AU2021104476A4 - Method for continuous production of recombinant glp-1 peptide by bacteria - Google Patents
Method for continuous production of recombinant glp-1 peptide by bacteria Download PDFInfo
- Publication number
- AU2021104476A4 AU2021104476A4 AU2021104476A AU2021104476A AU2021104476A4 AU 2021104476 A4 AU2021104476 A4 AU 2021104476A4 AU 2021104476 A AU2021104476 A AU 2021104476A AU 2021104476 A AU2021104476 A AU 2021104476A AU 2021104476 A4 AU2021104476 A4 AU 2021104476A4
- Authority
- AU
- Australia
- Prior art keywords
- peptide
- recombinant
- glp
- seq
- media
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
METHOD FOR CONTINOUS PRODUCTION OF RECOMBINANT
GLP-1 PEPTIDE BY BACTERIA"
ABSTRACT
The invention relates to a method for continuously producing and secreting
recombinant Glucagon-like peptide-1 (GLP-1) by bacteria, more specifically E.
coli. More specifically, the invention relates to use of novel bacterial expression
vector for producing and enabling extracellular secretion of GLP-1, use of novel
media composition for enhancing the secretion and enabling purification, and a
perfusion-based fermentation system for continuous production and separation of
recombinant GLP-1 peptide.
33
Description
METHOD FOR CONTINOUS PRODUCTION OF RECOMBINANT GLP 1PEPTIDE BY BACTERIA
The invention relates to a method for continuous production and secretion of recombinant Glucagon-like peptide-1 (GLP-1) by bacteria, more specifically, E. coli.
Glucagon-like peptide 1 (GLP-1) is a 31 amino acid potent incretin hormone produced in the L-cells of the distal ileum and colon. In the L-cells, GLP-1 is generated by tissue-specific posttranslational processing of the proglucagon gene. Nutrients, including glucose, fatty acids, and dietary fiber, are all known to upregulate the transcription of the gene encoding GLP-1, and they can stimulate the release of this hormone.
The initial product GLP-1 (1-37) is susceptible to amidation and proteolytic cleavage which gives rise to the two truncated and equipotent biologically active forms, GLP-1 (7-36) amide and GLP-1 (7-37).
GLP-1 is an incretin; thus exhibits insulinotropic effects i.e. have the ability to decrease blood sugar levels in a glucose-dependent manner by enhancing the secretion of insulin. Besides the insulinotropic effects, GLP-1 has been associated with numerous regulatory and protective effects. The action of GLP-1 is known in patients with type 2 diabetes and substantial pharmaceutical research has therefore been directed towards the development of GLP-1-based treatment. GLP-1 has also been implicated as a possible therapeutic agent for the management related metabolic disorders, such as obesity.
Hence, owing to the importance of production of GLP-1 there is a technological
gap wherein a method for producingof recombinant GLP-1 peptideis required
using recombinant bacteria, more specifically^. co/iwith high rate ofproduction.
The main object of the invention is to provide a method for continuous
production and secretion of recombinant GLP-1 peptide by bacteria, more
specifically E. coli, wherein, the recombinant GLP-1 is produced in the bacteria
by using a novel bacterial expression vector and secreted extracellularly by
culturing the bacteria in a chemically defined media using a perfusion-based
fermentation system.
Another object of the invention is to provide a method for enhancing secretion of
recombinant GLP-1 by using a novel bacterial expression vector comprising of
DNA sequence encoding GLP-1 peptide represented by Seq. ID 1; and at least
one secretory signal sequence comprising of a DNA sequence; and at least one
affinity tag sequence for enabling purification of GLP-1 peptide.
Yet another object of the invention is to provide a method for producing
recombinant GLP-1 which is easily purified using chemically defined media.
Yet another object of the invention is to provide a system and method for
enhanced production, and secretion of recombinant GLP-1 in bacteria with a
customized separation system for alternating tangential filtration flow for
continues removal of secreted recombinant GLP-1 from a culturing suspension.
The present invention relates to method for producing recombinant GLP-1 using bacteria. More specifically, the invention relates to producing and secreting recombinant GLP-1 by E. coli.
In the main embodiment, the invention provides a method for producing GLP-1 in bacteria, more specifically, E. coli, comprising the steps oftransforming E. coli with a bacterial expression vector of Seq. ID 6, carrying the DNA sequence encoding GLP-1 represented by Seq. ID 1 in conjugation with at least one secretory signal sequence; preparing a starter culture of recombinant E. coli by growing the culture at 37C with 225 rpm for 12 hours in a starter culture growth media till OD6..of the starter culture reaches 5.0-6.0; preparing a perfusion based fermenter system by adding initial batch media to the fermenter vessel comprising of glucose/ dextrose at a concentration of 10 g/L and maintaining the pH at 6.9; adding the starter culture to the fermenter vessel and maintaining the pH at 6.9 using 3N NaOH in the first hour and after first hour using 4M liquid ammonia; adding lac operon inducing agent such as lactose or lactose analogs to the fermenter vessel when the residual glucose/dextrose concentration in the initial batch media has reduced to -5 g/L for induction of production and secretion of recombinant GLP-1 peptide from recombinant E. coir, and initiating perfusion-based fermentation system after 30-40 mins of induction for separating the recombinant E. coli as retantate from the spent culture media containing the secreted recombinant GLP-1 peptide as permeate, harvesting recombinant GLP 1 peptide from the permeate, and re-feeding the fermenter vessel with fresh perfusion media and with the retantate recombinant E. coli for continuous production and secretion of recombinant GLP-1 peptide.
In yet another embodiment, the recombinant expression vector using Seq. ID 6 secretes the recombinant GLP-lpepttide in the range of 1-1.2 g/L/hr using perfusion-based fermentation system.
