AU2021101130A4 - Diagnostic assay for simple visual detection of streptococcus suis - Google Patents

Abstract

A loop-mediated isothermal amplification (LAMP) (102) based diagnostic assay system for simple visual detection of Streptococcus suis is disclosed. A primer set (104) with a primer combination consisting of at least six primers. A means for development and validation (118) of said loop modified isothermal amplification (LAMP) by extracting a bacterial genomic DNA (120) through lysis via specific boiling technique. A means of centrifugation (122) configured to perform centrifugation of said separated cells via a microcentrifuge (124). A LAMP reaction technique (126) configured to prepare a solution in order to amplify said primers. A visualization and interpretation module (128) configured to perform observation of said solution prepared during said reaction technique. Said module comprises addition of a diluted SYBR green dye into said solution tube, wherein a positive amplification indicates when said solution changes color from orange to green and a negative amplification indicates when said solution retains said orange color. 24 N 0 8 0 N R N N N N N N N n 0 C . . u " (U E 0 o0 w-. Ca.U .r mc c. mLE .X u - . E .E 0 m . m -; .0 ho -rn m E cu u U. 'o >. .c w cu CL 1- &. = E mE o C L o 1. ~ ~ ,- . I. -- M =. . o t .- a . © - & . rno E Ena. 4- cu o O- > +j E c -e = (E M .0 -- M E ~ c U u . W m 0 • m -. N hC a ..... m . C . .3 || a .. . .Eo .U ± g. tc- m " -rn . ! E~- .- CL N Cm -% M. u. - -o E _ W o a. E + C- En 0 E.- 0 " 0 C a..m ho ( • a h - mu mE 9 mcm . - 4 . o CE m m a w . war u.0 u S E~ 5C a0 m t. > c w, e- m - m w G - L En ER~ 20L rn w = -m E o -E h. C m E Eom = -CL > +j 4- -.c -1 4 %. E cu o xM CL0 - -oE m m h mo4 .s0 7 1. 0 w0 o to En -w D> C E r_ .a 14"

Description

N 0 8 0 N R N N N N N N N

n

0 C.

u (U.Ca.U E 0o0 w-. " .r mc c. mLE .X u - . E

.E 0 m . m -; .0 ho -rn m E cu u U. 'o >. .c w cu CL 1- = &. E mE o1. ~ ~ ,- . o CI. L -- M =. t . o .- a. © - & . rno E Ena. o (E M.0-- M4- cu E O- ~ >c +jE c -e U = u .

W m 0 • m -. N

hC a..... m. C . .3 || . .Eo a.. .U ± g. tc- m " -rn . !

Cm - % M. u. - -oE_ W E~- C-En 0 E.- .- 0 CL N

o a. E +

"0 C

a..m ho ( •

E~ a5C a0 mt. > h - mu mE c 9 mcm . - 4 .

o CE m m aw .

+j 4- -.c-1 4S waru.0 u e-w, w m G- - m LEn ER~ -m Eo -E 20L rn = w h. C Eom mE 7=-CL .s0 1. > 0 %. o to En o xM E cu D> -w C CL0 E r_ .a - 14"-oE m mh mo4 w0

DIAGNOSTIC ASSAY FOR SIMPLE VISUAL DETECTION OF STREPTOCOCCUSSUIS FILEDOFINVENTION

The present invention generally relates to a field of biological sciences and particularly to the field of diagnostic assay for cost effective and simple visual detection of Streptococcus suis (S. suis) from biological samples of pigs and/or transmitted hosts using LAMP (loop mediated isothermal amplification) technology involving amplification of a conserved gene (gdh gene) of S. suis.

BACKGROUND OF THE INVENTION

The Streptococcus suis is an important pathogen of swine responsible for a wide range of diseases, such as meningitis, arthritis, septicaemia, endocarditis, encephalitis, abortions, polyserositis, and bronchopneumonia. It is also an emerging zoonotic pathogen and can cause a variety of life-threatening infections including meningitis and even sudden death in both pigs and humans. S. suis is the most common cause of adult meningitis in Vietnam, the second most common in Thailand and the third most frequent cause of community acquired bacterial meningitis in Hong Kong. Thus, this pathogen poses a great danger to the pig industry and public health. Strains of S. suis are divided into serotypes according to polysaccharide capsular antigens. Thirty-five capsular serotypes (types 1/2 and 1 through 34) have been identified of which type 2 is considered to be the major cause of disease and is also the most frequently isolated serotype. Strains belonging to other serotypes such as types 1/2, 1, 7, 9, and 14 can also cause disease.

