Gln Glu Ala Val Asp Asn Ile Cys Arg Ala 20 25 30

Ala Ala Lys Val Ile Tyr Glu Asn Ala Ala Ile Leu Ala Arg Glu Ala 35 40 45

Val Asp Glu Thr Gly Met Gly Val Tyr Glu His Lys Val Ala Lys Asn 50 55 60

Gln Gly Lys Ser Lys Gly Val Trp Tyr Asn Leu His Asn Lys Lys Ser 65 70 75 80

Ile Gly Ile Leu Asn Ile Asp Glu Arg Thr Gly Met Ile Glu Ile Ala 85 90 95

Lys Pro Ile Gly Val Val Gly Ala Val Thr Pro Thr Thr Asn Pro Ile 100 105 110

Val Thr Pro Met Ser Asn Ile Ile Phe Ala Leu Lys Thr Cys Asn Ala 115 120 125

Ile Ile Ile Ala Pro His Pro Arg Ser Lys Lys Cys Ser Ala His Ala 130 135 140

Val Arg Leu Ile Lys Glu Ala Ile Ala Pro Phe Asn Val Pro Glu Gly 145 150 155 160

Met Val Gln Ile Ile Glu Glu Pro Ser Ile Glu Lys Thr Gln Glu Leu 165 170 175 Page 21

12956-144-228_SEQLIST.TXT 14 Jul 2022

Met Gly Ala Val Asp Val Val Val Ala Thr Gly Gly Met Gly Met Val 180 185 190

Lys Ser Ala Tyr Ser Ser Gly Lys Pro Ser Phe Gly Val Gly Ala Gly 195 200 205

Asn Val Gln Val Ile Val Asp Ser Asn Ile Asp Phe Glu Ala Ala Ala 210 215 220 2022205243

Glu Lys Ile Ile Thr Gly Arg Ala Phe Asp Asn Gly Ile Ile Cys Ser 225 230 235 240

Gly Glu Gln Ser Ile Ile Tyr Asn Glu Ala Asp Lys Glu Ala Val Phe 245 250 255

Thr Ala Phe Arg Asn His Gly Ala Tyr Phe Cys Asp Glu Ala Glu Gly 260 265 270

Asp Arg Ala Arg Ala Ala Ile Phe Glu Asn Gly Ala Ile Ala Lys Asp 275 280 285

Val Val Gly Gln Ser Val Ala Phe Ile Ala Lys Lys Ala Asn Ile Asn 290 295 300

Ile Pro Glu Gly Thr Arg Ile Leu Val Val Glu Ala Arg Gly Val Gly 305 310 315 320

Ala Glu Asp Val Ile Cys Lys Glu Lys Met Cys Pro Val Met Cys Ala 325 330 335

Leu Ser Tyr Lys His Phe Glu Glu Gly Val Glu Ile Ala Arg Thr Asn 340 345 350

Leu Ala Asn Glu Gly Asn Gly His Thr Cys Ala Ile His Ser Asn Asn 355 360 365

Gln Ala His Ile Ile Leu Ala Gly Ser Glu Leu Thr Val Ser Arg Ile 370 375 380

Val Val Asn Ala Pro Ser Ala Thr Thr Ala Gly Gly His Ile Gln Asn 385 390 395 400

Gly Leu Ala Val Thr Asn Thr Leu Gly Cys Gly Ser Trp Gly Asn Asn 405 410 415

Ser Ile Ser Glu Asn Phe Thr Tyr Lys His Leu Leu Asn Ile Ser Arg 420 425 430

Ile Ala Pro Leu Asn Ser Ser Ile His Ile Pro Asp Asp Lys Glu Ile 435 440 445 Page 22

12956-144-228_SEQLIST.TXT 14 Jul 2022

Trp Glu Leu 450

<210> 53 <211> 1116 <212> DNA <213> Porphyromonas gingivalis <400> 53 2022205243

atgcaacttt tcaaactcaa gagtgtaaca catcactttg acacttttgc agaatttgcc 60 aaggaattct gtcttggaga acgcgacttg gtaattacca acgagttcat ctatgaaccg 120

tatatgaagg catgccagct cccctgccat tttgttatgc aggagaaata tgggcaaggc 180 gagccttctg acgaaatgat gaataacatc ttggcagaca tccgtaatat ccagttcgac 240

cgcgtaatcg gtatcggagg aggtacggtt attgacatct ctaaactttt cgttctgaaa 300 ggattaaatg atgtactcga tgcattcgac cgcaaaatac ctcttatcaa agagaaagaa 360 ctgatcattg tgcccacaac atgcggaacg ggtagcgagg tgacgaacat ttctatcgca 420

gaaatcaaaa gccgtcacac caaaatggga ttggctgacg atgccattgt tgcagaccat 480

gccatcatca tacctgaact tctgaagagc ttgcctttcc acttctacgc atgcagtgca 540

atcgatgctc ttatccatgc catcgagtca tacgtatctc ctaaagccag tccatattct 600 cgtctgttca gtgaggcggc ttgggacatt atcctggaag tattcaagaa aatcgccgaa 660

cacggccctg aataccgctt cgaaaagctg ggagaaatga tcatggccag caactatgcc 720

ggtatagcct tcggaaatgc aggagtagga gccgtccacg cactatccta cccgttggga 780

ggcaactatc acgtgccgca tggagaagca aactatcagt tcttcacaga ggtattcaaa 840 gtataccaaa agaagaatcc tttcggctat atagtcgaac tcaactggaa gctctccaag 900

atactgaact gccagcccga atacgtatat ccgaagctgg atgaacttct cggatgcctt 960

cttaccaaga aacctttgca cgaatacggc atgaaggacg aagaggtaag aggctttgcg 1020

gaatcagtgc ttaagacaca gcaaagattg ctcgccaaca actacgtaga gcttactgta 1080 gatgagatcg aaggtatcta cagaagactc tactaa 1116

<210> 54 <211> 371 <212> PRT <213> Porphyromonas gingivalis <400> 54 Met Gln Leu Phe Lys Leu Lys Ser Val Thr His His Phe Asp Thr Phe 1 5 10 15

Ala Glu Phe Ala Lys Glu Phe Cys Leu Gly Glu Arg Asp Leu Val Ile 20 25 30

Thr Asn Glu Phe Ile Tyr Glu Pro Tyr Met Lys Ala Cys Gln Leu Pro 35 40 45

Page 23

12956-144-228_SEQLIST.TXT 14 Jul 2022

Cys His Phe Val Met Gln Glu Lys Tyr Gly Gln Gly Glu Pro Ser Asp 50 55 60

Glu Met Met Asn Asn Ile Leu Ala Asp Ile Arg Asn Ile Gln Phe Asp 65 70 75 80

Arg Val Ile Gly Ile Gly Gly Gly Thr Val Ile Asp Ile Ser Lys Leu 85 90 95 2022205243

Phe Val Leu Lys Gly Leu Asn Asp Val Leu Asp Ala Phe Asp Arg Lys 100 105 110

Ile Pro Leu Ile Lys Glu Lys Glu Leu Ile Ile Val Pro Thr Thr Cys 115 120 125

Gly Thr Gly Ser Glu Val Thr Asn Ile Ser Ile Ala Glu Ile Lys Ser 130 135 140

Arg His Thr Lys Met Gly Leu Ala Asp Asp Ala Ile Val Ala Asp His 145 150 155 160

Ala Ile Ile Ile Pro Glu Leu Leu Lys Ser Leu Pro Phe His Phe Tyr 165 170 175

Ala Cys Ser Ala Ile Asp Ala Leu Ile His Ala Ile Glu Ser Tyr Val 180 185 190

Ser Pro Lys Ala Ser Pro Tyr Ser Arg Leu Phe Ser Glu Ala Ala Trp 195 200 205

Asp Ile Ile Leu Glu Val Phe Lys Lys Ile Ala Glu His Gly Pro Glu 210 215 220

Tyr Arg Phe Glu Lys Leu Gly Glu Met Ile Met Ala Ser Asn Tyr Ala 225 230 235 240

Gly Ile Ala Phe Gly Asn Ala Gly Val Gly Ala Val His Ala Leu Ser 245 250 255

Tyr Pro Leu Gly Gly Asn Tyr His Val Pro His Gly Glu Ala Asn Tyr 260 265 270

Gln Phe Phe Thr Glu Val Phe Lys Val Tyr Gln Lys Lys Asn Pro Phe 275 280 285

Gly Tyr Ile Val Glu Leu Asn Trp Lys Leu Ser Lys Ile Leu Asn Cys 290 295 300

Gln Pro Glu Tyr Val Tyr Pro Lys Leu Asp Glu Leu Leu Gly Cys Leu 305 310 315 320

Page 24

12956-144-228_SEQLIST.TXT 14 Jul 2022

Leu Thr Lys Lys Pro Leu His Glu Tyr Gly Met Lys Asp Glu Glu Val 325 330 335

Arg Gly Phe Ala Glu Ser Val Leu Lys Thr Gln Gln Arg Leu Leu Ala 340 345 350

Asn Asn Tyr Val Glu Leu Thr Val Asp Glu Ile Glu Gly Ile Tyr Arg 355 360 365 2022205243

Arg Leu Tyr 370

<210> 55 <211> 1296 <212> DNA <213> Porphyromonas gingivalis <400> 55 atgaaagacg tattagcgga atatgcctcc cgaattgttt cggccgaaga agccgtaaaa 60

catatcaaaa atggagaacg ggtagctttg tcacatgctg ccggagttcc tcagagttgt 120 gttgatgcac tggtacaaca ggccgacctt ttccagaatg tcgaaattta tcacatgctt 180

tgtctcggcg aaggaaaata tatggcacct gaaatggccc ctcacttccg acacataacc 240

aattttgtag gtggtaattc tcgtaaagca gttgaggaaa atagagccga cttcattccg 300

gtattctttt atgaagtgcc atcaatgatt cgcaaagaca tccttcacat agatgtcgcc 360

atcgttcagc tttcaatgcc tgatgagaat ggttactgta gttttggagt atcttgcgat 420 tatagcaaac cggcagcaga aagcgctcat ttagttatag gggaaatcaa ccgtcaaatg 480

ccatatgtac atggcgacaa cttgattcac atatcgaagt tggattacat cgtgatggca 540

gactacccta tctattctct tgcaaagccc aaaatcggag aagtagaaga agctatcggg 600 cgtaattgtg ccgagcttat tgaagatggt gccacactcc aactcggtat cggcgcgatt 660

cctgatgcag ccctgttatt cctcaaggac aaaaaagatc tggggatcca taccgagatg 720 ttctccgatg gtgttgtcga attagttcgc agtggagtaa ttacaggaaa gaaaaagaca 780 cttcaccccg gaaagatggt cgcaaccttc ttaatgggaa gcgaagacgt atatcatttc 840

atcgacaaaa atcccgatgt agaactttat ccggtagatt acgtcaatga tccgcgagta 900 atcgctcaaa atgataatat ggtcagcatc aatagctgta tcgaaatcga tcttatggga 960 caagtcgtgt ccgaatgtat aggaagcaag caattcagcg gaaccggcgg tcaagtagat 1020

tatgttcgtg gagcagcatg gtctaaaaac ggcaaaagca tcatggcaat tccctcaaca 1080 gccaaaaacg gtactgcatc tcgaattgta cctataattg cagagggagc tgctgtaaca 1140

accctccgca acgaagtcga ttacgttgta accgaatacg gtatagcaca actcaaagga 1200 aagagtttgc gccagcgagc agaagctctt attgccatag cccacccgga tttcagagag 1260 gaactaacga aacatctccg caaacgtttc ggataa 1296

Page 25

12956-144-228_SEQLIST.TXT 14 Jul 2022

<210> 56 <211> 431 <212> PRT <213> Porphyromonas gingivalis <400> 56 Met Lys Asp Val Leu Ala Glu Tyr Ala Ser Arg Ile Val Ser Ala Glu 1 5 10 15

Glu Ala Val Lys His Ile Lys Asn Gly Glu Arg Val Ala Leu Ser His 20 25 30 2022205243

Ala Ala Gly Val Pro Gln Ser Cys Val Asp Ala Leu Val Gln Gln Ala 35 40 45

Asp Leu Phe Gln Asn Val Glu Ile Tyr His Met Leu Cys Leu Gly Glu 50 55 60

Gly Lys Tyr Met Ala Pro Glu Met Ala Pro His Phe Arg His Ile Thr 65 70 75 80

Asn Phe Val Gly Gly Asn Ser Arg Lys Ala Val Glu Glu Asn Arg Ala 85 90 95

Asp Phe Ile Pro Val Phe Phe Tyr Glu Val Pro Ser Met Ile Arg Lys 100 105 110

Asp Ile Leu His Ile Asp Val Ala Ile Val Gln Leu Ser Met Pro Asp 115 120 125

Glu Asn Gly Tyr Cys Ser Phe Gly Val Ser Cys Asp Tyr Ser Lys Pro 130 135 140

Ala Ala Glu Ser Ala His Leu Val Ile Gly Glu Ile Asn Arg Gln Met 145 150 155 160

Pro Tyr Val His Gly Asp Asn Leu Ile His Ile Ser Lys Leu Asp Tyr 165 170 175

Ile Val Met Ala Asp Tyr Pro Ile Tyr Ser Leu Ala Lys Pro Lys Ile 180 185 190

Gly Glu Val Glu Glu Ala Ile Gly Arg Asn Cys Ala Glu Leu Ile Glu 195 200 205

Asp Gly Ala Thr Leu Gln Leu Gly Ile Gly Ala Ile Pro Asp Ala Ala 210 215 220

Leu Leu Phe Leu Lys Asp Lys Lys Asp Leu Gly Ile His Thr Glu Met 225 230 235 240

Phe Ser Asp Gly Val Val Glu Leu Val Arg Ser Gly Val Ile Thr Gly 245 250 255 Page 26

12956-144-228_SEQLIST.TXT 14 Jul 2022

Lys Lys Lys Thr Leu His Pro Gly Lys Met Val Ala Thr Phe Leu Met 260 265 270

Gly Ser Glu Asp Val Tyr His Phe Ile Asp Lys Asn Pro Asp Val Glu 275 280 285

Leu Tyr Pro Val Asp Tyr Val Asn Asp Pro Arg Val Ile Ala Gln Asn 290 295 300 2022205243

Asp Asn Met Val Ser Ile Asn Ser Cys Ile Glu Ile Asp Leu Met Gly 305 310 315 320

Gln Val Val Ser Glu Cys Ile Gly Ser Lys Gln Phe Ser Gly Thr Gly 325 330 335

Gly Gln Val Asp Tyr Val Arg Gly Ala Ala Trp Ser Lys Asn Gly Lys 340 345 350

Ser Ile Met Ala Ile Pro Ser Thr Ala Lys Asn Gly Thr Ala Ser Arg 355 360 365

Ile Val Pro Ile Ile Ala Glu Gly Ala Ala Val Thr Thr Leu Arg Asn 370 375 380

Glu Val Asp Tyr Val Val Thr Glu Tyr Gly Ile Ala Gln Leu Lys Gly 385 390 395 400

Lys Ser Leu Arg Gln Arg Ala Glu Ala Leu Ile Ala Ile Ala His Pro 405 410 415

Asp Phe Arg Glu Glu Leu Thr Lys His Leu Arg Lys Arg Phe Gly 420 425 430

<210> 57 <211> 906 <212> DNA <213> Clostridium acetobutylicum

<400> 57 atgattaaga gttttaatga aattatcatg aaggtaaaga gcaaagaaat gaaaaaagtt 60

gctgttgctg tagcacaaga cgagccagta cttgaagcag taagagatgc taagaaaaat 120 ggtattgcag atgctattct tgttggagac catgacgaaa tcgtgtcaat cgcgcttaaa 180

ataggaatgg atgtaaatga ttttgaaata gtaaacgagc ctaacgttaa gaaagctgct 240 ttaaaggcag tagagcttgt atcaactgga aaagctgata tggtaatgaa gggacttgta 300 aatacagcaa ctttcttaag atctgtatta aacaaagaag ttggacttag aacaggaaaa 360

actatgtctc acgttgcagt atttgaaact gagaaatttg atagactatt atttttaaca 420 gatgttgctt tcaatactta tcctgaatta aaggaaaaaa ttgatatagt aaacaattca 480

Page 27

12956-144-228_SEQLIST.TXT 14 Jul 2022

gttaaggttg cacatgcaat aggaattgaa aatccaaagg ttgctccaat ttgtgcagtt 540 gaggttataa accctaaaat gccatcaaca cttgatgcag caatgctttc aaaaatgagt 600 gacagaggac aaattaaagg ttgtgtagtt gacggacctt tagcacttga tatagcttta 660

tcagaagaag cagcacatca taagggagta acaggagaag ttgctggaaa agctgatatc 720 ttcttaatgc caaacataga aacaggaaat gtaatgtata agactttaac atatacaact 780 gattcaaaaa atggaggaat cttagttgga acttctgcac cagttgtttt aacttcaaga 840 2022205243

gctgacagcc atgaaacaaa aatgaactct atagcacttg cagctttagt tgcaggcaat 900 aaataa 906

<210> 58 <211> 301 <212> PRT <213> Clostridium acetobutylicum <400> 58 Met Ile Lys Ser Phe Asn Glu Ile Ile Met Lys Val Lys Ser Lys Glu 1 5 10 15

Met Lys Lys Val Ala Val Ala Val Ala Gln Asp Glu Pro Val Leu Glu 20 25 30

Ala Val Arg Asp Ala Lys Lys Asn Gly Ile Ala Asp Ala Ile Leu Val 35 40 45

Gly Asp His Asp Glu Ile Val Ser Ile Ala Leu Lys Ile Gly Met Asp 50 55 60

Val Asn Asp Phe Glu Ile Val Asn Glu Pro Asn Val Lys Lys Ala Ala 65 70 75 80

Leu Lys Ala Val Glu Leu Val Ser Thr Gly Lys Ala Asp Met Val Met 85 90 95

Lys Gly Leu Val Asn Thr Ala Thr Phe Leu Arg Ser Val Leu Asn Lys 100 105 110

Glu Val Gly Leu Arg Thr Gly Lys Thr Met Ser His Val Ala Val Phe 115 120 125

Glu Thr Glu Lys Phe Asp Arg Leu Leu Phe Leu Thr Asp Val Ala Phe 130 135 140

Asn Thr Tyr Pro Glu Leu Lys Glu Lys Ile Asp Ile Val Asn Asn Ser 145 150 155 160

Val Lys Val Ala His Ala Ile Gly Ile Glu Asn Pro Lys Val Ala Pro 165 170 175

Ile Cys Ala Val Glu Val Ile Asn Pro Lys Met Pro Ser Thr Leu Asp Page 28

12956-144-228_SEQLIST.TXT 14 Jul 2022

180 185 190

Ala Ala Met Leu Ser Lys Met Ser Asp Arg Gly Gln Ile Lys Gly Cys 195 200 205

Val Val Asp Gly Pro Leu Ala Leu Asp Ile Ala Leu Ser Glu Glu Ala 210 215 220

Ala His His Lys Gly Val Thr Gly Glu Val Ala Gly Lys Ala Asp Ile 2022205243

225 230 235 240

Phe Leu Met Pro Asn Ile Glu Thr Gly Asn Val Met Tyr Lys Thr Leu 245 250 255

Thr Tyr Thr Thr Asp Ser Lys Asn Gly Gly Ile Leu Val Gly Thr Ser 260 265 270

Ala Pro Val Val Leu Thr Ser Arg Ala Asp Ser His Glu Thr Lys Met 275 280 285

Asn Ser Ile Ala Leu Ala Ala Leu Val Ala Gly Asn Lys 290 295 300

<210> 59 <211> 1068 <212> DNA <213> Clostridium acetobutylicum

<400> 59 atgtatagat tactaataat caatcctggc tcgacctcaa ctaaaattgg tatttatgac 60

gatgaaaaag agatatttga gaagacttta agacattcag ctgaagagat agaaaaatat 120

aacactatat ttgatcaatt tcaattcaga aagaatgtaa ttttagatgc gttaaaagaa 180 gcaaacatag aagtaagttc tttaaatgct gtagttggaa gaggcggact cttaaagcca 240

atagtaagtg gaacttatgc agtaaatcaa aaaatgcttg aagaccttaa agtaggagtt 300 caaggtcagc atgcgtcaaa tcttggtgga attattgcaa atgaaatagc aaaagaaata 360 aatgttccag catacatagt tgatccagtt gttgtggatg agcttgatga agtttcaaga 420

atatcaggaa tggctgacat tccaagaaaa agtatattcc atgcattaaa tcaaaaagca 480 gttgctagaa gatatgcaaa agaagttgga aaaaaatacg aagatcttaa tttaatcgta 540 gtccacatgg gtggaggtac ttcagtaggt actcataaag atggtagagt aatagaagtt 600

aataatacac ttgatggaga aggtccattc tcaccagaaa gaagtggtgg agttccaata 660 ggagatcttg taagattgtg cttcagcaac aaatatactt atgaagaagt aatgaaaaag 720

ataaacggca aaggcggagt tgttagttac ttaaatacta tcgattttaa ggctgtagtt 780 gataaagctc ttgaaggaga taagaaatgt gcacttatat atgaagcttt cacattccag 840 gtagcaaaag agataggaaa atgttcaacc gttttaaaag gaaatgtaga tgcaataatc 900

ttaacaggcg gaattgcgta caacgagcat gtatgtaatg ccatagagga tagagtaaaa 960 Page 29

12956-144-228_SEQLIST.TXT 14 Jul 2022

ttcatagcac ctgtagttag atatggtgga gaagatgaac ttcttgcact tgcagaaggt 1020

ggacttagag ttttaagagg agaagaaaaa gctaaggaat acaaataa 1068

<210> 60 <211> 355 <212> PRT <213> Clostridium acetobutylicum <400> 60 2022205243

Met Tyr Arg Leu Leu Ile Ile Asn Pro Gly Ser Thr Ser Thr Lys Ile 1 5 10 15

Gly Ile Tyr Asp Asp Glu Lys Glu Ile Phe Glu Lys Thr Leu Arg His 20 25 30

Ser Ala Glu Glu Ile Glu Lys Tyr Asn Thr Ile Phe Asp Gln Phe Gln 35 40 45

Phe Arg Lys Asn Val Ile Leu Asp Ala Leu Lys Glu Ala Asn Ile Glu 50 55 60

Val Ser Ser Leu Asn Ala Val Val Gly Arg Gly Gly Leu Leu Lys Pro 65 70 75 80

Ile Val Ser Gly Thr Tyr Ala Val Asn Gln Lys Met Leu Glu Asp Leu 85 90 95

Lys Val Gly Val Gln Gly Gln His Ala Ser Asn Leu Gly Gly Ile Ile 100 105 110

Ala Asn Glu Ile Ala Lys Glu Ile Asn Val Pro Ala Tyr Ile Val Asp 115 120 125

Pro Val Val Val Asp Glu Leu Asp Glu Val Ser Arg Ile Ser Gly Met 130 135 140

Ala Asp Ile Pro Arg Lys Ser Ile Phe His Ala Leu Asn Gln Lys Ala 145 150 155 160

Val Ala Arg Arg Tyr Ala Lys Glu Val Gly Lys Lys Tyr Glu Asp Leu 165 170 175

Asn Leu Ile Val Val His Met Gly Gly Gly Thr Ser Val Gly Thr His 180 185 190

Lys Asp Gly Arg Val Ile Glu Val Asn Asn Thr Leu Asp Gly Glu Gly 195 200 205

Pro Phe Ser Pro Glu Arg Ser Gly Gly Val Pro Ile Gly Asp Leu Val 210 215 220

Page 30

12956-144-228_SEQLIST.TXT 14 Jul 2022

Arg Leu Cys Phe Ser Asn Lys Tyr Thr Tyr Glu Glu Val Met Lys Lys 225 230 235 240

Ile Asn Gly Lys Gly Gly Val Val Ser Tyr Leu Asn Thr Ile Asp Phe 245 250 255

Lys Ala Val Val Asp Lys Ala Leu Glu Gly Asp Lys Lys Cys Ala Leu 260 265 270 2022205243

Ile Tyr Glu Ala Phe Thr Phe Gln Val Ala Lys Glu Ile Gly Lys Cys 275 280 285

Ser Thr Val Leu Lys Gly Asn Val Asp Ala Ile Ile Leu Thr Gly Gly 290 295 300

Ile Ala Tyr Asn Glu His Val Cys Asn Ala Ile Glu Asp Arg Val Lys 305 310 315 320

Phe Ile Ala Pro Val Val Arg Tyr Gly Gly Glu Asp Glu Leu Leu Ala 325 330 335

Leu Ala Glu Gly Gly Leu Arg Val Leu Arg Gly Glu Glu Lys Ala Lys 340 345 350

Glu Tyr Lys 355

<210> 61 <211> 906 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 61 atgattaaga gttttaatga aattatcatg aaggtaaaga gcaaagaaat gaaaaaagtt 60 gctgttgctg tagcacaaga cgagccagta cttgaagcag tacgcgatgc taagaaaaat 120

ggtattgcag atgctattct tgttggcgac catgacgaaa tcgtgtcaat cgcgcttaaa 180 ataggcatgg atgtaaatga ttttgaaata gtaaacgagc ctaacgttaa gaaagctgct 240

ttaaaggcag tagagctggt atcaactgga aaagctgata tggtaatgaa gggacttgta 300 aatacagcaa ctttcttacg ctctgtatta aacaaagaag ttggactgag aacaggaaaa 360

actatgtctc acgttgcagt atttgaaact gagaaatttg atcgtctgtt atttttaaca 420 gatgttgctt tcaatactta tcctgaatta aaggaaaaaa ttgatatcgt aaacaattca 480 gttaaggttg cacatgcaat aggtattgaa aatccaaagg ttgctccaat ttgtgcagtt 540

gaggttataa accctaaaat gccatcaaca cttgatgcag caatgctttc aaaaatgagt 600 gacagaggac aaattaaagg ttgtgtagtt gacggaccgt tagcacttga tatcgcttta 660

Page 31

12956-144-228_SEQLIST.TXT 14 Jul 2022

tcagaagaag cagcacatca taagggcgta acaggagaag ttgctggaaa agctgatatc 720 ttcttaatgc caaacattga aacaggaaat gtaatgtata agactttaac atatacaact 780 gatagcaaaa atggcggaat cttagttgga acttctgcac cagttgtttt aacttcacgc 840

gctgacagcc atgaaacaaa aatgaactct attgcacttg cagctttagt tgcaggcaat 900 aaataa 906

<210> 62 2022205243

<211> 906 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 62 atgattaaga gttttaatga aattatcatg aaggtaaaga gcaaagaaat gaaaaaagtt 60 gctgttgctg tagcacaaga cgagccagta cttgaagcag tacgcgatgc taagaaaaat 120

ggtattgccg atgctattct ggttggcgac catgacgaaa tcgtgtctat cgcgctgaaa 180 ataggcatgg atgtaaatga ttttgaaatt gttaacgagc ctaacgttaa gaaagctgcg 240

ttaaaggcag tagagctggt atcaactgga aaagctgata tggtaatgaa gggactggta 300

aataccgcaa ctttcttacg ctctgtatta aacaaagaag ttggtctgcg tacaggaaaa 360

accatgtctc acgttgcagt atttgaaact gagaaatttg atcgtctgtt atttttaaca 420

gatgttgctt tcaatactta tcctgaatta aaggaaaaaa ttgatatcgt taacaatagc 480 gttaaggttg cacatgccat tggtattgaa aatccaaagg ttgctccaat ttgtgcagtt 540

gaggttatta acccgaaaat gccatcaaca cttgatgcag caatgctttc aaaaatgagt 600

gaccgcggac aaattaaagg ttgtgtagtt gacggaccgc tggcacttga tatcgcttta 660 tcagaagaag cagcacatca taaaggcgta acaggagaag ttgctggaaa agctgatatc 720

ttcttaatgc caaacattga aacaggaaat gtaatgtata agacgttaac ctataccact 780 gatagcaaaa atggcggcat cctggttgga acttctgcac cagttgtttt aacttcacgc 840 gctgacagcc atgaaacaaa aatgaactct attgcactgg cagcgctggt tgcaggcaat 900

aaataa 906

<210> 63 <211> 906 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 63 atgattaaga gttttaatga aattatcatg aaggtaaaga gcaaagaaat gaaaaaagtt 60 gctgttgctg ttgcacaaga cgagccggta ctggaagcgg tacgcgatgc taagaaaaat 120

Page 32

12956-144-228_SEQLIST.TXT 14 Jul 2022

ggtattgccg atgctattct ggttggcgac catgacgaaa tcgtctctat cgcgctgaaa 180 attggcatgg atgttaatga ttttgaaatt gttaacgagc ctaacgttaa gaaagctgcg 240 ctgaaggcgg tagagctggt ttccaccgga aaagctgata tggtaatgaa agggctggtg 300

aataccgcaa ctttcttacg cagcgtactg aacaaagaag ttggtctgcg taccggaaaa 360 accatgagtc acgttgcggt atttgaaact gagaaatttg atcgtctgct gtttctgacc 420 gatgttgctt tcaatactta tcctgaatta aaagaaaaaa ttgatatcgt taacaatagc 480 2022205243

gttaaggttg cgcatgccat tggtattgaa aatccaaagg ttgctccaat ttgtgcagtt 540 gaggttatta acccgaaaat gccatcaaca cttgatgccg caatgcttag caaaatgagt 600

gaccgcggac aaattaaagg ttgtgtggtt gacggcccgc tggcactgga tatcgcgtta 660 agcgaagaag cggcacatca taaaggcgta accggcgaag ttgctggaaa agctgatatc 720

ttcctgatgc caaacattga aacaggcaat gtaatgtata aaacgttaac ctataccact 780 gatagcaaaa atggcggcat cctggttgga acttctgcac cagttgtttt aacctcacgc 840 gctgacagcc atgaaaccaa aatgaacagc attgcactgg cagcgctggt tgcaggcaat 900

aaataa 906

<210> 64 <211> 906 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 64 atgattaaaa gttttaacga aattatcatg aaagtgaaaa gcaaagagat gaaaaaagtg 60

gcggttgcgg ttgcgcagga tgaaccggtg ctggaagcgg tgcgcgatgc caaaaaaaac 120 ggtattgccg atgccattct ggtgggcgat cacgatgaaa ttgtctctat tgcgctgaaa 180

attggcatgg atgttaacga ttttgaaatt gttaatgaac cgaacgtgaa aaaagcggcg 240 ctgaaagcgg ttgaactggt ttccaccggt aaagccgata tggtgatgaa agggctggtg 300 aataccgcaa ccttcctgcg cagcgtgctg aataaagaag tgggtctgcg taccggtaaa 360

accatgagtc atgttgcggt gtttgaaacc gaaaaatttg accgtctgct gtttctgacc 420 gatgttgcgt ttaataccta tccggaactg aaagagaaaa ttgatatcgt taataacagc 480 gtgaaagtgg cgcatgccat tggtattgaa aacccgaaag tggcgccgat ttgcgcggtt 540

gaagtgatta acccgaaaat gccgtcaacg ctggatgccg cgatgctcag caaaatgagc 600 gatcgcggtc aaatcaaagg ctgtgtggtt gatggcccgc tggcgctgga tatcgcgctt 660

agcgaagaag cggcgcatca taaaggcgtg accggcgaag tggccggtaa agccgatatt 720 ttcctgatgc cgaatattga aaccggcaac gtgatgtata aaacgctgac ctataccacc 780 gacagcaaaa acggcggcat tctggtgggt accagcgcgc cggtggtgct gacctcgcgc 840

gccgacagcc atgaaaccaa aatgaacagc attgcgctgg cggcgctggt ggccggtaat 900 Page 33

12956-144-228_SEQLIST.TXT 14 Jul 2022

aaataa 906

<210> 65 <211> 1068 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide 2022205243