In another embodiment the invention provides the starter culture media, the initial batch media, and the perfusion media which are chemically defined media having the composition as described in Table 2.
In yet another embodiment, the invention provides a perfusion-based fermentation system enabling culture medium including the recombinant E. coli to be circulated over a separation system in alternating tangential flow, and the separation system removes a filtrate containing spent medium containing recombinant GLP-1 peptide from the culture medium and retains the recombinant E. coli in the culture medium for continuous production.
In yet another embodiment, the invention provides a novel bacterial expression vector comprising of:
1) a DNA sequence Seq. ID 1 encoding GLP-1 peptide; 2) at least one secretory signal sequence which is a combination of a) at least one DNA sequence encoding a signal sequence of genes selected from the group consisting ofpelB,ompA, yebF, andompF, and b) at least one DNA
sequence encoding a carrier peptide, preferably, DNA sequence Seq. ID 2
or Seq. ID 3, encoding truncated yebFof Seq. ID 4 or Seq. ID 5 respectively;
3) at least one gene expression cassette comprising of at least one inducible
promoter, an RBS, DNA sequence encoding the recombinant GLP-1
peptide, DNA sequence encoding an affinity tag, and at least one gene
terminator; with the secretory signal sequence, and the DNA sequence of the affinity tag operably linked to the DNA sequence of the recombinant
GLP-1 peptide;
4) at least one bacterial ori gene sequence for replication of the vector in the host bacterial cell; and 5) at least one DNA sequence for coding a selectable marker with a suitable promoter and a gene terminator sequence flanking the DNA sequence of the selectable marker.
The invention further provides a DNA sequence encoding recombinant GLP-1 Seq. ID 1.
The invention also provides an expression vector Seq. ID 6 for production and secretion of recombinant GLP-1 peptide in E. coli.
The invention also relates to perfusion-based fermenter system, wherein, the system provides a feed tank; a feed pump; a level sensor, a motor; a fermenter vessel; a magnetic levitation pump, separation module, harvest pump, and a harvest tank, wherein hallow fiber column in the separation module comprises a filter module comprising a filter module of hollow fiber membranes suitable for the removal of secreted recombinant protein from the culture medium. The separation module comprises a filter module comprising hollow fibers, e.g. hollow fibers made of polysulphone, Methyl Ester or Cellulose ester having a porosity of between 0.4 pm and 0.1 pm, e.g. a porosity of 0.2 pm. The separation system further comprises a filter module comprising membranes wherein the membranes have a molecular weight cut-off pore size of 500 kDa.
A complete understanding of the system and method of the present invention is obtained by reference to the following figure(s):
Figure 1 is a schematic representation of a bacterial expression vector for encoding and secreting recombinant GLP-1 peptide from E. coir,
Figure 2 elucidates the schematic diagram of the perfusion-based fermentation system;
Figure 3a is a graphical representation of growth kinetics of recombinant E. coli transformed with expression vector Seq. ID 6 and recombinant GLP-1 peptide secretion over time in batch fermentation process;
Figure 3b is representative image of SDS-PAGE comparing recombinant E. coli transformed with expression vector Seq. ID 6 cell lysates and culture media to detect recombinant GLP-1 peptide after different time points of 0.25 mM IPTG induction;
Figure 4 is a graphical representation of growth kinetics of recombinant E. coli transformed with expression vector Seq. ID 6 and glucose consumption over time in batch fermentation process;
Figure 5 is representative image of SDS-PAGE for recombinant GLP-1 peptide in recombinant E. co/ztransformed with expression vector Seq. ID 6 and media of batch fermentation process; His-purified recombinant GLP-1 peptide; and enter okinase digested recombinant GLP-1 peptide;
Figure 6a is a graphical representation of growth kinetics of recombinant E. coli transformed with expression vector Seq. ID 6 and glucose consumption over time in perfusion-based fermentation process;
Figure 6bis representative image of SDS-PAGE analysis of lOkDa GLP-1 peptide secretion is seen. Media samples were collected and analyzed after 0, 2, 4 and 6 hours of induction with 0.25mM IPTG; and
Figure 6c is a graphical representation of rate of production recombinant GLP-1 peptide in every hour of perfusion-based fermentation system for a period of 10 hours.
DETAILED DESCRIPTION OF THE INVENTION Abbreviations used:
pelBreiers to: leader DNA sequence encoding the N-terminal amino acid
residues of pectatelyase B
ompArefers to: leader DNA sequence encoding the amino acid residues of Outer membrane protein A
ompFrefers to: leader DNA sequence encoding the amino acid residues of Outer membrane protein F
yebFreiersto: leader DNA sequence encoding the amino acid residues of protein yebF
AmpR refers to: DNA sequence encoding ampicillin resistance gene
FI Ori Origin of replication
IPTG Isopropyl - d-l-thiogalactopyranoside
Lac or Lacl DNA sequence encodes lac repressor
RBS Ribosomal binding site
The present invention now will be described hereinafter with reference to the detailed description, in which some, but not all embodiments of the invention are indicated. Indeed, the invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout. The present invention is described fully herein with non-limiting embodiments and exemplary experimentation.
The present invention relates to producing and secreting recombinant GLP-1 peptide by E. coli. More specifically, the invention relates to producing and secreting GLP-1 by E. coli, followed by its separation using a perfusion-based fermentation system.
