AU2021201392B2 - Three-dimensional dynamic culture method for in-vitro expansion of spermatogonial stem cells using microcarriers - Google Patents

Abstract

Provided is a three-dimensional dynamic culture method for in-vitro expansion of spermatogonial stem cells using microcarriers. The method provides a three-dimensional dynamic culturing environment by using cationic collagen Type I-coated microcarriers as the 5 scaffolds, and thereby establishes a three-dimensional dynamic culturing system that enables rapid in-vitro proliferation of the male mouse testis-derived SSCs while retaining their undifferentiated features. The present three-dimensional dynamic culturing system exhibit excellent proliferation effect after culturing the SSCs in the RCCS for one week; after in-vitro culturing for 17-22 days, the SSCs exhibited a rapid proliferation, the produced SSCs retained o their and biological characteristics and functions in their undifferentiated state. The method of the present invention is superior in respect of easy operation, low cost, high reproducibility, high success rate, no need for subculturing, and no feeder cell pollution, making it a reliable in-vitro culturing scheme for SCCs. FIG. 1 7.0* 6.0 rTwo- imensional static cultuinug StemPro-34 SFM culturing 5.0 Three-dinensional dynamic 4,0- * culturing 3.0x z 2.0 1.0 S0.0 7d 12d 17d 22d Time FIG. 2 ,I /

Description

FIG. 1

7.0* 6.0 rTwo- imensional static cultuinug

StemPro-34 SFM culturing 5.0 Three-dinensional dynamic 4,0- * culturing

x 3.0 z 2.0 1.0

S0.0 7d 12d 17d 22d

Time

FIG. 2

,I / THREE-DIMENSIONAL DYNAMIC CULTURE METHOD FOR IN-VITRO EXPANSION OF SPERMATOGONIAL STEM CELLS USING MICROCARRIERS TECHNICAL FIELD

The present invention relates to the technical field of biological, and particularly relates to

a three-dimensional dynamic culture method for in-vitro expansion of spermatogonial stem

cells using microcarriers.

BACKGROUND

Spermatogonial stem cells (SSCs) are male germline stem cells which reside on the

basement membrane of the seminiferous tubule in the testis, and are adult stem cells with the

potentials of self-renewal and directed differentiation into sperms; they can also spontaneously

differentiate into pluripotent stem cells during in-vitro culture. Thus, SSCs have been

recognized as ideal seed cells for stem cell mechanism research and clinical application of

regenerative medicine.

There are very few adult stem cells existing in human and animal body, such that SSCs

only accounts for 0.03% of germ cells in the testis of adult mouses. In order to apply adult stem

cells in clinical medicine, a problem need to be addressed is how to realize in-vitro expansion

of these stem cells on a large scale so as to provide sufficient and compliant stem cells to meet

the requirements of clinical treatment. However, SSCs are generally cultivated using

two-dimensional methods, i.e., the traditional adherent culture methods, which are known for

their disadvantages such as high costs (for example, the StemPro-34 SFM serum-free medium

system, which has been reportedly used), need for feeder cells, slow SSCs growth, and natural

differentiation-causing tendency, especially when effective in-vitro proliferation protocols have

not been established for many species at present. Also, when SSCs are adherently grown, the

limited surface area cannot support the long-term growth of SSCs, making the methods suffer

from technical bottlenecks such as slow cell proliferation and lack of available undifferentiated

SSCs. Thus, how to produce functional SSCs through rapid and large-scale in-vitro expansion is

still a key technical problem need to be addressed; three-dimensional culture is a cultivation method that provides an environment more akin to an in vivo situation, and has been widely used currently.

Three-dimensional dynamic culturing environment provided by bioreactors has been

applied in the proliferation and differentiation of embryonic stem cells (ESCs) and induced

pluripotent stem cells (iPSCs), which significantly enhances the ability of stem cells to

proliferate and differentiate, improve the efficiency of stem cell culture, and thereby standardize

stem cell research and application. However, as SSCs are germline adult stem cells, whether the

proliferation in the three-dimensional dynamic culturing environment can provide alternative

protocols for the biological research of SSCs and clinical male sterility and regenerative

medicine still needs to be explored.