The detection of S. suis is dependent on standard culture methods and serotyping. These methods are labor intensive, time consuming and results can be ambiguous or inconclusive. Thus, detection and control of S. suis infection depends increasingly on the availability of rapid and precise diagnostic tests. PCR has been used for detection of different serotypes of S. suis and single PCR assay that permits detection of multiple serotypes is always preferred over monoplex PCRs targeting individual serotype. Glutamate dehydrogenase (gdh) gene of S. suis appears to be conserved and gdh-based PCR assay which is rapid, specific and sensitive, and can detect S. suis isolates regardless of serotype, or geographic origin has been reported.

One of the important factors that hamper the effective control of S. suis related diseases is the lack of sensitive diagnostics for the reliable, simple and rapid diagnosis of the disease in field level. Because this organism can cause severe and costly health problems in pigs and because humans working with infected animals are at risk, the development of a simple, reliable, rapid, sensitive, and specific diagnostic assay is needed for its detection at field level with minimum facilities and control.

Loop mediated isothermal amplification (LAMP) is a simple, rapid, highly specific and cost-effective single tube technique for the amplification of DNA. LAMP has the potential to be used as a simple screening assay in the field or at the point of disease outbreak by clinicians. It may be a useful method for infectious disease diagnosis particularly in developing countries. Currently, this method has been widely applied to the detection of pathogenic microorganisms and parasites but the same was not available for detection of S. suis.

Although in recent years, several detection methods of molecular biology to improve the specificity and sensitivity of pathogen detection, such as nucleic acid probes and PCR have been reported, such methods require costly equipments, time-consuming, and cannot meet the demand for rapid detection. Furthermore, their use is not suitable for on-site detection in the field or in primitive clinical laboratories, particularly in developing countries. Therefore, the development and evaluation of a new simple, rapid, and cost-effective assay to detect this important zoonotic pathogen is very much needed.

Therefore, the present invention isolated the native strain of S. suis, characterized and designed a novel LAMP protocol suitable for its detection in field conditions with minimum laboratory facilities. Their use would ease the detection of S. suis in particular and biological samples containing S. suis in general and hence having commercial implications.

SUMMARY OF THE INVENTION

The present invention generally relates to a loop-mediated isothermal amplification (LAMP) detection method for Streptococcus suis using a special primer set and its application thereof. The special primer set contains a primer combination consisting of six primers, namely a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP), a backward inner primer (BIP) and a forward loop primer (LF) and a backward loop primer (LB). The present invention pertains to methods of molecular biology detection of bacteria in the field of biotechnology and particularly relates to an LAMP visualized detection method based on Streptococcus suis glutamate dehydrogenase (gdh) gene. The LAMP detection method can give quicker, convenient and efficient detection of Streptococcus suis with high specificity and sensitivity under the isothermal condition. This can be used for detecting pure bacterial samples, biological samples from pigs such as heart fluid and tissues. The detection method provided by the invention does not need expensive instruments, simple in operation and can even be used in field situation.