In the main embodiment, as described in Figure 1, the invention provides a bacterial expression vector 100, particularly for E. coli, for producing and secreting recombinant GLP-1 peptide. The expression vector comprises of DNA sequence encoding GLP-1 peptide 103; and at least one secretory signal sequence which is a combination of a) at least one DNA sequence encoding a signal sequence of genes 101 selected from the group consisting ofpelB, ompA, yebF, and ompF, and b) at least one DNA sequence encoding a carrier peptide 102, preferably, DNA sequence Seq. ID 2 or Seq. ID 3, encoding truncated yebFof Seq. ID 4 or Seq. ID 5 respectively. The expression vector further comprises of at least one gene expression cassette operably linked to DNA sequence encoding GLP-1 peptide 103 comprising of at least one inducible promoter 104, an RBS 105, DNA sequence of an affinity tag, and at least one gene terminator 106. The secretory signal sequence 101 and 102, and the DNA sequence of the affinity tag are operably linked to the DNA sequence of the recombinant GLP-1 peptide 103. Further the expression vector comprises of at least one bacterial on'gene sequence 110 for replication of the vector in the host bacterial cell; and at least one antibiotic resistance gene 109 and at least one additional selection marker 112 each controlled by their respective gene promoters 108, and 113. The expression vector additionally comprises of at least one f1 ori sequence 111 for enabling packaging of recombinant GLP-1 peptide in F I bacteriphage system.
The affinity tag sequence is for enabling purification of recombinant GLP-1 peptide.
Further, the DNA sequence encoding recombinant GLP-1 peptide is separated from the secretory signal sequence by Enterokinase recognition sequence (DDDDK) to enable separation of recombinant GLP-1 peptide from the secretory signal sequence after harvesting the recombinant GLP-1 peptide.
The GLP-1 peptide comprises of 7-37 amino acid stretch of human GLP-1 protein (NCBI reference no AAP35459) encoded by Seq. ID 1; and Table 1 provides the DNA and Peptide sequences used in the bacterial expression vector.
TABLE 1 provide DNA and peptide sequences
Nameof Seq. ID no. and DNA sequence Seq. ID no. peptide and Peptide sequence GLP-1 Seq. ID 1 Peptide CACGCGGAAGGCACCTTCACCAGCGATGTGA HAEGTFT GCAGCTACCTGGAGGGTCAGGCGGCGAAAGA SDVSSYLE ATTTATCGCGTGGCTGGTTCGTGGTCGTGGC GQAAKEF IAWLVRG RG Signal Sequence pelB ATGAAATACCTGTTACCTACCGCGGCTGCGGG MKYLLPT GCTGCTGCTGTTAGCAGCTCAGCCGGCAATGG AAAGLLL CT LAAQPAM A yebF ATGAAAAAGCGTGGTGCGTTCCTGGGCCTGCT MKKRGAF GCTGGTTAGCGCGTGCGCGAGCGTGTTTGCG LGLLLVS ACASVFA ompA ATGAAGAAGACCGCGATTGCGATTGCGGTGG MKKTAIAI CGCTGGCGGGTTTTGCGACCGTGGCGCAGGC AVALAGF G ATVAQA ompF ATGATGAAGCGCAATATTCTGGCAGTGATCGT MMKRNIL CCCTGCTCTGTTAGTAGCAGGTACTGCAAACG AVIVPALL CT VAGTANA
Carrier peptide Truncated Seq. ID 2 Seq. ID 4 yebf peptide GCGAACAACGAAACCAGCAAGAGCGTGACCT ANNETSK TTCCGAAATGCGAAGATCTGGATGCGGCGGG SVTFPKCE TATTGCGGCGAGCGTTAAGCGTGACTACCAGC DLDAAGI AAAAC AASVKRD YQQN Truncated Seq. ID 3 Seq. ID 5 yebf peptide GCGAATAATGAGACCAGCAAAAGCGTGACCT ANNETSK TTCCGAAGGCGGAGGACCTGGATGCGGCGGG SVTFPKAE TATTGCGGCGAGCGTTAAACGTGACTACCAGC DLDAAGI AAAAC AASVKRD YQQN Expressio Seq. ID 6 n vector TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCG GCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTG CCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCT TTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATC GGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCAC CTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAG TGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGT TGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACT GGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTA TAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGA GCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATAT TAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTG CGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAAT ATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGA GCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCA ATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGA AAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGG TATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACC TATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGA AATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAA AAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCC ATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGT TATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGA TCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCA ACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCA CCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTC CCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAG TACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTC
Seq. ID 2 encodes for 33 amino acid carrier peptide, truncated yebf peptide, represented by Seq. ID 4, and Seq. ID 3 encodes for peptide represented by Seq. 5. The Seq. ID 3 is synthesized by mutating Seq. ID 2, wherein, TGC codon at position 40 in Seq. ID 2 is mutated to GCG codon, to mutate Cys at position 14 of Seq. ID 4 to Ala at position 14 of Seq. ID 5.
In another embodiment, the invention provides Seq. ID 6 representing the DNA sequence of expression vector comprising Seq. ID 1 encoding recombinant GLP 1 peptide,in conjugation with secretory signal sequence comprising of combination of signal peptide of the gene ompf and the DNA sequence carrier peptide of Seq. ID 3 encoding truncated yebf peptide of Seq. ID 5.