Microcarrier-based culture technology is currently an effective method for large-scale

expansion, which provides high specific surface area to allow more cells to attach in smaller

space, and thereby produces a large number of cells to meet the needs on cell quantity for tissue

engineering. Through the combination of three-dimensional dynamic culture and

microcarrier-based culture technology, it is possible to avoid the disadvantages of traditional

two-dimensional methods such as requiring multiple subcultures, complex operation, and being

time-consuming.

SUMMARY

The present invention provides a three-dimensional dynamic culture method for in-vitro

expansion of spermatogonial stem cells using microcarriers.

Through experiments, the inventors have finally identified the biological scaffold materials

that enable spermatogonial stem cells (SSCs) grow effectively in the rotary cell culture system

(RCCS), the cationic collagen Type I-coated microcarriers, which can support

three-dimensional dynamic culturing protocols for in-vitro rapid expansion of SSCs without the

use of feeder cells. The number of SSCs can multiply after culturing for one week, where the

expanded SSCs keep the undifferentiated features and induced differentiation capacity. The

large-scale expansion is thereby realized with the ideal environment for proliferation of spermatogonial stem cells. The SSCs proliferating in vitro with the provided culturing scheme maintain their undifferentiated state and biological characteristics such as expressing stem cell markers and induced differentiation ability, which makes it possible to provide seed cells for further research on SSCs biological characteristics and their application in male infertility and regenerative medicine.

Provided is a three-dimensional dynamic culture method for in-vitro expansion of

spermatogonial stem cells using microcarriers, comprising the following steps:

(1) pre-treating the microcarriers;

(2) adding a SSCs medium into a rotary cell culture system, and then adding the

pre-treated microcarriers; and

(3) inoculating primary spermatogonial stem cells to the pre-treated microcarriers, and

culturing to obtain the spermatogonial stem cells.

As mentioned above, the microcarriers are cationic collagen Type I-coated microcarriers

(for example, in some embodiments, FACT III microcarrier).

The step of pre-treating the microcarriers is conducted by coating the microcarriers with

polylysine and laminin. Specifically, the step comprises washing the microcarriers with a

sterilized PBS (phosphate buffered saline) solution; autoclaving the microcarriers at 120°C for

30 minutes; coating the microcarriers by using a 10-20 ng/mL polylysine solution and a 5-20

[g/mL laminin solution, wherein the polylysine solution and the laminin solution are

respectively provided in a volume five times of that of the microcarriers; soaking the

microcarriers in the SSCs medium.

The primary spermatogonial stem cells are obtained through the following steps:

harvesting testes from a 5 to 7-day-old male mouse, and removing tunica albuginea; digesting

the testes using a combination of 1 mg/mL collagenase type IV and 20 pg/mL DNAse I, then digesting the testes using a combination of 0.25% trypsin/0.01% EDTA and 20 pg/mL DNAse I, and treating with a 10 wt% FBS-containing DMEM to stop the digestion process; filtering using a 60 pm cell strainer, centrifuging at 1000 rpm for 6 minutes using a refrigerated centrifuge, and resuspending to obtain a single cell suspension containing the primary spermatogonial stem cells;

The SSCs medium comprises 1% (v/v) of an essential amino acids solution, 1% (v/v) of a

non-essential amino acids solution, 1% (v/v) of a vitamin solution, 55 pM of -mercaptoethanol,

2 mM of L-glutamine, 2 mM of sodium pyruvate, 5 wt% of fetal calf serum, 1% (v/v) of a

dual-antibiotic solution, 20 ng/mL of basic fibroblast growth factor (for example, in some

embodiments, recombinant mouse basic fibroblast growth factor, rmbFGF), 20 ng/mL of glial

derived neurotrophic factor (for example, in some embodiments, recombinant rat glial derived

neurotrophic factor, rrGDNF)), and 103 U/mL of leukemia inhibitory factor (for example, in

some embodiments, mouse leukemia inhibitory factor, mLIF), wherein the SSCs medium is

prepared by adding the above ingredients into a DMEM (Dulbecco's Modified Eagle Medium).