In an embodiment of the present invention a loop-mediated isothermal amplification (LAMP) based diagnostic assay system for simple visual detection of Streptococcus suis, is disclosed. The system comprising: a primer set with a primer combination consisting of at least six primers, namely a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP), a backward inner primer (BIP) and a forward loop primer (LF) and a backward loop primer (LB), wherein said primer set comprises a genomic DNA sequence of Streptococcus suis; a means for development and validation of said loop modified isothermal amplification (LAMP) by extracting bacterial genomic DNA through lysis via specific boiling technique, wherein said means includes suspending a single colony of a bacterial sample in at least 100 pl of an HPCL grade water, wherein said specific boiling technique comprises of heating said suspended sample at a specific temperature for specific time in a heat block in order to separate said colony; a means of centrifugation configured to perform centrifugation of said separated cells via a microcentrifuge, wherein said means is configured to transfer cell-free supernatant with associated DNAs into a tube and thereby kept at specific temperature; a LAMP reaction technique configured to prepare a solution in order to amplify said primers, wherein said technique comprises of said solution which includes specific quantities of said at least six primers, a reaction buffer, a DNA polymerase, betaine, magnesium sulfate, deoxyribonucleotide triphosphate (dNTP), said separated bacterial genomic DNA template, and a sterile nuclease free water, wherein said technique includes a positive and a negative control, with said positive control being a characterized S. suis extract genomic DNA and said negative control being said sterile water, wherein said mixture is configured to be incubated at a first threshold temperature for a specific threshold time limit, and then heated at a second threshold temperature for a second threshold time limit in order to stop said reaction; and a visualization and interpretation module configured to perform observation of said solution prepared during said reaction technique, wherein said module comprises addition of a diluted SYBR green dye into said solution tube, wherein a positive amplification indicates when said solution changes color from orange to green and a negative amplification indicates when said solution retains said orange color.

Another embodiment of the present invention states a method of loop mediated isothermal amplification (LAMP) based diagnostic assay for simple visual detection of S. suis. The method comprising steps: preparing a primer set with a primer combination consisting of at least six primers, namely a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP), a backward inner primer (BIP) and a forward loop primer (LF) and a backward loop primer (LB), wherein said primer set comprises a genomic DNA sequence of S. suis; suspending a single colony of a bacterial sample for development and validation of said loop modified isothermal amplification (LAMP) by extracting a bacterial genomic DNA through lysis via specific boiling technique, wherein said means includes suspending said single colony of a bacterial sample in at least 100 pl of an HPCL grade water; heating said suspended sample at a specific temperature for specific time in a heat block in order to separate said colony; centrifuging said separated cells via a microcentrifuge, wherein a means of centrifugation is configured to perform centrifugation of and to transfer cell-free supernatant with associated DNAs into a tube and thereby kept at specific temperature; amplifying said at least six primers via a LAMP reaction technique by preparing a solution, wherein said technique comprises of said solution which includes specific quantities of said at least six primers, a reaction buffer, a DNA polymerase, betaine, magnesium sulfate, deoxyribonucleotide triphosphate (dNTP), said separated bacterial genomic DNA template, and a sterile nuclease free water, wherein said technique includes a positive and a negative control, with said positive control being a characterized S. suis extract genomic DNA and said negative control being said sterile water; incubating said mixture at a first threshold temperature for a specific threshold time limit, and then heating said incubated solution at a second threshold temperature for a second threshold time limit in order to stop said reaction; and detecting a positive and/or a negative amplification via a visualization and interpretation module which is configured to perform observation of said solution prepared during said LAMP reaction technique, wherein said module comprises addition of a diluted SYBR green dye into said solution tube, wherein a positive amplification indicates when said solution changes color from orange to green and a negative amplification indicates when said solution retains said orange color.

To further clarify advantages and features of the present invention, a more particular description of the invention will be rendered by reference to specific embodiments thereof, which is illustrated in the appended drawings. It is appreciated that these drawings depict only typical embodiments of the invention and are therefore not to be considered limiting of its scope. The invention will be described and explained with additional specificity and detail with the accompanying drawings

BRIEF DESCRIPTION OF FIGURES

These and other features, aspects, and advantages of the present invention will become better understood when the following detailed description is read with reference to the accompanying drawings in which like characters represent like parts throughout the drawings, wherein:

Figure 1 illustrates a block diagram of components installed in a loop mediated isothermal amplification (LAMP) based diagnostic assay system for simple visual detection of Streptococcus suis.

Figure 2 illustrates a flowchart of steps involved in operating said loop-mediated isothermal amplification (LAMP) based diagnostic assay system for simple visual detection of Streptococcus suis.

Figure 3 illustrates a detection (visual as well as agarose gel electrophoresis of amplified products) of Streptococcus suis through LAMP using the primer combination.

Figure 4 illustrates a specificity assessment of LAMP assay using the primer combination.

Figure 5 illustrates a sensitivity assessment of LAMP assay using the primer combination.