In yet another embodiment, as described in Table 2, the invention provides a chemically defined media for growing and culturing bacteria transformed with the bacterial expression vector with DNA sequence encoding recombinant GTP 1 peptide, wherein, the media is devoid of any complex undefined materials which tend to decrease the solubility of secreted recombinant proteins in the culture media and reduce the final amount of recombinant proteins purified.The media comprises of at least one carbon source, more specifically, glucose/dextrose; and glycerol as a stabilizing agent, wherein the ratio of glucose/dextrose and glycerol is between 1:0.25 to 1:1, preferably, 1:0.5. Presence of glycerol in media is to prevent the high shearing forces and protect bacteria from damage, and to reduce denaturation of recombinant protein. The media further comprises of at least one nitrogen source, wherein the nitrogen source is an ammonium salt. Further, the media comprises of citric acid in the range of 5 to 25 mM. Citric acid's function in the said chemically defined media is to prevent infection of E. coli with bacteriophage. Infection of E. coli with bacteriophages is common problem in bacterial cultures which leads to decrease in number of live bacterial cells in the culture, this inversely affects the production of recombinant protein thereby reducing its production. Mechanistically, bacteriophages are very sensitive to citric acid and unable to infect the bacteria in the presence of citric acid. The common LB broth used for recombinant protein production lacks citric acid and is not effective in preventing bacteriophage infection in E. coli. The media also comprises of salts of magnesium, potassium, phosphorus, and sodium; and salts of trace elements selected from the group to not limited to iron, cobalt, manganese, copper, boron, molybdenum, and zinc. Additionally, the media also comprises of glycine which plays an important role in maintenance of membrane potential of bacterial cells and enhances protein secretion; and arginine which acts a chaperone molecule and enhances recombinant protein folding intracellularly, thereby reducing formation of inclusion bodies or aggregates and facilitates secretion of folded recombinant proteins extracellularly.Glycine enhances the secretion, whereas Arginine aids in folding of protein before secretion. Together, Glycine and Arginine, help secretion of recombinant proteins. Additionally, the media comprises of at least one chelating agent including but not limited to Ethylenediaminetetraacetic acid (EDTA), and at least one vitamin, more specifically, thiamine.
Table 2: Composition of chemically defined starter cultme media, initial batch media, and perfusion media.
Main Components of the media Concentration range (mM)
Citric Acid 5 to 25mM
KH2PO4 50 to 150mM
(NH4)2HP04 10 to 50mM
NACL 1 to 10mM
GLYCINE 1 to 10mM
GLYCEROL 10-100mM
ARGININE 0.5 to 10mM
CACL2 0.01 to 1mM
MGSO4.7H20 1 to 10mM
DEXTROSE 20 to 200mM
KANAMYCIN 20 to 200mM
THIAMINE 0.001 to 1mM
Salts of Trace elements in media Gram per Litre
Fe(III) citrate 1 to 5g
CoC12-6H20 0.1 to 2g
MnC12-4H20 0.5 to 5g
CuC12-2H20 0.01 to ig
H3B03 0.1 to ig
Na2MoO4-2H20 0.01 to ig
Zn acetate-2H20 0.5 to 5g
EDTA 0.01 to 5g
In another embodiment, the invention provides a method for producing and secreting recombinant GLP-1 by E. coli, using a perfusion-based fermentation system for continuous production and separation of secreted recombinant GLP-1 peptide. The method comprises the steps of: a) transforming E. coli with an expression vector encoding recombinant GLP-1 peptide, to produce recombinant E. coir, b) preparing a starter culture of recombinant E. coli by growing the culture at 31C with 225 rpm for 12 hou rs in a starter culture growth media till OD 0 oof the starter culture reaches 5.0-6.0; c) preparing a perfusion-based fermenter system by adding initial batch media to the fermenter vessel comprising of glucose/ dextrose at a concentration of 10 g/L and maintaining the pH at 6.9; d) adding the starter culture to the fermenter vessel and maintaining the pH at 6.9 using 3N NaOH in the first hour and after first hour using 4M liquid ammonia for maintaining pH at 6.9; e) adding lac operon inducing agent such as lactose or lactose analogs to the fermenter vessel when the residual glucose/dextrose concentration in the initial batch media has reduced to -5 g/L for induction of production and secretion of recombinant GLP-1 peptide from recombinant E. coli; and f) initiating perfusion-based fermentation system after 30-40 mins of induction for separating the recombinant E. colias retantatefrom the spent culture media containing the secreted recombinant GLP-1 peptide as permeate, harvesting recombinant GLP-1 peptide from the permeate, and re-feeding the fermenter vessel with fresh perfusion media and with the retantaterecombinant E. coli for continuous production and secretion of recombinant GLP-1 peptide.
The perfusion system involves growing the recombinant E. coli in perfusion suspension culture, wherein the culture medium including the bacteria is circulated over a separation system in alternating tangential flow, and the separation system removes a filtrate containing spent medium containing recombinant GLP-1 peptide from the culture medium and retains the bacteria in the culture medium for continuous production.
Figure 2 elucidates the schematic diagram of perfusion-based fermentation and separation system, the system comprising a feed tank (201); a feed pump (202); a level sensor (203); a motor (204); a fermenter vessel (205); a magnetic levitation pump (206); separation module (207); harvest pump (208), and a harvest tank (209), wherein hollow fiber column in the separation module (207) comprises a filter module of hollow fiber membranes suitable for the removal of secreted recombinant GLP-1 peptide from the culture medium.
The feed tank (201) stores media that are pumped via a feed pump (202) to a fermenter vessel (205). The fermenter vessel (205) holding the culturing suspension comprising of E. coli starter culture and the media is agitated by a motor (204). The fermenter vessel (205) is continuously or intermittently drained via a magnetic levitation pump (206). The level of media is maintained via a level sensor (203). The drained liquid is further passed through a filter module comprising hollow fiber membranes. The culturing suspension in the fermenter vessel (205) is circulated over a separation system in alternating tangential filtration flow. The separation module (207) separates recombinant E. coli as retentate, and the spent culture media comprising the recombinant GLP-1 peptide as permeate. The suspension filtered via a filter module further comprising hollow fiber membranes suitably removes the recombinant GLP-1 from the spent culture medium. The filtered E. colim the retentate is re-introduced into the fermenter vessel. The spent culture media is pumped via a harvest pump
(208) to the harvest tank (209).
In an embodiment of the preferred invention the separation system comprises a
filter module comprising hollow fibers, e.g. hollow fibers made of polysulphone,
Methyl Ester or Cellulose ester having a porosity of between 0.4 pm and 0.1 pm,
e.g. a porosity of 0.2 pm for the removal of secreted recombinant GLP-1 peptide
from the spent culture medium.