Preferably, the method comprises adding the SSCs medium to a vessel in the rotary cell

culture system, and adding the pre-treated microcarriers according to a microcarrier

concentration of 10-20 g/mL; purifying the primary spermatogonial stem cells by the

differential adhesion method, inoculating the purified primary spermatogonial stem cells to the

pre-treated microcarriers according to an inoculum density of 2x10 5 -7.5x105 cells/mL, and

statically culturing for 30 to 60 minutes, and then rotationally culturing to obtain the

spermatogonial stem cells.

Preferably, the step of purifying the primary spermatogonial stem cells by the differential

adhesion method comprises: (a) inoculating the single cell suspension to a 0.1 wt%

gelatine-coated flask, and incubating for 8-10 hours at 37°C in 5% C02 ; (b) inoculating

non-adherent suspended cells (since the somatic cells rapidly and firmly attached to the wall) to

another 0.1 wt% gelatine-coated flask, and incubating for 8-10 hours at 37°C in 5% C0 2 ; (c)

repeating step (b) for two times and then collecting resultant non-adherent cells and suspension,

and centrifuging at 1000 rpm for 5 minutes to obtain a population of the primary spermatogonial stem cells with a purity of over 85% (an average purity is determined to be

85.006% by cell smear examination).

Specifically, the step of statically culturing for 30 to 60 minutes is performed at 37°C in 5%

C02.

Specifically, the step of rotationally culturing is performed by culturing in the rotary cell

culture system with a certain rotation speed for a period of time, and then gradually increasing

the rotation speed.

More specifically, the step of culturing in the rotary cell culture system with a certain

rotation speed for a period of time is performed by culturing at a rotation speed of 10-12 rpm in

the rotary cell culture system for 7 days. More specifically, the step of gradually increasing the

rotation speed is performed by adjusting the rotation speed with an upper limit of 30 rpm to

maintain formed cell clusters in a relatively static state to prevent damage to the cells due to

free falling motion.

Specifically, the step of culturing to obtain the spermatogonial stem cells comprises

renewing the SSCs medium at the third day and then renewing half of the SSCs medium every

three days.

A three-dimensional dynamic culturing environment is constructed by using a rotary cell

culture system (RCCS), wherein cationic collagen Type I-coated microcarriers have been

selected as the scaffold materials for culturing male mouse testis-derived SSCs from male

mouse testis. Through a large number of experiments, the inventors have eventually constructed

a three-dimensional dynamic culturing system that enables rapid in-vitro proliferation of the

male mouse testis-derived SSCs while retaining their undifferentiated features. It has been

proved that, the optimized three-dimensional culturing system with the microcarriers and RCCS

enables effective proliferation of the primary SSCs without the use of feeder cells.

The present three-dimensional dynamic culturing system exhibited excellent proliferation

effect after culturing the SSCs in the RCCS for one week. After in-vitro culturing for 17-22 days, the SSCs exhibited a rapid proliferation, the produced SSCs retained their and biological characteristics and functions in their undifferentiated state, such as the strong positive in alkaline phosphatase test, and ability of clone formation and induced differentiation into sperm cells. The method of the present invention offers easy operation, low cost, high reproducibility, high success rate, no need for subculturing, and no feeder cell pollution, making it a reliable in-vitro culturing scheme for SCCs, which makes it possible to provide seed cells for further research on SSCs biological characteristics and their application in male infertility and regenerative medicine.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 presents the morphological observation of the SSCs in the three-dimensional

dynamic system.

FIG. 2 shows the comparison in SSCs proliferation between different culturing systems.

FIG. 3 shows the strong positive in alkaline phosphatase test of the SSCs after 22-day

three-dimensionalculturing.

FIG. 4 shows that the SSCs express three SSC markers after 6-day and 14-day

three-dimensional culturing.

DETAILED DESCRIPTION OF THE EMBODIMENTS

The following embodiments are to further illustrate the present invention, but not to limit

the present invention.