Further, skilled artisans will appreciate that elements in the drawings are illustrated for simplicity and may not have been necessarily been drawn to scale. For example, the flow charts illustrate the method in terms of the most prominent steps involved to help to improve understanding of aspects of the present invention. Furthermore, in terms of the construction of the device, one or more components of the device may have been represented in the drawings by conventional symbols, and the drawings may show only those specific details that are pertinent to understanding the embodiments of the present invention so as not to obscure the drawings with details that will be readily apparent to those of ordinary skill in the art having benefit of the description herein.

DETAILED DESCRIPTION

For the purpose of promoting an understanding of the principles of the invention, reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the invention is thereby intended, such alterations and further modifications in the illustrated system, and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates.

It will be understood by those skilled in the art that the foregoing general description and the following detailed description are exemplary and explanatory of the invention and are not intended to be restrictive thereof.

Reference throughout this specification to "an aspect", "another aspect" or similar language means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrase "in an embodiment", "in another embodiment" and similar language throughout this specification may, but do not necessarily, all refer to the same embodiment.

The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such process or method. Similarly, one or more devices or sub-systems or elements or structures or components proceeded by "comprises...a" does not, without more constraints, preclude the existence of other devices or other sub-systems or other elements or other structures or other components or additional devices or additional sub-systems or additional elements or additional structures or additional components.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The system, methods, and examples provided herein are illustrative only and not intended to be limiting.

Embodiments of the present invention will be described below in detail with reference to the accompanying drawings.

The object of the present invention is for the deficiencies of the prior art, to provide a diagnostic assay for simple visual detection of S. suis targeting conserved gene (gdh gene) of the organism. To provide an improved, user friendly, cost effective and rapid technique (based on loop mediated isothermal amplification (LAMP) method) for detection of S. suis for use at field condition.

The present invention relates to a primer combination which is designed for simple, rapid, accurate and visual detection of S. suis from pigs. This user friendly and cost-effective detection system is based on LAMP technology.

Figure 1 illustrates a block diagram of components installed in a loop mediated isothermal amplification (LAMP) based diagnostic assay system for simple visual detection of Streptococcus suis. The loop mediated isothermal amplification (LAMP) (102) based diagnostic assay system for simple visual detection of Streptococcus suis includes mainly following procedural steps.

A primer set (104)with a primer combination consisting of at least six primers, namely a forward outer primer (F3) (106), a backward outer primer (B3) (108), a forward inner primer (FIP) (110), a backward inner primer (BIP) (112) and a forward loop primer (LF) (114) and a backward loop primer (LB) (116), wherein said primer set (102) comprises a genomic DNA sequence of Streptococcus suis.

A means for development and validation (118) of said loop modified isothermal amplification (LAMP) by extracting a bacterial genomic DNA (120) through lysis via specific boiling technique, wherein said means includes suspending a single colony of a bacterial sample in at least 100 pl of an HPCL grade water, wherein said specific boiling technique comprises of heating said suspended sample at a specific temperature for specific time in a heat block in order to separate said colony.

A means of centrifugation (122) configured to perform centrifugation of said separated cells via a microcentrifuge (124), wherein said means is configured to transfer a cell-free supernatant with associated DNAs into a tube and thereby kept at specific temperature.

A LAMP reaction technique (126) configured to prepare a solution in order to amplify said primers, wherein said technique comprises of said solution which includes specific quantities of said at least six primers, a reaction buffer, a DNA polymerase, betaine, magnesium sulfate, deoxyribonucleotide triphosphate (dNTP), said separated bacterial genomic DNA template, and a sterile nuclease free water, wherein said technique includes a positive and a negative control, with said positive control being a characterized S. suis extract genomic DNA and said negative control being said sterile water, wherein said mixture is configured to be incubated at a first threshold temperature for a specific threshold time limit, and then heated at a second threshold temperature for a second threshold time limit in order to stop said reaction.

A visualization and interpretation module (128) configured to perform observation of said solution prepared during said reaction technique, wherein said module comprises addition of a diluted SYBR green dye into said solution tube, wherein a positive amplification indicates when said solution changes color from orange to green and a negative amplification indicates when said solution retains said orange color.