In yet another embodiment, the separation system comprises a filter module
comprising membranes wherein the membranes have a molecular weight cut-off
pore size of500 kDa.
EXAMPLE 1
E. coli CULTURE AND TRANSFORMATION
Seq. ID 6 representing the DNA sequence of expression vector comprising Seq.
ID 1 encoding recombinant GLP-1 peptide in conjuagation with secretory signal
sequence having the combination of signal peptide of the gene ompfand the DNA
sequence carrier peptide of Seq. ID 3 encoding truncated yebf peptide of Seq. ID
5 was used for all experimental procedures.
E. co/iBL2 1(DE3) strain was chosen as expression system and it is transformed by
chemical transformation method (i.e. CaC12) by taking lOOng of recombinant
vector Seq. ID 6. Chemical competent cells (i.eB21(DE3)) were incubated at 4C
after taken out from -80°C freezer and allowed to thaw. After thawing cell to 4°C,
vector was added and incubated for 15 minutes at°Cari/hefeafter
incubation heat shock was applied to cells by exposing them to 42! for about 1
minute. After application of heat shock, transformed E. coli cells were kept at 4°C
for about 15 minutes. There upon cells were grown by addition of Luria broth
(LB) media for 40 minutes. Later grown cells were spread on LB agar with appropriate antibiotic selection criteria.
EXAMPLE2
a) PREPARATION OF STARTER CULTURE
Adequate amount of pre-culture was prepared to carryout fed-batch fermentation using autoclaved starter culture media of composition described in Table 3. Typically, 300ml of growth media is taken in 21itre flask and inoculated with
single colony forming unit aseptically from transformed plate and incubated in
rotatory incubator maintained at 37°C with 225 rpm for 12 hours. Filter sterilized
media components such as Thiamine, Trace elements are reconstituted while
setting up starter culture. End of 12 hours of incubation OD 6ooreaches -5.0.
b) BATCH-FERMENTATION PROCESS
Bioreactor with growth media of composition of initial batch media described in
Table 3 is autoclaved at 121 0C with holding time of 45 minutes a nd later whole
assembled bioreactor is brought down to 3C by help of control tower having
SCADA software. During bioreactor packing all the requirement dosing tubing
0.2 micron hydrophobic filter for air inlet and exhaust unit, Dissolved Oxygen
probe, pH probe, baffle, impeller blades kept at 1:1L/D ratio are attached.
Fermentation process is started by maintaining required physical condition such
as pH at 6.90, temperature at 37C. Based on growth profile variable parameters
such as aeration, agitation is automatically controlled by Control Unit.
Aseptically starter culture is transferred to bioreactor. Reconstitution of filter
sterilized media components such as thiamine, trace elements are aseptically given to bioreactor from injection port. During start of fermentation Dextrose is added to make up to the final concentration of 10 g/L. MgSo4 stock solution is given in supplemental form to avoid media precipitation. pH is maintained with the help of 3N NaOH for first hour later 4N Ammonia till end of fermentation process. Cells are grown at maximum growth rate of- 0.6/ hr.
Hourly sample are drawn from bioreactor aseptically and cell density is measured using Spectrophotometer set at 600nm against blank media. Residual glucose is measured using digital glucometer with same sample. After 3 hours of fermentation feeding is done in exponential form. After attaining OD 6 0o of-40 culture is induced with IPTG i.e - 0.25mM, by making sure that residual glucose is about 5g/L.
Post induction pH is maintained at 6.90 only with 4N Ammonia. No acid is used throughout the fermentation process. Supplements are added to culture that includes Glycine, Arginine, Glutamic acid to make it to final concentration of 2mM each. Hourly sample are drawn and centrifuged to separate cells and media and later analyzed using PAGE to detect presence of recombinant protein expression in cells and amount of secretion in media. After end of 6hour of induction culture is drawn and centrifuged to separate cells and media.
c) PERFUSION-BASED FERMENTATION PROTOCOL
Transformed cells are prepared using BL21(DE3) taking appropriate plasmid by giving heat shock and spreading them on selective antibiotic LB agar plate followed by incubation for 12hour in incubator at 37C. Growth media is prepared by taking media components and dissolving in deionized water and adjusted to pH 6.90 using 5N NaOH. Starter culture media is sterilized at 1210 C with 45 minutes holding time in autoclave. All the other media component that are heat liable are filter sterilized i.e Thiamine, Kanamycin, Trace elements. Dextrose and MgS0 4 .7H 20 are separately autoclaved. Starter culture is prepared by inoculation of colony from LB agar plate into shake flask. Filter sterilized media components i.e Thiamine, Kanamycin 50mg/Lit, Trace elements lOOOx were added along with 1% Dextrose, MgSO 4 .7H 20- 5mM, yeast extract 0.2%.
Incubated the flask in shaker incubator at 37C at 225 rpm for overnight.
Bioreactor vessel packed with pre-calibrated pH probe, antifoam sensor along
with new membrane fitted to dissolved oxygen (DO) probe after refilling with
Oxylyte, sparger pipe and exhaust pipe fitted with 0.2 hydrophobic vent filter
each, baffle. Initial batch media as described in Table 3 is poured into fermenter
vessel excluding volume corresponding to reconstitutable media components.
Fermenter vessel is autoclaved at 121°C, 45 min holding time, 15 psi, later cooled
to room temperature and attached to Control unit. Fermentervessel is purged with 0.1 standard litre per minute (SLPM) of air overnight for DO probe
polarization. DO is calibrated just before addition of starter culture.