The rotary cell culture system (RCCS) was purchased from Synthecon Inc (licensed by

NASA). FACT III microcarriers were purchased from Germany Sartorius Company.

Recombinant mouse basic fibroblast growth factor (Recombinant Mouse FGF basic, rmbFGF)

and recombinant rat glial derived neurotrophic factor (Recombinant Rat GDNF, rrGDNF) were purchased from R & D Systems. Mouse leukemia inhibitory factor (mLIF) was purchased from

Merck (Chemicon).

FACT III microcarriers: cross-linked polystyrene coated with Type 1 porcine collagen

(gelatin) containing protein, cationic charge; diameter 125-212 [m; area/gram 360 cm 2/g;

relative density 1.022 - 1.030.

Embodiment 1

1. Preparation of materials

(1) SSCs Medium (DMEM complete medium)

Formulation: 1% (v/v) of an essential amino acids solution (Gibco, catalog number:

o 11130051), 1% (v/v) of a non-essential amino acids solution (Gibco, catalog number:

11140050), 1% (v/v) of a vitamin solution (Gibco, catalog number: 11120052), 55 pM of a

p-mercaptoethanol solution, 2 mM of L-glutamine, 2 mM of sodium pyruvate, 5 wt% of fetal calf serum (FCS), 1% (v/v) of a dual-antibiotic solution (Gibco, catalog number: 15140-122),

20 ng/mL of recombinant mouse basic fibroblast growth factor (rmbFGF), 20 ng/mL of

recombinant rat glial derived neurotrophic factor (rrGDNF), and 103 U/nL of mouse leukemia

inhibitory factor (mLIF), in a DMEM (Gibco, catalog number: 11885084).

The essential amino acids solution: Gibco, catalog number 11130051. L-Arginine

hydrochloride, 6320.0 mg/L; L-Cystine 1200.0 mg/L; L-Histidine hydrochloride-H20, 2100.0

mg/L; L-Isoleucine, 2620.0 mg/L; L-Leucine, 2620.0 mg/L; L-Lysine hydrochloride, 3625.0

mg/L; L-Methionine, 755.0 mg/L; L-Phenylalanine, 1650.0 mg/L; L-Threonine, 2380.0 mg/L;

L-Tryptophan, 510.0 mg/L; L-Tyrosine, 1800.0 mg/L; L-Valine, 2340.0 mg/L.

The non-essential amino acids solution: Gibco, catalog number 11140050. Glycine, 750.0

mg/L; L-Alanine, 890.0 mg/L; L-Asparagine, 1320.0 mg/L; L-Aspartic acid, 1330.0 mg/L;

L-Glutamic Acid, 1470.0 mg/L; L-Proline, 1150.0 mg/L; L-Serine, 1050.0 mg/L.

The vitamin solution: Gibco, catalog number 11120052. Choline chloride, 100.0 mg/L;

D-Calcium pantothenate, 100.0 mg/L; Folic Acid, 100.0 mg/L; Nicotinamide, 100.0 mg/L;

Pyridoxal hydrochloride, 100.0 mg/L; Riboflavin, 10.0 mg/L; Thiamine hydrochloride, 100.0

mg/L; i-Inositol, 200.0 mg/L; Sodium Chloride (NaCl), 8500.0 mg/L.

The dual-antibiotic solution: Gibco, catalog number 15140-122. 10000 units/mL of

penicillin and 10000 pg/mL of streptomycin.

The DMEM: Gibco, catalog number 11885084. Glycine, 30.0 mg/L; L-Arginine

hydrochloride, 84.0 mg/L; L-Cystine 2HCl, 63.0 mg/L; L-Glutamine, 584.0 mg/L; L-Histidine

hydrochloride-H20, 42.0 mg/L; L-Isoleucine, 105.0 mg/L; L-Leucine, 105.0 mg/L; L-Lysine

hydrochloride, 146.0 mg/L; L-Methionine, 30.0 mg/L; L-Phenylalanine, 66.0 mg/L; L-Serine,

o 42.0 mg/L; L-Threonine, 95.0 mg/L; L-Tryptophan, 16.0 mg/L; L-Tyrosine disodium salt

dihydrate, 104.0 mg/L; L-Valine, 94.0 mg/L; Choline chloride, 4.0 mg/L; D-Calcium

pantothenate, 4.0 mg/L; Folic Acid, 4.0 mg/L; Niacinamide, 4.0 mg/L; Pyridoxine

hydrochloride, 4.0 mg/L; Riboflavin, 0.4 mg/L; Thiamine hydrochloride, 4.0 mg/L; i-Inositol,