<400> 65 atgtatcgtt tactgattat caatcctggc tcgacctcaa ctaaaattgg tatttatgac 60

gatgaaaaag agatatttga gaagacttta cgtcattcag ctgaagagat agaaaaatat 120 aacactatat ttgatcaatt tcagttcaga aagaatgtaa ttctcgatgc gttaaaagaa 180

gcaaacattg aagtaagttc tttaaatgct gtagttggac gcggcggact gttaaagcca 240 atagtaagtg gaacttatgc agtaaatcaa aaaatgcttg aagaccttaa agtaggcgtt 300 caaggtcagc atgcgtcaaa tcttggtgga attattgcaa atgaaatagc aaaagaaata 360

aatgttccag catacatcgt tgatccagtt gttgtggatg agcttgatga agtttcacgt 420

atatcaggaa tggctgacat tccacgtaaa agtatattcc atgcattaaa tcaaaaagca 480

gttgctagac gctatgcaaa agaagttgga aaaaaatacg aagatcttaa tttaatcgtg 540 gtccacatgg gtggcggtac ttcagtaggt actcataaag atggtagagt aattgaagtt 600

aataatacac ttgatggaga aggtccattc tcaccagaaa gaagtggtgg cgttccaata 660

ggcgatcttg tacgtttgtg cttcagcaac aaatatactt atgaagaagt aatgaaaaag 720

ataaacggca aaggcggcgt tgttagttac ttaaatacta tcgattttaa ggctgtagtt 780 gataaagctc ttgaaggcga taagaaatgt gcacttatat atgaagcttt cacattccag 840

gtagcaaaag agataggaaa atgttcaacc gttttaaaag gaaatgtaga tgcaataatc 900

ttaacaggcg gaattgcgta caacgagcat gtatgtaatg ccatagagga tagagtaaaa 960

ttcattgcac ctgtagttcg ttatggtgga gaagatgaac ttcttgcact tgcagaaggt 1020 ggactgcgcg ttttacgcgg agaagaaaaa gctaaggaat acaaataa 1068

<210> 66 <211> 1068 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 66 atgtatcgtt tactgattat caatcctggc tcgacctcaa ctaaaattgg tatttatgac 60 gatgaaaaag agatatttga gaagacgtta cgtcattcag ctgaagagat tgaaaaatat 120 aacactatat ttgatcaatt tcagttccgc aagaatgtga ttctcgatgc gttaaaagaa 180

gcaaacattg aagtcagttc tttaaatgct gtagttggac gcggcggact gttaaagcca 240 Page 34

12956-144-228_SEQLIST.TXT 14 Jul 2022

attgtcagtg gaacttatgc agtaaatcaa aaaatgcttg aagaccttaa agtgggcgtt 300

caaggtcagc atgccagcaa tcttggtggc attattgcca atgaaatcgc aaaagaaatc 360 aatgttccag catacatcgt tgatccggtt gttgtggatg agcttgatga agttagccgt 420

ataagcggaa tggctgacat tccacgtaaa agtatattcc atgcattaaa tcaaaaagca 480 gttgctcgtc gctatgcaaa agaagttggt aaaaaatacg aagatcttaa tttaatcgtg 540 gtccacatgg gtggcggtac ttcagtaggt actcataaag atggtcgcgt gattgaagtt 600 2022205243

aataatacac ttgatggcga aggtccattc tcaccagaac gtagtggtgg cgttccaatt 660 ggcgatctgg tacgtttgtg cttcagcaac aaatatactt atgaagaagt gatgaaaaag 720 ataaacggca aaggcggcgt tgttagttac ctgaatacta tcgattttaa ggctgtagtt 780

gataaagcgc ttgaaggcga taagaaatgt gcactgattt atgaagcttt caccttccag 840 gtagcaaaag agattggtaa atgttcaacc gttttaaaag gaaatgttga tgccattatc 900 ttaacaggcg gcattgctta caacgagcat gtatgtaatg ccattgagga tcgcgtaaaa 960

ttcattgcac ctgtagttcg ttatggtggc gaagatgaac tgctggcact ggcagaaggt 1020 ggactgcgcg ttttacgcgg cgaagaaaaa gcgaaggaat acaaataa 1068

<210> 67 <211> 1068 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 67 atgtatcgtc tgctgattat caatcctggc tcgacctcaa ctaaaattgg tatttatgac 60

gatgaaaaag agatatttga gaaaacgtta cgtcatagcg ctgaagagat tgaaaaatat 120

aacactattt ttgatcaatt tcagttccgc aagaatgtga ttctcgatgc gctgaaagaa 180

gcaaacattg aagtcagttc gctgaatgcg gtagttggtc gcggcggtct gctgaagcca 240 attgtcagcg gcacttatgc ggtaaatcaa aaaatgctgg aagacctgaa agtgggcgtt 300

caggggcagc atgccagcaa tcttggtggc attattgcca atgaaatcgc caaagaaatc 360 aatgttccgg catacatcgt tgatccggtt gttgtggatg agctggatga agttagccgt 420

atcagcggaa tggctgacat tccacgtaaa agtattttcc atgcactgaa tcaaaaagcg 480 gttgcgcgtc gctatgcaaa agaagttggt aaaaaatacg aagatcttaa tctgatcgtg 540

gtgcatatgg gtggcggtac tagcgtcggt actcataaag atggtcgcgt gattgaagtt 600 aataatacac ttgatggcga aggtccattc tcaccagaac gtagcggtgg cgttccaatt 660 ggcgatctgg tacgtttgtg cttcagcaac aaatatacct atgaagaagt gatgaaaaag 720

ataaacggca aaggcggcgt tgttagttac ctgaatacta tcgattttaa ggcggtagtt 780 gataaagcgc tggaaggcga taagaaatgt gcactgattt atgaagcgtt caccttccag 840

Page 35

12956-144-228_SEQLIST.TXT 14 Jul 2022

gtggcaaaag agattggtaa atgttcaacc gttctgaaag gcaatgttga tgccattatc 900 ctgaccggcg gcattgctta caacgagcat gtttgtaatg ccattgagga tcgcgtaaaa 960 ttcattgcac ctgtggttcg ttatggtggc gaagatgaac tgctggcact ggcagaaggt 1020

ggtctgcgcg ttttacgcgg cgaagaaaaa gcgaaagaat acaaataa 1068

<210> 68 <211> 1068 <212> DNA 2022205243

<213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 68 atgtatcgtc tgctgattat caacccgggc agcacctcaa ccaaaattgg tatttacgac 60 gatgaaaaag agatttttga aaaaacgctg cgtcacagcg cagaagagat tgaaaaatac 120 aacaccattt tcgatcagtt ccagttccgc aaaaacgtga ttctcgatgc gctgaaagaa 180

gccaatattg aagtctcctc gctgaatgcg gtggtcggtc gcggcggtct gctgaaaccg 240 attgtcagcg gcacttatgc ggttaatcag aaaatgctgg aagatctgaa agtgggcgtg 300

caggggcagc atgccagcaa tctcggcggc attatcgcca atgaaatcgc caaagagatc 360

aacgtgccgg cttatatcgt cgatccggtg gtggttgatg aactggatga agtcagccgt 420

atcagcggca tggcggatat tccgcgtaaa agcattttcc atgcgctgaa tcagaaagcg 480

gttgcgcgtc gctatgccaa agaagtgggt aaaaaatatg aagatctcaa tctgattgtg 540 gtgcatatgg gcggcggcac cagcgtcggt acgcataaag atggtcgcgt gattgaagtg 600

aataacacgc tggatggcga agggccgttc tcgccggaac gtagcggcgg cgtgccgatt 660

ggcgatctgg tgcgtctgtg tttcagcaat aaatacacct acgaagaagt gatgaaaaaa 720 atcaacggca aaggcggcgt ggttagctat ctgaatacca tcgattttaa agcggtggtt 780

gataaagcgc tggaaggcga taaaaaatgc gcgctgattt atgaagcgtt taccttccag 840 gtggcgaaag agattggtaa atgttcaacc gtgctgaaag gcaacgttga tgccattatt 900 ctgaccggcg gcattgctta taacgaacat gtttgtaatg ccattgaaga tcgcgtgaaa 960

tttattgcgc cggtggtgcg ttacggcggc gaagatgaac tgctggcgct ggcggaaggc 1020 ggtctgcgcg tgctgcgcgg cgaagaaaaa gcgaaagagt acaaataa 1068

<210> 69 <211> 1407 <212> DNA <213> Clostridium biejerinckii

<400> 69 atgaataaag acacactaat acctacaact aaagatttaa aagtaaaaac aaatggtgaa 60

aacattaatt taaagaacta caaggataat tcttcatgtt tcggagtatt cgaaaatgtt 120 gaaaatgcta taagcagcgc tgtacacgca caaaagatat tatcccttca ttatacaaaa 180

Page 36

12956-144-228_SEQLIST.TXT 14 Jul 2022

gagcaaagag aaaaaatcat aactgagata agaaaggccg cattacaaaa taaagaggtc 240 ttggctacaa tgattctaga agaaacacat atgggaagat atgaggataa aatattaaaa 300 catgaattgg tagctaaata tactcctggt acagaagatt taactactac tgcttggtca 360

ggtgataatg gtcttacagt tgtagaaatg tctccatatg gtgttatagg tgcaataact 420 ccttctacga atccaactga aactgtaata tgtaatagca taggcatgat agctgctgga 480 aatgctgtag tatttaacgg acacccatgc gctaaaaaat gtgttgcctt tgctgttgaa 540 2022205243

atgataaata aggcaattat ttcatgtggc ggtcctgaaa atctagtaac aactataaaa 600 aatccaacta tggagtctct agatgcaatt attaagcatc cttcaataaa acttctttgc 660

ggaactgggg gtccaggaat ggtaaaaacc ctcttaaatt ctggtaagaa agctataggt 720 gctggtgctg gaaatccacc agttattgta gatgatactg ctgatataga aaaggctggt 780

aggagcatca ttgaaggctg ttcttttgat aataatttac cttgtattgc agaaaaagaa 840 gtatttgttt ttgagaatgt tgcagatgat ttaatatcta acatgctaaa aaataatgct 900 gtaattataa atgaagatca agtatcaaaa ttaatagatt tagtattaca aaaaaataat 960

gaaactcaag aatactttat aaacaaaaaa tgggtaggaa aagatgcaaa attattctta 1020

gatgaaatag atgttgagtc tccttcaaat gttaaatgca taatctgcga agtaaatgca 1080

aatcatccat ttgttatgac agaactcatg atgccaatat tgccaattgt aagagttaaa 1140 gatatagatg aagctattaa atatgcaaag atagcagaac aaaatagaaa acatagtgcc 1200

tatatttatt ctaaaaatat agacaaccta aatagatttg aaagagaaat agatactact 1260

atttttgtaa agaatgctaa atcttttgct ggtgttggtt atgaagcaga aggatttaca 1320

actttcacta ttgctggatc tactggtgag ggaataacct ctgcaaggaa ttttacaaga 1380 caaagaagat gtgtacttgc cggctaa 1407

<210> 70 <211> 468 <212> PRT <213> Clostridium biejerinckii <400> 70 Met Asn Lys Asp Thr Leu Ile Pro Thr Thr Lys Asp Leu Lys Val Lys 1 5 10 15

Thr Asn Gly Glu Asn Ile Asn Leu Lys Asn Tyr Lys Asp Asn Ser Ser 20 25 30

Cys Phe Gly Val Phe Glu Asn Val Glu Asn Ala Ile Ser Ser Ala Val 35 40 45

His Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55 60

Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Gln Asn Lys Glu Val 65 70 75 80

Page 37

12956-144-228_SEQLIST.TXT 14 Jul 2022

Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr Glu Asp 85 90 95

Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr Pro Gly Thr Glu 100 105 110

Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp Asn Gly Leu Thr Val Val 115 120 125 2022205243

Glu Met Ser Pro Tyr Gly Val Ile Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140

Pro Thr Glu Thr Val Ile Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160

Asn Ala Val Val Phe Asn Gly His Pro Cys Ala Lys Lys Cys Val Ala 165 170 175

Phe Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185 190

Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Glu Ser Leu Asp 195 200 205

Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr Gly Gly 210 215 220

Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys Lys Ala Ile Gly 225 230 235 240

Ala Gly Ala Gly Asn Pro Pro Val Ile Val Asp Asp Thr Ala Asp Ile 245 250 255

Glu Lys Ala Gly Arg Ser Ile Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270

Leu Pro Cys Ile Ala Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285

Asp Asp Leu Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300

Glu Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310 315 320

Glu Thr Gln Glu Tyr Phe Ile Asn Lys Lys Trp Val Gly Lys Asp Ala 325 330 335

Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser Asn Val Lys 340 345 350

Page 38

12956-144-228_SEQLIST.TXT 14 Jul 2022

Cys Ile Ile Cys Glu Val Asn Ala Asn His Pro Phe Val Met Thr Glu 355 360 365

Leu Met Met Pro Ile Leu Pro Ile Val Arg Val Lys Asp Ile Asp Glu 370 375 380

Ala Ile Lys Tyr Ala Lys Ile Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 2022205243

Tyr Ile Tyr Ser Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415

Ile Asp Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430

Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435 440 445

Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg Cys 450 455 460

Val Leu Ala Gly 465

<210> 71 <211> 1407 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 71 atgaataaag acacactaat acctacaact aaagatttaa aagtaaaaac aaatggtgaa 60

aacattaatt taaagaacta caaggataat tcttcatgtt tcggcgtatt cgaaaatgtt 120 gaaaatgcta taagcagcgc tgtacacgca caaaagatat tatcccttca ttatacaaaa 180 gagcaacgtg aaaaaatcat aactgagata agaaaggccg cattacaaaa taaagaggtc 240

ttggctacaa tgattctgga agaaacacat atgggacgtt atgaggataa aatattaaaa 300 catgaattgg tagctaaata tactcctggt acagaagatt taactactac tgcctggtca 360 ggtgataatg gtctgacagt tgtagaaatg tctccatatg gtgttattgg tgcaataact 420

ccttctacga atccaactga aactgtaata tgtaatagca taggcatgat tgctgctgga 480 aatgctgtag tatttaacgg acacccatgc gctaaaaaat gtgttgcctt tgctgttgaa 540

atgataaata aggcaattat ttcatgtggc ggtcctgaaa atctggtaac aactataaaa 600 aatccaacca tggagtctct ggatgcaatt attaagcatc cttcaataaa acttctttgc 660 ggaactgggg gtccaggaat ggtaaaaacc ctgttaaatt ctggtaagaa agctataggt 720

gctggtgctg gaaatccacc agttattgtc gatgatactg ctgatataga aaaggctggt 780 Page 39

12956-144-228_SEQLIST.TXT 14 Jul 2022

cgtagcatca ttgaaggctg ttcttttgat aataatttac cttgtattgc agaaaaagaa 840

gtatttgttt ttgagaatgt tgcagatgat ttaatatcta acatgctaaa aaataatgct 900 gtaattataa atgaagatca agtatcaaaa ttaatcgatt tagtattaca aaaaaataat 960

gaaactcaag aatactttat aaacaaaaaa tgggtaggaa aagatgcaaa attattcctc 1020 gatgaaatag atgttgagtc tccttcaaat gttaaatgca taatctgcga agtaaatgca 1080 aatcatccat ttgttatgac agaactgatg atgccaatat tgccaattgt acgcgttaaa 1140 2022205243

gatatcgatg aagctattaa atatgcaaag atagcagaac aaaatagaaa acatagtgcc 1200 tatatttatt ctaaaaatat cgacaacctg aatcgctttg aacgtgaaat agatactact 1260 atttttgtaa agaatgctaa atcttttgct ggtgttggtt atgaagcaga aggatttaca 1320

actttcacta ttgctggatc tactggtgag ggaataacct ctgcacgtaa ttttacacgc 1380 caacgtcgct gtgtacttgc cggctaa 1407

<210> 72 <211> 1407 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 72 atgaataaag acacactgat ccctacaact aaagatttaa aagtaaaaac aaatggtgaa 60

aacattaatt taaagaacta caaagataat agcagttgtt tcggcgtatt cgaaaatgtt 120

gaaaatgcta tcagcagcgc tgtacacgca caaaagatat tatcgctgca ttatacaaaa 180 gagcaacgtg aaaaaatcat cactgagata cgtaaggccg cattacaaaa taaagaggtg 240

ctggctacaa tgattctgga agaaacacat atgggacgtt atgaggataa aatattaaaa 300

catgaactgg tagctaaata tactcctggt acagaagatt taactactac tgcctggagc 360

ggtgataatg gtctgacagt tgtagaaatg tctccatatg gtgttattgg tgcaataact 420 ccttctacca atccaactga aactgtaatt tgtaatagca ttggcatgat tgctgctgga 480

aatgctgtag tatttaacgg acacccatgc gctaaaaaat gtgttgcctt tgctgttgaa 540 atgatcaata aggcaattat tagctgtggc ggtccggaaa atctggtaac aactataaaa 600

aatccaacca tggagtctct ggatgccatt attaagcatc cttcaataaa actgctttgc 660 ggaactggcg gtccaggaat ggtaaaaacc ctgttaaatt ctggtaagaa agctattggt 720

gctggtgctg gaaatccacc agttattgtc gatgatactg ctgatattga aaaggctggt 780 cgtagcatca ttgaaggctg ttcttttgat aataatttac cttgtattgc agaaaaagaa 840 gtatttgttt ttgagaatgt tgcagatgat ttaatatcta acatgctgaa aaataatgct 900

gtaattatca atgaagatca ggtatcaaaa ttaatcgatt tagtattaca aaaaaataat 960 gaaactcaag aatactttat caacaaaaaa tgggtaggta aagatgcaaa attattcctc 1020

Page 40

12956-144-228_SEQLIST.TXT 14 Jul 2022

gatgaaatcg atgttgagtc tccttcaaat gttaaatgca ttatctgcga agtgaatgcc 1080 aatcatccat ttgttatgac agaactgatg atgccaatat tgccaattgt gcgcgttaaa 1140 gatatcgatg aagctattaa atatgcaaag attgcagaac aaaatagaaa acatagtgcc 1200

tatatttata gcaaaaatat cgacaacctg aatcgctttg aacgtgaaat cgatactact 1260 atttttgtaa agaatgctaa atcttttgct ggtgttggtt atgaagcaga aggatttacc 1320 actttcacta ttgctggatc tactggtgag ggcataacct ctgcacgtaa ttttacccgc 1380 2022205243

caacgtcgct gtgtactggc cggctaa 1407

<210> 73 <211> 1407 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 73 atgaataaag acacgctgat cccgacaact aaagatctga aagtaaaaac caatggtgaa 60 aacattaatc tgaagaacta caaagataat agcagttgtt tcggcgtatt cgaaaatgtt 120

gaaaatgcta tcagcagcgc ggtacacgca caaaagatac tctcgctgca ttataccaaa 180

gagcaacgtg aaaaaatcat cactgagatc cgtaaggccg cattacaaaa taaagaggtg 240

ctggcaacaa tgattctgga agaaacacat atgggacgtt atgaggataa aatactgaaa 300

catgaactgg tggcgaaata tacgcctggt actgaagatt taaccaccac tgcctggagc 360 ggtgataatg gtctgaccgt tgtggaaatg tcgccttatg gtgttattgg tgcaattacg 420

ccttcaacca atccaactga aacggtaatt tgtaatagca ttggcatgat tgctgctgga 480

aatgcggtag tatttaacgg tcacccctgc gctaaaaaat gtgttgcctt tgctgttgaa 540 atgatcaata aagcgattat tagctgtggc ggtccggaaa atctggtaac cactataaaa 600

aatccaacca tggagtcgct ggatgccatt attaagcatc cttcaatcaa actgctgtgc 660 ggcactggcg gtccaggaat ggtgaaaacc ctgctgaata gcggtaagaa agcgattggt 720 gctggtgctg gaaatccacc agttattgtc gatgatactg ctgatattga aaaagcgggt 780

cgtagcatca ttgaaggctg ttcttttgat aataatttac cttgtattgc agaaaaagaa 840 gtatttgttt ttgagaatgt tgccgatgat ctgatctcta acatgctgaa aaataatgcg 900 gtgattatca atgaagatca ggttagcaaa ctgatcgatc tggtattaca aaaaaataat 960

gaaactcaag aatactttat caacaaaaaa tgggtaggta aagatgcaaa actgttcctc 1020 gatgaaatcg atgttgagtc gccttcaaat gttaaatgca ttatctgcga agtgaatgcc 1080

aatcatccat ttgtgatgac cgaactgatg atgccaattt tgccgattgt gcgcgttaaa 1140 gatatcgatg aagcgattaa atatgcaaag attgcagaac aaaatcgtaa acatagtgcc 1200 tatatttata gcaaaaatat cgacaacctg aatcgctttg aacgtgaaat cgataccact 1260

atttttgtga agaatgctaa atcttttgct ggtgttggtt atgaagcaga aggttttacc 1320 Page 41

12956-144-228_SEQLIST.TXT 14 Jul 2022

actttcacta ttgctggaag caccggtgaa ggcattacct ctgcacgtaa ttttacccgc 1380

caacgtcgct gtgtactggc cggctaa 1407

<210> 74 <211> 1407 <212> DNA <213> Artificial Sequence <220> 2022205243

<223> Description of Artificial Sequence: Synthetic polynucleotide <400> 74 atgaataaag atacgctgat cccgaccacc aaagatctga aagtgaaaac caacggcgaa 60 aatatcaacc tgaaaaacta taaagataac agcagttgct ttggcgtgtt tgaaaacgtt 120

gaaaacgcca tctccagcgc ggtgcatgcg caaaaaattc tctcgctgca ttacaccaaa 180 gagcagcgtg aaaaaattat caccgaaatc cgtaaagcgg cgctgcaaaa caaagaagtg 240 ctggcaacca tgatcctgga agaaacgcat atggggcgtt atgaagataa aattctgaaa 300

catgaactgg tggcgaaata cacgccgggc actgaagatc tgaccaccac cgcctggagc 360

ggcgataacg gcctgaccgt ggtggagatg tcgccttatg gcgtgattgg cgcgattacg 420

ccgtcaacca acccgaccga aacggtgatt tgtaacagca ttggcatgat tgccgcgggt 480 aatgcggtgg tgtttaacgg tcatccctgc gcgaaaaaat gtgtggcgtt tgccgttgag 540

atgatcaaca aagcgattat cagctgcggc ggcccggaaa atctggtgac caccatcaaa 600

aatccgacca tggaatcgct ggatgccatt atcaaacatc cttccatcaa actgctgtgc 660

ggcaccggcg gcccgggcat ggtgaaaacg ctgctgaaca gcggtaaaaa agcgattggc 720 gcgggcgcgg gtaacccgcc ggtgattgtc gatgacaccg ccgatattga aaaagcgggg 780

cgtagcatta ttgaaggctg ttcttttgat aacaacctgc cctgcattgc cgaaaaagaa 840

gtgtttgtct ttgaaaacgt cgccgatgat ctgatcagca atatgctgaa aaacaacgcg 900

gtgattatca atgaagatca ggttagcaaa ctgatcgatc tggtgctgca aaaaaacaac 960 gaaacgcagg aatattttat caacaaaaaa tgggttggta aagatgccaa actgtttctc 1020

gatgaaatcg atgttgaatc gccgtctaac gtgaaatgta ttatctgcga agtgaacgcc 1080 aaccatccgt ttgtgatgac cgaactgatg atgccgattc tgccgattgt gcgcgtgaaa 1140

gatatcgatg aagcgattaa atatgccaaa attgccgaac aaaaccgtaa acacagcgcc 1200 tatatttaca gcaaaaatat cgataacctg aaccgctttg aacgtgaaat cgataccacc 1260

atttttgtga aaaatgccaa aagttttgcc ggcgttggtt atgaagcgga aggttttacc 1320 acctttacca ttgccggtag caccggcgaa ggcattacca gcgcccgtaa ttttacccgc 1380 cagcgtcgct gcgtgctggc gggctaa 1407

<210> 75 <211> 1023 <212> DNA Page 42

12956-144-228_SEQLIST.TXT 14 Jul 2022

<213> Geobacillus thermoglucosidasius <400> 75 atgaaagctg cagtagtaga gcaatttaag gaaccattaa aaattaaaga agtggaaaag 60 ccatctattt catatggcga agtattagtc cgcattaaag catgcggtgt atgccatacg 120

gacttgcacg ccgctcatgg cgattggcca gtaaaaccaa aacttccttt aatccctggc 180 catgaaggag tcggaattgt tgaagaagtc ggtccggggg taacccattt aaaagtggga 240 gaccgcgttg gaattccttg gttatattct gcgtgcggcc attgcgaata ttgtttaagc 300 2022205243

ggacaagaag cattatgtga acatcaacaa aacgccggct actcagtcga cgggggttat 360 gcagaatatt gcagagctgc gccagattat gtggtgaaaa ttcctgacaa cttatcgttt 420 gaagaagctg ctcctatttt ctgcgccgga gttactactt ataaagcgtt aaaagtcaca 480

ggtacaaaac cgggagaatg ggtagcgatc tatggcatcg gcggccttgg acatgttgcc 540 gtccagtatg cgaaagcgat ggggcttcat gttgttgcag tggatatcgg cgatgagaaa 600 ctggaacttg caaaagagct tggcgccgat cttgttgtaa atcctgcaaa agaaaatgcg 660

gcccaattta tgaaagagaa agtcggcgga gtacacgcgg ctgttgtgac agctgtatct 720 aaacctgctt ttcaatctgc gtacaattct atccgcagag gcggcacgtg cgtgcttgtc 780

ggattaccgc cggaagaaat gcctattcca atctttgata cggtattaaa cggaattaaa 840

attatcggtt ccattgtcgg cacgcggaaa gacttgcaag aagcgcttca gttcgctgca 900

gaaggtaaag taaaaaccat tattgaagtg caacctcttg aaaaaattaa cgaagtattt 960

gacagaatgc taaaaggaga aattaacgga cgggttgttt taacgttaga aaataataat 1020 taa 1023

<210> 76 <211> 340 <212> PRT <213> Geobacillus thermoglucosidasius

<400> 76 Met Lys Ala Ala Val Val Glu Gln Phe Lys Glu Pro Leu Lys Ile Lys 1 5 10 15

Glu Val Glu Lys Pro Ser Ile Ser Tyr Gly Glu Val Leu Val Arg Ile 20 25 30

Lys Ala Cys Gly Val Cys His Thr Asp Leu His Ala Ala His Gly Asp 35 40 45

Trp Pro Val Lys Pro Lys Leu Pro Leu Ile Pro Gly His Glu Gly Val 50 55 60

Gly Ile Val Glu Glu Val Gly Pro Gly Val Thr His Leu Lys Val Gly 65 70 75 80

Asp Arg Val Gly Ile Pro Trp Leu Tyr Ser Ala Cys Gly His Cys Glu 85 90 95 Page 43

12956-144-228_SEQLIST.TXT 14 Jul 2022

Tyr Cys Leu Ser Gly Gln Glu Ala Leu Cys Glu His Gln Gln Asn Ala 100 105 110

Gly Tyr Ser Val Asp Gly Gly Tyr Ala Glu Tyr Cys Arg Ala Ala Pro 115 120 125

Asp Tyr Val Val Lys Ile Pro Asp Asn Leu Ser Phe Glu Glu Ala Ala 130 135 140 2022205243

Pro Ile Phe Cys Ala Gly Val Thr Thr Tyr Lys Ala Leu Lys Val Thr 145 150 155 160

Gly Thr Lys Pro Gly Glu Trp Val Ala Ile Tyr Gly Ile Gly Gly Leu 165 170 175

Gly His Val Ala Val Gln Tyr Ala Lys Ala Met Gly Leu His Val Val 180 185 190

Ala Val Asp Ile Gly Asp Glu Lys Leu Glu Leu Ala Lys Glu Leu Gly 195 200 205

Ala Asp Leu Val Val Asn Pro Ala Lys Glu Asn Ala Ala Gln Phe Met 210 215 220

Lys Glu Lys Val Gly Gly Val His Ala Ala Val Val Thr Ala Val Ser 225 230 235 240

Lys Pro Ala Phe Gln Ser Ala Tyr Asn Ser Ile Arg Arg Gly Gly Thr 245 250 255

Cys Val Leu Val Gly Leu Pro Pro Glu Glu Met Pro Ile Pro Ile Phe 260 265 270

Asp Thr Val Leu Asn Gly Ile Lys Ile Ile Gly Ser Ile Val Gly Thr 275 280 285

Arg Lys Asp Leu Gln Glu Ala Leu Gln Phe Ala Ala Glu Gly Lys Val 290 295 300

Lys Thr Ile Ile Glu Val Gln Pro Leu Glu Lys Ile Asn Glu Val Phe 305 310 315 320

Asp Arg Met Leu Lys Gly Glu Ile Asn Gly Arg Val Val Leu Thr Leu 325 330 335

Glu Asn Asn Asn 340

<210> 77 <211> 4090 Page 44

12956-144-228_SEQLIST.TXT 14 Jul 2022

<212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 77 atggctatcg aaatcaaagt accggacatc ggggctgatg aagttgaaat caccgagatc 60 ctggtcaaag tgggcgacaa agttgaagcc gaacagtcgc tgatcaccgt agaaggcgac 120 2022205243

aaagcctcta tggaagttcc gtctccgcag gcgggtatcg ttaaagagat caaagtctct 180 gttggcgata aaacccagac cggcgcactg attatgattt tcgattccgc cgacggtgca 240

gcagacgctg cacctgctca ggcagaagag aagaaagaag cagctccggc agcagcacca 300 gcggctgcgg cggcaaaaga cgttaacgtt ccggatatcg gcagcgacga agttgaagtg 360

accgaaatcc tggtgaaagt tggcgataaa gttgaagctg aacagtcgct gatcaccgta 420 gaaggcgaca aggcttctat ggaagttccg gctccgtttg ctggcaccgt gaaagagatc 480 aaagtgaacg tgggtgacaa agtgtctacc ggctcgctga ttatggtctt cgaagtcgcg 540

ggtgaagcag gcgcggcagc tccggccgct aaacaggaag cagctccggc agcggcccct 600

gcaccagcgg ctggcgtgaa agaagttaac gttccggata tcggcggtga cgaagttgaa 660

gtgactgaag tgatggtgaa agtgggcgac aaagttgccg ctgaacagtc actgatcacc 720 gtagaaggcg acaaagcttc tatggaagtt ccggcgccgt ttgcaggcgt cgtgaaggaa 780

ctgaaagtca acgttggcga taaagtgaaa actggctcgc tgattatgat cttcgaagtt 840

gaaggcgcag cgcctgcggc agctcctgcg aaacaggaag cggcagcgcc ggcaccggca 900

gcaaaagctg aagccccggc agcagcacca gctgcgaaag cggaaggcaa atctgaattt 960 gctgaaaacg acgcttatgt tcacgcgact ccgctgatcc gccgtctggc acgcgagttt 1020

ggtgttaacc ttgcgaaagt gaagggcact ggccgtaaag gtcgtatcct gcgcgaagac 1080

gttcaggctt acgtgaaaga agctatcaaa cgtgcagaag cagctccggc agcgactggc 1140

ggtggtatcc ctggcatgct gccgtggccg aaggtggact tcagcaagtt tggtgaaatc 1200 gaagaagtgg aactgggccg catccagaaa atctctggtg cgaacctgag ccgtaactgg 1260

gtaatgatcc cgcatgttac tcacttcgac aaaaccgata tcaccgagtt ggaagcgttc 1320 cgtaaacagc agaacgaaga agcggcgaaa cgtaagctgg atgtgaagat caccccggtt 1380

gtcttcatca tgaaagccgt tgctgcagct cttgagcaga tgcctcgctt caatagttcg 1440 ctgtcggaag acggtcagcg tctgaccctg aagaaataca tcaacatcgg tgtggcggtg 1500

gataccccga acggtctggt tgttccggta ttcaaagacg tcaacaagaa aggcatcatc 1560 gagctgtctc gcgagctgat gactatttct aagaaagcgc gtgacggtaa gctgactgcg 1620 ggcgaaatgc agggcggttg cttcaccatc tccagcatcg gcggcctggg tactacccac 1680

ttcgcgccga ttgtgaacgc gccggaagtg gctatcctcg gcgtttccaa gtccgcgatg 1740 gagccggtgt ggaatggtaa agagttcgtg ccgcgtctga tgctgccgat ttctctctcc 1800