Reconstitution of media is done before addition of starter culture. Dosing bottles
are attached and tubing's are primed. All the parameters are set in Control unit
i.e pH set to 6.90 with 0.1% Dead band, DO set to 30% in cascade mode,
Acid/Base in auto mode, antifoam sensor with 0.1% Sigma Antifoam 204,
Temperature set to 3TC. DO is controlled in cascade mode with Agitation, Gas
flow per minute, % of pure oxygen purging. Initial RPM is set to 200. Pre-culture
is aseptically transferred into bioreactor. First hour pH is maintained by attaching
dosing bottle with 3N NaOH Rest of the batch pH is maintained by 4M Liquid
Ammonia. MgSO 4 .7H 20 is reconstituted aseptically for three doses from zeroth
hour of fermentation. Hourly sampling is done to check cell density by UV/Vis
Spectrophotometer and residual glucose by glucometer. After 5 hours or batch
with residual glucose of-5 g/L is picked as ideal time point to induce the culture
with 0.2mM IPTG. Sterile 500kDa Hollow fiber is connected to perfusion
equipment and equilibrated with sterileinitial batch media, later tubings are
connected to bioreactor. 30 minutes after post induction perfusion is started, here culture is drawn out of vessel automatically by pump passed through hollow fiber, retentate from the hollow fiber which contains the recombinant E. coli cells is sent back to bioreactor. Harvest is collected from permeate end of hollow fiber by setting pump speed to ~ 16.6 ml/minutes and simultaneously at same flow rate perfusion media is added into fermenter vessel. Total fermentation is run till the completion of perfusion media. After completion of feeding perfusion media, culture is concentrated to 2/3 rd of batch volume by drawing 1/3 rd of permeate and batch is terminated. Post induction hourly samples are drawn to check expression and secretion of recombinant GLP-1 peptide. Hollow fibre is sanitized by 0.5N NaOH and stored in 0.IN NaOH.
Table 3: Composition of media
Initial Batch Media Perfusion Media
SL.NO Components Molarity (mM) Molarity (mM)
1 Citric Acid 8.84 8.84
2 KH2PO4 97.73 97.73
3 (NH4)2HP04 30.2 30.2
4 NACL 2.13 2.13
5 GLYCINE 1 1
6 GLYCEROL 54.29 54.29
7 ARGININE 1 1
8 CACL2 0.09 0.09
9 MGSO4.7H20 5 1
10 DEXTROSE 139 13.9
11 KANAMYCIN 0.05 0.05
12 THIAMINE 0.06 0.06
13 IPTG 0 0.2
EXAMPLE3
EFFICIENCY OF GROWTH OF RECOMBINANT BACTERIA AND SECRETION OF RECOMBINANT GLP-1 PEPTIDE
Growth kinetics,glucose consumption, and recombinant protein production and
secretion in the culture media was tested at different times using batch fermentation process.
Figure 3a provides a line graph representing the production of recombinant GLP
1 peptide of 10 kDain conjugation with secretory signal sequence and affinity tag
and growth of recombinant E. coli at indicated time points, which suggests steady
growth of bacteria and increase in recombinant protein secretion in media. However, under batch method, less than 2.5 g/L is produced at the completion
of the batch fermentation process at 4 hours.
Further, five microliters of culture supernatant were collected during
fermentation at indicated time points after induction using IPTG, and
recombinant E. coli cell lysates from respective time points were also collected
and then analyzed by reduced SDS-PAGE and compared. As depicted in Figure
3b, within 1 hour of induction the recombinant GLP-1 peptide started to be
produced and secreted by the bacteria. This steadily increased with time.
Moreover, there was hardly any recombinant GLP-1 peptide present in cell
lysates suggesting efficient secretion by the recombinant bacteria. This suggested the efficiency of the vector Seq. ID 6 in secretion of the recombinant GLP-1 peptide enabled by the chemically defined batch media composition.
The glucose consumption during the fermentation process was also analyzed. As depicted in Figure 4,glucose consumption starts at optimal rate soon after 1 hour of inoculation of starter culture to the perfusion-based fermentation process. We standardized and established adequate amount of glucose that need to be added prior to start of the cell proliferation stage to achieve maximal growth rate thereby adequate cell density is attained soon. Yield from per gram glucose remains optimal with thereby making the method economical and reliable compared to traditional cell proliferation techniques. Initial batch media has lOg/L concentration of glucose/dextrose, and induction is carried out when the residual glucose/ dextrose concentration reaches around 5g/L. Hence the use of the vector of Seq. ID 6 along with the chemically defined batch media is optimal for growth and secretion of the recombinant GLP-1 peptide.
EXAMPLE 4
ENTER.OKIN ASE DIGESTION OF RECOMBINANT GLP-1 PEPTIDE
The DNA sequence encoding recombinant GLP-1 peptide is separated from the secretory signal sequence by Enterokinase recognition sequence (DDDDK) to enable separation of recombinant GLP-1 peptide from the secretory signal sequence after harvesting the recombinant GLP-1 peptide. The GLP-1 peptide is in tandem with His-tag for purification process.
As depicted in Figure 5, the recombinant GLP-1 peptide is secreted in the media and after purification using His-affinity chromatography once digested with enterokinase produces smaller bands suggesting separation of secretory signal sequence.
EXAMPLE 5
RECOMBINANT GLP-1 PEPTIDE PRODUCTION BY PERFUSION BASED FERMENTATION
The perfusion-based fermentation process was carried out using recombinant E. coli transformed with Seq. ID 6 as explained example 2c. At any time point the fermenter can hold 1 litre of media for fermentation which is filtered for recovering recombinant bacteria and spent media containing secreted recombinant GLP-1 peptide. Secreted recombinant protein is continuously harvested at a rate of 1L/hour by removing spent media. Once the spent media is removed, the fermenter is re-fed with equal amount of fresh perfusion media and retantateL. coli for continuous fermentation and so on. Every hour a small amount of sample is collected for quantification and analysis. In one continuous batch of perfusion fermentation a total of 10 L of media is fermented for a period of 10 hours.