7.2 mg/L; Calcium Chloride (CaCl2) (anhyd.), 200.0 mg/L; Ferric Nitrate (Fe(N03)3"9H20),

0.1 mg/L; Magnesium Sulfate (MgSO4) (anhyd.), 97.67 mg/L; Potassium Chloride (KCl),

400.0 mg/L; Sodium Bicarbonate (NaHCO3), 3700.0 mg/L; Sodium Chloride (NaCl), 6400.0

mg/L; Sodium Phosphate monobasic (NaH2PO4-H20), 125.0 mg/L; D-Glucose (Dextrose),

1000.0 mg/L; Phenol Red, 15.0 mg/L; Sodium Pyruvate, 110.0 mg/L.

Preparation method: The above ingredients were mixed until dissolved, and then the

mixture was sterilized by filtration.

The SSCs medium was a modified medium, wherein growth factors were added into the

base medium and thereby the in-vitro proliferation of SSCs was significantly enhanced.

(2) Preparation for the rotary cell culture system (RCCS)

The rotary cell culture system (RCCS) comprised: (A) a power switch (power controller),

(B) a single station rotator base, and (C) an incubator. The RCCS was provided with high aspect

ratio vessels (HARVs), including 1 mL, 2mL, 4mL, 10 mL, and 50 mL vessels.

Disinfecting, sterilizing, and setting up the RCCS: The high aspect ratio vessels were

disinfected by soaking in 75% (v/v) alcohol overnight; after air-dried, they were wrapped in

gauze and sterilized by autoclaving at 110°C for 30 minutes. Before the culturing process, the

vessels were filled with the SSCs medium, and the device was set up for operation.

2. Producing high-purity spermatogonial stem cells

(1) Producing primary spermatogonial stem cells

Testes of 5 to 7-day-old male Kunming mice were harvested. After removing tunica

albuginea, the seminiferous tubules were excised and transferred to 10 mL centrifuge tubes. The

seminiferous tubules were washed with a 10-fold volume (i.e., a volume 10 times of that of the

seminiferous tubules) of PBS and then the supernatant was removed; this process was repeated

for three times. Then a 10-fold volume of PBS containing 1 mg/mL of collagenase type IV and

20 pg/mL of DNAse I (Deoxyribonuclease I) was added into each of the centrifuge tubes which

were then placed in 37°C water bath to allow digestion for 6 minutes; during the digestion

process, in order to maintain integrity of seminiferous tubules, the centrifuge tube were vibrated

regularly or repeatedly blown using a pipette. Then, the mixtures were centrifuged for 5

minutes at 600 rpm. After the supernatant was removed, a 5-fold volume of PBS containing

0.25% trypsin/0.01% EDTA (both 0.25% trypsin and 0.01% EDTA) and 20 pg/mL DNAse I

was added into each of the centrifuge tubes which were then placed in 37°C water bath to allow

digestion for 8 minutes, and then added with an identical volume (5-fold volume) of 10 wt%

FBS-containing DMEM to stop the digestion process. Then, the mixtures were centrifuged and

resuspended to obtain single cell suspensions containing the primary spermatogonial stem cells.

(2) Purifying by the differential adhesion method

The single cell suspensions were inoculated to 0.1 wt% gelatine coated flasks, and

incubated for 8 hours at 37°C in 5% CO2 . While the somatic cells firmly attached to the wall,

the non-adherent suspended cells were collected and inoculated to new 0.1 wt% gelatine coated

flasks, and incubated for 8-10 hours at 37°C in 5% C0 2 ; this step was repeated for three times.

