AU2021106553A4 - Modification method for MFS Patient-specific Induced Pluripotent Stem Cells - Google Patents

Abstract

The invention discloses a selection or modification method for MFS patient-specific induced pluripotent stem cell (iPSC), which belongs to the technical field of stem cells reprogramming and disease modelling; the method includes the following steps: episomal plasmids containing transcription factors are introduced into the primary vascular cells to be expressed by nucleofection.

Description

Modification method for MFS Patient-specific Induced Pluripotent Stem Cells

TECHNICAL FIELD

The invention relates to the field of iPSC reprogramming, in particular to a method for

generation of MFS patient-specific iPSC.

BACKGROUND

Marfan syndrome (MFS) is an autosomal dominant connective tissue disease with an

incidence of one in 3000 to 5000. In 90% of cases, it is caused by an alteration of Fibrillin

1 (FBN1) gene. FBNJ is a gene with 65 exons located on chromosome 15q-21.1. FBNJ is

a matrix glycoprotein and the main component of elastic fibers. Its changes can interfere

with the TGF-j signalling pathway. In addition to changes in the FBNJ gene, there may

also be changes in the gene encoding the TGF- receptor (TGF3R). Some individuals with

TGFRI or TGFPRII gene alterations have clinical features consistent with MFS, which

further proves the role of activating the TGF- signalling pathway in the pathogenesis of

MFS. Obtaining patient-specific iPSCs for MFS may provide a new in vitro human-derived

cell model for elucidating the molecular mechanism of MFS. So far, the research on the

molecular mechanism of MFS disease is not completely clear. At present, the research of

MFS is mainly carried out at the animal level. Due to species differences, animal models

and humans are very different in various physiological systems, and many research results

cannot be directly applied to its clinical application. Therefore, how to establish a human

derived iPSC and its differentiated vascular cell model is very important for the research

of cardiovascular diseases such as MFS.

The emergence of human induced pluripotent stem cells (hiPSCs) has provided a

revolutionary technology for translational medicine and regenerative medicine, as well as new methods and a large number of cell sources for the study of human genetic disease mechanisms. Initially, in 2006, Shinya Yamanaka at Kyoto University first reported the generation of mouse induced pluripotent stem cells in Cell. They cloned the four transcription factor genes Oct3/4, Sox2, c-Myc, and Klf4 into viral vectors, and then introduced them into mouse fibroblasts, with finding that generated iPS cells are similar to embryonic stem cells in terms of morphology, gene and protein expression, epigenetic modification status, cell multiplication ability, embryoid body and teratoma formation ability, and differentiation potential. In November 2007, the Thompson laboratory and the

Yamanaka laboratory almost simultaneously reported that the application of

reprogramming technology can also induce human skin fibroblasts to become iPSCs almost

identical to embryonic stem cells. Based on the generation and application of iPS cells, it

provides a new way to construct cells models, and the generation of MFS patient-specific

induced pluripotent stem cell models will provide useful cell models for studying the

disease.

SUMMARY

The purpose of the present invention is to provide a method for efficiently generating MFS

patient-specific induced pluripotent stem cells, which provides an inexhaustible cell source

for various type of cell differentiation for disease modelling, drug screening and other

application.

In order to achieve the objectives above, the present invention provides the following

solutions:

The present invention provides MFS patient-specific induced pluripotent stem cells which

includes the following steps:

The isolated vascular tissue from MFS patients is cultured in vitro to obtain primary

vascular cells;

The episomal plasmids containing the transcription factor are introduced into the primary

vascular cells for expression by a nucleofection method to obtain specific iPSC cell lines.

Preferably, the primary vascular cells are obtained according to the following steps:

Cut the obtained aortic tissue of the MFS patient into small pieces of about 1 mm3 , and

attach them to the culture flask, add DMEM medium containing 10% fetal bovine serum

and 1% penicillin/streptomycin (P/S), one side of attached the tissue blocks upward for a

period of culture, turn the culture flask over and continue culturing until a large number of

cells grew out and further expand to obtain primary vascular cells.