Page 45

12956-144-228_SEQLIST.TXT 14 Jul 2022

ttcgaccacc gcgtgatcga cggtgctgat ggtgcccgtt tcattaccat cattaacaac 1860 acgctgtctg acattcgccg tctggtgatg taagtaaaag agccggccca acggccggct 1920 tttttctggt aatctcatga atgtattgag gttattagcg aatagacaaa tcggttgccg 1980

tttgttgttt aaaaattgtt aacaattttg taaaataccg acggatagaa cgacccggtg 2040 gtggttaggg tattacttca cataccctat ggatttctgg gtgcagcaag gtagcaagcg 2100 ccagaatccc caggagctta cataagtaag tgactggggt gagggcgtga agctaacgcc 2160 2022205243

gctgcggcct gaaagacgac gggtatgacc gccggagata aatatataga ggtcatgatg 2220 agtactgaaa tcaaaactca ggtcgtggta cttggggcag gccccgcagg ttactccgct 2280

gccttccgtt gcgctgattt aggtctggaa accgtaatcg tagaacgtta caacaccctt 2340 ggcggtgttt gtctgaacgt gggttgtatc ccttctaaag cgctgctgca cgtggcaaaa 2400

gttatcgaag aagcgaaagc gctggccgaa cacggcatcg ttttcggcga accgaaaact 2460 gacattgaca agatccgcac ctggaaagaa aaagtcatca ctcagctgac cggtggtctg 2520 gctggcatgg ccaaaggtcg taaagtgaag gtggttaacg gtctgggtaa atttaccggc 2580

gctaacaccc tggaagtgga aggcgaaaac ggcaaaaccg tgatcaactt cgacaacgcc 2640

atcatcgcgg cgggttcccg tccgattcag ctgccgttta tcccgcatga agatccgcgc 2700

gtatgggact ccaccgacgc gctggaactg aaatctgtac cgaaacgcat gctggtgatg 2760 ggcggcggta tcatcggtct ggaaatgggt accgtatacc atgcgctggg ttcagagatt 2820

gacgtggtgg aaatgttcga ccaggttatc ccggctgccg acaaagacgt ggtgaaagtc 2880

ttcaccaaac gcatcagcaa gaaatttaac ctgatgctgg aagccaaagt gactgccgtt 2940

gaagcgaaag aagacggtat ttacgtttcc atggaaggta aaaaagcacc ggcggaagcg 3000 cagcgttacg acgcagtgct ggtcgctatc ggccgcgtac cgaatggtaa aaacctcgat 3060

gcaggtaaag ctggcgtgga agttgacgat cgcggcttca tccgcgttga caaacaaatg 3120

cgcaccaacg tgccgcacat ctttgctatc ggcgatatcg tcggtcagcc gatgctggcg 3180

cacaaaggtg tccatgaagg ccacgttgcc gcagaagtta tctccggtct gaaacactac 3240 ttcgatccga aagtgatccc atccatcgcc tacactaaac cagaagtggc atgggtcggt 3300

ctgaccgaga aagaagcgaa agagaaaggc atcagctacg aaaccgccac cttcccgtgg 3360 gctgcttccg gccgtgctat cgcttctgac tgcgcagatg gtatgaccaa actgatcttc 3420

gacaaagaga cccaccgtgt tatcggcggc gcgattgtcg gcaccaacgg cggcgagctg 3480 ctgggtgaga tcggcctggc tatcgagatg ggctgtgacg ctgaagacat cgccctgacc 3540

atccacgctc acccgactct gcacgagtcc gttggcctgg cggcggaagt gttcgaaggc 3600 agcatcaccg acctgccaaa cgccaaagcg aagaaaaagt aactttttct ttcaggaaaa 3660 aagcataagc ggctccggga gccgcttttt ttatgcctga tgtttagaac tatgtcactg 3720

ttcataaacc gctacacctc atacatactt taagggcgaa ttctgcagat atccatcaca 3780 ctggcggccg ctcgagcatg catctagcac atccggcaat taaaaaagcg gctaaccacg 3840

Page 46

12956-144-228_SEQLIST.TXT 14 Jul 2022

ccgctttttt tacgtctgca atttaccttt ccagtcttct tgctccacgt tcagagagac 3900 gttcgcatac tgctgaccgt tgctcgttat tcagcctgac agtatggtta ctgtcgttta 3960 gacgttgtgg gcggctctcc tgaactttct cccgaaaaac ctgacgttgt tcaggtgatg 4020

ccgattgaac acgctggcgg gcgttatcac gttgctgttg attcagtggg cgctgctgta 4080 ctttttcctt 4090

<210> 78 2022205243

<211> 475 <212> PRT <213> Escherichia coli

<400> 78 Met Met Ser Thr Glu Ile Lys Thr Gln Val Val Val Leu Gly Ala Gly 1 5 10 15

Pro Ala Gly Tyr Ser Ala Ala Phe Arg Cys Ala Asp Leu Gly Leu Glu 20 25 30

Thr Val Ile Val Glu Arg Tyr Asn Thr Leu Gly Gly Val Cys Leu Asn 35 40 45

Val Gly Cys Ile Pro Ser Lys Ala Leu Leu His Val Ala Lys Val Ile 50 55 60

Glu Glu Ala Lys Ala Leu Ala Glu His Gly Ile Val Phe Gly Glu Pro 65 70 75 80

Lys Thr Asp Ile Asp Lys Ile Arg Thr Trp Lys Glu Lys Val Ile Asn 85 90 95

Gln Leu Thr Gly Gly Leu Ala Gly Met Ala Lys Gly Arg Lys Val Lys 100 105 110

Val Val Asn Gly Leu Gly Lys Phe Thr Gly Ala Asn Thr Leu Glu Val 115 120 125

Glu Gly Glu Asn Gly Lys Thr Val Ile Asn Phe Asp Asn Ala Ile Ile 130 135 140

Ala Ala Gly Ser Arg Pro Ile Gln Leu Pro Phe Ile Pro His Glu Asp 145 150 155 160

Pro Arg Ile Trp Asp Ser Thr Asp Ala Leu Glu Leu Lys Glu Val Pro 165 170 175

Glu Arg Leu Leu Val Met Gly Gly Gly Ile Ile Gly Leu Glu Met Gly 180 185 190

Thr Val Tyr His Ala Leu Gly Ser Gln Ile Asp Val Val Glu Met Phe 195 200 205

Page 47

12956-144-228_SEQLIST.TXT 14 Jul 2022

Asp Gln Val Ile Pro Ala Ala Asp Lys Asp Ile Val Lys Val Phe Thr 210 215 220

Lys Arg Ile Ser Lys Lys Phe Asn Leu Met Leu Glu Thr Lys Val Thr 225 230 235 240

Ala Val Glu Ala Lys Glu Asp Gly Ile Tyr Val Thr Met Glu Gly Lys 245 250 255 2022205243

Lys Ala Pro Ala Glu Pro Gln Arg Tyr Asp Ala Val Leu Val Ala Ile 260 265 270

Gly Arg Val Pro Asn Gly Lys Asn Leu Asp Ala Gly Lys Ala Gly Val 275 280 285

Glu Val Asp Asp Arg Gly Phe Ile Arg Val Asp Lys Gln Leu Arg Thr 290 295 300

Asn Val Pro His Ile Phe Ala Ile Gly Asp Ile Val Gly Gln Pro Met 305 310 315 320

Leu Ala His Lys Gly Val His Glu Gly His Val Ala Ala Glu Val Ile 325 330 335

Ala Gly Lys Lys His Tyr Phe Asp Pro Lys Val Ile Pro Ser Ile Ala 340 345 350

Tyr Thr Glu Pro Glu Val Ala Trp Val Gly Leu Thr Glu Lys Glu Ala 355 360 365

Lys Glu Lys Gly Ile Ser Tyr Glu Thr Ala Thr Phe Pro Trp Ala Ala 370 375 380

Ser Gly Arg Ala Ile Ala Ser Asp Cys Ala Asp Gly Met Thr Lys Leu 385 390 395 400

Ile Phe Asp Lys Glu Ser His Arg Val Ile Gly Gly Ala Ile Val Gly 405 410 415

Thr Asn Gly Gly Glu Leu Leu Gly Glu Ile Gly Leu Ala Ile Glu Met 420 425 430

Gly Cys Asp Ala Glu Asp Ile Ala Leu Thr Ile His Ala His Pro Thr 435 440 445

Leu His Glu Ser Val Gly Leu Ala Ala Glu Val Phe Glu Gly Ser Ile 450 455 460

Thr Asp Leu Pro Asn Pro Lys Ala Lys Lys Lys 465 470 475

Page 48

12956-144-228_SEQLIST.TXT 14 Jul 2022

<210> 79 <211> 475 <212> PRT <213> Klebsiella pneumoniae

<400> 79 Met Met Ser Thr Glu Ile Lys Thr Gln Val Val Val Leu Gly Ala Gly 1 5 10 15

Pro Ala Gly Tyr Ser Ala Ala Phe Arg Cys Ala Asp Leu Gly Leu Glu 2022205243

20 25 30

Thr Val Ile Val Glu Arg Tyr Ser Thr Leu Gly Gly Val Cys Leu Asn 35 40 45

Val Gly Cys Ile Pro Ser Lys Ala Leu Leu His Val Ala Lys Val Ile 50 55 60

Glu Glu Ala Lys Ala Leu Ala Glu His Gly Ile Val Phe Gly Glu Pro 65 70 75 80

Lys Thr Asp Ile Asp Lys Ile Arg Thr Trp Lys Glu Lys Val Ile Thr 85 90 95

Gln Leu Thr Gly Gly Leu Ala Gly Met Ala Lys Gly Arg Lys Val Lys 100 105 110

Val Val Asn Gly Leu Gly Lys Phe Thr Gly Ala Asn Thr Leu Glu Val 115 120 125

Glu Gly Glu Asn Gly Lys Thr Val Ile Asn Phe Asp Asn Ala Ile Ile 130 135 140

Ala Ala Gly Ser Arg Pro Ile Gln Leu Pro Phe Ile Pro His Glu Asp 145 150 155 160

Pro Arg Val Trp Asp Ser Thr Asp Ala Leu Glu Leu Lys Ser Val Pro 165 170 175

Lys Arg Met Leu Val Met Gly Gly Gly Ile Ile Gly Leu Glu Met Gly 180 185 190

Thr Val Tyr His Ala Leu Gly Ser Glu Ile Asp Val Val Glu Met Phe 195 200 205

Asp Gln Val Ile Pro Ala Ala Asp Lys Asp Val Val Lys Val Phe Thr 210 215 220

Lys Arg Ile Ser Lys Lys Phe Asn Leu Met Leu Glu Ala Lys Val Thr 225 230 235 240

Ala Val Glu Ala Lys Glu Asp Gly Ile Tyr Val Ser Met Glu Gly Lys Page 49

12956-144-228_SEQLIST.TXT 14 Jul 2022

245 250 255

Lys Ala Pro Ala Glu Ala Gln Arg Tyr Asp Ala Val Leu Val Ala Ile 260 265 270

Gly Arg Val Pro Asn Gly Lys Asn Leu Asp Ala Gly Lys Ala Gly Val 275 280 285

Glu Val Asp Asp Arg Gly Phe Ile Arg Val Asp Lys Gln Met Arg Thr 2022205243

290 295 300

Asn Val Pro His Ile Phe Ala Ile Gly Asp Ile Val Gly Gln Pro Met 305 310 315 320

Leu Ala His Lys Gly Val His Glu Gly His Val Ala Ala Glu Val Ile 325 330 335

Ser Gly Leu Lys His Tyr Phe Asp Pro Lys Val Ile Pro Ser Ile Ala 340 345 350

Tyr Thr Lys Pro Glu Val Ala Trp Val Gly Leu Thr Glu Lys Glu Ala 355 360 365

Lys Glu Lys Gly Ile Ser Tyr Glu Thr Ala Thr Phe Pro Trp Ala Ala 370 375 380

Ser Gly Arg Ala Ile Ala Ser Asp Cys Ala Asp Gly Met Thr Lys Leu 385 390 395 400

Ile Phe Asp Lys Glu Thr His Arg Val Ile Gly Gly Ala Ile Val Gly 405 410 415

Thr Asn Gly Gly Glu Leu Leu Gly Glu Ile Gly Leu Ala Ile Glu Met 420 425 430

Gly Cys Asp Ala Glu Asp Ile Ala Leu Thr Ile His Ala His Pro Thr 435 440 445

Leu His Glu Ser Val Gly Leu Ala Ala Glu Val Phe Glu Gly Ser Ile 450 455 460

Thr Asp Leu Pro Asn Ala Lys Ala Lys Lys Lys 465 470 475

<210> 80 <211> 347 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

Page 50

12956-144-228_SEQLIST.TXT 14 Jul 2022

<400> 80 ataataatac atatgaacca tgcgagttac gggcctataa gccaggcgag atatgatcta 60

tatcaatttc tcatctataa tgctttgtta gtatctcgtc gccgacttaa taaagagaga 120 gttagtgtga aagctgacaa cccttttgat cttttacttc ctgctgcaat ggccaaagtg 180

gccgaagagg cgggtgtcta taaagcaacg aaacatccgc ttaagacttt ctatctggcg 240 attaccgccg gtgttttcat ctcaatcgca ttcaccactg gcacaggcac agaaggtagg 300 tgttacatgt cagaacgttt acacaatgac gtggatccta ttattat 347 2022205243

<210> 81 <211> 4678 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 81 aagaggtaaa agaataatgg ctatcgaaat caaagtaccg gacatcgggg ctgatgaagt 60

tgaaatcacc gagatcctgg tcaaagtggg cgacaaagtt gaagccgaac agtcgctgat 120

caccgtagaa ggcgacaaag cctctatgga agttccgtct ccgcaggcgg gtatcgttaa 180

agagatcaaa gtctctgttg gcgataaaac ccagaccggc gcactgatta tgattttcga 240 ttccgccgac ggtgcagcag acgctgcacc tgctcaggca gaagagaaga aagaagcagc 300

tccggcagca gcaccagcgg ctgcggcggc aaaagacgtt aacgttccgg atatcggcag 360

cgacgaagtt gaagtgaccg aaatcctggt gaaagttggc gataaagttg aagctgaaca 420

gtcgctgatc accgtagaag gcgacaaggc ttctatggaa gttccggctc cgtttgctgg 480 caccgtgaaa gagatcaaag tgaacgtggg tgacaaagtg tctaccggct cgctgattat 540

ggtcttcgaa gtcgcgggtg aagcaggcgc ggcagctccg gccgctaaac aggaagcagc 600

tccggcagcg gcccctgcac cagcggctgg cgtgaaagaa gttaacgttc cggatatcgg 660

cggtgacgaa gttgaagtga ctgaagtgat ggtgaaagtg ggcgacaaag ttgccgctga 720 acagtcactg atcaccgtag aaggcgacaa agcttctatg gaagttccgg cgccgtttgc 780

aggcgtcgtg aaggaactga aagtcaacgt tggcgataaa gtgaaaactg gctcgctgat 840 tatgatcttc gaagttgaag gcgcagcgcc tgcggcagct cctgcgaaac aggaagcggc 900

agcgccggca ccggcagcaa aagctgaagc cccggcagca gcaccagctg cgaaagcgga 960 aggcaaatct gaatttgctg aaaacgacgc ttatgttcac gcgactccgc tgatccgccg 1020

tctggcacgc gagtttggtg ttaaccttgc gaaagtgaag ggcactggcc gtaaaggtcg 1080 tatcctgcgc gaagacgttc aggcttacgt gaaagaagct atcaaacgtg cagaagcagc 1140 tccggcagcg actggcggtg gtatccctgg catgctgccg tggccgaagg tggacttcag 1200

caagtttggt gaaatcgaag aagtggaact gggccgcatc cagaaaatct ctggtgcgaa 1260 cctgagccgt aactgggtaa tgatcccgca tgttactcac ttcgacaaaa ccgatatcac 1320

Page 51

12956-144-228_SEQLIST.TXT 14 Jul 2022

cgagttggaa gcgttccgta aacagcagaa cgaagaagcg gcgaaacgta agctggatgt 1380 gaagatcacc ccggttgtct tcatcatgaa agccgttgct gcagctcttg agcagatgcc 1440 tcgcttcaat agttcgctgt cggaagacgg tcagcgtctg accctgaaga aatacatcaa 1500

catcggtgtg gcggtggata ccccgaacgg tctggttgtt ccggtattca aagacgtcaa 1560 caagaaaggc atcatcgagc tgtctcgcga gctgatgact atttctaaga aagcgcgtga 1620 cggtaagctg actgcgggcg aaatgcaggg cggttgcttc accatctcca gcatcggcgg 1680 2022205243

cctgggtact acccacttcg cgccgattgt gaacgcgccg gaagtggcta tcctcggcgt 1740 ttccaagtcc gcgatggagc cggtgtggaa tggtaaagag ttcgtgccgc gtctgatgct 1800

gccgatttct ctctccttcg accaccgcgt gatcgacggt gctgatggtg cccgtttcat 1860 taccatcatt aacaacacgc tgtctgacat tcgccgtctg gtgatgtaag taaaagagcc 1920

ggcccaacgg ccggcttttt tctggtaatc tcatgaatgt attgaggtta ttagcgaata 1980 gacaaatcgg ttgccgtttg ttaagccagg cgagatatga tctatatcaa tttctcatct 2040 ataatgcttt gttagtatct cgtcgccgac ttaataaaga gagagttagt cttctatatc 2100

acagcaagaa ggtaggtgtt acatgatgag tactgaaatc aaaactcagg tcgtggtact 2160

tggggcaggc cccgcaggtt actctgcagc cttccgttgc gctgatttag gtctggaaac 2220

cgtcatcgta gaacgttaca gcaccctcgg tggtgtttgt ctgaacgtgg gttgtatccc 2280 ttctaaagcg ctgctgcacg tggcaaaagt tatcgaagaa gcgaaagcgc tggccgaaca 2340

cggcatcgtt ttcggcgaac cgaaaactga cattgacaag atccgcacct ggaaagaaaa 2400

agtcatcact cagctgaccg gtggtctggc tggcatggcc aaaggtcgta aagtgaaggt 2460

ggttaacggt ctgggtaaat ttaccggcgc taacaccctg gaagtggaag gcgaaaacgg 2520 caaaaccgtg atcaacttcg acaacgccat catcgcggcg ggttcccgtc cgattcagct 2580

gccgtttatc ccgcatgaag atccgcgcgt atgggactcc accgacgcgc tggaactgaa 2640

atctgtaccg aaacgcatgc tggtgatggg cggcggtatc atcggtctgg aaatgggtac 2700

cgtataccat gcgctgggtt cagagattga cgtggtggaa atgttcgacc aggttatccc 2760 ggctgccgac aaagacgtgg tgaaagtctt caccaaacgc atcagcaaga aatttaacct 2820

gatgctggaa gccaaagtga ctgccgttga agcgaaagaa gacggtattt acgtttccat 2880 ggaaggtaaa aaagcaccgg cggaagcgca gcgttacgac gcagtgctgg tcgctatcgg 2940

ccgcgtaccg aatggtaaaa acctcgatgc aggtaaagct ggcgtggaag ttgacgatcg 3000 cggcttcatc cgcgttgaca aacaaatgcg caccaacgtg ccgcacatct ttgctatcgg 3060

cgatatcgtc ggtcagccga tgctggcgca caaaggtgtc catgaaggcc acgttgccgc 3120 agaagttatc tccggtctga aacactactt cgatccgaaa gtgatcccat ccatcgccta 3180 cactaaacca gaagtggcat gggtcggtct gaccgagaaa gaagcgaaag agaaaggcat 3240

cagctacgaa accgccacct tcccgtgggc tgcttccggc cgtgctatcg cttctgactg 3300 cgcagatggt atgaccaaac tgatcttcga caaagagacc caccgtgtta tcggcggcgc 3360

Page 52

12956-144-228_SEQLIST.TXT 14 Jul 2022

gattgtcggc accaacggcg gcgagctgct gggtgagatc ggcctggcta tcgagatggg 3420 ctgtgacgct gaagacatcg ccctgaccat ccacgctcac ccgactctgc acgagtccgt 3480 tggcctggcg gcggaagtgt tcgaaggcag catcaccgac ctgccaaacg ccaaagcgaa 3540

gaaaaagtaa ctttttcttt caggaaaaaa gcataagcgg ctccgggagc cgcttttttt 3600 atgcctgatg tttagaacta tgtcactgtt cataaaccgc tacacctcat acatacttta 3660 agggcgaatt ctgcagatat ccatcacact ggcggccgct cgagcatgca tctagcacat 3720 2022205243

ccggcaatta aaaaagcggc taaccacgcc gcttttttta cgtctgcaat ttacctttcc 3780 agtcttcttg ctccacgttc agagagacgt tcgcatactg ctgaccgttg ctcgttattc 3840

agcctgacag tatggttact gtcgtttaga cgttgtgggc ggctctcctg aactttctcc 3900 cgaaaaacct gacgttgttc aggtgatgcc gattgaacac gctggcgggc gttatcacgt 3960

tgctgttgat tcagtgggcg ctgctgtact ttttccttaa acacctggcg ctgctctggt 4020 gatgcggact gaatacgctc acgcgctgcg tctcttcgct gctggttctg cgggttagtc 4080 tgcattttct cgcgaaccgc ctggcgctgc tcaggcgagg cggactgaat gcgctcacgc 4140

gctgcctctc ttcgctgctg gatcttcggg ttagtctgca ttctctcgcg aactgcctgg 4200

cgctgctcag gcgaggcgga ctgataacgc tgacgagcgg cgtccttttg ttgctgggtc 4260

agtggttggc gacggctgaa gtcgtggaag tcgtcatagc tcccatagtg ttcagcttca 4320 ttaaaccgct gtgccgctgc ctgacgttgg gtacctcgtg taatgactgg tgcggcgtgt 4380

gttcgttgct gaaactgatt tgctgccgcc tgacgctggc tgtcgcgcgt tggggcaggt 4440

aattgcgtgg cgctcattcc gccgttgaca tcggtttgat gaaaccgctt tgccatatcc 4500

tgatcatgat agggcacacc attacggtag tttggattgt gccgccatgc catattctta 4560 tcagtaagat gctcaccggt gatacggttg aaattgttga cgtcgatatt gatgttgtcg 4620

ccgttgtgtt gccagccatt accgtcacga tgaccgccat cgtggtgatg ataatcat 4678

<210> 82 <211> 1114 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<220> <221> CDS <222> (323)..(958) <400> 82 caaaaaaccg gagtctgtgc tccggttttt tattatccgc taatcaatta catatgaata 60 tcctccttag ttcctattcc gaagttccta ttctctagaa agtataggaa cttcggcgcg 120

cctacctgtg acggaagatc acttcgcaga ataaataaat cctggtgtcc ctgttgatac 180 cgggaagccc tgggccaact tttggcgaaa atgagacgtt gatcggcacg taagaggttc 240

Page 53

12956-144-228_SEQLIST.TXT 14 Jul 2022

caactttcac cataatgaaa taagatcact accgggcgta ttttttgagt tgtcgagatt 300 ttcaggagct aaggaagcta aa atg gag aaa aaa atc act gga tat acc acc 352 Met Glu Lys Lys Ile Thr Gly Tyr Thr Thr 1 5 10

gtt gat ata tcc caa tgg cat cgt aaa gaa cat ttt gag gca ttt cag 400 Val Asp Ile Ser Gln Trp His Arg Lys Glu His Phe Glu Ala Phe Gln 15 20 25 tca gtt gct caa tgt acc tat aac cag acc gtt cag ctg gat att acg 448 Ser Val Ala Gln Cys Thr Tyr Asn Gln Thr Val Gln Leu Asp Ile Thr 2022205243

30 35 40 gcc ttt tta aag acc gta aag aaa aat aag cac aag ttt tat ccg gcc 496 Ala Phe Leu Lys Thr Val Lys Lys Asn Lys His Lys Phe Tyr Pro Ala 45 50 55 ttt att cac att ctt gcc cgc ctg atg aat gct cat ccg gaa tta cgt 544 Phe Ile His Ile Leu Ala Arg Leu Met Asn Ala His Pro Glu Leu Arg 60 65 70 atg gca atg aaa gac ggt gag ctg gtg ata tgg gat agt gtt cac cct 592 Met Ala Met Lys Asp Gly Glu Leu Val Ile Trp Asp Ser Val His Pro 75 80 85 90

tgt tac acc gtt ttc cat gag caa act gaa acg ttt tca tcg ctc tgg 640 Cys Tyr Thr Val Phe His Glu Gln Thr Glu Thr Phe Ser Ser Leu Trp 95 100 105

agt gaa tac cac gac gat ttc cgg cag ttt cta cac ata tat tcg caa 688 Ser Glu Tyr His Asp Asp Phe Arg Gln Phe Leu His Ile Tyr Ser Gln 110 115 120

gat gtg gcg tgt tac ggt gaa aac ctg gcc tat ttc cct aaa ggg ttt 736 Asp Val Ala Cys Tyr Gly Glu Asn Leu Ala Tyr Phe Pro Lys Gly Phe 125 130 135

att gag aat atg ttt ttc gtc tca gcc aat ccc tgg gtg agt ttc acc 784 Ile Glu Asn Met Phe Phe Val Ser Ala Asn Pro Trp Val Ser Phe Thr 140 145 150

agt ttt gat tta aac gtg gcc aat atg gac aac ttc ttc gcc ccc gtt 832 Ser Phe Asp Leu Asn Val Ala Asn Met Asp Asn Phe Phe Ala Pro Val 155 160 165 170

ttc acc atg ggc aaa tat tat acg caa ggc gac aag gtg ctg atg ccg 880 Phe Thr Met Gly Lys Tyr Tyr Thr Gln Gly Asp Lys Val Leu Met Pro 175 180 185

ctg gcg att cag gtt cat cat gcc gtt tgt gat ggc ttc cat gtc ggc 928 Leu Ala Ile Gln Val His His Ala Val Cys Asp Gly Phe His Val Gly 190 195 200

aga tgc tta atg aat aca aca gta ctg cga tgagtggcag ggcggggcgt 978 Arg Cys Leu Met Asn Thr Thr Val Leu Arg 205 210

aaggcgcgcc atttaaatga agttcctatt ccgaagttcc tattctctag aaagtatagg 1038 aacttcgaag cagctccagc ctacaccctt cttcagggct gactgtttgc ataaaaattc 1098 atctgtatgc acaata 1114

<210> 83 <211> 212 <212> PRT Page 54

12956-144-228_SEQLIST.TXT 14 Jul 2022

<213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide

<400> 83 Met Glu Lys Lys Ile Thr Gly Tyr Thr Thr Val Asp Ile Ser Gln Trp 1 5 10 15

His Arg Lys Glu His Phe Glu Ala Phe Gln Ser Val Ala Gln Cys Thr 2022205243

20 25 30

Tyr Asn Gln Thr Val Gln Leu Asp Ile Thr Ala Phe Leu Lys Thr Val 35 40 45

Lys Lys Asn Lys His Lys Phe Tyr Pro Ala Phe Ile His Ile Leu Ala 50 55 60

Arg Leu Met Asn Ala His Pro Glu Leu Arg Met Ala Met Lys Asp Gly 65 70 75 80

Glu Leu Val Ile Trp Asp Ser Val His Pro Cys Tyr Thr Val Phe His 85 90 95

Glu Gln Thr Glu Thr Phe Ser Ser Leu Trp Ser Glu Tyr His Asp Asp 100 105 110

Phe Arg Gln Phe Leu His Ile Tyr Ser Gln Asp Val Ala Cys Tyr Gly 115 120 125

Glu Asn Leu Ala Tyr Phe Pro Lys Gly Phe Ile Glu Asn Met Phe Phe 130 135 140

Val Ser Ala Asn Pro Trp Val Ser Phe Thr Ser Phe Asp Leu Asn Val 145 150 155 160

Ala Asn Met Asp Asn Phe Phe Ala Pro Val Phe Thr Met Gly Lys Tyr 165 170 175

Tyr Thr Gln Gly Asp Lys Val Leu Met Pro Leu Ala Ile Gln Val His 180 185 190

His Ala Val Cys Asp Gly Phe His Val Gly Arg Cys Leu Met Asn Thr 195 200 205

Thr Val Leu Arg 210

<210> 84 <211> 2521 <212> DNA <213> Artificial Sequence

Page 55

12956-144-228_SEQLIST.TXT 14 Jul 2022

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 84 ttatttggtg atattggtac caatatcatg cagcaaacgg tgcaacattg ccgtgtctcg 60

ttgctctaaa agccccaggc gttgttgtaa ccagtcgacc agttttatgt catctgccac 120 tgccagagtc gtcagcaatg tcatggctcg ttcgcgtaaa gcttgcagtt gatgttggtc 180 tgccgttgca tcacttttcg ccggttgttg tattaatgtt gctaattgat agcaatagac 240 2022205243

catcaccgcc tgccccagat tgagcgaagg ataatccgcc accatcggca caccagtaag 300 aacgtcagcc aacgctaact cttcgttagt caacccggaa tcttcgcgac caaacaccag 360 cgcggcatgg ctcatccatg aagatttttc ctctaacagc ggcaccagtt caactggcgt 420

ggcgtagtaa tgatatttcg cccgactgcg cgcagtggtg gcgacagtga aatcgacatc 480 gtgtaacgat tcagccaatg tcgggaaaac tttaatatta tcaataatat caccagatcc 540 atgtgcgacc cagcgggtgg ctggctccag gtgtgcctga ctatcgacaa tccgcagatc 600

gctaaacccc atcgttttca ttgcccgcgc cgctgcccca atattttctg ctctggcggg 660 tgcgaccaga ataatcgtta tacgcatatt gccactcttc ttgatcaaat aaccgcgaac 720

cgggtgatca ctgtcaactt attacgcggt gcgaatttac aaattcttaa cgtaagtcgc 780

agaaaaagcc ctttacttag cttaaaaaag gctaaactat ttcctgactg tactaacggt 840

tgagttgtta aaaaatgcta catatccttc tgtttactta ggataatttt ataaaaaata 900

aatctcgaca attggattca ccacgtttat tagttgtatg atgcaactag ttggattatt 960 aaaataatgt gacgaaagct agcatttaga tacgatgatt tcatcaaact gttaacgtgc 1020

tacaattgaa cttgatatat gtcaacgaag cgtagtttta ttgggtgtcc ggcccctctt 1080

agcctgttat gttgctgtta aaatggttag gatgacagcc gtttttgaca ctgtcgggtc 1140 ctgagggaaa gtacccacga ccaagctaat gatgttgttg acgttgatgg aaagtgcatc 1200

aagaacgcaa ttacgtactt tagtcatgtt acgccgatca tgttaatttg cagcatgcat 1260 caggcaggtc agggactttt gtacttcctg tttcgattta gttggcaatt taggtagcaa 1320 acgaattcat cggctttacc accgtcaaaa aaaacggcgc tttttagcgc cgtttttatt 1380

tttcaacctt atttccagat acgtaactca tcgtccgttg taacttcttt actggctttc 1440 attttcggca gtgaaaacgc ataccagtcg atattacggg tcacaaacat catgccggcc 1500 agcgccacca ccagcacact ggttcccaac aacagcgcgc tatcggcaga gttgagcagt 1560

ccccacatca caccatccag caacaacagc gcgagggtaa acaacatgct gttgcaccaa 1620 cctttcaata ccgcttgcaa ataaataccg ttcattatcg ccccaatcag actggcgatt 1680

atccatgcca cggtaaaacc ggtatgttca gaaagcgcca gcaagagcaa ataaaacatc 1740 accaatgaaa gccccaccag caaatattgc attgggtgta aacgttgcgc ggtgagcgtt 1800 tcaaaaacaa agaacgccat aaaagtcagt gcaatcagca gaatggcgta cttagtcgcc 1860

cggtcagtta attggtattg atcggctggc gtcgttactg cgacgctaaa cgccgggaag 1920 Page 56

12956-144-228_SEQLIST.TXT 14 Jul 2022

ttttcccagc cggtatcatt gcctgaagca aaacgctcac cgagattatt agcaaaccag 1980

ctgctttgcc agtgcgcctg aaaacctgac tcgctaactt cccgtttggc tggtagaaaa 2040 tcacctaaaa aactgggatg cggccagttg ctggttaagg tcatttcgct attacgcccg 2100

ccaggcacca cagaaagatc gccggtaccg cttaaattca gggccatatt cagcttcagg 2160 ttctgcttcc gccagtcccc ttcaggtaaa gggatatgca cgccctgccc gccttgctct 2220 aacccggtgc cgggttcaat ggtcagcgcc gttccgttaa cttcaggcgc tttcaccaca 2280 2022205243

ccaataccac gcgcatcccc gacgctaatc acaataaatg gcttgcctaa ggtgatattt 2340 ggcgcgttga gttcgctaag acgcgaaaca tcgaaatcgg cttttaacgt taaatcactg 2400 tgccagacct gaccggtata aatccctatc ttgcgttctt ccacgttctg attgccatca 2460

accatcaatg actcaggtaa ccaaaaatgg ataaaacttc gtttccgctg cagggtttta 2520 t 2521

<210> 85 <211> 3010 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 85 aagccacagc aggatgccca ctgcaacaaa ggtgatcaca ccggaaacgc gatggagaat 60

ggacgctatc gccgtgatgg ggaaccggat ggtctgtagg tccagattaa caggtctttg 120

ttttttcaca tttcttatca tgaataacgc ccacatgctg ttcttattat tccctgggga 180 ctacgggcac agaggttaac tttctgttac ctggagacgt cgggatttcc ttcctccggt 240

ctgcttgcgg gtcagacagc gtcctttcta taactgcgcg tcatgcaaaa cactgcttcc 300

agatgcgaaa acgacacgtt acaacgctgg gtggctcggg attgcagggt gttccggaga 360

cctggcggca gtataggctg ttcacaaaat cattacaatt aacctacata tagtttgtcg 420 ggttttatcc tgaacagtga tccaggtcac gataacaaca tttatttaat ttttaatcat 480

ctaatttgac aatcattcaa caaagttgtt acaaacatta ccaggaaaag catataatgc 540 gtaaaagtta tgaagtcggt atttcaccta agattaactt atgtaacagt gtggaagtat 600

tgaccaattc attcgggaca gttattagtg gtagacaagt ttaataattc ggattgctaa 660 gtacttgatt cgccatttat tcgtcatcaa tggatccttt acctgcaagc gcccagagct 720

ctgtacccag gttttcccct ctttcacaga gcggcgagcc aaataaaaaa cgggtaaagc 780 caggttgatg tgcgaaggca aatttaagtt ccggcagtct tacgcaataa ggcgctaagg 840 agaccttaaa tggctgatac aaaagcaaaa ctcaccctca acggggatac agctgttgaa 900

ctggatgtgc tgaaaggcac gctgggtcaa gatgttattg atatccgtac tctcggttca 960 aaaggtgtgt tcacctttga cccaggcttc acttcaaccg catcctgcga atctaaaatt 1020