Then the resultant non-adherent cells and suspensions were collected and centrifuged at 1000 rpm for 5 minutes to obtain a population of the primary spermatogonial stem cells with a purity of over 85% (an average purity was determined to be 85.006% by cell smear examination). Cell viability was determined to be over 95% by the trypan blue exclusion test.

3. Pre-treatment of FACT III microcarriers

The FACT III microcarriers were precisely weighed out according to the microcarrier

concentration of 10 g/mL. The FACT III microcarriers were washed with a sterilized PBS

solution and soaked overnight, and then autoclaved at 120°C for 30 minutes. The FACT III

microcarriers were then transferred to sterilized 15 mL centrifuge tubes and subjected to coating

treatment by firstly using a 10 ng/mL polylysine solution and then a 10 g/mL laminin solution,

wherein the polylysine solution and the laminin solution were respectively provided in a

volume five times of that of the FACT III microcarriers. The FACT microcarriers were then

soaked in the SSCs medium overnight to obtain pre-treated FACT microcarriers.

Experiments showed that the above pre-treated FACT microcarriers exhibited excellent

biocompatibility.

4. Three-dimensional dynamic culturing of SSCs

(1) The purified primary spermatogonial stem cells (without feeder cells) were inoculated

to the pre-treated FACT III microcarriers according to an inoculum density of 2.55x105

cells/mL, and statically cultured for 60 minutes at 37°C.

(2) The SSCs were then cultured at a rotation speed of 10 rpm in the rotary cell culture

system. After culturing for 7 days, the culture process continued while the rotation speed was

gradually increased within an upper limit of 30 rpm to maintain formed cell clusters in a

relatively static state to prevent damage to the cells due to free falling motion. During the whole

culture process, it was necessary to prevent bubble formation and renew the medium. The

medium was renewed in full at the third day and then renewed in half every three days. Samples

were also collected during the whole process.

Comparative test 1: SSCs were cultured using the traditional two-dimensional static culturing method. The primary SSCs purified by the differential adhesion method were inoculated to six-well plates according to an inoculum density of 2.55x105 cells/mL. 1 mL of the SSCs medium was added to each well. The medium was renewed in full at the third day and then renewed in half every three days. Samples were also collected during the whole process.

Comparative test 2: SSCs were cultured in the rotary cell culture system without the

pre-treated FACT III microcarriers. After the step of disinfecting, sterilizing, and setting up the

RCCS, 2 mL of the SSCs medium (the DMEM complete medium) was added into each HARV

vessel, followed by the addition of the primary spermatogonial stem cells purified by the

differential adhesion method according to an inoculum density of 2.55x105 cells/mL. The cells

were statically cultured for 60 minutes, and then cultured at a rotation speed of 10 rpm. Results

showed that, after only three days of three-dimensional dynamic culturing, cell viability

significantly reduced to about 30%.

Comparative test 3: SSCs were cultured using the same protocol of comparative test 1

except that the SSCs medium was replaced with StemPro-34 SFM (Gibco, catalog number:

10639011).

5. Biocompatibility between FACT III microcarriers and SSCs

During the culturing in the above step 4, the medium was renewed and sampled for the

first time at the third day, wherein spherical cells were observed around the FACT III

microcarriers with a large amount of suspended cells in the medium, while the SSCs cultured

by the traditional two-dimensional static culturing method attached firmly to the supporting

cells. At the seventh day, 8-10 FACT III microcarriers firmly aggregated due to the increase in

cell number and secretion of extracellular matrix during the three-dimensional dynamic

culturing; meanwhile in the two-dimensional group, typical SSC clones were observed, but

number of target cells reduced. At the tenth day, more FACT III carriers were observed

aggregating, and their surfaces were covered with more cells; meanwhile in the

two-dimensional group, SSCs did not attach to the microcarriers but reduced significantly. The

results showed the FACT III microcarriers exhibited excellent biocompatibility to SSCs, supporting the in-vitro proliferation of SSCs.