Preferably, the vascular cells include fibroblasts and vascular smooth muscle cells.

Preferably, obtaining the specific iPSC cell strain includes the following steps:

Step 1: When the vascular cells are cultured to have density of 8 0 - 9 0 %, they are digested

into single cells, centrifuged, and the cell pellet is taken;

Step 2: After mixing the episomal plasmids containing different genes with the

nucleofection solution, resuspending the cell pellet, and then performing nucleofection;

Step 3: After nucleofection, adding culture medium to resuspend the cells, and then

inoculating the cell suspension in DMEM medium containing 10% fetal bovine serum and

1% P/S. Changing the medium every day until the culture cell density is 90%. The cells

are digested, and cultured with the mixed solution-1. After one day of culture, changing to

the mixed solution-2. When specific iPSC clones are observed, changing to the culture

solution for iPSC clones' growth;

Step 4: After the iPSC clones are picked up, they are expanded and cultured with the

medium to obtain different iPSC cell lines.

Preferably, the mixed solution-i is a mixture of (hiPSC/hESC culture medium+10 ng/ml

HumanbFGF+0.25 mMNaB) and (DMEM+10% FBS+1% P/S medium) inavolume ratio

of 1:1;

The mixed solution-2 includes: hiPSC/hESC culture medium+10 ng/ml Human

bFGF+0.25 mM NaB;

The culture medium is: hiPSC/hESC culture medium.

Preferably, the episomal plasmids containing different genes include OCT4, KLF4, SOX2,

Lin28, 1-myc and shP53.

The invention also provides an iPSC model for MFS patients constructed according to the

reprogramming method.

The present invention also provides the application of the MFS patient iPSC model

constructed according to the reprogramming method in the following (a) or (b):

(a) Application in clinical drugs screening for treatment and/or prevention of MFS disease;

(b) Application in studying the cellular and molecular mechanisms of MFS-related

diseases.

The present invention discloses the following technical effects:

(1) The Marfan syndrome (MFS)-specific pluripotent stem cell (iPSC) disease model

established by the present invention has a patient-specific genetic background, which can

better reflect the patient's pathological state and the development process of the disease.

(2) At present, the establishment of iPSC mainly uses lentivirus (which will be integrated

into the genome), sendai virus (the preparation method is more difficult), etc. This study uses the episomal plasmids nucleofection method to directly transfer transcription factors into cells. This method is simple to operate and saves time. At the same time, genes will not be integrated into the genome, creating good conditions for MFS disease cells model.

BRIEF DESCRIPTION OF THE FIGURES

In order to explain the embodiments of the present invention or the technical solutions in

the prior art more clearly, the following will briefly introduce the figures needed in the

embodiments. Obviously, the figures in the following description are only some

embodiments of the present invention. For those of ordinary skill in the art, without creative

work, other figures can be obtained based on these figures.

Figure 1 shows the primary cultured aortic vascular cells of MFS patients; A: the

morphology of the primary cells that migrated and proliferated in the aorta tissue of MFS

patients; B: the morphology of the cells cultured after the passage of primary cells;

Figure 2 shows the reprogramming of primary aortic vascular cells from MFS patients into

iPSC; A: the cell morphology on Day 6 after nucleofection; B: small clones appeared on

Day 13 after nucleofection; C: On Day16 after nucleofection, small clones gradually grew

up; D: established passage 1 (P1) iPSC line in the culture plate;

Figure 3 shows the characterization of MFS patient-specific iPSCs; A: alkaline

phosphatase staining; B: karyotype analysis of MFS patient-specific iPSC; C:

immunofluorescence staining of pluripotency genes; D: PT-PCR products of pluripotency

genes in agarose gel; E: RT-qPCR quantified the expression of pluripotency gene; OCT4,

NANOG, SOX2, TRA-1-60, TRA-1-81 are pluripotency genes; Primary cell: primary

vascular cells from MFS patient aorta, H1ESC: HI human embryonic stem cell; F:

formation of embryonic body (EB); G: The staining of a-SMA, a marker of EB-mediated differentiation of mesodermal cell; H: The staining of a-Fetoprotein, a marker of EB mediated differentiation of endoderm cell; I: The staining of Nestin, a marker of EB mediated differentiation of ectoderm cell.