Figure 6a elucidates the growth curve of the bacterial cells fermented in the perfusion-based fermentation system. After 5 hours or batch with residual glucose of -5 g/L, induction using IPTG was started. After ls hour of induction, perfusion was started to supplement limiting nutrients in order to keep the cell proliferation at minimal rate. As depicted in Figure 6a, the E. coli OD6 0 0 is maintained between 8-10. Also most the time is dedicated for recombinant
protein production instead of increase in bacteria number.
Media samples were collected and analysed after 0, 2, 4 and 6 hours of induction
with 0.25mM IPTG in perfusion method where a total of 9 Litresof media
containing recombinant protein was collected for SDS-PAGE analysis. As
depicted in Figure 6b, lOkDa recombinant GLP-1 peptide secretion is seen after
induction with IPTG as soon as 2 hours and the amount of recombinant GLP-1
peptide secreted is almost same even after 6 hours. This clearly indicates that continuous production of recombinant GLP-1 peptide is seen perfusion-based fermentation method consistently over a long period of time.
As depicted in Figure 6c, within 1l hour itself the production of the recombinant GLP-1 peptide reach 1 g/L and even after 1 0th hour the production rate was around 1 g/L. This suggested steady production of recombinant GLP-1 peptide at a rate of 1 g/L/hr using Seq. ID 6 with chemically defined media using perfusion-based fermentation method.
While certain exemplary embodiments have been described and shown in the accompanying drawings, it is to be understood that such embodiments are merely illustrative of, and not restrictive on, the broad invention, and that this invention not be limited to the specific constructions and arrangements shown and described, since various other changes, combinations, omissions, modifications and substitutions, in addition to those set forth in the above paragraphs, are possible. Those skilled in the art will appreciate that various adaptations and modifications of the just described embodiments can be configured without departing from the scope and spirit of the invention.
This application is a divisional application from International Patent Application No. PCT/ IB2020/051550. The full disclosure of PCT/IB2020/051550 is incorporated herein by reference.
Claims (4)
1. A method for continuous production and secretion of recombinant GLP-1 peptide encoded by Seq. ID 1 by bacteria, more specifically E. coli, comprising the steps of: a) transforming E. coli with an expression vector encoding recombinant GLP-1 peptide to produce recombinant E. coli; b) preparing a starter culture of recombinant E. coli by growing the culture at 37C with 225 rpm for 12 hours in a starter culture growth media till OD60 0 of the starter culture reaches 5.0-6.0; c) preparing a perfusion-based fermenter system by adding initial batch media to the fermenter vessel comprising of glucose/dextrose at a concentration of 10 g/L and maintaining the pH at 6.9; d) adding the starter culture to the fermenter vessel and maintaining the pH at 6.9 using 3N NaOH in the first hour and after first hour using 4M liquid ammonia; e) adding lac operon inducing agent such as lactose or lactose analogs to the fermenter vessel when the residual glucose/dextrose concentration in the initial batch media has reduced to ~5 g/L for induction of production and secretion of recombinant GLP-1 peptide from recombinant E. coli; and f) initiating perfusion-based fermentation system after 30-40 mins of induction for separating the recombinant E. coli as retantate from the spent culture media containing the secreted recombinant GLP-1 peptide as permeate, harvesting recombinant GLP-1 peptide from the permeate, and re-feeding the fermenter vessel with fresh perfusion media and with the retantate recombinant E. coli for continuous production and secretion of recombinant GLP-1 peptide;
wherein,
the expression vector encoding recombinant GLP-1 peptide is of Seq. ID 6; the expression vector of Seq. ID 6 consists of DNA sequence Seq. ID 1, encoding recombinant GLP-1 peptide, in conjugation with secretory signal sequence consisting of combination of signal peptide of the gene ompf and the DNA sequence carrier peptide of Seq. ID 3 encoding truncated yebf peptide of Seq. ID 5; the expression vector encoding recombinant GLP-1 peptide of Seq. ID 6 secretes recombinant GLP-1 peptide in the range of 1-1.2 g/L/hr by perfusion-based fermentation system using E. coli bacteria; the perfusion-based fermentation system consists a feed tank (201); a feed pump (202); a level sensor (203); a motor (204); a fermenter vessel (205); a magnetic levitation pump (206); separation module (207); harvest pump (208), and a harvest tank (209), wherein, the separation module (207) comprises a filter module of hollow fiber membranes suitable for the removal of secreted recombinant protein from the culture medium; and the filter module of hollow fiber membranes comprises of polysulphone and Methyl Ester or Cellulose ester having a porosity between 0.4 tm and 0.1 tm, more particularly a porosity of 0.2 tm; and the membranes have a cut-off pore size of 500 kDa; and the perfusion-based fermentation system enables culture medium including the recombinant E. coli to be circulated over a separation system in alternating tangential flow, and the separation system removes a filtrate containing spent medium containing recombinant GLP-1 peptide from the culture medium and retains the recombinant E. coli in the culture medium for continuous production.
2. The method as claimed in claim 1, wherein, the initial batch media is a chemically defined media consisting of: 139 mM glucose/dextrose; 30.2 mM nitrogen source, more specifically, diammonium phosphate; 54.29 mM glycerol as stabilizing agent; 8.84 mM citric acid; 1 mM glycine as essential amino acid; 1 mM arginine as positively charged amino acid; 0.06 mM thiamine; 5 mM magnesium sulfate heptahydrate; 97.73 mM potassium dihydrogenphosphate; 2.13 mM sodium chloride; 0.09 mM calcium chloride; salts of trace elements Fe(III) citrate at 1-5g/L, CoCl 2-6H 20at 0.1-2g/L, MnCl2-4H20at 0.5-5g/L, CuCl2-2H200.01-1g/L, H3BO3 at 0.1-1g/L, Na 2 MoO 4
2H 20 at 0.01-1g/L, Zn acetate-2H 20 at 0.5-5g/L concentrations; and chelating agent EDTA at 0.01-5g/L concentration.