6. Morphological observation of the SSCs in the three-dimensional dynamic system

During the three-dimensional dynamic culturing of SSCs in the above step 4, samples were

collected for observation at the third day, wherein FACT III microcarriers mostly existed

individually with SSCs attached to their surfaces, while cell aggregates were observed in the

medium (FIG. 1-A). As the culturing proceeded, FACT III microcarriers aggregated due to the

cell connections; after 12 days and 22 days of rotary culturing, more FACT III carriers

aggregated (FIG. 1-B), and cell-microcarrier aggregates with larger sizes were formed (FIG.

1-C). After 35 days of rotary culturing, the cell-microcarrier aggregates were found to have a

diameter of 1-2 mm generally and 3-4 mm for large ones (FIG.1-D). The cell-microcarrier

aggregates, formed by 17-day and 22-day culturing, were subjected to trypsin digestion to give

single cells; the single cells were highly refractive and had high viability (FIG. 1-E and FIG.

1-F).

7. Comparison in SSCs proliferation between different culturing systems

During the culturing in the above step 4, the SSCs cultured by three-dimensional dynamic

culturing method using FACT III microcarriers for 22 days exhibited a constant-slow

proliferation-rapid proliferation process, wherein the slow proliferation stage occurred from day

7 to day 12, and the rapid proliferation stage occurred from day 17 to day 22. When compared

with the two-dimensional group and the SermPro-34 group, the FACT III/Three-dimensional

group exhibited began to show its advantage in proliferation, significantly higher than the other

two culturing system (P<0.05), as shown in FIG. 2.

8. Analysis on biological characteristics and functions of SSCs in the three-dimensional

dynamic culturing system

During the culturing in the above step 4, SSCs of different culturing stages were tested for

their undifferentiated features. Alkaline phosphatase activity of the SSCs was measured by an

AP activity kit (Boster Biological Technology Co. Ltd, catalog number: AR1023); results showed that the SSCs exhibited strong positive in alkaline phosphatase activity test (FIG. 3).

The expression of three marker genes in the proliferated SSCs was identified by RT-PCR

with the following steps:

(1) The cells were collected by centrifuging at 1000 rpm for 10 minutes in a refrigerated

centrifuge, and then total RNA was extracted using a total RNA kit (TIANGEN).

(2) First strand cDNA synthesis was conducted using a reverse transcription kit (TAKARA,

6210A) by incubating at 42°C for 60 minutes, maintaining at 70°C for 15 minutes, and then

cooling to 4°C; the product was then stored at -20°C.

(3) SSC marker genes, including Oct4, GFRal, and Bcl6b, were amplified, and -actin

was used as the internal control. A 20 pL reaction mixture comprises 0.6 pL of cDNA template,

0.4 pL of forward primer and 0.4 pL of reverse primer (the primer concentrations were 10 ptM;

primer information were as shown in Table 1), 10 pL of PCR mix, and 0.4 pL of Taq

polymerase, and the balance being double diluted water. PCR protocol: 94°C for 5 minutes; 36

cycles (94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 45 seconds); 72°C for 10

minutes.

Table 1 Primers for marker genes and internal control

Product Annealing NCBI Gene Primer Sequence Size (bp) Temperature (0 C) AccessionNo.

actin .- TCCATCATGAAGTGTGACGTTGA GTGCTAGGAGCCAGAGCAGTAATC 131 56 NM_007393

OCT4 ATCACTCACATCGCCAATCAG 132 56 NM013633 TGTCCCTGTAGCCTCATACTCTT

GFRal TACGGAAAGGATGGTCTCG 147 56 NM010279 CGATGTTTCTGCCAATGATAC

Bcl6b GCACAAGGCAGTTCTTATCG 133 56 NM007528 GAAGTCCAGAAGAGGAGCAAAG

RT-PCR results showed that, the proliferated SSCs expressed the three marker genes, Oct4,

GFRal, and Bcl6b, as shown in FIG. 4. Further functional analysis illustrated that the SSCs retained their ability of clone formation and induced differentiation into sperm cells. The above results all indicated that the SSCs proliferating in the three-dimensional culturing system of the present invention retained their biological characteristics as they maintained their undifferentiated state and ability of induced differentiation into sperm cells.