DESCRIPTION OF THE INVENTION

Various exemplary embodiments of the present invention will now be described in detail.

This part should not be considered as a limitation to the present invention, but as more

detailed information of certain aspects, characteristics, and embodiments of the present

invention.

It should be noted that the terms described in the present invention are only used to describe

specific embodiments and are not to limit the present invention. In addition, for the

numerical range in this invention, it should be understood that each intermediate value

between the maximum and the minimum is also specifically disclosed. Each smaller range

between any stated value or intermediate value within the stated range and any other stated

value or intermediate value within the stated range is also included in the present invention.

The upper and lower limits of these smaller ranges can be independently included or

excluded from the range.

Unless otherwise specified, all technical and scientific terms used herein have the same

meaning as commonly understood by those skilled in the art in the field of the present

invention. Although the present invention only describes preferred methods and materials,

any methods and materials similar or equivalent to those described herein can also be used

in the practice or testing of the present invention. All documents mentioned in this

specification are incorporated by reference to disclose and describe methods and/or materials related to the documents. In the event of conflict with any incorporated document, the content of this manual shall prevail.

Without departing from the scope or spirit of the present invention, various improvements

and changes can be made to the specific embodiments of the present specification, which

is apparent to those skilled in the art. Other embodiments derived from the description of

the present invention will be apparent to the skilled person. The specification and examples

of this application are only exemplary.

As used herein, "including", "composing", "having", "containing", etc., are all open terms,

which means including but not limited to.

Embodiment 1 A method for generation of MFS patient-specific pluripotent stem cells

includes the following steps:

1) Obtaining of primary vascular cells from patient aortic tissues

The tissue was obtained from a 28-year-old man from the First Affiliated Hospital of

Wenzhou Medical University. This patient was diagnosed as an MFS with hyaline

degeneration and mucous degeneration of the fibrous tissue of the "aortic valve". The

discarded aortic tissue of this patient was collected and rinsed with DPBS; then transferred

into dishes with DMEM basal medium; the tissue was cut into pieces with size of about 1

mm 3, which was attached to the bottom of the culture flask; the flask was placed up-and

down with culture medium (DMEM+10% FBS + 1% penicillin/streptomycin (P/S) in a

37C, 5% CO2 incubator for 2-3 hours; then the culture flask was turned over and the tissue

blocks could culture in the medium, and the medium changed every 2 days. When the

primary cells' density in the culture flask reached about 90%, which is referred to as PO primary cells (the morphology is shown in Figure 1A), and these cells were subcultured to further expansion, some of them were frozen for preservation.

Among them, the above-mentioned DPBS is a phosphate buffered saline, and DMEM is a

well-known medium containing various amino acids and glucose in the field. FBS is fetal

bovine serum, and the percentage in DMEM+10% FBS+1% penicillin/streptomycin (P/S)

medium is calculated by volume ratio.

2) Establishment of MFS patient-specific iPSC lines

After the primary cells' density has reached about 90% (the morphology is shown in Figure

IB), the cells were digested into single cells with 0.05% TE. Centrifugation was carried

out and the supernatant was aspirated. The four plasmids (containing the genes OCT4,

KLF4, SOX2, Lin28, 1-myc and shP53, purchased from Addgene, #27077, #27078,

#27080, #37624) and nucleofection solution (Lonza, #V4XP-3024) were mixed; the cell

pellet was resuspended, and then nucleofectionion was performed using LONZA 4D

Nucleofector with program FF-120.