Page 57

12956-144-228_SEQLIST.TXT 14 Jul 2022

acttttattg atggtgatga aggtattttg ctgcaccgcg gtttcccgat cgatcagctg 1080 gcgaccgatt ctaactacct ggaagtttgt tacatcctgc tgaatggtga aaaaccgact 1140 caggaacagt atgacgaatt taaaactacg gtgacccgtc ataccatgat ccacgagcag 1200

attacccgtc tgttccatgc tttccgtcgc gactcgcatc caatggcagt catgtgtggt 1260 attaccggcg cgctggcggc gttctatcac gactcgctgg atgttaacaa tcctcgtcac 1320 cgtgaaattg ccgcgttcct cctgctgtcg aaaatgccga ccatggccgc gatgtgttac 1380 2022205243

aagtattcca ttggtcagcc atttgtttac ccgcgcaacg atctctccta cgccggtaac 1440 ttcctgaata tgatgttctc cacgccgtgc gaaccgtatg aagttaatcc gattctggaa 1500

cgtgctatgg accgtattct gatcctgcac gctgaccatg aacagaacgc ctctacctcc 1560 accgtgcgta ccgctggctc ttcgggtgcg aacccgtttg cctgtatcgc agcaggtatt 1620

gcttcactgt ggggacctgc gcacggcggt gctaacgaag cggcgctgaa aatgctggaa 1680 gaaatcagct ccgttaaaca cattccggaa tttgttcgtc gtgcgaaaga caaaaatgat 1740 tctttccgcc tgatgggctt cggtcaccgc gtgtacaaaa attacgaccc gcgcgccacc 1800

gtaatgcgtg aaacctgcca tgaagtgctg aaagagctgg gcacgaagga tgacctgctg 1860

gaagtggcta tggagctgga aaacatcgcg ctgaacgacc cgtactttat cgagaagaaa 1920

ctgtacccga acgtcgattt ctactctggt atcatcctga aagcgatggg tattccgtct 1980 tccatgttca ccgtcatttt cgcaatggca cgtaccgttg gctggatcgc ccactggagc 2040

gaaatgcaca gtgacggtat gaagattgcc cgtccgcgtc agctgtatac aggatatgaa 2100

aaacgcgact ttaaaagcga tatcaagcgt taatggttga ttgctaagtt gtaaatattt 2160

taacccgccg ttcatatggc gggttgattt ttatatgcct aaacacaaaa aattgtaaaa 2220 ataaaatcca ttaacagacc tatatagata tttaaaaaga atagaacagc tcaaattatc 2280

agcaacccaa tactttcaat taaaaacttc atggtagtcg catttataac cctatgaaaa 2340

tgacgtctat ctataccccc ctatatttta ttcatcatac aacaaattca tgataccaat 2400

aatttagttt tgcatttaat aaaactaaca atatttttaa gcaaaactaa aaactagcaa 2460 taatcaaata cgatattctg gcgtagctat acccctattc tatatcctta aaggactctg 2520

ttatgtttaa aggacaaaaa acattggccg cactggccgt atctctgctg ttcactgcac 2580 ctgtttatgc tgctgatgaa ggttctggcg aaattcactt taagggggag gttattgaag 2640

caccttgtga aattcatcca gaagatattg ataaaaacat agatcttgga caagtcacga 2700 caacccatat aaaccgggag catcatagca ataaagtggc cgtcgacatt cgcttgatca 2760

actgtgatct gcctgcttct gacaacggta gcggaatgcc ggtatccaaa gttggcgtaa 2820 ccttcgatag cacggctaag acaactggtg ctacgccttt gttgagcaac accagtgcag 2880 gcgaagcaac tggggtcggt gtacgactga tggacaaaaa tgacggtaac atcgtattag 2940

gttcagccgc gccagatctt gacctggatg caagctcatc agaacagacg ctgaactttt 3000 tcgcctggat 3010

Page 58

12956-144-228_SEQLIST.TXT 14 Jul 2022

<210> 86 <211> 4180 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 86 cgcgatgtcg acgtcacgaa actgaaaaaa ccgctctaca ttctggcgac tgctgatgaa 60 2022205243

gaaaccagta tggccggagc gcgttatttt gccgaaacta ccgccctgcg cccggattgc 120 gccatcattg gcgaaccgac gtcactacaa ccggtacgcg cacataaagg tcatatctct 180 aacgccatcc gtattcaggg ccagtcgggg cactccagcg atccagcacg cggagttaac 240

gctatcgaac taatgcacga cgccatcggg catattttgc aattgcgcga taacctgaaa 300 gaacgttatc actacgaagc gtttaccgtg ccatacccta cgctcaacct cgggcatatt 360 cacggtggcg acgcttctaa ccgtatttgc gcttgctgtg agttgcatat ggatattcgt 420

ccgctgcctg gcatgacact caatgaactt aatggtttgc tcaacgatgc attggctccg 480 gtgagcgaac gctggccggg tcgtctgacg gtcgacgagc tgcatccgcc gatccctggc 540

tatgaatgcc caccgaatca tcaactggtt gaagtggttg agaaattgct cggagcaaaa 600

accgaagtgg tgaactactg taccgaagcg ccgtttattc aaacgttatg cccgacgctg 660

gtgttggggc ctggctcaat taatcaggct catcaacctg atgaatatct ggaaacacgg 720

tttatcaagc ccacccgcga actgataacc caggtaattc accatttttg ctggcattaa 780 aacgtaggcc ggataaggcg ctcgcgccgc atccggcgct gttgccaaac tccagtgccg 840

caataatgtc ggatgcgatg cttgcgcatc ttatccgacc tacagtgact caaacgatgc 900

ccaaccgtag gccggataag gcgctcgcgc cgcatccggc actgttgcca aactccagtg 960 ccgcaataat gtcggatgcg atacttgcgc atcttatccg accgacagtg actcaaacga 1020

tgcccaactg taggccggat aaggcgctcg cgccgcatcc ggcactgttg ccaaactcca 1080 gtgccgcaat aatgtcggat gcgatacttg cgcatcttat ccgacctaca cctttggtgt 1140 tacttggggc gattttttaa catttccata agttacgctt atttaaagcg tcgtgaattt 1200

aatgacgtaa attcctgcta tttattcgtt tgctgaagcg atttcgcagc atttgacgtc 1260 accgctttta cgtggcttta taaaagacga cgaaaagcaa agcccgagca tattcgcgcc 1320 aatgctagca agaggagaag tcgacatgac agacttaaat aaagtggtaa aagaacttga 1380

agctcttggt atttatgacg taaaagaagt tgtttacaat ccaagctacg agcaattgtt 1440 cgaagaagaa actaaaccag gtttagaagg ctttgaaaaa ggtactttaa ctacgactgg 1500

tgcagtggca gtagatacag gtatcttcac aggtcgttct ccaaaagata aatatatcgt 1560 gttagatgaa aaaaccaaag atactgtttg gtggacatct gaaacagcaa aaaacgacaa 1620 caagccaatg aaccaagcta catggcaaag cttaaaagac ttggtaacca accagctttc 1680

tcgtaaacgc ttatttgtag ttgatggttt ctgtggtgcg agcgaacacg accgtattgc 1740 Page 59

12956-144-228_SEQLIST.TXT 14 Jul 2022

agtacgtatt gtcactgaag tagcgtggca agcacatttt gtaaaaaata tgtttattcg 1800

cccaactgaa gaacaactca aaaattttga accagatttc gttgtaatga atggttctaa 1860 agtaaccaat ccaaactgga aagaacaagg tttaaattca gaaaactttg ttgctttcaa 1920

cttgactgaa cgcattcaat taatcggtgg tacttggtac ggcggtgaaa tgaaaaaagg 1980 tatgttctca atcatgaact acttcctacc acttaaaggt gttggtgcaa tgcactgctc 2040 agctaacgtt ggtaaagatg gcgatgtagc aatcttcttc ggcttatctg gcacaggtaa 2100 2022205243

aacaaccctt tcaacggatc caaaacgtga attaatcggt gacgatgaac acggctggga 2160 tgatgtgggt atctttaact ttgaaggtgg ttgctatgcg aaaaccattc acctttcaga 2220 agaaaatgaa ccagatattt accgcgctat ccgtcgcgac gcattattag aaaacgtggt 2280

tgttcgtgca gatggttctg ttgatttcga tgatggttca aaaacagaaa atactcgcgt 2340 gtcttaccca atttatcaca ttgataacat tgtaaaacca gtttctcgtg caggtcacgc 2400 aactaaagtg attttcttaa ctgcagatgc atttggcgta ttaccaccag tatctaaatt 2460

gacaccagaa caaactaaat actacttctt atctggtttc acagcaaaat tagcaggtac 2520 tgaacgtggt attactgaac caactccaac tttctcagca tgtttcggtg ctgcgttctt 2580

aacccttcac ccaactcaat atgcagaagt gttagtaaaa cgtatgcaag cagtgggtgc 2640

tgaagcttac ttagtaaata ctggttggaa tggcacaggc aaacgtatct caatcaaaga 2700

tactcgcgga atcattgatg caatcttaga tggctcaatt gaaaaagctg aaatgggcga 2760

attaccaatc tttaacttag ccattcctaa agcattacca ggtgtagatt ctgcaatctt 2820 agatcctcgc gatacttacg cagataaagc acaatggcaa tcaaaagctg aagacttagc 2880

aggtcgtttt gtgaaaaact ttgttaaata tgcaactaac gaagaaggca aagctttaat 2940

tgcagctggt cctaaagctt aatctagaaa gcttcctaga ggcatcaaat aaaacgaaag 3000 gctcagtcga aagactgggc ctttcgtttt atctgttgtt tgtcggtgaa cgctctcctg 3060

agtaggacga attcacttct gttctaacac cctcgttttc aatatatttc tgtctgcatt 3120 ttattcaaat tctgaatata ccttcagata tccttaagga attgtcgtta cattcggcga 3180 tattttttca agacaggttc ttactatgca ttccacagaa gtccaggcta aacctctttt 3240

tagctggaaa gccctgggtt gggcactgct ctacttttgg tttttctcta ctctgctaca 3300 ggccattatt tacatcagtg gttatagtgg cactaacggc attcgcgact cgctgttatt 3360 cagttcgctg tggttgatcc cggtattcct ctttccgaag cggattaaaa ttattgccgc 3420

agtaatcggc gtggtgctat gggcggcctc tctggcggcg ctgtgctact acgtcatcta 3480 cggtcaggag ttctcgcaga gcgttctgtt tgtgatgttc gaaaccaaca ccaacgaagc 3540

cagcgagtat ttaagccagt atttcagcct gaaaattgtg cttatcgcgc tggcctatac 3600 ggcggtggca gttctgctgt ggacacgcct gcgcccggtc tatattccaa agccgtggcg 3660 ttatgttgtc tcttttgccc tgctttatgg cttgattctg catccgatcg ccatgaatac 3720

gtttatcaaa aacaagccgt ttgagaaaac gttggataac ctggcctcgc gtatggagcc 3780 Page 60

12956-144-228_SEQLIST.TXT 14 Jul 2022

tgccgcaccg tggcaattcc tgaccggcta ttatcagtat cgtcagcaac taaactcgct 3840

aacaaagtta ctgaatgaaa ataatgcctt gccgccactg gctaatttca aagatgaatc 3900 gggtaacgaa ccgcgcactt tagtgctggt gattggcgag tcgacccagc gcggacgcat 3960

gagtctgtac ggttatccgc gtgaaaccac gccggagctg gatgcgctgc ataaaaccga 4020 tccgaatctg accgtgttta ataacgtagt tacgtctcgt ccgtacacca ttgaaatcct 4080 gcaacaggcg ctgacctttg ccaatgaaaa gaacccggat ctgtatctga cgcagccgtc 4140 2022205243

gctgatgaac atgatgaaac aggcgggtta taaaaccttc 4180

<210> 87 <211> 4960 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide

<400> 87 aataggcgta tcacgaggcc ctttcgtctt cacctcgaga attgtgagcg gataacaatt 60

gacattgtga gcggataaca agatactgag cacatcagca ggacgcactg accgaattca 120

attaagctag caagaggaga agtcgagatg aacttacatg aatatcaggc aaaacaactt 180 tttgcccgct atggcttacc agcaccggtg ggttatgcct gtactactcc gcgcgaagca 240

gaagaagccg cttcaaaaat cggtgccggt ccgtgggtag tgaaatgtca ggttcacgct 300

ggtggccgcg gtaaagcggg cggtgtgaaa gttgtaaaca gcaaagaaga catccgtgct 360

tttgcagaaa actggctggg caagcgtctg gtaacgtatc aaacagatgc caatggccaa 420 ccggttaacc agattctggt tgaagcagcg accgatatcg ctaaagagct gtatctcggt 480

gccgttgttg accgtagttc ccgtcgtgtg gtctttatgg cctccaccga aggcggcgtg 540

gaaatcgaaa aagtggcgga agaaactccg cacctgatcc ataaagttgc gcttgatccg 600

ctgactggcc cgatgccgta tcagggacgc gagctggcgt tcaaactggg tctggaaggt 660 aaactggttc agcagttcac caaaatcttc atgggcctgg cgaccatttt cctggagcgc 720

gacctggcgt tgatcgaaat caacccgctg gtcatcacca aacagggcga tctgatttgc 780 ctcgacggca aactgggcgc tgacggcaac gcactgttcc gccagcctga tctgcgcgaa 840

atgcgtgacc agtcgcagga agatccgcgt gaagcacagg ctgcacagtg ggaactgaac 900 tacgttgcgc tggacggtaa catcggttgt atggttaacg gcgcaggtct ggcgatgggt 960

acgatggaca tcgttaaact gcacggcggc gaaccggcta acttccttga cgttggcggc 1020 ggcgcaacca aagaacgtgt aaccgaagcg ttcaaaatca tcctctctga cgacaaagtg 1080 aaagccgttc tggttaacat cttcggcggt atcgttcgtt gcgacctgat cgctgacggt 1140

atcatcggcg cggtagcaga agtgggtgtt aacgtaccgg tcgtggtacg tctggaaggt 1200 aacaacgccg aactcggcgc gaagaaactg gctgacagcg gcctgaatat tattgcagca 1260

Page 61

12956-144-228_SEQLIST.TXT 14 Jul 2022

aaaggtctga cggatgcagc tcagcaggtt gttgccgcag tggaggggaa ataatgtcca 1320 ttttaatcga taaaaacacc aaggttatct gccagggctt taccggtagc caggggactt 1380 tccactcaga acaggccatt gcatacggca ctaaaatggt tggcggcgta accccaggta 1440

aaggcggcac cacccacctc ggcctgccgg tgttcaacac cgtgcgtgaa gccgttgctg 1500 ccactggcgc taccgcttct gttatctacg taccagcacc gttctgcaaa gactccattc 1560 tggaagccat cgacgcaggc atcaaactga ttatcaccat cactgaaggc atcccgacgc 1620 2022205243

tggatatgct gaccgtgaaa gtgaagctgg atgaagcagg cgttcgtatg atcggcccga 1680 actgcccagg cgttatcact ccgggtgaat gcaaaatcgg tatccagcct ggtcacattc 1740

acaaaccggg taaagtgggt atcgtttccc gttccggtac actgacctat gaagcggtta 1800 aacagaccac ggattacggt ttcggtcagt cgacctgtgt cggtatcggc ggtgacccga 1860

tcccgggctc taactttatc gacattctcg aaatgttcga aaaagatccg cagaccgaag 1920 cgatcgtgat gatcggtgag atcggcggta gcgctgaaga agaagcagct gcgtacatca 1980 aagagcacgt taccaagcca gttgtgggtt acatcgctgg tgtgactgcg ccgaaaggca 2040

aacgtatggg ccacgcgggt gccatcattg ccggtgggaa agggactgcg gatgagaaat 2100

tcgctgctct ggaagccgca ggcgtgaaaa ccgttcgcag cctggcggat atcggtgaag 2160

cactgaaaac tgttctgaaa taatctagca agaggagaag tcgacatgga aatcaaagaa 2220 atggtgagcc ttgcacgcaa ggctcagaag gagtatcaag ctacccataa ccaagaagca 2280

gttgacaaca tttgccgagc tgcagcaaaa gttatttatg aaaatgcagc tattctggct 2340

cgcgaagcag tagacgaaac cggcatgggc gtttacgaac acaaagtggc caagaatcaa 2400

ggcaaatcca aaggtgtttg gtacaacctc cacaataaaa aatcgattgg tatcctcaat 2460 atagacgagc gtaccggtat gatcgagatt gcaaagccta tcggagttgt aggagccgta 2520

acgccgacga ccaacccgat cgttactccg atgagcaata tcatctttgc tcttaagacc 2580

tgcaatgcca tcattattgc cccccacccc agatccaaaa aatgctctgc acacgcagtt 2640

cgtctgatca aagaagctat cgctccgttc aacgtaccgg aaggtatggt tcagatcatc 2700 gaagaaccca gcatcgagaa gacgcaggaa ctcatgggcg ccgtagacgt agtagttgct 2760

acgggtggta tgggcatggt gaagtctgca tattcttcag gaaagccttc tttcggtgtt 2820 ggagccggta acgttcaggt gatcgtggat agcaacatcg atttcgaagc tgctgcagaa 2880

aaaatcatca ccggtcgtgc tttcgacaac ggtatcatct gctcaggcga acagagcatc 2940 atctacaacg aggctgacaa ggaagcagtt ttcacagcat tccgcaacca cggtgcatat 3000

ttctgtgacg aagccgaagg agatcgggct cgtgcagcta tcttcgaaaa tggagccatc 3060 gcgaaagatg tagtaggtca gagcgttgcc ttcattgcca agaaagcaaa catcaatatc 3120 cccgagggta cccgtattct cgttgttgaa gctcgcggcg taggagcaga agacgttatc 3180

tgtaaggaaa agatgtgtcc cgtaatgtgc gccctcagct acaagcactt cgaagaaggt 3240 gtagaaatcg cacgtacgaa cctcgccaac gaaggtaacg gccacacctg tgctatccac 3300

Page 62

12956-144-228_SEQLIST.TXT 14 Jul 2022

tccaacaatc aggcacacat catcctcgca ggatcagagc tgacggtatc tcgtatcgta 3360 gtgaatgctc cgagtgccac tacagcaggc ggtcacatcc aaaacggtct tgccgtaacc 3420 aatacgctcg gatgcggatc atggggtaat aactctatct ccgagaactt cacttacaag 3480

cacctcctca acatttcacg catcgcaccg ttgaattcaa gcattcacat ccccgatgac 3540 aaagaaatct gggaactcta atctagcaag aggagaagtc gacatgcaac ttttcaaact 3600 caagagtgta acacatcact ttgacacttt tgcagaattt gccaaggaat tctgtcttgg 3660 2022205243

agaacgcgac ttggtaatta ccaacgagtt catctatgaa ccgtatatga aggcatgcca 3720 gctcccctgc cattttgtta tgcaggagaa atatgggcaa ggcgagcctt ctgacgaaat 3780

gatgaataac atcttggcag acatccgtaa tatccagttc gaccgcgtaa tcggtatcgg 3840 aggaggtacg gttattgaca tctctaaact tttcgttctg aaaggattaa atgatgtact 3900

cgatgcattc gaccgcaaaa tacctcttat caaagagaaa gaactgatca ttgtgcccac 3960 aacatgcgga acgggtagcg aggtgacgaa catttctatc gcagaaatca aaagccgtca 4020 caccaaaatg ggattggctg acgatgccat tgttgcagac catgccatca tcatacctga 4080

acttctgaag agcttgcctt tccacttcta cgcatgcagt gcaatcgatg ctcttatcca 4140

tgccatcgag tcatacgtat ctcctaaagc cagtccatat tctcgtctgt tcagtgaggc 4200

ggcttgggac attatcctgg aagtattcaa gaaaatcgcc gaacacggcc ctgaataccg 4260 cttcgaaaag ctgggagaaa tgatcatggc cagcaactat gccggtatag ccttcggaaa 4320

tgcaggagta ggagccgtcc acgcactatc ctacccgttg ggaggcaact atcacgtgcc 4380

gcatggagaa gcaaactatc agttcttcac agaggtattc aaagtatacc aaaagaagaa 4440

tcctttcggc tatatagtcg aactcaactg gaagctctcc aagatactga actgccagcc 4500 cgaatacgta tatccgaagc tggatgaact tctcggatgc cttcttacca agaaaccttt 4560

gcacgaatac ggcatgaagg acgaagaggt aagaggcttt gcggaatcag tgcttaagac 4620

acagcaaaga ttgctcgcca acaactacgt agagcttact gtagatgaga tcgaaggtat 4680

ctacagaaga ctctactaat ctagaaagct tcctagaggc atcaaataaa acgaaaggct 4740 cagtcgaaag actgggcctt tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt 4800

aggacaaatc cgccgcccta gacctaggcg ttcggctgcg acacgtcttg agcgattgtg 4860 taggctggag ctgcttcgaa gttcctatac tttctagaga ataggaactt cggaatagga 4920

actaaggagg atattcatat ggaccatggc taattcccat 4960

<210> 88 <211> 5083 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 88 tcgagaaatt tatcaaaaag agtgttgact tgtgagcgga taacaatgat acttagattc 60 Page 63

12956-144-228_SEQLIST.TXT 14 Jul 2022

aattgtgagc ggataacaat ttcacacaga attcaattaa gctagcaaga ggagaagtcg 120

acatggccaa cataagttca ccattcgggc aaaacgaatg gctggttgaa gagatgtacc 180 gcaagttccg cgacgacccc tcctcggtcg atcccagctg gcacgagttc ctggttgact 240

acagccccga acccacctcc caaccagctg ccgaaccaac ccgggttacc tcgccactcg 300 ttgccgagcg ggccgctgcg gccgccccgc aggcaccccc caagccggcc gacaccgcgg 360 ccgcgggcaa cggcgtggtc gccgcactgg ccgccaaaac tgccgttccc ccgccagccg 420 2022205243

aaggtgacga ggtagcggtg ctgcgcggcg ccgccgcggc cgtcgtcaag aacatgtccg 480 cgtcgttgga ggtgccgacg gcgaccagcg tccgggcggt cccggccaag ctactgatcg 540 acaaccggat cgtcatcaac aaccagttga agcggacccg cggcggcaag atctcgttca 600

cgcatttgct gggctacgcc ctggtgcagg cggtgaagaa attcccgaac atgaaccggc 660 actacaccga agtcgacggc aagcccaccg cggtcacgcc ggcgcacacc aatctcggcc 720 tggcgatcga cctgcaaggc aaggacggga agcgttccct ggtggtggcc ggcatcaagc 780

ggtgcgagac catgcgattc gcgcagttcg tcacggccta cgaagacatc gtacgccggg 840 cccgcgacgg caagctgacc actgaagact ttgccggcgt gacgatttcg ctgaccaatc 900

ccggaaccat cggcaccgtg cattcggtgc cgcggctgat gcccggccag ggcgccatca 960

tcggcgtggg cgccatggaa taccccgccg agtttcaagg cgccagcgag gaacgcatcg 1020

ccgagctggg catcggcaaa ttgatcactt tgacctccac ctacgaccac cgcatcatcc 1080

agggcgcgga atcgggcgac ttcctgcgca ccatccacga gttgctgctc tcggatggct 1140 tctgggacga ggtcttccgc gaactgagca tcccatatct gccggtgcgc tggagcaccg 1200

acaaccccga ctcgatcgtc gacaagaacg ctcgcgtcat gaacttgatc gcggcctacc 1260

gcaaccgcgg ccatctgatg gccgataccg acccgctgcg gttggacaaa gctcggttcc 1320 gcagtcaccc cgacctcgaa gtgctgaccc acggcctgac gctgtgggat ctcgatcggg 1380

tgttcaaggt cgacggcttt gccggtgcgc agtacaagaa actgcgcgac gtgctgggct 1440 tgctgcgcga tgcctactgc cgccacatcg gcgtggagta cgcccatatc ctcgaccccg 1500 aacaaaagga gtggctcgaa caacgggtcg agaccaagca cgtcaaaccc actgtggccc 1560

aacagaaata catcctcagc aagctcaacg ccgccgaggc ctttgaaacg ttcctacaga 1620 ccaagtacgt cggccagaag cggttctcgc tggaaggcgc cgaaagcgtg atcccgatga 1680 tggacgcggc gatcgaccag tgcgctgagc acggcctcga cgaggtggtc atcgggatgc 1740

cgcaccgggg ccggctcaac gtgctggcca acatcgtcgg caagccgtac tcgcagatct 1800 tcaccgagtt cgagggcaac ctgaatccgt cgcaggcgca cggctccggt gacgtcaagt 1860

accacctggg cgccaccggg ctgtacctgc agatgttcgg cgacaacgac attcaggtgt 1920 cgctgaccgc caacccgtcg catctggagg ccgtcgaccc ggtgctggag ggattggtgc 1980 gggccaagca ggatctgctc gaccacggaa gcatcgacag cgacggccaa cgggcgttct 2040

cggtggtgcc gctgatgttg catggcgatg ccgcgttcgc cggtcagggt gtggtcgccg 2100 Page 64

12956-144-228_SEQLIST.TXT 14 Jul 2022

agacgctgaa cctggcgaat ctgccgggct accgcgtcgg cggcaccatc cacatcatcg 2160

tcaacaacca gatcggcttc accaccgcgc ccgagtattc caggtccagc gagtactgca 2220 ccgacgtcgc aaagatgatc ggggcaccga tctttcacgt caacggcgac gacccggagg 2280

cgtgtgtctg ggtggcgcgg ttggcggtgg acttccgaca acggttcaag aaggacgtcg 2340 tcatcgacat gctgtgctac cgccgccgcg ggcacaacga gggtgacgac ccgtcgatga 2400 ccaaccccta catgtacgac gtcgtcgaca ccaagcgcgg ggcccgcaaa agctacaccg 2460 2022205243

aagccctgat cggacgtggc gacatctcga tgaaggaggc cgaggacgcg ctgcgcgact 2520 accagggcca gctggaacgg gtgttcaacg aagtgcgcga gctggagaag cacggtgtgc 2580 agccgagcga gtcggtcgag tccgaccaga tgattcccgc ggggctggcc actgcggtgg 2640

acaagtcgct gctggcccgg atcggcgatg cgttcctcgc cttgccgaac ggcttcaccg 2700 cgcacccgcg agtccaaccg gtgctggaga agcgccggga gatggcctat gaaggcaaga 2760 tcgactgggc ctttggcgag ctgctggcgc tgggctcgct ggtggccgaa ggcaagctgg 2820

tgcgcttgtc ggggcaggac agccgccgcg gcaccttctc ccagcggcat tcggttctca 2880 tcgaccgcca cactggcgag gagttcacac cactgcagct gctggcgacc aactccgacg 2940

gcagcccgac cggcggaaag ttcctggtct acgactcgcc actgtcggag tacgccgccg 3000

tcggcttcga gtacggctac actgtgggca atccggacgc cgtggtgctc tgggaggcgc 3060

agttcggcga cttcgtcaac ggcgcacagt cgatcatcga cgagttcatc agctccggtg 3120

aggccaagtg gggccaattg tccaacgtcg tgctgctgtt accgcacggg cacgaggggc 3180 agggacccga ccacacttct gcccggatcg aacgcttctt gcagttgtgg gcggaaggtt 3240

cgatgaccat cgcgatgccg tcgactccgt cgaactactt ccacctgcta cgccggcatg 3300

ccctggacgg catccaacgc ccgctgatcg tgttcacgcc caagtcgatg ttgcgtcaca 3360 aggccgccgt cagcgaaatc aaggacttca ccgagatcaa gttccgctca gtgctggagg 3420

aacccaccta tgaggacggc atcggagacc gcaacaaggt cagccggatc ctgctgacca 3480 gtggcaagct gtattacgag ctggccgccc gcaaggccaa ggacaaccgc aatgacctcg 3540 cgatcgtgcg gcttgaacag ctcgccccgc tgcccaggcg tcgactgcgt gaaacgctgg 3600

accgctacga gaacgtcaag gagttcttct gggtccaaga ggaaccggcc aaccagggtg 3660 cgtggccgcg attcgggctc gaactacccg agctgctgcc tgacaagttg gccgggatca 3720 agcgaatctc gcgccgggcg atgtcagccc cgtcgtcagg ctcgtcgaag gtgcacgccg 3780

tcgaacagca ggagatcctc gacgaggcgt tcggctaatc tagcaagagg agaagtcgac 3840 atgaagttat taaaattggc acctgatgtt tataaatttg atactgcaga ggagtttatg 3900

aaatacttta aggttggaaa aggtgacttt atacttacta atgaattttt atataaacct 3960 ttccttgaga aattcaatga tggtgcagat gctgtatttc aggagaaata tggactcggt 4020 gaaccttctg atgaaatgat aaacaatata attaaggata ttggagataa acaatataat 4080

agaattattg ctgtaggggg aggatctgta atagatatag ccaaaatcct cagtcttaag 4140 Page 65

12956-144-228_SEQLIST.TXT 14 Jul 2022

tatactgatg attcattgga tttgtttgag ggaaaagtac ctcttgtaaa aaacaaagaa 4200

ttaattatag ttccaactac atgtggaaca ggttcagaag ttacaaatgt atcagttgca 4260 gaattaaaga gaagacatac taaaaaagga attgcttcag acgaattata tgcaacttat 4320

gcagtacttg taccagaatt tataaaagga cttccatata agttttttgt aaccagctcc 4380 gtagatgcct taatacatgc aacagaagct tatgtatctc caaatgcaaa tccttatact 4440 gatatgttta gtgtaaaagc tatggagtta attttaaatg gatacatgca aatggtagag 4500 2022205243

aaaggaaatg attacagagt tgaaataatt gaggattttg ttataggcag caattatgca 4560 ggtatagctt ttggaaatgc aggagtggga gcggttcacg cactctcata tccaataggc 4620 ggaaattatc atgtgcctca tggagaagca aattatctgt tttttacaga aatatttaaa 4680

acttattatg agaaaaatcc aaatggcaag attaaagatg taaataaact attagcaggc 4740 atactaaaat gtgatgaaag tgaagcttat gacagtttat cacaactttt agataaatta 4800 ttgtcaagaa aaccattaag agaatatgga atgaaagagg aagaaattga aacttttgct 4860

gattcagtaa tagaaggaca gcagagactg ttggtaaaca attatgaacc tttttcaaga 4920 gaagacatag taaacacata taaaaagtta tattaatcta gaaagcttcc tagaggcatc 4980

aaataaaacg aaaggctcag tcgaaagact gggcctttcg ttttatctgt tgtttgtcgg 5040

tgaacgctct cctgagtagg acaaatccgc cgccctagac cta 5083

<210> 89 <211> 5097 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 89 tctgtatcag gctgaaaatc ttctctcatc cgccaaaaca gcttcggcgt taagatgcgc 60

gctcaaggac gtaagccgtc gactctcgcc gtgctggcgc aggacacggc taccactcct 120 ttctctgttg atattctgct tgccattgag caaaccgcca gcgagttcgg ctggaatagt 180

tttttaatca atattttttc tgaagatgac gctgcccgcg cggcacgtca gctgcttgcc 240 caccgtccgg atggcattat ctatactaca atggggctgc gacatatcac gctgcctgag 300

tctctgtatg gtgaaaatat tgtattggcg aactgtgtgg cggatgaccc agcgttaccc 360 agttatatcc ctgatgatta cactgcacaa tatgaatcaa cacagcattt gctcgcggcg 420

ggctatcgtc aaccgttatg cttctggcta ccggaaagtg cgttggcaac agggtatcgt 480 cggcagggat ttgagcaggc ctggcgtgat gctggacgag atctggctga ggtgaaacaa 540 tttcacatgg caacaggtga tgatcactac accgatctcg caagtttact caatgcccac 600

ttcaaaccgg gcaaaccaga ttttgatgtt ctgatatgtg gtaacgatcg cgcagccttt 660 gtggcttatc aggttcttct ggcgaagggg gtacgaatcc cgcaggatgt cgccgtaatg 720