It will be understood that the terms "comprise" and "include" and any of their derivatives (e.g.

comprises, comprising, includes, including) as used in this specification, and the claims that

follow, is to be taken to be inclusive of features to which the term refers, and is not meant to

exclude the presence of any additional features unless otherwise stated or implied.

Claims (1)

The claims defining the invention are as follows:

1. A three-dimensional dynamic culture method for in-vitro expansion of spermatogonial stem

cells (SSCs) using microcarriers, comprising the following steps:

adding SSCs medium to a vessel in a rotary cell culture system, and adding pre-treated

microcarriers at a microcarrier concentration of 10-20 [g/mL; purifying primary spermatogonial

stem cells by a differential adhesion method, inoculating the purified primary spermatogonial stem

cells to the pre-treated microcarriers at an inoculum density of 2x10 5-7.5x105 cells/mL, statically

culturing for 30 to 60 minutes, and then rotationally culturing to obtain the spermatogonial stem

cells;

wherein,

the microcarriers are cationic collagen Type I-coated microcarriers;

the step of purifying the primary spermatogonial stem cells by the differential adhesion method

comprises: (a) inoculating a single cell suspension to a 0.1 wt% gelatine-coated flask, and

incubating for 8-10 hours at 37°C in 5% C0 2 ; (b) inoculating non-adherent suspended cells to

another 0.1 wt% gelatine-coated flask, and incubating for 8-10 hours at 37°C in 5% C0 2 ; (c)

repeating step (b) for two times and then collecting resultant non-adherent cells and suspension, and

centrifuging at 1000 rpm for 5 minutes to obtain the purified primary spermatogonial stem cells;

the step of statically culturing for 30 to 60 minutes is performed at 37°C in 5% C02;

the step of rotationally culturing comprises culturing at a rotation speed of 10-12 rpm in a

rotary cell culture system for 7 days;

the step of rotationally culturing further comprises adjusting the rotation speed within an upper

limit of 30 rpm to maintain formed cell clusters in a relatively static state to prevent damage to the

cells due to free falling motion, after culturing at 10-12 rpm for 7 days;

the step of culturing to obtain the spermatogonial stem cells comprises renewing the SSCs

medium at the third day and subsequently renewing half of the SSCs medium every three days; the step of pre-treating the microcarriers comprises: washing the microcarriers with a sterilized

PBS solution; autoclaving the microcarriers at 120°C for 30 minutes; coating the microcarriers by

using a 10-20 ng/mL polylysine solution and a 5-20 g/mL laminin solution, wherein the polylysine

solution and the laminin solution are respectively provided in a volume five times of that of the

microcarriers; soaking the microcarriers in the SSCs medium;

the primary spermatogonial stem cells are obtained through the following steps: harvesting

testes from a 5 to 7-day-old male mouse, and removing tunica albuginea; digesting the testes using

a combination of 1 mg/mL collagenase type IV and 20 pg/mL DNAse I, then digesting the testes

using a combination of 0.25% trypsin/0.01% EDTA and 20 pg/mL DNAse I, and treating with a 10

wt% FBS-containing DMEM to stop the digestion process; filtering using a 60 pm cell strainer,

centrifuging at 1000 rpm for 6 minutes using a refrigerated centrifuge, and resuspending to obtain a

single cell suspension containing the primary spermatogonial stem cells; and

the SSCs medium comprises the following ingredients: 1% (v/v) of an essential amino acids

solution, 1% (v/v) of a non-essential amino acids solution, 1% (v/v) of a vitamin solution, 55 pM of

p-mercaptoethanol, 2 mM of L-glutamine, 2 mM of sodium pyruvate, 5 wt% of fetal calf serum, 1% (v/v) of a dual-antibiotic solution, 20 ng/mL of basic fibroblast growth factor, 20 ng/mL of glial

derived neurotrophic factor, and 103 U/mL of leukemia inhibitory factor, and wherein the SSCs

medium is prepared by adding the said ingredients into a DMEM.