3. The method as claimed in claim 1, wherein, the perfusion media is a chemically defined media consisting of 13.9 mM glucose/dextrose; 30.2 mM nitrogen source, more specifically, diammonium phosphate; 54.29 mM glycerol as stabilizing agent; 8.84 mM citric acid; 1miM glycine as essential amino acid; 1 mM arginine as positively charged amino acid; 0.06 mM thiamine; 1 mM magnesium sulfate heptahydrate; 97.73 mM potassium dihydrogenphosphate; 2.13 mM sodium chloride; 0.09 mM calcium chloride; salts of trace elements Fe(III) citrate at 1-5g/L, CoCl 2 -6H 2 0 at 0.1-2g/L,
MnC 2-4H20at 0.5-5g/L, CuCl2-2H200.01-1g/L, H3BO3 at 0.1-1g/L, Na 2 MoO 4
2H 20 at 0.01-1g/L, Zn acetate-2H 20 at 0.5-5g/L concentrations; and chelating agent EDTA at 0.01-5g/L concentration.
4. The method as claimed in claim 1, wherein, the expression vector encoding recombinant GLP-1 peptide is of Seq. ID 6 consisitng of DNA sequence Seq. ID 1, encoding recombinant GLP-l peptide, in conjugation with secretory signal sequence consisting of combination of signal peptide of the gene ompfand the DNA sequence carrier peptide of Seq. ID 3 encoding truncated yebf peptide of Seq. ID 5.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2021104476A AU2021104476A4 (en) | 2019-02-24 | 2021-07-23 | Method for continuous production of recombinant glp-1 peptide by bacteria |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
IN201941007166 | 2019-02-24 | ||
AU2020225920 | 2020-02-24 | ||
AU2021104476A AU2021104476A4 (en) | 2019-02-24 | 2021-07-23 | Method for continuous production of recombinant glp-1 peptide by bacteria |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/IB2020/051550 Division WO2020170228A1 (en) | 2019-02-24 | 2020-02-24 | Method for continous production of recombinant glp-1 peptide by bacteria |
Publications (1)
Publication Number | Publication Date |
---|---|
AU2021104476A4 true AU2021104476A4 (en) | 2021-09-16 |
Family
ID=77672487
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2021104476A Active AU2021104476A4 (en) | 2019-02-24 | 2021-07-23 | Method for continuous production of recombinant glp-1 peptide by bacteria |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU2021104476A4 (en) |
-
2021
- 2021-07-23 AU AU2021104476A patent/AU2021104476A4/en active Active
Similar Documents
Publication | Publication Date | Title |
---|---|---|
FI104733B (en) | Method and plasmid for the production of an interleukin 1 inhibitor | |
AU2016101562A4 (en) | Genetic recombinant human collagen, gene encoding the same, and preparation method thereof | |
EP0677109B1 (en) | Expression system for producing apolipoprotein ai-m | |
RU2005117338A (en) | IL-21 PRODUCTION IN PROKARIOTIC HOST-CELLS | |
JPS60217898A (en) | Production of heterogenic protein | |
CN103882015B (en) | A kind of recombinant bacterial strain of high expression human growth hormone and construction process and application | |
WO2020165873A1 (en) | Method and system for enhanced continuous production, secretion and separation of recombinant polypeptides from bacteria | |
CN113502310B (en) | Method for preparing semaglutide precursor through high-density fermentation | |
CN112584853A (en) | Structure of novel insulin aspart and method for preparing insulin aspart | |
CN105198972A (en) | Method for preparing high purity recombinant human brain natriuretic peptides | |
US20220127324A1 (en) | Method for continuous production of recombinant glp-1 peptide by bacteria | |
CN111378027B (en) | Preparation method of somaglutide precursor | |
AU2021104476A4 (en) | Method for continuous production of recombinant glp-1 peptide by bacteria | |
US20060003421A1 (en) | Method for purifying a fermentation-derived product | |
CN116574172B (en) | Recombinant humanized type I collagen and preparation method thereof | |
RU2447149C1 (en) | RECOMBINANT PLASMID DNA pMSIN4, CODING HYBRIDE POLYPEPTIDE - HUMAN INSULIN PRECURSOR, BL21(DE3)VpMSIN4-PRODUCER STRAIN OF RECOMBINANT HUMAN INSULIN, METHOD FOR PRODUCING RECOMBINANT HUMAN INSULIN | |
NO316519B1 (en) | Method for extraction of periplasmic proteins from prokaryotic microorganisms and use of arginine as a means of extraction | |
CN102277371A (en) | Method for preparing BNP (brain natriuretic peptide) | |
CN102732549B (en) | Preparation method of recombinant insulin-like growth factor-I (IGF-I) | |
CN102869767B (en) | The preparation method of interferon alpha 5 | |
CN112646044B (en) | TFF2-Fc fusion protein and high-efficiency expression production method thereof | |
CN101591660A (en) | A kind of in intestinal bacteria the method for excreting and expressing recombinant human granulocyte-colony factor | |
CN104725485B (en) | One kind restructuring active peptide and its synchronic preparation method | |
WO2005017174A2 (en) | Process for the purification of recombinant polypeptides | |
RU2322504C1 (en) | Method for preparing genetic-engineering human insulin |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FGI | Letters patent sealed or granted (innovation patent) |