Page 66

12956-144-228_SEQLIST.TXT 14 Jul 2022

ggctttgata atctggttgg cgtcgggcat ctgtttttac cgccgctgac cacaattcag 780 cttccacatg acattatcgg gcgggaagct gcattgcata ttattgaagg tcgtgaaggg 840 ggaagagtga cgcggatccc ttgcccgctg ttgatccgtt gttccacctg atattatgtt 900

aacccagtag ccagagtgct ccatgttgca gcacagccac tccgtgggag gcataaagcg 960 acagttcccg ttcttctggc tgcggataga ttcgactact catcaccgct tccccgtcgt 1020 taataaatac ttccacggat gatgtatcga taaatatcct tagggcgagc gtgtcacgct 1080 2022205243

gcgggagggg aatactacgg tagccgtcta aattctcgtg tgggtaatac cgccacaaaa 1140 caagtcgctc agattggtta tcaatataca gccgcattcc agtgccgagc tgtaatccgt 1200

aatgttcggc atcactgttc ttcagcgccc actgcaactg aatctcaact gcttgcgcgt 1260 tttcctgcaa aacatattta ttgctgattg tgcggggaga gacagattga tgctgctggc 1320

gtaacgactc agcttcgtgt accgggcgtt gtagaagttt gccattgctc tctgatagct 1380 cgcgcgccag cgtcatgcag cctgcccatc cttcacgttt tgagggcatt ggcgattccc 1440 acatatccat ccagccgata acaatacgcc gaccatcctt cgctaaaaag ctttgtggtg 1500

cataaaagtc atgcccgtta tcaagttcag taaaatgccc ggattgtgca aaaagtcgtc 1560

ctggcgacca cattccgggt attacgccac tttgaaagcg atttcggtaa ctgtatccct 1620

cggcattcat tccctgcggg gaaaacatca gataatgctg atcgccaagg ctgaaaaagt 1680 ccggacattc ccacatatag ctttcacccg catcagcgtg ggccagtacg cgatcgaagg 1740

tccattcacg caacgaactg ccgcgataaa gcaggatctg ccccgtgttg cctggatctt 1800

tcgccccgac taccatccac catgtgtcgg cttcacgcca cactttagga tcgcggaagt 1860

gcatgattcc ttctggtgga gtgaggatca caccctgttt ctcgaaatga ataccatccc 1920 gactggtagc cagacattgt acttcgcgaa ttgcatcgtc attacctgca ccatcgagcc 1980

agacgtgtcc ggtgtagata agtgagagga caccattgtc atcgacagca ctacctgaaa 2040

aacacccgtc tttgtcatta tcgtctcctg gcgctagcgc aataggctca tgctgccagt 2100

ggatcatatc gtcgctggtg gcatgtcccc agtgcattgg cccccagtgt tcgctcatcg 2160 gatgatgttg ataaaacgcg tgataacgat cgttaaacca gatcaggccg tttggatcgt 2220

tcatccaccc ggcaggaggc gcgaggtgaa aatggggata gaaagtgtta ccccggtgct 2280 catgaagttt tgctagggcg ttttgcgccg catgcaatcg agattgcgtc attttaatca 2340

tcctggttaa gcaaatttgg tgaattgtta acgttaactt ttataaaaat aaagtccctt 2400 actttcataa atgcgatgaa tatcacaaat gttaacgtta actatgacgt tttgtgatcg 2460

aatatgcatg ttttagtaaa tccatgacga ttttgcgaaa aagaggttta tcactatgcg 2520 taactcagat gaatttaagg gaaaaaaatg tcagccaaag tatgggtttt aggggatgcg 2580 gtcgtagatc tcttgccaga atcagacggg cgcctactgc cttgtcctgg cggcgcgcca 2640

gctaacgttg cggtgggaat cgccagatta ggcggaacaa gtgggtttat aggtcgggtg 2700 ggggatgatc cttttggtgc gttaatgcaa agaacgctgc taactgaggg agtcgatatc 2760

Page 67

12956-144-228_SEQLIST.TXT 14 Jul 2022

acgtatctga agcaagatga atggcaccgg acatccacgg tgcttgtcga tctgaacgat 2820 caaggggaac gttcatttac gtttatggtc cgccccagtg ccgatctttt tttagagacg 2880 acagacttgc cctgctggcg acatggcgaa tggttacatc tctgttcaat tgcgttgtct 2940

gccgagcctt cgcgtaccag cgcatttact gcgatgacgg cgatccggca tgccggaggt 3000 tttgtcagct tcgatcctaa tattcgtgaa gatctatggc aagacgagca tttgctccgc 3060 ttgtgtttgc ggcaggcgct acaactggcg gatgtcgtca agctctcgga agaagaatgg 3120 2022205243

cgacttatca gtggaaaaac acagaacgat caggatatat gcgccctggc aaaagagtat 3180 gagatcgcca tgctgttggt gactaaaggt gcagaagggg tggtggtctg ttatcgagga 3240

caagttcacc attttgctgg aatgtctgtg aattgtgtcg atagcacggg ggcgggagat 3300 gcgttcgttg ccgggttact cacaggtctg tcctctacgg gattatctac agatgagaga 3360

gaaatgcgac gaattatcga tctcgctcaa cgttgcggag cgcttgcagt aacggcgaaa 3420 ggggcaatga cagcgctgcc atgtcgacaa gaactggaat agtgagaagt aaacggcgaa 3480 gtcgctctta tctctaaata ggacgtgaat tttttaacga caggcaggta attatggcac 3540

tgaatattcc attcagaaat gcgtactatc gttttgcatc cagttactca tttctctttt 3600

ttatttcctg gtcgctgtgg tggtcgttat acgctatttg gctgaaagga catctagggt 3660

tgacagggac ggaattaggt acactttatt cggtcaacca gtttaccagc attctattta 3720 tgatgttcta cggcatcgtt caggataaac tcggtctgaa gaaaccgctc atctggtgta 3780

tgagtttcat cctggtcttg accggaccgt ttatgattta cgtttatgaa ccgttactgc 3840

aaagcaattt ttctgtaggt ctaattctgg gggcgctatt ttttggcttg gggtatctgg 3900

cgggatgcgg tttgcttgat agcttcaccg aaaaaatggc gcgaaatttt catttcgaat 3960 atggaacagc gcgcgcctgg ggatcttttg gctatgctat tggcgcgttc tttgccggca 4020

tattttttag tatcagtccc catatcaact tctggttggt ctcgctattt ggcgctgtat 4080

ttatgatgat caacatgcgt tttaaagata aggatcacca gtgcgtagcg gcagatgcgg 4140

gaggggtaaa aaaagaggat tttatcgcag ttttcaagga tcgaaacttc tgggttttcg 4200 tcatatttat tgtggggacg tggtctttct ataacatttt tgatcaacaa ctttttcctg 4260

tcttttattc aggtttattc gaatcacacg atgtaggaac gcgcctgtat ggttatctca 4320 actcattcca ggtggtactc gaagcgctgt gcatggcgat tattcctttc tttgtgaatc 4380

gggtagggcc aaaaaatgca ttacttatcg gagttgtgat tatggcgttg cgtatccttt 4440 cctgcgcgct gttcgttaac ccctggatta tttcattagt gaagttgtta catgccattg 4500

aggttccact ttgtgtcata tccgtcttca aatacagcgt ggcaaacttt gataagcgcc 4560 tgtcgtcgac gatctttctg attggttttc aaattgccag ttcgcttggg attgtgctgc 4620 tttcaacgcc gactgggata ctctttgacc acgcaggcta ccagacagtt ttcttcgcaa 4680

tttcgggtat tgtctgcctg atgttgctat ttggcatttt cttcttgagt aaaaaacgcg 4740 agcaaatagt tatggaaacg cctgtacctt cagcaatata gacgtaaact ttttccggtt 4800

Page 68

12956-144-228_SEQLIST.TXT 14 Jul 2022

gttgtcgata gctctatatc cctcaaccgg aaaataataa tagtaaaatg cttagccctg 4860 ctaataatcg cctaatccaa acgcctcatt catgttctgg tacagtcgct caaatgtact 4920 tcagatgcgc ggttcgctga tttccaggac attgtcgtca ttcagtgacc tgtcccgtgt 4980

atcacggtcc tgcgaattca tcaaggaatg cattgcggag tgaagtatcg agtcacgcca 5040 tatttcgtca cccgaagatg agttttgaga tattaaggca ggtgactttc actcaca 5097

<210> 90 2022205243

<211> 3525 <212> DNA <213> Nocardia iowensis

<400> 90 atggcagtgg attcaccgga tgagcggcta cagcgccgca ttgcacagtt gtttgcagaa 60

gatgagcagg tcaaggccgc acgtccgctc gaagcggtga gcgcggcggt gagcgcgccc 120 ggtatgcggc tggcgcagat cgccgccact gttatggcgg gttacgccga ccgcccggcc 180 gccgggcagc gtgcgttcga actgaacacc gacgacgcga cgggccgcac ctcgctgcgg 240

ttacttcccc gattcgagac catcacctat cgcgaactgt ggcagcgagt cggcgaggtt 300 gccgcggcct ggcatcatga tcccgagaac cccttgcgcg caggtgattt cgtcgccctg 360

ctcggcttca ccagcatcga ctacgccacc ctcgacctgg ccgatatcca cctcggcgcg 420

gttaccgtgc cgttgcaggc cagcgcggcg gtgtcccagc tgatcgctat cctcaccgag 480

acttcgccgc ggctgctcgc ctcgaccccg gagcacctcg atgcggcggt cgagtgccta 540

ctcgcgggca ccacaccgga acgactggtg gtcttcgact accaccccga ggacgacgac 600 cagcgtgcgg ccttcgaatc cgcccgccgc cgccttgccg acgcgggcag cttggtgatc 660

gtcgaaacgc tcgatgccgt gcgtgcccgg ggccgcgact taccggccgc gccactgttc 720

gttcccgaca ccgacgacga cccgctggcc ctgctgatct acacctccgg cagcaccgga 780 acgccgaagg gcgcgatgta caccaatcgg ttggccgcca cgatgtggca ggggaactcg 840

atgctgcagg ggaactcgca acgggtcggg atcaatctca actacatgcc gatgagccac 900 atcgccggtc gcatatcgct gttcggcgtg ctcgctcgcg gtggcaccgc atacttcgcg 960 gccaagagcg acatgtcgac actgttcgaa gacatcggct tggtacgtcc caccgagatc 1020

ttcttcgtcc cgcgcgtgtg cgacatggtc ttccagcgct atcagagcga gctggaccgg 1080 cgctcggtgg cgggcgccga cctggacacg ctcgatcggg aagtgaaagc cgacctccgg 1140 cagaactacc tcggtgggcg cttcctggtg gcggtcgtcg gcagcgcgcc gctggccgcg 1200

gagatgaaga cgttcatgga gtccgtcctc gatctgccac tgcacgacgg gtacgggtcg 1260 accgaggcgg gcgcaagcgt gctgctcgac aaccagatcc agcggccgcc ggtgctcgat 1320

tacaagctcg tcgacgtgcc cgaactgggt tacttccgca ccgaccggcc gcatccgcgc 1380 ggtgagctgt tgttgaaggc ggagaccacg attccgggct actacaagcg gcccgaggtc 1440 accgcggaga tcttcgacga ggacggcttc tacaagaccg gcgatatcgt ggccgagctc 1500

gagcacgatc ggctggtcta tgtcgaccgt cgcaacaatg tgctcaaact gtcgcagggc 1560 Page 69

12956-144-228_SEQLIST.TXT 14 Jul 2022

gagttcgtga ccgtcgccca tctcgaggcc gtgttcgcca gcagcccgct gatccggcag 1620

atcttcatct acggcagcag cgaacgttcc tatctgctcg cggtgatcgt ccccaccgac 1680 gacgcgctgc gcggccgcga caccgccacc ttgaaatcgg cactggccga atcgattcag 1740

cgcatcgcca aggacgcgaa cctgcagccc tacgagattc cgcgcgattt cctgatcgag 1800 accgagccgt tcaccatcgc caacggactg ctctccggca tcgcgaagct gctgcgcccc 1860 aatctgaagg aacgctacgg cgctcagctg gagcagatgt acaccgatct cgcgacaggc 1920 2022205243

caggccgatg agctgctcgc cctgcgccgc gaagccgccg acctgccggt gctcgaaacc 1980 gtcagccggg cagcgaaagc gatgctcggc gtcgcctccg ccgatatgcg tcccgacgcg 2040 cacttcaccg acctgggcgg cgattccctt tccgcgctgt cgttctcgaa cctgctgcac 2100

gagatcttcg gggtcgaggt gccggtgggt gtcgtcgtca gcccggcgaa cgagctgcgc 2160 gatctggcga attacattga ggcggaacgc aactcgggcg cgaagcgtcc caccttcacc 2220 tcggtgcacg gcggcggttc cgagatccgc gccgccgatc tgaccctcga caagttcatc 2280

gatgcccgca ccctggccgc cgccgacagc attccgcacg cgccggtgcc agcgcagacg 2340 gtgctgctga ccggcgcgaa cggctacctc ggccggttcc tgtgcctgga atggctggag 2400

cggctggaca agacgggtgg cacgctgatc tgcgtcgtgc gcggtagtga cgcggccgcg 2460

gcccgtaaac ggctggactc ggcgttcgac agcggcgatc ccggcctgct cgagcactac 2520

cagcaactgg ccgcacggac cctggaagtc ctcgccggtg atatcggcga cccgaatctc 2580

ggtctggacg acgcgacttg gcagcggttg gccgaaaccg tcgacctgat cgtccatccc 2640 gccgcgttgg tcaaccacgt ccttccctac acccagctgt tcggccccaa tgtcgtcggc 2700

accgccgaaa tcgtccggtt ggcgatcacg gcgcggcgca agccggtcac ctacctgtcg 2760

accgtcggag tggccgacca ggtcgacccg gcggagtatc aggaggacag cgacgtccgc 2820 gagatgagcg cggtgcgcgt cgtgcgcgag agttacgcca acggctacgg caacagcaag 2880

tgggcggggg aggtcctgct gcgcgaagca cacgatctgt gtggcttgcc ggtcgcggtg 2940 ttccgttcgg acatgatcct ggcgcacagc cggtacgcgg gtcagctcaa cgtccaggac 3000 gtgttcaccc ggctgatcct cagcctggtc gccaccggca tcgcgccgta ctcgttctac 3060

cgaaccgacg cggacggcaa ccggcagcgg gcccactatg acggcttgcc ggcggacttc 3120 acggcggcgg cgatcaccgc gctcggcatc caagccaccg aaggcttccg gacctacgac 3180 gtgctcaatc cgtacgacga tggcatctcc ctcgatgaat tcgtcgactg gctcgtcgaa 3240

tccggccacc cgatccagcg catcaccgac tacagcgact ggttccaccg tttcgagacg 3300 gcgatccgcg cgctgccgga aaagcaacgc caggcctcgg tgctgccgtt gctggacgcc 3360

taccgcaacc cctgcccggc ggtccgcggc gcgatactcc cggccaagga gttccaagcg 3420 gcggtgcaaa cagccaaaat cggtccggaa caggacatcc cgcatttgtc cgcgccactg 3480 atcgataagt acgtcagcga tctggaactg cttcagctgc tctaa 3525

Page 70

12956-144-228_SEQLIST.TXT 14 Jul 2022

<210> 91 <211> 1174 <212> PRT <213> Nocardia iowensis <400> 91 Met Ala Val Asp Ser Pro Asp Glu Arg Leu Gln Arg Arg Ile Ala Gln 1 5 10 15

Leu Phe Ala Glu Asp Glu Gln Val Lys Ala Ala Arg Pro Leu Glu Ala 20 25 30 2022205243

Val Ser Ala Ala Val Ser Ala Pro Gly Met Arg Leu Ala Gln Ile Ala 35 40 45

Ala Thr Val Met Ala Gly Tyr Ala Asp Arg Pro Ala Ala Gly Gln Arg 50 55 60

Ala Phe Glu Leu Asn Thr Asp Asp Ala Thr Gly Arg Thr Ser Leu Arg 65 70 75 80

Leu Leu Pro Arg Phe Glu Thr Ile Thr Tyr Arg Glu Leu Trp Gln Arg 85 90 95

Val Gly Glu Val Ala Ala Ala Trp His His Asp Pro Glu Asn Pro Leu 100 105 110

Arg Ala Gly Asp Phe Val Ala Leu Leu Gly Phe Thr Ser Ile Asp Tyr 115 120 125

Ala Thr Leu Asp Leu Ala Asp Ile His Leu Gly Ala Val Thr Val Pro 130 135 140

Leu Gln Ala Ser Ala Ala Val Ser Gln Leu Ile Ala Ile Leu Thr Glu 145 150 155 160

Thr Ser Pro Arg Leu Leu Ala Ser Thr Pro Glu His Leu Asp Ala Ala 165 170 175

Val Glu Cys Leu Leu Ala Gly Thr Thr Pro Glu Arg Leu Val Val Phe 180 185 190

Asp Tyr His Pro Glu Asp Asp Asp Gln Arg Ala Ala Phe Glu Ser Ala 195 200 205

Arg Arg Arg Leu Ala Asp Ala Gly Ser Leu Val Ile Val Glu Thr Leu 210 215 220

Asp Ala Val Arg Ala Arg Gly Arg Asp Leu Pro Ala Ala Pro Leu Phe 225 230 235 240

Val Pro Asp Thr Asp Asp Asp Pro Leu Ala Leu Leu Ile Tyr Thr Ser 245 250 255 Page 71

12956-144-228_SEQLIST.TXT 14 Jul 2022

Gly Ser Thr Gly Thr Pro Lys Gly Ala Met Tyr Thr Asn Arg Leu Ala 260 265 270

Ala Thr Met Trp Gln Gly Asn Ser Met Leu Gln Gly Asn Ser Gln Arg 275 280 285

Val Gly Ile Asn Leu Asn Tyr Met Pro Met Ser His Ile Ala Gly Arg 290 295 300 2022205243

Ile Ser Leu Phe Gly Val Leu Ala Arg Gly Gly Thr Ala Tyr Phe Ala 305 310 315 320

Ala Lys Ser Asp Met Ser Thr Leu Phe Glu Asp Ile Gly Leu Val Arg 325 330 335

Pro Thr Glu Ile Phe Phe Val Pro Arg Val Cys Asp Met Val Phe Gln 340 345 350

Arg Tyr Gln Ser Glu Leu Asp Arg Arg Ser Val Ala Gly Ala Asp Leu 355 360 365

Asp Thr Leu Asp Arg Glu Val Lys Ala Asp Leu Arg Gln Asn Tyr Leu 370 375 380

Gly Gly Arg Phe Leu Val Ala Val Val Gly Ser Ala Pro Leu Ala Ala 385 390 395 400

Glu Met Lys Thr Phe Met Glu Ser Val Leu Asp Leu Pro Leu His Asp 405 410 415

Gly Tyr Gly Ser Thr Glu Ala Gly Ala Ser Val Leu Leu Asp Asn Gln 420 425 430

Ile Gln Arg Pro Pro Val Leu Asp Tyr Lys Leu Val Asp Val Pro Glu 435 440 445

Leu Gly Tyr Phe Arg Thr Asp Arg Pro His Pro Arg Gly Glu Leu Leu 450 455 460

Leu Lys Ala Glu Thr Thr Ile Pro Gly Tyr Tyr Lys Arg Pro Glu Val 465 470 475 480

Thr Ala Glu Ile Phe Asp Glu Asp Gly Phe Tyr Lys Thr Gly Asp Ile 485 490 495

Val Ala Glu Leu Glu His Asp Arg Leu Val Tyr Val Asp Arg Arg Asn 500 505 510

Asn Val Leu Lys Leu Ser Gln Gly Glu Phe Val Thr Val Ala His Leu 515 520 525 Page 72

12956-144-228_SEQLIST.TXT 14 Jul 2022

Glu Ala Val Phe Ala Ser Ser Pro Leu Ile Arg Gln Ile Phe Ile Tyr 530 535 540

Gly Ser Ser Glu Arg Ser Tyr Leu Leu Ala Val Ile Val Pro Thr Asp 545 550 555 560

Asp Ala Leu Arg Gly Arg Asp Thr Ala Thr Leu Lys Ser Ala Leu Ala 565 570 575 2022205243

Glu Ser Ile Gln Arg Ile Ala Lys Asp Ala Asn Leu Gln Pro Tyr Glu 580 585 590

Ile Pro Arg Asp Phe Leu Ile Glu Thr Glu Pro Phe Thr Ile Ala Asn 595 600 605

Gly Leu Leu Ser Gly Ile Ala Lys Leu Leu Arg Pro Asn Leu Lys Glu 610 615 620

Arg Tyr Gly Ala Gln Leu Glu Gln Met Tyr Thr Asp Leu Ala Thr Gly 625 630 635 640

Gln Ala Asp Glu Leu Leu Ala Leu Arg Arg Glu Ala Ala Asp Leu Pro 645 650 655

Val Leu Glu Thr Val Ser Arg Ala Ala Lys Ala Met Leu Gly Val Ala 660 665 670

Ser Ala Asp Met Arg Pro Asp Ala His Phe Thr Asp Leu Gly Gly Asp 675 680 685

Ser Leu Ser Ala Leu Ser Phe Ser Asn Leu Leu His Glu Ile Phe Gly 690 695 700

Val Glu Val Pro Val Gly Val Val Val Ser Pro Ala Asn Glu Leu Arg 705 710 715 720

Asp Leu Ala Asn Tyr Ile Glu Ala Glu Arg Asn Ser Gly Ala Lys Arg 725 730 735

Pro Thr Phe Thr Ser Val His Gly Gly Gly Ser Glu Ile Arg Ala Ala 740 745 750

Asp Leu Thr Leu Asp Lys Phe Ile Asp Ala Arg Thr Leu Ala Ala Ala 755 760 765

Asp Ser Ile Pro His Ala Pro Val Pro Ala Gln Thr Val Leu Leu Thr 770 775 780

Gly Ala Asn Gly Tyr Leu Gly Arg Phe Leu Cys Leu Glu Trp Leu Glu 785 790 795 800 Page 73

12956-144-228_SEQLIST.TXT 14 Jul 2022

Arg Leu Asp Lys Thr Gly Gly Thr Leu Ile Cys Val Val Arg Gly Ser 805 810 815

Asp Ala Ala Ala Ala Arg Lys Arg Leu Asp Ser Ala Phe Asp Ser Gly 820 825 830

Asp Pro Gly Leu Leu Glu His Tyr Gln Gln Leu Ala Ala Arg Thr Leu 835 840 845 2022205243

Glu Val Leu Ala Gly Asp Ile Gly Asp Pro Asn Leu Gly Leu Asp Asp 850 855 860

Ala Thr Trp Gln Arg Leu Ala Glu Thr Val Asp Leu Ile Val His Pro 865 870 875 880

Ala Ala Leu Val Asn His Val Leu Pro Tyr Thr Gln Leu Phe Gly Pro 885 890 895

Asn Val Val Gly Thr Ala Glu Ile Val Arg Leu Ala Ile Thr Ala Arg 900 905 910

Arg Lys Pro Val Thr Tyr Leu Ser Thr Val Gly Val Ala Asp Gln Val 915 920 925

Asp Pro Ala Glu Tyr Gln Glu Asp Ser Asp Val Arg Glu Met Ser Ala 930 935 940

Val Arg Val Val Arg Glu Ser Tyr Ala Asn Gly Tyr Gly Asn Ser Lys 945 950 955 960

Trp Ala Gly Glu Val Leu Leu Arg Glu Ala His Asp Leu Cys Gly Leu 965 970 975

Pro Val Ala Val Phe Arg Ser Asp Met Ile Leu Ala His Ser Arg Tyr 980 985 990

Ala Gly Gln Leu Asn Val Gln Asp Val Phe Thr Arg Leu Ile Leu Ser 995 1000 1005

Leu Val Ala Thr Gly Ile Ala Pro Tyr Ser Phe Tyr Arg Thr Asp 1010 1015 1020

Ala Asp Gly Asn Arg Gln Arg Ala His Tyr Asp Gly Leu Pro Ala 1025 1030 1035

Asp Phe Thr Ala Ala Ala Ile Thr Ala Leu Gly Ile Gln Ala Thr 1040 1045 1050

Glu Gly Phe Arg Thr Tyr Asp Val Leu Asn Pro Tyr Asp Asp Gly 1055 1060 1065 Page 74

12956-144-228_SEQLIST.TXT 14 Jul 2022

Ile Ser Leu Asp Glu Phe Val Asp Trp Leu Val Glu Ser Gly His 1070 1075 1080

Pro Ile Gln Arg Ile Thr Asp Tyr Ser Asp Trp Phe His Arg Phe 1085 1090 1095

Glu Thr Ala Ile Arg Ala Leu Pro Glu Lys Gln Arg Gln Ala Ser 1100 1105 1110 2022205243

Val Leu Pro Leu Leu Asp Ala Tyr Arg Asn Pro Cys Pro Ala Val 1115 1120 1125

Arg Gly Ala Ile Leu Pro Ala Lys Glu Phe Gln Ala Ala Val Gln 1130 1135 1140

Thr Ala Lys Ile Gly Pro Glu Gln Asp Ile Pro His Leu Ser Ala 1145 1150 1155

Pro Leu Ile Asp Lys Tyr Val Ser Asp Leu Glu Leu Leu Gln Leu 1160 1165 1170

Leu

<210> 92 <211> 669 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 92 atgattgaaa ccattctgcc tgcaggcgtt gaaagcgcag aactgctgga atatccggaa 60

gatctgaaag cacatccggc agaagaacat ctgattgcca aaagcgttga aaaacgtcgt 120 cgtgatttta ttggtgcacg tcattgtgca cgtctggcac tggcagaact gggtgaacct 180

ccggttgcaa ttggtaaagg tgaacgtggt gcaccgattt ggcctcgtgg tgttgttggt 240 agcctgaccc attgtgatgg ttatcgtgca gcagcagttg cacataaaat gcgctttcgc 300

agcattggta ttgatgcaga accgcatgca accctgccgg aaggtgttct ggatagcgtt 360 agcctgccgc cggaacgtga atggctgaaa accaccgata gcgcactgca tctggatcgt 420

ctgctgtttt gtgcaaaaga agccacctat aaagcctggt ggccgctgac agcacgttgg 480 ctgggttttg aagaagccca tattaccttt gaaattgaag atggtagcgc agatagcggt 540 aatggcacct ttcatagcga actgctggtt ccgggtcaga ccaatgatgg tggtacaccg 600

ctgctgagct ttgatggtcg ttggctgatt gcagatggtt ttattctgac cgcaattgcc 660 tatgcctaa 669

Page 75

12956-144-228_SEQLIST.TXT 14 Jul 2022

<210> 93 <211> 222 <212> PRT <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 93 Met Ile Glu Thr Ile Leu Pro Ala Gly Val Glu Ser Ala Glu Leu Leu 2022205243