In an implementation, the developed assay was also compared with the conventional PCR. The developed assay was 10 fold more sensitive than conventional PCR with analytical sensitivity of 2ng and ng, respectively. The PCR was standardized by amplifying the gdh gene of S. suis using outer F3 and B3 LAMP primers. The PCR products were confirmed as PPV by sequencing. The sequences showed 100% homology with the gdh gene sequences of S. suis.

A PCR was standardized using the outer primers ; F3 and B3. The cycling condition consisted of an initial denaturation at 950 C for 45 seconds, followed by 30 cycles of denaturation at 950 C for 30 seconds, annealing at 56 0 C for 30 seconds and extension at 720 C for 30 seconds with a final extension at 720 C for 5 minutes. The PCR was carried out in a 50 pl volume reaction. 2-3 pl of DNA as template was added to PCR tube containing 25 pl of 2X DreamTaq Master Mix (Thermo Scientific), 1 pl of each forward outer and reverse outer primer (10pmole each) and the final volume was made to 50 pl using nuclease free water. The amplified products were run on 1.5% agarose gel in the presence of ethidium bromide, electrophoresed and photographed under UV illuminator. Positive and negative controls were used for the validation of the PCR.

The PCR products generated (by F3 and B3 primers) were purified using QIAquick PCR purification kit (QIAGEN) and sent to a commercial company (Eurofins Genomics India, Bangalore, India) for sequencing. Resulted sequences were edited and aligned using Bio Edit software (Ibis Biosciences, Carlsbad, CA, USA). The Basic Local Alignment Search Tool (BLAST) of NCBI (National Center for Biotechnology Information, Bethesda, MD, USA) was used to confirm the identity of the generated sequences in relation to the Gen Bank nucleotide database. Figure 2 illustrates a flowchart of steps involved in operating said loop-mediated isothermal amplification (LAMP) based diagnostic assay system for simple visual detection of Streptococcus suis. The method comprising steps as follows.

Step (202) involves preparing a primer set with a primer combination consisting of at least six primers, namely a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP), a backward inner primer (BIP) and a forward loop primer (LF) and a backward loop primer (LB), wherein said primer set comprises a genomic DNA sequence of Streptococcus suis; step (204) involves suspending a single colony of a bacterial sample for development and validation of said loop modified isothermal amplification (LAMP) by extracting a bacterial genomic DNA through lysis via specific boiling technique, wherein said means includes suspending said single colony of a bacterial sample in at least 100 pl of an HPCL grade water.

The step (206) involves heating said suspended sample at a specific temperature for specific time in a heat block in order to separate said colony; step (210) involves centrifuging said separated cells via a microcentrifuge, wherein a means of centrifugation is configured to perform centrifugation of and to transfer cell-free supernatant with associated DNAs into a tube and thereby kept at specific temperature.

The further step (212) involves amplifying said at least six primers via a LAMP reaction technique by preparing a solution, wherein said technique comprises of said solution which includes specific quantities of said at least six primers, a reaction buffer, a DNA polymerase, betaine, magnesium sulfate, deoxyribonucleotide triphosphate (dNTP), said separated bacterial genomic DNA template, and a sterile nuclease free water, wherein said technique includes a positive and a negative control, with said positive control being a characterized S. suis extract genomic DNA and said negative control being said sterile water.

The step (214) involves incubating said mixture at a first threshold temperature for a specific threshold time limit, and then heating said incubated solution at a second threshold temperature for a second threshold time limit in order to stop said reaction; and step (216) involves detecting a positive and/or a negative amplification via a visualization and interpretation module which is configured to perform observation of said solution prepared during said LAMP reaction technique, wherein said module comprises addition of a diluted SYBR green dye into said solution tube, wherein a positive amplification indicates when said solution changes color from orange to green and a negative amplification indicates when said solution retains said orange color.

Referring from Figure 3which illustrates a detection (visual as well as agarose gel electrophoresis of amplified products) of Streptococcus suis through LAMP using the primer combination; Figure 4 which illustrates a specificity assessment of LAMP assay using the primer combination; and Figure 5 which illustrates a sensitivity assessment of LAMP assay using the primer combination. For this method, genomic DNA is extracted from any type of porcine biological materials such as heart fluid, tissue sample or any nucleated cells. This technique is effective with very low amount of DNA, as low as 2ng or may be even less. Then the gdh gene of S. suis bacterium available in the DNA isolated from the biological material is amplified. The successful amplification by LAMP technology specifies the presence of this pathogen thereby confirming the diagnosis of S. suis infection.