After nucleofection, the culture solution was added to resuspend the cells; the cell

suspension was inoculated in medium containing DMEM+10% FBS+1% P/S; the medium

was changed every other day; on the 6th day,(Figure 2A),the cells' density is about 90 %.

On the 6th day, the digested cells were inoculated on a 35 mm culture dish pre-plated with

Matrigel, and the prepared culture medium for reprogramming (Nuwacell-ncEpic

hiPSC/hESC medium+10 ng/ml Human bFGF+0.25 mM NaB) mixed with culture medium

for primary cells (medium containing DMEM+10% FBS+1% P/S ) on the basis of 1:1 and

cultured for one day; then change the medium with the prepared medium for

reprogramming every other day. When iPSC clones emerged (Figure 2B), the medium should change to Nuwacell hiPSC/hESC medium (Nuwacell, #PR01001) daily. After the clones grow up (Figure 2C), they are picked up and expanded to establish specific iPSC cell lines.

Among them, Matrigel is from BD, and Nuwacell-ncEpic hiPSC/hESC culture medium is

from Nuwacell.

Episomal vector plasmids:

pCXLE-hOCT3/4-shp53 (Addgene, #27077)

pCXLE-hSK (Addgene, #27078)

pCXLE-hUL (Addgene, #27080)

pCXWB-EBNA1 (Addgene, #37624)

The nucleofection solution is from P3 Primary Cell 4D-Nucleofector X Kit L (Lonza,

#V4XP-3024).

The morphology of MFS patient-specific iPSCs during the reprogramming process is

shown in Figure 2. The results show that some cells initially underwent morphological

changes when they were cultured for 5 days after nucleofection, and some small iPSC

clones could be seen on day 13 after nucleofection. The clones will grow bigger after that.

The established MFS patient-specific iPSC lines will expand and stock (Figure 2D). The

iPSCs were characterized by small cells, high ratio of nucleus to cytoplasm, prominent

nuclei, and similar to ESC-like cells.

3) Characterization of MFS patient-specific iPSC lines

To characterize the pluripotency of established iPSC, the activity of alkaline phosphatase,

immunofluorescence staining and RT-PCR detection of pluripotency genes, embryoid

body (EB)-mediated differentiation of three germ layers, karyotype analysis were performed. The results showed that the iPSC clones showed very similar in cellular and molecular biology characteristics to that of hESCs. The detail procedures of these assays are as following:

The alkaline phosphatase staining (APS) assay identifies the pluripotency of iPSCs:

Follow the instructions of the BCIP/NBTAlkaline PhosphataseColor Development Kit for

APS.

The detailed process is as follows: aspirate the medium and wash the cells with PBS; fix

cells with 4% paraformaldehyde at room temperature for 20 minutes; then add the freshly

prepared APS working solution to stain cells for about 10 minutes. Stop the reaction,

aspirate the staining working solution, and wash twice with PBS. The positive APS staining

cells will show purple.

Immunofluorescence staining of pluripotency genes:

The results of immunofluorescence staining showed that pluripotency markers, OCT4,

NANOG, SOX2, expressed in the nucleus while TRA-1-60 and TRA-1-81 expressed on

the cell surface.

The process is as follows: the iPSC was cultured on a coverslip in 12-well plate, then fixed

cells with 4% paraformaldehyde for 20 minutes, then permeabilized and blocked the cells

in PBS containing 0. 5 % Triton X-100 and 5% normal goat serum for 1 hour at RT. The

cells incubate the following antibodies overnight at 4°C, rabbit anti-OCT4; rabbit anti

SOX2; rabbit anti-NANOG; mouse anti-TRA-1-60; mouse anti-TRA-1-81; mouse anti-a

SMA; rabbit anti-Nestin; rabbit anti-a-Fetoprotein. After wash with PBS, the cells stain

with secondary antibodies for 1 hour at room temperature, AF594 Goat Anti-Rabbit IgG;

AF488 Goat Anti-Mouse IgG; AF488 Goat Anti-Rabbit IgG. The cells were washed with ddH 20 and then mounted with a mounting medium containing 4',6-diamidino-2 phenylindole (DAPI), and then analyses using a Nikon microscope (Ts2-FL).