1 5 10 15

Glu Tyr Pro Glu Asp Leu Lys Ala His Pro Ala Glu Glu His Leu Ile 20 25 30

Ala Lys Ser Val Glu Lys Arg Arg Arg Asp Phe Ile Gly Ala Arg His 35 40 45

Cys Ala Arg Leu Ala Leu Ala Glu Leu Gly Glu Pro Pro Val Ala Ile 50 55 60

Gly Lys Gly Glu Arg Gly Ala Pro Ile Trp Pro Arg Gly Val Val Gly 65 70 75 80

Ser Leu Thr His Cys Asp Gly Tyr Arg Ala Ala Ala Val Ala His Lys 85 90 95

Met Arg Phe Arg Ser Ile Gly Ile Asp Ala Glu Pro His Ala Thr Leu 100 105 110

Pro Glu Gly Val Leu Asp Ser Val Ser Leu Pro Pro Glu Arg Glu Trp 115 120 125

Leu Lys Thr Thr Asp Ser Ala Leu His Leu Asp Arg Leu Leu Phe Cys 130 135 140

Ala Lys Glu Ala Thr Tyr Lys Ala Trp Trp Pro Leu Thr Ala Arg Trp 145 150 155 160

Leu Gly Phe Glu Glu Ala His Ile Thr Phe Glu Ile Glu Asp Gly Ser 165 170 175

Ala Asp Ser Gly Asn Gly Thr Phe His Ser Glu Leu Leu Val Pro Gly 180 185 190

Gln Thr Asn Asp Gly Gly Thr Pro Leu Leu Ser Phe Asp Gly Arg Trp 195 200 205

Leu Ile Ala Asp Gly Phe Ile Leu Thr Ala Ile Ala Tyr Ala 210 215 220

<210> 94 Page 76

12956-144-228_SEQLIST.TXT 14 Jul 2022

<211> 3522 <212> DNA <213> Mycobacterium smegmatis <400> 94 atgaccagcg atgttcacga cgccacagac ggcgtcaccg aaaccgcact cgacgacgag 60

cagtcgaccc gccgcatcgc cgagctgtac gccaccgatc ccgagttcgc cgccgccgca 120 ccgttgcccg ccgtggtcga cgcggcgcac aaacccgggc tgcggctggc agagatcctg 180 cagaccctgt tcaccggcta cggtgaccgc ccggcgctgg gataccgcgc ccgtgaactg 240 2022205243

gccaccgacg agggcgggcg caccgtgacg cgtctgctgc cgcggttcga caccctcacc 300 tacgcccagg tgtggtcgcg cgtgcaagcg gtcgccgcgg ccctgcgcca caacttcgcg 360 cagccgatct accccggcga cgccgtcgcg acgatcggtt tcgcgagtcc cgattacctg 420

acgctggatc tcgtatgcgc ctacctgggc ctcgtgagtg ttccgctgca gcacaacgca 480 ccggtcagcc ggctcgcccc gatcctggcc gaggtcgaac cgcggatcct caccgtgagc 540 gccgaatacc tcgacctcgc agtcgaatcc gtgcgggacg tcaactcggt gtcgcagctc 600

gtggtgttcg accatcaccc cgaggtcgac gaccaccgcg acgcactggc ccgcgcgcgt 660 gaacaactcg ccggcaaggg catcgccgtc accaccctgg acgcgatcgc cgacgagggc 720

gccgggctgc cggccgaacc gatctacacc gccgaccatg atcagcgcct cgcgatgatc 780

ctgtacacct cgggttccac cggcgcaccc aagggtgcga tgtacaccga ggcgatggtg 840

gcgcggctgt ggaccatgtc gttcatcacg ggtgacccca cgccggtcat caacgtcaac 900

ttcatgccgc tcaaccacct gggcgggcgc atccccattt ccaccgccgt gcagaacggt 960 ggaaccagtt acttcgtacc ggaatccgac atgtccacgc tgttcgagga tctcgcgctg 1020

gtgcgcccga ccgaactcgg cctggttccg cgcgtcgccg acatgctcta ccagcaccac 1080

ctcgccaccg tcgaccgcct ggtcacgcag ggcgccgacg aactgaccgc cgagaagcag 1140 gccggtgccg aactgcgtga gcaggtgctc ggcggacgcg tgatcaccgg attcgtcagc 1200

accgcaccgc tggccgcgga gatgagggcg ttcctcgaca tcaccctggg cgcacacatc 1260 gtcgacggct acgggctcac cgagaccggc gccgtgacac gcgacggtgt gatcgtgcgg 1320 ccaccggtga tcgactacaa gctgatcgac gttcccgaac tcggctactt cagcaccgac 1380

aagccctacc cgcgtggcga actgctggtc aggtcgcaaa cgctgactcc cgggtactac 1440 aagcgccccg aggtcaccgc gagcgtcttc gaccgggacg gctactacca caccggcgac 1500 gtcatggccg agaccgcacc cgaccacctg gtgtacgtgg accgtcgcaa caacgtcctc 1560

aaactcgcgc agggcgagtt cgtggcggtc gccaacctgg aggcggtgtt ctccggcgcg 1620 gcgctggtgc gccagatctt cgtgtacggc aacagcgagc gcagtttcct tctggccgtg 1680

gtggtcccga cgccggaggc gctcgagcag tacgatccgg ccgcgctcaa ggccgcgctg 1740 gccgactcgc tgcagcgcac cgcacgcgac gccgaactgc aatcctacga ggtgccggcc 1800 gatttcatcg tcgagaccga gccgttcagc gccgccaacg ggctgctgtc gggtgtcgga 1860

aaactgctgc ggcccaacct caaagaccgc tacgggcagc gcctggagca gatgtacgcc 1920 Page 77

12956-144-228_SEQLIST.TXT 14 Jul 2022

gatatcgcgg ccacgcaggc caaccagttg cgcgaactgc ggcgcgcggc cgccacacaa 1980

ccggtgatcg acaccctcac ccaggccgct gccacgatcc tcggcaccgg gagcgaggtg 2040 gcatccgacg cccacttcac cgacctgggc ggggattccc tgtcggcgct gacactttcg 2100

aacctgctga gcgatttctt cggtttcgaa gttcccgtcg gcaccatcgt gaacccggcc 2160 accaacctcg cccaactcgc ccagcacatc gaggcgcagc gcaccgcggg tgaccgcagg 2220 ccgagtttca ccaccgtgca cggcgcggac gccaccgaga tccgggcgag tgagctgacc 2280 2022205243

ctggacaagt tcatcgacgc cgaaacgctc cgggccgcac cgggtctgcc caaggtcacc 2340 accgagccac ggacggtgtt gctctcgggc gccaacggct ggctgggccg gttcctcacg 2400 ttgcagtggc tggaacgcct ggcacctgtc ggcggcaccc tcatcacgat cgtgcggggc 2460

cgcgacgacg ccgcggcccg cgcacggctg acccaggcct acgacaccga tcccgagttg 2520 tcccgccgct tcgccgagct ggccgaccgc cacctgcggg tggtcgccgg tgacatcggc 2580 gacccgaatc tgggcctcac acccgagatc tggcaccggc tcgccgccga ggtcgacctg 2640

gtggtgcatc cggcagcgct ggtcaaccac gtgctcccct accggcagct gttcggcccc 2700 aacgtcgtgg gcacggccga ggtgatcaag ctggccctca ccgaacggat caagcccgtc 2760

acgtacctgt ccaccgtgtc ggtggccatg gggatccccg acttcgagga ggacggcgac 2820

atccggaccg tgagcccggt gcgcccgctc gacggcggat acgccaacgg ctacggcaac 2880

agcaagtggg ccggcgaggt gctgctgcgg gaggcccacg atctgtgcgg gctgcccgtg 2940

gcgacgttcc gctcggacat gatcctggcg catccgcgct accgcggtca ggtcaacgtg 3000 ccagacatgt tcacgcgact cctgttgagc ctcttgatca ccggcgtcgc gccgcggtcg 3060

ttctacatcg gagacggtga gcgcccgcgg gcgcactacc ccggcctgac ggtcgatttc 3120

gtggccgagg cggtcacgac gctcggcgcg cagcagcgcg agggatacgt gtcctacgac 3180 gtgatgaacc cgcacgacga cgggatctcc ctggatgtgt tcgtggactg gctgatccgg 3240

gcgggccatc cgatcgaccg ggtcgacgac tacgacgact gggtgcgtcg gttcgagacc 3300 gcgttgaccg cgcttcccga gaagcgccgc gcacagaccg tactgccgct gctgcacgcg 3360 ttccgcgctc cgcaggcacc gttgcgcggc gcacccgaac ccacggaggt gttccacgcc 3420

gcggtgcgca ccgcgaaggt gggcccggga gacatcccgc acctcgacga ggcgctgatc 3480 gacaagtaca tacgcgatct gcgtgagttc ggtctgatct aa 3522

<210> 95 <211> 1173 <212> PRT <213> Mycobacterium smegmatis

<400> 95 Met Thr Ser Asp Val His Asp Ala Thr Asp Gly Val Thr Glu Thr Ala 1 5 10 15

Leu Asp Asp Glu Gln Ser Thr Arg Arg Ile Ala Glu Leu Tyr Ala Thr 20 25 30 Page 78

12956-144-228_SEQLIST.TXT 14 Jul 2022

Asp Pro Glu Phe Ala Ala Ala Ala Pro Leu Pro Ala Val Val Asp Ala 35 40 45

Ala His Lys Pro Gly Leu Arg Leu Ala Glu Ile Leu Gln Thr Leu Phe 50 55 60

Thr Gly Tyr Gly Asp Arg Pro Ala Leu Gly Tyr Arg Ala Arg Glu Leu 65 70 75 80 2022205243

Ala Thr Asp Glu Gly Gly Arg Thr Val Thr Arg Leu Leu Pro Arg Phe 85 90 95

Asp Thr Leu Thr Tyr Ala Gln Val Trp Ser Arg Val Gln Ala Val Ala 100 105 110

Ala Ala Leu Arg His Asn Phe Ala Gln Pro Ile Tyr Pro Gly Asp Ala 115 120 125

Val Ala Thr Ile Gly Phe Ala Ser Pro Asp Tyr Leu Thr Leu Asp Leu 130 135 140

Val Cys Ala Tyr Leu Gly Leu Val Ser Val Pro Leu Gln His Asn Ala 145 150 155 160

Pro Val Ser Arg Leu Ala Pro Ile Leu Ala Glu Val Glu Pro Arg Ile 165 170 175

Leu Thr Val Ser Ala Glu Tyr Leu Asp Leu Ala Val Glu Ser Val Arg 180 185 190

Asp Val Asn Ser Val Ser Gln Leu Val Val Phe Asp His His Pro Glu 195 200 205

Val Asp Asp His Arg Asp Ala Leu Ala Arg Ala Arg Glu Gln Leu Ala 210 215 220

Gly Lys Gly Ile Ala Val Thr Thr Leu Asp Ala Ile Ala Asp Glu Gly 225 230 235 240

Ala Gly Leu Pro Ala Glu Pro Ile Tyr Thr Ala Asp His Asp Gln Arg 245 250 255

Leu Ala Met Ile Leu Tyr Thr Ser Gly Ser Thr Gly Ala Pro Lys Gly 260 265 270

Ala Met Tyr Thr Glu Ala Met Val Ala Arg Leu Trp Thr Met Ser Phe 275 280 285

Ile Thr Gly Asp Pro Thr Pro Val Ile Asn Val Asn Phe Met Pro Leu 290 295 300 Page 79

12956-144-228_SEQLIST.TXT 14 Jul 2022

Asn His Leu Gly Gly Arg Ile Pro Ile Ser Thr Ala Val Gln Asn Gly 305 310 315 320

Gly Thr Ser Tyr Phe Val Pro Glu Ser Asp Met Ser Thr Leu Phe Glu 325 330 335

Asp Leu Ala Leu Val Arg Pro Thr Glu Leu Gly Leu Val Pro Arg Val 340 345 350 2022205243

Ala Asp Met Leu Tyr Gln His His Leu Ala Thr Val Asp Arg Leu Val 355 360 365

Thr Gln Gly Ala Asp Glu Leu Thr Ala Glu Lys Gln Ala Gly Ala Glu 370 375 380

Leu Arg Glu Gln Val Leu Gly Gly Arg Val Ile Thr Gly Phe Val Ser 385 390 395 400

Thr Ala Pro Leu Ala Ala Glu Met Arg Ala Phe Leu Asp Ile Thr Leu 405 410 415

Gly Ala His Ile Val Asp Gly Tyr Gly Leu Thr Glu Thr Gly Ala Val 420 425 430

Thr Arg Asp Gly Val Ile Val Arg Pro Pro Val Ile Asp Tyr Lys Leu 435 440 445

Ile Asp Val Pro Glu Leu Gly Tyr Phe Ser Thr Asp Lys Pro Tyr Pro 450 455 460

Arg Gly Glu Leu Leu Val Arg Ser Gln Thr Leu Thr Pro Gly Tyr Tyr 465 470 475 480

Lys Arg Pro Glu Val Thr Ala Ser Val Phe Asp Arg Asp Gly Tyr Tyr 485 490 495

His Thr Gly Asp Val Met Ala Glu Thr Ala Pro Asp His Leu Val Tyr 500 505 510

Val Asp Arg Arg Asn Asn Val Leu Lys Leu Ala Gln Gly Glu Phe Val 515 520 525

Ala Val Ala Asn Leu Glu Ala Val Phe Ser Gly Ala Ala Leu Val Arg 530 535 540

Gln Ile Phe Val Tyr Gly Asn Ser Glu Arg Ser Phe Leu Leu Ala Val 545 550 555 560

Val Val Pro Thr Pro Glu Ala Leu Glu Gln Tyr Asp Pro Ala Ala Leu 565 570 575 Page 80

12956-144-228_SEQLIST.TXT 14 Jul 2022

Lys Ala Ala Leu Ala Asp Ser Leu Gln Arg Thr Ala Arg Asp Ala Glu 580 585 590

Leu Gln Ser Tyr Glu Val Pro Ala Asp Phe Ile Val Glu Thr Glu Pro 595 600 605

Phe Ser Ala Ala Asn Gly Leu Leu Ser Gly Val Gly Lys Leu Leu Arg 610 615 620 2022205243

Pro Asn Leu Lys Asp Arg Tyr Gly Gln Arg Leu Glu Gln Met Tyr Ala 625 630 635 640

Asp Ile Ala Ala Thr Gln Ala Asn Gln Leu Arg Glu Leu Arg Arg Ala 645 650 655

Ala Ala Thr Gln Pro Val Ile Asp Thr Leu Thr Gln Ala Ala Ala Thr 660 665 670

Ile Leu Gly Thr Gly Ser Glu Val Ala Ser Asp Ala His Phe Thr Asp 675 680 685

Leu Gly Gly Asp Ser Leu Ser Ala Leu Thr Leu Ser Asn Leu Leu Ser 690 695 700

Asp Phe Phe Gly Phe Glu Val Pro Val Gly Thr Ile Val Asn Pro Ala 705 710 715 720

Thr Asn Leu Ala Gln Leu Ala Gln His Ile Glu Ala Gln Arg Thr Ala 725 730 735

Gly Asp Arg Arg Pro Ser Phe Thr Thr Val His Gly Ala Asp Ala Thr 740 745 750

Glu Ile Arg Ala Ser Glu Leu Thr Leu Asp Lys Phe Ile Asp Ala Glu 755 760 765

Thr Leu Arg Ala Ala Pro Gly Leu Pro Lys Val Thr Thr Glu Pro Arg 770 775 780

Thr Val Leu Leu Ser Gly Ala Asn Gly Trp Leu Gly Arg Phe Leu Thr 785 790 795 800

Leu Gln Trp Leu Glu Arg Leu Ala Pro Val Gly Gly Thr Leu Ile Thr 805 810 815

Ile Val Arg Gly Arg Asp Asp Ala Ala Ala Arg Ala Arg Leu Thr Gln 820 825 830

Ala Tyr Asp Thr Asp Pro Glu Leu Ser Arg Arg Phe Ala Glu Leu Ala 835 840 845 Page 81

12956-144-228_SEQLIST.TXT 14 Jul 2022

Asp Arg His Leu Arg Val Val Ala Gly Asp Ile Gly Asp Pro Asn Leu 850 855 860

Gly Leu Thr Pro Glu Ile Trp His Arg Leu Ala Ala Glu Val Asp Leu 865 870 875 880

Val Val His Pro Ala Ala Leu Val Asn His Val Leu Pro Tyr Arg Gln 885 890 895 2022205243

Leu Phe Gly Pro Asn Val Val Gly Thr Ala Glu Val Ile Lys Leu Ala 900 905 910

Leu Thr Glu Arg Ile Lys Pro Val Thr Tyr Leu Ser Thr Val Ser Val 915 920 925

Ala Met Gly Ile Pro Asp Phe Glu Glu Asp Gly Asp Ile Arg Thr Val 930 935 940

Ser Pro Val Arg Pro Leu Asp Gly Gly Tyr Ala Asn Gly Tyr Gly Asn 945 950 955 960

Ser Lys Trp Ala Gly Glu Val Leu Leu Arg Glu Ala His Asp Leu Cys 965 970 975

Gly Leu Pro Val Ala Thr Phe Arg Ser Asp Met Ile Leu Ala His Pro 980 985 990

Arg Tyr Arg Gly Gln Val Asn Val Pro Asp Met Phe Thr Arg Leu Leu 995 1000 1005

Leu Ser Leu Leu Ile Thr Gly Val Ala Pro Arg Ser Phe Tyr Ile 1010 1015 1020

Gly Asp Gly Glu Arg Pro Arg Ala His Tyr Pro Gly Leu Thr Val 1025 1030 1035

Asp Phe Val Ala Glu Ala Val Thr Thr Leu Gly Ala Gln Gln Arg 1040 1045 1050

Glu Gly Tyr Val Ser Tyr Asp Val Met Asn Pro His Asp Asp Gly 1055 1060 1065

Ile Ser Leu Asp Val Phe Val Asp Trp Leu Ile Arg Ala Gly His 1070 1075 1080

Pro Ile Asp Arg Val Asp Asp Tyr Asp Asp Trp Val Arg Arg Phe 1085 1090 1095

Glu Thr Ala Leu Thr Ala Leu Pro Glu Lys Arg Arg Ala Gln Thr 1100 1105 1110 Page 82

12956-144-228_SEQLIST.TXT 14 Jul 2022

Val Leu Pro Leu Leu His Ala Phe Arg Ala Pro Gln Ala Pro Leu 1115 1120 1125

Arg Gly Ala Pro Glu Pro Thr Glu Val Phe His Ala Ala Val Arg 1130 1135 1140

Thr Ala Lys Val Gly Pro Gly Asp Ile Pro His Leu Asp Glu Ala 1145 1150 1155 2022205243

Leu Ile Asp Lys Tyr Ile Arg Asp Leu Arg Glu Phe Gly Leu Ile 1160 1165 1170

<210> 96 <211> 3522 <212> DNA <213> Mycobacterium avium <400> 96 atgtcgactg ccacccatga cgaacgactc gaccgtcgcg tccacgaact catcgccacc 60

gacccgcaat tcgccgccgc ccaacccgac ccggcgatca ccgccgccct cgaacagccc 120

gggctgcggc tgccgcagat catccgcacc gtgctcgacg gctacgccga ccggccggcg 180

ctgggacagc gcgtggtgga gttcgtcacg gacgccaaga ccgggcgcac gtcggcgcag 240 ctgctccccc gcttcgagac catcacgtac agcgaagtag cgcagcgtgt ttcggcgctg 300

ggccgcgccc tgtccgacga cgcggtgcac cccggcgacc gggtgtgcgt gctgggcttc 360

aacagcgtcg actacgccac catcgacatg gcgctgggcg ccatcggcgc cgtctcggtg 420

ccgctgcaga ccagcgcggc aatcagctcg ctgcagccga tcgtggccga gaccgagccc 480 accctgatcg cgtccagcgt gaaccagctg tccgacgcgg tgcagctgat caccggcgcc 540

gagcaggcgc ccacccggct ggtggtgttc gactaccacc cgcaggtcga cgaccagcgc 600

gaggccgtcc aggacgccgc ggcgcggctg tccagcaccg gcgtggccgt ccagacgctg 660

gccgagctgc tggagcgcgg caaggacctg cccgccgtcg cggagccgcc cgccgacgag 720 gactcgctgg ccctgctgat ctacacctcc gggtccaccg gcgcccccaa gggcgcgatg 780

tacccacaga gcaacgtcgg caagatgtgg cgccgcggca gcaagaactg gttcggcgag 840 agcgccgcgt cgatcaccct gaacttcatg ccgatgagcc acgtgatggg ccgaagcatc 900

ctctacggca cgctgggcaa cggcggcacc gcctacttcg ccgcccgcag cgacctgtcc 960 accctgcttg aggacctcga gctggtgcgg cccaccgagc tcaacttcgt cccgcggatc 1020

tgggagacgc tgtacggcga attccagcgt caggtcgagc ggcggctctc cgaggccggg 1080 gacgccggcg aacgtcgcgc cgtcgaggcc gaggtgctgg ccgagcagcg ccagtacctg 1140 ctgggcgggc ggttcacctt cgcgatgacg ggctcggcgc ccatctcgcc ggagctgcgc 1200

aactgggtcg agtcgctgct cgaaatgcac ctgatggacg gctacggctc caccgaggcc 1260 ggaatggtgt tgttcgacgg ggagattcag cgcccgccgg tgatcgacta caagctggtc 1320

Page 83

12956-144-228_SEQLIST.TXT 14 Jul 2022

gacgtgccgg acctgggcta cttcagcacc gaccggccgc atccgcgcgg cgagctgctg 1380 ctgcgcaccg agaacatgtt cccgggctac tacaagcggg ccgaaaccac cgcgggcgtc 1440 ttcgacgagg acggctacta ccgcaccggc gacgtgttcg ccgagatcgc cccggaccgg 1500

ctggtctacg tcgaccgccg caacaacgtg ctcaagctgg cgcagggcga attcgtcacg 1560 ctggccaagc tggaggcggt gttcggcaac agcccgctga tccgccagat ctacgtctac 1620 ggcaacagcg cccagcccta cctgctggcg gtcgtggtgc ccaccgagga ggcgctggcc 1680 2022205243

tcgggtgacc ccgagacgct caagcccaag atcgccgact cgctgcagca ggtcgccaag 1740 gaggccggcc tgcagtccta cgaggtgccg cgcgacttca tcatcgagac caccccgttc 1800

agcctggaaa acggtctgct gaccgggatc cggaagctgg cgtggccgaa actgaagcag 1860 cactacgggg aacggctgga gcagatgtac gccgacctgg ccgccggaca ggccaacgag 1920

ctggccgagc tgcgccgcaa cggtgcccag gcgccggtgt tgcagaccgt gagccgcgcc 1980 gcgggcgcca tgctgggttc ggccgcctcc gacctgtccc ccgacgccca cttcaccgat 2040 ctgggcggag actcgttgtc ggcgttgaca ttcggcaacc tgctgcgcga gatcttcgac 2100

gtcgacgtgc cggtaggcgt gatcgtcagc ccggccaacg acctggcggc catcgcgagc 2160

tacatcgagg ccgagcggca gggcagcaag cgcccgacgt tcgcctcggt gcacggccgg 2220

gacgcgaccg tggtgcgcgc cgccgacctg acgctggaca agttcctcga cgccgagacg 2280 ctggccgccg cgccgaacct gcccaagccg gccaccgagg tgcgcaccgt gctgctgacc 2340

ggcgccaccg gcttcctggg ccgctacctg gccctggaat ggctggagcg gatggacatg 2400

gtggacggca aggtcatcgc cctggtccgg gcccgctccg acgaggaggc acgcgcccgg 2460

ctggacaaga ccttcgacag cggcgacccg aaactgctcg cgcactacca gcagctggcc 2520 gccgatcacc tggaggtcat cgccggcgac aagggcgagg ccaatctggg cctgggccaa 2580

gacgtttggc aacgactggc cgacacggtc gacgtgatcg tcgaccccgc cgcgctggtc 2640

aaccacgtgt tgccgtacag cgagctgttc gggcccaacg ccctgggcac cgcggagctg 2700

atccggctgg cgctgacgtc caagcagaag ccgtacacct acgtgtccac catcggcgtg 2760 ggcgaccaga tcgagccggg caagttcgtc gagaacgccg acatccggca gatgagcgcc 2820

acccgggcga tcaacgacag ctacgccaac ggctatggca acagcaagtg ggccggcgag 2880 gtgctgctgc gcgaggcgca cgacctgtgc gggctgcccg tcgcggtgtt ccgctgcgac 2940

atgatcctgg ccgacaccac gtatgccggg cagctcaacc tgccggacat gttcacccgg 3000 ctgatgctga gcctggtggc caccgggatc gcgcccggct cgttctacga gctcgacgcc 3060

gacggcaacc ggcagcgggc gcactacgac ggcctgccgg tcgagttcat cgccgcggcg 3120 atctcgacgc tgggttcgca gatcaccgac agcgacaccg gcttccagac ctaccacgtg 3180 atgaacccct acgatgacgg cgtcggtctg gacgagtacg tcgattggct ggtggacgcc 3240

ggctattcga tcgagcggat cgccgactac tccgaatggc tgcggcggtt cgagacctcg 3300 ctgcgggccc tgccggaccg gcagcgccag tactcgctgc tgccgctgct gcacaactac 3360

Page 84

12956-144-228_SEQLIST.TXT 14 Jul 2022

cgcacgccgg agaagccgat caacgggtcg atagctccca ccgacgtgtt ccgggcagcg 3420 gtgcaggagg cgaaaatcgg ccccgacaaa gacattccgc acgtgtcgcc gccggtcatc 3480 gtcaagtaca tcaccgacct gcagctgctc gggctgctct aa 3522

<210> 97 <211> 1173 <212> PRT <213> Mycobacterium avium 2022205243

<400> 97 Met Ser Thr Ala Thr His Asp Glu Arg Leu Asp Arg Arg Val His Glu 1 5 10 15

Leu Ile Ala Thr Asp Pro Gln Phe Ala Ala Ala Gln Pro Asp Pro Ala 20 25 30

Ile Thr Ala Ala Leu Glu Gln Pro Gly Leu Arg Leu Pro Gln Ile Ile 35 40 45

Arg Thr Val Leu Asp Gly Tyr Ala Asp Arg Pro Ala Leu Gly Gln Arg 50 55 60

Val Val Glu Phe Val Thr Asp Ala Lys Thr Gly Arg Thr Ser Ala Gln 65 70 75 80

Leu Leu Pro Arg Phe Glu Thr Ile Thr Tyr Ser Glu Val Ala Gln Arg 85 90 95

Val Ser Ala Leu Gly Arg Ala Leu Ser Asp Asp Ala Val His Pro Gly 100 105 110

Asp Arg Val Cys Val Leu Gly Phe Asn Ser Val Asp Tyr Ala Thr Ile 115 120 125

Asp Met Ala Leu Gly Ala Ile Gly Ala Val Ser Val Pro Leu Gln Thr 130 135 140

Ser Ala Ala Ile Ser Ser Leu Gln Pro Ile Val Ala Glu Thr Glu Pro 145 150 155 160

Thr Leu Ile Ala Ser Ser Val Asn Gln Leu Ser Asp Ala Val Gln Leu 165 170 175

Ile Thr Gly Ala Glu Gln Ala Pro Thr Arg Leu Val Val Phe Asp Tyr 180 185 190

His Pro Gln Val Asp Asp Gln Arg Glu Ala Val Gln Asp Ala Ala Ala 195 200 205

Arg Leu Ser Ser Thr Gly Val Ala Val Gln Thr Leu Ala Glu Leu Leu 210 215 220

Page 85

12956-144-228_SEQLIST.TXT 14 Jul 2022

Glu Arg Gly Lys Asp Leu Pro Ala Val Ala Glu Pro Pro Ala Asp Glu 225 230 235 240

Asp Ser Leu Ala Leu Leu Ile Tyr Thr Ser Gly Ser Thr Gly Ala Pro 245 250 255

Lys Gly Ala Met Tyr Pro Gln Ser Asn Val Gly Lys Met Trp Arg Arg 260 265 270 2022205243

Gly Ser Lys Asn Trp Phe Gly Glu Ser Ala Ala Ser Ile Thr Leu Asn 275 280 285

Phe Met Pro Met Ser His Val Met Gly Arg Ser Ile Leu Tyr Gly Thr 290 295 300

Leu Gly Asn Gly Gly Thr Ala Tyr Phe Ala Ala Arg Ser Asp Leu Ser 305 310 315 320

Thr Leu Leu Glu Asp Leu Glu Leu Val Arg Pro Thr Glu Leu Asn Phe 325 330 335

Val Pro Arg Ile Trp Glu Thr Leu Tyr Gly Glu Phe Gln Arg Gln Val 340 345 350

Glu Arg Arg Leu Ser Glu Ala Gly Asp Ala Gly Glu Arg Arg Ala Val 355 360 365

Glu Ala Glu Val Leu Ala Glu Gln Arg Gln Tyr Leu Leu Gly Gly Arg 370 375 380

Phe Thr Phe Ala Met Thr Gly Ser Ala Pro Ile Ser Pro Glu Leu Arg 385 390 395 400

Asn Trp Val Glu Ser Leu Leu Glu Met His Leu Met Asp Gly Tyr Gly 405 410 415

Ser Thr Glu Ala Gly Met Val Leu Phe Asp Gly Glu Ile Gln Arg Pro 420 425 430

Pro Val Ile Asp Tyr Lys Leu Val Asp Val Pro Asp Leu Gly Tyr Phe 435 440 445

Ser Thr Asp Arg Pro His Pro Arg Gly Glu Leu Leu Leu Arg Thr Glu 450 455 460

Asn Met Phe Pro Gly Tyr Tyr Lys Arg Ala Glu Thr Thr Ala Gly Val 465 470 475 480

Phe Asp Glu Asp Gly Tyr Tyr Arg Thr Gly Asp Val Phe Ala Glu Ile 485 490 495

Page 86

12956-144-228_SEQLIST.TXT 14 Jul 2022

Ala Pro Asp Arg Leu Val Tyr Val Asp Arg Arg Asn Asn Val Leu Lys 500 505 510

Leu Ala Gln Gly Glu Phe Val Thr Leu Ala Lys Leu Glu Ala Val Phe 515 520 525

Gly Asn Ser Pro Leu Ile Arg Gln Ile Tyr Val Tyr Gly Asn Ser Ala 530 535 540 2022205243

Gln Pro Tyr Leu Leu Ala Val Val Val Pro Thr Glu Glu Ala Leu Ala 545 550 555 560

Ser Gly Asp Pro Glu Thr Leu Lys Pro Lys Ile Ala Asp Ser Leu Gln 565 570 575

Gln Val Ala Lys Glu Ala Gly Leu Gln Ser Tyr Glu Val Pro Arg Asp 580 585 590

Phe Ile Ile Glu Thr Thr Pro Phe Ser Leu Glu Asn Gly Leu Leu Thr 595 600 605

Gly Ile Arg Lys Leu Ala Trp Pro Lys Leu Lys Gln His Tyr Gly Glu 610 615 620

Arg Leu Glu Gln Met Tyr Ala Asp Leu Ala Ala Gly Gln Ala Asn Glu 625 630 635 640

Leu Ala Glu Leu Arg Arg Asn Gly Ala Gln Ala Pro Val Leu Gln Thr 645 650 655

Val Ser Arg Ala Ala Gly Ala Met Leu Gly Ser Ala Ala Ser Asp Leu 660 665 670

Ser Pro Asp Ala His Phe Thr Asp Leu Gly Gly Asp Ser Leu Ser Ala 675 680 685

Leu Thr Phe Gly Asn Leu Leu Arg Glu Ile Phe Asp Val Asp Val Pro 690 695 700

Val Gly Val Ile Val Ser Pro Ala Asn Asp Leu Ala Ala Ile Ala Ser 705 710 715 720

Tyr Ile Glu Ala Glu Arg Gln Gly Ser Lys Arg Pro Thr Phe Ala Ser 725 730 735

Val His Gly Arg Asp Ala Thr Val Val Arg Ala Ala Asp Leu Thr Leu 740 745 750

Asp Lys Phe Leu Asp Ala Glu Thr Leu Ala Ala Ala Pro Asn Leu Pro 755 760 765

Page 87

12956-144-228_SEQLIST.TXT 14 Jul 2022

Lys Pro Ala Thr Glu Val Arg Thr Val Leu Leu Thr Gly Ala Thr Gly 770 775 780

Phe Leu Gly Arg Tyr Leu Ala Leu Glu Trp Leu Glu Arg Met Asp Met 785 790 795 800

Val Asp Gly Lys Val Ile Ala Leu Val Arg Ala Arg Ser Asp Glu Glu 805 810 815 2022205243

Ala Arg Ala Arg Leu Asp Lys Thr Phe Asp Ser Gly Asp Pro Lys Leu 820 825 830

Leu Ala His Tyr Gln Gln Leu Ala Ala Asp His Leu Glu Val Ile Ala 835 840 845

Gly Asp Lys Gly Glu Ala Asn Leu Gly Leu Gly Gln Asp Val Trp Gln 850 855 860

Arg Leu Ala Asp Thr Val Asp Val Ile Val Asp Pro Ala Ala Leu Val 865 870 875 880

Asn His Val Leu Pro Tyr Ser Glu Leu Phe Gly Pro Asn Ala Leu Gly 885 890 895

Thr Ala Glu Leu Ile Arg Leu Ala Leu Thr Ser Lys Gln Lys Pro Tyr 900 905 910

Thr Tyr Val Ser Thr Ile Gly Val Gly Asp Gln Ile Glu Pro Gly Lys 915 920 925

Phe Val Glu Asn Ala Asp Ile Arg Gln Met Ser Ala Thr Arg Ala Ile 930 935 940

Asn Asp Ser Tyr Ala Asn Gly Tyr Gly Asn Ser Lys Trp Ala Gly Glu 945 950 955 960

Val Leu Leu Arg Glu Ala His Asp Leu Cys Gly Leu Pro Val Ala Val 965 970 975

Phe Arg Cys Asp Met Ile Leu Ala Asp Thr Thr Tyr Ala Gly Gln Leu 980 985 990

Asn Leu Pro Asp Met Phe Thr Arg Leu Met Leu Ser Leu Val Ala Thr 995 1000 1005

Gly Ile Ala Pro Gly Ser Phe Tyr Glu Leu Asp Ala Asp Gly Asn 1010 1015 1020

Arg Gln Arg Ala His Tyr Asp Gly Leu Pro Val Glu Phe Ile Ala 1025 1030 1035

Page 88

12956-144-228_SEQLIST.TXT 14 Jul 2022

Ala Ala Ile Ser Thr Leu Gly Ser Gln Ile Thr Asp Ser Asp Thr 1040 1045 1050

Gly Phe Gln Thr Tyr His Val Met Asn Pro Tyr Asp Asp Gly Val 1055 1060 1065

Gly Leu Asp Glu Tyr Val Asp Trp Leu Val Asp Ala Gly Tyr Ser 1070 1075 1080 2022205243