The specific embodiments of the present invention comprise the steps of: Primer design: The primers were designed using S. suis gdh gene sequence publicly available in Gen bank (Accession number: AY853916.1) using the Primer Explorer V4. gdh gene sequence specific primer compositions are shown below:

The outer primers gdh-B3: 5 '- CGTGTACTGTGTGGCTGAA -3' (SEQ ID NO: 1);The outer primers gdh -F3: 5 '- CGGCCGTCTACTTCTTCAC -3' (SEQ ID NO: 2);

Primer gdh -BIP within:

'- TTGCGAGTCCGTAGAGAACGCCCAACATGCCATCTGACCT -3' (SEQ IDNO: 3);The inner primers gdh-FIP: 5 ' CAACGCTGGTGGTGTAGCTGTAGAGTCCATGACAAGCGAAGG -3'(SEQ ID NO: 4). Loop primer gdh-LB: 5 '- CCTTGTAGACTTTGATGGCATCA-3' (SEQ ID NO: 5). Loop primer gdh-LF: 5 ' TCTGCCCTTGAAATGAGTCAAA -3'(SEQ ID NO: 6)

Bacterial DNA Extraction: The well characterized S. suis maintained at the Animal Health laboratory of ICAR-National Research Centre on Pig, Rani, Guwahati, Assam, India was used for the development and validation of LAMP. Bacterial genomic DNA was extracted by lysis by a boiling method. Briefly, a single colony of the test bacterial isolate grown on nutrient agar plate (initially organisms were grown in Todd Hewitt broth) was suspended in 100 pl of HPLC grade water and heated at 1000C for 20 min in a heat block to lyse cells. Following centrifugation for 2 min at 13 000xg in a microcentrifuge, the cell-free supernatant containing DNA was transferred to a fresh tube and kept at -20 OC for short term storage backup.

The LAMP reaction system: Total reaction volume was 25pL. FIP and BIP (50 pmol) each 1pl; F3 and B3 (5pmol) each 0.1 pl; LB and LF (25pmol) each 0.5 pl;10 X Thermo-Pol reaction buffer 2.5 pl;Best DNA polymerase (8 U/L) 1 pl; Betaine (5M) 5 pl; MgS04 (100mM) 1 pl; dNTPs (10mM) 2 pl; Bacterial genomic DNA template 3 pl and add sterile nuclease free water up to 25 pl. Positive and negative control were also included. Wherein the positive control is a well characterized S. suis (maintained at ICAR-NRC on Pig, Guwahati, Assam, India) extract genomic DNA; negative control was sterile water.

LAMP reaction: The mixture was incubated at 60 0C for 55 min, and then heated at 800 C for 5 min to stop the reaction.

Visualization by the naked eye and interpretation of results: The inspection for amplification was performed through observations of color change following the addition of 2 pL of 1:10 diluted 10,000X concentration SYBR green I dye (Invitrogen) to the tube. The positive amplification was indicated by a color change from orange to green. Negative amplification was retained of orange. In addition, agarose gel electrophoresis of the amplified product was also done to determine the size of the amplified product.

LAMP sensitivity test: The sensitivity of the LAMP assay was determined by 10-fold serial dilution of template DNA.

LAMP specificity test: The specificity of the LAMP assay was determined using different bacteria such as Escherichia coli, Salmonella typhimurium and Staphylococcus aureus.

Results:

LAMP specificity experiment: The LAMP assay detected S. suis in the sample, revealing the characteristic ladder-like pattern in the gel (Figure 2B) and color changes from orange to green after the addition of SYBR Green I dye (Figure 2A). No ladder-like pattern or color changes of SYBR Green I dye was observed for Escherichia coli, Salmonella typhimurium, Staphylococcus aureus and RNase free water (negative control). This result revealed that the LAMP assay has a high specificity for S. suis.