RT-PCR detection of pluripotency genes:

H1ESCs were used as a positive control, and primary vascular cells were used as a negative

control. The results showed that the MFS patient-specific iPSCs and the H1ESC were

clearly expressed the pluripotency markers, while the primary cells did not.

The process is as follows: cells were lysated with Trizol and total RNA was isolated;

PrimerScript RT Reagent Kit (Takara, RR037A) was used to reverse transcribe RNA into

cDNA; PCR was performed as standard procedure by adding specific primers and Taq

DNA polymerase. The amplified PCR products were detected by agarose gel

electrophoresis. The PCR product size of OCT4, SOX2 and NANOG gene is 138 bp, 397

bp and 811 bp.

RT-qPCR detection of pluripotency genes:

H1ESC was used as a positive control, and primary vascular cells were used as a negative

control. The results showed that the MFS patient-specific iPSCs and the H1ESC were

highly expressed the pluripotency markers while the primary vascular cells did not.

The specific process is as follows: Total RNA was isolated by Trizol and cDNA was

synthesized by PrimerScript RT Reagent Kit. qPCR was conducted in StepOne Plus Real

Time PCR System (Applied Biosystems) using iTaq Universal SYBR Green Supermix

(Bio-Rad) and specific primers for hESC pluripotency genes.

Table 1 PCR primers

Gene Forward/Reverse primer (5'-3') RT-PCR primers OCT4 (138bp) CATTCAAACTGAGGTAAGGG/ TAGCGTAAAAGGAGCAACATAG NANOG (811bp) TAGCAATGGTGTGACGCAGA/ CCTCGCTGATTAGGCTCCAA

SOX2 (397bp) ATGCACCGCTACGACG/ CTTTTGCACCCCTCCCATTT GAPDH (133bp) TAGCAATGGTGTGACGCAGA/ CCTCGCTGATTAGGCTCCAA qPCR primers OCT4 (60bp) AGTGCCCGAAACCCACACTG/ ACCACACTCGGACCACATCCT NANOG (134bp) TGAACCTCAGCTACAAACAG/ TGGTGGTAGGAAGAGTAAAG SOX2 (154bp) GCCGAGTGGAAACTTTTGTCG/GGCAGCGTGTACTTATCCTTCT GAPDH (80bp) TGTGGGCATCAATGGATTTGG/ ACACCATGTATTCCGGGTCAAT

Embryoid body (EB)-mediated differentiation of three germ layers:

The specific process is as follows: We differentiated MFS patient-specific iPSC cell lines

into embryoid bodies (EB) in low-attachment petri dishes. Embryoid bodies (EB) are

spherical structure with high morphological similarity to the early embryonic

developmental stages of mammals and contain different types of cells of the endoderm,

mesoderm and ectoderm. As shown in the figure, the markers of three germ layers -a

Fetoprotein (endoderm), a-SMA (mesoderm), Nestin (ectoderm) were all positive,

indicating that the MFS patient-specific iPSCs could differentiate into three germ layers.

The differentiation of EB:

The iPSCs with a density of about 80%-90% were treated with collagenase IV for 20-30

minutes and cultured in EB medium in ultra-low attachment dish for 6 days. The culture

was transferred in DMEM containing 20% FBS on a gelatin-coated 6-well plate for 6-12

days. The medium was changed every other day. The differentiated cells were fixed and

stained for markers of the three germ layers. The preparation of EB medium is shown in

Table 2.