Ile Glu Arg Ile Ala Asp Tyr Ser Glu Trp Leu Arg Arg Phe Glu 1085 1090 1095

Thr Ser Leu Arg Ala Leu Pro Asp Arg Gln Arg Gln Tyr Ser Leu 1100 1105 1110

Leu Pro Leu Leu His Asn Tyr Arg Thr Pro Glu Lys Pro Ile Asn 1115 1120 1125

Gly Ser Ile Ala Pro Thr Asp Val Phe Arg Ala Ala Val Gln Glu 1130 1135 1140

Ala Lys Ile Gly Pro Asp Lys Asp Ile Pro His Val Ser Pro Pro 1145 1150 1155

Val Ile Val Lys Tyr Ile Thr Asp Leu Gln Leu Leu Gly Leu Leu 1160 1165 1170

<210> 98 <211> 3525 <212> DNA <213> Mycobacterium marinum

<400> 98 atgtcgccaa tcacgcgtga agagcggctc gagcgccgca tccaggacct ctacgccaac 60

gacccgcagt tcgccgccgc caaacccgcc acggcgatca ccgcagcaat cgagcggccg 120 ggtctaccgc taccccagat catcgagacc gtcatgaccg gatacgccga tcggccggct 180 ctcgctcagc gctcggtcga attcgtgacc gacgccggca ccggccacac cacgctgcga 240

ctgctccccc acttcgaaac catcagctac ggcgagcttt gggaccgcat cagcgcactg 300 gccgacgtgc tcagcaccga acagacggtg aaaccgggcg accgggtctg cttgttgggc 360 ttcaacagcg tcgactacgc cacgatcgac atgactttgg cgcggctggg cgcggtggcc 420

gtaccactgc agaccagcgc ggcgataacc cagctgcagc cgatcgtcgc cgagacccag 480 cccaccatga tcgcggccag cgtcgacgca ctcgctgacg ccaccgaatt ggctctgtcc 540

ggtcagaccg ctacccgagt cctggtgttc gaccaccacc ggcaggttga cgcacaccgc 600 gcagcggtcg aatccgcccg ggagcgcctg gccggctcgg cggtcgtcga aaccctggcc 660 gaggccatcg cgcgcggcga cgtgccccgc ggtgcgtccg ccggctcggc gcccggcacc 720

gatgtgtccg acgactcgct cgcgctactg atctacacct cgggcagcac gggtgcgccc 780 Page 89

12956-144-228_SEQLIST.TXT 14 Jul 2022

aagggcgcga tgtacccccg acgcaacgtt gcgaccttct ggcgcaagcg cacctggttc 840

gaaggcggct acgagccgtc gatcacgctg aacttcatgc caatgagcca cgtcatgggc 900 cgccaaatcc tgtacggcac gctgtgcaat ggcggcaccg cctacttcgt ggcgaaaagc 960

gatctctcca ccttgttcga agacctggcg ctggtgcggc ccaccgagct gaccttcgtg 1020 ccgcgcgtgt gggacatggt gttcgacgag tttcagagtg aggtcgaccg ccgcctggtc 1080 gacggcgccg accgggtcgc gctcgaagcc caggtcaagg ccgagatacg caacgacgtg 1140 2022205243

ctcggtggac ggtataccag cgcactgacc ggctccgccc ctatctccga cgagatgaag 1200 gcgtgggtcg aggagctgct cgacatgcat ctggtcgagg gctacggctc caccgaggcc 1260 gggatgatcc tgatcgacgg agccattcgg cgcccggcgg tactcgacta caagctggtc 1320

gatgttcccg acctgggtta cttcctgacc gaccggccac atccgcgggg cgagttgctg 1380 gtcaagaccg atagtttgtt cccgggctac taccagcgag ccgaagtcac cgccgacgtg 1440 ttcgatgctg acggcttcta ccggaccggc gacatcatgg ccgaggtcgg ccccgaacag 1500

ttcgtgtacc tcgaccgccg caacaacgtg ttgaagctgt cgcagggcga gttcgtcacc 1560 gtctccaaac tcgaagcggt gtttggcgac agcccactgg tacggcagat ctacatctac 1620

ggcaacagcg cccgtgccta cctgttggcg gtgatcgtcc ccacccagga ggcgctggac 1680

gccgtgcctg tcgaggagct caaggcgcgg ctgggcgact cgctgcaaga ggtcgcaaag 1740

gccgccggcc tgcagtccta cgagatcccg cgcgacttca tcatcgaaac aacaccatgg 1800

acgctggaga acggcctgct caccggcatc cgcaagttgg ccaggccgca gctgaaaaag 1860 cattacggcg agcttctcga gcagatctac acggacctgg cacacggcca ggccgacgaa 1920

ctgcgctcgc tgcgccaaag cggtgccgat gcgccggtgc tggtgacggt gtgccgtgcg 1980

gcggccgcgc tgttgggcgg cagcgcctct gacgtccagc ccgatgcgca cttcaccgat 2040 ttgggcggcg actcgctgtc ggcgctgtcg ttcaccaacc tgctgcacga gatcttcgac 2100

atcgaagtgc cggtgggcgt catcgtcagc cccgccaacg acttgcaggc cctggccgac 2160 tacgtcgagg cggctcgcaa acccggctcg tcacggccga ccttcgcctc ggtccacggc 2220 gcctcgaatg ggcaggtcac cgaggtgcat gccggtgacc tgtccctgga caaattcatc 2280

gatgccgcaa ccctggccga agctccccgg ctgcccgccg caaacaccca agtgcgcacc 2340 gtgctgctga ccggcgccac cggcttcctc gggcgctacc tggccctgga atggctggag 2400 cggatggacc tggtcgacgg caaactgatc tgcctggtcc gggccaagtc cgacaccgaa 2460

gcacgggcgc ggctggacaa gacgttcgac agcggcgacc ccgaactgct ggcccactac 2520 cgcgcactgg ccggcgacca cctcgaggtg ctcgccggtg acaagggcga agccgacctc 2580

ggactggacc ggcagacctg gcaacgcctg gccgacacgg tcgacctgat cgtcgacccc 2640 gcggccctgg tcaaccacgt actgccatac agccagctgt tcgggcccaa cgcgctgggc 2700 accgccgagc tgctgcggct ggcgctcacc tccaagatca agccctacag ctacacctcg 2760

acaatcggtg tcgccgacca gatcccgccg tcggcgttca ccgaggacgc cgacatccgg 2820 Page 90

12956-144-228_SEQLIST.TXT 14 Jul 2022

gtcatcagcg ccacccgcgc ggtcgacgac agctacgcca atggctactc gaacagcaag 2880

tgggccggcg aggtgctgtt gcgcgaggcg catgacctgt gtggcctgcc ggttgcggtg 2940 ttccgctgcg acatgatcct ggccgacacc acatgggcgg gacagctcaa tgtgccggac 3000

atgttcaccc ggatgatcct gagcctggcg gccaccggta tcgcgccggg ttcgttctat 3060 gagcttgcgg ccgacggcgc ccggcaacgc gcccactatg acggtctgcc cgtcgagttc 3120 atcgccgagg cgatttcgac tttgggtgcg cagagccagg atggtttcca cacgtatcac 3180 2022205243

gtgatgaacc cctacgacga cggcatcgga ctcgacgagt tcgtcgactg gctcaacgag 3240 tccggttgcc ccatccagcg catcgctgac tatggcgact ggctgcagcg cttcgaaacc 3300 gcactgcgcg cactgcccga tcggcagcgg cacagctcac tgctgccgct gttgcacaac 3360

tatcggcagc cggagcggcc cgtccgcggg tcgatcgccc ctaccgatcg cttccgggca 3420 gcggtgcaag aggccaagat cggccccgac aaagacattc cgcacgtcgg cgcgccgatc 3480 atcgtgaagt acgtcagcga cctgcgccta ctcggcctgc tctaa 3525

<210> 99 <211> 1174 <212> PRT <213> Mycobacterium marinum

<400> 99 Met Ser Pro Ile Thr Arg Glu Glu Arg Leu Glu Arg Arg Ile Gln Asp 1 5 10 15

Leu Tyr Ala Asn Asp Pro Gln Phe Ala Ala Ala Lys Pro Ala Thr Ala 20 25 30

Ile Thr Ala Ala Ile Glu Arg Pro Gly Leu Pro Leu Pro Gln Ile Ile 35 40 45

Glu Thr Val Met Thr Gly Tyr Ala Asp Arg Pro Ala Leu Ala Gln Arg 50 55 60

Ser Val Glu Phe Val Thr Asp Ala Gly Thr Gly His Thr Thr Leu Arg 65 70 75 80

Leu Leu Pro His Phe Glu Thr Ile Ser Tyr Gly Glu Leu Trp Asp Arg 85 90 95

Ile Ser Ala Leu Ala Asp Val Leu Ser Thr Glu Gln Thr Val Lys Pro 100 105 110

Gly Asp Arg Val Cys Leu Leu Gly Phe Asn Ser Val Asp Tyr Ala Thr 115 120 125

Ile Asp Met Thr Leu Ala Arg Leu Gly Ala Val Ala Val Pro Leu Gln 130 135 140

Page 91

12956-144-228_SEQLIST.TXT 14 Jul 2022

Thr Ser Ala Ala Ile Thr Gln Leu Gln Pro Ile Val Ala Glu Thr Gln 145 150 155 160

Pro Thr Met Ile Ala Ala Ser Val Asp Ala Leu Ala Asp Ala Thr Glu 165 170 175

Leu Ala Leu Ser Gly Gln Thr Ala Thr Arg Val Leu Val Phe Asp His 180 185 190 2022205243

His Arg Gln Val Asp Ala His Arg Ala Ala Val Glu Ser Ala Arg Glu 195 200 205

Arg Leu Ala Gly Ser Ala Val Val Glu Thr Leu Ala Glu Ala Ile Ala 210 215 220

Arg Gly Asp Val Pro Arg Gly Ala Ser Ala Gly Ser Ala Pro Gly Thr 225 230 235 240

Asp Val Ser Asp Asp Ser Leu Ala Leu Leu Ile Tyr Thr Ser Gly Ser 245 250 255

Thr Gly Ala Pro Lys Gly Ala Met Tyr Pro Arg Arg Asn Val Ala Thr 260 265 270

Phe Trp Arg Lys Arg Thr Trp Phe Glu Gly Gly Tyr Glu Pro Ser Ile 275 280 285

Thr Leu Asn Phe Met Pro Met Ser His Val Met Gly Arg Gln Ile Leu 290 295 300

Tyr Gly Thr Leu Cys Asn Gly Gly Thr Ala Tyr Phe Val Ala Lys Ser 305 310 315 320

Asp Leu Ser Thr Leu Phe Glu Asp Leu Ala Leu Val Arg Pro Thr Glu 325 330 335

Leu Thr Phe Val Pro Arg Val Trp Asp Met Val Phe Asp Glu Phe Gln 340 345 350

Ser Glu Val Asp Arg Arg Leu Val Asp Gly Ala Asp Arg Val Ala Leu 355 360 365

Glu Ala Gln Val Lys Ala Glu Ile Arg Asn Asp Val Leu Gly Gly Arg 370 375 380

Tyr Thr Ser Ala Leu Thr Gly Ser Ala Pro Ile Ser Asp Glu Met Lys 385 390 395 400

Ala Trp Val Glu Glu Leu Leu Asp Met His Leu Val Glu Gly Tyr Gly 405 410 415

Page 92

12956-144-228_SEQLIST.TXT 14 Jul 2022

Ser Thr Glu Ala Gly Met Ile Leu Ile Asp Gly Ala Ile Arg Arg Pro 420 425 430

Ala Val Leu Asp Tyr Lys Leu Val Asp Val Pro Asp Leu Gly Tyr Phe 435 440 445

Leu Thr Asp Arg Pro His Pro Arg Gly Glu Leu Leu Val Lys Thr Asp 450 455 460 2022205243

Ser Leu Phe Pro Gly Tyr Tyr Gln Arg Ala Glu Val Thr Ala Asp Val 465 470 475 480

Phe Asp Ala Asp Gly Phe Tyr Arg Thr Gly Asp Ile Met Ala Glu Val 485 490 495

Gly Pro Glu Gln Phe Val Tyr Leu Asp Arg Arg Asn Asn Val Leu Lys 500 505 510

Leu Ser Gln Gly Glu Phe Val Thr Val Ser Lys Leu Glu Ala Val Phe 515 520 525

Gly Asp Ser Pro Leu Val Arg Gln Ile Tyr Ile Tyr Gly Asn Ser Ala 530 535 540

Arg Ala Tyr Leu Leu Ala Val Ile Val Pro Thr Gln Glu Ala Leu Asp 545 550 555 560

Ala Val Pro Val Glu Glu Leu Lys Ala Arg Leu Gly Asp Ser Leu Gln 565 570 575

Glu Val Ala Lys Ala Ala Gly Leu Gln Ser Tyr Glu Ile Pro Arg Asp 580 585 590

Phe Ile Ile Glu Thr Thr Pro Trp Thr Leu Glu Asn Gly Leu Leu Thr 595 600 605

Gly Ile Arg Lys Leu Ala Arg Pro Gln Leu Lys Lys His Tyr Gly Glu 610 615 620

Leu Leu Glu Gln Ile Tyr Thr Asp Leu Ala His Gly Gln Ala Asp Glu 625 630 635 640

Leu Arg Ser Leu Arg Gln Ser Gly Ala Asp Ala Pro Val Leu Val Thr 645 650 655

Val Cys Arg Ala Ala Ala Ala Leu Leu Gly Gly Ser Ala Ser Asp Val 660 665 670

Gln Pro Asp Ala His Phe Thr Asp Leu Gly Gly Asp Ser Leu Ser Ala 675 680 685

Page 93

12956-144-228_SEQLIST.TXT 14 Jul 2022

Leu Ser Phe Thr Asn Leu Leu His Glu Ile Phe Asp Ile Glu Val Pro 690 695 700

Val Gly Val Ile Val Ser Pro Ala Asn Asp Leu Gln Ala Leu Ala Asp 705 710 715 720

Tyr Val Glu Ala Ala Arg Lys Pro Gly Ser Ser Arg Pro Thr Phe Ala 725 730 735 2022205243

Ser Val His Gly Ala Ser Asn Gly Gln Val Thr Glu Val His Ala Gly 740 745 750

Asp Leu Ser Leu Asp Lys Phe Ile Asp Ala Ala Thr Leu Ala Glu Ala 755 760 765

Pro Arg Leu Pro Ala Ala Asn Thr Gln Val Arg Thr Val Leu Leu Thr 770 775 780

Gly Ala Thr Gly Phe Leu Gly Arg Tyr Leu Ala Leu Glu Trp Leu Glu 785 790 795 800

Arg Met Asp Leu Val Asp Gly Lys Leu Ile Cys Leu Val Arg Ala Lys 805 810 815

Ser Asp Thr Glu Ala Arg Ala Arg Leu Asp Lys Thr Phe Asp Ser Gly 820 825 830

Asp Pro Glu Leu Leu Ala His Tyr Arg Ala Leu Ala Gly Asp His Leu 835 840 845

Glu Val Leu Ala Gly Asp Lys Gly Glu Ala Asp Leu Gly Leu Asp Arg 850 855 860

Gln Thr Trp Gln Arg Leu Ala Asp Thr Val Asp Leu Ile Val Asp Pro 865 870 875 880

Ala Ala Leu Val Asn His Val Leu Pro Tyr Ser Gln Leu Phe Gly Pro 885 890 895

Asn Ala Leu Gly Thr Ala Glu Leu Leu Arg Leu Ala Leu Thr Ser Lys 900 905 910

Ile Lys Pro Tyr Ser Tyr Thr Ser Thr Ile Gly Val Ala Asp Gln Ile 915 920 925

Pro Pro Ser Ala Phe Thr Glu Asp Ala Asp Ile Arg Val Ile Ser Ala 930 935 940

Thr Arg Ala Val Asp Asp Ser Tyr Ala Asn Gly Tyr Ser Asn Ser Lys 945 950 955 960

Page 94

12956-144-228_SEQLIST.TXT 14 Jul 2022

Trp Ala Gly Glu Val Leu Leu Arg Glu Ala His Asp Leu Cys Gly Leu 965 970 975

Pro Val Ala Val Phe Arg Cys Asp Met Ile Leu Ala Asp Thr Thr Trp 980 985 990

Ala Gly Gln Leu Asn Val Pro Asp Met Phe Thr Arg Met Ile Leu Ser 995 1000 1005 2022205243

Leu Ala Ala Thr Gly Ile Ala Pro Gly Ser Phe Tyr Glu Leu Ala 1010 1015 1020

Ala Asp Gly Ala Arg Gln Arg Ala His Tyr Asp Gly Leu Pro Val 1025 1030 1035

Glu Phe Ile Ala Glu Ala Ile Ser Thr Leu Gly Ala Gln Ser Gln 1040 1045 1050

Asp Gly Phe His Thr Tyr His Val Met Asn Pro Tyr Asp Asp Gly 1055 1060 1065

Ile Gly Leu Asp Glu Phe Val Asp Trp Leu Asn Glu Ser Gly Cys 1070 1075 1080

Pro Ile Gln Arg Ile Ala Asp Tyr Gly Asp Trp Leu Gln Arg Phe 1085 1090 1095

Glu Thr Ala Leu Arg Ala Leu Pro Asp Arg Gln Arg His Ser Ser 1100 1105 1110

Leu Leu Pro Leu Leu His Asn Tyr Arg Gln Pro Glu Arg Pro Val 1115 1120 1125

Arg Gly Ser Ile Ala Pro Thr Asp Arg Phe Arg Ala Ala Val Gln 1130 1135 1140

Glu Ala Lys Ile Gly Pro Asp Lys Asp Ile Pro His Val Gly Ala 1145 1150 1155

Pro Ile Ile Val Lys Tyr Val Ser Asp Leu Arg Leu Leu Gly Leu 1160 1165 1170

Leu

<210> 100 <211> 3522 <212> DNA <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic carboxylic acid reductase polynucleotide designated 891GA Page 95

12956-144-228_SEQLIST.TXT 14 Jul 2022

<400> 100 atgagcaccg caacccatga tgaacgtctg gatcgtcgtg ttcatgaact gattgcaacc 60 gatccgcagt ttgcagcagc acagccggat cctgcaatta ccgcagcact ggaacagcct 120

ggtctgcgtc tgccgcagat tattcgtacc gttctggatg gttatgcaga tcgtccggca 180 ctgggtcagc gtgttgttga atttgttacc gatgcaaaaa ccggtcgtac cagcgcacag 240 ctgctgcctc gttttgaaac cattacctat agcgaagttg cacagcgtgt tagcgcactg 300 2022205243

ggtcgtgcac tgagtgatga tgcagttcat ccgggtgatc gtgtttgtgt tctgggtttt 360 aatagcgttg attatgccac cattgatatg gcactgggtg caattggtgc agttagcgtt 420

ccgctgcaga ccagcgcagc aattagcagc ctgcagccga ttgttgcaga aaccgaaccg 480 accctgattg caagcagcgt taatcagctg tcagatgcag ttcagctgat taccggtgca 540

gaacaggcac cgacccgtct ggttgttttt gattatcatc cgcaggttga tgatcagcgt 600 gaagcagttc aggatgcagc agcacgtctg agcagcaccg gtgttgcagt tcagaccctg 660 gcagaactgc tggaacgtgg taaagatctg cctgcagttg cagaaccgcc tgcagatgaa 720

gatagcctgg cactgctgat ttataccagc ggtagcacag gtgcaccgaa aggtgcaatg 780

tatccgcaga gcaatgttgg taaaatgtgg cgtcgtggta gcaaaaattg gtttggtgaa 840

agcgcagcaa gcattaccct gaatttcatg ccgatgagcc atgttatggg tcgtagcatt 900 ctgtatggca ccctgggtaa tggtggcacc gcatattttg cagcacgtag cgatctgagc 960

accctgctgg aagatctgga actggttcgt ccgaccgaac tgaattttgt tccgcgtatt 1020

tgggaaaccc tgtatggtga atttcagcgt caggttgaac gtcgtctgag cgaagctggc 1080

gatgccggtg aacgtcgtgc agttgaagca gaagttctgg cagaacagcg tcagtatctg 1140 ctgggtggtc gttttacctt tgcaatgacc ggtagcgcac cgattagtcc ggaactgcgt 1200

aattgggttg aaagcctgct ggaaatgcat ctgatggatg gctatggtag caccgaagca 1260

ggtatggttc tgtttgatgg cgaaattcag cgtccgcctg tgattgatta taaactggtt 1320

gatgttccgg atctgggtta ttttagcacc gatcgtccgc atccgcgtgg tgaactgctg 1380 ctgcgtaccg aaaatatgtt tccgggttat tataaacgtg cagaaaccac cgcaggcgtt 1440

tttgatgaag atggttatta tcgtaccggt gatgtgtttg cagaaattgc accggatcgt 1500 ctggtttatg ttgatcgtcg taataatgtt ctgaaactgg cacagggtga atttgtgacc 1560

ctggccaaac tggaagcagt ttttggtaat agtccgctga ttcgtcagat ttatgtgtat 1620 ggtaatagcg cacagccgta tctgctggca gttgttgttc cgaccgaaga ggcactggca 1680

agcggtgatc cggaaaccct gaaaccgaaa attgcagata gcctgcagca ggttgcaaaa 1740 gaagcaggtc tgcagagcta tgaagttccg cgtgatttta ttattgaaac caccccgttt 1800 agcctggaaa atggtctgct gaccggtatt cgtaaactgg catggccgaa actgaaacag 1860

cattatggtg aacgcctgga acaaatgtat gcagatctgg cagcaggtca ggcaaatgaa 1920 ctggccgaac tgcgtcgtaa tggtgcacag gcaccggttc tgcagaccgt tagccgtgca 1980

Page 96

12956-144-228_SEQLIST.TXT 14 Jul 2022

gccggtgcaa tgctgggtag cgcagccagc gatctgagtc cggatgcaca ttttaccgat 2040 ctgggtggtg atagcctgag cgcactgacc tttggtaatc tgctgcgtga aatttttgat 2100 gttgatgtgc cggttggtgt tattgttagt ccggctaatg atctggcagc cattgcaagc 2160

tatattgaag cagaacgtca gggtagcaaa cgtccgacct ttgcaagcgt tcatggtcgt 2220 gatgcaaccg ttgttcgtgc agcagatctg accctggata aatttctgga tgcagaaacc 2280 ctggcagcag caccgaatct gccgaaaccg gcaaccgaag ttcgtaccgt gctgctgaca 2340 2022205243

ggtgcaaccg gttttctggg tcgttatctg gcactggaat ggctggaacg tatggatatg 2400 gttgatggta aagttattgc actggttcgt gcccgtagtg atgaagaagc acgcgcacgt 2460

ctggataaaa cctttgatag tggtgatccg aaactgctgg cacattatca gcagctggct 2520 gcagatcatc tggaagttat tgccggtgat aaaggtgaag caaatctggg tctgggtcag 2580

gatgtttggc agcgtctggc agataccgtt gatgttattg tggatccggc agcactggtt 2640 aatcatgttc tgccgtatag cgaactgttt ggtccgaatg cactgggcac cgcagaactg 2700 attcgtctgg cactgaccag caaacagaaa ccgtatacct atgttagcac cattggtgtt 2760

ggcgatcaga ttgaaccggg taaatttgtt gaaaatgccg atattcgtca gatgagcgca 2820

acccgtgcaa ttaatgatag ctatgcaaat ggctacggca atagcaaatg ggcaggcgaa 2880

gttctgctgc gcgaagcaca tgatctgtgt ggtctgccgg ttgcagtttt tcgttgtgat 2940 atgattctgg ccgataccac ctatgcaggt cagctgaatc tgccggatat gtttacccgt 3000

ctgatgctga gcctggttgc aaccggtatt gcaccgggta gcttttatga actggatgca 3060

gatggtaatc gtcagcgtgc acattatgat ggcctgccgg ttgaatttat tgcagcagcc 3120

attagcaccc tgggttcaca gattaccgat agcgataccg gttttcagac ctatcatgtt 3180 atgaacccgt atgatgatgg tgttggtctg gatgaatatg ttgattggct ggttgatgcc 3240

ggttatagca ttgaacgtat tgcagattat agcgaatggc tgcgtcgctt tgaaacctca 3300

ctgcgtgcac tgccggatcg tcagcgccag tatagcctgc tgccgctgct gcacaattat 3360

cgtacaccgg aaaaaccgat taatggtagc attgcaccga ccgatgtttt tcgtgcagcc 3420 gttcaagaag ccaaaattgg tccggataaa gatattccgc atgttagccc tccggtgatt 3480

gttaaatata ttaccgatct gcagctgctg ggtctgctgt aa 3522

<210> 101 <211> 1173 <212> PRT <213> Artificial Sequence

<220> <223> Description of Artificial Sequence: Synthetic carboxylic acid reductase polypeptide designated 891GA <400> 101 Met Ser Thr Ala Thr His Asp Glu Arg Leu Asp Arg Arg Val His Glu 1 5 10 15

Page 97

12956-144-228_SEQLIST.TXT 14 Jul 2022

Leu Ile Ala Thr Asp Pro Gln Phe Ala Ala Ala Gln Pro Asp Pro Ala 20 25 30

Ile Thr Ala Ala Leu Glu Gln Pro Gly Leu Arg Leu Pro Gln Ile Ile 35 40 45

Arg Thr Val Leu Asp Gly Tyr Ala Asp Arg Pro Ala Leu Gly Gln Arg 50 55 60 2022205243

Val Val Glu Phe Val Thr Asp Ala Lys Thr Gly Arg Thr Ser Ala Gln 65 70 75 80

Leu Leu Pro Arg Phe Glu Thr Ile Thr Tyr Ser Glu Val Ala Gln Arg 85 90 95

Val Ser Ala Leu Gly Arg Ala Leu Ser Asp Asp Ala Val His Pro Gly 100 105 110

Asp Arg Val Cys Val Leu Gly Phe Asn Ser Val Asp Tyr Ala Thr Ile 115 120 125

Asp Met Ala Leu Gly Ala Ile Gly Ala Val Ser Val Pro Leu Gln Thr 130 135 140

Ser Ala Ala Ile Ser Ser Leu Gln Pro Ile Val Ala Glu Thr Glu Pro 145 150 155 160

Thr Leu Ile Ala Ser Ser Val Asn Gln Leu Ser Asp Ala Val Gln Leu 165 170 175

Ile Thr Gly Ala Glu Gln Ala Pro Thr Arg Leu Val Val Phe Asp Tyr 180 185 190

His Pro Gln Val Asp Asp Gln Arg Glu Ala Val Gln Asp Ala Ala Ala 195 200 205

Arg Leu Ser Ser Thr Gly Val Ala Val Gln Thr Leu Ala Glu Leu Leu 210 215 220

Glu Arg Gly Lys Asp Leu Pro Ala Val Ala Glu Pro Pro Ala Asp Glu 225 230 235 240

Asp Ser Leu Ala Leu Leu Ile Tyr Thr Ser Gly Ser Thr Gly Ala Pro 245 250 255

Lys Gly Ala Met Tyr Pro Gln Ser Asn Val Gly Lys Met Trp Arg Arg 260 265 270

Gly Ser Lys Asn Trp Phe Gly Glu Ser Ala Ala Ser Ile Thr Leu Asn 275 280 285

Page 98

12956-144-228_SEQLIST.TXT 14 Jul 2022

Phe Met Pro Met Ser His Val Met Gly Arg Ser Ile Leu Tyr Gly Thr 290 295 300

Leu Gly Asn Gly Gly Thr Ala Tyr Phe Ala Ala Arg Ser Asp Leu Ser 305 310 315 320

Thr Leu Leu Glu Asp Leu Glu Leu Val Arg Pro Thr Glu Leu Asn Phe 325 330 335 2022205243

Val Pro Arg Ile Trp Glu Thr Leu Tyr Gly Glu Phe Gln Arg Gln Val 340 345 350

Glu Arg Arg Leu Ser Glu Ala Gly Asp Ala Gly Glu Arg Arg Ala Val 355 360 365

Glu Ala Glu Val Leu Ala Glu Gln Arg Gln Tyr Leu Leu Gly Gly Arg 370 375 380

Phe Thr Phe Ala Met Thr Gly Ser Ala Pro Ile Ser Pro Glu Leu Arg 385 390 395 400

Asn Trp Val Glu Ser Leu Leu Glu Met His Leu Met Asp Gly Tyr Gly 405 410 415

Ser Thr Glu Ala Gly Met Val Leu Phe Asp Gly Glu Ile Gln Arg Pro 420 425 430

Pro Val Ile Asp Tyr Lys Leu Val Asp Val Pro Asp Leu Gly Tyr Phe 435 440 445

Ser Thr Asp Arg Pro His Pro Arg Gly Glu Leu Leu Leu Arg Thr Glu 450 455 460

Asn Met Phe Pro Gly Tyr Tyr Lys Arg Ala Glu Thr Thr Ala Gly Val 465 470 475 480

Phe Asp Glu Asp Gly Tyr Tyr Arg Thr Gly Asp Val Phe Ala Glu Ile 485 490 495

Ala Pro Asp Arg Leu Val Tyr Val Asp Arg Arg Asn Asn Val Leu Lys 500 505 510

Leu Ala Gln Gly Glu Phe Val Thr Leu Ala Lys Leu Glu Ala Val Phe 515 520 525

Gly Asn Ser Pro Leu Ile Arg Gln Ile Tyr Val Tyr Gly Asn Ser Ala 530 535 540

Gln Pro Tyr Leu Leu Ala Val Val Val Pro Thr Glu Glu Ala Leu Ala 545 550 555 560

Page 99

12956-144-228_SEQLIST.TXT 14 Jul 2022

Ser Gly Asp Pro Glu Thr Leu Lys Pro Lys Ile Ala Asp Ser Leu Gln 565 570 575

Gln Val Ala Lys Glu Ala Gly Leu Gln Ser Tyr Glu Val Pro Arg Asp 580 585 590

Phe Ile Ile Glu Thr Thr Pro Phe Ser Leu Glu Asn Gly Leu Leu Thr 595 600 605 2022205243

Gly Ile Arg Lys Leu Ala Trp Pro Lys Leu Lys Gln His Tyr Gly Glu 610 615 620

Arg Leu Glu Gln Met Tyr Ala Asp Leu Ala Ala Gly Gln Ala Asn Glu 625 630 635 640

Leu Ala Glu Leu Arg Arg Asn Gly Ala Gln Ala Pro Val Leu Gln Thr 645 650 655

Val Ser Arg Ala Ala Gly Ala Met Leu Gly Ser Ala Ala Ser Asp Leu 660 665 670

Ser Pro Asp Ala His Phe Thr Asp Leu Gly Gly Asp Ser Leu Ser Ala 675 680 685

Leu Thr Phe Gly Asn Leu Leu Arg Glu Ile Phe Asp Val Asp Val Pro 690 695 700

Val Gly Val Ile Val Ser Pro Ala Asn Asp Leu Ala Ala Ile Ala Ser 705 710 715 720

Tyr Ile Glu Ala Glu Arg Gln Gly Ser Lys Arg Pro Thr Phe Ala Ser 725 730 735

Val His Gly Arg Asp Ala Thr Val Val Arg Ala Ala Asp Leu Thr Leu 740 745 750

Asp Lys Phe Leu Asp Ala Glu Thr Leu Ala Ala Ala Pro Asn Leu Pro 755 760 765

Lys Pro Ala Thr Glu Val Arg Thr Val Leu Leu Thr Gly Ala Thr Gly 770 775 780

Phe Leu Gly Arg Tyr Leu Ala Leu Glu Trp Leu Glu Arg Met Asp Met 785 790 795 800

Val Asp Gly Lys Val Ile Ala Leu Val Arg Ala Arg Ser Asp Glu Glu 805 810 815

Ala Arg Ala Arg Leu Asp Lys Thr Phe Asp Ser Gly Asp Pro Lys Leu 820 825 830

Page 100

12956-144-228_SEQLIST.TXT 14 Jul 2022

Leu Ala His Tyr Gln Gln Leu Ala Ala Asp His Leu Glu Val Ile Ala 835 840 845

Gly Asp Lys Gly Glu Ala Asn Leu Gly Leu Gly Gln Asp Val Trp Gln 850 855 860

Arg Leu Ala Asp Thr Val Asp Val Ile Val Asp Pro Ala Ala Leu Val 865 870 875 880 2022205243