LAMP sensitivity test: To determine the sensitivity of LAMP assay template DNA was diluted serially by 10-folds up to 2pg per pL with sterile water. One pL of genomic DNA from each dilution was used as a DNA template for the LAMP. The detection limit of the assay was 2ng/pl showing the characteristic ladder-like pattern in the gel (Figure

3B) and visualized directly with the naked eye by addition of SYBR Green I dye, showing color changes from orange to green (Figure 3A). For negative control, the RNase free water did not show either ladder like pattern in the gel (Figure 3B) or color change of SYBR Green I dye (Figure 3A).

The technical improvement and/or economic significance achieved by the present invention were hitherto not conceived by persons skilled in the art from existing knowledge.

The non-limiting advantages, achieved by the present invention may be summarized as follows:

Detection of S. suis in porcine biological samples in an accurate and reliable manner applying a specially designed primer combination using six different primers.

Present technology is user-friendly (LAMP-based diagnostic assay) and helps in rapid (within 1 hour) and cost-effective detection of S. suis in porcine biological samples.

The entire test protocol takes a maximum of 1 hour when the starting material is genomic DNA.

The present invention method neither requires sophisticated laboratory nor costly equipments and suitable for field application. It applies to health care, food and rapid detection of animal diseases.

The drawings and the forgoing description give examples of embodiments. Those skilled in the art will appreciate that one or more of the described elements may well be combined into a single functional element. Alternatively, certain elements may be split into multiple functional elements. Elements from one embodiment may be added to another embodiment. For example, orders of processes described herein may be changed and are not limited to the manner described herein. Moreover, the actions of any flow diagram need not be implemented in the order shown; nor do all of the acts necessarily need to be performed. Also, those acts that are not dependent on other acts may be performed in parallel with the other acts. The scope of embodiments is by no means limited by these specific examples. Numerous variations, whether explicitly given in the specification or not, such as differences in structure, dimension, and use of material, are possible. The scope of embodiments is at least as broad as given by the following claims.

Benefits, other advantages, and solutions to problems have been described above with regard to specific embodiments. However, the benefits, advantages, solutions to problems, and any component(s) that may cause any benefit, advantage, or solution to occur or become more pronounced are not to be construed as a critical, required, or essential feature or component of any or all the claims.

WE CLAIMS

1. A loop-mediated isothermal amplification (LAMP) (102) based diagnostic assay system for simple visual detection of Streptococcus suis, said system comprising:

a primer set (104)with a primer combination consisting of at least six primers, namely a forward outer primer (F3) (106), a backward outer primer (B3) (108), a forward inner primer (FIP) (110), a backward inner primer (BIP) (112) and a forward loop primer (LF) (114) and a backward loop primer (LB) (116), wherein said primer set (102)comprises a genomic DNA sequence of Streptococcus suis;

a means for development and validation (118) of said loop modified isothermal amplification (LAMP) by extracting a bacterial genomic DNA (120) through lysis via specific boiling technique, wherein said means includes suspending a single colony of a bacterial sample in at least 100 pl of an HPCL grade water, wherein said specific boiling technique comprises of heating said suspended sample at a specific temperature for specific time in a heat block in order to separate said colony;

a means of centrifugation (122) configured to perform centrifugation of said separated cells via a microcentrifuge (124), wherein said means is configured to transfer a cell-free supernatant with associated DNAs into a tube and thereby kept at specific temperature;

a LAMP reaction technique (126) configured to prepare a solution in order to amplify said primers, wherein said technique comprises of said solution which includes specific quantities of said at least six primers, a reaction buffer, a DNA polymerase, betaine, magnesium sulfate, deoxyribonucleotide triphosphate (dNTP), said separated bacterial genomic DNA template, and a sterile nuclease free water, wherein said technique includes a positive and a negative control, with said positive control being a characterized S. suis extract genomic DNA and said negative control being said sterile water, wherein said mixture is configured to be incubated at a first threshold temperature for a specific threshold time limit, and then heated at a second threshold temperature for a second threshold time limit in order to stop said reaction; and a visualization and interpretation module (128) configured to perform observation of said solution prepared during said reaction technique, wherein said module comprises addition of a diluted SYBR green dye into said solution tube, wherein a positive amplification indicates when said solution changes color from orange to green and a negative amplification indicates when said solution retains said orange color.