Table 2 Preparation of EB medium

Component Amount Final Concentration DMEM/F12 77.8 mL -

KnockOut Serum 20ml 20% 100xMEM-Non-Essential amino acids iml 10 mM 1OOxL-Glutamine (DMEM/F12 lacks 1mi 20 mM glutamine) 55 mM 2-Mercaptoethanol or 0.1 M 182 jiL of 55 mM 0.1 mM (1000x) stock (0.1 mL of 0.1 M)

Karyotyping:

Karyotype analysis showed that the MFS patient-specific iPSCs had a normal karyotype.

Karyotyping was performed on G-band metaphase chromosomes with a resolution of 400

bands per haploid genome. Briefly, proliferating iPSCs were blocked by 50 ng/ml of

colcemid for 2 h, digested with trypsin-EDTA into single cell, then treated with hypotonic

KCl solution for 20-40 min at 37 °C. Glass slides were prepared with three steps of fixation

in methanol/glacial acetic acid (3:1). QFQ-banding at 400 bands resolution according to

the International System for Human Cytogenetic Nomenclature (ISCN2016) was analyzed.

The iPSCs were confirmed to display a normal karyotype (46, XY). The results of alkaline

phosphatase staining are shown in Figure 3A; the results of karyotype analysis of

chromosomes are shown in Figure 3B; the results of immunofluorescence staining are

shown in Figure 3C, and the RT-PCR results of pluripotency genes are shown in Figure

3D. The expression of pluripotency genes by RT-qPCR as shown in Figure 3E; the

identification of embryoid body (EB)-mediated differentiation of the three germ layers is

shown in Figure 3 (F, G, H, I).

4) MFS patient-specific iPSCs contain two mutations in FBN1 gene

The pathogenesis of Marfan syndrome (MFS) is not completely known, it appears to be

due to heterozygous mutation in the fibrillin-1 gene (FBN1; 134797) on chromosome q21. So far, 3077 loci of FBN1 have been genetically altered in the general database. We found the patient-specific iPSCs have two missense mutations, c.3442 C>G (p.P1148A) and c.1415 G>A (p.C472Y), in the FBN1 gene through whole-exome sequencing, which may be related to the pathogenesis of this disease.

The above-mentioned embodiments only describe the preferred mode of the present

invention, and do not limit the scope of the present invention. Without departing from the

design spirit of the present invention, variations and improvements to the technical

solutions of the present invention made by those of ordinary skill in the field should fall

within the protection scope determined by the claims of the present invention.

Claims (1)

1. THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS

   1. A modification method for MFS patient-specific iPSC characterized in that it comprises

   the following steps:

   obtain a sample of isolated vascular tissue from MFS patients to obtain primary vascular

   cells;

   The episomal plasmids containing the transcription factors are introduced into the primary

   vascular cells by nucleofection.

   2. The method according to claim 1, wherein the obtaining of the primary vascular cells

   comprises the following steps:

   Cut the MFS patient aortic tissue into small pieces of about 1mm3 blocks, and attach them

   to the bottom of culture flask, place the flask up-and-down, then add DMEM medium

   containing 10% FBS and 1% P/S. Several hours later, flip the flask and let tissue merge in

   culture medium.

   3. The method according to claim 1, wherein the vascular cells include fibroblasts and

   vascular smooth muscle cells.

   4. The method according to claim 1, wherein the selecting of the specific iPSC lines

   comprises the following steps:

   Step 1: When the vascular cells are cultured to a cell density of 80-90%, they are digested

   into single cells, centrifuged, and the cell pellet is collected;

   Step 2: After mixing the episomal plasmids containing different genes with the

   nucleofection solution, resuspending the cell pellet, and then performing nucleofection;

   6. The method to claim 4, wherein the episomal plasmids containing transcription factors

   includes plasmids containing genes OCT4, KLF4, SOX2, Lin28, 1-myc and shP53.

   FIGURES 23 Aug 2021

   Figure 1 2021106553

   Figure 2

   Figure 3