Asn His Val Leu Pro Tyr Ser Glu Leu Phe Gly Pro Asn Ala Leu Gly 885 890 895

Thr Ala Glu Leu Ile Arg Leu Ala Leu Thr Ser Lys Gln Lys Pro Tyr 900 905 910

Thr Tyr Val Ser Thr Ile Gly Val Gly Asp Gln Ile Glu Pro Gly Lys 915 920 925

Phe Val Glu Asn Ala Asp Ile Arg Gln Met Ser Ala Thr Arg Ala Ile 930 935 940

Asn Asp Ser Tyr Ala Asn Gly Tyr Gly Asn Ser Lys Trp Ala Gly Glu 945 950 955 960

Val Leu Leu Arg Glu Ala His Asp Leu Cys Gly Leu Pro Val Ala Val 965 970 975

Phe Arg Cys Asp Met Ile Leu Ala Asp Thr Thr Tyr Ala Gly Gln Leu 980 985 990

Asn Leu Pro Asp Met Phe Thr Arg Leu Met Leu Ser Leu Val Ala Thr 995 1000 1005

Gly Ile Ala Pro Gly Ser Phe Tyr Glu Leu Asp Ala Asp Gly Asn 1010 1015 1020

Arg Gln Arg Ala His Tyr Asp Gly Leu Pro Val Glu Phe Ile Ala 1025 1030 1035

Ala Ala Ile Ser Thr Leu Gly Ser Gln Ile Thr Asp Ser Asp Thr 1040 1045 1050

Gly Phe Gln Thr Tyr His Val Met Asn Pro Tyr Asp Asp Gly Val 1055 1060 1065

Gly Leu Asp Glu Tyr Val Asp Trp Leu Val Asp Ala Gly Tyr Ser 1070 1075 1080

Ile Glu Arg Ile Ala Asp Tyr Ser Glu Trp Leu Arg Arg Phe Glu 1085 1090 1095

Page 101

12956-144-228_SEQLIST.TXT 14 Jul 2022

Thr Ser Leu Arg Ala Leu Pro Asp Arg Gln Arg Gln Tyr Ser Leu 1100 1105 1110

Leu Pro Leu Leu His Asn Tyr Arg Thr Pro Glu Lys Pro Ile Asn 1115 1120 1125

Gly Ser Ile Ala Pro Thr Asp Val Phe Arg Ala Ala Val Gln Glu 1130 1135 1140 2022205243

Ala Lys Ile Gly Pro Asp Lys Asp Ile Pro His Val Ser Pro Pro 1145 1150 1155

Val Ile Val Lys Tyr Ile Thr Asp Leu Gln Leu Leu Gly Leu Leu 1160 1165 1170

Page 102

Claims

The claims defining the invention are as follows:

1. A non-naturally occurring microbial organism, comprising a microbial organism having a 1,4-butanediol pathway comprising at least one exogenous nucleic acid encoding a 1,4 butanediol pathway enzyme expressed in a sufficient amount to produce 1,4-butanediol; said non-naturally occurring microbial organism further comprising:

(i) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from an ATP-citrate lyase, a citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, a fumarate reductase, isocitrate dehydrogenase, and an alpha-ketoglutarate:ferredoxin oxidoreductase;

(ii) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from a pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an H 2 hydrogenase; or

(iii) at least one exogenous nucleic acid encodes an enzyme selected from a CO dehydrogenase, an H 2 hydrogenase, and combinations thereof;

wherein said 1,4-butanediol pathway comprises a pathway selected from:

(a) 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, and a-ketoglutarate decarboxylase;

(b) 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-butyrate kinase, phosphotransbutyrylase, a-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase and an aldehyde/alcohol dehydrogenase;

(c) (i) an a-ketoglutarate decarboxylase, or an a-ketoglutarate dehydrogenase and a CoA dependent succinic semialdehyde dehydrogenase, or a glutamate:succinate semialdehyde transaminase and a glutamate decarboxylase; (ii) a 4-hydroxybutanoate dehydrogenase; (iii) a 4-hydroxybutyryl-CoA:acetyl-CoA transferase, or a butyrate kinase and a phosphotransbutyrylase; (iv) an aldehyde dehydrogenase; and (v) an alcohol dehydrogenase;

(d) 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, and 4-hydroxybutyryl-CoA dehydrogenase;

(e) 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4 aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating) and 4 aminobutan-1-ol transaminase;

(f) 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4 aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4 aminobutan-1-ol transaminase, [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4-aminobutanolyl)oxy]phosphonic acid transaminase, 4-hydroxybutyryl phosphate dehydrogenase, and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating);

(g) alpha-ketoglutarate 5-kinase, 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha-ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2-oxopentanoic acid decarboxylase, and 5-hydroxy-2 oxopentanoic acid dehydrogenase (decarboxylation);

(h) glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5 kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl-CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5 hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(i) 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl CoA A-isomerase, or 4-hydroxybutyryl-CoA dehydratase;

(j) homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase, 4- hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase;

(k) succinyl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA hydrolase, 4 hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating);

(1) glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4 aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4 hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating);

(m) 4-aminobutyrate kinase; 4-aminobutyraldehyde dehydrogenase (phosphorylating); 4 aminobutan-1-ol dehydrogenase; and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4 aminobutan-1-ol transaminase;

(n) 4-aminobutyrate kinase; [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating) or [(4-aminobutanolyl)oxy]phosphonic acid transaminase; 4-hydroxybutyryl phosphate dehydrogenase; and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating);

(o) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5 hydroxy-2-oxopentanoic acid decarboxylase;

(p) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(q) alpha-ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid decarboxylase;

(r) alpha-ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(s) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase; 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid decarboxylase;

(t) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase; 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(u) glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl CoA reductase (alcohol forming); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2 oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(v) glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); 2 amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5 hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(w) glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl CoA reductase; glutamate-5-semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5 hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(x) glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); glutamate-5-semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2 oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(y) homoserine deaminase; 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase; 4-hydroxybut-2-enoyl-CoA reductase;

(z) homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4-hydroxybut-2-enoyl-CoA reductase;

(aa) homoserine deaminase; 4-hydroxybut-2-enoate reductase; and 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4-hydroxybutyryl-CoA ligase;

(bb) (i) alpha-ketoglutarate decarboxylase; or alpha-ketoglutarate dehydrogenase and CoA dependent succinate semialdehyde dehydrogenase; or glutamate:succinate semialdehyde transaminase and glutamate decarboxylase; (ii) 4-hydroxybutyrate dehydrogenase; (iii) 4 hydroxybutyryl-CoA transferase; or 4-hydroxybutyrate kinase and phosphotrans-4 hydroxybutyrylase; (iv) 4-hydroxybutyryl-CoA reductase; and (v) 4-hydroxybutyraldehyde reductase; or aldehyde/alcohol dehydrogenase;

(cc) (i) alpha-ketoglutarate decarboxylase; or succinyl-CoA synthetase and CoA-dependent succinate semialdehyde dehydrogenase; (ii) 4-hydroxybutyrate dehydrogenase; (iii) 4 hydroxybutyryl-CoA transferase; or 4-hydroxybutyrate kinase and phosphotrans-4 hydroxybutyrylase; and (iv) aldehyde dehydrogenase; and alcohol dehydrogenase; or aldehyde/alcohol dehydrogenase;

(dd) (i) alpha-ketoglutarate decarboxylase; or glutamate dehydrogenase; glutamate decarboxylase; and deaminating 4-aminobutyrate oxidoreductase or 4-aminobutyrate transaminase; or alpha-ketoglutarate dehydrogenase and CoA-dependent succinate semialdehyde dehydrogenase; (ii) 4-hydroxybutyrate dehydrogenase; and (iii) 4 hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; 4-hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase; or 4-hydroxybutyrate kinase; phosphorylating 4-hydroxybutanal dehydrogenase; and 4-hydroxybutyraldehyde reductase; or 4-hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; and alcohol forming 4 hydroxybutyryl-CoA reductase; or 4-hydroxybutyryl-CoA transferase or 4-hydroxybutyryl CoA hydrolase or 4-hydroxybutyryl-CoA ligase; 4-hydroxybutyryl-CoA reductase; and 4 hydroxybutyraldehyde reductase; or 4-hydroxybutyryl-CoA transferase or 4-hydroxybutyryl CoA hydrolase or 4-hydroxybutyryl-CoA ligase; and alcohol forming 4-hydroxybutyryl-CoA reductase;

(ee) (i) glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase; glutamyl-CoA reductase; and glutamate-5-semialdehyde reductase; or glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase; and alcohol forming glutamyl-CoA reductase; or glutamate 5-kinase; phosphorylating glutamate-5-semialdehyde dehydrogenase; and glutamate-5-semialdehyde reductase; (ii) deaminating 2-amino-5 hydroxypentanoic acid oxidoreductase or 2-amino-5-hydroxypentanoic acid transaminase; and (iii) 5-hydroxy-2-oxopentanoic acid decarboxylase; and 4-hydroxybutyraldehyde reductase; or decarboxylating 5-hydroxy-2-oxopentanoic acid dehydrogenase; 4 hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase; or decarboxylating

-hydroxy-2-oxopentanoic acid dehydrogenase and alcohol forming 4-hydroxybutyryl-CoA reductase;

(ff) succinyl-CoA reductase (aldehyde forming); 4-hydroxybutyrate dehydrogenase; and 4 hydroxybutyrate reductase; and optionally 1,4-butandiol dehydrogenase;

(gg) alpha-ketoglutarate decarboxylase; 4-hydroxybutyrate dehydrogenase; and 4 hydroxybutyrate reductase; and optionally 1,4-butandiol dehydrogenase;

(hh) succinate reductase; 4-hydroxybutyrate dehydrogenase, and 4-hydroxybutyrate reductase; and optionally 1,4-butandiol dehydrogenase;

(ii) alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase or glutamate transaminase and glutamate decarboxylase and 4-aminobutyrate dehydrogenase or 4 aminobutyrate transaminase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase; and optionally 1,4-butandiol dehydrogenase;

(jj) alpha-ketoglutarate reductase; 5-hydroxy-2-oxopentanoate dehydrogenase; and 5 hydroxy-2-oxopentanoate decarboxylase; and optionally 1,4-butandiol dehydrogenase;

(kk) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; and 4-hydroxybutyryl-CoA reductase (alcohol forming);

(11) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; 4-hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(mm) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; 4-Hydroxybutyryl-CoA transferase, 4 Hydroxybutyryl-CoA synthetase, 4-Hydroxybutyryl-CoA hydrolase, or Phosphotrans-4 hydroxybutyrylase/4-Hydroxybutyrate kinase; 4-Hydroxybutyrate reductase; and 1,4 butanediol dehydrogenase;

(nn) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylasel; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(oo) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; 4 Hydroxybutyryl-phosphate reductase; and 1,4-butanediol dehydrogenase;

(pp) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase;

(qq) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming);

(rr) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(ss) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming);

(tt) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(uu) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate kinase; 4-Hydroxybutyryl-phosphate reductase; and 1,4-butanediol dehydrogenase;

(vv) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase;

(ww) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4 Hydroxybutyryl-CoA reductase (alcohol forming);

(xx) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(yy) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming);

(zz) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(aaa) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; 4-Hydroxybutyryl-phosphate reductase; and 1,4-butanediol dehydrogenase;

(bbb) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase;

(ccc) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming);

(ddd) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(eee) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming);

(ff) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate kinase; Phosphotrans-4 hydroxybutyrylase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(ggg) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate kinase; 4-Hydroxybutyryl phosphate reductase; and 1,4-butanediol dehydrogenase;

(hhh) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate reductase; and 1,4-butanediol dehydrogenase;

(iii) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyryl-CoA transferase, or 4 Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming);

(jjj) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyryl-CoA transferase, or 4 Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl-CoA reductase (aldehyde forming); and 1,4-butanediol dehydrogenase;

(kkk) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate kinase; Phosphotrans-4 hydroxybutyrylase; and 4-Hydroxybutyryl-CoA reductase (alcohol forming); and

(111) any of the pathways that produce 1,4-butanediol as shown in any of Figures 1, 8-13, 58, 62, 63 or 72-74.

2. The non-naturally occurring microbial organism of claim 1, wherein said microbial organism comprising (i) further comprises an exogenous nucleic acid encoding an enzyme selected from a pyruvate:ferredoxin oxidoreductase, an aconitase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, an acetate kinase, a phosphotransacetylase, an acetyl-CoA synthetase, an NAD(P)H:ferredoxin oxidoreductase, ferredoxin, and combinations thereof.

3. The non-naturally occurring microbial organism of claim 1, wherein said microbial organism comprising (ii) further comprises an exogenous nucleic acid encoding an enzyme selected from an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, NAD(P):ferredoxin oxidoreductase, ferredoxin, and combinations thereof.

4. The non-naturally occurring microbial organism of claim 1, wherein said microbial organism comprising (iii) further comprises an exogenous nucleic acid encoding an enzyme selected from NAD(P):ferredoxin oxidoreductase and ferredoxin.

5. The non-naturally occurring microbial organism of claim 1, wherein said microbial organism comprises two, three, four, five, six or seven exogenous nucleic acids each encoding a 1,4-butanediol pathway enzyme.

6. The non-naturally occurring microbial organism of claim 5, wherein said microbial organism comprises exogenous nucleic acids encoding each of the enzymes of a respective pathway in any of the pathways of (a)-(lll).

7. The non-naturally occurring microbial organism of claim 1, wherein said microbial organism:

(i) comprising pathways (a), (b) or (c) further comprises an enzyme selected from succinyl CoA synthetase, exogenous CoA-dependent succinic semialdehyde dehydrogenase or exogenous succinyl-CoA synthetase and exogenous CoA-dependent succinic semialdehyde dehydrogenase;

(ii) comprising pathway (d), (g), (h), (i), () further comprises an enzyme selected from 4 hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4 butanediol dehydrogenase;

(iii) comprising pathway (e) or (f) further comprises 1,4-butanediol dehydrogenase;

(iv) comprising pathway (k) further comprises succinyl-CoA reductase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans 4-hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase;

(v) comprising pathway (1) further comprises alpha-ketoglutarate decarboxylase, 4 hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4 hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

8. The non-naturally occurring microbial organism of claim 1, wherein said microbial organism comprises two, three, four or five exogenous nucleic acids each encoding enzymes

of (i), (ii) or (iii).

9. The non-naturally occurring microbial orgnaism of claim 8, wherein said microbial organism comprising (i) comprises three exogenous nucleic acids encoding ATP-citrate lyase or citrate lyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase;

wherein said microbial organism comprising (ii) comprises five exogenous nucleic acids encoding pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an H 2 hydrogenase; or

wherein said microbial organism comprising (iii) comprises two exogenous nucleic acids encoding CO dehydrogenase and H 2 hydrogenase.

10. The non-naturally occurring microbial organism of claim 1, wherein said at least one exogenous nucleic acid is a heterologous nucleic acid, or wherein said non-naturally occurring microbial organism is in a substantially anaerobic culture medium.

11. A method for producing 1,4-butanediol, comprising culturing the non-naturally occurring microbial organism of any of claims 1-10 under conditions and for a sufficient period of time to produce 1,4-butanediol.

12. A non-naturally occurring microbial organism, comprising a microbial organism having a 4-hydroxybutyrate pathway comprising at least one exogenous nucleic acid encoding a 4- hydroxybutyrate pathway enzyme 4-hydroxybutyrate expressed in a sufficient amount to produce 4-hydroxybutyrate; said non-naturally occurring microbial organism further comprising:

(i) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from an ATP-citrate lyase, citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, a fumarate reductase, isocitrate dehydrogenase and an alpha-ketoglutarate:ferredoxin oxidoreductase;

(a) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; and 4-Hydroxybutyryl-CoA transferase, 4-Hydroxybutyryl-CoA synthetase, 4-Hydroxybutyryl-CoA hydrolase, or Phosphotrans-4 hydroxybutyrylase/4-Hydroxybutyrate kinase;

(b) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; and 4-Hydroxybutyryl-CoA transferase, hydrolase or synthetase;

(c) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyrate kinase;

(d) Succinate reductase; and 4-Hydroxybutyrate dehydrogenase;

(e) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); and 4-Hydroxybutyrate dehydrogenase;

(f) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); and 4-Hydroxybutyrate dehydrogenase;

(g) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); and Succinyl-CoA reductase (alcohol forming);

(h) acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase, a 3-hydroxybutyryl-CoA dehydrogenase, a crotonase, a crotonyl-CoA hydratase, a 4-hydroxybutyryl-CoA transferase, a phosphotrans-4-hydroxybutyrylase, and a 4-hydroxybutyrate kinase.

(i) 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, and a-ketoglutarate decarboxylase;

(j) (i) an a-ketoglutarate decarboxylase, or an a-ketoglutarate dehydrogenase and a CoA dependent succinic semialdehyde dehydrogenase, or a glutamate:succinate semialdehyde transaminase and a glutamate decarboxylase; (ii) a 4-hydroxybutanoate dehydrogenase;

(m) homoserine deaminase; 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase; 4-hydroxybut-2-enoyl-CoA reductase;

(n) homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4-hydroxybut-2-enoyl-CoA reductase;

(o) homoserine deaminase; 4-hydroxybut-2-enoate reductase; and 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4-hydroxybutyryl-CoA ligase;

(p) succinyl-CoA reductase (aldehyde forming); and 4-hydroxybutyrate dehydrogenase;

(q) alpha-ketoglutarate decarboxylase; and 4-hydroxybutyrate dehydrogenase;

(r) succinate reductase; and 4-hydroxybutyrate dehydrogenase;

(s) alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase or glutamate transaminase and glutamate decarboxylase and 4-aminobutyrate dehydrogenase or 4 aminobutyrate transaminase; and 4-hydroxybutyrate dehydrogenase; and

(t) a 4-hydroxybutyrate pathway selected from any of the pathways that produce 4 hydroxybutyrate as shown in any of Figures 1, 8-13, 58, 62, 63 or 72-74.

13. The non-naturally occurring microbial organism of claim 12, wherein said microbial organism comprising (i) further comprises an exogenous nucleic acid encoding an enzyme selected from a pyruvate:ferredoxin oxidoreductase, an aconitase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, an acetate kinase, a phosphotransacetylase, an acetyl-CoA synthetase, an NAD(P)H:ferredoxin oxidoreductase, ferredoxin, and combinations thereof.

14. The non-naturally occurring microbial organism of claim 12, wherein said microbial organism comprising (ii) further comprises an exogenous nucleic acid encoding an enzyme selected from an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, NAD(P):ferredoxin oxidoreductase, ferredoxin, and combinations thereof.

15. The non-naturally occurring microbial organism of claim 12, wherein said microbial organism comprising (iii) further comprises an exogenous nucleic acid encoding an enzyme selected from NAD(P):ferredoxin oxidoreductase and ferredoxin.

16. The non-naturally occurring microbial organism of claim 12, wherein said microbial organism comprises two, three, four, five, six or seven exogenous nucleic acids each encoding a 4-hydroxybutyrate pathway enzyme.

17. The non-naturally occurring microbial organism of claim 12, wherein said microbial organism comprises exogenous nucleic acids encoding each of the enzymes selected from the pathway enzymes producing 4-hydroxybutyrate pathway enzymes as shown in any of Figures 1,8-13,58,62,63 or72-74.

18. The non-naturally occurring microbial organism of claim 12, wherein said microbial organism comprises two, three, four or five exogenous nucleic acids each encoding enzymes of (i), (ii) or (iii).

19. The non-naturally occurring microbial orgnaism of claim 18, wherein said microbial organism comprising (i) comprises three exogenous nucleic acids encoding ATP-citrate lyase or citrate lyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase;

20. The non-naturally occurring microbial organism of claim 12, wherein said at least one exogenous nucleic acid is a heterologous nucleic acid, or wherein said non-naturally occurring microbial organism is in a substantially anaerobic culture medium.

21. A method for producing 4-hydroxybutyrate, comprising culturing the non-naturally occurring microbial organism of any of claims 12-20 under conditions and for a sufficient period of time to produce 4-hydroxybutyrate.

22. A non-naturally occurring microbial organism, comprising a microbial organism having a gamma-butyrolactone pathway comprising at least one exogenous nucleic acid encoding a gamma-butyrolactone pathway enzyme expressed in a sufficient amount to produce gamma butyrolactone; said non-naturally occurring microbial organism further comprising:

(a) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; and spontaneous or enzyme catalyzed;

(b) Acetoacetyl-CoA thiolase or acetoacetyl-CoA synthase; 3-Hydroxybutyryl-CoA dehydrogenase; Crotonase; Crotonyl-CoA hydratase; Phosphotrans-4-hydroxybutyrylase; amd spontaneous or enzyme catalyzed;

(c) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous;

(d) Succinate reductase; 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous;

(e) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous;

(f) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (aldehyde forming); 4-Hydroxybutyrate dehydrogenase; 4 Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; 4-Hydroxybutyryl CoA hydrolase or spontaneous;

(g) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyrate kinase; Phosphotrans-4-hydroxybutyrylase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous;

(h) Alpha-ketoglutarate decarboxylase or (Glutamate dehydrogenase and/or Glutamate transaminase; Glutamate decarboxylase; 4-aminobutyrate dehydrogenase and/or 4 aminobutyrate transaminase); 4-Hydroxybutyrate dehydrogenase; 4-Hydroxybutyryl-CoA transferase, or 4-Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous;

(i) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyrate kinase; Phosphotrans-4 hydroxybutyrylase; 4-Hydroxybutyryl-CoA hydrolase or spontaneous;

(j) Succinyl-CoA transferase, or Succinyl-CoA synthetase (or succinyl-CoA ligase); Succinyl-CoA reductase (alcohol forming); 4-Hydroxybutyryl-CoA transferase, or 4 Hydroxybutyryl-CoA synthetase; and 4-Hydroxybutyryl-CoA hydrolase or spontaneous;

(k) alpha-ketoglutarate reductase; 5-hydroxy-2-oxopentanoate dehydrogenase; and 5 hydroxy-2-oxopentanoate dehydrogenase (decarboxylation)

(1) 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, and a-ketoglutarate decarboxylase;

(m) 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-butyrate kinase, phosphotransbutyrylase, a-ketoglutarate decarboxylase;

(n) (i) an a-ketoglutarate decarboxylase, or an a-ketoglutarate dehydrogenase and a CoA dependent succinic semialdehyde dehydrogenase, or a glutamate:succinate semialdehyde transaminase and a glutamate decarboxylase; (ii) a 4-hydroxybutanoate dehydrogenase; (iii) a 4-hydroxybutyryl-CoA:acetyl-CoA transferase, or a butyrate kinase and a phosphotransbutyrylase;

(o) 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, and 4-hydroxybutyryl-CoA dehydrogenase;

(p) 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4 aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating) and 4 aminobutan-1-ol transaminase;

(q) 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4 aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4 aminobutan-1-ol transaminase, [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase

(deaminating), [(4-aminobutanolyl)oxy]phosphonic acid transaminase, 4-hydroxybutyryl phosphate dehydrogenase, and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating);

(r) alpha-ketoglutarate 5-kinase, 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha-ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2-oxopentanoic acid decarboxylase, and 5-hydroxy-2 oxopentanoic acid dehydrogenase (decarboxylation);

(s) glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5 kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl-CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5 hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(t) 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl CoA A-isomerase, or 4-hydroxybutyryl-CoA dehydratase;

(u) homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase, 4 hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase;

(v) succinyl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA hydrolase, 4 hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating);

(w) glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4 aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4 hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating);

(x) 4-aminobutyrate kinase; 4-aminobutyraldehyde dehydrogenase (phosphorylating); 4 aminobutan-1-ol dehydrogenase; and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4 aminobutan-1-ol transaminase;

(y) 4-aminobutyrate kinase; [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating) or [(4-aminobutanolyl)oxy]phosphonic acid transaminase; 4-hydroxybutyryl phosphate dehydrogenase; and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating);

(z) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5 hydroxy-2-oxopentanoic acid decarboxylase;

(aa) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(bb) alpha-ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid decarboxylase;

(cc) alpha-ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(dd) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase; 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid decarboxylase;

(ee) alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase; 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(ff) glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl CoA reductase (alcohol forming); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2 oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(gg) glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); 2 amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5- hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5 hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(hh) glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl CoA reductase; glutamate-5-semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5 hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(ii) glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); glutamate-5-semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2 oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation);

(jj) homoserine deaminase; 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase; 4-hydroxybut-2-enoyl-CoA reductase;

(kk) homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4-hydroxybut-2-enoyl-CoA reductase;

(11) homoserine deaminase; 4-hydroxybut-2-enoate reductase; and 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4-hydroxybutyryl-CoA ligase;

(mm) (i) alpha-ketoglutarate decarboxylase; or alpha-ketoglutarate dehydrogenase and CoA dependent succinate semialdehyde dehydrogenase; or glutamate:succinate semialdehyde transaminase and glutamate decarboxylase; (ii) 4-hydroxybutyrate dehydrogenase; (iii) 4 hydroxybutyryl-CoA transferase; or 4-hydroxybutyrate kinase and phosphotrans-4 hydroxybutyrylase; and (iv) 4-hydroxybutyryl-CoA reductase;

(nn) (i) alpha-ketoglutarate decarboxylase; or succinyl-CoA synthetase and CoA-dependent succinate semialdehyde dehydrogenase; (ii) 4-hydroxybutyrate dehydrogenase; (iii) 4 hydroxybutyryl-CoA transferase; or 4-hydroxybutyrate kinase and phosphotrans-4 hydroxybutyrylase;

(oo) (i) alpha-ketoglutarate decarboxylase; or glutamate dehydrogenase; glutamate decarboxylase; and deaminating 4-aminobutyrate oxidoreductase or 4-aminobutyrate transaminase; or alpha-ketoglutarate dehydrogenase and CoA-dependent succinate semialdehyde dehydrogenase; (ii) 4-hydroxybutyrate dehydrogenase; and (iii) 4 hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; 4-hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase; or 4-hydroxybutyrate kinase; phosphorylating 4-hydroxybutanal dehydrogenase; and 4-hydroxybutyraldehyde reductase; or 4-hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; and alcohol forming 4 hydroxybutyryl-CoA reductase; or 4-hydroxybutyryl-CoA transferase or 4-hydroxybutyryl CoA hydrolase or 4-hydroxybutyryl-CoA ligase; 4-hydroxybutyryl-CoA reductase; and 4 hydroxybutyraldehyde reductase; or 4-hydroxybutyryl-CoA transferase or 4-hydroxybutyryl CoA hydrolase or 4-hydroxybutyryl-CoA ligase; and alcohol forming 4-hydroxybutyryl-CoA reductase;

(pp) (i) glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase; glutamyl-CoA reductase; and glutamate-5-semialdehyde reductase; or glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase; and alcohol forming glutamyl-CoA reductase; or glutamate 5-kinase; phosphorylating glutamate-5-semialdehyde dehydrogenase; and glutamate-5-semialdehyde reductase; (ii) deaminating 2-amino-5 hydroxypentanoic acid oxidoreductase or 2-amino-5-hydroxypentanoic acid transaminase; and (iii) 5-hydroxy-2-oxopentanoic acid decarboxylase; and 4-hydroxybutyraldehyde reductase; or decarboxylating 5-hydroxy-2-oxopentanoic acid dehydrogenase; 4 hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase; or decarboxylating -hydroxy-2-oxopentanoic acid dehydrogenase and alcohol forming 4-hydroxybutyryl-CoA reductase;

(qq) a gamma-butyrolactone pathway comprising a pathway selected from any of the pathways that produce 4-hydroxybutyryl-CoA or 4-hydroxybutyryl phosphate as shown in Figures 1, 8-13, 58, 62-63 or 72-74, wherein gamma-butyrolactone is produced enzymatically or by spontaneous chemical conversion.

23. The non-naturally occurring microbial organism of claim 22, wherein said microbial organism comprising (i) further comprises an exogenous nucleic acid encoding an enzyme selected from a pyruvate:ferredoxin oxidoreductase, an aconitase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, an acetate kinase, a phosphotransacetylase, an acetyl-CoA synthetase, an NAD(P)H:ferredoxin oxidoreductase, ferredoxin, and combinations thereof.

24. The non-naturally occurring microbial organism of claim 22, wherein said microbial organism comprising (ii) further comprises an exogenous nucleic acid encoding an enzyme selected from an aconitase, an isocitrate dehydrogenase, a succinyl-CoA synthetase, a succinyl-CoA transferase, a fumarase, a malate dehydrogenase, NAD(P):ferredoxin oxidoreductase, ferredoxin, and combinations thereof.

25. The non-naturally occurring microbial organism of claim 22, wherein said microbial organism comprising (iii) further comprises an exogenous nucleic acid encoding an enzyme selected from NAD(P):ferredoxin oxidoreductase and ferredoxin.

26. The non-naturally occurring microbial organism of claim 22, wherein said microbial organism comprises two, three, four, five, six or seven exogenous nucleic acids each encoding a gamma-butyrolactone pathway enzyme.

27. The non-naturally occurring microbial organism of claim 26, wherein said microbial organism comprises exogenous nucleic acids encoding each of the enzymes selected from a gamma-butyrolactone pathway shown in any of Figures 73 or 74.

28. The non-naturally occurring microbial organism of claim 22, wherein said microbial organism comprises two, three, four or five exogenous nucleic acids each encoding enzymes

of (i), (ii) or (iii).

29. The non-naturally occurring microbial orgnaism of claim 28, wherein said microbial organism comprising (i) comprises three exogenous nucleic acids encoding ATP-citrate lyase or citrate lyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase;

30. The non-naturally occurring microbial organism of claim 22, wherein said at least one exogenous nucleic acid is a heterologous nucleic acid.

31. The non-naturally occurring microbial organism of claim 22, wherein said non-naturally occurring microbial organism is in a substantially anaerobic culture medium.

32. A method for producing gamma-butyrolactone, comprising culturing the non-naturally occurring microbial organism of any of claims 22-31 under conditions and for a sufficient period of time to produce gamma-butyrolactone.

33. A carboxylic acid reductase, comprising an amino acid sequence having an amino acid substitution selected from E16K; Q95L; LIOM; A1O11T; K823E; T941S; H15Q; D198E; G446C; S392N; F699L; V8831; F467S; T987S; R12H; V295G; V295A; V295S; V295T; V295C; V295V; V295L; V2951; V295M; V295P; V295F; V295Y; V295W; V295D; V295E; V295N; V295Q; V295H; V295K; V295R; M296G; M296A; M296S; M296T; M296C; M296V; M296L; M2961; M296M; M296P; M296F; M296Y; M296W; M296D; M296E; M296N; M296Q; M296H; M296K; M296R; G297G; G297A; G297S; G297T; G297C; G297V; G297L; G2971; G297M; G297P; G297F; G297Y; G297W; G297D; G297E; G297N; G297Q; G297H; G297K; G297R; G391G; G391A; G391S; G391T; G391C; G391V; G391L; G3911; G391M; G391P; G391F; G391Y; G391W; G391D; G391E; G391N; G391Q; G391H; G391K; G391R; G421G; G421A; G421S; G421T; G421C; G421V; G421L; G4211 G421M; G421P; G421F; G421Y; G421W; G421D; G421E; G421N; G421Q; G421H; G421K; G421R; D413G; D413A; D413S; D413T; D413C; D413V; D413L; D4131; D413M; D413P; D413F; D413Y; D413W; D413D; D413E; D413N; D413Q; D413H; D413K; D413R; G414G; G414A; G414S; G414T; G414C; G414V; G414L; G4141; G414M; G414P; G414F; G414Y; G414W; G414D; G414E; G414N; G414Q; G414H; G414K; G414R; Y415G; Y415A; Y415S; Y415T; Y415C; Y415V; Y415L; Y4151; Y415M; Y415P; Y415F; Y415Y; Y415W; Y415D; Y415E; Y415N; Y415Q; Y415H; Y415K; Y415R; G416G; G416A; G416S; G416T; G416C; G416V; G416L; G4161; G416M; G416P; G416F; G416Y; G416W; G416D; G416E; G416N; G416Q; G416H; G416K; G416R; S417G; S417A; S417S; S417T; S417C; S417V S417L; S4171; S417M; S417P; S417F; S417Y; S417W; S417D; S417E; S417N; S417Q; S417H; S417K; and S417R, or combinations thereof.