2. The system as claimed in claim 1, wherein said bacterial sample is configured to be heated at 1000C for at least 20 minutes in said heat block.

3. The system as claimed in claim 1, wherein said centrifugation is configured to be performed for at least 2 minutes at a speed of 13 000xg in said microcentrifuge.

4. The system as claimed in claim 1, wherein said cell-free supernatant within said tube is configured to be kept at -20 0 C for a short-term storage backup.

5. The system as claimed in claim 1, wherein said LAMP reaction technique includes a reaction volume of 25pL containing said FIP and BIP (50 p/mol) with each 1pl; said F3 and B3 (5pmol) each 0.1 pl; LB and LF (25pmol) each 0.5 pl; 10 X thermo-pol reaction buffer 2.5 pl;DNA polymerase (8 U/L) 1 pl; Betaine (5M) 5 pl; MgS04 (100mM) 1 pl; dNTPs (10mM) 2 pl; Bacterial genomic DNA template 3 pl and sterile nuclease free water up to 25 pl.

6. The system as claimed in claim 1, wherein said solution is configured to be incubated at 60 0 C for 55 minutes, and then heated at 0C for 5 minutes in order to stop said reaction.

7. The system as claimed in claim 1, wherein said visualization module is configured to add at least 2 pL of 1:10 diluted 10,OOOX concentration SYBR green I dye (Invitrogen) into said tube with said solution in order to detect said positive and/or negative amplification.

8. The system as claimed in claim 1, wherein said LAMP primer composition of each primer (FIP and BIP): (LF and LB): (F3 and B3) molar ratio of 50: 25: 5.

9. A method of loop-mediated isothermal amplification (LAMP) based diagnostic assay for simple visual detection of Streptococcus suis, the method comprising steps:

preparing a primer set with a primer combination consisting of at least six primers, namely a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP), a backward inner primer (BIP) and a forward loop primer (LF) and a backward loop primer (LB), wherein said primer set comprises a genomic DNA sequence of Streptococcus suis;

suspending a single colony of a bacterial sample for development and validation of said loop modified isothermal amplification (LAMP) by extracting a bacterial genomic DNA through lysis via specific boiling technique, wherein said means includes suspending said single colony of a bacterial sample in at least 100 pl of an HPCL grade water; heating said suspended sample at a specific temperature for specific time in a heat block in order to separate said colony; centrifuging said separated cells via a microcentrifuge, wherein a means of centrifugation is configured to perform centrifugation of and to transfer cell-free supernatant with associated DNAs into a tube and thereby kept at specific temperature; amplifying said at least six primers via a LAMP reaction technique by preparing a solution, wherein said technique comprises of said solution which includes specific quantities of said at least six primers, a reaction buffer, a DNA polymerase, betaine, magnesium sulfate, deoxyribonucleotide triphosphate (dNTP), said separated bacterial genomic DNA template, and a sterile nuclease free water, wherein said technique includes a positive and a negative control, with said positive control being a characterized S. suis extract genomic DNA and said negative control being said sterile water; incubating said mixture at a first threshold temperature for a specific threshold time limit, and then heating said incubated solution at a second threshold temperature for a second threshold time limit in order to stop said reaction; and detecting a positive and/or a negative amplification via a visualization and interpretation module which is configured to perform observation of said solution prepared during said LAMP reaction technique, wherein said module comprises addition of a diluted SYBR green dye into said solution tube, wherein a positive amplification indicates when said solution changes color from orange to green and a negative amplification indicates when said solution retains said orange color.

Claims (1)

1O.The method as claimed in claim 9, wherein said LAMP reaction technique includes a reaction volume of 25pL containing said FIP and BIP (50 p/mol) with each 1pl; said F3 and B3 (5pmol) each 0.1 pl; LB and LF (25pmol) each 0.5 pl; 10 X thermo-pol reaction buffer 2.5 pl;DNA polymerase (8 U/L) 1 pl; Betaine (5M) 5 pl; MgSO 4 (100mM) 1 pl; dNTPs (10mM) 2 pl; Bacterial genomic DNA template 3 pl and sterile nuclease free water up to 25 pl.